Issuu on Google+

October 2012

The Official Magazine of The Canadian Hereford Association

2011 Commercial Producers of the Year The Meers Brothers, Alberta Edmund Russell, Manitoba Osterndorff Family, Ontario

Technical Sessions Summary th From the 16th World Hereford Conference

2012 Commercial Edition


Introducing  Our  New  Herdsire!

CB  57U  CAN  DOO  102Y    C02953537

          REMITALL  ONLINE  122L           STAR  BRIGHT  FUTURE  533P  ET             RB  L1  DOMINETTE  8116         RVP  STAR  533P  CAN-­AM  ET  57U             CS  BOOMER  29F           STAR  BONNIE  BETH  54N             HCC  BONITA  8L      

REMITALL  EMBRACER  8E   REMITALL  CATALINA  24H RB  L1  DOMINO  4067   RB  L1  BRIGHTNES  0058   REMITALL  BOOMER  46B   CS  MISS  1ST  FLAG  21A   H  8E  EMBRACER  8006   BIGT  75A  BONITA  C156

      BAR  B  15S  YANKEE     STAR  L1  TEXACO  1ET         IMR  L1  MARKETTE  5122     STAR  MKS  LIMELIGHT  288G         DR  P183  REBEL  926Y       DLR  MISS  DIXIE  143B         DLR  MS  SWEETHEART  143Y HF  74M  LIMELIGHT  LADY  42P         REMITALL  KEYNOTE  20X     RU  DUSTER  60D         RU  SARA  60X     HF  43K  DUSTY  LADY  74M         TEE-­JAY  707B  FORTUNE  4F       HF  92C  MISS  FORTUNE  43K         MISS  124Y  MIDDAY  LADY  92C

Actual  Birthweight: Show  weight  at  World  Hereford  Conference:  January  2,  2011        79  lbs.    1,705  lbs. EPDs:    BW  +4.4              WW  +46.8              YW  +71.5              MILK  +22.0              TM  +45.4      {DLF,  IEF,  HYF} Owned  with  Cayley  Brown  and  Rock  Bottom  Farm      *S EMEN  P ACKAGES  A  AVAILABLE* Birthdate:

Show  Results

‡ Bull  Calf  Champion  and  Reserve  Grand  Champion  Bull,   Beef-­A-­Rama  2011 ‡ Bull  Calf  Champion  and  Grand  Champion  Bull  at  2011  Lindsay   M.O.E.  Show ‡ Reserve  Grand  Champion  Bull  at  2011  Carp  M.O.E.  Show ‡ 2011  Royal  Winter  Fair  Senior  Bull  Calf  Champion  and   Reserve  Grand  Champion  Bull ‡ Dam  named  2011  Royal  Winter  Fair  Grand  Champion  Female,   with  Can  Doo  at  side ‡ 2011  Canadian  Western  Agribition,  National  Senior  Bull   Calf  Champion ‡ Silver  Trophy  Bull ‡ 2011  OHA  Show  Bull  of  the  Year ‡ 2012  Reserve  National  Reserve  Grand  Champion  Bull,  World   Hereford  Conference

Gold  Trophy  Dam  of   CAN  DOO  102Y

42P  with  CAN  DOO  102Y  at  foot

CAN  DOO  102Y

Grand  Champion  Female   National  Reserve  Grand   Champion  Bull  HF  74M  LIMELIGHT   at  2011  Royal  Winter  Fair 2012  World  Hereford  Conference LADY  42P

Owners  -­  The  Stevenson  Family Managers  -­  Phil  &  Catherine  Brown Ranch  Phone:  (250)  295-­4099      Fax:  (250)  295-­4079 Phil’s  Cell:  (250)  293-­6857                  Catherine’s  Cell:  (250)  293-­6858 Email:  coppercreek@xplornet.ca P.O.  Box  817    Princeton,  British  Columbia  V0X  1W0


3


4


5


C A N A D I A N

H E R E F O R D

D I G E S T

contents October 2012 Volume 70 | Number 4

Photo Credit: Teri Manning of Lost Lake Ranch, Rich Lake, Alberta

features

30

contents C AT H E R I N E B R OW N

B R A D D U B E AU

A True Legacy

Hereford Friendly

Douglas Lake Ranch

Edmund Russell’s Loyalty to the breed is recognized

B O N N I E WA R N Y C A

48 RON WELLS

Post World Hereford Conference Marketing

38

It’s up to YOU!

B R A D D U B E AU

Cash Crops & Calf Crops

52

Mandate for the Future Expanding the Keith Gilmore Foundation

70

Technology and Numbers Canadian Hereford breeders pave the way for feed efficiency gains

76

Fed Hereford Project 2011 Data

80

Herefords & The Canadian Cattle Genome Project

85

Show & Sale Results

94

Ontario Provincial Report

Herefords earn their way on this Ontario commercial operation 95 C AT H E R I N E B R OW N

Manitoba Provincial Report

96

Saskatchewan Provincial Report

98

Alberta Provincial Report

“Fifty Per Cent Hereford”

Summarizing the Science

The Meers Brothers’ Philosophy

A recap of World Hereford 102 Hereford Farewells Conference technical sessions

44

58

columns

6

64

10

UpFront

106 On The Edge of Common Sense

18

President’s Message

107 Quick Reference

19

Message du Président

109 Auctioneers, Consultants and Services

22

Hereford Horizons

110 Hereford EPD Averages

24

Photo Contest Submissions

111

92

General Manager’s Report

93

Rapport du Directeur Général

Digest Subscription Form & Ad Deadlines

100 British Columbia Provincial Report 101 CJHA Report 104 4-H Achievements

114 Announcement of The Annual General Meeting


C A N A D I A N

OCTOBER 4-8 ...........................................WLB Livestock 4th Internet Female Sale 5-7 ............................................ Expo Boeuf MOE Show, Victoriaville, QC 12-16 .......................................................... Harvie Ranching Internet Sale 13 .............................................. Remitall West Production Sale, Olds, AB 20 ............................................................Atlantic Bonus Sale, Nappan, NS 20 ....ANL Polled Herefords & Guests Production Sale, Steelman, SK 20 ..... C & T Polled Herefords Production Sale (evening), Kisbey, SK 20 .Maple Hill With Partners For Progress Sale, Clark Hill Shefford, QC 21 .......................Blair Athol/Haroldson’s & Friends Sale, Alameda, SK 22 ........................................... Square-D Production Sale, Langbank, SK 27 ................Crittenden Bros. & Guests Production Sale, Imperial, SK NOVEMBER 1 ........................................................Bar JB – Mature Cowherd Dispersal 1-3 ............. Fall MOE Show - Manitoba Livestock Expo, Brandon, MB Lloydminster Stockade Roundup Show 1 .................................................................Stockade Lady Heifer Jackpot 1 .......................................................................... Polled and Horned Show 2 .................................................................King of the Ring Bull Jackpot 3 .........................................Prospect Heifer & Steer Calf Show & Sale Royal Agricultural Winter Fair 2 ..............................................Ontario Hereford Assoc. Futurity Show 3 ..........................................................Eastern National Hereford Show Farmfair International 6 ............................................................................. Hereford Genes Event 7 .........................................................................Western National Show 6-9 ................................2nd Annual Private Treaty Internet Heifer Sale 7-10 ..................................................... Saskatoon Fall Fair, Saskatoon, SK 9-14 .................................................................Big Gully Farm Internet Sale 10........ Ontario West Zone Sale, Carson’s Sales Arena, Listowel, ON 10 ....East Central Zone Annual Meeting, Omemee Curling Club, ON 13 .................................... Brost Land & Cattle & Guests Sale, Irvine, AB 14................................. The Amigos Production Sale, Medicine Hat, AB 15 -21 ................................................ Justamere’s Online Sale of the Year 15 ..............................................Doenz Ranches Annual Sale, Warner, AB 16 .....................Fenton Hereford Ranch Inc. Production Sale, Irma, AB Canadian Western Agribition 22........................................................................ Agribition Hereford Sale 23 ........................................................... Agribition Hereford MOE Show 23 .................................................................. Agribition Red Coat Classic 27 ......... Anderson Family Herefords Complete Purebred Dispersal DECEMBER 1 ....Klein Farms Complete Dispersal, Balog Auction, Lethbridge, AB 1 ................................Ontario West Annual Zone Meeting, Guelph, ON 3 ..........BHR Ranches-Genetic Resource Female Sale, Balog Auction 4 ...... MJT Cattle Co. Ltd. Hereford & Angus Dispersal, Edgerton, AB 4 ..........Stromsmoe Hereford & Angus Production Sale, Etzikom, AB 6 ...................................................MHA Good As Gold Sale, Brandon, MB JANUARY 5 .......................... Manitoba Hereford Association AGM, Brandon, MB 15-17 .....................Manitoba Ag Days, Keystone Centre, Brandon, MB Ad Deadline 18..........................The Next Generation Semen and Embryo Directory 18-19 ......................................Camrose Bull Congress, Camrose Alberta 26 ......................MC Quantock “Canada’s Bull” Sale, Lloydminster, SK

5160 Skyline Way NE, Calgary, AB T2E 6V1

H E R E F O R D

D I G E S T

FEBRUARY 2....... Hill 70 Quantock Ranch “Barn Burnin” Sale, Lloydminster, SK 4.............. First Annual Premier Hereford Bull Sale, Lloydminster, SK 5....................................Bannerlane Production Sale #14, Livelong, SK 6............................................... Misty Valley Farms Sale, Maidstone, SK 7 .....................14th Annual Midwest Hereford Sale, Lloydminster, SK 8...................................4rd Annual Moving On Bull Sale, Cut Knife, SK 9..............................MJT “Back to the Basics” Bull Sale, Edgerton, AB 13 ...........................JNHR Bull & Female Sale, At the Ranch, Clyde, AB 19 ......Anderson Family Herefords Sale, Balog Auction, Lethbridge, AB 23 .................18th Annual Pine Butte Ranch Bull Sale, Kamloops, BC 23 ................... McCoy Cattle Co. & Beck Farms Bull Sale, Regina, SK 26 ................ Ulrich Hereford Ranch Spring Bull Sale, Balog Auction,

HEREFORD & HEREFORD INFLUENCE SALES BRITISH COLUMBIA Kamloops – Featuring Hereford Influence ........ Oct. 23, Nov. 6 Williams Lake Hereford/Angus Influence. ...Oct. 17 & 18, Nov. 7 & 8 Vanderhoof – Hereford/Angus Influence ........................ Oct. 19 ALBERTA Fort Macleod – Featuring Hereford & British X .............Oct. 25 Medicine Hat Feeding Co. Hereford/Angus Classic ..................................................Oct. 26 Hereford/Angus Powerhouse......................................... Oct. 31 Calgary Stockyards – British Influence British Influence. .................................. Oct. 13, Nov. 10, Dec. 1 Balog Auction Services, Inc. – 16th Annual British Breeds Bonanza Rancher Calf Sale #1 ......................................Oct. 23 British Breeds #2 ............................................................. Nov. 6 SASKATCHEWAN Assiniboia Livestock Auction Hereford/Angus Presort .......................... Oct. 27, Nov. 24 Maple Creek (Cowtown Livestock Exchange Inc) Hereford/Angus Presort ........................................ Oct. 20 All Breed Presort, featuring Hereford/Angus ...... Oct. 27 All Breed Presort, featuring Hereford/Angus .........Nov. 1 Mankota (Mankota Stockmen’s Weigh Co.) – All Breeds Calf Sale featuring Hereford/Charolais/Red Angus ... Oct. 26 Heartland Livestock Services (Swift Current) Sorted Baldie Sale .................................................. Oct. 27 Heartland Livestock Services (Lloydminster) Hereford/Angus Influence ..................................... Nov. 14 MANITOBA Winnipeg Livestock Sales.....................................................Oct. 5 Heartland Livestock Services (Brandon) Hereford Influence Presort............................................ Oct. 30 ONTARIO Ontario Stockyards, Cookstown ........................................................Oct 18 Hereford & Hereford Influence Calf Sale, Brussels Stockyards,Brussels ............................................................Oct 26 Hereford Sale, Lindsay Livestock Exchange, Lindsay, ON.....Oct. 27

Phone: 1.888.836.7242 Fax: 1.888.824.2329

Email: herefords@hereford.ca

The winner of our Cover Photo Contest is Carrie Braun from Braun Ranch, Simmie, Saskatchewan, with her photo of yearling bulls.

7


8


SAZ 995Z

MARKET INDEX 70X X HAMM 822H

SAZ 331Z MARKET INDEX 70X X NAZDAK 704K

SAZ 957Z

MARKET INDEX 70X X HAMM 822H

SAZ 452Z

TAURUS 42T X MUSCLEMAN G158

!"#$%&'()*&%&+,%-. RR #2 Langbank, SK S0G 2X0 Jim & Lori Duke Phone: 306-538-4556 Cell: 306-736-7921 Harvey Duke Phone: 306-761-2810 Cell: 306-536-4490 Email: square.d@yourlink.ca

SAO 393Y

STYLIST 328U X HINGE 290J

Website: square-dpolledherefords.com

!"#$%&'()#%*+,)"-,+.)/% %% Wascana Cattle Co. Bradley and Harvey Duke 3327 Baneberry Drive, Regina, SK S4V 2V2 Cell: 306-737-3980

Mannle Polled Herefords Scott and Maggie Mannle & Family Box 101, Whitewood, SK S0G 5CO Phone: 306-735-2981 Cell: 306-735-7180 Email: mannlepolledherefords@hotmail.com Website: www.mannlepolledherefords.com

SAZ 680Y

SUPER DUTY 42S X REVOLUTION 660L

012()%0#133/ Dale Stith: 918-760-1550 Ryan Dorran: 403-507-6483 Levi Landers: 308-730-1396

Joe Palsson: 613-897-3417 Brad Dubeau: 403-512-2235

SFM 501Y

BEYOND X SHIRAZ Bred SFM 17Y 9


C A N A D I A N

H E R E F O R D

D I G E S T

Newsworthy and notable stories from the Canadian Hereford industry

Bobby Hull Donates to the Bonanza Legacy Fund CJHA Auction at the 2012 World Hereford Conference Bobby Hull graciously donated a signed jersey and hockey stick that were auctioned at the 2012 World Hereford Conference in Olds, Alberta. The jersey was purchased by the Carmen and Allison Millham family (Hi-Cliffe) of Outlook, Saskatchewan. The hockey stick was purchased by the Bryan and Annette Latimer family (Remitall West) of Olds, Alberta. Proceeds from this auction totalling $2,900.00 go to the Bonanza Legacy Fund to support future Bonanzas. Thank you to the Millham and Latimer families for their support. Additional funds of $4,100.00 were raised for the CJHA through a 50/50 draw and silent auction at the end of the World Hereford Conference. •

PACE Deadline

Gordon Stephenson, General Manager of the Canadian Hereford Association and Jan Wills, Secretary General of the World Hereford Council, model the national costumes of Kazhakstan with Bakhyt Ataybekovym, owner of Dinara Ranch, at the World Hereford Conference. •

MOE Show Reminder Complete MOE show results must be sent to the CHA office as soon as possible after the completion of the MOE show. Please fill out the Digest MOE Show form when submitting results to the office. Call 1-888-836-7242 if you would like to request a form. •

Nomination Deadline is January 2, 2013 The deadline for Honour Roll, Memorial Scroll, Hereford Legacy Award, Special Service Award and Ambassador Award nominations is January 2, 2012. For nomination forms or for more information, contact the CHA office or visit our website at www.hereford.ca •

Hereford Cows Really are Hardy! At Braun Ranch they call 82S the cow with ‘nine lives’. 82S has a history of getting into trouble so when Carrie came across her scratching on this rock, Carrie decided she better stick around to make sure she could get off of it without help! This same cow survived a lightning strike in the summer of 2010 and also had to be rescued with ropes and the tractor when she cast herself. •

10

The deadline for submitting weights to be included in the Spring 2011 PACE run is November 1st. Please have your birth and weaning weights into the office by this date. All calves should be identified in groups when reporting weights this fall. Animals under the same management system should be in the same group. Genetic evaluations rely on accurate well defined management groups. The age range to take weaning weights is 110-300 days of age. Weaning weights and indexes are more meaningful when calves are weighed near 205 days – this means that the closer the AVERAGE AGE of the ALL calves weighed is to 205 days, the more reliable the data is. Calves do not actually have to be weaned before taking 205 day (weaning) weights. Use this opportunity to body condition score or weigh your cows as well. •


C A N A D I A N

H E R E F O R D

D I G E S T

upfront I wish to send my thanks to yourself and the Hereford Clubs of Canada’--also to farm owners and staff who have made my visit to Canada so enjoyable. You have all showed a new world that had only been seen on a map before. The Hereford Club people from New Zealand speak Errol Geoffrey Manderson at the World Hereford volumes of the planning and Conference, left, talking to Onatrio breeder Rae Junkin organization of an excellent tour and express a wish that some of you may be able to come to NZ for our Expo at Feilding if in NZ for a trip down under. Or maybe to join our Hereford Tour 2013. Down the South Island. Errol Geoffrey Manderson J.P IAME GAEDELIAN POLLED HEREFORDS

Colton Thomas’ Herd Bulls Colton Thomas, grandson of Stan and Susan Lock, from Lock Farms in Macklin, Saskatchewan, proves that taking care of livestock can be exhausting work. Colton supervised his herd bulls all day as they grazed in the living room, drank from the toilet and nibbled on cookies. When the cowboy got tired, they all curled up and had a nap. •

STARS Air Ambulance Jay Rimke, Junior Hereford Association member of AM Ranching, Oak Lake, Manitoba, is donating 10% of the proceeds from his 4-H steer to the STARS program which saved his life in early 2012. His parents, Albert and Michelle, are matching that donation. Through other matching donations, $2500.00 is being donated to the Manitoba division of STARS – the Shock, Trauma and Air Rescue Society. Thank you to the generous support of JM Beef Consulting- Kevin & Candice Wadham, Heartland Livestock Services – Virden, Renards Meat Services, Cheryl, Tim and Riley Hill, WKN Land & Cattle (Keith and Nadine Wohlgemuth), Oak Lake 4-H Beef Club, Tere & Tracy Stykalo & Family and Samantha and Levi Rimke, the latter of whom are giving $75.00 each. STARS is a charitable, non-profit organization dedicated to providing a safe, rapid, highly specialized emergency medical transport system for the critically ill and injured. The STARS Air Medical Crew consists of paramedics, nurses, and physicians who are committed to providing the very best in emergency medical care. The Aviation crew of pilots and engineers work to maintain helicopters and ensure safe flights. Since a helicopter was brought to Manitoba in April of 2011, there have been over 150 calls. Photo: Jay and steer buyer – Mike Hatfield of Hatfield Financial Services – Hamiota, MB, with Jay’s Reserve Champion Steer at Oak Lake 4-H Beef Club Achievement. •

Sale Result Corrections:

From the August 2012 Herd Reference Edition of The Digest 103rd Annual Lacombe Bull Sale

April 10, 2012

Lacombe, Alberta

Grand Champion Horned Bull HUXLEY 47R BRIT LAD 15X • Consigned By: CP Herefords, Huxley, Alberta Reserve Grand Champion Horned Bull HUXLEY 47R GENERAL LAD 24X • Consigned By: CP Herefords, Huxley, Alberta 11


Registered Herefords since 1954

!"#$%&#"%'()'*"+#,&-.'/0,,%')(#'1+,"' Also Yearling Bulls Sired By: ‡ AGA 95S STANMORE II 71U ‡ LBH 268P STANDARD 91U ‡ PHF 23H PRESTONE 21P

LBH 73L STANDARD 268P Thank you to Lilybrook Herefords for the use of 268P

Other Sires in Use: ‡ LLR 102T SUPER SILVER LAD 47X ‡ LLR 21P SILVER STD LAD 48U ‡ SGC 129P SUPER LAD 102T

CHECK OUT OUR UPDATED WEBSITE FOR SALE BULLAND HERDSIRE PHOTO PROFILES & STATS

www.lostlakeranch.cA E(<:'&$7(<$=C$5('&$."''

LLR 5Y Sire: LBH 268P STANDARD 91U

LLR 30Y Sire: AGA 95S STANMORE II 71U

B(+725/#$F$GH$E(5I(/1>&A()$J2&'7$4(#$ ;+K$D&5&+L&$3('C$3>(<:2=)$MNOM

LLR 90Y Sire: PHF 23H PRESTONE 21P

LLR 301Y Sire: LBH 73L STANDARD 268P

P&=:'&Q5$3>=21&$3>(<:2=)$P&)$=C$%+&7$B&2C&+5,$ GH$E(5I(/1>&A()$J2&'7$4(#,$M)7$?2<&$2)$R$S&(+5

Thank You to Our 2012 Buyers: !"#$%&'()*&+,$-'.&+/$0102''(),$3'2)/$4&56(+72)5,$8(77($9)/&+:+25&5,$;2<$4=+51>&27,$ ?=77$@+A2),$-#+&#$B&+&C=+7$D()1>

TERI MANNING & WOODY KUMPULA STOP BY ANYTIME TO Phone  Â&#x2021;Cell (780) 689-6606 12

Box 27, Site 5, Rich Lake, AB T0A 2Z0

VIEWTHE HERD

80km NW of St Paul or 50km SE of Lac La Biche


!"#$%"&%"'(%)'*+"#$(*%,-.$%$/0($**$1%-2%32+$($*+%32%4'5326%"'(%4'77*% 0(3"(%+"%+,$%*0(326%*-7$*8%*"%9$%,-.$%+(3$1%+"%-))"##"1-+$%+,$#:%%;.$(5% 4'77%,$($%<2"%,"714-)=*>%3*%0(3)$1%+"%*$77?%@77%5$-(7326*%-21%4'77%)-7.$*% ,-.$%4$$2%0(3)$1%-21%)-2%4$%0'(),-*$1%'0%'2+37%A$)$#4$(%B*+8%CDBC:%%@+% +,3*%+3#$%9$%9377%*"(+%"'+%-%E*+(326F%&"(%EG-76-(5F%-21%+,$%EH'77*%;5$F%-21% +,$5%9"2I+%4$%"&&$($1%-6-32%'2+37%+,$*$%($*0$)+3.$%*-7$*: !"#!"$%&'"#(&)#*&#%&'"#+,"!#*-"#.)$$/#"01$(#2&1#*-"# ."/*#/"$"%*,&3#4

&HB#IH@?JB#%K=LM?J@#NA@#JO#P#.H<<>#OBJL#EKA#5:95#!JB<D#-ABAOJBD#%J@OABA@QA

%#56)#/7($,3"#$08#9:(

%#56)#(0%-*#'0/*"1#99(

%#56)#1"8#/7($,3"#9;(

*KA#FA=B<?@R#SH<<>#M?QEHBAD#=SJTA#UABA#EHB@AD#S=QV#JHE#J@#RB=>>#=OEAB#EKA#!JB<D#-ABAOJBD#%J@OABA@QA#=@D#EKAF#QJ@E?@HA# EJ#DATA<JM#=@D#RBJUG###*KAF#=<J@R#U?EK#P:#JEKAB#.H<<W>#BAMBA>A@E#J@A#JO#EKA#>EBJ@RA>E#MA@>#UA#K=TA#ATAB#JOOABADG##*KAF# U?<<#>E=F#J@#RB=>>#H@E?<#L?DX&QEJSAB#UKA@#EKAF#U?<<#SA#SBJHRKE#KJLA#=@D#>E=BEAD#J@#EKA?B#U?@EAB#OAAD#B=E?J@G

!"#"#$"%&'((&$)((*&'%"&'+',('$("&)-.,(&/"0"#$"%&1*.2&34135

PY#Z#NJUABOH<#5:95#.H<<#%=<TA>#0<>J#0T=?<=S<A4

%<=>>#!?@@ABC#-=BD?>EF#2?A<D#8=FG%%J,$%7$6$21-(5%KLMML% -79-5*%7$&+%,3*%#-(=:%%N$+%"'(%KLMML%GBK%7$-.$%,3*%#-(=%32% 5"'(%,$(1%?%L2$%"&%+,$%4$*+%0("*0$)+*%9$%,-.$%$.$(%(-3*$1%?

%<=>>#!?@@ABC#-=BD?>EF#2?A<D#8=FG#!3($1%45%"'(%GODP% H'77%-21%"'+%"&%-2%$/)$77$2+%QOR%4($1%)"9:%%S$I*%*+"'+8%&'77% "&%($1%#$-+%-21%.$(5%$5$%-00$-7326?

BRAD & TAMMY, TY & MELISSA

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!"#$%&$"%'(((!!!!!!!!!!!!!!!!!!!!)*+!$$&,!-./01,!2)!3#4!#5#!!!!!!!!!! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!)6789:!-;..<!"#$%=$"%>&("!!!!!!!!!!?@7A.!B*6CA;..DEBB%A0;FGB7! HG"I@!JG,!(I@!KG!*L!M7:!N7:!5;6OAB;!5F7FA*0!*0!PQ1!(!7F!PQ1!>"',!-./01,!2)

13


Bar-RZ 85U Rolex 56X

He

ls Sel

{DLF, IEF, HYF}

Bar-RZ Young Herdsire

She

EPDs BW 2.3 WW 34.5 YW 61.1 Milk 16.2 TM 33.3 90 lb BW

ls

EPDs BW 3.3 WW 50.9 YW 82.7 Milk 23.2 TM 48.7

Bar-RZ 56X ZZ Top 22Z

Bar-RZ 261U Yasmine 51Y

1 place in class at Hardisty Field Day! Son of ROLEX 56X

Bred to Bar-RZ 85U Rolex 56X

st

Sel

She

Reserve Grand Champion Female at Rancher Day, World Hereford Conference BAR-RZ 30N U DAYA ET 54U & BAR-RZ 261U MISS ZAIDA 70Z

Sel

ls

EPDs BW 5.4 WW 56.4 YW 100.4 Milk 16.9 TM 45.1

Bar-RZ 59T Yolinda 12Y Tremendous Terrorist daughter! Champion Pen of Three Heifers Hardisty Field Day 2012

Stuart and Sherri Zoeteman Box 532, Fort Macleod, AB T0L 0Z0

Congratulations to Lamports Polled Herefords for winning Grand Champion Bull Calf at Hardisty Field Day! LAMPORT 23X TRIPLE CROWN 91Z, sired by BAR-RZ 59T TRIPLE X 23X

Phone: 403-553-2687 Cell: 403-330-6490

Fax: 403-553-2699 Email: barrz2@telus.net

!"#$%&'()(*+,&-(&$-%(".(/"0%(1$#,&"'("2(345(67(%"(88(9:;($2'(7(*+,&-(2"0%<("2(=&$0#&(8"$' 14


0()12&0(3$.*&,(%%-.& 42(%&53%&6($3-7&8)%#&9#:"&;."*

0012$344&'5$6*78&91:74$;'5)$ <7=)>?)*$+@A$.,+.

!"#$%&'()$*+)(,-&./,&01&2(33#4&5#,#6(,4$ !"##$%&#'()$*$+(&,#-./$!"##)$*$0(#(12$3",(4,(5$6(7&#()*$%877(,1-&#$!,(5$9(-:(,) !"#$%&'()*$+,-$.+/

B#-C$.DE6$!:F)$G&H$+,0!

##;I$.+/$J)&F$+,KJ

##;I$+,0!$J3-<$@,DJ$

L12)*$;:*)F$C)M*)F)41)8N !"#$%&'(()#(&*+%+(,)-./ %")0..)100)2+#%(3)104% %")0..)100)2+#%(3)-.05)6%

''78)9:3)/%&")0./ ;,"3)36<)'3+%+7"63):.0=

'>).4?)&<?+3&*)6%)@7 "&=A6B6)1-A)7AB)*&<)9>

!"#$%&'()*&+&,(%%-.&,#/&'%*/ Blaine 403-834-2262 Cell 403-502-5626

Box 96 Irvine, AB T0J 1V0 Fax (403) 834-2146 Email bsbrost@shockware.com

Glenn 403-834-2253 Cell 403-580-9363 15


16


8 miles North of Hwy 3 on Hwy 22

Klein Farms Herd Dispersal Sale December 1, 2012 - Balog Cow Palace

Offering Pure Bred: 30 Cows 12 2012 Bull Calves 14 2012 Heifer Calves

Commercial:

8 Bred Heifers 32 Cows 6 Yearling Bulls (Medicine Hat String) 11 2012 Heifer Calves 7 Bred Heifers 2 Herd Bulls

JNHR SILVER STANDARD 435M JNHR SILVER STANDARD 685T JNHR RED LADY 400P

GCK 685 RED STAN 9Y

FE 34Z STANDARD LAD 177D FE 177D STANDARD LAD 16L FE 07Y SUPER 57F

GCK 16 SUPER STAN 52P

FE 177D STANDARD LAD 16L GCK 16 SUPER STAN 52P GCK 5H SUPER DOMINO 57L

MACS RED RIBSTONE LAD 7R ZZB 7R STANDARD 8T ZZB 54M STANDARD 10R

GCK 8 STAN LASS 10X GCK 17 RIBSTONE CLASSIC 9M GCK DOM STAN 19S GCK 5H SUPER DOMINO 96L

GCK 335 EXTRA DOMINO 5H GCK 5H SUPER DOMINO 57L K 61Z SUPER LADY 109H

JNHR SILVER STANDARD 435M JNHR SILVER STANDARD 685T JNHR RED LADY 400P

A sample of one of our commercial cows on offer.

GCK 685 RED STAN 11Z FE 177D STANDARD LAD 16L GCK 16 SUPER STAN 52P GCK 5H SUPER DOMINO 57L

With calf 3Z at side.

Gordon & Cathy Klein & Family Phone/Fax  Â&#x2021;Cell (403)627-0006 Box 338 Lundbreck, AB T0K 1H0 17


C A N A D I A N

H E R E F O R D

D I G E S T

president’s message

By Randy Radau

PR E SI D EN T O F T H E CA N A D IA N H ER EFO R D A S SO CIATI O N

xAs I write my President’s report, harvest is in full progress in my part of Alberta. It is very

satisfying to combine a good crop of grain beside a pasture of attractive Hereford cows with big calves at side. We must all take a moment and appreciate the unprecedented times we are experiencing of both high cattle and grain prices. The terrific interest in Hereford cattle this summer has been very encouraging. The World Hereford Conference generated tremendous positive press for us both nationally and internationally. The spinoff from hosting WHC 2012 will be felt for some time. News of semen sales, embryos and live cattle are continually being reported. Our visitors to WHC 2012 continue to phone, e-mail and send letters of congratulations and thanks for the job well done. Our CHA staff, membership, and all of our volunteers can be extremely proud of their involvement in hosting the event of a lifetime. As I look back on my term as a CHA Director, and then my term as President, I am very pleased to have had a part in some very positive developments for our breed. DNA testing of all our sires and our genetic abnormality testing policy has led to fewer pedigree errors and more assured value for our purebred Hereford

Thank you to my family, CHA staff and all the membership for their support during my term on the board and as President. I have been warmly welcomed and hosted wherever I have travelled. The dedication and enthusiasm of our membership across the country has always impressed me. cattle. The science of genetics will have a profound effect on the future of purebred Hereford breeding and cattle breeding in general. The complete DNA sequencing of the bovine genome and the scientific field of genomics will provide us with further information. We will have the ability to know more about our cattle at a younger age through DNA testing than ever before. Your CHA board is always closely monitoring new scientific developments in cattle breeding and how best to use them to our members’ benefit. One of the priorities of the CHA has always been to improve communication with the membership. With the purchase of our national publication, The Canadian Hereford Digest, from the Gilmore family, we have united our major instrument of communication with the Canadian Hereford Association. The CHA staff certainly has achieved our goals with the professional look and readability of the new CHD. Another significant development recently has been the launch of the Hereford Research Fund and Bonanza Fund as part of the Keith Gilmore Foundation. There will be positive effects from these funds for years to come. We also have implemented many new recognition awards to reward the builders of our breed, such as the Hereford Ambassador, Special Service, Legacy and the All-Star program. My second year as President has been incredibly busy. Thank you to my family, CHA staff and all the membership for their support during my term on the board and as President. I have been warmly welcomed and hosted wherever I have travelled. The dedication and enthusiasm of our membership across the country has always impressed me. As my term as President draws to a close with the AGM in November at Agribition, this report will be my last President’s message. Thanks to the Board of Directors, Gordon Stephenson and all the staff of the CHA for being so professional and enjoyable to work with. Best of luck to everyone with the upcoming fall shows and sales.

18


C A N A D I A N

H E R E F O R D

D I G E S T

message du président

Par Randy Radau

PR É SI D EN T D E L’A S S O CIATI O N CA N A D I EN N E H ER EFO R D

Au moment où j’écris mon rapport de président, les récoltes sont en pleine progression dans mon coin de l’Alberta. Il est très satisfaisant de ramasser une bonne récolte de céréales à côté d’un pâturage où de belles vaches Hereford avec des gros veaux à leur côté broutent les derniers brins d’herbe de la saison. Nous devons tous prendre un moment et apprécier les bonnes choses que nous vivons tout autant au niveau du prix du bétail que celui des grains. L’intérêt incroyable démontré pour notre bétail Hereford l’été dernier est très encourageant. La Conférence Mondiale Hereford a généré une publicité énorme pour nous autant au niveau national qu’international. Les répercussions positives de la Conférence se feront sentir pendant longtemps. Des nouvelles ventes de semence, d’embryons et de bétail nous sont rapportées continuellement. Des téléphones, des courriels et lettres de remerciement et félicitations de nos visiteurs continuent de nous inonder. Le personnel de l’association, ses membres et tous nos bénévoles peuvent être extrêmement fiers de leur contribution à cet événement. Lorsque je fait le retour sur mon implication en tant que directeur d’AHC, et puis à la présidence, je suis très heureux d’avoir eu la chance de participer aux décisions concernant les développements très positifs pour notre

Je remercie ma famille, le personnel de l’ACH et tous les membres pour leur appui pendant mon terme sur le conseil et comme président. J’ai été chaudement accueilli partout où j’ai voyagé. La constance et l’enthousiasme de nos membres à travers le pays m’a toujours impressionné. race. Les tests d’ADN de tous les géniteurs et notre politique de testages d’anomalie génétique ont mené à peu d’erreurs dans nos registres et à ajouter une valeur assurée pour nos animaux de race Hereford. La science de la génétique aura un effet capital sur le futur de la race Hereford et l’élevage de bétail en général. L’ordonnancement complet d’ADN du génome de bovin et le domaine scientifique de la génomique nous fourniront davantage d’information. Par l’entremise de son ADN nous aurons la capacité d’en savoir plus au sujet de notre bétail et ce, à un plus jeune âge .Votre conseil d’administration surveille toujours étroitement les nouveaux développements scientifiques dans l’élevage de bétail et comment les employer à leur meilleur pour en faire bénéficierbénéficier nos membres. Une des priorités de l’association demeure toujours l’amélioration de la communication avec ses membres. Avec l’achat de notre publication nationale de la famille Gilmore, The Canadian Hereford Digest est notre instrument principal de communication pour ceux qui sont impliqués dans l’association. Le personnel de l’ACH a travaillé très fort pour atteindre les buts que nous nous étions fixés tant au niveau du contenu que d’une présentation professionnelle. Un autre nouveau développement d’importance est le lancement des fonds de recherches et des fonds pour le Bonanza provenant de la Fondation Keith Gilmore. Des effets positifs de ces fonds se feront sentir pendant plusieurs années à venir. Nous avons également mis en plan plusieurs nouveaux prix d’excellence pour souligner le travail des personnes qui sont ou ont été des ambassadeurs exemplaires pour la race. Ma deuxième année comme président a été incroyablement occupée. Je remercie ma famille, le personnel de l’ACH et tous les membres pour leur appui pendant mon terme sur le conseil et comme président. J’ai été chaudement accueilli partout où j’ai voyagé. La constance et l’enthousiasme de nos membres à travers le pays m’a toujours impressionné. Puisque mon temps comme président prend fin avec l’assemblée générale annuelle en novembre pendant l’Agribition, ce rapport sera ma dernière allocution comme président. Merci au conseil d’administration, à Gordon Stephenson et à tout le personnel pour votre professionnalisme. Ce fut un plaisir de travailler avec vous. Je vous souhaite une bonne saison d’automne et au plaisir de vous revoir. 19


20


BRETON WEST HEREFORDS

THANK YOU BUYERS, for a record setting Bull Selling Season At Calgary Bull Sale:

Since 1974

Bulls For Sale Any Time Out Of Darn Good Cows

John Simkin Jim & Georgine Westgard Stankievech Ranch (2) Anchor P Ranch Miller Ranch

At Home Bull Buyers:

NESP 99S Spring 99S, her dam, and her great grand-dam, 72G, all have excellent sons for sale. Golden Girl 72G is 15 and has yet another terrific bull calf at side!

Lisa Krisher TNT Farms Martin Rooyakkers Calerdon Cattle Co. Sky Track Ranch Norway Valley Farms (2) Denny Golden Glenn Amendt Josh Gardner Alan Peterson BT Bar Ranch (2) Garth Schmidt Art Dancause John Keleman Bev Kostiw Vince Pochynok Frank Block (2)

Female Buyers: Xports International

LLPH 58X Xcentric is an excellent young sire. There’s a large number of his impressive paternal brothers for sale.

Special thanks to Calerdon Cattle Co. & the Butler’s of Lone Pine Ranch for each buying 10 pairs in our ongoing Silent Auction Female Sale! If you are looking for purebred females, come have a look and we’ll make a deal.

!"#$%&"#%'#"()"**"'+#,"*")+-.'#./#

/.0#,%*"

Eugene, Norma, and Leonard Poholka 1$%'234.5#+.# %**#+$"#!67# .08%'-9"0,:

Ph: (780) 696-3878 Leonard’s Cell: (780) 898-9590 Fax: (780) 696-3777

Box 325, Breton, Alberta TOC OPO Email: bretonwest@gmail.com http://bretonwestherefords.com

5 mi. W. of Breton on #616, 2 mi. S. on Rge Rd. #50, 1 mi. W. on #474, 1 1/2 mi. S. on Rge. Rd. #51, 1/2 mi. W. 21


C A N A D I A N

H E R E F O R D

D I G E S T

hereford horizons

By Brad Dubeau

D I R ECTO R O F CO M M U N I CATI O N S

Those of us involved in the Hereford breed will look back on 2012 as a year to remember. Spring bull prices were as high as they may have ever been. Commercial calves also commanded top prices. Commercial prices backed off a bit during the summer months due to the difficulties that our neighbours to the south were experiencing but

The sales in the Maritimes and Ontario were extremely strong with huge demand for Purebred Hereford females across Canada and the US. The expectations are that this trend will stay the course throughout the fall for both Hereford females and bulls. While my spring travel plans into parts of Canada this year were cancelled due to obligations relating to World

The WHC Commemorative issue of the Canadian Hereford Digest was published and I can’t thank the membership enough for taking a leap of faith and supporting this issue as strongly as you did. since mid-August, the yearling market has been steady to strong. Calves moving in September also held strong and prices are expected to remain steady. Quality Hereford and Hereford Influence animals marketed didn’t take a back seat to any breed. Following the excitement from the spring bull sales, Hereford breeders were busy preparing for the 16th World Hereford Conference (WHC). The WHC Commemorative issue of the Canadian Hereford Digest

The free commercial calf listing service that the CHA offers is still available. To list or view calves, see the CHA website, on the left side of the homepage, under quick links. was published and I can’t thank the membership enough for taking a leap of faith and supporting this issue as strongly as you did. Comments from the international community were extremely positive and it’s thanks to you folks for being a part of it that made it so successful. The free commercial calf listing service that the CHA offers is still available. To list or view calves, see the CHA website, on the left side of the homepage, under quick links. If you or any of your customers are looking to increase their marketing exposure at no charge please encourage them to take advantage of this listing service.

22

Hereford Conference planning, things will return to normal next spring, allowing me to visit more breeders in 2013. As usual, I will be attending all contract advertisers’ sales. Sales that are not contract advertisers, I will attend as time and budget permits. We continue to offer ring service, the cost of which is based on the amount of business done with the Digest. The Digest publication side of the CHA continues to offer sale catalogues as well as other promotional materials to our breeders. If you have any questions regarding ring service or how the Canadian Hereford Digest can help with your promotional needs, please don’t hesitate to call. Good luck to all Hereford breeders at the shows this fall. See ya down the road!!


!"#$%#%&'(#)*+#,')#-."Â&#x2021;%:OEVÂ&#x2021;0DUFK 7KHODVWFDOIIURP-*:6DQGRXWRIDJRRG09)FRZ$JRRGVPRRWK FDOI7KLVGDPDOZD\VKDVDJRRGFDOI ! ! "#!$$%&!'()!"*)!+,! './01!23-)34536!+,-!"*)!%' ! ! 23-)34536!78"4*!9%" !"#$%#%&'(#)*+#,')#-." ! ! 4-!:%;!46!'(*-!<==& ! )>?1!4@;!<==&!'(*-!)#4!"*''!+$6!! ! ! 4@;!$,A;!'()!)#4!"*''!++B

!"#/01#%&)#'%&23#,')#4/"Â&#x2021;%:OEVÂ&#x2021;0DUFK $JRRGVWRXWFDOIRXWRID\RXQJJRRGSURGXFLQJFRZDQGWKH+=8 EXOOQRZDW:LQGLPXLU:HVWJDUG ! ! 23-)34536!+,-!"*)!%'  6LUH+=667'/$'8 ! ! 4@;!++8!'()!)#4!"*''!%A" !"#/01#%&)#'%&23#,')#4/"   /21$67(5/$'6  'DP)(6$67(5/$':   )(.5,%6721(3

!"#//&#%&)#)*+#45"#Â&#x2021;%:OEVÂ&#x2021;$SULO $JRRGWKLFNVPRRWKFODVV\FDOI+HLVZHOOPDUNHGDQGRXWRID\RXQJ WKLFNHDV\NHHSLQJ09)FRZDQGWKHKRPHUDLVHG+=7EXOOWKDWLV OHDYLQJJRRGIHPDOHV$GLIIHUHQWSHGLJUHHIRUVRPH   09)$67$1'$5'/$'/  6LUH+=/67$1/$'7 ! ! 4@;!<==&!'(*-!)#4!"*''!+$6 !"#//&#%&)#)*+#45"   09)*67$1'$5'92/7/$'/ ! )>?1!4@;!==:"!'()!)#4!"*''!9,$5! ! ! 4@;!$$=&!'()!)#4!"*''!9$<6!

!"#//&#367%&*(2#,')#48"Â&#x2021;%:OEVÂ&#x2021;0D\ $JRRG\RXQJFDOIRXWRIDWKLFNHDV\JRLQJ1HZPDQFRZDQGWKH +=7EXOO+HKDVDJRRGKDOIEURWKHULQWKH\HDUOLQJSHQ   09)$67$1'$5'/$'/  6LUH+=/67$1/$'7 ! ! 4@;!<==&!'(*-!)#4!"*''!+$6 !"#//&#367%&*(2#,')#48"#   )((5,%6721(/  'DP0+15,%6721(6 ! ! 47-!,7!'(*-)*6)!=4

23


C A N A D I A N

H E R E F O R D

D I G E S T

photo contest Thank you to everyone who sent in their photos for the Digest Cover Contest. We have some very talented shutterbugs out there taking Hereford photos! We encourage you to keep sending in your photos. You never know when yours will be featured on an upcoming cover, on the CHA website or on promotional materials and in ad campaigns.

K

Photo by Dan and Puff McKim of DU Ranch Cowley, British Columbia

K

Photos by Michelle Allison at Leveldale Farm Douglas, Manitoba

KPhoto by Ashleigh Ringdal at Ringdal Farms Armstrong, British Columbia

IPhoto by Erik Ringdal at Ringdal Farms Armstrong, British Columbia

24


C A N A D I A N

Photo by Scott Matthews Montreal, Quebec

Photo by Leonard Poholka of Breton West Herefords Breton, Alberta

Photo by Jaime Lutz at J Bar B Polled Herefords Warner Alberta

H E R E F O R D

D I G E S T

Photo by Heather Fisher LeBlanc Taken at the Salmon Arm Fair MOE Show

Photo by Larissa Lupul of Barefoot Polled Herefords Taken at NCX Polled Hereford, Brosseau, Alberta

IPhoto by Terri Nixdorff at YV Ranch Airdrie, Alberta

These are only a sample of some of the great photos we have received this year. We encourage everyone to continue to send their photos in to erin@hereford.ca all year long! 25


!"#$"%#&'()*+,"-."/)0123 !"#$!%&#'()*+",-.#/#01#2(&*+#3*+"#,4#5*6(-(7*#8!"#,7#839#:0;# <#2(&*+#7,="%#,7#>!7?*#>,!6#:1@#/#!"#$%&'()&*+,-*

# $

! "

CXT 119Y

PAHL 102Y

# $ CXT 42Y

# $

! "

PAHL 26Y

CXT 108Y

The Templetons Byron and Carolyn, Roberta, Jocelyn and Rosie 403-345-3889 Byronâ&#x20AC;&#x2122;s Cell 403-308-9971 Doran & Denise 403-345-4144 Brant & Sara 403-345-4124 Directions 9 miles North of Hwy 4 on Tempest Road or 7 miles South of Hwy 3 on Tempest Road or 11 miles East of Lethbridge on Jail Road & 3 1/2 miles South on Range Road 19-4

www.xtcherefords.com email: xtcherf@shockware.com 26

Box 761 Lethbridge, Alberta T1J 3Z6


!""#$%&'(! !Ä+RUQHGDQG3ROOHG/RQJ<HDUOLQJ+HUHIRUG%XOOV

Ä/RQJ<HDUOLQJ$QJXV%XOOVÄ3XUHEUHG%UHG+HLIHUVÄ&RPPHUFLDO%UHG+HLIHUV

! "

# $

CXT 86Y

PAHL 175Y

# $

PAHL 11Y

! "

# $

PAHL 56Y

CXT 5Y

!"#$%&'"#()*+"&$,$-)*)."/0123$-)..$)&$4(+/"5 !"#$%&"#'()#*(+%,"-%&.(/&0'&)1(2(3,,(4/+56(/%&70&1)#8%()#*(9),%(+)$)()-)",):,%; Scott Pahl 403-548-2356 403-580-9908 pahl.livestock@xplornet.com

Dan Pahl 403-548-8112 403-548-1614 dan@pahl-livestock.com

LeRay Pahl 403-548-6626 403-580-9906

Please visit our web site: www.pahl–livestock.com Box 245, Medicine Hat T1A 7E9 27


!"##$%&'&!$#() !"#$%&$#'()')*&& +,--.&"#$($'/(#*01

28

223$&45678--,9&:;&&<#=&#># 2I¿FH  ‡)D[   (PDLOVWDXIIHUIDUPV#SHQWQHWQHW !"#$%&'()*(+,-.%&/(0&/%("1(2&'(3&&4

*+,%&-.$"//)# +,--.&!"#$%&$)*('*?"

0+1$22$&*$##".3)#4


!"#$%&''()*%+,-.(/#0-'%1)*2 3(24.)56%72/2892,%:%;%<=>>?8 &#%#$2%,)'/$%<%@%80*24%4-(#$%-A%B#C0D-8%-'%EF5%""G

Featuring:

V"%E-,'2.%E2,2A-,.%K-'W%X2),*0'W%Y(**4 <%+-**2.%E2,2A-,.%K-'W%X2),*0'W%Y(** <>%Y*)/D%&'W(4%K-'W%X2),*0'W%Y(**4%

EE%&7H&PMB%">G>R%B3%%%%

<Z%Y*)/D%&'W(4%Y(**%M)*N24 <<%[-(,;X2),%;%J*.%M-882,/0)*%M-F4%9,2.%&OIO G\%]U[6%YY[6%-,%Y*)/D%/-882,/0)*%$20A2,4%9,2.%&OIO

MK%<%7JSIPJ%T<!<U%<B3%Q%7)8

YU%%%%UU%%%%XU%%%%S0*D%%%%1M%%%%]B&%%%%S),9 &&&&&3W3&&&&*)W#&&&4*W*&&&24W#&&&&#W+&&&&#W"$&&&&(#W32

YU%%%%UU%%%%XU%%%%S0*D%%%%1M%%%%]B&%%%%S),9 &&&&&*W#&&&&'3W)&&&&)4W#&&$#W*&&&&3W"&&&&&#W"$&&&&#W$+

/@KDA&DEBD&D677W&2"&DEBD&0O6K0S6N&07CEDA&X34Y###& @B&ZE7N6BD&2#32&D076W

/@KDA&DEBD&D677W&GNN@BS&6O6B&CEK6&C0A6KB07W

/899&:9;<=98>&?@A-@B&$##&C@76D&EB&077&F0AA76 G;;&HI;;J&0K6&-07A6K&LKEM6&0BN&-0O6&PQ@6A&N@DRED@A@EBD 90F-&LQ77&D677@BS&@BAE&0&FECC6KF@07&-6KN&?@77&L6&SQ0K0BA66N&QBFEBN@A@EB077T&UEK&$&UQ77&LK66N@BS&& &&&&D60DEBD V6&?EQ7N&L6&R760D6N&AE&?@BA6K&LQ77D&0A&0&FEDA G77&FECC6KF@07&U6C076D&0K6&SQ0K0BA66N&AE&?60B&0B&61F6776BA&F07U 5ECR7@C6BA0KT&7QBF-&RK@EK&AE&D076

!"#$%$&%'%(")*+,$-"#+$./0"#-%'."/$"#$%$0#++$1%(+$232$4(+%1+$&%((

HI7BJ%1&KBL%%M-82%2),*5%#-%N02F%#$2%/)##*2O P5*2%Q%H0/D0%%

%

%

email: nstromsmoe@yahoo.ca % % % %

%

%%%%%

Box !"#$%&'''($)*+&&&&&&&&&&&&&&&&&&&&&&&&& & 505,Etzikom,AB & & T0K &0W0 &&&&&&&&&&&& & Ranch location: 1& ½ mi. s.& of Etzikom 5677&!"#$%&4+4($)*+&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& & & &

%%M*0'#

&&,-./01&!"#$%&'''(234' &&5677&!"#$%&'"+('#44 29


C A N A D I A N

H E R E F O R D

D I G E S T

A True Legacy Douglas Lake Cattle Ranch By Catherine Brown

A S S O CIAT E ED ITO R

T he 120 -year hist or y of Douglas Lake Cattle Ranch was profiled in the 2012 World Hereford Conference (WHC ) Commemorative Edition of the Canadian Hereford Digest. The highest volume Hereford bull buyer in Canada, it is also the largest privately owned ranch in the country on a 500,000-acre land base in the Thompson-Nicola Region, south-east of Kamloops, British Columbia. Douglas Lake Cattle Ranch is the first and most fitting first-time recipient of the Canadian Hereford Association’s Legacy Award.

D o n’ t a s k S t a n a b o u t h i s crossbreeding philosophy. It’s not a two-way cross or a three-way cross that is at the core of his program. It’s the base of your cowherd that is important, he says. The history of cow lines is most important, in Stan’s opinion, no matter the breed or how they are crossed. Stan looks for cows that produce consistent results and for bulls from cows that produce consistent results, time after time. It’s the piece of the puzzle that’s often missing in front of cross-breeding programs, he says. Otherwise, you’re all over the map.

and sources those bulls from people that are frank about their breeding histories and results. They share what has worked for them and what they believe will work for the Douglas Lake operation. Stan spends hours going through individual pedigrees before bull sales. He pays attention to how sons of particular sires have worked for the ranch in the past and he looks into cow families at least three generations back. Stan says it’s the easiest thing in the world to pick a program – to know what you want to accomplish with

The herd base at Douglas Lake Cattle Ranch consists of about 4,500 Hereford cows, 2,500 black baldie cows and 450 bulls, producing in the range of about 6,600 calves annually. The herd base at Douglas Lake Cattle Ranch consists of about 4,500 Hereford cows, 2,500 black baldie cows and 450 bulls, producing in the range of about 6,600 calves annually. Herd management has been based on a 20-year-old breeding and marketing program that has worked well for the ranch. Cow Boss Stan Jacobs devises that program. Purebred and commercial producers the world-over could learn a thing or two from Jacobs’ experience. Wouldn’t you like to ask the man who purchases 70 to 80 bulls for his operation annually, his philosophy about selection and raising the best possible calf? We did, so listen up. Douglas Lake Cattle Ranch’s bull-tocow ratio is 5.5 per cent. That is, for every hundred females, 5.5 bulls are required. Bulls are kept in the herd for six years, on average.

30

Stan doesn’t like people referring to any of his cows as “black”. “The black ones are half Hereford, half Angus,” he says. And he knows their lineage. Stan buys bulls from good dams

the herd – and the hardest thing to stick to it. Stan’s and Douglas Lake’s philosophy is to convert grass into beef with the least amount of problems and in the most costeffective manner possible.

CHA President Randy Radau, Doulas Lake Cattle Ranch Manager Joe Gardner, Cow Boss, Stan Jacobs and CHA General Manager, Gordon Stephenson presenting Legacy Award at 2012 World Hereford Conference, Olds, Alberta


C A N A D I A N

Explaining what he means by sticking to a program, Stan says a threequarter Angus calf is a terminal calf, no matter how good a female it might produce. It simply isn’t what their program demands. “There are some good Chev dealers and some good Ford dealers too, but sometimes you only need one kind of truck and you don’t want one from

must keep nursing while producing next year’s calves and keeping their condition. Neither is their operation conducive to hauling feed, bedding or water. The Hereford cows prevail. Stan also evaluates bulls in person and prefers the qualities that come with feather-necked horned bulls. But he’ll overlook those preferences if he finds a complete animal. Neither

H E R E F O R D

D I G E S T

“intelligence”. He expects them to get the job done and know how to move when being handled without loosing their minds, and know when it’s time to get mad or use their protective instincts and when not to. Stan would like to see purebred breeders not put all their eggs into one basket. Whether it’s Angus and Hereford or heifer bulls and

Stan says it’s the easiest thing in the world to pick a program – to know what you want to accomplish with the herd – and the hardest thing to stick to it. Stan’s and Douglas Lake’s philosophy is to convert grass into beef with the least amount of problems and in the most cost-effective manner possible. each place,” Stan explains. Stan typically buys bulls at auction where the market price prevails. The biggest reason he keeps a Hereford cow base is because the Hereford cow does so much on so few resources. When environmental conditions call for early weaning on some operations, Stan says they don’t have the luxury of separating pairs in challenging years. The conditions simply don’t warrant it and cows

does Stan get hung up on numbers. And neither do scrotal measurements have to be exact; “just adequate,” he says. And he can tell if they’re adequate by looking at them. Most of all, before purchasing bulls, Stan likes to see them on the move. Structural soundness is difficult to see at a standstill but is very evident on the move, he says. A nd St a n’s e v e r- s o -p r ac t i c a l cowboy sense demands cattle with

performance bulls or bulls with maternal traits, he encourages producers to keep those lines, as long as those lines are consistent. Have a plan, in other words, and stick to it. It’s Stan’s “stick-to-itiveness” that has earned Douglas Lake Ranch the respect and recognition that it so fittingly deserves inside today’s beef industry circles.

PAST

PRESENT

FUTURE

MJT DUNN 195S

XTC 13S REGENT 17W

FA YANKEE BRITISHER 85X

Stan & Susan Lock

Box 215, Macklin, SK www.lockfarms.com

H: 1 (306) 753-2229 C: 1 (306) 753-7884 Email: lockfarms@xplornet.com 31


7RJHWKHUZLWKP\ZLIH7UDF\DQGRXUWZRJURZQVRQV(ULFDQG7\VRQZHDUHFRQWLQXLQJWKH¿IWKJHQHUDWLRQRIUDQFKLQJ:HUHFHQWO\ UHORFDWHGWR&DUQGXII6DVNDWFKHZDQZKHUHZHUXQFRPPHUFLDOFRZVZLWKDKHDGIHHGORW &XUUHQWO\ZHDUHXVLQJSROOHGDQGKRUQHG+HUHIRUGEXOOVRQRXUVROLGEODFNDQGVROLGUHGFRZVDQGKDYHEHHQLPSUHVVHGZLWKWKHUHVXOWV ERWKLQWKHIHHGORWDQGLQRXUUHSODFHPHQWKHLIHUV :KLOHORRNLQJIRUEXOOVWR¿WRXUSURJUDPZHFDPHDFURVVWKH'DOODVKHUG:HZHUHVRLPSUHVVHGZLWKWKHPDWHUQDOWUDLWVDQGTXDOLW\ WKDWZHSXUFKDVHGWKHFRZVDQGFDOYHV2XULQWHQWZDVWRNHHSWKHEXOOFDOYHVUHVHOOWKHFRZVDQGKHLIHUVWRSXUHEUHGEUHHGHUVIURP ZKRPZHFRXOGSXUFKDVHIXWXUHJHQHWLFVIURPIRURXUEXOOEDWWHU\ 2XUORQJWHUPSODQLVWRIXUWKHULQFUHDVHRXUEODFNFRZKHUGFURVVLQJWKHPZLWKSROOHGDQGKRUQHG+HUHIRUGVDQGIHHGLQJRXWWKHEDOGLH FDOYHV:LWKRXURQJRLQJQHHGIRUEXOOSRZHUZLWKLQRXUSURJUDPZHKRSHWRHVWDEOLVKUHODWLRQVKLSVWRGD\WKDWZHFDQGUDZRQIRU WKHVHIXWXUHJHQHWLFV )RUWKHPRQWKRI2FWREHUWKHFRZVZLOOEHKRXVHGLQWKH+LJK5LYHUDUHDVR'DYHFDQJHWWKHPVDOHUHDG\$OOFDWWOHZLOOEHSUHJ FKHFNHG,YRPHFHGDQGFDOYHVJLYHQWKHLUIDOOVKRWV 7RYLHZWKHFDWWOHRULI\RXKDYHDQ\TXHVWLRQVSOHDVHFDOO'DYHDW  7KHUHZLOOEHSOHQW\RIVDOHGD\SKRQHOLQHVDYDLODEOH LI\RXFDQQRWDWWHQG :HDUHH[FLWHGWREHSDUWRIWKLVXQLTXHRSSRUWXQLW\DQGORRNIRUZDUGWRYLVLWLQJZLWKDOORXUJXHVWV

!"#$%&'()

"+,,!# !"#$ %!



&' 

&' 

'' 

'' 

(' 

(' 

)) 

)) 

*) 

*) 

%!5$6789$:;5<$5=>=?$87@A$

&+85&+,//%521;:Â&#x2021;0*6*+$'$060$7&+32,17(78

6LUH

!"#$ %!



%!5$B8B$!CDD;E!F?$:;GG$8H7A$

5(0,7$//6+$71(56Â&#x2021;0*6$53$7&+$'$063

6LUH

"+,,!# !"#$ %!

%!5$678$>?EE<$876A$



&' 

&' 

'' 

'' 

(' 

(' 

)) 

)) 

*) 

*) 

&+85&+,//%521;:Â&#x2021;0*6$53$7&+$'$063

6LUH

!"#$ %!



%!5$B8B$I?E$:;5$8JHA

5(0,7$//6+$71(56Â&#x2021;0*6%%6)-/67'/$'3

6LUH

*+)$#+)($,-.+)#"/,+-$01("2($3+-/"3/4 Dave Dennis: (403) 815-3161 High River, Alberta 32

Bob Balog: (403) 382-5727 Balog Auction: (403) 320-1980

Ben Brillhart: (406) 947-2222 United States (406) 855-2021


33

OPI&-.4Q Born February 18, 2012 BW: 84 lbs, unassisted

OPI&514Q

Born January 14, 2012 BW: 72 lbs, unassisted

EPDs: CE 1.3 BW 4.4 WW 67.9 YW 105.2 Milk 21.5 TM 55.5 Owned with North Bluff Farms Inc. and NJW Polled Herefords 6HPHQVWUDZFHUWLĂ&#x20AC;FDWH

HJK&18L&/.4B&M"#$6$D&2N

OPI&4.Q

*+,&31.04-1043B. C$D,&31.04-10-.-.

?@&A(>#(%

E(D&48B8F&A$<:;)7$#F&EA&G8H&4I1

*+,&-./012304/55 67(#)89:);"<=>):

!"##$%&'(#)

Born March 4, 2012 BW: 82 lbs, unassisted We have a good group of DURAMAX bull calves for sale. Three of the calves pictured are out of two year olds.

OPI&4Q

Born January 20, 2012 BW: 92 lbs, unassisted


E6# 4J;D#0=:K@C;D#)L@@M 26# )K=B#'=DCMN=K=B#O=CP=KM E6## )K=B#O=K=PJKB#8JQQ=K<C:@# # O=CP=KM $F# F6$F#!J:@M#R)@L=MS#)@:<TMS#)L<TMTC;MS # ):U#'J:;MV !"#$%$&#'()*+,-"#./-.0#120

34

W## )KJT=#':;<9#A=@BC;DM

!"#$%%+#"3+'/#*(45"'#260#

789:;<=>#?#*:@=#A=@BC;D

!"#$EF*#!',-+4(-"#FGE0

!"#%2+#"HI"','#FG0


!"#$%&#'()*#+,-(#.$/

!"#%01#)'(",#2)''#334/

!"#343&#+,-(#567-*6#$48/#9##':;<#=<>?<@

':AB;<#':;<#!C:;

Al & Lori Fenton Becky & Curtis

Conrad & Janel Fenton Dalee, Prior & Emerson

Blair and Jessica Gray & Tayva Fenton

3KRQH)D[ &HOO

3KRQH &HOO

3KRQH &HOO

(PDLOIHQWRQKHUHIRUGUDQFK#JPDLOFRPÂ&#x2021;%R[,UPD$%7%+Â&#x2021;ZZZIHQWRQKHUHIRUGUDQFKFRP PL(RI,UPDRQ+Z\RUPL:RI:DLQZULJKW/RRNIRU+HUHIRUG6LJQ 35


36


37


C A N A D I A N

H E R E F O R D

D I G E S T

feature story

Post

Marketing It’s up to YOU!

By Bonnie Warnyca While the international g ue st s at t e nding t he World Hereford Conference (WHC) have gone home, the lasting legacy lives on for many Canadian Hereford producers. Many are still reminiscing about the tours and the many new contacts made and some are working on possible out-ofcountry semen and embryo sales. But the entire Canadian Hereford fraternity, whether they were able to attend the cross Canada tours, Calgary conference, or the cattle shows at Olds, can benefit from the highly visible gathering of so many good Hereford cattle and Hereford breeders.

The 2012 WHC brought the eyes of the world (including Canada) to our doorstep. Now how will the legacy continue? Bill and Nancy, Travis and Anthony Biglieni of WLB Livestock at Douglas, Manitoba attended the conference and they took cattle. But for the Biglienis, it was just one piece of a new marketing plan that they have worked on for the past four years. Many of the new puzzle pieces didn’t fit easily – in fact, they were out of their “comfort zone”. The couple has embraced social media together with their print advertising to market their mixed purebred herd of polled Herefords and Black and Red Simmentals. The yearling bulls, for the most part, are marketed into the commercial industry while females sell well into the purebred market. “Four years ago, we began looking to social media to adopt a more costeffective way to market our cattle. We had to find a way to add a premium to lower numbers of high quality Hereford females to market,” says Bill Biglieni.

38

“ We c a r ef u l l y a n a l y z e d o u r advertising dollars and refocused those efforts. We dramatically reduced our on-farm sales costs and went to an internet-based sale. We didn’t foresee the increased amount of exposure.” Last year, the couple’s internet Heifer Sale drew close to 400 viewers from over 40 provinces and states and four foreign countries. In all, there were 63 registered bidders for the 14 polled Hereford heifers. One interested breeder from Alabama, made the trip to the farm prior to the sale to see the offering himself and bought four head online.

New technology, in older hands, isn’t always easy “Last year, we were on satellite hookup which gave us a heap of trouble prior to sale day,” explains Biglieni. “On sale day, we rented a motel room in town and used two lap top computers to conduct the sale. They crashed at different times, but we were always able to stay online with one.” Bill and Nancy shoot their own videos and this year did their own catalogue to market their 12 females in October which was moved up a month earlier. They are now connected to 4G and the online sale will run over five days. “You get out of it what you put into it,” says Biglieni. It’s a lot like 4-H. You learn by doing. Our website has brought new customers to our program, but it’s always a struggle to keep it up-to-date.” The new WLB marketing program consists of a video bull sale in March and an Internet female sale in the fall. There are still some cattle marketed privately and the couple is working on a couple of international semen deals as a result of the WHC.

Carlrams Ranching from Cut Knife,

Saskatchewan, took 11 head to the WHC cattle show in July. The bulk of their marketing program is based on annual field days in both Saskatchewan and Alberta so they were keen to get some international exposure. But, in the end, they were surprised at how busy their stall was with local commercial cattlemen. “My dad and mom have been involved with the Hereford industry for many years, and they renewed some old international friendships at the congress,” says Carl Ramsay. “Now that my wife Dalynn and I are part of the operation, it gave us an opportunity to bring that generation up-to-date on our progress.” “But we think we made the most impact on the commercial side. We’ll sell around 50 long yearlings in our annual February bull sale here on the ranch so we’re hoping to see some new faces then.” Over the past few years, the ranch has increased its Hereford cow numbers to 250 and added a sizeable commerc ial herd. The fam i ly regularly takes bull calves to the Northwest Saskatchewan Hereford Club field day which moves around to different breeders’ locations. They hosted it two years ago and there can be up to 100 bull calves entered. They also take bull calves to Hardisty where the Alberta Hereford Association puts on a field day and the Hereford Genes Event during FarmFair International is a must on their agenda. “We have a website and a Facebook page and we adver tise in the Digest,” says Dalynn, “but most of our marketing program is based around meeting with our commercial customers face-to-face. Cal and Carl spend a lot of time going up and down the road visiting with our customers and we adapt our breeding program


C A N A D I A N

based on the future needs of those commercial outfits.” F ifteen miles east of Lethbridge, Alberta, the Byron Templeton family runs 150 purebred cows under the name of XTC Hereford Farms. Their focus is to provide practical bulls for the commercial outfits located mainly in southeastern Alberta and southwestern Saskatchewan. The bulk of their yearling bulls are sold in a joint production sale called the Amigos Sale with their partner Pahl Livestock. The sale is held at Redcliff near Medicine Hat midNovember. “The Hereford cross fits into so many different programs,” says Templeton. “Much of our business comes from commercial operations with Simmental influenced cow herds, but the last few years we’ve seen a rise in Hereford demand to get those red-white face and black-white face calves.” “We attended the WHC and were lucky enough to host some of the visitors both pre and post tours. Hosting such a high profile conference is good for Hereford business here in Canada. Like any form of advertising, you can’t measure the success of those contacts for months or even longer. It takes time to turn some of that into sales.” One thing Templeton is sure about is where his program fits into the industry. “You have to know what you have and where you fit to be successful in marketing,” he says. “Our management program mirrors that of a commercial program. They provide the blueprint of how we raise our cattle and that’s why our Hereford bulls work in many different programs and environments.” “We know that good cows need to be hardy and able to take care of themselves. I believe allowing Mother Nature to exercise a degree of environmental selection on a cow herd is a good thing.”

Templeton operates a 1,000 head feedlot stocked with both Hereford cross and straight bred Hereford calves. About 200 weaned calves are grassed every summer and finished on-farm while the heavier calves are sent to custom feeding under retained ownership. W hile hauling cattle from Tlell, on Haida Gwaii (formerly the Queen Charlotte Islands), an eight hour ferry ride off the North Coast of British Columbia, is not an easy trek, the Richardson Ranch took eight head of their own cattle and three head for friends to the WHC cattle shows at Olds. The trip may pay off as there was a lot of international interest in a Richardson Ranch raised bull calf. “We liked this calf from birth so we didn’t vaccinate him and he is IBR negative,” says Don Richardson, DVM. “We’ve already arranged to send him to stud in Alberta to begin his isolation time and hopefully we’re able to collect freezable semen to sell internationally for the 2013 breeding season.” Logistics and reduced cattle numbers in B.C. has forced the Richardsons to re-evaluate and diversify their marketing program. For 27 years they consigned their bulls to the Vanderhoof and Williams Lake Bull sales. These trips all include a $1,500 return trip ferry crossing and two full days of driving to get to these sales. But with the consignment auction numbers dwindling as B.C. cattle numbers go down and with the increase cost of ferry and fuel today, more of the cattle are being marketed from home. Even with purebred Hereford cow numbers at 35, the Richardsons have set a goal to gross over $100,000 from the cattle annually. To do that, they’ve become very creative. “We’ve had a website since the 1990s and three years ago went to online selling of our females and selection of our top bulls. The cattle mainly sell into western Canada as far as

H E R E F O R D

D I G E S T

Manitoba and embryos and semen go internationally,” says Richardson. “We cherry pick our domestic and international markets and go after them.”

Freezer beef sales add $3,000 to $4,000 for older cows The Richardson kids took a trailer load of eight cows a few weeks ago to Vanderhoof. Two of the recipient cows went to auction while the rest went to slaughter at a provincially inspected facilit y. The family members returned with a trailer load of hay and the 900 lbs. of sausage, pepperoni and beef jerky. Another 1,600 lbs. of hamburger will follow on a commercial freezer truck after processing. They sell Hereford beef to local customers out of their freezer located in the on-ranch feed store. For the past 15 years, Richardson put most of his bulls in a bull test centre on the mainland, and the ones that didn’t make the grade as breeding bulls came back to the Ranch, cut, wrapped and frozen to his beef clients’ specs. He also bought other finished yearling Hereford bulls on the rail that didn’t have a home as breeding bulls. “Our philosophy is to not head down just one path with our marketing,” he says. “Diversification makes every corner of the ranch profitable.” Richardson has the only veterinary practice on the Haida Gwaii, located on the ranch, while his wife Leslie runs a feed store from there. The whole family has been involved with the Hereford industry for more than 30 years. Through their international travels and participation in Bonanza, they’ve expanded their marketplace. They hosted a pre-tour group for the WHC and were able to show their program to a greater audience.

“The WHC exposed our program to a lot of international breeders and we could talk cattle. I liked the opportunity get to know more Horned Hereford breeders and I’d like to see that relationship grow. In addition, the number of juniors in the barn gave me a good feeling about the future of our breed.” ~ Bill Biglieni 39


C A N A D I A N

H E R E F O R D

D I G E S T

:@6>6(7M2(N2M68O;A(@2168/=>64(>7/342;7>(M686(1/764(M=7@(P86/7(86>;A7>Q( .72N(D0(7@6(8/3?@(28(?216(72(7@6(>/A6()6D8;/80(FB(GHIJ(72(>66(7@6=8(N2M68@2;>6(>23(9(@=>(N63(1/76>Q

.:$(JHJE(.R*KE''(SHJ.

.:$(ITTU(:K,EU-'(FHV:

89*"&:$$)#+&;5421/*&<1-1,(-4&=#+1>&)6D8;/80(FB(GHIJ(

K=7@(./A6(5/87368>L/2+HUHIRUGV1HZPDQ+HUHIRUGV5LYHU%ULGJH5DQFK

!"#$%&'()*+,-,'. $/01234! "#$%&!'()*(%+)

!"#$%&'()&*(&#++&(,&()-&.)/*(01-/&2"(&"1+314&*(&0#%1&*"5/&#&61-'&& /)..1//,)+&'1#-7

56768(9(:8;40(( :8/<=>(9($/?@6AA6 "#$%&!'()*(),'! !-6<=B(C28D(9(E/76 !!!!!!!!!!!!!!!!!!!!"#$%&!'()*#,'+

:244B(.;6(9(.@6AD0(  Â&#x2021;)D[   (PDLOVN\WUDFNUDQFK#VDVNWHOQHW

55//2<'0,167(56.69;Â&#x2021;NP1RQ+Z\NP(RQ7ZS5GNP1RQ5JH5G

!"#$%$&#'()*)+,-(#%./0

E+9&#$/'#&/$'($1/&F$ !G$CHI$3#'+'/9&#$JH?KÂ&#x2021;LLM$J?DN$81-&#$8NO$L*6$CK 338!$P8$5*/9'(Q+"($P?@5$Â&#x2021;8NM$8+*(6*#6$J@DR$O"%'("$BBN O3SM$DDG$<T+#*$U*#V$>N$$ Â&#x2021;

GWG$BDM$L*6$H?DI

"#1234#56#1674#68#594#:672;<#=4>3?2;<#@A??1#863#6A3#!2315#B347243#'A??#+>?4

C62;#A1#>5#594 J/+$G((1*.$$X#&%'&#$S&#&)"#6$31..$8*.&Â&#x2021;!4@3A>3=#D59E#%.$F##>5#594#G?6=H#-I92@2526;#J36A;H1 K259#1>?4#L>35;431M#":4#,434863H1E#B>3NO215>#,434863H1E#G6:N#!>371#P#Q>O241#(>;:92;<

!"#$%"#&$'()"#%*+'"(,$-.&*/&$0"(+*0+$1/2 3'..$4$5&(67 89*(*,$:'(*7&$4$;&(6*.. 40

<=&/9*%,$8; >?@ABC>ADC??


16th Annual British Breeds Bonanza Rancher Calf Sale

Special Rancher Calf Sales Every Friday - 10:30 AM Thru to Friday, December 21

Tuesday, October 23 - 10:30 AM

Plus

Tuesday, Oct. 23 - 10:30 AM Tuesday, Oct 30 - 10:30 AM Tuesday, Nov. 6 - 10:30 AM Tuesday, Nov. 13 - 10:30 AM

2500 Head on Offer HEREFORD â&#x20AC;&#x201C; BLACK ANGUS â&#x20AC;&#x201C; RED ANGUS SHORTHORN â&#x20AC;&#x201C; CROSSBRED CALVES

Monday, November 26 - 1:00 pm

Saturday, November 24 - 1:00 pm UĂ&#x160; *Ă&#x20AC;Â&#x2C6;âiĂ&#x192;Ă&#x160;vÂ&#x153;Ă&#x20AC;Ă&#x160;/Â&#x153;ÂŤĂ&#x160;*iÂ&#x2DC;Ă&#x192;Ă&#x160;Â&#x153;vĂ&#x160;xĂ&#x160; Ă&#x20AC;i`Ă&#x160;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192; UĂ&#x160; *Ă&#x20AC;Â&#x2C6;âiĂ&#x192;Ă&#x160;vÂ&#x153;Ă&#x20AC;Ă&#x160;/Â&#x153;ÂŤĂ&#x160;Ă&#x17D;Ă&#x160;*iÂ&#x2DC;Ă&#x192;Ă&#x160;Â&#x153;vĂ&#x160;£äĂ&#x160; Ă&#x20AC;i`Ă&#x160;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192;Ă&#x160;EĂ&#x160;"ÂŤiÂ&#x2DC;Ă&#x160;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192; All heifers will be judged, bring as many pens of five or ten as you want - or bring a liner load

Featuring UĂ&#x160; 100Ă&#x160;Â&#x2021;Ă&#x160;>Â&#x2DC;VĂ&#x17E;Ă&#x160;Â&#x2021;Ă&#x160;>Â&#x2DC;VĂ&#x17E;Ă&#x160;Â&#x2026;Â&#x153;Â&#x201C;iĂ&#x160;Ă&#x20AC;>Â&#x2C6;Ă&#x192;i`Ă&#x160;Ă&#x20AC;i`Ă&#x160;wĂ&#x20AC;Ă&#x192;Ă&#x152;Ă&#x160;V>Â?vĂ&#x160; Â&#x2026;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192;Ă&#x160;­Ă&#x17D;Ă&#x2030;{Ă&#x160;,i`Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160;Â&#x2021;Ă&#x160;ÂŁĂ&#x2030;{Ă&#x160;-Â&#x2C6;Â&#x201C;Â&#x201C;iÂ&#x2DC;Ă&#x152;>Â?ÂŽ UĂ&#x160; Â?Â?Ă&#x160;Ă&#x160;Ă&#x192;Ă&#x17E;Â&#x2DC;VÂ&#x2026;Ă&#x20AC;Â&#x153;Â&#x2DC;Â&#x2C6;âi`Ă&#x160;LĂ&#x20AC;i`Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160;,i`Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160;LĂ&#x2022;Â?Â?Ă&#x192;Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160; V>Â?Ă&#x203A;iĂ&#x160;Â&#x201C;Â&#x2C6;`Â&#x2021;>Â&#x2DC;Ă&#x2022;>Ă&#x20AC;Ă&#x17E; UĂ&#x160; ,iÂŤĂ&#x2022;Ă&#x152;>Ă&#x152;Â&#x2C6;Â&#x153;Â&#x2DC;Ă&#x160;Â&#x2021;Ă&#x160;/Â&#x153;ÂŤĂ&#x160;ÂľĂ&#x2022;>Â?Â&#x2C6;Ă&#x152;Ă&#x17E;Ă&#x160;Â&#x2026;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192;Ă&#x160;vĂ&#x20AC;Â&#x153;Â&#x201C;Ă&#x160;>Â&#x2DC;Ă&#x160; Â&#x153;Ă&#x2022;Ă&#x152;Ă&#x192;Ă&#x152;>Â&#x2DC;`Â&#x2C6;Â&#x2DC;}Ă&#x160;Â&#x153;Ă&#x2022;Ă&#x152;wĂ&#x152;

Chinook Farms Complete Ranch Cow Dispersal

Westwood Land & Cattle Ltd. Complete Cow Dispersal Moosomin, SK

Thursday, November 29 - 1:00 pm Featuring 850 Black Angus Ranch Cows UĂ&#x160; ÂŁĂ&#x192;Ă&#x152;Ă&#x160;V>Â?Ă&#x203A;iĂ&#x20AC;Ă&#x192;Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160;Â&#x201C;>Ă&#x152;Ă&#x2022;Ă&#x20AC;iĂ&#x160;VÂ&#x153;Ă&#x153;Ă&#x192; UĂ&#x160; Ă&#x20AC; i ` Ă&#x160; Ă&#x152; Â&#x153; Ă&#x160; i > Ă&#x192; Ă&#x17E; Ă&#x160; V > Â? Ă&#x203A; Â&#x2C6; Â&#x2DC; } Ă&#x160; Â&#x2026; Â&#x2C6; } Â&#x2026;Ă&#x160; ÂŤiĂ&#x20AC;vÂ&#x153;Ă&#x20AC;Â&#x201C;>Â&#x2DC;ViĂ&#x160;LĂ&#x2022;Â?Â?Ă&#x192;Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160;V>Â?Ă&#x203A;iĂ&#x160;ÂŤĂ&#x20AC;Â&#x2C6;Â?Ă&#x160; ÂŁÂ&#x2021;ÂŁĂ&#x17D; UĂ&#x160; Ă&#x20AC;i`Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;]Ă&#x160;-Â&#x2C6;Â&#x201C;Â&#x201C;iÂ&#x2DC;Ă&#x152;>Â?Ă&#x160;EĂ&#x160; Â?>VÂ&#x17D;Ă&#x160; >Ă?Ă&#x160; Ă&#x2022;Â?Â?Ă&#x192;Ă&#x160;Â&#x2021;Ă&#x160;Ă&#x2022;Â?Â?Ă&#x160;Â&#x2026;i>Â?Ă&#x152;Â&#x2026;Ă&#x160;ÂŤĂ&#x20AC;Â&#x153;}Ă&#x20AC;>Â&#x201C; One of the greatest sets of reputation ranch cows to sell this fall.

Tuesday, November 6 10:30 AM

Kay Wynder Annual Bred Heifer Sale

14th Annual Rainbowâ&#x20AC;&#x2122;s End Replacement Bred & Open Heifer Sale Featuring All Breeds

British Breeds #2 - Special Rancher Calf Sales

New Dayton, Alberta

1050 Fancy Young Ranch Cows

BHR Ranches Genetic Resource Female Sale Milk River, Alberta

5 Days - One For Each Pasture Monday, October 22 - 1:00 pm - Monday, October 29 - 1:00 pm Monday, November 5 - 1:00 pm - Monday, November 12 - 1:00 pm Monday, November 19 - 1:00 pm

Featuring

UĂ&#x160; 30Ă&#x160;Â&#x2C6;Ă&#x20AC;Ă&#x192;Ă&#x152;Ă&#x160; >Â?vĂ&#x160;iÂ&#x2C6;viĂ&#x20AC;Ă&#x192; UĂ&#x160; 300Ă&#x160;Ă&#x201C;Â&#x2DC;`Ă&#x160; >Â?Ă&#x203A;iĂ&#x20AC;Ă&#x192; UĂ&#x160; 300 Ă&#x17D;Ă&#x20AC;`Ă&#x160; >Â?Ă&#x203A;iĂ&#x20AC;Ă&#x192; UĂ&#x160; 370Ă&#x160;{Ă&#x152;Â&#x2026;Ă&#x160;Â&#x2021;Ă&#x160;Ă&#x2021;Ă&#x152;Â&#x2026;Ă&#x160; >Â?Ă&#x203A;iĂ&#x20AC;Ă&#x192; UĂ&#x160; *Â?Ă&#x2022;Ă&#x192;Ă&#x160;Ă&#x17D;Ă&#x2021;Ă&#x160;Ă&#x17E;Â&#x153;Ă&#x2022;Â&#x2DC;}Ă&#x160; Â?>VÂ&#x17D;Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160;EĂ&#x160;nĂ&#x160;Ă&#x17E;Â&#x153;Ă&#x2022;Â&#x2DC;}Ă&#x160;,i`Ă&#x160; Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160;LĂ&#x2022;Â?Â?Ă&#x192; II Â&#x153;Ă&#x153;Ă&#x192;Ă&#x160;Ă&#x153;Â&#x2C6;Â?Â?Ă&#x160;Ă&#x192;Ă&#x152;>Ă&#x20AC;Ă&#x152;Ă&#x160;V>Â?Ă&#x203A;Â&#x2C6;Â&#x2DC;}Ă&#x160;ÂŤĂ&#x20AC;Â&#x2C6;Â?Ă&#x160;ÂŁ]Ă&#x160;Ă&#x201C;ä£Ă&#x17D; IInä¯Ă&#x160;Â&#x153;vĂ&#x160;Ă&#x152;Â&#x2026;iĂ&#x160;VÂ&#x153;Ă&#x153;Ă&#x192;Ă&#x160;>Ă&#x20AC;iĂ&#x160; Â?>VÂ&#x17D;Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192; II/Â&#x2026;iĂ&#x192;iĂ&#x160;>Ă&#x20AC;iĂ&#x160;Ă&#x20AC;>Â&#x2DC;VÂ&#x2026;Ă&#x160;VÂ&#x153;Ă&#x153;Ă&#x192;Ă&#x160;Ă&#x152;Â&#x2026;>Ă&#x152;Ă&#x160;Â?Â&#x153;Â&#x153;Â&#x17D;Ă&#x160;>vĂ&#x152;iĂ&#x20AC;Ă&#x160;>Â&#x2DC;`Ă&#x160;V>Â?Ă&#x203A;iĂ&#x160;LĂ&#x17E;Ă&#x160;Ă&#x152;Â&#x2026;iÂ&#x201C;Ă&#x192;iÂ?Ă&#x203A;iĂ&#x192; *John Vandeurzen is 79 years old and runs the ranch himself!! His health has failed - thus the reason for this tremendous dispersal

Monday, December 3 - 1:00 pm Featuring 150 Fancy Young Ranch Females UĂ&#x160; 90Ă&#x160;Ă&#x201C;Â&#x2DC;`Ă&#x160;EĂ&#x160;Ă&#x17D;Ă&#x20AC;`Ă&#x160;V>Â?Ă&#x203A;Â&#x2C6;Â&#x2DC;}Ă&#x160;Ă&#x192;Ă&#x152;Ă&#x20AC;>Â&#x2C6;}Â&#x2026;Ă&#x152;Ă&#x160;LĂ&#x20AC;i`Ă&#x160; iĂ&#x20AC;ivÂ&#x153;Ă&#x20AC;`Ă&#x160;viÂ&#x201C;>Â?iĂ&#x192;Ă&#x160;LĂ&#x20AC;i`Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160; Â&#x153;iÂ&#x2DC;â]Ă&#x160;

> Ă&#x20AC; Â? Ă&#x20AC; > Â&#x201C; Ă&#x192; Ă&#x160; E Ă&#x160; Â&#x153; Ă&#x20AC; L Â&#x2C6; i Â? Â? Ă&#x160;  Â&#x153; Ă&#x20AC; Â&#x2DC; i `Ă&#x160; iĂ&#x20AC;ivÂ&#x153;Ă&#x20AC;`Ă&#x160; Ă&#x2022;Â?Â?Ă&#x192; UĂ&#x160; 30 -Â&#x153;Â?Â&#x2C6;`Ă&#x160;LÂ?>VÂ&#x17D;Ă&#x160;Ă&#x201C;Â&#x2DC;`Ă&#x160;V>Â?Ă&#x203A;Â&#x2C6;Â&#x2DC;}Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160; viÂ&#x201C;>Â?iĂ&#x192;Ă&#x160;LĂ&#x20AC;i`Ă&#x160;Ă&#x152;Â&#x153;Ă&#x160; Â&#x153;Ă&#x20AC;LÂ&#x2C6;iÂ?Â?Ă&#x160;iĂ&#x20AC;ivÂ&#x153;Ă&#x20AC;`Ă&#x160; LĂ&#x2022;Â?Â?Ă&#x192; UĂ&#x160; 30Ă&#x160;-Â&#x153;Â?Â&#x2C6;`Ă&#x160;LÂ?>VÂ&#x17D;Ă&#x160;ÂŁĂ&#x192;Ă&#x152;Ă&#x160;V>Â?vĂ&#x160; Â?>VÂ&#x17D;Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160; Ă? Ă&#x160; - Â&#x2C6; Â&#x201C; Â&#x201C; i Â&#x2DC; Ă&#x152; > Â? Ă&#x160; Â&#x2026; i Â&#x2C6; v i Ă&#x20AC; Ă&#x192; Ă&#x160; L Ă&#x20AC; i ` Ă&#x160; Ă&#x152; Â&#x153;Ă&#x160; iÂ&#x2DC;VÂ&#x2026;Â&#x201C;>Ă&#x20AC;Â&#x17D;Ă&#x160; Â?>VÂ&#x17D;Ă&#x160;Â&#x2DC;}Ă&#x2022;Ă&#x192;Ă&#x160;LĂ&#x2022;Â?Â?Ă&#x192;

Call any member of the Balog team to discuss your marketing needs

Call us at 1-877-320-1988

or (403) 320-1980 Fax (403) 320-2660 Email: sold@balogauction.com Web site: www.balogauction.com Box 786, Lethbridge, AB T1J 3Z6 41


42


43


C A N A D I A N

H E R E F O R D

D I G E S T

feature story

The Meers Brothers’ Philosophy

“Fifty Per Cent Hereford” By Brad Dubeau

D I R ECTO R O F CO M M U N I CATI O N S

How do three brothers and their families farm successfully together? The philosophy of all three Meers brothers – Gary, Dwight and Kent – is to vote early when making tough, key decisions, so you’re not the third and deciding vote! The third-generation Meers farm and ranch celebrated its 100th year in business this past August. It lies northeast of Acadia Valley; just six miles from the Saskatchewan border. Gordon and Mable Meers started with one homesteaded quarter section and one pre-empted quarter, in 1912, when they farmed with horses and had a few cows. Gordon and Mable’s son, Mervin took over operations at the age of 21 and with his wife Amanda, continued to develop the farm and ranch. In 2013, the couple will celebrate 60 years of marriage. In the early eighties, when Mervin turned 65, he turned the operation over to his sons, Gary, Dwight and Kent Meers and their families. Over the years, land acquisitions have expanded the operation, which now encompasses about 14,000 acres. One half of the acreage is dedicated to annual crops, with rotations of wheat, durum, barley, mustard, canola and peas. The remaining acreage 44

includes native pasture and reseeded perennials for hay and grazing. The cow/calf enterprise has bounced back and forth between 100 and 200 pairs, with deliberate fluctuations made according to growing conditions and moisture levels – thereby reducing the need to haul water and buy extra feed. A Hereford base has always been maintained in the cow herd. Horned Hereford bulls have been purchased from a number of local breeders over

decision has been recently made to go back to Red Angus bulls to increase calf marketability. Hybrid vigor has resulted in some desirable females – cows which are a little smaller and which use less feed but still raise a great calf. They typically have nice square, tight udders. The crossbred female has become a favourite, as long as they are a minimum 50% Hereford. Cows on the Meers operation start calving around the end of March

The Alberta Hereford Association is pleased to honour the Meers Brothers as Commercial Cattlemen of the Year for 2011. the years, including Westerlunds, Blumes, Clarence Peters, Gordon and Allen Henderson, Peggy Gerber, Allen Code, Robbie Fischer, Kevin Dorance, Kallal Herefords, Fenton Ranches, Mark Rosgen and many others. The brothers have experimented with crossbreeding to a number of different breeds over the years, but have chosen to stay with the quality they have achieved with the red color. They typically raise their own replacement heifers which have traditionally been bred to Tarentaise bulls for their first calf. However, the

through April. Steer calves are weaned and sold in November weighing in around 550 lbs to 600 lbs. Traditionally, calves have been marketed at Bow Slope Shipping in Brooks, Alberta but the Meers have recently used Medicine Hat Feeding Co. with successful results. Heifers are all backgrounded and from that group, replacements are selected in the spring. Operating a family farm has its challenges, but the Meers brothers and their families have found that keeping a cool head and talking


C A N A D I A N

things out results in easier decision making. The operation’s philosophy is to put everything into one pot and maximize the returns for all – sharing in the successes and the not so fortunate circumstances equally. Why do the Meers boys stick with Herefords? The answer is “ease of handling and feed efficiency,” in Dwight’s words. “Temperament plays a major role in their operation and the cows need to look after themselves.” Gary and Nancy are now empty nesters. Their three girls are married and have brought four grandchildren into the family. Amber, Wes and Isaac live in Coledale; LeeAnne, Thomas, Jayna and Mason live in Medicine Hat and Donna, Cory and Dylan live at Redcliff. Nancy works part-time at the Post Office and the Municipal District Office in Acadia Valley. Gary and Nancy built a cabin a few years ago on Lake Diefenbaker in Saskatchewan. They enjoy their free time fishing, relaxing and entertaining family and friends. They look forward to spending more time at the lake in the near future. Dwight and Wendy live about a city block north of the main farm on the site where his grandparents first located. In addition to farming, Dwight has been on the local Municipal District council for 13 years and is currently the Reeve for the MD of Acadia. In the past, he coached his son Derek’s hockey for 12 years and spent 2 years as president of the local Recreation Club. Wendy has worked for 19 years with Dr. Little at the Chiropractor Clinic in Oyen and also works part time for the Niblock and Company law firm. As their children grew up, she managed Derek’s hockey team and taught tap dancing to their daughter Candice. Candice married Jeff MacDougal 7 years ago. They live with their son Brock in Macoun, Saskatchewan where Candice is a full time Mom and Jeff is a Manager with

H E R E F O R D

D I G E S T

Sidewinder Oil. Derek and his wife Andria have just celebrated their 2nd anniversary. They own a home in Medicine Hat where Derek has worked for Sanjel Oil Co for six years and Andrea is in her second year of teaching. Kent came back from school in 1985 to join the farming operation, although he also worked off the farm as a journeyman Heavy Duty Mechanic for the first seven years. This training now comes in handy on the farm. He married Leanna Champ of Innisfail in 1987 who teaches in Acadia Valley. Their oldest son Kyle (21) graduated from SAIT in 2011 and is currently working as a Mechanical Engineering Technician at Foremost Industries in Calgary. He is returning to school in January to receive his Mechanical Engineering Degree. Logan (18) will enter his second year of Mechanical Engineering at the University of Alberta this fall. Kent coached minor hockey in Oyen for 14 years and is an active member of the Oyen Crocus Masonic and Eastern Star Lodges. He has also served on the Acadia Valley Recreation Club and is involved with the building of the new arena in Acadia Valley. Leanna is an active member of the Acadia Valley Community Club, Serenity Chapter of Eastern Star and is currently treasurer of the Friends of South Central High School. Parents Mervin and Amanda still live on the farm where he helps move equipment and does some lathe work as a pastime. They enjoyed square dancing for many years, travelling to points across southern Alberta and Saskatchewan. The Alberta Hereford Association is pleased to honour the Meers Brothers as Commercial Cattlemen of the Year for 2011. Photo, opposite page: Wendy, Dwight, Nancy, Gary, Leanna, Kent and in foreground, Mervin and Mable Meers

A main herd sire from Diamond T Herefords working at the Meers brothers

Photos from top to bottom: • Mervin with lathe on-farm • Homemade 10-ton press • Homemade seed cleaning unit • Weigh scale for grain & cattle • Homemade portable handling system


12+'%("*"&3452&6"!!&,-/7&89:&12+'%("*"&;<-"&6"!!&</.= $)HEUXDU\GDXJKWHURXWRIDQ8QOHDVKHGWZR\HDUROGDQGWKHLQĂ XHQWLDOVLUH35/1('(TXLWHWKHJHQHWLFTXHHQ KDYLQJDIRXQGDWLRQW\SHSHGLJUHHWKDWFRXOGEHEXLOWXSRQIRUJHQHUDWLRQVWRFRPH

&KDPSLRQ Bull at both the Manitoba Hereford Field 'D\DQGWKH 6DVNDWFKHZDQ Hereford Field 'D\

(3'V !"# 8?&$$$$ $%$ %?&$$$$ %%$ 8&?;$$ &%$ :;?7$$ 0$ %H?H$$ 70$ 8<?;

!"#"!$%!"&#?@'>*0&B.4'&B=

(3'V !"# 0?:$$$$ $%$ I?0$$$$ %%$ 8&?7$$ &%$ &0?<$$ 0$ 7:?:$$ 70$ I7?<

!"#"!$%!"&(+&=>$?%@&3'&.=

(3'V !"# =0?%$$$ $%$ 8?%$$$$ %%$ 8&?&$$ &%$ H&?%$$ 0$ <%?0 70$ I;?0

!"#"!$%!"&'"()'*"++&,-'&./0

(3'V !"# %?8$$$$ $%$ <?8$$$$ %%$ 88?;$$ &%$ H%?;$$ 0$ 7I?8 70$ 8:?:

!"#"!$%!"&+A%("!"++&5;7&4=

/HYHOGDOH3ROOHG+HUHIRUGVÂ&#x2021;'RXJ )D\H$OOLVRQ !"#$%&&$$$'"()*+,-$.!$/01$0/0$$$ $23"45$67089$:;<=8<8< &RG\ 0LFKHOOH$OOLVRQÂ&#x2021;   >>>?*5@5*A+*5B"**5A35C5D"CA,?E"F$$$$$$$A"()G*5@5*A+*5B"**5A35C5D"CA,?E"F 46


!"#!$$%&' +HUG6LUH3URVSHFWVÂ&#x2021;6KRZ+HLIHU3URVSHFWVÂ&#x2021;%UHG)HPDOHV (PEU\RV 5LJKW7R)OXVK

75,$5$81/($6+('8

(3'V !"# C*9D" $%" C69E %%" CFE9G" !"#$%&$'($)*++, &%" CD49H" !"#$-%&$'($)*++, 0" CGD94 5($"CG9*D )0," CG$F9)" !"#$-%&$'($)*++,

8QOHDVKHG#KDVEUHGYHU\ZHOOLQWRSKHUGVWKURXJKRXW1RUWK$PHULFDVLULQJSUREOHPIUHHFDWWOHWKDWDUHJHQXLQH LQWKHLUFRPSRVLWLRQ+LVGDXJKWHUVLQSURGXFWLRQDUHWKHUHDOWHVWDPHQWRIKRZJRRGDEXOOKHLVDQGZH¶UHJODGWRKDYH TXLWHDIHZWRZRUNZLWK8QIRUWXQDWHO\ZHORVWWKLVJUHDWVLUHDQGWKXVKLVSURJHQ\ZLOOEHRQO\RIIHUHGYHU\VSDULQJO\#

7KH2QOLQH6DOHRI7KH<HDUZLOOEH\RXURSSRUWXQLW\WRVHL]HVRPHJHQHWLFVWKDW DGGYDOXHWR\RXUERWWRPOLQH

3OHDVHORRNWRRXUZHEVLWHVIRUDOOVDOHLQIRUPDWLRQFDWWOHSLFWXUHV YLGHRVDQGDYHU\VSHFLDOORWWREHQHILWWKH0DMRU-D\)R[7UXVW$FFRXQW ZZZMXVWDPHUHUDQFKHVFRPÂ&#x2021;ZZZOHYHOGDOHSROOHGKHUHIRUGVFRP -XVWDPHUH5DQFKHVÂ&#x2021;%HQ /LQGD)R[ !!"#$"%&'(")*""""+,-(./01"23"!45"674 2IILFH  Â&#x2021;0RELOH  Â&#x2021;)D[   8889:-;<,'=>=>,0?.=;9?&'""""""""":-;<,'=>=>,0?.@A',/B9?&' 47


C A N A D I A N

H E R E F O R D

D I G E S T

feature story

!!

The best attributes of the Hereford breed are temperament and ease of fleshing. Herefords go out into the tough country and come back in fair condition

!!

~ Edmund Russell

Hereford Friendly Edmund Russell’s Loyalty to the breed is recognized

By Brad Dubeau

D I R ECTO R O F CO M M U N I CATI O N S

Edmund Russell and his sister Audrey move freely through their herd while some of the cows come up to Edmund to be scratched. “Herefords are just pleasant to be around,” he says. This November, Edmund L. Russell will be 75 years of age. But he keeps farming and one of the things that keep him farming, he says, is “Herefords.” “They’re so pleasant to be around,” he says. “They keep it fun!” Edmund’s parents, Fred and Elsie Russell, mar r ied in 193 4 and moved from Winnipeg, Manitoba to a quarter-section about 5.5 miles northeast of Ashern, Manitoba, in 1935. Ten years later, they moved to the present farm, a quarter-section

48

northwest, were Edmund Russell farms today. He was one of nine children, growing up with one sister and seven brothers. Edmund, who is the third oldest son, decided to continue farming and in 1958, went into partnership with his father under the name of Fred Russell & Son. While Fred worked at various jobs, he came home to farm full time with his son Edmund from 1969 until 1977, when he and Elsie moved off the farm into the town of Ashern. Edmund took full ownership of the farm in 1977 but Fred came out to help with the farm work until his passing in September 1996. Elsie later passed away in December of 1997. In 1997, Edmund’s older sister Audrey retired from her job in Winnipeg and

came back to Ashern to help Edmund on the farm. Audrey remains there to this day. The original cows at the Russells’ consisted of Hereford and Shorthorn breeding. The first horned Hereford bull was bought from Gordon Otto of Ashern. Over the years, bulls were purchased from Saskatchewan, Alberta and Manitoba. The cowherd now numbers 100 straightbred horned Herefords. Five Hereford bulls were used for the 2012 breeding season. Cows start calving around February 10th. They are placed in the barn for calving for at most three days, depending on the weather. Cows go to pasture by the end of May, where they are bred for a 60 to 70 day


C A N A D I A N

period. The herd is returned home by bulls off pasture on foot with a bit of the middle of October. grain. They tell the story of pouring Calves are weaned anywhere from some grain on the ground at the gate the first to the middle of November and coaxing the bulls out of the field. and all the calves are backgrounded. Edmund then walks behind them Both the steers and heifers are sent to with a switch and Audrey follows grass at the community pasture for with the truck on the road. The bulls the summer. Heifers aren’t bred until make their way home without giving they are two years of age. The Russells believe that breeding heifers as yearlings means more time and care prior to and during calving. The community pasture where the yearlings run is “tough country” as described by Edmund. It’s swampy with lots of water and “Bull Dogs” ( Horse Flies). There are good ridges for the cattle to pasture on but the area suits best those breeds that offer hardiness and ease of fleshing, both of which, Herefords have. When yearling s are brought back home, Females from the Russell herd. the steers and those heifers not selected for replacements are sold in early October as long yearlings. Steers weigh in around 1,000 to 1,050 lbs. by then. They are sold in Ashern, Manitoba at the Interlake Cattlemen’s A ssociat ion Auct ion Market. “The best attributes of the Hereford breed are temperament and ease of f leshing,” Edmund says. “Herefords go out into t he t oug h c ou nt r y and come back in fair condition,” he says. Edmund and Audrey can gather and move Edmund Russell and his sister Audrey

H E R E F O R D

D I G E S T

them a problem. A second story shared is about the ease of handling of their cows. To move the cowherd from one field to another, Edmund and Audrey can open a gate and shake a pail of grain. The cows will come out of the trees and pastures and as they exit the gate they can be counted. Edmund shares these stories because for him it has to be fun doing what he does and Herefords keep it fun. When buying bulls, body, hair coat, sound feet, not too much leg and a good hind quarter are some of the traits that Edmund looks for. He also prefers to buy bulls that are semen tested prior to a Hereford breeder’s sale; either that, or tested in the spring, prior to delivery. Edmund was the 4-H leader for the Picnic Ridge 4-H Club for a number of years and judged at the Mankota Bull Sale. He held the position of President of the Seniors Club in the community and was Director of the Mulvihill Manitoba Community Pasture. H e c a n ap p r e c i at e other breeds and what they have to offer but E d m u n d ’s g r e a t e s t joy is working with Hereford cattle and he is very passionate about the Hereford breed in general.

49


<DEEFG

012$345623$78832649$78$:1;;<$5=6<$>3?2@$74;>$5=3$A32>$:3<5$78$712$&B.$C?;A3<$D323$E3F5G$

!

"#$!%&'()!*)+!,-&

!

"#$!%&'()!*)+!,-&

!

"#$!-270!*:/;!"/)'+)0+!1@-&

!

"#$!-270!*:/;!"/)'+)0+!1@-&

!

"#$!-12'!"/+!34*/!-.5"

!

*=%!->5?!0:="/4';!-,8/!

!

*=%!>1'!":*3;0!<0:+;!712&

!

"#$!5.<!04C)*!)A:#4!-52"

!"#$&BH!$!I+)-+J-$,+-$KK/ $ 6/$!789!"&'"%:';!)'';!.2<

<DEEFG

!"#$%&'$(')*+$,+-$&./ $ "#$!-.'!"/)'+)0+!*)""!--0

!"#$%&'$(')*+$,+-$.L/ $ "#$!.79!"/)'+)0+!*)""!.2'!

!"#$.L&'$JP-$+QN"0$R&/$ $ "#$!-52"!)A:#4!*)""!-11B

!"#$.L&'$JP-$!I-$KL/$ $ "#$!-52"!)A:#4!*)""!1-,B

50

!"#$&%MI$JNO!I0)P$B&/ $ "#$!-@-*!"/)'+)0+!*)""!--7/

!"#$R.S'$!N,TPJ$,+-$HH/ $ "#$!-270!"/)'+)0+!*)""!-1@&

!"#$&HS!$+QN"0$,+-$HM/$ $ "#$!-@-*!"/)'+)0+!*)""!--@0


!"#$%&'($)*$+#,-&.($.#(&.*$&/0$&.$1&'2&#*$&/0$3(.(#&/$4+#,/2$56''$4&'(%7

!9332<

'

NO1')0!'PQRGJ'GSTOQ'/)MN

'

NO1')0!'PQRGJ'GSTOQ'/)MN

'

NO1'/.MX'NHU'IQJH'/0)N'

'

JBE'/K)V'PTBNHQX4'/Z*H'

481$9:;4$<=>8?$@<A$B:C $ P1'/+E'PQRGJ'P4U'JGNN'/+0V

481$9:;4$<=>8?$@<A$DJC$ $ NO1'/+/J'NHGXUGPU'JGNN'Z.N'

481$9K:4$4L<GA<MA$@<A$DNC$ $ NO1')0!'P4U'JGNN'/Z)N

481$9DBL$M>54L?GP$9I9C$ $ $ SEX'UQSTXQ'IQJH'CMH

'

NO1'EWXYG'JGU'Z/W'

'

NO1')0!'PQRGJ'GSTOQ'/)MN

'

NO1')0!'PQRGJ'GSTOQ'/)MN'

'

O1V'/C*'PTB'1JGNNT1'C+W

481$D9E$FEGH<$@<A$9I;C $ NO1'//+S'NHGXUGPU'KN

481$9:;4$<=>8?$@<A$99:C$ $ SEX'NHGXUGPU'C/!

481$9:;4$<=>8?$@<A$9O;C$ $ NO1'/+/J'NHGXUGPU'JGNN'/ZN

481$JIE$M>5$1@<44>1$9;KC$ $ $ SEX'PTBNHQX4'/K!

!"#$%&"'()%"*+(,(-%./0+ B9&'C)*D'E%8<6=@FD'GB'H+B'/I+ !"#$%&'()*+,'***-./0*'''1233'()*+,'***-/++. J97%@2<'K'56A'4A'9;'E%8<6=@F'9:'ELFA'/C'%:<'C#M'56A'NA 45%63'789:2"282;98<=>&?398:2@A795 51


C A N A D I A N

H E R E F O R D

&

D I G E S T

feature story

Cash Crops Calf Crops

Herefords earn their way on this Ontario commercial operation By Ron Wells

G EN ER A L M A N AG ER , O N TA R I O H ER EFO R D A S S O CIATI O N

“The name of the game to stay in business, is to get the weight on those calves,” says cow-calf producer Barry Osterndorff. At the age of twelve, Osterndorff had a dream to some day own and operate his own cow-calf business. Robert Osterndorff, Barry’s father, began a farm machinery business in 1968 at the original farm location in Elmwood, Ontario. It was known as Robert’s Farm Equipment. With the assistance of his sons, he expanded and relocated to Chesley, Ontario. Much of Barry’s time was devoted to the farming operations with his father, who purchased Barry 15 cows to encourage his interest. That was the beginning of Barry’s dream-come-true, which continues today with his operation of 300 cows and 1,800 acres of pasture, hay and cash crop. The current farm location is directly across the road from what used to be home. Barry and his family have worked to develop a practical, compact, maintenance-free operation that is under Barry’s management. Cash crops consist of corn, soybeans and wheat produced on mainly sandy loam soil. One of the key requirements for livestock production in Ontario is proper facilities. The Osterndorffs’ facilities have been developed with thorough planning to make everything as labour-efficient and as time-efficient as possible. With this in mind, the present facilities were built in one location, beginning with the use of the original bank barn. Over time, Barry renovated, made additions, and added new coveralls, with terrain, weather factors and 52

ease of movement in mind, enabling him to concentrate on the end product – a calf that will command a top dollar on the market. The facilities include an addition on the original bar n w it h outside exposure, which houses a well-vent ilated and well-lit working area. Another section consists of an 80-by-80-foot calving barn and a working chute system under cover. There are 15 to 18 calving pens adjacent to the holding pens. All calving pens are under a video surveillance system, which has saved many calves over the years. There have been as many as 17 calvings in one evening. The holding pen accommodates fifty cows at a time and as they appear to be close to calving, they are relocated into calving pens. Two days after calving, cows are moved into another holding area that is under cover, again with open ventilation, after which they graduate to the fresh sand paddock area with a shelter. Calving takes place from January to midMarch of each year. Tw o c o v e r a l l s w i t h concrete flooring with a central manger in each are connected, allowing the herd access to both areas f rom a cent ral

Ron Wells, Ontario Hereford Association Secretary & Manager, Barry Osterndorff, Ontario Hereford Association Past President Rob Flack and Amanda and Laura Osterndorff


C A N A D I A N

bedded coverall that serves as hay storage for the summer months that is fed by early fall. All these facilities are located on the crest of a sandy embankment with watering facilities placed away from any bedded or feeding areas. “It is really neat how the Hereford cows like to lay out on the open hill, rather than take shelter in the coverall,” says Barry. “They are real easy keepers and a pleasure to work with.” Barry is also quick to mention that the mothering instinct is a real benefit when working with the calves alongside the Hereford cow. Creep feed is made available to the calves from early spring and a herd health program is precisely followed with

position at the manger. These straw bales are removed and replaced in the bottom centre as the manger is refilled with stacked hay bales. These feeding areas are cleaned out on a regular basis, with no bedding used. Waste is stockpiled for composting and is then spread on the hay ground in late summer after harvesting the hay crop of mainly alfalfa and timothy. With an environmental farm plan in operation, this helps eliminate winter runoff. A supply of loose mineral and salt blocks are provided to the cows at all times. Bred yearlings and replacement heifers are housed at a separate facility. One-third of the cowherd consists of

H E R E F O R D

D I G E S T

supplements, saves dollars every day, and that is what the Hereford cow has done for the Osterndorffs. A look over t he pic t u resque Oster ndor ff past ures shows rotationally grazed fields divided into 50-acre paddocks, shade trees dotting the fields and water being pumped by a solar system drawn from a fenced running brook. Cattle are rotated on pasture every couple of weeks – another example of a well managed operation. The farming enterprise is by no means the most important part of Barry’s life. His wife Brenda and their two daughters, Amanada and Laura, take priority. Brenda works full time off the farm and Amanda and Laura take significant interest in the cattle

In a dry period such as Ontario has experienced this past summer, the ability for a cow to maintain her condition and milk flow without feed supplements, saves dollars every day, and that is what the Hereford cow has done for the Osterndorffs. age verification records. Hay and straw is in large square bales for practical storage in easily accessible cover a l l bu i ld i ng s. Designed excavation of the land, forms a snow trap in order to make movement from storage to feed bunk simple. Barry explains how he wanted to save time and fuel with his feeding program as he layers enough bales in the two bunks to feed the whole cow herd for five days with little to no waste. By placing a bottom layer of straw bales in the centre of the bunk, the slices from the square hay bales piled on the top fall down along the feeding area inside the rail on either side, enabling the cows to stay in one location to feed, rather then pulling the hay out and relocating their

straight-bred Hereford females, with the remainder being Red Angus and Charolais. The breeding ratio is one bull for 30 cows. Careful selection of the Charolais bulls have proven to result in a vigorous, rapid gaining calf. Market ing of the calf crop is strategically planned by Barry in order to obtain the best financial returns. It is obvious by the volume, length of body and spring of rib exhibited in the calf crop, that this cowherd has not been an accident, but indeed an application and understanding of market requirements. In a dry period such as Ontario has experienced this past summer, the ability for a cow to maintain her condition and milk flow without feed

while adding a great deal of energy for their father. Barry continues to look out for modifications that would help to advance his program, such as the move away from larger framed cows. Herefords have played a role in this operation since Barry’s realization that today’s Herefords are no longer his grandfather’s type of Hereford. A new coverall shelter is being erected this fall, with herd expansion in mind. We congratulate Barry, his wife Brenda and family as the recipients of this first-time Ontario Commercial Cattleman of the Year’ award, presented by the Ontario Hereford Association.

53


54


55


!"#$%&'()"*+(,-"./0"

D,%DA"%-,##,C)?E%9(""+"($%-,(%9:<)?E%FG%H"?"D)@$%DA)$%I>$D%$">$,?J A"/&<1##?(,-#-/B :1#6./(>"%*? C-</(D%E1/ 4-??(A7"33-%& 41&&.%(!.%.3-%&(4"/F< G177#.(>-%7(!.%.3-%&?H(!"#$%$&"'()*(+$ CC(+(I./(AF<.%#-?J1 K"%B(!"%E--& ,-%6.77(>"L#J/.%

4"/&B(+(I"7<%B/(:-/.7 0B#.(A7%-*?*-.H"#$%$&"'()*(+$ ,"/"F.(:L.<#.% A1*M?-/(4"/F< N7O(A./71/.#(4"/F< A7.$.(,%-L?. %XVKÀHOG)DUPV 4.*-/7(K%"P1/Q KL./7</.%(4"/F<

;1M.#1/.(K%"P1/Q ,<"&(G-%./P A"%"<(012&-%33 C.//"(012&-%33 )##"/(>#.7F<.% :O(N.B.% @*1#B(,%-B N.Q"/(,%-B

!-*.(4"1?.&'(A7%"1Q<7( !.%.3-%&( +( >V( :"#&1.( 4.M#"F.*./7(!.13.%?( 1/2"#()%"a0-/.(<.#&(6"FJb

K"(+%L)("$%M?%N$"J

RS(A8)4(A84T,I(UVWX RS(YVZ8(AT0(;[X@4(G)\(]W^ G:!(5_`;(A8)0\)4\(]ZT A0A(`]`A(N)4I(G)\(]9X

O(B%L)("%M?%N$"J

G:!(VZ58(AT;@4(4D:(V9`^

!"#$%&%'"(()%!)*+,(-!"#$"%&'()&"*(+(,-#.*"/(012&-%33

56

445'()1%&%1.'()#6.%7"( 89:(5)9

;<-/.=(./012.3145/. >"2=(./012.3100// 0.#?(,.##=(./0146/17886

@*"1#=(9:##$;<=(>?@AB@> CCCB<=(>?@AB@>


C A N A D I A N

H E R E F O R D

D I G E S T

Bannerlane Buyers 2012

BANNERLANE YANKEE VALLEY 36Y BW: 89 lbs WW: 822 lbs adj. YW: 1,166 lbs adj. EPDs: CE: -0.2 BW: 4.4 WW: 47.2 YW: 62.1 Milk: 12.3 TM: 35.9

Bill & Ruth Bannerman (306) 845-2445

Don Farnell Marlin Farms Dixon Ranch {3} Dale Davis O.K. Ranch Ltd. Norm Grenier Neil Forseille Victor Hamm Douglas Lake Cattle Co. {3} Stephen Hut P.F.R.A. Kozlinski Ranch

“Our promise to you.....Quality cattle” Box 148 Livelong, SK S0M 1J0 email:bannerlane@littleloon.ca

O’Hare Ranch Bowie Ranch Misty Valley Farms Holloway Farms Ltd. Randy Aims Bill Laclare Ron Gervais Pilling Ranch Bob Balog Dugdale Agro Ltd. Randy Bauer Scott Macnab

Rob & Joanne Bannerman & Sons Ph/Fax: 306-845-2764 Cell: 306-845-7790 57


C A N A D I A N

H E R E F O R D

D I G E S T

feature story

Summarizing the Science

A recap of World Hereford Conference technical sessions

By Catherine Brown

A S S O CIAT E ED ITO R

Review and Forecast of Beef Industry Trends on a Global Basis Speaker: Robert Meijer, President, Canada Beef Inc. (former Director of Corporate Affairs, Cargill Ltd.) Robert Meijer started with the bad news first, followed by a summary of beef marketing opportunities globally. “Federal marketings are down from the previous year by 16 per cent in 2011,” he said. “And federal production is expected to decline further over the next two years.” “Forty-two per cent of Canadian beef production is exported,” said Meijer. About 73.5 per cent of those exports go into U.S. markets. We should consider our U.S. neighbours to be our “best friends” in this regard. There is still opportunity in that arena, he says. Global beef consumption is projected to grow by six per cent over the next three years, with the largest import growth expected in the European Union, according to Meijer. But there are production growth limitations worldwide. Canada Beef, an organization that was still under a year old at the time of the World Hereford conference, is an amalgamation of the Beef Information Centre (BIF) and the Canadian Beef Exporting Federation (CBEF). Its mission is to add value to the Canadian beef brand, which most of

the world already values, according to Meijer. Our work is cut out for us in China, Hong Kong and Korea, which now have a greater awareness of U.S. and Australian beef. And Mexico is a growing serious competitor. The Middle East markets, by comparison, are showing great promise. Exports to Japan are expected to rise and Russia’s acceptance into the WTO is expected to pave the way for more formalized, fair trade. Meijer suggests working together with our competitors to serve these growing markets. He also stresses a familiar refrain – the need for better alliances, cooperation and information sharing across the beef production chain. And that includes “getting more dollars into farmers jeans,” as he put it. Meijer underscored to producers the value of our quality brand, both scientifically and emotionally. He says that quality starts with breeding, genetics and the welfare standards and practices of our producers. “What was good enough five years ago is not good enough now,” says Meijer. Don’t rest on your morals, he implied. “Keep asking how we can do things better.”

.

Improving Beef Tenderness and Consumer Satisfaction Through Genomics Speaker: Dr. Steve Miller, Director of the Centre for the Genetic Improvement of Livestock, University of Guelph Miller calls his genomics research the “No More Tough Steaks” project. His message and that of his colleagues, underlines the fact that value orientation is where the beef industry is headed. “Consumer surveys show us we need to do a better job on tenderness,” says Miller. “The most common complaint is ‘toughness’.” The same problem ranked high in the U.S. National Cattlemen’s Beef Association (NCBA) quality audit. We have selected for marbling, but Miller says the genetic correlation between marbling and tenderness is low. But the industry shouldn’t expect a magic bullet, according to Miller. Management, feeding and processing will still have to be done right. Aging, for instance, is still a great tool to improve beef tenderness. But we need the right genetics to start with, he says. The calpastatin gene is proving to effect significant differences in tenderness scores. Validation work is being done in the U.S. on this finding and producers can start to 58

change their herd profiles where tenderness is concerned, through companies which offer tests to identify it. Producers might have to face the fact that the best performing animals might not always prove the best for tenderness traits. But Miller uses the analogy that we have to pull the chain, not push it, in regards to market demand. In other words, demand should not be pushed by the purebred end but should rather be pulled by the marketplace or commercial end of the industry. Miller also reminded producers about CANADACOW.CA (the Canadian Cattle Genome project, of which the Canadian Hereford Association [CHA] is a partner.) He encourages producers to check their semen tank inventories and to submit semen which is no longer wanted or in abundant supply, for genetic evaluation. A tax receipt will be offered for the donation but another advantage to breeders is that of having their animals in reference populations. The same donation will also contribute to more accurate EPDs. Those interested may contact Jeff Hyatt, Breed Development Coordinator with the CHA (jeff@hereford.ca)

.


C A N A D I A N

H E R E F O R D

D I G E S T

Genomic Prediction in Hereford Cattle Speaker: Dr. Dorian Garrick, Jay Lush Endowed Chair in Animal Breeding and Genetics, Iowa State University Dr. Garrick – who is currently gene sequencing 10 Hereford bulls - points out that gene sequencing and genomic predictions are in their adolescence and that some traits are easier to pinpoint than others. The gene that determines whether or not cattle are horned, polled or scurred is physically located on gene or chromosome 19. Geneticists also know that polled is dominant to horned and that scurs dominate in males. Scurs can also be present when horns are present. The trouble when geneticists apply the same technique to growth rate, however, is that genetic markers affecting growth are on hundreds, if not thousands, of genes. And

the predictions don’t work the same across breeds. Garrick says there can be a lot of variation in the offspring of one sire but you can learn a lot about the quality of a sire by the average of his offspring. If he has thousands of offspring, his estimated breeding values (EBVs) or expected progeny differences (EPDs) can be fairly accurate, he says. Cattle have 30 pairs of chromosomes, each of which has about 100 million base pairs. That is why the size of training populations is important. Validation is critical, he says. When asked how producers should balance genotype and phenotype selection, Garrick answered that genomic data will never operate independently of phenotype. “Don’t drop the ball on phenotype,” he said

.

Understanding Heterosis and the Value of Hereford Cattle Speaker: Dr. Dave Daley, Professor of Animal Science; Associate Dean, College of Agriculture, California State University, Chico. “We have focused on sexy traits rather than profitable traits,” says Daley. “We have focused on maximums versus maximum returns.” In the U.S., cattle have been docked in the marketplace for not having black hides. “We will see that start to change,” says Daley. Some of the traits that are most difficult to measure will have a “net positive cumulative effect,” he says. And many of those traits are the result of heterosis. “Crossbreds are better than the average of both breeds,”

says Daley, who is a cattle breeder and rancher himself. One of the best gains from crossbreeding is what Daley refers to as “maternal heterosis”. It is essentially longevity and disease resistance, the first of which is the most undervalued trait in beef cattle herds, as Daley puts it. Instead of just measuring for outputs like ribeye size, we need to pay attention to the whole system, according to Daley. Besides, he says, consumers are telling us that ribeyes are too large. And as you crossbreed, Daley adds, be aware of docility. “Get rid of the wild cows you can’t handle,” he says

.

Economics of Docility in Beef Cattle Speaker: Dr. Robert Weaber,

assistant professor, Beef Breeding and Genetics; Cow/calf Extension specialist, Kansas State University

Docility in beef cattle offers a win-win for the industry: improved animal welfare and proven economic advantages. Temperament affects growth rates, meat quality, reproduction efficiency and producer safety, as proven in recent research. When researchers moved cattle through handling systems in order to measure their reactions, it is interesting to note that the worst ones got worse, each time they were handled subsequently, while the ones with good temperaments got better. The Limousin breed used a chute scoring system to create a temperament EPD in the early nineties and have since seen a 20 per cent improvement in score levels across the breed. The American Simmental Association also has a disposition EPD. Weaber says a key finding in recent research is that Bos Indicus cattle, such as Zebu and Brahmans, tend to be more excitable than Bos Taurus cattle, which represent British and Continental breeds. The research has also proven that cattle of all types with the worst temperaments had the lightest weaning weights,

the lowest average daily gain (ADG), the lowest placement weights, and the lowest dry matter intake (DMI). Temperament also has a strong association with meat quality. Higher-strung animals are consistently less tender, are often dark cutters and are subject to more bruising. There has been no genetic corelation found between temperament and meat yield or marbling, however. Temperament, does, however, play a role in animal health status. In research trials, Weaber says calm animals responded better to vaccines. High blood cortisol levels in cattle with bad temperaments inhibit both innate and adaptive immunity. Higher strung animals consistently had higher blood cortisol levels and higher death rates, in the research trials. There is also increased interest in temperament’s effects on reproduction. Weaber says high cortisol levels inhibit the release of reproductive hormones which are responsible for ovulation. “Don’t rest on your laurels,” Weaber says to his audience of Hereford breeders. “We need data to track temperament as part or our selection criteria,” he says

.

59


C A N A D I A N

H E R E F O R D

D I G E S T

Feed Efficiency in Beef Cattle Speaker: Dr. John Basarab, Senior Research scientist, Alberta Agriculture and Rural Development; Adjunct Professor, University of Alberta

It took only 70 per cent fewer animals to raise the same amount of beef in 2007, as it did in the year 1977. On a per head basis, those animals required only 81 per cent of the feed, drank only 88 per cent of the water and used only 67 per cent of the land that was required in ’77 to produce the same amount of beef. The result is a reduction in our industry’s carbon footprint by 16 per cent (Judith Capper, 2011, Animal Frontiers). “But we haven’t changed the maintenance requirements for beef cattle,” says Basarab. “Two-thirds of the feed energy consumed each day by steers, heifers or cows is used for maintenance, with considerable individual animal variation.” Basarab points out that over the past 100 years, feed efficiency of beef cattle has remained largely unchanged, while competing protein sources such as pork and poultry have made dramatic improvements in this area. In the past, feed conversion ratios (FCR) have been used for improving feed efficiency. But this method is proven to be ineffective, since it relates to growth, body size and body composition. In other words, an animal might be faster growing but in order to grown more, it eats more, which does nothing for feed efficiency. Alternatively, residual feed intake (RFI) is moderately heritable, is independent of body weight, average daily gain and body composition and is defined as the difference between actual feed intake and the expected feed requirements in beef cattle. RFI values are like golf scores, says Basarab; the lower the score, the better. Higher scoring animals are loosing energy on maintenance requirements. It’s like they are eating “just for fun,” says Basarab. But what happens when we start selecting for low RFI values? It will reduce feed intake while having no effect on body size or growth. In research, feed intake has been reduced by 10-12 per cent at equal body size and average daily gain (ADG). At the same time, feed conversion ratios are improved by 9-15 per cent at equal body size and ADG. Recently Basarab looked at the effects of Hereford, Aberdeen Angus, Red Angus, Charolais and TX

Beefbooster sire RFI values on progeny performance in the feedlot. Progeny from the highest RFI bulls consumed 0.97 kilograms more dry matter per day than the average, while the progeny of low RFI bulls consumed 0.573 kgs less than the average, reflecting a feed cost saving of $10 to $15 per head based on 150 days on feed, in this case scenario. In Basarab’s research, he has found a four to five kilogram difference between comparable cows, in terms of their daily feed requirements. Selecting for low RFI cows has had no effect on pregnancy, calving or weaning rates. Neither has it affected birth weights and weaning weights of their calves. Selection for low RFI heifers has had no effect on age at puberty, pregnancy or calving pattern. It has made no difference in cumulative pregnancy or conception rates. Basarab also reports on research relating to the effects of RFI levels and early life calf survival. In fact, lower RFI animals have lower heat production, leaving more energy available for production and for the uterine environment. Calf deaths are less frequent when mothers are more efficient. Low RFI cows may also be more adaptable to stressful conditions, compared with high RFI cows, resulting in cows with more fat reserves and reduced winter maintenance. Selecting for low RFI animals has a further benefit of reducing manure production and greenhouse gas emissions from youthful cattle. Basarab explains that infrared thermography (IRT) is showing promise in screening heifers and mature cows for low versus high heat production (low vs. high RFI), and could reduce the time and expense to rank animals for RFI by 80 to 90 per cent. Suffice it to say that RFI measures stand to have a very positive effect on profitability and feed efficiency if the industry takes advantage of these tools. Basarab just reminds producers that RFI is just one trait and must be balanced with growth, fertility, carcass traits or whatever the breeding goals of the herd. The point is to avoid single trait selection

.

Hereford Breed Strengths – Cow-Calf Production Speaker: Stan Jacobs, cow boss, Douglas Lake Cattle Ranch Jacobs explains that his main duty at Douglas Lake Cattle Ranch is to grow grass and produce the most efficient beasts to harvest that grass for profit. Hereford cows, he says, make up the base herd in his operation. “There is nothing that can starve like a Hereford cow,” he says, in reference to the low maintenance environments in which his cattle herds run. Wood ticks and distances between water sources are two of the ranch’s challenges. Jacobs has seen cows go for two days without water, by necessity. The average age of his cowherd is five years old, though it isn’t uncommon for the ranch to have many 15 to 17-year60

old cows. About 1,500 replacement heifers come into the herd annually. About 60 per cent of the bulls are used for six years. If cows don’t have a calf, they don’t go to pasture. If not pregnant, they are culled. Very few performance numbers are analyzed in Douglas Lake Ranch’s bull selection criteria. Jacobs says he sources bulls from the many great cowherds he knows – those that thrive in the same type of environment as do his cows. The mean winter temperature at Douglas Lake Ranch is minus eight degrees Celsius. Mature cows have a 45-day winter feeding period in which they are fed grass hay and some alfalfa hay

.


C A N A D I A N

H E R E F O R D

D I G E S T

Feed Efficiency in Hereford Cattle Speaker: Dr. Kee Jim, Founding parner, CEO and Managing Director, Feedlot Health Management Services Ltd. Dr. Jim says the beef industry has for many generations selected cattle based on visual assessment and also on weight criteria such as birth, weaning and yearling weight, and weight per day of age (WPDA). While carcass traits are sometimes evaluated, based on ultrasound measurements in live cattle, or actual carcass measurements, there has never been enough of that in any breed, he says. That is partly so due to the lack of retained ownership and the fact that most bull buyers don’t ask for carcass data. That will change in the near future, he says, as more and more carcass data is being produced for EPDs. Feed conversion values, which historically belonged to research facilities, are becoming more important than average daily gain (ADG), says Dr. Jim. The missing link is the communication needed between the cow-calf and feedlot sectors in order to clarify value parameters. Results from RFI feeding trials at Feedlot Health Management Services with the progeny of 19 Hereford

TICKDV&W31C&[&'&PCFG&UI!Q&3331 P7@%8\& P%8;784"#$%\& '%#9%8& T7=A& Q54%#657#

bulls, showed a lot of variation when they were ranked according to ADG, feed conversion and RFI. The lowest feed conversion rate was 5.66, compared to the highest, of 9. This is good, according to Dr. Jim, as it indicates room for improvement and suggests a high degree of heritability. The same trend is seen in RFI values. Dr. Jim says there is a strong correlation between average daily gain (ADG) and feed conversion. A big initiative is under way to study this in Canada, he says. He says the industry should support this type of research as long as feed is not free. He encourages breeders to submit bulls for evaluation through November and December, 2012. In response to audience questions about selection, Dr. Jim says feed conversion rates generally have a low heritability. Selection criteria based on RFI values, however, show more promise, where heritability is concerned. But Jim cautions breeders to also keep an eye on ADG to ensure that it continues to meet desired parameters. The bottom line to Jim and his colleagues’ research trials, is that there “appears to be significant opportunity to improve feed efficiency in Hereford cattle.”

.

BDSK<IFG&L1F&[& TICKDV&>CKDGF&-33

<7=%8"9%\&T5?0T7=5%=\&B98"5?:90!5#%=

:ƵŶŝŽƌ/ŶĐĞŶƟǀĞͲΨϱϬϬϬĨŽƌŚĂŵƉŝŽŶKǁŶĞĚ&ĞŵĂůĞĂƚϮϬϭϯŽŶĂŶnjĂŝŶƌĂŶĚŽŶ͕D

!"#"$"%&"'(')"$*+&"')+$",-' <BC&D'E&FGHI!CDJIK&LF&M&'&'FCN&,2LO&GD&M&PQ>F&2,R&BDSK<IFG&L1F TJU0UC!!V&-33&TICKDV&W31C&M&<>&<IKC<GKD&O3W3 DFJP!G0S&3D&'>FI<G&--X&M&<SYSFFS&HJ'G&SQ<JFS! '&ESKDSBDJ'&23-W&M&B!QZ&HGKQGDDS&H0/&M&B&S&H&PFIQJUV&O3,3 ZBC&TICKDV&>CKDGF&-33&M&B>P>&2K&TGGE<SK&2OC

!"##$%&'()*+,-%&.)*+,&/&0$1,(&.,)+23)*

WŚŽŶĞͬ&Ădž͗;ϯϬϲͿϴϵϯͲϮϴϳϵථථ !"#$%&'%(()&*+,-./,+012// ͲŵĂŝů͗ůĞĂĐŚŵĂŶͺďŝŐŐƵůůLJΛŚŽƚŵĂŝů͘ĐŽŵථථ 32&45(%6&#789:&7;&<"5=697#%&7#&>5?:@"A&23 61


62


Norm,  Joanne,  Michael,  Marc  Parrent Box  111  Clyde,  Alberta,  T0G  0P0 Phone:  1-­780-­348-­5835        Fax:  1-­780-­348-­5839 Norm  Cell:  780-­307.6586    Mike  Grimmeyer:  780-­307-­3385 Tanga  Herefords  -­  Gary  Seutter:  780-­387-­0626 63


C A N A D I A N

H E R E F O R D

D I G E S T

Mandate for the Future Expanding  the  

Keith  Gilmore  Foundation

By Catherine Brown

A S S O CIAT E ED ITO R

The Keith Gilmore Foundation, established in 1987 in honour of the late Keith Gilmore, editor and publisher of the Canadian Hereford Digest for 30 years, was created to offer scholarships in the field of agriculture, veterinary medicine and agricultural journalism and to support research related to the betterment of the industry. That Foundation has now widened its mandate and scope as the umbrella organization for two additional funds which will help secure the future of the Hereford breed; both in terms of its support for youth in the industry and its support of scientific research and advancement of the breed. It does so in partnership with the Canadian Hereford Association (CHA). The original Keith Gilmore Foundation (KGF) was designed to recognize Gilmore’s contribution to the Hereford Breed, agricultural journalism and the beef cattle industry. It was and continues to be offered to encourage and promote excellence in education and research related to the agricultural industry and to agricultural journalism. It currently offers college, undergraduate and post-graduate students several scholarship opportunities in related fields. The CHA has provided administrative support as an in-kind contribution to the Foundation since its inception in 1987, fulfilling one of the association’s own purposes of enhancing and promoting the marketability of Hereford genetics through research and support of youth education. Expenses relating to the KGF for which the CHA has been responsible are accounting costs, phone calls, website hosting support and

64

upgrades, travel costs of the secretary (Gordon Stephenson) to attend trustee meetings, free advertising of the foundation in the Digest and staff time for the administration of the foundation. The administrative services provided to the KGF by the CHA staff are estimated to be in excess of $15,000 annually. But the Keith Gilmore Foundation is now more than a scholarship fund. It is the umbrella charity foundation under which three funds are managed. The first is the previously mentioned scholarship fund. The second is the Hereford Research Fund and the third is the Bonanza Legacy Fund. The latter two are explained here below.

Hereford Research Fund

One of the Keith Gilmore Foundation’s original mandates, “to support research related to the betterment of the industry”, has until now not been fulfilled. So when the Hereford Canada Research Fund was established in 2010, in celebration of the 150th anniversary of Herefords in Canada, it became a logical choice to place management of the fund under the Foundation. The Hereford Research Fund’s mandate is to encourage the pursuit of research, as it relates to the betterment of the Hereford industry. It supports research projects conducted in cooperation with universities, government agencies, private companies and beef operations and is open to involve collaboration with other Hereford breed associations outside of Canada. Because the Hereford Research Fund operates under the Keith Gilmore Foundation, it will now

be a designated charity under the Income Tax Act. All charitable donations to this fund will therefore be tax-deductible and will be used for research purposes within the mandate of the Foundation. Separate financial statements will report contributions and expenses of the fund in the audited financial statements of the Keith Gilmore Foundation.

Bonanza Legacy Fund

The Bonanza Legacy Fund indirectly begins with a $46,000 surplus from the Bonanza 2009 budget, when Bonanza was hosted by Copper Creek Ranch in Princeton, B.C. The surplus, which came from sponsorship money and registration fees, is the result of contributions of the Stevenson family, owners of Copper Creek Ranch, who made provisions for most of the amenities required for Bonanza ‘09. It has been the responsibility of the Bonanza committee of the BC Hereford Association (BCHA) to manage this surplus. The BCHA wanted to start a Bonanza Legacy Fund to be managed by the CHA but there was no financial advantage to that and it would put too many restrictions on withdrawal amounts. Ultimately, the BCHA Bonanza committee and the CHA invested the surplus funds in a GIC under the ownership of the Canadian Junior Hereford Association (CJHA). The BCHA agreed that $2,500 of these funds would be dispersed annually to the Bonanza hosting province, until the fund runs dry. That GIC remains active and so does the agreement to disperse funds to future Bonanza hosting provinces, respectively. But all possible future donations to a CJHA Bonanza fund could not be


C A N A D I A N

H E R E F O R D

D I G E S T

www.keithgilmorefoundation.com tax deductible, without following the rules and requirements of Revenue Canada’s Charities Act. And since that time, the Stevenson family of Copper Creek Ranch has further offered to match the surplus funds. Furthermore, if a separate charity foundation were established for the additional funds, it would be very costly in terms of legal fees and administration. It is also difficult to get things approved for registration under the Charities Act, according to CHA General Manager Gordon Stephenson. Sometimes the process can last at least two years. Since the CHA already provided inkind support to the Keith Gilmore Foundation, it made sense to include a Bonanza Legacy Fund under its larger umbrella, tying things together to ensure the proper administration support would be there. The Bonanza Legacy fund was thereby created “to provide educational development of youth in beef production and life skills, through the support of the annual Bonanza event, sponsored by the CHA and the CJHA.”

Again, separate financial statements report contributions and expenses of the fund in the audited financial statements of the Keith Gilmore Foundation. The Keith Gilmore Foundation, in its current expanded format, will be formalized in a partnership agreement with the Canadian Hereford Association by the end of 2012, while both the KGF and CHA will remain entirely separate entities. “The Foundation will continue providing the management and distribution of funds…..[while] the Canadian Hereford Association will continue providing administrative support as outlined in the Governance document.” All the above funds are now open for tax-deductible donations and these donations can be targeted to the fund of the donor’s choice. Under the terms of the current agreement, a trustee from the KGF will be an ad hoc member of the Hereford Breed Improvement Committee and the Junior Adult Advisory Committee.

Keith Gilmore Scholarship Fund

Chairman of the Keith Gilmore Foundation is John Blacklock, of Saskatoon; Secretary is CHA General Manager Gordon Stephenson and Treasurer is Cathy Lasby of Ontario. Other trustees are Kurt Gilmore of Calgary, Neal Church of Calgary and Jay Cross, also of Calgary. The CHA will continue to update members in future issues of the Digest regarding developments pertaining to the Keith Gilmore Foundation and its respective funds.

Hereford Canada Research Fund

Bonanza Legacy Fund

Purpose

Provision of scholarships in the fields of Agriculture, Veterinary Medicine & Ag Journalism

Support research for the advancement of the Purebred Industry in Canada

Educational development of youth in beef production and life skills

Distribution of Funds

Students

Research Institutions & Universities

Annual Junior Bonanza Event

Decision Authority on Distribution

KGF Board of Trustees

KGF Board of Trustees

KGF Board of Trustees

Advisory Body

KGF Board of Trustees

Hereford Breed Improvement Committee

Adult Advisors to the CJHA

65


XLP  1131W  REESE  5Z

CWA  Red  Coat  Classic

y>W>&>E,ϭϲϴ CWA  Red  Coat  Classic

</Zzͳ>KEW/E^z/>ϰϬϯ CWA  Sale  Entry

Please visit our website to learn more about our Agribition show string

Lone Pine Cattle Services

Rob  and  Dawn  O’Connor Box  158  Vibank,  Sk.  S0G  4Y0 66

(306)  762-­‐4543 ǁǁǁ͘ůŽŶĞƉŝŶĞĐĂƩůĞ͘ĐĂ


BR 9279 Extra Deep 15Z

BR 9279 Extra Deep 106Z

BR 9279 Extra Deep 125Z

BR 9279 Domino 128Z

See  them  at  Agribition  or  the  2013  Ranch  Ready  Bull  Sale.     Dick  and  Lorraine  Braun Phone/Fax:  306-­297-­6404

Visitors  Always  Welcome Craig  and  Carrie  Braun Phone:  306-­297-­2132 Cell:  306-­297-­7114

 email:  braunranch@xplornet.ca  Simmie,  SK 67


Pull up your Genes at Farmfair 2012! A  unique  event  bringing  together  Commercial  Producers  and  Purebred  Hereford  Breeders

K_\n`ee\if]k_\9lccf]k_\GiX`i`\j[iXnnXjA`d IXeZ_\iĂ&#x2039;j:_f`Z\>iXe[:_Xdg`fe9lccn\ekkf=< IXeZ_\iĂ&#x2039;j:_f`Z\I\j\im\>iXe[:_Xdg`fe9lcc Al[p?`[\]ifdN\jkcfZb#8cY\ikX%K_\pZ_fj\CCI(')K +*K<DG<IFI)*'O]ifd=\ekfe?\i\]fi[IXeZ_ n\ekkf99J=,)L<O<:LK@M<((0O]ifdA9ifjk JLG<IJK;C8;0,O]ifdCfjkCXb\IXeZ_#I`Z_CXb\# @eZ%#i\Z\`m`e^(#,''% CXe[:Xkkc\:f%Ck[%#i\Z\`m`e^(#'''% 8cY\ikX#n_fi\Z\`m\[XZ_\hl\]fi/#'''%

Reverse   Draw   for   the   winnerâ&#x20AC;&#x2122;s   choice   of   bull.     $8,000  goes  to  the  owner  of  the  chosen  bull! Rancherâ&#x20AC;&#x2122;s  Choice  following  the  Bull  Parade Finalists  of  the  Rancherâ&#x20AC;&#x2122;s  Choice  are  presented  at   the  Ranch  Rodeo     Heritage  Ranch  Rodeo  Finals Food,  Door  Prizes,  Entertainment    &  Fun!

Tuesday,  November  6th  4:30  PM 4:30  -­  Registration  and  viewing  of  the  bulls 5:30  -­  Dinner 7:30  -­  Ranch  Rodeo  Finals  Begin 9:45  -­  Reception  and  draws

Farmfair  International,  Edmonton  Northlands

For  more  information  on  the  Hereford  Genes  Event  and  to  purchase  tickets  contact   Al  Fenton  at  780-­754-­2384  or  email:  fentonherefordranch@gmail.com

Farmfair International Western National Show 68

November 7th -­ 9 a.m.


Proven  Genetics  –  Consistent  Performance EPDs CE   BW   WW     YW   Milk   TM  

1.1   4.3 33.7 53.7 2.9 19.8

EPDs CE   BW   WW     YW   Milk   TM  

-­2.8   4.7 54.8 90.8 21.9 49.3

EPDs CE   BW   WW     YW   Milk   TM  

-­1.8   6.7 64.0 104.5 14.4 46.4

ARNL  42P                                            

ULH  1U                                                        

PTT  732W  

WLN  34Y  –  Son  of  42P

WLN  81Y  –  Son  of  1U  

WLN  98Y    –  Son  of  732W

EPDs CE   BW   WW     YW   Milk   TM  

-­1.8   6.7 46.4 82.7 12.8 36.0

EPDs CE   BW   WW     YW   Milk   TM  

-­1.5   4.1 45.8 78.3 22.3 45.2

EPDs CE   BW   WW     YW   Milk   TM  

-­1.5   6.3 58.5 101.8 16.8 46.1

Les  &  Karen  Holloway

Ph:  (403)  882-­‐3416                            Fax:  (403)  882-­‐3417                          Cell:  (403)  740-­‐0380 Located  1  mile  north  of  Castor  on  Highway  36  and  5  miles  east  on  secondary  Highway    599

Jeff  &  Amy  Holloway                    

www.hollowayfarmsltd.com          Anthony  &  Samantha  Plett 69


C A N A D I A N

H E R E F O R D

D I G E S T

Canadian Hereford breeders pave the way for feed efficiency gains

Technology and Numbers By Catherine Brown

A S S O CIAT E ED ITO R

The exciting and ambitious million-dollar feed efficiency research project was reported in the August Herd Reference edition of the Canadian Hereford Digest. Beginning this fall, and over the next three years, the Canadian Hereford Association is assisting researchers in measuring 900 bulls for residual feed intake (RFI). It is a collaborative effort with Olds College, the University of Alberta, Livestock Gentec and CattleLand Feedyards, to produce an EPD (expected progeny difference) for feed efficiency.

In doing so, it will have the tools to increase feed efficiencies in the wider industry. Dr. Kee Jim of Feedlot Health Management Ser vices Ltd. and a Hereford breeder himself, has do c u ment e d t he g a i n s. Fe e d conversion, he says, is the most economically important parameter in feedlot production. But it is also important in the cow/calf sector. Research shows that efficient cows consume up to 15 per cent less feed. As Dr. Jim notes, if a steer converts at 6:1 versus 7:1, the difference in feed cost of gain is 13.5 cents per pound

the amount of feed required to produce one pound of live weight gain. s Average Daily Gain (ADG) is different. The industr y has selected for ADG for over a century and we currently index cattle on this basis. It is ADG stats that go into our current growth EPDs. Selecting exclusively for ADG has resulted in bigger cattle with bigger appetites. It has not improved feed conversion rates or feed efficiency. s Residual Feed Intake is also different. It is equivalent to the

The Hereford breed is the first in Canada to participate in this research - the first project of its kind. The Hereford breed is the first in Canada to participate in this research - the first project of its kind. Only the American Angus association has formally participated in related research. The technology used to measure residual feed intake and feed conversion – the globally used GrowSafe system – is manufactured right here in Airdrie, Alberta. Why has the CHA gone down this trail to support feed efficiency research? It has done so, according to CHA General Manager Gordon Stephenson, in order to document the economic benefits of feed efficiency traits to both the cow/calf and feedlot sectors.

70

(if barley costs $260/mt). If a steer gains 600 pounds in the feedlot, the difference in cost of gain is $81 per head. In an industr y that has been phenotype-focused for decades, producers still shy away from sciencebased numbers. But this research will help put a lot of important data into useable formats, helping producers identify more efficient bloodlines. Let’s first clarify the jargon and define the measuring parameters that are being thrown around in a lot of industry banter. s Feed conversion = Feed-to-Gain = Feed Efficiency = Dry Matter(DM)to-gain ratio. All are defined as

U.S. terminology of Net Feed Efficiency (NFE). It is defined as the difference between an individual animal’s actual feed intake and its predicted feed intake. In the most fundamental terms, it identifies the most feed efficient cattle based on resource utilization. The best RFI scores go to cattle whose maintenance requirements are lowest, which therefore put more energy resources into production and growth. Cattleland was the first for-profit company to use the GrowSafe system to measure RFI in cattle in 2005. “Residual feed intake (RFI) has become a preferred method of


C A N A D I A N

improving feed efficiency in beef cattle as it is independent of body weight, average daily gain and backfat thickness and is moderately heritable,” in the words of Dr. John Basarab, senior research scientist with Alberta Agriculture and Rural Development and adjunct professor at the University of Alberta. Basarab is a world-renowned researcher in the field of feed efficiency. Basarab reports that “selection for RFI

cur rent research is rev iew ing the effects of selecting for each, individually and combined. In other words, there may ultimately be an EPD for RFI or feed conversion or both. Either way, feedlot operators stand to gain on efficiencies as much as cow/ calf producers. Efficiencies on pasture will also translate to higher stocking densities, according to Dr. Jim. Only since the advent of the GrowSafe system has the industry measured

Basarab reports that “selection for RFI will have little if any affect on growth rate, body size and carcass merit…..[but] will improve feed conversion rates and feed efficiency.” will have little if any effect on growth rate, body size and carcass merit….. [but] will improve feed conversion rates and feed efficiency.” In the scientific sessions of the World Hereford Conference, Basarab told industry guests that RFI values are like golf scores; the lower the score, the better. Higher scoring animals are loosing energy on maintenance requirements. It’s like they are eating “just for fun,” he said. Feed Conversion rates, on the other hand, are considered to be less heritable than RFI measures, while having a strong positive correlation with ADG. But the jury is still out on this. Dr. Jim explains that the amount of research data in this field is still too negligible to draw decisive conclusions. It may very well be that RFI turns out to be the selection tool the industry uses to improve feed conversion. But feed conversion values might still be needed. Ongoing

feed conversion rates on a large scale, says Dr. Jim. What remains to be seen is whether the progeny of lower feed conversion bulls also have good feed conversion rates. And while good RFI values indicate high efficiencies, extremely low RFI values sometimes relate to low average daily gains. Dr. Jim says that this means that we may not be able to use RFI parameters independently. For producers who have independently measured RFI up until now, there has been no way to compare results with the rest of the breed, due to the lack of available data. Research participants hope to change that over the course of the next three years. Progeny of many of the bulls tested will hopefully come back to Cattleland to verify the heredity of measured feed efficiency traits, according to William Torres, Bull test, Research and Cattle Manager at Cattleland’s Integrated Beef Research Station (IBRS). Dr. Jim talks about the change in demographics within the cattle indust r y and t he at t r it ion of producers. “Consolidation is occurring,” he says “and the cow/calf sector is the last to feel it.” “About 10 per cent of producers now own over 50 per cent of the cows in North America,” says Dr. Jim. “And 80 per cent of feedlot production is in the hands of 17 per cent of the players.” The remaining players, he says, are those using the latest industry technology. It’s a numbers game.

H E R E F O R D

D I G E S T

CALL FOR HEREFORD BULLS Producers are encouraged to loan bulls to contribute to a total of 900 Hereford bull calves (612 months of age; both horned and polled) to satisfy research requirements for this feed efficiency trial at Cattleland Feedyards Ltd., Strathmore, Alberta. While this year’s quota of 300 bulls has already been met, the CHA reminds breeders that they may still submit their names to a waiting list for future selection in years two and three of the trial. Questions about this project a nd i n qu i r i e s p e r t a i n i ng to participation, should be directed to Jeff Hyatt, CHA breed development coordinator, at the CHA office by phone: (403) 275-2662 or by e-mail: jeff@hereford.ca .

A RESEARCH TRIAL BONUS Hereford bulls participating in RFI feed efficiency trials at Cattleland for the next three years will also provide DNA samples to Dr. Dorian Garrick, of Iowa State University, who is a director of the U.S. National Beef Cattle Evaluation Consortium that focuses on the development and application of methods that use genomic information to predict genetic merit in beef cattle. Garrick is working with the CHA to develop a Canadian Hereford 50K genomic SNP panel, having already received about 75 samples of Canadian Hereford genetics. See article: Herefords and the Canadian Cattle Genome Project, Page 80.

71


C A N A D I A N

H E R E F O R D

D I G E S T

Davies  Ranch

would  like  to  invite  all  cattlemen  to  the   First  Annual  Premier  Bull  Sale,  February  4,   2013  in  Lloydminster,  Saskatchewan.  

On  offer  5  sons  of KTD  HI  STANDARD  63U Reserve  Grand  Champion  Bull  a t  t h e   2011  P ride  of  The  Prairies  92 n d  A n n u a l   Bull  Sale.  Special  thank  you  to  P h i l  &   Susan   Howard   of   Vermilion,   A l b e r t a   for  purchasing  this  bull.

72

Also  selling  3  sons  of  KTD  BS  LAD  49T

Box  90    LaCorey,  Alberta    T0A  2E0

We  are  looking  forward  to  working  with  Ayrey   Herefords,  Parkvista  Herefords,  Lock  Farms  &   Ace  Herefords  in  February  at  this  sale.

Keith  Davies:  (780)  826-­0383 Trevor  &  Madeline:  (780)  826-­5431 5  miles  east  of  LaCorey  on  Hwy  55,  1/4  mile  north


73


74


Plan to join us on February 6th, 2013 for our

37th Annual Production Sale

We really appreciate the continued interest we have received from our customers over the years.

Featuring sons of

BBSF 46P Turin 219T & MHH 826M Stan Lad 21R

If you are looking to increase your cow herd, we will also be offering a quality selection of registered and commercial bred heifers that will fit into your program as well as some top heifer calves.

We welcome your visit anytime and look forward to seeing you on February 6th, 2013 MVFâ&#x20AC;&#x2122;s newest herdsman, Carter Oddan Harold, Alice & Merle Oddan Ph/Fax 306-893-2783 Email mvf@sasktel.net Maurice, Ellen, Mark, Tracy & Carter Oddan Ph 306-893-2737 Fax 306-893-2777 R,R, #1 Maidstone, SK S0M 1MO 20 km N. of Maidstone on Hwy 21, 6.5 km W. on Hwy 303, then 6 km N. on Range Road 3241 OR 38.5 km E. of Lloydminster on Hwy 303, then 6 km N. on Range Road 3241. 75


C A N A D I A N

H E R E F O R D

D I G E S T

Fed Hereford Project By Jeff Hyatt

B R EED D E V ELO PM EN T CO O R D I N ATO R

The Fed Hereford Project continued this past year with Feedlot Health Management Services (FHMS). There were 903 Purebred Hereford and Hereford-influence animals that were evaluated in the 2011 Project. In 2010, Lakeside wasn’t providing carcass data to FHMS, but this year, many of the animals were sold to Lakeside and carcass data was returned. Carcass data was returned on all 903 head, of which 695 were steers and 208 were heifers. In the steer group, 21.4% graded AAA or higher and 89.1% had a yield grade of 2 or higher. In the heifer group, 53.8% graded AAA or higher and 78.8% had a yield grade of 2 or higher. The most profitable carcasses, when sold on the grid, are those that grade AAA or higher with a yield grade of 1. For clarification, the following is an elementary explanation of our grading system. Cattle that have an A class grade must be youthful animals with muscle which is bright red, firm and fine grained and fat that is firm and white. The following are breakdowns for each of the youthful Grades. B1 – No marbling or less than 4mm exterior fat B2 – Yellow fat B3 – Poor muscling B4 – Dark Cutters

2011 Data

A - Trace amounts of marbling AA - Slight amounts of marbling AAA - Small or greater amounts of marbling There are several measurements by which graders determine Yield Grade. These include depth of the backfat and the length and width of the ribeye. Yield Grade (YG) 1 - 59% or greater lean yield Yield Grade 2 - 54-58% lean yield Yield Grade 3 - 53% or lower lean yield. FHMS is continuing the Fed Hereford Project through 2012 and into 2013. All returned data is sent to participating producers and if registration data can be attached to the CCIA by the producer, then the data is also used for genetic evaluations. Cattle considered for this project must be at least 50% Hereford and have either a registered sire or dam. For those of you who are interested in participating, Contact Jeff Hyatt at the CHA for submission forms. Jeff’s contact information: jeff@hereford.ca or (403) 275-2662. Once completed, forms should be sent to FHMS and once received, FHMS will contact you to negotiate placement and delivery.

695 Steers Average

Carcass Wt

Ribeye

Marbling Score

Quality Grade

Yield Grade

809.1

12.4

349.2

0.43% Angus Pride

44.17% YG1

0.29% Sterling Silver

44.89% YG2

0.14% Certified Angus

10.94% YG3

20.58% AAA 71.51% AA 6.19% A

Average

208 Heifers

Carcass Wt

Ribeye

Marbling Score

Quality Grade

Yield Grade

722.5

12.3

394.8

1.92% Angus Pride

24.52% YG1

7.69% Sterling Silver

54.33% YG2

0.96% Certified Angus

21.15% YG3

43.27% AAA 44.71% AA 0% A 1.44% B4

The Fed Hereford project, launched in the spring of 2009, was designed to provide both purebred and commercial Hereford producers with a means of receiving carcass data on their feeder animals, without retaining ownership. Dr. Kee Jim of Feedlot Health Management Systems, Strathmore, Alberta, purchases the calves and manages the project, offering our producers an excellent means of determining Hereford carcass characteristics and an opportunity to promote genetic improvement. This is also the first step in the creation of a year-round supply chain.

76


LCI 107R STONEWALL 25X BW: 3.0 WW: 50.5 YW: 87.7 Milk: 30.0 TM: 55.3 Thanks to Locharburn Herefords, N.Z., Geof & Joyce Brown, for purchasing the New Zealand semen rights to Stonewall.

40 bred heifers from our purebred herd. Bred to calve in March and April to service of: LBH 39T STERLING 281W JEN 195T KAP 20X and CC 206P EASY 21Y. Call for more details.

Plus 20 Long Yearling Bulls by Private Treaty

77


C A N A D I A N

H E R E F O R D

ACE 21Y

Born

D I G E S T

April 11, 2011 BW:95 lbs 205: 825lbs WHC - July 2012: 1,412lbs Brady  Moncrieff  

We  will  have  a  number  of  bulls  on  offer  ready  to  go  to  work  if  you  prefer  live  cover  for  either   your  purebred  or  commercial  cows.  We’re  serious  about  raising  good  cattle  and  serious   about  having  a  little  fun.  If  you  like  talking  cows,  stop  in  for  a  coffee,  we’d  love  to  see  you!

Senlac,  SK

Genetics

Home:  306-­228-­2239        Cell:  306-­228-­9177

GAH  EVEREST  244U

6HPHQ4XDOL¿HV)RU,QWHUQDWLRQDO([SRUW

New Ideas - From Old Values )RUPHUO\7UH¿DN+HUHIRUGV6LQFH  

 The  Genetics  You  Need!   For  The  Cattle  You  Want! Kirk Stierwalt, Leedy, Oklahoma

International Qualified Semen & Embryos of World Class

Sheldon & Shannon Archibald Irma, AB

Visit us 6 miles North of Irma, Alberta on Secondary 881, and 1 mile east (SW26-46-09W4)

(780) 754-2850 www.sscattle.ca sscattle@telus.net

Knows great cattle

We were fortunate to have a leader in the cattle show industry see our cattle. Please stop by for a visit anytime %XOO&RQJUHVV&KDPSLRQ 2QHRI2XU*UHDW6LUHV 66723/,1(1(21)25781(83URJHQ\)RU6DOH

78

+HUG6LUH 66723/,1(5 :$<025(: 3URJHQ\)RU6DOH

&KDPSLRQ)HPDOH66723/,1(<(6&$1$',$11$< 9LVLWWRVHHPRUHFKDPSLRQIHPDOHVLQRXUKHUG


to our buyers from the Autumn Alliance Sale XXX

and our recent bull buyers

‡Crittenden Bros Polled Herefords, SK

‡Bob Livingston -­ Southfield Farm, Orangeville, ON

‡Raymond Johnson, Leross, SK

‡Gordon Sinclair -­ Kemble, ON

‡Paul Gendron, Quebec

‡Todd Wickens, Dundalk, ON

Lian Mor Polled Herefords Wallace & Fern Pugh

Phone: (519) 941-8515 553245 Country Road 16 Mono, ON L9W 6M1 Email: lianmor@sympatico.ca 79


C A N A D I A N

H E R E F O R D

D I G E S T

& The Canadian Cattle Genome Project By Jeff Hyatt

B R EED D E V ELO PM EN T CO O R D I N ATO R

You may have seen the list of the most influential bulls in Canadian Hereford history. The list was sent out to CHA breeders this past spring. The Canadian Cattle Genome Project section of the Genome Canada Project was given the complete CHA pedigree file to determine which breeding animals had the most influence on the Canadian Hereford herd. The Canadian Cattle Genome Project is led by Dr. Stephen Miller of University of Guelph.

So what does this mean to you as a CHA Breeder?

Using the genotype data that is provided by the Canadian

at younger ages. The American Hereford Association has already developed such a panel and is using it successfully to develop more accurate trait predictions. But there is a low correlation between the AHA panel and Canadian Herefords, so the CHA had to work to develop a panel based on its own population of Herefords. Now that the pedigree files have been analyzed, we are trying to solicit breeders for semen sires that have had an influence on the Canadian Hereford population. A list of 2,700 sires, both ancestor-influential and recent influential sires, will be released in the near future - both

Now that the pedigree files have been analyzed, we are trying to solicit breeders for semen sires that have had an influence on the Canadian Hereford population. Cattle Genome Project, the CHA will develop a 50K (50,000) SNP panel for the Canadian Hereford population. It will allow breeders to get increased accuracy on trait predictions such as EPDs, especially for younger animals. And sires with very few or no progeny at all will be able to demonstrate more accurate EPDs. This genomics work will also allow breeders to have an insight into difficult-to-measure traits such as feed efficiency and fertility. Seven beef breeds have had their pedigree files analyzed and are having their animals sequenced and genotyped. These breeds include: Angus, Beef Booster, Charolais, Gelbvieh, Hereford, Limousin and Simmental.

Why is the CHA involved?

This work signals the beginning of a genomic database (panel) for the breed, allowing for the calculation of increasingly more accurate trait predictions for cattle

80

on the CHA website and in a December mailing. And once the Canadian Cattle Genome Project has gotten as many sire samples collected from the historical sires list as they can, they will completely sequence the top 25 historical sires with available DNA material and the top 5 young sires. These animals will be completely sequenced, which means they will have every amino acid on their DNA read. This will provide genetic information on approximately 40-60% of the Canadian Hereford gene pool. The next step in this project is to high-density genotype moderately to highly influential sires and dams. A total of 480 individual animals will be profiled in this phase. Influential sires (both young and old) will be profiled in this project. The remaining influential historical sires will also be genotyped with high-density genotype SNP tests. The high density SNP tests measure 770,000 (770K) SNP


C A N A D I A N

(Single Nucleotide Polymorphisms) markers on the genome. As a rule, the greater the number of SNPs in a test, the higher the density. These SNPs are alterations of a single nucleotide on the genome sequence. Every animal has many SNPs that combine to create its unique DNA pattern. The letters in the following example are a partial section of the amino acids along the genome. The highlighted letters

H E R E F O R D

D I G E S T

between cattle that aren’t closely related. This is why the CHA has decided to develop its own 50k SNP panel to use on the Canadian Hereford population for more accurate predictions. Since horned and polled cattle aren’t very closely related, this also means that we need a larger number of animals for our 50k SNP panel as well as a more diverse group. Once we develop our own 50k SNP panel, ours will be

The CHA is working with Dorian Garrick, of Iowa State University, to develop a genomic 50k panel for the Canadian Hereford population. in the following sample illustrate the differences in the sequences, known as the SNP markers which affect a particular trait. Animal 1: ACGTACCTGGTCGATGACATGGCTAGACA Animal 2: ACGCACCTGGTCGATGACCTGGCTAGACA In the next step of the Canadian Cattle Genome Project, 500-560 Hereford animals must be tested with a moderate density SNP test. This moderate density SNP test will measure approximately 50,000 (50k) SNP markers from along the genome. The bulls included will be some moderately influential sires, such as your herdsires as well as other influential bulls. Additional samples will be taken from bulls in the first year of the Residual Feed Intake (RFI) trial that the CHA is running in conjunction with Olds College, University of Alberta, Cattleland Feedyard and Livestock Gentec. These bulls will also be genotyped with 50k SNP tests. Further, commercial animals will be genotyped with a low density (6k)SNP test. With so many levels of sequencing and genotyping, the Canadian Cattle Genome Project will make it increasingly possible to derive DNA sequences from low density SNP panels. In other words, if a Hereford animal has a low density SNP test done but an ancestor of this animal has had a sequence or higher density genotype done, then the area in between the SNP markers on the progeny can be devised if the SNPs for both the ancestor and the progeny match.

blended with the AHA 50k SNP panel to validate both American and Canadian cattle. By the end of 2013, the CHA will have approximately 1,375 genotyped cattle.

NEEDED

In an upcoming mailing in December, the CHA will be sending out the list of bulls from which the project requires semen. If you have semen from any of these bulls and are willing to donate it to the project, please contact Jeff Hyatt at the CHA office at jeff@hereford.ca or at 403-275-2662. Also needed are semen or hair (80 follicles) samples of breeders’ current herdsires. Of particular interest is a sample from the bull REMITALL KEYNOTE 20X. For anyone able to donate 20X semen, the new Research Fund of the Keith Gilmore Foundation is willing to provide a charitable tax receipt.

What will the CHA do with all this information?

The CHA is working with Dorian Garrick, of Iowa State University, to develop a genomic 50k panel for the Canadian Hereford population. This panel will evaluate each of the SNP markers within Canadian Hereford cattle tested to determine how they will affect individual traits such as birth weight or feed efficiency, within these animals. For example, if an A is at a given SNP marker, it may increase the birth weight by 1 pound, while a T at the SNP marker may decrease birth weight by two pounds. So by developing a training panel by genotyping a thousand animals from the Canadian Hereford population, we will have a fairly good understanding of how each of these SNP markers affect different traits. The American Hereford Association has recently created a 50k panel with 1,500 unique cattle. There are only approximately 75 Canadian cattle included in this 50k SNP panel, therefore the correlation of SNP markers and traits to Canadian Hereford cattle is quite low. SNP panels do not correlate well to give accurate trait profiles

'($1),(/'167$1'$5'/$'; Grand Champion and High Selling Hereford Bull at the Williams Lake Bull Sale Thanks to the buyers and bidders at the 75th Williams Lake Bull Sale as well as private treaty buyers ¹ ¹ ¹ ¹

7XUQHU5DQFK/WG SXUFKDVHG; ¹ 6KDUSH/DNH5DQFK 4XHQWLQ0RWOH\'70RWOH\)DUPV ¹ 7HUHQFH,QVNLS SULYDWHWUHDW\

&KDUVSULQJV5DQFK ¹ +RUVFK5DQFK SULYDWHWUHDW\

&OHPLWVRQ5DQFK

Bob & Colleen Gowans & Family 202 Campbell Range Road, Kamloops, BC V2C 6W4

Phone: 250.573.4088 Fax: 250.573.4054 HPDLOGHDQÀHOGUDQFK#\DKRRFD 81


Keith  Gilmore  Foundation

Thank  You

to  our  2012  “Leaderboard”  Sponsors

Platinum  Sponsors: Silver  Sponsors: ĂŶĂĚŝĂŶ,ĞƌĞĨŽƌĚƐƐŽĐŝĂƟŽŶ Gordon  &  Rosemary  Church  &   Family Karl  Gilmore  &  Family Kent  Gilmore

Ken  &  Nora  Balog/Wilcox  Energy   Corp. Ovalyn  Ranches  Ltd. ůƚĂ'ĞŶĞƟĐƐ/ŶĐ͘

Bronze  Sponsors: Donnie  Mitchell,  Maidstone Lanni  &  Virginia  Bristow Don  Eggertson JoNomn  Hereford  Ranch Bar  RZ  Polled  Herefords &ĞŶƚŽŶ,ĞƌĞĨŽƌĚZĂŶĐŚ/ŶĐ͘ Andre  &  Janet  DeChaine ƌŽƐƚ>ĂŶĚΘĂƩůĞŽ͘ Jean  Jones

Congratulations  to the 2012 KGF Scholarship Winners $2,500.00

$2,000.00

$1,500.00

Thank  You  

Thank  You  

Thank  You  

Dan  &  Gwen  Aebly Pahl  Livestock Bob  &  Yvonne  Olson Karl  Gilmore Cesar  Fuertes Lloyd  &  Linda  Fowlie Dean  Jones David  &  Dianna  Burnat Jean  Jones Gene  Aebly Ted  &  Karen  Burnat ĂůŽŐƵĐƟŽŶ^ĞƌǀŝĐĞƐ ^ĐŽƩͲůƚĂ&ĂƌŵƐ ^ƚĞǁĂƌƚƵƐŵĂŶŶ Brad  Dubeau XTC  Hereford  Ranch

ĂůŽŐƵĐƟŽŶ^ĞƌǀŝĐĞƐ ůƚĂ'ĞŶĞƟĐƐ Karen  &  Norris  Graham Karl  Gilmore  &  Family &ŽǁůŝĞĂƩůĞŽ͘ Pahl  Livestock Canadian  Hereford  Digest DĂĞƌƚĞŶƐͲWŽŽůĞŚĂƌƚĞƌĞĚĐĐŶƚ͛Ɛ Aebly  Ranch ůĂĐŬůŽĐŬƵĐƟŽŶ^ĞƌǀŝĐĞ Canadian  Beef  Breeds  Council Don  Osadczuk ,,,ĂƩůĞŽ͘ >ŝƩůĞ&Žƌƚ,ĞƌĞĨŽƌĚƐ WĞƌƌLJtŝůŬĞƐ/ZZĞĂůƐƚĂƚĞ ŐƌŝͲDĂƌŬĞƟŶŐ^ĞƌǀŝĐĞƐ/ŶĐ͘

www.keithgilmorefoundation.com

Caitlyn  Best Rebecca  Cornell DĂƩŚĞǁtĂůƉŽůĞ Kristen  Podalsky

to those who donated items to the 2012 KGF Country Auction ůďĞƌƚΘ^ŚŝƌůĞLJEŝĞŵĂŶ Gerry  &  Linda  Miller John  Blacklock Jim  Hauser Gwen  Aebly Walter  Blume ƌĞĂƟǀĞǀĞŶƵĞƐ/ŶĐ͘ Tom  Mueller

82

Anna  Ree Megan  Rosso ƌŝƩĂŶLJ^ŵŝƚŚ Nicole  Wiart  

to the 2012 KGF Auction Buyers

Mario  Roy Colin  Verbeek Julie  Wehlage

to the 2012 KGF Hole Sponsors


2012  Golf  Tournament

dŚĂŶŬLJŽƵƚŽŽƵƌƉůĂLJĞƌƐ͕ĐĂƐŚĚŽŶŽƌƐ͕ĂƵĐƟŽŶĚŽŶŽƌƐĂŶĚǀŽůƵŶƚĞĞƌƐ͊ ^ƉĞĐŝĂůƚŚĂŶŬLJŽƵƚŽƚŚĞƉĞŽƉůĞŽĨWĂŚů>ŝǀĞƐƚŽĐŬ͘

dŚĞƐĞƉĞŽƉůĞŚĞůƉĞĚƚŽƌĂŝƐĞŽǀĞƌΨϯϬ͕ϬϬϬƚŚŝƐLJĞĂƌĨŽƌdŚĞ<ĞŝƚŚ'ŝůŵŽƌĞ&ŽƵŶĚĂƟŽŶĂŶĚ ŚĞůƉĞĚĮŶĂŶĐĞϭϭŵŽƌĞƐĐŚŽůĂƌƐŚŝƉƐŝŶϮϬϭϮ͊

2012 Golfers

Dan  &  Gwen  Aebly Dennis  &  Andrea  Babiuk Pearl  Brower David  &  Dianna  Burnat ^ƚĂŶΘŝĂŶĞDĐ>ĞĂŶ Ted  &  Karen  Burnat   LeRay  &  Joann  Pahl Cesar  Fuertes

ĂŶΘ^ŚĂƵŶĂWĂŚů Bob  Poole   Lorne  &  Gloria  Krauss David  Maisey Bob  &  Yvonne  Olson Mick  &  Elaine  Nieman Colin  Page Grant  &  Roxane  Rushton   :ĞīΘDĂƌLJ^ŚŝŐĞŵĂƚƐƵ

Brad  Dubeau Dean  Jones Blaine  Brost ^ƚĞǁĂƌƚƵƐŵĂŶŶ Ron  DeGray ^ĐŽƩWĂŚů Lloyd  &  Linda  Fowlie Karl  Gilmore Rick  Gilman

www.keithgilmorefoundation.com

The  winning   team  in  this   LJĞĂƌ͛ƐŐŽůĨ tournament   included  Bob  &   Yvonne  Olson   ;ůƚͿĂŶĚ^ŚĂƵŶĂ &  Dan  Pahl

Dennis  Ulrich :ŝŵ^ĐŽƩ ŝůůΘĞƩLJ,Žī ƌŶƐƚΘ^ŚĞƌƌLJ:ĞŶƐĞŶ Bob  &  Rose  Pender Don  Osadczuk Travis  Wasko Byron  Templeton 83


ͳ͝Ä&#x201D;Ä&#x2018;Ä&#x2122;Ä&#x2020;Ä&#x2030;͡

 ÍľÄ&#x160;Ä&#x2DC;Ä&#x2122;Ä&#x2022;Ä&#x201D;Ä&#x17D;Ä&#x201C;Ä&#x2122;͜Ͳ

Watch  for  our  consignment  to  the  Calgary  Bull  Sale  in  the  January  Edition  of  The  Digest

Bull  calves  available  now  by  these  proven  herdsires

We  sell  only  by  private  treaty  and  at  the  Calgary  Bull  Sale Scott  Nixdorff  &  Sons

Rob  (403)  948-­â&#x20AC;?2569 Cell  (403)  510-­â&#x20AC;?2687 Scott  (403)  948-­â&#x20AC;?5232

â&#x20AC;&#x153;The  Idea  Is  Excellenceâ&#x20AC;? 84

Paul  (403)  935-­â&#x20AC;?4334 Fax  (403)  935-­â&#x20AC;?3576 Â?Â&#x192;Â&#x2039;Â&#x17D;Â&#x2022;Â?Â&#x2022;̡Â&#x2021;Ď?Â&#x2039;Â&#x201D;Â&#x2021;Â&#x160;Â&#x2018;Â&#x2022;Â&#x2021;ǤÂ?Â&#x2021;Â&#x2013;

ǤǤÍ´ÇĄÂ&#x2039;Â&#x201D;Â&#x2020;Â&#x201D;Â&#x2039;Â&#x2021;ǥ͜ʹ͜


C A N A D I A N

H E R E F O R D

D I G E S T

show& sale results show index 37th Annual Quebec 4-H Provincial Rally ........................................................................... 86 Quebec Junior Beef Show ...................................................................................................... 86 Manitoba Hereford Association 2012 Summer MOE Show ............................................. 87 Expo St. Hyacinthe MOE Show ............................................................................................. 87 MHA Field Day 2012 ............................................................................................................... 87 Southeast SK Hereford Zone Field Day ............................................................................... 87 Expo Quebec MOE Show ....................................................................................................... 88 Expo Ayer’s Cliff MOE Show ................................................................................................. 88 Maritime Hereford Futurity Show ....................................................................................... 88 Expo Brome MOE Show ......................................................................................................... 88 Orangeville Fair MOE Show .................................................................................................. 89 Salmon Arm Fair MOE Show ................................................................................................ 89 Northwest Saskatchewan Field Day (In Saskatchewan Provincial Report) ................. 96 Southeast Hereford Zone MOE Show (In Saskatchewan Provincial Report)................ 97 Northern Alberta Club Hardisty Field Day (In Alberta Provincial Report)................... 99

sale index Triara’s Big Cowherd Dispersal ............................................................................................ 89 Richardson Ranch 3rd Annual Online Sale ......................................................................... 90 Genetic Designs VIII ............................................................................................................... 90 Autumn Alliance Sale XXX................................................................................................... 91 2012 DownEast Hereford Sale............................................................................................... 91 A.X.A. Earlybird Sale of the East .......................................................................................... 91

85


C A N A D I A N

H E R E F O R D

D I G E S T

show results

37th Annual Quebec 4-H Provincial Rally July 5-8, 2012 Quebec 4-H’ers celebrated Canada’s favourite sport, hockey, July 5-8 at this year’s 37th annual Provincial Rally. 4-H clubs from across Quebec, as well as some 4-H clubs from Eastern Ontario gathered at the Shawville fairgrounds, just north of Gatineau, to demonstrate their agricultural skills. Rally is one of few times clubs all gather together. 101 4-H’ers aged 6-25 showed off 121 projects divided into: 66 dairy, 16 beef, 10 life skills, 9 public speaking, 5 sheep, 5 poultry, 3 goats, 3 rabbits, 2 steers and 2 horses. All the results can be found on our website: http://www.quebec4-H.com/rally Québec Herefords sponsored this Rally’s Champion Hereford award. Tyler Tubman of Shawville 4-H won the award with his junior yearling RAF Danette 6Y. Jonathan Hamilton of Shawville 4-H was a close second as he took home the prize of Reserve Champion Hereford, sponsored by Québec Herefords, with his junior yearling RAF Lori 29Y. The 38 Annual Provincial Rally will be hosted by the Sawyerville 4-H club July 18-21 at the Cookshire fairgrounds, in the Eastern Townships. The theme will celebrate 4-H’s centennial anniversary in Canada. Each club will select a decade to demonstrate agriculture in that period.

Quebec Junior Beef Show July 6-8, 2012 Brome, Quebec Judge : M. Rob Jamieson

Grand Champion Hereford Bull

Grand Champion Hereford Female

BLACK-RIVER YAGGERMEISTER 14Y

TRIARA YOURS TRULY ET 359Y

Participants at the Quebec Junior Beef Show

Reserve Grand Champion Hereford Female

Exhibited By: Colt Mastine, Melbourne, QC

Exhibited By: Colt Mastine, Melbourne, QC

TRIARA FOREVER 150Y

Exhibited By: Allison Mastine, Pierrefonds, QC

86


C A N A D I A N

Manitoba Hereford Association 2012 Summer MOE Show

H E R E F O R D

D I G E S T

show results

June 30, 2012 Killarney, Manitoba Judge: Jeff Lees

Grand Champion Bull

Reserve Grand Champion Bull

HI-CLIFFE WLB SAMMY 13X

CRLY 45S YAHOO 104Y

Exhibited By: WLB Livestock

Exhibited By: Orianna Hyndman

Grand Champion Female

Reserve Grand Champion Female

WLB 69T JUST LOVELY 84X

ROSELAWN BELL 154U 83Y

Premier Breeder: Roselawn Polled Herefords

Premier Exhibitor: Roselawn Polled Herefords

Exhibited By: WLB Livestock

Exhibited By: Roselawn Polled Herefords

Expo St. Hyacinthe MOE Show July 18-23, 2012 Saint-Hyacinthe, QuĂŠbec Judge: Sebastian Belanger

Grand Champion Bull

Reserve Grand Champion Bull

GLENLEES 50S WIRED 4Y

RWB COGNAC 9Y

Grand Champion Female

Reserve Grand Champion Female

RHBF 117L SNOWFLAKE 101S

DAN DEX 50S VICTORIA 107Y

Premier Breeder: Amanda Bushey

Premier Exhibitor: Five Star Farm

Exhibited By: Maple Hill Herefords

Exhibited By: Five Star Farm

Exhibited By: RWB Herefords

Exhibited By: Daniel Dextradeur

MHA Field Day 2012 July 21, 2012 Judges: Ryan Shear, Dallas Kreuger and Jeff Bieganski

Grand Champion Bull

Reserve Grand Champion Bull

LEVELDALE VICTORY 719T

GHR 137W 8Z

Grand Champion Female

Reserve Grand Champion Female

LEVELDALE ULTRA 15M 5U

WLB 21T QUEEN 103X

Premier Breeder: Leveldale Polled Herefords

Premier Exhibitor: Leveldale Polled Herefords

Exhibited By: Leveldale Polled Herefords

Exhibited By: Leveldale Polled Herefords

Exhibited By: Guilford Hereford Ranch

Exhibited By: WLB Polled Herefords

Southeast SK Hereford Zone Field Day August 11, 2012 Judges: Heather Brokenshire, Howard Crittenden and Riley Lafrentz

Grand Champion Bull

Reserve Grand Champion Bull

LEVELDALE VICTORY 719T 7Z

LEVELDALE WILDCAT 5T 28W

Grand Champion Female

Reserve Grand Champion Female

ANL GG 521X PEBBLES 3X 18Z

ANL 425X COREY 49W 38Z

Premier Breeder: ANL Polled Herefords

Premier Exhibitor: ANL Polled Herefords

Exhibited By: Leveldale Polled Herefords

Exhibited By: ANL Polled Herefords

Exhibited By: Leveldale Polled Herefords

Exhibited By: ANL Polled Herefords

87


C A N A D I A N

H E R E F O R D

D I G E S T

show results

Expo Quebec MOE Show August 15-17, 2012 Judge: Billy Elmhirst

Quebec City, Québec

Grand Champion Bull

Reserve Grand Champion Bull

RVP STAR 122L YES SIR 20Y

RRF GOLD RUSH 892Y

Grand Champion Female

Reserve Grand Champion Female

RRF ECLIPSE 92X

DAN DEX 893U REMINDER

Premier Breeder: Ferme Andre Beaumont

Premier Exhibitor: Ferme Andre Beaumont

Exhibited By: Ferme Crystal Brook Farm

Exhibited By: Scott Mastine

Exhibited By: Scott Mastine

Exhibited By: Daniel Dextradeur

Expo Ayer’s Cliff MOE Show August 25, 2012 Judge: Ray Smith

Ayer’s Cliff, Québec

Grand Champion Bull

Reserve Grand Champion Bull

RVP STAR 122L YES SIR 20Y

RWB COGNAC 9Y

Grand Champion Female

Reserve Grand Champion Female

RHBF SNOW FLAKE 101S

BAR-J0M ANNIE 9W

Premier Breeder: RWB Herefords

Premier Exhibitor: RWB Herefords

Exhibited By: Ferme Crystal Brook Farm

Exhibited By: Five Star Herefords

Exhibited By: RWB Herefords

Exhibited By: RWB Herefords

Maritime Hereford Futurity Show August 30, 2013 Judge: Adam Fraser

Grand Champion Bull

Reserve Grand Champion Bull

BENTVILLE JACK

THUNDERBROOK STEADY & READY 4Z

Grand Champion Female

Reserve Grand Champion Female

CGJH 13P LACEY 20U

THUNDERBROOK YAHOO 3Y

Premier Breeder: Thunderbrook Farms

Premier Exhibitor: Thunderbrook Farms

Exhibited By: Bentville Farm

Exhibited By: Thunderbrook Farms

Exhibited By: Bentville Farm

Exhibited By: Thunderbrook Farms

Expo Brome MOE Show August 31 - September 3, 2012 Judge: John Neilson

Brome, Québec

Grand Champion Bull

Reserve Grand Champion Bull

BEEBE PLAIN TOP CHOICE 17X

RRF GOLD RUSH 892Y

Exhibited By: Five Star Farm

Grand Champion Female

Reserve Grand Champion Female

TRIARA ENCORE 892U

MAPLE HILL 100W ZURICK 5Z

Premier Breeder: Scott Mastine

Premier Exhibitor: Daniel Dextrateur

Exhibited By: Scott Mastine

88

Exhibited By: Scott Mastine

Exhibited By: Maple Hill Farm


C A N A D I A N

D I G E S T

show results

Orangeville Fair MOE Show September 2, 2012 Judge: Bill Doig Jr.

H E R E F O R D

Orangeville, Ontario

Grand Champion Bull

Reserve Grand Champion Bull

CHULA-VISTA ABSOLUTE HEAT 104Z

MHPH 9W YEOMAN 203Y

Exhibited By: Casey & Jill Van Kessel

Exhibited By: Medonte Highlands Polled Herefords

Grand Champion Female

Reserve Grand Champion Female

DELHAWK SUNNY 1014 ET

GRO-JDL TEMPTATION 743 129Y

Premier Breeder: Medonte Highlands Polled Herefords

Premier Exhibitor: Medonte Highlands Polled Herefords

Exhibited By: Medonte Highlands Polled Herefords

Exhibited By: Grosvenor Farm and JDL Cattle Co.

Salmon Arm Fair MOE Show September 7-9, 2012 Judge: Bruce Rolph

Salmon Arm, British Columbia

Grand Champion Bull

Reserve Grand Champion Bull

CB 100W POWERADE 123Z

KOOTENAY 8X MARVEL MAN 30Z

Exhibited By: Caylynne Brown

Exhibited By: Kootenay Polled Herefords

Grand Champion Female

Reserve Grand Champion Female

3-D-L AMBER 4X

STAR KKH SSF GOTTAWANT 237Y ET

Premier Breeder: 3-D-L Farms

Premier Exhibitor: 3-D-L Farms

Exhibited By: 3-D-L Farms

Exhibited By: Copper Creek Ranch

sales results Hereford Lots

Triara’s Big Cowherd Dispersal August 19, 2012 Melbourne, Quebec Auctioneer: Steven Barrie

Hereford Top Sellers Cow/Calf Pair $5,400 Lot 324 & 324A – NJW 58P M326 MONTANA 95X & TRIA 243Z Lot 324 - NBG Polled Herefords, North Gower, ON Buyer: Buyer: Lot 324A – Justamere Ranches, Dauphin, MB Sire: Lot 324 – KCF BENNETT 3008 M326 SOD: LLL C&L CUSTOM 100K Sire: Lot 324A – TRIARA UNLEASHED 893U Bred Heifers $3,300 Lot 326 – TRIARA FOREVER MINE 38X Buyer: River Road Farms, Windsor, QC Sire: JOYCLIFF STAR POWER 201R SOD: REMITALL EMBRACER 8E

21 2 9 3 11 2 46 42 51 15

AVER AGE

Cow/Calf Pairs $2,814.00 Heifer Calves $1,250.00 Yearling Heifers $1,433.00 Bred Heifers $2,100.00 Cows $2,400.00 Bull Calves $1,125.00 lots grossed $107,200.00, averaging $2330.00 Embryo’s $171.00 Angus lots grossed $150,200.00, averaging $2,945.00 Simmental lots grossed $31,400.00, averaging $2,093.00

Heifer Calf $2,000 Lot 331A – TRIARA TINLEY 256Z Buyer: Mike Herrington, NY, USA Sire: SHF RIB EYE M326 R117 SOD: GHC SCF ESK PREMIER 6J Bull Calf $2,200 Buyer: Sire: SOD:

Lot 311A – TRIARA EPIC 263Z Justamere Ranches, Dauphin, MB FHF 8403 STARBUCK 19H NS KENO 005

89


C A N A D I A N

H E R E F O R D

D I G E S T

F O R A D D I T I O N A L S A L E S R E S U LT S V I S I T W W W. H E R E F O R D . C A

sales results

Richardson Ranch 3rd Annual Online Sale September 12 – 17, 2012 Tlell, British Columbia Hosted by LiveAuctionTV

Top Sellers

AVER AGE

2 Yearling Bulls $4,450.00 2 Bull Calves $6,100.00 3 Heifer Calves $2,900.00 5 Bred Heifers $2,880.00 3 Cows $3,733.33 15 lots grossed $55,400.00, averaging $3,693.00 2 Steers $925.00 Total Sale Gross: $57,250.00

Bull Calf $9,900 Lot: TLELL 8N RED ZULU 1Z Buyer: Leonard & Leslie Conlon, C.L.L. Holdings, Lloydminster, SK Sire: TLELL 29F RED CEDAR 8N SOD: TLELL 199S RED BULL 20U

Yearling Heifer $4,300 Lot: TLELL 57U CAN I AM 2Y Buyer: Blaine Brost, Brost Land and Cattle Co, Irvine, AB Sire: RVP STAR 533P CAN-AM ET 57U SOD: REMITALL ICON 24K

Yearling Bull $4,500 Lot: TLELL 20W HOLD’EM 30Y Buyer: D&S Farm, Port Coquitlam, BC Sire: TLELL 42S SUPER DUDE 20W SOD: HF 4L BEYOND 36N

Cow $7,200 Buyer: Sire: SOD:

Heifer Calf $4,100 Lot: TLELL 57U ZINGER 20Z Ron Berg, Prairie Rose Stock Farm, Camrose, AB Buyer: Sire: RVP STAR 533P CAN-AM ET 57U SOD: TLELL 29F RED CEDAR 8N

Lot: TLELL 20U JADE 32X Doug and Wanda Mann, Phantom Creek Livestock, Swift Current, SK BY TLELL 199S RED BULL 20U REMITALL OLYMPIAN ET 262L

AVER AGE

Genetic Designs VIII September 14, 2012 Auctioneer: Dale Stith

Newburgh, Ontario

Top Sellers Cow/Bull Calf Pair $18,250 Lot 18 - MAPLE-HILL 91P XTERA 40X Buyer: Harvie Ranching, Olds, Alberta Sire: C&T 66F ALTON 91P SOD: C&T 4G JASPER 9K Lot 18A - RVP 743 ZACK 27Z Buyer: McMurry Cattle, Billings, Montana Sire: CRR ABOUT TIME 743 SOD: C&T 66F ALTON 91P Cow/Heifer Calf Pair $11,100 Lot 28 - RVP 122L IT’S A WRAP ET 1107W Buyer: Ridgeview Farm, Alto, Michigan and Cutler’s Little Farm, Middleville, Michigan Sire: REMITALL ONLINE 122L SOD: CS BOOMER 29F Lot 28A - RVP 144U ZIP BOOM BA 42Z Buyer: Crittenden Bros., Imperial, Saskatchewan Sire: NJW 73S M326 TRUST 100W ET SOD: REMITALL ONLINE 122L Yearling Bull $3,800 Lot 1 - RVP 100W YUL 123Y Buyer: Ferme Claude Forest, St. Damien de Brandon, Quebec Sire: NJW 73S M326 TRUST 100W ET SOD: BR DM CHANNING ET 90

Bull Calf $2,000 Buyer: Sire: SOD:

5 Cow/bull calf pairs $8,040.00 22 Cow/heifer calf pairs $5,018.00 1 Yearling bull $3,800.00 1 Bull calf $2,000.00 12 Heifer calves $2,662.50 4 Bred heifers $2,700.00 5 Cows $2,580.00 50 lots grossed $212,050.00, averaging $4,241.00 3 Embryos $250.00 Total Sale Gross: $212,800.00 Lot 10 - RVP 29F CZAR ET 64Z Cedarwood Polled Herefords, Lindsay, ON CS BOOMER 29F HF 4L BEYOND 36N

Heifer Calf $4,600 Lot 14 - RVP 122L ZELMA 11Z Buyer: Cayley Cattle Co., Princeton, BC Sire: REMITALL ONLINE 122L SOD: NS KENO 005 Bred Heifer $3,100 Lot 51 - TL 19H TAMARA 9Y Buyer: Mannle Polled Herefords, Whitewood, SK Sire: FHF 8403 STARBUCK 19H SOD: MHPH 24K NEBRASKA 314N Cow $3,000 Buyer: Sire: SOD:

Lot 33 - RVP 45S SEXY LADY 49X Glenview Farms, Shinglehouse, Pennsylvania STAR 2013 BATTLE CRY 45S RRO TRM TA-DAH-BOOM 4267


Autumn Alliance Sale XXX September 16, 2012 Auctioneer: Dale Stith

Orillia, Ontario Sale management: T Bar C Cattle Co. Ltd.

Top Sellers Yearling Bull $15,000 Reference Sire F - MHPH 9W YEOMAN 203Y Buyer: Double J Polled Herefords, Maidstone, SK & C.L.L. Holdings, Lloydminster, SK Sire: ANL MHPH PBG 45P TANK 9W SOD: WILGOR 55K NORTHEASTERN OL 2N Bull Calf $31,000

Lot 1 - MHPH 521X ZIP CODE 318Z (1/4 Interest)

Buyer: Sire: SOD:

Zip Code Investment Syndicate, Baysville, ON TH 122 71I VICTOR 521X ET STAR AMERICA BNMHPH SS MKS 68M

Cow/Heifer Calf Pair $17,000 Lot 6 - MHPH MS 533P DUCHESS ET 124W Buyer: Bird’s Hill Farms, Wilmot, New Brunswick Sire: STAR BRIGHT FUTURE 533P ET SOD: STAR AMERICA BNMHPH SS MKS 68M Lot 6A - MHPH 9W DUCHESS 1011Z Buyer: Copper Creek Ranch, Princeton, BC Sire: ANL MHPH PBG 45P TANK 9W SOD: STAR BRIGHT FUTURE 533P ET

Bred Heifer $3,300 Lot 40 - LIAN 49S YESSICA 111Y Buyer: Raymond Johnston, Leross, Saskatchewan Sire: MCCOY 55M ABSOLUTE 49S SOD: LIAN 62J PROFESSOR ET 229P Bred Cow $7,100 Lot 16 - MHPH MS 122L AMBER 121X Buyer: Remitall West, Olds, Alberta & Dorbay Polled Herefords, Dorchester, ON Sire: REMITALL ONLINE 122L SOD: REMITALL LAGRD POUNDER ET 204P Heifer Calf $6,000 Lot 7 - MHPH 101S PEBBLES 103Z Buyer: ANL Polled Herefords, Steelman, SK Sire: BNMHPH 13P HEAT 101S SOD: NJW FHF 9710 TANK 45P

2012 DownEast Hereford Sale September 8, 2012

Wilmot, New Brunswick

Top Sellers Bull Calf $2,60 Lot 1 - BIRD’S-HILL ARIZONA 101Z Buyer: Roy, Stephen and Chris Goodine, Bear Island, NB Sire: REMITALL SUPER DUTY 42S SOD: FCC 60G MADDUX 4L Heifer Calf $3,700 Lot 5 - BIRD’S-HILL KATHY 114Z Buyer: Medonte Highlands Polled Herefords, Mississauga, ON Sire: GHC-TABOO COALITION 52U SOD: FORC 29F BOOMER 18L

Sussex, New Brunswick

Top Sellers Bred Heifer $5,200 Lot 6 - AXA 69T ULTIMATE 106Y (1/2 Interest) Buyer: Harvie Ranching, Olds, AB Sire: HARVIE TRAVELER 69T SOD: RU GALAXY 58G $5,000 Buyer: Sire: SOD:

Lot 5 – HILLS AXA SARAH 155Y Dorbay Polled Hereford, Dorchestere, ON GOLDEN OAK FUSION 3S SONORA 145R

AVER AGE

1 Bull Calf $2,600.00 11 Heifer Calves $2,345.00 8 Bred Heifers $1,944.00 4 Cow/Heifer Calf pairs $3,038.00 24 lots grossed $56,100.00, averaging $2,338.00

Bred Heifer $2,950 Lot 10 - BIRD’S-HILL MS SHAPLEY 106Y Buyer: Scott Mannle, Whitewood, SK Sire: WLB SHAPLEY 50S 40U SOD: REMITALL PATRIOT ET 13P Cow/Heifer Calf Pair Lot 13 - BNC 17R Phoebe 53U $4,250 Buyer: Don Kimball, Hartford, NB Sire: REMITALL REWARD 17R SOD: REMITALL KEYNOTE 20X Lot 13A - BIRD’S-HILL MISS ET 226Z Buyer: Harvey Duke, Regina, SK Sire: REMITALL SUPER DUTY 42S SOD: REMITALL REWARD 17R

A.X.A. Earlybird Sale of the East September 9, 2012 Auctioneer: Mark Sloat

AVER AGE

1 Yearling bull $15,000.00 3.25 Bull calves $13,077.00 15 Cow/heifer calf pairs $7,767.00 2 Bred heifers $2,850.00 10 Bred cows $3,475.00 14 Heifer calves $3,039.00 45.25 lots grossed $257,000.00, averaging $5,680.00

AVER AGE 15 Heifer Calves $1,793.00 1 Bull Calf $1,500.00 4.5 Bred Heifers $4,167.00 1 Cow/Heifer Calf Pair $4,200.00 4 Cows $1,550.00 25.5 lots grossed $57,850.00, averaging $2,269.00 8 Embryos $487.00 1 Right to Flush $4,000.00 Total Sale Gross: $65,450.00

Cow/Heifer Calf Pair $4,200 Lot 35 – BURNSIDE EXPRESS 45X Buyer: Grant & Donnie McCaffrey, PEI Sire: RV STOCKER 6662 SOD: ELM-LODGE NEXT BIG THING 3N Lot 35A - BRUNSIDE ZESTY 30Z Sire: SHR RIB EYE R117 SOD: RV STOCKER 666Z Heifer Calf $3,300 Lot 17 – EARLYBIRD 28M 9T ZAYBA 12Z Buyer: Maple Hill Farms, Shefford, QC Sire: GOLDEN OAK MAXIUM 28M SOD: NS KENO 005

91


C A N A D I A N

H E R E F O R D

D I G E S T

general manager’s report Canadian Hereford Association

By Gordon Stephenson

G EN ER A L M A N AG ER , CA N A D IA N H ER EFO R D A S S O CIATI O N

I hereby offer some information for our members about Hereford genomics and what direction the Canadian Hereford Association is taking, with regards to research and access to this technology. Staying proactive and keeping abreast of genomics technology will keep us competitive and also compatible with other countries moving to SNP (Single Nucleotide Polymorphisms) technology for parent verification, genetic abnormality identification and for the enhancement of Hereford evaluation programs. The Canadian Hereford Association and all other countries, except for the United States, currently use DNA technology to make parentage qualifications using microsatellites. This has been the case since Livestock registries stopped using blood typing many years ago. The industry moved from blood typing to DNA Microsatellite technology and it is now preparing to move to SNP Technology which is more advanced yet and will be less expensive. The American Hereford Association has already moved to SNP Technology, since June 26th of this year, and is currently rolling out four different products, including parentage, genetic abnormalities, a bovine 50K panel and a Horned /Polled test. The importance of the US market for our members is no secret, therefore, we must as an association move to SNP

The industry moved from blood typing to DNA Microsatellite technology and it is now preparing to move to SNP Technology which is more advanced yet and will be less expensive. technology to remain compatible, competitive and to prevent any artificial trade barriers. The move to SNP technology will occur in steps, some of which have already been initiated. The first step will be to identify and provide a SNP panel for parentage and the three genetic abnormalities. My estimate, subject to Board approval, could occur in early 2013. We are currently doing the due diligence with the guidance and input of the Hereford Breed Improvement Committee. The Association is currently doing research within the Genome Canada project to develop and validate a “made-inCanada” 50K panel whereby SNP markers will be used to enhance the accuracy of our EPD’s. The 50K SNP panel test will be optional for our members, and will provide test results that will be blended with the test animal’s current EPDs to enhance accuracies, which is especially important for young animals. (Refer to the article by Jeff Hyatt for more details). Some members of the American Hereford Association have already tested animals on their 50K panel and the results were blended into the July 2012 EPD reports. An animal search on the AHA website will show animals with a GE-EPD Logo (Genetically Enhanced EPD), which means these are genetically assisted EPDs, blended from the 50K panel test results. Do not be alarmed by this, as the objective is to improve accuracies, which is the most important component of any EPD report. The Hereford Breed Improvement committee has also asked the staff to do the due diligence on offering an optional Horned/Polled test that identifies the homozygous or heterozygous polled genotype. This optional test may be available to the membership in early 2013. I encourage any member who wishes to discuss genomics and the contents of this article with me, to call the office at your convenience. I also encourage as many members as possible to attend the CHA annual meeting and luncheon on Thursday, November 22 at 12 noon at Agribition. We will have further updates there, on these genomic projects for the membership.

92


C A N A D I A N

H E R E F O R D

D I G E S T

rapport du directeur général Association Canadienne Hereford

Par Gordon Stephenson

D I R ECT EU R G ÉN ÉR A L D E L’A S S O CIATI O N CA N A D I EN N E H ER EFO R D

Chers membres, je vous propose par la présente quelques informations sur la position de l’Association canadienne Herefords au sujet de la recherche et de l’accès à la technologie concernant la génomique des Hereford. En restant proactif et à la page des dernières technologies de la génomique, nous gardons notre position concurrentielle et nous seront également compatibles avec d’autres pays qui se dirigent vers la technologie SNP (polymorphismes mono nucléotidiques) pour vérification de parenté, d’identification des anomalies génétiques et d’amélioration des programmes d’évaluation génétiques Hereford. L’Association canadienne Hereford et tous les autres pays, à l’exception des États-Unis, utilisent actuellement la technologie de l’ADN pour les tests de parenté selon la méthode microsatellite. Cela en est le cas depuis que les registres d’élevage ont cessé d’utiliser le typage sanguin il y a de nombreuses années. L’industrie est passée du test sanguin à la technologie de l’ADN Microsatellite et nous sommes maintenant en préparation du passage vers la technologie SNP qui est encore plus avancée et sera moins coûteuse. L’Association américaine Hereford a déjà adopté la technologie SNP, depuis le 26 juin de cette année et déploie actuellement quatre produits différents,comprenant la vérification des parents, les anomalies génétiques, un panneau de 50K et

L’industrie est passée du test sanguin à la technologie de l’ADN Microsatellite et nous sommes maintenant en préparation du passage vers la technologie SNP qui est encore plus avancée et sera moins coûteuse. un test pour la prédiction de l’homogésité polled. L’importance du marché américain pour nos membres n’est pas un secret, c’est pourquoi, nous devons en tant qu’association progresser vers la technologie SNP et rester compatible, concurrentiel et éviter les barrières commerciales artificielles. Le passage à la technologie SNP se produira en étapes, dont certaines ont déjà été lancées. La première étape consistera à identifier et à fournir un panneau SNP pour la vérification des parents et les trois anomalies génétiques. J’estime, sous réserve d’approbation par le Conseil, que le tout pourrait se produire début 2013. Nous sommes actuellement en communication avec la direction et le Comité d’amélioration de la race. L’Association est en projet de recherche dans le cadre de Génome Canada pour élaborer et valider un panneau de 50K « fait au Canada » selon laquelle les marqueurs SNP serviront à améliorer l’exactitude de nos EPD. Le panneau SNP 50K, qui sera facultatif pour nos membres, fournira des résultats qui seront mélangés aux EPD actuels pour un animal afin d’améliorer la précision, qui est particulièrement importante pour les jeunes animaux. Certains membres de l’Association américaine ont déjà testé des animaux avec le panneau de 50K et les résultats ont été mariés aux évaluations génétiques de juillet 2012. Lorsque que vous faites une recherche sur un animal par l’entremise du site web de AHA, les animaux démarqués avec un GE-EPD (EPD génétiquement amélioré), signifie que le calcul des EPD de ceux-ci a été assisté avec les résultats du panneau 50K. Ne vous alarmez pas par cette addition, car l’objectif est d’améliorer la précision, qui est la composante la plus importante de tout le rapport des EPD. Le Comité d’amélioration de race Hereford a également demandé au personnel de faire une recherche au sujet d’un test facultatif qui identifie le génotype polled homozygote ou hétérozygote. Ce test facultatif devrait être disponible aux membres début 2013. J’encourage tout membre qui souhaite discuter de la génomique de le faire avec notre personne bilingue. J’encourage aussi les membres en autant que possible d’assister à la réunion annuelle de l’association qui se tiendra jeudi le 22 novembre à 12hrs à l’Agribition. Nous aurons des nouvelles mises à jour à ce moment-là sur ces projets en cours.

93


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports O N TA R I O

By Ron Wells

ONTARIO HEREFORD ASSOCIATION SECRETARY/MANAGER

Secretary/Manager Ron Wells

I realize from the inquiries received into the office and as I travel our province, the interest in the Hereford breed continues to increase. The demand seems to be greatest coming from the commercial breeders sourcing a Hereford cow base. As input costs have

following year. To those who purchased genetics at these three events, you may feel a SHAKING for the rest of your Hereford life. Our appreciation goes out to River Valley, Elmlodge and Medonte Highlands and all consignors. These hosts afford the rest of our breeders

The ‘Ontario Hereford Weekend’ was the most successful ever with three great sales creating a STIR in Ontario and the Hereford breed, which will last for weeks and months to come carrying on into the following year. reached an all-time high this summer, the feed-efficient livestock take priority as well as other Hereford attributes that I hear cattlemen talking about such as “easy doin’ and easy handling”. There is a great potential for this breed to capture a much larger percentage of the market share in all segments of the beef production in Canada. Ontario continues to welcome new members to the Hereford breed and to our provincial association with seven new breeders since January and there are more anticipated before the end of the year. Over the past two years the membership has remained steady. Some early shows have already passed and all indications are that the Hereford breed will once again be very prominent. Several of our Mark of Excellence (MOE) Shows have one hundred head plus for entries. It is at these events that different genetics can be compared and marketing takes place. Thanks to the zone boards in the planning and execution of these great shows. The ‘Ontario Hereford Weekend’ was the most successful ever with three great sales creating a STIR in Ontario and the Hereford breed, which will last for weeks and months to come carrying on into the

94

an opportunity to purchase superior genetics and experience great food and fellowship in our own backyard. The next major event in Ontario will be the Royal Agricultural Winter Fair at Toronto with the Hereford shows to be held on November 2nd and 3rd, 201 2. Justin Morrison of Radville Saskatchewan will preside as judge of the open show. It is during that show that ‘The 2012 DREAMGIRLS EVENT’ will take place, to give you an opportunity to win a 2012 show heifer. In 2013, Ontario will be hosting the National Hereford Show at Toronto, so make your plans to show and attend this great venue. There is a special effort to make this National the greatest ever, with a major sponsor now in place and a committed committee already at work. Looking even further afield, the Canadian Hereford Association Annual General Meeting and CJHA Bonanza will be held in July, 2014, at Lindsay, Ontario. We look forward to seeing many of you at the fall events and wish you every success in your marketing programs.


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports MANITOBA

By Stephanie Kopeechuk Once again it is time to write a provincial report for the Hereford Digest. It seems like only yesterday that the last report was written. How time has flown by. Not much has happened since the last report. After the World Hereford

M A N ITO B A H ER EFO R D A S S O CIATI O N G EN ER A L M A N AG ER

two bus loads of international delegates and hosted 180 people to a roast beef supper. I hope that everyone that was in attendance got a chance to visit with the delegates from many different countries. It was very interesting to be able to sit down and chat with them. I only wish

stephan1@mts.net, or by mail. We have also introduced a new award this year - The Manitoba Hereford Association Ambassador Award. The criteria for this award are posted on the MHA website. We also invite nominations for this and they can also be sent to

The CHA staff must be commended for all their hard work to organize an event of this magnitude. Our breeders recognize this. We should all be very proud of what the Hereford breed has achieved this year. Conference and Post Tour everyone has been busy with finishing haying and combining was right behind. As of early September, most of the combining has been completed in our area with some flax still left. The last month has been very hot and dry with ideal conditions to complete the harvest. Those of you who attended the World Hereford Conference in Olds, Alberta, we congratulate you on your achievements. Some breeders traveled near and far to attend this event. The CHA staff must be commended for all their hard work

that we had more time to visit as I know myself that I missed talking to a few of them. Complete show results of the MHA Field Day are posted on the MHA website. As fall approaches, most breeders are now in the process of selecting their fall show string and sale offerings. Weaning time (my least favorite time of year), is soon upon us. Fall sale catalogues are filling our mailboxes. We wish everyone success in the fall production sales. The next biggest event for the MHA

The MHA is now seeking nominations for the 2012 Commercial Breeder of the Year. We have also introduced a new award this year - The Manitoba Hereford Association Ambassador Award. to organize an event of this magnitude. Our breeders recognize this. We should all be very proud of what the Hereford breed has achieved this year. The Post Conference Tour that was held in conjunction with the Manitoba Hereford Association Field Day and hosted by RSK Farms was also a great success. There were approximately 120 head entered with a Commercial Cow/Calf pen display included. We were pleased to be able to welcome

me. The MHA will soon be making the draw for the $500.00 gift certificate to be used by 4-H and Junior members showing a Hereford influence animal. The announcement will be made in time for these members to be able to purchase an animal in the upcoming fall sales. We wish the winner good luck with his or her purchase. Entry forms for the MHA 2012 Good As Gold Sale have been sent out and the deadline for this is soon approaching. The sale date is Thursday, December 6, 2012, at the Keystone Center. In closing, the MHA would like to wish everyone the best of success with their fall sales and shows.

is the Fall MOE Show, which is being held in conjunction with the Manitoba Livestock Expo with the Hereford show being held on November 3rd, 2012. We hope to see a large number of cattle entered this year and look forward to seeing everyone there. The MHA is now seeking nominations for the 2012 Commercial Breeder of the Year. If you know of anyone you would like to nominate for this award please send your nominations to me at

95


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports S A S K AT C H E WA N

By Marilyn Charlton

SA S K ATC H E WA N H ER EFO R D A S S O CIATI O N G EN ER A L M A N AG ER

The Saskatchewan Hereford Association again had a busy summer with the northwest and southeast areas of the province hosting their annual Field Days. Both of these events were very well attended and are important for our breed to continue to influence the commercial market in understanding the benefits of the Hereford breed in their operations. The Northwest Saskatchewan Hereford Club held its annual Field Day on August 2nd, hosted by the Houghams of Tomlyn Ranch, at Frenchman Butte, Sakatchewan. Judge for the day was Ryan Noble of Pieceland, Sk. Junior Champion Bull Calf Sponsored By: Richardson Pioneer, Marshall, Sk. • Carlrams 181U Lad 72Z - Carlrams Ranching Ltd., Cut Knife, Sk. Reserve Junior Champion Bull Calf Sponsored By: Sirrah Management Ltd., Cut Knife, Sk. • LLR 102T Super STD Lad 362Z - Lost Lake Ranch, Rich Lake, AB. Intermediate Champion Bull Calf Sponsored By: Weir Vet Services, Lloydminster, Sk. • Riverbridge 128S Lad 19Z - River Bridge Ranch, Maidstone, Sk. Reserve Intermediate Bull Calf Sponsored By: Paradise Hill Farm Supply, Paradise Hill, Sk. • WA 105W Zipper 83Z - Ayrey Hereford Farms, Evesham, Sk. Senior Champion Bull Calf Sponsored By: Keranda Industrial Supply, Maidstone, Sk. • Big-Gully 47R Stanmore 466Z - Big Gully Farm, Maidstone, Sk. Reserve Senior Champion Bull Calf Sponsored By: Cargil Animal Health • Big-Gully 517U Heavycrude 281Z - Big Gully Farm, Maidstone, Sk.

Grand Champion Bull Calf Sponsored By: Balog Auction Services Inc. & Tomlyn Ranch • Big-Gully 47R Stanmore 466Z - Big Gully Farm, Maidstone, Sk.

Reserve Grand Champion Bull Calf Sponsored By: Pfizer Animal Health • Riverbridge 128S Lad 19Z - River Bridge Ranch, Maidstone, Sk. 96

Champion Pen of 3 Heifer Calves Sponsored By: Sky Track Ranch, Lloydminster, Sk. • Bannerlane Herefords, Livelong, Sk. Champion Pen of 3 Bred Heifers Sponsored By: Misty Valley farms, Maidstone, Sk. • Lost Lake Ranch, Rich Lake, Sk. Champion Yearling Bull Sponsored By: Big Gully Farm, Maidstone, Sk. • FE 152S Frontline 208Y - Fenton Ranch, Irma, AB. The Field Day also featured the Northwest Saskatchewan Hereford Club Honor Roll that recognizes purebred and commercial breeders for their continued support of the Hereford industry. The 2012 inductees were:

Purebred Breeders of the Year - Buddy Leachman - Greg Ramsay

-

Commercial Breeder of the Year Diamond J Cattle Co.

-

2012 Young Gun Award Carl Ramsay

The club also honored Raymond Bygrove who stepped down as Secretary/ Treasurer of club after 36 years. Our thanks Raymond for your dedication to the club your wisdom and talents will be greatly missed! Special thanks to Tom and Marilyn Hougham and family for hosting the day and providing such great hospitality!


C A N A D I A N

The Southeast Hereford zone held its Mark of Excellence Field Day on August 11th at the Brooks Farm, Alameda, Saskatchewan. A three-person judging team consisted of Heather Brokenshire, Bienfait, Sk., Howard Crittenden, Imperial, Sk., and Riley Lafrentz, Beinfait, Results of the day’s events are: Junior Champion Heifer Calf • ANL 425X Corey 49W 38Z - ANL Polled Herefords, Steelman, Sk. Reserve Junior Champion Heifer Calf • ANL D & M 8203 Mindy 76S ET 37Z - ANL Polled Herefords Senior Champion Heifer Calf • ANL GG 521X Pebbles ET 3X 18Z - ANL Polled Herefords Reserve Senior Champion Heifer Calf • MA 18W Tammy 21X 1Z - Meadow-Acres Farm, Lampman, Sk. Champion Heifer Calf • ANL GG 521X Pebbles ET 3X 18Z - ANL Polled Herefords Reserve Champion Heifer Calf • ANL 425X Corey 49W 38Z – ANL Polled Herefords Champion Bred Heifer • Glenlees 1015 Libby 21Y - Glenlees Farm, Arcola, Sk. Reserve Champion Bred Heifer • S7R She’s A Cutie 702Y - Section 7 Ranch, Rocanville, Sk.

Junior Champion Bull Calf • Glenlees 7101 Pay Day 31Z - Glenlees Farm, Arcola, Sk. Reserve Junior Champion Bull Calf • ANL 719T Victor 92R ET 56Z - ANL Polled Herefords, Steelman, Sk. Senior Champion Bull Calf • Leveldale Victory 719T 7Z - Leveldale Polled Herefords, Douglas, MB Reserve Senior Champion Bull Calf • Leveldale Bad Company 4R 17Z - Leveldale Polled Herefords

D I G E S T

Grand Champion Bull Calf • Leveldale Victory 719T 7Z - Leveldale Polled Herefords, Douglas, MB Reserve Grand Champion Bull Calf • Leveldale Bad Company 4R 17Z - Leveldale Polled Herefords Champion Cow/Calf Pair • ANL 7R Corey 49W - ANL Polled Herefords Reserve Champion Cow/Calf Pair • Leveldale Wildcat 5T 28W - Leveldale Polled Herefords Get of Sire: Meadow-Acres Farms, Lampman, Sk.

• Grand Champion Female • ANL GG 521X Pebbles 3X 18Z - ANL Polled Herefords, Steelman, Sk. Reserve Grand Champion Female • ANL 425X Corey 49W 38Z - ANL Polled Herefords, Steelman, Sk.

H E R E F O R D

Premier Breeder & Premier Exhibitor ANL Polled Herefords, Steelman, Sk.

Thanks to the sponsors for their generous support: Alameda Agencies Prairie Petro Chem Norquay Auction Services Nelson Motors Prairie Pride Credit Union Feedrite Moose Creek Trucking Magnascope Champion Technologies Alameda Co-op Arthur Polled Herefords Baker Petro Lite K & D Young Farms Thank you to Brooks Farm for hosting the MOE Field Day!

97


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports A L B E R TA

By Leonard Poholka A L B ER TA H ER EFO R D A S S O CIATI O N PR E SI D EN T & Michele Rutledge A L B ER TA H ER EFO R D A S S O CIATI O N M A N AG ER President Leonard Poholka Manager Michele Rutledge

A message from the new AHA President, Leonard Poholka It was uplifting to witness and take part in the World Hereford Conference (WHC) events at Olds this past summer. I wish I could have taken in the entire conference and tours. It is terrific to see that so many people from around the world and across Canada are so passionate and enthusiastic about Hereford cattle. I was almost 6 years old when my family took part in a post-conference

Canadian beef industry, as well as the many more years of people jumping on the bandwagon of other breeds, can certainly be thankful for the return of our breed’s popularity and be very proud of our resilience. I look forward to serving and representing Alberta breeders as your President over the next two years. When you see me at an event please stop to talk to me about our Association and Herefords. Thank you to the board members for giving me your vote of

Those of us who made it through the last decade of hard times for the whole Canadian beef industry, as well as the many more years of people jumping on the bandwagon of other breeds, can certainly be thankful for the return of our breed’s popularity and be very proud of our resilience. tour in 1976. I can remember being at McIntyre Ranch in southern Alberta and seeing huge numbers of Herefords on the range. The heat and the dust from the convoy of vehicles on the dirt road are vivid memories. I wonder how many kids that experienced the 2012 WHC will be at the next one held in Canada. I hope many of them will still be involved with our breed. There is obviously an increased interest in and demand for Hereford bulls and females here in Alberta. The export demand is also a very welcome boost for breeders. The future certainly looks good for being a Hereford breeder. Those of us who made it through the last decade of hard times for the whole

confidence. We look forward to working with our members to promote Alberta Herefords any way we can. Our AHA Manager, Michele has been working for us for 10 years now. Please thank her for her dedication when you get the chance. I would like to thank Gordon Klein and Kolby Heaven who have left the AHA Board of Directors and welcome Wilf Edgar and Jaime Lutz as new directors. Your new AHA Vice-President is Blair Fenton with Scott Harvie serving as Executive Director.

Managers Report Planning for the fifth annual Hereford Genes Event is well underway with Al Fenton once again at the helm. Don’t miss out on this opportunity to network and socialize with fellow Hereford breeders and commercial cattlemen. Breeders who consign to this event will invite five of their own customers (ten people) to be their guests for a beef supper and the final night of the Ranch Rodeo where a draw will take place among these guests to win a bull of their choice. The owner of the chosen bull receives $8,000. Also included is the chance to vote for the Rancher’s Choice Bull. Last year the Rancher’s Choice Bull consignor received $1,500. This event generates a lot of traffic through the barns and pulls a large crowd of qualified buyers to a central location. We invite you to get in on the action. The Hereford Genes Event is looking for consignors, sponsors and the donation of door prizes. For more information contact Al Fenton at (780) 754-2384 or (780) 842-7806 (cell). The Hereford Genes Event takes place Tuesday, November 6 followed by the open Hereford Show on Wednesday, November 7.

President: Leonard Poholka Manager: Michele Rutledge Box 325 Breton, AB T0C 0P0 Box 570 Hardisty, AB T0B 1V0 Cell (780) 898-9590 Fax (780) 696-3777 Ph (780) 888-2813 Fax (780) 888-2814 Email: bretonwest@gmail.com Email: abherefords@xplornet.com Website: www.albertaherefords.com 98


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports

The Northern Alberta Hereford Club Hardisty Field Day was again another huge success. It was held on August 18th at the Hardisty Rodeo Grounds. Judge Steve Upham, from Spedden, AB evaluated the record-breaking number of 197 bull calves. The 16th Annual Hardisty Field Day continues to grow each year, holding on to its reign as the largest bull calf futurity in Canada. The crowd was great and following the show they handed in their ballots on the nearly 30 pens of heifers that were on display. The Northern Alberta Hereford Club then hosted a supper and refreshments for all to enjoy. This field day wouldn’t have been possible without the sponsors. A huge thank you goes out to Balog Auction, Hardisty Bulk Sales, Killam Feed and Farm & Hi-Pro Feeds, and the Wainwright Credit Union, Hardisty Branch. Also, each year a donation heifer is auctioned to raise money for the NAHC and this year the heifer was donated by Gary Seutter/Tanga Herefords of Millet, AB. A very special thank you to them for the heifer. Novice Champion • SGC 42W SUPER RED LAD 123Z - Crone Herefords, Hardisty, AB Novice Reserve Champion • SGC 42W SUPER RED STD 105Z - Crone Herefords, Hardisty, AB Junior Champion • RIVERBRIDGE 943W LAD 42Z - River Bridge Ranch, Maidstone, SK Junior Reserve Champion • LLR 102T SUPER STD LAD 362Z - Lost Lake Ranch, Rich Lake, AB Intermediate Champion • LPG DON LANDLORD LAD 32Z - Little Poplar Grove, Forestburg, AB Intermediate Reserve Champion • LBH 105X JP GALAXY 299Z - Michelle Schuepbach, Claresholm, AB Senior Champion • LAMPORTS 23X TRIPLE CROWN 91Z - Lamport’s Herefords, Rockyview County, AB Senior Reserve Champion • YV 915W ZOOM 9Z - YV Ranch, Airdrie, AB

Champion Pen of Three Heifers • Bar-RZ Polled Herefords, Fort Macleod, AB

Grand Champion • LAMPORTS 23X TRIPLE CROWN 91Z - Lamport’s Herefords, Rockyview County, AB

Reserve Grand Champion • YV 915W ZOOM 9Z - YV Ranch, Airdrie, AB

99


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports BRITISH COLUMBIA

By Bob Gowans PR E SI D EN T O F T H E B C H ER EFO R D A S S O CIATI O N The Salmon Arm Fair and Hereford MOE Show took place from September 7th-9th where the BCHA once again held its AGM at the Podollan Inn, Salmon Arm. CHA General Manager Gordon Stephenson was in attendance, and he and CHA director Daryl Kirton brought the membership up-to-date regarding happenings within the CHA. Daryl congratulated Gordon on the success of the recent World Hereford Conference and acknowledged the time and

Next year’s AGM will be hosted by the Yellowhead Hereford Breeders in conjunction with the Williams Lake Bull Sale, on April 17th, 2013. commitment of CHA staff and the committees involved, to accomplish this success. A banquet and fundraiser auction was held in the Sun Wave Arena in Salmon Arm where great food and Hereford camaraderie were enjoyed by all. Next year’s AGM will be hosted by the Yellowhead Hereford Breeders in conjunction with the Williams Lake Bull Sale, on April 17th 2013. The new executive committee for the BCHA is as follows: President and CHA director Daryl Kirton Vice President Murray Gore Secretary Darlene Borrow Treasurer Vic Redekop Past President Bob Gowans Catherine Brown from Copper Creek Ranch is our new BCJHA adult adviser. Thanks to Catherine and assistant adult adviser John Lewis for taking this on. Hopefully we will see more BC Juniors getting involved in the program. Also, thanks to Heather Fisher LeBlanc and Cayley Brown for being our Junior representitives to the National Council. Darlene Borrow continues to do quarterly newsletters to keep the membership up to date with Hereford news. The new Breeder Directory was printed in time for the WHC and will be made available at auction marts throughout BC. Vic and Judy Redekop deserve credit for putting the directory together. Dena Finlay of Finlay Farms is in charge of the BCHA’s role in recognizing 4-H boys and girls showing Hereford and Hereford-Influence steers and heifers.

100

Our BCHA website was designed and is maintained by Don Richardson. A huge thank you to those mentioned above. Your time and efforts are very much appreciated. The Bonaza Legacy Fund has been set up and will be administered through the CHA. The 2009 Bonanza Junior Hereford Show was hosted by the BCHA and BCJHA and was held at Copper Creek Ranch in Princeton, BC. Surplus funds from this event have been invested and will be drawn down each year as start-up money to each respective province hosting Bonanza. The Stevenson family of Copper Creek Ranch has generously pledged to donate matching funds to the Canadian Junior Hereford Association to also be used for future Bonanza Shows. When this report is published, the 3rd annual Richardson Online Sale will have taken place from September 12th to the 17th and the annual Pacific International All-Breed Female Sale on September 29th, at the Williams Lake Stock Yards, willl be over. The Provincial Winter Fair is being held in Barrier from September 21st to 24th. 4-H members winning with Hereford or Hereford Influence animals are as follows: Comox Valley Fall Fair: Champion Bull Calf - Logan Cullen Reserve Champion Bull Calf - Hope Lewis Champion Heifer Calf- Hope Lewis Reserve Champion Bred Heifer - Hope Lewis Okanagan 4-H Stock Show: Best Hereford Female - Katie Hudson Best Hereford Steer - Ashleigh Ringdal Williams Lake Stock Show and Sale: Best Hereford Female - Carman Kaufman Best Hereford Steer and Reserve Champion - Nathan Rymer Pacific National Exhibition: Best Hereford Influence Steer - Tyson Boyes As my term as President has come to an end, I would like to thank the BCHA Board of Directors for its dedication and commitment to the Hereford breed. With the World Hereford Conference just over, it is very evident that worldwide demand for Hereford genetics will continue to position the breed a leader in beef production. I appreciate having had the opportunity to express my views with regards to Herefords and the beef industry in general. Thank you, and God bless.


C A N A D I A N

H E R E F O R D

D I G E S T

provincial reports C A N A D I A N J U N I O R H E R E F O R D A S S O C I AT I O N

By Amy Troop Hello Everyone! I am extremely honored to be the new serving president of the Canadian Junior Hereford Association (CJHA). Herefords have always played a part in my family history and I am so excited to represent this wonderful breed in the best way I possibly can. I attended my first Bonanza in 2008, sitting in as a delegate in the annual meetings. I knew then that the junior board was somewhere I wanted to be in my near future. The following years I sat on the board and represented both Manitoba and Canada, following closely and listening to the great presidents that came before me. It is now the last year of my eligibility for being a junior and I am ready to accept the challenge of being president.

C J H A PR E SI D EN T

Another project that wrapped up at World Hereford Conference was the CJHA auction. Thank you to everyone who supported and donated to both the Heifer Lottery and the Auction. Once updates are made to the website we will have a complete list of supporters for both the Heifer lottery and the Auction, at http://www.hereford.ca/ projects.asp . Two of our projects will be wrapping up shortly: the Semen Donation and the CJHA Calendar. If you would like to participate and have not yet been contacted, please contact your National Delegates as soon as possible. Contact information is available on the Hereford Association Website link Contacts. Congratulations are in order for a few of our junior members. First of

Manitoba. All Dreams Lead to Bonanza 2013, July 29th to August 4th. I look forward to seeing you there! If you have any questions, ideas, or suggestions, we would love to hear them! Feel free to contact me or our national delegates. All of our contact information is available on the Hereford Association website.

I would like to send out another huge thank you to all the supporters of the Junior Association, and extend an invitation to Bonanza 2013 in Brandon Manitoba. All Dreams Lead to Bonanza 2013, July 29th to August 4th. I would like to extend many thanks to all of the volunteers for making the World Hereford Conference a success this year. It was incredible to be able to attend such a well-organized event. Thank you to the sponsors, exhibitors, judges and everyone else who took part in the WHC. The CJHA projects were another big success this year. This year our heifer lottery was able to get 41 sanctioned sales, allowing us to have five draws which were made at the World Hereford Conference. Just a reminder that this year the Heifer Lottery changed a little bit. It has now opened up to apply to the purchase of ALL females: calf, yearling, and pairs.

all, to the two inductees to the CJHA Honour Roll, Hal Nixdorff of Alberta, and Meghan Black of the Maritimes. This award recognizes their outstanding involvement through the CJHA and the Hereford Industr y. A second congratulations goes out to the recipients of the Future of the Breeds Scholarship award: Danielle Cavanagh of Ontario, Adam Nixdorff of Alberta, Hal Nixdorff of Alberta, and Meghan Black of the Maritimes. Applications are available at www.hereford.ca. I strongly encouraged eligible members to apply. I would like to send out another huge thank you to all the supporters of the Junior Association, and extend an invitation to Bonanza 2013 in Brandon

101


C A N A D I A N

H E R E F O R D

D I G E S T

Hereford Farewells Dolores Lavonne Ochs July 11, 1930 – August 5, 2012 With regret, the Canadian Hereford Association announces the passing of Doloress (Dee) Ochs. Dolores Lavonne Ochs was on born July 11th, 1930, the first child of Elmer and Lena Mausolf at Larned, Kansas. She completed her life on earth August 5th, 2012 and is now in heaven with her Lord and Savior Jesus Christ and her earlier departed family and friends. Dee and Ken were married upon their graduations from University on June 12th, 1952. Shortly after their marriage, Ken was called to active duty in the U.S. Army. Their first child, Cecilia, was born at Fort Riley, Kansas in 1954 during their Army service. They moved to Colorado Spring in 1956 to join Ken’s brothers in a business venture. Brad was born in 1957. Amy followed in 1963. Dee was a steadfast wife, mother and homemaker. She resided at the home that she and Ken purchased on Parkview Boulevard for fifty-six years. Dee was involved in activities at the First United Methodist Church. She was a member of the Junior League of Colorado Springs and served that organization for many years - particularly the Memorial Hospital. Dee assisted with the Hearing Program for newborn babies, which was implemented at Memorial with the help of the Junior League. The Debutant Ball also received her services. Dee was very outgoing with people. She was one of the best when it came to helping and caring for family and friends. Dee and Ken naturally complemented each other during a marriage that lasted fifty-seven years until Ken’s death in September 2009. Dee was preceded in death by her parents Elmer and Lena Mausolf, her husband Ken Ochs, her daughter Cecilia Ochs and her sister and brother-in-law Joan and Glen Cooper. She is survived by her step-mother Alberta Kraus, her son Brad (Kristin) and their children Susi Bracewell (Ryan) and greatgrandsons (Ryder and Chance), Wes and Mike Ochs, her daughter Amy Ochs (Don Johnson) and their children Nicole Schnapp (Ryan), Daniel Montoya (Coral Thompson) and great-grandchildren (Braydan and Avery), Jordan, Maty and Molly Montoya, Garrett and Eric Johnson and other close family members and friends.

Jane Susan Westerlund June 22, 1956—August 18, 2012 The Canadian Hereford Association regrets to announce that Jane Susan Westerlund passed away peacefully at the Oyen Hospital, with her family by her side, on August 18th, 2012, after bravely battling cancer for the past four and a half years. She was born to David and Betty Gullickson on June 22nd, 1956, in Seattle, Washington and spent most of her younger years with “Mom and Pop” (Peggy and Ray) Gullickson. Jane attended grade school and graduated from high school in Seattle. While in school, she was a Jobs Daughter, learned to sew and always looked out for younger brother Dave. It was while visiting relatives near Oyen, Alberta, and taking part in a trail ride, that she first encountered the big smile of a young cowboy – Terry Westerlund. She moved to Alberta to attend Mount Royal College in 1975 and she and Terry married later that year. Jane adapted well to the ranching world on the prairies, soon taking part in everything from branding calves, feeding and moving cows, to TaekwonDo, gardening, canning, baking and making ice cream and butter. Once her children were grown, Jane worked at the Big Country Hospital in Oyen for over 10 years. She was also an assistant at Prairie House Kitchens on a part-time basis for 20 years. Jane enjoyed ceramics and developed an amazing talent for quilting, creating everything from placemats and wall hangings to king size bed covers. Jane was diagnosed with Ovarian Cancer in February 2008 – the beginning of a battle in which she consistently dodged mine fields and surpassed medical expectations. Her attitude was not only to survive but to live life to the fullest which she was able to do until just recently. Jane is survived by the love of her life and soul mate Terry; daughters Janie (Wes) Comstock and Pam (Darcy) Gorgichuk; son Terry (Liz) Westerlund; grandchildren Roper & Laycee Gorgichuk, Colt & Ruger Comstock and Emma, Douglas & Warren Westerlund; brothers David (Tammy), Daniel (LaVonne) & Mike (Michelle) Gullickson; sister Donna Lambert; step-mom Shirley Gullickson; mother-inlaw Joyce Westerlund; in-laws Tim (Dianne)Westerlund, Clay (Sharon) Westerlund, and Kathy (Darren) Simpson, plus a number of nieces and nephews. She was pre-deceased by her biological parents David and Betty Gullickson; Mom (Peggy) and Pop (Raymond) Gullickson; brother Richard Cash; and father-in-law Doug Westerlund.

102


C A N A D I A N

H E R E F O R D

D I G E S T

Florence Frances Conway August 2, 1927 – September 16, 2012 It is with regret that the Canadian Hereford Association announces the passing of MRS. FLORENCE FRANCES CONWAY, beloved wife of the late James Albert Conway of Lethbridge, formerly of Milk River. Florence passed away at the Peter Lougheed Hospital in Calgary, AB, on Sunday, September 16th, 2012, at the age of 85 years. She is the loving mother of Roxanne (Keith) Thompson of Claresholm, Wade (Lorna) Conway of Foremost, Boyd (Patsy) Conway of Coaldale, Layne (Donna) Conway of Milk River and Troy (Chrissy) Conway of Spruce View and 14 grandchildren - Quinn Thompson; Kristin (J.R.) Wiltshire, Mason and Shannon Conway; Sara Conway (Brad Thompson), Owen, Kyla and Halli Conway; Logan, Dilan and Dayne Conway; Carter, Grady and Lucas Conway; two great grandchildren, Nate Conway and Briar Thompson. She is also survived by a sister-in-law Madeline “Wutzke” (Jerry) Smith and numerous nieces and nephews. She was predeceased by her husband Albert, brothers Fred “Fritz” Wutzke and his wife Flora and John Wutzke. Florence was born August 2nd, 1927, in Skiff, AB - the oldest child of Fred & Edna Wutzke. She was raised on the family farm and attended school in Skiff from Grade 1-10. She lived with her grandparents while attending Barrhill School for 2 years and completed her final year of Grade 12 in Foremost. In 1948, she moved to Lucky Strike where she accepted a teaching position. It was there she met Albert and they were married December 12th, 1951. It was on their family farm where they raised their five children. Florence was a hard working farm wife and mother who loved her garden, canning and cooking for friends & family. Florence was one of the founding members of the Lucky Strike Community Club, a lifetime member of the Foremost Royal Purple and an active member of the Milk River C.W.L.. She was formally recognized for her ongoing commitment for canvassing for the Canadian Cancer Society. In 1989, Florence and Albert retired and moved to Milk River. During her retirement, Florence took great pride in her flowers, baking, ceramics and playing cards. Some of her great loves included watching sports (hockey, curling, baseball and rodeo) and attending her children’s and grandchildren’ events. She was a devoted wife, mother, grandmother and great grandmother and will be deeply missed.

A True Hereford Friend and Digest Legend. You will never be forgotten “Eddie” James Edward Jupp 1926 - 2012 The Canadian Hereford Association regrets to announce that James Edward Jupp passed away peacefully on Saturday September 8th at the age of 86 . He is survived by his wife Lynn, daughter Jill and her husband James Taylor, and two grandsons, Justin and Michael, who were the apple of Grandpa’s eye. At the encouragement of two mates from England who were working at the Lee’s Bros. in Arcola Saskatchewan, Edward immigrated to Canada in June of 1953. He ended up working for the late Walter Olson and Margaret Olson at Arcola. The Olson boys, Elmer and Allen remark to this day, what a positive influence Edward had on their lives It was during his tenure with the Olsons, that Edward established a reputation that would earn him respect in the Hereford industry. Keith Gilmore, publisher of the Canadian Hereford Digest (CHD) was quick to recognize the work ethic, punctuality and integrity of this young man, that would establish a relationship that spanned two and a half decades. After visiting the Wolfe Hereford sale in Walla Walla Oregon with Edward in tow, Keith turned him loose to act as the Fieldman for the CHD in Saskatchewan, Manitoba, Central Canada and the Maritimes. So much for on-the-job training. During his travels, Edward established friendships that lasted throughout his life. Quick to offer an opinion on a variety of topics, Edward’s advice was based on experience of “walking his talk”. Edward mentored many young breeders in the Hereford industry on a variety of subjects, including economics, marketing and more importantly advice on how to look after their money once they had earned it. In their retirement years, Edward and Lynn moved to Sherwood Park, Alberta to be closer to their daughter and grandchildren. Edward enjoyed gardening and visits with the grandsons. In lieu of flowers, you are encouraged to make a donation to the Keith Gilmore Foundation or a Charity of your choice. 103


C A N A D I A N

H E R E F O R D

D I G E S T

4-H achievements Featuring successful Hereford and Hereford Influence projects Send your results to erin@hereford.ca

104

Grand Champion Steer of the Chilliwack 4-H Beef Club and was a blue ribbon steer at the PNE Exhibited by: Cole Flokstra Club: Chilliwack 4-H Beef Club, British Columbia

Reserve Club Champion with her three year old cow/calf pair Exhibited by: Cassandra Rasmussen Club: Prairie Partners 4-H Club, Alberta

Reserve Club Champion with her two year old cow/calf pair Exhibited by: Stephanie Rasmussen Club: Prairie Partners 4-H Club, Alberta

1st Cow/calf class with his Hereford cow/ calf at Saskatchewan NE Regional 4-H Achievement Exhibited by: Taryn Heidecker Club: Three Lakes 4-H Beef Club, Saskatchewan

1st Hereford Heifer class at Saskatchewan NE Regional 4-H Achievement Exhibited by: Makenna Heidecker Club: Three Lakes 4-H Beef Club, Saskatchewan

1st Hereford steer class & 1st in heaviest weight class at Saskatchewan NE Regional 4-H Achievement Exhibited by: Morgan Heidecker Club: Three Lakes 4-H Beef Club, Saskatchewan

Reserve Champion Steer at the Oak Lake 4-H Beef Club Achievement Day Exhibited by: Jay Rimke Club: Oak Lake 4-H Club, Manitoba

Champion 2 year old and calf at Oak Lake 4-H Achievement Exhibited by: Samantha Rimke Club: Oak Lake 4-H Club, Manitoba

Champion Yearling Heifer at Oak Lake 4-H Achievement Exhibited by: Samantha Rimke Club: Oak Lake 4-H Club, Manitoba


C A N A D I A N

H E R E F O R D

D I G E S T

Reserve Champion Female at Manitoba Youth Beef Round-Up at Neepawa, MB Exhibited by: Levi Rimke Club: Oak Lake 4-H Club, Manitoba

Champion Hereford Female at Manitoba Youth Beef Round up Exhibited by: Levi Rimke Club: Oak Lake 4-H Club, Manitoba

Reserve Intermediate Showperson at Manitoba Youth Beef Round-up Exhibited by: Samantha Rimke Club: Oak Lake 4-H Club, Manitoba

Reserve Champion of the Nebraska Multi 4-H Beef Club and best Rate of Gain at the Club and District Level Exhibited by: Kyle Knight Club: Lacombe 4-H Beef Club, Alberta

Winner of their middle weight class at the Saskatoon Prairieland Ag Showcase Exhibited by: Morgan Millham Club: Saskatoon 4-H Beef Club, Sasktachewan

Champion Hereford Heifer at the Saskatoon Prairieland Ag Showcase Exhibited by: Morgan Millham Club: Saskatoon 4-H Beef Club, Sasktachewan

Champion Bull Calf, Comox Valley Fall Fair Exhibited by: Logan Cullen Club: Comox Valley 4H Calf Club, British Columbia

Reserve Champion Bull Calf, Comox Valley Fall Fair Exhibited by: Hope Lewis Club: Comox Valley 4H Calf Club, British Columbia

Reserve Champion Bred Heifer and Showman, Comox Valley Fall Fair Exhibited by: Hope Lewis Club: Comox Valley 4H Calf Club, British Columbia

Champion Heifer Calf, Comox Valley Fall Fair Exhibited by: Hope Lewis Club: Comox Valley 4H Calf Club, British Columbia

Best Hereford Steer at the Okanagan 4-H Stock Show Exhibited by: Ashleigh Ringdal

Grand Champion Cow/Calf Pair at both Serath Multiple 4-H Club Achievement Day and Parkland Regional Show and Sale. Overall Reserve Supreme female at Parkland Regional Show and Sale Exhibited by: Kayla Hordos Club: Serath Multi 4-H Club, Saskatchewan

105


C A N A D I A N

H E R E F O R D

D I G E S T

IT’S WOMAN’S WORK

You don’t have to hang around the cattle business long to realize how many women are running their own farms or ranches. Often they are widows who have taken over the operation with the help of their children and made it work. More recently, these women-farmers are daughters who have come home after schooling and become part of the family team. And there are occasions when women decide on the occupation and buy their own place. In today’s world nobody questions a woman’s ability to run the ranch. If your community has an FFA chapter you can see the preponderance of young women in leadership positions, fully supported by both mom and dad. These girls are taken seriously as future leaders in agriculture. Universities around the nation are filled with women majoring in agricultural fields. They are officers in the Block & Bridle, Alpha Zeta, the Young Farmers and Ranchers, and the Horseman’s club. They are on the judging teams, getting post-graduate degrees in animal science, range science, agriculture, environmental resources and agronomy. They compete on level ground with men. At major veterinary schools that still emphasize food animal medicine, the women out-number the men four to one. I spoke at the Pfizer Ohio State Food Animal Vet Student Symposium last spring. It was attended by vet students from California Western to Cornell, from Michigan State to Louisiana State across the country, all of them interested in livestock and 80% of them women. In the last census in Canada and the USA, it showed the number of farms and ranches owned and operated by women continues to rise. Operations in this category amount to 14%. One in seven outfits is managed by a woman. As we all know, many farms and ranches are operated by the team of husband and wife, yet their outfit is listed as a partnership with the man’s name first. To the banker, loan officer, census taker and USDA, it is considered to be managed by the man. But…how many times have you heard some rancher or farmer introduce his wife as, “…this is my wife, she does the books.” I do it myself! I can’t tell you what my electric bill is, or if the plates on my trucks are up to date, how much money we have in the bank, who insures the shop, how I’m deducting the 4-wheeler, who we still owe money to, if our kids are coming home for Thanksgiving or when I last had a dental appointment. But she can, so I don’t worry. I have more important things to do; fix the brakes on the one-ton, change the hot-wire around the house lot, grade the gravel driveway, shoe the horses, find the missing heifer, fix the water line to the middle drinkers, get the waterer ready for winter, repair the alley gate in the corral, catch Cattlemen to Cattlemen on RFD-TV (I consider it continuing education) and find a 5/16 nut for the float arm. I’m on the job doin’ Man’s Work. I remember being so busy one time that I asked my wife if we could afford a hired man. She said, “What are you talkin’ about? I’ve already got a good one!”

106

www.baxterblack.com


C A N A D I A N

quick reference

H E R E F O R D

D I G E S T

Maximum exposure with an audience that matters. A quick reference ad in every issue of The Hereford Digest for only

$

25000

To place an ad in The Canadian Hereford Digest, call 1-888-836-7242 or visit our website at www.hereford.ca   Andy  Schuepbach Ph:  (403)  625-­4693 Fax:  (403)  625-­1500 Cell  (403)  625-­6316

Daryl & Linda Kirton 30018 Townshipline Rd. Abbotsford BC V4X 1Z4

Hans  Ulrich Ph:  (403)  625-­2237 Box  2044 Claresholm,  AB   T0L  0T0

3-D-L Polled Herefords Email: 3-d-l@telus.net Website: www.3-d-l.com Phone: (604) 856-5755 Fax: (604) 856-5749 BRITISH COLUMBIA

3UDFWLFDO(IÂżFLHQW&DWWOHDUHRXU/LYHOLKRRG andy@lilybrookherefords.com www.lilybrookherefords.com

LITTLE RED DEER HEREFORD FARM â&#x20AC;&#x153;Legendary Hereford Progenyâ&#x20AC;?

Maximum exposure with an audience that matters. A quick reference ad in every issue of The Hereford Digest for only

George  Edgar   Wilf  Edgar (403)  227-­2392   (403)  227-­4541 R.R. 3, Site 5, Box 2, Innisfail, Alberta T4G 1T8

250

$

00

2 mi. South, 4 1/2 mi. West, 1 mi. North of Innisfail

AIRDRIE, ALBERTA, CANADA T4A 0P7 Fax: (430) 226-4873 Gladys Allen & Shanna (403) 226-0055 (403) 226-0767 RR#3, Site 12, Comp 18 RR#3, Site 12, Comp 17 (PDLODVMRQHV#HĂ&#x20AC;UHKRVHQHW

Lakeford  Polled  Herefords Dave and Jean Prichard Dan & Shelley Prichard Ph 780-385-2226 Kaylee, Amber & Erin Fax (780) 385-2298 Ph 780-385-2298 Cell (780) 385-5125

  TERI   MANNING  &  WOODY  KUMPULA Phone  (780)  623-­â&#x20AC;?7468        Cell  (780)  689-­â&#x20AC;?6606 Box  27,  Site  5,  Rich  Lake,  AB    T0A  2Z0 80  km  NW  of  St.  Paul  or  50  km  SE  of  Lac  La  Biche ALBERTA

ALBERTA

Breeders of Quality Hereford Cattle Since 1905

Gerry  Hutton Ph/Fax  (403)  631-­3734 Cell  (403)  566-­5222 Mack  Hutton Box  13,   Ph  (403)  631-­2410  (messages) Torrington,  AB Cell  (403)  507-­3018 T0M  2B0

Box 394, Killam, Alberta T0B 2L0

Email: lakeford@xplornet.com

ALBERTA

Lamportâ&#x20AC;&#x2122;s Polled Herefords WE OFFER AN OUTCROSS ADVANTAGE

Brad & Kathy Dallas Ph.:(403) 224-2162 Fax: (403) 224-3738 Box 89, Bowden, Alta. T0M 0K0 1/4 mile East of Bowden underpass on #587

ULTON  HEREFORDS Carstairs, Alberta

Dwayne/Shannon Ph: 403-337-2890 Fax: 403-337-8607 Email: dsfulton@airenet.com

John/Sharon Ph: 403-337-2095

Yearling and two-year-old bulls for sale selected for carcass superiority.

Bill Lamport Brad Lamport 403-226-0345 403-226-0450 Balzac, AB www.lamportspolledherefords.com

Polled Herefords â&#x20AC;&#x153;Reg. Cattle Since 1952â&#x20AC;?

Evan Roberts Farm 780-349-2086 Cell 780-206-6802 Box 5279, Westlock, Alberta T7P 2P4 Located 1 mile North of Westlock on Hwy. 44

Do e nz Ranc h e s Annual Sale: November 15, 2012 E-mail: doenzranches@gmail.com www.doenzranches.net

Nelson & Paula Doenz: Phone: (403) 642-2380 Fax: (403) 642-2471 Brad & Veronica Doenz: (403) 642-7694 PO Box 362, Warner, AB T0K 2L0 3.2 km E of Warner on #504 & 3.2 km N on Rg #170

Dennis & Andrea Babiuk Phone: (780) 657-2270 Cell: (780) 603-1079 Box 102 Fax: (780) 657-2778 Brosseau, AB Email ncx@xplornet.ca T0B 0P0 Quality Cattle For Sale At All Times

107


C A N A D I A N

H E R E F O R D

D I G E S T

HerefordsThatWork.com

REGISTERED  COMMERCIAL  HORNED  HEREFORDS

Box  25,  Landis,  SK  S0K  2K0 Email:  grltd@yourlink.ca

J

â&#x20AC;&#x153;Herefordsâ&#x20AC;?

s

Balzac,  Alberta  T0M  0E0 (403)  226-­â&#x20AC;?â&#x20AC;&#x2018;0200                            (403)  226-­â&#x20AC;?â&#x20AC;&#x2018;0623

9  1/2  km  E.  of  Balzac  interchange  on  Hwy.  #2  &  1  km  N.

Quality  Breeding  Stock 613-­623-­7948

Wes,  Bernie,  Dustin,  Cody  &  Austin Phone:  (306)  658-­4535 Cell:  (306)  948-­9663

Lyons Polled Herefords William & Audrey Lyons 10893 Mill Rd. RR7 St. Thomas, ON N5P 3T2

Horned  Hereford Black  Angus Black  Baldie  Heifers

Web  Site:  www.lockfarms.com

ONTARIO

 S.  Jones  &  Sons

SASK ATCHEWAN

Verne    (306)  658-­2022 Bill  &  Luke    (306)  658-­4750

Phone: 519-764-9560 Cell: 519-639-8991

Fax: 519-764-9615 Email: ablyons@amtelecom.net

(PDLOVFRWDOWD#WHOXVQHWÂ&#x2021;ZZZKHUHIRUGEUHHGHUFRP

Don,  Diane  Guilford  &  Family

Clearwater,  MB        (204)  873-­2430 REG.  BLACK  ANGUS  &  POLLED  HEREFORDS

FERME QUEBEC

Jim & Shirley Scott 3KRQH  Â&#x2021;)D[   R.R. #4, Red Deer, AB T4N 5E4

MANITOBA

ALBERTA

ScottPolled Alta Farms Herefords

Wayne & Mary Skelton &Family %%%#$ $$ !& 

 '       %#$  #$"# 

MARITIMES

Paul (403) 935-4334 Fax (403) 948-3300

ONTARIO

ULRICH  

HEREFORD  RANCH  INC.

â&#x20AC;&#x153;Performance Tested Herefordsâ&#x20AC;? Hans Ulrich Peter Ulrich (403) 625-2237 Ph/Fax (403) 625-2434 Cell (403) 625-1036 Email: peter@ulrichherefords.com Web site: www.ulrichherefords.com Box 843, Claresholm, Alberta T0L 0T0 From Claresholm, 8 mi. (12.8 km) E., 4 mi. (6.4 km) N., 1/4 mi. E.

108

FARM

POLLED HEREFORDS ACĂ&#x2C6;RES 150, Route 220 Bonsecours, QC J0E 1H0

TĂŠlĂŠphone Ferme: (450) 535-6606 mahjam@cooptel.qc.ca

FAMILLE TĂ&#x2030;TREAULT - JEAN & ALAN

Visitors Welcome Anytime S. Nixdorff & Sons R.R. 2, Airdrie, Alta. T4B 2A4 Rob (403) 948-2569 Scott (403) 948-5232

MAHJAM

Oulton Farm Victor & Novadawn Oulton

RR #1, Windsor, NS B0N 2T0 Phone/Fax: 902-798-4440 Email. oulton.farm@ns.sympatico.ca




C A N A D I A N

H E R E F O R D

D I G E S T

auctioneers, consultants and

services index To place an ad in The Canadian Hereford Digest, call 1-888-836-7242 or visit our website at www.hereford.ca

G GRRAANNTT R ROOLLSSTTOONN PPHHOOTTOOGGRRAAPPHHYY LLTTDD Box 410 Coalhurst, Alberta T0L 0V0

Grant Ph: 403-593-2217 Craig Ph: 403-651-9441 Email: grantspix@gmail.com Web: www.grantspix.com

Heather  Barr

Balog Auction Service Ltd.

Canadian  Farm Insurance  Corp.

â&#x20AC;&#x153;The complete auction serviceâ&#x20AC;? Box 786, Lethbridge, Alta. T1J 3Z6 Bus.: (403) 320-1980 Res.: (403) 327-1016 Fax : (403) 320-2660 Bob Balog, Auctioneer 067454

Phone/Fax  (403)  337-­0052 Cell  (780)  853-­7067 2I¿FH  

3rd)ORRU6W$OEHUW7UDLO(GPRQWRQ$%7/: KEDUU#FGQIDUPLQVFRPZZZFGQIDUPLQVFRP Commercial              Personal  Lines              Farm            Livestock

LLOYDâ&#x20AC;&#x2122;S  CORRESPONDENT MARJORIE  BLACKLOCK R.R.  #4,  Box  277,  Site  412 Saskatoon,  SK    S7K  3J7 Ph:  306-­931-­0088     Fax:  306-­931-­8782 YOUR  LIVESTOCK  INSURANCE  SPECIALIST

JOHN B. BLACKLOCK AUCTIONEER 2IĂ&#x20AC;FH²   5HV²   0RELOH²   #105 - 71st Street Saskatoon, SK S7R 1B4

109


C A N A D I A N

H E R E F O R D

D I G E S T

Canadian Hereford Digest 5160 Skyline Way NE Calgary, AB T3G 4B4 Phone: 1-888-836-7242 Fax: 1-888-824-2329 Email: brad@hereford.ca or erin@hereford.ca

CHA Board of Directors Randy Radau, President RR 1, Box 1, Site 10 Bowden, AB T0M 0K0 P:(403) 227-2259 F:(403) 227-5278 couleecrestfarm@gmail.com Burt Grundy, Vice President RR2, 2932 Mackey Rd. North Gower, ON K0A 2T0 P: (613) 489-3136 F: (613) 489-1006 ngbhereford@xplornet.com Andy Carter 3510 West Leicester Amherst, NS B4H 3Y1 P: ( 902) 667-6163 awcarter@live.ca

Official Voice of the Canadian Hereford Association Circulation Director – Brad Dubeau Publisher – Canadian Hereford Association Production Manager – Erin Zatylny with Editor – Brad Dubeau Catherine Brown Associate Editor – Catherine Brown Art Director – Erin Zatylny Sales Catalogue Production - Erin Zatylny Advertising Director – Brad Dubeau & Jeff Hyatt Editorial Advisory Board/ Steering Committee – Catherine Brown, Gordon Stephenson, Erin Zatylny, Brad Dubeau Special thank you to Anne Burgess for translations and all of the CHA office staff for their support in the production of The Canadian Hereford Digest. The Canadian Hereford Digest Advisory Committee Commercial

Purebred

Don Richardson, Tlell, BC Ph:250-557-4348 Email: docdon@qcislands.net

Lyle Alberts, Williams Lake, BC Ph:250-297-6415 Email: piccreek@xplornet.com

Joanne Parrent, Clyde, AB Ph:780-348-5835

John Simkin, Eastend, SK Ph: 306-295-3899 Email: red.rock@sasktel.net

Robin Flieck, Neilburg, SK Ph:306-823-4483 Email: ramsay_rr@hotmail.com

Don Banford, Eastend, SK Ph: 306-295-3889 Email: red.rock@sasktel.net

Wally Pugh RR 4, Orangeville, ON L9W 2Z1 P: (519) 941-8515 F: (519) 941-8243 lianmor@sympatico.ca

Kevin Stocki, Fisher Branch, MB Ph: 204-372-6811

Barry Osterndorff, Elmwood, ON Ph: 519-881-4406 Email: osterndorfffarms@live.ca

Catherine Brown, Princeton, BC Ph:250-293-6858 Email: cabrown@xplornet.ca

Steve Hamilton, Shawville, QC Ph: 819-647-3540 Email: steve@rollingacres.biz

Albert Rimke Box 370, Oak Lake, MB R0M 1P0 P: (204)855-2534 F: (204)855-2711 amrimke@rfnow.com

Norm Taylor, Shefford, QC Ph:450-539-2936

Dean Manning, Falmouth, NS Ph: 902-798-4541 Email: cd.manning@ns.sympatico.ca

Murray Andrews Box 1373, Moose Jaw, SK S6H 4R3 P: (306) 694-5821 F: (306) 692-6007 mandrews@sasktel.net

VISION The Canadian Hereford Digest is committed to being the showcase for both the breed and breeders of Canadian Hereford cattle.

David Reid 706 Nesslin Cres Saskatoon, SK S7J 4V3 P: (306) 373-6100 F: (306) 933-3512 david.reid@rbc.com

MISSION To support the unity of the Hereford breed locally, nationally and internationally. Emphasizing communication between breeders, their provincial and national associations and their customers.

Jean Tetreault 150 Route 220 Bonsecours, PQ J0E 1H0 P: (450) 535-6606 mahjam@cooptel.qc.ca

Doug Mann Box 1256 Swift Current, SK S9H 3X4 P/F: (306) 773-4121 w_mann@xplornet.ca Andy Schuepbach Box 2044, Claresholm, AB T0L 0T0 P: (403) 625-4693 F: (403) 625-1500 andy@lilybrookherefords.com Doug Finseth Site 6, Box 19, RR 2, Okotoks, AB T1S 1A2 P: (403) 938-7726 F: (403) 938-7163 finsethjudy@gmail.com Daryl Kirton 30018 Townshipline Rd. Abbotsford, BC V4X 1Z4 P: (604) 856-5755 F: (604) 855-2287 3-d-l@telus.net 110

Larry & Pat Ward, Middle Musquodoboit, NS Ph:902-384-2878 Email: larryward@xplornet.com

Hereford EPD Averages Spring 2012

CE (%)

BW (lbs)

WW (lbs)

YW (lbs)

Milk (lbs)

TM (lbs)

MCE (%)

SC (cm)

CW (lbs)

Stay (%)

MPI

FMI

REA (in2)

FAT (in)

MARB

Active Sires*

0.5

3.6

46.0

76.0

18.0

42.0

1.0

0.8

87.0

-0.3

142.5

126.2

0.27

0.003

0.05

Active Dams**

0.1

3.7

41.0

68.0

16.0

36.0

0.6

0.6

82.0

-0.3

135.2

119.8

0.18

0.001

0.02

Calves***

0.5

3.5

45.0

74.0

18.0

41.0

1.0

0.7

85.0

-0.2

139.9

123.3

0.25

0.002

0.05

CE- Calving Ease BW - Birth Weight WW - Weaning Weight YW - Yearling Weight MILK - Milk TM - Total Maternal (1/2 WW + Milk) MCE - Maternal Calving Ease SC - Scrotal CW - Cow Weight Stay - Stayability MPI - Maternal Productivity Index FMI - Feedlot Merit Index REA - Rib-Eye Area FAT - Back Fat MARB - Marbling Score * Active Sires: Those sires that have sired at least 1 calf in the last 2.5 years **Active Dams: Those dams that have had a calf reported in the last 2.5 years ***Calves are those animals born from 2010 to 2012 inclusive. These are the averages on the website. Canadian Publications Agreement No.: 40006161 Return undeliverable Canadian addresses to: Circulation Department Canadian Hereford Digest 5160 Skyline Way NE Calgary, AB T2E 6V1

Printed By PRINTWEST, Saskatoon, Saskatchewan The Canadian Hereford Digest is published three times per year. G.S.T. Registration No: R122019193

All Contents are the sole property of The Canadian Hereford Association. Any reproduction in whole or in part without express permission is strictly forbidden.


C A N A D I A N

ADVERTISING AND SUBSCRIPTION

H E R E F O R D

D I G E S T

Maximum exposure with an audience that matters.

rates

A quick reference ad in every issue of the Hereford Digest for only

25000

$

To place an ad in The Canadian Hereford Digest, call 1-888-836-7242 or visit our website at www.hereford.ca

The Canadian Hereford Digest Advertising Rates AD SIZE

FOUR COLOUR PROCESS

1000.00

Full Page AD

$

Contract Rate for 2010, 3 full pages per year

$

1/2 Page AD

$

1/4 Page AD

$

Strip AD

$

Canada Wide Quick Reference AD

$

Back Cover

$

Inside Front Cover

$

Inside Back Cover

$

Advertising Deadlines January 2013 Issue: December 14, 2012 Semen & Embryo Directory: January 18, 2013

2500.00 600.00 400.00 300.00 250.00/year 1,300.00 1,200.00 1,100.00

Please add 5% GST or applicable HST to all Ad Rates and Subscription Rates Agency commissions are additional. Covers are booked on a first-come, first-served basis and can be contracted for the year. Discounted contract rates do not apply to covers.

Subscription Rates Country

Regular Mailing

First Class

Canada

$25.00

$72.00

US

$35.00

$84.00

International

$40.00

$132.00

Canadian Subscription Rates with GST or HST: (please note that cheque or money order must include the correct taxes in order for your subscription to be processed. It is the responsibility of the subscriber to ensure that the proper amount is being sent.) BC: $28.00/$80.64 AB: $26.25/$75.60 SK: $26.25/$75.60 MB: $26.25/$75.60 ON: $28.25/$81.36 QC: $26.25/$75.60 Newfoundland and Labrador: $28.25/$81.36 NB: $28.25/$81.36 NS: $28.75/$82.80 PEI: $26.25/$75.60 Yukon: $26.25/$75.60 NWT: $26.25/$75.60 Nunavut: $26.25/$75.60

Digital Photography Submissions With every issue, we are using more and more digital photos and normally, with great convenience and success. However, sometimes customer supplied digital pictures lack the quality required for a good reproduction. We cannot grant advertising discounts based on the quality of a supplied digital picture. Remember! Digital pictures sent by email must be sent as an “attached document” in either a jpeg or tiff format in order for us to use them in your ad. Please call Erin in our office if you have any questions. Advertising Content The Editorial Committee of The Canadian Hereford Digest assumes no responsibility for the accuracy and truthfulness of submitted advertising copy, and reserves the right to refuse any ad copy or photos. Advertisers shall indemnify and hold harmless the Digest containing pedigrees or statements regarding performance. These must conform to records kept by the Canadian Hereford Association. Copy deviating from official records may be changed as necessary without advertiser consent. Photographs are welcome, but no responsibility is assumed during transit or while in the office. Editorial Policy Opinions expressed are the writer’s and not necessarily those of The Canadian Hereford Digest or the Canadian Hereford Association. The Editorial Committee of The Canadian Hereford Digest reserves the right to refuse any editorial content that is not in the best interest of the Canadian Hereford Association.

We are pleased to bring you The Canadian Hereford Digest three times per year and hope you continue to enjoy it. To subscribe please complete the form below and return it with your payment to:

SUBSCR IPTIONS

Canadian Hereford Association 5160 Skyline Way NE Calgary, Alberta T2E 6V1 Phone (403) 275-2662 Toll Free (888) 836-7242 Fax: (403) 295-1333 Toll Free (888) 824-2329

NAME ADDRESS

CITY/TOWN

PROVINCE

CREDIT CARD NUMBER

EXPIRY DATE

POSTAL CODE

SIGNATURE

111


C A N A D I A N

H E R E F O R D

D I G E S T

advertisers index To place an ad in The Canadian Hereford Digest, call 1-888-836-7242 or visit our website at www.hereford.ca

#

3-D-L Polled Herefords .........................................................107

a

Farmfair ...................................................................................72 Fenton Hereford Ranch ...................................................34, BC Fulton Herefords ...................................................................107

Ace Herefords .........................................................................78 Alta Genetics ........................................................................109 Anderson Family Herefords ................................................... 16 Art Family Photography .......................................................109 A.X.A. Polled Herefords ........................................................108 Ayrey Hereford Farms ........................................................... 40

g

b

h

Balog Auction Services Inc. ...........................................41, 109 Bannerlane Herefords ............................................................57 Bar JB Ranch ...........................................................................32 Bar Pipe Hereford Ranch........................................................62 Barr, Heather .........................................................................109 Bar-RZ Polled Herefords ........................................................ 14 Big Gully Farm ......................................................................... 61 Blacklock, John B. .................................................................109 Bradley Farms .......................................................................108 Braun Ranch ............................................................................67 Breton West Herefords .......................................................... 21 Brost Land & Cattle Co. Ltd. .................................................. 15

c

Canadian Western Agribition ................................................74 Calgary Bull Sale ................................................................... 114 Carlrams Ranching Ltd. ........................................................ 20 Chestermere Herefords .......................................................107 Copper Creek Ranch..............................................................IFC Coppertone Farm ..................................................................107 Corbiell Herefords .................................................................. 13 Coulee Crest Herefords .........................................................77 Crone Herefords .................................................................... 50

d

Dallas Farms ..........................................................................107 Davies Ranch...........................................................................72 Davis-Rairdan Embryo Transplants Ltd. .............................109 Deanfield Ranch ..................................................................... 81 Doenz Ranches .................................................................4, 107 Dorbay Polled Herefords ......................................................108 Dorran, Ryan .........................................................................109

112

f

Garrett Ranch Ltd. ................................................................108 Gillespie Hereford Ranch ...................................................... 42 Grant Rolston Photography .................................................109 Guilford Hereford Ranch ......................................................108

HBM Polled Herefords ..........................................................108 HerefordsThatWork.com .....................................................108 Hereford Genes Event ........................................................... 68 Highmark Ranching Polled Herefords ................................107 Holloway Farms Lts. .............................................................. 69 HZ Herefords ...........................................................................23

j

Jones Hereford Ranches ......................................................107 JoNomn Hereford Ranch ........................................................63 Justamere Ranches ............................................................... 46

k

Keith Gilmore Foundation ......................................................82 Klein Farms.............................................................................. 17 Kootenay Polled Herefords ....................................................33

l

Lakeford Polled Herefords ...................................................107 Lamportâ&#x20AC;&#x2122;s Polled Herefords ...........................................73, 107 Leveldale Polled Herefords ................................................... 46 Lian Mor Polled Herefords .....................................................79 Lilybrook Herefords.......................................................107, IBC Little Red Deer Hereford Farm ............................................107 Lock Farms ...................................................................... 31, 108 Lone Pine Cattle Services ..................................................... 66 Lost Lake Ranch .............................................................. 12, 107 Lyons Polled Herefords ........................................................108


C A N A D I A N

H E R E F O R D

D I G E S T

advertisers index To place an ad in The Canadian Hereford Digest, call 1-888-836-7242 or visit our website at www.hereford.ca

m

Manitoba Hereford Association ..........................................108 Manitoba Hereford Association Good As Gold Sale.............11 Majam Farm ..........................................................................108 Medonte Highlands Polled Herefords ....................................3 Misty Valley Farms .................................................................75 MJT Cattle Co. Ltd. Herefords & Angus ................................36 MN Herefords..........................................................................55 Moccasin Flat Ranch ............................................................107 Myalta Farms ........................................................................107

n

NBG Pollled Herefords..........................................................108 NCX Polled Herefords ...........................................................107

o

t

Taboo Polled Herefords ........................................................108 Triple A Herefords ..................................................................37 Triple H Farm .........................................................................108

u

Ulrich Herefords Ranch Inc. ......................................... 54, 108

x

XTC Hereford Farms ...............................................................26

y YV Ranch .................................................................................56

Oulton Farm ..........................................................................108

p Pahl Livestock Ltd. .................................................................27 Partners for Progress Sale ....................................................57 Pine Butte Ranch ......................................................................8

r

Ranch of the Vikings ............................................................108 Richardson Ranch.................................................................107

s

S. Jones & Sons .....................................................................108 Sampsonâ&#x20AC;&#x2122;s Thunderbird Ranch Ltd. ....................................108 Scott Alta Farms Polled Herefords .....................................108 Skelton Cattle Co. .................................................................108 Sky Track Ranch .................................................................... 40 SNS Herefords ................................................................ 84, 108 Square-D Herefords..................................................................9 SS Cattle Company Inc.................................................. 78, 108 Stauffer Farms Ltd..................................................................28 Stith, Dale ..............................................................................109 Stockmens Insurance ..........................................................109 Stromsmoe Hereford and Black Angus ................................29

113


The Board of Directors of the Canadian Hereford Association wishes to announce Notice of the Annual General Meeting of the Association as follows:

Date: Thursday, November 22, 2012 Time: 12 Noon Location: Agribition Grounds, Canadian Western Agribition

during

The name of the room is Conference Room #4, located in the Queensbury Centre (2nd floor, east wing), which is located on the east side of the Agribition grounds and adjacent to the Agridome.

The Annual meeting will include a noon luncheon, followed by the business meeting. The Hereford sale is at 5:00pm in the Auditorium this same day, followed by the Agribition Hereford Show on Friday, November 23rd in the Stadium. 114


A Program on the Move Coming or going they look and perform their best

We collect and keep track of any measurable trait, ask us about it. We also retain ownership on all our steers to finish.

Offering 80 Long Yearling Bulls & 80 Bred Purebred Heifers for your appraisal and purchase. The bull calves are weaned and looking for a new home.

THANKS

TO ALL OUR

BIDDERS

AND

BUYERS,

YOUR BUSINESS AND FRIENDSHIPS ARE GREATLY APPRECIATED.

For a complete picture of our program, please come and visit us at the ranch, check us out on the web or ask us for our 2012 Pasture Tour DVD

Andy & Margaret Schuepbach

Ruth, Michelle and Daniel Phone: (403) 625-4693 Cell: (403) 625-6316 Fax: (403) 625-1500 Box 2044, Claresholm, AB T0L 0T0 10 miles (16 km) East of Claresholm to sign, then 4 1/2 miles (7.2 km) North

Email: andy@lilybrookherefords.com

Hans Ulrich (403): 625-2237

www.lilybrookherefords.com


48th Annual Production Sale November 16, 2012 at the Ranch Sale offering includes our banner winners from the 2012 World Hereford Conference

FE 152S FRONTLINE 54Y

FE 43T EMPEROR 66Y

FE 43T EMPEROR 172Y

FE 44U RANCHER SPECIAL 180Y

FE 17U STAN BRIT 204Y

FE 152S FRONTLINE 208Y

Reserve Champion Pen of Three Junior Division Reserve Champion Pen of Three Intermediate Division

)(867$1%5,7< )(6)5217/,1(< )(8'$1'<5('*(0<

)(85('6.</,1(< )(7(03(525< )(7(03(525<

Doris Fenton in her 98th year checking out the sale bulls on a sale gelding

Al & Lori Fenton Becky & Curtis

Conrad & Janel Fenton Dalee, Prior & Emerson

Blair and Jessica Gray & Tayva Fenton

3KRQH)D[ &HOO

3KRQH &HOO

3KRQH &HOO

(PDLOIHQWRQKHUHIRUGUDQFK#JPDLOFRPÂ&#x2021;%R[,UPD$%7%+Â&#x2021;ZZZIHQWRQKHUHIRUGUDQFKFRP PL(RI,UPDRQ+Z\RUPL:RI:DLQZULJKW/RRNIRU+HUHIRUG6LJQ


October 2012 Commercial Edition of The Cadadian Hereford Digest