Test Bank For Biology Now with Physiology Fourth Edition Anne Houtman Megan Scudellari Cindy Malone

Test Bank For Biology Now with Physiology Fourth Edition Anne Houtman Megan Scudellari Cindy Malone Chapter 1-17

Chapter 01: The Nature of Science MULTIPLE CHOICE 1. When scientists generate a single informed, logical, and plausible explanation for a question and observations of the natural world, they are proposing a scientific a. hypothesis. c. theory. b. observation. d. correlation.

ANS: A DIF: Easy REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Remembering 2. Experimentation is the primary, but not only, means used to verify or refute the ________ made by a hypothesis. a. variables c. laws b. theories d. predictions ANS: D DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 3. A scientific hypothesis must be constructed with which of the following characteristics? a. It is always provable and clearly states what is already known to be fact. b. It provides a reasonable explanation to a question and is consistent with current observations; it must also be testable and falsifiable. c. It provides an explanation consistent with accepted theological ideas and does not need to be tested. d. It does not require testing by experimentation or additional observations. It is not falsifiable.

ANS: B DIF: Easy REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Remembering 4. Is it important for scientists to communicate their results to fellow scientists? a. Yes. Scientists want to receive recognition and monetary reward for their work. b. No. There is no reason for scientists to communicate their results to fellow scientists. c. Yes. The quality and accuracy of the scientific work can be enhanced by input, further review, and possibly even repetition by other scientists working in the same field. d. No. Communication between scientists is discouraged because it can confuse the details of the experiments.

ANS: C DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Remembering 5. A scientific hypothesis must be ________; if not, science cannot evaluate it.

a. provable b. testable

c. accepted d. rejected

ANS: B DIF: Easy REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Remembering 6. Whenever we ________, we are proceeding scientifically. a. invoke a supernatural power as an explanation for how a natural phenomenon occurred b. stop questioning our observations c. try to solve a problem by systematically evaluating the plausibility of various solutions d. develop an unchangeable and definitive explanation ANS: C DIF: Moderate REF: 1.0 Intro OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Applying 7. Is it possible for scientists to study events that happened to animals or plants that lived millions of years ago? a. Yes. Apply the laws of physics and nature that we know exist today to evaluate the evidence of past events. For example, observe modern animal behavior, structure, and function, and compare them to the structures of fossilized animals to deduce the function of the fossilized structures. b. No. The laws of physics that exist today are not the same laws of physics that existed in the past, so there is no way to compare plant or animal fossils to those of modern organisms and deduce the function of fossilized structures. c. Yes. Genetic manipulation of fossils allows scientists to directly test metabolic and behavioral characteristics of plants and animals from the past. d. No. There is no way to analyze plant or animal fossils that lived millions of years ago because the laws of nature that exist today have changed dramatically from the past.

ANS: A DIF: Difficult REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Applying 8. Victoria, who is 10 years old, wants to be a zoologist when she grows up because she loves animals. So, she decided to begin her training by ―doing something scientific.‖ Specifically, she weighed and measured the lengths of all the earthworms she could find in her yard and recorded the data in a notebook. She then made a graph showing the maximum, minimum, and average weights and heights of the earthworms. Was she doing something scientific? a. No, because she is too young to think like a scientist. b. No, because she had no hypothesis to direct her data collection or interpretation. c. Yes, because scientists always make measurements. d. Yes, because scientists always construct graphs with the data they collect.

ANS: B DIF: Difficult REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 9. A group of researchers conducted an experiment and collected the data presented in the graph below.

The graph shows that the hypothesis was ________ because all members of the control group ________ while most of the members of both treatment groups ________ by the end of the study.

a. b. c. d.

proven beyond a doubt; survived; died proven; survived; died not supported; died; survived supported; survived; died

ANS: D DIF: Difficult REF: 1.3 Catching the Culprit OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Analyzing 10. A scientist notices that a population of birds has decreased dramatically within one year and suspects that a newly introduced snail population may be affecting the bird population. Some individuals within the bird population eat snails, primarily, while other individuals avoid eating snails. Which of the following statements represents a prediction based on a well-constructed hypothesis for this observation? a. If birds are affected by eating snails, then there will be a difference in the survival rate of birds that eat snails and those that avoid snails. b. If snails live in moist habitats, then snails will be eaten more frequently by birds. c. If birds consume snails, then they will have a higher body mass index than birds that do not eat snails. d. If snails that are sick leave their shells so that birds will consume them, then snail populations are protected from illness.

ANS: A DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Analyzing 11. Recently, beekeepers have noticed an alarming and sudden disappearance of honeybees from their hives.

Some beekeepers and environmentalists worry that crops genetically engineered to produce Bt insecticidal toxin may be killing the bees. Without data from a scientific experiment, is it reasonable to state that Bt-containing crops are responsible for the loss of honeybees? a. Yes, because it is obviously the Bt crops killing the bees. b. Yes, because there cannot possibly be any other explanation for the loss of the honeybees. c. No, because there is no reason to suspect that an insecticide would kill honeybees. d. No, because there could be some other unknown or unmentioned factor affecting the survival of honeybees.

ANS: D DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Understanding

12. The hypothesis that there is a common ancestor to all living organisms is strengthened by what observation? a. Almost all cells in all living organisms use DNA to direct their structure, function, and behavior. b. All living organisms use energy acquired directly from the environment or from other organisms. c. All living organisms reproduce. d. Each type of living organism adheres to the general principles of the biological hierarchy.

ANS: A DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 13. Which of the following statements is true? a. Once a hypothesis has been proposed, it can never be challenged. b. A valid scientific hypothesis is self-evident and does not need to be tested by experimentation. c. If properly designed, experiments always prove hypotheses to be wrong. d. The scientific method or process can help people make informed medical and environmental decisions.

ANS: D DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 14. Which of the following questions could NOT be used to develop a testable hypothesis? a. Does exposure to secondhand smoke affect the probability of developing lung cancer? b. Do organic vegetables contain harmful substances? c. Should everyone drink bottled water only? d. Does a can of vegetable juice contain more salt than the same size can of iced tea?

ANS: C DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 15. Recently, beekeepers have noticed an alarming and sudden disappearance of honeybees from their hives.

Some beekeepers and environmentalists worry that crops genetically engineered to produce Bt insecticidal toxin may be killing the bees. Which of these experiments tests the hypothesis that Bt toxin is killing the bees? a. spraying Bt toxin on a field and counting the number of bees present before and after spraying b. collecting hundreds of bees; half of the bees would be kept in a facility with plants genetically engineered to contain the gene for Bt toxin, while the other half would be kept in a facility with plants not genetically engineered to contain the gene for Bt toxin. The survival rate for both sets of bees would be calculated and compared. c. collecting hundreds of bees and spraying only half of them with Bt toxin; the survival rate for both sets of bees would be calculated and compared d. The number of bees in two adjacent fields would be counted before and after spraying one of the fields with Bt toxin. The survival rate of bees in both fields would be calculated and compared.

ANS: B DIF: Difficult REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying

16. Some questions fall outside the realm of science. Which of the following questions could NOT be answered using the scientific method? a. What is the function of the appendix in human beings? b. Why is it so difficult to quit smoking? c. Why do smokers develop lung cancer more frequently than nonsmokers? d. Why is it unethical to test newly developed drugs in animals?

ANS: D DIF: Difficult REF: 1.0 Intro OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 17. Researchers hypothesized that a North American fungus not only caused symptoms of white-nose syndrome (WNS) but also caused death. The results from their experiment are shown in the graph below.

Based on this graph, which of the following hypotheses would be the MOST logical hypothesis for further studies?

a. ―Sham injected‖ bats have a higher mortality rate than bats that are not injected. b. Bats injected with the North American fungus are less likely to care for their offspring than ―sham injected‖ bats. c. Bats injected with European fungus have a lower mortality rate than ―sham injected‖ bats. d. Other species of bats injected with European fungus will experience death.

ANS: D DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Understanding 18. New medications undergo extensive human testing before receiving FDA approval. These tests represent an experiment, and variations in the dosage given to participants represents the a. dependent variable. c. correlation coefficient. b. independent variable. d. invariable.

ANS: B DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 19. The group of 18 bats that were ―sham injected‖ represents a ________ group that experienced ________.

a. b. c. d.

control; no change in the independent variable control; a change in the dependent variable treatment; no change in the independent variable treatment; no change in the dependent variable

ANS: A DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Understanding 20. Once supported by a predictable experimental outcome, a scientific hypothesis a. is never reexamined. b. still cannot be considered to have been proven true. c. can be used to predict the outcome of all future similar events. d. is elevated to the status of theory.

ANS: B DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Understanding 21. David Blehert and his research team captured 117 healthy bats to study in the laboratory and divided them into four groups. Group 1 was housed in an area free from the fungus Geomyces destructans.

Group 2 was housed in an area that shared the same air as bats infected with WNS, but these bats did not have direct contact with the infected bats. Group 3 was housed in direct contact with other bats infected with WNS. Bats in group 4 were directly exposed to Geomyces destructans when it was applied to their wings. During the study period the bats were monitored for signs of WNS. Which group is the control group? a. group 1 c. group 3 b. group 2 d. group 4 ANS: A DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 22. Which of the following represents conducting an experiment? a. dialing a telephone number b. comparing prices of computers c. checking midterm grades online d. predicting the outcome of a basketball game ANS: A DIF: Difficult REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an

experiment.

MSC: Analyzing

23. David Blehert and his research team captured 117 healthy bats to study in the laboratory and divided them into four groups. Group 1 was housed in an area free from Geomyces destructans. Group 2 was housed in an area that shared the same air as bats infected with WNS, but these bats did not have direct contact with the infected bats. Group 3 was housed in direct contact with other bats infected with WNS. Bats in group 4 were directly exposed to Geomyces destructans when researchers applied it to the bats’ wings. During the study period the bats were monitored for signs of WNS. What is the specific hypothesis being tested by the inclusion of group 4 in this experiment? a. Geomyces destructans causes WNS, and it can be transmitted through the air. b. Geomyces destructans causes WNS, and it is only transmitted by direct contact with other infected bats. c. Geomyces destructans causes WNS, and it can be transmitted by direct contact with the fungus; no contact with infected bats is needed for transmission of the fungus. d. Group 4 is the control.

ANS: C DIF: Difficult REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Analyzing 24. David Blehert and his research team captured 117 healthy bats to study in the laboratory and divided them into four groups. Group 1 was housed in an area free from Geomyces destructans. Group 2 was housed in an area that shared the same air as bats infected with WNS, but these bats did not have direct contact with the infected bats. Group 3 was housed in direct contact with other bats infected with WNS. Bats in group 4 were directly exposed to Geomyces destructans when it was applied to their wings.

During the study period the bats were monitored for signs of WNS. In this experiment, the independent was ________ and the dependent variable was ________. a. the type of exposure to Geomyces destructans; whether the bats became sick with WNS b. whether the bats became sick with WNS; the type of exposure to Geomyces destructans c. whether the bats became sick with WNS; the number of bats included in the study d. the number of bats included in the study; the type of exposure to Geomyces destructans ANS: A DIF: Difficult REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Analyzing 25. The information presented in the following figure represents a scientific

a. theory. b. hypothesis.

c. observation. d. fact.

ANS: D DIF: Easy REF: Chapter 1 Infographic OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding 26. Scientists are human beings and, like all human beings, are susceptible to personal and group biases that may influence how they interpret evidence. Before original research work is accepted and added to a growing body of scientific understanding, perhaps even contributing to our understanding of an important scientific theory, it must be scrutinized by experts in the field who have no direct connection to the research under review. The main mechanism for doing this is a. popular magazines. c. peer-reviewed publications. b. the Discovery Channel. d. Wikipedia.

ANS: C DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding 27. A patient is coughing and producing a wheezing sound as she breathes; she also has a fever. She goes to the doctor who listens to her chest, takes X-rays of her chest, and determines that she probably has something called croup. Which of the following are the facts in this scenario? a. The patient is coughing, wheezing, and has a fever. b. The patient probably has croup. c. The patient probably has whooping cough. d. The patient probably needs antibiotics.

ANS: A DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Applying 28. In science, when a hypothesis or group of hypotheses supported by repeated experimental evidence holds true through time, it can be developed into a a. law. c. hypothesis. b. mathematical theorem. d. theory.

ANS: D DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding 29. The human heart pumps blood throughout the blood vessels in the body. This is a scientific a. theory. c. fact. b. hypothesis. d. experiment.

ANS: C DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Applying 30. A patient often experiences numbness and pain in the thumb and first two fingers on his right hand. He goes to the doctor, who suspects that carpal tunnel syndrome is the reason for the numbness and pain.

The doctor then orders a simple test to see how fast nerve impulses are moving up and down the patient’s arm. The doctor’s preliminary diagnosis of carpal tunnel syndrome is a(n) a. theory. c. experiment. b. fact. d. hypothesis.

ANS: D

DIF: Moderate

REF: 1.3 Catching the Culprit

OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Analyzing 31. Which of the following would be a theory? a. Specific pathogens are directly responsible for specific diseases and conditions. b. A fungal infection is responsible for the spread of white noses and associated higher mortality across bat populations and species. c. Bats with white noses have been observed in the wild. d. A fungal infection causes bats to wake up repeatedly during the winter and use up their fat reserves.

ANS: A DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding 32. In 1890, Robert Koch developed a hypothesis regarding the cause of communicable diseases. He designed an experiment and collected data that supported his hypothesis. Later, his experiment was repeated by many other scientists who used other pathogens and documented similar results that not only supported their hypotheses but also supported Koch’s original hypothesis. These many experiments that supported multiple hypotheses regarding the cause of communicable diseases contributed to the development of the a. theory of evolution. c. theory of relativity. b. germ theory of disease. d. law of gravity.

ANS: B DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding 33. Scientific understanding can always be challenged, and even changed, with new ways of observing and with different interpretations. For example, new tools and techniques have resulted in new observations and the discovery of additional information. This has resulted in revised ways of understanding how molecules are moved across the plasma membrane of cells. Hence, there is no certainty in science, only degrees of probability (likelihood) and potential for change. In light of this understanding, which of the following statements is MOST meaningful? a. Scientific knowledge is absolute knowledge. b. Scientific knowledge is based on current knowledge. c. Scientific knowledge is a static and unchanging collection of facts. d. Scientific knowledge is a rigid collection of invariable facts.

ANS: B DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Applying 34. Which of the following would be a fact? a. Specific pathogens are directly responsible for specific diseases and conditions. b. A fungal infection is solely responsible for the spread of white noses and associated higher mortality across bat populations and species. c. Bats with white noses have been observed in the wild. d. A fungal infection causes bats to wake up repeatedly during the winter and use up their fat reserves.

ANS: C DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding

35. Which of the following sequences correctly represents the biological hierarchy of a multicellular organism? a. cells  tissues  organs  individual b. tissues  organs  cells  individual c. individual  cells  organ systems  tissues d. organ systems  organs  tissues  individual ANS: A DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Applying 36. A tissue is defined as a. a group of cells that performs a unique set of tasks in the body. b. two or more atoms held together by strong chemical bonds. c. the basic unit of life. d. a network of organs that perform a wide range of functions.

ANS: A DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Remembering 37. A researcher studying a group of individuals of the same species living and interacting in a shared environment is said to be working at the level of a a. biome. c. community. b. biosphere. d. population.

ANS: D DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 38. Carbon, hydrogen, and oxygen atoms are held together by chemical bonds to form ________ of sugar. a. organ systems c. cells b. molecules d. atoms ANS: B DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 39. Bats use echolocation to orient themselves and locate objects. Doing this requires special adaptations in their inner ear, midbrain, and auditory cortex of their cerebrum. The echolocation system of bats is an example of a(n) a. cell. c. organ. b. tissue. d. organ system.

ANS: D DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 40. The caves in upstate New York, where Alan Hicks’s team first noticed the deaths of thousands of bats, represent the ________ where the bats lived. a. biosphere c. ecosystem b. biome d. community ANS: C DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Applying 41. Which term best describes the temperate deciduous forests that cover the northeastern United States, including the Adirondack Mountains? a. biosphere c. ecosystem b. biome d. community ANS: B DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Analyzing 42. Land biomes are most commonly defined by a. their climate, physical characteristics, and dominant animal life. b. only the dominant plant life in them. c. the dominant plant life that influences the dominant animal life in them. d. their climate and physical characteristics that influence the dominant plant life and, subsequently, animal life in them.

ANS: D DIF: Difficult REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Applying 43. What characteristic is NOT shared by all living organisms? a. They make their own energy. b. They grow and develop. c. They evolve through time. d. They are composed of one or more cells.

ANS: A DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 44. Living organisms maintain a constant internal environment by sensing and responding to their internal conditions. This stable maintenance of internal conditions is known as a. homeostasis. c. reproduction. b. evolution. d. sensation.

ANS: A DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 45. DNA is one of the features common to all known forms of life; it a. forms the protective outer membrane of cells. b. is used to transfer information from parents to their offspring. c. is used to obtain energy from the environment. d. is used in sensing changes within the environment.

ANS: C DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 46. The roots of a sunflower plant growing downward while the shoot grows upward and the flower turns toward the sun are examples of what characteristic of all living organisms? a. They reproduce using DNA. b. They evolve through time.

c. They make their own energy. d. They sense the environment and respond to it.

ANS: D DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Understanding 47. A species of butterflies gradually becomes darker in color over many generations; this is an example of which characteristic of living organisms? a. They reproduce using DNA. b. They obtain energy from the environment to support metabolism. c. They can evolve as groups. d. They sense the environment and respond to it.

ANS: C DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Analyzing 48. Which of these characteristics of living organisms are present in viruses? a. composed of one or more cells b. can evolve as groups c. maintain a constant internal environment d. obtain energy from their environment ANS: B DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Understanding 49. What is the MOST likely explanation for why all living organisms use the same genetic code stored in DNA? a. DNA is a molecule that was found in the earliest life-form and has been passed on to all offspring. b. DNA is more compact than other molecules and therefore fits more easily into cells. c. DNA is required for organisms to sense and respond to changes in the environment. d. DNA is required for organisms to maintain a stable internal environment when conditions vary.

ANS: A DIF: Difficult REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Evaluating 50. A small, potentially living object was found. For this object to be considered alive, the object must a. be composed of tissues. c. have evolved from a known life-form. b. be found with offspring. d. contain one or more cells.

ANS: D DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Applying COMPLETION 1. The first two steps of the scientific process typically include making ________ and forming a ________.

ANS: observations; hypothesis

DIF: Easy REF: 1.0 Intro OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Remembering 2. After observing that students who regularly attend class appear to be making good grades, I propose the hypothesis that regular class attendance increases the probability that students earn higher grades. If I attend classes regularly this semester, I should make higher grades than I did last semester when I often missed class. This is a ________.

ANS: prediction DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Applying 3. When a hypothesis is well constructed, a prediction can be made using a(n) ―________‖ statement.

ANS: if then DIF: Easy REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Remembering 4. When Dr. Blehert and his team set out to determine the cause of death for thousands of bats, they determined that the sick and dead bats had a strange white fuzz on their noses and wings along with depleted fat reserves and damaged wing tissue. After performing observational studies, the researchers used a branch of mathematics called ________ to quantify the reliability of their data.

ANS: statistics DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 5. During an experimental study, a control group is maintained under a standard set of conditions with no change in the independent variable. The ________ group is maintained under the same standard set of conditions as the control group, but the independent variable is adjusted.

ANS: treatment experimental DIF: Easy REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Remembering 6. A direct and repeatable observation of any aspect of the natural world can be considered a scientific ________.

ANS: fact DIF: Easy

REF: 1.3 Catching the Culprit

OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Remembering 7. A way to visualize the breadth and scope of life, from the smallest structures of atoms and cells to the broadest interactions between living and nonliving systems that we can comprehend, is typically referred to as the biological ________.

ANS: hierarchy DIF: Easy REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Remembering 8. The genetic material used for reproduction by those organisms conventionally considered to be living is ________.

ANS: DNA DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Applying SHORT ANSWER 1. Explain the self-correcting nature of science.

ANS: The process of science is based on evidence that can be demonstrated through observations and experiments. Scientific findings are subject to peer review and independent validation and can, therefore, be challenged by anyone on the basis of evidence. When new evidence demonstrates that current scientific thinking is incorrect, hypotheses are adjusted or discarded and investigation continues.

DIF: Moderate REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Applying 2. Explain why hypotheses can be supported, but never proven absolutely true.

ANS: A hypothesis is based on the best evidence available at a given time. There may be alternative explanations for supported hypotheses.

DIF: Moderate REF: 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 3. A student complains about the requirement of taking a biology course. She states that she is capable of following the ―set recipe‖ of the scientific method, but she does not believe that science is useful because it cannot answer all questions. Explain to this student the types of questions science can answer. Also address her misunderstanding of the scientific method.

ANS:

Science provides answers to questions about the natural world. Science cannot provide answers to questions regarding supernatural beings or anything that cannot be detected and measured. Science is often referred to as a process to emphasize that science is more flexible than a ―set recipe.‖ Scientists do not follow a rigid pattern to answer questions. Instead, scientists use evidence-based methods for acquiring knowledge. Evidence is used to support hypotheses and the best evidence at any given time may change previously held ideas.

DIF: Moderate REF: 1.0 Intro OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 4. Describe the main mechanism used to reduce researcher bias, or even prevent fraud, in science.

ANS: When scientists communicate their results to fellow scientists during the peer-reviewed publication process, reviewers who are subject experts with no direct contact in the study being reviewed scrutinize the submitted work. If there are any concerns about the methodology, results, or analysis, the researcher submitting the work must address those concerns before his or her work is published.

DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 5. People who exercise regularly have a lower average resting heart rate and blood pressure than people who do not exercise. Given this observation, develop a hypothesis and provide one prediction relating to that hypothesis.

ANS: Hypothesis: Daily exercise reduces average resting heart rate and blood pressure.

Prediction: If one group of people exercises for thirty minutes every day and another group does not exercise, the first group will experience a reduction in average resting heart rate and blood pressure. The second group will not experience a change in average resting heart rate and blood pressure.

DIF: Difficult REF: 1.2 Prove Me Wrong OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 6. A parent heard a celebrity on television stating there was a study published in 1998 that asserted a connection between the measles-mumps-rubella (MMR) vaccine and the onset of autism in children.

The celebrity went on to say that after the MMR vaccine replaced the old simple measles vaccine in 1988 there was a 273 percent increase in autism rates during the next 11 years. The celebrity, however, did not reveal that the study published in 1998 included a sample size of 12 children who were already known to have some form of autism or similar developmental difficulties. He also did not present the evidence from hundreds of studies conducted since 1998 that show no connection between vaccines and the onset of autism. What was the hypothesis, regarding vaccines and autism, implied by the celebrity? State at least two obvious problems with the structure of the 1998 study.

ANS: The celebrity’s implied hypothesis was, ―Vaccines cause autism.‖ Two obvious problems with the structure of the 1998 study include the extremely small sample size of 12 children and the bias introduced because all of the children had already been diagnosed with some form of autism or developmental difficulties. It was hardly a random sample.

DIF: Difficult

REF: 1.2 Prove Me Wrong

OBJ: 1.2 Develop a hypothesis from a given observation and suggest one or more predictions based on that hypothesis.

MSC: Applying 7. The claim has been made that women may be able to achieve significant improvements in memory by taking Gingko biloba supplements. To determine if the claim is fraudulent and prior to accepting this claim, what type of evidence would you like to see? Provide brief details of an investigative design.

ANS: The hypothesis to be examined is, ―Taking Gingko biloba supplements significantly improves the memory of women.‖ The prediction is that if women take Gingko biloba supplements their memory function will improve. This can be tested by setting up an experiment that includes a control group of randomly selected women who receive a placebo and an experimental group of women who will actually receive Gingko biloba supplements. Consuming the Gingko biloba supplement would be the independent variable. The experiment should attempt to control for other possible factors such as age, amount of daily exercise, and other dietary considerations when selecting participants. Both groups of women would be tested before the study begins to determine their average memory capabilities (dependent variable) prior to the experiment. Both groups of women would be retested at the end of the experiment. Statistical analyses should be conducted to determine if any differences in memory function between the two groups are significant and if the data supports the hypothesis.

DIF: Difficult REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Evaluating 8. Terrance observes that tomato seeds sprouting in his fresh compost pile seem to grow at a faster rate than tomato seeds that he planted in potting soil that was previously used to grow house plants. Describe an experiment that he could use to test the hypothesis that tomato seeds grown in fresh compost grow faster than those grown in used potting soil. Include information about appropriate variables, treatments, and controls.

ANS: A large group of tomato seeds would be randomly assigned to one of two groups. One group, the control group, would be grown in used potting soil. The second group, the experimental group, would be grown in fresh compost. The only difference in the treatment of the groups would be the single independent variable of the compost. The dependent variable would be the measured growth rate.

DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 9. Your friend says to you, ―You do not need to understand evolution to understand biology because evolution is just a theory.‖ How would you explain to your friend that a ―theory‖ in science is not ―just a theory‖?

ANS: In science, a theory usually consists of a group of well-researched and supported hypotheses that are interrelated. There are so many diverse and independent lines of investigation supporting these related hypotheses that form the theory that we can rely on the theory to help guide our understanding of all related topics. In the nonscience vernacular, the word theory usually refers to an untested explanation.

DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Understanding

10. Organize the following concepts in order of broadest interactions between groups to the smallest structure and give a brief explanation of the concepts: biome, biosphere, community, ecosystem, organism, and population.

ANS: Organism (an individual), population (a group of individuals of the same species living and interacting in a shared environment), community (the populations of different species that live and interact with one another in a particular place), ecosystem (a particular physical environment and all the communities found there), biome (a large region of the world defined by its physical characteristics, especially climate, and a distinctive community of organisms), biosphere (all the world’s living organisms and the places where they live) DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Remembering 11. Describe how DNA makes it possible for organisms to make new individuals like themselves.

ANS: No matter how simple or complex the life-form, the genetic code found in DNA provides the instructions to build new cellular components, carry out cellular metabolism, and dictate cellular behavior, including the initiation of cell reproduction and the transfer of information from one generation to the next. The DNA is read to produce proteins that direct cellular reproduction, produce new cellular components, and initiate cellular reproduction.

DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Applying 12. Consider the characteristics of living organisms. Would you classify viruses as living or nonliving?

Justify your response.

ANS: Viruses are typically considered nonliving because they lack most of the characteristics of life. Viruses can evolve as groups, but they do not display any of the other characteristics of life. Viruses are not composed of cells. They are not capable of reproducing without a host cell’s machinery. They also are not capable of capturing energy from their environment, sensing their environment, or maintaining homeostasis.

DIF: Moderate REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Evaluating MATCHING Match the correct terms with the sentences below. a. b. c. d. e. f.

tests communicate accept, reject, or modify observe analyze hypothesis

g. predictions 1.

2.

3.

4.

5.

6.

7.

________and ask questions about the natural world.

Suggest a ________ to explain your observations and questions.

Generate ________ to test your hypothesis.

Design ________ of the predictions of your hypothesis. ________your results to fellow scientists for their review and input. ________your hypothesis, predictions, or test according to the results. ________the results.

1. ANS: D DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 2. ANS: F DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 3. ANS: G DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 4. ANS: A DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 5. ANS: B DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 6. ANS: C DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding 7. ANS: E DIF: Easy REF: 1.1 Bat Crazy | 1.2 Prove Me Wrong OBJ: 1.1 Caption a diagram of the scientific method, identifying each step in the process.

MSC: Understanding Read the summary of an experiment below. Then match the correct term with each statement. Terms may be used more than once or not at all.

Dead mice within a cave where bats are infected with white-nose syndrome (WNS) have white fuzz on their noses that appears to be similar to the white fuzz seen on the noses of bats ill with WNS. A researcher hypothesizes that mice are also susceptible to WNS when they live in close contact with infected bats. To test this hypothesis, the researcher captures 50 healthy mice and randomly separates them into two groups. One group is housed in an area that contains healthy bats. The other group of mice is housed in an enclosure that contains bats that have WNS. The mice in both groups are monitored for signs of WNS. a. independent variable b. dependent variable c. control group d. treatment group 8.

9.

10.

11.

Presence or absence of any signs of WNS in the mice.

Mice housed in an area with healthy bats.

Mice housed in an area with bats that have WNS. Presence or absence of WNS in the bats.

8. ANS: B DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an

experiment.

MSC: Applying 9. ANS: C DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 10. ANS: D DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying 11. ANS: A DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.3 Identify the use of appropriate variables, treatments, and controls in the design of an experiment.

MSC: Applying Read each statement and identify whether the statement is a scientific fact, a scientific theory, or an opinion. Choices may be used more than once or not at all. a. scientific fact b. scientific theory c. opinion 12.

13.

14.

15.

The most beautiful sunsets are those observed in deserts.

White-nose syndrome in bats is a disease that is spreading across the United States.

Treating human infections and maintaining hygiene is based on substantial knowledge of germs.

A disease that affects tomatoes, tomato blight, is caused by a fungus.

12. ANS: C DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Analyzing 13. ANS: A DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Analyzing 14. ANS: B DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Analyzing 15. ANS: A DIF: Moderate REF: 1.3 Catching the Culprit OBJ: 1.4 Give specific examples of a scientific fact and a scientific theory.

MSC: Analyzing Match each term describing a level of biological hierarchy with its proper description. Terms may be used more than once or not at all. a. b. c. d. e. f. g.

organism organ molecules biome ecosystem atoms biosphere

16. The individual building blocks of life, such as oxygen, are referred to as ________.

17. Chemical bonds hold hydrogen and oxygen atoms together to form ________.

18. The physical environment, especially the climate, and the organisms that live in deserts throughout the world make up a(n) ________.

19. The liver, a body part composed of different tissue types, is considered a(n) ________.

16. ANS: F DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 17. ANS: C DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 18. ANS: D DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding 19. ANS: B DIF: Moderate REF: 1.4 No End in Sight OBJ: 1.5 Create a graphic showing the levels of biological organization.

MSC: Understanding Match the following terms with the corresponding characteristic of life. a. b. c. d. e.

20.

21.

22.

23.

24.

evolution homeostasis metabolism cell DNA

maintaining a relatively constant internal environment genetic material used to transfer information from parent to offspring the smallest living unit a change in the characteristics of a group of organisms over time the way organisms capture, store, and use energy from the environment

20. ANS: B DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 21. ANS: E DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 22. ANS: D DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 23. ANS: A DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering 24. ANS: C DIF: Easy REF: 1.1 Bat Crazy OBJ: 1.6 Determine whether something is living or nonliving based on the characteristics of living things.

MSC: Remembering

Chapter 02: Evaluating Scientific Claims MULTIPLE CHOICE 1. Your own scientific literacy would NOT be helpful in answering which of the following questions? a. Should I take a cinnamon capsule every morning to help regulate my blood sugar? b. Should I spend the extra money to buy a particular pair of shoes that claims to help tone my leg muscles better than other athletic shoes? c. Will my cell phone cause me to have cancer? d. Which movie should I watch this weekend?

ANS: D DIF: Easy REF: 2.1 True or False?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 2. Which of the following would NOT be a situation where your own scientific literacy would be helpful in decision-making? a. Should I send my child to a school that requires my child be vaccinated according to the vaccination schedule recommended by the Centers for Disease Control? b. Should I pay to store umbilical cord blood when my baby is born? c. Should I vote to support a new oil pipeline through a sensitive natural area? d. Is the space travel in Star Wars really possible?

ANS: D DIF: Moderate REF: 2.1 True or False?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 3. Which of the following statements about the process of science is accurate? a. Science is a systematic method of procedures designed to answer questions by evaluating evidence. b. Science attempts to solve a problem by evaluating the plausibility of only one solution without considering other possible explanations. c. Science does not use evidence and data collected to advance our understanding of natural and supernatural phenomena. d. Science can answer all questions regarding the human experience and personal values.

ANS: A DIF: Difficult REF: 2.1 True or False?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 4. Which of the following is LEAST likely to include unchecked bias when making scientific statements? a. political groups c. marketing groups b. religious groups d. peer-reviewed scientific journals ANS: D DIF: Easy REF: 2.1 True or False? | 2.2 Credentials, Please OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Understanding

5. Therapeutic touch (TT) is a type of ―energy‖ medicine that involves the practitioner moving his or her hands over the energy field of the patient, without actually touching the patient, but redirecting the energy field to heal the patient. If a researcher were to design a survey of TT practitioners and their patients to determine the validity of TT, which of the following questions would NOT be helpful in determining the validity of the survey? a. Is the researcher a regular TT practitioner or patient? b. Do the survey participants have a working relationship with the researcher or were they paid to participate? c. Are any non-TT patients included in the survey? d. How old is the researcher?

ANS: D DIF: Easy REF: 2.2 Credentials, Please | 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Analyzing 6. Which of the following would be a positive consideration when evaluating a researcher’s expertise regarding a particular scientific claim? a. The researcher has an ideological, political, or religious belief that will be supported by the scientific claims being made. b. The researcher stands to make money if others accept the claims being made. c. The researcher stands to gain in prestige if others accept the claims being made. d. The researcher has a PhD, MD, or at least an MS and years of experience in the field in which he or she is making a scientific claim.

ANS: D DIF: Moderate REF: 2.2 Credentials, Please | 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter.

MSC: Understanding 7. An individual claims to be able to detect the presence of graves in an old cemetery by using a ―dowsing‖ or ―divining‖ rod. The rod is a forked twig held in front of the individual as he walks across the cemetery. The ―dowser‖ (person who is using the dowsing rod) claims that depending on which way the twig moves (up and down or side to side) he can determine if there is a grave there and the gender and age of the individual buried at that spot. Which of the following would NOT help evaluate if the dowser is a fraud? a. It would help to know if the dowser had any previous knowledge of the cemetery. b. It would help to actually dig up the site to determine if the dowser’s predictions were accurate. c. It would help to at least use X-rays or some other means to examine what might, or might not, be buried in the ground. d. It would help to know the dowser’s age and affiliation with other dowsers.

ANS: D DIF: Moderate REF: 2.2 Credentials, Please | 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Evaluating 8. Therapeutic touch (TT) is a type of ―energy‖ medicine that involves the practitioner moving his or her hands over the energy field of the patient, without actually touching the patient, to redirect the energy field and heal the patient. Which of the following would be the first concept to investigate to help evaluate the claims of TT practitioners? a. documentable and repeatable evidence that an external energy field actually exists for humans

b. documentable and repeatable evidence that any existing energy field can be manipulated by merely passing hands over it c. documentable and repeatable evidence that TT practitioners can, without seeing their subjects, actually feel the energy field of a patient d. documentable claims by TT practitioners and their patients that the patients thought they felt better after being treated by the TT practitioner even though there was no change in their diseases ANS: A DIF: Difficult REF: 2.2 Credentials, Please | 2.3 To the Books | 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Analyzing 9. You are reading an article written by Neil Shubin et al. regarding the pectoral fin of Tiktaalik roseae in the peer-reviewed journal Nature. Dr. Shubin is a member of the National Academy of Sciences and is employed by The University of Chicago. This article represents a ________ literature presentation of ________ research. a. primary; basic c. secondary; basic b. primary; applied d. secondary; applied ANS: A DIF: Difficult REF: 2.2 Credentials, Please | 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter. | 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 10. You are reading an article in Discover magazine about Tiktaalik roseae, the organism thought to be the link between fish and terrestrial tetrapods. The researcher that discovered Tiktaalik was publicly funded.

This article represents a ________ literature presentation of ________ research. a. primary; basic c. secondary; basic b. primary; applied d. secondary; applied ANS: C DIF: Difficult REF: 2.2 Credentials, Please | 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter. | 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 11. Scientists working for a major cosmetics company are attempting to determine if a new face cream can reduce the number of fine lines and wrinkles on a person’s face. This is an example of a. applied research. c. meta-analysis. b. basic research. d. a cohort study.

ANS: A DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 12. Scientists at a major university are attempting to isolate the gene that slows the degeneration of collagen in skin. This is an example of a. applied research. c. meta-analysis. b. basic research. d. a case-control study.

ANS: B DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying

13. A research team funded by federal grants is studying the coevolution of pain receptors in grasshopper mice and the neurotoxic venom of scorpions (one of their primary food sources) to determine how the mice have adapted to the venom of their prey. This is an example of ________ research. a. basic c. pseudoscientific b. applied d. random ANS: A DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 14. A research team funded by a pharmaceutical company is studying the adaptation of grasshopper mice to the neurotoxic venom of scorpions in an attempt to determine how the mice’s adaptation could be used as a possible solution to pain management in humans. This is an example of ________ research. a. basic c. pseudoscientific b. applied d. random ANS: B DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 15. The federally funded Centers for Disease Control routinely collect and evaluate data regarding communicable diseases. This information helps researchers make recommendations regarding vaccination schedules for children and adults. This is an example of a. basic research. c. a case-control study. b. applied research. d. a cohort study.

ANS: A DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 16. A pharmaceutical company conducts trials on animals and cell lines to determine the safety of a new vaccine before performing clinical trials on adult human volunteers. This is an example of a. basic research. c. a case-control study. b. applied research. d. a cohort study.

ANS: B DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 17. Which of the following examples indicates a situation where the researcher is MOST likely to have a possible bias regarding his or her work? a. A researcher, funded by a pharmaceutical company, is testing the clinical effectiveness and safety of a new vaccine. b. A researcher, funded by a public grant, is testing the clinical effectiveness and safety of a new vaccine. c. A federally funded researcher is working on developing a genetically engineered microbe to quickly digest oil spills. d. A privately funded researcher is working on developing a genetically engineered and patented microbe to quickly digest oil spills. If successful, the microbe would be marketed worldwide.

ANS: D DIF: Difficult REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying

18. You are reading an article in National Geographic regarding the evolution of humans. This would be an example of ________ literature. a. primary c. peer-reviewed scientific journal b. secondary d. meta-analysis ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Applying 19. Announcing ―scientific‖ findings in a press conference before they have been published in an established scientific journal is an example of a. primary literature. b. secondary literature. c. neither primary nor secondary literature because it has not yet undergone peer review to be primary literature, and secondary literature follows primary literature. d. both primary and secondary literature because it does not need to undergo peer review to be either primary or secondary literature.

ANS: C DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Applying 20. The reliability of primary scientific literature is strengthened by the ________ process, in which the work is examined by other leaders in the same field. For instance, a scientific paper examining the evolution of tetrapods would be reviewed by other evolutionary biologists and paleontologists. a. peer-review c. applied research b. basic research d. random research ANS: A DIF: Difficult REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Understanding 21. You are reading a paper in the journal Vaccine that analyzed and combined the results from five observational studies involving over 1 million children and another five studies that compared children with autism to children without autism (a total of nearly 10,000 children). The paper you are reading is best recognized as a a. secondary literature source. b. meta-analysis and primary literature source. c. cohort study. d. case-control study.

ANS: D DIF: Easy REF: 2.4 Correlation or Causation?

OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Applying 22. Based on the scientific evidence presented in the journals Lancet and Vaccine which of the following is NOT the reason for the observed increase in incidence of autism in the United States and other countries since the 1970s? a. There is a heightened awareness of autism in society. b. More schools are screening more students for autism. c. People are generally more willing to label a broader range of conditions within the spectrum of autism disorders. d. The MMR vaccine is being more broadly administered, so more children are getting autism.

ANS: D

DIF: Easy

REF: 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.5 Distinguish between correlation and causation, and give a clear example of each. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience. MSC: Remembering 23. A researcher noticed that as the prevalence of cell phone usage increased between the years of 1998 and 2010 so did the number of individuals diagnosed with autism. He decided that cell phone usage by expectant mothers was causing autism. Which of the following would be the first step in evaluating his assumption? a. The researcher should develop a clearly testable and falsifiable hypothesis. b. The researcher should carefully design a reproducible experiment. c. The researcher’s experiment should include thousands of participants from all gender, socioeconomic, racial, and ethnic groups both with and without autism. d. The researcher should use a small sample size (20 participants) of autistic children and their mothers to support the hypothesis.

ANS: A DIF: Moderate REF: 2.4 Correlation or Causation? | 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing 24. The graph below shows which of the following?

a. There is a strong correlation between the sale/consumption of organic food and the number of individuals diagnosed with autism between 1998 and 2007. b. The increased consumption of organic food has led to an increase in the rate of autism between 1998 and 2007. c. Consuming organic food causes autism. d. There is strong evidence that a cause-effect relationship exists between the consumption of organic food and the development of autism.

ANS: A DIF: Moderate REF: 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying

25. Thomas’s foot began to swell after he was stung by a scorpion. Thomas’ friend said his mom had an old, trusted herbal poultice remedy that would absorb the venom from the foot, reduce the swelling, and heal the foot. Thomas allowed his friend to place the herbal poultice on his foot before going to bed that night, and the swelling was gone in the morning. Which of the following can be concluded about the herbal poultice remedy? a. The poultice definitely worked because the swelling went down. b. The poultice definitely did not cause the swelling to go down. c. It is very likely that the poultice caused the swelling to go down. d. There is not anything that can be concluded about the effectiveness of the poultice remedy.

ANS: D DIF: Difficult REF: 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying 26. When Lori was diagnosed with breast cancer, the doctor recommended a lumpectomy followed by radiation therapy. Lori underwent the prescribed treatment recommended by the doctor. However, she also continued to eat lots of fruits and vegetables, walk three miles every day, and complete a daily yoga practice. Within about three months Lori was cancer-free. Afterward, Lori told everyone that her healthy lifestyle had helped to cure her. Is this conclusion reasonable given the circumstances? a. No, a healthy diet and exercise regimen can never help cure cancer. b. No, there are too many confounding factors to know exactly what happened. c. Yes, the healthy diet and exercise regimen definitely helped to cure her. d. Yes, this evidence very strongly supports the hypothesis that a healthy diet and exercise regimen probably helped to cure her.

ANS: B DIF: Difficult REF: 2.4 Correlation or Causation? | 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing 27. The fact that the onset of autism symptoms typically occur at about the same age children receive many of their vaccinations, including the MMR, is an example of an observed a. correlation but not necessarily evidence of a cause-effect relationship. b. correlation and strong evidence of a cause-effect relationship. c. and evidence supported cause-effect relationship. d. cause-effect relationship but not necessarily a correlation.

ANS: A DIF: Difficult REF: 2.4 Correlation or Causation?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing 28. Which of the following is NOT a reason to scientifically evaluate the plausibility of claims made by a psychic who states that a missing child is alive and located in a particular area of the countryside months after the child went missing? a. Precious time finding the child could be lost. b. Manpower could be wasted looking in a location when there is no evidence indicating the child might be there. c. It could cause additional and unnecessary grief when the new hopes and expectations of the parents are dashed. d. There is anecdotal evidence suggesting that psychics can predict the location of missing children.

ANS: D

DIF: Difficult

REF: 2.4 Correlation or Causation? | 2.5 Real or Pseudo?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying 29. Rick has high blood pressure and decides to try an herbal supplement recommended by his friend.

Which of the following questions should Rick ask first to scientifically evaluate his friend’s recommendation before he begins taking the herbal supplement? a. Has this herbal supplement been studied in a clinical trial by trained medical professionals? b. If this supplement was studied, who paid for the study? c. If this supplement was studied, how many people were included as patients in the study? d. What are the credentials of the team investigating the supplement?

ANS: A DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter.

MSC: Applying 30. Although it seems contradictory, real science does not intend to ―prove‖ a hypothesis to be true. This is because a. all true hypotheses will be rejected by the scientific method because they can be proven false. b. future experiments or discoveries may provide data that refutes the hypothesis. c. science is a human endeavor, and like all human endeavors, it is limited by human understanding. d. the scientific method is limited to examination of the natural world.

ANS: B DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter.

MSC: Analyzing 31. Developing a scientific understanding of a natural phenomenon typically begins by a. observing a quantifiable natural phenomena. b. proving an answer. c. making a prediction. d. testing a hypothesis.

ANS: A DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Remembering 32. Sue has twin baby boys and is trying to decide whether to have them vaccinated against chicken pox or to take them to a ―chicken pox party‖ where they can be naturally exposed to other children who currently have chicken pox. Which of the following would be the first relevant question for Sue to research before making her decision? a. Are there any peer-reviewed, scientific studies of observable and quantifiable claims regarding the chicken pox vaccine or chicken pox parties? b. Do any relevant studies make testable and falsifiable predictions related to a clearly stated hypothesis? c. Are the relevant studies well designed and described with large sample sizes and minimization of bias, and have the results been reproducible? d. Are there a lot of parents on the Internet endorsing the chicken pox parties?

ANS: A DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 33. When determining whether a claim about a new cleansing juice diet is scientific or pseudoscientific, which of the following is NOT a helpful question to ask yourself? a. What are the credentials and possible bias or agenda of the person(s) making the claim? b. Has the claim been published in a peer-reviewed, reputable scientific journal? c. Does the scientific study purporting to support the claim meet the standards of the scientific method? d. Are there a lot of people, including celebrities, endorsing the product as a healthy weight-loss method?

ANS: D DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Understanding 34. A popular post on the Internet states that hugs ―transfer energy‖ between participants, giving them an ―emotional lift.‖ Which of the following is a scientific approach to evaluating the claim of ―energy transfer‖ during hugs? The hypothesis for the experiment would be as follows: if one person hugs another, the person receiving the hug will have more measurable energy after the hug. a. First, develop a method of physically measuring the amount of energy available in a human being. Divide hundreds of subjects randomly into two groups, huggers and nonhuggers. The available energy in the individuals of each group would be measured, the individuals would then hug (or not), and then the energy levels are measured again. The experimenter should not know which group is the hugging or nonhugging group to avoid expectation bias. The experiment should be repeated numerous times before analyzing the data. b. The researcher would need some people willing to hug someone else and fill out a survey stating how they felt before and after the hug. This should be repeated several times. c. The researcher would need some people willing to keep a daily log of how they feel during the day, how many hugs they get, and which days they feel the best at the end of the day. d. The researcher would need some people willing to complete a scientifically developed life history hugging survey. Through the survey, participants will document their own life histories of hugs (average number of hugs per day and how long they lasted) and emotional well-being. Once the survey is completed, the researcher will collate and evaluate the evidence. He or she should repeat this with a few different groups of people.

ANS: A DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Evaluating 35. In the fall of 2012, a veterinarian from Texas issued a press release stating that her team of scientists had completed a five-year DNA study confirming the existence of ―Sasquatch‖ or ―Bigfoot.‖ Which of the following statements, if true, would lend support to her claims? a. She released her findings in a press conference prior to any peer review of her findings. b. There are no corresponding lines of documented physical evidence (fossil record, historic record, undisputed clear picture or video, or evidence that the environment could support a breeding population of large primates in the areas where they have been reported) to support her claims. c. The paper is published in an online source that consists of one issue with only this one paper (the full paper is for sale), and this new online publication is owned by the veterinarian. d. She consulted experts in the field of human genomics and made her DNA samples available to them for analysis.

ANS: D

DIF: Moderate

REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Analyzing 36. Announcing ―scientific‖ findings in a press conference before they have been published in an established scientific journal suggests a. there may be reason to question the validity of the results or conclusions. b. that the results were too ground-breaking to wait for or need peer review. c. there is no reason to question the validity of the results. d. that the media has scientifically determined the results to be valid and repeatable.

ANS: A DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Understanding 37. A scientific paper that combines results from several cohort studies and a case-control study would be considered a(n) ________-analysis. a. meta c. omega b. beta d. pseudo ANS: A DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 38. Observational studies that follow a particular group of individuals over a certain time period are ________ studies. a. case-control c. beta-analysis b. meta-analysis d. cohort ANS: D DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Remembering 39. If the Centers for Disease Control’s recommended vaccination schedule is delayed, the children who do not receive their vaccines on schedule a. are just as well protected from diseases as they would be if they were on schedule. b. experience a decreased risk of contracting disease than they would experience if they were on schedule. c. experience no change in protection from diseases as they would experience if they were ahead of schedule. d. experience an increased risk of disease.

ANS: D DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Remembering 40. Which of the following situations might present a logical reason for accepting a scientific claim made by a person who did not have appropriate credentials for making that claim? a. The claim could be supported by other nonbiased and credentialed scientists who have conducted similar research and arrived at the same conclusion and been reviewed by their peers. b. The claim could be supported by many other noncredentialed people who share the same ideas. c. The claim could be supported because the person really, truly believes what he or she is

saying is accurate from his or her own personal experiences. d. The claim could be supported because certain celebrities have endorsed the idea presented by this particular researcher.

ANS: A DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 41. Scientific studies that compare patients with a disease to those without the disease are referred to as a. case-control studies. c. cohort studies. b. clinical trials. d. in vitro studies.

ANS: A DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering 42. Which of the following would NOT be a reason for a peer-reviewed paper to be retracted by its publisher as untrue or inaccurate? a. The author has made a clear error in the scientific process. b. It has been shown that the author plagiarized someone else’s work. c. It has been discovered that the author violated ethical guidelines or was involved in other scientific misconduct. d. Other researchers have published work that appears to contradict the paper in question.

ANS: D DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Understanding 43. A scientist publishes a paper in a peer-reviewed journal; this paper is later retracted. Which of the following (if found to be true) is NOT a legitimate reason for the retraction? a. The study involved only 12 participants, but sweeping conclusions were made by the author. These participants were not randomly sampled; they were picked specifically for their symptoms. Furthermore, there was no control group. b. The findings could not be replicated, and there were many peer-reviewed studies, including millions of participants that found no evidence for the claims of the original paper. c. The primary author of the paper received large amounts of money as a paid expert for lawyers who were suing companies based on the author’s claim. The author would also benefit financially in other ways, such as patents on alternative products. d. Although the findings were not replicated by other researchers, some studies indicated that the original paper might suggest a valid line of reasoning and warrants further investigation.

ANS: D DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 44. You discover that a holistic treatment called ―ear candling‖ involves putting the end of a wax-coated cloth cone (a ―candle‖) into your ear and lighting it on fire, letting it burn to within about four inches of your face, and then repeating with a new candle. This process is supposed to remove tension, anxiety, and stress from your body. Which of the following statements or questions would be MOST helpful in scientifically evaluating these claims? a. Your great-aunt used ear candling on all of her children and grandchildren and they have all lived long and healthy lives. b. Have there been any studies that measured the feelings of well-being in individuals before and after ear candling?

c. Ear candling has been used for centuries by many different cultures to cure earaches, reduce stress, and promote general well-being. d. Have there been any reproducible, peer-reviewed studies that compared ear candling in individuals who have ear infections with those who do not have ear infections?

ANS: D DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 45. According to the Centers for Disease Control (CDC), by the end of September 2014, roughly 8,000 cases of whooping cough had been reported in California for that year; more than 250 patients (mostly infants and young children) were hospitalized with 58 of them requiring intensive care. Several other childhood diseases that were once common but then eradicated through high vaccination rates have returned since the antivaccination movement grew in the 1990s. The epidemiological data collected by the CDC indicates this resurgence of childhood diseases is most likely the result of a. reduced herd/community immunity. b. reduced vaccine effectiveness. c. increased virulence of the pathogens causing these diseases. d. simply the increased number of people present in the United States.

ANS: A DIF: Moderate REF: 2.6 Fears versus Facts OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 46. The figure below, based on data collected by The National Institute of Allergy and Infectious Diseases, graphically illustrates that as

a. increasingly more individuals in a community are vaccinated against a particular pathogen, future outbreaks of the disease are limited to fewer individuals because fewer people will become infected and then pass it on. b. individuals in a community become ill, increasingly more individuals either become ill or think they are becoming ill as they find out about the illness from friends, family, and the media. c. increasingly more individuals in a community are vaccinated against a particular pathogen, future outbreaks of the disease are limited to fewer individuals because fewer people think they can become ill. Just the idea of vaccines protecting from disease will make people think they are protected so they will not experience any symptoms. d. a population of individuals is infected with a particular pathogen, more and more people will become infected. This is beneficial because everyone will always survive, and their offspring will be immune to any future infections.

ANS: A DIF: Difficult REF: 2.6 Fears versus Facts OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Analyzing 47. The figure below, based on data collected by The National Institute of Allergy and Infectious Diseases, graphically illustrates that a disease is less likely to spread to vulnerable members of a population if most of the population is immunized against the disease. This phenomenon occurs because

a. when fewer individuals in the population are likely to become infected, fewer people are able to spread the disease, and the vulnerable members of the population are less likely to come in contact with contagious individuals. b. if more individuals in the population become infected, fewer people are able to spread the

disease, and the vulnerable members of the population are less likely to come in contact with contagious individuals. c. if more individuals in the population become infected, more people are able to spread the disease, and the vulnerable members of the population are less likely to come in contact with contagious individuals. d. when none of the population is immune to the disease, no one will contract the disease and therefore pass it on to the vulnerable members of the population.

ANS: A DIF: Difficult REF: 2.6 Fears versus Facts OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Analyzing 48. The graph below shows that post vaccination program, the number of adult meningitis cases is

a. strongly correlated with the number of childhood meningitis cases; this appears to be related to the increased vaccination rates in children. b. not correlated with the number of childhood meningitis cases; there appears to be no relationship to the increased vaccination rates in children. c. weakly correlated with the number of childhood meningitis cases; there appears to be no relationship to the increased vaccination rates in children. d. strongly but negatively correlated with the number of childhood meningitis cases; this is caused by the increased vaccination rates in children.

ANS: A DIF: Difficult REF: Chapter 2 Infographic OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing 49. The graph below shows that after the childhood vaccination program was initiated in the United Kingdom in 1999, the annual number of meningitis cases in children

a. decreased to nearly zero by 2004, as did the meningitis rate for adults. b. increased to over 700 in 1999 before slowly decreasing in 2000, as did the meningitis rate for adults. c. did not decrease or increase; there was also no change in the meningitis rate for adults. d. decreased to zero by 2000, as did the meningitis rate for adults.

ANS: A DIF: Moderate REF: Chapter 2 Infographic OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing 50. When Anna Eaton was deciding whether to vaccinate her baby, Caroline, she came across the fact that the onset of autism symptoms typically occurs around 16–24 months of age. Most children receive the MMR vaccine around the age of 15 months. This is an example of a a. definite cause-effect relationship, but there is no support for a correlation between the MMR vaccine and autism. b. correlation, but there is no support for a cause-effect relationship between the MMR vaccine and autism. c. definite cause-effect relationship and full support for a correlation between the MMR vaccine and autism. d. negative correlation between the MMR vaccine and autism and full support of a cause-effect relationship.

ANS: B DIF: Moderate REF: 2.4 Correlation or Causation?

OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying COMPLETION 1. If a statement about how the natural world works can be supported (or not) by using the scientific method, the statement is a(n)________ claim ANS: scientific DIF: Easy REF: 2.1 True or False?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter.

MSC: Remembering

2. When individuals use the scientific process to question information and make informed decisions about the world around them, they are acting in a(n) ________ literate manner.

ANS: scientifically DIF: Moderate REF: 2.1 True or False?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 3. The U.S. federal government funds the vast majority of scientific research intended to expand the ―fundamental knowledge base‖ of sciences such as the life sciences, biomedicine, and agriculture. Since the funding comes from taxpayers, this ________ research is not considered biased.

ANS: basic DIF: Easy REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Remembering 4. Peer-reviewed scientific journals, technical reports, conference proceedings, and dissertations are considered ________ literature.

ANS: primary DIF: Easy REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering 5. Claims that are characterized by scientific-sounding statements, beliefs, or practices but are not actually based on the scientific method are properly viewed as ________.

ANS: pseudoscience DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Remembering 6. A company is spending $200 million to determine if a newly isolated plant extract will help increase the effectiveness of an antidepressant drug currently on the market. This research would be an example of ________ research.

ANS: applied DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Applying 7. Anna Eaton went to her local library to begin a search for answers regarding vaccination. She checked out and read a textbook about how vaccines work. This textbook is an example of ________ literature.

ANS: secondary DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in

the latter.

MSC: Understanding

8. The MMR vaccine became available in the late 1960s. In the early 1970s, organizations began recording the number of people with autism. The incidence of autism has increased 20- to 30-fold since that time.

The number of children immunized with the MMR vaccine has also increased since that time. This rise in the rate of autism with the increased use of vaccines is a ________.

ANS: correlation DIF: Easy REF: 2.4 Correlation or Causation?

OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Understanding 9. If we examine 100,000 children who have never had the MMR vaccine and 100,000 children who have received the vaccine and find that both groups of children have the same rate of autism, our data would NOT support the idea that the MMR vaccine ________ autism.

ANS: causes DIF: Moderate REF: 2.4 Correlation or Causation?

OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying 10. Claims that are vague, based on unclearly stated research questions and hypotheses, or are contrary to well-documented facts about the physical and natural world are considered ________ claims. These claims fail to generate testable and falsifiable predictions.

ANS: pseudoscientific false DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Understanding 11. The spread of measles to individuals who cannot be vaccinated is minimized and/or preventable by ________, which is promoted by vaccinating a critical portion of the population with the measles vaccine.

ANS: herd immunity DIF: Moderate REF: 2.6 Fears versus Facts OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Understanding 12. Vaccines approved for use are continually monitored and tested for ________ by the FDA. ANS: safety DIF: Easy REF: 2.6 Fears versus Facts OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Remembering

SHORT ANSWER 1. Why would it be beneficial for you to be scientifically literate when choosing whether to purchase expensive workout apparel that claims to reduce muscle fatigue and promote circulation better than other brands of apparel?

ANS: It would benefit me to understand how to evaluate the claims to ―reduce muscle fatigue‖ and ―promote circulation‖ because there may be no scientific evidence supporting the claim that the more expensive clothes do this or are any better at doing this than a less expensive brand. I would waste my money if the less expensive brand does these things just as well as the more expensive brand.

DIF: Moderate REF: 2.1 True or False?

OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Applying 2. What is a first step an individual should take when beginning to assess a ―scientific‖ claim made by another person?

ANS: A first step toward assessing the strength of a person’s scientific claim is to check her credentials. Does the individual have a degree, such as a PhD or MD, and is her degree in a field directly related to the area in which she is asserting expertise? It would be suspicious if the individual has a PhD in business and is making claims about a new wonder drug.

DIF: Moderate REF: 2.2 Credentials, Please OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter.

MSC: Understanding 3. A large biotech company would like to market a microbe that will help clean up oil spills in the ocean by actually consuming and detoxifying the oil. Would this research be basic or applied? Explain your answer.

ANS: This would be applied research because the scientific knowledge is being applied to a human/environmental issue with potential commercial application. There is the potential for bias on the part of the researcher if he or she stands to benefit either financially or professionally from the findings.

DIF: Difficult REF: 2.2 Credentials, Please OBJ: 2.4 Compare and contrast basic and applied research, and give an example of each.

MSC: Understanding 4. Cheryl searches the Internet for information regarding the use of a particular herbal supplement because she has heard claims that it will help her safely build muscle while losing fat. During her search she comes across a site that claims to have evidence to support those claims. What questions should Cheryl ask herself as she peruses the site?

ANS: What evidence does the site share? If there was a study, where was the study conducted? Who paid for the study? Is there a description of the study readily available for me to read? Maybe most importantly, was the study published in a peer-reviewed scientific journal or in primary literature? Additionally, she would want to ask if the site is trying to sell her a product.

DIF: Difficult

REF: 2.3 To the Books

OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Applying 5. Evaluate the following and determine whether the treatment method is most likely based on science or pseudoscience. Provide a brief explanation of your answer. ―The symptoms of your cold are similar to those of mercury poisoning, so mercury should be the remedy you use. Of course, you should dilute it by using one part mercury to one trillion parts of pure water. This one all-natural remedy will treat all of your symptoms. You can trust this method because it is a very widely used system of medicine in the world and its popularity is growing. Babies and pregnant women can use this method with no adverse effects and it works in harmony with your immune system.‖ ANS: This treatment is most likely based on pseudoscience. The statement uses scientific-sounding terminology without applying the scientific method/process. Although it would be possible to design an experiment to test a hypothesis with clearly measurable, testable, and falsifiable predictions, no such experiment has been mentioned nor have any results been presented. Overstated conclusions are presented as fact. Just because a method is ―all natural,‖ ―widely used,‖ or ―growing in popularity‖ does not mean that it is effective or has been scientifically evaluated and peer-reviewed.

DIF: Difficult REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Evaluating 6. The graph below illustrates the predicted number of meningitis cases with or without herd immunity after the initiation of the meningitis vaccination program in the United Kingdom in 1999. Write a short paragraph comparing the observed number of cases to the predicted number of cases. Assess the predictive value of the model used to generate the graph and how this relates to the prediction of the number of cases that would exist without herd immunity.

ANS: Comparing the number of predicted cases with herd immunity to that of observed cases demonstrates a very close correlation between the two data sets. Assuming that the vaccination program successfully generated herd immunity in the population, we can deduce that the model used to make the predictions is accurate. If the model can accurately predict the number of ―meningitis cases with herd immunity,‖ then it is also likely to accurately predict the number of ―meningitis cases without herd immunity.‖ DIF: Difficult

REF: Chapter 2 Infographic

OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Analyzing | Evaluating 7. How does a chicken pox vaccine stimulate immunity in an individual human? Be sure to accurately include the following terms: antibodies, disease organism, immune system, vaccine, virus.

ANS: A vaccine containing a harmless form of the chicken pox virus is injected under the skin of the individual. When the individual’s immune system encounters the virus, the immune system will begin to produce antibodies that recognize the virus. If some time later the individual is exposed again to the chicken pox virus, his or her immune system is already primed with antibodies to attack the invading virus.

DIF: Moderate REF: 2.0 Intro OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 8. Your best friend, Joe, is selling a new apparatus he claims will generate ―alkaline water‖ (having pH levels greater than 8) for you to drink in your own home. Joe also claims that drinking ―alkaline water‖ will decrease your risk of getting cancer, lower your blood pressure, lower your blood sugar, improve your digestion, balance your body’s energy, and generate a sense of well-being. You can own your own machine for just $2,500 plus shipping and handling! Which of Joe’s claims are scientific and which are pseudoscientific? Include rationale, such as which claims could be tested in a lab, and describe why it is important to question Joe’s claims.

ANS: First of all, the pH of the water produced by the machine could be tested to determine the actual pH; this would be a testable scientific claim. Another claim that could be tested is that it will lower your blood pressure and it will lower your blood sugar. The claim that it will lower your risk of getting cancer would require more time to test, but could possibly be tested. If you wanted to test how much it improves your digestion, you would need to determine how to measure that improvement. All of these testable things would also require testing on many people to support, or not, Joe’s claims. Joe’s claims that it will ―balance your body’s energy and generate a sense of well-being‖ are vague and nondescript claims that would be extremely difficult if not impossible to test, so these are probably pseudoscientific claims. It is important to question or test Joe’s claims because the machine is expensive and even if it really does make ―alkaline water,‖ it might not actually be good for me.

DIF: Difficult REF: 2.1 True or False? | 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Understanding | Applying 9. In 2015, the dietary supplements industry, including herbal remedies and energy drinks, in the United States grossed somewhere between 12 and 24 billion dollars in sales. The FDA regulates the safety and manufacture of conventional, pharmaceutical drugs before they are marketed to consumers. However, the companies that produce dietary supplements are responsible for evaluating the safety and purity of their own products before these are marketed to consumers. The FDA is only responsible for taking action against any adulterated or misbranded dietary supplement product after it reaches the market and consumers. The FDA will also issue warnings about a product after adverse reactions have been reported.

Your friend, Vivian, is selling a fruit juice that contains a ―secret, proprietary blend‖ of herbal ingredients. Vivian tells you that this fruit juice cured her dad’s migraine headaches, so you should use it to cure your migraines and quit taking the medicine prescribed for you by your doctor. Write at least three steps you should take before you decide to follow Vivian’s advice about the juice.

ANS: 1. Try to discover what is in the ―secret, proprietary blend‖ because I might be allergic to one of the ingredients.

2. Look up the product to see if there are any health warnings (like from the FDA) that have been issued regarding the product or its ingredients.

3. Consult secondary literature to gain a basic understanding of the product and any claims associated with it.

4. Consult primary literature to discover if there are any peer-reviewed scientific studies investigating the effectiveness and safety of the product and its ingredients.

5. Check to see who conducted and paid for any published studies regarding the product.

DIF: Difficult REF: 2.1 True or False? | 2.2 Credentials, Please | 2.3 To the Books OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Analyzing | Evaluating 10. Why is it necessary to receive a new flu vaccine each year?

ANS: A new flu vaccine is needed each year because the flu virus changes (mutates) rapidly and the strains going around each year are usually different from the previous year.

DIF: Easy REF: 2.0 Intro OBJ: 2.2 Explain the importance of scientific literacy for making informed decisions.

MSC: Understanding 11. You see a blog post on social media stating that this year’s flu vaccine is not very effective against the strains of flu currently going around. The post urges readers to avoid the vaccine because it might actually give you the flu.

What steps should you take and what types of information should you consider when evaluating this statement before deciding whether to get vaccinated with this year’s flu vaccine? Be sure to include examples of primary versus secondary literature.

ANS: Some of the things I should consider before making my decision would include the following: Is my friend a trained physician, what do reliable secondary scientific sources (WebMD) say about the vaccine, what do peer-reviewed scientific articles (primary sources might include CDC articles but definitely Journal of American Medical Association) say about the vaccine, and is there any benefit other than preventing this year’s flu? Although this year’s vaccine might not prevent me from getting the flu this year, it might prevent my getting the flu that will be going around in the future. Is there any peer-reviewed, scientific evidence that getting the flu vaccine will actually give me the flu?

DIF: Difficult REF: 2.0 Intro | 2.1 True or False? | 2.2 Credentials, Please | 2.3 To the Books OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Applying 12. Between 1997 and 2007, mobile cell phone subscriptions have steadily increased from 18 users per 100 inhabitants to roughly 97 users per 100 inhabitants in developed countries. During this same time, diagnosed cases of autism have also steadily increased from around 50,000 to 250,000. Your friend decides that cell phones must cause autism. Briefly describe what your response would be to your friend’s conclusion, indicating any possible relationship(s) that may or may not exist.

ANS: I would tell my friend that although there seems to be a positive correlation (as one variable has risen, so has the other) between the use of cell phones in the developed world and the occurrence of autism, this data does not establish a cause-effect relationship between the two variables. There could be many other things influencing the autism rate. Someone would need to conduct some scientific experiments to demonstrate a cause-effect relationship between these two variables.

DIF: Difficult REF: 2.4 Correlation or Causation?

OBJ: 2.5 Distinguish between correlation and causation, and give a clear example of each.

MSC: Applying | Analyzing 13. Medical researchers at the University of Sydney in Australia examined data from several cohort studies and several case-control studies regarding links between vaccines and autism. Overall, these studies included more than 1.25 million children from four different countries and vaccines for five different diseases. The conclusion of this paper indicates that there is no link between vaccines and autism. This work was published in the peer-reviewed journal Vaccine, and there is no evidence that the researchers at the University of Sydney have any conflict of interest with vaccines or treatment of autistic children.

Briefly describe this type of study and research (including if it is basic or applied research) and evaluate the strength of the researchers’ claim that there is no link between vaccines and autism. List four lines of evidence to support your assertion.

ANS: This type of study is a meta-analysis that combines, analyzes, and evaluates the results from different studies. There is a very good chance that the researchers’ conclusion is supported with solid science.

First, the research team appears to have the appropriate credentials for investigating claims regarding vaccines and autism. Second, the study meets the standards of real science by including various lines of evidence and large sample sizes. Third, the study has been reviewed by other researchers specializing in the field of vaccines and then published in the primary literature. Fourth, there is no evidence of a conflict of interest; the researchers are not trying to sell us something or support some sort of nonscientific belief.

DIF: Difficult REF: 2.2 Credentials, Please | 2.3 To the Books | 2.5 Real or Pseudo?

OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter. | 2.4 Compare and contrast basic and applied research, and give an example of each. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Analyzing 14. A friend tells you that vaccines, in general, are not safe and that no one is keeping track of the side effects and dangers associated with vaccines. Your friend has decided that he will not be vaccinated and will not have any of his children vaccinated. You want to encourage your friend to reconsider his views, so you share with him that there are actually various organizations continually testing and evaluating vaccines for effectiveness, safety, and side effects. Summarize the three ways this occurs.

ANS: 1. New vaccines are extensively tested on animals or cell lines before clinical trials on adult human volunteers even begin. Only if the vaccine is safe and effective will the U.S. FDA approve it for commercial sale.

2. Even after approval, every facility manufacturing vaccines is inspected by the FDA, each vaccine batch is tested for safety/purity/potency, and anyone can report a vaccine adverse reaction to the Vaccine Adverse Event Reporting System (VAERS).

3. Before a vaccine is added to the official list of recommended immunizations, all of the data regarding that vaccine is reviewed by the Advisory Committee on Immunization Practices (ACIP) and then again by the director of the Centers for Disease Control (CDC).

DIF: Difficult REF: 2.6 Fears versus Facts OBJ: 2.1 Evaluate a scientific claim, using the process described in the chapter. | 2.2 Explain the importance of scientific literacy for making informed decisions. | 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying | Analyzing MATCHING Which of the following texts are examples of primary literature and which are examples of secondary literature? a. primary b. secondary 1.

2.

3.

4.

5.

6.

7.

8.

Biology Now 2e, your textbook review articles found in peer-reviewed scientific journals Journal of the American Medical Association, a peer-reviewed scientific journal Science, a peer-reviewed scientific journal National Geographic, a popular magazine about science and the world Discover, a popular magazine about science Popular Science, a popular magazine about science The Proceedings of the 15th Annual Meeting of the Society for Integrative and Comparative Biology, a publication of peer-reviewed presentations at a professional meeting

1. ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 2. ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 3. ANS: A DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 4. ANS: A DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 5. ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 6. ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 7. ANS: B DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding 8. ANS: A DIF: Moderate REF: 2.3 To the Books OBJ: 2.3 Distinguish between secondary and primary literature, and explain the role of peer review in the latter.

MSC: Remembering | Understanding Indicate which of the following examples are most likely ―real science‖ and which are most likely ―pseudoscience.‖

a. real science

b. pseudoscience

9. This herbal remedy must work because people have used it for thousands of years and it always makes them feel better.

10. Facilitated Communication only works when everyone in the room believes it will work.

11. When this herbal remedy was given to 1,500 individuals who suffer from high blood pressure, 75 percent of those individuals experienced a decrease in their blood pressure. This was compared to a decrease in the blood pressure of 35 percent of the 1,500 individuals who were given the placebo.

Another 1,500 participants in the study were given the standard blood pressure medication and 73 percent of those individuals experienced a reduction in their blood pressure.

12. Dr. Simoncini insists, on his website, that cancers are actually fungal infections that can be cured by increasing the pH of the human body. He will gladly cure your cancer for 500,000 euros.

13. The Baylor College of Medicine publishes peer-reviewed research indicating that immunotherapy can help fight certain types of cancer.

14. The Journal of the American Medical Association publishes an article showing a link between certain strains of the Human Papilloma Virus (HPV) and cancers of the urogenital tracts in both females and males.

9. ANS: B DIF: Moderate REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 10. ANS: B DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 11. ANS: A DIF: Easy REF: 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 12. ANS: B DIF: Moderate REF: 2.2 Credentials, Please | 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 13. ANS: A DIF: Easy REF: 2.2 Credentials, Please | 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying 14. ANS: A DIF: Easy REF: 2.2 Credentials, Please | 2.5 Real or Pseudo?

OBJ: 2.6 Determine whether a scientific claim is based on real science or pseudoscience.

MSC: Applying

Chapter 03: Chemistry of Life MULTIPLE CHOICE 1. The subatomic particles that possess a single negative charge and surround the nucleus are the a. isotopes. c. neutrons. b. protons. d. electrons.

ANS: D DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 2. Nitrogen has seven protons, seven neutrons, and seven electrons. What is the atomic mass of nitrogen? a. 0 c. 14 b. 7 d. 21

ANS: C DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 3. The bonds connecting the atoms in the molecule below are ________ bonds

a. polar, hydrogen b. polar, covalent

c. nonpolar, ionic d. nonpolar, covalent

ANS: B DIF: Moderate REF: 3.1 One Picture, a Thousand Experiments OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Analyzing 4. Which of the images shown below illustrates both hydrogen bonds and covalent bonds? a. c.

b.

d.

ANS: A DIF: Difficult REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Analyzing 5. O2, also termed atmospheric oxygen, is formed by a covalent bond between two oxygen atoms. This type of bond involves oxygen atoms a. releasing protons. c. sharing protons. b. releasing electrons. d. sharing electrons.

ANS: D DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 6. Atoms in a single molecule of methane, CH4, share electrons. Methane is formed by ________ bonds joining ________ atoms. a. hydrogen; 2 c. ionic; 5 b. covalent; 5 d. ionic; 2 ANS: B DIF: Moderate REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Applying 7. The chemical reaction that represents photosynthesis is 6 H2O  6 CO2  C6H12O6  6 O2. What are the reactants? a. H2O and CO2 c. H2O and O2 b. C6H12O6 and CO2 d. C6H12O6 and CO2 ANS: A DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Applying 8. The subatomic particles that possess a single negative charge, surround the nucleus, and are lost or gained by atoms called ions are the a. isotopes. c. neutrons. b. protons. d. electrons.

ANS: D DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 9. Sodium chloride (table salt) is formed when positively charged sodium ions and negatively charged chloride ions are chemically attracted to each other. This attraction is best described as a(n) a. hydrogen bond. c. covalent bond. b. ionic bond. d. solution.

ANS: B DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 10. In the chemical reaction that forms hydrogen peroxide (H2O2), hydrogen and oxygen share electrons, creating ________ bonds between the two atoms. a. covalent c. hydrogen b. peptide d. ionic ANS: A

DIF: Easy

REF: 3.0 Intro

OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Applying 11. Ionic bonds ________, whereas covalent bonds ________. a. form between the same two elements; form between different elements b. hold together compounds that do not dissolve in water; hold together molecules that dissolve in water c. hold together oppositely charged atoms; hold together atoms that share electrons d. consist of atoms with partial charges; consist of atoms with full positive and negative charges ANS: C DIF: Moderate REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 12. When calcium (Ca) and chloride (Cl) interact with one another, they bond using ________ bonds. a. hydrogen c. covalent b. peptide d. ionic ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Applying 13. Hydrogen and oxygen atoms are held together within an individual water molecule by ________ bonds. a. hydrogen c. polar covalent b. peptide d. ionic ANS: C DIF: Moderate REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 14. Which of the following is likely to participate in ionic bonding? a. Li c. He b. H2O d. C6H12O6 ANS: A DIF: Moderate REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Analyzing 15. Individual water molecules orient toward each other because of the ________ bonds that form between them. a. covalent c. hydrogen b. peptide d. ionic ANS: C DIF: Easy REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Understanding 16. Which of the following is correct about hydrogen bonds? a. Individually, hydrogen bonds are very strong. b. They form between neighboring oxygen atoms. c. They do not involve binding with a hydrogen atom. d. They form due to partial positive and partial negative charges on atoms.

ANS: D DIF: Difficult REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those

bonds produce the unique properties of water.

MSC: Remembering

17. Which of the labeled areas of the water molecule pictured below possesses a partial negative charge?

a. A only b. B only

c. C only d. A and C

ANS: B DIF: Moderate REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Applying 18. If iodide ions (I) were dissolved in water, they would be attracted to

a. A only. b. B only.

c. C only. d. A and C.

ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Analyzing 19. Neighboring water molecules are held together with hydrogen bonds because a. partially negatively charged oxygen atoms and partially positively charged hydrogen atoms on separate water molecules are attracted to one another. b. the hydrogen and oxygen atoms within a single water molecule share electrons equally. c. the oxygen and hydrogen atoms that participate in hydrogen bonding are sharing electrons within a single valence shell. d. ionic interactions repel water molecules from hydrophobic oils that may be present in a

solution.

ANS: A DIF: Difficult REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Evaluating 20. Ice floats on water because a. the crystal structure of ice is more regular than that seen in liquid water. b. the distance between water molecules in ice is greater than in liquid water. c. the cool temperature of ice reduces the extent of molecular motion relative to liquid water. d. when ice forms, the hydrogen bond in the water molecule becomes nonpolar; ice behaves like oil.

ANS: B DIF: Difficult REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Analyzing 21. When sodium chloride (NaCl) is dissolved in water, the sodium ion is a. attracted to the hydrogen atoms of water molecules. b. repelled by the oxygen atoms of water molecules. c. attracted to other sodium ions that are being dissolved. d. attracted to the oxygen atoms of water molecules.

ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Analyzing 22. In living systems, a critical component of many reactions is a. carbon dioxide. c. water. b. calcium. d. hydrogen sulfide.

ANS: C DIF: Moderate REF: 3.3 The Smell of Success OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Remembering 23. Oil and water do not mix well because a. water is polar and oil is nonpolar. b. only identical molecules of the same chemical can easily mix. c. water has hydrogen bonds and oil is polar. d. water and oil are covalently bonded.

ANS: A DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying 24. You are given an unknown substance and asked to determine whether it is polar or nonpolar. The easiest way to do this would be to a. determine whether the compound is held together by hydrogen bonds. b. determine the number of electrons in the compound’s outer shell. c. mix the compound with an ionic substance to see whether its bonds can withstand the pressure. d. determine whether the compound dissolves in water.

ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Analyzing

25. In making her morning tea, Dorothy drops a sugar cube into the hot water. She stirs the mixture but no longer sees the sugar cube at the bottom of her mug. In this scenario, the sugar is a. nonpolar. c. an acid. b. the solvent. d. a solute.

ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying 26. In making her morning tea, Dorothy drops a sugar cube into some hot water. She stirs the mixture but no longer sees the sugar cube at the bottom of her mug. Based on her observation of sugar dissolving in hot water, she can properly conclude that the sugar is a. hydrophobic. c. hydrophilic. b. nonpolar. d. inert.

ANS: C DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying 27. A carwash attendant offers to treat Martin’s windshield with a protective agent. This substance coats the glass, causing beads of water to easily roll off during a rain shower. Which of the following must be correct about the protective agent? a. It resists temperature changes well. c. It is a polar substance. b. It must be an acid. d. It must be hydrophobic.

ANS: D DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying 28. The pH scale measures the a. amount of water in a solution. b. likelihood that a solution will evaporate. c. concentration of hydrogen ions in a solution. d. number of atoms found within a molecule.

ANS: C DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Remembering 29. An acid is a polar substance that dissolves in water and a. becomes nonpolar. c. accepts hydrogen ions from the solution. b. leaves behind an OH ion. d. donates hydrogen ions to the solution.

ANS: D DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Understanding 30. After adding a small amount of Solution A to Solution B, the pH of Solution B declines from 8 to 3.

Solution A must contain a. a salt. c. water only. b. a base. d. an acid.

ANS: D DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying

31. When ammonia (NH3) is dissolved in a solution, it accepts hydrogen ions from its surroundings.

Ammonia is therefore a(n) a. base. c. salt. b. isotope. d. acid.

ANS: A DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Understanding 32. A solution with a pH of 3 is a. acidic. b. basic.

c. nonpolar. d. neutral.

ANS: A DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Understanding 33. Of the following values, which indicates the MOST basic pH? a. 5 c. 8 b. 7 d. 10 ANS: D DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 34. Which of the following solutions has the highest concentration of free H ions? a. pH 1 c. pH 7 b. pH 4 d. pH 14 ANS: A DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 35. The highest concentration of free hydrogen ions is found in

a. household ammonia. b. lemons.

c. human blood. d. stomach acid.

ANS: D DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 36. Based on the figure shown below, which of the following has a lower concentration of hydrogen ions?

a. milk b. oranges

c. antacids d. baking soda

ANS: C DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 37. The most basic solution in the figure shown below is

a. seawater. b. borax.

c. baking soda. d. tomatoes.

ANS: B DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 38. The most acidic solution in the figure shown below is

a. stomach acid. b. lemons.

c. oven cleaner. d. pure water.

ANS: A DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 39. A solution with a pH of 4 is ________ acidic than a solution with a pH of 5. The solution with the pH of 4 has a ________ concentration of hydrogen ions than the solution with a pH of 5. a. more; higher c. less; higher b. more; lower d. less; lower ANS: A DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Analyzing 40. Carbon atoms are bound to each other by ________ bonds. a. ionic c. hydrogen b. polar d. covalent

ANS: D DIF: Moderate REF: 3.5 Life’s First Steps OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Remembering 41. Carbon’s prominence in living systems can be explained by the fact that a. it forms weak reversible bonds. b. it bonds with up to three other atoms. c. carbon-based molecules can form long chains and rings. d. it does not form small molecules.

ANS: C DIF: Difficult REF: 3.5 Life’s First Steps OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Understanding 42. Which of the following is an organic compound? a. water (H2O) c. ammonia (NH3) b. methane (CH4) d. carbon dioxide (CO2) ANS: B DIF: Moderate REF: 3.0 Intro OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Analyzing 43. Astronauts returning from outer space studied samples taken from their lunar landing. They found that one of their samples was coated with organic compounds. Which of the following statements must be correct about their samples? a. The compounds must be covered with ammonia (NH3) and water vapor. b. The samples must lack water, but contain DNA. c. The samples must contain carbon atoms. d. The specimen must lack water, pesticides, and added hormones.

ANS: C DIF: Moderate REF: 3.0 Intro OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Evaluating 44. Carbon is an example of a(n) a. compound. b. macromolecule.

c. element. d. amino acid.

ANS: C DIF: Easy REF: 3.0 Intro OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Remembering 45. The central element found in organic molecules is a. calcium. c. silicon. b. carbon. d. sodium.

ANS: B DIF: Easy REF: 3.0 Intro OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Remembering 46. Which of the following pieces of evidence would best demonstrate that a bacterium found on an asteroid originated in outer space? a. the presence of volcanic ash on the outside of the bacterial cell b. the absence of common gases found in Earth’s atmosphere c. the presence of right-handed amino acids in the bacterium’s proteins

d. the absence of hydrogen bonds between water molecules in the bacterial cell ANS: C DIF: Moderate REF: 3.3 The Smell of Success OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Analyzing 47. Which of the following statements is true of proteins, carbohydrates, and nucleic acids? a. All three are used to store genetic information. b. None of these macromolecules mixes well with water. c. Each of these molecules is built from a common set of monomers. d. All of these molecules are primarily used as energy-storage molecules.

ANS: C DIF: Moderate REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 48. A researcher in a laboratory tests a food item and identifies protein in it. The food item must also contain a. glucose. c. amino acids. b. lipids. d. nucleotides.

ANS: C DIF: Difficult REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 49. Macromolecules are typically formed by repetitively adding small monomers together. Which macromolecule is properly matched with the appropriate monomer? a. polypeptide—amino acid c. polysaccharide—nucleotide b. nucleic acid—amino acid d. triglyceride—cholesterol ANS: A DIF: Easy REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 50. A disaccharide consists of two a. sugars. b. hydrocarbons.

c. fatty acids. d. amino acids.

ANS: A DIF: Easy REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 51. Nucleotides a. are the building blocks of proteins. b. are involved in every chemical reaction in the cell. c. form physical structures such as hair. d. are the building blocks of nucleic acids.

ANS: D DIF: Easy REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 52. The genetic material found in all living things is made of building blocks called a. nucleotides. c. phospholipids. b. monosaccharides. d. steroids.

ANS: A

DIF: Moderate

REF: 3.6 Fifty More Years

OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 53. Which of the following are composed of the same monomers? a. proteins and DNA c. starch and cellulose b. RNA and cellulose d. cholesterol and sucrose ANS: C DIF: Moderate REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Applying 54. Which of the following is the largest in size? a. glucose b. protein

c. carbon atom d. nucleotide

ANS: B DIF: Difficult REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 55. Which of the following could be built solely from glucose molecules? a. fatty acids c. oils b. DNA d. starch ANS: D DIF: Difficult REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 56. A scientist observed a chemical that changes to bright red in the presence of organic compounds containing nitrogen and phosphorus. To test this chemical, a set of test tubes each containing a purified sample of one of the following organic compounds is prepared. The chemical is then added to each tube.

The test tube containing ________ will always turn bright red. a. nucleic acids c. carbohydrates b. proteins d. phospholipids ANS: A DIF: Difficult REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Analyzing 57. Laura’s supervisor provides her with lipids, carbohydrates, proteins, and nucleic acids and asks her to determine their chemical components. Which of the following elements would she NOT expect to find in these items? a. phosphorus c. hydrogen b. iron d. nitrogen ANS: B DIF: Difficult REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 58. One of the symptoms of kidney disease is the presence of proteins in a patient’s urine. To quickly test for kidney disease using a urine sample, a doctor might add a chemical that causes a color change when a. nitrogen, but not oxygen, is present. b. nitrogen, but not phosphorus, is present. c. only oxygen and hydrogen are present. d. only carbon and hydrogen are present.

ANS: B

DIF: Difficult

REF: 3.6 Fifty More Years

OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Applying 59. We use soap to clean ourselves better than we could with water alone. Soaps contain phospholipids that are responsible for the cleansing action. Which of the following statements is the MOST likely explanation for how soaps work? a. Phospholipids are ions and therefore mix with both the water and oily dirt. b. Phospholipids are completely hydrophilic, and therefore oily dirt takes the place of the phospholipid molecules that would be dissolved in the rinse. c. The phospholipid tail attaches to the oily dirt while the phospholipid head interacts with the rinse water and carries the dirt (and soap) away with it. d. The nonpolar fatty acid chains that make up the heads of the phospholipid are hydrophilic, and thus are repelled by the water.

ANS: C DIF: Difficult REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Applying 60. Monomers that can be commonly made from components in Earth’s atmosphere are a. nucleotides. c. triglycerides. b. amino acids. d. monosaccharides.

ANS: B DIF: Easy REF: 3.0 Intro | 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 61. How many different amino acids are used to build proteins? a. 90 c. 19 b. 20 d. 4 ANS: B DIF: Easy REF: 3.3 The Smell of Success OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 62. Antibodies are an important class of human proteins that function in immune defense. If scientists fragmented antibodies under laboratory conditions, what chemical building blocks would they recover? a. monosaccharides c. amino acids b. phospholipids d. nitrogenous bases ANS: C DIF: Moderate REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Applying COMPLETION 1. The positively charged subatomic particle is located in the ________.

ANS: nucleus DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 2. An atom that becomes charged due to the gain or loss of an electron is called a(n) ________.

ANS: ion DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Remembering 3. The weak electrical attractions that form between two water molecules are called ________ bonds.

ANS: hydrogen DIF: Easy REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Remembering 4. Molecules with an uneven distribution of charge are described as ________.

ANS: polar DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Remembering 5. Nonpolar molecules that are repelled by water are known as ________ molecules.

ANS: hydrophobic DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Remembering 6. The number that represents neutrality on the pH scale is ________.

ANS: 7 DIF: Easy REF: 3.3 The Smell of Success OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Remembering 7. A solution with a pH of 9 is more ________ than a solution with a pH of 7.

ANS: basic DIF: Easy REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Understanding 8. A solution with a higher free H ion concentration is more ________ than a solution with a lower free H ion concentration.

ANS: acidic DIF: Easy

REF: 3.4 Getting the Right Mix

OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Understanding 9. The element ________ makes up the chemical backbone of most molecules on planet Earth.

ANS: carbon DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Remembering 10. The class of macromolecules that do not form true polymers are the ________.

ANS: lipids DIF: Easy REF: 3.6 Fifty More Years OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding 11. The biomolecules that are copied and transmitted from parents to offspring are ________.

ANS: nucleic acid(s) DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering SHORT ANSWER 1. Nitrogen has an atomic number of 7 and an atomic mass number of 14. Using the image provided below, diagram the location and number of protons, neutrons, and electrons in nitrogen.

ANS: The atomic number tells us the number of protons, whereas the atomic mass is the sum of protons and neutrons. Therefore, nitrogen has 7 protons, 7 neutrons, and 7 electrons. In the diagram, students should demonstrate that there are 7 protons and 7 neutrons in the atomic nucleus. The 7 electrons should be drawn in the shells.

DIF: Easy REF: 3.0 Intro OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Applying 2. Lithium, with an atomic number of 3, has a tendency to lose electrons when it chemically bonds to another atom. What type of chemical bonds does lithium usually form with other atoms? Explain how you determined your answer.

ANS: When lithium loses electrons it becomes positively charged and participates in ionic bonding. Since lithium is positively charged, it will interact with negatively charged atoms.

DIF: Moderate REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 3. During a study session, a Biology classmate holds up a bottle of water and mentions that there are both hydrogen bonds and covalent bonds found within the liquid. Explain your classmate’s statement by describing the types of bonds that are found within your bottle of water.

ANS: Your classmate is correct in his or her assessment of the bonds in the water. Within a water molecule, the hydrogen and oxygen atoms are held together by covalent bonds. Hydrogen bonds attract neighboring water molecules due to partial positive and partial negative charges on the hydrogen and oxygen atoms, respectively.

DIF: Moderate REF: 3.0 Intro | 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water. MSC: Understanding 4. The bonds within an individual water molecule and between separate water molecules explain the special properties of water. Describe the type of bond within individual water molecules and the type of bond between separate water molecules. Then, list two unique properties of water.

ANS: Individual water molecules are held together by polar, covalent bonds. These bonds involve an unequal sharing of electrons that cause water molecules to have slightly positive and slightly negative ends.

Hydrogen bonds are the relatively weak attractions that occur between the slightly negative end of one water molecule and the slightly positive end of another water molecule. The combination of the polarity of water molecules and the hydrogen bonds between them lead to the following properties of water mentioned in the textbook: water acts as the ―universal solvent‖ capable of dissolving many substances, ice is less dense than liquid water, and water is a liquid at room temperature.

DIF: Moderate REF: 3.2 The World of Water OBJ: 3.2 Diagram the hydrogen bonds that form between water molecules and explain how those bonds produce the unique properties of water.

MSC: Understanding 5. After giving a baby a bath, a parent applies baby oil to their child’s skin. How does the baby oil help the baby’s skin to retain moisture throughout the day? Explain the chemical basis of water retention in this example.

ANS:

Because the oil is hydrophobic and the water is hydrophilic, the two substances do not mix well. Coating the baby’s skin with baby oil surrounds the skin with a thin barrier that helps to prevent the loss of moisture since the two substances do not interact with each other. The two fail to mix because they do not share the same charged nature. Although water is electrically neutral, the oxygen and hydrogen ends of the molecule possess partial charges. The baby oil on the other hand is held together by nonpolar covalent bonds, so it has no partial charges.

DIF: Difficult REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Applying 6. Gina makes vinaigrette dressing with olive oil and vinegar and then shakes the jar vigorously. For a few minutes it appears as if the oil and vinegar have mixed. Then, she notices the two liquids separating from each other. Describe why these two liquids do not stay together even after vigorous mixing.

ANS: Oil is a nonpolar, hydrophobic substance that does not dissolve easily in water. Vinegar is a hydrophilic substance that is soluble in water. Hydrophobic and hydrophilic substances do not mix well and will separate as a result. Oil is also a less dense substance than vinegar and will rise to the top of an oil and vinegar solution.

DIF: Moderate REF: 3.2 The World of Water OBJ: 3.3 Explain the difference between hydrophilic and hydrophobic molecules, and between acidic and basic molecules.

MSC: Understanding 7. The pH value of pure water is 7.0. When Ralph measures the pH of rainwater in his neighborhood, he finds the pH value is 6.0. Which of these solutions has a higher concentration of hydrogen ions? What is the difference in the hydrogen ion concentration?

ANS: The rainwater has a 10-fold increase in the concentration of hydrogen ions when compared to pure water.

DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying 8. Stomach acid has a pH value of 1.5–2.0. Antacids have a pH value of 10.5. Antacids are a common medication used to reduce the ―burning‖ effect of stomach acid moving back up into the esophagus (the tube that carries food to the stomach). Describe how antacids affect the concentration of free hydrogen ions to provide relief from ―heartburn.‖ ANS: Antacids are a base and bases remove free hydrogen ions from a solution. In the case of heartburn, highly acidic stomach acid is causing damage and pain. By adding antacids to the solution, the pH is raised as free hydrogen ions are accepted by the antacids (the solution becomes more basic) and the burning sensation is relieved.

DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.4 Predict whether a solution has a high or low concentration of free hydrogen ions by using its pH number.

MSC: Applying

9. There are four major classes of macromolecules that are found in living systems and each uses a carbon skeleton as its structural backbone. Why is carbon regularly assembled to make important biological molecules?

ANS: All of the major biological molecules (macromolecules) of living systems are organic molecules. As such, these molecules are formed using a carbon skeleton. This element is a central player because of its small size and need for four covalent bonds. Carbon readily participates in covalent bonding with other carbon atoms, forming single, double, and triple bonds. Carbon-carbon bonds may also branch or form rings. The carbon-carbon bond is also quite stable, which ensures the integrity of biological molecules in living systems.

DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Understanding 10. Using the figure below, contrast the abundance of nitrogen, oxygen, and carbon in Earth’s atmosphere and the human body. Address the reason for the difference in the abundance of carbon.

ANS:

Nitrogen is much more abundant in Earth’s atmosphere than it is in the human body. Oxygen is more abundant in the human body than it is in Earth’s atmosphere. Carbon is part of the ―1% other elements‖ group in Earth’s atmosphere but makes up 18 percent of the human body. Carbon is found at much higher amounts in a living organism because of carbon’s unique chemical properties that allow it to interact with other atoms and form organic molecules.

DIF: Moderate REF: Chapter 3 Infographic OBJ: 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Analyzing 11. Indicate the basic subunits used to build each of the four major classes of macromolecules.

ANS: Carbohydrates are composed of monomers called monosaccharides. When amino acids are joined by peptide bonds, they form proteins. Nucleic acids like DNA and RNA are built from nucleotide monomers. Lipids are not constructed in the same manner as the other three classes of macromolecules.

This diverse class of macromolecules does not share a common monomer.

DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Understanding MATCHING Match the type of bond associated with each description. Terms may be used more than once. a. covalent b. hydrogen c. ionic 1.

2.

3.

4.

5.

A positively charged sodium ion is attracted to a negatively charged chloride ion to form table salt.

Carbon shares electrons with oxygen atoms in a carbon dioxide molecule.

A weak electrical attraction that holds individual water molecules together.

An unequal sharing of electrons within an individual water molecule.

Some structure in a protein molecule is due to weak electrical attractions.

1. ANS: C DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 2. ANS: A DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 3. ANS: B DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 4. ANS: A DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding 5. ANS: B DIF: Easy REF: 3.2 The World of Water OBJ: 3.1 Compare and contrast the types of bonds used to form molecules.

MSC: Understanding

Use the molecule of ethanol shown below to match the numbers with the questions they answer.

Numbers may be used more than once or not at all.

a. 0 b. 1 c. 2 6.

7.

8.

9.

10.

d. 4 e. 8

How many covalent bonds are indicated?

How many valence electrons are in each carbon atom?

How many electrons is the oxygen atom sharing?

How many valence electrons are in each hydrogen atom?

What is the total number of carbon atoms?

6. ANS: E DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Applying 7. ANS: D DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Applying 8. ANS: C DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Applying 9. ANS: B DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Applying 10. ANS: C DIF: Moderate REF: 3.4 Getting the Right Mix OBJ: 3.1 Compare and contrast the types of bonds used to form molecules. | 3.5 Describe the chemical qualities of carbon that make it the basis of life on Earth.

MSC: Applying Using the answer choices below, match the characteristic with its macromolecule class. a. lipids

c. nucleic acids

b. carbohydrates 11.

12.

13.

14.

15.

16.

17.

18.

d. proteins

participate in nearly every chemical reaction in living systems store and transmit genetic information speed chemical reactions act as short-term energetic molecules form the major framework of biological membranes exhibit various levels of structure function energy storage and structural support used to create steroid molecules like cholesterol

11. ANS: D DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 12. ANS: C DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 13. ANS: D DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 14. ANS: B DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 15. ANS: A DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 16. ANS: D DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 17. ANS: B DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering 18. ANS: A DIF: Easy REF: 3.5 Life’s First Steps OBJ: 3.6 Compare and contrast each of the four main classes of biomolecules and their subunits.

MSC: Remembering

Chapter 04: Life Is Cellular MULTIPLE CHOICE 1. Which of the following is a part of accepted cell theory? a. Every living organism is composed of one or more cells, and all living cells have membrane-enclosed organelles. b. All living cells arise from preexisting cells, and all living cells have membrane-enclosed organelles. c. All living cells have membrane-enclosed organelles. d. Every living organism is composed of one or more cells, and all living cells arise from preexisting cells.

ANS: D DIF: Easy REF: 4.1 Life, Rewritten OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Remembering

2. Which of the following types of organisms are single-celled (unicellular)? a. bacteria, yeast, and many protozoans b. many fungi, some protozoans, and plants c. plants and animals d. many fungi, plants, and animals ANS: A DIF: Moderate REF: 4.1 Life, Rewritten OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Understanding 3. Adenine (A), thymine (T), guanine (G), and cytosine (C) are the ________ building blocks for DNA; they are organized in different combinations to code for all of the proteins needed to accomplish everything the cell does. a. carbohydrate c. protein b. nucleotide d. lipid ANS: B DIF: Easy REF: 4.2 Starting Small OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Remembering 4. Which of the following accurately describes viruses? a. They are small, cellular infectious agents that are only capable of reproducing when inside a living cell, and they can attack plants as well as animals. b. Each is typically a piece of genetic material encased in proteins, and they can reproduce on their own. c. They can attack plants, animals, and protozoans, and each is typically a piece of self-replicating genetic material encased in proteins. d. Typically a piece of genetic material encased in proteins, viruses are small, noncellular infectious agents that are only capable of reproducing when inside a living cell such as those of plants, animals, fungi, protozoans, or bacteria.

ANS: D DIF: Moderate REF: 4.2 Starting Small OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Remembering 5. Some antibiotics used to treat bacterial infections kill the bacteria by chemically punching holes in the cell wall of the bacteria, by preventing the bacteria from replicating their DNA, or by many other actions that ultimately cause cell death. Why do these antibiotics not work to kill viruses and cure people of viral infections? a. Antibiotics cannot kill a virus because viruses are not living cells with cell walls to puncture, nor do they have their own organelles to replicate DNA. b. Viruses are too virulent to be killed by those antibiotics. c. Viruses are too quick for the antibiotics to work. d. Viruses mutate at a rate faster than the rate at which antibiotics can kill them.

ANS: A DIF: Moderate REF: 4.2 Starting Small OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Understanding 6. Scientists repeat their experiments over and over again because they a. never get it right the first time. b. can never be sure what procedural steps they followed the first few times. c. must make sure the results were not accidents and that they are repeatable. d. simply have extra time and resources that must be used.

ANS: C DIF: Moderate REF: 4.3 Congratulations, It’s a . . . Cell OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Understanding 7. Living cells have an intact phospholipid bilayer that separates the cell from its external environment; this structure is commonly referred to as the a. nucleus. c. endoplasmic reticulum. b. mitochondria. d. plasma membrane.

ANS: D DIF: Easy REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Remembering 8. Liposomes form spontaneously from ________ and are important because ________. a. DNA; they provide a rigid structure to support the cell b. phospholipid monolayers; these phospholipid monolayers provide a stable barrier between the internal and external environments c. rigid cell walls; they provide support for the living cell and a barrier between the external and internal environments d. phospholipid bilayers; they provide a barrier between an external environment and an internal environment ANS: D DIF: Moderate REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Analyzing 9. An experiment mixed oil (lipids), organophosphate-containing detergent in water, and copper ions to act as a catalyst for a chemical reaction. Membranes budded off of the oil in this mixture. Which of the following is a reasonable and possible explanation of the experimental results? a. The chemical reaction caused the organophosphates from the detergent to chemically combine with lipids from the oil to form phospholipids. The hydrophilic tails lined up toward each other with their hydrophobic heads pointing out toward the water; this configuration formed a phospholipid bilayer that pulled into a liposome. b. The chemical reaction caused the organophosphates from the detergent to chemically combine with lipids from the oil to form phospholipids with hydrophilic heads and hydrophobic tails. The hydrophobic tails lined up toward each other with their hydrophilic heads pointing out toward the water; this configuration formed a phospholipid bilayer that pulled into a spherical liposome. c. The copper ions permanently, chemically combined with the lipids to form phospholipids.

The hydrophilic tails lined up toward each other with their hydrophobic heads pointing out toward the water; this configuration formed a phospholipid bilayer that pulled into a liposome. d. The copper ions permanently, chemically combined with the lipids and phosphates to form phospholipids. The hydrophilic tails lined up toward each other with their hydrophobic heads pointing out toward the water; this configuration formed a phospholipid bilayer that pulled into a liposome.

ANS: B DIF: Difficult REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Analyzing 10. Phospholipids are large organic molecules with a hydrophilic, polar phosphate head connected to hydrophobic, nonpolar fatty acid tails. These molecules arrange themselves to form a mostly impermeable barrier between a liposome and its environment by lining up

a. hydrophilic head to hydrophilic head with the tails all facing outward from the center line of the membrane. b. hydrophobic tails facing each other at the center line of the membrane with the hydrophilic heads facing outward, away from the center line of the membrane. c. hydrophobic tails facing hydrophilic heads. d. hydrophilic tails facing hydrophobic heads with every other tail facing outward from the center line of the membrane.

ANS: B DIF: Difficult REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 11. Which of the following statements best describes the differences between the nuclear envelope and the plasma membrane? a. The nuclear envelope consists of two concentric phospholipid bilayers, while the plasma membrane is only one phospholipid bilayer. Both membranes are selectively permeable and have pores. b. The nuclear envelope consists of two concentric phospholipid bilayers, while the plasma membrane is only one phospholipid bilayer. Neither membrane is selectively permeable or has pores. c. Both membranes consist of two concentric phospholipid bilayers, are selectively permeable, and have pores. d. Both membranes consist of two concentric phospholipid bilayers, and neither is selectively permeable or has pores.

ANS: A DIF: Moderate REF: 4.4 A Different Approach | 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Understanding 12. The selective permeability of a phospholipid bilayer membrane can be increased with help from ________ proteins. a. transport b. channel c. passive carrier d. transport proteins, channel proteins, and passive carrier ANS: D DIF: Easy REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 13. During the process of ________, water diffuses across a semipermeable membrane from an area where water is more concentrated to an area where water is less concentrated (it moves along the water concentration gradient). a. osmosis c. facilitated diffusion b. simple diffusion d. pinocytosis ANS: A DIF: Easy REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Remembering 14. Cells naturally, without using energy, respond to changes in water concentration through the process of a. facilitated diffusion. c. phagocytosis. b. osmosis. d. active transport.

ANS: B

DIF: Easy

REF: 4.5 Through the Barrier

OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 15. The plasma membrane of some white blood cells contain ________ proteins that bind with proteins of cells such as bacteria that have invaded the human body. a. channel c. diffusion b. receptor d. carrier ANS: B DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 16. If the concentration of sugar molecules in water on side ―A‖ of a selectively permeable membrane is 5 percent, and the concentration of sugar molecules in water on side ―B‖ of a selectively permeable membrane is 15 percent, the water will a. mostly move from side ―B‖ to side ―A‖ because the water concentration is higher on side―B.‖ b. mostly move from side ―A‖ to side ―B‖ because the water concentration is higher on side―A.‖ c. mostly move from side ―A‖ to side ―B‖ because the water concentration is higher on side―B.‖ d. not move at all because the water concentrations are isotonic.

ANS: B DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 17. A screen door allows breezes to enter and aromas to exit but keeps out insects. Its function most resembles a. the cytosol. c. the ER lumen. b. the plasma membrane. d. a ribosome.

ANS: B DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Applying 18. Cheryl is in a lab attempting to prepare a slide of cow blood for observation in a wet mount. She places a small drop of the blood on a slide, adds a drop of strong saline (salt) solution, and then covers all of it with a coverslip. After returning to her desk, she observes the slide with her microscope and notices that all of the red blood cells (RBCs) do not look like the nice round donut-shaped cells in her lab manual.

Instead, the RBCs look very shriveled up. Her lab partner, Derek, has also made a slide, but the RBCs on his slide do look like the ones in the lab manual. Derek used a more dilute solution of saline but the same vial of blood.

The most plausible explanation for the appearance of the blood cells on Cheryl’s slide is that the a. saline she used was hypotonic to the RBCs; this resulted in water osmosing through the RBC plasma membrane mostly into the cells. b. saline she used was isotonic to the RBCs; this resulted in water osmosing through the RBC plasma membrane into and out of the cells at an equal rate. c. saline she used was hypertonic to the RBCs; this resulted in water osmosing through the RBC plasma membrane mostly out of the cell. d. RBCs were hypertonic to the saline; this resulted in water osmosing through the RBC plasma membrane mostly into the cells.

ANS: C DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others

out.

MSC:

Applying

19. Dialysis tubing is a selectively permeable membrane that can be filled with a solution to simulate a cell.

A piece of dialysis tubing has been filled with a cloudy white solution of 5 percent starch, 5 percent egg albumin (protein), and 5 percent glucose (a small sugar) dissolved in water to simulate a cell. This simulated cell is weighed and then placed in a beaker of water. After soaking in the water for one hour, the simulated cell is once again weighed.

Over time, the weight of the simulated cell can be expected to a. decrease because it is hypotonic to the beaker environment and water will enter the simulated cell through osmosis. b. decrease because it is hypertonic to the beaker environment and water will leave the simulated cell through osmosis. c. increase because the solution in the beaker is hypotonic to the simulated cell and water will enter the simulated cell through osmosis. d. remain constant because it is isotonic to the beaker environment and water will be drawn into the simulated cell because of the albumin.

ANS: C DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Analyzing 20. Examine the figure below. Assume each sugar molecule represents a percentage point of sugar dissolved in the solution. Over time, the solution level on the left side of the figure would ________, while the solution level on the right side of the figure would ________. This is because the solution on the left side of the figure is ________, while the solution on the right side of the figure is ________.

a. b. c. d.

rise; decrease; hypertonic; hypotonic decrease; rise; hypertonic; hypotonic decrease; rise; hypotonic; hypertonic There will be no net movement of water because the solutions are isotonic.

ANS: A DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Evaluating 21. Examine the figure below. Assume each sugar molecule represents a percentage point of sugar dissolved in the solution. Over time, the solution level on the left side of the figure would ________, while the solution level on the right side of the figure would ________. This is because the solution on the left side of the figure is ________, while the solution on the right side of the figure is ________.

a. b. c. d.

rise; decrease; hypertonic; hypotonic decrease; rise; hypertonic; hypotonic decrease; rise; hypotonic; hypertonic There will be no net movement of water because the solutions are isotonic.

ANS: D DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Evaluating 22. Which of the following statements MOST accurately describes a selectively permeable membrane? a. Solutes are never able to cross the membrane. b. Large molecules are always excluded from crossing the membrane. c. Substances can only pass through the membrane with the help of either active or passive transport proteins. d. Certain solutes move freely across the membrane by simple diffusion, while others must be helped across by active or passive transport proteins; some substances are completely excluded from crossing the membrane.

ANS: D DIF: Easy REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Remembering 23. If a bottle of perfume was spilled in the corner of a large lecture hall, the students sitting near that corner of the room would very quickly smell the perfume. Over time, the students sitting in the far corner of the room would smell the perfume. What phenomenon has occurred to the perfume molecules that have entered the air? a. osmosis c. active transport b. facilitated diffusion d. simple diffusion ANS: D DIF: Easy REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Understanding 24. A scientist is observing a membrane through which water and some small hydrophobic molecules can freely pass along a concentration gradient from high to low. However, some sugar molecules are too large to pass through the membrane either way without the assistance of passive transport proteins.

Additionally, small Na ions and some proteins can pass through the membrane against the concentration gradient, but both require the assistance of active transport proteins. What general type of membrane are they observing? a. impermeable c. semipermeable b. impenetrable d. completely permeable ANS: C DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Understanding 25. Which of the following would be likely to require facilitated diffusion to move across the plasma membrane? a. water (H2O) b. sodium ions (Na), hydrogen ions (H), sugars, and amino acids c. oxygen (O2) d. carbon dioxide (CO2) ANS: B DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Understanding 26. Ross buys a bunch of small, round, red radishes at the grocery store; they are on sale because they have been sitting in the produce aisle for a while. When he gets home he notices their texture is not as crisp and crunchy as he would like. Ross’s friend recommends that he refrigerate them in a bowl of water overnight. The next day the radishes are crisp and crunchy again. The most likely explanation of why they became crunchy again after soaking in water is that the water was ________ to the radish cells it contained. So, the water osmosed across the plasma membranes ________ the radish cells, ________ the turgor pressure inside of the cells. a. hypertonic; into; increasing b. hypotonic; out of; decreasing c. hypertonic; into; decreasing d. hypotonic; into; increasing ANS: D DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Applying 27. Why would hydrophilic substances such as sodium ions (Na), hydrogen ions (H), sugars, and amino acids be unable to simply diffuse across a plasma membrane? a. They readily mix with the hydrophobic tails forming the core of the phospholipid bilayer. b. They are repelled by the hydrophilic heads of the phospholipids that form the phospholipid bilayer. c. They do not readily mix with the hydrophobic tails forming the core of the phospholipid bilayer; therefore, they must move across by facilitated diffusion. d. They do not readily mix with the hydrophobic tails forming the core of the phospholipid bilayer; therefore, the only way they can move into the cell is by endocytosis.

ANS: C DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Analyzing 28. An amoeba, a protozoan that moves by pseudopodia, approaches a smaller protozoan and extends its pseudopodia (extensions of cytoplasm in plasma membrane) around the smaller protozoan. Once the amoeba’s pseudopodia completely surrounds the other protozoan, the amoeba’s plasma membrane pinches off by folding back into the amoeba and creating a vesicle containing the smaller protozoan.

This vesicle is now within the amoeba itself and will soon fuse with other vesicles containing digestive enzymes. This is an example of a. pinocytosis. c. osmosis. b. exocytosis. d. phagocytosis.

ANS: D DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Applying 29. A white blood cell (WBC) encounters bacteria in a scrape on the knee of a child who has fallen off of his bicycle. The WBC’s job is to take the bacteria inside of itself and destroy the bacteria. If the bacteria cannot be moved across the WBC membrane, how will the WBC most likely take it in? a. exocytosis c. facilitated diffusion b. pinocytosis d. phagocytosis ANS: D DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Understanding 30. A protein molecule, transferrin, embedded in the plasma membrane recognizes iron molecules and causes the plasma membrane to fold in around the iron and take it into the cell. This is an example of a. osmosis. c. receptor-mediated endocytosis. b. diffusion. d. pinocytosis.

ANS: C DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Applying 31. Which of the following would be likely to move through a plasma membrane by simple diffusion? a. water (H2O), carbon dioxide (CO2), and oxygen (O2) b. polysaccharides, large protein molecules, and low-density lipoprotein particles c. bacteria and yeast d. sodium ions (Na), hydrogen ions (H), sugars, and amino acids ANS: A DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Understanding 32. Neurotransmitters are chemicals that transmit a nerve impulse across the gap between nerve endings.

These chemicals are often large and unable to pass through the membrane, so the cell packages them in a vesicle that can fuse with the plasma membrane. The inside of the vesicle opens to the outside of the cell, releasing the neurotransmitters into the gap. This type of transport of cellular products is called a. pinocytosis. c. exocytosis. b. receptor-mediated endocytosis. d. phagocytosis.

ANS: C DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Understanding 33. Cells lining blood vessels can form vesicles outside of the cell that can fold into the cell taking in liquids and solutes from the bloodstream. This is an example of a. pinocytosis. c. exocytosis. b. receptor-mediated endocytosis. d. phagocytosis.

ANS: A DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Understanding 34. A factory with an office that controls the information sent to separate rooms for each of the manufacturing and shipping processes would be analogous to a

a. b. c. d.

virus. prokaryotic cell with a nucleus. prokaryotic cell without a nucleus. eukaryotic cell with a nucleus.

ANS: D DIF: Moderate REF: 4.7 Prokaryotes versus Eukaryotes OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Applying 35. The enzymes needed to perform photosynthesis in plant cells are closely associated with the membranes in a. chloroplasts. c. mitochondria. b. plasma membrane. d. ER. ANS: B DIF: Easy REF: 4.7 Prokaryotes versus Eukaryotes OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 36. Prokaryotes and eukaryotes are primarily distinguished by the absence or presence of internal a. ribosomes. b. membranes. c. membrane-enclosed organelles. d. cell walls.

ANS: C DIF: Easy REF: 4.7 Prokaryotes versus Eukaryotes OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Remembering 37. The membranes of the mitochondria provide a place for enzymes needed for ________to anchor and function. a. photosynthesis c. mitosis b. export of proteins d. cellular respiration ANS: D DIF: Easy REF: 4.7 Prokaryotes versus Eukaryotes OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 38. Martin observes a wet mount slide preparation using the compound light microscope in the lab room. He observes layers of cells that have a definite, rigid, rectangular shape; there appears to be a nucleus in all of the cells and there are many oval-shaped green structures that seem to be moving around inside of the cells in an orderly fashion. What general cell type is he MOST likely observing? a. prokaryotic and plant b. prokaryotic and animal c. eukaryotic and plant d. eukaryotic and animal ANS: C DIF: Moderate REF: 4.7 Prokaryotes versus Eukaryotes | 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Applying 39. Ribosomes are very small nonmembranous organelles that can either exist freely in the cytoplasm or be embedded in the endoplasmic reticulum of a cell. They are associated with the synthesis of a. lipids. c. nucleic acids. b. proteins. d. carbohydrates.

ANS: B DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 40. The smooth endoplasmic reticulum a. is the site where lipids destined for other cellular compartments are manufactured. b. produces the energy needed to run chemical reactions in the cell. c. converts sunlight into chemical energy. d. stores water, nutrients, and enzymes.

ANS: A DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 41. The Golgi apparatus a. is the place where a cell’s genetic material is stored. b. sorts proteins and lipids and sends them to their final destination. c. captures energy from sunlight and sends it to the mitochondria. d. creates energy by converting ribosomes to proteins.

ANS: B DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 42. The boundary that surrounds the contents of the nucleus is the a. plasma membrane. c. nuclear pore. b. nuclear envelope. d. cytosol.

ANS: B DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 43. Which of the following statements is true of chloroplasts? a. They produce proteins used by other parts of the cell. b. They capture energy from sunlight. c. They give an animal cell its shape. d. They contain an entire copy of a cell’s genetic material.

ANS: B DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Remembering 44. Human muscle cells need large amounts of ATP to function in the movement of the body, which is why ________ are especially abundant in muscle cells. a. mitochondria b. ribosomes c. smooth endoplasmic reticulum d. lysosomes ANS: A DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying

45. In plants, the epidermis layer functions like a covering of skin to protect the leaf, while vascular bundles carry water and nutrients through the leaf. The palisade mesophyll layer is responsible for most of the photosynthesis that occurs, while the spongy mesophyll layer underneath it aids in the exchange of gases (CO2 and O2) and water vapor. In which leaf tissues would one expect to find the highest density of chloroplasts? a. epidermis c. spongy mesophyll b. vascular bundles d. palisade mesophyll ANS: D DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Understanding 46. Which of the following would be the best analogy for the function of the Golgi apparatus? a. the machine that assembles a product b. a worker in a factory who places labels on products and then packs them into a shipping box c. the garbage truck that hauls away the wastes produced as a product is made d. the blueprints for making the product ANS: B DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying 47. A long piece of ribbon wired along both long edges is twisted into a helix and wrapped around individual pipe cleaners that have been rolled into spools; this grouping is then twisted (super coiled) again to condense it. This could be best used as a simple model for a a. plasma membrane, where the pipe cleaners represent the phospholipid bilayer and the ribbon represents proteins embedded in the membrane. b. cell wall. c. mitochondrion. d. chromosome, where the pipe cleaners represent bundles of proteins around which the DNA double helix (wired ribbon) is wrapped.

ANS: D DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying 48. A solid waste (garbage) transfer facility that sorts and breaks down garbage into recyclables and waste to be thrown away in the landfill would be a suitable analogy for which cellular organelle? a. smooth ER c. lysosome b. rough ER d. nucleus ANS: C DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying 49. The flexible poles providing structure to a soft-sided tent most closely resemble the a. endoplasmic reticulum in a bacterial cell. b. Golgi apparatus in a plant cell. c. cytoskeleton in an animal cell or other cell without a cell wall. d. nucleus in a eukaryotic cell.

ANS: C DIF: Difficult REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying

50. The endoplasmic reticulum (ER) is a single membrane continuous with the nuclear envelope and a series of interconnected sacs throughout the cell. Why might it be beneficial to the cell for the ER to be continuous with the nuclear envelope? It might be beneficial for the ER and nuclear envelope to be connected because it a. takes less energy, DNA, carbohydrates, and phospholipids for the ER to synthesize centrioles. b. is easier for messages to get from the nucleus to the ER where proteins and lipids are made for the cell; this would require the use of less energy. c. would make it easier for the nucleus to actually carry out cellular respiration. d. would make it easier for the ER to carry out photosynthesis.

ANS: B DIF: Difficult REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Analyzing COMPLETION 1. The smallest and most basic units of life are microscopic, self-contained units enclosed by a water-repelling membrane and are called ________.

ANS: cells DIF: Easy REF: 4.1 Life, Rewritten OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Remembering 2. All cells living today came from a preexisting ________.

ANS: cell DIF: Easy REF: 4.1 Life, Rewritten OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Remembering 3. Viruses use their ________ material to take over their host cell’s metabolic machinery to produce the components needed for the virus to reproduce.

ANS: genetic DIF: Easy REF: 4.2 Starting Small OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Understanding 4. All cells have a ________ that acts as a barrier separating the cellular components from the external environment.

ANS: plasma membrane DIF: Easy REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Remembering

5. A plasma membrane is constructed of two layers of ________ , organic molecules that have a hydrophilic head and a hydrophobic tail.

ANS: phospholipids DIF: Moderate REF: 4.4 A Different Approach OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. MSC: Understanding 6. ________ transport of molecules across a selectively permeable membrane requires the input of energy from the cell, whereas ________ transport of molecules across a selectively permeable membrane does not require the use of cellular energy.

ANS: Active; passive DIF: Easy REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Remembering 7. When a white blood cell engulfs an entire bacterial cell by surrounding it with plasma membrane and bringing it into the cell in a vesicle, the white blood cell is accomplishing ________.

ANS: phagocytosis DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Understanding 8. When an amoeba has digested a bit of pond scum in a vesicle and that vesicle then carries the waste products to the amoeba’s cell membrane, fuses with the membrane, and releases the waste products outside of the cell, ________ has occurred.

ANS: exocytosis DIF: Difficult REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Applying 9. Streptococcus pyogenes can cause a bacterial infection of the throat. Since the bacterium lacks a nucleus or membrane-encased organelles, Streptococcus pyogenes is a(n) ________ cell type.

ANS: prokaryotic DIF: Moderate REF: 4.7 Prokaryotes versus Eukaryotes OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Understanding 10. An animal cell that contains an extensive network of ________ is likely to be a key source of lipids and/or hormones important in the development and functioning of that animal.

ANS: smooth ER smooth endoplasmic reticulum

DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Understanding 11. A cell containing a nucleus, mitochondria, Golgi apparatus, both smooth and rough ER, ribosomes, cytoskeleton, a large vacuole, and chloroplasts would be an example of a typical ________ cell.

ANS: plant DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Understanding 12. A cell that has numerous ________ is a plant cell that plays an important role in photosynthesizing sugars for the entire plant.

ANS: chloroplasts DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.6 Describe the role of any given organelle in a eukaryotic cell. | 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Applying 13. A cell surrounded by only a plasma membrane but containing a nucleus, mitochondria, Golgi apparatus, both smooth and rough ER, ribosomes, cytoskeleton, and lysosomes would be an example of a typical ________ cell.

ANS: animal DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Understanding SHORT ANSWER 1. Using what you know about cell theory and viruses, explain why viruses are not alive.

ANS: Cell theory states that all living things are made of cells, and cells arise from preexisting cells. Viruses do not have the cellular organelles and structures needed to maintain life, metabolize nutrients, or reproduce on their own. Viruses are not cells, so they cannot be alive.

DIF: Moderate REF: 4.1 Life, Rewritten | 4.2 Starting Small OBJ: 4.1 Explain cell theory and why it is central to the study of life. | 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Understanding | Applying 2. When scientists such as J. C. Venter and Daniel Gibson engineer a cell constructed with synthetic DNA in the laboratory, do they challenge accepted cell theory? If so, which part of cell theory do they challenge? Briefly explain your answer.

ANS:

The engineering of such a cell is a challenge to the ―all cells arise from preexisting cells‖ portion of cell theory because a new cell has been generated without dividing a preexisting cell into two new cells. OR: The process does not challenge cell theory because the DNA is actually a copy of a preexisting cell’s DNA, and therefore it actually does arise from a preexisting cell.

DIF: Difficult REF: 4.1 Life, Rewritten | 4.3 Congratulations, It’s a . . . Cell OBJ: 4.1 Explain cell theory and why it is central to the study of life.

MSC: Analyzing 3. Examine the infographic below. Are all bacteria (prokaryotes) likely to be 3 µm in length and all protozoans (eukaryotes) 500 µm in size? Support your answer using information from the infographic.

ANS: There are likely to be other sizes of prokaryotic bacteria and eukaryotic protozoans other than those shown for the bacteria, E. coli, and the protozoan, Amoeba proteus. Human cells are eukaryotic and come in many different sizes. Even viruses (not actually alive) come in different sizes. This would lead one to think that bacteria and protozoa would also be different sizes.

DIF: Difficult REF: Chapter 4 Infographic | 4.2 Starting Small OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Analyzing | Evaluating

4. In your own words, briefly point out the primary difference between prokaryotes and eukaryotes, and then explain what might keep viruses from being included in either of these categories.

ANS: Although prokaryotic cells have a cell membrane, they do not possess membrane-enclosed organelles or an organized, membrane-enclosed nucleus like those found in eukaryotic cells. Viruses possess genetic material similar to that found in prokaryotic and eukaryotic cells, but they are not membrane-enclosed cells and do not have any membrane-enclosed organelles or carry out any life functions on their own without the use of a host cell’s metabolic machinery. They do not carry out respiration or photosynthesis or DNA synthesis on their own; therefore, they do not fit into either category.

DIF: Moderate REF: 4.2 Starting Small OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes.

MSC: Applying 5. Label the plasma membrane below. Use the following terms: cellular environment, external environment, plasma membrane, hydrophilic heads, hydrophobic tails, energy, water, sugar, and transport protiens.

ANS: (1) external environment (2) cellular environment (3) energy (4) transport proteins (5) plasma membrane (6) hydrophilic heads (7) hydrophobic tails (8) water (9) sugar DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Applying 6. The figure below depicts a transport protein in a plasma membrane. The dark blue molecules represent a protein that is being transported out of the cell. Is the transport of the protein active or passive? Support your answer by describing evidence visible in the figure and stating its significance regarding your answer.

ANS: The protein transport is active transport. The illustration indicates that the concentration of protein is higher on the outside of the cell than it is within the cell. Whenever a substance is moved into or out of a cell against the concentration gradient, it typically requires the input of cellular energy to accomplish active transport.

DIF: Difficult REF: 4.5 Through the Barrier OBJ: 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Analyzing 7. The figure below depicts transport proteins in a plasma membrane. Molecules are moving through the plasma membrane. How are the molecules moving across the membrane? Is this movement active or passive? Support your answer by describing evidence visible in the figure and stating its significance regarding your answer.

ANS:

The molecules are moving across the membrane by facilitated diffusion. The molecules are moving through membrane proteins and with the concentration gradient from high to low, and there is no evidence that energy is being used; this is a passive transport system.

DIF: Moderate REF: 4.5 Through the Barrier OBJ: 4.3 Explain how the structure of a plasma membrane allows some substances in and keeps others out. | 4.4 Compare and contrast passive and active transport of materials into and out of cells.

MSC: Applying 8. Examine the photo below. This photo shows low-density lipoprotein (LDL) particles bound to receptors on the outside of a cell membrane. You view the same cell later and notice that the LDL particles are now enclosed in vesicles inside of the cell. What would you propose as the explanation for how the LDL particles arrived in their new location? Support your explanation.

ANS: The most likely way the LDL particles entered the cell was through receptor-mediated endocytosis. The receptors on the cell membrane that bound the LDL particles were probably specific for the LDL particles. The membrane began to fold into a pocket inside of the cell and eventually pinched off, forming a vesicle inside of the cell.

DIF: Difficult REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Evaluating 9. Explain the process through which cells lining blood vessels bring in pockets of fluids from the bloodstream. Is this process specific or nonspecific?

ANS: Cells lining blood vessels would form pockets of fluids from the bloodstream through the nonspecific process of pinocytosis. Pinocytosis happens when the plasma membrane folds into the cell, forming a vesicle that is filled with whatever fluids and solutes happen to be around the cell at the time.

DIF: Moderate REF: 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Understanding

10. If a white blood cell (WBC) is approximately 18 µm in diameter, which of the cell types or viruses seen in the infographic below would it be large enough to engulf? Describe the process the white blood cell would use to engulf another cell.

ANS: The WBC is larger than rhinovirus, influenza virus, measle virus, E. coli bacterium, and red blood cell.

So, it would be large enough to engulf them. The WBC would phagocytize the cell or virus by lining up beside it and folding its own plasma membrane around the other cell or virus. This fold would fold inward into the cell and pinch off as a vesicle.

DIF: Difficult REF: Chapter 4 Infographic | 4.6 Another Way Through OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis.

MSC: Applying | Analyzing 11. What additional structures would the cell below need to become a plant cell?

ANS: This cell would need a nuclear membrane to enclose the DNA (this would have to be wound around histones and coiled into chromosomes). This cell would also need some ribosomes, mitochondria, endoplasmic reticulum, a Golgi body, maybe a vacuole, and some chloroplasts.

DIF: Moderate REF: 4.7 Prokaryotes versus Eukaryotes | 4.8 What’s in a Cell?

OBJ: 4.2 Describe the differences in the structures of viruses, prokaryotes, and eukaryotes. | 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Analyzing 12. There are cells in the human pancreas that produce insulin, a peptide hormone important in the regulation of blood sugar levels by adjusting the metabolism of sugars and fats. Once the pancreas cells have produced the initial peptide (small string of amino acids) component of insulin, it must be finished, packaged, and shipped out of the cell. Which organelles would likely be involved in this process of finishing, packaging, and shipping of a peptide hormone? Include a brief, general description of what happens to the hormone at each organelle and the plasma membrane.

ANS: The insulin would be finished by the rough ER, budded into a transport vesicle, and transported to the Golgi apparatus where it might undergo further modification as it moves through the Golgi apparatus. At some point, a transport vesicle containing the insulin will bud off of the Golgi apparatus that has chemically tagged it to be destined to hook up with the plasma membrane. Once it arrives at the plasma membrane, the membrane of the vesicle fuses with the plasma membrane opening to the outside of the cell and releases the hormone through exocytosis.

DIF: Difficult REF: 4.8 What’s in a Cell?

OBJ: 4.5 Differentiate between exocytosis and the three types of endocytosis. | 4.6 Describe the role of any given organelle in a eukaryotic cell.

MSC: Applying 13. Indicate which cell in the figure below is the plant cell and which is the animal cell. Label all cellular structures 1–12 in both cells. Include a brief description of each organelle’s function with its label.

ANS: The cell on the left is the animal cell. The cell on the right is the plant cell.

(1) large central vacuole (water and solute storage) (2) nucleus (location of DNA) (3) cytoskeleton (organization and structural support) (4) mitochondrion (cellular respiration) (5) ribosomes (protein synthesis) (6) rough endoplasmic reticulum (protein synthesis) (7) smooth endoplasmic reticulum (lipid synthesis) (8) Golgi apparatus (tags proteins for movement) (9) lysosome (enzymatic breakdown of large molecules) (10) plasma membrane (regulate what moves in and out of cell) (11) cell wall (structure and support for cell) (12) chloroplast (photosynthesis) DIF: Moderate REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Understanding MATCHING Match the following cellular structures with their primary function (you may need to use a function more than once).

a. b. c. d. e. f. g. h. i. j. k.

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

photosynthesis regulate what moves in and out of cell structure and support for cell lipid synthesis tags proteins for movement enzymatic breakdown of large molecules protein synthesis cellular respiration water and solute storage location of DNA internal organization and structural support

central vacuole nucleus cytoskeleton mitochondrion ribosomes rough endoplasmic reticulum smooth endoplasmic reticulum Golgi apparatus lysosome plasma membrane cell wall chloroplast

1. ANS: I DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 2. ANS: J DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 3. ANS: K DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 4. ANS: H DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 5. ANS: G DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 6. ANS: E DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 7. ANS: D DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 8. ANS: H DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 9. ANS: F DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering

10. ANS: B DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 11. ANS: C DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering 12. ANS: A DIF: Easy REF: 4.8 What’s in a Cell?

OBJ: 4.7 Identify the main differences between a plant cell and an animal cell.

MSC: Remembering

Chapter 05: How Cells Work MULTIPLE CHOICE 1. The energy required for life processes must be extracted from an organism’s a. nucleus. c. predators. b. environment. d. biosynthesis.

ANS: B DIF: Easy REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Remembering 2. The illustration below indicates that photosynthesis and cellular respiration are both complementary and balanced. An excess of sugars produced fossil fuels like coal and petroleum; this suggests that in the past,

a. the amount of photosynthesis occurring exceeded the amount of cellular respiration. b. sugars were only one of several products of photosynthesis. c. reduced carbon-rich molecules could be produced independently from the photosynthetic process. d. the energy release from respiration must have exceeded energy use in photosynthesis.

ANS: A DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Analyzing

3. What is the importance of photosynthesis to organisms other than plants? a. All other organisms require carbon dioxide for life processes. b. The sugars made during photosynthesis are building blocks of DNA. c. All cells must have chloroplasts in order to survive. d. Photosynthesis captures energy that other organisms access when they eat either plants or organisms that eat plants.

ANS: D DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Understanding 4. Photosynthetic organisms capture energy from sunlight and convert it into chemical bonds by forming a. sugars. c. work. b. enzymes. d. substrates.

ANS: A DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Understanding 5. Photosynthesis and cellular respiration are both complementary and relatively balanced, but early history of life on Earth showed increasing oxygen concentrations. This indicates that a. both photosynthesis and respiration were occurring at approximately the same levels. b. neither photosynthesis nor respiration were occurring. c. the amount of photosynthesis occurring exceeded the amount of cellular respiration. d. the amount of cellular respiration occurring exceeded the amount of photosynthesis.

ANS: C DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Applying 6. Each time a person takes a breath, he or she is bringing in the oxygen he or she needs to stay alive. The ultimate source of the oxygen used by all aerobic organisms comes from a reaction that breaks down a. carbon dioxide. c. water. b. ATP. d. NADPH. ANS: C DIF: Difficult REF: 5.3 Into the Light, Part 1 OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Applying 7. What would be the initial outcome of decreasing the number of photosynthetic organisms on Earth with no change in the number of organisms using cellular respiration? a. Oxygen levels would increase. b. Carbon dioxide levels would increase. c. More glucose would be available to animals. d. Animals would access energy directly from sunlight.

ANS: B DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Analyzing 8. What type of reactions release energy by breaking down complex molecules? a. catabolic c. photosynthetic b. anabolic d. dehydration synthesis ANS: A DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Remembering 9. A chemical reaction that uses ATP to build cellular components is a. catabolic. c. photosynthetic. b. anabolic. d. respiration.

ANS: B DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Understanding 10. The capture and use of energy by living organisms involves numerous chemical reactions. Collectively these processes are known as a. metabolism. c. anabolic reactions. b. respiration. d. catabolic reactions.

ANS: A DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Remembering 11. Chemical reactions that break down lipids are a. catabolic. c. metabolic. b. anabolic. d. respiration.

ANS: A DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Understanding 12. Some kinds of drain cleaners use enzymes rather than strong, more dangerous chemicals. These enzymes must be able to a. catalyze a catabolic reaction. b. raise the energy of the reaction that clears the clog. c. create energy that can be used to break up the clog. d. catalyze an anabolic reaction.

ANS: A DIF: Difficult REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Applying 13. Plants and animals use different energy storage molecules, yet they both use the same mechanism to ―burn‖ their stored energy. How can plants and animals both be successful, even though they ―burn‖ different energy storage molecules? a. The internal components of plant and animal cells are identical. b. The first law of thermodynamics says that all cells have the same energy transfer system. c. The breaking of the chemical bonds of a storage molecule transfers energy, no matter what molecule is stored. d. All organisms have the same enzymes to catalyze their energy-producing reactions.

ANS: C DIF: Difficult REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Analyzing 14. A worker is paid every two weeks. She uses some of this money to pay for essentials and puts the remainder of her money in a savings account at a bank. The money the worker saves is analogous to the a. conversion of ADP and phosphate into ATP. b. conversion of ATP into ADP and phosphate.

c. way electrons are used to pump protons across a membrane. d. way enzymes catalyze chemical reactions in a cell.

ANS: A DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Analyzing 15. Which of these molecules carries the most energy? a. ADP c. NADH b. ATP d. NAD ANS: B DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Understanding 16. Which of the following is either consumed or synthesized in virtually every cellular reaction? a. sugars c. DNA b. enzymes d. ATP ANS: D DIF: Easy REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Applying 17. When ATP breaks down into ADP and a phosphate group, a. energy is absorbed by ADP and transferred to enzymes. b. energy is released and can power cellular activities. c. ADP becomes the active site in an enzyme. d. the energy in the broken bond is transferred to the phosphate group.

ANS: B DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Understanding 18. As an energy carrier, ATP differs from NADPH in that a. ATP transfers energy through phosphorylation, whereas NADPH donates electrons and hydrogen ions. b. ATP transfers energy through redox reactions, whereas NADPH uses phosphorylation. c. NADPH is involved in a larger variety of chemical reactions than ATP. d. NADPH is made by photosystem I, whereas ATP is made by photosystem II. ANS: A DIF: Difficult REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Understanding 19. Cells contain the molecule GTP (guanosine triphosphate). Would this molecule be useful as an energy carrier (similar to ATP)? a. No, because it does not contain the adenosine necessary for storing energy. b. No, because it contains fewer phosphates than ATP. c. Yes, because it contains a nitrogenous base just like ATP. d. Yes, because it contains the same number of phosphates as does ATP. ANS: D DIF: Difficult REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Applying 20. The first law of thermodynamics states that a. metabolic reactions must be balanced. b. the flow of energy connects living things to their environments. c. energy cannot be created nor destroyed. d. systems tend to become more disorderly.

ANS: C DIF: Easy REF: 5.1 Energy for Life OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Remembering 21. Which of the following events in a cell would require ATP? a. passive movement of molecules through the cell membrane b. linking together amino acids to form a protein c. breaking a carbohydrate into individual sugar subunits d. splitting a lipid molecule into smaller parts ANS: B DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Applying 22. In a human cell, a. one enzyme usually catalyzes more than five different chemical reactions. b. nearly all chemical reactions are catalyzed by enzymes. c. enzymes must be constantly replaced as they are used up in the reactions that they catalyze. d. some enzymes are specialized to store energy in the form of electrons.

ANS: B DIF: Easy REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Understanding 23. Enzymes can catalyze a reaction only if they a. encounter a molecule of ATP. b. have a phosphate bound to their active site. c. have both products in their active site at the same time. d. encounter a substrate that fits their active site.

ANS: D DIF: Easy REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Applying 24. A given enzyme a. can be used for many different kinds of chemical reactions. b. is permanently changed during a chemical reaction. c. has a special site where the products bind before the reaction begins. d. increases the rate of a particular reaction.

ANS: D DIF: Easy REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Applying 25. In the reaction C6H12O6  6 O2  6 CO2  6 H2O, the 6 CO2 molecules are examples of a. substrates. c. enzymes. b. products. d. reactants.

ANS: B DIF: Easy REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Applying 26. In many organelles, groups of different enzymes are located on membranes in close proximity to each other because a. attaching enzymes to the membrane prevents the cell from losing them to the surrounding environment. b. when enzymes are in close proximity, each one can catalyze more than one type of reaction.

c. these enzymes are involved in the same metabolic pathway, and keeping them closer together increases the efficiency of the pathway. d. all enzymes must act in groups to position substrates in the proper orientation to produce the product.

ANS: C DIF: Difficult REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Understanding 27. The image below diagrams the action of an enzyme. Notice that the enzyme is depicted as being more tightly wrapped around the substrates in step 2 than it is in step 1. Why is this?

a. When a substrate locks into the active site of an enzyme, the enzyme changes shape to mold itself around the substrates. b. Generally, the size of a substrate is larger than the size of the active site into which it must fit. When the substrate enters the active site, the active site must stretch to fit. c. Before catalysis can occur, a substrate must change its shape so that it fits into the active site of the enzyme more precisely. d. Most active sites are only designed to hold one substrate. In this image, two substrates enter the active site, creating a tighter fit.

ANS: A DIF: Difficult REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Understanding 28. In the reaction H2O  CO2  carbonic anhydrase  H  HCO3 carbonic anhydrase, carbonic anhydrase is a(n) a. reactant. c. enzyme. b. product. d. active site.

ANS: C DIF: Difficult REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Analyzing 29. After an enzyme catalyzes a reaction there is a(n) ________ in the concentration of ________. a. increase; reactants c. decrease; the enzyme b. increase; the enzyme d. increase; products ANS: D DIF: Easy REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Understanding 30. The enzyme rubisco is important to the process of

a. catabolism. b. fermentation.

c. glycolysis. d. carbon fixation.

ANS: D DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 31. The events of the Calvin cycle a. use ATP and NADPH to produce sugars. b. move electrons from photosystem II to photosystem I. c. move light-energized electrons to photosystem II. d. absorb light from the light reactions.

ANS: A DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 32. The role of water in photosynthesis is to a. provide a phosphate group to ATP. b. capture light energy and transfer it to the electron transport chain. c. provide electrons to the chlorophyll. d. combine with carbon dioxide (CO2) to make glucose.

ANS: C DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Understanding 33. Which of the following statements describe the function of the light reaction in photosynthesis? a. As electrons move through the light reaction, they release energy that is used to concentrate protons in the thylakoid. b. As electrons move through the light reaction, they catalyze the formation of ATP. c. The light reaction releases CO2 from glucose. d. The light reaction captures and stores the electrons given off by NADPH. ANS: A DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Understanding 34. In photosynthesis, the carbon used to make sugars is a. provided by enzymes. c. extracted from DNA. b. provided by carbon dioxide. d. oxidized to make sugars.

ANS: B DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Applying 35. The chemical 3-(3,4-dichloro-phenyl)-1,1-dimethylurea (DCMU) blocks the movement of electrons at the point indicated by the black, downward-pointing arrow in the figure below. Which of the following would be an immediate effect of treating a chloroplast with this drug?

a. b. c. d.

Water molecules would be split at a faster rate.

The amount of NADPH produced by the light reactions would increase.

A proton gradient would not be created, so ATP could not be made.

The production of water would increase.

ANS: C DIF: Difficult REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Applying 36. Examine the illustration below. Which statement best summarizes the contribution of photosystem I (PS I) during photosynthesis?

a. PS I provides the initial energy boost to the electrons on their way to photosystem II (PS II). b. PS I energizes electrons that initially accumulate within the thylakoid space and eventually drive ATP synthesis. c. PS I energizes electrons that are transported by NADPH to the Calvin cycle and will eventually reduce the carbon in CO2. d. PS I regulates the transmembrane passage of protons through the thylakoid membrane.

ANS: C DIF: Difficult REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Applying 37. Which of the following is a product of the light reactions of photosynthesis? a. water c. oxygen b. carbon dioxide d. glucose ANS: C DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Understanding

38. The three stages of cellular respiration (in order) are a. photosynthesis, glycolysis, and oxidative phosphorylation. b. glycolysis, the Krebs cycle, and oxidative phosphorylation. c. glycolysis, fermentation, and the Krebs cycle. d. photosynthesis, the Krebs cycle, and fermentation.

ANS: B DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 39. Glycolysis is an anaerobic process, indicating that the glycolytic reactions a. require no oxygen. c. produce ATP. b. produce molecular oxygen. d. produce citric acid.

ANS: A DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 40. The Krebs cycle produces a. NADH, ATP, and FADH2. b. water and carbon dioxide.

c. ADP and NADP. d. acetyl CoA and sugars.

ANS: A DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Remembering 41. Which step of cellular respiration occurs outside the mitochondria? a. glycolysis c. Calvin cycle b. Krebs cycle d. electron transport chain ANS: A DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 42. Which of the following molecules carries electrons to the electron transport chain of oxidative phosphorylation? a. ATP c. CO2 b. NADH d. ADP ANS: B DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Remembering 43. If the mitochondria of a cell did not produce an inner membrane, the mitochondria would be unable to a. maintain the proton gradient required for ATP production. b. capture ATP from the sun. c. perform the Krebs cycle. d. perform glycolysis.

ANS: A DIF: Difficult REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Analyzing 44. During exercise, the increase in respiration rate and heart rate are driven by the need to replenish the oxygen used to support a. lactic acid fermentation.

b. carbon dioxide synthesis in the lungs. c. oxidative phosphorylation in muscle cell mitochondria. d. the Calvin cycle of photosynthesis.

ANS: C DIF: Difficult REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Applying 45. The Krebs cycle functions to a. accept electrons and hydrogen ions from energy carriers. b. transform carbon from carbon dioxide into sugar. c. use energy from sunlight to split water molecules. d. transfer chemical energy from pyruvate to energy carriers.

ANS: D DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 46. Which of the following statements comparing photosynthesis and cellular respiration is accurate? a. Photosynthesis is a catabolic pathway, whereas cellular respiration is an anabolic pathway. b. Water is formed during photosynthesis but broken apart during cellular respiration. c. Both photosynthesis and cellular respiration require electron transport chains. d. Both photosynthesis and cellular respiration produce CO2 as metabolic end products.

ANS: C DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding 47. A plant cell is mutated so ATP synthase no longer functions. Which process will be affected? a. photosynthesis only b. respiration only c. both photosynthesis and respiration d. neither photosynthesis nor respiration ANS: C DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Applying 48. The energy carriers NADPH and NADH differ structurally. Functionally they are a. quite similar; each is produced in catabolic pathways and is used in anabolic pathways. b. quite similar; each is produced in anabolic pathways and is used in catabolic pathways. c. somewhat different; NADPH is produced from catabolic processes, whereas NADH is used in anabolic processes. d. somewhat different; NADH is produced from catabolic processes, whereas NADPH is used in anabolic processes.

ANS: D DIF: Difficult REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Analyzing 49. The reaction sugar  oxygen  carbon dioxide  water  ATP is part of a. photosynthesis. c. the Krebs cycle. b. cellular respiration. d. the Calvin cycle.

ANS: B DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Remembering 50. Which of the following is a similarity between photosynthesis and respiration? a. Neither is a metabolic process. b. They are both metabolic processes. c. Neither is an anabolic process. d. They are both mainly anabolic processes.

ANS: B DIF: Easy REF: 5.1 Energy for Life OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Remembering 51. Carbon dioxide is one product of a metabolic process, which occurs in both plants and animals. This process is called a. catalysis. c. respiration. b. glycolysis. d. photosynthesis.

ANS: C DIF: Moderate REF: 5.1 Energy for Life OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding COMPLETION 1. Photosynthesis and cellular respiration cycle the element ________ through the environment. When a plant does photosynthesis, it takes this element from the air and produces sugars. When animals conduct cellular respiration, they break down sugars and exhale a gas that contains this element.

ANS: carbon DIF: Difficult REF: 5.1 Energy for Life OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Understanding 2. Humans store sugars in the form of glycogen. Glycogen is made by linking many glucose molecules together. This process is ________.

ANS: anabolic dehydration synthesis condensation reaction DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Analyzing 3. A protein in the cell membrane is used to transport molecules against their concentration gradient by active transport. ________ is required for this type of transport.

ANS: ATP DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Analyzing

4. The ________ of an enzyme is an area with a specialized shape and set of chemical properties that allows the enzyme to bind with a particular substrate.

ANS: active site DIF: Moderate REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Remembering 5. A cell is found that uses sunlight to produce ATP, but it does not produce NADPH. The portion of the light reaction that is not functioning is ________.

ANS: PS I DIF: Difficult REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Applying 6. The step of cellular respiration that produces a product that will also be used in the Calvin cycle is the ________.

ANS: Krebs cycle citric acid cycle DIF: Difficult REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 7. A new bacterial cell is found that is able to grow without food as long as sunlight is available. This cell likely uses ________ to produce its own food.

ANS: photosynthesis DIF: Easy REF: 5.1 Energy for Life OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Applying SHORT ANSWER 1. Two students are debating whether switching energy production from fossil fuels to traditional biomass would reduce carbon dioxide emissions. Explain the role of photosynthesis in storing carbon dioxide in these two energy sources. What is the total energy consumption shown for these two energy sources?

ANS: Fossil fuels, such as oil and petroleum, were created when ancient organisms used photosynthesis to capture energy from sunlight. Part of the process of photosynthesis is the production of sugars from carbon dioxide. Traditional biomass, including wood and agricultural fuels, also relies on photosynthesis as a way to capture light energy and store it as chemical energy that is released when these materials are burned. The total energy consumption from fossil fuels and traditional biomass is 87.2 percent.

DIF: Difficult REF: 5.0 Intro | 5.1 Energy for Life | Chapter 5 Infographic OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Applying 2. Compare the energy sources shown below that rely on photosynthesis with the energy sources that do not rely directly on photosynthesis.

ANS: Nuclear power, 2.5 percent of the total energy consumed, is the only energy source consumed that does not rely directly on photosynthesis. The other energy sources shown, 97.5 percent of the total energy consumed, rely on photosynthesis to convert sunlight energy into chemical energy.

DIF: Moderate REF: 5.1 Energy for Life | Chapter 5 Infographic OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Applying 3. Defend the following statement by discussing the importance of the products of photosynthesis: ―The evolution of photosynthesis was an essential event for the evolution of life as we know it.‖ ANS: Photosynthesis produces oxygen, which allows other organisms to conduct cellular respiration rather than fermentation. This allows these organisms to produce much more ATP. Photosynthesis also produces sugars, which are used as an energy source by other organisms.

DIF: Moderate REF: 5.1 Energy for Life | 5.3 Into the Light, Part 1 OBJ: 5.1 Explain how photosynthesis and cellular respiration support life on Earth.

MSC: Evaluating 4. Support or refute the following statement:

―Cells would not be able to survive unless anabolic and catabolic processes occurred in linked reactions.‖ ANS: This statement is true because anabolic processes need the energy released from catabolic processes.

DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating 5. Is the burning of wood most representative of anabolism or catabolism? Defend your answer.

ANS: Burning wood releases energy and breaks down larger molecules into smaller components. Therefore, burning of wood represents catabolism.

DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Analyzing 6. A hypothetical chemical forms a permanent bond between the phosphates in ATP. How would this affect the cell?

ANS: The cell would not be able to break the bond between the last two phosphates and would not be able to use ATP to power cellular processes.

DIF: Moderate REF: 5.4 Catalyzing Reactions OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Analyzing

7. List the energy carriers in a cell. Which of the energy carriers carries the most energy?

ANS: The energy carriers are ATP, NADPH, NADH, and FADH2. ATP carries the most energy.

DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.3 Detail the role of ATP in a cell.

MSC: Remembering

8. The sequential reaction pathway A  B  C  D is dependent on enzymes for each separate step. The enzyme that has ―C‖ as a substrate becomes nonfunctional. Explain how this affects the metabolic pathway shown.

ANS: A will still be converted to B, which will still be converted to C. However, D will not be produced because the enzyme that produces D is not functional.

DIF: Moderate REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Applying 9. Explain how an increase in body temperature may affect the activity of enzymes with human cells.

ANS:

Enzymes are typically proteins, and the shape of proteins is affected by an increase in temperature. In the case of enzymes, an increase in temperature may change the shape of the enzyme and affect its ability to catalyze chemical reactions. The function of an enzyme is based on the shape of the enzyme.

DIF: Moderate REF: 5.4 Catalyzing Reactions OBJ: 5.4 Describe the importance of enzymes in metabolic pathways.

MSC: Understanding 10. A mutation in a plant cell produces rubisco enzymes, which can only bind O2 (and not CO2). What would be the outcome of this mutation?

ANS: This plant would not be able to produce sugars in the Calvin cycle because they would not bind the carbon needed to produce the sugars.

DIF: Difficult REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Applying 11. What products are produced by the light reactions of photosynthesis? Of these products, which are by-products that are released to the atmosphere? Which products are used within the Calvin cycle?

ANS: The products of the light reactions of photosynthesis are oxygen gas and the energy carriers ATP and NADPH. Oxygen gas is a by-product released to the atmosphere. The energy carriers are used in the Calvin cycle to help convert carbon dioxide into sugars.

DIF: Moderate REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Understanding 12. Two students are discussing the importance of glycolysis in human cells. One student states that the main function of glycolysis is to produce ATP. The other states that the main function is to produce NADH. Which student is correct?

ANS: The second student is correct. Although glycolysis does produce some ATP, the NADH produced by glycolysis will be used by the electron transport chain to produce much more ATP. Therefore, the bulk of the ATP produced is due to the production of NADH rather than ATP directly in glycolysis.

DIF: Difficult REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Evaluating 13. List the three stages of cellular respiration. If the mitochondria in a eukaryotic cell are damaged, which of the three stages of cellular respiration would be impacted?

ANS: The three stages of cellular respiration are glycolysis, the Krebs cycle (or citric acid cycle), and oxidative phosphorylation. If the mitochondria are damaged, the aerobic stages that occur in mitochondria, the Krebs cycle and oxidative phosphorylation, would be impacted.

DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.6 Define the three stages of cellular respiration and explain the function of each.

MSC: Understanding 14. Excess carbon dioxide in the atmosphere is increasing climate change. How do photosynthesis and cellular respiration relate to this issue, and how can we use this knowledge to help decrease this problem?

ANS: Photosynthesis takes in carbon dioxide; respiration produces it. If we increase the number of photosynthetic organisms, we could decrease the concentration of carbon dioxide in the atmosphere.

DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Applying 15. Photosynthesis and cellular respiration are linked metabolic processes in the sense that the products of one feed into the other. What are the products of each metabolic process that feed into the other?

ANS: Photosynthesis produces oxygen and sugars that are then used in cellular respiration. Cellular respiration produces carbon dioxide that is then used in photosynthesis.

DIF: Moderate REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Applying

MATCHING Determine whether each statement is an analogy for an anabolic pathway or a catabolic pathway. a. anabolic b. catabolic 1.

2.

3.

4.

5.

A worker uses individual bricks to build a wall.

In a popular video game an ax is used to chop trees into individual blocks of wood.

In a popular video game individual blocks of material are used to build objects.

An individual invests money in the stock market.

An individual spends money on a new car.

1. ANS: A DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating 2. ANS: B DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating 3. ANS: A DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating 4. ANS: A DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating 5. ANS: B DIF: Moderate REF: 5.2 An Unusual Pathway OBJ: 5.2 Differentiate between anabolic and catabolic metabolic processes.

MSC: Evaluating For each characteristic below, determine if it applies to the light reactions or the light-independent reactions of photosynthesis. a. light reactions b. light-independent reactions 6.

7.

8.

9.

10.

11.

produces oxygen gas produces sugars uses energy carriers produces energy carriers uses water uses carbon dioxide

6. ANS: A DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 7. ANS: B DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 8. ANS: B DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 9. ANS: A DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering 10. ANS: A DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering

11. ANS: B DIF: Easy REF: 5.3 Into the Light, Part 1 OBJ: 5.5 Outline the light reactions and the Calvin cycle of photosynthesis.

MSC: Remembering For each characteristic below, determine if it applies to photosynthesis and/or cellular respiration. a. photosynthesis only b. cellular respiration only c. both photosynthesis and cellular respiration d. neither photosynthesis nor cellular respiration 12.

13.

14.

15.

16.

produces carbon dioxide produces sugars used by plant cells used by animal cells produces light energy

12. ANS: B DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding 13. ANS: A DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding 14. ANS: C DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding 15. ANS: B DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding 16. ANS: D DIF: Easy REF: 5.5 Into the Light, Part 2 OBJ: 5.7 Compare and contrast photosynthesis and cellular respiration.

MSC: Understanding

Chapter 06: Cell Division MULTIPLE CHOICE 1. Which of the following pairs of processes encompasses the entire cell cycle? a. G1 phase and mitosis b. G1 phase and G2 phase c. interphase and metaphase d. cell division and interphase ANS: D DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 2. A pool of cells is treated with a chemical that halts progress through the cell cycle. In which stage of the cell cycle would most cells be found? a. metaphase c. anaphase b. interphase d. cytokinesis ANS: B DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Applying

3. The G0 phase of the cell cycle is distinguished by a. the failure of cells to divide following telophase. b. a doubling of chromosomes. c. an absence of preparation for DNA synthesis. d. the appearance of a metaphase plate.

ANS: C DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 4. According to the image below, during which phase of the cell cycle is the genetic material duplicated?

a. Region 1 b. Region 3

c. Region 4 d. Region 5

ANS: B DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Understanding 5. According to the image below, during which phase of the cell cycle does the cell increase in size in preparation for division?

a. Region 1 b. Region 2

c. Region 3 d. Region 4

ANS: B DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Understanding 6. According to the image below, during which phase of the cell cycle is the genetic material evenly partitioned between daughter cells?

a. Region 1 b. Region 2

c. Region 5 d. Region 6

ANS: D DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Understanding 7. What are the stages of interphase? a. G0, G1, and G2 b. S1, S2, and G0

c. G0, G1, and S d. S, G1, and G2

ANS: D DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 8. Which of the following statements about cell division is correct? a. It is the process by which organisms grow and maintain their tissues. b. It is no longer necessary once an organism reaches maturity. c. It occurs in two sequential stages in all cells: mitosis and meiosis. d. It is the process by which fertilization occurs.

ANS: A DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering 9. The outcome of meiosis is the a. creation of genetically identical offspring. b. protection of cells from cancer. c. production of eggs and sperm. d. regulation of the progression through the cell cycle.

ANS: C DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering 10. The process of cell division is different for prokaryotic versus eukaryotic cells because a. prokaryotes have a circular DNA molecule. b. prokaryotic cells do not undergo cell division. c. prokaryotic cells are larger than eukaryotic cells. d. prokaryotic DNA contains different bases from those in eukaryotic DNA. ANS: A DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering 11. The processes of mitosis, meiosis, and binary fission all a. generate haploid gametes. b. occur in eukaryotic and prokaryotic cells. c. are used to produce daughter cells. d. generate clones.

ANS: C DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Analyzing 12. A researcher is recording the process of bacteria cell division using time-lapse microscopy. Which of the following processes would she be observing? a. meiosis

b. mitosis c. binary fission d. She may be observing either meiosis or mitosis, depending on the growth conditions.

ANS: C DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Analyzing 13. Which of the following is associated with mitosis? a. independent assortment b. maintenance of chromosome number c. crossing over d. reductional division ANS: B DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Understanding 14. Some daughter cells are described as clones. For this description to be appropriate, the daughter cells must a. show the same differentiation characteristics as the parent cell. b. separate from one another and experience an independent existence. c. contain a set of DNA that is identical to that of the parent cell. d. have been produced by meiotic cell division.

ANS: C DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Applying 15. Which of the following differentiates meiosis from mitosis? a. Mitosis is used for the repair of cells, whereas meiosis creates cells for sexual reproduction. b. In mitosis four identical daughter cells are produced, whereas two genetically different cells are produced in meiosis. c. Meiosis is a form of asexual division, whereas mitosis is a form of sexual division. d. Mitosis occurs in prokaryotic cells, whereas meiosis occurs in eukaryotic cells.

ANS: A DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering 16. Which of the following is a difference between binary fission and mitosis? a. replication of the genetic material b. breakdown of the nuclear envelope c. cell growth and expansion d. increase in cytoplasmic factors ANS: B DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Understanding 17. The process shown in the figure below could produce two ________ cells.

a. identical skin b. genetically unique sperm

c. cloned red blood d. identical prokaryotic

ANS: D DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Understanding 18. The process of mitosis is thought to have evolved from binary fission. What similarities exist between these processes? a. The DNA being separated is attached to a membrane during both processes. b. Both processes involve the separation of more than one piece of DNA. c. Both processes include DNA segregation. d. Both processes occur in bacterial cells.

ANS: C DIF: Difficult REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Understanding 19. The circle near the center of the replicated chromosome below represents a

a. chromatid. b. centromere.

c. centriole. d. homologous chromosome.

ANS: B DIF: Easy REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Understanding 20. A replicated chromosome consists of ________ sister chromatid(s). a. 1 c. 4 b. 2 d. 6 ANS: B DIF: Easy REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Understanding 21. The chromosomes in a homologous pair a. both came from the organism’s mother. b. both came from the organism’s father. c. do not join during meiosis. d. carry the same genes.

ANS: D DIF: Easy REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering 22. Which term is best associated with a synapsed pair of homologous chromosomes? a. a pair of sister chromatids attached at the centromere b. unpackaged DNA c. a tetrad d. the mitotic spindle ANS: C DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Understanding 23. Homologous chromosomes a. are only found in bacterial cells. b. are only in the cell during S phase. c. consist of a maternal and paternal copy of each chromosome.

d. consist of six sister chromatids that are held together at the centrosome.

ANS: C DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering 24. An actively dividing cell has six chromosomes. How many sister chromatids are present within this cell at the end of G2 phase? a. 0 c. 6 b. 3 d. 12 ANS: D DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Applying 25. Chromosomes are lined up at the middle of the cell during the ________ portion of cell division. a. metaphase c. interphase b. anaphase d. telophase ANS: A DIF: Easy REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering 26. When examining the rapidly dividing cells of a fish embryo, a researcher notices a cell that seems to contain two nuclei. The middle of the cell is pinched inward. This cell must be in ________ of mitosis. a. prophase c. metaphase b. telophase d. anaphase ANS: B DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Applying 27. Which of the following would promote a cell to move through the G2 checkpoint? a. The cell lacks necessary nutrients. b. The genetic information has been duplicated. c. The cell is too small in size. d. A chromosome has been damaged.

ANS: B DIF: Moderate REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering | Understanding 28. Which of the following is NOT a factor that influences a cell’s progression through the cell cycle? a. gametes c. hormones b. cell cycle regulatory molecules d. growth factors ANS: A DIF: Easy REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering 29. Cells that demonstrate anchorage independence a. exist in G0. b. are primed to become metastatic. c. closely monitor their progression through the cell cycle. d. are benign tumors that are of little concern.

ANS: B DIF: Moderate REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Understanding 30. Cancers are groups of cells that divide rapidly and uncontrollably. Thus, cancer cells a. are always in the G0 phase. b. never enter the cell cycle. c. have a relatively short G1 phase. d. are stuck at the metaphase plate.

ANS: C DIF: Difficult REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Applying 31. Which of the following predicts a likely outcome of bypassing the G2 checkpoint in the cell cycle? a. Damaged DNA would be immediately replicated and passed on to the two daughter cells, giving rise to helpful, new alleles. b. Incompletely replicated DNA may be passed to the two daughter cells; these cells could be lacking specific genes or chromosomes and would likely not survive. c. The cell cycle would pause if cell size or nutrient supply is inadequate, DNA is damaged, or DNA replication is incomplete. d. The cell cycle would simply skip mitosis and go directly to G1 to start over.

ANS: B DIF: Difficult REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Applying | Analyzing 32. Anna Soto and Carlos Sonnenschein found evidence that nonylphenol interferes with the G0 and G1 checkpoints in the cell cycle of human breast cells. A possible unfortunate consequence of bypassing checkpoint G0 or G1 is that the cell a. may begin to replicate DNA before it is ready or allow damaged DNA to be replicated and then continue dividing inappropriately. If unchecked, this cell division could continue to form a potentially cancerous tumor. b. will immediately enter into mitosis without replicating its DNA during S phase. The cell will not be able to survive because it will have too few chromosomes. c. will complete mitotic separation of its replicated DNA but will not complete cytokinesis. d. life cycle will stop before DNA replication and separation can occur. This dead cell will become a potentially cancerous tumor.

ANS: A DIF: Difficult REF: 6.1 Divide and Conquer | 6.2 Trade Secret | 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Applying | Analyzing 33. Which of the following cell types is produced by meiosis? a. skin c. pancreatic b. muscle d. sperm ANS: D DIF: Easy REF: 6.4 Unequal Division OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Applying 34. During meiosis I, the chromosome number is reduced to haploid by separating a. each sister chromatid into two different daughter cells. b. one of each homologous chromosome pair into two different daughter cells.

c. each sister chromatid into four different daughter cells. d. one of each homologous chromosome pair into four different daughter cells.

ANS: B DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering | Understanding 35. When a germ cell has completed both rounds of meiosis, cells are created which are a. diploid, and each sister chromatid is in one of two different daughter cells. b. diploid, and one of each homologous chromosome pair is in one of two different daughter cells. c. haploid, and each sister chromatid is in one of four different daughter cells. d. haploid, and each sister chromatid is in one of four different daughter cells.

ANS: C DIF: Difficult REF: 6.4 Unequal Division OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering | Understanding 36. Patricia Hunt determined that bisphenol A (BPA) was hindering the process of meiosis in the ovaries of the mice in her experiment. BPA disrupted the ability of the chromosomes to separate into four haploid cells. Which of the following statements describes possible outcome(s) of this disruption? a. All four resulting cells will have exactly half the number of chromosomes found in the mother cell. b. Three of the resulting cells will have exactly half the number of chromosomes found in the mother cell. The fourth cell will have double the chromosome number found in the mother cell. c. Two of the resulting cells will have exactly half the number of chromosomes found in the mother cell. The other two cells will have exactly triple the chromosome number found in the mother cell. d. Two of the resulting cells may have exactly half the chromosome number of the mother cell.

One cell may have half the chromosome number of the mother cell plus one or more extra chromosomes, while the remaining cell would have less than half the number of chromosomes found in the mother cell.

ANS: D DIF: Difficult REF: 6.4 Unequal Division OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Applying | Analyzing 37. The successful union of one male and one female gamete forms a new single cell known as a a. chromatid. c. zygote. b. spindle. d. gametocyte.

ANS: C DIF: Easy REF: 6.4 Unequal Division OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering 38. Which of the following foods is MOST likely to contain haploid cells? a. a sirloin steak c. a stalk of celery b. an apple d. an egg ANS: D DIF: Easy REF: 6.4 Unequal Division OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Applying

39. If a plant has a total of 18 chromosomes, how many chromosomes would be present in each of its gametes? a. 36 c. 9 b. 18 d. 6 ANS: C DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Applying 40. Gametes are produced by meiosis rather than mitosis because a. mitosis would produce too many sister cells. b. meiosis reduces the chromosome number so that zygotes produced will have one full genome. c. meiosis doubles the chromosome number so that each gamete has twice the usual number of genes. d. meiosis ensures that the gametes are identical to the cell that produced them.

ANS: B DIF: Difficult REF: 6.4 Unequal Division OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Understanding 41. If crossing-over does not occur and homologous chromosome pairs are not independently assorted during meiosis I, resulting in all maternal chromosomes sorted to one cell while all paternal chromosomes are sorted to another cell, what would be the genetic results in the gametes produced at the end of meiosis II? a. Twenty-five percent of the gametes would contain only maternal DNA and 75% of the gametes would contain only paternal DNA. b. Seventy-five percent of the gametes would contain only maternal DNA and 25% of the gametes would contain only paternal DNA. c. Fifty percent of the gametes would contain only maternal DNA and 50% of the gametes would contain only paternal DNA. d. All gametes would contain equal amounts of maternal and paternal DNA. ANS: C DIF: Moderate REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Applying 42. All of the following contribute to genetic uniqueness EXCEPT a. binary fission. c. crossing over. b. independent assortment. d. random fertilization.

ANS: A DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering 43. Which two processes work in conjunction to create genetic diversity and maintain chromosome number? a. mitosis and meiosis b. meiosis and independent assortment c. binary fission and mitosis d. fertilization and meiosis ANS: D DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering

44. The possible combinations of alleles in gametes ________ due to independent assortment and crossing over. a. increases b. decreases c. stays the same d. increases or decreases depending on the cell type ANS: A DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering 45. Which of the following examples accurately describes crossing over? a. Sister chromatids of maternal chromosome 1 exchange segments of genetic information with one another. b. Maternal chromosome 3 exchanges segments of DNA with paternal chromosome 21. c. Sister chromatids of paternal chromosome 1 exchange segments of genetic information with one another. d. Paternal chromosome 7 exchanges segments of DNA with maternal chromosome 7.

ANS: D DIF: Moderate REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Understanding 46. In genetic engineering, molecular biologists often combine segments of DNA from two separate organisms. This is an example of genetic recombination that occurs in a laboratory setting. Which of the following is a form of genetic recombination that occurs naturally within cells? a. mitosis c. crossing over b. independent assortment d. asexual reproduction ANS: C DIF: Moderate REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Understanding 47. What is the significance of crossing over? a. Two copies of the same chromosome can become part of the same gamete. b. The resulting gametes will have novel gene combinations compared to their parent cells’ gene combinations. c. The bivalent chromosomes can exchange genetic material with other pairs of chromosomes. d. The gametes that are produced will have twice as many chromosomes as the parent cells had.

ANS: B DIF: Difficult REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Understanding 48. Which of the following is known to result from the disruption of mitosis and meiosis? a. Alzheimer’s disease c. autism b. prostate cancer d. heart disease ANS: B DIF: Easy REF: 6.6 Ten Years Later OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering 49. A scientist wishing to generate cancerous cells in vitro could subject the cells to which of the following procedures?

a. b. c. d.

immerse the cells in water for extended periods of time starve the cells of nutrients expose cells to chemicals that disrupt mitosis overfeed the cells by frequently feeding them

ANS: C DIF: Easy REF: 6.6 Ten Years Later OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering 50. Model organisms (like mice) used in the study of genetic disease a. are selected strictly for ethical reasons. b. cannot be trusted since they are very different from human cells. c. should either be mice or bacteria. d. may accurately reflect how diseases like cancer occur in humans.

ANS: D DIF: Moderate REF: 6.6 Ten Years Later OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Understanding 51. Which of the following statements is supported by the infographic shown below?

a. Though there is more than double the chance of a female getting breast cancer, it is more likely that a female who has lung and bronchus cancer would die from her disease. Males are almost three times more likely to die from having lung and bronchus cancer than from having prostate cancer. b. A female is twice as likely to die from thyroid cancer than from uterine cancer. c. A male is three times more likely to die from non-Hodgkin lymphoma than from having esophageal cancer. d. Both males and females are four times more likely to die of leukemia than from having pancreatic cancer.

ANS: A DIF: Moderate REF: Chapter 6 Infographic OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Understanding | Applying

COMPLETION 1. The last stage in the cell cycle is ________; this consists of ________, which separates the replicated DNA, and ________, which divides and portions the contents of the cell into two new daughter cells.

ANS: cell division; mitosis; cytokinesis DIF: Moderate REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering | Understanding 2. Cells spend the bulk of their time in the ________ stage of the cell cycle.

ANS: interphase DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 3. Binary fission is the form of asexual reproduction that mainly occurs in ________ cells.

ANS: bacterial prokaryotic DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering 4. Sister chromatids are held together at a constriction point called a ________.

ANS: centromere DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering 5. Chromosomes decondense and nuclear envelopes form during the ________ portion of mitosis.

ANS: telophase DIF: Easy REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering 6. In order to increase their supply of nutrients, tumors undergo ________, the formation of new blood vessels.

ANS: angiogenesis DIF: Easy REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering

7. When tumor cells become anchorage independent and begin to invade other tissues, they are considered to be transformed into cancer cells, also known as ________.

ANS: malignant cells DIF: Easy REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering 8. Per somatic nucleus, humans have 46 chromosomes arranged in 23 pairs of________ ; half of each came from the mother and half from the father.

ANS: homologous chromosomes DIF: Easy REF: 6.4 Unequal Division OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Remembering | Understanding 9. When everything proceeds without error, the process of ________ produces ________ daughter cells that are genetically identical to the mother cell, while the process of ________ produces ________ daughter cells that have half the genetic information present in the mother cell.

ANS: mitosis; two; meiosis; four DIF: Easy REF: 6.2 Trade Secret | 6.4 Unequal Division OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Remembering | Understanding 10. The random distribution of the homologous chromosomes into daughter cells during ________ results in ________ of chromosomes into gametes.

ANS: meiosis I; independent assortment DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering 11. The result of ________ is to increase genetic diversity by creating a new diploid individual from haploid cells.

ANS: fertilization DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering 12. Crossing-over produces chromosomes with new combinations of DNA; this is followed by independent assortment of ________ chromosomes to generate even more genetic diversity among gametes.

ANS: homologous DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Remembering

13. The number-one cancer responsible for deaths is ________; it is followed by ________ in females and ________ in males.

ANS: lung and bronchus cancer; breast cancer; prostate cancer DIF: Easy REF: Chapter 6 Infographic OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Remembering | Understanding

SHORT ANSWER 1. Diagram the major events of the cell cycle. Describe the processes that occur during each of these major stages.

ANS: Students should draw a circular picture and indicate G1-S-G2-M at intervals around the circle. At G1, the cells grow and increase in size. During S phase, cells duplicate the genetic material. During G2 phase, the cells are growing in preparation for cell division. The chromosomes are separated in a characteristic manner during mitosis.

DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 2. Describe the G0 phase of the cell cycle. Provide an example of what type of cell would enter the G0 stage and propose why this cell would enter the G0 phase.

ANS: The G0 of the cell cycle is a nondividing state that can last for a few days or through the lifetime of the organism. An example would be nerve cells. Nerve cells must be long enough to accommodate the size of the organism and remain stable throughout the life of the organism, so once they are formed and ―full grown‖ there is probably no need for them to replicate unless there is an injury.

DIF: Difficult REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Applying | Analyzing | Evaluating 3. Consider mitosis, meiosis, and binary fission. Which one of these three processes is the simplest for a cell to complete? Explain.

ANS: Binary fission is the most efficient process that the cells may carry out. Prokaryotic cells typically use this method of division. Since bacterial cells typically have only a single chromosome and they lack a nuclear envelope, binary fission is a less complex process.

DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Understanding 4. What is the purpose of having cell cycle checkpoints? What are the consequences of not having them?

ANS: Cell cycle checkpoints ensure that cells are ready to progress to the next stage of the cell cycle. Cell cycle regulatory proteins mediate the checkpoints. They prevent cells from progressing inappropriately or too quickly through the cell cycle phases. One consequence of uncontrolled progression through the cell cycle is cancer. Cancerous cells may self-signal in the absence of growth factors and hormones.

Such signal promotes unnecessary and harmful cell growth.

DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Understanding

5. A cell has completed S phase and is preparing to divide via mitosis. How is the genetic material arranged in G2 phase?

ANS: During S phase the uncondensed chromosomes (chromatin) duplicate, and now there are replicated chromosomes present in the nucleus. The replicated chromosomes consist of two sister chromatids that are held together at a narrowing called the centromere. Early in mitosis the chromatin condenses and tightens into highly compacted chromosomes.

DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Understanding 6. Describe the two structures seen below. When would they most likely be present in the cell cycle?

ANS: The structure on the left is a single uncoiled strand of chromosome that would most likely be present during the G1 phase of the cell cycle. The structure on the right is a duplicated, uncoiled chromosome consisting of two sister chromatids held together at the centromere; this would most likely be present during the G2 phase of the cell cycle.

DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages. | 6.3 Distinguish between sister chromatids and homologous chromosomes.

MSC: Understanding 7. What would happen to a cell if the cell cycle regulatory proteins overregulated in G1 even in the absence of any DNA damage and with plenty of nutrients available? Could this phenomenon possibly be used to treat cancer? Explain.

ANS: The cell would be unable to begin S (synthesis) phase. Without entering S phase, the cell will not duplicate its DNA and will not be able to complete the cell cycle; cell death would result. If you could determine a way to stimulate the cell cycle regulatory proteins in cancer cells, you might be able to use them to stop the cancer cells from reproducing.

DIF: Difficult REF: 6.3 Good Cells Gone Bad OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Applying | Analyzing | Evaluating

8. A cell containing 56 chromosomes is undergoing meiosis. Explain how chromosome number changes as the cells proceed through meiosis.

ANS: A cell whose diploid chromosome number is 56 will contain 28 chromosomes at the conclusion of meiosis. The goal of the first round of meiosis, meiosis I, is to make the cells haploid. This happens because cells no longer carry both a maternal and a paternal copy of each chromosome. At the conclusion of telophase I, the nuclei of cells become haploid.

DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Understanding 9. Which processes associated with meiosis ensure genetic diversity in offspring? Name two processes that promote variation and explain how they operate.

ANS: There are three processes that allow for genetic variation in the production of offspring. Crossing over between nonsister chromatids of a tetrad exchanges segments of DNA between maternal and paternal homologs. Independent assortment shuffles different combinations of maternal and paternal chromosomes into gametes. A unique egg may then be randomly fertilized with a unique sperm cell.

DIF: Easy REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Understanding 10. If cells with two pairs of homologous chromosomes can generally produce four kinds of gametes, what happens to the genetic variety of the gametes if an unspecified number of crossing-over events between homologous chromosomes occur during meiosis I? ANS: The higher the number of crossing-over events between homologous chromosomes, the greater the genetic variation in the gametes, especially if the chromosomes in the gametes are compared to the mother cell chromosomes. The crossing-over events just add an additional layer of genetic variation to the recombination achieved by independent assortment of homologous chromosomes.

DIF: Moderate REF: 6.5 Shuffling the DNA OBJ: 6.6 Identify the ways in which meiosis and fertilization together produce genetically diverse offspring.

MSC: Applying | Analyzing 11. Explain which of the three cell division processes (mitosis, meiosis, binary fission) is most complex and summarize why it is necessary to promote genetic diversity and maintain a constant chromosome number in organisms.

ANS: Meiosis is the most complex of the three processes. Not only is there more than one division of the genetic material but the amount of genetic material is systematically reduced by half and four daughter cells are produced instead of two. This is important to sexually reproducing organisms because it provides haploid gametes that can join with another haploid gamete to form a viable diploid zygote.

Additionally, the opportunity for crossing over (an exchange of material between homologous chromosomes) during meiosis provides for additional, random variations in the genes assorted into the daughter cells; this increases the genetic variation in the offspring.

DIF: Difficult REF: 6.4 Unequal Division | 6.5 Shuffling the DNA OBJ: 6.2 Compare and contrast cell division by binary fission, mitosis, and meiosis.

MSC: Analyzing | Evaluating 12. Design an experiment testing the hypothesis that increased exposure of a sexually reproducing population to BPA will result in an increase in the number of offspring who have an extra chromosome or who are missing one of their chromosomes. Use the following materials and abilities: BPA, a placebo, 1,500 lab mice, and the ability to extract gametes from the mice and examine their chromosome number.

Indicate in which phase of meiosis the error is most likely to occur.

ANS: The mice will be divided into three groups of 500 mice each. The first group will be the control group who will not receive any treatment. The second group will be the placebo group exposed to an inert placebo. The third group will be the experimental group exposed to a specific level of BPA. All three groups will be cared for and monitored for the same length of time. Gametes extracted from all three groups of mice will be examined to determine the chromosome numbers in the gametes. Abnormalities will be recorded and compared across the groups to determine if the BPA group showed an increased rate of missing chromosomes. The experiment could be repeated with a fresh set of mice and various doses of BPA to determine if the result is dose dependent. An error in meiosis I is the most likely place for the error to occur because that is when the homologous chromosomes are supposed to separate.

DIF: Difficult REF: 6.4 Unequal Division | 6.5 Shuffling the DNA OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order. | 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Analyzing | Evaluating 13. Compare and contrast the incidence rate per 100,000 individuals versus deaths per 100,000 individuals for breast cancer in females and for prostate cancer in males presented in the infographic below. What does this suggest about the survivability of breast cancer and prostate cancer?

ANS: The incidence rate per 100,000 individuals of prostate cancer is 101.6, while the death rate is only 19.2; roughly 81 percent of the individuals who get prostate cancer survive the experience. The incidence rate per 100,000 of female breast cancer is 123.7, while the death rate is only 20.7; roughly 71 percent of the individuals who get female breast cancer survive the experience. The good news is that for either of these cancers, you are far more likely to survive it than you are to succumb to it!

DIF: Difficult REF: Chapter 6 Infographic OBJ: 6.5 Explain the importance of the checkpoints in the cell cycle and the consequences of bypassing those checkpoints.

MSC: Analyzing | Evaluating

MATCHING Match the stage of the cell cycle with the appropriate description. a. b. c. d. e.

1.

2.

3.

4.

5.

Duplicated chromosomes are separated during this phase.

Cells prepare to divide and check that the proper steps have occurred for division. phase in which cells duplicate the genetic material resting stage assumed by cells that exit the cell cycle Two new daughter cells grow in preparation for division.

G0 phase G1 phase G2 phase M phase S phase

1. ANS: D DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 2. ANS: E DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 3. ANS: B DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 4. ANS: A DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering 5. ANS: C DIF: Easy REF: 6.1 Divide and Conquer OBJ: 6.1 Label a figure of the major stages of the cell cycle, and explain the processes that occur during each of these stages.

MSC: Remembering Match the event or stage of mitosis with the appropriate description. a. b. c. d. e.

prophase metaphase anaphase telophase cytokinesis

6. Replicated chromosomes condense and attach to the mitotic spindle.

7. The entire cell physically divides into two daughter cells.

8. The sister chromatids separate and become individual chromosomes that begin to move toward the poles of the cell.

9. The mitotic spindle aligns the replicated chromosomes at the center of the cell.

10. As new chromosomes reach the poles, the nuclear envelopes re-form, and the chromatin decondenses.

6. ANS: A DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 7. ANS: E DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 8. ANS: C DIF: Moderate REF: 6.2 Trade Secret

OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 9. ANS: B DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 10. ANS: D DIF: Moderate REF: 6.2 Trade Secret OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding Match the event or stage of meiosis with the appropriate drawing. a. b. c. d. e. f. g. h.

11.

12.

13.

prophase I metaphase I anaphase I telophase I and cytokinesis I prophase II metaphase II anaphase II telophase II and cytokinesis II

14.

15.

16.

17.

18.

11. ANS: H DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 12. ANS: A DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 13. ANS: D DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 14. ANS: E DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 15. ANS: C DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 16. ANS: F DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 17. ANS: G DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding 18. ANS: B DIF: Moderate REF: 6.4 Unequal Division OBJ: 6.4 List the steps in mitosis and in meiosis in chronological order.

MSC: Remembering | Understanding

Chapter 07: Patterns of Inheritance MULTIPLE CHOICE 1. Which of the following choices represents the genotype of an individual diploid organism? a. BbCCdd c. bcd b. BCd d. BbCd ANS: A DIF: Easy REF: 7.2 Pet Project OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding 2. An allele is a. a version of a gene. b. a trait that can be affected by the external environment. c. always codominant to its counterpart in another chromosome. d. the result of a change in phenotype.

ANS: A DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 3. Which of the following does NOT represent a phenotype? a. a person’s susceptibility to Addison’s disease b. the height of a draft horse c. the alleles in a mouse that control hair color

d. the extent to which an individual is shy ANS: C DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding 4. Which of the following statements regarding genes is NOT true? a. Genes are located on chromosomes. b. Genes consist of a long sequence of DNA. c. Genes are the basic unit of information affecting a genetic trait. d. Genes are found as single copies in cells other than sperm or egg.

ANS: D DIF: Moderate REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding 5. Which of the following statements is NOT true? a. Two organisms with the same phenotype may have different genotypes. b. Two organisms with the same genotype are homozygous. c. A heterozygous organism may have the same phenotype as a homozygous organism. d. A heterozygous organism has fewer alleles for a given gene than a homozygous organism.

ANS: B DIF: Moderate REF: 7.2 Pet Project OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Applying 6. A Thoroughbred racehorse could have at most ________ alleles of the same gene. a. 16 c. 4 b. 8 d. 2 ANS: D DIF: Moderate REF: 7.2 Pet Project OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding 7. Mutations will affect the a. genotype without affecting the phenotype. b. phenotype without affecting the genotype. c. genotype, which may affect the phenotype. d. phenotype, which may affect the genotype.

ANS: C DIF: Moderate REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding 8. When comparing a human sperm cell to a skin cell from the same individual, what differences would be expected? a. The sperm cell would contain four alleles for a given gene; the skin cell would contain two alleles. b. The sperm cell would contain only one allele for a given gene; the skin cell would contain two alleles. c. Both sperm and skin cells may carry different alleles for an individual gene. d. Both sperm and skin cells would contain 46 chromosomes found as homologous pairs.

ANS: B DIF: Moderate REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding

9. Based on Mendelian inheritance, would it be necessary to have both the genotype and phenotype for an organism when attempting to predict the inheritance pattern for a trait, such as hair color, in offspring? a. Yes; individuals with different genotypes often have the same phenotype. b. Yes; individuals with different phenotypes often have the same genotype. c. No; knowing the phenotype will indicate the genotype. d. No; knowing the genotype will indicate the phenotype.

ANS: D DIF: Difficult REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Analyzing 10. Mendel used ________ as his research organism to study patterns of genetic inheritance. a. garden peas c. mice b. snapdragons d. Siamese cats ANS: A DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Remembering 11. Mendel’s laws a. are less accurate than Punnett square results. b. determine whether an allele is dominant. c. explain how genes are inherited. d. predict inheritance of complex traits.

ANS: C DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Understanding 12. When Mendel proposed the law of segregation, which of the following pieces of information did he NOT have? a. data on the outcomes of crossing two true-breeding pea plants b. ratios to predict the outcome of crossing two heterozygous pea plants c. a prediction for how a single trait is inherited d. knowledge of the location of the alleles for flower color ANS: D DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Applying 13. In Mendel’s controlled mating experiments, the individuals produced by crossing two true-breeding parents are referred to as a. the P generation. c. the F2 generation. b. the F1 generation. d. dihybrids.

ANS: B DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Remembering 14. Mendel’s manuscript discussing his pea-breeding results is considered one of the two most important scientific papers of the nineteenth century because he was the first to explain how a. mutations produced the variety of alleles displayed by individuals of the same species. b. traits are passed from one generation to the next. c. meiosis controls the distribution of alleles to each gamete.

d. genes are arranged on chromosomes in the cell.

ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Analyzing 15. Which of the following did Gregor Mendel notice in garden peas? a. Some plants always produced offspring with flowers that were the same color as the parent plants’ flowers. b. The first generation from a genetic cross of true-breeding plants always produced offspring that were intermediate in their phenotype and did not look like either parent. c. Garden peas always produce a variety of phenotypes in their offspring, which result from frequent mutations. d. Any individual pea plant carries at least three different alleles for flower color.

ANS: A DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Applying 16. Why did Mendel analyze thousands of plants while conducting his research? a. to allow him to control the environment of his pea plants b. The likelihood of seeing a clear pattern is higher with a larger data set. c. Mendel knew that chromosomes undergo recombination during meiosis. d. to eliminate the probability of mutations affecting his data ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Understanding 17. Mendel’s laws of segregation and independent assortment both have their biological basis in events that take place during a. chromosome formation. c. mitosis. b. mutation. d. meiosis.

ANS: D DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Remembering 18. The figure shown below illustrates

a. the law of independent assortment. b. the law of segregation.

c. a dihybrid cross. d. a monohybrid cross.

ANS: B DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Analyzing 19. Which of the following expresses Mendel’s law of segregation? a. All dominant alleles of different genes divide into different cells from the recessive alleles. b. Two alleles of a gene separate during meiosis and end up in different gametes. c. When gametes form, the genes originally from one parent all end up in different gametes from the genes originally from the other parent. d. Gametes with recessive alleles will fuse only with each other.

ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Applying 20. The 9:3:3:1 ratio of phenotypes that occurs in the F2 generation of the cross shown below can be explained using

a. b. c. d.

blending inheritance.

Mendel’s law of segregation only.

Mendel’s law of independent assortment only. both the laws of segregation and independent assortment.

ANS: D DIF: Difficult REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Analyzing 21. A Punnett square is used to a. determine the source of new alleles. b. determine how many genes control a given trait. c. predict the gametes that will be produced by an organism. d. predict the genotypes and phenotypes of a genetic cross.

ANS: D DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Understanding 22. Two organisms that are true-breeding for a certain genetic characteristic are mated and their offspring analyzed. Which of the following statements about this situation is true? a. Both parents are heterozygotes. b. The offspring are either 100 percent homozygotes or 100 percent heterozygotes. c. The offspring represent the P generation. d. The gametes produced by the offspring will carry two alleles for this gene.

ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Analyzing 23. A pea plant that is heterozygous for the flower color gene makes gametes. What is the probability that a specific gamete contains the recessive allele for flower color? a. 0 percent c. 50 percent b. 25 percent d. 75 percent ANS: C DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 24. Consider a gene with two alleles that show complete dominance. When two heterozygotes for this gene breed, they have a 25 percent chance of producing a homozygous recessive offspring. The next time these two individuals breed, what are the chances that they will once again have a homozygous recessive progeny? a. 0 percent c. 50 percent b. 25 percent d. 75 percent ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Understanding

25. In the Punnett square shown below, the lettered circles on the top and left of the square (indicated by the arrows) represent the

a. b. c. d.

offspring that will be produced by the cross. genotypes of the parents involved in the cross. gametes that may be produced by each parent involved in the cross. offspring that could be produced by the cross.

ANS: C DIF: Moderate REF: 7.4 Peas in a Pod OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Understanding 26. Suppose D were dominant and d were recessive, and you could label the D allele in the P generation with a radioactive substance that could be inherited over several generations. You create hybrids by mating your radioactive DD individuals to dd individuals. Finally, you cross two F1 individuals (with the Dd genotype). In 1,000 offspring, how many would you predict would be radioactive? a. 250 c. 750 b. 500 d. 1,000 ANS: C DIF: Difficult REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 27. In a genetic cross of Gg with Gg guinea pigs, none of the four offspring were gg. This a. disproves Mendel’s law of independent assortment. b. neither supports nor disproves Mendel’s law of independent assortment. c. supports Mendel’s law of independent assortment. d. supports Mendel’s law of segregation.

ANS: B DIF: Moderate REF: 7.3 Crisscrossing Plants | 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Applying 28. Which of the following did Mendel use to help him form the law of independent assortment? a. dihybrid crosses between pea plants b. monohybrid crosses between pea plants c. traits that were codominant d. traits with incomplete dominance

ANS: A DIF: Easy REF: 7.4 Peas in a Pod OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Remembering 29. Which of the following statements is a basic summary of one of Mendel’s laws? a. All beneficial human genetic traits are dominant, and harmful traits are recessive. b. The pattern of inherited characteristics of organisms is not predictable. c. The separation of alleles for one gene does not affect the separation of alleles for other genes. d. Recessive alleles cause the death of the gamete.

ANS: C DIF: Easy REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Analyzing 30. Which of the following is the mechanism described by Mendel that results in a new combination of alleles in a pea plant seed? a. mutation of multiple alleles during mitosis b. mutation of multiple alleles during meiosis c. separation of alleles for two different genes during meiosis d. separation of alleles for a single gene during meiosis ANS: C DIF: Easy REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Understanding 31. What is the smallest number of traits that are needed to test Mendel’s law of independent assortment? a. one c. four b. two d. eight ANS: B DIF: Moderate REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Understanding 32. In a particular plant, two genes control leaf shape and color. Round leaves (R) are dominant to jagged leaves (r). Yellow fruits (Y) are dominant to white fruits (y). A true-breeding round-leaved, yellow-fruited plant is mated with a true-breeding jagged-leaved, white-fruited plant. What are the genotypes of the plants involved in this cross? a. RRYY  RRYY b. RRYY  rryy c. RrYy  RrYy d. cannot determine from the information given ANS: B DIF: Moderate REF: 7.4 Peas in a Pod OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 33. Which of the following represents all of the possible gametes that can be formed by an individual with the genetic makeup FfGgHH? a. FGH, FgH, fGH, fgH c. FG, FH, Fg, fH, fG, fg, GH, gH b. Ff, Gg, HH d. FfGhHH, FFGGHH, ffgghh ANS: A DIF: Difficult REF: 7.4 Peas in a Pod OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known

genotype—both for single genes and for two independent genes.

MSC: Applying 34. The leaf color of a certain plant is controlled by one gene. For that gene, the allele G = orange and g = green. You have a plant with orange leaves but do not know whether that plant’s genotype is GG or Gg. Which of the following would help you determine the plant’s genotype? a. cross the plant to another plant with orange leaves b. cross the plant to a plant with green leaves c. cross two true-breeding, orange-leaved plants to each other and then cross one of their offspring to the plant with the unknown genotype d. change the environment in which the plant grows to find the conditions that cause the leaves to produce the orange color ANS: B DIF: Difficult REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 35. If two different alleles for the same trait have an equal effect on the phenotype, the alleles are a. codominant. c. epistatic. b. recessive. d. incompletely dominant.

ANS: A DIF: Easy REF: 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Remembering 36. A chestnut-colored (red-colored) horse is mated with a cremello (cream-colored) horse. Over a 10-year period, all of their offspring are palominos (gold-colored). This pattern of inheritance is best explained by a. complete dominance. b. incomplete dominance. c. multiple gene effects. d. environmental effects on genes.

ANS: B DIF: Moderate REF: 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 37. Feather color in a certain species of bird is controlled by a pair of alleles that exhibit incomplete dominance. If birds that are homozygous for one allele are black and birds that are homozygous for the other allele are white, then heterozygous birds would be a. black. c. gray. b. white. d. black with white stripes.

ANS: C DIF: Moderate REF: 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 38. The observation that individuals afflicted with albinism also always have vision problems is an example of a. codominance. c. pleiotropy. b. incomplete dominance. d. epistasis.

ANS: C DIF: Easy REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 39. Two genes control fur color in Labrador retrievers. The first gene determines whether the pigment to be deposited in the hairs will be black or brown. The second gene determines whether the pigments are put into the dog’s hairs at all. A dog homozygous for the recessive allele of this second gene will be yellow because no pigment is deposited in its hairs. This is an example of a. epistasis. c. codominance. b. pleiotropy. d. incomplete dominance.

ANS: A DIF: Easy REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 40. Most human genetic characters are a. controlled by one gene. b. not inherited according to Mendel’s laws. c. controlled by more than one gene. d. not heritable.

ANS: C DIF: Easy REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Understanding 41. One of the first medical tests a newborn receives determines if the child has phenylketonuria (PKU).

PKU is the result of a mutation in a single gene that causes mental retardation and a host of other phenotypes (light hair and skin color, eczema, and a ―mousy‖ smell). By detecting PKU early, doctors are able to reduce the effect of this condition with a modified diet. PKU is an example of a. epistasis. c. pleiotropy. b. a polygenic trait. d. codominance.

ANS: C DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 42. The figure shown below indicates two diseases with genetic links that are common in industrialized nations. The fact that both are about 80–90 percent avoidable indicates that

a. people are most likely avoiding having children with individuals who are affected by these diseases. b. these diseases are Mendelian traits that are expressed more frequently in industrialized nations where the average life span is longer.

c. industrialized nations can use more resources to track these diseases in populations. d. these diseases are most likely affected by environmental factors in addition to genes.

ANS: D DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Understanding 43. The figure shown below indicates two Labrador retrievers that are both homozygous recessive for fur color. One dog is brown and the other is yellow due to

a. pleiotropy. b. codominance.

c. epistasis. d. incomplete dominance.

ANS: C DIF: Easy REF: 7.5 Going to the Dogs | 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Understanding 44. Which of the following statements is NOT true? a. Traits that are determined by the effect of more than one gene are known as polygenic. b. Environmental factors can alter the effects of genes. c. Most traits are under the control of more than one gene. d. A genotype is always expressed in the phenotype.

ANS: D DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Understanding 45. It would become nearly impossible to predict the phenotype of an individual with a known genotype if the a. environment affects the phenotype. b. genotype of the parents is unknown. c. genotype of offspring is unknown. d. You should always be able to predict the phenotype if you know the genotype.

ANS: A DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Applying 46. The pleiotropy that occurs when a single gene controls multiple skeletal traits in dogs, such as leg bone length and skull size, may be explained because a. dogs share a common ancestor. b. the skeletal traits are related in the overall function of the dog. c. dogs have lived with humans for thousands of years.

d. the effect of this gene depends on the environment.

ANS: B DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Understanding 47. A hammer is needed to pound nails into a board. Even if one has the nails, they cannot be used without first getting ahold of a hammer. This is similar to the genetic relationship known as a. heterozygosity. c. epistasis. b. codominance. d. independent assortment.

ANS: C DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Applying 48. Which of the following statements explains how genetically identical plant clones can exhibit dramatic phenotypic variation? a. Environmental conditions under which plants are grown can cause variations in phenotypes. b. Plants undergo mutations to adapt to temperature extremes. c. Plants are able to shut off genes that are not adaptive in their current environment. d. Genetically identical plants cannot have different phenotypes.

ANS: A DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Understanding 49. The coat color in a Siamese cat is determined by a temperature-sensitive allele that allows the brownish pigment melanin to be produced in extremities of the body. What might explain this phenomenon? a. Melanin appears darker in extremities because less light is reflected. b. Alleles are used to produce proteins that function best in specific temperature ranges. c. Siamese cats evolved in warm climates and did not need melanin. d. Extremities in a cat are more prone to damage from sunlight.

ANS: B DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Analyzing 50. Which of the following might explain how two separate genes control a single trait? a. Both genes have the same alleles. b. One gene functions better at higher temperatures. c. There are two genes to control two separate steps in a pathway. d. Two genes cannot control a single trait.

ANS: C DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Applying COMPLETION 1. The observable physical characteristics of an organism are known as its ________.

ANS: phenotype DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 2. The genetic makeup of an organism, such as Gg, is its ________.

ANS: genotype DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 3. The individual who used data from breeding garden peas to discover the patterns of inheritance that form the foundation of modern-day genetics was ________.

ANS: Gregor Mendel Mendel DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Remembering 4. A Punnett square shows the possible ways that alleles combine to form________.

ANS: gametes DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Remembering 5. The separation of two alleles into different cells during meiosis is Mendel’s law of ________.

ANS: segregation DIF: Easy REF: 7.3 Crisscrossing Plants OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Remembering 6. According to Mendel’s law of ________, when gametes are formed, the separation of alleles for one gene is unrelated to the separation of alleles for other genes.

ANS: independent assortment DIF: Easy REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Remembering 7. In a genetic cross in which the heterozygous phenotype is intermediate between the two homozygous phenotypes, ________ dominance is expressed.

ANS: incomplete DIF: Easy REF: 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Remembering 8. Most traits in humans involve complex inheritance where the trait is governed by the action of more than one ________.

ANS: gene DIF: Easy REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Remembering SHORT ANSWER 1. If you were a scientist studying patterns of inheritance in dogs and you were given extensive information about the inheritance of multiple physical traits, such as hair color and height, would you be able to piece together the entire genome of dogs? Explain your answer.

ANS: No. The genome would encompass all of the genes in dogs. Multiple physical traits represent phenotypes and would allow you to gather information about some, but not all, genes.

DIF: Moderate REF: 7.1 Getting to the Genes | 7.5 Going to the Dogs OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Analyzing 2. In humans there are three blood type alleles: A, B, and O. The blood type alleles A and B are fully expressed when they are present. Neither allele is considered dominant or recessive and neither is diluted when both alleles are present. The allele O is considered recessive and indicates a lack of either the A or B allele. How many blood type alleles are found in a given individual? What are the possible genotypes of an individual with type A blood in which only the A allele is expressed?

ANS: For any given gene, including blood type, an individual has two alleles. An individual with type A blood, expressing only the A allele, could have two A alleles (AA) or he or she could have one A allele and one O allele (AO).

DIF: Difficult REF: 7.1 Getting to the Genes | 7.2 Pet Project | 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Applying 3. Explain the relationship between the genotype and the phenotype of a given trait.

ANS: The genotype of a given trait is the pair of alleles, or versions of a gene, that an individual has within his or her cells. These alleles are passed from parent to offspring. Genes code for the phenotype, the physical characteristics, of an organism.

DIF: Moderate REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Understanding

4. Gregor Mendel began his studies by crossing plants that bred true for flower color. One parent bred true for purple flower color and the other parent bred true for white flower color. The flower color purple is dominant and the flower color white is recessive. If Mendel had erroneously crossed purple-flowered plants that were not true-breeding with white-flowered plants, how would this have altered the first generation produced?

ANS: If Mendel had crossed plants with purple flowers that were heterozygotes rather than homozygotes, the first generation would have contained a 1:1 mix of purple flowers and white flowers. Half of the offspring would have been heterozygous for the flower color gene. The other half would have been homozygous for the recessive allele. When Mendel crossed plants that were true-breeding for flower color, all of the first generation plants were heterozygotes with purple flowers.

DIF: Moderate REF: 7.2 Pet Project | 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Analyzing 5. A single gene with one dominant allele for black hair (B) and one recessive allele for brown hair (b) controls hair color in mice. A male mouse with black hair mates with a female mouse with brown hair and they have 12 offspring. Are you able to determine the predicted ratio of hair color in their offspring using a Punnett square? Explain your answer.

ANS: Because the male mouse exhibits the dominant phenotype, you would need to know his genotype.

Without knowing whether the male mouse is homozygous dominant (BB) or heterozygous (Bb), it is impossible to predict the outcome using a Punnett square.

DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Analyzing 6. If an individual is a carrier for a recessive disorder (with one copy of the recessive allele) and his or her partner is also a carrier, what is the probability that they will produce a child affected by the disorder?

Explain your answer.

ANS: Both parents are heterozygous. For each parent, half of the gametes produced will contain the recessive allele. The probability of the recessive alleles from both parents joining to produce a child with two copies of the recessive allele is 1:4.

DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 7. How is Mendel’s law of segregation represented in a Punnett square?

ANS: Mendel’s law of segregation states that two alleles of a given gene separate during meiosis and end up in different gametes. A Punnett square shows the possible ways that alleles of a gene separate to form individual gametes and the possible combinations of those alleles through fertilization.

DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Understanding 8. Jennifer uses a dihybrid cross of fruit flies to examine inheritance patterns for eye color (black or white) and head shape (round or elongated). This cross produces 10,000 offspring, and the ratio is 1 (black eyes, round head): 1 (black eyes, elongated head): 1 (white eyes, round head): 1 (white eyes, elongated head).

Is this what Jennifer should have expected from a dihybrid cross? Explain why or why not.

ANS: No. The pattern predicted by the law of independent assortment for a dihybrid cross is 9:3:3:1. Mendel’s law states that two alleles should segregate independently of other pairs of alleles. The example given illustrates a ratio produced when two alleles do not segregate independently.

DIF: Moderate REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Evaluating 9. Miles is a student studying two Mendelian traits in a plant. He creates a Punnett square to examine the phenotype ratio in the F2 generation. Interestingly, Miles finds that the phenotype ratio does not match up with the predicted phenotypes. He soon realizes that the two genes are physically linked to each other on the same chromosome. How would close physical proximity on the same chromosome affect the law of independent assortment?

ANS: The law of independent assortment states that during meiosis any pair of alleles of a given gene will segregate independently of any other pair of alleles of another gene. If two genes are physically linked on the same chromosome, the alleles will not be able to separate during meiosis.

DIF: Difficult REF: 7.4 Peas in a Pod OBJ: 7.3 Explain the significance of Mendel’s laws of segregation and independent assortment.

MSC: Evaluating 10. What type of inheritance pattern is indicated in the body size of the dogs shown below? How does this pattern differ from Mendelian traits?

ANS: Body size in dogs follows a pattern of incomplete dominance. With incomplete dominance, heterozygotes display an intermediate phenotype. If a trait is Mendelian, heterozygotes will display the dominant phenotype.

DIF: Easy REF: 7.5 Going to the Dogs OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Understanding 11. If Gregor Mendel had studied a polygenic trait that did not follow the straightforward single-gene, single-phenotype pattern, do you believe he would have been able to describe how genes are passed from parents to offspring? Justify your answer.

ANS: No. Studying traits with dominant and recessive alleles was important in allowing Mendel to determine that each parent carried a pair of alleles for each trait (although the language he used to describe ―alleles‖ was different from our modern terminology). This information contributed to our understanding of basic genetic inheritance. Polygenic traits are controlled by the actions of two or more genes, and their inheritance patterns are much more complex.

DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.2 Describe the importance of Gregor Mendel’s experiments to our understanding of inheritance.

MSC: Evaluating 12. Differentiate between pleiotropy and polygenic traits.

ANS: Pleiotropy involves a single gene controlling multiple traits (for example, a single gene controls multiple skeletal traits in dogs). Polygenic traits are single traits controlled by multiple genes (for example, human body size is controlled by multiple genes).

DIF: Moderate

REF: 7.6 It’s Complicated

OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Understanding 13. Is it possible for two organisms with the same genotype to have different phenotypes? Explain your answer.

ANS: Yes. The expression of the genotype in an individual can be affected by the environment. Phenotype may be controlled by environmental factors. One example is hair color in Siamese cats.

DIF: Difficult REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Evaluating 14. Up to 300 inherited diseases found in dogs are similar to human diseases. Based on the information shown below, why might it be easier to study the genetics of these diseases in dogs rather than in humans?

ANS: The size of the dog genome is smaller than the size of the human genome. Having a smaller genome makes it easier to map the genome.

DIF: Moderate REF: Chapter 7 Infographic OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Analyzing

MATCHING Match a mode of inheritance to a statement listed below. a. b. c. d. e. f.

incomplete dominance epistasis polygenic pleiotropy codominance Mendelian trait

1. The frizzle gene in chickens affects many traits, including feather type, metabolic rate, blood flow rates, and digestion.

2. A parent with curly hair and a parent with straight hair produce a child with wavy hair.

3. The color of wheat kernels is controlled by the interaction of two separate genes, with one gene affecting the expression of the other gene.

4. A human’s ability to roll his or her tongue is dependent on a single gene that is either dominant or recessive.

1. ANS: D DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Remembering 2. ANS: A DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Remembering 3. ANS: B DIF: Moderate REF: 7.6 It’s Complicated OBJ: 7.6 Explain how an individual’s phenotype may be determined by multiple genes that interact with one another and with the environment.

MSC: Remembering 4. ANS: F DIF: Moderate REF: 7.4 Peas in a Pod OBJ: 7.5 Give examples of Mendelian traits and of traits with complex inheritance.

MSC: Remembering Match the following terms with their definitions. a. b. c. d. e. f.

5.

6.

7.

8.

allele genotype gene phenotype chromosome mutation

a physical characteristic seen in an organism a molecule of DNA and associated proteins a section of DNA that controls a genetic trait a variant of a given gene

5. ANS: D DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 6. ANS: E DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 7. ANS: C DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering 8. ANS: A DIF: Easy REF: 7.1 Getting to the Genes OBJ: 7.1 Distinguish between the genotype and phenotype of a given genetic trait.

MSC: Remembering Fur texture in a group of rabbits is determined by a Mendelian trait. Straight hair is dominant and curly hair is recessive. Match the predicted genotype frequencies of heterozygous offspring from the genetic crosses given. a. 0 percent b. 25 percent c. 50 percent d. 75 percent e. 100 percent 9. a heterozygous straight hair rabbit and a homozygous curly hair rabbit 10. a homozygous straight hair rabbit and a homozygous curly hair rabbit 11. two heterozygous straight hair rabbits 9. ANS: C DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 10. ANS: E DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying 11. ANS: C DIF: Moderate REF: 7.3 Crisscrossing Plants OBJ: 7.4 Use a Punnett square to predict the phenotype of offspring from parents with a known genotype—both for single genes and for two independent genes.

MSC: Applying

Chapter 08: Chromosomes and Human Genetics MULTIPLE CHOICE 1. Two copies of the same gene on a single chromosome would indicate a(n) ________ had occurred. a. deletion c. inversion b. duplication d. translocation ANS: B DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Understanding 2. Which of the following would explain two chromosomes in an individual cell that contain some, but not all, of the same genes at the same loci? a. Both of the chromosomes are paternal. b. Both of the chromosomes are maternal. c. The chromosomes are from a common ancestor. d. A chromosomal alteration has occurred.

ANS: D DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Analyzing

3. A ________ is a chart that shows genetic relationships within a family over several generations. a. karyotype c. Punnett square b. pedigree d. single-gene disorder map ANS: B DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Remembering 4. Humans have ________ pairs of homologous chromosomes. a. 46 c. 22 b. 23 d. 44 ANS: B DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Remembering 5. A karyotype shows a chromosomal abnormality that does not change the length of any of the chromosomes. Which abnormality is indicated? a. inversion c. translocation b. deletion d. duplication ANS: A DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Understanding 6. On chromosomes within an individual, there are ________ alleles for a given gene found on ________ chromosomes. a. two; homologous c. four; paternal b. four; maternal d. two; Y ANS: A DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Understanding 7. Chromosomes that are NOT involved in determining gender are known as a. autosomes. c. homologues. b. sex chromosomes. d. linked.

ANS: A DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Remembering 8. Which of the following statements about homologous chromosomes is true? a. There are 46 pairs in humans. b. They contain the same genes in the same locations. c. They contain identical alleles in the same locations. d. They are also known as sex chromosomes.

ANS: B DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Understanding 9. One chromosomal abnormality that is usually fatal is a. a mutation in a gene. b. an exchange of material between homologous chromosomes.

c. extra copies of sex chromosomes. d. the addition of an extra autosomal chromosome.

ANS: D DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Applying 10. Which of the following must be true for a woman who is heterozygous for a given gene? a. She must be heterozygous for all genes. b. All of her eggs will contain both of the alleles for that gene. c. All of her eggs will contain one allele or the other but not both alleles. d. She carries a rare mutation.

ANS: C DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Analyzing 11. During cell division a piece of a chromosome breaks off and reattaches to the same chromosome, but the piece is now in reverse order. How would this abnormality affect the chromosome? a. An extra copy of the chromosome will be made to ensure normal function. b. The inverted section will be deleted to prevent problems. c. The chromosome will take on a circular configuration. d. Genes in the section that was inverted could lose normal function.

ANS: D DIF: Difficult REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Analyzing 12. In the pedigree shown below the individual indicated represents a(n)

a. healthy male. b. healthy female.

c. affected male. d. affected female.

ANS: B DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Understanding 13. Which of the following genetic changes would NOT be passed from parent to child? a. a mutation in a skin cell

b. the loss of a chromosome in a sperm cell c. the addition of a chromosome in an egg cell d. a translocation in a gamete ANS: A DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Applying 14. The karyotype shown below is from a(n)

a. b. c. d.

male. female. individual of undetermined sex. individual with a genetic disorder.

ANS: A DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Understanding 15. What information is NOT visible in a karyotype? a. the individual’s sex b. the number of autosomes c. genetic mutations d. chromosomal deletions

ANS: C DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Analyzing 16. In a karyotype of a male, which of the following would indicate an abnormality? a. one X chromosome and one Y chromosome b. three copies of chromosome 22 c. 22 pairs of autosomes d. a total of 46 chromosomes ANS: B DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Applying 17. A karyotype of an individual with mild mental retardation shows three copies of the X chromosome. If this individual decides to have children, how is her chromosomal abnormality likely to affect her offspring? a. All of her children will inherit an extra copy of the X chromosome. b. Any female children have a 75 percent chance of inheriting an extra copy of an X chromosome. c. She will be unable to produce male children. d. Half of her eggs will contain an extra copy of the X chromosome.

ANS: D DIF: Difficult REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Applying 18. A karyotype from an adult male indicates a chromosomal abnormality, which does not affect his health.

Which of the following abnormalities is MOST likely seen? a. three copies of the X chromosome b. no copies of chromosome 2 c. a translocation between chromosome 14 and chromosome 15 d. a deletion on chromosome 5 ANS: C DIF: Difficult REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Applying 19. In humans, X-linked genetic diseases a. are associated with autosomes. b. tend to be expressed more in females than males. c. only affect males. d. tend to be expressed more in males than in females.

ANS: D DIF: Easy REF: 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Understanding 20. The sex of a human child is determined by the a. loci. b. egg. c. presence or absence of specific autosomes. d. presence or absence of the Y chromosome.

ANS: D

DIF: Easy

REF: 8.3 Looking for Loci | 8.4 X Marks the Spot

OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Understanding 21. In humans, the ―master sex switch‖ that determines whether an embryo will become a male is the a. X chromosome. c. SRY gene. b. locus. d. androgen switch.

ANS: C DIF: Easy REF: 8.3 Looking for Loci OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Remembering 22. Which of the following genotypes represents a human male? a. XY c. XX b. YY d. XO ANS: A DIF: Easy REF: 8.2 Painful Pedigree | 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Remembering 23. The gene for a certain sex-linked trait is found only on the Y chromosome. If the male parent has this gene, the trait will be expressed in a. 100 percent of the female offspring. b. 50 percent of the female offspring. c. 100 percent of the male offspring. d. 50 percent of the male offspring.

ANS: C DIF: Moderate REF: 8.2 Painful Pedigree | 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Applying 24. The X chromosome in humans is a. found as a pair in females. b. the only human sex chromosome. c. present only in females. d. always found in single copy.

ANS: A DIF: Moderate REF: 8.2 Painful Pedigree | 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Applying 25. Because an individual with an XX genotype is a female, is an individual with an XO (no second sex chromosome) a male? a. No, because the X always overrides the Y and makes that embryo female. b. No, because the Y chromosome contains the gene that makes an embryo male. c. Yes, because if there is only one X, the embryo cannot become female. d. Yes, because all embryos start off as males.

ANS: B DIF: Difficult REF: 8.2 Painful Pedigree | 8.3 Looking for Loci OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Analyzing 26. A person is genetically XX and develops as a male. How can this be explained?

a. In humans, males are XX. b. An error in karyotyping this individual must have occurred, because XX individuals cannot develop into males. c. A piece of a Y chromosome has become attached to one of the X chromosomes. d. The SRY gene was deleted in this individual.

ANS: C DIF: Difficult REF: 8.2 Painful Pedigree | 8.3 Looking for Loci OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Analyzing 27. Most inherited human genetic disorders are inherited as ________ alleles. a. dominant c. homologous b. recessive d. sex-linked ANS: B DIF: Easy REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Remembering 28. An allele that appears more frequently in males is MOST likely a. dominant. c. autosomal. b. nonhomologous. d. sex-linked.

ANS: D DIF: Easy REF: 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 29. Both members of a couple are carriers for a recessive disease allele. If the couple has four children, which of the following statements must be true? a. One of the children has the disease. b. Two of the children have the disease. c. All of the male children have the disease. d. Fifty percent of the children could be carriers of the disease.

ANS: D DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 30. Autosomal dominant diseases are exhibited by anyone who carries at least one dominant allele for that gene. How is it that dominant lethal genes, such as the one that causes Huntington disease, can persist in a population? a. The disease-causing allele can ―hide‖ in the heterozygous condition. b. The disease develops only under the influence of other genes. c. These diseases usually take effect later in life after people have had children. d. The environment plays a large role in determining whether the gene is expressed.

ANS: C DIF: Moderate REF: 8.6 Deadly with One Allele OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 31. Which of the following statements would indicate a pedigree that shows the inheritance pattern of a recessive X-linked disease? a. Most affected individuals are females. b. Most affected individuals are males.

c. Males and females are affected equally. d. The disease is seen in every generation.

ANS: B DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Applying 32. In which of the following situations would looking at a pedigree be MOST useful? a. An adopted boy is admitted to the hospital with recurrent vomiting. b. A young girl is born with diminished hearing and a cleft palate. c. Six unrelated individuals with similar symptoms are admitted to the hospital in a one-week period. d. Three young boys who are first cousins show symptoms of a neurological disorder.

ANS: D DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Applying 33. The pedigree shown below diagrams an X-linked gene. The individual indicated is ________ for the gene.

a. b. c. d.

heterozygous homozygous autosomal There is not enough information to determine the answer.

ANS: A DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Applying 34. An X-linked carrier is a female individual with a ________ genotype, on her X chromosomes, who does not express the recessive trait but can pass it along to offspring. a. homozygous c. recessive b. heterozygous d. dominant ANS: B DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Remembering 35. Why are X-linked recessive genetic disorders more commonly seen in males? a. For an X-linked disorder to occur, an individual must receive one allele only found on the X chromosome and a second allele found only on the Y chromosome, which females do not have. b. Females must receive two copies of the recessive allele to exhibit the disorder, but males need only one copy. c. The alleles of sex-linked genes are carried only on the Y chromosome, which females do not have.

d. Females only have X chromosomes and genes on the X chromosome are not expressed.

ANS: B DIF: Difficult REF: 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 36. If a father is affected by an X-linked recessive condition and the mother is a carrier, what is the probability of their children being affected? a. All sons will be affected. b. Half of the sons will be affected. c. All daughters will be affected. d. Half of the sons will be carriers.

ANS: B DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 37. Which of the following is true of the genetic cross shown in the figure below?

a. b. c. d.

All of their daughters will be carriers.

Their sons have a 50 percent chance of being carriers.

Their sons have a 50 percent chance of having the disorder.

Their daughters have a 50 percent chance of having the disorder.

ANS: C DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying

38. A female who is a carrier of the sex-linked gene A has the genotype a. Aa. c. aa. b. AA. d. XAXa. ANS: D DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Remembering 39. A female carrier of the X-linked recessive gene for red-green color blindness will display a phenotype of a. normal color vision. c. red-green color blindness. b. XCXc. d. XCXC. ANS: A DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Understanding 40. The genotype of a female carrier of the X-linked recessive gene for Duchene muscular dystrophy is represented as a. XDY. c. Xd Y. b. XDXd. d. XDXD. ANS: B DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Remembering | Understanding 41. If a female who carries the X-linked recessive gene for hemophilia mates with a male who does not have hemophilia, what is the chance that their daughter will be a carrier of the gene? a. 0 percent c. 50 percent b. 25 percent d. 75 percent ANS: C DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits. | 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 42. The genetic disorder followed through the pedigree shown below is

a. recessive and X-linked. b. recessive and autosomal.

c. dominant and X-linked. d. dominant and autosomal.

ANS: B DIF: Difficult REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Applying 43. Most inherited human disorders are the result of a. recessive mutations of genes located on autosomes.

b. dominant mutations of genes located on the X chromosome. c. recessive mutations of genes located on the Y chromosome. d. simultaneous mutations of the same gene on homologous chromosomes.

ANS: A DIF: Difficult REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 44. If a recessive allele causes a fatal disease that kills the affected individual before he or she can reproduce, why doesn’t that allele quickly become extinct in the population? a. Alleles are never lost from a population. b. The homozygous dominant individuals protect the recessive allele in their genomes. c. The recessive allele is carried in the genome of heterozygotes, who do not suffer from the disease. d. The homozygous recessive individuals give their alleles to other individuals before they die from the disease.

ANS: C DIF: Difficult REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Analyzing 45. Which of the following information is available in a Punnett square showing the inheritance pattern for an autosomal recessive disorder? a. the percentage of males likely to be affected by the disorder b. the percentage of females likely to be affected by the disorder c. the percentage of all children likely to be affected by the disorder d. the number of children born to the two parents ANS: C DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 46. Among children with parents who are both carriers of Tay-Sachs, an autosomal recessive disorder, chances are that a. 75 percent will be carriers. b. 50 percent will die in a few years. c. 75 percent will not carry the recessive Tay-Sachs’s allele. d. 50 percent will be carriers.

ANS: D DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 47. Sickle-cell disease is an inherited chronic blood disease caused by an autosomal recessive allele.

Suppose a man with sickle-cell disease fathers a child by a woman who is a carrier for sickle-cell disease. What are the chances their children will exhibit the disease? a. 0 percent c. 50 percent b. 25 percent d. 75 percent ANS: C DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story

OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 48. The parents in the figure shown below are carriers of a genetic disorder. Based on the Punnett square, the allele that causes the disorder must be

a. autosomal. b. sex-linked.

c. dominant. d. incompletely dominant.

ANS: A DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 49. If two parents are heterozygous for an autosomal recessive disease, a. they are both considered genetic carriers for the disease. b. their children have no chance of inheriting the disease. c. their children have a 50 percent chance of inheriting the disease. d. all of their children will also be heterozygous.

ANS: A DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 50. If the male in generation II of the figure below was affected, what would the pattern of inheritance MOST likely be?

a. X-linked recessive b. X-linked dominant

c. autosomal recessive d. autosomal dominant

ANS: D DIF: Moderate REF: 8.6 Deadly with One Allele OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Understanding 51. What information in a pedigree would indicate a condition is likely dominant? a. Twenty-five percent of the individuals in the pedigree have the condition. b. Two-thirds of the affected individuals are females. c. None of the affected individuals have unaffected parents. d. Most of the affected individuals are males.

ANS: C DIF: Moderate REF: 8.6 Deadly with One Allele OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Applying 52. If a genetic disorder is caused by a dominant allele, individuals with which of the following genotypes would be affected by the disorder? a. AA and aa c. AA and Aa b. aa and Aa d. AA, Aa, and aa ANS: C DIF: Moderate REF: 8.6 Deadly with One Allele OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 53. Which of the following best estimates the occurrence of the X-linked recessive disorder Duchenne muscular dystrophy in all births per year as shown in the figure below?

a. 0.03 percent b. 0.15 percent

c. 0.015 percent d. 0.5 percent

ANS: C DIF: Moderate REF: Chapter 8 Infographic OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying | Analyzing 54. The source of the gene needed for gene therapy treatment of the sex-linked adrenoleukodystrophy (ALD) would be a(n) ________ chromosome with a ________ copy of the ALD gene. a. X; functional c. X; nonfunctional b. Y; functional d. Y; nonfunctional ANS: A DIF: Easy REF: 8.7 Replacing Deadly Genes: A Work in Progress OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 55. Phenylketonuria (PKU) is a metabolism disorder that can result in mental retardation if untreated. This recessive disorder is caused by a defective gene located on chromosome twelve. The most reliable source for the functional gene needed for gene therapy would be a(n) a. female that is heterozygous for the functional gene. b. male that is heterozygous for the functional gene. c. individual that is homozygous dominant for the functional gene.

d. individual that does not have PKU. ANS: C DIF: Moderate REF: 8.7 Replacing Deadly Genes: A Work in Progress OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying COMPLETION 1. Ross is a genetic counselor working with a family that has lost a child to an unidentified illness. The family tells him there have been other children in the family history who have died after having the same symptoms. As Ross examines several generations of the family’s pedigree, he notices that females are affected as frequently as males and that parents never exhibit the symptoms. This information leads him to think this disorder has a(n) ________ mode of inheritance.

ANS: autosomal recessive DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Understanding 2. If an individual has two alleles at a given locus that are different, the individual is said to be ________ for the gene.

ANS: heterozygous DIF: Easy REF: 8.3 Looking for Loci OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Remembering 3. Every gene in a human occupies a specific position or ________ on a chromosome.

ANS: locus DIF: Easy REF: 8.3 Looking for Loci OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Remembering 4. Except for the sex chromosomes, all the chromosomes shown in a karyotype are numbered and are called ________.

ANS: autosomes DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Remembering 5. Human males have one chromosome that females do not. That chromosome is the ________ chromosome.

ANS: Y DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Remembering 6. While examining the pedigree of a human female, you discover that she has 44 autosomes and two sex chromosomes, an X and a Y. This may lead you to suspect that there is a mutation within this individual’s ________ gene.

ANS: SRY DIF: Moderate REF: 8.2 Painful Pedigree | 8.3 Looking for Loci OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Applying 7. A female who carries on her X chromosomes one copy of a recessive mutated allele and one normal copy is referred to as a genetic ________.

ANS: carrier DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Remembering 8. An individual who has the genotype XNXn for night blindness is considered a ________ for night blindness.

ANS: genetic carrier carrier DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Remembering 9. X-linked disorders more commonly affect males than females because males have only one ________ chromosome.

ANS: X DIF: Easy REF: 8.2 Painful Pedigree | 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Remembering 10. An allele that is not expressed in heterozygous carriers is called a(n) ________ allele.

ANS: recessive DIF: Easy REF: 8.4 X Marks the Spot | 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Remembering 11. A parent who is a carrier for the recessive autosomal disorder B has the genotype ________.

ANS: Bb

DIF: Easy REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying 12. Zoe’s parents were both heterozygous for the recessive cystic fibrosis allele. Zoe had cystic fibrosis. The chance that any of Zoe’s future siblings will have cystic fibrosis is ________.

ANS: 25 percent 1 in 4 one-fourth DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding | Applying 13. A horizontal line directly between a square and a circle in a pedigree indicates that those two individuals are a(n) ________ pair.

ANS: mating DIF: Easy REF: 8.2 Painful Pedigree | 8.4 X Marks the Spot | 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Understanding 14. As shown in the figure below, the number of males born each year with hemophilia ________ the number of males born with Fragile-X syndrome each year.

ANS: is equal to equals is the same as DIF: Easy REF: Chapter 8 Infographic OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding

15. A disease caused by an inherited mutation is a ________ disorder.

ANS: genetic DIF: Easy REF: 8.1 A Mysterious Malady OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Remembering 16. Researchers hope to develop treatments for sex-linked genetic disorders such as Wiskott-Aldrich syndrome (WAS), by using a virus to insert a properly functioning gene into the patient’s blood cells.

This technique for correcting defective genes is ________, a specific type of genetic engineering.

ANS: gene therapy DIF: Easy REF: 8.7 Replacing Deadly Genes: A Work in Progress OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Remembering SHORT ANSWER 1. What factors make it difficult to study human genetic disorders?

ANS: It is difficult to study genetic disorders in humans for several reasons. Not only do humans have a long generation time and provide small sample sizes, they usually select their own mates and choose when to have children or if they have any children at all. It is also unethical for researchers to perform experiments directly on humans to determine how genetic disorders are inherited.

DIF: Moderate REF: 8.1 A Mysterious Malady OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 2. Karen and Jared produce three healthy children. The first child is a boy (Daniel) and the next two are girls (Leslie and Alice). Daniel grows up, marries Dana, and they have two children. Their first child is a healthy baby boy and the second is a little girl who is diagnosed with phenylketonuria (PKU). Draw this family’s pedigree.

ANS:

DIF: Difficult

REF: 8.2 Painful Pedigree

OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Analyzing | Evaluating 3. A karyotype of a human female reveals a total of 45 chromosomes: 44 autosomes and one sex chromosome. Is this karyotype typical of human females? Explain your reasoning.

ANS: This karyotype is not typical of human females. Human females should have 44 autosomes and 2 sex chromosomes (XX). This female is missing one of her X chromosomes. She has Turner syndrome; she will likely live a long, healthy life but may have mild to moderate reproductive issues.

DIF: Easy REF: 8.2 Painful Pedigree OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Understanding 4. A man with a translocation in a chromosome that does not affect gene function may not realize he has a translocation until he attempts to have a child. Explain how a translocation that does not affect the individual may become problematic during reproduction.

ANS: A chromosome with a translocation contains segments from two nonhomologous chromosomes. During meiosis it is difficult for these chromosomes to align properly and segregate into separate cells because they are not completely homologous.

DIF: Difficult REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Applying 5. The chromosome on the left of the figure below is chromosome number 5 from the father of a newborn child with cri du chat syndrome. The chromosome on the right is paternal chromosome number 5 in the child. What type of chromosomal abnormality has caused this syndrome in the child? Explain your answer.

ANS: The cri du chat syndrome in the child is caused by the deletion of some genetic material on chromosome number 5 from the father. This is represented by the absence of the lighter-toned segment that appears in the father’s chromosome number 5.

DIF: Moderate REF: 8.2 Painful Pedigree OBJ: 8.3 Diagram a chromosome, identifying genes, alleles, and loci.

MSC: Understanding | Applying 6. Would a karyotype for a human male be considered normal if it shows 45 autosomes and a single pair of sex chromosomes? Explain your reasoning.

ANS: A karyotype with 45 autosomes indicates that an extra chromosome (trisomy) is present. A normal male should have 44 autosomes (22 pairs) and one pair of sex chromosomes, XY.

DIF: Easy REF: 8.2 Painful Pedigree | 8.3 Looking for Loci OBJ: 8.2 Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

MSC: Understanding 7. Explain how two brothers might have different X chromosomes, but they must share identical Y chromosomes.

ANS: Males inherit one of two X chromosomes from their mother. The X chromosomes are not identical.

Their Y chromosome is inherited from their father, who only has one copy of the Y chromosome.

DIF: Moderate REF: 8.2 Painful Pedigree | 8.4 X Marks the Spot OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Evaluating 8. Explain how an individual who has both an X and a Y sex chromosome would develop embryologically as a female instead of a male.

ANS: Embryos that have both X and Y sex chromosomes typically develop as males because the SRY gene present on the Y chromosome acts as the ―master switch‖ directing development of the embryo to display male characteristics instead of female characteristics. If the SRY gene on the sole Y chromosome inherited from the father is nonfunctional, then the embryo will develop as a female instead of a male.

DIF: Moderate REF: 8.3 Looking for Loci OBJ: 8.4 Explain how sex is genetically determined in humans, and how sex determination relates to the inheritance of sex-linked traits.

MSC: Understanding 9. Can a male human be a carrier of an X-linked trait? Explain your answer.

ANS: No, a male human cannot be considered a carrier of an X-linked trait. If the allele for the trait is present on the male’s only X chromosome, it will be expressed. There is no matching allele on his other sex chromosome, the Y chromosome, to conceal the phenotypic expression of the allele on his X chromosome. To be a carrier of a trait, one must have the allele but not express it.

DIF: Moderate REF: 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits.

MSC: Understanding | Applying 10. Describe the possible genotypes and phenotypes (include probabilities) of offspring from a cross between a female heterozygous for the X-linked allele that produces Wiskott-Aldrich syndrome (WAS) and a male who does not have WAS. ANS: The female offspring from this cross would all have the normal phenotype (no WAS); they would have a 50 percent chance of being homozygous dominant genotype and 50 percent chance of being a heterozygous carrier of the allele. Male offspring from this cross would have a 50 percent chance of having the allele for WAS and therefore a 50 percent chance of having WAS. DIF: Difficult REF: 8.3 Looking for Loci | 8.4 X Marks the Spot OBJ: 8.5 Describe the genotype and phenotype of a ―genetic carrier‖ and use this term appropriately for sex-linked traits and autosomal recessive traits. | 8.6 Compare and contrast the inheritance of

recessive, dominant, and sex-linked genetic disorders.

MSC: Applying | Analyzing

11. What characteristics of inheritance would allow you to distinguish whether a disorder is recessive autosomal, dominant autosomal, or sex-linked?

ANS: Both recessive autosomal and sex-linked disorders appear to ―skip generations.‖ Sex-linked disorders are indicated when more males than females are affected. Recessive autosomal disorders affect males and females equally. Dominant autosomal disorders affect males and females equally but are unable to ―hide‖ in carriers because an individual with at least one allele will be affected.

DIF: Moderate REF: 8.4 X Marks the Spot | 8.5 More Common, but No Less Deadly: Zoe’s Story | 8.6 Deadly with One Allele OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 12. If DNA testing reveals that Tina carries a single allele for a particular genetic disorder but she does not currently show symptoms of the disease, is it possible that she will develop the disease later in life?

Explain.

ANS: Yes, it is possible but not probable. If the disease is recessive and Tina is a carrier, she will not develop the disease later. If the disease is autosomal dominant, she could show symptoms of the disease later in life.

DIF: Difficult REF: 8.4 X Marks the Spot | 8.5 More Common, but No Less Deadly: Zoe’s Story | 8.6 Deadly with One Allele OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Evaluating 13. Does the pedigree shown below most likely represent a condition that is autosomal recessive, dominant, or sex-linked? Explain your reasoning.

ANS:

The pedigree shows a disorder that is most likely autosomal recessive. Individuals of both sexes are equally likely to be affected by autosomal disorders. The disease shown appears to be recessive because it ―skips‖ generations, which indicates some individuals are unaffected carriers. Dominant disorders would appear in each generation.

DIF: Moderate REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.1 Interpret a human pedigree to determine whether a given condition is recessive, dominant, or sex-linked.

MSC: Evaluating 14. Why are dominant genetic disorders more rare than recessive disorders?

ANS: Dominant genetic disorders tend to cause serious health problems earlier in life than recessive disorders, and affected individuals may not live long enough to pass the affected allele on to children. Recessive alleles can remain in populations when they are ―hidden‖ in heterozygous carriers. Dominant alleles cannot ―hide‖ in the same way recessive alleles can and are always expressed in individuals who have at least one copy.

DIF: Moderate REF: 8.6 Deadly with One Allele OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 15. During routine genetic testing before the 2014 NBA Draft former Baylor Bears’ basketball center Isaiah Austin was diagnosed with Marfan syndrome. This genetic condition results in connective tissue problems for the individual. One of the more life-threatening features of this condition is aortic enlargement, which can leave the aorta susceptible to rupture. In 75 percent of the cases, the allele is inherited from one parent; in the other 25 percent of the cases, a new mutation has occurred. Explain whether this condition is likely an autosomal disorder (recessive or dominant) or an X-linked disorder; support your answer with information from the infographic shown below.

ANS: This condition appears to be an autosomal disorder because it seems to occur with about the same frequency in both males and females. It is probably caused by a dominant allele because it can be inherited from one parent. It is also generally more rare than the recessive disorders occurring in the population.

DIF: Difficult REF: Chapter 8 Infographic OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying | Analyzing 16. Wiskott-Aldrich syndrome (WAS) is a sex-linked recessive blood disorder that results when an individual does not have a functional WAS gene. Explain where a functional WAS gene can be isolated and how genetic engineering could be used to treat a patient who has WAS. ANS: A functional WAS gene can be isolated from the X chromosome of a healthy male or a healthy female who is not a carrier of the defective WAS gene. The functional WAS gene can be inserted into a harmless virus. This genetically engineered virus is now used to insert the functional WAS gene into the genome of some of the patient’s own blood stem cells. These genetically engineered cells are reinjected into the patient where they reproduce and begin to produce the missing protein. This method of correcting a defective gene responsible for a disease is gene therapy.

DIF: Moderate

REF: 8.7 Replacing Deadly Genes: A Work in Progress

OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Applying MATCHING Match each correct statement to the set of alleles listed below. a. Bb b. XaY c. XAXa d. bb e. XAXA f. BB g. XAY 1.

2.

3.

4.

5.

recessive homozygous for an autosomal gene heterozygous for an autosomal gene dominant homozygous for an autosomal gene male affected by recessive sex-linked disease female carrier of a sex-linked disease

1. ANS: D DIF: Easy REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 2. ANS: A DIF: Easy REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 3. ANS: F DIF: Easy REF: 8.5 More Common, but No Less Deadly: Zoe’s Story OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 4. ANS: B DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding 5. ANS: C DIF: Easy REF: 8.4 X Marks the Spot OBJ: 8.6 Compare and contrast the inheritance of recessive, dominant, and sex-linked genetic disorders.

MSC: Understanding

Chapter 09: What Genes Are MULTIPLE CHOICE 1. The two strands of a DNA molecule are held together by ________ bonds between their base pairs. a. hydrogen c. phosphate b. amino acid d. protein ANS: A DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Remembering

2. Along one side of a DNA molecule, the nucleotides are connected to each other by ________ bounds between ________. a. covalent; phosphate groups and sugar molecules b. hydrogen; adenine and guanine c. covalent; bases and sugar molecules d. hydrogen; adjacent sugar molecules ANS: A DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Remembering 3. Which of the following is NOT a base found in DNA? a. thymine c. guanine b. adenine d. uracil ANS: D DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Understanding 4. What part of a nucleotide accounts for the genetic variation between individuals? a. sugar c. nitrogenous base b. phosphate d. polymerase ANS: C DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Understanding 5. In a single strand of DNA, the total number of phosphate groups present is equal to the total number of ________ bases. a. adenine b. adenine and thymine c. guanine and cytosine d. adenine, thymine, guanine, and cytosine ANS: D DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Applying 6. If a segment of double-stranded DNA has 20 percent adenine (A), how much of it is cytosine (C)? a. 20 percent c. 40 percent b. 30 percent d. 60 percent ANS: B DIF: Difficult REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing 7. When bases of DNA correctly bind to the complementary strand, a. A always pairs with T. c. A always pairs with C. b. A sometimes pairs with T. d. A sometimes pairs with C. ANS: A DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Remembering 8. In a strand of double-stranded DNA, cytosine (C) will always be bound with a. A. c. C.

b. T.

d. G.

ANS: D DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Remembering 9. If one strand of DNA has the sequence CGATT, the sequence of the other strand of the same molecule will be a. CGATT. c. TACGG. b. GCTUU. d. GCTAA. ANS: D DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Applying 10. When looking at a single-stranded piece of DNA, a. G will always be next to C. c. G will sometimes be next to T. b. G will always be next to G. d. G will never be next to A. ANS: C DIF: Difficult REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Understanding 11. When examining the two complementary strands of nucleotides in one DNA molecule, it would be expected that the sum of ________ in one strand would be ________ the sum of the ________ in the other strand. a. Gs and Cs; equal to; Gs and Cs b. Ts and As; equal to; Cs and Gs c. Ts and As; greater than; Ts and As d. As and Cs; less than; Ts and Gs ANS: A DIF: Difficult REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Analyzing 12. The sequence of DNA differs among individuals within a species. This is the reason for a. mutation. c. base pairing. b. protein structure. d. variations in phenotypes.

ANS: D DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Understanding 13. The hereditary genetic material present in all living cells is a. carbohydrate. c. DNA. b. protein. d. RNA. ANS: C DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Remembering 14. The order of the base pairs in a DNA molecule a. differs from species to species. b. is identical in all organisms. c. is identical in organisms of the same species. d. differs from cell to cell in a given organism.

ANS: A DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Understanding 15. The CRISPR-Cas9 system is made up of two guide ________ molecules and two Cas9 ________ molecules. a. RNA; protein c. DNA; protein b. protein; RNA d. protein; DNA ANS: A DIF: Easy REF: 9.2 Precise Cuts OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Remembering 16. Once attached to the proper DNA sequence, Cas9 proteins found in the CRISPR-Cas9 system ________ both strands of DNA. a. polymerize c. wind b. cleave d. unwind ANS: B DIF: Easy REF: 9.2 Precise Cuts OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Remembering 17. Targeting the pol gene in pig DNA works to remove the 62 porcine endogenous retrovirus (PERV) genes because the pol gene is typically ________ in all 62 copies of PERV genes and ________ in other pig genes. a. lacking; present c. present; lacking b. present; present d. lacking; lacking ANS: C DIF: Moderate REF: 9.2 Precise Cuts | 9.4 Making Mutations | 9.5 Pigs Are People Too? OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Understanding 18. The CRISPR-Cas9 complex cuts through both strands of DNA in two neighboring sites. The chromosome does not break apart because during normal repair processes, the DNA sequences between the cut sites are a. replaced with normal pig DNA. b. looped outward and remain attached to the chromosome. c. removed and the remaining DNA is relinked. d. reattached to the DNA but switched to the opposite direction.

ANS: C DIF: Moderate REF: 9.2 Precise Cuts | 9.4 Making Mutations OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works. | 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Remembering | Understanding 19. Before using the CRISPR-Cas9 system to edit the pig genome, it is necessary to sequence the pig DNA to identify any copies of porcine endogenous retrovirus (PERV) DNA. Knowing the PERV DNA sequences will help researchers determine which ________ sequences to use as guides for the CRISPR-Cas9 complex. a. DNA c. protein b. RNA d. amino acid ANS: B DIF: Difficult REF: 9.2 Precise Cuts | 9.4 Making Mutations OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Understanding | Applying 20. Researchers used the CRISPR system to make 455 different cuts in the porcine endogenous retrovirus (PERV) pol genes in the pig genome. All of the PERV genes were inactivated in the pig embryos even though only 20 percent of the resulting mutations were larger than nine base pairs. The resulting mutations were successful at knocking out the PERV genes because a. even single point mutations can be enough to make a gene product useless or inactivate a gene. b. large mutations are not useful in knocking out genes. c. inactivating 20 percent of the PERV genes is just as good as inactivating 100 percent of the PERV genes. d. only 20 percent of the PERV genes need to be inactivated to result in all of them being inactive.

ANS: A DIF: Difficult REF: 9.2 Precise Cuts | 9.4 Making Mutations OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works. | 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Understanding | Applying 21. It could help meet transplant needs to use a patient’s own stem cells to grow a human liver in a pig embryo modified by CRISPR. As an additional and essential step in the process to ensure the liver is safe for the patient, CRISPR should be used to a. knock out all of the pig brain genes to prevent the pig brain cells from infecting the patient. b. insert human immune cell DNA into the pig embryo to make it more similar to the patient. c. insert human hemoglobin DNA into the pig embryo to make it possible for the growing pig to support the human liver. d. knock out all of the porcine endogenous retrovirus (PERV) genes to prevent infection of the human patient with porcine endogenous retroviruses.

ANS: D DIF: Difficult REF: 9.2 Precise Cuts | 9.5 Pigs Are People Too? OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Evaluating 22. The significance of specific base pairing in DNA is that a. it stabilizes the sugar molecule. b. it provides a method for making exact copies of DNA. c. it prevents errors in DNA replication. d. protein copies can be made directly from the DNA. ANS: B DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Understanding 23. Once replication in a DNA molecule is complete, each new DNA molecule contains a. one old strand and one new strand. b. the paired old strands and the paired new strands. c. new DNA polymerase. d. a new sequence of nucleotides.

ANS: A DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Remembering 24. When a cell divides, it a. breaks down its DNA.

b. deletes old genetic information. c. copies information from neighboring cells. d. copies its own genetic information.

ANS: D DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Understanding 25. DNA replication a. involves the copying of only the parts of a chromosome that encode protein. b. occurs before mitosis in the cell cycle. c. occurs immediately after mitosis. d. converts the double helix to two single helices.

ANS: B DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Understanding 26. The figure below shows a short sequence of DNA. During DNA replication, the piece of DNA depicted in this figure will produce

a. one single-stranded molecule with the sequence CAGT. b. two single-stranded molecules with the sequence GTCA. c. one single-stranded molecule with the sequence CAGT and a separate single-stranded molecule with the sequence GTCA. d. two double-stranded molecules that look just like the figure.

ANS: D DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Applying 27. Replication of DNA cannot begin until ________ bonds between ________ are broken. a. phosphate; nucleotides b. hydrogen; complementary bases c. covalent; sugar molecules d. hydrogen; nucleotides in one strand ANS: B DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Understanding 28. A rapidly dividing cell is exposed to a chemical that converts the bond that forms between adenine and thymine to a stronger covalent bond. Which of the following is MOST likely to occur? a. DNA replication would produce two molecules of DNA with mutations at every base that once held an A-T base pair. b. DNA replication would not occur because the two nucleotide strands that make up the DNA molecule would not be able to separate.

c. DNA replication would occur more slowly because DNA repair proteins would have to fix the covalent bonds before replication could begin. d. DNA replication would be faster because covalent bonds require less energy to break than hydrogen bonds.

ANS: B DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Analyzing 29. The adenine bases in a DNA molecule are radioactively labeled. The DNA is then placed in a solution containing unlabeled nucleotides and the enzymes needed for DNA replication. The DNA molecule is allowed to replicate twice, forming four new DNA molecules. The radioactively labeled adenine would be found in a. each of the eight strands. c. all but one strand. b. two of the eight strands. d. six of the eight strands.

ANS: B DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Applying 30. The polymerase chain reaction (PCR) is used to a. produce many copies of a selected DNA sequence. b. insert DNA from one organism into a new host. c. screen for a particular gene. d. deliver DNA products into a human patient.

ANS: A DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Remembering 31. The figure below shows the first cycle in polymerase chain reaction (PCR). The structure marked ―P‖ in this figure

a. represents the heat-tolerant DNA polymerase used in PCR to copy the gene of interest. b. represents a sequence of DNA complementary to parts of the gene being amplified that allows DNA polymerase to attach to the gene. c. indicates where on the DNA that DNA polymerase should terminate replication. d. indicates the location of the promoter for the gene being amplified.

ANS: B DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Understanding

32. The DNA primers used in polymerase chain reaction (PCR) are a. identical to the entire base sequence of one strand of the DNA. b. produced when a gene of interest is read by restriction enzymes. c. attached to the gene of interest by polymerase. d. complementary to DNA sequences at both ends of the DNA sequence of interest.

ANS: D DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Understanding 33. DNA polymerase is used by the cell to a. perform gel electrophoresis procedures. b. cure patients of certain genetic diseases. c. make copies of a DNA sequence. d. attach DNA fragments to each other.

ANS: C DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Applying 34. A detective finds a miniscule spot of blood on a murder suspect’s shirt. What method would the police lab be expected to use to get enough DNA from the blood droplet to perform DNA fingerprinting? a. inserting the blood’s DNA into viral DNA b. polymerase chain reaction (PCR) c. inserting the sample’s DNA into a plasmid d. DNA sequencing ANS: B DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Applying 35. A segment of DNA in a test tube replicates and produces many copies of itself. What was probably in the test tube that enhanced this process? a. repair enzymes c. plasmids b. DNA polymerase d. a mutagen ANS: B DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Applying 36. The polymerase chain reaction (PCR) technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes? a. Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary. b. Bacterial enzymes can bind to DNA outside of a cell. c. DNA can be cut into fragments only at high temperatures. d. The temperature required to separate DNA strands during PCR degrades other enzymes.

ANS: D DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Analyzing 37. Viral DNA that has entered the pig genome and remains active is passed from generation to generation through

a. mutations. b. histone proteins.

c. DNA replication. d. CRISPR-Cas9.

ANS: C DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Remembering 38. According to the infographic below, the number of references to CRISPR in the PubMed database ________ between 2014 and 2016.

a. quadrupled b. more than tripled

c. doubled d. more than quadrupled

ANS: B DIF: Easy REF: Chapter 9 Infographic OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Understanding 39. The first human trial using CRISPR and approved by NIH used the system to edit a. a mutated gene in human embryos and cure a genetic blood disorder. b. targeted genes in both human and mouse cells. c. bacterial genomes. d. a cancer patient’s own immune system cells.

ANS: D DIF: Moderate REF: Chapter 9 Infographic OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Understanding 40. Damaged DNA may be repaired by a special class of a. nucleotides. c. deoxyribose molecules. b. proteins. d. phosphate bonds.

ANS: B DIF: Easy REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Remembering 41. If DNA polymerase did not have the ability to proofread, then DNA replication would a. not proceed at all. b. proceed more slowly. c. result in more mutations.

d. result in additional copies of DNA. ANS: C DIF: Easy REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Understanding 42. Mismatch errors are a. almost always corrected by mutagens. b. also called mutations. c. almost always corrected by specialized proteins. d. usually caused by mutated proteins.

ANS: C DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Understanding 43. The figure below illustrates DNA undergoing replication. The region indicated by the arrow represents a

a. single base pair. b. mismatch error.

c. mutation. d. transformation.

ANS: B DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Applying 44. Which of the following must occur for a mismatch error to be repaired? a. DNA repair proteins identify damaged DNA. b. The sequence of nucleotides in the damaged DNA sequence guides the synthesis of the correct DNA sequence. c. DNA-eating enzymes within the nucleus destroy entire strands of damaged DNA. d. The damaged DNA undergoes DNA replication one more time.

ANS: A DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Analyzing 45. Which of the following will NOT generally cause mutations? a. chemicals c. viruses b. radiation d. DNA replication ANS: D DIF: Difficult REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Remembering

46. A permanent change in the DNA base sequence due to an uncorrected mismatch error is called a(n) a. mutation. c. repair protein. b. replication. d. insertion.

ANS: A DIF: Easy REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Remembering 47. The difference between the alleles of a single gene is a. their DNA base sequences. b. the way they are copied when the cell divides. c. the type of lipid of which they are composed. d. that they are not heritable.

ANS: A DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Understanding 48. A scientist uses polymerase chain reaction (PCR) to compare the sequence of a disease gene and a healthy gene. The scientist finds that these two genes are identical except for one G in place of a T at position 256 in the gene. This type of mutation is a(n) a. deletion. c. silent mutation. b. insertion. d. substitution mutation.

ANS: D DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Applying 49. A species that lacks DNA repair mechanisms is likely to have ________ variations between individuals than a species that possesses repair mechanisms because ________. a. fewer; there are fewer ways to change the DNA b. fewer; the repair mechanisms introduce more variation into the DNA sequence c. more; more spontaneous mutations will go uncorrected d. more; without a repair mechanism, the cell’s DNA replication genes are inactivated ANS: C DIF: Difficult REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Applying 50. DNA fingerprinting is based on regions of DNA that are variable between individuals. Many of these differences between individuals produce no change in phenotype. This type of mutation is a(n) a. deletion. c. silent mutation. b. insertion. d. substitution mutation.

ANS: C DIF: Difficult REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Applying 51. A pig’s pancreas is still not ready for transplant into a human even after inactivating all of the 62 porcine endogenous retrovirus (PERV) genes in a pig embryo. The pig’s ________ system genes would need to be manipulated to help prevent organ rejection by the human. a. nervous c. digestive b. immune d. endocrine ANS: B DIF: Moderate REF: 9.5 Pigs Are People Too? OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Applying 52. If the human transplant patient in the figure below needs a new kidney because of a genetic mutation that has made her own kidneys nonfunctional, what additional step would need to happen to produce a functional kidney for this patient?

a. The mutation that resulted in her nonfunctional kidneys should be edited or corrected before her stem cells are inserted into the pig embryo. b. Mutated kidney genes can be easily corrected after the pig embryo begins to grow. c. Nothing else needs to be done. The kidney genes in the patient’s stem cells will have autocorrected themselves already. d. The mutated kidney genes should be corrected after the human kidney is harvested from the pig and before it is implanted in the human.

ANS: A DIF: Difficult REF: 9.5 Pigs Are People Too? OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Evaluating COMPLETION 1. A protein binds to the outside of a DNA strand. This protein will NOT likely bind to the ________ of the DNA nucleotides.

ANS: nitrogenous bases DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Applying

2. A strand of DNA has the sequence GCAATTCG. The sequence of the complementary strand is ________.

ANS: CGTTAAGC DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Applying 3. Short lengths of DNA are wound around bundles of ________ to create a structure consisting of many nucleosomes strung together by strings of DNA. ANS: histone proteins DIF: Easy REF: 9.2 Precise Cuts OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Remembering 4. The CRISPR-Cas9 system is a combination of guide ________ and ________ proteins.

ANS: RNA molecules; Cas9 DIF: Moderate REF: 9.2 Precise Cuts OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Remembering 5. The CRISPR-Cas9 system is used to generate a ________ mutation when most of the pol gene is ―knocked out‖ and any remnants of the pol gene are nonfunctional.

ANS: deletion DIF: Moderate REF: 9.2 Precise Cuts | 9.4 Making Mutations OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works. | 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Understanding 6. After the CRISPR-Cas9 system cuts a segment of DNA, the cell’s DNA repair process actually removes the DNA sequences between the cut sites. This repair process is most likely facilitated by BOTH ________.

ANS: repair proteins and enzymes repair proteins and DNA polymerase enzymes and repair proteins DNA polymerase and repair proteins DIF: Difficult REF: 9.2 Precise Cuts | 9.4 Making Mutations OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works. | 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Applying 7. The enzyme that copies DNA is called ________.

ANS: DNA polymerase DIF: Easy

REF: 9.3 Double or Nothing

OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Remembering 8. In the first step of the polymerase chain reaction (PCR), the two strands of the DNA being amplified must be separated by exposing the DNA to high ________.

ANS: heat temperatures DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Understanding 9. A new copy of a double helix that is composed of a template strand and a newly replicated strand of DNA is created using ________ replication.

ANS: Semiconservative DIF: Easy REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Understanding 10. Cooling cycles during PCR amplification of DNA enable enzymes to build two new strands of ________ through ________ base-pairing.

ANS: DNA; complementary DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Understanding 11. Exposure to ultraviolet (UV) light can alter DNA sequences in a cell. Uncorrected, these changes can lead to skin cancer. Individuals who have a mutation in a gene that produces DNA ________ protein may be at an increased risk for skin cancer.

ANS: repair DIF: Easy REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Applying 12. A mutation is due to the addition of two bases in a strand of DNA. This is called a(n) ________.

ANS: insertion DIF: Easy REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Understanding 13. Compare the segment of DNA for normal hemoglobin DNA with the segment for sickle-cell hemoglobin DNA below. Sickle-cell disease is caused by a ________ mutation.

ANS: substitution point DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Understanding SHORT ANSWER 1. A chemical that disrupts hydrogen bonds is added to a test tube containing DNA. What would be the result of this reaction?

ANS: The individual strands of DNA would separate and the tube would contain single-stranded pieces of DNA. DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Applying 2. When studying genomes of organisms, scientists often will only list the sequence of a single strand.

Explain why the sequence of the second strand would be unnecessary information.

ANS: The sequence of the second strand is complementary to the first strand and would not provide any additional information. It is a simple thing to determine the sequence based on base-pairing rules.

DIF: Easy REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Applying

3. Describe the building blocks of DNA and how they are bonded together to form the DNA double helix.

ANS: The basic building blocks of DNA are nucleotides that are composed of deoxyribose, a phosphate group, and one of four nucleic acid bases. A sequence of nucleotides is linked together by covalent bonds between the phosphate of one nucleotide and the deoxyribose of the next one to form one strand; this forms one side of the ladder. The nucleic acid bases of one strand form complementary pairs with the bases of another strand. The base adenine will pair with thymine by two hydrogen bonds. The base cytosine will pair with guanine by three hydrogen bonds. These pairs connected by hydrogen bonds form the rungs of the DNA ladder. Once formed, the ladder twists into a double helix.

DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Understanding 4. What would you expect to find if you examined the DNA base-pair sequence of the allele for a mutated cystic fibrosis transmembrane regulator gene (CFTR) and compared it to the DNA base-pair sequence of the allele for a fully functional CFTR gene?

ANS: The DNA base-pair sequence for these two alleles should be similar, but there should also be one or more differences in these sequences because they code for different proteins.

DIF: Difficult REF: 9.1 Deep in the DNA OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand.

MSC: Applying 5. Using the figure below, describe how the two guide RNA molecules in the CRISPR-Cas9 system find the target DNA sequence.

ANS: The two guide RNA molecules find the segments of the DNA with their complementary base sequence and link with it. These DNA segments of bases are ―clustered regularly interspaced short palindromic repeats‖ (CRISPR).

DIF: Difficult

REF: 9.2 Precise Cuts

OBJ: 9.2 Use the base-pairing rules to determine a complementary strand of DNA based on a given template strand. | 9.3 Describe how the genome editing tool CRISPR-Cas9 works.

MSC: Analyzing | Evaluating 6. A scientist used CRISPR-Cas9 to inactivate the pol gene for DNA polymerase in the porcine endogenous retrovirus (PERV) sequences of a pig embryo. The resulting pig embryo cells were then placed in proximity of human cells, but there was no infection of the human cells by the PERVs. Why were the PERVs no longer able to infect the human cells?

ANS: The pol gene originally present in the PERVs would have been essential for the virus DNA to replicate and form viral particles. The pol gene was mutated by removing (deleting) a portion of it making this gene nonfunctional. If the viruses cannot replicate, they cannot infect other cells.

DIF: Difficult REF: 9.2 Precise Cuts | 9.4 Making Mutations | 9.5 Pigs Are People Too? OBJ: 9.3 Describe how the genome editing tool CRISPR-Cas9 works. | 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Analyzing | Evaluating 7. A chemical is found that binds to a replicating strand of DNA but does not allow the next nucleotide to bind to the growing chain. Explain how this chemical would affect cell division.

ANS:

This chemical would inhibit DNA replication because it would not be possible to add the appropriate nucleotide bases and complete the sequence. If DNA replication is not complete, then chromosome replication is not complete nor are the chromosomes properly configured to enter into mitosis. This would prevent cells from dividing and may even cause cell death unless the damaged DNA is repaired.

DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.4 Identify the steps of DNA replication and the location of each.

MSC: Evaluating 8. A scientist adds a single polymerase and primer to a polymerase chain reaction (PCR) but does not add nucleotides. How many strands would be present after three replications if a single original strand was present? Explain your answer.

ANS: Without nucleotides, PCR cannot proceed. Therefore, only the single original strand would be present after three rounds.

DIF: Difficult REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Analyzing 9. You are working for a pharmaceutical company that hopes to produce genetically engineered human pancreatic amylase from rapidly reproducing E. coli cells. Your colleague has worked for months to isolate a minute amount of DNA that she suspects contains the gene for human pancreatic amylase. You need more of this DNA for testing and evaluation. Describe how you can easily produce millions of exact copies of this DNA. ANS: Polymerase chain reaction (PCR) is used to produce millions of exact copies of the DNA. The DNA is heated to separate the double strands into two single strands. These single strands are mixed with a solution of primer (short segments to start replication of DNA), DNA polymerase to form new DNA, and free-floating nucleotides. This mixture is placed in the PCR machine that will conduct a series of heating (unwinding DNA) and cooling (primers and nucleotides pair with the template DNA while the polymerase strings them all together) cycles to produce millions of copies of the desired DNA. DIF: Moderate REF: 9.3 Double or Nothing OBJ: 9.5 Identify when PCR and gene sequencing technology should be used in an experiment.

MSC: Applying 10. The cells in tissue that produces mammalian sperm cells are rapidly reproducing to provide a continuous supply of sperm cells. Considering the effect of heat on double-stranded DNA, what is likely to happen to the production of mutation free sperm cells if this tissue is kept at a significantly warmer temperature than usual?

ANS: If the sperm-producing cells are kept at too warm of a temperature, the warm temperature might cause the hydrogen bonds between the base pairs to turn loose, leaving separated strands of DNA. If the DNA cannot form new hydrogen bonds, the cells will not be able to form new double-stranded DNA or chromosomes. There would likely be an increase in mutations.

DIF: Difficult REF: 9.3 Double or Nothing | 9.4 Making Mutations OBJ: 9.4 Identify the steps of DNA replication and the location of each. | 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Analyzing | Evaluating

11. Nitrous acid is a chemical that can react with DNA and change cytosine to uracil. If a cell is exposed to nitrous acid and some of the cytosine nucleotides in a gene are converted to uracil nucleotides, what should happen when that cell replicates?

ANS: The gene with the uracil nucleotides is mutated. During DNA replication, repair proteins will tag the damaged DNA segment for repair enzymes to cut and remove. Once the damaged segment has been removed, repair DNA polymerase will fill in the missing segment of DNA with the correct bases.

DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Applying 12. Being in the sun for short stretches of time is not as likely to cause mutations as is being in the sun for long stretches of time. Explain why longer exposure to ultraviolet (UV) is more likely to cause mutations.

ANS: Being in the sun for too long can overwhelm the repair enzymes. These enzymes may not be able to keep up with the number of errors, and mutations may remain.

DIF: Difficult REF: 9.4 Making Mutations OBJ: 9.6 Explain the cause of DNA replication errors, and describe how they are repaired.

MSC: Analyzing 13. Are mutations always harmful? Justify your answer using an example.

ANS: Mutations are not always harmful. A mutation is a change in an organism’s DNA sequence. This can either be harmful, helpful, or neutral depending on the change. For example, E. coli mutated to produce stronger toxin, which was beneficial to the E. coli cell.

DIF: Moderate REF: 9.4 Making Mutations OBJ: 9.7 Give an example of a mutation and its potential effects on an organism.

MSC: Evaluating MATCHING Put the following in order from smallest to largest. a. gene b. base c. nucleotide d. genome e. base pair 1.

2.

3.

4.

5.

This is the smallest in size.

This is the second smallest in size.

This is the middle in size.

This is the second largest in size.

This is the largest.

1. ANS: B DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing 2. ANS: C DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing 3. ANS: E DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing 4. ANS: A DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing 5. ANS: D DIF: Moderate REF: 9.1 Deep in the DNA OBJ: 9.1 Describe the structure of DNA, using appropriate terminology.

MSC: Analyzing

Chapter 10: How Genes Work MULTIPLE CHOICE 1. Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei. Therefore, prokaryotic a. cells are unable to undergo transcription and translation. b. cells do not need to undergo translation. c. cells do not need to undergo transcription. d. transcription and translation both take place in the cytoplasm.

ANS: D DIF: Moderate REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Analyzing 2. A human gene put into a plant cell will a. not produce a protein. b. produce a plant protein. c. produce the same protein produced in a human cell. d. produce a hybrid protein consisting of both human and plant components.

ANS: C DIF: Easy REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Remembering 3. DNA technology can be used with all organisms because they all a. contain antibodies. b. can contract the same diseases. c. share the same chemical DNA structure. d. contain the same genes.

ANS: C DIF: Moderate REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Understanding 4. Bacteria and humans use the same DNA components, and both kinds of cells also perform transcription and translation. Which of the following choices is a potentially significant outcome of this shared mechanism? a. Bacteria are able to transcribe and translate human DNA, and thus they potentially could produce human proteins. b. Bacteria are able to transcribe and translate human DNA; thus, they could evolve into

humans. c. Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same. d. Bacterial and human DNA are identical in sequence because the method for producing them is the same.

ANS: A DIF: Difficult REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Applying 5. Protein-coding genes specify the production of ________ as their immediate product. a. rRNA c. DNA b. tRNA d. mRNA ANS: D DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Remembering 6. The function of genes is to control the production of a. enzymes. c. all proteins. b. structural proteins. d. amino acids.

ANS: C DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding 7. Which of the following does NOT take place in the nucleus? a. transcription c. DNA replication b. intron removal d. translation ANS: D DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding 8. The order of the bases in DNA determines the order of the a. amino acids in DNA. c. amino acids in mRNA. b. bases in a protein. d. bases in mRNA. ANS: D DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding 9. Some viruses produce an enzyme called reverse transcriptase which causes the reverse process of transcription. Based on your understanding of gene expression, this enzyme should produce ________ from a(n) ________ template. a. RNA; DNA c. proteins; RNA b. DNA; RNA d. RNA; protein ANS: B DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA

OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Applying 10. In bacteria, the antibiotic erythromycin prevents ribosomes from functioning. The MOST likely reason that bacteria die from treatment with erythromycin is because the antibiotic a. inhibits transcription. b. inhibits translation. c. causes the wrong bases to be added to the growing mRNA strand. d. causes the wrong amino acids to be bound to the tRNA strands.

ANS: B DIF: Difficult REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Applying 11. The key enzyme used during transcription is a. RNA polymerase. b. DNA polymerase.

c. rRNA. d. terminase.

ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering 12. As transcription begins, RNA polymerase binds to a segment of a gene called a(n) a. promoter. c. start codon. b. intron. d. anticodon.

ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering 13. Which of the following is true of transcription? a. It destroys the DNA template. b. The DNA molecule must unwind. c. Base pairing is unimportant. d. The end result is a protein.

ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Understanding 14. If a strand of DNA has the sequence CGTAA, the RNA made from this molecule will have the sequence a. CGTAA. c. TAGCC. b. GCUTT. d. GCAUU. ANS: D DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Applying 15. During transcription, a. the DNA strands replicate, producing four mRNA molecules.

b. each strand in the DNA molecule directs the production of an mRNA molecule. c. a template strand of DNA directs the production of an mRNA molecule. d. a template strand of DNA directs the production of a tRNA molecule.

ANS: C DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Understanding 16. Following transcription, the a. strands of DNA bond back to each other. b. mRNA is digested. c. DNA molecule is broken down. d. ribosome is released from the tRNA molecule.

ANS: A DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Understanding 17. The information in a gene is encoded by the a. introns of eukaryotic cells. b. amino acids that make up the genes. c. base sequences of the gene’s DNA. d. rRNA that transfers amino acids to ribosomes.

ANS: C DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Analyzing 18. A mutation occurs in the promoter of a protein-encoding gene. How might this mutation affect the production of the protein encoded by the gene? a. The mRNA made from this gene would exhibit the same mutation and, therefore, would not fold or function properly. b. The protein made from the promoter would have a different amino acid sequence and, therefore, would not function properly. c. The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription. d. The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.

ANS: C DIF: Difficult REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Applying 19. The bases present in an RNA molecule are a. C, T, A, and G. b. U, A, C, and G.

c. G, C, U, and T. d. U, C, T, and A.

ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Understanding

20. In bacteria, the antibiotic chloramphenicol prevents amino acids from bonding. The MOST likely reason that bacteria die from treatment with chloramphenicol is because the antibiotic a. inhibits transcription. b. inhibits translation. c. causes the wrong bases to be added to the growing mRNA strand. d. causes the wrong amino acids to be bound to the tRNA strands.

ANS: B DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Applying 21. Which molecules are involved in translation? a. DNA and RNA b. mDNA, tDNA, and rDNA c. mRNA, tRNA, and rRNA d. proteins, amino acids, and DNA ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 22. Which RNA molecule brings new amino acids to the growing protein chain in translation? a. mRNA c. rRNA b. tRNA d. dRNA ANS: B DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 23. The importance of tRNA is that it a. carries a specific amino acid to the mRNA. b. reads the DNA molecule. c. contains codons that specify amino acids. d. is important in the construction of ribosomes.

ANS: A DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 24. Which of the following is true of rRNA? a. It is made up of base pairs. b. It carries amino acids. c. It is not translated. d. It helps transcribe DNA. ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding

25. Which of the lettered arrows in the diagram below of translation indicates a codon?

a. A b. B

c. C d. D

ANS: D DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 26. During translation, a. many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein. b. one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein. c. strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein. d. one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.

ANS: D DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 27. Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation. In this analogy, what would best match the job of the ribosome? a. the instructions b. the person building the bookshelf c. the pieces of wood d. the bookshelf ANS: B DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 28. In bacteria, the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome. The MOST likely reason that bacteria die from treatment with tetracycline is because the antibiotic a. inhibits the cell from producing the mRNA. b. causes the tRNA molecules to randomly arrange into proteins that do not function. c. causes tRNA rather than mRNA to be made into proteins. d. prevents the bacteria from assembling essential proteins.

ANS: D DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Analyzing 29. An mRNA molecule that is 99 bases long will create a protein composed of a. 33 amino acids. c. 33 tRNA molecules. b. 99 amino acids. d. 99 tRNA molecules.

ANS: A DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 30. A smartphone app converts spoken English into Spanish. This is similar to the process by which ________ are converted into ________. a. nitrogenous bases in DNA; nitrogenous bases in mRNA b. nitrogenous bases in mRNA; a sequence of amino acids c. amino acids in a protein; nitrogenous bases in tRNA d. nitrogenous bases in tRNA; nitrogenous bases in mRNA ANS: B DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 31. Each set of three bases in an mRNA molecule codes for one of 20 specific a. rRNA molecules. c. amino acids. b. nucleotides. d. proteins.

ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Remembering 32. The codon GAU codes for which amino acid?

a. CUA b. CTA

c. aspartate d. leucine

ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Remembering 33. Which of the following codons codes for proline?

a. UCC b. CCU

c. UUU d. CUU

ANS: B DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Understanding 34. Which of the following codons does NOT code for an amino acid?

a. UGA b. AUG

c. GAU d. UAC

ANS: A DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Understanding

35. Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG.

a. b. c. d.

ACAUGCUAUAUCCCG ACATGCTATATCCCG cysteine-threonine-isoleucine-glycine threonine-cysteine-tyrosine-isoleucine-proline

ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Applying 36. Which of the following codons codes for the same amino acid as the codon AGU?

a. AGA b. CGU

c. UCA d. GCU

ANS: C DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Understanding

37. What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation?

a. UCG b. AGC

c. TCC d. Serine

ANS: B DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Applying 38. Using the following chart, what chain of amino acids would be produced by the sequence of this very short, complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

a. b. c. d.

tyrosine-tyrosine-alanine tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine methionine-proline-glutamate methionine-proline-glutamate-isoleucine-alanine

ANS: C DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Applying 39. In the genetic code, a codon is ________ bases long for ________. a. two; all cell types b. three; all cell types c. three; bacterial cells and two bases long for plant cells d. three; plant cells and three bases long for bacterial cells ANS: B

DIF: Easy

REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Applying 40. Which of the following is a codon? a. U b. UU

c. UUU d. UUUU

ANS: C DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Applying 41. Which of the following is NOT a feature of the genetic code? a. Every individual has a different genetic code. b. Each codon in the genetic code specifies only one amino acid. c. The genetic code is redundant. d. The same genetic code can be applied to virtually every organism on Earth.

ANS: A DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Understanding 42. In humans the tRNA with the anticodon AAU carries the amino acid leucine. In plants, this tRNA would a. not have an anticodon. b. not carry an amino acid. c. carry the same amino acid. d. carry a different amino acid.

ANS: C DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Analyzing 43. The expression of most genes is regulated by a. internal signals only. b. external signals only. c. both internal and external signals. d. neither internal nor external signals.

ANS: C DIF: Easy REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Remembering 44. Gene expression is a. nonvariable for cells; it is the same for all cells of the same type. b. highly variable; it changes for many different reasons throughout the life of a cell. c. set by internal factors early in the life cycle of a cell and remains the same from that point forward. d. set by external factors early in the life cycle of a cell and remains the same from that point forward.

ANS: B DIF: Easy REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this

ability is important for an organism.

MSC: Understanding

45. Gene regulation is the ability to a. cut out a certain region of DNA to save energy. b. increase or decrease protein synthesis from a given gene. c. change the sequence of a gene to produce a new protein. d. share genetic information between different organisms.

ANS: B DIF: Easy REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Remembering 46. Liver cells are different from heart cells of the same organism because these cell types a. have different genes. b. express different genes. c. have a different DNA sequence. d. mutated from a stem cell to produce new cell types.

ANS: B DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Understanding 47. A gene in a region of DNA that is wound more tightly around proteins in the nucleus will be a. transcribed more often than other genes. b. transcribed less often than other genes. c. transcribed equally as often as any other gene. d. digested and recycled to produce new DNA. ANS: B DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Understanding 48. In humans, the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase. As a result, a. more mRNA for aromatase is produced. b. less mRNA for aromatase is produced. c. the production of aromatase is inhibited. d. aromatase is degraded by other enzymes in the cell.

ANS: A DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 49. In bacteria, a particular gene codes for a protein that helps the bacteria break down and use lactose as a food source. If no lactose is present, the a. gene will be broken down, so no enzyme is made. b. gene will mutate to produce another, more useful, enzyme. c. promoter for this gene will be blocked, so RNA polymerase can’t bind. d. promoter for this gene will be enhanced, so RNA polymerase binds more readily.

ANS: C DIF: Difficult REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 50. Since 1900, at least ________ people worldwide have died as a result of an H1N1 influenza infection.

a. 50,000,000 b. 50,285,000

c. 650,000 d. 52,535,000

ANS: B DIF: Easy REF: Chapter 10 Infographic OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding COMPLETION 1. The genetic code is ________, which means that all cells use the same code.

ANS: universal DIF: Easy REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Remembering 2. If a molecule of mRNA is a sentence, its bases are the letters and the codons are the ________.

ANS: words DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Applying 3. The process of using an RNA template to make proteins is called ________.

ANS: translation DIF: Moderate

REF: 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 4. A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.

This molecule is most likely a ________ molecule.

ANS: tRNA transfer RNA DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 5. A tRNA with the anticodon GGG would have the amino acid ________ bound to it.

ANS: Proline Pro DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Analyzing 6. A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.

ANS: promoter DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Analyzing

SHORT ANSWER 1. Explain how different cells in a human body, such as liver cells and skin cells, house the same genetic material but have different functions.

ANS: Although all cells in an individual contain the same genetic material, they are able to control which genes are expressed. Controlling gene expression allows cells to control the proteins produced from different genes.

DIF: Moderate REF: 10.0 Intro OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding 2. A mutation in the promoter region of a specific gene prevents RNA polymerase from binding. How would this mutation affect the function of this gene?

ANS: If RNA polymerase is unable to bind to the promoter, transcription will not occur. Without an mRNA transcript, translation will also not occur. The affected gene will not direct the production of a protein.

DIF: Moderate REF: 10.0 Intro | 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Understanding 3. DNA viruses cause disease when the host cell uses the viral DNA to produce more viruses. The host cell uses the viral DNA to make viral proteins as well as more viral DNA; these are then used to produce more viruses and cause disease. In a eukaryotic cell, the viral DNA is often inserted into the host genome. Explain why viral DNA that stays in the cytoplasm would not cause disease.

ANS: In a eukaryotic cell, the enzymes needed for transcription are in the nucleus. If the viral DNA remains in the cytoplasm, it will not get transcribed. This means that no viral proteins will be made.

DIF: Difficult REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.1 Explain how an organism uses gene expression to create a phenotype from a genotype.

MSC: Evaluating 4. Transforming plants with a human gene produces a protein that is identical to the original human protein. Explain how this evidence demonstrates that the genetic code is universal, and list another experiment that could be used to further support this theory.

ANS: If the genetic code was not universal, this process would not produce an identical protein. The production of an identical protein requires that transcription, translation, and the genetic code are the same for plants and animals. Transforming the same gene into bacteria (or fungi, or any other living organism) would help support this theory if the same protein was again produced.

DIF: Moderate REF: 10.1 Fighting the Flu with Tobacco OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Evaluating

5. Bacteria do not have a nucleus, and therefore do not use RNA splicing after translation. The initial mRNA that is produced is translated directly. An experiment transforms a bacterial cell and a eukaryotic cell with an identical gene (of identical length). Explain how the proteins from each cell would differ.

ANS: RNA splicing removes introns from the mRNA, which produces a shorter final mRNA strand.

Therefore, the eukaryotic cell would be translating a shorter mRNA strand and would produce a shorter protein.

DIF: Difficult REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Evaluating 6. A mutation that changes the anticodon of a tRNA is generally much more detrimental to a cell than a mutation that changes the codon of an mRNA. Explain why this might be the case.

ANS: A mutation in an mRNA could result in the production of a nonfunctional protein. The effect on the cell depends on how important that particular protein is. A mutation in a tRNA could result in the wrong amino acid being added to many different proteins. This would potentially be more harmful to the cell because more proteins could be nonfunctional.

DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Evaluating 7. Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.

ANS: The mRNA sequence produced from this DNA sequence is AUGAUUCCU and the amino acid sequence is methionine-isoleucine-proline.

DIF: Difficult REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Applying

8. Which of the following mutations would be more detrimental to an organism: 1) a mutation that changes the codon GGU to GGA, or 2) a mutation that changes the codon AAU to AAA? Defend your choice.

ANS: A mutation that changes the codon GGU to GGA would not change the amino acid inserted; in both cases the amino acid is glycine. This first mutation would be considered a silent mutation. A mutation that changes the codon AAU to AAA changes the amino acid from asparagine to lysine. Changing the amino acid may affect the structure and function of the protein, which would be more detrimental to the organism.

DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Analyzing 9. A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.

Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so, what are the sequences of mRNA and DNA? If not, why not?

ANS:

There is only one codon that codes for the amino acid tryptophan. The mRNA used to insert this amino acid in a protein is UGG and the corresponding DNA sequence is ACC. Valine and glycine are amino acids that are associated with redundancy in the genetic code; there are four codons that could produce each of them. More information would be required to determine the mRNA and DNA sequences for valine and glycine.

DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Evaluating 10. Explain what is meant by ―redundancy‖ in the genetic code.

ANS: There are 64 codons, 61 that specify an amino acid, and only 20 amino acids that are linked together to build proteins. Although each codon corresponds to a single amino acid, there are often multiple codons for each of the 20 amino acids.

DIF: Moderate REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Understanding 11. A silent mutation is a mutation where a DNA nucleotide has changed, but the resulting protein is identical to the protein produced before the mutation. Explain why such a mutation is possible.

ANS: The genetic code is redundant. This means that there is more than one codon that codes for each amino acid. A silent mutation would result when the mRNA sequence before and after the mutation produced a different codon that coded for the same amino acid.

DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.4 Determine the correct amino acid from a given codon.

MSC: Evaluating 12. Organisms can regulate both transcription and translation to control gene expression. What is one advantage and one disadvantage of regulating transcription rather than translation?

ANS: Producing mRNA requires energy. If gene expression is regulated at the level of transcription, this energy does not have to be used. Producing mRNA takes time. If gene expression is regulated at the level of translation, proteins can be produced faster when up-regulating protein production.

DIF: Difficult REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Evaluating 13. One concern with biopharming is that genes used to produce desired proteins could ―escape‖ a laboratory setting and spread to food crops. What does it mean for a gene to ―escape?‖ How would food crops be affected?

ANS: Food crops could incorporate a gene inserted into a plant species in a laboratory and begin producing the protein coded for by that gene because the genetic code is universal. Although the protein is desired in a laboratory setting, the effect of food crops producing the protein could be problematic.

DIF: Moderate REF: 10.5 To the Market OBJ: 10.5 Justify how the genetic code fits the definitions of ―redundant‖ and ―universal.‖ MSC: Applying MATCHING Identify if the following situations represent an increase or decrease in transcription or translation. a. Transcription is up-regulated. b. Transcription is down-regulated. c. Translation is up-regulated. d. Translation is down-regulated.

1.

2.

3.

4.

5.

RNA polymerase binds to the promoter more easily.

Fewer RNA polymerase enzymes are produced.

The mRNA molecules are broken down quickly in the cytoplasm.

More ribosomes are produced.

Fewer tRNA molecules are produced.

1. ANS: A DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 2. ANS: B DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 3. ANS: D DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 4. ANS: C DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying 5. ANS: D DIF: Moderate REF: 10.4 Tweaking Gene Expression OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism.

MSC: Applying Determine whether each molecule plays a role in transcription, translation, or both. a. transcription c. both transcription and translation b. translation 6.

7.

8.

9.

10.

11.

mRNA tRNA rRNA DNA amino acids RNA polymerase

6. ANS: C DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying 7. ANS: B DIF: Easy

8.

9.

10.

11.

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying Match the descriptions to the molecules of transcription and translation. a. mRNA b. tRNA c. RNA polymerase d. rRNA e. amino acids f. DNA

12.

13.

14.

15.

contains groups of nucleotides called codons double-stranded molecule that ultimately provides a template for protein synthesis important part of ribosomes molecule that carries amino acids to ribosomes

12. ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 13. ANS: F DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant

molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 14. ANS: D DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA.| MSC: Remembering 15. ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering Match the steps of transcription and translation to the location they take place within a eukaryotic cell. a. nucleus b. cytoplasm 16.

17.

18.

19.

20.

RNA splicing pairing of codons and anticodons recognition of a promoter gene construction of an mRNA molecule formation of a covalent bond between amino acids

16. ANS: A DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 17. ANS: B DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 18. ANS: A DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 19. ANS: A DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding 20. ANS: B DIF: Moderate REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant

molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding Put the following steps in the process of transcription in chronological order. a. first b. second c. third d. fourth 21.

22.

23.

24.

RNA splicing RNA polymerase exposes the DNA template strand.

RNA polymerase binds to the promoter region.

RNA bases are paired with DNA bases.

21. ANS: D DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering 22. ANS: B DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering 23. ANS: A DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering 24. ANS: C DIF: Easy REF: 10.2 Two-Step Dance, Transcription: DNA to RNA OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules.

MSC: Remembering Put the following steps in the process of translation in chronological order. a. first b. second c. third d. fourth e. fifth 25.

26.

27.

28.

29.

A stop codon is reached.

Recognition occurs between a codon and an anticodon.

Amino acids are covalently bonded. mRNA binds to a ribosome.

An amino acid chain is released.

25. ANS: D DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 26. ANS: B DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 27. ANS: C DIF: Easy

REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 28. ANS: A DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering 29. ANS: E DIF: Easy REF: 10.3 Two-Step Dance, Translation: RNA to Protein OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering

Chapter 11: Evidence for Evolution MULTIPLE CHOICE 1. Evolution is a. not supported by scientific evidence. b. strongly supported by scientific evidence. c. not supported by the fossil record. d. too obscure to study.

ANS: B DIF: Easy REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Remembering 2. Which of the following statements about evolution is true? a. Evolution only results in the addition of traits to existing organisms. b. Evolution only results in the loss of traits from existing organisms. c. Evolution can result in the addition or loss of traits in existing organisms. d. Evolution has nothing to do with the addition or loss of traits.

ANS: C DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 3. Which of the following statements regarding the evolutionary history of an organism is FALSE? a. Predictions of evolutionary relatedness based on fossil records often agree with predictions based on continental drift. b. Predictions of evolutionary relatedness based on fossil evidence often agree with those based on protein sequences. c. Predictions of evolutionary relatedness based on DNA usually contradict those based on anatomical evidence. d. Predictions based on DNA sequences provide the strongest evidence that two organisms are related.

ANS: C DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 4. Breeding programs for farm-raised chickens result in a variety of unusual colors and feathers. Is this an example of evolution? a. No; domesticated animals do not undergo evolution. b. No; evolution occurs over long periods of time and cannot be observed.

c. Yes; chickens that are better adapted to the environment will survive and breed. d. Yes; the change in chicken coloration is a genetic change in the population over time.

ANS: D DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Applying 5. Cultivation of corn over thousands of years has resulted in a modern corncob that looks very different from the tiny ancestral cob. Does this support the concept of evolution? a. No; the change in corn was accidental and does not demonstrate the process of evolution. b. Yes; the change in corn is an example of natural selection and demonstrates the process of evolution. c. No; artificial selection is driven by humans rather than natural selection and does not demonstrate what occurs in the wild. d. Yes; artificial selection demonstrates that evolution can occur, even though the driving force was humans rather than natural selection.

ANS: D DIF: Difficult REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution. | 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 6. Humans simulate the process of natural selection when they use ________ to develop new varieties of crop plants that better meet the needs of farmers. a. artificial selection c. habitat changes b. gene flow d. continental drift ANS: A DIF: Easy REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Understanding 7. Natural selection a. is the principle cause of extinctions. b. is the principle cause of evolutionary change. c. occurs only in gametes. d. cannot occur without genetic drift.

ANS: B DIF: Easy REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Remembering 8. The result of ________ over evolutionary time spans is that alleles that allow organisms to survive and reproduce at a higher rate than other individuals become more common in the population. a. natural selection c. homology b. artificial selection d. gene flow ANS: A DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Remembering 9. Natural selection tends to a. increase the commonality of characteristics that enhance survival and reproduction. b. decrease the number of individuals in any given population. c. lead to an increase in genetic drift. d. decrease the likelihood of adaptation.

ANS: A

DIF: Moderate

REF: 11.1 Artificial to Natural

OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Understanding 10. Peppered moths are generally light in color and blend into the trunks of the trees on which they live.

Populations of peppered moths found in areas where soot has blackened the tree trunks are dark in color.

This example demonstrates a. artificial selection. c. genetic drift. b. natural selection. d. vestigial coloration.

ANS: B DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 11. A group of scientists proposed that mammals with fur that contrasts with their background are hunted more by predators than mammals with fur that blends in with their background. After running several experiments, the scientists found that dark mice were attacked 25 percent of the time in a dark habitat and 75 percent of the time in a light habitat. The light-colored mice were attacked 25 percent of the time in a light habitat and 75 percent of the time in a dark habitat. These data a. support the hypothesis because dark-colored mice are attacked more often in both light and dark environments. b. support the hypothesis because dark-colored mice were attacked more in light environments and light-colored mice were attacked more in dark environments. c. do not support the hypothesis because although dark-colored mice are captured more often in light environments, they are also captured more often in dark environments. d. do not support the hypothesis because light-colored mice are attacked more often in both light and dark environments.

ANS: B DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 12. One of the reasons scientists have had so much difficulty finding a cure for HIV/AIDS is that the HIV virus is quick to evolve resistance to the drugs used to treat it. What is the most likely mechanism for this type of evolution? a. Certain versions of the virus persist longer in the presence of a drug than others. Those viruses may survive drug treatment and pass their genes to their offspring. b. Every time an HIV drug is taken, it randomly kills off most but not all virus particles. Those that survive repopulate the body of their host. c. Although all copies of a particular strain of the HIV virus are identical, some are better at ―hiding‖ in regions of the body that drugs cannot reach, and those viruses ―teach‖ their offspring where to hide. d. Some versions of the HIV virus produce chemicals that break down the drugs before they can harm the virus.

ANS: A DIF: Difficult REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Analyzing 13. What is biological evolution? a. the process of direct observation of the fossil record b. adaptations to common descent over time c. the unchanging nature of life on Earth d. change in the inherited characteristics of a group of organisms over generations ANS: D

DIF: Easy

REF: 11.0 Intro | 11.2 Fossil Secrets

OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Remembering 14. Fossils found in deeper layers are ________ than fossils found in more shallow layers. a. older c. more informative b. younger d. less informative ANS: A DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Remembering 15. Two fossils are found in a hillside. Fossil A was found in an upper layer and fossil B was found in a lower layer. Which of the following statements is true? a. A likely evolved from B. b. B likely evolved from A. c. A is likely the oldest of these fossils. d. B is likely the oldest of these fossils.

ANS: D DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Applying 16. The fossil record a. proves that all known species of organisms appeared at the same time. b. contains strong evidence that major new groups of organisms arose from previously existing organisms. c. indicates that humans date back as far as the first indications of life. d. has often been artificially created by evolutionary biologists.

ANS: B DIF: Moderate REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Understanding 17. Equus (horses) have a single toe on their hoof, while Hyracotherium (the ancestor to horses) had four toes. Which of the following evidence would support this conclusion? a. a transition fossil that has one toe b. an Equus fossil that has four toes c. a transition fossil that has three toes d. a Hyracotherium fossil that has one toe ANS: C DIF: Moderate REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Applying 18. Bears have thinner bones than whales. Hippopotami have intermediate bone thickness. What hypothesis does this support? a. Hippopotami live in dense, murky waterways. b. Whales and bears both evolved from hippopotami. c. Hippopotami spend part of their time living in water and part living on land. d. Hippopotami are an intermediate species in the evolutionary lineage between whales and bears.

ANS: C DIF: Difficult REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Understanding

19. Neanderthal fossils a. are likely to be found in layers above human fossils. b. are likely to be found in layers below human fossils. c. provide evidence of artificial selection during ancient times. d. disprove evolutionary theory because they are not ancestors of humans.

ANS: B DIF: Difficult REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Applying 20. The fossils of Pakicetus, Ambulocetus, Rodhocetus, and Dorudon are examples of ________, demonstrating the fifteen million years of evolution between Indohyus and Balaena (modern baleen whale). a. adaptive traits c. homologous traits b. transitional fossils d. analogous traits ANS: B DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Understanding 21. Both humans and whales evolved from a common ancestor. Although our forelimbs are quite different, they are made of the same bones. This is an example of a(n) a. artificial selection. c. transition fossil. b. homologous structure. d. vestigial structure.

ANS: B DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Remembering 22. Two different species may have similar features because of a. continental drift. b. the fossil record. c. artificial selection. d. descent from a common ancestor.

ANS: D DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Understanding 23. A species of cave beetle that lives in total darkness is blind but has remnants of what looks like eyes.

These ―eyes‖ are a. vestigial. c. analogous. b. homologous. d. convergent.

ANS: A DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Applying 24. Whales have tiny thighbones embedded in the skin next to their pelvis. This is an example of a. fossilization. c. a vestigial structure. b. genetic drift. d. an analogous structure.

ANS: C DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Remembering

25. The fact that small, nonfunctioning hind legs are found in the skeletons of many snakes suggests that snakes a. are in the process of evolving legs. b. evolved from organisms with legs. c. are really populations of lizards with severe mutation in limb development. d. evolved from eels (snakelike fish).

ANS: B DIF: Moderate REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Applying 26. The diagram below shows the bone structure of a whale flipper and a bat wing. Which of the following suggests that these two structures are homologous rather than analogous?

a. Both the flipper and the wing contain five fingerlike bone projections. b. The flipper is formed from the entire front appendage of the whale, but the wing is only formed from the hand part of the front appendage of the bat. c. The bones that form the five fingerlike projections in the flipper have much thicker bones than the bones that form these projections in the bat. d. The flipper of the whale contains more bones than the wing of the bat.

ANS: A DIF: Moderate REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Analyzing 27. The hands of a human and the hands of a chimpanzee are similar in structure because humans a. and chimpanzees share a recent common ancestor. b. evolved from chimpanzees. c. and chimpanzees evolved from different organisms that lived in similar environments. d. artificially selected for chimpanzees with hands during domestication.

ANS: A DIF: Moderate REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the

theory of common descent. MSC:

Applying

28. Although snakes and dogs are different species, they both have a bony vertebral column surrounding and protecting the nerve cord running down the center of their back. This column of bone is an example of a ________ trait and evidence of snakes and dogs sharing a common ________. a. analogous; descent c. homologous; ancestor b. vestigial; ancestor d. vestigial; descent ANS: C DIF: Moderate REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Applying 29. The proteins and DNA of organisms that share a recent common ancestor are ________ the proteins and DNA of organisms that do not share a recent common ancestor. a. more similar than c. identical to b. less similar than d. homologous to ANS: A DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Remembering 30. Whale DNA is more similar to hippo DNA than to the DNA of any other mammal. This indicates that a. whales descended from hippos. b. hippos descended from whales. c. hippos are whales’ closest living relatives. d. whales and hippos may be the same species.

ANS: C DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Remembering 31. The following image shows genetic comparisons of human, chicken, mouse, and chimpanzee. The shaded regions show nucleotide differences. This data supports that ________ are more closely related to ________ than to ________.

a. humans; mice; chickens b. humans; mice; chimpanzees

c. chickens; mice; chimpanzees d. chickens; chimpanzees; mice ANS: A DIF: Moderate REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Understanding 32. Examine the figure below. According to this figure, which two breeds have the LEAST similar DNA?

a. b. c. d.

Gun dog and Borzoi Gun dog and Spaniels Gun dogs and Scent hounds Sight hounds and Scent hounds

ANS: A DIF: Moderate REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Applying 33. When comparing certain amino acid sequences in the protein hemoglobin of humans to those of other animals, scientists found that baboons had seven amino acids that were different than the human protein, dogs had 10 amino acids that were different than the human protein, gorillas had one amino acid that was different than the human protein, and lemurs had eight amino acids that were different than the human protein. Which of these animals is most closely related to humans? a. baboon c. lemur b. dog d. gorilla ANS: D DIF: Difficult REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Analyzing 34. Whales and Indohyus share a more recent common ancestor than whales and fish. Which of the following is true? a. Whales, fish, and Indohyus will all have the same amount of genetic similarities. b. Whales and Indohyus will have more similarities in their DNA than whales and fish. c. Whales and fish will have more similarities in their DNA than whales and Indohyus. d. Fish and Indohyus will have more similarities in their DNA than fish and whales.

ANS: B

DIF: Difficult

REF: 11.4 Clues in the Code

OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Applying 35. How closely related two DNA molecules, and the organisms from which they came, are is measured through a. vestigial traits. c. homologous traits. b. DNA sequence similarity. d. amino acids.

ANS: B DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Remembering 36. Pangaea is a. the process of continental drift. b. the combined fossil record of ancient species. c. an ancient, giant continent. d. the result of natural selection.

ANS: C DIF: Easy REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Remembering 37. Fossils of organisms that lived on Pangaea are likely found a. mainly in Africa. b. mainly in Eurasia. c. mainly in South America. d. widely dispersed throughout the world.

ANS: D DIF: Moderate REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Understanding 38. Two fossils of the same species are found in both Africa and South America. What does this indicate? a. This organism evolved after the separation of Pangaea. b. This organism evolved before the separation of Pangaea. c. The fossil from South America evolved from the organism from Africa. d. The fossil from Africa evolved from the organism from South America.

ANS: B DIF: Moderate REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Applying 39. Kangaroos are found only in Australia; these organisms a. have few adaptive qualities. b. have a narrow biogeography. c. evolved few vestigial structures. d. evolved before the separation of Pangaea.

ANS: B DIF: Moderate REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Understanding 40. In the figure below, the region at the lower right indicated by the arrow is the only modern-day location of the freshwater lungfish. Fossils of the ancestors of the lungfish, however, have been found all over the world (dots throughout the map). What does the distribution of these fossils indicate?

a. When Pangaea separated to form smaller continents, the living ancestors of the lungfish were separated. When they died, some of them formed fossils in their new lands. b. The same species of lungfish evolved on all of Earth’s major landmasses after continental drift had stopped. c. The ancestors of the lungfish existed on Pangaea. After they died, some were fossilized.

Their fossils were separated by continental drift. d. Lungfish were much more successful in the climates of North America than they were in the climates of South America.

ANS: C DIF: Difficult REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Analyzing 41. The fossils of organisms that existed when the continents were connected are distributed across ________ continents than the fossils of organisms that evolved after the continents separated. a. more c. older b. fewer d. younger ANS: A DIF: Difficult REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Analyzing 42. The genus Lycopodium includes plants that evolved before the breakup of Pangaea. The genus Sequoiadendron (Sequoia trees) evolved after Pangaea split into separate landmasses. Which genus would you expect to have the widest distribution of living representatives across the modern continents? a. Lycopodium b. Sequoiadendron c. Both should be equally distributed. d. Both should be extinct.

ANS: A DIF: Difficult REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Applying 43. By 200 million years ago, parts of the supercontinent of Pangaea had begun to drift away from each other. Laurasia (North America and Eurasia) separated from Gondwanaland (South America, Africa, Antarctica, Australia, and India). Which of the following would you expect to find?

a. Plants and animals (and fossils) in North America and Europe and Asia would be dramatically similar. b. There would be little resemblance between the fossils of plants and animals found in South America and Africa. c. There would be greater similarity between the plants and animals of Asia and Antarctica than between those of Asia and Europe. d. There would be less similarity between the plants and animal of North America and Europe than those between North America and India.

ANS: A DIF: Difficult REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Analyzing 44. Which of the following embryos will look similar to human embryos for the longest? a. bird c. fish b. cat d. reptile ANS: B DIF: Easy REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Understanding 45. Why do human embryos develop gill slits? a. The gill slits become the lungs. b. The ancestor of humans had gills. c. This helps the embryo breathe in the womb. d. This is an unexplained mutation in humans that does not exist in other animals.

ANS: B DIF: Moderate REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Understanding 46. Some whales have teeth as embryos but do not as adults. What is the most likely explanation of this phenomenon? a. Whales are in the process of evolving teeth. b. Whale teeth appear as the result of a frequently occurring mutation. c. Whales evolved from organisms that have teeth. d. The allele for teeth is unusually common in some whale populations.

ANS: C

DIF: Moderate

REF: 11.6 Growing Together

OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Applying 47. Tails are found a. in all embryos. b. only in adults and begin forming late in development. c. only in embryos of organisms that will have a tail as adults. d. in embryos of a wide variety of organisms, some of which have a tail as adults and others do not.

ANS: D DIF: Difficult REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Understanding 48. Dolphin embryos develop hind limb buds, but these buds disappear after a short time. What is one mechanism to explain how this change occurs in the embryo? a. The hind limbs are not used and atrophy. b. The dolphin does not have the gene for the production of hind limbs. c. The hind limbs are not adaptive, and dolphins with hind limbs do not survive as well. d. Genes that control the development of the embryo turn off the development of the hind limb.

ANS: D DIF: Difficult REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Analyzing 49. Human and fish embryos share a number of features. Why is this? a. Humans and fish share a common ancestor. b. Embryos of all organisms, plant and animal, look alike. c. Mutations in human and fish embryos have caused them to look alike. d. Humans and fish have exactly the same genes, but as they develop, different genes are turned on in fish than in humans.

ANS: A DIF: Difficult REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Applying 50. The evolution of new organs usually builds on preexisting structures that are modified in form and sometimes function. The embryos of fish, amphibians, reptiles, birds, and mammals all have pharyngeal pouches or gill slits. These pouches develop into gills in adult fish and they are used to absorb oxygen from their watery environment. These same pouches become parts of the ________ in humans. a. lungs and heart c. ear and throat b. eyes and nose d. eyes and lungs ANS: C DIF: Easy REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Remembering 51. Consider the experimental design presented in the infographic below. What is the significance of growing the populations at 42.2oC? The increased growth temperature serves as a method of

a. natural selection. b. common ancestry.

c. direct mutation of DNA. d. artificial selection.

ANS: D DIF: Moderate REF: Chapter 11 Infographic OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying COMPLETION 1. The increase in antibiotic resistance in E. coli as a result of treating healthy animals with antibiotics is an example of ________ driving evolution.

ANS: natural selection DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution. | 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 2. The evolutionary process by which a population becomes better suited to its environment over time because advantageous traits are passed from one generation to the next is called ________.

ANS: adaptation DIF: Easy

REF: 11.1 Artificial to Natural

OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Remembering 3. Humans bred cows specialized for milk production by allowing female cows that produce large quantities of milk to mate only with male cows with mothers that also produced large quantities of milk.

This is an example of ________ selection.

ANS: artificial DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 4. Grasshopper mice prey on venomous scorpions. Though the mice have some level of resistance to the scorpion venom, scorpions with more potent venom are better able to fend off attack by a grasshopper mouse. Over time, the population of scorpions all produce more potent venom. This is an example of ________ selection.

ANS: natural DIF: Easy REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Understanding 5. The preserved remains of formerly living organisms are called ________.

ANS: fossils DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Remembering 6. Indohyus’s thick bones made it easier for this animal to wade and dive in water to evade predators and find plants to eat on the river bottom. This is an example of a(n) ________, a feature that gives an individual improved function in a competitive environment.

ANS: adaptive trait DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Remembering 7. The human appendix is an example of a(n) ________ structure.

ANS: vestigial DIF: Moderate REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Understanding 8. An organism from which more than one species has evolved is referred to as a(n) ________. The group of organisms arising from it have a common descent.

ANS: common ancestor

DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Remembering 9. The ________ would have DNA most similar to the Borzoi.

ANS: Afghan hound DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Understanding 10. DNA is the genetic (hereditary) material found in all living things on planet Earth. The genetic code is the same for everything from bacteria to plants and humans; this is evidence that the great diversity of life evolved from a ________.

ANS: common ancestor DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Remembering | Understanding 11. Continental drift is the ________ of Earth’s landmasses through geologic time.

ANS: movement DIF: Moderate REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Understanding 12. The geographic locations where an organism (or its fossils) can be found are described as the species’ ________.

ANS: biogeography DIF: Easy REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Remembering 13. The study of organisms prior to birth or hatching is called ________.

ANS: embryology

DIF: Moderate REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past. MSC: Understanding 14. Human embryos have webbing between their fingers and toes, but genes turn on during development that cause this webbing to dissolve before birth. Tiktaalik and other early amphibians had lobed fins or limbs. This evidence supports the hypothesis that humans and amphibians had a ________ in fish.

ANS: common ancestor DIF: Moderate REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past. MSC: Understanding 15. The E. coli populations that survived the selective pressure of growing at the warmer temperatures did so because of ________ present in their DNA.

ANS: mutations DIF: Moderate

REF: Chapter 11 Infographic

OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Understanding SHORT ANSWER 1. A friend states that ―evolution is just a theory because it does not have supporting evidence.‖ Evaluate this statement, including a list of the types of evidence used in drawing your conclusion.

ANS: Scientific theories require substantial evidence. Evidence for evolution includes direct observation, fossil evidence, shared characteristics among living organisms, comparative DNA, comparative embryology, and biogeographic evidence.

DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Evaluating 2. A population of grasshoppers, ranging in color from bright green to greenish-tan, live in a lush green grassland; their coloring helps to camouflage them in their environment and helps them hide from predators. Over the course of several years, a severe drought kills off the grasses, leaving mostly dry, tan-colored sand and topsoil with sparse green vegetation. Predict what the surviving population of grasshoppers will look like in the changed environment. Explain your answer and indicate which evolutionary process has occurred.

ANS: The surviving population of grasshoppers will most likely be a greenish-tan color. The bright green grasshoppers will be more easily seen and eaten by their predators as the environment becomes less green. Once they are eaten, they will be unable to pass their genes on to the next generation of grasshoppers. As more of the greenish-tan grasshoppers survive to pass their genes to the next generation, there will be fewer bright green grasshoppers in the population. This is an example of adaptation, an evolutionary process by which a population becomes better suited to survive in its environment. It is driven by natural selection of the individuals who survive and reproduce at a higher rate; in this case that would be the better-camouflaged greenish-tan grasshoppers.

DIF: Difficult REF: 11.1 Artificial to Natural OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Applying 3. Although they are protected in many countries, humans still hunt elephants for their ivory tusks. A mutation that results in tuskless elephants is increasing in frequency in some elephant populations. Is this an example of artificial or natural selection? Support your answer.

ANS: This is an example of natural selection because humans are not directly selecting which animals breed.

Humans are acting more as a predator in this example because they are killing individuals that have something the human desires. The elephants that are not appealing to the predator are able to survive and reproduce.

DIF: Difficult REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Analyzing

4. Briefly propose how it could be possible that the cultivated vegetables Kohlrabi, Brussels sprouts, cabbage, cauliflower, broccoli, and kale are all the same species, Brassica oleracea (common wild mustard).

ANS: The process of artificial selection makes this possible. Desired traits from the wild mustard were chosen and selectively bred for by humans to exaggerate that trait. By breeding only the plants that exhibited the selected trait, the trait became more established in the population with each generation.

DIF: Moderate REF: 11.1 Artificial to Natural OBJ: 11.2 Compare and contrast artificial selection and natural selection.

MSC: Applying 5. Explain how an intermediate fossil can provide evidence for the lineage of current species.

ANS: Intermediate fossils show some characteristics that are similar to the ancestral group and some characteristics that are similar to the modern-day organism. They also show transition characteristics in between the two organisms. This evidence is used to support lineages because it can show how the evolutionary process progressed.

DIF: Difficult REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Analyzing 6. Oxygen in the molecules that make up teeth comes from the water and food that an animal ingests.

Additionally, carbon isotopes incorporated into the teeth and the shape of teeth can indicate what type of food an animal consumes. What ―tooth evidence‖ would support the hypothesis that Indohyus spent a great deal of its life near or in the water and grazed on plants? Briefly explain your answer.

ANS: Examination and testing of the oxygen and carbon molecules present in the fossilized teeth of Indohyus showing results similar to (or matching) those found in modern water-going mammals who eat plants would support the hypothesis that Indohyus lived near/in the water and grazed on plants. Additional support of the hypothesis would be if Indohyus’s teeth are also shaped like those of modern plant-eating, water-going mammals. Comparing the fossils of extinct organisms to organisms still alive today can provide evidence about the appearance and structure of the extinct organisms and their lives.

DIF: Difficult REF: 11.2 Fossil Secrets OBJ: 11.3 Summarize the argument that the fossil record provides evidence in support of evolution.

MSC: Applying | Evaluating 7. Dogs have vestigial digits called dewclaws. Describe the most likely origin of these structures.

ANS: The ancestor of dogs had more digits than modern dogs. These structures were not harmful and were not selected against, and so remained.

DIF: Difficult REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Applying

8. Carpal tunnel syndrome happens when the median nerve in a person’s hand is compressed or squeezed, causing pain in the fingers. When the condition is severe enough, a surgeon can correct it by cutting through the transverse carpal ligament that is putting pressure on the nerve; this cutting of the ligament does not adversely affect the person’s ability to use his or her hand or fingers. What does this suggest about the trait of having a transverse carpal ligament? Briefly explain your answer.

ANS: This would suggest that the transverse carpal ligament is a vestigial trait humans no longer need. Though it does not typically cause a problem for most people, it can become bothersome over time for others.

Since cutting it does not adversely affect the person’s use of his or her hand or fingers, it would appear that it no longer actually serves any detectable function. It probably served some function in the evolutionary past of humans, or it would not be present today.

DIF: Difficult REF: 11.3 The Ultimate Family Tree OBJ: 11.4 Give an example of a homologous or vestigial trait, and explain how such traits support the theory of common descent. MSC: Evaluating 9. Placing a human gene into a plant produces the same protein as would be produced in a human. Some of the genes in plants are similar to human genes; others are very different. What does this information indicate about the relationship between humans and plants?

ANS: The similarity of some genes indicates that humans and plants had a common ancestor at some point.

However, the differences in other genes indicate that this common ancestor existed a very long time ago.

DIF: Moderate REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Evaluating 10. Evaluate the DNA sequences presented below to determine which of the organisms (B, C, or D) shares the most closely related ancestor to organism A. Which organism shares the least closely related ancestor to A? Support your answer with DNA sequence similarity evidence from the figure that represents the DNA sequence for a single protein found in all four organisms.

ANS: It is clear that organisms A and D are most closely related with respect to this DNA sequence. There is only one base pair difference between A and D, while there are five base pair differences between A and C. A and B are most distantly related because there are sixteen base pair differences between their sequences. The fewer number of base pair differences indicates closer DNA sequence similarity and a closer shared ancestor. The greater number of base pair differences indicates a greater disparity in the DNA sequence similarity and a more distant shared ancestor.

DIF: Difficult REF: 11.4 Clues in the Code OBJ: 11.5 Explain why even distantly related species have similar DNA. MSC: Evaluating 11. A fossil is found in Africa and South America but nowhere else in the world. What does this tell us about this organism?

ANS: The organism lived prior to the breakup of Pangaea but had a very narrow habitat.

DIF: Difficult REF: 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Analyzing 12. Dana finds a plant on the southeastern coast of North America and a very similar plant on the northwestern coast of Africa. Upon evaluating their DNA sequence similarity, she determines they had a common ancestor. How long ago should Dana predict that the common ancestor existed, and where should she expect to find fossil evidence of it or transitional forms? Support this prediction.

ANS: The common ancestor of these plants would probably have existed before the supercontinent of Pangaea began to drift apart about 200 million years ago. The best places to look for fossil evidence of the common ancestor and any transitional forms would probably be in the same areas where the modern species is found (southeastern coast of North America and northwestern coast of Africa), in layers of earth that date back more than 200 million years ago.

DIF: Difficult REF: 11.2 Fossil Secrets | 11.3 The Ultimate Family Tree | 11.4 Clues in the Code | 11.5 Birthplace of Whales OBJ: 11.6 Use your knowledge of evolution and continental drift to make a prediction about the geographic location of a given set of fossils.

MSC: Analyzing | Evaluating 13. Dolphin embryos have both forelimbs, which will become the flippers, and hind limbs, which will not develop. Explain how this supports the conclusion that dolphins are related to humans.

ANS: Dolphin embryos have four limbs because dolphins evolved from the same four-limbed ancestor as did humans.

DIF: Moderate REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Evaluating

14. Fish typically have eyes on the sides of their heads. The embryos of amphibians, birds, and mammals begin with their eyes on the sides of their heads, but the eyes move toward the center of the head during development. What does this suggest about the common ancestor of these diverse animals? Provide additional supporting evidence from your reading.

ANS: This suggests that these diverse groups of animals had a common ancestor in the fishes. Additionally, the embryos of fishes, amphibians, reptiles, birds, and mammals all develop pharyngeal gill slits (pouches).

These pouches become the gills of adult fish but in mammalian embryos they typically become parts of the ear and throat. These common patterns of development reflect the patterns of descent from a common ancestor, in this case, a fish.

DIF: Difficult REF: 11.6 Growing Together OBJ: 11.7 Relate similarities in embryonic development among species to their shared evolutionary past.

MSC: Analyzing | Evaluating 15. How can a researcher determine if the mutations to the RNA polymerase complex or the mutations in the rho gene were caused by the growth in increased temperatures or if they were merely selected for by growing the ancestral E. coli in the warmer temperatures?

ANS:

The researcher can sequence DNA samples from the original 115 ancestral E. coli populations in step one to determine if the mutations are already present in the population before it is subjected to the higher temperatures. If the mutations are already present in some of those 115 ancestral populations, then the high growth temperatures simply artificially select for those individuals who have the mutations. If the mutations are not present in the original populations, then the high growth temperatures may be contributing to the mutation of the E. coli DNA. DIF: Difficult REF: Chapter 11 Infographic OBJ: 11.1 Define evolution and list the six types of evidence for evolution. | 11.2 Compare and contrast artificial selection and natural selection. | 11.5 Explain why even distantly related species have similar DNA. MSC: Analyzing | Evaluating MATCHING Match each example to the type of evidence supporting evolution. a. b. c. d. e.

1.

2.

3.

4.

5.

comparative embryology fossil evidence comparative anatomy comparative DNA biogeographic evidence

The human and chimpanzee insulin genes are 98 percent similar.

Dolphins develop hind limb buds, but these structures disappear before adulthood.

Bats have the same forelimb bones as humans, but the size of these bones is different.

The freshwater lungfish Neoceratodus fosteri is found on every continent except Antarctica.

Indohyus (an extinct ancestor to the whale) has whalelike ears and slender legs tipped with hooves.

1. ANS: D DIF: Easy REF: 11.4 Clues in the Code OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 2. ANS: A DIF: Easy REF: 11.6 Growing Together OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 3. ANS: C DIF: Easy REF: 11.3 The Ultimate Family Tree OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 4. ANS: E DIF: Easy REF: 11.5 Birthplace of Whales OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding 5. ANS: B DIF: Easy REF: 11.2 Fossil Secrets OBJ: 11.1 Define evolution and list the six types of evidence for evolution.

MSC: Understanding

Chapter 12: Mechanisms of Evolution MULTIPLE CHOICE 1. Evolution can be described as a. predesigned change in the genetic characteristics of a population of organisms over time. b. sudden shifts in the genetic characteristics of an individual in a population. c. a change in the genetic characteristics of a population of organisms over time. d. isolation of populations due to geologic forces.

ANS: C DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Remembering 2. Evolutionary changes occur when ________ acts upon populations containing individuals with genetic differences. a. continental drift c. weather b. natural selection d. mutation ANS: B DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Remembering 3. An example of evolution that has been readily observed is a. a chameleon changing colors as it moves from a leaf of one color to a leaf of another color. b. increased resistance of bacteria to an antibiotic that is used to kill them. c. chimpanzees learning sign language. d. humans teaching dogs to obey certain commands.

ANS: B DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Understanding 4. What is the total number of alleles present for any given gene in a population of 100 individuals? a. 50 c. 200 b. 100 d. 400 ANS: C DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Applying 5. A gene has two alleles, D and d. The frequency of the D allele is 0.2. What is the frequency of the d allele? a. 0.2 c. 0.64 b. 0.4 d. 0.8 ANS: D DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Applying 6. If a given population has 30 RR individuals, 10 Rr individuals, and 10 rr individuals, what is the allele frequency of R? a. 0.1 c. 0.5 b. 0.3 d. 0.7 ANS: D DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Applying 7. Jean-Baptiste Lamark proposed that populations evolve when traits acquired during the lifetime of a parent are passed down to offspring. What is wrong with this proposal? a. Only changes in the DNA sequence of an organism can be inherited. Traits acquired throughout life generally do not involve DNA. b. The environment chooses which traits are necessary for survival rather than the individual. c. Changes in a species occur at the individual level rather than at the population level.

d. The inheritance of acquired traits would not lead to speciation because it would cause all of the individuals in a population to become more similar.

ANS: A DIF: Difficult REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Understanding 8. New alleles arise by a. nonrandom mating. b. allele frequency.

c. genetic drift. d. mutation.

ANS: D DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Remembering 9. Which of the following is true with regard to mutations? a. Mutations occur in response to environmental pressures. b. Mutations are more common in slowly growing organisms. c. Mutations appear without regard to environmental pressures. d. Several mutations must occur at one time for a new phenotype to appear.

ANS: C DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Understanding 10. Insecticides are used to kill insects. However, insecticide-resistant insects are being found. What is the mechanism for this new insect trait? a. An insect with a random mutation is not killed by the insecticide and reproduces. b. Exposing insects to insecticides leads to mutations, which make the insects resistant. c. Human interference with natural processes leads to genetic drift, which results in resistant insects. d. Insecticides kill all the insects in a population, and a different species of resistant insects colonizes the available resources.

ANS: A DIF: Difficult REF: 12.1 Birth of a Superbug OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Applying 11. The color of a certain species of beetle is determined by a single gene. Two beetles homozygous for green coloration (meaning they have two copies of the green allele) produce a single offspring with brown coloration. Brown color appeared in this offspring as a result of a. bottleneck. c. genetic drift. b. gene flow. d. mutation.

ANS: D DIF: Difficult REF: 12.1 Birth of a Superbug OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Applying 12. Alex is a student with Strep throat (caused by a strain of bacterium) who is given a prescription for an antibiotic and is told to take the drug for two weeks. After a week, he feels better and stops taking the drug. Two months later, Alex again shows symptoms of Strep throat and decides to finish the leftover antibiotic rather than going to the doctor again. Two months after that, he develops Strep throat for a third time and returns to the doctor. This time, the antibiotic does not work. The doctor runs a test and discovers that the bacterial strain Alex is carrying is antibiotic resistant. What most likely happened? a. Because the use of antibiotics lowers the effectiveness of the immune system, the student

continually reinfected himself with the bacteria. The third time, the student happened to be reinfected with a resistant strain. b. When the student stopped taking the drug, a small number of bacteria—those that were more drug resistant—still survived in his body. Those bacteria repopulated his throat and, over time, drug-resistant alleles became more common. c. The student must have eaten produce that had been genetically engineered with antibiotic-resistant genes. When he consumed them, the bacteria in the student’s throat picked up these genes through horizontal gene transfer. d. The antibiotic caused mutations in the bacterium. The more exposure to the antibiotic, the more mutations.

ANS: B DIF: Difficult REF: 12.1 Birth of a Superbug | 12.2 Rising Resistance OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Understanding 13. Which of the following is NOT a mode of natural selection? a. directional selection c. dormant selection b. disruptive selection d. stabilizing selection ANS: C DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Remembering 14. Disruptive selection operates whenever a. natural selection is disrupted by genetic drift. b. there is a balanced gene pool. c. only the smallest individuals survive. d. both extremes of the phenotype are more successful.

ANS: D DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Remembering 15. When robins lay a clutch of more than four eggs, their chicks are often malnourished because they have so many to feed. If the robins lay fewer than four eggs, they may not have any viable offspring. As a result, robins typically lay a clutch of four eggs. This is an example of a. disruptive selection. c. stabilizing selection. b. directional selection. d. convergent evolution.

ANS: C DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Applying 16. The population of a cactus species in a particular area has two to seven spines with an average of four spines per square centimeter of surface area. Cacti with fewer than four spines per square centimeter are more easily eaten by the wild boars thriving in the area. Over time, the population of this cactus species in this area have an average of six spines per square centimeter of surface area. This is an example of a. disruptive selection. c. stabilizing selection. b. directional selection. d. genetic drift.

ANS: B DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Applying

17. When individuals with intermediate values of an inherited phenotypic trait, like head circumference at birth, have an advantage over other individuals in the population, ________ is the apparent pattern of natural selection. a. genetic drift c. directional selection b. disruptive selection d. stabilizing selection ANS: D DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Remembering 18. In a shallow bay, a population of oysters is the food source for the local crabs. The lightest colored oysters blend with the color of the rocks and the darkest colored oysters are concealed in the shadows cast by the rocks. Oysters with an intermediate coloring are easily detected by the crabs and become a tasty meal for them. Over time, fewer and fewer oysters display the intermediate coloring while more oysters are either the lightest coloring or the darkest coloring. This is an example of a. stabilizing selection. c. disruptive selection. b. directional selection. d. genetic drift.

ANS: C DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Understanding 19. In natural selection, ________ that increase survival and reproductive success become more common in a population. a. genotypes c. bottlenecks b. allele frequencies d. phenotypes ANS: D DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Understanding 20. Several related bird species live in a desert. One species is much smaller than the other species. This small species nests in holes in cacti. Because the bird is so small, it can easily squeeze between the spines of the cactus and create a well-protected nest. This is an example of a. genetic drift. c. natural selection. b. mutation. d. gene flow.

ANS: C DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Applying 21. Two different species may have similar features because of a. genetic drift. b. the founder effect. c. a bottleneck. d. descent from a common ancestor.

ANS: D DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Understanding 22. Convergent evolution occurs when natural selection causes distantly related organisms to a. evolve into the same species despite the fact that they are members of separate populations. b. merge into one continuous population because of reversals in continental drift. c. evolve both analogous and homologous characteristics.

d. evolve similar structures in response to similar environmental challenges.

ANS: D DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Understanding 23. Two unrelated species evolving to look more similar due to environmental pressures is called a. gene flow. c. convergent evolution. b. genetic drift. d. divergent evolution.

ANS: C DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Remembering 24. Convergent evolution produces a. genetic drift. b. lines of common descent.

c. homologous characteristics. d. analogous characteristics.

ANS: D DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Remembering 25. Both insects and humans evolved jointed legs to allow locomotion on land. These structures are considered analogous because insects and humans a. stopped evolving at different times in Earth’s history. b. evolved from different ancestors. c. cannot breed. d. faced different environmental challenges during evolutionary time.

ANS: B DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Applying 26. Some finches on the Galápagos Islands eat insects, an unusual food for finches to eat. These finches a. evolved from a lineage of birds other than finches that ate insects. b. learned their habits from local birds. c. switched to insects because they tasted better than their usual food. d. fill roles that birds other than finches would fill in other places.

ANS: D DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Analyzing 27. The wings of a bird and the wings of a bat both form from the front appendages (arms). The bird wing is covered by feathers, and the bat wing consists of a thin layer of skin stretched between the ―finger‖ bones. Are the wings of the bird and bat homologous or analogous? a. homologous, because they evolved from the same body part b. analogous, because birds’ flight requires feathers and bats use skin; both are wings, but they evolved differently c. both; they are homologous because they both evolved from a front appendage, but analogous because they evolved differently d. neither, because birds and bats do not share a recent common ancestor ANS: C DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Applying

28. Both mammals and octopi have evolved similar eye structures. This is an example of a. convergent evolution. c. disruptive selection. b. divergent evolution. d. directional selection.

ANS: A DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Applying 29. Which of the following is NOT likely to be a cause of rapid evolution in a population? a. a changing environment b. an organism that exhibits a rapid rate of mutation c. an organism that reproduces very slowly d. the immigration of individuals carrying a new allele that significantly increases reproductive success ANS: C DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Applying 30. Which of the following is NOT a cause of evolution? a. mutation b. gene flow c. stable environmental conditions d. sexual selection ANS: C DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Understanding 31. For a population to evolve, there must be genetic differences between organisms in that population.

These differences arise by a. mutation. b. a change in an organism’s behavior. c. natural selection. d. common descent.

ANS: A DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Understanding 32. Genetic variation is based on a. the inheritance of alleles accumulated during the lifetime of an individual. b. differences in genotypes between the individuals in a population. c. the accumulation of mutations in somatic cells (as opposed to gametes). d. the formation of new combinations of alleles during asexual reproduction.

ANS: B DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Remembering 33. UV light causes mutations within skin cells. Is UV light a major driving force in the evolution of animals? a. Yes; UV light is always present outside and can produce both favorable and harmful mutations in skin cells. Only the favorable mutations will be passed on to the next

generation. b. Yes; a mutation in the skin cell will result in an organism that is better protected from the sun. This individual will be more likely to survive and pass on this mutation to the next generation. c. No; only mutations in gametes will be passed on to the next generation. Only mutations that are passed on to offspring contribute to evolution. d. No; only mutations that have a favorable adaptive quality will be passed on to the next generation. UV light produces only harmful mutations.

ANS: C DIF: Difficult REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Applying 34. A mutation in a gene produces the identical protein to the original gene and, therefore, an identical trait.

Will evolution act upon this mutation? a. No, because evolution acts upon phenotypes. b. Yes, because evolution acts upon phenotypes. c. Yes, because mutations do contribute to evolution. d. No, because mutations do not contribute to evolution.

ANS: A DIF: Difficult REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Analyzing 35. Gene flow occurs a. as a result of genetic drift. b. when an individual migrates between two otherwise isolated populations of a species. c. as a result of mutations in one population but not in another. d. when individuals within a population interbreed.

ANS: B DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Remembering 36. During gene flow, a. chance events alter the gene pool of a population. b. new individuals contribute their alleles to the gene pool of a population. c. alleles that make an individual more successful move from one population to another. d. crossing-over creates new combinations of alleles during gamete formation.

ANS: B DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Remembering 37. While on a camping trip, Brian collects a white tadpole from a pond and takes it home. The tadpole develops into a white bullfrog. When the frog gets too big, he releases it into a local pond. The next year, several white bullfrogs are observed in the pond. This is an example of a. genetic drift. c. gene flow. b. natural selection. d. sexual selection.

ANS: C DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Applying 38. Gene flow between two populations

a. b. c. d.

makes the genetic composition of the two populations more similar. eliminates harmful alleles. magnifies the effects of genetic drift. creates genetic differences between the populations.

ANS: A DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Understanding 39. Which of the following is NOT a step in the evolutionary process? a. Mutation results in the formation of new alleles, and sexual reproduction results in new combinations of alleles. b. New genes are introduced into a population when members of that population mate with members of other species and produce offspring. c. Genetic variation is inherited by the next generation of a population. d. Genetic drift, gene flow, and natural selection cause allele frequencies to change over time.

ANS: B DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Understanding 40. The following image is an example of

a. gene transfer. b. genetic drift.

c. natural selection. d. mutation.

ANS: A DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Understanding 41. An example of gene flow would be if pollen from a population ________ plant lands on ________. a. A; the same plant (mating with itself) b. A; another population A plant c. A; a population B plant d. B; two other population B plants ANS: C DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Applying 42. In the following figure, the flying bird moves permanently into the population shown on land. As a result, the allele frequency of A in the population changes from

a. 1 to 0.75. b. 0 to 0.25.

c. 0 to 0.75. d. 1 to 0.25.

ANS: A DIF: Difficult REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Analyzing 43. How do natural selection and sexual selection differ? a. Natural selection increases the frequency of alleles that contribute to survival, but sexual selection may increase the frequency of alleles that are not beneficial to survival. b. Natural selection contributes to genetic drift, but sexual selection contributes to gene flow. c. Natural selection is more random than sexual selection. d. Natural selection increases the fitness of an allele, but sexual selection increases the dimorphism of an allele.

ANS: A DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Understanding 44. Sexual selection can result in an increased frequency of alleles, which a. may be harmful to the individual’s survival but is always beneficial to its reproductive rate. b. are always beneficial to the individual’s survival but may be harmful to its reproductive rate. c. are always beneficial to both the individual’s survival and reproductive rates. d. may be harmful to both the individual’s survival and reproductive rates.

ANS: A DIF: Difficult REF: 12.4 Primed for Pickup OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Analyzing 45. What is genetic drift? a. gene mutation within, or between, populations b. chance evolutionary change occurring in small populations c. natural selection acting on large populations d. shifts in allelic frequencies due to mutation ANS: B DIF: Easy REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using

examples.

MSC: Remembering

46. A population of 8,250 mice occupies the sand dunes in a coastal area. A severe hurricane washes out several miles of sand dunes. As a result, only 50 mice remain. The population has experienced a. horizontal gene transfer. c. a founder effect. b. gene flow. d. a bottleneck.

ANS: D DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 47. Which of the following statements concerning evolution is FALSE? a. Natural selection requires variation in the population. b. An individual that is better adapted than others in a population will always be more reproductively successful. c. Genetic drift causes little evolutionary change in large populations. d. Evolution involves a change of frequency of alleles in the gene pool.

ANS: B DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Understanding 48. Compared to a large mainland population, genetic drift in a small island population is________ important because________. a. less; there is less variation with which to work b. less; only a few individuals do all the breeding c. more; of a smaller gene pool. d. more; of the absence of competition.

ANS: C DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Understanding 49. A used car is shipped from Australia to the United States. Stowed away in the trunk of the car is a piece of wood infected with Australian termites. Once in the United States, the buyer of the car finds the rotting wood and dumps it on the side of the road. The termites survive and establish a colony on the side of the road but do not mate with local termite populations. This is an example of a. genetic drift. c. natural selection. b. mutation. d. gene flow.

ANS: A DIF: Difficult REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 50. A fisherman catches one trout from each of two ponds. Pond A contains 100 trout and pond B contains 1,000 trout. Which population is more affected by the fisherman? a. Pond A; the fisherman has a greater likelihood of completely removing alleles from the gene pool by taking a fish from the smaller population. b. Pond A; fewer fish are able to move into a small pond and find mates. c. Pond B; the fisherman is more likely to catch a fish that is undergoing evolution in a bigger population. d. Pond B; the process of evolution occurs more slowly in large populations and removing a fish speeds up the process.

ANS: A

DIF: Difficult

REF: 12.4 Primed for Pickup

OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Analyzing 51. Although millions of prairie chickens once occupied Illinois, in 1993 only 50 remained. Starting in 1992, scientists moved almost 300 prairie chickens from large populations in other states to Illinois to ________ Illinois prairie chicken populations. a. prevent the development of nonheritable mutations in b. introduce genetic variation back into c. induce stabilizing selection in d. cause genetic drift in ANS: B DIF: Difficult REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Analyzing COMPLETION 1. The only mechanism of evolutionary change that is not influenced by chance events is ________.

ANS: natural selection DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Analyzing 2. Evolution occurs when there are changes in the frequencies of alleles and genotypes in a(n) ________ over time.

ANS: population DIF: Easy REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Remembering 3. A scientist is studying beak length in a species of hummingbird. The scientist establishes a population of birds with beaks ranging from very small to very long and allows the population to breed for 10 years. At the end of the experiment, she finds that the majority of birds in the population have very long beaks.

This is an example of the ________ selection pattern of natural selection.

ANS: directional DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Applying 4. When individuals with intermediate phenotypes have an advantage over all others in the population, such as the case with human birth weight in the 1930s–1940s, ________ selection is the likely mechanism of evolution responsible.

ANS: stabilizing DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Remembering 5. Natural selection acts on ________ traits. By favoring certain phenotypes over others, the individuals having those phenotypes survive and reproduce at a higher rate than individuals who do not have those traits.

ANS: adaptive DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Understanding 6. When similar environmental pressures, such as permafrost in low-altitude tundra and permafrost in high-altitude alpine tundra, cause genetically distantly related organisms to evolve similar structures for survival and reproduction under similar conditions, ________ has occurred.

ANS: convergent evolution DIF: Easy REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Understanding 7. The result of convergent evolution is ________ traits.

ANS: analogous DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Understanding 8. The original source of genetic variation within a population is ________.

ANS: mutation DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Understanding 9. Natural selection and other mechanisms of evolution act upon the ________ that result from the novel genotypes produced by mutations.

ANS: phenotypes DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Understanding 10. Bacteria often store genes on small, circular pieces of DNA called plasmids. The process of transmitting these plasmids and the genes they contain to other bacteria is called ________ and is an example of gene flow.

ANS: horizontal gene transfer DIF: Easy

REF: 12.3 Enter Enterococcus

OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Remembering 11. Two populations of geese live near each other. As time passes, the populations are becoming more genetically alike. This is probably due to ________.

ANS: gene flow DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Applying 12. A chance evolutionary change occurring in small populations is referred to as ________.

ANS: genetic drift DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Remembering 13. If the size of a population drops for at least one generation and causes a loss of genetic variation, a ________ occurs.

ANS: genetic bottleneck DIF: Easy REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Remembering 14. Between 1980 and 1999, the Food and Drug Administration (FDA) approved 52 new antibacterial drugs.

Only 8 new antibacterial drugs gained approval between 2000 and 2012. The lack of new antibacterial drugs may contribute to the ________ selection of antibiotic-resistant bacteria.

ANS: natural directional DIF: Easy REF: Chapter 12 Infographic OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection. | 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Understanding SHORT ANSWER 1. In an original population of 30 mice, the frequency of dark-fur-pigment alleles is 57% and the frequency of white-fur-pigment alleles is 43%. Ten generations later, the population of 30 mice now has 28 dark-fur-pigment alleles and 32 white-fur-pigment alleles? What are the new allele frequencies? Is there evidence of ongoing evolution? Explain.

ANS:

In the original population, the dark-fur-pigment allele frequency is 57 percent while the white-fur-pigment frequency is 43 percent. In the resulting population, the dark-fur-pigment allele frequency is now 47 percent and the white-fur-pigment allele frequency is 53 percent. There has been a marked change in the allele frequencies for fur pigment in this population; this indicates that evolution may be occurring.

DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Applying 2. Evaluate the accuracy of the following statement: ―The natural selection of a prey species can be altered if a new predator is introduced.‖ Explain how you reached your conclusion.

ANS: This statement is true. A new predator may alter the traits that are favorable for survival. The prey will need to adapt to the new predator if it is to survive. Different individuals in the prey population may be better adapted to avoid this new predator and may be more likely to survive than before.

DIF: Difficult REF: 12.1 Birth of a Superbug OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Evaluating 3. A friend states, ―Exposing bacteria to antibiotics causes the cells to mutate to become antibiotic resistant.‖ Explain to your friend why he is incorrect and provide the correct explanation.

ANS: This statement is false. Mutations occur randomly; some bacteria had already mutated to be antibiotic resistant prior to exposure to the antibiotics. These resistant bacteria survive when antibiotics are present, while the rest of the population is killed. The resistant bacteria then reproduce to form a population of resistant cells.

DIF: Difficult REF: 12.1 Birth of a Superbug OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Evaluating 4. Evaluate the accuracy of the following statement: ―Individuals evolve by becoming more adapted to their environment.‖ Explain how you reached your conclusion.

ANS: This statement is false because individuals do not evolve; populations do. Individuals that are more adapted will be more likely to reproduce and will pass on those adaptive traits to the next generation.

This change over time is the process of evolution.

DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.1 Clarify why evolution occurs only in populations, not in individuals.

MSC: Evaluating 5. Propose an explanation for why the circumference of newborn babies’ heads would act as a stabilizing selective force in a population of humans that does not have access to modern medical care.

ANS:

As with the baby’s overall size, babies with very large circumference heads would have a more difficult time making it through the birth canal without assistance; this could easily lead to the demise of both the mother and the baby. On the other hand, babies with exceptionally small circumference heads may have an easier time making it through the birth canal, but they may also have smaller brains and other developmental problems, making it less likely they will survive to pass their genes on to the next generation. Babies with intermediate-sized heads would be more likely to survive birth and less likely to succumb to other developmental problems before having the chance to pass their genes to the next generation.

DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Applying 6. Bees and hummingbirds are very good accidental pollinators. When they visit flowers to extract nectar, they pick up pollen from a flower and carry it to the next flower that they visit; this helps to distribute the pollen and the genes carried in the pollen to a different plant. Explain how bright red wildflowers that easily attract bees and hummingbirds might become more prevalent in a wildflower population of both red and white flowers through natural selection.

ANS: If the bright red wildflowers attract more bees and hummingbirds than the white flowers, the allele for the red flowers will spread more easily throughout the population as the bees and hummingbirds move from one flower to the next distributing the pollen to other flowers. The seeds produced by these flowers will have the allele for red flower color and will continue to produce more red flowers and pollen as they grow. In this case, natural selection is favoring red flower color.

DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.3 Explain how natural selection brings about increased reproductive success of a population in its environment.

MSC: Applying 7. New-world vultures are related to raptors, while old-world vultures are more closely related to storks.

However, both of these birds eat carrion (decaying animals) and have a similar beak structure. Explain how this similarity in beak structures arose.

ANS: This is an example of convergent evolution. Both vultures have similar environmental pressures—the need to tear into flesh—and evolved a similar strategy.

DIF: Difficult REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Analyzing 8. Provide an example of analogous traits in two organisms and explain how/why those traits evolved in such distantly related organisms.

ANS: Possible answers may read like the following: ―Both sharks and dolphins have streamlined bodies that are well adapted for maneuverability and speed in the water. However, sharks are fish and dolphins are mammals; they are only distantly related. Both of these animals are predators in an aquatic environment; both animals must be able to swoop in on their prey if they want to survive and reproduce in this environment. This is an example of environmental pressures giving rise to convergent evolution and producing analogous traits.‖ Or:

―Plants in the deserts of North America, Africa, and Asia often resemble each other even though they have vastly different genetics. The desert environments have provided the selective pressures that encouraged survival of plants that naturally conserve water and managed to thrive in hot dry environments. The tiny spines and thick skin of these plants are analogous traits produced through convergent evolution.‖ DIF: Moderate REF: 12.2 Rising Resistance OBJ: 12.4 Compare and contrast convergent evolution and evolution by common descent, and give an example of each.

MSC: Remembering | Understanding 9. What pattern of natural selection is demonstrated by the information in the graph below? What is the selective pressure? What are the relative rates of evolution among the strains of bacteria? Provide your rationale.

ANS: The information in this graph illustrates the process of directional selection in bacteria as a result of the selective pressure of antibiotic use. Salmonella Typhi appears to be evolving resistance to ciprofloxacin at a much higher rate than Campylobacter. Salmonella Typhi antibiotic resistance tripled between 1999 and 2011, while resistance in Campylobacter increased by only twofold between 1997 and 2011. Group B Streptococcus has evolved resistance to erythromycin and clindamycin with an increased incidence of twofold between 2000 and 2010. During that same time, Salmonella Typhi resistance to ciprofloxacin tripled, giving it the fastest relative rate of evolution among this sample of bacterial strains.

DIF: Difficult REF: Chapter 12 Infographic | 12.2 Rising Resistance OBJ: 12.2 Distinguish among directional, stabilizing, and disruptive selection.

MSC: Analyzing | Evaluating 10. Explain why a mutation in an individual’s skin cells does not directly contribute to evolution.

ANS: If an individual cannot pass a mutation on to its offspring, the mutation cannot directly contribute to evolution. The mutation will not cause a change in allele or genotype frequencies in the population.

DIF: Easy REF: 12.3 Enter Enterococcus OBJ: 12.5 Describe how DNA mutations can create new alleles at random.

MSC: Understanding 11. In the figure below, the migrating bird is successful at introducing the recessive allele a into population 2 and producing offspring with the Aa genotype. Over time, these offspring mate with each other to produce offspring. Birds of various genotypes from both populations fly back and forth between the populations sharing alleles. Predict the outcome of genotype or allele frequency changes in these two populations after many generations.

ANS: The two-way gene flow between these two populations will result in them having very similar genotype or allele frequencies over time. The greater amount of gene flow back and forth will result in both populations actually looking very similar to the original population 1.

DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Understanding 12. Two populations of mice exist: one lives in an area with light rocks and the other lives in an area of dark rocks. A dark mouse from the population living on dark rocks migrates to the area of light rocks and breeds with mice there. Will this alter the allele frequency in the population? Discuss changes that may or may not be seen in the next generation and in following generations.

ANS: The dark-colored mouse will add dark alleles to the population and will produce dark-colored offspring.

This may alter the allele frequency in the next few generations. However, the dark-colored mice are more likely to be killed by predators and will be less likely to reproduce. Therefore, over time, the allele frequency will likely return back to what it was before the gene flow event occurred.

DIF: Difficult REF: 12.3 Enter Enterococcus OBJ: 12.6 Illustrate how gene flow works and how it may inhibit evolution.

MSC: Analyzing 13. Compare and contrast bottleneck and founder effect.

ANS: Both of these processes are examples of genetic drift and result in populations with a smaller gene pool.

A genetic bottleneck occurs when the size of a population drops drastically due to deaths of many individuals, while the founder effect is due to a small group leaving the original population.

DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Understanding 14. Around 12,000 years ago, a massive extinction event decimated about 75 percent of the world’s large mammal populations. A small number of cheetahs survived this event and began to reproduce. Discuss the implications of this event on the genetic diversity of today’s cheetah population.

ANS: This mass extinction followed by a few cheetahs reproducing to establish a new population is an example of a genetic bottleneck. Because there were few cheetahs to begin reproducing, there would be lots of inbreeding and a limited variety in their gene pool. Without a great deal of heritable mutations (mutations that can be passed from one generation to the next), today’s cheetah population would be very similar to those few survivors and very similar to each other. The lack of genetic diversity caused by a genetic bottleneck can result in a concentration of unfortunate genetic disorders in the population.

DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying MATCHING Match each example to one of the processes below. a. b. c. d. e.

genetic drift genetic bottleneck founder effect gene flow natural selection

1. An area consists of dark and light rocks. Mouse populations that live on the dark rocks tend to be darkly colored; mouse populations that live on the light rocks tend to be lightly colored.

2. A large boulder rolls down a mountain and kills all the flowers in its path.

3. A tourist carries seeds to a new location. These seeds are able to breed with plants of the same species in this new location.

4. Overfishing results in an endangered fish population with a very small population size.

5. Algae attach to a boat motor and are transported to a new lake where they establish a new colony.

1. ANS: E DIF: Moderate REF: 12.1 Birth of a Superbug OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 2. ANS: A DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 3. ANS: D DIF: Moderate REF: 12.3 Enter Enterococcus OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 4. ANS: B DIF: Moderate REF: 12.4 Primed for Pickup

OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying 5. ANS: C DIF: Moderate REF: 12.4 Primed for Pickup OBJ: 12.7 Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

MSC: Applying

Chapter 13: Adaptation and Species MULTIPLE CHOICE 1. Evolution by natural selection allows species to a. reduce mutation rate. b. decrease genetic variation. c. adjust to environmental changes. d. hybridize.

ANS: C DIF: Easy REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Understanding 2. Which of the following statements is true about adaptation? a. It is large-scale movement of a single species over a new geographic area. b. It occurs when a more adapted species causes the extinction of a less adapted one. c. It is the process by which natural selection improves the match between an organism and its environment over time. d. It is an increase in the adaptiveness of many species that have already evolved.

ANS: C DIF: Easy REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Remembering 3. When a brightly colored guppy population is placed in an area containing many predators, the population changes in only a few generations to one containing only guppies with drab, dull colors that blend into their environment. This is an example of how natural selection can a. force new color mutations to occur. b. convert a dominant allele into a recessive allele. c. improve the match between guppies and their environment. d. change the color preferences of female guppies.

ANS: C DIF: Moderate REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Understanding 4. A lizard is attacked by a bird. The lizard escapes and survives without his hind legs. Fortunately for this lizard, the loss of his hind limbs allows him to live within a smaller crevice than other lizards of the same species, so he experiences less competition. Which of the following is true for this lizard? a. The loss of his legs provided an advantage within his environment. b. The loss of his hind legs would be considered an adaptive trait. c. A lack of hind limbs should become more common in this population. d. This lizard will be unable to reproduce.

ANS: A DIF: Moderate REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Applying

5. The faster a cheetah can run, the more likely it is to capture its prey. Cheetahs with longer legs are able to run faster than those with shorter legs. Although the existing cheetah population shows a variety of leg lengths, cheetah legs are not continuing to increase in length from one generation to the next. Which of the following is a possible explanation? a. The genes that are involved in cheetah leg length do not undergo mutation. b. Cheetahs with long legs are reproductively isolated from cheetahs with short legs. c. Natural selection does not act on traits involved in predation. d. Longer cheetah leg bones are more likely to break.

ANS: D DIF: Difficult REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Analyzing 6. Every year, environmental signals in Africa cause flycatchers to return to the Netherlands to breed.

When they arrive, they depend on freshly hatched caterpillars for food. Global climate change has caused the caterpillars to hatch earlier in the Netherlands, but the environmental cues in Africa remain the same. Now, when the flycatchers return to the Netherlands, the caterpillars are no longer available as a food source. Which of the following is most likely to happen to this species of flycatcher? a. Flycatchers may learn that caterpillars are hatching earlier and will begin flying to the Netherlands earlier. b. Flycatchers will adapt to environmental change if genetic traits that aid flycatchers in utilizing food sources other than caterpillars are present. c. Flycatchers will not adapt to environmental change because bird species are unable to utilize new food sources. d. Flycatchers will remain in the Netherlands instead of returning to Africa.

ANS: B DIF: Difficult REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Analyzing 7. Which of the following examples does NOT illustrate a difference in fitness that would lead to evolution by natural selection? a. Male peacocks with larger, more colorful tails are more frequently chosen as mates. b. Moths with coloration that allows them to blend in with the bark of spruce trees are more difficult for predators to find. c. Wolves who are more successful hunting in packs find mates more frequently. d. A female panda living in a zoo in China is impregnated more frequently than a female panda living in a zoo in the United States.

ANS: D DIF: Difficult REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Applying 8. Some species of orchids attract wasps to assist them in reproduction by producing flowers that look like female wasps. The flowers fool male wasps into attempting to mate with them. As a result, the wasp is covered with pollen that it takes with it to the next flower with which it attempts to mate. This example shows adaptation by a. the orchids. c. all flowering plants. b. the wasps. d. ancestral wasps.

ANS: A DIF: Difficult REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Applying

9. Bacteria reproduce asexually, so scientists classify them based on a. DNA sequence similarity and morphology. b. reproductive isolation. c. the biological species concept. d. the idea that they are all strains of the same species.

ANS: A DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Understanding 10. Using the biological species concept as a method of defining a species is NOT useful for a. species whose ranges overlap. b. species that cannot produce hybrids. c. organisms known only from fossils. d. organisms that reproduce sexually.

ANS: C DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Understanding 11. The fossils of two adult birds are found in a nest containing several fossilized eggs. Physically, the bird fossils look very different. Scientists are most likely to classify these species using a. the biological species concept. b. DNA from the fossils. c. morphology of the fossils. d. evidence of reproduction.

ANS: C DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Understanding 12. The red-breasted nuthatch and the white-breasted nuthatch are similar in appearance and, in many regions of the United States, their ranges overlap. The two organisms do not interbreed. Based on this information, red-breasted and white-breasted nuthatches are a. different species. b. different populations of the same species. c. hybrids. d. polyploids.

ANS: A DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Applying 13. Individuals of the same species generally a. experience prezygotic barriers to reproduction. b. do not interbreed extensively. c. share many common physical and behavioral characteristics. d. vary only slightly in appearance.

ANS: C DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Understanding 14. According to the biological species concept, a species is defined when individuals of the same species a. differ widely in their DNA sequences.

b. always have the same physical traits. c. are capable of interbreeding and producing fertile offspring. d. must reproduce asexually.

ANS: C DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Understanding 15. Which of the following organisms would best be identified as a species using the biological species concept? a. a population of mice living on a mountaintop where the nearest population of mice is 50 miles away b. a bacteria found living in the human gut with thousands of other bacteria c. dinosaurs identified by morphologically similar fossil remains located in a single valley in South America d. a rare plant living in a remote location in Peru that reproduces asexually ANS: A DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Applying 16. Two populations of lizards live in the same area. Which of the following evidence would convince you that they are two distinct species? a. Individuals in one population display a different color pattern than individuals in the second population. b. Individuals in one population are noticeably larger than individuals in the second population. c. The two populations are not capable of interbreeding and producing fertile offspring. d. The two populations are capable of interbreeding and producing fertile hybrid offspring.

ANS: C DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Analyzing 17. Populations within a species are connected by a. gene flow. c. continental drift. b. speciation. d. genetic drift.

ANS: A DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Remembering 18. Speciation a. can result from geographic isolation. b. occurs in the absence of genetic divergence. c. occurs only in species living on remote islands. d. reduces variation.

ANS: A DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Understanding 19. The formation of a new species a. can occur any time genetic divergence occurs. b. can only occur when two populations are geographically isolated.

c. can only occur when two populations are sympatric. d. is a process that stopped occurring thousands of years ago.

ANS: A DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Understanding 20. Which of the following must occur for one species to split into two or more species? a. The species must move into a new habitat. b. DNA sequences of genes must accumulate differences. c. Morphological changes must be obvious within the population. d. One species must undergo geographic isolation.

ANS: B DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Applying 21. Some freshwater snail eggs are accidentally introduced into a new habitat that is geographically isolated from the original population. Which of the following must occur before these snails are described as two separate species? a. gene flow c. adaptation b. sympatric speciation d. genetic divergence ANS: D DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Understanding 22. For two populations to accumulate enough genetic differences to cause speciation, the factors that promote these differences a. must operate in populations that are not physically separated. b. must have a greater effect than does the amount of ongoing gene flow. c. need to be combined with the forces of genetic drift. d. should include polyploidy.

ANS: B DIF: Difficult REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Analyzing 23. Geographic isolation limits the ________ between separated populations of a species. a. genetic differences c. directional selection b. adaptation d. gene flow ANS: D DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Remembering 24. A large population of animals is split in two by a physical barrier. Over time, the genetic makeup of the two resulting populations becomes more and more different until each population becomes a separate species. This is an example of a. sympatric speciation. c. genetic drift. b. allopatric speciation. d. natural selection.

ANS: B DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding

25. For which of the following would a mountain range MOST likely represent a geographic barrier that would block gene flow? a. birds c. mice b. deer d. butterflies ANS: C DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Applying 26. Which of the following would NOT be expected after a population undergoes geographic isolation? a. a decrease in gene flow b. an increase in gene flow c. allopatric speciation d. formation of adaptive traits ANS: B DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding 27. Two populations that live ________ do NOT provide an example of geographic isolation. a. in two valleys on opposite sides of a mountain range b. on different mountains with a valley between them c. on opposite sides of a river d. in different parts of a small lake ANS: D DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Applying 28. The two squirrel species shown in the figure below arose from the same ancestor. The Kaibab squirrel lives on the north rim of the Grand Canyon and the Abert’s squirrel lives on the south rim. Which is the MOST likely explanation for their speciation?

a. The population of ancestral squirrel occupied only one of the rims of the Grand Canyon. As the population grew, some members of the population crossed the Grand Canyon to form a new population. b. The population of the ancestral squirrel was split by the formation of the Grand Canyon.

Since the habitats were different on each rim, the populations evolved differently and became reproductively isolated. c. When the Grand Canyon formed, competition for food and shelter became fierce. The two species arose through sympatric speciation as some individuals gathered food on the north

rim rather than on the south rim. d. The ancestral squirrel was actually a hybrid of two squirrel species. When the populations were separated and could no longer mate, the characteristics of the two species became more obvious.

ANS: B DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Evaluating 29. How does geographic isolation lead to speciation? a. Geographic isolation allows mechanisms of evolution to cause genetic divergence. b. Populations that are geographically isolated develop reproductive barriers. c. The habitats for geographically isolated species are always different, and this leads to morphological differences. d. Geographic isolation does not lead to speciation.

ANS: A DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Analyzing 30. In general, geographical isolation occurs when a. populations migrate to new environments. b. gene flow is reduced by more than 75 percent due to climate change. c. mutations overcome genetic drift across physical barriers. d. populations are separated by a distance that is great enough to limit gene flow.

ANS: D DIF: Difficult REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Analyzing 31. Two populations of ________ are NOT an example of speciation. a. sea urchins in the same territory, which are physically unable to mate b. small rodents that look similar but have genetic differences c. morphologically distinct lizards that lack differences in DNA sequences d. butterflies that live in the same area but breed in different seasons ANS: C DIF: Moderate REF: 13.2 What Makes a Species? | 13.4 Different Depths, Different Habitats OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Analyzing 32. Genetic adaptations in two closely related species living within the same territory indicates that a. gene flow is extensive between the two species. b. geographic isolation is required for evolution. c. allopatric speciation has occurred. d. sympatric speciation has occurred.

ANS: D DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding 33. Two species live in the same area but breed in different parts of their habitat. These species are a. geographically isolated. c. artificially isolated. b. ecologically isolated. d. likely to produce hybrids.

ANS: B

DIF: Easy

REF: 13.3 Caribbean Corals

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding 34. Which of the following is an example of a postzygotic barrier? a. The gametes cannot join. b. The zygote fails to develop. c. The breeding seasons are different. d. The courtship behaviors are different.

ANS: B DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Remembering 35. Sympatric speciation a. occurs only in plants. b. is impossible, because the populations of a species must be isolated from one another for speciation to occur. c. is always a result of polyploidy. d. occurs when a new species emerges from a population in the absence of a geographical barrier.

ANS: D DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Remembering 36. Although populations of North American apple maggot flies are not geographically isolated, they appear to be in the process of diverging into two new species. Which of the following could be causing speciation between two populations in the lack of geographic isolation? a. feeding on two different types of food b. producing fertile hybrids c. laying their eggs in the same location d. increased gene flow between them ANS: A DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Applying 37. Two birds that are similar in morphology and live in the same forest exhibit different courtship behaviors. Which of the following describes the relationship of these birds? a. These birds are the same species because they share morphology. b. Mating would be prevented because these birds would not respond to each other’s behaviors. c. Allopatric speciation is occurring between these birds. d. Coevolution is causing these birds to have similar morphology.

ANS: B DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Applying 38. Before the cultivation of the apple tree, apple maggot flies laid their eggs exclusively on the fruit of Hawthorne trees. As apple orchards became more prominent, apple maggot flies began to lay their eggs on both the fruit of the Hawthorne tree and the fruit of cultivated apple trees. Now, apple maggot flies that live on apple trees mate and lay their eggs at different times of the year than apple maggot flies that live on Hawthorne trees. Is this an example of reproductive isolation? a. Yes; these two fly populations exhibit a postzygotic barrier that prevents hybrid individuals

from developing properly. b. No; although these two fly populations do not mate in nature, they can be forced to mate in a laboratory because their DNA sequences are still the same. c. No; this is an example of speciation rather than reproductive isolation. d. Yes; these two fly populations exhibit a behavioral prezygotic barrier that prevents their gametes from encountering each other.

ANS: D DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Analyzing 39. Which of the following is an example of a prezygotic barrier that can isolate two species living in the same geographic area? a. The members of two populations of birds living in neighboring forests freely interbreed. b. One species of cichlid has the same mating behavior as another cichlid species in the same lake. c. The gametes of one species of orchid in a rainforest are unable to fuse with the gametes of another species of orchid in the same rain forest. d. Two species of wildflowers mate and produce a hybrid that is capable of successfully breeding with either species.

ANS: C DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Applying 40. A rain forest is a highly complex habitat with organisms living at various levels in the trees, on the ground, and underground. Is it possible to consider two populations of insects living in the same tree to be geographically isolated? a. No, because if they are in the same tree, they are in the same geographic area. b. No, because if they are in the same square acre, they cannot be considered geographically isolated. c. Yes, because insects only undergo allopatric speciation, and there are many species of insects. d. Yes, because there are so many habitats in one tree that the populations may never interact.

ANS: D DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Analyzing 41. In many predator-prey relationships, evolutionary change in the prey will result in evolutionary change in the predator, a phenomenon known as a. polyploidy. c. coevolution. b. allopatrism. d. sympatric speciation.

ANS: C DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Remembering 42. Close ecological interactions between two different species may lead to a. allopatric speciation. c. coevolution. b. sympatric speciation. d. geographic isolation.

ANS: C DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Remembering

43. The rough-skinned newt produces one of the most potent toxins on the planet. Scientists in Oregon have found that as newts evolve to produce a more deadly toxin, their primary predator, the garter snake, evolves ways to resist the toxin. This is an example of a. ecological trade-offs in the evolution of the newt. b. an adaptation of the newt to living in aquatic environments. c. reproductive isolation in a population of garter snakes. d. coevolution of predator and prey.

ANS: D DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Applying 44. Which of the following statements gives an example of coevolution? a. Two unrelated species form at the same time after ancestral species populate a newly formed volcanic island. b. Two closely related mice species on different mountaintops in the southwest United States both adapt the same trait because food sources are similar. c. An ant species and a plant species both develop adaptations in response to changes in the other species. d. A wild cat species and a wild dog species both have similar bacteria living in their guts, which allow them to produce vitamin K. ANS: C DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Understanding 45. The best explanation of the role of coevolution in speciation is that coevolution a. leads to two species that are perfectly adapted to exist together. b. may lead to benefits for both of the species involved. c. only occurs in species like corals and sea urchins that live in marine environments. d. always benefits one species and harms another species.

ANS: B DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Applying 46. How does coevolution lead to speciation? a. Coevolution is the mechanism that allows allopatric speciation to occur. b. Coevolution causes the extinction of species that have limited genetic diversity. c. The adaptations that occur during coevolution are passed on to other species. d. An adaptation in one organism drives adaptation in a second organism.

ANS: D DIF: Moderate REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Understanding 47. Convergent evolution involves unrelated, or distantly related, organisms developing similar traits.

Coevolution is similar to convergent evolution in that coevolution also a. involves changes in unrelated, or distant, organisms. b. often occurs in geographic isolation. c. is a process that occurs when food sources change. d. leads to similar traits developing in two species.

ANS: A DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Applying 48. Which of the following is MOST likely an example of coevolution? a. The color of a rodent’s hair changes to better match a new environment. b. A parasitic worm develops a new mechanism to attach to the gut lining of an organism that

has a special adaptation designed to shed parasitic worms. c. Two different species of plants produce flowers that are the same color, which attracts honeybees. d. Two unrelated rodent species on different continents develop flaps of skin between their front legs and bodies that allow them to glide between trees.

ANS: B DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Applying 49. Which of the following is one of the three important characteristics of an adaptation? a. An adaptation must be a physical change. b. Adaptations are typically simple behavioral changes. c. An adaptation improves an organism’s survival in its environment. d. An adaptation must result in a perfect match between an organism and its environment.

ANS: C DIF: Easy REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Remembering 50. Which of the following is an example of a postzygotic barrier? a. Two species produce zygotes that fail to develop normally and die prior to birth. b. Two species have reproductive organs that are physically incompatible. c. Breeding occurs at different times of the day for two species in the same area. d. Different courtship displays prevent two species from interbreeding.

ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding COMPLETION 1. Individual organisms with inherited characteristics that enable them to survive and reproduce are said to have greater ________ fitness than individuals who fail to survive and reproduce.

ANS: reproductive genetic DIF: Easy REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Remembering 2. Based on the ________ species concept, organisms that interbreed and produce fertile offspring are most likely classified as species.

ANS: biological DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Remembering 3. The great diversity of life on Earth is caused by the formation of new species in a process known as ________.

ANS: speciation DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Remembering 4. When populations of a species are separated by a physical barrier, thereby becoming geographically isolated and subsequently reproductively isolated from one another, ________ speciation can occur.

ANS: allopatric DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Remembering 5. Two species live near each other but do not respond to each other’s courtship displays. This is an example of ________ isolation, a type of prezygotic barrier.

ANS: behavioral DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Remembering 6. Two species evolving together in response to interactions between the two species is referred to as ________.

ANS: coevolution DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Remembering 7. There are approximately 8.74 million eukaryotic species on Earth. Of the groups shown in the infographic below, ________ make up approximately 11 percent of the known species.

ANS: insects DIF: Moderate REF: Chapter 13 Infographic OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Applying SHORT ANSWER 1. There is color variation in a population of insects living within an area. Some individuals are solid black and other individuals are gray with green spots. Individuals who are solid black do not blend into the environment, and they tend to be eaten by predators. Explain how differences in survival rates will lead to more individuals in the population being gray with green spots.

ANS: Individuals with adaptive coloration will tend to survive and reproduce at higher rates. The adaptive coloration will be passed on to their offspring and that trait will become more common in the population.

This is an example of evolution by natural selection.

DIF: Moderate REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Applying 2. Within a population of mice there is an allele for a gene that leads to the production of larger front teeth.

In areas where seeds have thicker coatings, larger teeth allow these mice to chew through thicker seed coatings and survive at a higher rate than mice with smaller teeth. Would you expect an increase in the percentage of mice with larger teeth in a population of mice living in an area with seeds that have thicker coatings? Explain your reasoning.

ANS: In an area with seeds that have a thicker coating, mice with larger teeth will survive and reproduce at a higher rate than mice with smaller teeth. Therefore, the percentage of mice with larger teeth will be expected to increase in frequency. The larger teeth are considered an adaptive trait.

DIF: Difficult REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Evaluating 3. A lizard learns to avoid predatory birds after being attacked and losing part of its tail to a bird. What is required for this avoidance behavior to be considered an adaptive trait?

ANS: This trait would need to be an inherited trait, not just a learned behavior. This trait would also need to increase survival and successful reproduction.

DIF: Moderate REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Understanding 4. Two biologists discover two populations of toads living in the same area. Morphologically, these two populations are different. The toads in one population have much wider heads and darker coloration than the second population. One of the biologists suggests names for the two new species. The second biologist questions whether the two populations are separate species. Why is the second biologist hesitant to declare these populations are two species?

ANS: The second biologist would probably like more information about whether the two groups can interbreed and produce fertile offspring.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Evaluating 5. Two birds with distinct differences in their plumage successfully mate and produce viable, fertile offspring. Using the biological species concept, explain whether these two birds would be defined as a single species. Also address whether you would require more information to make this determination.

ANS: The biological species concept is based on the ability of individuals to interbreed and produce fertile offspring. Although these two birds look different from each other, they fit the definition of a species because they are capable of interbreeding and producing viable, fertile offspring. No further information is required in this case.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Applying 6. A microbiologist discovers a Streptococcus bacterium living on a human scalp. She wants to know whether the bacterium she found is the same species as a Streptococcus bacterium she isolated from the throat of the same human. Explain how she could determine whether these bacteria are the same species.

ANS:

The biological species definition will not help in this case because bacteria reproduce asexually. The researcher would need to use other information, such as DNA sequence similarity and morphology, to determine whether these are the same species.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Evaluating 7. The three sea urchin species shown below are separated by gametic isolation. Do these species fit the definition of species as defined by the biological species concept? Why or why not?

ANS: Yes. These species are reproductively isolated from one another.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Applying 8. If two populations of beetles living in isolated areas are physically different but genetically similar, would they be considered one species or two? Explain your answer.

ANS: Although the physical differences may lead to these two populations being considered two species, the lack of genetic divergence would most likely still allow these two populations to interbreed if they came into contact with each other. At this point in time the two populations should be considered one species because of the potential for interbreeding.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new

species.

MSC: Evaluating

9. Gene flow is completely blocked between two populations of a flowering plant for 300 years. One population develops light green leaves, tall spindly stems, and purple flowers. The other population develops dark green leaves, short stems, and white flowers. At the end of the 300 years, people begin planting these flowering plants together in decorative gardens. People quickly realize that these two flowering plants are capable of interbreeding. Did speciation occur during the 300-year separation?

Explain your reasoning.

ANS: Although these two populations diverged morphologically, they did not undergo speciation because they were still capable of interbreeding. The amount of genetic divergence was not enough to prevent them from reproducing. For speciation to occur, genetic divergence must lead to reproductive isolation.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Analyzing 10. This figure shows two squirrels that represent two separate species. Explain how the geographic barrier between these two populations led to the formation of two distinct species.

ANS: Geographic barriers prevent gene flow between populations of a species. Given enough time, a lack of gene flow between two populations leads to genetic divergence as mechanisms of evolution, such as mutation, genetic drift, and natural selection, occur. This is an example of allopatric speciation.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding 11. Speciation may be described as either allopatric or sympatric. What is the primary difference between the two types of speciation?

ANS: Allopatric speciation occurs when two populations become separate species after they are separated by a geographical barrier. Sympatric speciation occurs when two populations become reproductively isolated in the absence of a geographical barrier.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Understanding 12. Of the three species of sea urchins shown, one species is considered allopatric with Echinometra lucunter and the other is considered sympatric with E. lucunter. Name the allopatric species and identify one factor that may have led to speciation between E. lucunter and the allopatric species. Next, name the sympatric species and identify one factor that may have led to speciation between E. lucunter and the sympatric species.

ANS: The allopatric species, E. vanbrunti, is found in a different geographical area than E. lucunter.

Geographical barriers prevent gene flow between species located in different geographical regions. The sympatric species, E. viridis, is found in the same geographical area as E. lucunter. Sympatric speciation occurs when either prezygotic or postzygotic barriers lead to reproductive isolation.

DIF: Moderate REF: 13.2 What Makes a Species?

OBJ: 13.4 Differentiate between allopatric and sympatric speciation.

MSC: Applying 13. Choose two different reproductive barriers that lead to sympatric speciation and explain how they work.

ANS: Sympatric speciation occurs when new species form in the same geographic location. Ecological, behavioral, and mechanical isolation all prevent mating from occurring. Gametic isolation prevents fertilization after mating has occurred. There are also two postzygotic barriers—zygote death and hybrid performance—that act as barriers after fertilization has occurred.

DIF: Moderate

REF: 13.4 Different Depths, Different Habitats

OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Remembering 14. Explain how a change in the depth, either a lengthening or shortening, of flowers that contain nectar eaten by a particular species of hummingbird would potentially lead to a change in the hummingbird.

ANS: If the nectar contained in these flowers was the primary food utilized by the hummingbird, it would be reasonable to assume that the birds best able to access the nectar due to the length of their bill would survive and reproduce. The greater reproductive fitness of these birds would lead to evolution by natural selection. The change in one species due to an adaptation in another species is coevolution.

DIF: Difficult REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Analyzing 15. Summarize how genetic divergence between two populations leads to reproductive barriers that isolate species living in the same area. Give specific examples of the barriers produced.

ANS: Genetic divergence leads to populations with different inherited traits. Inherited traits control prezygotic traits such as the time that mating occurs (ecological isolation), mating behaviors (behavioral isolation), the shape of reproductive organs (mechanical isolation), and the gametes formed (gametic isolation).

Another possibility is that postzygotic barriers may be introduced as genetic divergence occurs.

DIF: Difficult REF: 13.2 What Makes a Species? | 13.4 Different Depths, Different Habitats OBJ: 13.3 Define speciation and the role of genetic divergence among populations in creating new species.

MSC: Evaluating MATCHING Match each numbered statement to one of the terms listed below. a. b. c. d. e. f.

1.

2.

3.

4.

coevolution biological species concept morphological species concept speciation morphology adaptation

an organism’s physical characteristics process by which one species splits to form two species or more process of evolution through natural selection evolution in one species that leads to reciprocal adaptation in another species

1. ANS: E DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Remembering 2. ANS: D DIF: Easy REF: 13.2 What Makes a Species?

OBJ: 13.2 Defend the utility of the biological species concept, and discuss its shortcomings.

MSC: Remembering 3. ANS: F DIF: Easy REF: 13.1 Leaping Lizards OBJ: 13.1 Diagram the relationships among adaptive traits, reproductive fitness, and evolution by natural selection.

MSC: Remembering

4. ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.6 Define and give an example of coevolution.

MSC: Remembering Determine the type of reproductive barrier described in each statement. a. b. c. d. e.

5.

6.

7.

8.

hybrid sterility behavioral isolation ecological isolation zygote death gametic isolation

Two toad species in the same habitat breed at different times of the year.

A horse and a donkey successfully mate; their offspring is sterile.

The gametes of sea urchins living on a reef together are incapable of fusing.

Female fruit flies only recognize the mating rituals of male fruit flies that are the same species.

5. ANS: C DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 6. ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 7. ANS: E DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 8. ANS: B DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding Identify whether a type of reproductive barrier is prezygotic or postzygotic. a. prezygotic 9.

10.

11.

12.

13.

b. postzygotic

hybrid sterility gametic isolation zygote death mechanical isolation ecological isolation

9. ANS: B DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 10. ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 11. ANS: B DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 12. ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding 13. ANS: A DIF: Easy REF: 13.4 Different Depths, Different Habitats OBJ: 13.5 Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

MSC: Understanding

Chapter 14: The History of Life MULTIPLE CHOICE 1. Which kind of organism makes up the oldest fossil found on Earth? a. protist c. bacteria b. animal d. plant ANS: C DIF: Easy REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 2. The first eukaryotes evolved approximately ________ years ago. a. 200,000 c. 2 billion b. 200 million d. 2 trillion ANS: C DIF: Easy REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 3. The appearance of eukaryotes may have been delayed until more ________ accumulated in Earth’s atmosphere. a. oxygen c. carbon b. nitrogen d. sulfur ANS: A DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Understanding 4. If a plant evolved during the Permian period and spread across the continent of Pangaea, where might the fossils of this animal be found now? a. North America only b. North and South America c. North and South America, Europe, and Asia d. North and South America, Europe, Asia, and Africa ANS: D DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Applying 5. How was the distribution of humans (after they evolved) affected by continental drift? a. The supercontinent of Pangaea had not yet split up before humans evolved. This made it very easy for humans to travel over the entire landmass of Earth. b. The supercontinent of Pangaea had already begun to split up, but the continents were still very close together, making it easy for humans to travel from one continent to another. c. The supercontinent of Pangaea had not yet split up before humans evolved. This had little impact on the distribution of humans because they did not travel until the 1400s. d. The supercontinent of Pangaea split apart and the resulting continents were in their present-day locations by the time modern humans evolved. This would have slowed the distribution of humans until they developed ways of easily traveling the oceans.

ANS: D DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Applying

6. In a fictional movie set in a land dominated by flowering plants, advancing and retreating glaciers, and a cast that includes a human, a wooly mammoth, a saber-toothed cat, and dinosaurs, the ________ would be most out of place in the setting according to the geological time line of life on Earth. a. saber-toothed cat and the human b. wooly mammoth and the human c. saber-toothed cat and the dinosaurs d. dinosaurs ANS: D DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Applying 7. At the base of the evolutionary tree of all life is the ________ ancestor. a. universal c. derived b. convergent d. descended ANS: A DIF: Easy REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Remembering 8. Evolutionary tree diagrams representing the relationships between various organisms can be drawn only when those organisms share a a. common cellular metabolism. c. common cellular organization. b. distinct lineage. d. common ancestor.

ANS: D DIF: Easy REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Understanding 9. In the evolutionary tree below, which of the nodes corresponds to the MOST recent common ancestor of troodontids, dromaeosaurids, and Archaeopteryx?

a. A b. B

c. C d. D

ANS: D DIF: Easy REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Applying 10. Evolutionary trees are based on a. the principle of convergent evolution. b. a set of shared characteristics believed to have arisen in a common ancestor. c. similarities in the function of a characteristic or trait. d. consensus among biologists regarding the usefulness of particular traits.

ANS: B DIF: Moderate REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Understanding 11. Any two groups of organisms will have ________ most recent common ancestor(s). a. two c. only one b. no more than four d. as many as 16 ANS: C DIF: Moderate REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Applying

12. Monotremes, like the duck-billed platypus, are egg-laying mammals covered in hair, have mammary and skin glands, have three ear ossicles, are diphyodont, and possess dentary-squamosal jaw articulation.

Marsupials, such as kangaroos and koalas, are pouched mammals that have a vertical tympanic membrane in addition to possessing characteristics observed in monotremes. Eutherians, such as humans, are placental mammals that have a vertical tympanic membrane in addition to possessing characteristics observed in monotremes.

What one shared derived trait sets marsupials and eutherians apart from monotremes? a. being diphyodont b. having a vertical tympanic membrane c. having a dentary-squamosal jaw d. being covered in hair ANS: B DIF: Moderate REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Analyzing 13. Monotremes, like the duck-billed platypus, are egg-laying mammals covered in hair, have mammary and skin glands, have three ear ossicles, are diphyodont, and possess dentary-squamosal jaw articulation.

Marsupials, such as kangaroos and koalas, are pouched mammals that have a vertical tympanic membrane in addition to possessing characteristics observed in monotremes. Eutherians, such as humans, are placental mammals that have a vertical tympanic membrane in addition to possessing characteristics observed in monotremes.

What traits are shared derived traits for monotremes, marsupials, and eutherians? a. mammary and skin glands, three ear ossicles, diphyodont, dentary-squamosal jaw articulation b. vertical tympanic membrane, three ear ossicles, diphyodont, dentary-squamosal jaw articulation c. three ear ossicles, diphyodont, dentary-squamosal jaw articulation, egg-laying d. vertical tympanic membrane, three ear ossicles, diphyodont, placenta ANS: A DIF: Moderate REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Analyzing 14. The ________ feature occurs between each branch on an evolutionary tree. a. evolution of a new derived b. loss of a derived c. evolution of a shared ancestral d. evolution of a convergent ANS: A DIF: Difficult REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Understanding 15. The following numbered sets each represent a distinct group of organisms: (1) three toes per foot, cold-blooded, feathers, no finger adaptations (2) three toes per foot, warm-blooded, body hair, opposable thumbs (3) three toes per foot, warm-blooded, feathers, no finger adaptation (4) three toes per foot, warm-blooded, body hair, no finger adaptations Which of the following choices is the MOST likely to represent the order in which these groups would appear on an evolutionary tree, from oldest to most recent? a. 1, 2, 3, 4 c. 1, 3, 4, 2 b. 4, 2, 3, 1 d. 2, 1, 4, 3

ANS: C DIF: Difficult REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Analyzing 16. The Cambrian explosion a. caused a lack of air in Earth’s atmosphere. b. was caused by an increase in volcanic activity. c. was volcanic in nature. d. increased the diversity of animal life on Earth.

ANS: D DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Understanding 17. The Cambrian explosion occurred primarily in the oceans. The first challenges that had to be overcome during the mass colonization of dry land in the Ordovician period were a. support of body structure without buoyancy in water, movement, and reproduction. b. photosynthesis, cellular respiration, and reproduction. c. DNA replication, photosynthesis, and cellular respiration. d. DNA replication, phagocytosis, and cellular respiration.

ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Understanding 18. During the Devonian period, plants evolved which of the following key innovations to overcome the harsh, dry conditions of life on land and flourish? a. waterproof cuticle, vascular systems, structural support tissues, leaves, roots, seeds, and specialized reproductive structures b. amniotic eggs with a hard shell, photosynthesis, flowers with protected seeds c. flowers with protected seeds, photosynthesis, hard-shelled amniotic eggs d. photosynthesis, flowers with protected seeds, waterproof cuticle ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Understanding 19. The Cambrian explosion resulted in the evolution of more than 17,000 species of an animal known as the trilobite. The sheer number of trilobite fossils found in modern times suggests that trilobites were abundant, perhaps the rulers of the seas. Today, no living descendants of this group exist. What happened? a. Trilobites evolved before the first mass extinction, so it is possible that any of the five mass extinctions could have wiped out the entire group. b. In order to disappear from the planet entirely, trilobites must have undergone the process of adaptive radiation. c. It is unlikely that trilobites could have survived the increase in atmospheric oxygen once the process of photosynthesis had evolved. d. Being so plentiful, trilobites must have been the major food source for terrestrial dinosaurs.

The extinction of the trilobite may have caused the mass extinction of dinosaurs.

ANS: A DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Applying

20. According to the tree below, which of the following combinations of organisms are MOST closely related?

a. amoebas and plants b. animals and fungi

c. plants and fungi d. fungi and amoebas

ANS: B DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Understanding 21. The current classification system used by biologists is a. complex and unchanging. b. universally accepted by all biologists. c. based on four generalized types of living organisms: Bacteria, Archaea, Eukarya, and Protista. d. updated and revised whenever new information becomes available.

ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Understanding 22. In order to best determine relationships among different organisms, scientists examine a. DNA and behavior. b. DNA and body structures. c. body structures and behavior. d. DNA, body structures, and behavior.

ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Understanding 23. The emergence of each new branch on the evolutionary tree represents a. the addition of a new Linnaean taxon within that lineage. b. the completion of a generation for that particular organism. c. the introduction of the most important features of a group. d. a common ancestor and the introduction of a new shared derived feature.

ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Applying 24. Branches on the evolutionary tree are sometimes rearranged by scientists because a. new, related fossils or new information about existing fossils changes the understanding of

the relationships. b. new, unrelated fossils are intentionally put on the tree with existing fossils. c. scientists are trying to prove a nonexistent relationship between species. d. scientists have proven a relationship between two or more species.

ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Understanding 25. The evolutionary history of the protists remains unresolved, but it is being refined with the addition of DNA evidence. This is an example of how scientific a. data may change our interpretation of an evolutionary tree without challenging our understanding of evolution. b. data proves that a hypothesis regarding an evolutionary tree is true. c. evidence proves that the theory of evolution is wrong. d. evidence proves that the Protista did not share the same universal ancestor as the rest of the living organisms on Earth.

ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Understanding 26. Evolutionary trees are continually revised by scientists as new information becomes available from various sources such as a. better understanding of the details of physiological processes. b. additional, similar fossils found in relation to the geological time period. c. the continued evolution of current Earth species. d. the identification of alien species that have reached Earth via meteorites and comets.

ANS: B DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Applying 27. Scientists use existing fossils to predict what the transitional forms between organisms might look like.

Why might it be so hard for scientists to find fossils of these transitional forms? a. Scientists have no way to determine how deep in a rock to look for a transitional fossil, so they just have to dig and dig until they find the right fossil. b. Because of continental drift, the exact location of where a transitional fossil should be found cannot be determined. Looking for a particular fossil that could be anywhere on the planet is like looking for a needle in a haystack. c. Fossils of transitional species may have never formed due to environmental conditions, or if they did form, natural processes like erosion may have destroyed them. d. The transitional form of any organism is only hypothetical in nature; it never truly existed on the planet and, therefore, could never become a fossil.

ANS: C DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Analyzing 28. Which of the following statements about bird evolution is NOT correct? a. Scientific studies have revealed so many errors in the traditional dinosaur-bird evolutionary tree that none of it is considered useful to understanding the evolution of birds and flight. b. Scientific studies of the Xiaotingia fossil caused scientists to adjust the traditional dinosaur-bird evolutionary tree. c. Scientific comparisons of Archaeopteryx and Xiaotingia fossils caused scientists to adjust

the traditional dinosaur-bird evolutionary tree. d. It is important to understand the dinosaur-bird evolutionary tree in order to have a better understanding of how flight evolved.

ANS: A DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Analyzing 29. Which of the kingdoms below share a most recent, common ancestor?

a. Plantae and Fungi b. Plantae and Animalia

c. Animalia and Protista d. Animalia and Fungi

ANS: D DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Remembering 30. A marine biologist has isolated a microorganism from the Gulf of Mexico. This organism is unicellular, photosynthetic, uses a flagellum to swim, and has been observed ingesting smaller microorganisms in its vicinity. To what kingdom does this organism MOST likely belong? a. Fungi c. Plantae b. Animalia d. Protista ANS: D DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying 31. What criteria best characterize membership in the kingdom Protista? a. a continuous lineage of descent from a common ancestor b. a large assortment of unique shared derived traits c. a common evolutionary heritage d. the inability to meet the characteristics that define each of the remaining eukaryotic kingdoms ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Understanding 32. Resolving the relationship between the various kingdoms has been challenging because species often resemble one another. For example, the kingdom ________ contains some organisms that are animal-like and others that are plant-like. a. Bacteria c. Archaea b. Fungi d. Protista

ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying 33. Gymnosperms and angiosperms are believed to be more closely related to one another than the other major plant groups because a. they alone possess vascular systems. b. both groups produce separate male and female gametes. c. they provide their embryos with stored food in seeds. d. they alone possess a waxy cuticle.

ANS: C DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Applying 34. Although it is costly to produce fruit, the large number of fruit-producing plant species attests to its success as an evolutionary adaptation. In what way is fruit production helpful to plants? a. Fruits attract pollinators like insects and birds to move pollen between different plants. b. Fruit toxins can discourage potential consumers from eating the plant. c. Plants can store energy in fruits during summer and then later recover the energy during winter, when the fruit decomposes. d. Consumers eating fruits also eat seeds that, when not digested, can be deposited far from the parent plant and increase the range of that plant species.

ANS: D DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Applying 35. Neighboring plant or fungi cells share a common cell wall, making multicellularity relatively simple.

How do animal cells remain connected to one another? a. Animal cells share a common plasma membrane rather than a common cell wall. b. Long interconnecting fibers extend from the nucleus of one cell to the nucleus of an adjacent cell. c. Most animals produce a felt-like extracellular matrix to which their cells can attach. d. Animal cells are connected to each other by the cytoskeleton.

ANS: C DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Applying 36. Upon examining specimens recovered from the small intestine of a murder victim during the autopsy, clusters of cells are found that are attached to each other by shared cell walls. The outer layers of these cells are covered with a waxy cuticle, and there is evidence of many green organelles inside the more intact cells in the clusters. What type of cells might these be? a. plant cells c. bacteria b. fungal cells d. protozoan cells ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Applying 37. The most ancient lineage in kingdom Animalia is the ________, followed closely by the ________. a. sponges; cnidarians c. chordates; deuterostomes b. echinoderms; chordates d. arthropods; protostomes

ANS: A DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 38. Imagine the discovery of an undescribed nonphotosynthetic, multicellular organism. To determine whether it is a(n) ________, it would need to be examined microscopically to determine if its cells ________. a. animal or fungi; have cell walls c. plant or fungi; have cell walls b. animal or plant; have nuclei d. animal or fungi; contain DNA ANS: A DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Analyzing 39. When making sourdough bread, bakers use a combination of microorganisms to produce the sour flavor and to leaven the dough before baking. The organisms typically used to produce the lactic acid that give sourdough its distinctive flavor are very small rod-shaped prokaryotic organisms known generally as Lactobacilli. These microorganisms are from the kingdom ________. The other organisms that produce the leavening effect are nonphotosynthetic eukaryotes, have cell walls, absorb their nutrients from their environment, and (in this case) are very tolerant of acidic environments. These microorganisms are from the kingdom ________. a. Bacteria; Fungi c. Animalia; Bacteria b. Plantae; Fungi d. Plantae; Bacteria ANS: A DIF: Difficult REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Analyzing 40. For the species Homo sapiens the first part of the name, Homo, denotes the a. class. c. order. b. family. d. genus.

ANS: D DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 41. The most recent mass extinction, which occurred during the Cretaceous period, may have been caused by a. extra heat from the sun. c. the dinosaurs. b. the pull of the moon on Earth. d. an asteroid hitting Earth.

ANS: D DIF: Easy REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Remembering 42. The figure below shows the number of living taxonomic families that existed on Earth during the last 540 million years. The sudden decreases in family numbers at 445, 360, 250, 200, and 65 million years ago represent Earth’s five mass extinction events. Based on this data, which mass extinction had the biggest impact on the overall diversity of life on Earth?

a. 200 million years ago b. 250 million years ago

c. 360 million years ago d. 445 million years ago

ANS: B DIF: Moderate REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Applying 43. Why might many new species form in the aftermath of a mass extinction? a. Gene flow among the remaining species would be increased, giving rise to many new genetic recombinations. b. Changed environments and reduced competition would provide opportunities for new adaptations. c. New environments would increase mutation rates. d. Populations of remaining species would expand rapidly and reduce geographic isolation.

ANS: B DIF: Moderate REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Analyzing 44. The mass extinction at the end of the Cretaceous period about 65 mya is believed to have been caused by a massive comet or asteroid smashing into what is now known as the Yucatan Peninsula in the Gulf of Mexico. The debris arising from this impact would have blocked the sun’s rays from reaching Earth.

How would this cause a mass extinction? a. With no sunlight, the plants would not be able to photosynthesize and they would die. Any animals that fed on those plants would also die and this chain reaction would continue up the food chain. b. A giant fireball would have spontaneously incinerated every living thing, and the evolution of life on Earth would have started completely fresh. c. A massive wave spread out from the epicenter of the impact and drowned all of the terrestrial life on Earth. Evolution of all life on land started over after that event. d. All of the terrestrial plants and animals choked to death on the debris cloud.

ANS: A DIF: Moderate REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Applying 45. The mass extinction at the end of the Permian period (about 250 million years ago) is thought to have killed off as many as 60 percent of the animal families. What group of animals dominated life on land at that time? a. trilobites c. reptiles

b. mammals

d. amphibians

ANS: C DIF: Moderate REF: 14.1 Dinosaurs and Domains | 14.4 Tussling with Trees OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance. | 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Understanding 46. Mass extinctions cause the loss of many species, no matter how well adapted those species were before the extinction. Why might previous adaptations NOT help a species survive a mass extinction? a. The rapid environmental changes that cause mass extinctions do not leave the organisms time to adapt. b. Ongoing continental drift allows more species to interbreed, which lowers the genetic variability available for adaptation. c. Adaptive radiations are stronger than adaptations. d. Well-adapted organisms will not be affected by mass extinction; these are the groups that will survive.

ANS: A DIF: Difficult REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Analyzing 47. What is a likely reason the Cretaceous extinction about 65 mya is the best studied mass extinction? a. It is the most recent mass extinction. Therefore, the fossils are typically closer to the surface and more easily reached for study. b. It was by far the most far-reaching extinction and most interesting extinction event because it killed everything in the oceans. c. It was the mass extinction farthest back in time, and it gave rise to the Cambrian explosion. d. It was the mass extinction event that killed off all of the animals and plants that arose during the Cambrian explosion.

ANS: A DIF: Difficult REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Analyzing 48. The mass extinction at the end of the Ordovician period killed a. 50 percent of marine animal families, including many trilobites. b. 50 percent of terrestrial and marine animal families, including many trilobites. c. 90 percent of terrestrial and marine animal families, and 100 percent of terrestrial plants. d. 100 percent of trilobites and 90 percent of terrestrial and marine animal families.

ANS: A DIF: Difficult REF: 14.1 Dinosaurs and Domains | 14.4 Tussling with Trees OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance. | 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Applying 49. Roughly 360 mya at the end of the ________ period, a mass extinction wiped out 30 percent of animal families, including many fishes and trilobites. The terrestrial animals at this time would have included ________. a. Devonian; many insects, other invertebrates, and amphibians b. Cambrian; dinosaurs and mammals c. Silurian; mammals and humans

d. Carboniferous; reptiles and humans ANS: A DIF: Difficult REF: 14.1 Dinosaurs and Domains | 14.4 Tussling with Trees OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance. | 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Understanding 50. The fourth mass extinction occurred about 200 mya at the end of the ________ period. This extinction eliminated 35 percent of the existing animal species, including ________. a. Triassic; reptiles, early dinosaurs, and the first mammals b. Jurassic; dinosaurs, the first birds, and many flowering plants c. Silurian; insects, birds, and mammals d. Carboniferous; insects, birds, and mammals ANS: A DIF: Difficult REF: 14.1 Dinosaurs and Domains | 14.4 Tussling with Trees OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance. | 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Understanding COMPLETION 1. In an evolutionary tree, a given ancestor and all its descendants make up a ________, or branch.

ANS: clade DIF: Easy REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Remembering 2. About 540 mya, there was an astonishing burst of evolutionary activity that correlated to the first appearance in the fossil record of most of the major living animal groups. Popularly known as the ________, this geologic time changed the face of life on Earth.

ANS: Cambrian explosion DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 3. The domain ________ encompasses the traditional four kingdoms of Protista, Plantae, Fungi, and Animalia.

ANS: Eukarya DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 4. The evolution of sperm-cell-containing structures called ________ freed gymnosperms from requiring water for fertilization.

ANS: pollen DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Remembering 5. Canis lupus is the scientific name for wolves. Canis refers to the ________ name.

ANS: genus DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying 6. According to the classification chart shown below, humans are in the order ________.

ANS: primates Primates

DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying 7. According to the classification chart shown below, humans are in the phylum ________.

ANS: chordata Chordata DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying 8. Because there is always new information to discover and interpret, scientists must be prepared to revise their ________ when there is evidence to suggest it is not correct.

ANS: hypothesis DIF: Easy REF: 14.4 Tussling with Trees OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our

understanding of evolution.

MSC: Understanding

9. The fossil record indicates that species have become extinct throughout the history of life. There have been five ________, during which greater than 50 percent of Earth’s species became extinct.

ANS: mass extinctions DIF: Easy REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Remembering SHORT ANSWER 1. When did photosynthesis evolve and how did it influence the evolution of life on Earth?

ANS: Roughly 2.8 bya (during the Precambrian period) a group of bacteria evolved a type of photosynthesis that released oxygen as a by-product. This increased the atmospheric oxygen concentration over time.

The first single-celled eukaryotes evolved about 2.1 bya. By roughly 650 mya the atmospheric oxygen concentrations had reached a level that supported the evolution of more complex multicellular organisms (aerobic organisms were capable of more efficient cellular respiration and therefore had more energy to fuel a more complex living system).

DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Understanding 2. The following geologic periods, listed in alphabetical order, are the most recent: Cretaceous, Jurassic, Paleogene/Neogene, Quaternary, and Triassic. Re-order the names of the periods beginning with the most recent. Then, choose one of these geologic time periods and describe the major events during that period.

ANS: Quaternary, Paleogene/Neogene, Cretaceous, Jurassic, and Triassic The Quaternary period includes the evolution of humans, advancement and retreat of glaciers, and extinction of large birds and mammals. The Paleogene/Neogene period was the age when mammals began to dominate, flowering plants and pollinating insects increased, and continents were near their present positions. During the Cretaceous period, flowering plants dominated and the last of the non-avian dinosaurs went extinct at the end along with many other organisms. During the Jurassic period dinosaurs diversified and the first birds and flowering plants appeared. The Triassic period was the period when early dinosaurs and the first mammals appeared.

DIF: Moderate REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 3. List the three domains of life. Then, identify which two domains are most closely related to one another.

Finally, indicate which domains are classified as prokaryotes and which are classified as eukaryotes.

ANS: The three domains of life are Bacteria, Archaea, and Eukarya. The most closely related are Archaea and Eukarya. The domains Bacteria and Archaea include prokaryotes. The domain Eukarya includes eukaryotes.

DIF: Easy REF: 14.1 Dinosaurs and Domains OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Remembering 4. Early birds had small, thick skulls and two toes on each foot. Archaeopteryx had a long, almost pointy skull and three toes on each foot. Early birds and Archaeopteryx shared the traits of feathers; clawed hands; and a long, bony tail. Examine the two trees presented in the figure below. Assuming that Xiaotingia shared traits with Archaeopteryx that neither of them shared with birds and looking only at the traits presented here, which of the trees shows the most likely relationship between these three animals? Support your answer by indicating which tree branch is initiated by which characteristic.

ANS: Xu’s dinosaur-bird tree is the more probable tree. Feathers; clawed hands; and a long, bony tail would be part of the therapod branch, according to this tree. Small, thick skulls and two toes on each foot would initiate the ―birds‖ branch of the tree. A long, almost pointy skull and three toes on each foot would likely initiate the deinonychosaurs branch of this tree. However, it is important to keep in mind that there are many other traits that have been presented in this evaluation.

DIF: Difficult REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Evaluating 5. According to the figure of Xu’s dinosaur-bird tree shown below, was Archaeopteryx the ancestor of modern birds? Explain your answer.

ANS: Xu’s tree indicates that Archaeopteryx is not the ancestor of modern birds. Archaeopteryx is categorized in the clade arising from deinonychosaurs, commonly called raptors, and separate from modern birds and their ancestors.

DIF: Easy REF: 14.2 Feathered Friends OBJ: 14.2 Interpret an evolutionary tree of a group of organisms.

MSC: Evaluating 6. Identify key characteristics for kingdom Fungi and provide three examples of members of this kingdom.

ANS: Fungi are eukaryotes. Some fungi are single-celled, such as yeasts and some molds, while others are multicellular, like mushrooms. These organisms digest organic material outside the body and absorb the molecules released as breakdown products. Their manner of obtaining nutrients makes them especially helpful as decomposers in ecosystems. Fungi produce protective cell walls around the plasma membrane. Like animals, fungi can store surplus food energy in the form of glycogen.

DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 7. The following Linnaean classifications are listed alphabetically: class, family, genus, kingdom, order, phylum, and species. Re-order these classification names beginning with the category that includes the largest number of organisms and ending with the category with the least number.

ANS: kingdom, phylum, class, order, family, genus, species DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Understanding 8. List the four kingdoms within the domain Eukarya and list one characteristic for each of the four kingdoms.

ANS: Kingdom Protista includes organisms that do not fit into the other three kingdoms. Most protists are single-celled; some are animal-like, some are plant-like, and others are fungus-like. The kingdom Plantae includes multicellular autotrophs that form the basis for most land-based food webs. The kingdom Fungi includes mushrooms, molds, and yeasts. The fungi are heterotrophs and their cells contain cell walls. The kingdom Animalia includes heterotrophic organisms that lack a cell wall; animals contain true tissues.

DIF: Moderate REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 9. List at least three basic functions of life that are handled differently on land than they are in water.

ANS: The support structure required, movement, reproduction, regulation of temperature, and the control of water loss are some basic functions that are handled differently on land than they are in water.

DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.5 Give an example of an adaptation that enabled a group of organisms to transition from an aquatic existence to life on land.

MSC: Understanding 10. Briefly explain how new scientific findings may change the arrangement of an evolutionary tree while enhancing our understanding of evolution.

ANS: Upon finding and evaluating fossils, it is possible that formerly unknown species may be identified. As the relationship of any newly discovered species to previously known species is determined, it may change the way we understand the relationships of known species. This does not undermine our understanding of evolution; it only enhances it by adding to our knowledge and understanding. The more that is learned about the relationships between related species, the better we will understand the evolutionary progression.

DIF: Moderate REF: 14.4 Tussling with Trees OBJ: 14.3 Explain how new scientific data may change an evolutionary tree without challenging our understanding of evolution.

MSC: Analyzing 11. Explain two ways that mass extinctions can have a profound impact on evolved biodiversity in the ecosystem.

ANS:

One way that a mass extinction impacts biodiversity is that entire groups of organisms quickly die out, and they (or anything like them) may never be seen again in the history of life on Earth. A second way that mass extinction impacts biodiversity is that it eliminates one or more dominant species (or groups of species), and whatever caused the mass extinction may have also altered the environment. Both of these occurrences would leave voids in the ecosystem and open up new niches/opportunities for other species to fill. Species could evolve along similar paths to fill the newly vacant niches, or very different innovations could evolve from the surviving species to fill the voids. This all leads to a dramatically altered evolutionary history and biodiversity.

DIF: Difficult REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Analyzing 12. If Earth’s current mass extinction were to end tomorrow, what would be expected to occur with adaptive radiations?

ANS: After mass extinctions occur there are typically great adaptive radiations as remaining organisms expand to fill gaps left by organisms that became extinct. New species form as organisms fill new roles and expand into new habitats.

DIF: Easy REF: 14.4 Tussling with Trees OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Analyzing 13. How is the current mass extinction, shown in the figure below, similar to past mass extinctions? What is the cause of the current mass extinction?

ANS: In all mass extinctions a high number of species, including plants and animals, go extinct. Scientists agree that the cause of the current mass extinction is human activity.

DIF: Easy REF: 14. Infographic OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Understanding

14. Information about the decline in animal groups during the first five mass extinctions was expressed as a percentage of animal families that went extinct. Can the graph shown below be used to determine the percentage of animal families lost during the current mass extinction? If so, what is the percentage of animal families that have gone extinct since 1500? If not, why not?

ANS: To determine the percentage of animal families lost you need to know the total number of animal families. The information shown indicates the number of species lost within each group, but does not give a total number of animal species. You need more information to calculate the percentage of animal families that have gone extinct since 1500.

DIF: Difficult REF: 14. Infographic OBJ: 14.6 Describe the impact of prehistoric mass extinctions on Earth’s biodiversity, and infer the likely impact of the current extinction rate on biodiversity.

MSC: Applying MATCHING Correctly match the definition with the correct geologic time period. a. Quaternary b. Jurassic c. Carboniferous d. Ordovician e. Precambrian f. Paleogene/Neogene g. Triassic h. Devonian i. Cambrian j. Cretaceous k. Permian l. Silurian 1. large and relatively sudden increase in the diversity of animal life; increase in diversity of algae; first vertebrates; 490–540 mya 2. increase in diversity of fishes; first hints of colonization of land by insects and other invertebrates; 415– 445 mya

3. increase in diversity of land plants; first amphibians colonize land; mass extinction late in period; 360– 415 mya 4. continents come together to form Pangaea; reptiles dominate life on land by 265 mya; mass extinction at end of period; 250–300 mya 5. continents begin to separate; diverse dinosaurs; first birds; first flowering plants; 145–200 mya 6. continents near present positions; increased diversity of flowering plants, birds, mammals, and pollinating insects; 2.6–65 mya 7. repeated advance and retreat of glaciers; evolution of humans; extinction of large mammals and birds; 0–2.6 mya 8. flowering plants begin to dominate life on land; mass extinction at end of period, including extinction of the last dinosaurs; 65–145 mya 9. origin of life; photosynthesis causes oxygen content of Earth’s atmosphere to increase; first eukaryotes; first multicellular organisms; 540 mya–3.8 bya 10. early dinosaurs; first mammals; mass extinction at end of period; 200–250 mya 11. further increases in diversity of marine invertebrates and vertebrates; plants and fungi begin to colonize land; mass extinction at end of period; 445–490 mya 12. extensive forests; amphibians dominate life on land; increase in diversity of insects; first reptiles; 300– 360 mya 1. ANS: I DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 2. ANS: L DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 3. ANS: H DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 4. ANS: K DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 5. ANS: B DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 6. ANS: F DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 7. ANS: A DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 8. ANS: J DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 9. ANS: E DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 10. ANS: G DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering 11. ANS: D DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering

12. ANS: C DIF: Difficult REF: 14.1 Dinosaurs and Domains OBJ: 14.1 Identify critical events on a time line of life on Earth and explain their evolutionary importance.

MSC: Remembering Use the figure shown below to match the Linnaean classifications with category names for humans.

a. b. c. d. e. f. g.

13.

14.

15.

16.

17.

18.

19.

genus order family kingdom species class phylum

Animalia Hominidae Homo Mammalia Homo sapiens Primates Chordata

13. ANS: D

DIF: Easy

REF: 14.3 The History of Life on Earth

14.

15.

16.

17.

18.

19.

OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: C DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: A DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: F DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: E DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: B DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying ANS: G DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Applying Match each adaptation with the most specific group in which that adaptation arose. a. gymnosperms b. angiosperms c. plants d. animals e. chordates f. fungi

20.

21.

22.

23.

24.

development of true tissues production of chitin to strengthen and protect the body development of a waxy cuticle to retain moisture first plants to produce pollen flowering plants with a fleshy ovary wall to protect seeds

20. ANS: D DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 21. ANS: F DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 22. ANS: C DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 23. ANS: A DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering 24. ANS: B DIF: Easy REF: 14.3 The History of Life on Earth OBJ: 14.4 Classify a given species at each level of the Linnaean system.

MSC: Remembering

Chapter 15: Bacteria and Archaea

MULTIPLE CHOICE 1. Bacteria and archaea are both classified as a. eukaryotes. b. protists.

c. fungi. d. prokaryotes.

ANS: D DIF: Easy REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Remembering 2. Which of these comparisons is correct? a. Eukaryotes are more abundant than prokaryotes. b. Prokaryotes reproduce at a slower rate than eukaryotes. c. Bacteria are more widespread than archaeans. d. Prokaryotes show more diversity in metabolism than eukaryotes.

ANS: D DIF: Moderate REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Understanding 3. Which of the following pairs of domains are MOST closely related? a. Bacteria and Archaea b. Bacteria and Eukarya c. Archaea and Eukarya d. Domains Bacteria, Archaea, and Eukarya are equally related.

ANS: C DIF: Easy REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Remembering 4. Which of the following groups of characteristics defines prokaryotes? a. single-celled, membrane-enclosed organelles, nucleus, asexual reproduction b. single or multicellular, no nucleus, single loop of DNA, sexual reproduction c. single-celled, single loop of DNA, no membrane-enclosed organelles, asexual reproduction d. single or multicellular, no nucleus, single loop of DNA, sexual reproduction ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Understanding 5. A single-celled organism has linear DNA enclosed within a nucleus. This organism must be a(n) a. eukaryote because it has a nucleus. b. bacterium because it is single-celled. c. archaean because it has linear DNA. d. prokaryote because it has a nucleus.

ANS: A DIF: Moderate REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Applying 6. As a group, prokaryotes a. live in extreme environments and lack a nucleus. b. are single-celled and possess pili. c. are single-celled and lack a nucleus.

d. obtain energy from inorganic chemicals.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Applying 7. Why do prokaryotes reproduce more rapidly than single-celled eukaryotes? a. Only prokaryotes use asexual reproduction. b. Prokaryotes have much less DNA than eukaryotes. c. Prokaryotes live in more diverse environments. d. Prokaryotes use pili to adhere to each other.

ANS: B DIF: Moderate REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Understanding 8. Prokaryotes are capable of reproducing more rapidly than eukaryotes because prokaryotes a. have smaller ribosomes. b. use asexual reproduction. c. have less genetic material. d. have more flexible plasma membranes.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Applying 9. Prokaryotes have an optimum temperature for growth. If a prokaryote can divide into two cells every 20 minutes when the temperature is 37oC, what would happen if the temperature dropped to 35oC? a. The prokaryote would continue to divide every 20 minutes. b. The generation time would increase. c. The generation time would decrease. d. The prokaryote would be unable to divide.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Analyzing 10. An experiment is performed to see if an antiseptic will change the skin microbiome. Skin swabs are used before an antiseptic is applied, after the antiseptic is applied, and on the same area 48 hours later. It is observed that the antiseptic drastically reduced the numbers of Staphyloccocus and other bacteria. After 48 hours Staphylococcus reappears as the most common species. What can be inferred from these results? a. Antiseptics are only effective against one type of bacteria. b. Staphylococcus has a short generation time. c. Staphylococcus tolerates oxygen better than other bacteria. d. Staphylococcus uses sporulation to survive antiseptic treatment.

ANS: B DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Analyzing 11. A prokaryotic cell and a eukaryotic cell are placed in an environment ideal for growth of both cells. After 24 hours it is observed that the prokaryote cell population is significantly higher than the eukaryote cell population. This has occurred because prokaryotes a. use quorum sensing to inhibit growth of eukaryotes.

b. have a simpler structure, which allows more rapid reproduction. c. were the earliest life-forms on Earth. d. are single-celled and eukaryotes are all multicellular.

ANS: B DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Applying 12. As shown in the figure below, a single bacterium has a generation time of 10 minutes. Approximately how much time will have passed when the population is 100 cells?

a. 20 minutes b. 50 minutes

c. 70 minutes d. 100 minutes

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Applying 13. Many bacteria have a shorter generation time at warmer temperatures. Why do food safety guidelines recommend rapidly cooling leftover foods and maintaining them at refrigerator temperatures? a. Prokaryotes are incapable of reproducing at refrigerator temperatures. b. Many bacteria reach disease-causing levels rapidly when food is warm. c. Refrigerator temperatures reduce the amount of oxygen available for aerobic bacteria. d. Prokaryotes require light for reproduction and the inside of a refrigerator is dark.

ANS: B DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Analyzing 14. Escherichia coli, a bacterium that normally lives in the gut of humans, will have the shortest generation time when it is found a. on foods in a refrigerator set to a low temperature. b. on the inside of a toilet at room temperature. c. in an incubator set close to human body temperature. d. on foods left out at room temperature.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Understanding

15. The generation time for a prokaryote is 30 minutes. If one cell is present on a petri dish, how many cells will be present after three hours? a. 16 c. 64 b. 32 d. 86 ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Applying 16. Citizens use an app to document the location of ash trees in their community. These citizen scientists are participating a. in data analysis. c. in data collection. b. in experimental design. d. as experimental subjects.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Applying 17. Professional scientists benefit from citizen science because citizens a. review their experimental designs. b. increase their ability to collect samples. c. help report results from studies to other citizens. d. help make science fun.

ANS: B DIF: Moderate REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding 18. Citizen science projects contribute to scientific research by the public a. collectively forming hypotheses for experiments. b. designing and carrying out experiments. c. participating in the collection of data. d. peer-reviewing professional research.

ANS: C DIF: Moderate REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding 19. Individuals who participate in research as experimental subjects are a. data collectors. c. professional scientists. b. citizen scientists. d. data analyzers.

ANS: B DIF: Easy REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding 20. If a professional scientist is trying to build an extensive database of bacterial swabs from humans in all parts of the world, what is the most cost-effective way to increase the number of samples collected in a one-year time period? a. Train citizens to collect samples from the public. b. Hire more researchers to travel around the world. c. Send a single professional scientist to locations throughout the world. d. Pay for citizens around the world to travel to a central laboratory where samples will be collected.

ANS: A

DIF: Moderate

REF: 15.0 Intro

OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Applying 21. Archaeans are often referred to as ―extremophiles‖ because they are a. capable of living in extreme environments where other organisms cannot function. b. the only living organisms to reproduce using binary fission, an extreme form of asexual reproduction. c. examples of the earliest life-forms on Earth and have existed for an extremely long time. d. single-celled organisms that have extreme mechanisms for causing diseases in humans.

ANS: A DIF: Moderate REF: 15.1 Merry Microbes OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Applying 22. Microbes that make up the domains Bacteria and Archaea are most similar in their a. DNA sequences. b. plasma membrane structures. c. metabolism. d. lack of membrane-enclosed organelles.

ANS: D DIF: Moderate REF: 15.1 Merry Microbes OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Applying 23. Cells that lack membrane-enclosed organelles and have a single loop of DNA may be a. bacteria only. c. eukaryotes only. b. archaea only. d. either bacteria or archaea.

ANS: D DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Applying 24. Compared to the domain Bacteria, the domain Archaea tends to live a. in environments with more oxygen. c. in more mild environments. b. more frequently on human skin. d. in more extreme environments.

ANS: D DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Understanding 25. Archaea are able to live in extreme environments because they have a. simpler cells than eukaryotes. b. evolutionary adaptations that other organisms lack. c. a thick capsule. d. flagella that other organisms lack.

ANS: B DIF: Moderate REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Applying 26. Archaeans known as halophiles would most likely be found living in a(n) a. salt lake. c. deep-sea hydrothermal vent. b. mineral hot spring. d. abandoned copper mine.

ANS: A DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Applying 27. A water sample is taken from a mineral hot spring. The water is found to be highly acidic. Which of the following organisms is MOST likely to be living in this sample? a. a eukaryotic rotifer b. a bacterium typically found living in belly buttons c. an archaean d. a multicellular eukaryote ANS: C DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Applying 28. The term ―extremophiles‖ is sometimes used to describe ________ based on the environments in which they live. a. archaeans c. prokaryotes b. bacteria d. eukaryotes ANS: A DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Remembering 29. In which of the following environments would archaea be expected but not bacteria? a. a hydrothermal vent c. water in a cave b. a belly button d. dead matter in shallow water ANS: A DIF: Moderate REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Understanding 30. Prokaryotes that are observed attaching onto nonliving surfaces most likely possess a. pili. c. a flagellum. b. a capsule. d. a nucleus.

ANS: A DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Applying 31. Prokaryotes that are observed ―swimming‖ through a liquid environment most likely possess a. pili. c. a flagellum. b. a capsule. d. a nucleus.

ANS: C DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Applying 32. Prokaryotes may pick up pieces of DNA from the environment or other bacteria and incorporate these pieces into their own genome through a. vertical gene transfer. c. sexual reproduction. b. horizontal gene transfer. d. binary fission.

ANS: B DIF: Moderate REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 33. Small loops of extra DNA in the cytoplasm of prokaryotes are called

a. spores. b. plasmids.

c. ribosomes. d. pili.

ANS: B DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 34. Structures produced by bacteria, but not archaeans, that are extremely resistant to boiling and freezing temperatures are a. spores. c. ribosomes. b. plasmids. d. pili.

ANS: A DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 35. A disease-causing bacterium may be protected from the immune system by a slippery a. pilus. c. capsule. b. flagellum. d. cell wall.

ANS: C DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 36. Disease-causing bacteria in a human begin to multiply rapidly when they sense that their numbers are high enough to overpower an immune response. This is possible because of a. quorum sensing. b. a bacterial cell wall. c. a limited amount of DNA in the bacteria. d. sporulation.

ANS: A DIF: Moderate REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Understanding 37. Bacterial conjugation is the process in which a bacterium a. splits in two. b. exchanges DNA directly with another bacterium. c. adheres to a surface to form a biofilm. d. takes in DNA from its environment.

ANS: B DIF: Moderate REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 38. Which of the following prokaryotes would be MOST likely to survive a full year in a freezing arctic tundra? a. an anaerobic bacterium b. an aerobic bacterium c. a bacterium capable of sporulation d. a nitrogen-fixing bacterium ANS: C DIF: Moderate REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Analyzing

39. If one forgets to brush his or her teeth, bacteria may use ________ to attach onto the surface of the teeth. a. flagella c. capsules b. pili d. plasma membranes ANS: B DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Understanding 40. Archaeans found in deep-sea hydrothermal vents would be expected to a. use carbon dioxide in photosynthesis. b. obtain energy from inorganic chemicals. c. produce oxygen gas as a by-product. d. obtain energy from sunlight.

ANS: B DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Analyzing 41. Anaerobic archaeans living in hydrogen-rich environments may feed on hydrogen and release ________ gas as a by-product. a. oxygen c. methane b. carbon dioxide d. nitrogen ANS: C DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Remembering 42. A prokaryote living in a deep-sea environment that has limited gases and a deep layer of dead organic matter most likely fits in the category represented by the letter ________ in the figure below.

a. A b. B

c. C d. D

ANS: D DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 43. A photosynthetic, heterotrophic prokaryote fits in the category represented by the letter ________ in the figure below.

a. A b. B

c. C d. D

ANS: C DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 44. A photosynthetic, autotrophic prokaryote fits in the category represented by the letter ________ in the figure below.

a. A b. B

c. C d. D

ANS: A DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 45. Heterotrophic bacteria and archaeans that are decomposers are important in a. water cycling. c. capturing sunlight energy. b. nutrient cycling. d. carbon fixation.

ANS: B DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding

46. Prokaryotes can be found in most habitats because they a. are smaller than eukaryotes. b. can survive in both oxygen-rich and oxygen-free environments. c. have a single loop of DNA. d. can obtain energy from sunlight.

ANS: B DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 47. An individual with a deep, closed belly button is more likely to have more ________ bacteria living in his or her belly button compared to an individual with a shallow, open belly button. a. anaerobic c. nitrogen-fixing b. aerobic d. photoheterotrophic ANS: A DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 48. One of the earliest prokaryotes on Earth played an important role in the evolution of multicellular eukaryotes. These early prokaryotes changed Earth’s chemistry when they began a. recycling nutrients locked in organic matter. b. to produce oxygen as a by-product of photosynthesis. c. capturing energy from inorganic iron ore. d. to exist in oxygen-free environments.

ANS: B DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Analyzing 49. Prokaryotes described as chemoautotrophs are represented by the category labeled ________ in the figure below.

a. A b. B

c. C d. D

ANS: B DIF: Moderate REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying

50. Which of the following organisms found in the human microbiome is NOT known to be a pathogen? a. archaeans c. fungi b. gut bacteria d. skin bacteria ANS: A DIF: Easy REF: 15.4 Healthy Balance OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Remembering 51. The belly button project has used citizen scientists to collect information about the prevalence of different belly button species. Using the graphic shown below, determine species abundance from most abundant to least abundant.

a. b. c. d.

Staphylococcaceae, Porphyromonos, Corynebacterium, Anaerococcus Porphyromonos, Anaerococcus, Staphylococcaceae, Corynebacterium Corynebacterium, Staphylococcaceae, Anaerococcus, Porphyromonos Anaerococcus, Porphyromonos, Corynebacterium, Staphylococcaceae

ANS: C DIF: Easy REF: 15. Infographic OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding COMPLETION 1. Bacteria and archaea are together referred to as ________.

ANS: prokaryotes DIF: Easy REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Remembering

2. A citizen scientist documenting dates when migratory birds arrive in an area are participating in data ________.

ANS: collection DIF: Moderate REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding 3. A prokaryote living in a hot hydrothermal vent deep in the ocean is most likely a(n) ________.

ANS: archaean DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.3 Give examples of the environments in which archaeans are found.

MSC: Understanding 4. The prokaryotic structures used to link bacteria together and adhere to surfaces are called ________.

ANS: pili pilus DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 5. Prokaryotes typically reproduce by splitting in two through a process called ________.

ANS: binary fission DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Remembering 6. Plaque that form on the surface of teeth are an example of a(n) ________.

ANS: biofilm DIF: Moderate REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Understanding 7. A prokaryote that uses carbon dioxide for photosynthesis and sunlight for energy is called a(n) ________.

ANS: photoautotroph DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding

SHORT ANSWER 1. List three characteristics shared between bacteria and archaea.

ANS: Both are single-celled organisms, have a single loop of DNA free in the cytoplasm, and lack a nucleus and membrane-enclosed organelles. Both reproduce quickly using a process called binary fission. Both groups show a wide diversity in metabolism.

DIF: Easy REF: 15.0 Intro OBJ: 15.1 Differentiate between bacteria and archaea, and explain why they are together referred to as prokaryotes.

MSC: Remembering 2. Eukaryote cells require hours for mitosis to occur. Prokaryotes can often divide into two cells in 10–30 minutes. What cell characteristics explain the difference in the length of time required for division?

ANS: Prokaryote cells are simpler in structure compared to eukaryote cells. Prokaryote cells lack membrane-enclosed organelles and a nucleus. Prokaryotes also have a single circular loop of DNA rather than the multiple linear chromosomes found in eukaryotes.

DIF: Easy REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Understanding 3. Beginning with a single bacterium for generation 0, calculate the number of cells present at generation 4.

ANS: The number of cells present at generation 4 is 16. Each cell will divide into two cells during a generation.

The single starting cell becomes two cells (generation 1). Those two divide into four cells (generation 2).

Four cells divide into eight cells (generation 3), and those eight divide into 16 cells (generation 4).

DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Applying 4. Explain why the growth curve shown in the figure below changes from a relatively flat line to a steeper upward line as the generation number increases.

ANS: The growth curve shown indicates exponential growth as each individual cell is dividing into two cells.

During the early generations the difference between the number of parent cells and the number of daughter cells is much less than the difference between those numbers in later generations.

DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Evaluating 5. If the generation time for the bacterium shown in the figure below is 30 minutes, how much time will have gone by when the population has reached 1,000?

ANS: Five hours will have passed.

DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid

reproduction can be advantageous.

MSC: Analyzing

6. A bacterium that normally resides on human skin and does not cause disease has a very short generation time compared to disease-causing bacteria. How might this short generation time be beneficial to the human?

ANS: The bacterium with the short generation time will be able to divide more rapidly than disease-causing bacteria. The larger number of cells produced will use up resources in the environment that could otherwise be used by disease-causing bacteria.

DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Analyzing 7. Ben drinks directly out of a new milk container and then leaves the milk out of the refrigerator for at least an hour before remembering to put it away. The next morning, his roommate complains that the milk he just bought has already turned sour. Why did the milk turn sour more quickly than usual?

ANS: As the milk was sitting out of the refrigerator, it had time to warm up and bacteria within the milk were able to divide more rapidly. The sour taste was from by-products of bacterial metabolism. Drinking directly out of the container added even more bacteria to those that were already present.

DIF: Difficult REF: 15.0 Intro OBJ: 15.2 Explain why prokaryotes can reproduce more rapidly than eukaryotes and why rapid reproduction can be advantageous.

MSC: Evaluating 8. In some cases, science is advanced when the public participates in collecting, and sometimes analyzing, data. Name one way in which citizen scientists benefit from this type of collaborative effort.

ANS: Citizen scientists may learn new things, have fun, and/or feel a sense of purpose when they engage in this type of work.

DIF: Moderate REF: 15.0 Intro OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding 9. After boiling water for a short period of time, the water is checked for the presence of living cells. When it is determined that no active, living cells are present, the water is used to make agar, a media used for bacterial growth. Within 48 hours there are numerous colonies of cells growing on the agar. What type of prokaryote is growing? Why was the organism not detected in the water?

ANS: The organism is a bacterium that produces spores; archaea do not undergo sporulation. Spores are thick-walled, dormant structures that are capable of surviving boiling conditions.

DIF: Difficult REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Applying 10. Explain how bacteria can incorporate a gene for antibiotic resistance from another bacterial cell.

ANS: Bacteria do not pick up genes from other bacteria through sexual reproduction. Bacteria are able to use horizontal gene transfer to pick up bits of DNA from their environment or other cells and incorporate those bits into small loops of DNA called plasmids.

DIF: Difficult REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Applying 11. What role do pili serve in the formation of a biofilm?

ANS: Pili are structures that allow bacteria to adhere to each other and to a surface. Attaching to a surface is the first step in the formation of a biofilm.

DIF: Easy REF: 15.2 Talk, but No Sex OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Applying 12. In what way do prokaryotes directly help plants?

ANS: Prokaryotes can convert nitrogen gas in the air into a form that plants can use through a process called nitrogen fixation.

DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding 13. An experiment is designed to test whether plants grow better in a sterile environment free of bacteria than they do in environments with bacteria. The soil, growing containers, and all materials are sterilized and seeds are planted. The seeds sprout but all of the seedlings die very quickly from nitrogen deficiency. Why? ANS: Although the air we breathe contains abundant nitrogen, plants are unable to utilize this form of nitrogen.

Bacteria can convert nitrogen gas into ammonia or nitrate, which can then be used by plants.

DIF: Difficult REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Applying 14. A biofilm within a medical device is formed by several bacteria species. A bacterium that is part of this biofilm has a mutation that prevents the formation of the slimy secretion used to protect a developing biofilm. Will this mutation prevent the formation of the biofilm?

ANS: No. If a biofilm is made up of multiple species, a mutation in one species that prevents the formation of the slime coat will not affect other species from secreting a slime coat to protect the entire group of cells.

DIF: Difficult REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Analyzing

15. If prokaryotes were unable to convert nitrogen gas into ammonia or nitrate, how would life on Earth be different than it is today?

ANS: Plants require nitrogen fixation by prokaryotes. If prokaryotes were unable to perform this role, plants would not be able to survive. Any organisms, including humans, that rely on plants would not exist.

DIF: Difficult REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Evaluating 16. What is the phenomenon referred to as dysbiosis? What problems may occur as a result of dysbiosis?

ANS: Dysbiosis is a term used when the healthy balance in the human microbiome shifts out of balance.

Dysbiosis may result in human illness because microbial biodiversity helps to keep pathogens from overwhelming human defenses.

DIF: Moderate REF: 15.4 Healthy Balance OBJ: 15.6 Explain how citizen science contributes to scientific research.

MSC: Understanding MATCHING Match the prokaryotic cell structures with their functions. a. capsule b. pili c. flagella d. ribosomes e. DNA 1.

2.

3.

4.

5.

contains information used to construct proteins helps protect disease-causing bacteria from destruction by the immune system spins like a propeller to allow movement through a liquid environment allow bacteria to adhere to each other or to a surface in their environment used for protein synthesis

1. ANS: E DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 2. ANS: A DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 3. ANS: C DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 4. ANS: B DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 5. ANS: D DIF: Easy REF: 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering

Determine whether a cell structure is found in prokaryotes only, eukaryotes only, or both prokaryotes and eukaryotes. a. prokaryotes only b. eukaryotes only c. both prokaryotes and eukaryotes 6.

7.

8.

9.

10.

11.

12.

13.

cell membrane ribosomes DNA capsule pili nucleus membrane-enclosed organelles cytoplasm

6. ANS: C DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 7. ANS: C DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 8. ANS: C DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 9. ANS: A DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 10. ANS: A DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 11. ANS: B DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 12. ANS: B DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering 13. ANS: C DIF: Easy REF: 15.0 Intro | 15.1 Merry Microbes OBJ: 15.5 Explain the function of at least one cellular structure that is unique to prokaryotes.

MSC: Remembering Match each term describing prokaryotes with ways of obtaining energy and carbon. a. photoheterotroph b. chemoautotroph c. photoautotroph d. chemoheterotroph 14.

15.

16.

17.

a prokaryote that consumes organic matter to obtain energy and carbon a prokaryote that obtains energy from inorganic iron ore and carbon from carbon dioxide a prokaryote that uses sunlight to obtain energy and consumes organic matter to obtain carbon a prokaryote that uses sunlight to obtain energy and takes in carbon dioxide to conduct photosynthesis

14. ANS: D DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding 15. ANS: B DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding 16. ANS: A DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding 17. ANS: C DIF: Easy REF: 15.3 All Hands on Deck OBJ: 15.4 Illustrate through example the breadth of metabolic diversity found in bacteria.

MSC: Understanding

Chapter 16: Plants, Fungi, and Protists MULTIPLE CHOICE 1. Eukaryotic DNA is enclosed in two concentric layers of cell membranes that form the ________ in the eukaryotic cell. a. nuclear envelope c. Golgi apparatus b. nucleoid d. rough endoplasmic reticulum ANS: A DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering

2. Eukaryotic cells can complete tasks such as digesting and storing food and ridding the cell of waste products because they contain an elaborate system of internal membranes and compartments. This compartmentalization is lacking in a. protists. c. prokaryotes. b. fungi. d. plants.

ANS: C DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering

3. DNA exists in a concentration of strands known as a nucleoid in ________ cells. a. eukaryotic c. protozoan b. prokaryotic d. fungal ANS: B DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering | Understanding 4. The volume of a prokaryotic cell is, on average, ________ than that of a eukaryotic cell. a. 10 times greater c. 1,000 times greater b. 10 times less d. 1,000 times less ANS: D DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering

5. A eukaryotic cell that is involved in producing a lot of protein would have an extensive network of a. rough endoplasmic reticulum. c. chloroplasts. b. smooth endoplasmic reticulum. d. mitochondria.

ANS: A DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

6. Ribosomes can be found in ________ cells.

MSC: Understanding

a. only prokaryotic b. only eukaryotic

c. both prokaryotic and eukaryotic d. neither prokaryotic or eukaryotic

ANS: C DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding

7. Photosynthetic ________ would NOT have chloroplasts. a. algae c. mosses b. bacteria d. flowering plants ANS: B DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding

8. While they may differ in chemical composition, cell walls are often found in a. animal cells and occasionally in fungi. b. protozoans and animal cells only. c. protozoans, animal, and plant cells only. d. prokaryotes, protists, fungi, and plant cells.

ANS: D DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding

9. The bacterium that causes strep throat would be a ________ that belongs to ________. a. prokaryote; domain Bacteria b. eukaryote; kingdom Protista c. prokaryote; kingdom Protista d. eukaryote; domain Bacteria ANS: A DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding | Applying

10. The organism Entamoeba histolytica is one of the causes of amoebic dysentery. Infection occurs when cysts of this organism are swallowed and enter the patient’s digestive tract. These cysts each have four nuclei, and once in the digestive tract the cysts divide into four cells, each with its own nucleus. Each new cell can invade the mucosal lining of the digestive tract by pushing its pseudopodia into the lining.

This organism is a ________ that belongs to ________. a. prokaryote; domain Bacteria b. eukaryote; kingdom Protista c. prokaryote; kingdom Protista d. eukaryote; domain Bacteria ANS: B DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Applying

11. Protists and other organisms that use energy and carbon from a variety of sources to fuel their growth and reproduction are most appropriately referred to as a. autotrophs. c. heterotrophs. b. auxotrophs. d. mixotrophs.

ANS: D DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Understanding 12. A drop of pond water is examined with a microscope, revealing small, green, motile, unicellular organisms that seem to be moving by whipping a small flagellum around. These organisms most likely belong to kingdom

a. Fungi. b. Plantae.

c. Protista. d. Animalia.

ANS: C DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 13. Some protists break down waste material by consuming other dead organisms and releasing nutrients into the environment to be reused by producers and cycled back into the food chain. These protists are a. decomposers. c. autotrophs. b. producers. d. auxotrophs.

ANS: A DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Understanding 14. As Charlotte snorkels near the shoreline, she notices large masses of something green swaying with the surf. She suspects this to be a large plant in the ocean. She collects a sample. Upon closer examination, she discovers that there are no vascular structures to absorb and transport water and nutrients throughout the organism, but there are chloroplasts present in the cells. This organism most likely belongs to kingdom a. Fungi. c. Animalia. b. Plantae. d. Protista.

ANS: D DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 15. Within kingdom Protista, the ________ are photosynthetic and may or may not be motile. a. protozoans c. fungi b. algae d. plantae ANS: B DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Remembering 16. According to the phylogenetic tree below, which of the following combinations are MOST closely related?

a. Red algae and Forams b. Green algae and Amoebas

c. Diplomonads and Euglenoids d. Ciliates and Amoebas

ANS: C DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Applying 17. The organism that causes malaria is transmitted to humans by the bite of mosquitoes. Once in the human bloodstream, this unicellular organism takes up residency inside the red blood cells. It has a nucleus and other cellular structures that are visible upon microscopic examination of the blood. This pathogenic organism is the a. protest, Plasmodium. c. protist, Amoeba. b. fungi, Plasmodium. d. fungi, Amoeba.

ANS: A DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 18. It is particularly important for pregnant women to carefully wash their hands and take other precautions if they have a pet cat and are changing the litter box. An organism occasionally carried by cats, pig, and sheep can infect humans and pass from mother to child in utero, resulting in severe symptoms in the growing child. Microscopic examination of this organism shows a nucleus and other visible cellular organelles. It obtains all its nutrients from whichever host it currently occupies and can multiply by fission. This pathogenic organism is the a. plant, Plasmodium vivax. b. protist, Plasmodium vivax.

c. plant, Toxoplasma gondii. d. protist, Toxoplama gondii.

ANS: D DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 19. Like the first plants that evolved to live on land, the ________ (liverworts and mosses) living today thrive as very simple plants with extremely flat, thin bodies that can directly absorb water into their cells. a. gymnosperms c. angiosperms b. bryophytes d. aquatic algae ANS: B DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Remembering 20. On a hike, Cheryl notices some flat green plants clinging to the side of a damp rock. She brings a few of these flat but leaf-shaped plants back to the lab to examine under the microscope and determines that these plants are only a few cells thick and have no vascular tissues like xylem and phloem. They appear to be absorbing water directly through their surfaces. These little plants are probably a. angiosperms. c. bryophytes. b. aquatic algae. d. gymnosperms.

ANS: C DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Applying 21. An autotrophic organism that grows on land, has vascular tissues, but does not produce seeds is probably a a. bryophyte from kingdom Plantae. b. fern from kingdom Protista. c. bryophyte from kingdom Protista. d. fern from kingdom Plantae.

ANS: D DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 22. Fiddlehead greens are the curled, young fronds of a fern. Harvested very early and trimmed close to the ground, they provide a tasty addition to salads. These multicellular, photosynthetic, vascularized organisms that do not produce seeds belong to kingdom a. Eubacteria. c. Fungi. b. Plantae. d. Protista.

ANS: B DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 23. Gingko biloba is the sole surviving species of what was once many species. Popular as ornamentals in the United States and Europe, Ginkgos are trees that can reach heights of 90 feet or more. They have wedged-shape leaves that show a branching network of vascular tissues. Pollen is produced on male trees, and the seeds are produced on female trees but are not enclosed in a fruit structure. The Gingko biloba are an example of a. gymnosperms. c. aquatic algae. b. angiosperms. d. bryophytes.

ANS: A

DIF: Moderate

REF: 16.3 Green-Fingered Thieves

OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Applying

24. Which of the following is NOT an evolutionary advantage of seed-bearing plants? The plant embryo a. has a supply of stored food to use until it is ready to begin photosynthesis. b. and food supply are encased in a protective covering. c. is protected from drying out and predation. d. will be able to immediately start photosynthesis.

ANS: D DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 25. Which of the following describes the primary evolutionary advantage of producing flowers on a plant? a. Water and minerals are absorbed by the whole plant through the flower. b. Photosynthesis occurs and CO2 is absorbed throughout the entire plant. c. Male and female gametes are brought together for fertilization, enhancing genetic diversity. d. Materials such as cotton and pharmaceuticals are produced for human use.

ANS: C DIF: Moderate REF: 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 26. In the late spring, Miles moves into a new house with a small tree growing in the yard. The flowers on this tree have five white petals tinged with pink. Later in the summer, he notices a small fruit where each of the flowers had bloomed. Miles does not take long to realize this is an apple tree, Malus pumila. This apple tree is a(n) ________ from kingdom Plantae. a. gymnosperm c. bryophyte b. angiosperm d. cycad ANS: B DIF: Moderate REF: 16.3 Green-Fingered Thieves | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 27. Pignoli are pine nuts that have lent themselves to culinary uses as far back as the Roman Empire. Pignoli are naked seeds harvested from the scales of the cones produced by the Italian Stone Pine tree. The Italian Stone Pine and other pine nut–producing trees are ________ from kingdom Plantae. a. gymnosperms c. bryophytes b. angiosperms d. cycads ANS: A DIF: Moderate REF: 16.3 Green-Fingered Thieves | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 28. Basil will produce tiny flowers if it is not kept trimmed back. After these tiny flowers are pollinated, they produce tiny seeds encased in a papery covering. Basil is an example of a a. bryophyte. c. angiosperm. b. fungus. d. gymnosperm.

ANS: C DIF: Moderate REF: 16.3 Green-Fingered Thieves | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying

29. Based upon the evolutionary traits visible in blooming rose bushes in a garden, a reasonable deduction would be that the a. lack of an extensive vascular system means they are bryophytes. b. presence of seeds means they are gymnosperms. c. lack of visible fruit means they are ferns. d. presence of flowers means they are angiosperms.

ANS: D DIF: Moderate REF: 16.3 Green-Fingered Thieves | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 30. Pinus sylvestris, Scotch Pine, is native to Europe and Asia. Most Americans refer to them as ―Christmas trees.‖ This species of tree grows from the naked seeds produced on cones and released about 22–24 months after pollination. This tree is an example of a ________ from kingdom ________. a. gymnosperm; Fungi c. angiosperm; Fungi b. gymnosperm; Plantae d. angiosperm; Plantae ANS: B DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 31. Cycas revoluta and Zamia furfuracea are species of cycads commonly used as ornamental plants in landscaping. Both species can grow fairly large and produce naked seeds on very large and unusual-looking cones made of specialized leaves. Neither of these species produces flowers. These species are examples of a. gymnosperms. c. angiosperms. b. bryophytes. d. ferns.

ANS: A DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Applying 32. In angiosperms the modified leaf evolved into the ovary wall, layers of tissue that enclose and protect the ovules. Once fertilized, these ovules develop into ________ and the ovary wall becomes the fruit wall.

The fruits of many plants provide food for heterotrophs. a. stomata c. cellulose b. seeds d. pollen ANS: B DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 33. Flowers enhance sexual reproduction in plants by providing an avenue for male gametes to unite with female gametes. The drawing below illustrates that the ________ bears the female gamete and the ________ will develop into the fruit.

a. anther; ovule b. stamen; ovary

c. carpel; anther d. ovule; ovary

ANS: D DIF: Difficult REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 34. There are three major groups of fungi: zygomycetes, ascomycetes, and basidiomycetes. These groups are named for their a. modes of obtaining food energy. b. differing abilities to produce mycelia. c. unique reproductive structures. d. ability to photosynthesize carbon compounds.

ANS: C DIF: Easy REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Remembering 35. According to the phylogenetic tree shown below,

a. b. c. d.

ascomycetes are more closely related to zygomycetes than they are to basidiomycetes. basidomycetes are more closely related to zygomycetes than they are to ascomycetes. zygomycetes are more closely related to basidiomycetes than they are to ascomycetes. zygomycetes have an equally close relationship to basidiomycetes and ascomycetes.

ANS: D DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Understanding 36. Like plant cells, all fungal cells have a. a protective cell wall that wraps around the plasma membrane and encases the cell. b. the ability to photosynthesize carbon compounds for energy. c. the ability to store extra food energy in the form of glycogen. d. only a plasma membrane wrapping around the cell for protection.

ANS: A DIF: Easy REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Remembering 37. Truffles are the subterranean fruiting body of a mychorrhizal fungus and usually found in close association with tree roots. The mycelial mat of the truffle a. provides energy-packed sugars to the trees while the tree roots absorb water and minerals from the soil and share them with the truffles. b. absorbs water and minerals from the soil and shares them with the tree while the tree provides energy-packed sugars to the truffles. c. absorbs energy-packed sugars, water, and nutrients from the soil and shares them with the tree roots. d. photosynthesizes sugars and absorbs water and minerals from the soil before sharing these products with the tree.

ANS: B DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Understanding 38. Fungi often form mutualistic relationships with plants. These mutualistic relationships are typically characterized by benefits to a. only the plant. b. only the fungus. c. both the plant and the fungus. d. a third species nearby, but neither the plant nor the fungus benefits.

ANS: C DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Understanding 39. A lichen is a mutualistic association between a fungus and a photosynthetic prokaryote such as a. red algae. c. diplomonads. b. brown algae. d. cyanobacteria.

ANS: D DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Understanding 40. Jim is mowing the lawn and accidently runs over a large round object that seems to explode in a cloud of dust. Upon closer examination, he determines that the object was actually the club-shaped reproductive structure of an organism that has cells with cell walls but no chloroplasts, and the dust particles were actually spores. This organism is probably a ________ that belongs to kingdom ________. a. basidiomycete; Fungi c. zygomycete; Fungi b. ascomycete; Plantae d. basidiomycete; Plantae ANS: A DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment. |

16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 41. Grapes harvested and crushed into juice will often produce a fermented beverage containing alcohol.

Grains (such as wheat, barley, rye, or corn) will also produce an alcoholic beverage if they are soaked and allowed to ferment. Which of the following organisms, naturally present in the environment, is the likely cause of the fermentation? a. angiosperms c. basidiomycetes b. yeasts d. ciliates ANS: B DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 42. Yeasts provide leavening in bread by metabolizing the starches and sugars present in flour. Carbon dioxide bubbles are produced when the ________ present in yeast cells use(s) the sugars for cellular respiration to produce energy for the cell. a. chloroplasts c. mitochondria b. Golgi body d. endoplasmic reticulum ANS: C DIF: Moderate REF: 16.0 Intro | 16.5 Truffle Trouble OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes. | 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Applying 43. Eva returns from her month-long holiday and discovers that she left a loaf of bread sitting on the countertop. The bread is now covered in a fuzzy black, gray, and white coating. Because she’s curious, she decides to take the bread with her to a biology lab and examine a bit of the fluff under the microscope. She sees branching, colorless hair-like threads running throughout the bread and small round black spores over the surface of the bread. This is likely an example of a ________ belonging to kingdom ________. a. green algae; Protista b. basidiomycete; Protista c. diplomonad; Fungi d. zygomycete; Fungi ANS: D DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 44. In the photo below, the plant on the ________ is most likely to be host to mycorrhizal fungi because the ________.

a. left; fungi are obviously stunting its growth b. right; mycelial mat of the fungus is enhancing the supply of water and essential minerals to the plant c. right; mycelial mat of the fungus is photosynthesizing sugars to provide the plant with energy d. left; mycelial mat of the fungus is photosynthesizing toxic sugars and pulling in minerals that are harming the plant ANS: B DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 45. Since ginseng has bright-red seed heads that develop from the flowers after pollination, ginseng is a(n) ________ in the kingdom ________. a. angiosperm; Plantae b. angiosperm; Protista c. gymnosperm; Plantae d. gymnosperm; Protista ANS: A DIF: Easy REF: 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 46. Large sheets of brownish organisms are attached to the seafloor and waving in the surf. These photosynthetic organisms do not have any vascular tissue and do not live on land. These are probably ________ in the kingdom ________. a. ferns; Plantae c. green algae; Plantae b. brown algae; Protista d. bryophytes; Protista ANS: B DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 47. Paramecium caudatum are unicellular organisms with a thick flexible pellicle covered in cilia and two nuclei. They ingest bacteria and other microorganisms in the environment. Paramecium caudatum is a(n) ________ in the kingdom ________. a. algae; Protista b. bryophyte; Plantae c. zygomycete; Fungi d. protozoan; Protista ANS: D DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 48. Diatomaceous earth is used in an amazing variety of ways. It can be a filtration aid in fish tanks, mild abrasive in toothpaste and metal polishes, insecticide, absorptive for liquids, filler in plastics and rubber, kitty litter, porous support for chemical catalysts, stabilizing component of dynamite, and insulation.

This versatile product is actually the fossilized remains of eukaryotic, unicellular, photosynthetic organisms that contained a high amount of silica in their cell walls. These fossilized diatoms were once living examples of ________ from the kingdom ________.

a. b. c. d.

Euglena; Plantae bryophytes; Protista algae; Protista Amoeba; Plantae

ANS: C DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Applying 49. Many of the 7,000 crops cultivated or collected by humans for food contain seeds encased in a fruit like the one seen in the image below. These types of crops are ________ in kingdom ________.

a. b. c. d.

angiosperms; Plantae angiosperms; Protista gymnosperms; Plantae gymnosperms; Protista

ANS: A DIF: Moderate REF: 16. Infographic | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding | Applying 50. Five cereal crops provide 60 percent of the food energy taken in by the world’s human population. These cereals (grains) are rice, maize, wheat, millet, and sorghum. The portion of these crops consumed by humans is actually the seed with its protective coverings from the fruit. These crops are ________ in kingdom ________. a. gymnosperms; Protista b. bryophytes; Plantae c. angiosperms; Plantae d. ferns; Protista ANS: C DIF: Moderate REF: 16. Infographic | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. | 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding | Applying

COMPLETION 1. The diameter of a eukaryotic cell is typically ________ than that of a prokaryotic cell.

ANS: greater larger DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering

2. Lipids and hormones are manufactured within the eukaryotic cell’s ________.

ANS: smooth endoplasmic reticulum DIF: Easy REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Remembering

3. Prokaryotes and some eukaryotes reproduce through a type of ________ reproduction known as binary fission. This occurs when a cell splits into two genetically identical cells.

ANS: asexual DIF: Easy REF: 16.2 Two Cells Are Better Than One OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding 4. There are two broad categories within kingdom Protista. The ________ are motile and heterotrophic.

The algae are photosynthetic and may or may not be motile.

ANS: protozoans DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Remembering 5. Some protozoa move and obtain food using shape-changing, cellular projections called ________.

ANS: pseudopodia DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Remembering 6. The amoeba pictured below uses the food vacuoles to ________ its food.

ANS: digest DIF: Easy REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Remembering 7. The first land plant with a vascular system was the ancestor of present-day ________.

ANS: ferns DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Remembering

8. The first plants to evolve the seed were ________.

ANS: gymnosperms DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Remembering

9. The key evolutionary innovation in ________ is the flower.

ANS: angiosperms DIF: Easy REF: 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Remembering

10. Fungi digest organic material outside the body and absorb the breakdown products. Thus, fungi are ________.

ANS: absorptive heterotrophs DIF: Easy REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Remembering 11. Single-celled species of fungi are typically referred to as ________.

ANS: yeasts DIF: Easy

REF: 16.5 Truffle Trouble

OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Remembering 12. Fungi are similar to animals in that they store surplus food energy in the form of ________.

ANS: glycogen DIF: Easy REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Remembering 13. The international Union for Conservation of Nature announced that 31 percent of cactus species, renowned for their unique forms and beautiful________, are in danger of extinction.

ANS: flowers DIF: Easy REF: 16.6 Fighting for the Future OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Remembering

14. According to the infographic shown below, ninety-five percent of the food energy taken in by the world’s human population is provided by ________ crops in kingdom ________.

ANS: thirty; Plantae 30; Plantae DIF: Easy REF: 16. Infographic OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding SHORT ANSWER

1. Explain how the compartmentalization of eukaryotic cells enables them to have a much greater cell volume than prokaryotes and still efficiently carry out cell functions and move materials in and out of the cell.

ANS: The compartmentalization of eukaryotic cells by organelles and membranes helps these large cells to efficiently carry out cellular processes such as respiration, photosynthesis, digestion, and the elimination of cellular waste. The compartments, or organelles, and membranes keep the chemicals needed for cellular processes isolated from each other and from the cell’s cytoplasm. The network of membranes within the cell facilitates communication and movement of materials throughout the large cell. The large cell size makes it possible for some eukaryotic cells to engulf their food source, package it into a vesicle for digestion, and then package the waste into a vesicle that will carry it to the cell membrane to be disposed.

DIF: Difficult REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Applying

2. Compare and contrast prokaryotes and eukaryotes.

ANS: Prokaryotes are much smaller and simpler than eukaryotes. While there are some general structures common to both cell types (cell wall, plasma membrane, ribosomes, flagella, and cilia), there are other structures present in eukaryotic cells but not prokaryotic cells. Eukaryotic cells house their DNA within a membrane-bound nucleus, and many of the chemical processes and activities needed to sustain life are carried out within specialized, membrane-bound organelles (endoplasmic reticulum, Golgi body, mitochondria, chloroplasts, vacuoles, and lysomes).

DIF: Moderate REF: 16.0 Intro OBJ: 16.1 Compare and contrast prokaryotes and eukaryotes.

MSC: Understanding

3. What is distinctive about how the members of kingdom Protista are grouped together? How is this different from the way other eukaryotic kingdoms are composed?

ANS: All members of kingdom Protista are eukaryotic. Some members are multicellular associations, but most are unicellular. Protists are different sizes, different shapes, and obtain their nutrients in a variety of ways. They are grouped into this kingdom because they do not cleanly fit into any other kingdom. This is unusual because organisms are assigned to the other eukaryotic kingdoms (Plantae, Fungi, Animalia) based upon characteristics that make them similar to each other.

DIF: Moderate REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Understanding 4. Examine the phylogenetic tree below and explain whether the red, green, and brown algae are equally related and why.

ANS: This tree indicates that the red and green algae are more closely related to each other than either is related to the brown algae. According to this tree, the red and green algae share a recent common ancestor. The ancestor common to all three organisms is two levels back from the red and green algae and three levels back from the brown algae. So, they are not all equally related.

DIF: Difficult REF: 16.1 Peculiar Protists OBJ: 16.2 Explain what is distinctive about the kingdom Protista.

MSC: Evaluating 5. Explain the advantage afforded to plants with the evolution of roots with vascular tissues.

ANS: The evolution of roots with vascular tissues made it possible for plants to grow larger on land. The plants no longer needed to absorb water and minerals through all of their surfaces or die from dehydration. The roots could now absorb water and minerals from the soil while providing support and a solid point of attachment to the land.

DIF: Moderate REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Applying

6. Explain why the evolution of sexual reproduction in aquatic algae would significantly increase the chances of plant diversity on land.

ANS: Sexual reproduction promotes genetic diversity in the organisms that have evolved to reproduce this way. The greater the genetic diversity within any population, the greater chance there are organisms in that population that will have traits that provide the organism with an advantage to grow and reproduce in new or changing environments. Even the first, very simple plants were capable of sexual reproduction. Now plants had the potential to adapt to the changing terrestrial landscapes.

DIF: Difficult REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Applying

7. Propose an explanation for how the evolution of lignin in cell walls led to the evolution and growth of the gymnosperms known as giant redwood trees.

ANS: The cell walls of land plants were originally made of cellulose like those of green algae in the protist kingdom. Plants with the ability to produce and incorporate lignin in their cell walls had stronger cell walls and could grow taller with a solid, rigid network of connected cell walls. Taller plants might have had an advantage getting sunlight. As some of these taller plants evolved the production of pollen, they would have had a reproductive advantage of being able to spread their genes far and wide in the wind.

Gymnosperms, such as the redwood trees, were the first to evolve pollen.

DIF: Difficult REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Evaluating

8. Propose an explanation for how the evolution of flowers contributed to the global distribution and awe-inspiring variety of angiosperms.

ANS: The flowers characteristic of angiosperms facilitate sexual reproduction by providing a meeting place for male and female gametes. There is a nearly endless variety of floral shapes, colors, and scents attracting pollinators that carry the pollen to other plants; this promotes increased genetic diversity in the population. The greater the genetic diversity in the population, the more likely there is a portion of the population able to thrive and reproduce in new conditions. Additionally, the flowers develop into fruit with seeds. Some types of fruit are consumed by animals who then deposit the seeds in distant locations.

All of this contributes to the global distribution and variety of angiosperms.

DIF: Difficult REF: 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Evaluating

9. Correctly use the terms ―fruiting body,‖ ―hypha (hyphae),‖ ―mating type,‖ ―mycelium (mycelia),‖ and ―sexual spores‖ to describe the life cycle of a fungus.

ANS: A fruiting body is produced after two mating types of a particular fungus successfully mate (exchange genetic material). This fruiting body now produces sexual spores that can survive for a long time in a dormant state waiting for favorable conditions to sprout. As they sprout, they grow into new hyphae. A cluster of these hyphae is known as a mycelium. The mycelium will be one particular mating type; if it encounters a different mating type from the same species, the two mating types can sexually produce new spores. Not all spores are sexually produced spores.

DIF: Moderate REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Understanding

10. Explain why/how fungal body form often makes fungi good decomposers.

ANS: The branching hair-like threads of hyphae increase the surface area of the fungus; they are also capable of growing/penetrating into the structures of dead organisms. As the hyphae grow through the dead material, they excrete chemicals that digest the dead material. The fungal hyphae then absorb some of the nutrients for energy. The rest of the nutrients remain in the soil or environment to be absorbed by plants and algae.

DIF: Difficult REF: 16.5 Truffle Trouble OBJ: 16.4 Connect structure and function in how fungi obtain energy from the environment.

MSC: Applying 11. How does the key evolutionary innovation of angiosperms contribute to the successful domestication of plants for crops to feed the world’s human population?

ANS: The key evolutionary innovation of angiosperms is the flower. Flowers provide an environment for sexual reproduction by bringing together male gametes (sperm cells in pollen) and female gametes (egg cells in ovules). This ability to exchange genetic information between different individuals of the same species provides farmers the opportunity to select, breed, and reproduce crops based on their desirable traits. Farmers have domesticated crops by fertilizing desired plants with pollen from plants that are hearty and easier to grow or produce better-tasting, more nutritious food. These plants are eaten and their seeds used to grow the next generation of plants to feed the world’s population.

DIF: Difficult REF: 16. Infographic OBJ: 16.3 Outline the key evolutionary innovations of plants.

MSC: Evaluating

12. How does the environment benefit when plant and fungi species are protected from extinction?

ANS: Plants and fungi are integral components of a healthy ecosystem. Plants can help regulate temperature, create oxygen, and provide food for animals. Fungi help break down dead plants and animals and return their nutrients to the soil.

DIF: Moderate REF: 16.5 Truffle Trouble | 16.6 Fighting for the Future OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding

MATCHING Match each correct evolutionary trait to the indicated box.

a. b. c. d.

1.

2.

3.

4.

A B C D

flowers evolve adaptation to terrestrial seeds evolve vascular tissue evolves

1. ANS: D DIF: Easy REF: 16.3 Green-Fingered Thieves | 16.4 Searching for Flowers OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 2. ANS: A DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 3. ANS: C DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding 4. ANS: B DIF: Easy REF: 16.3 Green-Fingered Thieves OBJ: 16.3 Outline the key evolutionary innovations of plants. MSC: Understanding Match these organisms to the correct taxonomic grouping(s). a. brown algae b. liverworts and mosses c. Streptococcus thermophilus (bacteria used in making yogurt) d. zygomycetes (molds) 5.

6.

7.

8.

domain Bacteria domain Eukarya, kingdom Protista domain Eukarya, kingdom Plantae domain Eukarya, kingdom Fungi

5. ANS: C DIF: Easy REF: 16.1 Peculiar Protists |16.3 Green-Fingered Thieves |16.5 Truffle Trouble OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding 6. ANS: A DIF: Easy REF: 16.1 Peculiar Protists |16.3 Green-Fingered Thieves |16.5 Truffle Trouble OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding

7. ANS: B DIF: Easy REF: 16.1 Peculiar Protists |16.3 Green-Fingered Thieves |16.5 Truffle Trouble OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding 8. ANS: D DIF: Easy REF: 16.1 Peculiar Protists |16.3 Green-Fingered Thieves |16.5 Truffle Trouble OBJ: 16.5 Identify the key characteristics and give an example organism for each kingdom covered in this chapter.

MSC: Understanding

Chapter 17: Animals and Human Evolution MULTIPLE CHOICE 1. The correct two-word Latin scientific name for modern humans is a. Homo sapiens. c. homo sapiens. b. Homo neanderthalensis. d. homo neanderthalensis.

ANS: A DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 2. Which of the following could NOT be used to describe humans? a. eutherian c. primate b. mammal d. marsupial ANS: D DIF: Easy REF: 17.1 Animal Kingdom | 17.2 Mammals R Us OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates. | 17.3 Compare and contrast the three types of mammals.

MSC: Understanding 3. The first vertebrates to evolve lacked jaws and had skeletons made from a strong flexible tissue called cartilage. As shown in the figure below, ________ are a modern example of this ancient group of vertebrates known as jawless fishes.

a. Amphibians b. Reptiles

c. Ray-finned fishes d. Lampreys

ANS: D DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Understanding 4. The phylum Chordata includes several subgroups of organisms. To which of these subgroups would humans belong? a. vertebrates c. urochordates b. cephalochordates d. monotremes ANS: A DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Applying 5. Rafael is relaxing on the veranda of his beachfront home on the Gulf of Mexico when he notices a small (about 5 inches long) green quadruped clinging to the ceiling. As it begins to run down the wall, he catches it and notices that it is covered with dry scales, has a long tail, and has specialized toe pads that allow it to stick to surfaces. According to the figure below, this animal most likely belongs to which class?

a. Mammalia b. Amphibia

c. Reptilia d. Osteichthyes

ANS: C DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Applying 6. Which of the groupings of animals shown in the figures below are MOST closely related to each other?

a. starfish, butterflies, lizards b. frogs, goldfish, birds

c. bats, kangaroos, elephants d. lemurs, chimps, humans

ANS: D DIF: Difficult REF: 17.1 Animal Kingdom | 17.2 Mammals R Us OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Analyzing 7. According to the phylogenetic tree below, which of the groups of animals listed would display radial symmetry?

a. flatworms b. nematodes

c. cnidarians d. arthropods

ANS: C DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Understanding 8. Which of the following organisms displays bilateral symmetry? a. sponges c. bees b. jellyfish d. amoeba ANS: C DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Understanding 9. Which of the following organisms displays radial symmetry? a. flatworm c. spider b. sea anemone d. human ANS: B DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Understanding 10. Which of the following is an example of the last segment of an arthropod’s body having evolved into a beneficial trait? a. human thorax with an arm b. bird thorax with a wing c. lizard abdomen with a leg d. wasp abdomen with a stinger ANS: D DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Applying 11. Based on the image below, which of the following identify the body segments of lobster?

a. b. c. d.

head, thorax, abdomen vertebrae, notochord, cartilage claws, walking legs, swimming legs tail segments, antennae, eyes

ANS: A

DIF: Moderate

REF: 17.1 Animal Kingdom

OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Applying 12. Damien is camping in the south central United States when he happens across an animal with several ―armored‖ plates covering its back and shoulders. The plates are bony and separated by thin bands of flexible skin. The belly of this short-legged quadruped is covered with skin and soft fur. He also notices four young ones scurrying along behind the adult. This animal is most likely a(n) a. eutherian mammal. c. marsupial mammal. b. marsupial amphibian. d. eutherian reptile.

ANS: A DIF: Difficult REF: 17.1 Animal Kingdom | 17.2 Mammals R Us OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates. | 17.3 Compare and contrast the three types of mammals.

MSC: Applying 13. Echidnas are spiny animals named after a character in Greek mythology who was half woman and half snake and perceived to have characteristics of both. Echidnas are covered in coarse hair or spines, they lay eggs, and the poorly developed young quickly attach to the mother’s mammary glands after they hatch. Echidnas are a. marsupials. c. hominins. b. monotremes. d. eutherians.

ANS: B DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals. MSC: Applying 14. Baleen whales are large ocean-dwelling animals once hunted for their modified hair, baleen. The young are fully developed at birth and nurse on their mother’s mammary glands. Baleen whales are a. monotremes. c. eutherians. b. hominins. d. marsupials.

ANS: C DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals. MSC: Applying 15. Possums are found throughout much of Central and North America. Although their bodies are covered in hair, their tails and ears are hairless. They have many teeth and opposable clawless ―thumbs‖ on their rear appendages. They produce poorly developed young that live in mom’s pouch for about two and a half months before climbing on her back. Possums are a. eutherians. c. monotremes. b. primates. d. marsupials.

ANS: D DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals. MSC: Applying 16. The development of upright posture in hominins is likely an adaptation for a. living on the ground instead of in the trees. b. living on land instead of on the water. c. no longer needing to carry tools. d. having no functional knees.

ANS: A DIF: Easy REF: 17.2 Mammals R Us | 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Understanding 17. Which of the following is an advantage of bipedalism in hominins? a. Standing on two feet makes it easier to climb trees. b. Standing on four feet elevates the head, making it easier to see over obstacles and to see

farther to allow earlier detection of predators. c. Walking on two feet requires more muscle groups and more energy than walking on all fours. d. The hands are free to carry food, tools, and weapons.

ANS: D DIF: Easy REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 18. All primates have opposable thumbs. This means the thumbs can be touched a. together. b. to each of the other fingers on the opposite hand. c. to each of the other fingers on the same hand. d. to each of the toes on both feet.

ANS: C DIF: Easy REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Understanding 19. According to the evolutionary tree shown below, when did hominins branch away from the other apes?

a. 35 mya b. 12–16 mya

c. 7–8 mya d. 5–7 mya

ANS: D DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 20. Which of the following is a feature of hominins that helps to distinguish them from other apes? a. quadrupedal walking c. opposable big toe b. upright posture d. face pulled forward

ANS: B DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Remembering 21. Which of the following traits was likely deleterious for early hominins? a. a large brain compared to body size b. bipedal walking c. a pronounced arch and heel in the foot d. an opposable big toe on the foot ANS: D DIF: Moderate REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 22. Which of the following anatomical changes was an especially important contributor to the development of full bipedalism in hominins? a. face pulled forward with spinal cord entering rear of skull b. gain of opposable big toes c. restructuring of the pelvis accompanied by a change in the angle of knee joints that support body weight d. having no arch in the foot ANS: C DIF: Moderate REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Understanding 23. Fossilized foot bones show that some hominids living between 3 and 3.5 mya walked upright but had partially opposable big toes. This suggests that a. the shift to bipedalism was not sudden and complete, and the earliest bipedal hominins may have also spent some time in the trees for shelter or to find food. b. the shift from quadrupedalism to bipedalism happened abruptly about 2.5 mya when hominins could no longer find any food in trees. c. hominins actually shifted from bipedalism to quadrupedalism, as it proved to be an advantage when acquiring food. d. having a partially opposable big toe helped bipedal hominins run faster to avoid their predators.

ANS: A DIF: Difficult REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Analyzing 24. The positioning of the toe indicated by the arrow in the figure below suggests that the animal with this fossil hominid foot

a. b. c. d.

most likely always traveled on four feet. most likely spent all of its time swinging in the trees. traveled mostly on four feet but also spent a great deal of time swinging in the trees. probably walked upright on two feet and may have spent time in trees.

ANS: D DIF: Difficult REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 25. An archaeological dig in Africa discovers a collection of stone tools along with several skeletons in a cave. These bipedal skeletons date to about 3.5 million years ago and show no evidence of a partially opposable toe. Measurements indicate the brains would have been a little less than a third of the volume of modern humans. The teeth found on these skeletons look more like those of an ape than those of a human. This skeletal discovery is most likely which of the following? a. Sahelanthropus tchadensis c. Australopithecus afarensis b. Ardipithecus ramidus d. Homo erectus ANS: C DIF: Difficult REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 26. Examine the skulls shown in the figure below. What can be said regarding trends in braincase size and teeth over time?

a. Older hominin fossils have larger braincases and generally smaller, more humanlike teeth. b. More recent hominin fossils have larger braincases and generally smaller, more humanlike teeth. c. More recent hominin fossils have smaller braincases and generally larger, more apelike teeth. d. There is no apparent change in braincase size or size and structure of the teeth in hominins.

ANS: B DIF: Moderate REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 27. How is mitochondrial DNA inherited in humans? a. All mitochondrial DNA is inherited from the mother. b. Fifty percent of mitochondrial DNA is inherited from the mother and 50 percent from the father. c. All mitochondrial DNA is inherited from the father. d. Only 75 percent of mitochondrial DNA is inherited from the father; the other 25 percent is inherited from the mother.

ANS: A DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Remembering 28. How is nuclear DNA inherited? a. All nuclear DNA is inherited from the father’s ancestral line. b. Seventy-five percent of nuclear DNA is inherited from the mother’s ancestral line and 25 percent from the father’s ancestral line. c. All nuclear DNA is inherited from the mother’s ancestral line. d. Fifty percent of nuclear DNA is inherited from the mother’s ancestral line and 50 percent from the father’s ancestral line.

ANS: D DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Remembering 29. Which of the following best describes the source of a human’s mitochondrial DNA? a. All is inherited from the mother. b. All is inherited from the father.

c. Half is inherited from the mother and half from the father. d. Seventy-five percent is inherited from the mother and 25 percent from the father.

ANS: A DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Understanding 30. Which of the following best describes the source of a human’s DNA? a. All is inherited from the mother. b. All is inherited from the father. c. Half is inherited from the mother and half from the father. d. Seventy-five percent is inherited from the mother and 25 percent from the father.

ANS: C DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Understanding 31. Eggs provide ________ to the zygote. a. both nuclear and mitochondiral DNA b. only nuclear DNA

c. only mitochondiral DNA d. no DNA

ANS: A DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Remembering 32. Sperm provide ________ to the zygote. a. both nuclear and mitochondiral DNA b. only nuclear DNA c. only mitochondiral DNA d. no DNA ANS: B DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Remembering 33. The hypothesis that Neanderthals evolved sometime after hominins migrated out of Africa would be supported by the presence of Neanderthal DNA in the a. mitochondria of modern African humans. b. genomes of modern African humans. c. genomes of modern humans in all ethnic groups except for those of Africans. d. genomes of Australopithecus africanus.

ANS: C DIF: Moderate REF: 17.4 Hominins United | 17.5 All in the Family OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. | 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Understanding 34. If a female’s mitochondrial DNA was sequenced and compared to the sequence of mitochondrial DNA isolated from her mother’s paternal grandmother (the mother of her mom’s dad), she likely ________be a significant match because ________. a. would not; a person’s mitochondrial DNA is inherited from her mom who inherited it from her mom b. would not; a person’s mitochondrial DNA is inherited from her dad who inherited it from his mom c. would; a person inherits her mitochondrial DNA from her dad who inherited it from his

mom d. would; a person inherits her mitochondrial DNA from her mom who inherited from her dad ANS: A DIF: Difficult REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Analyzing 35. DNA from a fossil is found, and it is hypothesized that the mother was a Neanderthal and the father was a human. Which of the following would support this hypothesis? a. finding discernable amounts of nuclear Neanderthal and human DNA but no mitochondrial Neanderthal DNA b. finding discernable amounts of mitochondrial and nuclear Neanderthal DNA along with nuclear human DNA c. finding significant amounts of human mitochondrial and nuclear DNA along with some nuclear Neanderthal DNA d. finding all of the nuclear DNA to be Neanderthal and all of the mitochondrial DNA to be human ANS: B DIF: Difficult REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Analyzing 36. The infamous American outlaw Jesse Woodson James died April 3, 1882. His body was originally interred on the James’ farm but was later moved to Mt. Olivet Cemetery in Kearney, Nebraska. Some people have hypothesized that his death was staged. Researchers have exhumed the body and analyzed mitochondrial DNA found in the teeth with that of mitochondrial DNA from hair samples from the James’ farm burial site; they matched. These samples were then compared to the mitochondrial DNA of Jesse’s sister Susan’s great-grandson and her great-great-grandson. The hypothesis that the body buried in Mt. Olivet Cemetery is not Jesse James would be supported if the mitochondrial DNA from the grave a. matches the mitochondrial DNA obtained from Susan’s great-grandson and great-great-grandson. b. does not match the mitochondrial DNA obtained from Susan’s great-grandson and great-great-grandson. c. matches Susan’s mitochondrial DNA. d. matches not only the mitochondrial DNA obtained from Susan’s great-grandson and her great-great-grandson but also the mitochondrial DNA from Susan’s daughter.

ANS: B DIF: Difficult REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Analyzing 37. In 2010, Dr. Svante Pääbo published research indicating that all modern ethnic groups, other than Africans, carry traces of Neanderthal DNA in their nuclear genomes. His earlier work indicated no overlap between Neanderthal mitochondrial DNA and that of Homo sapiens. Which of the following is NOT a likely possible hypothesis that could be supported by this information? a. The shared nuclear DNA could be a remnant of DNA from a common ancestor shared by Neanderthals and Homo sapiens. b. The shared nuclear DNA could be the result of interbreeding between male Neanderthals and female Homo sapiens. c. The shared nuclear DNA could be a remnant of DNA from Homo erectus, one of the most recent species since Australopithecus. d. The shared nuclear DNA is definitely the result of interbreeding between female Neanderthals and male humans.

ANS: D

DIF: Difficult

REF: 17.4 Hominins United | 17.5 All in the Family

OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. | 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Evaluating 38. Fossil evidence indicates that the first members of the genus Homo arose in Africa approximately ________ years ago. a. 2 to 3 million c. 500,000 b. 200,000 d. 1 million ANS: A DIF: Easy REF: 17.4 Hominins United OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Remembering 39. Examine the Hominin evolutionary tree below. Which of the following are MOST closely related?

a. b. c. d.

Homo habilis and Homo sapiens Homo erectus and Homo sapiens Australopithecus africanus and Homo habilis Australopithecus afarensis and Homo habilis

ANS: B DIF: Moderate REF: 17.3 Rise of the Apes OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Applying 40. Evidence indicates that archaic Homo sapiens gave rise to which of the following? a. Homo habilis and Homo neanderthalensis b. modern humans and Homo habilis c. modern humans and Homo neanderthalensis d. Homo rudolfensis and Homo neanderthalensis ANS: C DIF: Moderate REF: 17.5 All in the Family OBJ: 17.4 Interpret an evolutionary tree of the primates. |17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Remembering 41. Is it possible for Homo sapiens and Neanderthals to be related even if humans are not the direct descendants of Neanderthals? a. No, because this would mean there is no connection at all between humans and Neanderthals.

b. No, because the evolution of humans is clearly linear. c. Yes, but only because humans and Neanderthals commonly interbred. d. Yes, because humans and Neanderthals share a common ancestor.

ANS: D DIF: Moderate REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Understanding 42. Fossilized hominin bones have been found in Germany along with some tools and evidence of charred and fossilized bones from large animals dating to about 350,000 years ago. The hominin bones bear resemblance to both Homo erectus and Homo sapiens. Which of the following is the MOST likely possible identity of these fossils? a. Australopithecus anamensis c. Paranthropus boisei b. Homo habilis d. archaic Homo sapiens ANS: D DIF: Moderate REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Applying 43. Fossils from different species of the genus Homo dating from 1.7–1.9 mya have been found in ecologically diverse areas across central Asia, China, and Indonesia. These species appear to be closely related to Homo erectus. Which of the following is a likely explanation of these findings? a. Homo erectus migrated across the Asian continent and expanded into a new ecological role.

These groups became increasingly reproductively isolated from other Homo erectus groups and eventually formed new species in the genus Homo. b. Homo sapiens migrated across the Asian continent and expanded into a new ecological role.

These groups became increasingly reproductively isolated from other Homo sapien groups and eventually formed new species in the genus Homo that were more like Homo erectus and less like Homo sapiens. c. Homo floresiensis migrated across the Asian continent and expanded into a new ecological role. These groups became increasingly reproductively isolated from other Homo floresiensis groups and eventually formed new species in the genus Homo that were more like Homo erectus and less like Homo floresiensis. d. Homo neanderthalensis migrated across the Asian continent and expanded into a new ecological role. These groups became increasingly reproductively isolated from other Homo neanderthalensis groups and eventually formed new species in the genus Homo that were more like Homo erectus and less like Homo neanderthalensis.

ANS: A DIF: Difficult REF: 17.5 All in the Family OBJ: 17.4 Interpret an evolutionary tree of the primates. | 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Applying 44. It is possible that modern humans may have comingled with which of these other ancestors? a. Paranthropus aetheopicus b. Homo neanderthalensis c. Australopithecus africanus d. Australopithecus afarensis ANS: B DIF: Easy REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Understanding

45. When researchers determined that the jawbone of an Italian Neanderthal dating to around 43,000– 45,000 years ago showed the presence of an intermediate chin and mitochondrial Neanderthal DNA, they hypothesized that the jawbone belonged to an individual who was the product of a mating between a modern human and a Neanderthal. This hypothesis would be further supported if the fossil had a. Neanderthal and Homo sapiens genomic DNA. b. only Neanderthal mitochondrial and genomic DNA. c. only Neanderthal genomic DNA. d. both Neanderthal and Homo habilis genomic DNA. ANS: A DIF: Moderate REF: 17.4 Hominins United | 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Applying 46. When researchers found a fossilized jawbone from a late (about 43,000–45,000 years ago) Italian Neanderthal, they noted that the shape of the jawbone suggested the individual had an intermediate chin instead of no chin like most Neanderthals. This would provide evidence supporting which of the following hypotheses? a. Homo habilis and Homo neanderthalensis successfully bred with each other while both were present in central Africa. b. Homo habilis and Homo neanderthalensis successfully bred with each other while both were present on the Italian peninsula of Europe. c. Modern Homo sapiens and Homo neanderthalensis successfully bred with each other while both were present on the Italian peninsula of Europe. d. Modern Homo sapiens and Homo neanderthalensis successfully bred with each other while both were present in central Africa.

ANS: C DIF: Difficult REF: 17.4 Hominins United | 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Analyzing 47. Consider that fossils of Homo erectus dating between 1.66 and 1.85 mya have been found scattered across Eastern Europe through China and Southeast Asia and dating back to 2.4 mya in Africa. The earliest known specimens of anatomically modern Homo sapiens in Africa date back to roughly 200,000 years ago and 40,000 to 60,000 years ago across Europe and Asia, with some at 115,000 years ago in India. Additionally, Homo neanderthalensis was present across Europe by 150,000 years ago and then spread into western Asia. If there were no evidence indicating the presence of any other early Homo species in Europe, which of the following hypotheses might be supported by this information? a. Homo neanderthalensis is a possible common ancestor to Homo erectus and Homo sapiens. b. Homo erectus is a possible common ancestor to Homo neanderthalensis and Homo sapiens. c. Homo sapiens is a possible common ancestor to Homo erectus and Homo neanderthalensis. d. Homo floresiensis is the most likely common ancestor to Homo erectus, Homo neanderthalensis, and Homo sapiens.

ANS: B DIF: Difficult REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Analyzing 48. You are a researcher excavating a site in a cave in Israel. There are many layers of sediment and primitive artifacts (flint tools for cutting and scraping) from ancestral Homo species within the cave. As you work your way deeper and deeper through the layers, you notice that artifacts in the deeper layers (laid before 350,000 years ago) do not show any signs of having been exposed to fire. Artifacts in layers less than 350,000 years ago show rapidly increasing evidence of exposure to fire. Your colleagues working in nearby caves and caves scattered around the eastern Mediterranean Sea have found similar evidence dating in the same time frames. The evidence is also consistent with that of European sites.

What does this suggest about the use of fire by ancestral humans?

a. Ancestral humans could not have migrated into climates cooler than those found in Africa until about 150,000 years ago because they had not yet figured out how to use fire before that time. b. Ancestral humans (about 200,000 years ago) were simply using fire they obtained from lightning-sparked wildfires; they did not make or maintain their own fires. c. Ancestral humans who had migrated to areas around the eastern Mediterranean Sea and Europe very likely learned to control and use fire around the same time (about 300,000 to 350,000 years ago), and they became increasingly good at it. d. The hominins occupying the caves, making and using fire, must have been modern Homo sapiens because no other human ancestors were still surviving 300,000–350,000 years ago and no other human ancestors were ever able to use fire.

ANS: C DIF: Difficult REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Evaluating 49. Which of the following is the strongest evidence that suggests Homo sapiens may have intermingled with other species such as H. heidelbergensis and H. neanderthalensis? a. Evidence of DNA shared between the species would suggest that they may have intermingled with each other. b. Fossils from all or some of these Homo species dating to the same time period and found in overlapping geographic areas would suggest that they may have intermingled with each other. c. Fossils from all or some of these Homo species found in overlapping geographic areas as well as evidence of DNA shared between the species would suggest that they may have intermingled with each other. d. Fossils from all or some of these Homo species dating to the same time period and found in overlapping geographic areas, showing phenotypes intermediate to at least two of the other species as well as evidence of DNA shared between the species, would suggest that they may have intermingled with each other.

ANS: D DIF: Easy REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Applying 50. In light of the out-of-Africa hypothesis, which of the following is a parsimonious reason why species like Homo neanderthalensis, Homo floresinensis, and Homo erectus do not exist today? a. Modern Homo sapiens outcompeted and replaced other hominin species as they migrated around the world. b. Extensive gene flow between human populations led to a blending of traits that resulted in the evolution of Homo sapiens. c. As modern Homo sapiens developed new and more accurate hunting skills, they were able to hunt other hominin species to extinction. d. Climate change in Africa caused the extinction of all hominin populations except for the ones that gave rise to modern Homo sapiens.

ANS: A DIF: Moderate REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Analyzing

51. Consider that fossils of Homo erectus dating between 1.66 and 1.85 mya have been found scattered across Eastern Europe through China and Southeast Asia and dating back to 2.4 mya in Africa. The earliest-known specimens of anatomically modern Homo sapiens in Africa date back to roughly 200,000 years ago and 40,000 to 60,000 years ago across Europe and Asia, with some at 115,000 years ago in India. Additionally, Homo neanderthalensis was present across Europe by 150,000 years ago and then spread into western Asia. Concerning the out-of-Africa hypothesis, this suggests that a. hominins migrated north from Africa, spreading out across Europe and Asia three times. b. hominins migrated north from Africa, spreading out across Europe and Asia at least twice. c. there was only one major migration of hominins out of Africa. d. there must have been at least seven major migrations of hominins out of Africa.

ANS: B DIF: Moderate REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Analyzing 52. Which of the following organisms are extant eutherian mammals and most closely related to humans? a. chimpanzees c. zebra fish b. mice d. platypuses ANS: A DIF: Moderate REF: 17. Infographic OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates. | 17.3 Compare and contrast the three types of mammals.

MSC: Understanding | Applying COMPLETION 1. All chordates have a dorsal ________, a flexible rod along the center of the body that is critical for development.

ANS: notochord DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 2. In vertebrates, the dorsal notochord has evolved to become the cushioning discs between ________, the strong, hollow sections of the backbone.

ANS: vertebrae DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 3. An animal that can be divided by just one vertical plane into two halves that mirror each other displays ________ symmetry.

ANS: bilateral DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Remembering

4. If an animal’s body can be sliced symmetrically along any number of vertical planes passing through the center of the animal, this displays ________ symmetry.

ANS: radial DIF: Easy REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Remembering 5. Egg-laying mammals that lack a placenta are ________.

ANS: monotremes DIF: Easy REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals.

MSC: Remembering

6. Humans and polar bears are examples of ________, mammals that nourish their developing offspring through a well-developed placenta prior to birth.

ANS: eutherians DIF: Easy REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals.

MSC: Remembering

7. Members of the ―human‖ branch of the ape family, including modern humans as well as our extinct relatives, are properly referred to as ________.

ANS: hominins DIF: Easy REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Remembering

8. Humans did not evolve from chimpanzees. Humans and chimpanzees share a ________.

ANS: common ancestor DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Understanding

9. All of your mitochondrial DNA was inherited from your ________.

ANS: mother DIF: Easy REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Remembering 10. The fossil record indicates that the first Homo sapiens originated between 400,000 and 300,000 years ago. Homo erectus, who had a brain larger than Homo habilis and a skull more similar to H. sapiens, probably migrated from Africa about 2 mya. The fact that these species often existed in the same locations at the same time and their fossils share certain characteristics while displaying some intermediate characteristics suggests that these prehistoric ________ species may have reproduced with each other.

ANS: hominin DIF: Moderate REF: 17.4 Hominins United OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Understanding 11. Fossil evidence from around the world indicates that anatomically modern humans first evolved in Africa about 195,000–200,000 years ago from a population of archaic Homo sapiens and then successfully migrated to and inhabited almost all continents by 13,000 years ago. During literally tens of thousands of years, modern humans lived alongside other ________ genera, eventually replacing them.

ANS: Homo DIF: Moderate REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Understanding 12. The DNA compared across species in this infographic is ________ DNA.

ANS: nuclear DIF: Moderate REF: 17. Infographic | 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Applying SHORT ANSWER

1. Between annelids, chordates, cnidarians, echinoderms, and nematodes, which two groups of organisms are most closely related? Support your answer with information from the phylogenetic tree below.

ANS: Echinoderms and chordates are the two that are most closely related. These two groups share a recent common ancestor that had a notochord. Nematodes are at least two common ancestors away from echinoderms and chordates and do not have a notochord. While annelids share the trait of bilateral symmetry with nematodes, echinoderms, and chordates, the annelids are at least five common ancestors away from all of these groups. Cnidarians are at least four common ancestors away from the other four groups.

DIF: Difficult REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Analyzing 2. Compare and contrast amphibians with reptiles and birds using the phylogenetic tree shown below.

ANS: Amphibians, reptiles, and birds all have four limbs. The fact that reptiles and birds not only have an amniotic egg (making it possible for them to complete their life cycles on land) but that they also have scales sets them apart from amphibians.

DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Understanding 3. How might being bilaterally symmetrical be an evolutionary advantage for a fish?

ANS: Most bilaterally symmetrical animals like fish have nearly identical body parts on each side of their bodies. This facilitates movement in these animals. Fish typically have paired fins on either side of their bodies; this arrangement of fins helps them swim faster and maneuver efficiently. They are better at chasing down their food and better at evading their predators. Therefore, they have the evolutionary advantage of being more likely to survive to pass their genes along to the next generation.

DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Applying 4. Explain segmentation and its significance for an animal such as a lobster.

ANS:

Segmentation in animals occurs when their body plans include repeated segments or units. Specialized appendages with diverse functions often originate in pairs from specific segments of an animal’s body.

An example of this would be the claws, walking legs, swimming legs, and tail segments of the lobster.

The different types of legs and tail segment give the lobster the ability to move efficiently in its environment, while the claws provide defense and eating abilities; all of this helps the lobster survive.

DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.2 Explain the significance of symmetry and segmentation for some animal groups.

MSC: Applying 5. Compare and contrast the three types of mammals.

ANS: Almost all mammals have body hair, sweat glands, and produce milk in their mammary glands.

Mammals are typically sorted into three different general groups based on how their offspring develop prior to birth. Eutherians nourish their offspring inside of the mother’s body through the placenta until the fairly well-developed young are born. Marsupials have a more simple placenta that does not nourish the developing young for as long of a time. The marsupial’s young are poorly developed at birth and spend the first period of their lives inside their mother’s pouch to complete their development. Finally, there are monotremes. The monotremes, like the platypus, are mammals that actually lay eggs. These mammals do not produce a placenta.

DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals.

MSC: Understanding

6. The kangaroo is a marsupial. Briefly discuss the developmental state of a young kangaroo at birth and how it would be nourished until it is ready to survive on its own.

ANS: The young kangaroo would not be fully developed to survive when it is born because marsupials do not produce a well-developed placenta to nourish the young in utero. Because marsupials are also mammals, we should expect the young to nurse on their mother’s mammary glands inside the protective, external pouch until the young kanga is developed enough to leave the pouch.

DIF: Moderate REF: 17.2 Mammals R Us OBJ: 17.3 Compare and contrast the three types of mammals.

MSC: Understanding

7. Briefly explain the difference between hominids and hominins.

ANS: All members of the ape family belong to the grouping known as hominids. The hominins are a special grouping of bipedal apes that includes humans.

DIF: Easy REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Understanding

8. Which of the primates shown in the figure below could act as an outgroup (a group closely related to the rest of the organisms on the tree, but it clearly stands apart) to be compared to the other primates when constructing an evolutionary tree? Support your answer.

ANS: The lemurs would serve as an outgroup. They branched off about 65 mya and are least like the rest of the primates. Characteristics of the other primates could be compared to those of the lemurs to determine their relationships. The rest of the primates are all more closely related to each other than they are to the lemur because they share more recent common ancestors.

DIF: Difficult REF: 17.2 Mammals R Us OBJ: 17.4 Interpret an evolutionary tree of the primates.

MSC: Analyzing | Evaluating

9. The fossil of a male hominin is discovered, and it appears to share traits with both humans and Neanderthals. What could mitochondrial-DNA sequencing and whole-genome DNA sequencing convey about the fossil’s parents?

ANS: Finding a significant amount of human mitochondrial DNA with the whole-genome DNA being about half human and half Neanderthal would indicate that the mother was human and the father was Neanderthal. Finding no human mitochondrial DNA but finding about half of whole-genome DNA is human and half is Neanderthal would indicate that the father was human.

DIF: Difficult REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Evaluating

10. In 2012, researchers determined that the Neanderthal DNA had been introduced into the human genome between 90,000 and 40,000 years ago. Does this support the hypothesis that Neanderthal DNA present in the human genome is a remnant from a common hominin ancestor? Support your answer by indicating roughly when DNA from Neanderthals would have been introduced to the human genome if that Neanderthal DNA was a remnant from a common hominin ancestor.

ANS: If the Neanderthal DNA present in the human (Homo sapiens) genome were a remnant from a common hominin ancestor, it would have been introduced into the human genome at least 900,000 to a million years ago. This is at least 10 times older than the Neanderthal DNA present in modern Homo sapiens.

Therefore, the 2012 results do not support the hypothesis that Neanderthal DNA present in the human genome is a remnant from a common hominin ancestor.

DIF: Difficult REF: 17.4 Hominins United OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Evaluating 11. Consider that fossils of Homo erectus dating between 1.66 and 1.85 mya have been found scattered across Eastern Europe through China and Southeast Asia and dating back to 2.4 mya in Africa. The earliest known specimens of anatomically modern Homo sapiens in Africa date back to roughly 200,000 years ago and 40,000 to 60,000 years ago across Europe and Asia, with some at 115,000 years ago in India. Additionally, Homo neanderthalensis was present across Europe by 150,000 years ago and then spread into western Asia. If there were no evidence indicating the presence of any other early Homo species in Europe, propose a hypothesis that would be supported by this information.

ANS: Homo erectus is a possible common ancestor to Homo neanderthalensis and Homo sapiens.

DIF: Difficult REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Analyzing 12. You are a researcher excavating a site in a cave in Israel. There are many layers of sediment and primitive artifacts (flint tools for cutting and scraping) from ancestral Homo species within the cave. As you work your way deeper and deeper through the layers, you notice that artifacts in the deeper layers (laid before 350,000 years ago) do not show any signs of having been exposed to fire.

Artifacts in layers less than 350,000 years ago show rapidly increasing evidence of exposure to fire.

Your colleagues working in nearby caves and caves scattered around the eastern Mediterranean Sea have found similar evidence dating in the same time frames. The evidence is also consistent with that of European sites. What does this suggest about the use of fire by ancestral humans?

ANS: Ancestral humans who had migrated to areas around the eastern Mediterranean Sea and Europe very likely learned to control and use fire around the same time (about 300,000 to 350,000 years ago), and they became increasingly good at it.

DIF: Difficult REF: 17.5 All in the Family OBJ: 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Evaluating 13. What evidence would support the hypothesis that a male Homo sapiens mated with a female Homo neanderthalensis and produced offspring?

ANS:

Analyzing DNA from fossilized bones that showed traits intermediate to both Homo sapiens and Homo neanderthalensis and finding it to contain genomic DNA from both species along with mitochondrial DNA only from Homo neanderthalensis would support the hypothesis that a male H. sapiens successfully mated with a female H. neanderthalensis.

DIF: Moderate REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. | 17.6 Describe the evidence suggesting that prehistoric hominin species reproduced with our direct ancestors.

MSC: Applying 14. You and your brother share the same father but have different mothers. Compare and contrast the mitochondrial and nuclear DNA profiles of you and your brother.

ANS: My brother and I would share about 50 percent of our nuclear DNA because we each inherited 50 percent of our nuclear DNA from our father. We would not share a very similar mitochondrial DNA profile because we had different mothers. We would have each inherited all of our mitochondrial DNA from our different mothers.

DIF: Moderate REF: 17.4 Hominins United OBJ: 17.5 Illustrate the inheritance of mitochondrial DNA as compared to nuclear DNA. MSC: Applying MATCHING Match each correct evolutionarily significant character to the appropriate lettered box on the phylogenetic tree below.

a. b. c. d. e. f. g. h. i. j.

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

A B C D E F G H I J

amniotic egg backbone bony skeleton four limbs fur, mammary glands jaws lobed fins notochord scales skull

1. ANS: H DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 2. ANS: C DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 3. ANS: E DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 4. ANS: G DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 5. ANS: J DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 6. ANS: D DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 7. ANS: F DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 8. ANS: A DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 9. ANS: I DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering 10. ANS: B DIF: Moderate REF: 17.1 Animal Kingdom OBJ: 17.1 Identify the key characteristics of animals, and give an example organism for each group within the chordates.

MSC: Remembering