Test Bank For Essential Biochemistry 5th Edition By Charlotte Pratt, Kathleen Cornely | Chapter 1-22

Test Bank For Essential Biochemistry 5th Edition By Charlotte W. Pratt, Kathleen Cornely Chapter 1-22 Chapter 1: The Chemical Basis of Life Question type: Multiple Choice 1) Which of the following is the most abundant element in the human body?

A) B) C) D) E)

nitrogen carbon oxygen phosphorous none of the above

Answer: B Difficulty: Easy Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

2) Of the following amino acids, which contains an alcohol? a

b

c

d

A) a B) b C) c D) d E) all of the above Answer: A Difficulty: Easy Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

3) Which of the major types of biomolecules is never found in a polymeric form?

A) amino acids B) carbohydrates C) nucleotides D) lipids E) none of the above Answer: D Difficulty: Medium Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

4) Which of the following biopolymers is correctly paired with the bond that forms between the monomers?

A) protein: ester bond B) polysaccharide: glycosidic bond C) DNA: phosphate bond D) RNA: phosphate bond E) all of the above Answer: B Difficulty: Hard Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

5) Which of the biopolymers is correctly paired with its major function?

A) protein: information encoding B) nucleic acids: energy storage C) lipids: information encoding D) polysaccharide: energy storage E) none of the above Answer: D Difficulty: Medium Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

6) What functional groups are present in the following molecule?

A) amine and carboxylic acid B) amine, ketone and carboxylic acid C) amine, amide and carboxylic acid D) alcohol, amine, amide and carboxylic acid E) none of the above are correct Answer: C Difficulty: Medium Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

7) Which elements are found in simple carbohydrates?

A) carbon, hydrogen and oxygen B) carbon, hydrogen, oxygen and nitrogen C) carbon, hydrogen, oxygen and phosphorous D) carbon, hydrogen, oxygen and sulfur E) none of the above Answer: A Difficulty: Medium Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

8) Entropy is used to measure _____.

A) free energy B) heat content C) temperature D) randomness E) all of the above Answer: D Difficulty: Easy

Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

9) A spontaneous process always has _____.

A) G < 0 B) G > 0 C) H < 0 D) H > 0 E) none of the above Answer: A Difficulty: Easy Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

10) If a reaction at 37C has a H of 23 kJ/mol and a S of 337 J/Kmol, what is the G for the reaction?

A) 65 kJ/mol B) -47 kJ/mol C) 18 kJ/mol D) -19 kJ/mol E) none of the above Answer: B Difficulty: Hard Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

11) An exergonic process _____.

A) occurs without the addition of free energy B) has a G < 0 C) is spontaneous D) will have more products than reactants at equilibrium E) all of the above Answer: E

Difficulty: Medium Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

12) Which of the following molecules contains the most oxidized form of carbon?

A) acetaldehyde B) ethanol C) acetic acid D) ethylene E) carbon dioxide Answer: E Difficulty: Easy Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

13) If the following two reactions were coupled, what would be the G for the overall exergonic reaction?

ATP + H2O  ADP + Pi Glucose + Pi  glucose-1-phosphate + H2O

G = -31 kJ/mol G = 21 kJ/mol

A) -52 kJ/mol B) -10 kJ/mol C) 10 kJ/mol D) 52 kJ/mol E) none of the above Answer: B Difficulty: Medium Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

14) A gaseous mixture of hydrogen, water, ammonia and methane can produce which of the biomolecules when exposed to an electrical discharge (such as lightning)?

A) carbohydrates B) nucleotides C) lipids

D) amino acids E) none of the above Answer: D Difficulty: Medium Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

15) Which of the following explains how nucleotides might have polymerized into nucleic acids in the prebiotic world?

A) a mixture of hydrogen cyanide, formaldehyde and phosphate can form nucleotides in the presence of an electrical discharge B) nucleotides formed short polymers in the high temperatures of hydrothermal vents C) nucleotides used the surface of clay as a catalyst to form polymers D) catalysts such as iron sulfide allow for the formation of new C—C bonds E) all of the above Answer: C Difficulty: Hard Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

16) Photosynthetic organisms use energy from the sun to reduce _____ to _____.

A) formaldehyde; ethanol B) CO2; ethanol C) CO2; carbohydrates D) CO2; oxygen E) none of the above Answer: C (both C and D may be correct based on the text on page 16) Difficulty: Medium Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

17) The biological classification system categorizes organisms into which of the following domains?

A) bacteria and eukarya

B) prokarya and eukarya C) archaea and eukarya D) bacteria, eukarya and prokarya E) bacteria, archaea and eukarya Answer: E Difficulty: Medium Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

18) Which of the following is a major difference between eukaryotic and prokaryotic cells?

A) eukaryotic cells contain a nucleus, prokaryotic cells do not B) eukaryotic cells contain organelles, prokaryotic cells do not C) eukaryotic cells are much larger than prokaryotic cells D) eukaryotic cells often form multicellular organisms, prokaryotic cells do not E) all of the above Answer: E Difficulty: Easy Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

19) The similarity of one organism to another (for example a bacteria versus a human) is most easily done by comparing which biopolymer?

A) nucleic acids B) polysaccharides C) proteins D) lipids E) all of the above Answer: A Difficulty: Medium Section Reference: 1-4 Learning Objective: Summarize the evolutionary history of cells

20) Which of the following correctly identifies the progression from individual molecules to a functioning multi-cellular organism?

A) molecules, cell, organelle, organ, organism B) molecules, organelle, organ, cell, organism C) molecules, organelle, cell, organ, organism D) molecules, organ, organelle, cell, organism E) molecules, cell, organ, organelle, organism Answer: C Difficulty: Easy Section Reference: 1-1 Learning Objective: Recognize the main themes of biochemistry

21) The biochemical principle that organisms acquire, transform, store, and use energy requires that cells be able to ______.

A) produce their own energy B) convert light into other forms of energy C) extract heat from their environment D) extract energy from their environment E) use only one form of energy from their environment Answer: D Difficulty: Easy Section Reference: 1-1 Learning Objective: Recognize the main themes of biochemistry

Question type: Text Entry 22) What are the four most common elements in biological systems? ___; ___; ___; ___ Answer 1: carbon Answer 2: hydrogen Answer 3: nitrogen Answer 4: oxygen Difficulty: Easy Section Reference: 1-2

Learning Objective: Identify the major classes of biological molecules

23) Name the four major types of biomolecules. ___; ___; ___; ___ Answer 1: amino acids Answer 2: carbohydrates Answer 3: nucleotides Answer 4: lipids Difficulty: Medium Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

24) The second law of thermodynamics states ______.

A) that spontaneous processes are characterized by the overall conversion of order to disorder B) that spontaneous processes are characterized by the conversion of work to force C) that nonspontaneous processes are characterized by the conversion of order to disorder D) that spontaneous processes are characterized by the conversion of heat to pressure E) none of the above Answer: A Difficulty: Easy Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

25) Change in enthalpy (ΔH) is best defined as ______.

A) the sum of heat absorbed and work done B) the heat content of a system C) the pressure change at constant temperature D) the measure of disorder in a system E) none of the above Answer: B Difficulty: Easy Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

Question type: Multiple Choice

For questions 26–28, consider the structure of the coenzyme NADP.

B

O NH 2

O O

P

N

O

A

O O

H

H

OH

OH

H

H O

P

NH2

C

O N

N

O N

N

O H

H

OH

O

H

D

H

O

P

E O

O

26) Which arrow points at a phosphoester bond?

A) A B) B C) C D) D E) E Answer: E Difficulty: Easy Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

27) Which arrow points at an amide bond?

A) A B) B C) C D) D E) E Answer: B Difficulty: Easy Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

28) Which arrow points at a phosphoanhydride bond?

A) A B) B C) C D) D E) E Answer: A Difficulty: Moderate Section Reference: 1-2 Learning Objective: Identify the major classes of biological molecules

29) A reaction with a ______ ΔH and a ______ ΔS will never be spontaneous.

A) positive, positive B) positive, negative C) negative, positive D) negative, negative E) none of the above Answer: B Difficulty: Moderate Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

30) An endergonic reaction with a ______ ΔH and a ______ ΔS can be changed into an exergonic reaction by decreasing the temperature.

A) positive, positive B) positive, negative C) negative, positive D) negative, negative Answer: D Difficulty: Moderate Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

31) For a reaction with ΔH = 23 kJ/mol and ΔS = 22 J/K•mol, at 2°C, the reaction is ______.

A) spontaneous B) nonspontaneous C) at equilibrium D) impossible to determine reactivity E) none of the above Answer: B Difficulty: Moderate Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

Question type: Short Answer

32) Consider a reaction in which ΔH = -20. kJ/mol and ΔS = 10. J/mol · K. a. Calculate the ΔG for this reaction at 25°C. b. Is the reaction spontaneous (explain your answer)?

Answer: a. ΔG = ΔH − TΔS  ΔG = –20,000 J/mol – (298 × 10 J/mol) = −23,000 J/mol b. The reaction is spontaneous because the ΔG is negative.

Difficulty: Moderate Section Reference: 1-3

Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

Question type: Multiple Choice

33) Calculate the ΔG for a reaction with ΔH = 20. kJ/mol and ΔS = 20. J/K•mol that is carried out at 27°C. A) 14 J/mol B) 140 J/mol C) 1,400 J/mol D) 14,000 J/mol E) none of the above Answer: D Difficulty: Moderate Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

34) Based on the information given (ΔH = 5 kJ/mol and ΔS = 20. J/K•mol that is carried out at 15°C. Please describe the following reaction.

A) spontaneous and endergonic B) spontaneous and exergonic C) nonspontaneous and endergonic D) nonspontaneous and exergonic E) none of the above Answer: B Difficulty: Difficult Section Reference: 1-3 Learning Objective: Explain how enthalpy, entropy, and free energy apply to biological systems

Essential Biochemistry Test Bank, Chapter 2: Aqueous Chemistry Question type: Multiple Choice

1) In a water molecule, hydrogens are partially _____; oxygens are partially _____.

A) negative; negative B) negative; positive C) positive; positive D) positive; negative E) none of the above Answer: D Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

2) At any given moment, a single water molecule participates in _____ strong hydrogen bond(s). The role played by the water molecule is best characterized as _____.

A) two ; one H-bond donor, one H-bond acceptor B) two ; two H-bond donor C) two ; two H-bond acceptor D) one; H-bond donor E) one; H-bond acceptor Answer: A Difficulty: Medium Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

3) Which of the following is a physical property of water that results from hydrogen bonding?

A) high boiling point relative to molecular weight B) a solid state that is less dense than the liquid state C) high surface tension D) ability to solubilize polar molecules E) all of the above Answer: E Difficulty: Medium Section Reference: 2-1

Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

4) In a hydrogen bond between a water molecule and another biomolecule, _____.

A) a hydrogen ion on the water molecule forms an ionic bond with a hydride ion on the other molecule B) the hydrogen bond will typically form between a hydrogen atom and either a nitrogen, sulfur, or oxygen atom C) the partial charge on a hydrogen of the water interacts with the partial charge on a hydrogen of the other molecule D) a hydrogen on the water molecule forms a covalent bond to an oxygen or nitrogen atom on the other molecule E) the hydrogen atom is located between an oxygen atom of the water and a carbon atom of the other molecule Answer: B Difficulty: Medium Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

5) The strongest non-covalent interactions are _____.

A) van der Waals interactions B) London dispersion forces C) hydrogen bonds D) dipole-dipole interactions E) ionic interactions Answer: E Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

6) Hydrogen bonds are approximately _____% of the bond strength of covalent C-C or C-H bonds.

A) 1 B) 5 C) 20 D) 50 E) 95 Answer: B

Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

7) Due to the formation of hydrogen bonds, _____ is highly soluble in water.

A) carbon dioxide B) sodium chloride C) methanol D) octane E) cholesterol Answer: C Difficulty: Medium Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

8) Which of the following explains the interactions that occur between the atoms of water molecules and the ions that form when sodium chloride dissolves in water?

A) hydrogens interact with the sodium ion, oxygens interact with the chloride ion B) hydrogens interact with the chloride ion, oxygens interact with the sodium ion C) hydrogens interact with the sodium ion and the chloride ion D) oxygens interact with the sodium ion and the chloride ion E) none of the above Answer: B Difficulty: Medium Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

9) Which of the following functional groups has two hydrogen bond donors and one hydrogen bond acceptor?

A) alcohol B) ester C) thiol D) amine E) amide Answer: D

Difficulty: Hard Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

10) Hydrogen bonds within liquid water are _________.

A) attractions between the protons of the oxygen nuclei B) ion-induced dipole interactions C) dipole-dipole interactions D) attractions between two oxygen atoms E) attractions between the H+ and –OH ions of the liquid Answer: C Difficulty: Medium Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

11) When a non-polar substance is added to water, how do the molecules of water behave?

A) the regular hydrogen bond pattern is disrupted resulting in a decrease of entropy B) the regular hydrogen bond pattern is disrupted resulting in an increase of entropy C) the regular hydrogen bond pattern is disrupted resulting in a decrease of enthalpy D) the regular hydrogen bond pattern is disrupted resulting in an increase of enthalpy E) none of the above Answer: A Difficulty: Medium Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

12) What term is used to describe the exclusion of nonpolar substances from an aqueous solution?

A) nonpolar effect B) lipid effect C) hydrophobic effect D) oil droplet effect E) amphiphilic effect Answer: C Difficulty: Easy Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

13) Which of the following is an example of the hydrophobic effect?

A) the lipid membrane of cells and organelles B) protein folding that places hydrophobic amino acids in the interior of the protein C) the separation of salad dressing D) oil sheens seen on the ocean following an oil spill E) all of the above Answer: E Difficulty: Easy Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

14) Which of the following explains the attractive forces between hydrophobic molecules in an aqueous solution?

A) in an aqueous environment, London dispersion forces between hydrophobic molecules become stronger B) in an aqueous environment, London dispersion forces between hydrophobic molecules and water become stronger C) since nonpolar molecules do not form hydrogen bonds with hydrogen bonds with water, they can form hydrogen bonds with other nonpolar molecules D) there is no increase in attractive forces between nonpolar molecules in an aqueous environment E) none of the above Answer: D Difficulty: Hard Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

15) Considering the energetics of transferring nonpolar molecules from water to a nonpolar solvent, the factor TS is generally _____, causing G to be _____.

A) positive; negative B) negative; negative C) positive; positive D) positive; positive E) negligible; either positive or negative Answer: A Difficulty: Hard

Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

16) A molecule that has both a polar and nonpolar region is called _____________.

A) micelleic B) amphiphilic C) endergonic D) a membrane E) none of the above Answer: B Difficulty: Easy Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

17) Which of the following is an example of an amphipathic molecule?

A) adenine, a base found in nucleic acids B) glucose, a monosaccharide C) serine, an amino acid D) palmitic acid, a fatty acid E) none of the above Answer: D Difficulty: Medium Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

18) In aqueous solution, globules of up to several thousand amphiphilic molecules arranged with the hydrophilic groups on the surface and the hydrophobic groups buried in the center are called _____.

A) micelles B) vacuoles C) liposomes D) bilayers E) none of the above Answer: A Difficulty: Easy Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

19) Fatty acid anions most commonly assemble into _____ in aqueous solution.

A) lipid bilayers B) solvent-filled vesicles C) micelles D) liposomes E) none of the above Answer: C Difficulty: Easy Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

20) Which of the following molecules would be prevented from readily crossing a lipid bilayer?

A) glucose B) sodium ions C) potassium ions D) water E) all of the above Answer: E Difficulty: Medium Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

21) Which of the following is true regarding hydrophobic interactions between nonpolar molecules or groups?

A) they result from the tendency to maximize water's contact with nonpolar molecules B) they require the presence of surrounding water molecules C) they are the result of strong attractions between nonpolar regions D) they are the result of strong repulsion between water and nonpolar regions E) they depend on strong permanent dipoles in the nonpolar molecules Answer: B Difficulty: Medium Section Reference: 2-2 Learning Objective: Relate the solubility of substances to the hydrophobic effect

22) In an aqueous solution, if the [OH-] is 3.010-5 M, what is the [H+]?

A) 7.010-9 B) 7.010-2 C) 3.310-3 D) 3.310-10 E) none of the above Answer: D Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

23) What is the [H+] of an aqueous solution with a pH of 6.2?

A) 6.210-6 B) 1.610-8 C) 6.310-7 D) 3. 310-5 E) none of the above Answer: C Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

24) What would be the resulting pH if one drop (0.05 ml) of 1.0 M HCl was added to one liter of pure water (assume pH 7.0)?

A) 2.7 B) 4.3 C) 5.0 D) 7.0 (there would be no significant change) E) 9.7 Answer: B Difficulty: Hard Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

25) What would be the resulting pH if one ml of 1.0 M NaOH was added to one liter of pure water (assume pH 7.0)?

A) 1 B) 3 C) 7.3 D) 11 E) 13 Answer: D Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

26) Which of the following would be the strongest acid?

A) formic acid, pK=3.75 B) succinic acid, a diprotic acid with pK=4.21 and 5.64 C) acetic acid, pK=4.76 D) ammonium ion, pK=9.25 E) cannot be determined from the given information Answer: A Difficulty: Easy Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

27) What is the pH of a solution that contains three parts of acetic acid and one part sodium acetate? The pK for acetic acid is 4.76.

A) 5.24 B) 5.06 C) 4.46 D) 4.28 E) cannot be determined from the given information Answer: D Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

28) If the pK values for phosphoric acid are 2.15, 6.82 and 12.38, at what pH would one observe equal amounts of H2PO4- and HPO42-?

A) 2.15 B) 4.49 C) 6.82 D) 9.60 E) 12.38 Answer: C Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH 29) If 1.0 mL of 1.0 M acetic acid (pK = 4.76, K = 1.74 x 10–5) was added to one liter of pure water, what is the resulting pH? A) 1.0 B) 1.3 C) 3.0 D) 3.9 E) 10.1 Answer: D Difficulty: Hard Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

30) If the pK values for phosphoric acid are 2.15, 6.82 and 12.38, _____ would predominate at pH 5 while _____ would predominate at pH 10.

A) H3PO4; H2PO4B) H3PO4; HPO42C) H3PO4; PO43D) H2PO4-; PO43E) H2PO4-; HPO42Answer: E Difficulty: Medium Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

31) What is the conjugate acid of H2PO4-?

A) HPO42B) H2PO4

C) H3PO4 D) PO43E) none of the above Answer: C Difficulty: Easy Section Reference: 2-3

Learning Objective: Determine the effect of acids and bases on a solution’s pH

32) Considering a 0.1 M formic acid buffer, what is the concentration of formic acid present in a solution of pH 4.25 if the pK of formic acid is 3.75?

A) 0.024 M B) 0.033 M C) 0.067 M D) 0.076 M E) none of the above Answer: A Difficulty: Hard Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

33) Which of the following shows the buffer that is found in the blood stream?

A) H3PO4 B) H2PO4C) HPO42D) H2CO3 E) HCO3-

H2PO42- + H+ HPO42- + H+ PO43- + H+ HCO3- + H+ CO32- + H+

Answer: D Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

34) Which of the following shows the intracellular buffer?

A) H3PO4 B) H2PO4C) HPO42D) H2CO3

H2PO42- + H+ HPO42- + H+ PO43- + H+ HCO3- + H+

E) HCO3-

CO32- + H+

Answer: B Difficulty: Medium Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

35) If a phosphate buffer (pK=6.82) was formulated such that its pH was 7.3, it would be best suited to buffer against _____. If instead, it was formulated such that its pH was 6.3, it would be best suited to buffer against _____.

A) acid; base B) acid; acid C) base; acid D) base; base E) a buffer with a pH that far from the pK would not be an effective buffer Answer: A Difficulty: Hard Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

36) Which of the following could be used to formulate 100 mls of a 0.10 M acetate buffer (pK=4.76) at pH 5 if you start with 64 mls of 0.10 M sodium acetate?

A) 3.6 mls of 1 M HCl B) 3.6 mls of 1 M NaOH C) 34 mls of 0.10 M HCl D) 34 mls of 0.10 M NaOH E) 34 mls of 0.10 M acetic acid Answer: E Difficulty: Hard Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

37) Which of the following could be used to formulate 100 mls of a 0.10 M phosphate buffer (pK=6.82) at pH 7.2?

A) 2.9 mmoles of Na2HPO4 and 7.1 mmoles of NaHPO4 B) 10 mmoles of Na2HPO4 and 7.1 mmoles of NaOH C) 10 mmoles of NaHPO4 and 7.1 mmoles of HCl

D) 10 mmoles of H3PO4 and 17.1 mmoles of NaOH E) all of the above Answer: E Difficulty: Hard Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

38) Metabolic acidosis often causes increased respiratory rates. What portion of the bloodstream buffer is lost through increased respiration?

A) H+ B) HCO3C) H2CO3 D) CO2 E) H2O Answer: D Difficulty: Easy Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

39) What is the resulting pH if 10 millimoles of HCl is added to 1 liter of a 0.1 M phosphate buffer at pH 7.00 (pK=6.82)?

A) 6.82 B) 6.98 C) 7.01 D) 7.19 E) cannot be determined Answer: A Difficulty: Hard Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

40) During vigorous exercise, hydrogen ions are produced within cells as a result of increased metabolism. What component of the intracellular buffer would increase as a result of the increased H + production?

A) H3PO4 B) H2PO4-

C) HPO42D) PO43E) none of the above Answer: B Difficulty: Medium Section Reference: 2-4

Learning Objective: Describe how buffer solutions resist changes in pH

Question type: True/False 41) The most common disorder of acid-base chemistry in the human body is metabolic alkalosis.

Answer: False Difficulty: Easy Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH Question type: Multiple-Selection

42) Which of the following can cause metabolic acidosis?

A) shock B) overproduction of mineralcorticoids C) slow, shallow breathing D) renal failure E) central nervous system depression Answer 1: A Answer 2: D Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

Question type: Dropdown

43) During metabolic acidosis, ___ ventilation excretes acid in the form of ___.

Dropdown 1: increased, decreased Dropdown 2: H2CO3, HCO3-, CO2

Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH Question type: Dropdown

44) The amino acid ___ is metabolized in the kidney to produce ___ molecules of ammonia.

Dropdown 1: glutamic acid, glutamine, lysine Dropdown 2: 1, 2, 3 Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

Question Type: True/false 45) Free amine groups are excreted as the ammonium ion, NH4+, and thus help to lower blood pH. Answer: True Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

Question type: Dropdown

46) Metabolic alkalosis most commonly results from ___ or ___.

Dropdown 1: central nervous system depression, excessive vomiting, renal failure Dropdown 2: rapid, deep breathing, overproduction of mineralcorticoids, severe diarrhea Difficulty: Medium Section Reference: 2-5

Learning Objective: Explain how the human body maintains a constant pH

Question type: Text entry

47) The 104.5° bond angle in the water molecule is the result of the ______ of electron orbitals around oxygen.

Answer: tetrahedral arrangement Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

48) The polarity of the O–H bond is caused by the ______ of oxygen relative to that of hydrogen.

Answer: higher electronegativity Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

Question type: Multiple choice

49) Which of the following statements about water is not true?

A) It has a high dielectric constant.

B) It dissolves salts and polar substances.

C) It can form two hydrogen bonds per water molecule.

D) It packs in a hexagonal- (honeycomb-) shaped lattice when the temperature falls below 0°C. E) In the liquid state it is only 15% less hydrogen bonded than in the solid state at 0°C. Answer: C Difficulty: Easy

Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

50) Molecules such as methanol and ethanol are very soluble in water because ______.

A) they tend to avoid contact with each other B) they contain C─H groups that donate H-bonds to water C) they contain C─H groups that accept H-bonds from water D) they contain O─H groups that can form multiple H-bonds with water E) they do not form intermolecular H-bonds Answer: D Difficulty: Easy Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

51) Hydrophobic interactions between nonpolar molecules ______.

A) result from the tendency of water to maximize contact with nonpolar molecules B) are the result of strong attractions between nonpolar molecules C) are the result of strong repulsion between water and nonpolar molecules D) depend on strong permanent dipoles in the nonpolar molecules E) require the presence of surrounding water molecules Answer: E Difficulty: Easy Section Reference: 2-2

Learning Objective: Relate the solubility of substances to the hydrophobic effect

52) Urea is a water-soluble product of nitrogen metabolism. How many hydrogen bonds can one urea molecule donate to surrounding water molecules?

A) 2 B) 3 C) 4 D) 5 E) 6 Answer: C Difficulty: Moderate Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds

53) Phosphoric acid is a polyprotic acid, with pK values of 2.14, 6.86, and 12.38. Which ionic form predominates at pH 9.3?

A) H3PO4 B) H2PO4− C) HPO42− D) PO43− E) none of the above Answer: C Difficulty: Moderate

Section Reference: 2-3 Learning Objective: Determine the effect of acids and bases on a solution’s pH

Question type: Short Answer

54) Biological processes can be best understood in the context of water. a. What effect does water have on the noncovalent interactions between either charged or polar groups/molecules? b. Why is this effect important with respect to biochemical processes?

Answer: a. Water reduces the strength of those interactions. b. Water reduces the strength of polar and ionic interactions. This makes those interactions reversible and life is based on reversible interaction between biomolecules.

Difficulty: Difficult Section Reference: 2-1 Learning Objective: Explain water’s properties in terms of its ability to form hydrogen bonds.

Essential Biochemistry Test Bank, Chapter 3: Nucleic Acid Structure and Function Question type: Multiple Choice

1) Which of the following is a characteristic of Chargaff’s rules?

A) A + T = C + G B) A + G = C + T C) A + G = C + U D) all organisms have identical amounts of all four nucleotides E) none of the above Answer: B Difficulty: Medium Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

2) A base found exclusively in DNA is _____ while _____ is found only in RNA. A) adenine; cytosine B) guanine; thymine C) uracil; adenine D) cytosine; guanine E) thymine; uracil Answer: E Difficulty: Easy Section Reference: 3-1

Learning Objective: Recognize the structures of nucleotides.

3) The purines found in nucleic acids are _____ and _____.

A) adenine; cytosine B) guanine; thymine C) uracil; adenine D) adenine; guanine E) thymine; uracil Answer: D Difficulty: Easy Section Reference: 3-1

Learning Objective: Recognize the structures of nucleotides.

4) In DNA, the ribose derivative lacks an _____ on carbon _____.

A) alcohol; 2 B) alcohol; 3 C) amine; 2 D) amine; 3 E) none of the above Answer: A Difficulty: Medium Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

5) Which of the following is correctly paired with its nucleoside?

A) adenine: adenylate B) cytosine: cytidine diphosphate C) guanine: guanosine D) thymine: thymidylate E) uridine: uridine triphosphate Answer: C

Difficulty: Medium Section Reference: 3-1

Learning Objective: Recognize the structures of nucleotides.

6) The coenzymes known as NAD+, FAD and coenzyme A all contain a derivative of _____.

A) adenosine B) cytidine C) guanosine D) thymidine E) uridine Answer: A Difficulty: Medium Section Reference: 3-1

Learning Objective: Recognize the structures of nucleotides.

7) What type of bond is made between nucleotides?

A) ester B) phosphate ester C) phosphodiester D) glycosidic E) none of the above Answer: C Difficulty: 1 Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

8) The 5 end of a polynucleotide contains _____ while the 3 end contains _____.

A) a hydroxyl group; a phosphate group B) a phosphate group; a hydroxyl group C) a phosphate group; a phosphate group D) a hydroxyl group; a hydroxyl group E) none of the above Answer: B

Difficulty: Easy Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

9) The most common base pairs in DNA are _____ and _____.

A) A-T; A-G B) G-C; C-A C) T-A; A-U D) C-G; T-A E) G-U; A-T Answer: D Difficulty: Medium Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

10) An A-T base pair consists of _____ H-bond(s); a C-G base pair consists of _____ H-bond(s).

A) 1; 2 B) 2; 1 C) 2; 2 D) 3; 2 E) 2; 3 Answer: E Difficulty: Easy Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

11) Which of the following correctly describes the B-DNA double helix?

A) antiparallel strands B) right-handed helix C) base pairs are located in the center of the helix D) one helical rotation has a rise of 3.4 nm E) all of the above

Answer: E Difficulty: Hard Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

12) Differences in structure between a DNA helix and an RNA helix can predominantly be attributed to the presence of _____ in RNA. A) uracil B) 2 hydroxyl group C) 3 hydroxyl group D) smaller sizes of RNA molecules E) none of the above Answer: B Difficulty: Medium Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

13) Which of the following non-covalent interactions is the most important in maintaining the structure of the double helix?

A) phosphodiester bonds B) hydrogen bonds C) London dispersion forces D) van der Waals interactions E) ionic interactions Answer: D Difficulty: Medium Section Reference: 3-2

Learning Objective: Describe the structure and stabilizing forces of DNA

14) What term describes the process of converting the information found in DNA into the sequence of a protein?

A) replication

B) transcription C) translation D) expression E) none of the above Answer: D Difficulty: Easy Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

15) The DNA strand that serves as the template for the synthesis of RNA is often called the _____.

A) coding strand B) noncoding strand C) messenger strand D) transfer strand E) transcription strand Answer: B Difficulty: Easy Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

16) If instead of four different bases in DNA and RNA, there were six, what is the minimum size of a codon to encode the 20 amino acids commonly found in proteins?

A) 1 B) 2 C) 3 D) 4 E) cannot be determined Answer: B Difficulty: Hard Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

17) The replication of DNA is made possible by the presence of _____ strands in the double helix of DNA. A) antiparallel B) hydrogen bonded C) complementary D) genomic E) none of the above Answer: C Difficulty: Easy Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

18) Which of the following represents a DNA mutation in the template strand that would convert serine to cysteine?

A) 5-GCT-3 to 5-GCA-3 B) 5-AGC-3 to 5-TGC-3 C) 5-AGC-3 to 5-UGC-3 D) 5-AGU-3 to 5-UGU-3 E) 5-TCG-3 to 5-TCC-3 Answer: A Difficulty: Hard Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

19) The triplet code allows many amino acids to be specified by more than one codon. Such a code is said to be _____.

A) conclusive B) elusive C) replicative D) recursive E) degenerate Answer: E Difficulty: Medium Section Reference: 3-3

Learning Objective: Summarize the biological roles of DNA and RNA

20) Bacteria and archaea typically have fewer than _____ genes while plants and animals typically have greater than _____ genes.

A) 200; 1,000 B) 500; 2,500 C) 1,000; 5,000 D) 5,000; 10,000 E) 10,000; 100,000 Answer: D Difficulty: Medium Section Reference: 3-4

Learning Objective: Identify the types of information provided by genomic analysis

21) What term is used to describe short segments of DNA that are copied many times and inserted randomly in chromosomes?

A) moderately repetitive sequences B) highly repetitive sequences C) transposable elements D) spliced sequences E) none of the above Answer: C Difficulty: Medium Section Reference: 3-4

Learning Objective: Identify the types of information provided by genomic analysis

22) An open reading frame is defined by _____.

A) a start and stop codon B) homology with other species C) placement on a genome map D) presence of transposable elements E) absence of highly repetitive sequences

Answer: A Difficulty: Medium Section Reference: 3-4

Learning Objective: Identify the types of information provided by genomic analysis

23) The presence of _____ approximately once in every 1000 base pairs is what makes each individual human genetically unique.

A) orphan genes B) horizontal genes C) homologous genes D) transposable elements E) single nucleotide polymorphisms Answer: E Difficulty: Medium Section Reference: 3-4

Learning Objective: Identify the types of information provided by genomic analysis

24) In humans, approximately _____ % of the genome encodes proteins.

A) 78 B) 45 C) 33 D) 11 E) 1.5 Answer: E Difficulty: Medium Section Reference: 3-4

Learning Objective: Identify the types of information provided by genomic analysis

Question type: Text Entry

25) The two purines found in DNA are _____ and _____.

Answer 1: adenine Answer 2: guanine

Difficulty: Easy

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

26) The pyrimidine found in both DNA and RNA is _____. The pyrimidine found only in DNA is _____ while the pyrimidine found only in RNA is _____.

Answer 1: cytosine Answer 2: thymine Answer 3: uracil Difficulty: Medium

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

Question type: Dropdown

27) The link between a purine and ribose is made from the ___ of the purine ring to the ___ of the ribose.

Dropdown 1: N1, N3, N7, N9 Dropdown 2: C1, C2, C3, C4, C5

Difficulty: medium

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

28) The link between a pyrimidine and ribose is made from the *dropdown 1* of the pyrimidine ring to the *dropdown 2* of the ribose.

Dropdown 1: N1, N3 Dropdown 2: C1, C2, C3, C4, C5

Difficulty: medium

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

29) Coenzyme A contains *dropdown 1* and *dropdown 2*.

Dropdown 1: adenosine diphosphate, cytosine diphosphate, guanosine diphosphate, uridine diphosphate Dropdown 2: cysteine, pantothenic acid

Difficulty: medium

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

30) Nicotinamide adenine dinucleotide contains *dropdown 1* and *dropdown 2*.

Dropdown 1: adenosine monophosphate, adenosine diphosphate, adenosine triphosphate Dropdown 2: deoxyribose, ribose

Difficulty: medium

Section Reference: 3-1 Learning Objective: Recognize the structure of nucleotides

Question type: Multiple Choice

31) Nucleotides play a central role in living organisms because ______.

A) they mediate transport of energy within the cell B) they are involved in oxidation-reduction reactions C) they are involved in intracellular signaling D) they function as building blocks for nucleic acids E) all of the above

Answer: E Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

32) Nucleoside triphosphates are useful for energy transfer because the phosphoanhydride bonds are relatively ______.

A) stable B) high energy

C) biocompatible D) large E) low energy

Answer: B

Difficulty: Easy Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

33) Which of the following bases pairs with guanine?

Answer: E

Difficulty: Easy Section Reference: 3-1

Learning Objective: Recognize the structures of nucleotides.

34) Which of the following bases is not present in RNA?

Answer: D

Difficulty: Easy Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

35) An A-T base pair consists of _____ H-bond(s); a C-G base pair consists of _____ H-bond(s).

A) 1; 2 B) 2; 1 C) 2; 2 D) 3; 2

E) 2; 3

Answer: E

Difficulty: Easy Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

36) In living organisms, genetic information is most often stored in the form of ______.

A) ribonucleic acid B) deoxyribonucleic acid C) proteins D) enzymes E) deoxynucleotides

Answer: B

Difficulty: Easy Section Reference: 3-3 Learning Objective: Summarize the biological roles of DNA and RNA

37) What group is attached to the pyrimidine ring in thymine and is not present in uracil?

A) ribose B) –CH3

C) –NH2 D) deoxyribose E) none of the above

Answer: B

Difficulty: Moderate Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

38) Nucleotides contain one or more phosphate groups that are usually attached to the ______.

A) C-3ꞌ or C-5ꞌ atoms B) C-3 or C-3ꞌ atoms C) C-5 or N-3 atoms D) C-1ꞌ or N-3 atoms E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

39) Nucleoside triphosphates carry energy in the form of ______.

A) glycosidic bonds B) phosphoester bonds C) phosphoanhydride bonds D) hydrogen bonds E) amide linkages

Answer: C

Difficulty: Moderate Section Reference: 3-1 Learning Objective: Recognize the structures of nucleotides.

Question type: Text entry

40) The pyrimidine found in both DNA and RNA is _____. The pyrimidine found only in DNA is _____, and the pyrimidine found only in RNA is _____.

Answer 1: cytosine Answer 2: thymine Answer 3: uracil

Difficulty: Moderate Section Reference: 3-1 Learning Objective 1: Recognize the structures of nucleotides.

Question type: Multiple Choice

41) DNA is _____, resulting in the production of _____.

A) transcribed; mRNA B) translated; tRNA C) transcribed; protein D) translated; protein E) translated; rRNA

Answer: A

Difficulty: Moderate Section Reference: 3-3 Learning Objective: Summarize the biological roles of DNA and RNA

42) DNA encodes proteins undergoes the process of _____ to produce _____.

A) transcription; mRNA B) transcription; tRNA C) translation; rRNA D) translation; proteins E) transcription; proteins

Answer: A

Difficulty: Moderate Section Reference: 3-3 Learning Objective: Summarize the biological roles of DNA and RNA

43) Mutations leading to changes that can be inherited by the next generation have to be introduced at the ______ level.

A) DNA B) rRNA C) protein D) mRNA E) tRNA

Answer: A

Difficulty: Moderate Section Reference: 3-3 Learning Objective: Summarize the biological roles of DNA and RNA

Question type: Text entry

44) This is the structure of adenine.

a. Is adenine a purine or a pyrimidine? b. Which base does adenine base-pair (H-bond) with in DNA? c. What is the name of the molecule that is composed of adenine linked to the C-1ꞌ of ribose? d. Indicate on the drawing through which atom adenine is connected to ribose or deoxyribose. e. Indicate on the drawing which groups on adenine are involved in base-pairing or H-bonding with its complementary base.

Answer: a. purine b. thymine c. adenosine d. see diagram e. see diagram

Difficulty: Difficult Section Reference: 3-1 Section Reference: 3-2

Learning Objective 1: Recognize the structures of nucleotides.

Learning Objective 2: Describe the structure and stabilizing forces in DNA.

45) This is the structure of cytosine.

a. What are the names of the other three bases that are found in DNA? b. Is cytosine a purine or a pyrimidine? c. Give the name and the one letter abbreviation of the base cytosine base-pairs (H-bonds) with in DNA. d. What is the name of the molecule composed of cytosine linked to ribose? e. Indicate on the drawing through which atom cytosine is connected to ribose or deoxyribose f. Indicate on the drawing which groups on cytosine are involved in base-pairing (H-bonding) with its complementary base.

Answer: a. adenine, guanine, and thymine b. pyrimidine c. guanine, G d. cytidine e. see diagram f. see diagram

Difficulty: Difficult Section Reference: 3-1 Section Reference: 3-2

Learning Objective 1: Recognize the structures of nucleotides.

Learning Objective 2: Describe the structure and stabilizing forces of DNA

Question type: Short answer

46) There are three types of RNA that are directly involved in translation. a. Name these three types of RNA. b. Briefly describe the function of each of these types of RNA.

Answer: a. mRNA, tRNA, rRNA b. mRNA moves genetic information from the nucleus to the ribosomes in the cytoplasm. tRNA decodes the genetic message; it matches sequences of three nucleotides to amino acids. rRNA is involved in the catalysis of amide bond formation.

Difficulty: Difficult Section Reference: 3-3 Learning Objective: Summarize the biological roles of DNA and RNA

Essential Biochemistry Test Bank, Chapter 4: Protein Structure Question type: Multiple Choice

1) When a peptide bond forms, a(n) ___ reacts with a carboxylate group. a) amide b) amine c) alcohol d) ester e) none of these choices Answer: b Difficulty: easy

Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

2) At a pH above its pKa, the phenolic group of tyrosine is ___. a) protonated and neutral b) protonated and positively charged c) deprotonated and neutral d) deprotonated and negatively charged e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1 3) At a pH above its pKa, the -amino group of lysine is ___. a) protonated and neutral b) protonated and positively charged c) deprotonated and neutral d) deprotonated and negatively charged e) none of these choices Answer: b Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

4) At a pH above its pKa, the R-group of Asp is ___. a) protonated and neutral b) protonated and positively charged c) deprotonated and neutral d) deprotonated and negatively charged e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

5) What is the C-terminal amino acid in the pentapeptide Val-Leu-Arg-Ser-Gly? a) Val b) Leu c) Arg d) Ser e) Gly Answer: e Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

6) At pH 3, how many charged groups are present in the pentapeptide Ala-Asp-His-Ser-Lys? a) 1 b) 2 c) 3 d) 4 e) 5 Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

7) Which of the following structures shows the prevalent form of glutamic acid at pH 3?

a) a

b) b c) c d) d e) none of these choices Answer: c Difficulty: hard Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

8) Which of the following amino acids has a positively charged side chain at pH 7.4? a) Glu b) Ala c) Lys d) Leu e) His Answer: c Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

9) Which of the following amino acids has a thiol group in its side chain? a) Ser b) Asn c) Cys d) Tyr e) Met Answer: c Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1 Question type: Text Entry

10) Serine has a ___ side chain; valine has a ___ side chain.

Answer 1: polar Answer 2: non-polar Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

Question type: Multiple Choice

11) Which of the following amino acids contains a side chain that is polar and uncharged from pH 1-13? a) Phe b) Tyr c) Asp d) Gln e) Ile Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

12) Which of the following structures shows the prevalent form of histidine at pH 5?

a) a b) b c) c d) d e) none of these choices Answer: c

Difficulty: hard Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

13) At pH ___, the pentapeptide Ala-Glu-His-Val-Cys would contain two positively charged groups and one negatively charged group. a) 1 b) 3 c) 5 d) 7 e) 9 Answer: b Difficulty: hard Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

14) Disulfide bonds form between two residues of which amino acid? a) Met b) Ser c) Asn d) Thr e) Cys Answer: e Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

Question type: Text Entry

15) Leucine has a ___ side chain; glutamate has a ___ side chain.

Answer 1: non-polar Answer 2: charged Difficulty: easy

Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

Question type: Multiple Choice:

16) At physiological pH, all amino acids have at least ___ charged groups. a) 0 b) 1 c) 2 d) 3 e) cannot be determined Answer: c Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

17) Which of the following structures shows the prevalent form of cysteine at pH 12?

a) a b) b c) c d) d e) none of these choices Answer: d Difficulty: hard Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

18) The formation of a dipeptide from two amino acids requires ___.

a) reduction of the -carboxyl group b) protonation of the -amine group c) interaction of the two side-chains d) loss of water e) none of these choices Answer: d Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

19) What is the net charge of the pentapeptide Ala-Cys-Ser-Glu-Asn at pH 7? a) -2 b) -3 c) 0 d) +1 e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

20) What level of protein structure is characterized by the amino acid sequence? a) primary b) secondary c) tertiary d) quaternary e) none of these choices Answer: a Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

21) What level of protein structure is characterized by the three dimensional structure of an entire polypeptide including all amino acid side chains?

a) primary b) secondary c) tertiary d) quaternary e) none of these choices Answer: c Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

22) What is the N-terminal residue of the peptide AYSDG? a) glutamic acid b) glycine c) aspartic acid d) alanine e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

23) Which of the 20 standard amino acids is optically inactive? a) Arg b) Pro c) Ile d) Gly e) Cys Answer: d Difficulty: easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

24) If a protein underwent a mutation such that a Glu residue was changed to another amino acid, which of the following amino acids would least likely result in a change in the overall structure

of the protein? a) Ser b) Asp c) Gln d) Lys e) Ala Answer: b Difficulty: medium Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Learning Objective 2: Describe the forces that stabilize protein structure.

Section Reference 1: 4-1 and 4-3

25) Since there are 20 standard amino acids, the number of possible linear polypeptides of length N can be expressed as ___. a) 20  10N b) N20 c) N  1020 d) 20N e) N  20 Answer: d Difficulty: hard Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

26) In the following figure, which bond would be unable to rotate?

a) a b) b c) c

d) d e) none of these choices Answer: b Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 27) The predominant non-covalent interaction seen in -helices and -sheets is ___. a) electrostatic interactions b) hydrogen bonds c) dipole-dipole interactions d) hydrophobic interactions e) all of these choices Answer: b Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 28) Which of the following amino acids is generally absent from an -helix? a) Trp b) Ser c) Ile d) Pro e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 29) -helices and -sheets comprise ___ structure. a) primary b) secondary c) tertiary d) quaternary

e) none of these choices Answer: b Difficulty: easy Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 30) Which of the following best describes the peptide backbone in a -sheet? a) coiled b) compacted c) highly extended d) rigid e) none of these choices Answer: c Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 31) If an -helical region of a protein contained 18 amino acid residues, how many helical turns would be present? a) 3.33 b) 4 c) 5 d) 6 e) none of these choices Answer: c Difficulty: hard Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 32) Which of the following atoms would be considered a hydrogen bond donor in an -helix?

a) a b) b c) c d) d e) none of these choices Answer: a Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2

33) The following is an example of ___.

a) parallel -helix b) parallel -sheet c) antiparallel -helix d) antiparallel -sheet e) none of these choices Answer: d Difficulty: medium Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2

34) Lysine can form a salt bridge by interacting with the side chain of ___. a) Glu b) Gly c) Asn d) Ser e) Pro Answer: a Difficulty: medium Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

35) The side chain of serine could interact with the side chain of ___ using a(n) ___. a) Val; hydrophobic interaction b) His; hydrogen bond c) Gln; hydrophobic interaction d) Asn; electrostatic interaction e) none of these choices Answer: b Difficulty: hard Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

36) For a globular protein that is found in the cytosol, ___ would most likely be found in the proteins interior while ___ would most likely be found on the surface. a) Val; Phe b) Leu; Ile c) Leu; Ser d) Thr; His e) none of these choices Answer: c Difficulty: hard Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

37) Which of the following is most critical for maintaining the tertiary structure of a protein? a) hydrogen bonds b) hydrophobic interactions c) disulfide bonds d) salt bridges e) none of these choices Answer: b Difficulty: medium Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

38) Molecular chaperones assist proteins in the formation of ___. a) aggregates b) tertiary structure c) peptide bonds d) primary structure e) none of these choices Answer: b Difficulty: easy Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

39) The amino acid ___ is commonly phosphorylated. a) Ser b) Asp c) Asn d) His e) none of these choices Answer: a Difficulty: medium Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

40) Which of the following interactions would be involved in quaternary structure? a) hydrogen bonds b) hydrophobic interactions c) disulfide bonds d) salt bridges e) all of these choices Answer: e Difficulty: easy Learning Objective 1: Recognize quaternary structure in proteins.

Section Reference 1: 4-4

41) If the following mixture of proteins was applied to a size-exclusion chromatography column, what would be the order of elution?

Proteins with molecular weights: myoglobin (17.7 kDa) , hemoglobin (64.5 kDa) , lysozyme (14.3 kDa) and triose phosphate isomerase (57.4 kDa) a) lysozyme, myoglobin, triose phosphate isomerase, hemoglobin b) triose phosphate isomerase, hemoglobin, lysozyme, myoglobin c) hemoglobin, myoglobin, lysozyme, triose phosphate isomerase d) hemoglobin, triose phosphate isomerase, myoglobin, lysozyme, e) cannot be determined Answer: d Difficulty: medium Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

42) Given pKa values of 2.3 and 9.7, what is the pI of alanine? a) 12 b) 7.4 c) 6 d) 4.2 e) none of these choices Answer: c Difficulty: medium Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

43) Given pKa values of 2.1, 9.8 and 3.9 (side chain), what is the pI of aspartic acid? a) 6.0 b) 6.9 c) 5.3 d) 3.0 e) none of these choices Answer: d Difficulty: hard Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

44) Which of the following methods for cleaving a protein is properly identified? a) chymotrypsin: cleaves on the C-terminal side of Lys or Arg b) trypsin: cleaves on the C-terminal side of Ala or Val c) cyanogen bromide: cleaves on the C-terminal side of Met d) elastase: cleaves on the C-terminal side of Phe, Trp or Tyr e) none of these choices Answer: c Difficulty: medium Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

45) What are the products from treatment of the following peptide with chymotrypsin?

Met-Tyr-Ala-Ser-Phe-Val-Lys-Asn-His-Tyr-Gly-Arg-Met-Trp a) 1 tripeptide, 1 tetrapeptide, 1 pentapeptide, and two free amino acids b) 1 dipeptide, 1 tripeptide, 1 tetrapeptide and 1 pentapeptide c) 1 dipeptide, 1 tetrapeptide and 1 octapeptide d) 1 dipeptide, 2 tripeptides, 1 pentapeptide and one free amino acid e) none of these choices Answer: e Difficulty: hard

Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

46) What are the products from treatment of the following peptide with trypsin?

Leu-Val-Ala-Arg-Phe-Val-Lys-Asn-Leu-Gly-Arg-Cys-Asp a) 2 dipeptides, 1 tripeptide and 1 tetrapeptide b) 3 tripeptides and 1 tetrapeptide c) 2 tripeptides, 1 tetrapeptide and 3 free amino acids d) 1 dipeptide, 1 tripeptide and 2 tetrapeptides e) none of these choices Answer: d Difficulty: hard Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

47) A technique for determining protein structure that requires crystals of the protein is ___. a) NMR spectroscopy b) X-ray crystallography c) electron crystallography d) mass spectrometry e) none of these choices Answer: b Difficulty: easy Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

48) A technique for determining protein structure where the protein is in solution is ___. a) NMR spectroscopy b) X-ray crystallography c) electron crystallography d) mass spectrometry e) none of these choices Answer: a

Difficulty: easy Learning Objective 1: Describe techniques for purifying and analyzing proteins.

Section Reference 1: 4-6

Question type: True/false 49) The only observable regular secondary structures are -helices and -sheets.

Answer: true Difficulty: easy Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 Question type: Text Entry 50) Hemoglobin contains ___ alpha subunits and ___ beta subunits, thus making hemoglobin a ___ protein.

Answer 1: 2 Answer 2: 2 Answer 3: heterotetrameric Difficulty: medium Learning Objective 1: Recognize quaternary structure in proteins.

Section Reference 1: 4-4 51) The aggregated proteins seen in Alzheimer’s disease and Parkinson’s disease are commonly known as ___.

Answer: amyloid deposits Difficulty: medium Learning Objective 1: Identify the common features of amyloid diseases.

Section Reference 1: 4-5

52) A misfolded protein can undergo ___ to attain the native structure or it can undergo ___ to become a plaque.

Answer 1: refolding Answer 2: aggregation

Difficulty: medium Learning Objective 1: Identify the common features of amyloid diseases.

Section Reference 1: 4-5 53) The protein -synuclein normally forms ___ upon binding to other molecules but forms ___ that lead to amyloid deposits.

Answer 1: -helix, Answer 2: -secondary structures Difficulty: hard Learning Objective 1: Identify the common features of amyloid diseases.

Section Reference 1: 4-5

54) Transmission spongiform encephalopathies alter ___ protein that impacts the ___ conformation of the protein resulting in aggregates.

Answer 1: prion Answer 2: beta or  Difficulty: medium Learning Objective 1: Identify the common features of amyloid diseases.

Section Reference 1: 4-5

Question type: Multiple Choice 55) Which amino acid does not have a primary -amino group? a) glutamine b) arginine c) lysine d) proline e) glutamate Answer: d Difficulty: Easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1 56) Which one of the representations describes the oligopeptide shown below?

a) Tyr-Ala-Thr b) Tyr-Gly-Cys c) Tyr-Ala-Ser d) Phe-Gly-Cys e) Phe-Ala-Thr Answer: c Difficulty: Easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1 57) The diagram below shows _____.

a) an amino acid b) a dipeptide c) a tripeptide d) a tetrapeptide e) a polypeptide Answer: d Difficulty: Easy Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

58) For β sheets, the terms ―parallel‖ and ―antiparalllel‖ refer to _____. a) the ―direction‖ of the associated peptide strands b) the orientation of the amide cross links c) the quaternary structure of the protein d) the orientation of the hydrogen bonding e) the topology of the reverse turns Answer: a Difficulty: Easy Learning Objective 1: Recognize the common types of regular secondary structure.

Section Reference 1: 4-2 59) Noncovalent forces that stabilize protein structure include all of the following except _____. a) the hydrophobic effect b) salt bridges c) electrostatic interactions with metal ions d) hydrogen bonding e) disulfide bridges Answer: e Difficulty: Easy Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3 60) The disulfide bond between two cysteine molecules _____. a) is a peptide bond b) is an ionic interaction that is stable at physiological pH c) is a covalent bond formed by oxidation d) is a hydrogen bond between the two sulfhydryl groups e) is a dipole–dipole interaction Answer: c Difficulty: Easy Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-3

Question type: Short Answer 61) Draw the predominant structure of valine at pH 10 (pKas are 2.3 and 9.7).

Difficulty: Moderate Section: 3.1 Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Section Reference 1: 4-1

Question type: Multiple Choice 62) Which of the following tripeptides would be expected to be the most hydrophobic? a) KYG b) KYA c) GYA d) DYA e) DYG Answer: c Difficulty: Moderate Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Learning Objective 2: Recognize the common types of regular secondary structure.

Section Reference 1: 4-1 and 4-2 63) In a protein, the most conformationally restricted amino acid is ______; the least conformationally restricted is ______. a) Trp, Gly b) Met, Cys c) Pro, Gly d) Ile, Ala e) Ala, Pro Answer: c Difficulty: Moderate Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Learning Objective 1: Describe the forces that stabilize protein structure.

Section Reference 1: 4-1 and 4-3

64) The two peptides shown in the diagram below are linked through _____.

a) a hydrogen bond b) a glycosidic bond c) a peptide bond d) a disulfide bond e) an ester linkage Answer: d Difficulty: Moderate Learning Objective 1: Identify the 20 amino acids that occur in proteins.

Learning Objective 2: Describe the forces that stabilize protein structure.

Section Reference 1: 4-1 and 4-3 Essential Biochemistry Test Bank, Chapter 5: Protein Function Question type: Multiple Choice

1) Heme is considered a _____.

A) catalyst B) prosthetic group C) coenzyme D) cofactor E) none of the above Answer: B

Difficulty: Easy Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

2) The central ion of the heme group of hemoglobin is _____.

A) Cu+ B) Cu2+ C) Fe2+ D) Fe3+ E) none of the above Answer: C Difficulty: Easy Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

3) When oxygen is bound to the heme group of myoglobin, it is coordinated between _____ and _____.

A) F8 His; Fe3+ of heme B) E7 His; Fe3+ of heme C) F8 His; Fe2+ of heme D) E7 His; Fe2+ of heme E) none of the above Answer: D Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

4) Myoglobin is _____; hemoglobin is _____.

A) monomeric; dimeric B) monomeric; trimeric C) monomeric; tetrameric D) dimeric; trimeric E) dimeric; tetrameric

Answer: C Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

5) The individual hemoglobin subunits and myoglobin share similar _____ structure but have rather different _____ structure.

A) primary; secondary B) secondary; tertiary C) primary; tertiary D) secondary and tertiary; primary E) primary and secondary; tertiary Answer: D Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

6) What is the prominent type of secondary structure observed in myoglobin?

A) -helices B) -bends C) parallel -sheets D) antiparallel -sheets E) -helices Answer: E Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

7) Which of the following is an example of a conservative amino acid substitution?

A) Ile  Leu B) Ser  Glu C) Phe  Tyr

D) Asp  Gln E) Arg  Cys Answer: A Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

8) While the composition of hemoglobin in adult humans is 22, in the developing fetus, _____ is observed A) 22 B) 22 C) 22 D) 22 E) 22 Answer: E Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

9) The idea that binding of one molecule of oxygen to hemoglobin enhances further binding of oxygen to hemoglobin is called _____.

A) homologous binding B) cooperativity C) fractional saturation D) allosterism E) none of the above Answer: B Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

10) With respect to oxygen saturation, hemoglobin is _____ saturated at the pO2 of the lungs and _____

saturated at the pO2 of the tissue A) 20%; 20% B) 25%; 20% C) 50%; 20% D) 50%; between 30 and 70% E) >90%; between 30 and 70% Answer: E Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

11) Which of the following best explains the ability for carbon monoxide (CO) to bind to hemoglobin (Hb) despite the relatively low concentrations of CO? A) CO binds to Hb with less affinity than oxygen B) CO binds to Hb with an affinity about the same as oxygen C) CO binds to Hb about 5 times more strongly than oxygen D) CO binds to Hb about 250 times more strongly than oxygen E) none of the above Answer: D Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

12) Which of the following occurs in hemoglobin upon oxygen binding?

A) the heme Fe2+ is pulled out of the plane of the heme group B) the His coordinated to the heme Fe2+ is pushed away from the heme group C) the central cavity between the four subunits is decreased in size D) hemoglobin changes from the R state to the T state E) all of the above occur Answer: C Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

13) Which of the following explains the conversion of hemoglobin subunits from deoxy to oxy state?

A) all four subunits switch simultaneously B) each subunit switches only upon oxygen binding to the particular subunit C) both  subunits simultaneously switch first followed by both  subunits D) both  subunits simultaneously switch first followed by both  subunits E) none of the above Answer: A Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

14) Proteins such as hemoglobin are known as _____ proteins since binding of a molecule to one site alter binding to other sites.

A) ligand-activated B) allosteric C) induced-fit D) cooperative E) none of the above Answer: B Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

15) A plot of the binding of oxygen to myoglobin as a function of pO2 gives a _____ shape; a similar plot for hemoglobin gives a _____ shape.

A) sigmoidal; sigmoidal B) sigmoidal; hyperbolic C) hyperbolic; sigmoidal D) hyperbolic; hyperbolic E) hyperbolic; exponential Answer: C

Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

16) Hemoglobin S, the variant responsible for the misshapen red blood cells characteristic of the disease sickle-cell anemia, is potentially advantageous to heterozygotes because it confers some level of resistance to the disease _____.

A) AIDS B) malaria C) polycythemia D) rickets E) cyanosis Answer: B Difficulty: Easy

Section Reference: 5-2 Learning Objective: Relate genetic variations to changes in protein function 17) How does CO2 affect hemoglobin-oxygen binding?

A) CO2 binds directly to the oxygen binding site, displacing oxygen and thus promoting the deoxy state B) CO2 displaces BPG, thus promoting the oxy state C) CO2 is converted to bicarbonate and H+ which promotes the oxy state D) CO2 is converted to bicarbonate and H+ which promotes the deoxy state E) none of the above Answer: D Difficulty: Hard Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

18) Which allosteric effector has the greatest ability to stabilize the deoxy state of hemoglobin?

A) BPG B) CO2 C) O2 D) H+ E) all of the above have equal ability

Answer: A Difficulty: Medium Section Reference: 5-1

Learning Objective: Compare the structures and functions myoglobin and hemoglobin

19) Which of the following fibers is correctly paired with the protein that forms the fiber?

A) microfilaments: actin B) microtubule: tubulin C) extracellular support fibers: collagen D) intermediate filaments: keratin E) all of the above Answer: E Difficulty: Medium Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

20) During the formation of microfilaments, which of the following occurs?

A) ATP binds to F-actin B) F-actin polymerizes, becoming G-actin C) ATP hydrolysis is catalyzed by F-actin D) polymerization proceeds quickly at first, then slows after about ten actin monomers have polymerized E) none of the above Answer: C Difficulty: Medium Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

21) When a cell moves along a surface, actin _____ occurs at the leading edge while _____ occurs at the trailing edge A) polymerization; depolymerization B) depolymerization; polymerization C) denaturation; renaturation D) renaturation; denaturation

E) none of the above Answer: A Difficulty: Medium Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

22) Which of the following details the nucleotide-binding site when tubulin dimers assemble into microtubules?

A) both  and  sites are bound to GTP B) the  site is bound to GTP; the  site is bound to GDP C) the  site is bound to GDP; the  site is bound to GTP D) both  and  sites are bound to GDP E) the  site is bound to GTP; the  site is unoccupied following GTP hydrolysis and release of GDP Answer: B Difficulty: Hard Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

23) Which of the following explains how cell division is blocked by drugs that prevent proper microtubule function?

A) the condensation of chromatin requires a microtubule skeleton B) production of new membranes for organelles and nucleus requires microtubules C) chromosomes separate along a microtubule spindle D) division of organelles between daughter cells requires organelle movement along microtubules E) none of the above Answer: C Difficulty: Medium Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

24) What is the most prevalent secondary structure observed in the proteins of intermediate filaments?

A) -helices B) -helices

C) -sheets D) -sheets E) both -helices and  -helices are observed Answer: A Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

25) Which amino acid is critical for crosslinking of keratin fibers?

A) Ser B) Lys C) His D) Cys E) Gln Answer: D Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

26) During the initial synthesis of collagen molecules, _____ and _____ are most often incorporated into the growing protein.

A) Ser; Gly B) Pro; Ala C) Gly; Pro D) Ala; Gly E) Ser; Pro Answer: C Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

27) Ascorbic acid is required for the production of _____ in collagen.

A) hydroxylysine

B) -carboxyglutamic acid C) desmosine D) aspartate -semialdehyde E) hydroxyproline Answer: E Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

28) The helical structure of collagen contains _____.

A) three right-handed helices wound around each other in a right-handed triple helix B) three right-handed helices wound around each other in a left-handed triple helix C) three left-handed helices wound around each other in a left-handed triple helix D) three left-handed helices wound around each other in a right-handed triple helix E) none of the above Answer: D Difficulty: Medium Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

29) Which amino acid is critical for crosslinking of collagen trimers?

A) Ser B) Lys C) His D) Cys E) Gln Answer: B Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

30) Bone and tendons contain _____ while hair and nails contain _____.

A) collagen; keratin

B) actin; keratin C) tubulin; collagen D) collagen; actin E) tubulin; keratin Answer: A Difficulty: Easy Section Reference: 5-3 Learning Objective: Compare the structures and functions of structural proteins

31) In a muscle cell, what is the name for the bundles of myosin tails?

A) cytoskeleton B) thick filaments C) intermediate filaments D) thin filaments E) none of the above Answer: B Difficulty: Easy Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

32) Each myosin head contains a binding site for _____ and a binding site for _____.

A) tubulin; GTP B) another myosin molecule; ATP C) kinesin; GTP D) actin; ATP E) none of the above Answer: D Difficulty: Medium Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

33) Which of the following correctly describes the sequence of events in the myosin-actin cycle?

A) myosin release from actin, ATP binds to myosin, myosin binds to another actin subunit, release of P i and ADP, stretched myosin returns to original conformation B) myosin release from actin, ATP binds to myosin, myosin binds to another actin subunit, stretched

myosin returns to original conformation, release of Pi and ADP C) ATP binds to myosin, myosin release from actin, myosin binds to another actin subunit, release of P i and ADP, stretched myosin returns to original conformation D) ATP binds to myosin, myosin release from actin, myosin binds to another actin subunit, stretched myosin returns to original conformation, release of Pi and ADP E) myosin release from actin, myosin binds to another actin subunit, ATP binds to myosin, stretched myosin returns to original conformation, release of Pi and ADP Answer: C Difficulty: Hard Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

34) Each kinesin head contains a binding site for _____ and a binding site for _____.

A) tubulin; GTP B) another kinesin molecule; GTP C) myosin; ATP D) actin; ATP E) tubulin; ATP Answer: E Difficulty: Medium Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

35) The heads of kinesin bind to _____; the light chains of kinesin bind to _____.

A) tubulin; proteins in the membrane of a vesicle B) proteins in the membrane of an organelle; tubulin C) proteins in the membrane of a vesicle; actin D) collagen fibers; proteins in the cell membrane E) none of the above Answer: A Difficulty: Medium Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

36) Which of the following correctly describes the sequence of events in the kinesin reaction cycle? For simplicity, the two heads are referred to as head 1 and head 2. Head 1 starts as the leading head.

A) head 1 releases tubulin, ATP binds to head 1, head 2 swings forward, head 2 binds to tubulin, ADP release from head 2, ATP hydrolysis in head 1 B) ATP binds to head 1, head 2 swings forward, ADP release from head 2, ATP hydrolysis in head 1, head 2 binds to tubulin, head 1 releases tubulin C) ATP binds to head 1, head 2 swings forward, head 2 binds to tubulin, ATP hydrolysis in head 1, ADP release from head 2, head 1 releases tubulin D) ATP binds to head 1, head 2 swings forward, head 2 binds to tubulin, ADP release from head 2, ATP hydrolysis in head 1, head 1 releases tubulin E) none of the above Answer: D Difficulty: Hard Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

37) Which of the following represents the longest distance traveled by a kinesin-vesicle complex?

A) movement of a mitochondria in a cardiac cell B) movement of a neurotransmitter vesicle down the axon of a nerve cell C) movement of a glucose filled vesicle to the membrane of a liver cell D) movement of a lipid-filled vesicle within an intestinal cell E) none of the above Answer: B Difficulty: Medium Section Reference: 5-4 Learning Objective: Explain how motor proteins operate

Question type: Text Entry

38) The best-known hemoglobin variant is _____.

Answer: sickle cell hemoglobin; Hb S; hemoglobin S Difficulty: Medium Section Reference: 5-2 Learning Objective: Relate genetic variations to changes in protein function

Question type: Dropdown

39) In Hb S, a ___ residue is replaced by a ___ residue.

Dropdown 1: aspartate, glutamate, glycine Dropdown 2: lysine, histidine, valine Difficulty: Medium Section Reference: 5-2 Learning Objective: Relate genetic variations to changes in protein function

40) In Hb S, a valine residue binds to a(n) ___ patch causing ___ of the hemoglobin.

Dropdown 1: hydrophilic, hydrophobic, acidic, basic Dropdown 2: unfolding, aggregation Difficulty: Medium Section Reference: 5-2 Learning Objective: Relate genetic variations to changes in protein function

41) The aggregation of Hb S occurs in the ___ state, thus the formation of aggregates is most likely to occur in the ___.

Dropdown 1: oxy, deoxy Dropdown 2: arteries, capillaries Difficulty: Medium Section Reference: 5-2 Learning Objective: Relate genetic variations to changes in protein function

Essential Biochemistry Test Bank, Chapter 6: How Enzymes Work

Question type: Multiple Choice

1) Different enzymes that catalyze the same reaction are known as _____.

A) transferases B) isomerases C) allosteric enzymes D) holoenzymes E) isozymes Answer: E Difficulty: Easy Section Reference: 6-1

Learning Objective: Describe how enzymes differ from other catalysts

2) An uncatalyzed reaction has a rate of 4.2 x 10 –7 sec–1. When an enzyme is added the rate is 3.2 x 10 4 sec– 1. Calculate the rate enhancement caused by the enzyme.

A) 7.6 x 1010 B) 3.2 x 104 C) 1.3 x 10–2 D) 7.4 x 10–3 E) cannot be determined Answer: A Difficulty: Medium Section Reference: 6-1

Learning Objective: Describe how enzymes differ from other catalysts

3) Which of the following is the most effective way to increase the rate of a biochemical reaction?

A) increase the temperature B) increase the concentrations of the reactants C) increase or decrease the pH D) add a catalyst E) none of the above Answer: D

Difficulty: Easy Section Reference: 6-1

Learning Objective: Describe how enzymes differ from other catalysts

4) Chymotrypsin catalyzes the hydrolysis of a peptide bond and is therefore categorized as a _____.

A) oxidoreductase B) transferase C) hydrolase D) lyase E) ligase Answer: C Difficulty: Medium Section Reference: 6-1

Learning Objective: Describe how enzymes differ from other catalysts

5) The ability for an enzyme to pick out one particular substrate from the myriad of molecules floating around its environment is an example of _____.

A) natural selection B) specificity C) high affinity D) processivity E) none of the above Answer: B Difficulty: Easy Section Reference: 6-1

Learning Objective: Describe how enzymes differ from other catalysts

6) The highest point in a reaction coordinate diagram represents _____.

A) an intermediate of the reaction pathway B) the reactants in an exergonic reaction C) the products in an endergonic reaction D) the transition state

E) the overall G for the reaction Answer: D Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

7) How does a catalyst affect the overall G of an endergonic reaction?

A) it has no effect B) the reaction becomes more endergonic C) the reaction has a G of zero D) the reaction becomes exergonic E) none of the above Answer: A Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

8) How does a catalyst increase the rate of a reaction?

A) it makes the reaction more exergonic B) it increases the temperature of the reaction C) it allows reacting molecules to more easily form the transition state D) it causes a localized increase in the concentration of reactants E) none of the above Answer: C Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

9) An organic molecule that is tightly bound to an enzyme and participates in an enzyme catalyzed reaction is specifically referred to as a _____.

A) cofactor B) metal ion C) coenzyme D) cosubstrate E) prosthetic group Answer: E Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

10) An enzyme that forms a covalent bond with its substrate during the course of a reaction is considered to undergo _____.

A) acid-base catalysis B) covalent catalysis C) electrophilic catalysis D) metal ion catalysis E) none of the above Answer: B Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

11) Which of the following amino acids would be most likely found in the active site of an enzyme that uses acid-base catalysis?

A) Asn B) Ser C) Met D) His E) Trp Answer: D Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

12) Which of the following is seen in a reaction coordinate diagram for an enzyme-catalyzed reaction that uses covalent catalysis?

A) an intermediate B) two distinct transition states C) reactants that are lower in energy than an intermediate D) products that are lower in energy than an intermediate E) all of the above Answer: E Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

13) In the enzyme catalyzed decarboxylation of acetoacetate, a Schiff base is formed between the ketone of acetoacetate and a _____ residue in the active site of the enzyme.

A) Arg B) Asn C) Lys D) Glu E) Ser Answer: C Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

14) Of the following ions, which would be most likely to participate in metal ion catalysis?

A) Na+ B) Zn2+ C) Ag+ D) K+ E) Ba2+ Answer: B

Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

15) In an enzyme mechanism that generates a negative charge in the transition state, which of the following would be most effective to have in the active site of the enzyme?

A) transition metal cation B) Asp residue C) Gln residue D) transition metal anion E) none of the above Answer: A Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

16) What three amino acids are found in the catalytic triad of chymotrypsin?

A) Glu, His, Thr B) Ser, Arg, Cys C) Asp, His, Ser D) Cys, Lys, Glu E) Asn, His, Thr Answer: C Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

17) What amino acid performs the nucleophilic attack during the chymotrypsin mechanism?

A) Ser B) His C) Lys D) Cys

E) Thr Answer: A Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

18) During the first half of the chymotrypsin mechanism where the acyl-enzyme intermediate is formed, what role does His play?

A) general acid only B) general base only C) general acid then general base D) general base then general acid E) nucleophile Answer: D Difficulty: Hard Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

19) If the Asp in the chymotrypsin active site was mutated to another amino acid, which of the following would be considered an invisible mutation in that it is least likely to impact the function of the enzyme?

A) Asp  Asn B) Asp  Glu C) Asp  His D) Asp  Ser E) Asp  Lys Answer: B Difficulty: Medium Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

20) Of all the species that enzymes bind, they are thought to bind most tightly to _____.

A) substrates B) products C) transition states D) intermediates E) all are bound very tightly Answer: C Difficulty: Easy Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

21) In the chymotrypsin mechanism, what is used to stabilize the negative charge on the carbonyl oxygen of the transition state?

A) hydrogen bonding between the enzyme and the anion from the carbonyl oxygen B) electrostatic interaction of the positively charged His and carbonyl oxygen C) electrostatic interaction of the negatively charged Asp and carbonyl oxygen D) electrostatic interaction of the active site Zn2+ and carbonyl oxygen E) all of the above Answer: A Difficulty: Medium Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

22) If an enzyme rate increases 10-fold for every 5.7 kJ/mol decrease in the energy of activation, what rate increase would be observed if three H-bonds were stabilizing the transition state with each H-bond having a strength of 21 kJ/mol?

A) 11-fold increase B) 37-fold increase C) 60-fold increase D) 100-fold increase E) 1011-fold increase Answer: E Difficulty: Hard Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

23) When the transition state is formed, what is the specific interaction observed between Asp and His that helps stabilize the transition state?

A) dipole-dipole interaction B) electrostatic interaction C) hydrogen bond D) low-barrier hydrogen bond E) covalent bond Answer: D Difficulty: Medium Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

24) The ability for an enzyme to change its shape upon substrate binding represents the concept of _____.

A) lock and key B) induced fit C) proximity and orientation effects D) covalent catalysis E) none of the above Answer: B Difficulty: Easy Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

25) The enzyme hexokinase catalyzes a reaction where its substrates are completely sequestered from the aqueous environment allowing for interactions to occur between enzyme and substrates that would not normally occur in an aqueous environment. What term describes this type of catalysis?

A) electrostatic catalysis B) desolvation catalysis C) non-aqueous catalysis D) hydrogen-bonded catalysis

E) closed-system catalysis Answer: A Difficulty: Medium Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

26) Chymotrypsin catalyzes the hydrolysis of peptide bonds adjacent to _____ residues in a peptide.

A) neutral polar B) nonpolar C) negatively charged D) positively charged E) all of the above since chymotrypsin has little substrate specificity Answer: B Difficulty: Medium Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

27) What amino acid residue present in the specificity pocket allows trypsin to bind to peptides containing Arg or Lys? A) Ser B) His C) Lys D) Val E) Asp Answer: E Difficulty: Easy Section Reference: 6-4

Learning Objective: Recognize that chymotrypsin illustrates general features of enzyme evolution and physiology

28) Chymotrypsin has a large specificity pocket to bind the aromatic amino acids while elastase has a

very small specificity pocket meant to bind Ala or Gly. Which of the following amino acid substitutions changes the specificity pocket of chymotrypsin to that of elastase?

A) Trp  Ser B) Leu  Ala C) Gly  Val D) Lys  Asp E) Val  Asn Answer: C Difficulty: Medium Section Reference: 6-4

Learning Objective: Recognize that chymotrypsin illustrates general features of enzyme evolution and physiology

29) The molecule chymotrypsinogen is known as a(n) _____.

A) apoenzyme B) holoenzyme C) protease inhibitor D) zymogen E) none of the above Answer: D Difficulty: Easy Section Reference: 6-4

Learning Objective: Recognize that chymotrypsin illustrates general features of enzyme evolution and physiology

30) Which protein in the blood is responsible for converting fibrinogen to fibrin?

A) thrombin B) factor X C) factor VII D) factor VIIa E) prothrombin Answer: A Difficulty: Easy

Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade.

31) Conversion of factor X to factor Xa represents a(n) _____ form of activation; binding of antithrombin to thrombin represents a(n) _____ form of inhibition.

A) reversible; reversible B) irreversible; reversible C) reversible; irreversible D) irreversible; irreversible E) none of the above since antithrombin is not an inhibitor of thrombin Answer: B Difficulty: Medium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade.

32) Which of the following is true regarding heparin?

A) it is an allosteric activator of antithrombin B) it is a sulfated polysaccharide C) it simultaneously binds to antithrombin and the target of antithrombin D) it is used clinically as an anticoagulant E) all of the above Answer: E Difficulty: Hard Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade.

33) Zymogens are not enzymatically active because _____.

A) they do not contain the cofactors required for catalysis B) they are the product of mutated genes C) their active sites are distorted and incapable of enzymatic activity D) the pH of their environment is not optimal for activity E) none of the above

Answer: C Difficulty: Medium Section Reference: 6-4

Learning Objective: Recognize that chymotrypsin illustrates general features of enzyme evolution and physiology

34) Which of the following is a feature of protease inhibitor specific for trypsin?

A) contains a positive charge to mimic the charge of the substrate B) ability to interact with the Ser of the catalytic triad C) inability to form the tetrahedral intermediate D) high affinity for the enzyme active site E) all of the above Answer: E Difficulty: Hard Section Reference: 6-4

Learning Objective: Recognize that chymotrypsin illustrates general features of enzyme evolution and physiology

Question type: Text Entry

35) Fibrinogen is converted to _____ by the action of _____.

Answer 1: fibrin; fibrin monomers Answer 2: thrombin

Difficulty: Medium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

Question type: Dropdown

36) Thrombin is similar to ___ as it cleaves peptide bonds following ___ residues.

Dropdown 1: trypsin, chymotrypsin Dropdown 2: aspartate, alanine, arginine

Difficulty: Nedium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

37) Thrombin circulates in the blood as a(n) ___ that is called ___.

Dropdown 1: zymogen, isozyme Dropdown 2: prethrombin, prothrombin

Difficulty: medium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

38) The blood coagulation cascade is triggered when ___ is converted to ___.

Dropdown 1: factor IX, factor X, factor XI, prothrombin Dropdown 2: factor IXa, factor Xa, factor XIa, thrombin

Difficulty: Medium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

Question type: Text Entry

39) Name one protease inhibited by antithrombin.

Answer: factor IXa; factor Xa; thrombin

Difficulty: Easy Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

Question type: Dropdown

40) Heparin enhances the activity of ___ by acting as ___.

Dropdown 1: factor X, prothrombin, antithrombin Dropdown 2: a promoter for its synthesis, an allosteric activator

Difficulty: Medium Section Reference: 6-5

Learning Objective: Describe blood coagulation as a protease cascade

Question type: Multiple Choice

41) The ability for an enzyme to change its shape upon substrate binding represents the concept of _____.

A) lock and key B) induced fit C) proximity and orientation effects D) covalent catalysis E) none of the above

Answer: B

Difficulty: Easy Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

42) Enzyme X catalyzes the addition of a hydroxyl group to substrate Y. In the process a metal cofactor is reduced and then reoxidized. What class of enzyme is X?

A) oxidoreductase B) ligase C) hydrolase D) isomerase

E) lyase

Answer: A

Difficulty: Easy Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

43) When a substrate and enzyme interact, the first chemical species formed is the _____.

A) enzyme-substrate complex B) enzyme-transition state complex C) enzyme-product complex D) enzyme plus product E) none of the above

Answer: A

Difficulty: Easy Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

44) Which of these amino acid groups would not make a good nucleophilic catalyst?

A) amino B) sulfhydryl C) imidazole D) methyl E) hydroxyl

Answer: D

Difficulty: Easy Section Reference: 6-2 Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

45) Proton transfer from an acid, lowering the free energy of a reaction’s transition state, is characteristic of _____.

A) electrostatic catalysis B) nucleophilic catalysis C) general base catalysis D) general acid catalysis E) concerted acid-base catalysis

Answer: D

Difficulty: Easy Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

46) Curved arrows are conventionally used to illustrate the movement of _____.

A) electron pairs B) single electrons C) protons D) anions E) All of the above use this convention.

Answer: A

Difficulty: Easy Section Reference: 6-2 Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

47) The enzyme pictured below is shown in two configurations, A (open) and B (closed). Upon binding substrate in the active site, the enzyme converts the structure shown in B. Which of the following is true based on the given information?

A) The enzyme requires a high concentration of substrate to function.

B) This example exemplifies the “lock-and-key” model.

C) This enzyme must require ATP. D) This example exemplifies the concept of the “induced-fit” model.

E) None of the above

Answer: D

Difficulty: Moderate Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

48) Research scientists are trying to clone a gene. To accomplish this task, they join two pieces of DNA. Which class of the enzymes below might accomplish this task?

A) oxidoreductase B) ligase C) hydrolase D) isomerase E) lyase

Answer: B

Difficulty: Moderate

Section Reference: 6-3

Learning Objective: Explain how active site structure contributes to catalysis

49) How does a catalyst increase the rate of a reaction?

A) It makes the reaction more exergonic.

B) It increases the temperature of the reaction.

C) It allows reacting molecules to more easily form the transition state.

D) It causes a localized increase in the concentration of reactants.

E) None of the above

Answer: C

Difficulty: Moderate Section Reference: 6-1 Learning Objective: Describe how enzymes differ from other catalysts

50) The imidazole side chain of histidine can function as either a general acid catalyst or a general base catalyst because _____.

I. the imidazole group has a pKa in the physiological pH range II. in the physiological pH range, the nitrogen in the ring can be easily protonated/deprotonated III. one guanidine group is protonated, and the other is deprotonated at physiological pH IV. the imidazole group is a strong reducing agent at physiological pH

A) I, II B) I C) II, IV D) II, III E) IV

Answer: A

Difficulty: Moderate Section Reference: 6-2 Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

51) If you add enzymes to a solution containing only the product(s) of a reaction, would you expect any substrate to form?

A) It depends on the time interval and temperature of reaction.

B) It depends on the concentration of products added.

C) It depends on the energy difference between E + P and the transition state.

D) All of the above may determine if product forms.

E) None of the above determines if product forms.

Answer: C

Difficulty: Difficult Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

52) Which of the following amino acid residues would not provide a side chain for acid-base catalysis at physiological pH? (Assume pK values of each amino acid are equal to the pK value for the free amino acid in solution.)

I. leucine II. lysine III. aspartic acid IV. histidine

A) I, II, III B) I, II C) I D) II E) I, III

Answer: A

Difficulty: Difficult Section Reference: 6-2 Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

53) Which of the following would result in the greatest decrease in function of the catalytic triad found in serine proteases?

A) mutation to Ser, Cys, Asp B) mutation to Ser, His, Asp C) mutation to Cys, His, Asp D) mutation to Ser, His, Glu E) mutation to Cys, His, Glu

Answer: C

Difficulty: Difficult Section Reference: 6-2

Learning Objective: Describe the chemical mechanisms enzymes use to accelerate reactions

Essential Biochemistry Test Bank, Chapter 7: Enzyme Kinetics and Inhibition Question type: Multiple Choice

1) Which of the following is true about enzymes?

A) enzymes show very little specificity for their substrates B) enzymes catalyze reactions in only one direction C) enzyme activities can often be regulated D) enzymes reaction rates are generally slower than other chemical catalysts E) enzymes operate under a wide range of temperatures and pH Answer: C Difficulty: Medium Section Reference: 7-1

Learning Objective: Explain why an enzyme’s activity varies with substrate concentration

2) A plot of velocity versus substrate concentration for a simple enzyme-catalyzed reaction produces a _____. This indicates that at some point, the enzyme is _____.

A) straight line; inhibited by product B) hyperbolic curve; saturated with substrate

C) sigmoidal curve; inhibited by substrate D) hyperbolic curve; activated by substrate E) sigmoidal curve; saturated with substrate Answer: B Difficulty: Medium Section Reference: 7-1

Learning Objective: Explain why an enzyme’s activity varies with substrate concentration

3) When a substrate and enzyme interact, the first chemical species formed is _____.

A) enzyme-substrate complex B) enzyme-transition state complex C) enzyme-product complex D) enzyme plus product E) none of the above Answer: A Difficulty: Easy Section Reference: 7-1

Learning Objective: Explain why an enzyme’s activity varies with substrate concentration

4) How is an enzyme-catalyzed reaction affected by the addition of more enzyme?

A) velocity is not effected B) velocity will increase only if more substrate is also added C) velocity will increase D) velocity will decrease E) none of the above Answer: C Difficulty: Easy Section Reference: 7-1

Learning Objective: Explain why an enzyme’s activity varies with substrate concentration

5) For a reaction A + B → C, if [B] is much larger than [A] so that [B] essentially remains constant over the

course of the reaction, the kinetics will be _____.

A) zero-order B) hyperbolic C) first-order D) sigmoidal E) pseudo first-order Answer: E Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

6) Which of the following expresses the velocity for an enzyme-catalyzed reaction that obeys MichaelisMenten kinetics?

A) v = k1[E][S] B) v = k1[E][S] - k-1[ES] C) v = k1[E][S] + k2[ES] D) v = k2[ES] E) v = k2[ES] - k-1[ES] Answer: D Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

7) Which of the following must be true if the steady state assumption is to be used?

A) [E]T = [ES] B) (k2 - k-1) / k1 = 1 C) k1[E][S] = k2[ES] D) k1[E][S] = k2[ES] - k-1[ES] E) d[ES] / dt = 0 Answer: E Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

8) The Michaelis constant is defined as _____.

A) KM = k2 / k1 B) KM = (k2 + k-1) / k1 C) KM = (k2 - k-1) / k1 D) KM = (k2 + k1) / k-1 E) KM = (k2 - k1) / k-1 Answer: B Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

9) Which of the following properly expresses the Michaelis-Menten equation?

A) vo = Vmax [S] / (KM + [S]) B) vo = Vmax KM / (KM + [S]) C) kcat = Vmax / [E]T D) Vmax = vo [S] / (KM + [S]) E) Vmax = vo KM / (KM + [S]) Answer: A Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

10) When is KM considered to be the same as the dissociation constant for the ES complex i.e., KM  [E] [S] / [ES].

A) ES → E + P is fast compared to ES → E + S B) the turnover number is very large C) kcat/KM is near the diffusion-controlled limit D) k2 << k-1 E) KM can never be the same as the dissociation constant Answer: D Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

11) What percentage of Vmax is obtained when the substrate is present at ¼ of the KM? ` A) 5% B) 20% C) 25% D) 80% E) 100% Answer: B Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

12) If an enzyme-catalyzed reaction has a velocity of 2 mM/min and a Vmax of 10 mM/min when the substrate concentration is 0.5 mM, what is the KM? A) 0.2 mM B) 0.5 mM C) 1 mM D) 2 mM E) 5 mM Answer: D Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

13) Which of the following must be true for an enzymatic reaction obeying the Michaelis-Menten equation to reach 3/4 of its maximum velocity?

A) [S] must be ¾KM B) [S] must be 1.5KM C) [S] must be 2KM D) [S] must be 3KM E) [S] must be 4KM Answer: D Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

14) If an enzyme-catalyzed reaction with a KM of 3.5 mM has a velocity of 5 mM/min at a substrate concentration of 0.5 mM, what is the Vmax?

A) 0.625 mM/min B) 15 mM/min C) 17.5 mM/min D) 35 mM/min E) 40 mM/min Answer: E Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

15) What is the kcat for a reaction in which Vmax is 0.4 mmoles/min and the reaction mixture contains 5  106 micromoles of enzyme?

A) 2 x 10-14 min-1 B) 2 x 10-11 min-1 C) 8 x 107 min-1 D) 4 x 108 min-1 E) 8 x 109 min-1 Answer: C Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

16) The catalytic constant, or kcat, is also known as the _____.

A) turnover number B) saturation number C) catalytic efficiency number D) diffusion number E) Menten number Answer: A Difficulty: Easy

Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

17) Which of the following indicates that an enzyme has evolved to its most efficient form?

A) kcat is a large number B) KM is a small number C) KM is a large number D) kcat/KM is a small number E) kcat/KM is near the diffusion-controlled limit Answer: E Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

18) An extremely efficient enzyme has a _____ KM and a _____ kcat.

A) small; small B) small; large C) large; large D) large; small E) kcat and KM do nothing to predict the efficiency of an enzyme Answer: B Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

19) A Lineweaver-Burk plot is a _____.

A) double reciprocal plot B) Michaelis-Menten plot C) sigmoidal plot D) hyperbolic plot E) logarithmic plot Answer: A Difficulty: Easy

Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

20) If a Lineweaver-Burk plot gave a line with an equation of y = 0.490 x + 0.059, what is the velocity at a substrate concentration of 5 mM? The original units for substrate were in mM and velocity in mM/s.

A) 0.288 mM/s B) 0.399 mM/s C) 2.51 mM/s D) 6.37 mM/s E) the velocity cannot be determined from this data Answer: D Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

21) If a Lineweaver-Burk plot gave a line with an equation of y = 0.25 x + 0.34, what are the values of KM and Vmax if the substrate concentration is in mM and the velocity in mM/s?

A) 0.085 mM and 0.34 mM/s B) 2.9 mM and 0.023 mM/s C) 0.74 mM and 2.9 mM/s D) 0.37 mM and 1.4 mM/s E) 1.35 mM and .034 mM/s Answer: C Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

22) Which of the following types of enzyme-catalyzed reactions follows non-Michaelis-Menten kinetics?

A) bisubstrate reactions with a random mechanism B) bisubstrate reactions with a ping pong mechanism C) bisubstrate reactions with an ordered mechanism D) allosteric enzyme reactions E) all of the above Answer: E

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

23) In a bisubstrate reaction, reactant A binds, followed by reactant B which then get converted to products C and D. An experiment showed that B cannot bind without A having bound first. What mechanism is indicated by this data?

A) ordered mechanism B) random mechanism C) ping pong mechanism D) cooperative mechanism E) none of the above Answer: A Difficulty: Medium Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

24) In a bisubstrate reaction, reactant A binds and is then converted to product C. Next, reactant B binds and is then converted to product D. An experiment showed that B cannot bind without C being released first. What mechanism is indicated by this data?

A) ordered mechanism B) random mechanism C) ping pong mechanism D) cooperative mechanism E) none of the above Answer: C Difficulty: Hard Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

25) Some irreversible inhibitors are called _____ because they bind to the active site of the enzyme and begin the catalytic process, just like a normal substrate.

A) irreversible substrates B) suicide substrates C) noncompetitive substrates

D) ping pong substrates E) allosteric substrates Answer: B Difficulty: Easy Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

26) An inhibitor that binds to the active site only in the absence of the substrate and in a reversible fashion is a(n) _____.

A) allosteric inhibitor B) suicide substrate C) mixed inhibitor D) noncompetitive inhibitor E) competitive inhibitor Answer: E Difficulty: Easy Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors kinetics

27) How are the kinetics of an enzyme-catalyzed reaction affected by a competitive inhibitor?

A) Vmax decreased, KM increased B) Vmax decreased, KM decreased C) Vmax decreased, KM unchanged D) Vmax unchanged, KM increased E) Vmax unchanged, KM decreased Answer: D Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

28) If a Lineweaver-Burk plot was made for an enzyme-catalyzed reaction, both with and without a competitive inhibitor present, what difference would be seen?

A) the y-intercept would be lower for the inhibited reaction

B) the y-intercept would be higher for the inhibited reaction C) the slope would be less for the inhibited reaction D) the slope would be greater for the inhibited reaction E) none of the above Answer: C Difficulty: Hard Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

29) What type of inhibition explains why even at very high substrate concentrations, enzyme activity will decrease as time increases?

A) allosteric inhibition B) product inhibition C) transition state analogs D) irreversible inhibition E) uncompetitive inhibition Answer: B Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

30) What does the KI for a competitive inhibitor mean?

A) higher KI values mean tighter binding to ES complex B) lower KI values mean tighter binding to ES complex C) higher KI values mean tighter binding to the enzyme D) lower KI values mean tighter binding to the enzyme E) KI values tell nothing about inhibitor binding Answer: D Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

31) Which of the following is true regarding transition state analogs?

A) they are competitive inhibitors B) they bind to an active site with much higher affinity than most inhibitors C) they are much more stable than the transition state D) their affinity for an enzyme is often much greater that the substrate E) all of the above Answer: E Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

32) A reversible inhibitor that binds to a site other than the active site regardless of whether or not the substrate is bound is a _____.

A) noncompetitive inhibitor B) competitive inhibitor C) uncompetitive inhibitor D) allosteric inhibitor E) suicide substrate Answer: A Difficulty: Easy Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

33) How are the kinetics of an enzyme-catalyzed reaction affected by a purely noncompetitive inhibitor?

A) Vmax decreased, KM increased B) Vmax decreased, KM decreased C) Vmax decreased, KM unchanged D) Vmax unchanged, KM increased E) Vmax unchanged, KM decreased Answer: C Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

34) If a Lineweaver-Burk plot was made for an enzyme-catalyzed reaction, both with and without a

noncompetitive inhibitor present, what difference would be seen?

A) the y-intercept would be higher with slope unchanged for the inhibited reaction B) the y-intercept would be lower with larger slope for the inhibited reaction C) the y-intercept would be lower with smaller slope for the inhibited reaction D) the y-intercept would be higher with larger slope for the inhibited reaction E) the y-intercept would be higher with smaller slope for the inhibited reaction Answer: D Difficulty: Hard Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

35) How are the kinetics of an enzyme-catalyzed reaction affected by a mixed inhibitor?

A) Vmax decreased, KM increased or decreased B) Vmax decreased, KM decreased C) Vmax decreased, KM increased D) Vmax unchanged, KM increased E) Vmax unchanged, KM increased or decreased Answer: A Difficulty: Hard Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

36) A reversible inhibitor that only affects multisubstrate enzymes and binds to the enzyme only after one substrate has bound is a _____.

A) noncompetitive inhibitor B) uncompetitive inhibitor C) competitive inhibitor D) allosteric inhibitor E) suicide substrate Answer: B Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

37) Which of the following types of inhibition can be reversed by addition of more substrate?

A) noncompetitive inhibition B) competitive inhibition C) uncompetitive inhibition D) irreversible inhibition E) none of the above Answer: B Difficulty: Easy Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

38) Which of the following statements regarding allosteric enzymes is true?

A) they are always oligomeric B) they are generally found at regulatory sites in metabolic pathways C) they are subject to regulation by both positive and negative effectors D) a plot of velocity versus [substrate] often yields a sigmoidal curve E) all of the above Answer: E Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

39) Which of the following represents a rapid and reversible mechanism to alter the activity of an enzyme?

A) synthesis of more enzyme to increase activity B) degradation of enzyme to decrease activity C) covalent attachment of a phosphate group to increase or decrease activity D) movement of an enzyme from one cellular compartment to another E) none of the above Answer: C Difficulty: Medium Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

Question type: Dropdown

40) Acyclovir is an analog of ___ that lacks interferes with ___.

Dropdown 1: adenosine, guanosine, cytidine, thymidine Dropdown 2: DNA synthesis, protein synthesis Difficulty: Medium Section Reference: 7-4 Learning Objective: Describe the process of drug development

Question type: Text entry

41) If A  B is a zero-order reaction, the rate is dependent on ______.

Answer: the rate constant

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

Question type: Multiple Choice

42) In the plot below, can the KM be determined? If so, what is its value?

A) Yes, it is 30 mM. B) Yes, it is 30 mM/sec.

C) Yes, it is 60 mM/sec.

D) Yes, it is 60 mM. E) No, these data do not follow Michaelis-Menten kinetics.

Answer: A

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

43) From the graph below plotting data that was collected under steady state conditions, velocity on the y-axis in units of μM/s and substrate concentration of the x-axis in units of μM, what is the Vmax?

A) 0.24 μM/s B) 18 μM C) 0.2 μM D) 0.24 μM E) 0.12 μM/s

Answer: A

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

44) From the graph below plotting data that was collected under steady state conditions, velocity on the y-axis in units of μM/s and substrate concentration of the x-axis in units of μM, what is the KM?

A) 0.24 μM/s B) 18 μM C) 0.2 μM D) 0.24 μM E) 0.12 μM/s

Answer: B

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

45) KM

A) is the concentration of substrate where the enzyme achieves one-half Vmax B) is equal to Ks C) measures the stability of the product

D) is high if the enzyme has high affinity for the substrate E) All of the above

Answer: A

Difficulty: Easy Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

46) Irreversible enzyme inhibitors _____.

A) inactivate the enzyme B) inhibit competitively C) maximize product by minimizing ES  E + S D) behave allosterically E) function via ping pong mechanism

Answer: A

Difficulty: Easy Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

47) The breakdown of dopamine is catalyzed by the enzyme monoamine oxidase (MAO). What is the final concentration of product if the starting dopamine concentration is 0.050 M and the reaction runs

for 5 seconds? (Assume the rate constant for the reaction is 0.249 s−1.)

A) 0.050 M B) 0.014 M C) 0.018 M D) 1.2 M E) 0.025 M

Answer: B

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

48) Find the initial velocity for an enzymatic reaction when Vmax = 6.5 × 10–5 mol•sec–1, [S] = 3.0 × 10–3 M, KM = 4.5 × 10–3 M, and the enzyme concentration at time zero is 1.5 × 10-2 M.

A) 3.9 × 10–5 mol•sec–1 B) 2.6 × 10–5 mol•sec–1 C) 1.4 × 10–2 mol•sec–1 D) 8.7 × 10–3 mol•sec–1 E) Not enough information is given to make this calculation.

Answer: B

Difficulty: Moderate

Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior

49) When [S] = KM, 0 = (_____) × (Vmax).

A) [S] B) 0.75 C) 0.5 D) KM E) kcat

Answer: C

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

50) KM is _____.

A) a measure of the catalytic efficiency of the enzyme B) equal to half of Vmax C) the rate constant for the reaction ES  E + P D) the [S] that half-saturates the enzyme

E) a ratio of substrate concentration relative to catalytic power

Answer: D

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

51) The Michaelis constant KM is defined as _____.

I. (k–1 + k2)/k1 II. one-half Vmax III. [S] = [ES] IV. [ES]/2

A) I B) I, II C) II D) I, IV E) II, IV

Answer: A

Difficulty: Moderate Section Reference: 7-2

Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

52) Determine the KM and Vmax from the following graph. (Note: On the x-axis the minor tick mark spacing is 0.005; on the y-axis the minor tick mark spacing is 0.002) 0.05

0.04

1/v

0.03

0.02

0.01

0

-0.05

-0.025

0

-0.01

0.025

0.05

0.075

0.1

0.125

0.15

0.175

0.2

1/[S]

A) KM = [0.006]; Vmax = 0.0075/s B) KM = [0.196]; Vmax = 0.0075/s C) KM = [165]; Vmax = 33/s D) KM = [33]; Vmax = 167/s E) KM = [270]; Vmax x = 68/s

Answer: D

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

0.225

53) Based on the figure below, which of the following expressions would correctly define KM?

A) A = KM B) KM = A/2 C) B = KM D) C = –KM E) D= 1/KM

Answer: C

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior..

54) A new drug has been discovered that inhibits the reaction catalyzed by enzyme A. Based on the information shown below, what is this drug?

A) competitive inhibitor B) uncompetitive inhibitor C) mixed inhibitor D) allosteric activator E) more information is required to answer the question

Answer: A

Difficulty: Moderate Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

55) Which of the following is (are) true?

A) The [ES] will remain constant if k2 > k1 and k−1 < k2.

B) The reaction is zero order with respect to [S] if [S]>>[E] C) It describes a double displacement reaction D) All of the above are true.

E) None of the above is true.

Answer: B

Difficulty: Difficult Section Reference: 7-2

Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

56) For the reaction, the steady state assumption _____.

A) implies that k1 = k−1 B) implies that k−1 and k2 are such that the [ES] = k1[ES] C) [P]>>[E] D) [S] = [P] E) ES breakdown occurs at the same rate as ES formation

Answer: E

Difficulty: Difficult Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

57) Find kcat for a reaction in which Vmax is 4 × 10-4 mol•min-1 and the reaction mixture contains one microgram of enzyme (the molecular weight of the enzyme is 200,000 D).

A) 2 × 10-11 min-1 B) 8 × 107 min-1 C) 8 × 109 min-1 D) 2 × 10-14 min-1 E) 4 × 108 min-1

Answer: B

Difficulty: Difficult Section Reference: 7-2 Learning Objective: Use the Michaelis–Menten equation to describe enzyme behavior.

58) I propose to design a new drug that will act as an inhibitor for an enzyme. If I have used all current information about the mechanism of this enzyme to design this inhibitor and I carefully engineer it with similar chemical properties of the transition state, what type of inhibitor am I attempting to engineer, and how will I know if I have succeeded?

A) a competitive inhibitor; collect kinetic data both in the presence and absence of inhibitor and watch for a change in Vmax B) a competitive inhibitor; collect kinetic data both in the presence and absence of inhibitor and watch for a change in KM C) an uncompetitive inhibitor; collect kinetic data both in the presence and absence of inhibitor and watch for a change in KM D) an uncompetitive inhibitor; collect kinetic data both in the presence and absence of inhibitor and watch for a change in Vmax E) none of the above

Answer: A

Difficulty: Difficult Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

59) Following several experiments, the data presented on the graph below were obtained. What can you determine from this graph?

A) These data may have been collected both in the absence (solid line) and presence (dashed line) of a competitive inhibitor.

B) These data may have been collected both in the absence (solid line) and presence (dashed line) of a mixed (noncompetitive) inhibitor.

C) These data may have been collected both in the absence (solid line) and presence (dashed line) of a mechanism-based inhibitor.

D) These data may have been collected both in the absence (solid line) and presence (dashed line) of an inhibitor that binds the active site.

E) More than one of the above are correct.

Answer: B Difficulty: Difficult Section Reference: 7-3 Learning Objective: Distinguish the effects of different types of enzyme inhibitors

Essential Biochemistry Test Bank, Chapter 8: Lipids and Membranes Question type: Multiple Choice

1) What are the characteristics of most unsaturated fatty acids found within a human cell?

A) protonated carboxylic acid and trans double bonds B) deprotonated carboxylic acid and trans double bonds C) protonated carboxylic acid and cis double bonds D) deprotonated carboxylic acid and cis double bonds E) none of the above Answer: D Difficulty: Easy Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

2) Which of the following is considered an omega-3 fatty acid?

A) 9,12-Octadecadienoic acid B) 9,12,15-Octadecatrienoic acid C) 6,9,12-Octadecatrienoic acid D) 8,11,14-Eicosatrienoic acid E) 5,8,11,14-Eicosatetraenoic acid Answer: B Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

3) The major lipid component of cell membranes are _____.

A) triacylglycerols B) cholesterol C) glycerophospholipids D) cerebrosides E) gangliosides Answer: C Difficulty: Easy Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

4) Which of the following alcohols is esterified to the phosphate group of glycerophospholipids?

A) choline B) ethanolamine C) glycerol D) serine E) all of the above Answer: E Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

5) The most notable difference between _____ and other lipids is the presence of four fused rings.

A) cholesterol B) arachidonic acid C) gangliosides D) plasmologens E) triacylglycerols Answer: A Difficulty: Easy Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

6) Which of the following terms describes all glycerophospholipids?

A) zwitterionic B) amphipathic C) nonpolar D) amphoteric E) none of the above Answer: B Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

7) Which of the following is the primary building block for the synthesis of molecules like cholesterol or ubiquinone?

A) acetyl-CoA B) palmitic acid C) choline D) isoprene E) sphingosine

Answer: D Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

8) A type of lipid that commonly forms a waterproof barrier and is composed of a fatty acid and a fatty alcohol is called a _____.

A) terpenoid B) ganglioside C) capsaicin D) steroid E) wax Answer: E Difficulty: Easy Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

9) Which of the following vitamins is derived from cholesterol?

A) vitamin A B) vitamin D C) vitamin E D) vitamin K E) none of the above Answer: B Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

10) What two molecules are used in the synthesis of sphingosine?

A) arachidonic acid and serine B) stearic acid and isoprene

C) palmitic acid and choline D) linoleic acid and isoprene E) palmitic acid and serine Answer: E Difficulty: Medium Section Reference: 8-1

Learning Objective: Recognize the physical characteristics of lipids

11) Which of the following explains why free fatty acids do not form bilayers?

A) the width of the polar head is greater than the nonpolar tail B) the width of the polar head is less than the nonpolar tail C) the width of the polar head is equal to the nonpolar tail D) the width of the nonpolar head is greater than the polar tail E) the width of the nonpolar head is less than the polar tail Answer: A Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

12) As temperatures grow colder with the onset of winter, animals will adapt by changing the fatty acid composition of cell membranes. What characteristics of fatty acids will be seen?

A) longer chains with greater unsaturation B) longer chains with greater saturation C) shorter chains with greater unsaturation D) shorter chains with greater saturation E) chain length and saturation do not change in a cell membrane Answer: C Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

13) A membrane raft is a(n) _____ in the lipid bilayer of a cell membrane.

A) transmembrane protein B) integral membrane protein oriented to the intracellular side C) integral membrane protein oriented to the extracellular side D) region of high cholesterol and sphingolipid content E) none of the above Answer: D Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

14) Which of the following is true regarding membrane asymmetry?

A) transverse diffusion occurs very quickly B) lateral diffusion occurs very slowly C) a flippase causes lateral diffusion to occur very rapidly D) carbohydrates attached to membrane lipids are usually found on the cytosolic side of the membrane E) none of the above Answer: E Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

15) In an -helical protein that spans a cell membrane, _____ would likely be in the center of the membrane while _____ would likely be associated with the polar head groups and _____ would likely be associated with the aqueous environment A) Trp; Asn; Ala B) Leu; Gln; Asp C) Tyr; Glu; Gly D) Ile; Arg; Gln E) Val; Ser; Thr Answer: B Difficulty: Hard Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

16) Which of the following statements describes integral membrane proteins?

A) they never completely span the lipid bilayer B) they are easily removed by changes in pH or high salt C) the amino acids that contact the core of the membrane are hydrophobic D) they tend to be water soluble E) their association with the membrane is through an attached fatty acyl or prenyl group Answer: C Difficulty: Medium Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

17) If a transmembrane domain of protein contains -sheet structure, the overall structure of the transmembrane portion is likely a ____________.

A) -barrel B) -tube C) -turn D) -helix E) none of the above Answer: A Difficulty: Easy Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

18) Which fatty acid is commonly attached to proteins to allow membrane localization?

A) eicosapentaenoic acid (EPA) B) arachidonic acid C) linoleic acid D) myristic acid E) farnesylic acid Answer: D Difficulty: Medium Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

19) If polar amino acids are found in a membrane spanning -helical region, they are most likely _____.

A) mutations B) modified with nonpolar groups by prenylation, methylation and/or acylation C) hydrogen-bonded to other polar amino acids to prevent interaction with the membrane lipids D) hydrogen-bonded with hydroxyl groups of the membrane fatty acids E) none of the above Answer: C Difficulty: Hard Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

20) Which of the following is a characteristic of integral membrane proteins?

A) most of their movement is by lateral diffusion B) transverse diffusion occurs often but rather slowly C) interactions between proteins makes the membrane highly rigid D) all have carbohydrates attached to the extracellular domain E) none of the above Answer: A Difficulty: Medium Section Reference: 8-4 Learning Objective: Summarize the features of the fluid mosaic model

21) The carbohydrate portion of a membrane spanning glycoprotein is found _____.

A) spanning the membrane B) on both the cytoplasmic and extracellular sides of the membrane C) only on the cytoplasmic side of the membrane D) only on the extracellular side of the membrane E) carbohydrates are not found on membrane spanning glycoproteins Answer: D

Difficulty: Medium Section Reference: 8-4 Learning Objective: Summarize the features of the fluid mosaic model

22) Which of the following aspects of membrane protein movement is explained by the fluid mosaic model?

A) proteins that are immobile are often esterified to cholesterol via an Asp residue B) proteins that are mobile only in a small area are sequestered by proteins attached to the cytoskeleton C) proteins that freely diffuse through the membrane often undergo flip-flopping D) proteins confined to a lipid raft are linked to phosphatidylserine via and amide bond E) none of the above Answer: B Difficulty: Hard Section Reference: 8-4 Learning Objective: Summarize the features of the fluid mosaic model

Question type: Dropdown

23) ___ and ___ have the appropriate geometry to form lipid bilayers while ___ tends to form micelles.

Dropdown 1: Fatty acids, Waxes, Glycerophospholipids Dropdown 2: triacylglycerols, sphingolipids, isoprenoids Dropdown 3: fatty acids, triacylglycerols, sphingolipids Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Text Entry

24) For a saturated fatty acid, melting point _____ with increasing chain length due to a greater number of _____ interactions.

Answer 1: increases Answer 2: van der Waals Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Dropdown

25) In a mixed bilayer, longer acyl chains tend to be ___ than shorter acyl chains and unsaturated acyl chains are ___ than saturated chains.

Dropdown 1: more mobile, less mobile Dropdown 2: less mobile, more mobile Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Dropdown

26) In a mixed bilayer, cholesterol restricts the movement of nearby acyl chains, thus preventing the membrane from becoming too ___. Cholesterol inserts between membrane lipids, preventing close packing, thus preventing the membrane from becoming too ___.

Dropdown 1: solid, fluid Dropdown 2: solid, fluid Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Text Entry

27) Regions of a membrane that contain tightly packed cholesterol and sphingolipids are called _____ and are thought to have a _____ consistency.

Answer 1: membrane rafts; lipid rafts Answer 2: near-crystalline Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Dropdown

28) Transverse diffusion occurs ___ lateral diffusion occurs ___.

Dropdown 1: very rapidly, very slowly Dropdown 2: very rapidly, very slowly Difficulty: Medium Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Dropdown

29) A membrane protein in a lipid raft will ___ a membrane protein attached to the cytoskeleton will ___.

Dropdown 1: move freely through the entire membrane, move within a relatively small area Dropdown 2: be virtually immobile, move freely through the entire membrane Difficulty: Medium Section Reference: 8-4 Learning Objective: Summarize the features of the fluid mosaic model

Question type: Text entry

30) With respect to polarity, sphingolipids can be described as ______.

Answer: amphipathic

Difficulty: Easy Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

Question type: Multiple choice

31) Unsaturated fatty acids _____.

A) are commonly found in plants B) usually contain a double bond with cis stereochemistry C) sometimes contain multiple double bonds D) have lower melting points than the analogous saturated fatty acids E) all of the above

Answer: E Difficulty: Easy Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

32) A type of lipid that commonly forms a waterproof barrier and is composed of a fatty acid and a fatty alcohol is called a(n) _____.

A) terpenoid B) ganglioside C) isoprene D) steroid E) wax Answer: E Difficulty: Easy

Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

33) Which of the following amino acids from an integral membrane protein would likely contact the membrane?

A) Asn B) Gln C) Glu D) Ala E) Asp

Answer: D Difficulty: Easy Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

Question type: Text entry

34) ______ are the lipids that are most abundant even though they are not components of membranes.

Answer: Triacylglycerols Difficulty: Easy Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

Question type: Multiple choice

35) Which of the following lipids would not likely be found in a lipid raft?

I. glycosphingolipids II. glycerophospholipids III. cholesterol IV. palmitoleic acid

A) I, IV B) I, II, IV C) II, IV D) III, IV

E) IV

Answer: C Difficulty: Easy Section Reference: 8-2

Learning Objective: Describe the physical properties

36) Considering the characteristics of common fatty acids found in animals described in the text, which of the structures shown below would you consider the rarest fatty acid if found in animals?

A) structure A B) structure B

C) structure C D) structure D E) All structures would be equally rare.

Answer: C Difficulty: Moderate Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

37) Which of the structures below is an example of an -3 polyunsaturated fatty acid?

A) structure A B) structure B C) structure C D) structure D E) none of the above

Answer: B Difficulty: Moderate Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

38) Identify the compound below.

A) glycerophospholipid B) sphingosine C) ceramide

D) spingomylelin E) ganglioside

Answer: D Difficulty: Moderate Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

39) Which of the following structures correctly represents a glycerophospholipid?

A) structure A B) structure B C) structure C D) structure D E) none of the above

Answer: A Difficulty: Moderate Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

40) Which of the following segments of the integral membrane protein glycophorin most likely contains the membrane-spanning sequence?

A) LSTTEVAMHTTTSSSVSKSY B) SQTNDTHKRDTYAATPRA C) VSEISVRTVYPPEEETGE D) ITLIIFGVMAGVIGTILLI E) YGIRRLIKKSPSDVKPLP

Answer: D Difficulty: Moderate Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

41) Use the diagram below to answer the following question. The enzyme flippase would catalyze which of the following types of reactions?

A) exchange of a phospholipid in position A for a cholesterol in position A B) exchange for a lipid in position A for a lipid in position B C) exchange for a phospholipid in position A with a phospholipid in position C D) exchange of a lipid in position B for a lipid in position D E) exchange of a glycerophospholipid in position A for a sphingolipid in position C

Answer: B Difficulty: Moderate Section Reference: 8-4 Learning Objective: Summarize the features of the fluid mosaic model

42) Transmembrane proteins _____.

I. are predominantly constructed of a single hydrophobic α helix that serves as a pore II. are often constructed from bundles of hydrophobic α helices III. are sometimes constructed from β sheets and serve as pores IV. require detergents to remove them from membranes

A) I, III, IV B) II, III

C) II, III, IV D) I, IV E) II, IV

Answer: C Difficulty: Moderate Section Reference: 8-3

Learning Objective: Explain how proteins associate with membranes

Question type: Text entry

43) Regions of a membrane that contain tightly packed cholesterol and sphingolipids are called _____ and are thought to be important to _____.

Answer 1: lipid rafts Answer 2: cell signaling

Difficulty: Moderate Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Question type: Multiple choice

44) Rank the melting points of the following fatty acids from highest to lowest: (1)

cis-oleic (18:1)

(2)

trans-oleic (18:1)

(3)

linoleic (18:2)

(4)

stearic (18:0)

(5)

palmitic (16:0)

A) 1 > 2 > 3 > 5 > 4 B) 4 > 5 > 2 > 1 > 3 C) 4 > 5 > 3 > 2 > 1 D) 5 > 4 > 2 > 1 > 3 E) none of the above

Answer: B Difficulty: Difficult Section: 8-1 Learning objective: Recognize the physical characteristics of lipids

45) Which of the following classes of proteins associates with the membrane bilayer with the lowest energy and would therefore be most difficult to separate from the membrane?

A) extrinsic proteins B) lipid-linked proteins C) transmembrane proteins D) peripheral proteins E) hydrophilic proteins

Answer: C

Difficulty: Difficult Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

46) Which of the following statements describes integral membrane proteins?

I. They protect the contents of the cell from chaotropic agents such as urea.

II. They are easily dissociated from the membrane by changes in pH or high salt concentration.

III. They are held in place by hydrophobic effects between the membrane and hydrophobic amino acids.

A) I, II, III B) I, III C) I D) II E) III

Answer: E Difficulty: Difficult Section Reference: 8-2 Learning Objective: Describe the physical properties of the lipid bilayer

Essential Biochemistry Test Bank, Chapter 9: Membrane Transport Question type: Multiple Choice

1) What is the membrane potential created by a sodium gradient where [Na+]out = 145 mM and [Na+]in = 12mM at 37 C?

A) 67 mV B) 7.9 mV C) -7.9 mV D) -29 mV E) -67 mV Answer: E Difficulty: Hard Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

2) What is the [Na+]in/[Na+]out ratio created by depolarization in a nerve cell if the final potential is +50 mV at 37 C? A) 6.4  106 B) 6.5 C) 1.5 D) 0.15 E) 1.6  10-7 Answer: B Difficulty: Hard Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

3) Inside a nerve cell at rest, [Na+] is _____ and [K+] _____ relative to the concentrations seen outside the cell.

A) high; high B) high; low C) low; high D) low; low E) low; equal Answer: C Difficulty: Medium Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

4) Nerve cells contain high levels of _____ which is a derivative of _____.

A) phosphatidylethanolamine; palmitic acid B) cholesterol; isoprene C) phosphatidylcholine, phosphatidic acid D) sphingomyelin; sphingosine E) ganglioside GM1; ceramide Answer: D Difficulty: Medium Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

5) After depolarization of a nerve cell, what event restores the resting potential?

A) K+ efflux B) K+ influx C) Na+ efflux D) Na+ influx E) Cl- efflux Answer: A Difficulty: Medium Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

6) For a cell with [Na+]out = 150 mM and [Na+]in = 15 mM at 37 C, what is the free energy for movement of sodium ions from outside the cell to inside if the potential across the membrane is -60 mV? A) 11.7 kJ/mol B) 0.145 kJ/mol C) -0.145 kJ/mol D) -11.7 kJ/mol E) cannot be calculated from given information Answer: D

Difficulty: Hard Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

7) The movement of glucose into a cell when blood sugar is high is accomplished by _____. The movement of K+ against its concentration gradient is accomplished by _____.

A) simple diffusion; active transport B) passive transport; passive transport C) active transport; membrane potential D) simple diffusion; passive transport E) passive transport; active transport Answer: E Difficulty: Medium Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

8) All known porins are _____ proteins composed of _____.

A) monomeric; seven transmembrane -helices B) dimeric; -barrels C) dimeric; three transmembrane -helices D) trimeric; -barrels E) trimeric; four transmembrane -helices Answer: D Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

9) Which of the following will cause the opening or closing of a gated ion channel?

A) pH change B) phosphorylation C) voltage change D) ligand binding E) all of the above

Answer: E Difficulty: Easy Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

10) What type of transporter is responsible for moving water across membranes?

A) aquachannel B) aquaporin C) aquaphore D) aquaporter E) aquapermease Answer: B Difficulty: Easy Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

11) Which of the following statements regarding membrane transporters is true?

A) a porin is always open but only transports solutes in one direction B) an ion channel selective for K+ will also allow Na+ through since both are small enough to fit through the channel C) amphotericin is able to assemble inside a membrane in such a manner to form a channel through which K+ and Na+ flow, thus disrupting the ion gradient D) K+ channels can work in both directions, allowing the neuronal action potential to move in multiple directions E) none of the above Answer: C Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

12) Which amino acid in the aquaporin channel hydrogen bonds with water to prevent the movement of

protons?

A) Asn B) Leu C) Phe D) Val E) Ile Answer: A Difficulty: Easy Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

13) What is a transporter that moves two different molecules or ions in the same direction?

A) uniporter B) diporter C) symporter D) antiporter E) none of the above Answer: C Difficulty: Easy Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

14) Which of the following is true regarding the glucose transporter?

A) in addition to glucose, it will transport any other monosaccharide with six carbons B) binding of glucose causes a conformational change so that the transporter is never open on both sides of the membrane C) ATP hydrolysis prevents the transporter from working in reverse D) it is able to transport glucose into a cell against a concentration gradient E) none of the above Answer: B Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

15) The Na,K-ATPase is a(n) _____ that moves Na+ from _____ and K+ from _____.

A) antiporter; inside to out; outside to in B) antiporter; outside to in; inside to out C) symporter; inside to out; inside to out D) symporter; outside to in; outside to in E) none of the above Answer: A Difficulty: Medium Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

16) Hydrolysis of ATP by the Na,K-ATPase moves _____ while hydrolysis of the phosphate moves _____.

A) 3 Na+; 2 K+ B) 2 Na+; 3 K+ C) 3 K+; 2 Na+ D) 2 K+; 3 Na+ E) none of the above Answer: A Difficulty: Medium Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

17) The P-glycoprotein is an example of a(n) _____ which has been linked to drug resistance in the treatment of _____.

A) ABC transporter; bacterial infections B) ABC transporter; cancer C) Na,K-ATPase; viral infections D) Na,K-ATPase; parasitic infections E) none of the above Answer: B

Difficulty: Medium Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

18) Transport of glucose from the intestine into the intestinal cells is accomplished by a(n) ________. This is an example of ___________.

A) uniporter; passive transport B) uniporter; primary active transport C) symporter; primary active transport D) symporter; secondary active transport E) antiporter; secondary active transport Answer: D Difficulty: Hard Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

19) A sudden increase in the concentration of _____ causes the release of acetylcholine from the axon of a nerve cell.

A) Na+ B) K+ C) Ca2+ D) ClE) H+ Answer: C Difficulty: Easy Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

20) Which of the following would be the first to occur following opening of Ca 2+ channels during acetylcholine-mediated neurotransmission to a muscle cell?

A) binding of SNARE complex to synaptic vesicles and pre-synaptic membrane B) binding of acetylcholine to muscle cell receptors

C) reuptake of acetylcholine by the nerve cell D) hydrolysis of acetylcholine by acetylcholinesterase E) release of acetylcholine by the nerve cell Answer: A Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

21) Which type of ion channel is blocked by lidocaine, a local anesthetic?

A) K+ B) Na+ C) pre-synaptic Ca2+ D) post-synaptic Ca2+ E) none of the above Answer: B Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

22) Serotonin reuptake occurs by a(n) _____.

A) uniporter B) antiporter using Na+ C) antiporter using Ca2+ D) symporter using Na+ E) symporter using Ca2+ Answer: D Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

23) Which of the following is true regarding SNARE complex formation?

A) prior to membrane association, SNARE proteins are in an unfolded state B) two proteins of the SNARE complex come from the membrane and one from the synaptic vesicle C) formation of a four-helix complex is critical for membrane association of the vesicle D) formation of the SNARE complex is thermodynamically favorable, as is membrane fusion E) all of the above Answer: E Difficulty: Hard Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

24) Which of the following occurs during the fusion of a synaptic vesicle and cell membrane?

A) SNARE complexes dissociate to allow membrane fusion to occur B) addition of triacylglycerols to the membrane allows the bilayer to bow inward C) selective removal of acyl chains from membrane phospholipids allows the bilayer to bow outward D) the composition of the two membranes has no effect upon the rate of fusion E) none of the above Answer: C Difficulty: Hard Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

Question type: True/False

25) The GLUT proteins have little structural resemblance to other transport proteins despite having a similar mechanism of transport.

Answer: false Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

26) The GLUT transporters have a 12-stranded -barrel structure that spans the membrane of the cell.

Answer: false Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

Question type: Dropdown

27) The two conformational states of the GLUT proteins are ___ thus glucose ___.

Dropdown 1: in equilibrium, not in equilibrium Dropdown 2: can only be transported from outside the cell to inside, can only be transported from inside the cell to outside, can be transported in both directions.

Difficulty: Medium Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

Question type: Dropdown

28) At the neuromuscular synapse, acetylcholine is stored in vesicles in the ___ while acetylcholine receptors are found on the ___.

Dropdown 1: nerve cell, muscle cell Dropdown 2: nerve cell, muscle cell Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

Question type: True/Flase

29) Pinocytosis is a specific type of exocytosis where small amounts of intracellular material are sequestered in a vesicle followed by membrane fusion and transport of the material to the outside of the cell.

Answer: false Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

Question type: Dropdown

30) During receptor-mediated endocytosis, the movement of the receptor-ligand complex requires the presence of ___ that functions by mediating ___.

Dropdown 1: coat proteins, SNARE proteins Dropdown 2: direct movement of the receptor-ligand complex through the membrane, pinching off a portion of the membrane containing the receptor-ligand complex Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

Question type: Dropdown

31) Exosomes often contain ___, ___ and ___.

Dropdown 1: proteins, glucose, ATP

Dropdown 2: neurotransmitters, lipids, membrane receptors Dropdown 3: myoglobin, RNA, protease enzymes Difficulty: Medium Section Reference: 9-4

Learning Objective: Describe the process of membrane fusion

Question type: Multiple choice

32) Integrins and aquaporins are examples of _____.

A) uniporters B) peripheral membrane proteins C) integral membrane proteins D) signal transduction receptors E) none of the above is correct

Answer: C Difficulty: Easy Section Reference: 9-2

Learning Objective: Describe the operation of passive transport systems

Question type: Text entry

33) An example of nonmediated transport is ______.

Answer: simple diffusion Difficulty: Easy Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

34) A transporter that moves two substances simultaneously in the same direction is an example of a(n) ______.

Answer: symport

Difficulty: Easy Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

Question type: Multiple choice

35) Which of the following is an example of nonmediated transport?

A) simple diffusion B) facilitated diffusion C) passive transport D) active transport E) all of the above

Answer: A Difficulty: Easy Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

36) A pore that simultaneously transports two different molecules in different directions is called _____.

A) a symport B) a uniport C) a gap junction D) an equilibrium channel E) an antiport

Answer: E Difficulty: Easy Section Reference: 9-3

Learning Objective: Describe the operation of active transport systems

37) D-Glucose and D-Mannitol are similarly soluble, but D-Glucose is transported through the erythrocyte membrane four times as rapidly as D-Mannitol. What is the most likely explanation?

A) D-Glucose undergoes simple diffusion more rapidly than D-Mannitol because glucose is less polar.

B) D-Glucose and D-Mannitol enter the erythrocyte via an ion-gated channel.

C) D-Glucose and D-Mannitol are transported via a system that distinguishes the two sugars.

D) D-Glucose flux through the membrane is linear, whereas D-Mannitol flux is described by a hyperbolic curve.

E) None of the above provides the explanation.

Answer: C Difficulty: Moderate Section Reference: 9-1

Learning Objective: Explain how ion movements affect membrane potential

38) Use the diagram below to answer the following question. The enzyme flippase would catalyze which of the following types of reactions?

A) exchange of a phospholipid in position A for a cholesterol in position A B) exchange for a lipid in position A for a lipid in position B C) exchange for a phospholipid in position A with a phospholipid in position C D) exchange of a lipid in position B for a lipid in position D E) exchange of a glycerophospholipid in position A for a sphingolipid in position C

Answer: B

Difficulty: Moderate Learning Objective: Describe the operation of active transport systems

Essential Biochemistry Test Bank, Chapter 10: Signaling Question type: Multiple Choice

1) Hormones bind to _____ with _____ affinity.

A) ligands; low B) agonists; high C) antagonists; low D) G proteins; low E) receptors; high Answer: E Difficulty: Medium Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

2) When a receptor loses its ability to transmit a signal following continuous exposure to a ligand, the receptor is said to be _____.

A) saturated B) desensitized C) transduced D) specific E) none of the above Answer: B Difficulty: Easy Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

3) Which of the following can be a hormone?

A) amino acid derivatives B) steroids C) polypeptides D) eicosanoids E) all of the above Answer: E Difficulty: Medium Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

4) A sample of cells with a total receptor concentration of 50 M was incubated with a ligand concentration of 100 M. Following the incubation period, the concentration of unbound receptors was determined to be 15 M. What is the Kd for the receptor-ligand interaction?

A) 28 M B) 43 M C) 143 M D) 217 M E) 333 M Answer: A Difficulty: Hard Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

5) A small molecule produced inside a cell in response to a hormone binding to its receptor is called a(n) _____.

A) inside messenger B) agonist C) antagonist D) second messenger E) G protein Answer: D Difficulty: Easy Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

6) Which of the following is a ligand of the 2-adrenergic receptor?

A) tyrosine B) serotonin C) norepinephrine D) caffeine E) adenosine Answer: C Difficulty: Easy Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

7) Activation of a G protein in response to hormone binding requires binding of _____ to the _____ subunit.

A) GDP;  B) GTP;  C) GDP;  D) GTP;  E) GDP;  Answer: B Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

8) What enzyme is activated by association with an active G protein?

A) adenylate cyclase B) cAMP phosphodiesterase C) protein kinase A D) protein kinase G E) all of the above Answer: A Difficulty: Easy Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

9) The second messenger _____ is produced by the enzyme _____.

A) nitric oxide; arginase B) cGMP; GTP cyclase C) cAMP; adenylate cyclase D) triacylglycerol; phospholipase C E) inositol diphosphate; phospholipase C Answer: C Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

10) cAMP binds to the _____ subunits of protein kinase A allowing the tetramer to dissociate into _____.

A) active subunits; an active dimer and two inactive monomers B) active subunits; two active monomers and an inactive dimer C) regulatory subunits; an active dimer and two inactive monomers D) regulatory subunits; two active monomers and an inactive dimer E) regulatory subunits; two active monomers and two inactive monomers Answer: D Difficulty: Hard Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

11) What two amino acid residues are the targets of protein kinase A? A) Asn and Gln B) Thr and Ser C) Tyr and Thr D) Ser and Tyr E) Cys and Ser Answer: B Difficulty: Easy

Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

12) Desensitization of a G protein-coupled receptor is caused by phosphorylation of the receptor by a specific kinase. What protein recognizes the phosphorylated receptor?

A) phospholipase C B) the G protein  subunit C) cAMP phosphodiesterase D) adenosine receptor E) arrestin Answer: E Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

13) The second messenger _____ opens Ca2+ channels in the endoplasmic reticulum.

A) inositol trisphosphate B) diacylglycerol C) cAMP D) cGMP E) nitric oxide Answer: A Difficulty: Easy Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

14) Ligand binding to a receptor tyrosine kinase causes _____ of the receptor which then _____ the next protein in the signaling pathway.

A) methylation; hydrolyzes B) hydrolysis; inhibits C) phosphorylation; phosphorylates D) acylation; activates

E) none of the above Answer: C Difficulty: Medium Section Reference: 10-1 and 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

15) The _____ receptor is a receptor tyrosine kinase.

A) 1- adrenergic B) 2-adrenergic C) calmodulin D) insulin E) cortisol Answer: D Difficulty: Easy Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

16) Activity of the Ras protein is analogous to the _____ in terms of its ability to bind GTP. A) G protein  subunit B) G protein  subunit C) G protein  subunit D) calmodulin E) all of the above Answer: A Difficulty: Medium Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

17) Where are the ultimate targets of the Ras-dependent signaling cascade located within the cell?

A) cytoplasm

B) nucleus C) endoplasmic reticulum D) mitochondria E) cell membrane Answer: B Difficulty: Medium Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

18) The ability for some receptor tyrosine kinases to ultimately activate phospholipase C is an example of _____.

A) antagonism B) desensitization C) autophosphorylation D) poor receptor-ligand specificity E) cross-talk Answer: E Difficulty: Medium Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

19) Which of the following hormones is able to cross biological membranes and thus the receptor is found inside the cell, not on the cell surface?

A) insulin B) glucagon C) cortisol D) epinephrine E) platelet derived growth factor Answer: C Difficulty: Easy Section Reference: 10-4

Learning Objective: Compare lipid signaling to other signal transduction pathways

20) The complex formed between a lipid hormone and its receptor binds to _____ which are specific DNA sequences.

A) transcription factors B) nuclear localization sequences C) DNA-binding domains D) hormone response elements E) none of the above Answer: D Difficulty: Easy Section Reference: 10-4

Learning Objective: Compare lipid signaling to other signal transduction pathways

21) The eicosanoids are derived from the membrane fatty acid _____.

A) stearic acid B) linoleic acid C) -linolenic acid D) arachidonic acid E) docosahexaenoic acid (DHA) Answer: D Difficulty: Easy Section Reference: 10-4

Learning Objective: Compare lipid signaling to other signal transduction pathways

22) Which of the following is an inhibitor of cyclooxygenase?

A) acetaminophen B) aspirin C) eicosanoic acid D) thromboxane E) progesterone Answer: B Difficulty: Medium Section Reference: 10-4

Learning Objective: Compare lipid signaling to other signal transduction pathways

23) Which of the following can be regulated by eicosanoids?

A) blood pressure B) blood coagulation C) inflammation D) fever E) all of the above Answer: E Difficulty: Easy Section Reference: 10-4

Learning Objective: Compare lipid signaling to other signal transduction pathways

Question type: Dropdown

24) In order for cAMP to ___ protein kinase A, cAMP binds to the ___ subunits.

Dropdown 1: inhibit, activate Dropdown 2: regulatory, catalytic, allosteric Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Question type: Dropdown

25) The action of a ___ results in the hydrolysis of cAMP, thus decreasing the signal from ___.

Dropdown 1: nucleotide kinase, phosphodiesterase

Dropdown 2: epinephrine, insulin Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Question type: Dropdown

26) The action of phospholipase c produces the second messengers ___ and ___.

Dropdown 1: inositol trisphosphate, diacylglycerol phosphate Dropdown 2: diacylglycerol, inositol bisphosphate Difficulty: Medium Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Question type: True/False

27) Two molecules of insulin must bind to the insulin receptor in order for activation to occur.

Answer: false

Difficulty: Easy Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

Question type: Dropdown

28) Interaction of the Ras protein with ___ results in activation by ___ Dropdown 1: an adaptor protein, a receptor tyrosine kinase Dropdown 2: binding of GTP, hydrolysis of GTP Difficulty: Medium Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

Question type: Text entry

29) Proteins that bind molecules and elicit a cellular response are called _____.

Answer: receptors Difficulty: Easy Section Reference: 10-1

Learning Objective: Summarize the properties of a receptor

30) A molecule that often functions as a second messenger is ______.

Answer: cyclic AMP

Difficulty: Easy Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Question type: Multiple choice

31) Which of the following functions as a regulatory protein by dephosphorylating activated enzymes?

A) receptor tyrosine kinase B) phosphoprotein phosphatase C) heterotrimeric G protein phosphorylase D) guanine nucleotide exchange factor E) Sos protein Answer: B Difficulty: Easy Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Question type: Text entry

32) The _____ signaling pathway undergoes autophosphorylation, resulting in kinase activation.

Answer: receptor tyrosine kinase Difficulty: Easy Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

Question type: Multiple choice

33) Which of the following is (are) an advantage(s) of protein phosphorylation regarding biochemical signaling?

I. Phosphorylation is rapid and specific.

II. Phosphorylation is enzymatically reversible.

III. Phosphorylation can be amplified by cascade systems.

IV. Phosphorylation results in covalent modification of enzymes and proteins.

A) I, II, III, IV B) II, III, IV C) II, III D) I, II E) III only

Answer: A Difficulty: Moderate Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

34) The activity of protein kinase A is affected by which of the following?

I. activated adenylate cyclase II. levels of cAMP III. phosphodiesterases

A) I only B) II only C) III only

D) I and II E) I, II, and III

Answer: E Difficulty: Moderate Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

35) Which of the following correctly states an essential step in the function of heterotrimeric G protein function?

A) A cascade of events must occur that ultimately activates protein kinase C. B) Binding of a hormone to a receptor must signal the exchange of GDP for GTP. C) Binding of GTP to the receptor protein must induce a change in conformation of the receptor.

D) Binding of cAMP to the α subunit of the G protein must initiate translocation of the subunit.

E) All of the above are correct.

Answer: B Difficulty: Moderate Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

36) Insulin binds to a receptor that _____.

I. is coupled to a G protein II. possesses tyrosine kinase activity III. possesses serine/threonine phosphatase activity IV. interacts with proteins such as IRS-1 A) I, II, III B) II only C) I, III D) II, IV E) I, IV

Answer: D Difficulty: Moderate Section Reference: 10-3

Learning Objective: Describe the receptor tyrosine kinase signaling pathway

37) Heterotrimeric G proteins _____.

I. consist of three subunits, G, G, and G II. function as an autoinhibtory segment III. can function as a mediator to adenylate cyclase activity IV. are anchored to the cytoplasmic side of the membrane

A) I, II, IV B) I, III, IV C) I, IV D) I, III E) I only

Answer: B Difficulty: Difficult Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

38) Which of the following is (are) associated with cAMP binding to cAMP-dependent protein kinase A (PKA)?

I. cAMP binds to the regulatory subunits.

II. PKA tetrameric regulatory subunits and catalytic subunits dissociate.

III. Catalytic subunits phosphorylate multiple targets with specific serine and threonine residues.

IV. cAMP is membrane bound via phosphoinositol attachment.

A) I, II, III, IV B) I, II, III C) I, II D) II, III, IV E) III, IV

Answer: B Difficulty: Difficult Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

39) Which of the following correctly ranks the steps in the secretory pathway?

1. Ligand (hormone) binds to receptor.

2. Activated adenylate cyclase produces cAMP from ATP. 3. G protein α subunit exchanges bound GDP for GTP. 4. cAMP binds to the regulatory subunits of PKA, activating it.

5. G α subunit dissociates from complex and activates adenylate cyclase.

6. Active PKA subunits phosphorylate targets in the cell, regulating function.

7. The catalytic subunits of PKA dissociate.

A) 1, 2, 5, 4, 6, 7, 3 B) 1, 3, 5, 2, 4, 7, 6

C) 2, 4, 1, 3, 5, 6, 7 D) 2, 4, 3, 5, 4, 6, 7 E) 1, 3, 4, 2, 5, 7, 6

Answer: B Difficulty: Difficult Section Reference: 10-2

Learning Objective: Describe signaling via G protein-coupled receptors

Essential Biochemistry Test Bank, Chapter 11: Carbohydrates Question type: Multiple Choice

1) The molecular formula for a monosaccharide is _____ where _____.

A) CnH2n+2On; n  3 B) CnH2nOn; n  3 C) CnH2nOn; n  4 D) CnH2n+2On; n  4 E) none of the above Answer: B Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

2) The three-carbon monosaccharide _____ is a(n) _____.

A) dihydroxyacetone; enantiomer B) fructose; triose C) ribose; hemiacetal D) galactose; ketose E) glyceraldehyde; aldose

Answer: E Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

3) What is the only monosaccharide that is achiral?

A) glyceraldehyde B) ribose C) galactose D) dihydroxyacetone E) fructose Answer: D Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

4) Glucose and galactose are _____ of each other.

A) epimers B) enantiomers C) diastereomers D) anomers E) none of the above Answer: A Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

5) Which of the following best describes the relationship between the following molecules?

A) epimers B) anomers C) diastereomers D) pentoses E) one is a D sugar, one is an L sugar Answer: E Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

6) Which of the monosaccharides seen below are L sugars?

A) A and B B) A and C C) B and C D) C and D E) A, B and C Answer: D Difficulty: Medium Section Reference: 11-1

Learning Objective: Identify the structural features of monosaccharides and their derivatives

7) Which monosaccharide(s) seen below is(are) the enantiomer(s) of A?

A) B B) C C) D D) B and C E) C and D Answer: C Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

8) Which two monosaccharides seen below are epimers?

A) A and B B) A and C C) B and C D) C and D E) B and D Answer: A

Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

9) The transformation of a monosaccharide into its _____ occurs easily and does not require the assistance of a catalyst.

A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above Answer: B Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

10) In the following structure, which carbon is the anomeric carbon?

A) A B) B C) C D) D E) E Answer: E Difficulty: Medium Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

11) Which of the following Haworth projections correctly shows the  anomer of galactose?

A) A B) B C) C D) D E) none of the above Answer: D Difficulty: Hard Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

12) At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes the solution?

A) consists of approximately equal amounts of the - and -anomers B) the -anomer is more stable and is slightly preferred over the -anomer C) the -anomer predominates over the -anomer by a ratio of approximately 2:1 D) straight-chain form is present in high concentration E) none of the above Answer: C Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

13) The reaction between an alcohol and an anomeric carbon of a carbohydrate forms a _____ bond.

A) anomeric B) glycosidic

C) hemiacetal D) ester E) ether Answer: B Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

14) Any sugar that has a free aldehyde group is called a(n) _____.

A) reducing sugar B) non-reducing sugar C) ketose D) aldohexose E) alditol Answer: A Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

15) Which of the following is glucose-6-phosphate?

A) A B) B C) C D) D E) none of the above Answer: C Difficulty: Medium

Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

16) Which of the following would be positively charged at physiological pH? A) glucuronic acid B) fructose-6-phosphate C) xylitol D) glucosamine E) all of the above Answer: D Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

17) The following is a(n) _____ disaccharide with a(n) _____ glycosidic bond.

A) ; (14) B) ; (11) C) ; (14) D) ; (11) E) ; (14) Answer: C Difficulty: Hard Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

18) Which of the following disaccharides has both anomeric carbons involved in the glycosidic bond?

A) lactose B) maltose C) amylose D) chitin E) sucrose Answer: E Difficulty: Easy Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

19) Lactase, the enzyme responsible for breaking lactose into its monomers, is a(n) _____ enzyme.

A) -galactosidase B) -amylase C) -glycosidase D) -glycosyltransferase E) none of the above Answer: A Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

20) Amylopectin contains primarily _____ glycosidic bonds with _____ glycosidic bonds as branch points.

A) (14); (12) B) (14); (16) C) (14); (16) D) (14); (14) E) (14); (16) Answer: B Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

21) Which of the following is the major difference between glycogen and amylopectin?

A) glycogen contains -glycosidic bonds, amylopectin contains -glycosidic bonds B) glycogen is branched, amylopectin is linear C) glycogen contains a reducing end, amylopectin does not D) glycogen contains about twice the number of branch points as amylopectin E) glycogen is found in plants, amylopectin is found in animals Answer: D Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

22) Which of the following are characteristic of cellulose?

A) highly extended fibers B) (14) glycosidic bonds C) extensive hydrogen bonding between individual molecules D) unbranched polymer E) all of the above Answer: E Difficulty: Easy Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

23) Which of the following is a heteropolysaccharide?

A) amylopectin B) cellulose C) pectin D) chitin E) none of the above Answer: C Difficulty: Easy Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

24) The enzyme _____ from _____ allows animals such as cows to derive energy from cellulose.

A) chitinase; termites B) cellulase; microorganisms C) glucosyltransferase; viruses D) lactase; microorganisms E) none of the above Answer: B Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

25) Which of the following is a major difference between cellulose and chitin?

A) chitin is produced by insects, cellulose is produced by plants B) chitin contains glucose and glucosamine, cellulose contains only glucose C) chitin contains (16) glycosidic bonds, cellulose contains (14) glycosidic bonds D) chitin is a branched polymer, cellulose is linear E) none of the above Answer: A Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

26) Unlike proteins and oligonucleotides, polysaccharides _____.

A) are readily metabolized in the absence of specialized enzymes B) often have branched structures C) are achiral D) are always completely water soluble E) are components of every known living organism Answer: B

Difficulty: Medium Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

27) O-linked oligosaccharides are commonly attached to the oxygen of _____.

A) ribose B) tyrosine C) lysine D) threonine E) galactose Answer: D Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

28) N-linked oligosaccharides can be covalently linked to proteins at the amino acid _____.

A) Gln B) Pro C) Lys D) Arg E) Asn Answer: E Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

29) The initial addition of oligosaccharides of N-glycosylated proteins occurs in the _____.

A) lysosome B) Golgi apparatus C) endoplasmic reticulum D) vacuole E) cytoplasm

Answer: C Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

30) Processing of N-glycosylated proteins within the Golgi apparatus involves the removal of monosaccharides by _____ and addition of new monosaccharides by _____.

A) glycosidases; glycosyltransferases B) epimerases; glycosidases C) cellulases; lactases D) glycosyltransferases; N-amidases E) proteases; glycosylases Answer: A Difficulty: Medium Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

31) What glycosidic bonds are seen in the following portion of an N-linked oligosaccharide?

Abbreviations: galactose: Gal; glucose: Glu; N-acetylglucosamine: NAG

A) (14) between Gal and NAG; (16) between Glu and NAG B) (14) between Gal and NAG; (13) between Glu and NAG C) (13) between Gal and NAG; (14) between Glu and NAG D) (14) between Gal and NAG; (13) between Glu and NAG E) (14) between Gal and NAG; (13) between Glu and NAG

Answer: D Difficulty: Hard Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

32) In the ABO blood type system, how many monosaccharides are found in each of the oligosaccharides for the various blood types?

A) A: 3, B) A: 4, C) A: 6, D) A: 6, E) A: 5,

B: 4, B: 5, B: 5, B: 6, B: 5,

O: 3 O: 4 O: 5 O: 5 O: 4

Answer: E Difficulty: Hard Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

33) In a _____, the carbohydrate is responsible for most of the mass; in a _____, the protein is responsible for most of the mass.

A) glycoprotein; proteoglycan B) proteoglycan; glycoprotein C) N-linked glycoprotein; O-linked glycoprotein D) O-linked glycoprotein; N-linked glycoprotein E) N-linked proteoglycan; O-linked glycoprotein proteoglycan Answer: B Difficulty: Medium Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

34) Chondroitin sulfate, shown below, contains which of the following?

A) a (13) glycosidic bond B) a (14) glycosidic bond C) a glucuronic acid residue D) a sulfate ester of N-acetylgalactosamine E) all of the above Answer: E Difficulty: Hard Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

35) Which of the following describes glycosaminoglycans?

A) found in extracellular space B) associated with the cytoskeleton C) bound to other proteins to minimize interactions with water D) homopolymer composed of only one type of monosaccharide E) none of the above Answer: A Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

36) Bacterial cell walls are made of _____.

A) pectin B) chondroitin sulfate C) peptidoglycans D) keratin sulfate E) heparin Answer: C Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

37) The active portion of the penicillin molecule is the _____ ring.

A) glucopyranose B) fructofuranose C) 5-membered sulfur containing D) -lactam E) none of the above Answer: D Difficulty: Medium Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

Question type: True/False

38) Milk contains many oligosaccharides that cannot be digested by mammalian enzymes but instead are thought to serve as a source of nutriment for intestinal bacteria.

Answer: true

Difficulty: Medium

Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

Question type: Dropdown

39) In eukaryotes, intracellular proteins can be glycosylated by attachment of ___ to a ___ residue.

Dropdown 1:N-acetylglucosamine, N-acetylgalactosamine Dropdown 2: tyrosine or asparagine, serine or threonine Difficulty: Medium Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

Question type: Multiple choice

40) Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid except Pro?

A) Gln—X—Ser B) His—X—Ser C) Arg—X—Ser D) Asn—X—Ser E) Asp—X—Ser

Answer: D Difficulty: Easy

Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

41) Which of the following describes glycosaminoglycans?

A) found in extracellular space B) associated with the cytoskeleton C) bound to other proteins to minimize interactions with water D) homopolymer composed of only one type of monosaccharide E) none of the above Answer: A Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

Question type: Text entry

42) The main component of a bacterial cell wall is a ______.

Answer: peptidoglycan Difficulty: Easy Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

Question type: Multipart

43) We encounter a great variety of sugars in living organisms. a. Are most carbohydrates in living organisms D or L? b. Draw a Fischer projection of the smallest aldose (include all atoms). c. What is the name of this molecule?

Answer: a. D

b. see drawing c. D-Glyceraldehyde

Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

Question type: Text entry

44) The _____ sugars are monosaccharides in which a hydroxyl group is replaced with a hydrogen atom.

Answer: deoxy

Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

Question type: Multiple choice

45) The bonding of alcohols to the anomeric center of a carbohydrate results in the formation of a(n) _____ bond.

A) anomeric B) amide C) glycosidic D) ester E) hydrogen

Answer: C Difficulty: Easy Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

46) In a _____, the carbohydrate is responsible for most of the mass; in a _____, the protein is responsible for most of the mass.

A) glycoprotein; proteoglycan B) proteoglycan; glycoprotein C) N-linked glycoprotein; O-linked glycoprotein D) O-linked glycoprotein; N-linked glycoprotein

E) N-linked proteoglycan; O-linked glycoprotein proteoglycan Answer: B Difficulty: Moderate Section Reference: 11-3

Learning Objective: Describe the structures and functions of glycoproteins

47) The structure below shows a Fischer projection of D-Idose.

Which of the structures below represents -D-Idopyranose?

Answer: E

Difficulty: Moderate Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

This figure is used in questions 48–50.

48) The structure shown in the figure above represents a _____.

A) glucopyranose.

B) ribofuranose C) myo-inositol D) fructofuranose E) glucofuranose

Answer: D Difficulty: Moderate Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

49) Which of the carbon atoms shown in the figure above represent the anomeric carbon?

A) A B) B C) C D) D E) E

Answer: E Difficulty: Moderate Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

50) The configuration around which carbon atom shown in the figure above determines whether this is a D or an L sugar?

A) A B) B C) C D) D E) E

Answer: A Difficulty: Moderate

Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

51) Which structure(s) shown in the figure above represent reducing sugar(s)?

A) A B) D C) C and D D) A, B, C, and D E) A, B, and C

Answer: E Difficulty: Moderate Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives

Question type: Multipart

52) The drawing below shows the structure of the disaccharide sucrose.

a. What are the names of the two monosaccharides that form sucrose? b. Draw squares around the carbons that determine the designation D or L for each of the monosaccharides. c. Draw circles around the anomeric carbon atoms on the drawing. d. Indicate on the drawing for each of the anomeric carbon atoms whether they are in the  or the  configuration. e. Is sucrose a reducing sugar? Explain your answer in one sentence.

Answer: a. glucose (glucopyranose) and fructose (fructofuranose).

b. see drawing c. see drawing d. see drawing

e. Sucrose is a nonreducing sugar because both anomeric carbons are involved in a glycosidic bond.

Difficulty: Moderate Section Reference: 11-2

Learning Objective: Relate the structures of polysaccharides to their biological functions

Question type: Multiple choice

53) Conversion of galactose to glucose _____,

I. may require an epimerase II. requires uridine diphosphate III. requires a transferase IV. requires an isomerase A) I, II, III, IV B) I, II, III C) II, III, IV D) II, III E) I, III Answer: B Difficulty: Difficult Section Reference: 11-1

Learning Objective: Recognize monosaccharides and their derivatives Essential Biochemistry Test Bank, Chapter 12: Metabolism and Bioenergetics Question type: Multiple Choice

1) Plants are considered _____.

A) chemoautotrophs B) photoautotrophs C) chemoheterotrophs D) photoheterotrophs E) none of the above

Answer: B Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

2) Energy is generated during _____, the breakdown of larger molecules into smaller while energy is consumed during _____, the building of larger molecules from smaller ones.

A) reduction reactions; oxidation reactions B) anabolic reactions; catabolic reactions C) catabolic reactions; anabolic reactions D) hydrolysis reactions; condensation reactions E) none of the above Answer: C Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

3) Digestion of food by mammals converts _____ into _____ which can be absorbed from the intestines.

A) proteins; dipeptides and tripeptides B) polysaccharides; monosaccharides and disaccharides C) cholesterol; acetyl CoA D) nucleic acids; polynucleotides E) triacylglycerols; fatty acids Answer: E Difficulty: Medium Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

4) Digestion of food utilizes enzymes that catalyze _____ reactions.

A) hydrolysis B) reduction C) condensation D) oxidative

E) group transfer Answer: A Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

5) Which of the following is used to move lipids around the bloodstream?

A) micelles B) liposomes C) liposuctions D) lipoproteins E) cholesterol esters Answer: D Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

6) The bulk of triacylglycerols in the human body are stored in _____.

A) liver cells B) adipocytes C) muscle cells D) nerve cells E) lipoproteins Answer: B Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

7) The _____ stores glucose as glycogen and converts excess glucose to _____.

A) muscle; amino acids B) adipose tissue; fatty acids C) liver; fatty acids D) brain; energy E) none of the above

Answer: C Difficulty: Medium Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

8) Amino acids can be converted to _____.

A) carbohydrates B) fatty acids C) nucleotides D) peptides E) all of the above Answer: E Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

9) Which of the following is mobilized for energy use by a phosphorolysis reaction, not a hydrolysis?

A) glycogen B) protein C) triacylglycerols D) polynucleotides E) cholesterol esters Answer: A Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

10) Degradation of proteins within a cell can occur within the _____ or by use of _____.

A) endoplasmic reticulum; protease enzymes chymotrypsin and trypsin B) Golgi apparatus; protease enzymes chymotrypsin and trypsin C) endoplasmic reticulum; a proteasome D) lysosome; a proteasome E) mitochondria; ubiquitin Answer: D

Difficulty: Medium Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

11) The _____-terminus of ubiquitin is linked to a _____ residue of proteins to be degraded.

A) N; Asp B) N; Glu C) C; Lys D) C; Ser E) C; Tyr Answer: C Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

12) Which of the following molecules is involved with the oxidation of glucose, synthesis of fatty acids and oxidation of fatty acids?

A) pyruvate B) acetyl-CoA C) alanine D) oxaloacetate E) glyceraldehyde-3-phosphate Answer: B Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

13) A reaction that results in the loss of electrons from a molecule is a(n) _____.

A) reduction B) ligation C) hydrolysis D) oxidation E) phosphorolysis

Answer: D Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

14) Which of the following is more highly oxidized than acetaldehyde?

A) ethane B) ethanol C) ethylene D) ethylene glycol E) acetic acid Answer: E Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

15) The oxidized form of NADH is _____.

A) NADH+ B) NAD+ C) NADH D) NADH2 E) none of the above Answer: B Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

16) Which of the following molecules is in the most reduced state?

A) methane B) formaldehyde

C) formic acid D) methanol E) carbon dioxide Answer: A Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

17) The conversion of a carbohydrate into CO2 is a(n) _____ process; the conversion of CO2 into a carbohydrate is a(n) _____ process.

A) reductive; oxidative B) endergonic; exergonic C) exergonic; endergonic D) oxidative; exergonic E) endergonic; reductive Answer: C Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

18) Which of the following is a lipid-soluble electron carrier in its reduced state?

A) NADPH B) NADH C) NAD+ D) ubiquinol E) ubiquinone Answer: D Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

19) Which of the following is correct regarding metabolic pathways?

A) most pathways are isolated from other pathways B) the activity of most pathways is not regulated C) all cells within a multi-cellular organism contain the same pathways D) anabolic pathways never occur at the same time as catabolic pathways E) none of the above are correct Answer: E Difficulty: Hard Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

20) Which of the following is correctly described?

A) proteome: the complete set of proteins present in a cell at a given time B) metabolome: the complete set of metabolic enzymes active in a cell at a given time C) transcriptome: the complete set of proteins being synthesized at a given time D) genome: the complete set of genes that are expressed at a given time E) none of the above Answer: A Difficulty: Hard Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

21) Which of the following is an essential amino acid?

A) Ala B) Val C) Cys D) Tyr E) Gly Answer: B Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

22) Which of the following vitamins is correctly paired with its biochemical function?

A) folic acid: carboxylation reactions B) biotin: decarboxylation reactions C) riboflavin: acyl transfer reactions D) pyridoxine: amino-group transfer reactions E) pantothenic acid: redox reactions Answer: D Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

23) Which of the following vitamins is correctly paired with the disease that is caused by its deficiency?

A) biotin: scurvy B) pantothenic acid: beriberi C) nicotinamide: pellagra D) thiamine: anemia E) folic acid: rickets Answer: C Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

24) When a reaction is at equilibrium, the G is equal to _____.

A) 1 B) 0 C) -1 D) ΔG° E) none of the above Answer: B Difficulty: Easy

Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

25) If the ΔG° is known, how can Keq be calculated?

A) Keq = log e(ΔG°/RT) B) Keq = e(ΔG°/TS) C) Keq = RT ln ΔG° D) Keq = e-(ΔG°/RT) E) Keq = ln (ΔG°/TS) Answer: D Difficulty: Hard Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

26) For the following reaction, calculate the Keq at 25°C. succinyl-CoA + acetoacetate

acetoacetyl-CoA + succinate

ΔG° = -1.25 kJ/mol

A) 0.602 B) 1.00 C) 1.66 D) 3.21 E) 4.22  102 Answer: C Difficulty: Hard Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

27) For the following reaction, calculate the ΔG° at 37°C. glucose-6-phosphate A) -2.87 kJ/mol

fructose-6-phosphate

Keq = 0.517

B) -1.70 kJ/mol C) 0.203 kJ/mol D) -0.738 kJ/mol E) 1.70 kJ/mol Answer: E Difficulty: Medium Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

28) For the following reaction, calculate the ΔG at 37°C, given concentrations for glucose-1-phosphate of 25 mM and glucose-6-phosphate of 1 mM. glucose-1-phosphate

glucose-6-phosphate

ΔG° = -7.1 kJ/mol

A) -15.4 kJ/mol B) -8.1 kJ/mol C) -6.1 kJ/mol D) 1.2 kJ/mol E) none of the above Answer: A Difficulty: Hard Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

29) What is the intracellular glucose concentration if the ΔG for the following reaction is at 37°C and concentrations for glucose-6-phosphate and phosphate are both 1 mM? glucose-6-phosphate A) 1.9 M B) 87 M C) 1.9 mM D) 27 mM E) 87 mM Answer: E Difficulty: Hard

glucose + Pi

ΔG° = -13.8 kJ/mol

-20.1 kJ/mol

Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

30) Which of the following describes the bonding of the three phosphates to adenosine in ATP? How many phosphoanhydride bonds are found in ATP? A) one phosphoanhydride bond, two low energy phosphate esters B) two phosphoanhydride bonds, one low energy phosphate ester C) three phosphoanhydride bonds, one low energy phosphate ester D) three phosphoanhydride bonds E) none of the above Answer: B Difficulty: Medium Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

31) If the following reactions were coupled, what would be the overall ΔG°? glucose + Pi ATP + H2O

glucose-6-phosphate ADP + Pi

ΔG° = 13.8 kJ/mol ΔG° = -30.5 kJ/mol

A) 44.3 kJ/mol B) 16.7 kJ/mol C) 0 kJ/mol D) -16.7 kJ/mol E) -44.3 kJ/mol Answer: D Difficulty: Medium Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

32) Generally speaking, ATP is produced by _____ reactions and used by _____ reactions.

A) catabolic; anabolic B) anabolic; catabolic

C) endergonic; exergonic D) oxidation; reduction E) reduction; oxidation Answer: A Difficulty: Easy Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

33) Which of the following factors contributes to the highly exergonic nature of ATP hydrolysis?

A) removal of phosphate from the cytoplasm B) addition of water to the hydrophilic ATP molecule C) decrease in negative-ion repulsion in ATP D) low energy of activation for the hydrolysis E) none of the above Answer: C Difficulty: Medium Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

34) Which of the following has the most spontaneous hydrolysis?

A) 1,3-bisphosphoglycerate B) phosphocreatine C) glucose-1-phosphate D) pyrophosphate E) phosphoenolpyruvate Answer: E Difficulty: Easy Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

35) In highly active muscle, _____ is used to regenerate ATP.

A) phosphocreatine B) 1,3-bisphosphoglycerate C) pyrophosphate D) phosphoenolpyruvate E) acetyl-CoA Answer: A Difficulty: Easy Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

36) The ΔG° for the hydrolysis of acetyl CoA is most similar to the ΔG° for the hydrolysis of _____.

A) 1,3-bisphosphoglycerate B) ATP C) glucose-1-phosphate D) glucose-6-phosphate E) phosphoenolpyruvate Answer: B Difficulty: Easy Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

Question type: True/False

37) Metabolomics is the study of the metabolic activity of a cell or tissue by identifying and quantifying all of its metabolites.

Answer: true Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

Question type: Dropdown

38) The amino acid ___ is considered essential in humans while ___ is considered non-essential.

Dropdown 1: methionine, glycine, aspartic acid Dropdown 2: histidine, threonine, glutamine

Difficulty: Medium Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

Question type: Multiple choice

39) The common products of fuel metabolism in mammals are ____.

A) oxaloacetate and acetyl-CoA B) pyruvate and acetyl-CoA C) ATP and acetyl-CoA D) pyruvate and glucose E) none of the above Answer: B Difficulty: Easy Section Reference: 12-2

Learning Objective: Recognize the common chemical features of metabolic pathways

Question type: Text entry

40) The _____ stores very little glycogen and therefore requires a steady supply of glucose from the blood.

Answer: brain Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

Question type: Multiple choice

41) The reaction below is an example of _________________.

A) dehydration B) hydration C) oxidation D) reduction E) none of the above Answer: A

Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

42) Eukaryotes evolved and developed extensive intracellular membraines enclosed in compartments called _______.

A) lysosomes B) organelles C) peroxisomes D) vacuoles

Answer: B Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

Question type: Text entry

43) Lipoproteins formed in the intestinal mucosal cells are called _____.

Answer: chylomicrons Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

Question type: Multiple choice

44) The conversion of triacylglycerides into fatty acids for energy generation is an example of which of the following?

A) heterotropism B) anaerobism C) catabolism D) anabolism E) glycolysis

Answer: C

Difficulty: Easy Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

45) Adipocytes convert glucose into fatty acids and _____.

A) glycerol B) cholesterol C) ketone bodies D) lactate E) ribose-5-phosphate Answer: A Difficulty: Moderate Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

46) Which of the following can generate glucose?

I. kidney II. liver III. adipose tissue IV. muscle A) I, II, III, IV B) I, II, IV C) I, II D) II, IV E) II only Answer: C Difficulty: Moderate Section Reference: 12-1 Learning Objective: Summarize the pathways for digesting and mobilizing metabolic fuels

47) Consider the reaction A + B « C + D. After reaching equilibrium at 25°C, the following concentrations of reactants and products were measured: [A] = 10 µM, [B] = 15 µM, [C] = 10 µM, [D] = 10 µM. Calculate ∆G°ꞌ for this reaction.

A) 1,000 J/mol B) 10 kJ/mol C) 1 J/mol D) insufficient data to determine answer E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

Question type: Essay

48) Consider the isomerization reaction R  P, in which R is converted to P. The G°ꞌ for this reaction is −10. kJ/mol. Calculate the [P]/[R] at equilibrium at 25°C.

Answer: At equilibrium [P]/[R] = Keq = e−G°/RT  [P]/[R] = e− -(−-10000 J/mol)/8.3145 × 298 J/mol = e10000/8.3145 × 298 = 57

Difficulty: Moderate Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

Question type: Multiple choice

49) Consider the following reaction, which has a ∆G˚' ≈ +30 kJ/mol. malate + NAD+ → oxaloacetate + NADH + H+ In muscle cells, the reaction proceeds as written. Which of the following explains how the reaction occurs as written despite the positive value for G°'?

A) It is thermodynamically favored under standard conditions.

B) In the cell, it is kinetically favored, even though it is thermodynamically unfavorable.

C) The concentration of malate must be higher than oxaloacetate for this reaction to occur in the cell.

D) [H+] must be higher in muscle than under standard conditions, thus altering ∆G˚ to ∆G˚'.

E) None of the above

Answer: C

Difficulty: Difficult Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

Question type: Essay

50) Phosphoglucomutase catalyzes the reaction in which a phosphate group is transferred from the C-1 of glucose to the C-6 of glucose (G1P  G6P). A student incubates a 0.2 M solution of glucose-1phosphate overnight with a small amount of the enzyme. At equilibrium the concentration of glucose-1phosphate is 9.0 × 10−3 M and the concentration of glucose-6-phosphate is 19.1 × 10−2 M. Calculate the equilibrium constant (Keq) and the standard state free energy (∆G°ꞌ) for this reaction at 25°C.

Answer: The equilibrium constant Keq = [G6P]eq/[G1P]eq = 19.1 × 10−2 M/ 9.0 × 10−3 M = 21. G°ꞌ = −RTlnKeq = −8.3145 × 298 J/mol × ln 21.2 = −7,600 J/mol.

Difficulty: Difficult Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

51) Acetylcholinesterase catalyzes the reaction in which acetylcholine is hydrolyzed into acetate and

choline. This is a reversible reaction. A student incubates a 1 M solution of acetylcholine for two hours with 100uL of acetylcholinesterase. At equilibrium the concentration of acetylcholine is 3.0 × 10 mM and the concentration of acetate and choline are 5.2 × 10−3 M and 7.4 x 10-2 M, respectively.

Calculate the equilibrium constant (Keq) and the standard state free energy (∆G°ꞌ) for this reaction at 17°C.

Answer: The equilibrium constant Keq = [acetaete]eq x [choline]eq/[acetylcholine]eq = (5.2 × 10−3 M)(7.4 x 10-2 M)/ 3.2 × 10−3 M = 0.13. G°ꞌ = −RTlnKeq = −8.3145 × 300 J/mol × ln 0.12 = 5,300 J/mol.

Difficulty: Difficult Section Reference: 12-3

Learning Objective: Analyze the free energy changes that occur during metabolic reactions

Essential Biochemistry Test Bank, Chapter 13: Glucose Metabolism Question type: Multiple Choice

1) The process of _____ converts glucose into _____.

A) electron transport; CO2 B) glycolysis; pyruvate C) glycogenolysis; glycogen D) gluconeogenesis; glycogen E) glycogen synthesis; pyruvate Answer: B Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

2) What pathway is used to make glucose from other metabolites such as oxaloacetate?

A) glycogen synthesis B) glycogen degradation C) glycolysis D) pentose phosphate pathway E) gluconeogenesis Answer: E Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

3) In eukaryotes, glycolysis typically occurs in the _____, gluconeogenesis typically occurs in the _____.

A) mitochondria; cytosol B) Golgi apparatus; mitochondria C) endoplasmic reticulum; mitochondria D) cytosol; cytosol E) lysosome; cytosol Answer: D Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

4) The coenzyme _____ is the oxidizing agent in glycolysis.

A) ADP B) thiamine pyrophosphate C) NAD+ D) FAD E) biotin Answer: C Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

5) Which of the following represents the net products of glycolysis from one molecule of glucose?

A) 2 pyruvate, 2 NADH, 2 ATP B) 2 pyruvate, 2 NADH, 4 ATP C) 3 pyruvate, 2 NADH, 4 ATP D) 6 CO2, 30 ATP E) 6 CO2, 32 ATP Answer: A Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

6) In glycolysis, the net gain of ATP during the energy investment phase is _____ while the net gain of ATP during the energy payoff phase is _____.

A) -4; 6 B) -2; 4 C) -2; 2 D) -1; 3 E) 0; 2 Answer: B Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

7) Hexokinase is an example of a(n) _____ enzyme A) ligase B) hydrolase C) transferase D) ligase E) isomerase Answer: C Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

8) With a G of -16.7 kJ/mol, the reaction catalyzed by hexokinase is considered to be _____.

A) at equilibrium B) substrate and product concentration dependent C) freely reversible D) metabolically irreversible E) none of the above Answer: D Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

9) Phosphoglucose isomerase has a G of 2.2 kJ/mol but a G of -1.4 kJ/mol. Based upon this difference, which of the following is true?

A) within a cell, concentrations are non-standard B) within a cell, the concentration of glucose-6-phosphate is higher than fructose-6-phosphate C) within a cell, concentrations of products are often lowered by their rapid use in other reactions D) within a cell, the reaction catalyzed by phosphoglucose isomerase would be considered freely reversible E) all of the above Answer: E Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

10) Which of the following enzymes requires ATP as a substrate?

A) phosphofructokinase B) phosphoglucose isomerase C) aldolase D) triose phosphate isomerase E) enolase Answer: A

Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

11) What enzyme catalyzes the major regulatory step of glycolysis?

A) hexokinase B) aldolase C) glyceraldehyde-3-phosphate dehydrogenase D) phosphofructokinase E) phosphoglucose isomerase Answer: D Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

12) Which of the following is a potent activator of phosphofructokinase in mammals?

A) fructose-6-phosphate B) glucose-6-phosphate C) fructose-2,6-bisphosphate D) fructose-1,6-bisphosphate E) glyceraldehyde-3-phosphate Answer: C Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

13) In bacterial cells, _____ is an activator of phosphofructokinase while _____ is an inhibitor.

A) glucose-6-phosphate; ATP B) ADP; phosphoenolpyruvate C) fructose-2,6-bisphosphate; fructose-6-phosphate D) AMP; glyceraldehyde-3-phosphate

E) citrate; ADP Answer: B Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

14) The enzyme responsible for the synthesis of fructose-2,6-bisphosphate is _____.

A) phosphofructokinase-2 B) hexosephosphatekinase-2 C) aldolase-2 D) phosphofructose isomerase-2 E) none of the above Answer: A Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

15) Which enzyme is responsible for splitting a hexose into two trioses?

A) enolase B) phosphoglycerate mutase C) phosphofructose isomerase D) triose phosphate isomerase E) aldolase Answer: E Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

16) The active site of aldolase contains a Lys residue which forms a(n) _____ and a(n) _____ residue that participates in acid-base reactions.

A) amide; His B) Schiff base; Asp C) secondary amine; Glu D) amide; Cys E) Schiff base; Tyr Answer: B Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

17) In the reaction catalyzed by aldolase, the bond broken is between carbons 3 and 4 of the substrate.

What functional groups are present on these two carbons (C3 and C4) in the products?

A) C3 becomes an alcohol; C4 becomes a carboxylic acid B) C3 becomes an aldehyde; C4 becomes a ketone C) C3 becomes an aldehyde; C4 becomes an alcohol D) C3 becomes an alcohol; C4 becomes an aldehyde E) C3 becomes a ketone; C4 becomes an alcohol Answer: D Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

18) Triose phosphate isomerase catalyzes a reaction that is most similar to _____.

A) phosphoglycerate mutase B) phosphoglucose isomerase C) hexokinase D) aldolase E) enolase Answer: B Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

19) What is the name for the process that produces ATP from ADP in glycolysis?

A) substrate-level phosphorylation B) oxidative phosphorylation C) autophosphorylation D) glycolytic phosphorylation E) cytosolic phosphorylation Answer: A Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

20) Experimental evidence indicates that glyceraldehyde-3-phosphate dehydrogenase contains a critical _____ residue in its active site, as shown by its inactivation by iodoacetamide.

A) Lys B) His C) Asp D) Ser E) Cys Answer: E Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

21) Glyceraldehyde-3-phosphate dehydrogenase oxidizes _____.

A) an alcohol to a ketone B) a carboxylic acid to CO2 C) an alcohol to an aldehyde D) an aldehyde to a carboxylic acid E) an aldehyde to an alcohol Answer: D Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

22) Glyceraldehyde is oxidized to _____ which can transfer a phosphate to _____.

A) phosphoenolpyruvate; ADP B) phosphoenolpyruvate; AMP C) 1,3-bisphosphoglycerate; ADP D) 1,3-bisphosphoglycerate; AMP E) 3-phosphoglycerate; ADP Answer: C Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

23) Why is phosphoglycerate kinase still considered a kinase even though ADP is converted to ATP? A) the enzyme is freely reversible B) ATP is the ultimate source of the phosphate that is transferred to ADP C) the phosphate is transferred in conjunction with an oxidation reaction D) the reaction is metabolically irreversible E) none of the above Answer: A Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

24) What residue of phosphoglycerate mutase undergoes covalent catalysis during the reaction?

A) Asp B) His C) Ser D) Tyr E) Cys Answer: B

Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

25) What type of enzyme is enolase, which catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate and water?

A) transferase B) hydrolase C) ligase D) lyase E) oxidoreductase Answer: D Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

26) What is the greatest driving force for the reaction catalyzed by pyruvate kinase?

A) hydrolysis of phosphate from phosphoenolpyruvate B) transfer of phosphate from phosphoenolpyruvate to ADP C) release of ATP from active site D) tautomerization of enolpyruvate to pyruvate E) release of pyruvate from the active site Answer: D Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

27) What sort of activity does fructose-1,6-bisphosphate have on pyruvate kinase?

A) no effect B) competitive inhibitor C) noncompetitive inhibitor

D) allosteric inhibitor E) feed-forward activator Answer: E Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

28) Which of the following contains a high energy bond that is used for a substrate-level phosphorylation in glycolysis?

A) fructose-1,6-bisphosphate B) 1,3-bisphosphoglycerate C) acetyl phosphate D) 2,3-bisphosphoglycerate E) 1-phosphoglycerate Answer: B Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

29) What regulatory enzyme of glycolysis is skipped during fructose metabolism?

A) hexokinase B) phosphoglucose isomerase C) phosphofructokinase D) pyruvate kinase E) fructose metabolism does not skip any steps of glycolysis Answer: C Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

30) If a cell were given glucose labeled at carbon-3 with 14C, what carbon(s) of pyruvate would contain the label?

A) 1 B) 2 C) 3 D) 1 and 3 E) 2 and 3 Answer: A Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

31) Under anaerobic conditions in skeletal muscle, pyruvate is converted into _____.

A) ethanol and CO2 B) propionate C) acetyl-CoA D) lactate E) alanine Answer: D Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

32) Fill in the missing reagents in the following reaction.

A) reactant: NAD+ + H+; product: NADH B) reactant: NADH + H+; product: NAD+ C) reactant: ATP; product: ADP + Pi D) reactant: NADH + H+; product: CO2 E) none of the above Answer: B Difficulty: Medium

Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

33) Under aerobic conditions, pyruvate is converted to _____ by pyruvate dehydrogenase.

A) oxaloacetate B) ethanol C) lactate D) glucose E) acetyl-CoA Answer: E Difficulty: Medium Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

34) What coenzyme is required for the conversion of pyruvate to oxaloacetate?

A) NADH B) pyridoxal phosphate C) biotin D) thiamine E) FADH2 Answer: C Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

35) Which of the following correctly describes the mechanism of pyruvate carboxylase?

A) ATP and bicarbonate react, carboxyphosphate formed, carboxyl group transferred to biotin, deprotonated pyruvate attacks carboxyl group B) ATP and bicarbonate react, carboxyl group transferred to biotin carboxyphosphate formed, deprotonated pyruvate attacks carboxyl group C) ATP and bicarbonate react, carboxyphosphate formed, deprotonated pyruvate attacks carboxyl group, carboxyl group transferred to biotin

D) carboxyphosphate formed, ATP and bicarbonate react, carboxyl group transferred to biotin, deprotonated pyruvate attacks carboxyl group E) carboxyphosphate formed, deprotonated pyruvate attacks carboxyl group, ATP and bicarbonate react, carboxyl group transferred to biotin Answer: A Difficulty: Hard Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

36) Which of the following forms a substrate cycle with hexokinase?

A) phosphoglucose isomerase B) glucose-6-phosphatase C) phosphofructokinase D) phosphoglycerate kinase E) fructose bisphosphatase Answer: B Difficulty: Medium Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

37) Which of the following can serve as a source of carbon for gluconeogenesis?

A) glycerol B) serine C) alanine D) glutamate E) all of the above Answer: E Difficulty: Medium Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

38) How many equivalents of ATP are required to convert two molecules of pyruvate to glucose?

A) 2 B) 4 C) 6 D) 8 E) 10 Answer: C Difficulty: Medium Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

39) What would occur if both phosphofructokinase and fructose bisphosphatase were active simultaneously?

A) a futile cycle B) a substrate cycle C) an inhibitor cycle D) the alanine cycle E) the Cori cycle Answer: A Difficulty: Easy Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

40) Gluconeogenesis is most active in the _____.

A) muscles B) brain C) heart D) liver E) kidneys Answer: D Difficulty: Easy Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

41) Fructose-2,6-bisphosphate is an activator of _____ and an inhibitor of _____.

A) phosphofructokinase; hexokinase B) fructose bisphosphatase; phosphofructokinase C) phosphofructokinase; fructose bisphosphatase D) glucose-6-phosphatase; pyruvate kinase E) pyruvate kinase; phosphoenolpyruvate carboxykinase Answer: C Difficulty: Medium Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

42) Muscle cells are not able to supply glucose for other tissues because they do not contain which of the following enzymes?

A) debranching enzyme B) pyruvate carboxylase C) glycogen phosphorylase D) fructose bisphosphatase E) glucose-6-phosphatase Answer: E Difficulty: Hard Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

43) Which of the following supplies the energy for glycogen synthesis?

A) ATP B) GTP C) CTP D) UTP E) none of the above Answer: C Difficulty: Easy

Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

44) Which of the following correctly relates the order of intermediates during the synthesis of glycogen?

A) glucose  glucose-1-phosphate  glucose-6-phosphate  UDP-glucose  glycogen B) glucose  glucose-6-phosphate  glucose-1-phosphate  UDP-glucose  glycogen C) glucose  glucose-6-phosphate  UDP-glucose  glucose-1-phosphate  glycogen D) glucose  UDP-glucose  glucose-1-phosphate  glucose-6-phosphate  glycogen E) glucose  UDP-glucose  glucose-6-phosphate  glucose-1-phosphate  glycogen Answer: B Difficulty: Medium Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

45) Which of the following enzymes catalyzes the conversion of glucose-1-phosphate to glucose-6phosphate?

A) phosphoglucomutase B) glucose phosphatase C) glycogen phosphorylase D) phosphoglucose isomerase E) phosphorylase mutase Answer: A Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

46) In glycogen synthesis, what is the intermediate between glucose-1-phosphate and glycogen?

A) glucose-6-phosphate B) glucose-1,6-bisphosphate C) UTP-glucose D) UDP-glucose E) none of the above

Answer: D Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

47) In the muscle, when a residue of glucose is cleaved from glycogen and converted to pyruvate via glycolysis, what is the net ATP production?

A) 1 B) 2 C) 3 D) 4 E) 5 Answer: C Difficulty: Medium Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

48) Glycogen storage occurs in _____ and _____ tissue.

A) muscle; kidney B) liver; pancreas C) brain; muscle D) kidney; pancreas E) muscle; liver Answer: E Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

49) The main enzyme of glycogen catabolism is _____, which catalyzes a _____ reaction.

A) glycogen hydrolase; hydrolysis

B) glycogen phosphorylase; phosphorolysis C) glycogen mutase; mutarotation D) debranching enzyme; hydrolysis E) glycogen transferase; glucose residue transfer Answer: B Difficulty: Medium Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

50) NADPH used in lipid biosynthesis is produced in _____.

A) the pentose phosphate pathway B) the citric acid cycle C) glycolysis D) gluconeogenesis E) none of the above Answer: A Difficulty: Easy Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

51) For each molecule of glucose-6-phosphate that enters the pentose phosphate pathway, _____ NADPH and _____ CO2 are produced.

A) 1; 0 B) 1; 1 C) 2; 1 D) 2; 2 E) 3; 2 Answer: C Difficulty: Medium Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

52) Which of the following enzymes catalyzes an oxidative decarboxylation reaction?

A) glucose-6-phosphate dehydrogenase B) glyceraldehyde-3-phosphate dehydrogenase C) glycogen dehydrogenase

D) 6-phosphogluconate dehydrogenase E) none of the above Answer: D Difficulty: Medium Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

53) Which of the following requires large amounts of both ribose-5-phosphate and NADPH? A) DNA synthesis B) amino acid synthesis C) lipid synthesis D) glycogen synthesis E) cholesterol synthesis Answer: A Difficulty: Easy Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

54) In the event that NADPH is needed but ribose is not, which of the following is an end product of the pentose phosphate pathway?

A) ribulose-5-phosphate B) dihydroxyacetone phosphate C) fructose-1,6-bisphosphate D) 1,3-bisphosphoglycerate E) glyceraldehyde-3-phosphate Answer: E Difficulty: Medium

Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

55) In the conversion of ribulose-5-phosphate to glycolytic intermediates, which of the following enzymes is used?

A) phosphoglucomutase B) transketolase C) phosphoglycerate mutase D) phosphofructoisomerase E) none of the above Answer: B Difficulty: Medium Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

Question type: True/False

56) A deficiency of pyruvate kinase in red blood cells increases the production of 2,3bisphosphoglycerate, further reducing the delivery of oxygen by red blood cells.

Answer: False

Difficulty: Medium Section Reference: 13-5

Learning Objective: Relate enzyme deficiencies to defects in carbohydrate metabolism

57) Fructose intolerance results from a deficiency of fructose-1-phosphate aldolase, resulting in cell death of liver tissue.

Answer: True

Difficulty: Medium Section Reference: 13-5

Learning Objective: Relate enzyme deficiencies to defects in carbohydrate metabolism

Question type: Dropdown

58) During infancy, an inability to convert ___ into glucose can be deadly since ___ is the major carbohydrate source.

Dropdown 1: fructose, galactose Dropdown 2: lactose, sucrose

Difficulty: Medium Section Reference: 13-5

Learning Objective: Relate enzyme deficiencies to defects in carbohydrate metabolism

Question type: Dropdown

59) A deficiency of glucose-6-phosphate dehydrogenase decreases the production of ___ in red blood cells thus resulting in ___ of oxidative damage.

Dropdown 1: pyruvate, ATP, NADPH Dropdown 2: increase, decrease

Difficulty: Medium Section Reference: 13-5

Learning Objective: Relate enzyme deficiencies to defects in carbohydrate metabolism

Question type: Dropdown

60) The most common type of glycogen storage disease is ___ which is caused by a defect in ___.

Dropdown 1: GSD6, GSD7, GSD9 Dropdown 2: phosphorylase kinase, glycogen phosphorylase

Difficulty: Medium Section Reference: 13-5

Learning Objective: Relate enzyme deficiencies to defects in carbohydrate metabolism

Question type: Multiple choice

61) Which enzyme below is not required for the synthesis of branched glycogen?

A) glycogen phosphorylase B) glycogen synthase C) branching enzyme

D) phosphoglucomutase E) All are required for synthesis of glycogen.

Answer: A Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

62) Which of the following best explains the energetically favorable formation of UDP–glucose in the liver and muscle?

A) G°' for the reaction glucose-1-phosphate + UTP  UDP–glucose + PPi is very negative.

B) G°' for the reaction glucose-1-phosphate + UTP  UDP–glucose + PPi is very positive.

C)  phosphoglucoisomerase°' for the reaction PPi  2Pi is very negative.

D) G°' for the reaction PPi  2Pi is very positive.

E) G°' for the overall reaction is very positive.

Answer: C Difficulty: Moderate Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

Question type: Text entry

63) The breakdown of glycogen is referred to as ______.

Answer: glycogenolysis Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

64) The first step in the breakdown of glycogen is catalyzed by ______.

Answer: phosphorylase a

Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation.

Question type: Multiple choice

65) Which of the following best describes the function of the glycogen debranching enzyme in glycogenolysis?

A) It cleaves (1  6) branch points releasing glucose-6-phosphate.

B) It cleaves (1  6) branch points releasing glucose-1-phosphate.

C) It cleaves (1  6) branch points releasing glucose.

D) It transfers an (1  4) linked trisaccharide unit to the nonreducing end of an alternate branch, then cleaves the (1  6) branch point, releasing glucose-1-phosphate.

E) It transfers an (1  4) linked trisaccharide to the nonreducing end of an alternate branch, then cleaves the (1  6) branch point, releasing glucose.

Answer: E Difficulty: Easy Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation

66) Which of the following enzymes catalyzes the transfer of a phosphoryl group from ATP to glucose?

A) hexokinase B) phosphoglucose isomerase C) glucose-6-phosphatase D) phosphoglucose mutase E) A transfer such as this does not occur in glycolysis.

Answer: A Difficulty: Easy

Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

67) Of the reaction types listed below, which type of reaction is NOT used in glycolysis?

A) oxidation B) phosphorylation C) dehydration D) isomerization E) All are used in glycolysis.

Answer: E Difficulty: Easy Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

68) Aerobic activity in response to stress results in which of the following?

I. Glycolysis occurs in the muscle.

II. Glycolysis occurs in the liver.

III. Glycogenolysis occurs in the muscle.

IV. Glycogenolysis occurs in the liver.

A) I, III, IV B) I, II, IV C) I, IV D) II, III E) III, IV Answer: A Difficulty: Moderate Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

69) Which of the following can generate glucose?

I. kidney II. liver III. adipose tissue IV. muscle A) I, II, III, IV B) I, II, IV C) I, II D) II, IV E) II only Answer: C Difficulty: Moderate Section Reference: 13-2

Learning Objective: Describe the substrates, products, and reactions of gluconeogenesis

70) Which statement is true concerning the metabolic reaction shown below?

HOCH2

-2

O

OPO3-2

O3POCH2 O

OH

OH

OH

OH OH

OH OH

A) The enzyme that catalyzes this reaction is called a mutase.

B) The enzyme that catalyzes this reaction is called a kinase.

C) This reaction requires the free energy of ATP hydrolysis.

D) This reaction requires multiple steps catalyzed by a phosphorylase and a mutase.

E) The oxidation of glucose-1-phosphate is higher than that of glucose-6-phosphate.

Answer: A Difficulty: Moderate Section Reference: 13-3 Learning Objective: Compare the processes of glycogen synthesis and degradation

71) The glycogen debranching enzyme is required for _____.

A) the transfer of 3-glucose units from one branch to another

B) the transfer of phosphate from one position to another C) cleaving  1  6) sugar linkages D) A and C E) A, B, and C Answer: D Difficulty: Moderate Section: 8.1 Learning Objective: Analyze the pathways of glycogen biosynthesis and breakdown, and the regulation of these pathways.

Question type: Text entry

72) Both glycogen synthesis and glycogen breakdown share the metabolite ______.

Answer: glucose-1-phosphate Difficulty: Moderate Section Reference: 13-3 Learning Objective: Compare the processes of glycogen synthesis and degradation

Question type: Multiple choice

73) Which is the net equation for aerobic glycolysis?

A) B) C) D) E)

Glucose + 2 ATP  2 lactate + 2 ADP + 2 Pi Glucose + 2 ADP + 2 Pi + 2 NAD+  2 pyruvate + 2 ATP + 2 NADH + + 2 H2O 4 H+ Glucose + 2 ADP + 2 Pi  2 lactate + 4 ATP + 4 H+ Glucose + 2 ATP + 2 NAD+ 2 pyruvate + 4 ATP + 4 NADH + 4 H+ Glucose + 2 ADP + 2 Pi + 2 NAD+ 2 lactate + 4 ATP + 2 NADH + 4 H+

Answer: B Difficulty: Moderate Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

74) During reactions using the enzymes shown below, in which case(s) is ATP produced?

I. phosphofructokinase (PFK) II. phosphoglycerate kinase (PGK) III. pyruvate kinase (PK) A) I B) II C) III D) I, II E) II, III Answer: E Difficulty: Moderate Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

75) In which of the following metabolic conversions is ATP required during glycolysis?

I. fructose-6-phosphate  fructose-1,6-bisphosphate II. glucose  glucose-6-phosphate III. fructose-1,6-bisphosphate  dihydroxyacetone phosphate + glyceraldehyde-3phosphate IV. glucose-6-phosphate  fructose-6-phosphate A) I only B) II only C) I, II D) I, III E) I, IV Answer: C Difficulty: Moderate Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

76) Phosphofructokinase is allosterically _____ by high concentrations of _____.

I. activated; ATP

II. inhibited; ATP III. inhibited; fructose-2,6-bisphosphate IV. activated; fructose-2,6-bisphosphate A) I, III B) II, III C) II, IV D) I, IV E) none of the above Answer: C Difficulty: Moderate Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

77) The breakdown of glycogen produces G1P. Which of the following is false regarding G1P? A) It is involved in the use of fructose by glycolysis in the liver.

B) It is involved in the use of fructose by glycolysis in the muscle.

C) It is involved in use of galactose by glycolysis.

D) It is converted to G6P by phosphoglucoisomerase (PGI).

E) It is produced as an intermediate in the central glycolytic sequence.

Answer: D Difficulty: Difficult Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

78) Which of the following statements about glycogen is true?

I. Glycogen is a polymer of glucose in (1  6) linkages with (1  4) linked branches every 8–14 residues.

II. UDP–glucose is produced from glycogen by the action of the enzyme phosphorylase.

III. In glycogen breakdown, glucose residues are sequentially removed from the nonreducing ends.

IV. The breakdown of glycogen in skeletal muscle ultimately supplies glucose-6phosphate, which can enter glycolysis to generate ATP. A) I, II, III, IV B) I, II C) II, III, IV

D) III, IV E) III only Answer: D Difficulty: Difficult Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation.

79) Patient ―G‖ has a glycogen storage disease that results in decreased muscle glycogen levels.

Muscle biopsies indicate poor glycogen structure in the muscle. Which of the following enzymes might be related to the cause?

A) muscle debranching enzyme B) muscle glycogen phosphorylase C) liver debranching enzyme D) muscle glycogen synthase E) liver glycogen synthase Answer: D Difficulty: Difficult Section Reference: 13-3

Learning Objective: Compare the processes of glycogen synthesis and degradation.

80) Levels of glucose-6-phosphate (G6P) are affected by which of the following?

I. glycogen breakdown II. activity of the pentose phosphate pathway III. galactose preparation for entry into glycolysis A) I, II B) I, II, III C) III D) II, E) I, III Answer: B Difficulty: Difficult Section Reference: 13-4

Learning Objective: Describe the substrates, products, and reactions of the pentose phosphate pathway

81) Triose phosphate isomerase catalyzes a reaction that is most like that of _____.

A) phosphoglycerate mutase B) phosphoglucose isomerase C) hexokinase D) aldolase E) enolase Answer: B Difficulty: Difficult Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

82) Consider the following portion of the glycolytic sequence catalyzed by the enzymes above the arrows. Which products(s) will produce ATP?

O C

H

HC OH CH2OPO3-2

E1

I.

E2

E3 II.

E4 III.

CO2-2 C OPO3

E5

IV.

E6

V.

CH2

A) I, IV B) II, IV C) II only D) III, IV E) IV only Answer: B Difficulty: Difficult Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

83) Which of the following compounds is used to produce ATP by substrate-level phosphorylation in glycolysis?

O C H C OH

A)

CH2OPO3-2 O C O

C OPO3-2

B)

CH2OPO3-2 CO2-2 C OPO3

C)

CH2 O

D)

CH3CCO2-

O

E)

CH3C OPO3-2

Answer: C Difficulty: Difficult Section Reference: 13-1

Learning Objective: Describe the substrates, products, and chemical reaction for each step of glycolysis

Essential Biochemistry Test Bank, Chapter 14: The Citric Acid Cycle Question type: Multiple Choice

1) What cellular location contains pyruvate dehydrogenase and most of the citric acid cycle enzymes?

A) cytosol B) mitochondrial matrix C) inner mitochondrial membrane D) mitochondrial inter-membrane space E) outer mitochondrial membrane Answer: B

Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

2) Which of the following is correct concerning the reaction catalyzed by pyruvate dehydrogenase?

A) it is an oxidative decarboxylation B) it is activated by high concentrations of ATP C) the enzyme contains a pyridoxal phosphate prosthetic group D) the reaction is an anaplerotic reaction since it can replace citric acid intermediates that are removed for other pathways E) the enzyme contains two different types of subunits Answer: A Difficulty: Medium Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

3) Which of the following indicates the correct order of product release by pyruvate dehydrogenase?

A) acetyl-CoA, CO2, NADH B) NADH, CO2, acetyl-CoA C) CO2, NADH, acetyl-CoA D) CO2, acetyl-CoA, NADH E) NADH, acetyl-CoA, CO2 Answer: D Difficulty: Medium Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

4) Which of the following pyruvate dehydrogenase enzymes is correctly paired with the coenzyme that is associated with it?

A) E1: coenzyme A B) E2: thiamine pyrophosphate C) E3: FAD

D) E2: NAD+ E) E3: lipoamide Answer: C Difficulty: Medium Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

5) Which of the following coenzymes is directly responsible for the oxidation of the hydroxyethyl group to the acetyl group?

A) coenzyme A B) thiamine pyrophosphate C) FAD D) NAD+ E) lipoamide Answer: E Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

6) What amino acid is covalently linked to lipoic acid in E2?

A) Lys B) Ser C) His D) Gln E) Thr Answer: A Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

7) What type of bond forms when the hydroxyethyl group is transferred to lipoamide?

A) ester

B) amide C) thioester D) anhydride E) none of the above Answer: C Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

8) Which of the following is an inhibitor of pyruvate dehydrogenase?

A) CoA B) pyruvate C) FADH2 D) NADH E) CO2 Answer: D Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

9) In the citric acid cycle, what reduced cofactors are derived from the oxidation of one molecule of acetyl CoA to two molecules of CO2?

A) 2 NADH and 1 QH2 B) 3 NADH and 1 QH2 C) 2 NADH and 2 QH2 D) 3 NADH and 2 QH2 E) 4 NADH and 2 QH2 Answer: B Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

10) What makes the reaction catalyzed by citrate synthase highly exergonic?

A) hydrolysis of ATP B) hydrolysis of GTP C) decarboxylation reaction D) conversion from keto to enol tautomer E) hydrolysis of thioester Answer: E Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

11) Which of the following explains the proper binding of the two substrates for citrate synthase?

A) the binding is random B) acetyl-CoA binds, then oxaloacetate C) oxaloacetate binds, then acetyl-CoA D) oxaloacetate binds to one subunit, acetyl-CoA binds to the other E) in one subunit, acetyl-CoA binds, then oxaloacetate; on the other subunit, this is reversed Answer: C Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

12) Which of the following is observed in the mechanism of citrate synthase?

A) a histidine residue acts as a base, deprotonating oxaloacetate B) an aspartic acid residue acts as a base, deprotonating oxaloacetate C) a histidine residue hydrogen bonds with the carbonyl oxygen of oxaloacetate to enable a nucleophilic attack D) removal of the CoA is accomplished by transfer to a serine residue, then hydrolysis E) all of the above Answer: B

Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

13) Which of the following condenses with oxaloacetate to form citrate?

A) acetyl-CoA B) cis-aconitate C) carboxybiotin D) oxalosuccinate E) succinyl-phosphate Answer: A Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

14) Which of the following is an intermediate between citrate and isocitrate in the citric acid cycle?

A) oxalosuccinate B) succinyl-phosphate C) cis-aconitate D) carboxybiotin E) hydroxyethyl-TPP Answer: C Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

15) Aconitase catalyzes the _____ of citrate to aconitate followed by the _____ of aconitate to isocitrate.

A) oxidation; reduction

B) reduction; oxidation C) hydration; dehydration D) dehydration; hydration E) isomerization; isomerization Answer: D Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

16) Which of the following describes the isomerization of citrate to isocitrate?

A) a major regulatory step for the citric acid cycle B) an oxidation reaction C) the only unnecessary step of the citric acid cycle D) protects cells from the toxic effects of arsenite ion E) converts a tertiary alcohol, which cannot easily be oxidized, to a secondary alcohol that can be oxidized Answer: E Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

17) Given the following structure of isocitrate, the carbon labeled _____ is lost as CO 2 by isocitrate dehydrogenase while the carbon labeled _____ is lost as CO2 by -ketoglutarate dehydrogenase.

A) 1; 2 B) 2; 1 C) 1; 3 D) 3; 1 E) 2; 3

Answer: E Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

18) During the oxidation of isocitrate, the intermediate that is decarboxylated to form α-ketoglutarate is _____.

A) oxalosuccinate B) succinyl-phosphate C) cis-aconitate D) carboxybiotin E) hydroxyethyl-TPP Answer: A Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

19) Which enzyme catalyzes a reaction most similar to that catalyzed by -ketoglutarate dehydrogenase?

A) glyceraldehyde-3-phosphate dehydrogenase B) pyruvate dehydrogenase C) isocitrate dehydrogenase D) succinate dehydrogenase E) malate dehydrogenase Answer: B Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

20) Which of the following enzymes catalyzes a substrate-level phosphorylation?

A) malate synthase B) succinate dehydrogenase C) -ketoglutarate dehydrogenase D) succinyl-CoA synthetase E) fumarase Answer: D Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

21) Which of the following amino acids participates in the transfer of a phosphate group in the reaction catalyzed by succinyl-CoA synthetase?

A) lysine B) serine C) glutamine D) aspartic acid E) histidine Answer: E Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

22) Which of the following is an enzyme-associated intermediate that is similar in energy to 1,3bisphosphoglycerate?

A) phosphohistidine B) succinyl phosphate

C) oxalosuccinate D) carboxybiotin E) hydroxyethyl-TPP Answer: B

Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

23) Which of the following enzymes contains an FAD prosthetic group?

A) pyruvate dehydrogenase B) isocitrate dehydrogenase C) succinate dehydrogenase D) -ketoglutarate dehydrogenase E) malate dehydrogenase Answer: C Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

24) Where is succinate dehydrogenase located?

A) mitochondrial matrix B) mitochondrial inner membrane C) mitochondrial inter-membrane space D) mitochondrial outer membrane E) none of the above Answer: B Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

25) The oxidation of succinate to fumarate is best characterized as an oxidation of _____.

A) an alkane to an alkene B) an alcohol to an aldehyde

C) an alcohol to a ketone D) an aldehyde to a carboxylic acid E) a -keto acid to CO2 and a carboxylic acid that is one carbon smaller Answer: A Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

26) The reaction catalyzed by fumarase is _____.

A) an isomerization of an alcohol B) a dehydration of an alcohol C) a hydroxylation of an alkene D) a hydration of an alkene E) none of the above Answer: D Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

27) How does the reaction catalyzed by malate dehydrogenase proceed despite a G of 29.7 kJ/mol?

A) an elevated [H+] allows the reaction to proceed B) high levels of NAD+ allow the reaction to proceed C) concentrations of oxaloacetate are kept very low by rapid use in the subsequent step D) the enzyme is unique in its ability only to catalyze the reaction in one direction E) the enzyme catalyzed reaction under cellular conditions has a much smaller energy of activation Answer: C Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

28) How many electrons are transferred from one acetyl group when it is converted to two carbon dioxide molecules in the citric acid cycle?

A) 2 B) 4 C) 6 D) 8 E) 10 Answer: D Difficulty: Easy Section Reference: 14-3

Learning Objective: Explain how the citric acid cycle recovers energy for the cell

29) If acetyl-CoA labeled on the methyl carbon were used as the substrate for the citric acid cycle, where would the labeled carbon appear in oxaloacetate produced from one round of the cycle?

A) C1 B) C4 C) C1 or C2 D) C1 or C4 E) C2 or C3 Answer: E Difficulty: Hard Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

30) If all reduced electron carriers are reoxidized to run oxidative phosphorylation, how many ATP can be generated from the oxidation of one acetyl-CoA? A) 6 B) 10 C) 15 D) 20 E) 32 Answer: B

Difficulty: Easy Section Reference: 14-3

Learning Objective: Explain how the citric acid cycle recovers energy for the cell

31) Which of the following is an equilibrium-controlled step within the mitochondria?

A) malate dehydrogenase B) isocitrate dehydrogenase C) citrate synthase D) pyruvate dehydrogenase E) -ketoglutarate dehydrogenase Answer: A Difficulty: Medium Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

32) Which of the following is activated by ADP? A) malate dehydrogenase B) aconitase C) isocitrate dehydrogenase D) citrate synthase E) succinyl-CoA synthetase Answer: C Difficulty: Easy Section Reference: 14-3

Learning Objective: Explain how the citric acid cycle recovers energy for the cell

33) Which of the following can be converted into glutamic acid in a single enzyme-catalyzed step?

A) isocitrate B) oxaloacetate C) malate D) -ketoglutarate

E) succinyl-CoA Answer: D Difficulty: Easy Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

34) Which of the following can be converted into glucose using parts of the citric acid cycle?

A) malate B) isocitrate C) glutamic acid D) succinate E) all of the above Answer: E Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

35) What citric acid cycle intermediate is effectively used as a mechanism for the transport of acetyl-CoA from the mitochondria to the cytosol?

A) citrate B) isocitrate C) fumarate D) malate E) oxaloacetate Answer: A Difficulty: Easy Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

36) When acetyl-CoA and NADPH are needed for lipid synthesis, which of the following reactions is used to produce NADPH in the cytosol?

A) reduction of oxaloacetate to malate B) oxidation of malate to pyruvate C) reduction of fumarate to succinate D) oxidation of malate to oxaloacetate E) oxidation of isocitrate to -ketoglutarate Answer: B Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

37) Which of the following is an anaplerotic reaction that is often used in the cell?

A) conversion of pyruvate to acetyl-CoA B) conversion of -ketoglutarate to glutamic acid C) conversion of citrate to oxaloacetate and acetyl-CoA D) conversion of pyruvate to oxaloacetate E) conversion of succinyl-CoA to heme Answer: D Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

38) Which of the following terms indicates that the citric acid cycle is both catabolic and anabolic in nature?

A) cataplerotic B) amphipathic C) anaplerotic D) diabolic E) amphibolic Answer: E Difficulty: Easy Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

39) Which of the following is activated by high levels of acetyl-CoA? A) malate dehydrogenase B) succinyl-CoA synthetase C) pyruvate carboxylase D) pyruvate dehydrogenase E) -ketoglutarate dehydrogenase Answer: C Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

40) Which of the following enzymes allows for a net increase of citric acid cycle metabolites without expending any energy in the form of ATP or its equivalents?

A) alanine aminotransferase B) pyruvate dehydrogenase C) pyruvate carboxylase D) citrate lyase E) none of the above Answer: A Difficulty: Hard Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

41) Which of the following can cause a large increase in the activity of the citric acid cycle?

A) activation of isocitrate dehydrogenase by ADP B) activation of -ketoglutarate dehydrogenase by Ca2+ C) increasing concentrations of oxaloacetate by pyruvate carboxylase D) increasing concentrations of -ketoglutarate by transamination E) all of the above Answer: E Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

42) The mechanism of malate synthase that catalyzes the conversion of glyoxylate and acetyl-CoA to malate would be most similar to which citric acid cycle enzyme?

A) fumarase B) aconitase C) citrate synthase D) isocitrate dehydrogenase E) succinyl-CoA synthetase Answer: C Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

43) Why can germinating plant seeds convert acetyl-CoA from fatty acids into carbohydrates, while animals are incapable of converting fatty acids into glucose?

A) animals have glycogen and don't need to make glucose from fatty acids B) plants, not animals, use the glyoxylate cycle to convert acetyl CoA to oxaloacetate C) plant seeds use photosynthesis to make sugar D) animals use the citric acid cycle exclusively for energy production, plants only use glycolysis for energy E) none of the above Answer: B Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

44) What citric acid cycle enzyme is not used in the glyoxylate cycle?

A) isocitrate dehydrogenase B) fumarase C) malate dehydrogenase D) aconitase E) succinate dehydrogenase

Answer: A Difficulty: Medium Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

Question type: Text entry

45) The citric acid cycle is also called the _____ cycle.

Answer: Krebs or tricarboxylic acid Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

46) ______ is used in the first reaction of the citric acid cycle and regenerated upon completion of one turn of the citric acid cycle.

Answer: Oxaloacetate Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

Question type: Multiple choice

47) Condensation of _____ with oxaloacetate yields citrate.

A) acetyl-CoA B) α-ketoglutarate C) isocitrate

D) fumarate E) oxalosuccinate Answer: A Difficulty: Easy Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

48) Which of the following enzymes catalyzes a substrate-level phosphorylation?

A) malate synthase B) succinate dehydrogenase C) -ketoglutarate dehydrogenase D) succinyl-CoA synthetase E) fumarase Answer: D Difficulty: Easy Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

49) The reaction catalyzed by _____ requires an enzyme-bound flavin coenzyme.

A) isocitrate dehydrogenase B) -ketoglutarate dehydrogenase C) succinyl-CoA synthetase D) succinate dehydrogenase E) malate dehydrogenase

Answer: D

Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

50) The reaction catalyzed by pyruvate carboxylase is an example of a(n) ______ reaction because it replenishes the citric acid cycle intermediates that have been siphoned off for use in other reactions.

A) amphibolic B) amphipathic C) anaplerotic D) cataplerotic E) none of the above

Answer: C Difficulty: Easy Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

51) One turn of the citric acid cycle generates _____.

A) 2 FADH2, 3 ATP, 1 NADH B) 1 NAD+, 2FADH2, 1 ATP C) 1 GTP, 3 NADH, 1 FADH2 D) 1 FAD, 2 ATP, 3 NADH E) 1 FADH2, 1GTP, 2 NADH

Answer: C

Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

52) Considering the reactions within the citric acid cycle, which of the following molecules will be produced from the intermediate pictured on the right?

O

C

O-

CH 2 C

COO -

HC

COO -

A) citrate B) isocitrate C) succinate D) succinyl-CoA E) α-ketoglutarate

Answer: B

Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

Question type: Text entry

53) ______ catalyzes a substrate-level phosphorylation reaction within the citric acid cycle.

Answer: Succinyl-CoA synthetase Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

Question type: Multiple choice

54) Which reaction below produces GTP in the citric acid cycle?

A) isocitrate  -ketoglutarate B) -ketoglutarate  succinyl CoA C) succinyl CoA  succinate D) fumarate  malate E) malate  oxaloacetate

Answer: C

Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

55) Which of the following is inhibited by high levels of acetyl-CoA? A) malate dehydrogenase B) succinyl-CoA synthetase C) pyruvate carboxylase D) pyruvate dehydrogenase E) -ketoglutarate dehydrogenase Answer: D Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

56) Which of the following enzymes of the citric acid cycle is inhibited by ATP?

A) citrate synthase B) isocitrate dehydrogenase C) -ketoglutarate dehydrogenase D) succinyl-CoA synthetase E) A and B

Answer: B

Difficulty: Moderate Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

57) Which of the following represents a point of regulation for the citric acid cycle?

I. pyruvate dehydrogenase complex II. aconitase III. isocitrate dehydrogenase IV. fumarase

A) I, II, III, IV B) I, II, IV C) II, III D) I, III E) I, IV

Answer: D

Difficulty: Moderate Section Reference: 14-3

Learning Objective: Explain how the citric acid cycle recovers energy for the cell

58) Which of the following citric acid cycle intermediates can be converted to aspartate via transamination?

A) citrate B) α-ketoglutarate C) succinate

D) fumarate E) oxaloacetate

Answer: E

Difficulty: Moderate Section Reference: 14-4

Learning Objective: Explain how the citric acid cycle connects with other metabolic processes

59) If acetyl-CoA labeled with 14C, as shown in the figure, were used as the substrate for the citric acid cycle, which of the following intermediates would be produced during the first round of the cycle?

O CoAS

C *CH3

OH H O2*C

C C

CH2 CO2

H CO2

A)

OH H O 2C

C C *CH2 CO2 H CO2

B)

OH H O 2C C)

C C

CH2 *CO2

H CO2 OH H O2C *C C CH2 CO2

D)

H CO2

OH H O2C C *C CH2 CO2 H CO2

E)

Answer: B

Difficulty: Difficult Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

60) Aconitase catalyzes the _____ of citrate, followed by a _____ reaction.

A) oxidation; reduction B) reduction; oxidation C) hydration; dehydration D) dehydration; hydration E) isomerization; isomerization Answer: D Difficulty: Difficult Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

61) Consider the following reaction, which has a ∆G˚' ≈ +30 kJ/mol. malate + NAD+ → oxaloacetate + NADH + H+ In muscle cells, the reaction proceeds as written. Which of the following explains how the reaction occurs as written despite the positive value for G°'?

A) It is thermodynamically favored under standard conditions.

B) In the cell, it is kinetically favored, even though it is thermodynamically unfavorable.

C) The concentration of malate must be higher than oxaloacetate for this reaction to occur in the cell.

D) [H+] must be higher in muscle than under standard conditions, thus altering ∆G˚ to ∆G˚'.

E) None of the above

Answer: C

Difficulty: Difficult Section Reference: 14-3

Learning Objective: Explain how the citric acid cycle recovers energy for the cell

62) Bioinformatics has identified some enzymes used in the citric acid cycle in primitive bacteria. Once such a cycle used many of the citric acid cycle intermediates but occurred in the reverse direction. Researchers suspect which of the following based on this information?

A) Researchers suspect that the ―original‖ citric acid cycle was used by all species.

B) Researchers suspect that portions of the reverse cycle might have been responsible for fixing CO2.

C) Researchers suspect that early methods for converting pyruvate to acetyl CoA did not exist.

D) Researchers suspect that the current ―clockwise‖ version of the citric acid cycle could be used to help humans feed off CO2.

E) Researchers suspect that primitive prokaryotic use of the citric acid enzymes was focused on the production of CO2 rather than the use of CO2.

Answer: B

Difficulty: Difficult Section Reference: 14-2

Learning Objective: Describe the substrate, product, and type of chemical reaction for each step of the citric acid cycle

63) An individual with a shortage of B vitamins (which include thiamine and riboflavin) may feel fatigued because of decreased pyruvate dehydrogenase activity. Which of the following would be true regarding this shortage?

A) The amount of acetyl CoA produced from carbohydrate metabolism that enters the citric acid cycle would be decreased.

B) A decrease in the amount of NADH would likely decrease activity of citrate synthase.

C) Flux through the citric acid cycle would cease until adequate pyruvate is available.

D) None of the above E) All of the above

Answer: A

Difficulty: Difficult Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

64) Which of the following would decrease activity of the citric acid cycle overall?

I. high concentration of NADH II. high concentration of Ca2+ III. high concentration of ATP IV. high concentration of citrate

A) I only B) I, II, III, IV C) I, III

D) I, III, IV E) I, IV

Answer: D

Difficulty: Difficult Section Reference: 14-1

Learning Objective: Summarize the reactions carried out by the pyruvate dehydrogenase complex

Essential Biochemistry Test Bank, Chapter 15: Oxidative Phosphorylation Question type: Multiple Choice

1) The oxidation of FADH2 to FAD involves the transfer of _____; the oxidation of NADH to NAD + involves the transfer of _____.

A) a hydrogen atom and an H+; a hydride B) two hydrogen atoms; a hydride C) a hydride and an H+; a hydrogen atom and an H+ D) a hydride; two hydrogen atoms E) two hydrides; one hydride Answer: B Difficulty: Hard Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

2) Which of the following is the correct half reaction for the oxidation of acetaldehyde?

A) acetaldehyde + H2O  acetate- + 3H+ + 2eB) acetate- + 3H+ + 2e-  acetaldehyde + H2O C) acetaldehyde + 2 H+ + 2e-  ethanol D) ethanol  acetaldehyde + 2 H+ + 2eE) acetaldehyde + CO2 + H+ + 2e-  pyruvate-

Answer: A Difficulty: Medium Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

3) If the following half-reactions are combined, what is the potential for the spontaneous reaction? oxaloacetate- + 2H+ + 2e-  malateNAD+ + H+ + 2e-  NADH

 = -0.166  = -0.315

A) -0.481 V B) -0.149 V C) 0.0523 V D) 0.149 V E) .0481 V Answer: D Difficulty: Medium Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

4) If the reduction potential for NAD+ is -0.315 V and the reduction potential for oxygen is 0.815 V, what is the potential for the oxidation of NADH by oxygen?

A) -1.13 V B) -0.50 V C) 0.185 V D) 0.50 V E) 1.13 V Answer: E Difficulty: Medium Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

5) In a muscle cell at 37C, if the concentrations of pyruvate and lactate are 100 M and 50M respectively, what is the actual reduction potential if  for pyruvate reduction is -0.185 V?

A) -0.194 V B) -0.186 V C) -0.176 V D) 0.176 V E) 0.194 V Answer: C Difficulty: Hard Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

6) What is the G for the reduction of pyruvate to lactate by NADH given the following half reactions? pyruvate- + 2H+ + 2e-  lactateNAD+ + H+ + 2e-  NADH

 = -0.185  = -0.315

A) -96.5 kJ/mol B) -25.1 kJ/mol C) -12.5 kJ/mol D) 25.1 kJ/mol E) 96.5 kJ/mol Answer: B Difficulty: Hard Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

7) What does the reduction potential of 0.815 V for the reduction of water to oxygen indicate?

A) water is a very strong reducing agent B) water is a very strong reducing agent and oxygen is a very strong oxidizing agent C) oxygen is a very strong oxidizing agent D) water will be spontaneously reduced to oxygen E) none of the above Answer: C

Difficulty: Easy Section Reference: 15-1

Learning Objective: Summarize the thermodynamics of oxidation–reduction reactions

8) For eukaryotes, where are the Complexes of electron transport located?

A) cytosol B) outer mitochondrial membrane C) mitochondrial intermembrane space D) inner mitochondrial membrane E) mitochondrial matrix Answer: D Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

9) What genes are found in the mitochondrial genome?

A) electron transport proteins B) citric acid cycle enzymes C) fatty acid oxidation enzymes D) outer membrane transport proteins E) none of the above Answer: A Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

10) What is the terminal electron acceptor in aerobic organisms?

A) NAD+ B) FAD C) ubiquinone D) varies from one organism to another E) none of the above Answer: E Difficulty: Easy

Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

11) In the malate-aspartate shuttle, _____ is reduced to _____ in the cytosol.

A) aspartate; oxaloacetate B) oxaloacetate; malate C) aspartate; malate D) malate; aspartate E) malate; oxaloacetate Answer: B Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

12) In the malate aspartate shuttle, _____ is transferred into the mitochondria while _____ is transferred to the cytosol.

A) NADH; NAD+ B) NAD+; NADH C) malate; oxaloacetate D) malate; aspartate E) oxaloacetate; aspartate Answer: D Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

13) Which of the following transport mechanisms is used in the inner mitochondrial membrane? IMS = intermembrane space A) antiport of ATP from IMS to matrix, ADP from matrix to IMS B) symport of ATP and H+ from matrix to IMS C) symport of Pi and H+ from IMS to matrix D) antiport of ADP from IMS to matrix, Pi from matrix to IMS

E) symport of ADP and H+ from IMS to matrix Answer: C Difficulty: Hard Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

14) The reduction potentials of all prosthetic groups of Complex I have reduction potentials between _____ and _____.

A) NAD+; ubiquinone B) NADH; ubiquinol C) FAD; ubiquinone D) ubiquinone; oxygen E) ubiquinone; cytochrome c Answer: A Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

15) The process of _____ allows electrons to be transferred between redox centers that are up to 1.4 nm apart.

A) reduction B) swinging arm electron transfer C) electron shuttling D) electron teleporting E) tunneling Answer: E Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

16) Which of the following represents the correct order of electron flow in Complex I?

A) NADH  ubiquinone  Fe-S clusters  FMN B) NADH  Fe-S clusters  FMN  ubiquinone C) NADH  FMN  ubiquinone  Fe-S clusters D) NADH  FMN  Fe-S clusters  ubiquinone E) NADH  ubiquinone  FMN  Fe-S clusters Answer: D Difficulty: Hard Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

17) How many protons are transported from the matrix to the intermembrane space by Complex I? A) 0 B) 2 C) 4 D) 6 E) 8 Answer: C Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

18) What shuttle mechanism transfers cytosolic NADH into the mitochondria with a loss of reductive power, with the electrons entering the electron transport chain as ubiquinol instead of NADH? A) glycerol-3-phosphate shuttle B) alanine aminotransferase shuttle C) malate-aspartate shuttle D) adenine nucleotide shuttle E) none of the above Answer: A Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

19) Which of the following is a source of ubiquinol?

A) Complex I B) fatty acyl-CoA dehydrogenase C) succinate dehydrogenase D) mitochondrial dehydrogenase E) all of the above Answer: E Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

20) Complex III accepts electrons from _____ and transfers them to _____.

A) cytochrome c; cytochrome a B) ubiquinol; cytochrome c C) ubiquinone; cytochrome c D) ubiquinol; cytochrome b E) ubiquinone; cytochrome a Answer: B Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

21) The cytochromes undergo which of the following oxidation reactions?

A) Fe3+  Fe2+ B) Fe0  Fe2+ C) Fe2+  Fe3+ D) Cu1+  Cu2+ E) Cu2+  Cu1+ Answer: C Difficulty: Easy

Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

22) How many protons are moved across the inner mitochondrial membrane at Complex III? A) 1 B) 2 C) 3 D) 4 E) none of the above Answer: D Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

23) Which of the following results from the first round of the Q cycle?

A) two reduced cytochrome c and one ubiquinone B) one reduced cytochrome c and one ubiquinone C) one reduced cytochrome c, one reduced cytochrome B and one ubiquinone D) two reduced cytochrome c and one ubiquinol E) one reduced cytochrome c and one semiquinone Answer: E Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

24) Ubiquinone is a _____ molecule that serves as a _____ electron carrier; cytochrome c is a _____ molecule that serves as a _____ electron carrier.

A) hydrophobic; 2; hydrophilic; 1 B) hydrophobic; 1; hydrophilic; 1 C) hydrophilic; 2; hydrophobic; 2 D) hydrophilic; 2; hydrophobic; 1 E) hydrophobic; 1; hydrophilic; 2

Answer: A Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

25) Complex IV uses _____ and _____ ions to reduce oxygen to water.

A) manganese; iron B) copper; iron C) manganese; copper D) zinc; copper E) iron; zinc Answer: B Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

26) How many cytochrome c molecules are oxidized by Complex IV for each molecule of oxygen that is reduced?

A) 1 B) 2 C) 3 D) 4 E) it depends upon the efficiency of the electron transfer in Complex IV Answer: D Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

27) What free radical is thought to be commonly produced by the electron transport chain?

A) hydroxyl

B) peroxyl C) superoxide D) hydrogen peroxyl E) all of the above Answer: C Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

28) For every two electrons transferred from NADH to oxygen, _____ protons are pumped from the matrix to the intermembrane space.

A) 4 B) 6 C) 8 D) 10 E) 12 Answer: D Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

29) The imbalance of protons across the inner mitochondrial membrane is referred to as _____.

A) the protonmotive force B) the chemiosmotic force C) the electron transport force D) the ATP synthase force E) the proton gradient force Answer: A Difficulty: Easy Section Reference: 15-3

Learning Objective: Explain how the protonmotive force links electron transport and ATP synthesis

30) If the pH of the matrix is 7.7, what is the pH of the intermembrane space if the G for transport of H+ is 20 kJ/mol at 37C with  = 170 mV? A) 2.6 B) 7.1 C) 8.3 D) 12.8 E) cannot be determine Answer: B Difficulty: Hard Section Reference: 15-3

Learning Objective: Explain how the protonmotive force links electron transport and ATP synthesis

31) If the G for the oxidation of NADH by oxygen is -220 kJ/mol and the G for transport of H+ across the inner membrane is 20 kJ/mol, what is the efficiency for energy captured in the proton gradient versus energy evolved from NADH oxidation?

A) 9.1% B) 36% C) 45% D) 73% E) 91% Answer: E Difficulty: Hard Section Reference: 15-3

Learning Objective: Explain how the protonmotive force links electron transport and ATP synthesis

32) How many ATP molecules are synthesized from the oxidation of one NADH molecule?

A) 3 B) 2.5 C) 2 D) 1.5 E) 1 Answer: B

Difficulty: Easy Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

33) How many ATP can be produced from the complete oxidation of glucose if the malate-aspartate shuttle is used?

A) 2 B) 19.5 C) 28 D) 30 E) 32 Answer: E Difficulty: Hard Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

34) If an ATP synthase has 12 c subunits, how many protons must move through the enzyme to produce one ATP? A) 2.5 B) 3 C) 4 D) 10 E) 12 Answer: C Difficulty: Medium Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

35) Which subunit of ATP synthase is responsible for the catalysis of ATP formation?

A) a B) c C) 

D)  E)  Answer: D Difficulty: Easy Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

36) Which of the following occurs when the catalytic subunit of ATP synthase is in the loose state?

A) ADP and Pi bind B) ADP and Pi are converted to ATP C) ATP is hydrolyzed D) ATP is released E) none of the above Answer: A Difficulty: Medium Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

37) What is the P/O ratio for the oxidation of ubiquinone if three protons are required to synthesize one ATP? A) 1 B) 1.5 C) 2 D) 3 E) 3.3 Answer: B Difficulty: Medium Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

Question type: True/False

38) Ubiquinone is found in the inner mitochondrial membrane while cytochrome c is found in the matrix.

Answer: False

Difficulty: Medium Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

Question type: Dropdown

39) Under normal metabolic conditions, the difference in pH between the matrix and intermembrane space is ___ suggesting that the processes of electron transport and oxidative phosphorylation ___.

Dropdown 1: less than 1, between 1 and 2, greater than 2 Dropdown 2: always have a high level of activity, maintain a steady state, are relatively inactive

Difficulty: Medium Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

Question type: Dropdown

40) The F0 component of ATP synthase contains ___ subunits; the F1 component contains ___ subunits.

Dropdown 1: a and c,  and  Dropdown 2: a and c,  and 

Difficulty: Medium Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

Question type: Text entry

41) Complexes I and II each transfer electrons to ______.

Answer: ubiquinone Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

Question type: Multiple choice

42) Electrons from FADH2 are delivered to _____, and electrons from NADH are delivered to _____ of the electron transport chain.

A) Complex I; Complex II B) Complex I; Complex III

C) Complex II; Complex III D) Complex II; Complex I E) Complex I; Complex IV

Answer: D

Difficulty: Easy Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

43) All of the following inhibit electron transport except _____.

A) oxaloacetate B) rotenone C) anitimycin A D) cyanide E) All of the above inhibit electron transport.

Answer: A

Difficulty: Easy Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

44) Which conformation of the active sites in ATP synthase allows binding of substrates?

A) L state B) O state C) T state D) C state E) A and B

Answer: A

Difficulty: Easy Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

45) The imbalance of protons across the inner mitochondrial membrane is referred to as _____.

A) the protonmotive force B) the chemiosmotic force C) the electron transport force D) the ATP synthase force E) the proton gradient force Answer: A Difficulty: Easy Section Reference: 15-3

Learning Objective: Explain how the protonmotive force links electron transport and ATP synthesis

46) Which of the following statements is(are) true about oxidative phosphorylation?

I. Electron transport provides energy to pump protons into the intermembrane space.

II. An electrochemical gradient is formed across the inner mitochondrial membrane.

III. Potassium and sodium ions form an ionic gradient across the inner mitochondrial membrane.

IV. Complexes I, III, IV actively transport protons into the intermembrane space during electron transport.

A) I, II, III, IV B) I, II, IV C) II, III, IV D) I, IV E) II, IV

Answer: B

Difficulty: Moderate Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

47) In the electron transport chain, electrons are passed from redox center to redox center ____.

A) spontaneously because of the redox potential gradient B) in an ATP dependent fashion C) because of the addition of free energy D) because of the proton gradient E) with the assistance of a carrier protein

Answer: A

Difficulty: Moderate Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

48) Which statement concerning Complex II of the electron transport chain is false?

I. This complex oxidizes FADH2 and reduces coenzyme Q. II. This complex includes the covalently bound enzyme succinate dehydrogenase.

III. This complex pumps protons from the matrix to the intermembrane space.

IV. This complex also oxidizes succinate to fumarate in the citric acid cycle.

A) I, II B) II only C) II, III D) III only E) IV only

Answer: D

Difficulty: Moderate Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

49) Which of the prosthetic groups listed can accept or donate either one or two electrons because of the stability of the semiquinone state?

A) cytochrome c B) NADH C) ubiquinone D) [2Fe-2S] E) Rieske center

Answer: C

Difficulty: Moderate Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

Question type: Text entry

50) The cytochromes within Complex III all contain _____ groups.

Answer: heme Difficulty: Moderate Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

Question type: Multiple choice

51) Which of the following best describes the function of cytochrome c oxidase?

A) Cytochrome c oxidase oxidizes four consecutive cytochrome c molecules, via one-electron transfers, while simultaneously reducing one O2 to two H2O. B) Cytochrome c oxidase oxidizes two consecutive cytochrome c molecules, via two-electron transfers, while simultaneously reducing one O2 to two H2O. C) Cytochrome 0 oxidase oxidizes four consecutive cytochrome c molecules, via one-electron transfers, while simultaneously reducing two O2 to two H2O. D) Cytochrome c oxidase oxidizes two consecutive cytochrome c molecules, via two- electron transfers, while simultaneously reducing two O2 to two H2O.

Answer: A

Difficulty: Moderate Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

52) _____ the gradient with the synthesis of ATP via oxidative phosphorylation.

I. The Fo portion of ATP synthase dissipates II. Thermogenin uncouples III. 2,4-dinitrophenol (DNP) dissipates IV. An ionophore capable of transporting potassium ions across the membrane

A) I, II, III, IV B) II, III, IV C) II, III D) II only E) I, IV

Answer: C

Difficulty: Moderate Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

53) Which of the following occurs when the catalytic subunit of ATP synthase is in the loose state?

A) ADP and Pi bind.

B) ADP and Pi are converted to ATP. C) ATP is hydrolyzed.

D) ATP is released.

E) None of the above Answer: A Difficulty: Moderate Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

54) Based on the information in the chapter, which of the following is true regarding Complex III? I. A large portion of Complex III dissociates from the membrane-bound portion of the complex.

II. Complex III contains three identical cytochrome redox centers.

III. The Q cycle allows stepwise reoxidation of the two electrons from CoQH2.

IV. A change in conformation of iron sulfur protein (ISP) ensures that the Rieske center is reduced preferentially by CoQ-.

A) I only B) I, II C) III only D) III, IV E) I, III, IV

Answer: C

Difficulty: Difficult Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

55) In a newly discovered electron transport complex, a researcher has identified the redox center Fe-S, cytochrome c, and coenzyme Q. The researcher also knows that this complex ultimately passes its electrons to oxygen. What is most likely the redox center that completes this task?

A) Fe-S B) 2Fe-2S C) coenzyme Q D) cytochrome c E) none of the above

Answer: D

Difficulty: Difficult Section Reference: 15-2

Learning Objective: Map the path of electrons through the redox groups of the electron transport pathway

56) A poison that prevents the transfer of electrons from the last [Fe-S] cluster of Complex I to coenzyme Q is added to a suspension of actively respiring mitochondria. Which of the following will be observed?

A) ATP production would be impaired due to the uncoupling of oxidative phosphorylation from electron transport.

B) ATP production would be reduced because of inhibition of the CoQ subunit of ATP synthase.

C) ATP production would be reduced because of a decrease in the number of protons pumped out of the mitochondrial matrix.

D) ATP production would be halted completely because of the block in electron transport through the electron transport chain.

E) ATP production would be maintained at the normal rate because of functional overlap between Complex I and Complex II.

Answer: C

Difficulty: Difficult Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

57) The effects of a poison on actively respiring mitochondria are being studied to determine its mode of action. When the poison is added, every component of the electron transport chain is found to be in its reduced form based on spectroscopic analysis, and ATP production ceases entirely. It is reasoned that the poison is either blocking the final transfer of electrons to oxygen or is blocking the ATP synthase. Which of the following experiments will help unravel this dilemma?

A) Add a second blocking agent to interfere with either Complex I or Complex II along with the poison.

B) Add an artificial electron donor along with the poison.

C) Add an uncoupling agent along with the poison.

D) Any of the above would allow differentiation between these two possibilities.

E) None of the above will help distinguish between these two possibilities.

Answer: C

Difficulty: Difficult Section Reference: 15-4

Learning Objective: Describe the structure and operation of ATP synthase

Essential Biochemistry Test Bank, Chapter 16: Photosynthesis Question type: Multiple Choice

1) What were the first organisms that had the ability to oxidize water to oxygen?

A) purple bacteria B) green sulfur bacteria C) cyanobacteria D) ferns E) green plants Answer: C Difficulty: Easy Section Reference: 16-1 Study Objective: Describe the structure and purpose of pigment molecules

2) What organelle is responsible for photosynthesis?

A) Golgi apparatus

B) chloroplast C) endoplasmic reticulum D) peroxisome E) glyoxysome Answer: B Difficulty: Easy Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

3) What part of the chloroplast is the site of the energy-transducing reactions of photosynthesis?

A) chloroplast outer membrane B) chloroplast inner membrane C) stroma D) thylakoid lumen E) thylakoid membrane Answer: E Difficulty: Easy Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

4) How much energy is contained in a mole of photons with a wavelength of 490 nm?

A) 4.1  10-19 J/mol B) 2.4  10-4 J/mol C) 127 kJ/mol D) 244 kJ/mol E) 2.4  105 kJ/mol Answer: D Difficulty: Medium Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

5) Chlorophylls and carotenoids absorb most light between ______ nm and _____ nm while reflecting most light between _____ nm.

A) 400-500; 600-700; 500-600 B) 300-400; 600-700; 400-600 C) 400-600; 700-800; 600-700 D) 300-400; 700-800; 400-700 E) none of the above Answer: A Difficulty: Easy Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

6) Which of the following can happen when a photosynthetic pigment absorbs light?

A) energy lost as heat B) energy given off by fluorescence C) exciton transfer D) photooxidation E) all of the above Answer: E Difficulty: Easy Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

7) What is an assembly of antenna pigments?

A) thylakoid B) granum C) light-harvesting complex D) reaction center E) lamella Answer: C Difficulty: Easy Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

8) Which of the following explains how a reaction center is excited?

A) a reaction center can only be excited by direct absorption of a photon of light B) excitation can occur by any of the antenna pigments in direct contact with the reaction center C) excitation occurs when an antenna fluoresces so that the photon of light can be captured by a reaction center D) any antenna of the light harvesting complex can transfer an electron to the reaction center by exciton transfer E) transfer of heat energy from antenna to reaction center allows for excitation Answer: D Difficulty: Medium Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

9) The P680 of photosystem II is composed of _____.

A) two chlorophylls B) two carotenoids C) one chlorophyll and one phycocyanin D) one chlorophyll and one carotenoid E) one carotenoid and one phycocyanin Answer: A Difficulty: Easy Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

10) Complete the following reaction: P680 + light  _____  _____ A) P680*; P680- + H+ B) P680*; P680+ + eC) P680-; P680* D) P680+; P680* E) none of the above Answer: B Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

11) Electrons are transferred from P680 to _____, then to cytochrome b6f.

A) ubiquinone B) plastoquinone C) plastocyanin D) P700 E) NADP+ Answer: B Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

12) How many photons of light must be absorbed by photosystem II to produce one molecule of oxygen?

A) 1 B) 2 C) 4 D) 8 E) 16 Answer: C Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

13) During the oxidation of water, where do the protons go?

A) thylakoid lumen B) stroma C) space between inner and outer chloroplast membrane D) cytosol E) protons are not released but transferred to proteins for metabolic use

Answer: A Difficulty: Easy Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

14) Since the reduction potential of oxygen is +0.815 V and the reaction catalyzed by P680 is highly exergonic, which of the following is most likely the reduction potential of P680*?

A) -1.15 V B) -0.815 V C) +0.77 V D) +0.83 V E) +1.15 V Answer: E Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

15) Cytochrome b6f is most similar to mitochondrial _____ with the exception that electrons are passed to _____, not to cytochrome c.

A) complex I; plastocyanin B) complex I; plastoquinone C) complex III; plastocyanin D) complex III; plastoquinone E) none of the mitochondrial complexes are similar to cytochrome b6f Answer: C Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

16) The active group of photosystem I is known as _____.

A) P800 B) P700 C) P660 D) P650 E) P450 Answer: B Difficulty: Easy Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

17) Why is photosystem I unable to oxidize water?

A) it cannot transfer protons to the stroma B) it contains proteins that prevent oxygen from binding to it C) its reduction potential is exactly equal to that of oxygen D) it is a very good reducing agent E) it is not a strong enough oxidizing agent Answer: E Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

18) Which of the following shows the correct movement of electrons in the Z-scheme of photosynthesis?

A) H2O  P700  plastoquinone  cytochrome b6f  plastocyanin  P680  ferredoxin  NADP+ B) H2O  P680  plastocyanin  cytochrome b6f  plastoquinone  P700  ferredoxin  NADP+ C) H2O  P680  plastoquinone  ferredoxin  plastocyanin  P700  cytochrome b6f  NADP+ D) H2O  P680  plastoquinone  cytochrome b6f  plastocyanin  P700  ferredoxin  NADP+ E) H2O  P680  ferredoxin  plastoquinone  P700  cytochrome b6f  plastocyanin  NADP+ Answer: D Difficulty: Hard Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

19) Which of the following occurs during cyclic electron flow?

A) photosystem I absorbs light but not photosystem II B) protons are pumped into the lumen by cytochrome b6f C) electrons are transferred from photosystem I  ferredoxin cytochrome b6f  plastocyanin, then back to photosystem I D) there is no production of NADPH or oxygen E) all of the above Answer: E Difficulty: Hard Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

20) For each molecule of oxygen generated, _____ photons are absorbed by photosystems I and II, _____ protons are transferred from stroma to lumen allowing for the production of _____ molecules of ATP. A) 4; 8; 2 B) 4; 12; 4 C) 8; 8; 4 D) 8; 12; 3 E) 8; 16; 4 Answer: D Difficulty: Hard Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

21) Light dependent ATP production is called _____ and occurs in the _____ of chloroplasts.

A) photophosphorylation; thylakoid membrane B) photophosphorylation; inner membrane C) non-oxidative phosphorylation; thylakoid membrane

D) non-oxidative phosphorylation; inner membrane E) chloroplast-associated phosphorylation; thylakoid membrane Answer: A Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

22) The carbon fixing reactions occur in the _____ .

A) thylakoid lumen B) thylakoid membrane C) stroma D) space between inner and outer chloroplast membrane E) cytosol Answer: C Difficulty: Easy Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

23) In the rubisco mechanism, what performs the nucleophilic attack on carbon dioxide?

A) water B) enediolate intermediate C) enol intermediate D) a carboxylate E) none of the above Answer: B Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

24) Why does rubisco make up about half of the protein content in a typical chloroplast?

A) most of the enzyme is in an oxidized state, waiting for the production of NADPH to reactivate it B) it has an extremely high Km for CO2, thus a large number of enzymes increased the chance of substrate binding C) since oxygen is also a substrate, those enzymes that bind oxygen are sequestered D) it is a very inefficient enzyme, catalyzing only three reactions per second E) none of the above Answer: D Difficulty: Easy Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

25) If carbon dioxide is used as a substrate, the major products of rubisco are _____; if oxygen is used as a substrate, the major products of rubisco are _____.

A) 2 molecules of 3-phosphoglycerate; 2-phosphoglycolate and 3-phosphoglycerate B) 2 molecules of 3-phosphoglycerate; glyoxylate and 3-phosphoglycerate C) 3-phosphoglycerate and glyceraldehyde-3-phosphate; 2-phosphoglycolate and 3-phosphoglycerate D) 3-phosphoglycerate and glyceraldehyde-3-phosphate; glyoxylate and 3-phosphoglycerate E) none of the above Answer: A Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle 26) Which of the following describes photorespiration?

A) consumes ATP B) consumes NADPH C) produces CO2 D) consumes oxygen E) all of the above Answer: E Difficulty: Easy Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

27) In C4 plants, CO2 (as bicarbonate) is condensed with _____ to yield _____ in the mesophyll cells.

A) pyruvate; oxaloacetate B) 3-phosphoglycerate; malate C) lactate; fumarate D) phosphoenolpyruvate; oxaloacetate E) oxaloacetate; -ketoglutarate Answer: D Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

28) In C4 plants, _____ is found in the mesophyll cells to capture CO2 while _____ is found in the bundle sheath cells to release CO2.

A) phosphoenolpyruvate carboxylase; malic enzyme B) pyruvate carboxylase; malic enzyme C) pyruvate carboxylase; -ketoglutarate dehydrogenase D) pyruvate kinase; pyruvate dehydrogenase E) none of the above Answer: A Difficulty: Hard Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

29) The products of the light reactions, ATP and NADPH, are used by ______ and ______, respectively.

A) rubisco; glyceraldehyde-3-phosphate dehydrogenase B) phosphoglycerate kinase; glyceraldehyde-3-phosphate dehydrogenase C) phosphoribulokinase; 3-phosphoglycerate dehydrogenase D) phosphofructokinase; pyruvate dehydrogenase E) phosphoglycerate kinase; 3-phosphoglycerate dehydrogenase Answer: B Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

30) The Z-scheme of photosynthesis produces a 3:2 ratio of ATP:NADPH. How does a C 4 plant compensate for the greater ATP requirement created by the C4 pathway?

A) no changes need to be made since there is more ATP available from the light reactions than actually needed for carbon fixation B) no cyclic photophosphorylation can occur C) more cyclic photophosphorylation must occur D) oxygen production must be increased at photosystem II E) oxygen production must be decreased at photosystem II Answer: C Difficulty: Hard Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

31) Regeneration of the rubisco substrate, ribulose-1,5-bisphosphate involves which of the following sugars?

A) a tetrose-phosphate B) a pentose-phosphate C) a hexose-phosphate D) a heptose-phosphate E) all of the above Answer: E Difficulty: Easy Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

32) The production of one molecule of glucose requires _____.

A) 6 CO2, 9 ATP, 6 NADPH B) 6 CO2, 18 ATP, 12 NADPH C) 6 CO2, 6 ATP, 9 NADPH D) 6 CO2, 12 ATP, 18 NADPH E) 3 CO2, 9 ATP, 6 NADPH

Answer: B Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

33) What causes carboxylation of a critical lysine residue that coordinates Mg 2+ in the rubisco active site to occur?

A) when ATP levels are high due to high activity of the light reactions B) when NADPH level are high due to high activity of the light reactions C) when pH is low due to low activity of the light reactions D) when pH is high due to high activity of the light reactions E) when reduced ferredoxin is high due to high activity of the light reactions Answer: D Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

34) The Z-scheme of photosynthesis produces a 3:2 ratio of ATP:NADPH. How does a plant compensate when starch or sucrose is being synthesized?

A) no changes need to be made since there is more ATP available from the light reactions than actually needed for carbon fixation B) no cyclic photophosphorylation can occur C) more cyclic photophosphorylation must occur D) more NADPH must be made E) none of the above Answer: C Difficulty: Hard Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

35) What two substrates are needed to produce sucrose in plants?

A) UDP-glucose and fructose-6-phosphate B) UDP-fructose and glucose-6-phosphate C) glucose and fructose-1,6-bisphosphate D) UDP-glucose-6-phosphate and fructose E) UDP-glucose and fructose-1,6-bisphosphate Answer: A Difficulty: Medium Section Reference: 16-3

Learning Objective: Describe the steps of carbon fixation by the Calvin cycle

Question type: True/False

36) Fluorescence and exciton transfer are the two mechanisms by which an excited chlorophyll molecule can productively transfer energy; heat and photooxidation are unproductive mechanisms for energy transfer.

Answer: False

Difficulty: Medium Section Reference: 16-1

Learning Objective: Describe the structure and purpose of pigment molecules

37) Cyclic electron flow allows the chloroplast to produce a greater amount of NADPH than it would under noncyclic electron flow.

Answer: False

Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

Question type: Dropdown

38) During photosynthetic electron transport, protons are pumped from the ___ to the ___.

Dropdown 1: stroma, lumen, space between inner and outer membrane Dropdown 2: stroma, lumen, space between inner and outer membrane

Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

Question type: Dropdown

39) The chloroplast ATP synthase move protons from ___ with release of ATP into the ___.

Dropdown 1: stroma to lumen, lumen to stroma Dropdown 2: stroma, lumen

Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

Question type: Dropdown

40) Fixation of one molecule of CO2 in the Calvin cycle requires ___ ATP and ___ NADPH.

Dropdown 1: 1, 2, 3, 4

Dropdown 2: 1, 2, 3, 4

Difficulty: Medium Section Reference: 16-2

Learning Objective: Trace the energy transformations that take place during the light reactions of photosynthesis

Essential Biochemistry Test Bank, Chapter 17: Lipid Metabolism Question type: Multiple Choice

1) Of the major lipoproteins, _____ are highest in cholesterol and cholesterol esters while _____ are highest in triacylglycerols.

A) chylomicrons; HDL B) VLDL; LDL C) LDL; VLDL D) LDL; chylomicrons E) HDL; VLDL Answer: D Difficulty: Medium Section Reference: 17-1

Learning Objective: Summarize the roles of lipoproteins in lipid metabolism

2) To oxidize the fatty acids in a triacylglycerol, what must occur first?

A) fatty acid activation B) lipolysis C) transport into the mitochondria D) oxidation of a carbon-carbon single bond to an alkene E) none of the above Answer: B Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

3) The hydrolysis of triacylglycerols stored in adipose tissue is catalyzed by the enzyme _____.

A) hormone-sensitive lipase B) lipoprotein lipase C) albumin-associated lipase D) chylomicron lipase E) adipocyte lipase Answer: A Difficulty: Easy Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

4) What is the product of fatty acid activation?

A) acyladenylate B) pyrophosphate C) acyl-CoA D) acyl ester E) acyl-carnitine Answer: C Difficulty: Easy Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

5) What transport system moves activated fatty acids from the cytosol to the mitochondrial matrix?

A) triacylglycerol shuttle B) glycerol phosphate shuttle C) acyl adenylate shuttle D) lipoprotein shuttle E) carnitine shuttle Answer: E Difficulty: Easy Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

6) Each round of -oxidation of a saturated fatty acyl-CoA produces _____.

A) 1 NADH, 1 QH2, 1 CO2, 1 acetyl-CoA B) 1 NADH, 1 QH2, 1 acetyl-CoA C) 1 NADH, 1 QH2, 2 acetyl-CoA D) 1 NADH, 1 QH2, 1 H2O, 1 acetyl-CoA E) 2 NADH, 1 QH2, 1 acetyl-CoA Answer: B Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

7) What are the -oxidation products of stearic acid, a saturated fatty acid with 18 carbons?

A) 9 NADH, 9 QH2, 9 acetyl-CoA B) 9 NADH, 8 QH2, 9 acetyl-CoA C) 8 NADH, 9 QH2, 9 acetyl-CoA D) 8 NADH, 8 QH2, 9 acetyl-CoA E) 8 NADH, 7 QH2, 9 acetyl-CoA Answer: D Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

8) In the -oxidation pathway, the oxidation occurs at carbon _____ with the acetyl group that becomes acetyl-CoA derived from the _____ end of the fatty acid.

A) 1; carbonyl B) 1; methyl C) 2; carbonyl D) 2; methyl E) 3; carbonyl Answer: E Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

9) How many ATP can be produced by the complete oxidation of palmitoleic acid, a 16-carbon monounsaturated fatty acid, considering that the fatty acid must first be activated?

A) 26.5 B) 96.5 C) 104.5 D) 106.5 E) none of the above Answer: C Difficulty: Hard Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

10) What coenzyme is required for the complete -oxidation of a polyunsaturated fatty acid?

A) NADPH B) NADP+ C) NADH D) FADH2 E) all of the above Answer: A Difficulty: Hard Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

11) During -oxidation of an odd-chain fatty acid, the last three carbon atoms from the oxidized fatty acid enter the citric acid cycle as _____.

A) propionyl-CoA B) methylmalonyl-CoA C) succinyl-CoA D) succinate E) fumarate Answer: C Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

12) During -oxidation in the peroxisome, what reoxidizes the enzyme-bound FADH2 during the first oxidation of the pathway?

A) H2O2 B) O2 C) NAD+ D) FMN E) none of the above Answer: B Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

13) Which of the following types of fatty acids would be oxidized exclusively in the peroxisome instead of the mitochondria?

A) short-chain saturated fatty acids B) very long-chain saturated fatty acids C) monounsaturated fatty acids D) polyunsaturated fatty acids E) branched-chain fatty acids

Answer: E Difficulty: Medium Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

14) Fatty acid oxidation occurs in the _____; fatty acid synthesis occurs in the _____.

A) mitochondria; cytosol B) mitochondria; lysosome C) lysosome; Golgi apparatus D) cytosol; Golgi apparatus E) mitochondria; endoplasmic reticulum Answer: A Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

15) The portion of the acyl carrier protein that activates the growing fatty acid is similar to the structure of _____.

A) biotin B) thiamine pyrophosphate C) tetrahydrobiopterin D) coenzyme A E) folic acid Answer: D Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

16) The activation of acetyl-CoA for fatty acid synthesis is achieved by converting the acetyl-CoA into _____.

A) propionyl-CoA

B) malonyl-CoA C) acetoacetyl-CoA D) HMG-CoA E) -hydroxybutyryl-CoA Answer: B Difficulty: Medium Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

17) Acetyl-CoA carboxylase requires the coenzyme _____ and _____ as an energy source.

A) FADH2; acyl-CoA hydrolysis B) NADPH; GTP C) biotin; ATP D) coenzyme A; GTP E) thiamine pyrophosphate; acyl-CoA hydrolysis Answer: C Difficulty: Medium Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

18) What molecule is able to move across the mitochondrial membrane and is thus used to “transfer” acetyl-CoA from the mitochondria to the cytosol?

A) acetate B) oxaloacetate C) -ketoglutarate D) citrate E) succinate Answer: D Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

19) If a reaction that included all of the enzymes involved in fatty acid synthesis was supplied with excess ATP, NADPH, acetyl-CoA and 14CO2 (where the carbon was a 14C-label), where would the labeled carbon appear in the finished fatty acid?

A) odd-numbered carbons B) even-numbered carbons C) every third carbon D) every fifth carbon E) no carbons would be labeled Answer: E Difficulty: Hard Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

20) In fatty acid synthesis, _____ catalyzes the reverse reaction of _____ in -oxidation.

A) 3-ketoacyl-ACP synthase; acyl-CoA dehydrogenase B) 3-ketoacyl-ACP reductase; 3-hydroxyacyl-CoA dehydrogenase C) 3-hydroxyacyl-ACP dehydrase; enoyl-CoA hydratase D) enoyl-ACP reductase; thiolase E) transacylase; enoyl-CoA hydratase Answer: C Difficulty: Hard Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

21) When a growing fatty acid is not attached to the ACP, it is attached to a _____ residue of the fatty acid synthase complex.

A) Cys B) Ser C) Tyr D) Glu E) His Answer: A

Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

22) What are the energy requirements for the synthesis of one molecule of palmitate from eight molecules of acetyl-CoA in the mitochondria?

A) 16 NADPH, 15 ATP B) 16 NADPH, 8 ATP C) 16 NADPH, 7 ATP D) 14 NADPH, 15 ATP E) 14 NADPH, 7 ATP Answer: D Difficulty: Hard Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

23) What pathway supplies the bulk of the NADPH needed for fatty acid synthesis in mammals?

A) citric acid cycle B) pentose phosphate pathway C) glycolysis D) light reactions of photosynthesis E) all of the above Answer: B Difficulty: Medium Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

24) What enzymes are required to make fatty acids containing 22 or 24 carbons?

A) elongases B) reductase C) desaturase D) hydratase

E) malonyl-CoA ligase Answer: A Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

25) Which enzyme is the most important control point for fatty acid synthesis?

A) ATP-citrate lyase B) transacylase C) 3-ketoacyl-ACP reductase D) 3-hydroxyacyl-ACP dehydrase E) acetyl-CoA carboxylase Answer: E Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

26) Ketone bodies are produced in the _____ and used by the _____ only under conditions such as a prolonged fast.

A) liver; heart B) liver; brain C) liver; skeletal muscle D) kidneys; heart E) kidneys; brain Answer: B Difficulty: Medium Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

27) The conversion of 3-hydroxybutyrate to two molecules of acetyl-CoA produces 1 NADH and consumes 1 equivalent of ATP. What is the net ATP yield from the complete oxidation of 3-

hydroxybutyrate?

A) 1.5 B) 11.5 C) 13.5 D) 21.5 E) 23.5 Answer: D Difficulty: Hard Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

28) The synthesis of triacylglycerols involves the addition of acyl groups to glycerol-3-phosphate. What is the source of the acyl groups?

A) free fatty acid B) fatty acid attached to the acyl carrier protein C) fatty acyladenylate D) acyl-carnitine E) fatty acyl-CoA Answer: E Difficulty: Medium Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

29) Which of the following best describes the order for the conversion of glycerol-3-phosphate into a triacylglycerol?

A) 1 phosphatase reaction then 3 acyltransferase reactions B) 1 acyltransferase reaction, 1 phosphatase reaction, then 2 more acyltransferase reactions C) 2 acyltransferase reactions, 1 phosphatase reaction, then 1 acyltransferase reaction D) 3 acyltransferase reactions then 1 phosphatase reaction E) 1 acyltransferase reaction, 1 phosphatase reaction, 1 acyltransferase reaction, 1 phosphatase reaction, then 1 acyltransferase reaction Answer: C Difficulty: Hard Section Reference: 17-4

Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

30) What is used to activate phosphoethanolamine prior to reaction with a diacylglycerol?

A) ATP B) CTP C) GTP D) TTP E) UTP Answer: B Difficulty: Medium Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

31) Which of the following best describes the sequence of events for the synthesis of phosphatidylcholine?

A) phosphocholine condenses with glycerol-3-phosphate, then two fatty acids are added B) CDP-choline reacts with a monoacylglycerol followed by fatty acid addition C) a diacylglycerol pyrophosphate reacts with choline D) CDP-choline reacts with a diacylglycerol E) none of the above Answer: D Difficulty: Hard Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

32) Which of the following explains how phosphatidylserine is synthesized?

A) serine displaces the ethanolamine from a phosphatidylethanolamine B) serine reacts with a diacylglycerol pyrophosphate C) CDP-serine reacts with diacylglycerol D) serine reacts with a CDP-diacylglycerol E) the ethanolamine group of phosphatidylethanolamine is carboxylated to form serine Answer: A Difficulty: Medium Section Reference: 17-4

Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

33) What enzyme is the major control point of cholesterol synthesis in humans?

A) HMG-CoA synthase B) HMG-CoA lyase C) HMG-CoA reductase D) thiolase E) isopentenyl pyrophosphate synthase Answer: C Difficulty: 1 Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

34) What mechanism is used to control whether HMG-CoA is used for ketone body synthesis or for cholesterol synthesis?

A) control of HMG-CoA lyase versus HMG-CoA reductase B) control of NADPH versus acetyl-CoA levels C) control of NADPH:NAD+ levels D) depletion of products influences where HMG-CoA will be shunted E) ketone bodies are synthesized in the mitochondria; cholesterol is synthesized in the cytoplasm Answer: E Difficulty: Medium Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

35) What class of lipid is squalene, the precursor to cholesterol?

A) isoprenoid B) fatty acid C) steroid D) wax E) triacylglycerol Answer: A Difficulty: Easy

Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

36) Which of the following commonly occurs before cholesterol is packaged into a VLDL? A) oxidation to increase water solubility B) esterification with a fatty acid C) phosphorylation by ATP D) hydration of the alkene E) all of the above may occur Answer: B Difficulty: Medium Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

37) Cholesterol is converted into _____, a molecule that aids in the absorption of dietary lipids.

A) aldosterone B) cortisol C) -estradiol D) progesterone E) cholate Answer: E Difficulty: Medium Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

38) Which of the lipoproteins is responsible for removing cholesterol from cells?

A) chylomicron B) VLDL C) LDL D) HDL E) VHDL Answer: D Difficulty: Easy

Section Reference: 17-1

Learning Objective: Summarize the roles of lipoproteins in lipid metabolism

Question type: True/False

39) Three of the key events in atherosclerosis are lipid accumulation on arterial walls, inflammation, and calcification.

Answer: true Difficulty: Medium Section Reference: 17-1

Learning Objective: Summarize the roles of lipoproteins in lipid metabolism

Question type: Dropdown

40) A ___ becomes a ___ through loss of cholesterol to tissue.

Dropdown 1: chylomicron, VLDL, LDL, HDL Dropdown 2: chylomicron, VLDL, LDL, HDL

Difficulty: Medium Section Reference: 17-1

Learning Objective: Summarize the roles of lipoproteins in lipid metabolism

Question type: Dropdown

41) The movement of ___ into a cell occurs by endocytosis following ___.

Dropdown 1: VLDL, LDL Dropdown 2: binding of LDL to the LDL receptor, oxidation of the LDL particle, removal of triacylglycerols from the VLDL.

Difficulty: Medium Section Reference: 17-1

Learning Objective: Summarize the roles of lipoproteins in lipid metabolism

Question type: Multiple choice

42) The most notable difference between _____ and other lipids is the presence of four fused rings.

A) cholesterol B) arachidonic acid C) ganglioside D) plasmalogen E) triacylglycerol Answer: A Difficulty: Easy Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

Question type: Text entry

43) Eicosanoids are 20-carbon compounds derived from _____.

Answer: arachidonic acid or eicosapentaenoic acid or dihomogamalinolenic acid

Difficulty: Easy Section Reference: 17-4 Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

44) The -oxidation of odd-numbered fatty acids results in _____ as a final product.

Answer: propionyl-CoA Difficulty: Easy Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

Question type: Multiple choice

45) Which enzyme is the rate-determining step for fatty acid synthesis?

A) ATP-citrate lyase B) trans acylase C) 3-ketoacyl-ACP reductase D) 3-hydroxyacyl-ACP dehydrase E) acetyl-CoA carboxylase Answer: E Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

Question type: Text entry

46) Fatty acid synthesis requires both acetyl-CoA and _____ as initiator molecules.

Answer: malonyl-CoA

Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

47) The molecules acetoacetate, acetone, and D--hydroxybutyrate are metabolic fuels termed _____.

Answer: ketone bodies Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

48) Which of the following is the starting metabolite in ketone body biosynthesis?

A) acetyl CoA B) malonyl CoA C) propionyl CoA D) acetyl CoA and propionyl CoA E) acetyl CoA and malonyl CoA Answer: A Difficulty: Easy Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

49) Considering the characteristics of common fatty acids found in animals described in the text, which of the structures shown below would you consider the rarest fatty acid if found in animals?

A) structure A B) structure B C) structure C D) structure D E) All structures would be equally rare.

Answer: C

Difficulty: Moderate Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

50) Which of the following statements describes one reason that plant oils are generally healthier for human consumption than animal fats?

A) Plant oils usually contain more unsaturated fatty acids than animal fats.

B) Plant oils usually contain more trans fatty acids than animal fats.

C) Plant oils usually have more saturation than animal fats.

D) Plant oils are glycerol based rather than phospholipid based.

E) Plant oils have shorter chain fatty acids than animal fats.

Answer: A

Difficulty: Moderate Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

51) Triglycerides contain more metabolic energy per unit weight than glycogen because _____.

I. glycogen has greater polarity than fatty acids II. fatty acids predominate in an anhydrous form III. fatty acids are less oxidized than carbohydrates IV. triglycerides have a higher average molecular mass

A) I, II, III, IV B) I, II, III C) I, II

D) II, III E) III

Answer: B

Difficulty: Moderate Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

52) Considering the figure below, what compound would be formed by action of acyl-CoA dehydrogenase?

F)

G)

H)

I)

J)

Answer: A Difficulty: Moderate Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

53) During -oxidation of an odd-chain fatty acid, the last three carbon atoms from the oxidized fatty acid enter the citric acid cycle as _____.

A) propionyl-CoA B) methylmalonyl-CoA C) succinyl-CoA D) succinate E) fumarate Answer: C Difficulty: Moderate Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

54) What is the net production of ATP from complete catabolism of the following fatty acid to CO2 and H2O? O C OH

A) < 50 B) 51–90 C) 91–120 D) 121–150 E) 151 + Answer: B Difficulty: Moderate Section Reference: 17-2

Learning Objective: Describe the chemical reactions required to oxidize fatty acids

54) The activation of acetyl-CoA for fatty acid synthesis is achieved by converting the acetyl-CoA into _____.

A) propionyl-CoA B) malonyl-CoA C) acetoacetyl-CoA D) HMG-CoA E) -hydroxybutyryl-CoA Answer: B Difficulty: Moderate Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

55) Which of the following statements are true regarding fatty acids?

I. Fatty acids with fewer than 14 carbons are the most common.

II. Synthesis of fatty acids occurs in 2 carbon units.

III. Fatty acids with conjugated double bonds are the most common type of fatty acid.

IV. In higher plants and animals, C16 and C18 species predominate.

A) I, II, III, IV B) I, II, III C) I, III D) II, III, IV E) II, IV

Answer: E

Difficulty: Moderate Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

56) In which location listed below does the following reaction take place?

HMG-CoA → acetoacetate + Acetyl-CoA A) cytosol of cardiomyocytes B) mitochondria of cardiomyocytes C) cytosol of liver cells D) mitochondria of liver cells E) all of the above Answer: D Difficulty: Moderate Section Reference: 17-4

Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

57) Which of the following is true regarding the enzyme acetyl-CoA carboxylase?

I. It catalyzes the rate-limiting step in fatty acid oxidation.

II. It requires S-adenosylmethionine.

III. It produces malonyl CoA. IV. It uses acetyl CoA. A) I, II, III, IV B) I only C) I, III, IV D) III, IV E) III only Answer: D Difficulty: Difficult Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

58) Which of the following diets would most likely promote the formation of ketone bodies?

A) high simple carbohydrates, low fat B) high complex carbohydrates, high fructose

C) high fat, high protein, low carbohydrate D) low fat, high protein, high complex carbohydrates E) high fructose; high whole-grain carbohydrates Answer: C Difficulty: Difficult Section Reference: 17-3

Learning Objective: Describe the chemical reactions required to synthesize fatty acid and ketone bodies

59) Which of the following is the correct sequence of events in cholesterol synthesis? (Note: not all events in the sequence are included.)

A) HMG-CoA > isopentyl pyrophosphate > farnesyl pyrophosphate > geranyl pyrophosphate B) isopentyl pyrophosphate > squalene > oxidosqualene > geranyl pyrophosphate C) dimethylallyl pyrophosphate > geranyl pyrophosphate > farnesyl pyrophosphate > squalene D) HMG–CoA > phosphomevalonate > squalene > farnesyl pyrophosphate E) mevalonate > dimethylallyl pyrophosphate > farnesyl pyrophosphate > geranyl pyrophosphate Answer: C Difficulty: Difficult Section Reference: 17-4

Learning Objective: Summarize the synthesis of triacylglycerols, phospholipids, and cholesterol

Essential Biochemistry Test Bank, Chapter 18: Nitrogen Metabolism Question type: Multiple Choice

1) How many ATP and electrons are required for the reduction of one molecule of nitrogen to two molecules of ammonia in the reaction catalyzed by nitrogenase?

A) 8 ATP and 8 electrons B) 16 ATP and 8 electrons C) 16 ATP and 16 electrons D) 8 ATP and 16 electrons E) 16 ATP and 6 electrons Answer: B Difficulty: Medium Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

2) Which of the following are required by nitrogenase to carry out the reduction of nitrogen?

A) an iron-molybdenum cofactor B) iron-sulfur centers C) a strong reducing agent such as ferredoxin D) the absence of oxygen E) all of the above Answer: E Difficulty: Medium Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

3) In the process of nitrification, nitrate reductase converts _____ into _____.

A) nitrate; nitrogen B) nitrate; ammonia C) nitrate; nitrite D) nitrate; nitric oxide E) nitrogen; nitrate Answer: C Difficulty: Medium Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

4) What enzyme is responsible for the incorporation of ammonia from nitrogen fixation into organic molecules?

A) glutamine synthetase B) glutamine synthase C) glutamate synthetase D) glutamate synthase E) transaminase

Answer: A Difficulty: Easy Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

5) Given the following reaction, what is the missing product of the net reaction of glutamine synthetase and glutamate synthase? -ketoglutarate + NH4+ + NADPH + ATP  NADP+ + ADP + Pi + _____ A) aspartate B) asparagine C) glutamate D) glutamine E) none of the above Answer: C Difficulty: Easy Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

6) What are the products of the following transamination reaction? -ketoglutarate + alanine

_____ + _____

A) aspartate; oxaloacetate B) glutamate; oxaloacetate C) aspartate; pyruvate D) glutamate; pyruvate E) none of the above Answer: D Difficulty: Medium Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

7) What amino acid is attached to the pyridoxal-5-phosphate in a typical transaminase?

A) Ser B) His C) Arg D) Gln E) Lys Answer: E Difficulty: Easy Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

8) When the transaminase enzyme is in the _____ form, it will only react with _____.

A) pyridoxal; -keto acid B) pyridoxal; -amino acid C) pyridoxamine; -amino acid D) pyridoxal; -keto acid E) pyridoxamine; -amino acid Answer: B Difficulty: Easy Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

9) Which of the following nonessential amino acids is correctly paired with the essential amino acid that is required for its synthesis?

A) Phe: Trp B) Cys: Met C) Ser: Gly D) Asp: Glu E) His: Gln Answer: B Difficulty: Hard Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

10) Which of the following citric acid cycle intermediates can be converted to aspartate via transamination?

A) succinate B) fumarate C) -ketoglutarate D) citrate E) oxaloacetate Answer: E Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

11) Which of the following glycolytic intermediates is the common precursor to serine, cysteine and glycine?

A) 3-phosphoglycerate B) pyruvate C) fructose-6-phosphate

D) dihydroxyacetone phosphate E) glyceraldehyde-3-phosphate

Answer: A Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

12) Which of the following amino acids is properly paired with the amino acid from which it is derived?

A) Gln: Asp B) Pro: Ala C) Arg: Lys D) Tyr: Phe E) Ser: Cys

Answer: D Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

13) What coenzyme is required for the conversion of serine to glycine?

A) pyridoxal phosphate B) lipoic acid C) tetrahydrofolate D) biotin E) cobalamin Answer: C Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

14) What form of the folate coenzyme is required for the conversion of homocysteine to methionine?

A) methyl-tetrahydrofolate B) methylene-tetrahydrofolate C) methenyl-tetrahydrofolate D) formyl-tetrahydrofolate E) dihydrofolate Answer: A Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

15) Which of the following amino acids requires chorismate for its synthesis?

A) Met B) Lys C) Ile

D) Trp E) none of the above Answer: D Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

16) Which of the following amino acids cannot be produced in a plant that has been treated with glyphosate?

A) Cys B) Phe C) Leu D) Arg E) Pro Answer: B Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

17) What enzyme catalyzes the conversion of phenylalanine to tyrosine?

A) phenylalanine hydrolase B) phenylalanine desaturase C) phenylalanine oxidase D) phenylalanine decarboxylase E) phenylalanine hydroxylase Answer: E Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

18) What amino acid is the precursor for the neurotransmitters epinephrine and norepinephrine?

A) tryptophan B) serine C) tyrosine D) aspartate E) glutamate Answer: C Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

19) Which of the following neurotransmitters is correctly paired with the amino acid from which it is synthesized?

A) dopamine: tyrosine B) -aminobutyric acid: glutamate C) serotonin: tryptophan D) epinephrine: tyrosine E) all of the above Answer: E Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

20) The molecule _____ which is synthesized from _____, stimulate vasodilation.

A) nitric oxide; arginine B) nitrous oxide; arginine C) nitric oxide; citrulline D) nitrous oxide; citrulline E) none of the above

Answer: A

Difficulty: Medium Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

21) What coenzyme is used when inosine monophosphate is oxidized to xanthosine monophosphate?

A) NADPH B) NADP+ C) NADH D) NAD+ E) FAD Answer: D Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

22) Which of the following amino acids is a source of both carbon and nitrogen for IMP? A) Glu B) Gln C) Gly D) Asp E) Asn Answer: C Difficulty: Medium Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

23) The conversion of IMP to AMP requires _____; the conversion of IMP to GMP requires _____.

A) Gln; Glu B) Asp; Gln C) Asn; Asp D) Glu; Asn

E) Asp; Glu Answer: B Difficulty: Medium Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

24) Which of the following correctly describes the general synthesis of purine nucleotides?

A) The basic ring structure, orotate, is synthesized and then linked to PRPP B) The basic ring structure, orotate, is synthesized stepwise on PRPP C) The basic ring structure, inosine, is synthesized and then linked to PRPP D) The basic ring structure, inosine, is synthesized stepwise on PRPP E) none of the above Answer: D Difficulty: Medium Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

25) The energy for the conversion of IMP to GMP is supplied by _____.

A) ATP B) CTP C) GTP D) TTP E) UTP Answer: A Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

26) What step controls the activity of both purine and pyrimidine synthesis?

A) conversion of IMP to adenylosuccinate for AMP production B) conversion of IMP to xanthosine monophosphate for GMP production C) conversion of ribose-5-phosphate to 5-phosphoribosyl pyrophosphate D) conversion of UTP to CTP E) ribonucleotide reductase Answer: C Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

27) Which of the following amino acids is a source of both carbon and nitrogen for UMP? A) Glu B) Gln C) Gly D) Asp E) Asn Answer: D Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

28) What enzyme is responsible for the conversion of nucleotides to deoxynucleotides?

A) ribonucleotide deoxidase B) ribonucleotide dehydratase C) ribonucleotide dehydrogenase D) ribonucleotide oxidase E) ribonucleotide reductase Answer: E Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

29) In the mechanism of ribonucleotide reductase, a _____ is generated at C3 to stabilize the _____ that is formed at C2.

A) radical; carbocation B) radical; carbanion C) carbocation; radical D) carbanion; radical E) carbanion; carbocation Answer: A Difficulty: Hard Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

30) What molecule is used to reduce ribonucleotide reductase back to its catalytically active state?

A) NADH B) NADPH C) thioredoxin D) ferredoxin E) FADH2 Answer: C Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

31) What nucleotide is methylated to produce dTMP? A) dAMP B) dCMP C) dGMP D) dUMP E) both dCMP and dUMP can be converted to dTMP

Answer: D Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

32) Which of the following organisms excrete uric acid?

A) birds B) insects C) reptiles D) primates E) all of the above Answer: E Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

33) The disease gout is characterized by high levels of _____, which forms crystal deposits of _____, resulting in painful joints

A) urea; uric acid B) uric acid; sodium urate C) sodium urate; urea D) uric acid; urea E) none of the above

Answer: B Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

34) Which of the following is formed as a result of pyrimidine metabolism?

A) alanine B) aspartate C) asparagine D) glycine E) -alanine Answer: E Difficulty: Easy Section Reference: 18-5

Learning Objective: Describe the key reactions in the synthesis and degradation of nucleotides and deoxynucleotides

35) Which of the following amino acids is exclusively ketogenic?

A) Leu B) Val C) Phe D) Arg E) Thr Answer: A Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

36) What are the products of the glycine cleavage system?

A) formyl-tetrahydrofolate, ammonia and carbon dioxide B) methylene-tetrahydrofolate, ammonia and carbon dioxide C) methyl-tetrahydrofolate, ammonia and carbon dioxide D) methylene-tetrahydrofolate and carbamoyl phosphate E) methyl-tetrahydrofolate and carbamoyl phosphate Answer: B Difficulty: Medium

Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

37) Threonine is considered both ketogenic and glucogenic because it is converted to _____ and _____.

A) pyruvate; acetyl-CoA B) ammonia; acetoacetate C) carbamoyl phosphate; acetoacetate D) glycine; acetyl-CoA E) glycine; glutaryl-CoA Answer: D Difficulty: Hard Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

38) What type of reaction is used to deaminate most amino acids?

A) ATP-dependent ligation B) transamination C) oxidation D) condensation E) reduction

Answer: B Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

39) Degradation to pyruvate makes an amino acid _____; degradation to acetoacetate makes an amino acid _____.

A) glucogenic; glucogenic

B) glucogenic; glucogenic and ketogenic C) glucogenic; ketogenic D) ketogenic; glucogenic E) ketogenic; ketogenic Answer: C Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

40) What coenzyme is required by phenylalanine hydroxylase?

A) NADPH B) dihydrofolate C) ferredoxin D) FADH2 E) tetrahydrobiopterin Answer: E Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

41) The enzyme _____ is missing in phenylketonuria while _____ is missing in alkaptonuria.

A) tyrosine transaminase; phenylalanine hydroxylase B) phenylalanine hydroxylase; p-hydroxy-phenylpyruvate dioxygenase C) phenylalanine hydroxylase; homogentisate oxidase D) p-hydroxy-phenylpyruvate dioxygenase; homogentisate oxidase E) homogentisate oxidase; tyrosine transaminase Answer: C Difficulty: Hard Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

42) The amino acids metabolized by the branched chain keto acid dehydrogenase complex are _____.

A) Val, Leu and Ile B) Thr, Val and Pro C) Pro, Leu and Met D) Ile, Thr and Pro E) none of the above Answer: A Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

43) In high levels, ammonia is toxic to _____ cells.

A) kidney B) cardiac C) liver D) nerve E) intestinal Answer: D Difficulty: Easy Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

44) Glutamate undergoes a(n) _____, catalyzed by glutamate dehydrogenase, to yield -ketoglutarate, NADH and _____.

A) reductive deamination; water B) oxidative deamination; ammonia C) reductive amination; water D) oxidative amination; ammonia E) none of the above Answer: B Difficulty: Medium Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

45) In the mechanism of carbamoyl phosphate synthetase, what undergoes nucleophilic attack by ammonia?

A) the carbonyl group of carboxyphosphate B) the terminal phosphate of ATP C) the middle phosphate of ATP D) the carbonyl group of carbamate E) the phosphate of carboxyphosphate Answer: A Difficulty: Hard Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

46) Which of the following contains the correct sequence of reactants for carbamoyl phosphate synthetase?

A) ATP and ammonia, then bicarbonate, then ATP B) ATP and ammonia, then ATP, then bicarbonate C) ATP and bicarbonate, then ammonia, then ATP D) ATP and bicarbonate, then ATP, then ammonia E) ammonia and bicarbonate, then two ATP molecules Answer: C Difficulty: Hard Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

47) Which urea cycle intermediate reacts with carbamoyl phosphate?

A) citrulline B) aspartate C) argininosuccinate D) arginine E) ornithine Answer: E Difficulty: Easy

Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

48) Based upon the following, what is the net ATP production for the synthesis of one molecule of urea in the urea cycle? Consider that one nitrogen atom comes from glutamate dehydrogenase and the other comes from aspartate.

The conversion of fumarate to oxaloacetate gives 1 NADH (oxaloacetate is transaminated to aspartate) Carbamoyl phosphate synthesis requires 2 ATP equivalents Argininosuccinate synthesis requires 2 ATP equivalents Glutamate dehydrogenase produces 1 NADH A) -4 ATP B) -1.5 ATP C) -1 ATP D) +1 ATP E) +3 ATP Answer: D Difficulty: Hard Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

49) What enzyme associated with the urea cycle enzyme is activated by N-acetylglutamate?

A) carbamoyl phosphate synthetase B) glutamate dehydrogenase C) argininosuccinate synthetase D) arginase E) ornithine transcarbamoylase Answer: A Difficulty: Easy Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

50) What do birds excrete as nitrogen waste instead of urea?

A) asparagine B) uric acid C) carbamoyl phosphate D) citrulline E) arginine Answer: B Difficulty: Easy Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

Question type: Text entry

51) ______ is the degradation product of glucose, fatty acids, and ketogenic amino acids.

Answer: Acetyl-CoA Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

Question type: Multiple choice

52) The common products of fuel metabolism in mammals are ____.

A) oxaloacetate and acetyl-CoA B) pyruvate and acetyl-CoA C) ATP and acetyl-CoA D) pyruvate and glucose

E) none of the above Answer: B Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

53) Which of the following metabolic pathways is carried out only in the liver?

A) glycogen storage B) ketogenesis C) fatty acid synthesis D) triacylglycerol synthesis E) pentose phosphate pathway Answer: B Difficulty: Easy Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

Question type: Text entry

54) The enzyme ______ is critical to regulating nitrogen metabolism.

Answer: glutamine synthetase Difficulty: Easy Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

55) The cofactor ______ is used to transfer C-1 units such as methyl, formyl, and methenyl groups.

Answer: THF Difficulty: Easy Section Reference: 18-2

Learning Objective: Summarize the pathways for synthesizing the essential and nonessential amino acids

Question type: Multiple choice

56) The interorgan pathway that allows transport of nitrogen from muscle to the liver uses _____ as an amino group acceptor in the transamination reaction generating _____.

A) acetyl-CoA; alanine B) acetyl-CoA; glutamine C) pyruvate; glutamine D) pyruvate; glutamate E) pyruvate; alanine Answer: E Difficulty: Moderate Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

Question type: Text entry

57) The amino acid _____ has been thought to act as a transfer system for NH 3, safely allowing the toxic molecule to be transported from the liver to the kidneys.

Answer: glutamate Difficulty: Moderate Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

Question type: Text entry

58) What species are combined to produce carbamoyl phosphate?

A) NH3, PO43−, HCO3− B) NH4+, PO43−, Ac-CoA, releasing CoA-SH C) glycine and inorganic phosphate, releasing CO2 D) acetate and NH4+, releasing CO2 E) alanine and inorganic phosphate, releasing acetate

Answer: A

Difficulty: Moderate Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

59) In which cellular location listed below does the following reaction take place? arginine → urea + ornithine

A) cytosol B) mitochondrial matrix

C) lysosome D) A and B E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

60) In which cellular location listed below does the following reaction take place? ornithine + carbamoyl-phosphate → citrulline

A) cytosol B) mitochondrial matrix C) lysosome D) A and B E) none of the above

Answer: B

Difficulty: Moderate Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

61) Which of the following control the urea cycle?

I. substrate concentration of the cycle enzymes II. allosteric activation of carbamoyl phosphate synthetase I III. concentration of glutamate IV. availability of glucose

A) I, III B) II, III C) II, IV D) I, II, III E) I, IV

Answer: D

Difficulty: Moderate Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

62) The amino acids Ala, Cys, Gly, and Ser are all degraded to the metabolic intermediate _____ and are considered _____.

A) acetyl-CoA; glucogenic B) acetyl-CoA; ketogenic C) pyruvate; glucogenic

D) pyruvate; ketogenic E) acetoacetate; ketogenic

Answer: C

Difficulty: Moderate Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

63) Which of the following is true regarding catabolism of leucine?

A) The pathway begins with aspartate.

B) The pathway requires -ketoglutarate.

C) The pathway requires TPP. D) The pathway generates HMG-CoA. E) none of the above

Answer: D

Difficulty: Moderate Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

64) The kidney has a small amount of gluconeogenic activity. Which of the following explains the source of carbon for gluconeogenesis?

A) conversion of aspartate into oxaloacetate B) conversion of citrate into acetyl-CoA and oxaloacetate C) conversion of odd-chain fatty acids into succinyl-CoA D) conversion of alanine into pyruvate E) conversion of glutamine into glutamic acid, then to -ketoglutarate Answer: E Difficulty: Difficult Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

65) Oxidative deamination of glutamate I. generates -ketoglutarate.

II. is inhibited by glutamate.

III. is activated by GTP. IV. eliminates the keto group from -keto acids.

A) I only B) I, II C) I, III D) II, IV E) III, IV

Answer: A

Difficulty: Difficult Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

66) The activity of glutamine synthetase is I. regulated allosterically by tryptophan.

II. inhibited allosterically by glucosamine-6-phosphate.

III. activated by nine allosteric feedback inhibitors.

IV. altered by covalent modification.

A) I, III B) III, IV C) I, II D) I, IV E) I, II, III, IV

Answer: E

Difficulty: Difficult Section Reference: 18-1

Learning Objective: Describe the chemical reactions of nitrogen fixation and assimilation

67) A mutation in GDH of patients with HI/HA (hypoglycemia/hyperammonemia) results in a decrease in allosteric control of GDH via GTP. Which of the following will be observed in the patients?

A) an increase in ammonia B) an increase in glutamate C) an increase in NADH

D) A and B E) A and C

Answer: E

Difficulty: Difficult Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

68) Which enzyme catalyzes a reaction that requires ATP and proceeds via an enzyme-bound adenylated intermediate?

A) glutamine synthetase B) argininosuccinate synthetase C) carbamoyl phosphate synthetase I D) Ac-CoA decarboxylase E) arginase

Answer: B

Difficulty: Difficult Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

69) Which of the following reaction sequences could result in glucose synthesis?

A) fumarate  arginine  urea B) fumarate  malate  oxaloacetate C) citrulline  urea  aspartate D) urea  arginine  ornithine E) none of the above

Answer: B

Difficulty: Difficult Section Reference: 18-4

Learning Objective: Describe the chemical reactions of the urea cycle

70) Which of the following statements about phenylalanine is(are) true?

A) The enzymatic degradation of phenylalanine requires the tetrahydrobiopterin cofactor.

B) Individuals with defects in phenylalanine catabolism require tyrosine in their diet.

C) An inability to hydroxylate phenylalanine results in increased blood levels of phenylalanine, causing mental disability.

D) A and C E) A, B, and C

Answer: D

Difficulty: Difficult

Section Reference: 18-3

Learning Objective: Summarize the pathways for degrading amino acids

Essential Biochemistry Test Bank, Chapter 19: Regulation of Mammalian Fuel Metabolism Question type: Multiple Choice

1) Which of the following metabolic pathways is carried out only in the liver?

A) glycogen storage B) ketogenesis C) fatty acid synthesis D) triacylglycerol synthesis E) pentose phosphate pathway Answer: B Difficulty: Easy Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

2) Which of the following metabolic pathways occurs exclusively in the cytosol?

A) citric acid cycle B) ketogenesis C) urea cycle D) amino acid degradation E) fatty acid synthesis Answer: E Difficulty: Medium Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

3) Which of the following pathways is active in the muscle only during the well-fed state?

A) glycolysis B) fatty acid oxidation C) glycogen storage

D) ketone body synthesis E) fatty acid synthesis Answer: C Difficulty: Easy Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

4) Adipocytes convert glucose into fatty acids and _____.

A) glycerol B) cholesterol C) ketone bodies D) lactate E) ribose-5-phosphate Answer: A Difficulty: Medium Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

5) The kidney has a small amount of gluconeogenic activity. Which of the following explains the source of carbon for gluconeogenesis?

A) conversion of aspartate into oxaloacetate B) conversion of citrate into acetyl-CoA and oxaloacetate C) conversion of odd-chain fatty acids into succinyl-CoA D) conversion of alanine into pyruvate E) conversion of glutamine into glutamic acid, then to -ketoglutarate Answer: E Difficulty: Hard Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

6) What metabolite is used in unusually high amounts by cancerous tumors and thus a derivative is often used as a means to visualize cancerous tissue?

A) lactate

B) glutamine C) glucose D) ketone bodies E) very long chain fatty acids Answer: C Difficulty: Medium Section Reference: 19-4

Learning Objective: Relate metabolic changes to the rapid growth of cancer cells

7) In a variation of the Cori cycle, what amino acid is transported from the muscle to the liver?

A) glycine B) glutamate C) aspartate D) alanine E) glutamine

Answer: D Difficulty: Easy Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

8) Under anaerobic conditions, _____ is produced in the muscle and is then used by the liver for _____.

A) glycerol; triacylglycerol synthesis B) lactate; gluconeogenesis C) citrate; fatty acid synthesis D) oxaloacetate; gluconeogenesis E) glycogen; glycogenolysis Answer: B Difficulty: Easy Section Reference: 19-1

Learning Objective: Summarize the metabolic functions of liver, kidney, muscle, and adipose tissue

9) What type of receptor is the insulin receptor?

A) tyrosine kinase receptor B) G-protein coupled receptor C) serine/threonine phosphatase receptor D) nuclear receptor E) MAP kinase coupled receptor Answer: A Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

10) The  cells of the pancreatic islets secrete _____ in response to _____ glucose levels.

A) insulin; high B) insulin; low C) glucagon; high D) glucagon; low E) epinephrine; low

Answer: D Difficulty: Medium Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism.

11) How does insulin cause an increase in the rate of glucose transport into cells?

A) binds to the glucose transporter causing a conformational change resulting in greater transport velocity B) activates Na/K ATPase to increase glucose active transport C) recruits glucose transporters from intracellular vesicles to the cell membrane D) activates an insulin-dependent porin that allows for rapid glucose transport E) all of the above Answer: C

Difficulty: Medium Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

12) Which of the following enzymes is inhibited as a result of glucose binding to its receptor?

A) glycogen synthase B) pyruvate kinase C) acetyl-CoA carboxylase D) pyruvate dehydrogenase E) fructose-1,6-bisphosphatase Answer: E Difficulty: Medium Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

13) Which of the following is an activator of glycogen synthase?

A) AMP B) UDP-glucose C) cAMP-dependent protein kinase D) glucose-6-phosphate E) all of the above Answer: D Difficulty: Medium Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

14) Glycogen phosphorylase has its greatest activity when _____; glycogen synthase has its greatest activity when _____.

A) phosphorylated; not phosphorylated B) phosphorylated; phosphorylated C) not phosphorylated; phosphorylated D) not phosphorylated; not phosphorylated E) neither enzyme is controlled by phosphorylation Answer: A Difficulty: Medium

Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

15) The effect of epinephrine upon the liver is most similar to which of the following hormones?

A) insulin B) glucagon C) leptin D) resistin E) ghrelin Answer: B Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

16) Which of the following best explains the chain of events that occurs when glucagon binds to its receptor?

A) activation of protein kinase A, activation of G protein, activation of adenylate cyclase, production of cAMP B) activation of adenylate cyclase, production of cAMP, activation of protein kinase A, activation of G protein C) production of cAMP, activation of adenylate cyclase, activation of protein kinase A, activation of G protein D) activation of G protein, activation of protein kinase A, activation of adenylate cyclase, production of cAMP E) activation of G protein, activation of adenylate cyclase, production of cAMP, activation of protein kinase A Answer: E Difficulty: Hard Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

17) Which of the following is a second messenger?

A) cortisol B) epinephrine

C) ghrelin D) cyclic AMP E) none of the above Answer: D Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

18) What hormone that is produced in adipose tissue signals satiety?

A) adiponectin B) cholecystokinin C) leptin D) ghrelin E) amylin Answer: C Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

19) Where are the receptors for leptin and PYY3-36 located?

A) hypothalamus B) pancreas C) liver D) adipose tissue E) intestine Answer: A Difficulty: Medium Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

20) In the liver, activation of AMP-dependent protein kinase occurs when levels of _____ are elevated, resulting in the activation of _____.

A) AMP; acetyl-CoA carboxylase B) ADP; phosphofructokinase-2 C) ATP; glycogen phosphorylase D) AMP; fructose-1,6-bisphosphatase E) ADP; lactate dehydrogenase Answer: B Difficulty: Hard Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

21) After several days of fasting, the liver begins producing relatively large amounts of ketone bodies.

Which type of tissue is highly dependent upon this as its sole source of energy in the absence of glucose?

A) heart B) kidney C) skeletal muscle D) brain E) all of the above Answer: D Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

22) During a long-term fast, which of the following is a major source of carbon for gluconeogenesis?

A) lactate B) acetoacetate C) 3-hydroxybutyrate D) acetone E) glycerol Answer: E Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

23) What hormone is most likely responsible for the body weight set-point?

A) adiponectin B) cholecystokinin C) leptin D) ghrelin E) all of the above Answer: C Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

24) What organelle is found in much higher amounts in brown adipose tissue than white adipose tissue?

A) mitochondria B) lysosome C) endoplasmic reticulum D) chloroplast E) none of the above Answer: A Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

25) Which of the following aspects of brown adipose tissue is responsible for its ability to generate heat?

A) brown adipose tissue contains many small fat droplets instead of one large globule B) blood flow to brown adipose tissue is larger than to white adipose tissue C) brown adipose tissue has receptors for norepinephrine D) the uncoupling protein allows fatty acid oxidation without ATP production E) none of the above Answer: D Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

26) Which of the following is the most common type of diabetes in the US? A) type 1 B) type 2 resulting from a genetic defect in the insulin receptor C) type 2 without a genetic defect in the insulin receptor D) type 3 E) all of the above are about equal in prevalence Answer: C Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

27) In a diabetic liver, which of the following pathways would be constantly active?

A) glycogen synthesis B) gluconeogenesis C) fatty acid synthesis D) ketone body oxidation E) glycolysis Answer: B Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

28) What happens to excess glucose in the eye that causes diabetics to develop cataracts?

A) oxidized to glucuronic acid causing aggregation of lens proteins B) reduced to sorbitol causing aggregation of lens proteins C) non-enzymatic glycosylation of lens proteins D) oxidized and cyclized to a lactone causing modification of lens proteins E) none of the above Answer: B Difficulty: Hard

Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

29) The synthesis of what liver enzyme is inhibited by the drug metformin, an activator of AMPK? A) phosphofructokinase B) glycogen phosphorylase C) acetyl-CoA carboxylase D) pyruvate carboxylase E) glucose-6-phosphatase Answer: E Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

30) What hormone that is commonly produced in typical body fat has very little production in visceral fat (also known as abdominal fat)?

A) leptin B) resistin C) neuropeptide Y D) ghrelin E) cholecystokinin Answer: A Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

31) TNF prevents the proper activity of IRS-1 triggering resistance to what hormone?

A) norepinephrine B) glucagon C) leptin D) insulin E) all of the above

Answer: D Difficulty: Medium Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

Question type: True/False

32) Cancer cells express a variant form of pyruvate kinase that has increased activity compared to that of normal cells.

Answer: False

Difficulty: Medium Section Reference: 19-4

Learning Objective: Relate metabolic changes to the rapid growth of cancer cells

Question type: Dropdown

33) In cancerous cells, glucose is often converted into ___which is important for ___.

Dropdown 1: fatty acids, glycine, oxaloacetate Dropdown 2: cholesterol synthesis, amino acid synthesis, nucleotide synthesis

Difficulty: Medium Section Reference: 19-4

Learning Objective: Relate metabolic changes to the rapid growth of cancer cells

Question type: Dropdown

34) Cancer cells require increased activity of ___ which is achieved by the inhibition of ___.

Dropdown 1: the citric acid cycle, the pentose phosphate pathway, oxidative phosphorylation Dropdown 2: ATP-citrate lyase, pyruvate kinase, phosphofructokinase

Difficulty: Hard Section Reference: 19-4

Learning Objective: Relate metabolic changes to the rapid growth of cancer cells

Question type: True/False

35) Glutamine, a source of nitrogen for nucleotide synthesis, is also converted to aspartate, another source of nitrogen for nucleotide synthesis. This conversion requires glutamate dehydrogenase and several enzymes of the citric acid cycle.

Answer: True

Difficulty: Medium Section Reference: 19-4

Learning Objective: Relate metabolic changes to the rapid growth of cancer cells

Question type: Text entry

36) The _____ stores very little glycogen and therefore requires a steady supply of glucose from the blood.

Answer: brain Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

37) Following prolonged starvation, _____ are used as fuel by the brain.

Answer: ketone bodies Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

Question type: Multiple choice

38) During a long-term fast, which of the following is a major source of carbon for gluconeogenesis?

A) lactate B) acetoacetate C) 3-hydroxybutyrate D) acetone E) glycerol Answer: E Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

Question type: Text entry

39) The endocrine glands secrete _____, which results in numerous cellular responses.

Answer: hormones Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

Question type: Multiple choice

40) Which of the following proteins stimulates the appetite?

A) leptin B) ghrelin C) adiponectin D) insulin E) PYY3-36 Answer: B Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

41) Which of the following is always true of hormones?

A) Hormones always bind membrane-bound receptors.

B) Hormones elicit specific cellular responses.

C) Hormones are secreted from a gland via a robust network of ducts.

D) The release of hormones is influenced by adrenal receptors.

E) All of the above are true.

Answer: B Difficulty: Easy Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

42) Insulin-dependent (type 1) diabetes _____.

A) is associated with a deficiency of pancreatic β cells B) is associated with a deficiency of insulin receptors C) is associated with a deficiency of signal transduction D) can be treated with injections of leptin E) can be treated with injections of ghrelin Answer: A Difficulty: Easy Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

43) Aerobic activity in response to stress results in which of the following?

I. Glycolysis occurs in the muscle.

II. Glycolysis occurs in the liver.

III. Glycogenolysis occurs in the muscle.

IV. Glycogenolysis occurs in the liver.

A) I, III, IV B) I, II, IV C) I, IV D) II, III E) III, IV Answer: A Difficulty: Moderate Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

44) Which of the following can generate glucose?

I. kidney II. liver III. adipose tissue IV. muscle A) I, II, III, IV B) I, II, IV C) I, II D) II, IV E) II only Answer: C Difficulty: Moderate Section Reference: 19-1

Learning Objective: Summarize the metabolic functions

45) Which of the following is true regarding pancreatic  cells?

A) Insulin is secreted by the  cells in response to the increase in  cell glucose receptor binding.

B) Glucagon is secreted by the  cells in response to the increase in  cell glucose receptor binding.

C) Insulin is secreted by the  cells in response to high glucose levels.

D) Insulin is secreted by the  cells in response to low glucose levels.

E) Glucagon is secreted by the  cells in response to high glucose levels.

Answer: C Difficulty: Moderate Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

46) The  cells of the pancreas secrete _____ in response to _____ glucose levels in the muscle and/or adipose tissue.

A) insulin; low B) insulin; elevated C) glucagon; low D) glucagon; elevated E) somatostatin; elevated Answer: B Difficulty: Moderate Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

47) What hormone is commonly produced in typical body fat?

A) leptin B) resistin C) neuropeptide Y D) ghrelin E) cholecystokinin Answer: A Difficulty: Moderate Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

48) Metformin and thiazolidinediones (TZDs) are used to treat _____ and produce a(n) _____ in AMPK activity.

A) type 2 diabetes; decrease B) type 2 diabetes; increase C) type 1 diabetes; decrease D) type 1 diabetes; increase E) both type 1 and type 2 diabetes; decrease Answer: B Difficulty: Moderate Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

49) Which of the following occurs during starvation?

I. The kidney generates approximately half the glucose required for the body.

II. The brain uses ketone bodies as a fuel source.

III. The adipose tissue releases fatty acids.

IV. Gluconeogenesis occurs in the liver.

A) I, II, III, IV B) I, II, III C) I, II D) II, III E) II, III, IV Answer: B Difficulty: Difficult Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

50) Which of the following are effects of insulin secretion?

I. Muscle and adipose tissue are stimulated to take up glucose.

II. Glycogen synthesis increases in the liver.

III. Gluconeogenesis is inhibited in the liver and kidney.

IV. Lipolysis increases in the adipose tissue.

A) I, II B) I C) I, II, III D) I, III E) II, IV Answer: C Difficulty: Difficult Section Reference: 19-2

Learning Objective: Describe the effects of hormone signaling on fuel metabolism

51) Which of the following statements is true regarding the blood glucose level of non-insulindependent diabetics compared with that of normal individuals?

A) Blood glucose levels of diabetics tend to be very stable, but at a higher level.

B) Blood glucose levels of diabetics tend to be variable and higher.

C) Blood glucose levels decrease more rapidly following a meal, often dropping lower than is tolerable.

D) Blood glucose levels average the same level in diabetics but reach higher peaks for short periods.

E) None of the above is true.

Answer: B Difficulty: Difficult Section Reference: 19-3

Learning Objective: Compare the metabolic changes that occur in starvation, obesity, and diabetes

Essential Biochemistry Test Bank, Chapter 20: DNA Replication and Repair Question type: Multiple Choice

1) Which of the following explains why circular DNA, such as the chromosomes of some viruses and bacteria, appears to be twisted?

A) hybridization B) supercoiling C) circular DNA is Z-form D) viral and bacterial DNA is always single stranded E) none of the above Answer: B Difficulty: Easy Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

2) What are the two components of supercoiling?

A) twist and writhe B) twist and anti-twist C) writhe and relaxation D) negative supercoiling and positive supercoiling E) single stranded and double stranded Answer: A Difficulty: Easy Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

3) Which of the following explains supercoiling in naturally occurring DNA? A) positively supercoiled, making the helix tighter B) positively supercoiled, making the helix looser C) negatively supercoiled, making the helix tighter D) negatively supercoiled, making the helix looser E) negatively supercoiled without changing the nature of the helix Answer: D Difficulty: Medium Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

4) What effect does a topoisomerase have upon DNA? A) denatures DNA B) converts double stranded DNA to single stranded DNA C) changes the supercoiling of DNA D) changes B-form DNA to A-form E) none of the above Answer: C Difficulty: Easy Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

5) An antibiotic that interferes with bacterial topoisomerase activity is _____, which specifically inhibits _____.

A) ciprofloxacin; DNA gyrase B) doxorubicin; type IA topoisomerase C) novobiocin; ATPase D) camptothecin; type II topoisomerase E) none of the above

Answer: A Difficulty: Medium Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

6) An E. coli has _____ replication fork(s) on its single chromosome; humans have _____ replication fork(s) on each chromosome.

A) 1; 1 B) 1; 2 C) 2; 2 D) 2; many E) many; many Answer: D

Difficulty: Easy Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

7) What is the purpose of DNA helicase?

A) removal of negative supercoiling to allow for replication B) removal of positive supercoiling to allow for replication C) separation of double stranded DNA into single stranded DNA in front of DNA polymerase D) conversion of single stranded DNA to double stranded DNA behind DNA polymerase E) none of the above Answer: C Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

8) Besides the obvious role of keeping DNA in a single strand state, what do single-strand binding proteins do?

A) prevent supercoiling B) protect single stand DNA from nucleases C) aid in the formation of hairpin structures D) aid DNA polymerase with DNA binding E) all of the above Answer: B Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

9) Which of the following is correctly paired with its function?

A) helicase: creates single strand DNA

B) primase: production of an RNA primer for DNA polymerase C) RNase H: removal of RNA primer D) DNA ligase: joins the discontinuous segments on the lagging strand E) all of the above Answer: E Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

10) Which strand of DNA is replicated exclusively in a discontinuous fashion?

A) forward strand B) reverse strand C) leading strand D) lagging strand E) the strand that is read in a 5 to 3 direction Answer: D Difficulty: Easy Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

11) What is the nucleophile in the DNA polymerase mechanism?

A) an oxygen anion on the -phosphate of the dNTP B) the oxygen on the -phosphate of the dNTP C) the oxygen on the -phosphate of the dNTP D) the 5 hydroxyl on the deoxyribose E) the 3 hydroxyl on the deoxyribose Answer: E Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

12) If the smallest human chromosome is 4.6107 base pairs in size, which of the following is the best estimate of the number of Okazaki fragments resulting from its replication?

A) 300,000 B) 30,000 C) 3,000 D) 300 E) 30 Answer: A Difficulty: Hard Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

13) What metal cations are found in the active site of DNA polymerase?

A) two Zn2+ B) one Zn2+ and one Mg2+ C) two Mg2+ D) one Mg2+ and one Ca2+ E) two Ca2+ Answer: C Difficulty: Easy Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

14) Which of the following best describes a new strand of DNA relative to the template strand used to synthesize it?

A) an exact duplicate of the template B) a negative copy of the template C) a palindromic copy of the template

D) an exact copy of the template but with the 3' and 5' ends reversed E) none of the above

Answer: B Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

15) In most organisms, replication proceeds in a _____ manner from the _____.

A) bidirectional; replication origin B) bidirectional; theta site C) bidirectional; lagging strand D) unidirectional; chromosome ends E) none of the above

Answer: A Difficulty: Easy Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

16) Without telomeres, what would happen to the ends of eukaryotic chromosomes during replication?

A) they would be replicated just like the rest of the chromosome B) they would be mutated C) they would be lengthened D) they would be shortened E) none of the above Answer: D

Difficulty: Easy Section Reference: 20-2

Learning Objective: Explain the synthesis and purpose of telomeres

17) Synthesis of telomeres requires the enzyme _____, which is a type of _____.

A) telomerase; helicase B) telomerase; reverse transcriptase C) ribonuclease; RNA-specific nuclease D) ribotelomerase; ligase E) none of the above Answer: B Difficulty: Medium Section Reference: 20-2

Learning Objective: Explain the synthesis and purpose of telomeres

18) Which of the following is found in high concentration in all telomeres?

A) A B) C C) G D) T E) U Answer: C Difficulty: Easy Section Reference: 20-2

Learning Objective: Explain the synthesis and purpose of telomeres

19) What does a reverse transcriptase do?

A) replicates DNA in a 3 to 5 fashion B) replicates RNA in a 5 to 3 fashion C) replicates RNA in a 3 to 5 fashion D) converts a DNA genome into an RNA genome E) converts an RNA genome into a DNA genome

Answer: E Difficulty: Medium Section Reference: 20-2

Learning Objective: Explain the synthesis and purpose of telomeres

20) Which tumor suppressor gene is found to be mutated in at least half of all human tumors?

A) BRCA1 B) BRCA2 C) retinoblastoma D) p53 E) none of the above Answer: D Difficulty: Easy Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

21) Which of the following is a potential modification to DNA that can result in a mutation or interfere with replication or transcription?

A) deamination of cytosine to uracil B) oxidation of guanine to 8-oxoguanine C) formation of thymine dimers by reaction with UV light D) reaction with hydroxyl radicals causing DNA strand breaks E) all of the above Answer: E Difficulty: Easy Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

22) Which of the following mutations would cause a bulge in the DNA backbone?

A) point mutation

B) transversion mutation C) transition mutation D) frame shift mutation E) all of the above Answer: B Difficulty: Medium Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

23) Which type of DNA repair is used to remove and replace a single modified base that cannot be converted back to the normal base by a direct repair process?

A) base excision repair B) nucleotide excision repair C) mismatch repair D) DNA photolyase E) none of the above Answer: A Difficulty: Medium Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

24) What is the process used for genes shuffling in meiosis that is also used to repair double-strand breaks?

A) homologous end-joining B) nonhomologous end-joining C) recombination D) non-mutagenic strand coupling E) telomerase-assisted ligation Answer: C Difficulty: Medium Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

25) In the nucleus, DNA is wrapped around _____ to form _____.

A) ribosomes; heterochromatin B) histones; nucleosomes C) polyribose; euchromatin D) polyarginine; 30-nm fibers E) none of the above Answer: B Difficulty: Medium Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

26) Which of the nucleosome proteins is found in the linker DNA between nucleosomes and not actually part of the nucleosome core?

A) H1 B) H2A C) H2B D) H3 E) H4 Answer: A Difficulty: Easy Section Reference: 20-5

Learning Objective: Describe how DNA is packaged in cells

Question type: True/False

27) An E. coli cell actively undergoing replication contains a single replisome.

Answer: False

Difficulty: Medium Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

28) It is generally believed that the three causes of cancer are inherited genetic variations, environmental factors, and random mutations.

Answer: True

Difficulty: Medium Section Reference: 20-4

Learning Objective: Describe the molecular mechanisms that can lead to cancer

Question type: Dropdown

29) An example of a viral infection leading to cancer is ___ causing ___.

Dropdown 1: hepatitis B, human papillomavirus, HIV Dropdown 2: ovarian, lung, liver

Difficulty: Medium Section Reference: 20-4

Learning Objective: Describe the molecular mechanisms that can lead to cancer

Question type: Dropdown

30) DNA damage activates ___ and leads to an increase in the cellular concentration of ___.

Dropdown 1: ATM, BRCA1, p53

Dropdown 2: ATM, BRCA2, p53

Difficulty: Medium Section Reference: 20-4

Learning Objective: Describe the molecular mechanisms that can lead to cancer

Question type: Dropdown

31) In cells with DNA damage, p53 either ___ if the DNA can be repaired or ___ if the DNA cannot be repaired.

Dropdown 1: blocks cell division, promotes DNA replication Dropdown 2: terminates DNA replication, initiates apoptosis

Difficulty: Medium Section Reference: 20-4

Learning Objective: Describe the molecular mechanisms that can lead to cancer

Question type: Dropdown

32) There are approximately ___ genes that are known to be associated with carcinogenesis but a typical cancer contains mutation in only ___.

Dropdown 1: 40, 140, 240 Dropdown 2: 1 or 2, 2 to 8, 8 to 20

Difficulty: Medium Section Reference: 20-4

Learning Objective: Describe the molecular mechanisms that can lead to cancer

Question type: Multiple choice

33) The DNA strand that serves as the template for the synthesis of RNA is often called the _____.

A) coding strand B) noncoding strand C) messenger strand D) transfer strand E) transcription strand

Answer: B

Difficulty: Easy Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

34) What term describes a small, circular molecule of DNA that can be used to transfer genetic material from one organism to another?

A) plasmid B) bacteriophage C) clone D) tRNA

E) splice

Answer: A

Difficulty: Easy Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

35) What term describes the production of multiple identical organisms from a single ancestor?

A) transcription B) cloning C) sequencing D) phenotyping E) ligation

Answer: B

Difficulty: Easy Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

36) What enzyme is required to form a new phosphodiester bond when inserting DNA into a plasmid?

A) DNA polymerase B) endonuclease C) exonuclease D) ligase E) clonase

Answer: D

Difficulty: Easy Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

37) What technique involves addition of primers that do not exactly match the sequence of a gene, thus allowing for introduction of a mutation?

A) cloning B) transformation C) site-directed mutagenesis D) selection E) none of the above

Answer: C

Difficulty: Easy Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

38) DNA polymerase from Thermus aquaticus is used in PCR because _____.

A) it is a soluble protein B) the genes from Thermus aquaticus are readily distinguished from those of “normal” organisms C) the enzyme is readily deactivated by heat, effectively halting the reaction D) it is stable at high temperatures E) it is not infectious

Answer: D

Difficulty: Easy Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

39) Because of the high temperature _____ step during a PCR reaction, the DNA polymerase from _____ is used.

A) primer extension; E. coli B) strand separation; Thermus aquaticus C) primer annealing; Thermus aquaticus D) primer extension; bacteriophage  E) strand separation; E. coli

Answer: B

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

40) What reagents are required to perform PCR?

A) DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase B) DNA fragment, primers flanking the region of interest, dNTPs, ddNTPs, DNA polymerase C) DNA fragment, one primer, dNTPs, DNA polymerase, DNA ligase D) DNA fragment, one primer, dNTPs, DNA polymerase, DNA endonuclease E) DNA fragment, primers flanking the region of interest, dNTPs, DNA endonuclease

Answer: A

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

41) Which of the following represents the correct order of steps in a PCR reaction beginning with double-stranded DNA?

A) primer annealing, strand separation, primer extension B) strand separation, primer extension, primer annealing

C) strand separation, primer annealing, primer extension D) primer extension, primer annealing, strand separation E) primer annealing, primer extension, strand separation

Answer: C

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

42) Double-stranded DNA molecules can be cleaved at specific recognition sites by _____.

A) RNA polymerase B) DNA ligase C) DNA polymerase D) reverse transcriptase E) Type II restriction endonucleases

Answer: E

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

43) Mutations leading to changes that can be inherited by the next generation have to be introduced at the ______ level.

A) DNA B) rRNA C) protein D) mRNA E) tRNA

Answer: A

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

44) In molecular cloning, transformed organisms must be identified. One common method for accomplishing this involves the inclusion of ______ in the plasmid.

A) a restriction site B) a nuclease gene C) a deletion D) an origin of replication E) an antibiotic resistance gene

Answer: E

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

45) To perform PCR, which of the following describes the reagents that must be included in the reaction mixture?

A) DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase B) DNA fragment, primers flanking the region of interest, dNTPs, ddNTPS, DNA polymerase C) DNA fragment, one primer, dNTPs, DNA polymerase, DNA ligase D) DNA fragment, primers flanking the region of interest, dNTPs, DNA ligase E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

46) A gene knockout is _____.

A) a gene that has been inactivated or removed from an organism B) a dominant gene that knocks out expression of other genes C) a gene inserted in place of another gene D) a gene present on a YAC

E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 20-3

Learning Objective: Describe the enzymes and other proteins that repair damaged DNA

Question type: Multipart

47) This is the structure of adenine.

a. Is adenine a purine or a pyrimidine? b. Which base does adenine base-pair (H-bond) with in DNA? c. What is the name of the molecule that is composed of adenine linked to the C-1ꞌ of ribose? d. Indicate on the drawing through which atom adenine is connected to ribose or deoxyribose. e. Indicate on the drawing which groups on adenine are involved in base-pairing or H-bonding with its complementary base.

Answer: a. purine b. thymine c. adenosine d. see diagram e. see diagram

Difficulty: Difficult Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

Question type: Essay

48) Describe the structure of a DNA molecule by listing six characteristics.

Answer:

1. DNA forms a double helix.

2. The two strands run antiparallel.

3. The sugar is deoxyribose.

4. The sugar-phosphate groups are on the outside of the helix.

5. The bases are in the center of the helix.

6. The bases are planar, and their plane is orientated perpendicular to the axis of the helix.

7. There are four bases: adenine, guanine, cytosine, and thymine.

8. The strands are held together by H-bonding between complementary bases: adeninethymine and guanine-cytosine.

9. The helix has a minor and a major groove on its surface.

Difficulty: Difficult Section Reference: 20-1

Learning Objective: Summarize the actions of the enzymes and other proteins involved in synthesizing the leading and lagging strands

Question type: Multiple choice

49) EcoRI recognizes the sequence 5ꞌ-GAATTC-3ꞌ (the arrow indicates the point of cleavage). Treatment of the following oligonucleotide with EcoRI would produce two oligonucleotides with sizes of _____ nucleotides containing _____ ends.

5ꞌ–AAGTCGATACAGAATTCGTACCTAG–3ꞌ

A) 12 and 13; blunt B) 12 and 8; blunt C) 11 and 8; sticky D) 12 and 13; sticky

E) 9 and 13; sticky

Answer: D

Difficulty: Difficult Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

50) DNA sequencing by the chain-termination method uses DNA polymerase I to make a complementary copy of the target or template DNA molecule. A reaction with a 20 bp template and dideoxyadenosine nucleotides as terminators results in the production of a 5 bp fragment. Based on this result, we can conclude that the template contains _____.

A) a cytosine at position 5 B) a thymine at position 5 C) a cytosine at position 16 D) a thymine at position 16 E) a uracil at position 5

Answer: D

Difficulty: Difficult Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

51) Which of the following statements about PCR is (are) true?

A) Small amounts of DNA can be easily amplified to millions of copies.

B) PCR is often used in forensics laboratories.

C) PCR reaction products can be used in molecular cloning.

D) PCR is used in clinical laboratories.

E) All of the above

Answer: E

Difficulty: Difficult Section Reference: 20-6

Learning Objective: Describe how researchers manipulate and sequence DNA

Essential Biochemistry Test Bank, Chapter 21: Transcription and RNA Question type: Multiple Choice

1) Which of the following is responsible for RNA splicing?

A) rRNA B) miRNA C) tRNA D) siRNA E) snRNA Answer: E Difficulty: Easy

Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

2) Genomic DNA that encodes proteins undergoes the process of _____ to produce _____.

A) transcription; mRNA B) transcription; tRNA C) translation; rRNA D) translation; proteins E) transcription; proteins Answer: A Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

3) Which of the following best describes the nucleic acid complex formed during RNA polymerization?

A) two DNA-RNA hybrids since both DNA strands are transcribed simultaneously B) one DNA-RNA hybrid and one single stranded DNA C) one DNA-RNA hybrid with the other DNA strand bound to an RNA molecule on RNA polymerase D) there is no interaction between the growing RNA and the DNA E) none of the above Answer: B Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

4) Addition of a(n) _____ group to certain lysine residues of a histone protein makes the region of chromatin transcriptionally _____; addition of a(n) _____ group to certain lysine residues makes the region of chromatin transcriptionally _____.

A) methyl; highly active; acetyl; active B) acetyl; silent; methyl; active C) phosphate; silent; methyl; silent D) methyl; silent; acetyl; active

E) methyl; silent; phosphate; active Answer: D Difficulty: Hard Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

5) What is the region immediately adjacent to the starting site for RNA polymerization called?

A) promoter B) enhancer C) initiator D) consensus sequence E) TF binding site Answer: A Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

6) Which subunit of the E. coli RNA polymerase recognizes the promoter region?

A)  B)  C)  D)  E)  Answer: E Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

7) Which of the eukaryotic transcription factors is responsible for binding the TATA box?

A) TFIIB B) TFIID C) TFIIE D) TFIIF

E) TFIIH Answer: B Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

8) TFIIH is a transcription factor that is responsible for forming the transcription bubble. For this reason, TFIIH is best described as a _____.

A) gyrase B) ligase C) helicase D) endonuclease E) single-strand binding protein Answer: C Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

9) Eukaryotic enhancers are located up to _____ base pairs upstream from the promoter.

A) 50 B) 120 C) 500 D) 1,500 E) 120,000 Answer: E Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

10) The most prevalent mode of DNA-protein interaction is achieved with a(n) _____ that binds to the _____ groove of DNA. A) -helix; major

B) -helix; minor C) -sheet; major D) -sheet; minor E) -turn; major Answer: A Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

11) Genes that are not often transcribed generally have _____ sequences that bind to _____ proteins.

A) inhibitor; mediator B) interrupter; regulatory C) obstruction; restraint D) silencer; repressor E) negative control; arrestor Answer: D Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

12) The protein that is responsible for bringing together proteins bound to enhancers with proteins bound to promoters is called _____.

A) TAF1 B) chromatin remodeling enhancer C) mediator complex D)  subunit of RNA polymerase E) none of the above Answer: C Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

13) What sugar is metabolized by the enzymes under the control of the lac operon?

A) sucrose B) mannose C) galactose D) lactose E) maltose Answer: D Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

14) What does allolactose bind?

A) lac operon B) lac repressor C) operator D) promoter E) all of the above Answer: B Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

15) Which of the following best describes the functioning of the lac repressor protein?

A) in the presence of allolactose, the protein binds the operator inhibiting transcription B) in the presence of allolactose, the protein binds the operator enhancing transcription C) in the absence of allolactose, the protein binds the operator inhibiting transcription D) in the absence of allolactose, the protein binds the operator enhancing transcription E) none of the above

Answer: C Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

16) Which of the following eukaryotic RNA polymerase is correctly paired with the type of RNA that it produces?

A) RNA polymerase III: tRNA B) RNA polymerase I: rRNA C) RNA polymerase II: mRNA from protein-coding genes D) RNA polymerase III: small RNAs such as miRNA and snRNA E) all of the above Answer: E Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

17) Separation of DNA into a single stranded region around RNA polymerase creates _____.

A) hybridized DNA B) a transcription bubble C) Z-DNA D) DNA bound to single stranded binding proteins E) none of the above Answer: B Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

18) How do the NTPs enter RNA polymerase?

A) base-paired with the incoming (downstream) DNA B) with the incoming DNA but not base-paired with it C) from the exit site, as the DNA leaves the enzymes, the NTPs move in the opposite direction D) through a special channel sized just for NTPs E) there is no specific way, any of the above routes are used Answer: D Difficulty: Medium

Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

19) What are the two metal ions found in the active site of RNA polymerase?

A) two Ca2+ B) a Ca2+ and a Zn2+ C) two Zn2+ D) a Zn2+ and a Mg2+ E) two Mg2+ Answer: E Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

20) What is the approximate size of the DNA-RNA hybrid present inside the RNA polymerase?

A) 3 base pairs B) 6 base pairs C) 9 base pairs D) 12 base pairs E) 15 base pairs Answer: C Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

21) RNA polymerase is said to have high _____, meaning that it can catalyze thousands to millions of reactions without releasing the DNA template A) processivity B) continuity C) fidelity D) stability E) connectivity Answer: A

Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

22) Which transcription factor is required to aid RNA polymerase in the removal of an incorrect nucleotide incorporated into the growing RNA? A) TFIIP B) TFIIS C) TFIIT D) TFIIX E) TFIIZ Answer: B Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

23) In prokaryotic transcription, what must be released for the switch from initiation to elongation to occur?

A) TFIIB B) ADP following phosphorylation of the RNA polymerase C-terminal domain C) regulatory subunit bound to the C-terminal domain D)  subunit E) the TATA-binding protein Answer: D Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

24) Phosphorylation of the C-terminal domain of eukaryotic RNA polymerase inhibits interaction with what protein, thus allowing the polymerase to leave the promoter?

A) mediator complex B) all transcription factors C) TFIIF and TFIIH D) TFIIS E) none of the above

Answer: A Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

25) What DNA sequence is found on the template strand at the termination of prokaryotic transcription?

A) series of CG repeats followed by string of 10-12 U B) section of Z-DNA followed by repetitive CAT sequence C) palindromic sequence followed by poly(A) region D) series of TATA boxes E) series of CpG islands Answer: C Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

26) During termination, Rho acts as a _____.

A) polymerase B) ligase C) NTP hydrolase D) single-strand binding protein E) helicase Answer: E Difficulty: Medium Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

27) Eukaryotic transcription termination generally occurs at _____ sites in the DNA sequence.

A) stop B) pause C) disconnect D) exonuclease binding E) CpG island

Answer: B Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

28) Which of the following modifications occurs to all eukaryotic mRNA? A) addition of a poly(A) tail to the 3 end of the molecule B) hydrolysis of the terminal phosphate from the 5 triphosphate end of the molecule C) addition of GMP to the 5 end via a 5 to 5 linkage D) methylation of the 2 hydroxyl on the first nucleotide of the molecule E) all of the above Answer: E Difficulty: Medium Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

29) What is the purpose of the poly(A) tail on eukaryotic mRNA? A) binds to short poly(U) molecules forming duplex RNA that resists degradation B) forms a stem loop to aid in transport to the cytosol C) aids in transport to the lysosome for degradation once the ribosome is finished with it D) binds to the poly(A) binding protein to prevent exonuclease activity E) none of the above Answer: D Difficulty: Medium Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

30) During mRNA synthesis, _____ are removed and the _____ are spliced together to create the mature mRNA A) introns; exons B) exons; introns C) snRNAs; miRNAs D) miRNAs; snRNAs E) none of the above

Answer: A Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

31) What protein/RNA complex is responsible for the removal of introns?

A) intronase B) RNA processing complex C) spliceosome D) ribozyme E) none of the above Answer: C Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

32) In a typical gene, what percentage of the bases represents introns?

A) 5% B) 10% C) 25% D) 50% E) 90% Answer: E Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

33) Which of the following allows a gene to give more than one viable protein product?

A) exon suppression B) alternative splicing C) use of RNA interference D) frame shift mutations E) action of the decapping enzyme

Answer: B Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

34) Which of the following is the major factor in determining how quickly an mRNA is degraded?

A) overall length of the mRNA B) degree of intron removal C) how quickly the cap is removed D) length of poly(A) tail E) all of the above play a role Answer: D Difficulty: Medium Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

35) Which of the following details the correct sequence of events for RNA interference mediated by siRNA? A) degradation of passenger RNA strand, binding of mRNA, formation of double-stranded RNA, cleavage by dicer, binding to RISC, cleavage of mRNA B) binding to RISC, binding of mRNA, formation of double-stranded RNA, degradation of passenger RNA strand, cleavage by dicer, cleavage of mRNA C) formation of double-stranded RNA, cleavage by dicer, binding to RISC, degradation of passenger RNA strand, binding of mRNA, cleavage of mRNA D) binding of mRNA, formation of double-stranded RNA, degradation of passenger RNA strand, cleavage by dicer, binding to RISC, cleavage of mRNA E) binding of mRNA, formation of double-stranded RNA, cleavage by dicer, degradation of passenger RNA strand, binding to RISC, cleavage of mRNA, Answer: C Difficulty: Hard Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

36) Which of the following is a common modification seen in rRNA and tRNA?

A) dihydrouridine B) N2,N2-dimethylguanosine C) 3-methylcytidine D) pseudouridine E) all of the above Answer: E Difficulty: Medium Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

37) Which of the following is seen in the following figure?

A) a standard G-C base pair with a nonstandard A-G base pair B) a standard A-U base pair with a nonstandard A-G base pair C) a standard G-U base pair with a nonstandard A-C base pair D) a standard A-C base pair with a nonstandard U-G base pair E) a standard G-U base pair with a nonstandard G-G base pair Answer: A Difficulty: Hard Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

38) What modified base is seen in the following figure?

A) 3-methyluridine B) 3-methylcytidine C) 3-methyladenosine D) 3-methylguanosine E) none of the above Answer: B Difficulty: Hard Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

39) Which of the following best describe the following base pair?

A) a typical G-C base pair B) a typical A-U base pair C) a nonstandard C-A base pair D) a nonstandard G-U base pair E) a nonstandard G-C base pair Answer: D Difficulty: Hard Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

40) Which of the following is thought to be the origin of RNA interference?

A) removal of mistranscribed mRNA B) removal of excessive mRNA C) antiviral defense D) antibiotic for RNA based bacteria E) none of the above Answer: C Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

41) Histone proteins that bind to areas of DNA that are highly transcribed are often _____ on _____ residues.

A) methylated; lysine B) phosphorylated; serine C) phosphorylated; tyrosine D) acetylated; histidine E) acetylated; lysine Answer: E Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

42) Which of the following details the progression of structural levels from DNA to chromosome in eukaryotic DNA? A) A-DNA  30-nm fiber  nucleosome  loop  chromosome B) A-DNA  nucleosome  loop  30-nm fiber  chromosome C) B-DNA  nucleosome  30-nm fiber  loop  chromosome D) B-DNA  nucleosome  loop  30-nm fiber  chromosome E) Z-DNA  30-nm fiber  nucleosome  loop  chromosome Answer: C Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

43) What type of modification is used to make CpG islands?

A) acetylation of guanine B) methylation of guanine C) phosphorylation of guanine D) acetylation of cytosine E) methylation of cytosine Answer: E Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Dropdown

44) In terms of histone modification enzymes, a(n) ___ is an example of an eraser while a ___ is an example of a writer.

Dropdown 1: acetyltransferase, kinase, demethylase Dropdown 2: kinase, demethylase, deacetylase

Difficulty: Medium Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Multiple choice

45) The DNA strand that serves as the template for the synthesis of RNA is often called the _____.

A) coding strand

B) noncoding strand C) messenger strand D) transfer strand E) transcription strand

Answer: B

Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

46) RNA occurs primarily as single-stranded molecules that can give rise to _______ structures.

A) diploid B) stem-loop C) parallel D) tautomeric E) haploid

Answer: B

Difficulty: Easy Section Reference: 21-2

Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

47) Which of the following bases is not present in RNA?

Answer: D

Difficulty: Easy Section Reference: 21-2 Learning Objective: Summarize the activity of RNA polymerase in elongation and termination

48) In living organisms, genetic information is most often stored in the form of ______.

A) ribonucleic acid B) deoxyribonucleic acid C) proteins D) enzymes E) deoxynucleotides

Answer: B

Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

49) All cellular RNAs are transcribed from ______.

A) DNA templates B) RNA templates C) either DNA or RNA templates, but not both in the same organism D) a combination of DNA and RNA templates E) none of the above

Answer: A

Difficulty: Easy Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

50) RNA interference is a mechanism of post-transcriptional RNA-dependent ______.

A) chromatin-remodeling B) gene silencing C) histone methylation D) coactivation E) apoptosis

Answer: B

Difficulty: Easy Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

Question type: Text entry

51) The pyrimidine found in both DNA and RNA is _____. The pyrimidine found only in DNA is _____, and the pyrimidine found only in RNA is _____.

Answer 1: cytosine Answer 2: thymine Answer 3: uracil

Difficulty: Moderate Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Multiple choice

52) In DNA, the ribose derivative lacks an _____ on C-_____.

A) alcohol; 2

B) alcohol; 3 C) amine; 2 D) amine; 3 E) none of the above

Answer: A

Difficulty: Moderate Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Multipart

53) This is the structure of adenine.

a. Is adenine a purine or a pyrimidine? b. Which base does adenine base-pair (H-bond) with in DNA? c. What is the name of the molecule that is composed of adenine linked to the C-1ꞌ of ribose?

d. Indicate on the drawing through which atom adenine is connected to ribose or deoxyribose. e. Indicate on the drawing which groups on adenine are involved in base-pairing or H-bonding with its complementary base.

Answer: a. purine b. thymine c. adenosine d. see diagram e. see diagram

Difficulty: Difficult Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Essay

54) Describe the structure of a DNA molecule by listing six characteristics.

Answer:

1. DNA forms a double helix.

2. The two strands run antiparallel.

3. The sugar is deoxyribose.

4. The sugar-phosphate groups are on the outside of the helix.

5. The bases are in the center of the helix.

6. The bases are planar, and their plane is orientated perpendicular to the axis of the helix.

7. There are four bases: adenine, guanine, cytosine, and thymine.

8. The strands are held together by H-bonding between complementary bases: adeninethymine and guanine-cytosine.

9. The helix has a minor and a major groove on its surface.

Difficulty: Difficult Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Multipart

55) This is the structure of cytosine.

a. What are the names of the other three bases that are found in DNA? b. Is cytosine a purine or a pyrimidine? c. Give the name and the one letter abbreviation of the base cytosine base-pairs (H-bonds) with in DNA. d. What is the name of the molecule composed of cytosine linked to ribose? e. Indicate on the drawing through which atom cytosine is connected to ribose or deoxyribose f. Indicate on the drawing which groups on cytosine are involved in base-pairing (H-bonding) with its complementary base.

Answer: a. adenine, guanine, and thymine b. pyrimidine c. guanine, G d. cytidine e. see diagram f. see diagram

Difficulty: Difficult Section Reference: 21-1

Learning Objective: Describe the roles of proteins and DNA sequences in initiating transcription

Question type: Multiple choice

56) Which of the following would likely result in the formation of RNA?

A) injection of antisense RNA from a human into human cells B) injection of sense RNA into C. elegans C) injection of antisense RNA from yeast into a human D) all of the above E) none of the above

Answer: E

Difficulty: Difficult Section Reference: 21-3 Learning Objective: Describe the ways that RNA is processed

Essential Biochemistry Test Bank, Chapter 22: Protein Synthesis Question type: Multiple Choice

1) The genetic code is said to be _____ because several codons may correspond to the same amino acid.

A) deteriorate B) despicable C) degenerate D) decadent E) depraved Answer: C Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

2) What is the similarity between the amino acids that have only one codon each?

A) they are aromatic amino acids B) they are the sulfur containing amino acids C) they are neutral polar amino acids D) they occur very infrequently in proteins E) none of the above Answer: D Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

3) The codon is found _____ while the anticodon is found _____.

A) on the proteins of the ribosome; in the mRNA

B) in the mRNA; on the RNA of the ribosome C) on the tRNA; on the RNA of the ribosome D) on the tRNA; in the mRNA E) in the mRNA; on the tRNA Answer: E Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

4) Which of the following describes the general three-dimensional structure of a tRNA? A) a cloverleaf shape with the anticodon and acceptor stem on “leaves” that are opposite each other B) an L shape with the anticodon at one end of the L and the acceptor stem at the other C) a large loop with the anticodon and 3 end in very close proximity to each other D) an elongated cylinder shape with the anticodon and acceptor stem at opposite ends E) since all tRNAs have very different three-dimensional structure, it is difficult describe a general shape Answer: B Difficulty: Medium Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

5) Which of the following is the only tRNA loop that is exclusively single stranded RNA? A) acceptor step B) D loop C) TC loop D) anticodon loop E) none of the above Answer: E Difficulty: Medium Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

6) During the charging of a tRNA, what intermediate is formed?

A) aminoacyl-adenylate B) aminoacyl-tRNA C) aminoacyl-ADP D) tRNA-adenylate

E) none of the above Answer: A Difficulty: Medium Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

7) Which of the following explains why the aminoacyl-tRNA synthetase for isoleucine rarely incorporates valine despite the similar structure of these two amino acids?

A) valine does not fit into the binding site for isoleucine B) only leucine and isoleucine can fit in the active site of the enzyme C) the enzyme contains a proofreading site that only allows isoleucine D) the enzyme contains a proofreading site that only excludes isoleucine E) none of the above Answer: D Difficulty: Hard Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

8) Which of the following is required for the correct charging of a tRNA? A) tRNA, mRNA, amino acid, GTP and aminoacyl-tRNA synthetase B) tRNA, amino acid, ATP and aminoacyl-tRNA synthetase C) tRNA, amino acid, ATP and transpeptidase D) tRNA, amino acid, GTP and transpeptidase E) tRNA, mRNA, amino acid, ATP and transpeptidase Answer: B Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

9) What type of bond connects the tRNA with its amino acid (AA)?

A) ester between AA carboxylate and tRNA 3 hydroxyl B) mixed anhydride of AA carboxylate and tRNA 3 phosphate C) phosphoramide of AA amine and tRNA 3 phosphate

D) mixed anhydride of AA carboxylate and tRNA 5 phosphate E) phosphoramide of AA amine and tRNA 5 phosphate Answer: A Difficulty: Hard Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

10) Where is the anticodon in the following structure?

A) 1 B) 2 C) 3 D) 4 E) 5 Answer: C Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

11) Given the following anticodon, which mRNA codon would pair with it?

5-IGC-3 A) 5-UCA-3 B) 5-UCG-3 C) 5-ACU-3 D) 5-GUA-3

E) 5-GCU-3 Answer: E Difficulty: Hard Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

12) Approximately what fraction of the mass of a ribosome is due to protein?

A) 1/2 B) 1/3 C) 1/4 D) 1/5 E) 1/6 Answer: B Difficulty: Easy Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

13) What are the predominant interactions between the 30S and 50S subunits that allow the formation of the 70S ribosome?

A) 30S protein with 50S rRNA B) 30S rRNA with 50S protein C) protein-protein interactions from both subunits D) rRNA-rRNA interactions from both subunits E) interactions of 50S rRNA with tRNA D loop and interactions of 30S rRNA with anticodon loop are the only interactions holding the 70S ribosome together Answer: D Difficulty: Medium Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

14) Why does the mRNA adopt a sharp bend as it moves through the ribosome?

A) so that the mRNA can enter the 30S subunit and exit the 50S subunit B) in order to maximize base pairing with the 23S rRNA C) so the tRNAs in both the A and P site can interact with their appropriate codons D) to prevent dissociation of the 30S and 50S subunits E) all of the above Answer: C Difficulty: Hard Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

15) Which of the following tRNA binding sites is correctly defined?

A) A site: accepts incoming aminoacyl-tRNA B) E site: entrance site for initial tRNA binding C) P site: site occupied by the tRNA that accepts the growing peptide chain D) T site: site that is briefly occupied while the tRNA is passed from the A site to P site E) all of the above Answer: A Difficulty: Easy Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

16) Which amino acid is the first incorporated into a prokaryotic protein?

A) N-formylthreonine B) N-formylmethionine C) N-formylaspartate D) N-formylglutamine E) N-formylcysteine Answer: B Difficulty: Easy Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

17) What sequence is located about 10 bases upstream of the initiation codon?

A) Watson-Crick sequence B) Meselson-Stahl sequence C) Hershey-Chase sequence D) Avery-MacLeod sequence E) Shine-Dalgarno sequence Answer: E Difficulty: Easy Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

18) What two elements of translation are paired by a Shine-Dalgarno sequence?

A) initial tRNA with the initiation codon B) initial tRNA with the ribosomal A site C) mRNA with 23S rRNA of the ribosome D) mRNA with 16S rRNA of the ribosome E) mRNA with initial tRNA Answer: D Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

19) In E. coli translation, _____ aids with binding of the fMet-tRNA to the 30S subunit while _____ blocks the A site.

A) IF-1; IF-2 B) IF-1; IF-3 C) IF-2; IF-1 D) IF-2; IF-3 E) IF-3; IF-1 Answer: C Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

20) Which of the following initiation steps results in GTP hydrolysis?

A) binding of mRNA to the 30S subunit B) binding of the 50S subunit to the 30S subunit C) binding of the fMet-tRNA to the ribosome D) binding of IF-2 to the 30S subunit E) binding of IF-1 to the A site Answer: B Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

21) How is the initiation codon found in eukaryotic translation?

A) a sequence similar to the Shine-Dalgarno sequence is located B) the 5 cap binds just beyond the P site of the ribosome C) the fMet-tRNA is able to locate the initiation codon before binding to the ribosome D) when the mRNA circularizes, the poly(A) tail enables location of the initiation codon E) the first AUG codon is found when the 40S subunit scans the mRNA from the 5 end Answer: E Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

22) Which of the following best describes the preparation of fMet-tRNA for translation in prokaryotes?

A) Met is first added to a tRNA specific for the start codon that differs from that designed to carry Met, then formylated

B) Met is first formylated, then added to a tRNA specific for the start codon and differs from the tRNA designed to carry Met C) Met is first added to a "regular" tRNAMet, then formylated; the fact that it has the formyl group allows use in the initiation codon

D) Met is first formylated, then added to a "regular" tRNAMet; the fact that it has the formyl group allows use in the initiation codon E) fMet isn't used in prokaryotes, only in eukaryotes

Answer: A Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

23) Which of the following is true regarding the interaction of EF-Tu with aminoacyl-tRNAs? A) the higher the occurrence of an amino acid in a protein, the stronger the interaction B) EF-Tu binds charged and uncharged tRNAs with the same affinity C) free aminoacyl-tRNAs can only bind to the ribosome in vitro D) binding occurs with about equal affinity for all aminoacyl-tRNAs E) the interaction always involves the anticodon loop Answer: D Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

24) The interaction used to insure correct codon-anticodon recognition involves RNA interactions from _____ that specifically check interactions at _____.

A) mRNA and tRNA; first and second codon positions B) mRNA and tRNA; second and third codon positions C) mRNA, tRNA and rRNA; first and second codon positions D) mRNA, tRNA and rRNA; second and third codon positions E) mRNA, tRNA and rRNA; all three codon positions Answer: C Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

25) Hydrolysis of GTP by EF-Tu is thermodynamically required for _____.

A) proofreading B) transpeptidation C) translocation D) aminoacyl-tRNA binding to the ribosomal A site E) none of the above Answer: A Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

26) Besides the proofreading function of EF-Tu, what other mechanism is used to insure the proper tRNA is in the A site?

A) interaction between the D loop and the 50S subunit B) interaction between the TC loop and the 30S subunit C) interaction of the aminoacyl group with certain proteins in the A site D) interaction of the codon with the 50S subunit E) none of the above Answer: E Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

27) Polypeptide synthesis proceeds from the _____ to the _____.

A) entrance site; exit site B) 50S subunit; 30S subunit C) C-terminus; N-terminus D) N-terminus; C-terminus E) peptidyl site; aminoacyl site

Answer: D Difficulty: Easy Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

28) Which of the following provides the energy for the peptidyl transferase reaction?

A) GTP  GDP + Pi B) GTP  GMP + PPi C) ATP  ADP + Pi D) ATP  AMP + PPi E) since an ester is being converted to an amide, no external energy input is required Answer: E Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

29) Which of the following is responsible for the catalytic activity of peptidyl transferase?

A) protein component of 50S subunit B) rRNA component of 50S subunit C) protein component of 30S subunit D) rRNA component of 30S subunit E) both protein and rRNA of the 50S subunit Answer: B Difficulty: Easy Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

30) What type of catalysis is seen by the nucleotides in the active site of peptidyl transferase?

A) acid-base catalysis B) nucleophilic catalysis C) electrophilic catalysis

D) proximity and orientation effects E) covalent catalysis Answer: D Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

31) EF-G is required for _____ as it binds to the ribosome in a manner similar to _____.

A) translocation; the EF-Tu-tRNA complex B) transpeptidation; the EF-Tu-GDP complex C) transferase; an uncharged tRNA D) transduction; an aminoacyl-tRNA E) none of the above Answer: A Difficulty: Hard Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

32) Which of the following antibiotics mimics an aminoacyl-tRNA? A) chloramphenicol B) erythromycin C) penicillin D) puromycin E) streptomycin Answer: D Difficulty: Medium Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

33) What recognizes stop codons?

A) a termination tRNA that does not carry an amino acid on its acceptor stem B) release factors C) ribosome recycling factors D) fMet-tRNA E) nothing recognizes stop codons, that is why translation ceases Answer: B Difficulty: Easy Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

34) Which of the following aids in protein folding by completely sequestering a polypeptide from its environment?

A) ubiquitin B) trigger factor C) chaperonin D) heat shock protein E) signal recognition particle Answer: C Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

35) Chaperones such as trigger factor generally bind to what regions of a polypeptide?

A) hydrophobic regions B) acidic regions C) basic regions D) both acidic and basic regions E) neutral polar regions Answer: A Difficulty: Easy Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

36) Signal recognition particle is a _____ whose function is to _____.

A) DNA-protein complex; transport proteins into the eukaryotic nucleus B) ribonucleoprotein; direct proteins to the membrane or endoplasmic reticulum C) chaperone; aid in protein folding D) glycosylase; catalyze posttranslational modification E) none of the above

Answer: B Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

37) In eukaryotic cells, when a protein is to be translocated to the endoplasmic reticulum, what must occur for complete translation to occur?

A) the N-terminus binds SRP which delivers the ribosome and growing peptide to the ER B) the N-terminus binds SRP which is then partially cleaved by a signal peptidase C) the ribosome must be translocated into the ER prior to initiation of translation D) the ribosome must be bound to the ER before translation begins E) a chaperone protein embedded in the ER membrane binds the N-terminus Answer: A Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

38) Chaperonins such as the GroEL/ES system function _____.

A) only when heat shock proteins are activated B) in a non-aqueous environment C) only at low pH D) only when bound to the ER membrane E) in an ATP-dependent manner

Answer: E Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

39) Which of the following commonly occurs at asparagine residues of extracellular proteins?

A) hydrolysis of the amide to form Asp B) phosphorylation C) glycosylation D) peptide cleavage E) none of the above Answer: C Difficulty: Easy Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

40) Which of the following occurs during the post-translational processing of insulin?

A) glycosylation B) phosphorylation C) acetylation of lysine residues D) formation of disulfide bonds E) amidation of the C-terminal amino acid Answer: D Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

41) Attachment of _____ to a Lys residue of a protein targets it for transport into the nucleus.

A) ubiquitin B) SUMO C) SRP

D) DnaK E) trigger factor Answer: B Difficulty: Medium Section Reference: 22-4

Learning Objective: List the events that occur during post-translational processing

42) Which of the following bases is not present in RNA?

Answer: D

Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

43) The term rRNA refers to ______ RNA.

A) ribosomal

B) retroviral C) recombinant D) rho factor

Answer: A

Difficulty: Easy Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

44) Transfer RNA molecules are involved in ______.

A) transcription B) translation C) replication D) reverse transcription E) post-translational processing

Answer: B

Difficulty: Easy Section Reference: 22-1 Learning Objective: Describe the role of tRNA in reading the genetic code

Question type: Text entry

45) In bacteria, riboflavin can inhibit its own synthesis by binding to an mRNA element termed a ______.

Answer: riboswitch

Difficulty: Moderate Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

Question type: Multiple choice

46) Which of the following is a function of the ribosome?

I. bind mRNA and allow codon recognition II. mediate the binding of proteins necessary for initiation, elongation, and termination III. catalyze synthesis of peptide bonds IV. translocate such that multiple codons can be read

A) I only B) I, II C) I, IV D) II only E) I, II, III, IV

Answer: E

Difficulty: Moderate Section Reference: 22-2

Learning Objective: Recognize the major features of the ribosome

47) Which diagram correctly depicts a ribosome engaged in translation?

A) a B) b C) c D) d

Answer: A

Difficulty: Difficult

Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination

Question type: Essay

48) There are three types of RNA that are directly involved in translation. a. Name these three types of RNA b. Briefly describe the function of each of these types of RNA.

Answer: a. mRNA, tRNA, rRNA b. mRNA moves genetic information from the nucleus to the ribosomes in the cytoplasm. tRNA decodes the genetic message; it matches sequences of three nucleotides to amino acids. rRNA is involved in the catalysis of amide bond formation.

Difficulty: Difficult Section Reference: 22-3

Learning Objective: Summarize the events of translation initiation, elongation, and termination