TEST BANK for Genetics: Analysis and Principles 7th Edition. by Robert Brooker. All Chapter 1-29.

CHAPTER 1 MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

1) The basic unit of heredity is the ___________.

A) B) C) D) E)

2)

A variation of a gene is called a(n) _______.

A) B) C) D) E)

3)

species morph genome allele proteome

Which of the following acts to accelerate chemical reactions in a cell?

A) B) C) D) E)

4)

individual gene macromolecule trait none of the answers are correct

Nucleic acids Lipids Carbohydrates Enzymes DNA

The building blocks of DNA are _____________.

Version 1

1

A) B) C) D) E)

amino acids carbohydrates enzymes nucleotides lipids

5) If a carbohydrate is going to be broken down for energy, which of the following molecules would be directly involved in the breakdown?

A) B) C) D) E)

6)

RNA is formed by the process of _____________.

A) B) C) D)

7)

Catabolic enzymes Nucleotides Anabolic enzymes Lipids Chromosomes

transcription translation both transcription and translation Replication

A characteristic that an organism displays is called __________.

A) B) C) D) E)

Version 1

a gene a chromosome DNA gene expression a trait

2

8) The level of study of genetics where the prevalence of a trait in a species is investigated is known as _____ .

A) B) C) D)

population genetics organismal genetics cellular genetics molecular genetics

9) The study of the processes of transcription and translation is at what level of biological organization?

A) B) C) D)

10)

Alternate versions of a specific gene are called _________.

A) B) C) D)

11)

nucleotides chromosomes alleles traits

Genetic variation is ultimately based upon which of the following?

A) B) C) D)

12)

Population Organismal Cellular Molecular

Morphological differences Small variations in nucleotide sequence of the DNA Carbohydrate content of the cell Translation

An organism whose cells contains two copies of each chromosome is called _______.

Version 1

3

A) B) C) D) E)

13)

a genetic mutation a morph haploid diploid alleles

A cell that makes up the body structure of an organism and is diploid is _______.

A) B) C) D) E)

a gamete a somatic cell an allele rare a sperm cell

14) In many organisms, one set of chromosomes comes from the maternal parent, while the other set comes from the paternal parent. Similar chromosomes in these sets are said to be _________.

A) B) C) D) E)

15)

morphs alleles haploid homologs physiological traits

In humans, gametes are different than other cells of the body in that they are _________.

A) B) C) D)

Version 1

diploid haploid genetic mutations morphs

4

16)

Which of the following is correct regarding natural selection?

A) B) C) D)

17)

The use of a gene sequence to synthesize a functional protein is known as __________.

A) B) C) D)

18)

It is not based on competition for resources Beneficial traits are not passed on to the next generation It does not enable a species to become better adapted to its environment It may drastically change a species over time

loss-of-function mutation gene expression the human genome project proteomics

The differences in inherited traits among individuals in a population are called _______.

A) B) C) D)

species variation genetic mutations genetic variation natural selection

19) Three populations of a type of animal, each with drastically different external markings, but still members of the same species, would be called _______.

A) B) C) D) E)

20)

homologs mutants communities alleles morphs

The changes in the genetic makeup of a population over time is called _______.

Version 1

5

A) B) C) D) E)

21)

homologous recombination model organisms studies genetic crosses biological evolution hypothesis testing

Which of the following level of genetics studies the effects of loss-of-function mutations?

A) Population genetics B) Transmission genetics C) Molecular genetics

22) Which of the following level of genetics would use a genetic cross to determine patterns of inheritance?

A) Population genetics B) Transmission genetics C) Molecular genetics

23) Which of the following level of genetics studies the relationship between genetic variation and the environment?

A) Population genetics B) Transmission genetics C) Molecular genetics

24) Which of the following level of genetics began with the work of Gregor Mendel in the 19th century?

Version 1

6

A) Population genetics B) Transmission genetics C) Molecular genetics

25) Which of the following level of genetics how the forces of nature have influenced the spread of traits?

A) Population genetics B) Transmission genetics C) Molecular genetics

26)

What is the difference between hypothesis testing and discovery-based research?

A) Hypotheses can be validated or invalidated while discovery-based research relies more on collection and analysis of data without a hypothesis.

B) Discovery-based science can be validated or invalidated while hypothesis based research relies more on collection and analysis of data.

C) There is only one type of experimental approach, both terms describe the same approach.

D) Hypothesis-based research results in believable science while discovery-based research results in unreliable conclusions.

27) A scientist observes two populations of birds that differ slightly in their morphology. In order to explain these observations, which strategy should the scientist employ as a first step?

A) B) C) D)

Version 1

Propose a hypothesis Relate structure and function Analyze data Use statistics

7

28) The cloned sheep Dolly was was born to an ewe that had a black face yet Dolly had a white face. What is the explanation for this?

A) Dolly was a mutant black faced sheep and should have had a black face.

B) The ewe that gave birth to Dolly was a mutant white faced sheep.

C) Dolly's genome was originally from an ewe that was a white faced breed of sheep.

D) Dolly was the result of mating a white faced ram and the black faced ewe when that occurs all the progeny will have a white face.

29) Fish from lakes that are stained with the plant pigment tannin are more darkly colored than fish from lakes that have less tannin. If the offspring from the fish from a lake with high tannin levels are raised in a low tannin lake they turn out to be lightly pigmented. This would most likely be an example of __________.

A) B) C) D)

the pigmentation only being controlled by genetic factors the male fish only producing sperm that resulted in the lightly pigmented morph the environment controlling the pigmentation of the fish the female fish only producing eggs with the lightly pigmented gene

30) Mendel is frequently credited with the discovery of transmission genetics and his major contribution relied on the breeding of peas to see what types and ratios of different offspring the plants could produce. This is an example of what kind of experiment?

A) B) C) D)

Discovery-based Hypothesis testing A mixture of discovery-based and hypothesis testing Neither discovery-based nor hypothesis testing

31) What would be the anticipated result if a gene produced less RNA for an essential enzyme?

Version 1

8

A) B) C) D) mutation.

There would be no change in the cell or the organism.

The cell or organism would die.

The cell or organism could experience difficulty possibly leading to death.

The cell or organism would not be any different than one that did not carry the

32) When rats are controlled by pesticides a specific allele for the oxygen carrying protein hemoglobin becomes more prevelant in the population and rats carrying the allele are more resistant to the poison. However, this allele is also less efficient at carrying oxygen. When the pesticide is no longer used then the frequency of the mutant allele drops in the population and the more efficient oxygen carrying allele increases. This can be considered an example of __________.

A) natural selection B) gene regulation C) DNA being the informational molecule

33) The blood types of the ABO typing system are inheritable even though they result from different forms of a carbohydrate on the cell surface. The explanation for why this in an inheritable trait is __________.

A) B) C) D)

34)

a protein controls the formation of the carbohydrate this is an exception of DNA being the inheritable molecule the carbohydrate is synthesized from the mRNA the carbohydrate is synthesized directly from the DNA

A mutation in a codon will result in __________.

A) B) C) D)

Version 1

a new gene a new allele a new lipid a new carbohydrate

9

35) If two separate species have genes with nearly identical DNA sequences it most likely means that __________.

A) B) C) D)

36)

they evolved from a common ancestor they are really the same species and not two different species they share no real relationship the proteins that one of the genes makes is non-functional

Why would a mouse be more useful than a bacterium as a model organism?

A) B) C) D)

Version 1

Bacteria divide/replicate more slowly.

Mouse physiology is more closley related to humans.

Mice have simpler genetics and inheritance patterns.

Bacterial genes are more closely related to human genes.

10

Answer Key Test name: Chap 01_7e 1) B 2) D 3) D 4) D 5) A 6) A 7) E 8) A 9) D 10) C 11) B 12) D 13) B 14) D 15) B 16) D 17) B 18) C 19) E 20) D 21) C 22) B 23) A 24) B 25) A 26) A Version 1

11

27) A 28) C 29) C 30) A 31) C 32) A 33) A 34) B 35) A 36) B

Version 1

12

CHAPTER 2 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Mendel's work on inheritance had an immediate influence on the scientific community and theories of inheritance. ⊚ ⊚

2)

true false

Differences in plant flower color or plant height are called a variant of a trait. ⊚ ⊚

true false

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

3) The theory of pangenesis was first proposed by ________.

A) B) C) D) E)

4)

Aristotle Galen Mendel Hippocrates None of the answers are correct

Mendel's work was rediscovered in 1900 by which of the following individual(s)?

A) B) C) D)

Carl Correns Erich von Tschermak Hugh de Vries All of the answers are correct

5) Which of the following characteristics made the pea plant Pisum sativum an ideal organism for Mendel's studies?

Version 1

1

A) B) C) D)

It has the ability to self-fertilize It was easy to cross-fertilize one plant with another It has easily identifiable traits All of the answers are correct

6) The anther represents the _____ portion of the plant, while the ovules represent the ____ portion of the plant.

A) B) C) D)

7)

female; male male; female female; female male; male

Which of the following traits was not studied by Mendel?

A) B) C) D) E)

Flower color Seed color Pod color Pollen color Plant height

8) A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring have green pods. From this information, it can be stated that the green color is _____ to the yellow color.

A) B) C) D) E)

Version 1

recessive dominant subservient blended None of these choices are correct

2

9) Mendel's work with single-factor crosses resulted in the development of which of the following?

A) B) C) D) E)

Law of segregation Law of independent assortment Theory of natural selection Law of biological evolution All of these choices are correct

10) When Mendel crossed two plants that were heterozygous for a single trait, what was the phenotypic ratio of their offspring?

A) B) C) D) E)

11)

An individual who has two identical alleles for a trait is said to be ___________.

A) B) C) D)

12)

1:2:1 9:3:3:1 3:1 7:4 Varied depending on the trait

homozygous heterozygous isozygous a variant

The genetic composition of an individual is called its _____________.

A) B) C) D) E)

Version 1

phenotype genotype hybrid dominance None of these choices are correct

3

13)

The observable characteristics of an organism are called its ___________.

A) B) C) D) E)

14)

An individual who has two different alleles for a trait is called ____________.

A) B) C) D) E)

15)

haploid homozygous heterozygous isozygous true-breeding

In a Punnett square diagram, the outside of the box represents the _________.

A) B) C) D)

16)

phenotype genotype dominance genes None of these choices are correct

diploid offspring haploid offspring diploid gametes haploid gametes

Mendel's work with two-factor (dihybrid) crosses led directly to which of the following?

A) B) C) D) E)

Version 1

Chromosomal theory of inheritance Particulate theory of inheritance Law of segregation Law of independent assortment Theory of biological evolution

4

17) In a dihybrid cross using Mendelian inheritance, if both parents are heterozygous for both traits, what will be the phenotypic ratio of their offspring?

A) B) C) D)

18)

In humans, patterns of inheritance are often studied using which of the following?

A) B) C) D) E)

19)

3:1 1:2:1 1:1 9:3:3:1

Loss-of-function alleles Production of true-breeding lines Pedigree analysis Self-fertilization None of these choices are correct

The chance that a future event will occur is called ____________.

A) B) C) D) E)

probability goodness of fit degrees of freedom random selection All of these choices are correct

20) Which of the following would be used to determine the probability of three independent events in order?

Version 1

5

A) B) C) D) E)

Sum rule Product rule Chi-square test Binomial expansion Random sampling error

21) A couple would like to know what the probability is that out of five children, three will be girls. This is solved using which of the following?

A) B) C) D) E)

Sum rule Product rule Chi-square test Binomial expansion Random sampling error

22) Using Mendel's flower color (purple is dominant, white is recessive), if two heterozygous plants are crossed, what is the probability that the first two offspring will have purple flowers?

A) B) C) D) E)

1/2 1/4 6/4 9/16 1/16

23) The _____ indicates the probability that differences between the observed values and the expected values are due to random chance alone.

A) B) C) D) E)

Version 1

P value goodness of fit degrees of freedom empirical approach None of these choices are correct

6

24)

In the biological sciences, the null hypothesis is usually rejected if the P value is _____.

A) B) C) D) E)

greater than 1 less than 0.30 less than 0.95 less than 0.05 less than 1

25) _______ is the belief that seeds are produced by all parts of the body and transmitted to the next generation.

A) B) C) D) E)

26)

Hippocrates Pangenesis Blending Particulate theory Homunculus

Mendel had experience in the fields of _______ and _______.

A) B) C) D) E)

physics; mathematics English; psychology psychology; biology biology; philosophy None of these choices are correct.

27) A cross in which a researcher investigates the patterns of inheritance of a single trait is called a __________.

Version 1

7

A) B) C) D) E)

monohybrid cross dihybrid cross two-factor cross cross-fertilization self-fertilization

28) In a genetic cross, the _______ represent offspring with genetic combinations that were not found in the parental lines.

A) B) C) D) E)

29)

P generation nonrecombinants parentals nonparentals None of these choices are correct

The study of family trees in humans is called a _______ analysis.

A) B) C) D) E)

pedigree monohybrid dihybrid statistical probability

30) Statistical analysis determines the _______ between observed data and what was expected from the original hypothesis.

A) B) C) D)

Version 1

degrees of freedom P values complete hypothesis goodness of fit

8

31) If a Punnett square is used to visualize a three-factor cross (trihybrid cross) how many boxes would be inside of the square?

A) B) C) D) E)

3 8 48 64 Can't be determined

32) According to Mendel's law of segregation, allele segregation into gametes is __________.

A) B) C) D)

33)

based on whether the allele is dominant or recessive random based on whether the individual is homozygotic or heterozygotic based on whether the individual is male or female

In the Punnett square below, in which box wouldhomozygotic dominant progeny be

represented?

Version 1

McGraw-Hill Education

9

A) B) C) D)

34)

A B C D

The Law of Independent Assortment states that __________.

A) two different genes will randomly assort their alleles during the formation of haploid

cells B) two different alleles will randomly assort during the formation of haploid cells C) two different genes will NOT randomly assort their alleles during the formation of haploid cells D) two different genes will randomly assort their alleles during the formation of diploid cells

35)

An allele that produces an inactive enzyme would be classified as what kind of allele?

A) B) C) D)

36)

Loss-of-function Gain-of-function Dominant These do not occur and therefore there is no classification for them.

Which definition below is the best definition for probability?

A) The chance that an outcome will occur in the future.

B) The frequency at which homozygous recessive traits are seen in an individual mating.

C) The number of times homozygotic recessives appear through successive generations of a family as compared to heterozygotes.

D) The number of times a coin is flipped.

Version 1

10

37) What is the probability that an offspring will have an ssRR genotype from a cross of two SsRr individuals?

A) B) C) D)

6.25% 12.5% 25% 3.12%

38) If an individual that phenotypically has dominant traits is mated to another individual that also has dominant traits and the progeny have both dominant and recessive traits it indicates that __________.

A) B) C) D)

both parents are heterozygotic one parent is heterozygotic and one is homozygotic both parents are homozygotic no conclusions can be made about the genotypes of the parents

39) The results of a study of a population is presented in the following table. The "-" indicates that the other allele is unknown.

Parent 1 genotype

Parent 2 genotype

Ratio and genotype of offspring

S-

S-

989 S - 53 ss

ss

S-

560 S - 200 ss

ss

ss

700 ss

Which of the conclusions listed below is correct?

A) The ratios of the offspring in the S- x S - matings conform to the expected ratio for a single-gene cross.

B) The ratios of the offspring in the S - x S - matings are due to some S - parents being homozygotic and some being heterozygotic.

C) If the S- offspring of the S - x S - matings were mated to the S - offspring from the S - x ss matings there would be no ss offspring; all would be S -.

D) All of the S - offspring from the S - x S - matings are homozygotic.

Version 1

11

40) Phenotype

Number of progeny

Tall/purple flowers

850

Short/purple flowers

350

Short/white flowers

87

Tall/white flowers

313

The results of a two-genecross of plants that are both heterozygous for the traits belowareshownin the table. What conclusions would you make?

A) More progeny should be counted since the number of progeny is too low to make this type of analysis.

B) The chi square value is so close to the p value at 0.05 a conclusion should not be drawn and another mating should be performed.

C) The results are statistically the same as the expected results.

D) The results are statistically significantly different than the expected results.

41) Cystic fibrosis is caused by mutations in the CF gene, and there are several different mutations that are known to result in CF disease. The CF mutations behave as recessive alleles to the WT CF allele. If two carriers that have different mutations in their CF genes have children what is the probability that one of their children will have CF disease?

A) B) C) D)

100% 25% 50% 75%

42) Huntington's disease is a fatal syndrome caused by a dominant mutation in the HD gene.

The disease has an average age of onset of 35 and the majority of individuals that are affected are heterozygotes. What is the probability that a 25-year-old woman with no symptoms and who is the daughter of a man that has HD and a mother who does not will have a child that will have the mutant HD allele? (Assume she mates with a man who has normal HD genes.)

Version 1

12

A) B) C) D)

25% 50% 75% 100%

43) Two plants that are heterozygous for production of an enzyme are crossed. The levels of the enzyme are measured in the progeny and represented in the graph below. Homozygous dominant individuals have high enzyme levels, heterozygous individuals have intermediate enzyme levels, and homozygous recessive individuals have low enzyme levels. What is the expected ratio of the phenotypes A, B, and C in the progeny?

McGraw-Hill Education A) B) C) D)

Version 1

A: 33.3%B: 33.3%C: 33.3% A: 50%B: 25%C: 25% A: 25%B: 50%C: 25% A: 25%B: 25%C: 50%

13

44) Twopea plants that are heterozygous for thedominanttall gene and the dominant purple flower geneare mated. The cross resulted in 9866 progeny, of which 5550 were tall with purple flowers. What are the expected ratios of the other phenotypic classes?

A) B) C) D)

1850 short/white flower616 tall/white flower1850 short/purple flower 1850 short/white flower1850 tall/white flower1850 short/purple flower 616 short/white flower1850 tall/white flower1850 short/purple flower 5550 short/white flower5550 tall/white flower5550 short/purple flower

45) If the progeny of a mating of pea plants have the following ratios 1342 smooth seed/green pod, 447 wrinkled seed/yellow pod, 429 smooth seed/ yellow pod, 1361 wrinkled seed/green pod what are the genotypes of the parents?

A) Parent 1: Homozygous for seed shape and pod colorParent 2: Heterozygous for seed shape and homozygous for pod color B) Both parents are heterozygous for seed shape and pod color C) Parent 1: Heterozygous for seed shape and pod colorParent 2: Homozygous seed shape and heterozygous for pod color D) Parent 1: Heterozygous for both seed shape and pod colorParent 2: Homozygous for both seed shape and pod color

46) Cystic fibrosis is an autosomal recessive disorder that affects lung function in humans.A man and a woman are both unaffected heterozygous carriers of a cystic fibrosis gene. If the couple has two children, what is the probability that their first child will be unaffected and their second child will be unaffected?

A) B) C) D)

6.25% 18.75% 37.5% 56.25%

47) Cystic fibrosis is an autosomal recessive disorder that affects lung function in humans.If a couple, who are both unaffected, have an affected child, what is the probability their next child will be an affected girl?

Version 1

14

A) B) C) D)

1/2 1/4 1/8 1/16

48) You are a researcher examining the expression pattern of a wobbly fly phenotype. You have flies that fly straight and those having a wobble flight.When you cross a straight flying strain with a strain showing a wobble flight, all the F1 flies fly straight. In the F2 generation, you get 762 straight flying flies and 238 wobbly flies. Your null hypothesis is that one gene controls flight patterns and that straight is dominant to wobbly.Use chi square analysis to test your hypothesis. What is your chi square number?Do you reject or accept the null hypothesis? Use the table listed below to help answer the question.

Version 1

15

A) B) C) D)

Chi square = 0.768; reject Chi square = 0.768; accept Chi square = 0.192; reject Chi square = 0.192; accept

49) Suppose that we are dealing with four genes, each gene consisting of a dominant allele (capital letter) and a recessive allele (small case letter).If the cross CcMmLlPP X CCmmLlpp is made, what is the probability of obtaining an individual who is CcmmLLPp? A) B) C) D) E)

Version 1

1/2 1/4 1/8 1/16 1/32

16

50) In tomatoes, yellow flowers (Y) are dominant to white flowers (y) and round fruit (R) is dominant to oblong fruit (r).You cross a heterozygous yellow round plant with a plant with white flowers and oblong fruit.You get the following progeny:238 yellow round 210 yellow oblong 270 white round 282 white oblong Formulate a null hypothesis and performing a chi square analysis on it, what chi squarenumber would you obtain?Based upon this number, would you reject or acceptyour null hypothesis?Use the table listed below.

A) B) C) D)

Version 1

Chi square = 12.7; reject Chi square = 12.7; accept Chi square = 987; reject Chi square = 987; accept

17

51) The Law of Independent Assortment does not always apply to genes that are __________.

A) B) C) D)

linked dominant recessive loss-of-function

52) If this pedigree shows a recessive disorder caused by homozygosity of the a allele, what are the genotypes of the parents in this pedigree?

McGraw-Hill Education A) B) C) D)

Version 1

aa and aa AA and aa Aa and aa Aa and Aa

18

53) If this pedigree shows a dominant disorder caused by the dominant A allele, what are the genotypes of the parents in this pedigree?

A) B) C) D)

Version 1

aa and aa aa and AA aa and Aa Aa and Aa

19

Answer Key Test name: Chap 02_7e 1) FALSE 2) TRUE 3) D 4) D 5) D 6) B 7) D 8) B 9) A 10) C 11) A 12) B 13) A 14) C 15) D 16) D 17) D 18) C 19) A 20) B 21) D 22) D 23) A 24) D 25) B 26) A Version 1

20

27) A 28) D 29) A 30) D 31) D 32) B 33) A 34) A 35) A 36) A 37) A 38) A 39) B 40) D 41) B 42) A 43) C 44) C 45) C 46) D 47) C 48) B 49) D 50) A 51) A 52) C 53) C

Version 1

21

CHAPTER 3 CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

1) Which of the following statements is correct regardingprokaryotic cells?Check all that apply.

A) B) C) D)

2)

Sister chromatids are separated during anaphase of __________. (Check all that apply.)

A) B) C) D)

3)

Genetic information is contained within a nucleoid region.

Genetic material is organized as a single circular chromosome.

Membrane-bound organelles are found in the cytoplasm.

A cell wall surrounds the plasma membrane.

mitosis meiosis II meiosis I cytokinesis

Which of the following occurs during prophase? Check all that apply.

A) B) C) D) E)

Chromosomes start to condense.

Sister chromatids separate and head towards opposite poles of the cell.

The chromosomes line up in the center of the cell.

The nuclear membrane starts to disassociate.

Separated sister chromatids are considered independent chromosomes.

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

4) Organelles are _____.

Version 1

1

A) B) C) D)

5)

structures that contain the genetic material. membrane-bound compartments of eukaryotic cells. the region that contains the DNA in prokaryotic cells. the outer, rigid covering of a prokaryotic cell.

A karyotype is a(n) _____.

A) B) C) D) E)

organelle of eukaryotic cells. stage of prophase I in meiosis. division of the cytoplasmic material following mitosis. organized representation of the chromosomes within a cell. protein complexbound to the centromereof an individual chromosome.

6) You are performing a karyotype for the first time and you forget to add the colchicine.

How do you predict this will affect your karyotype?

A) No affect - your karyotype will look normal.

B) You willbe unable to see any chromosomes under the microscope.

C) You will only be able to see one of each chromosome.

D) The chromosomes will look normal (highly compacted) in some cells, but distinct chromosomes will be hard to identify in other cells.

7) During sexual reproduction, each parent contributes one set of chromosomes. Members of a pair of chromosomes (one from each parent) are called _____.

A) B) C) D)

8)

karyotypes sister chromatids homologs sex chromosomes

Which of the following would contain genetic material that is 100% identical?

Version 1

2

A) B) C) D)

Homologous chromosomes Sister chromatids X and Y chromosomes All of these choices are correct - all answers are identical.

9) You are studying a diploid organism that has 14 pairs of chromosomes. How many chromatids would this cell have in G2 phase?

A) B) C) D) E)

7 14 28 56 112

10) You are studying a diploid organism that has 14 pairs of chromosomes. How many chromatids will a gamete from this organism have?

A) B) C) D) E)

7 14 28 56 112

11) You are studying a diploid organism that has 14 pairs of chromosomes. How many chromatids will a cell from this organism have in metaphase of meiosis II? A) B) C) D) E)

Version 1

7 14 28 56 112

3

12)

The location of a gene on a chromosome is called its _____.

A) B) C) D)

karyotype allele locus homolog

13) Cell division in prokaryotic cells is called ________, while in eukaryotic cells it is called ________.

A) B) C) D)

14)

Sister chromatids are formed during which phase of the cell cycle?

A) B) C) D) E)

15)

binary fission ; binary fission binary fission ; mitosis meiosis ; mitosis mitosis ; binary fission

G 1 phase G 2 phase S phase Prophase Cytokinesis

Chromosomes start to condense during which phase of the cell cycle?

A) B) C) D) E)

Version 1

Metaphase Prometaphase Telophase Anaphase Prophase

4

16)

Which of the following indicates the correct order of these events?

A) B) C) D)

17)

Anaphase - Telophase - Prophase - Prometaphase - Metaphase Telophase - Prometaphase - Prophase - Metaphase - Anaphase Metaphase - Prometaphase - Prophase - Anaphase - Telophase Prophase - Prometaphase - Metaphase - Anaphase - Telophase

In animals, somatic cells are ________ and germ cells are __________.

A) B) C) D)

diploid ; diploid diploid ; haploid haploid ; diploid haploid ; haploid

18) If the gametes of an organism are different morphologically, they are said to be __________.

A) B) C) D)

19)

The general purpose of the synaptonemal complex is to __________.

A) B) C) D) E)

20)

isogamous heterogamous diploid haploid

provide a link between homologous chromosomes in meiosis enable the reformation of the cell wall during cytokinesis separate the sister chromatids during anaphase independently assort the chromosomes during metaphase of meiosis None of the answers are correct.

What occurs during leptotene of prophase I?

Version 1

5

A) B) C) D) E)

21)

A bivalent contains how many chromatids?

A) B) C) D)

22)

2 4 8 Depends on the cell

The process of crossing over occurs during which phase of meiosis?

A) B) C) D) E)

23)

The homologous chromosomes recognize one another by synapsis.

Crossing over occurs.

The replicated chromosomes condense.

The synaptonemal complex dissociates.

None of the answers are correct.

Diakinesis Diplotene Pachytene Zygotene Leptotene

What represents the correct order of events during prophase I? A) B) C) D)

Pachytene - diplotene - diakinesis - leptotene - zygotene Leptotene - zygotene - pachytene - diplotene - diakinesis Zygotene - leptotene - pachytene - diakinesis - diplotene Diplotene - pachytene - leptotene - diakinesis - zygotene

24) The physical structure that is formed when two chromatids cross over is called a(n) _______.

Version 1

6

A) B) C) D)

synaptonemal complex bivalent karyotype chiasma

25) If an organism has five pairs of chromosomes, how many chromosomal combinations are possible at metaphase I of meiosis?

A) B) C) D) E)

26)

The end result of meiosis in animals is ______.

A) B) C) D) E)

27)

25 100,000 9,765,625 32 1024

two diploid cells two haploid cells four diploid cells four haploid cells None of the answers are correct.

Oogenesis is a gametogenic process involving ________ that produces _______.

A) B) C) D) E)

Version 1

binary fission ; sperm cells mitosis ; egg cells meiosis ; egg cells meiosis ; sperm cells mitosis ; sperm cells

7

28) In plants, the haploid generation is called the ______ and the diploid generation is called the __________.

A) B) C) D)

29)

In plants, spores are produced by the process of __________.

A) B) C) D) E)

30)

male gametophyte female gametophyte male sporophyte female sporophyte

In a plant, which of the following is triploid (3n)?

A) B) C) D) E)

32)

spermatogenesis meiosis mitosis binary fission oogenesis

A pollen grain in a plant represents the ________.

A) B) C) D)

31)

sporophyte ; spermatogenesis gametophyte ; sporophyte sporophyte ; gametophyte oogenesis ; gametophyte

Pollen grain Embryo sac Seed Endosperm None of theses choices are correct.

Which microtubule type is paired to its correct function?

Version 1

8

A) B) C) D)

33)

Polar microtubules - positioning of the spindle apparatus Aster microtubules - positioning of the spindle apparatus Kinetochore microtubules - separate the poles Polar microtubules - bind kinetochore to centromere

The chromosomal theory of inheritance was first proposed by ___________.

A) B) C) D)

Mendel Boveri and Sutton Darwin and Mendel Weismann and Boveri

34) In a species of turtles you are studying, you find that when eggs are incubated at a low temperature, the hatched turtle will be male. Eggs incubated at a high temperature yield females, and intermediate temperatures lead to both male and female offpsring. This mode of sex determination is most similar to that in __________.

A) B) C) D)

insects birds bees alligators

35) A male produced from an unfertilized haploid egg is an example of what type of sex determination system?

A) B) C) D) E)

Version 1

X-Y Z-W X-O Haplo-diploid None of the answers are correct

9

36) In several mammals, including some rat and shrew species, the presence of two X chromosomes means the animal will be a female, whereas having just one X chromosome dictates maleness. This mode of sex determination is most similar to that in __________.

A) B) C) D)

other mammals insects bees birds

37) You are studying a type of cell that you don't know much about. You want to determine what organism the cell comes from. You decide to watch cell division in this cell using the appropriate cell biology tools. After some experimentation, you determine that cytokinesis in this cell is sensitive to myosin inhibitors. You are likely studying a/an __________.

A) B) C) D)

plant cell animal cell bacterial cell cell type that has not been previously studied

38) The process where two gametes fuse with each other in the process of fertilization to begin the life of a new organism is called __________.

A) B) C) D) E)

sexual reproduction gametogenesis asexual reproduction X-linked inheritance multicellularity

39) You are studying a new species of plant similar to Mendel's pea plants. You are specifically interested in two genes that are located on two different chromosomes. In this plant, the gene for height has two alleles, T (tall) and t (short). The gene for leaf color has two alleles P (purple) and p (pink). What meiotic products do you expect from diploid cells that are homozyous for the tall allele and heterozygous for the leaf color alleles?

Version 1

10

A) B) C) D)

An equal number of Tp, tP, tp, and TP gametes An equal number of TP and Tp gametes An equal number of TP and tp gametes 2 TP gametes for every 1 Tp gamete

40) You are performing a fruit fly cross similar to those that Morgan performed.

Unfortunately, you forgot to write down the parents of your cross. You count the progeny, and find you have 40 red-eyed males, 80 red-eyed females, and 40 white-eyed males. Assuming that all genotypes from this cross should have equal survival rates, what are the genotypes of the parent flies?

A) B) C) D)

XwY and Xw+Xw+ XwY and Xw+Xw Xw+Y and Xw+Xw Xw+Y and XwXw

41) Zip1 is a protein in yeast that is required for synaptonemal complex formation. Assuming synaptonemal complexes are required for meiosis in yeast, where do you predict thatcells lacking Zip1 will arrest (stop progressing through meiosis)?

A) B) C) D) E)

Prometaphase of meiosis I Metaphase of meiosis I Metaphase of meiosis II Between the zygotene and pachytene stages Diakinesis

42) Vincristine is a cancer chemotherapy drug that binds to tubulin dimers, thereby inhibiting assembly of microtubules. Where do you predict that vincristine stops the cell cycle?

Version 1

11

A) B) C) D)

S phase Prophase Metaphase Telophase

43) The yeast Saccharomyces cerevisiae produces haploid cells of two mating types, a and α, which are morphologically similar. Cells of opposite mating types can mate. Saccharomyces cerevisiae is a/an ___________ species.

A) B) C) D)

isogamous heterogamous prokaryotic asexual

44) A diploid organism that you are studying has 17 pairs of chromosomes. How many total chromosomes are found in a somatic cell from this organism? A sperm cell? An egg cell?

A) B) C) D)

17; 16; 16 17; 17; 17 34; 17; 34 34; 17; 17

45) Cytokinesis in animals occurs through the formation of a ______, whereas in plants a ______ forms.

A) B) C) D)

Version 1

cleavage furrow; cell plate cell plate; cleavage furrow cleavage furrow; kinetochore kinetochore; cell plate

12

46) An organized structure composed of DNA and proteins in living cells that contains hereditary information in the form of genes is called a _____.

A) B) C) D) E)

chromosome karyotype centromere centrosome kinetochore

47) Lutinos are considered the albino version of the green series of parakeets. A lutino features lush, buttercup-yellow feathers on the body and head, silver-white cheek patches and paler yellow coloring on the tail and primary flight feathers. The lutino phenotype is inherited in a sex-linked recessive manner, with the green (ZB) allele being dominant to the lutino (Zb) allele.

Which of the following crosses would result in 50% of the offspring being lutino females?

A) B) C) D) E)

48)

Z BZ B × Z BW Z BZ B × Z bW Z bZ b × Z BW Z BZ b × Z BW Z BZ b × Z bW

Of just the following events listed, which would occur first during mitosis?

A) B) C) D) E)

The microtubules of the spindle fiber attach to the kinetochore.

Sister chromatids separate and head towards opposite poles of the cell.

The chromosomes line up in the center of the cell.

The nuclear membrane reforms around the chromosomes.

Separated sister chromatids are considered independent chromosomes.

49) Which of the following events would be the next to occur upon conclusion of prometaphase?

Version 1

13

A) B) C) D) E)

Version 1

The chromosomes line up along the center of the cell.

Sister chromatids separate and head towards opposite poles of the cell.

The nuclear membrane reforms around the chromosomes.

The microtubules of the spindle fiber attach to the kinetochore.

Separated sister chromatids are considered independent chromosomes.

14

Answer Key Test name: Chap 03_7e 1) [A, B, D] 2) [A, B] 3) [A, D] 4) B 5) D 6) D 7) C 8) B 9) D 10) B 11) C 12) C 13) B 14) C 15) E 16) D 17) B 18) B 19) A 20) C 21) B 22) C 23) B 24) D 25) D 26) D Version 1

15

27) C 28) B 29) B 30) A 31) D 32) B 33) B 34) D 35) D 36) B 37) B 38) A 39) B 40) C 41) D 42) C 43) A 44) D 45) A 46) A 47) C 48) A 49) A

Version 1

16

CHAPTER 4 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Male-pattern baldness is solely inherited an autosomal dominant manner in humans. ⊚ ⊚

2)

In an epistatic interaction, the genes must be located on the same chromosome. ⊚ ⊚

3)

true false

Typically, a recessive allele increases the expression of a functional protein. ⊚ ⊚

4)

true false

true false

Human blood groups are determined by antigens on the surface of red blood cells. ⊚ ⊚

true false

5) Incomplete penetrance indicates that individuals who possess a dominant trait always express the trait. ⊚ ⊚

6)

true false

Variable expressivity means that the phenotype of a trait can vary between individuals. ⊚ ⊚

true false

7) Paralogs are often functionally redundant and can compensate for the loss of either of the paralogs in a set.

Version 1

1

⊚ ⊚

true false

8) In codominance, both alleles make functional gene products which are expressed simultaneously. ⊚ ⊚

true false

9) In sex influenced traits, both sexes can express the trait, depending on their genotype, but in sex limited inheritance a particular sex can only have one phenotype for the trait in question. ⊚ ⊚

true false

10) In the white spotting coat pattern,portions of an animal’s fur lack pigmentation. Anallele of the gene MITF that results in its reduced expression confers the white spotting phenotype due to an increased number of melanocytes. ⊚ ⊚

Version 1

true false

2

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

11) The pedigree below shows the inheritance pattern for one gene involved in eye color within a particular family. The loss-of-function, recessive allele affects the amount of melanin in the eye, but one copy of a functional allele results in brown eyes. The loss-of-function, recessive allele is not rare within the population. Those with filled in circles and squares have lighter colored eyes. Identify all of the individuals who must be carriers in the pedigree below.

A) II-1 B) II-2 C) II-3 D) II-4 E) III-1 F) III-2 G) III-3 H) III-4 I) III-5

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

12) Genes that are not required for survival, but are likely to be beneficial to the organism, are called _________.

Version 1

3

A) B) C) D) E)

essential genes lethal alleles semilethal alleles nonessential genes conditional lethal alleles

13) Temperature-sensitive alleles that kill an organism only in a particular temperature range are examples of _____.

A) B) C) D) E)

essential genes lethal alleles semilethal alleles nonessential genes conditional lethal alleles

14) The allele that causes Huntington disease in humans is an example of a(n) _______ that exerts its effects later in life.

A) B) C) D) E)

lethal allele epistatic allele semilethal allele recessive allele environmental effect

15) A heterozygote possesses a phenotype that is intermediate between the homozygous dominant and homozygous recessive phenotypes. This is most likely an example of ________.

A) B) C) D)

Version 1

lethal alleles incomplete dominance gene dosage sex-influenced inheritance

4

16) In four-o'clock plants, red flower color is dominant to white flower color. However, heterozygous plants have a pink color. If a pink-flowered plant is crossed with a white-flowered plant, what will be the phenotypic ratios of their offspring?

A) B) C) D) E)

¼ red, ½ pink, ¼ white All pink All white ½ pink, ½ white ½ red, ½ pink

17) The coat characteristics of arctic foxes and Siamese cats, where proteins in the extremities function differently than in other parts of the body, is an example of _________.

A) B) C) D) E)

incomplete dominance multiple allele systems semilethal alleles temperature-sensitive allele None of the answers are correct

18) In rabbits, full coat color ( c) is the dominant trait. A second allele, chinchilla ( cch) is recessive to full coat color. Himalayan coat color ( ch) is recessive to chinchilla and full coat colors, and albino ( c) is recessive to all coat colors. If two chinchilla rabbits mate, what coat color is not possible in their offspring?

A) B) C) D) E)

Full coat color Chinchilla coat color Himalayan coat color Albino coat color All coat colors are possible

19) In human blood groups, the fact that an individual can have an AB blood type is an example of ___________.

Version 1

5

A) B) C) D) E)

incomplete dominance incomplete penetrance sex-influenced trait temperature-sensitive conditional allele codominance

20) An individual with type A blood and an individual with type B blood mate and have offspring. What blood type is not possible in their offspring?

A) B) C) D) E)

Type O blood Type A blood Type B blood Type AB blood All blood types are possible

21) At the molecular level, type A and type B blood differ in which of the following characteristics?

A) B) C) D)

The antigens present on the surface of the red blood cells The type of sugar found in each type The antibodies that are generated against the other type of blood All of the answers are correct

22) For a certain trait, a heterozygous individual has a selective advantage as compared to a homozygous dominant or homozygous recessive individual. This is called ________.

A) B) C) D) E)

Version 1

codominance incomplete dominance overdominance incomplete penetrance multiple allele systems

6

23) Humans homozygous for the sickle cell allele have sickle cell anemia. A human that is heterozygous for the sickle cell allele is an example of _____________.

A) B) C) D)

codominance incomplete penetrance heterozygous advantage multiple allele systems

24) At the molecular level, which of the following best explain heterozygous advantage and overdominance?

A) A heterozygous individual can produce more varieties of homodimer proteins B) The alleles produce two different proteins with slightly different functions C) The proteins produced by the alleles may provide a broader range of environmental tolerance, such as temperature ranges D) Infectious organisms may recognize only a specific functional protein E) All of the answers are possibilities

25) An individual carries the allele for polydactyly, a dominant trait, but is phenotypicallynormal. This is an example of __________.

A) B) C) D) E)

26)

simple Mendelian inheritance incomplete dominance incomplete penetrance codominance gene dosage

If a geneticist describes a trait as being 70% penetrant, what would they mean?

Version 1

7

A) B) C) D)

27)

Individuals with the trait show variation in expression.

It is lethal in 30% of the individuals who have the trait.

Only 70% of the individuals who carry the allele(s) for a trait express the trait.

The trait is present in 70% of the population.

Phenylketonuria in humans is an example of __________.

A) B) C) D)

incomplete penetrance codominance an environmentally-influenced trait incomplete dominance

28) If an autosomal allele is dominant in one sex and recessive in another, it is an example of ___________.

A) B) C) D)

sex-limited inheritance sex-influenced inheritance incomplete dominance simple Mendelian inheritance

29) A woman who is heterozygous for an allele that results in X-linked pattern baldness marries a man who is nonbald. Which of the following would be true of their offspring?

A) B) C) D) E)

30)

All would be bald All of the females would be nonbald, all males would be bald All of the females would be nonbald, ½ of the males would be bald ½ of females would be bald, and ½ of the males would be bald All would be nonbald

A paralog ____________.

Version 1

8

A) B) C) D) E)

31)

The interaction of two genes to produce a phenotype was first described by __________.

A) B) C) D) E)

32)

is found for every gene in mammals is only found on the X but not the Y chromosome can explain the lack of phenotype for a gene knockout cannot be mutated has the same DNA sequence as the original duplicated gene

Morgan and Bridges Mendel Darwin Bateson and Punnett None of the answers are correct

Epistasis is _______________.

A) B) C) D) E)

another term for overdominance when one gene can mask the expression of a second gene a trait that is only expressed in one sex of the species when two dominant alleles can be expressed in the same individual None of the answers are correct

33) In a dihybrid cross of two heterozygous individuals, you expect a 9:3:3:1 phenotypic ratio in the offspring, but observe a ratio of 9:7. What is the most likely explanation?

A) B) C) D) E)

Version 1

Codominance It is a sex-limited trait Simple Mendelian inheritance Incomplete penetrance Epistatic interaction of the two genes

9

34)

Which of the following is not correct concerning epistatic interactions?

A) They can be associated with enzymatic pathways.

B) They produce variations in the expected 9:3:3:1 ratio of a dihybrid cross.

C) They can result when a gene at one locus masks the expression of a gene at a different locus.

D) They always result in a 9:7 ratio of a dihybrid cross.

E) They are due to gene interactions.

35) The production of wild-type offspringfrom a cross between parents that both display the same recessive phenotype illustrates the genetic phenomenon of _______.

A) B) C) D) E)

36)

simple recessive alleles incomplete penetrance complementation gene dosage a spontaneous mutation

The multiple effects of a single gene on the phenotype of an organism is called _______.

A) B) C) D) E)

epistasis penetrance expressivity overdominance pleiotropy

37) A ______ allele is the most prevalent allele in a population and usually encodes a protein that is made in the proper amount and functions normally.

Version 1

10

A) B) C) D) E)

38)

loss-of-function mutant wild-type gain-of-function lethal

In overdominance, the _______ genotype is beneficial over the _______ genotypes.

A) B) C) D) E)

heterozygous, homozygous homozygous, heterozygous homozygous dominant, homozygous recessive homozygous recessive, homozygous dominant incomplete dominant, codominant

39) In cattle, the presence or absence of scurs follows a sex-influenced pattern of inheritance.

A heterozygous male has _______ and a heterozygous female has _______ .

A) B) C) D)

no scurs, no scurs no scurs, scurs scurs, scurs scurs, no scurs

40) If a combination of two or more genes is required to produce a specific trait, it is called a(n) _______.

A) B) C) D) E)

Version 1

overdominance simple mendelian trait sex-influenced trait sex-linked trait gene interaction

11

41) Coat color in rodents involves a gene interaction between two genes (A and C) that produces three phenotypes and involves________.

A) B) C) D) E)

simple recessive alleles incomplete penetrance a gene modifier effect gene dosage a spontaneous mutation

42) The presence of a group of antigens that determine blood type occurs as a result of a/an ____________.

A) B) C) D)

semilethal allele sex-linked trait multiple allele system incomplete dominance

43) Eosin,white, and red (wild type) are allallelesof the same gene white ( w) ,located on the X chromosome, where red is dominant to white. Eosin is a pale orange color. The expression of the eosin allele depends on the number of copies present. Females homozygous for the eosin allel have eosin eyes. Females heterozygous for the eosin and white alleles have light-eosin eyes.

Females heterozygous for the red and eosin alleles have red eyes. Males that have a single copy of the eosin allele have eosin eyes. If an eosin-eyed male Drosophila is crossed to a homozygous red-eyed female, what will be the phenotype of their offspring?

A) B) C) D)

Version 1

All offspring will have red eyes.

All males will have light-eosin eyes and all females will have eosin eye All females will have red eyes, all males will have light-eosin eyes.

All flies will have white eyes.

12

44) The pedigree below traces a trait through a family. Filled in circles and square show affected individuals. Theinheritance of this trait by individual III-3 exemplifies ______.

A) B) C) D)

incomplete dominance codominance pseudoautosomal inheritance X-linked inheritance

45) Heavy metals, such as copper, are required for proper development. However, if too much copper is present it can lead to developmental defects. A scientist was interested in studying the developmental defects that could occur at various concentrations of copper.

Genetically identical organisms were grown in 6 different concentrations of copper. This experiment evaluates a/an _____________.

A) B) C) D)

epistasis dominant trait recessive trait norm of reaction

46) Achondroplasia is a type of dwarfism caused by the presence of a dominant allele (A).

However, the presence of two dominant alleles is lethal. What is the probability that two individuals with achondroplasia have a non-dwarf child?

Version 1

13

A) B) C) D) E)

1/3 1/2 1/4 2/3 3/4

47) The pedigree below shows the inheritance pattern of a rare genetic disorder that is inherited in anX-linked dominant manner through one family. The filled in circles and squares show affected individuals. What is the probability of individual III-2 being born male and affected?

A) B) C) D)

Version 1

1/2 1/3 1/4 0

14

48) The pedigree below shows the inheritance pattern of a rare genetic disorder that is inherited in anX-linked dominant manner through one family. The filled in circles and squares show affected individuals.What is the probability of individual III-2 being born female and

affected?

A) B) C) D)

1/2 1/3 1/4 0

49) Gout, a type of inflammatory arthritis, is a sex-influenced trait, where a loss-of-function allele of an autosomal gene is dominant in males, but recessive in females. If a heterozygous male with gout and a heterozygous female without gout have children, what proportion of the male offspring will not have gout?

A) B) C) D) E)

0% 25% 50% 75% 100%

50) You identify a rare purple plumed parrot. When you cross the parrot to a true breeding white parrot, you get white and purple parrots. When you cross two purple parrots you get white parrots and purple parrots. Which of the following best explains this result?

Version 1

15

A) B) C) D)

The purple allele is lethal in the homozygous state.

The purple allele is lethal in the heterozygous state.

White is dominant to purple.

The white allele is lethal in the homozygous state.

51) You cross a rose comb chicken with a pea comb chicken and get all walnut comb progeny. You then cross two of the walnut combed chickens from the F1 generation and get 9 walnut combs: 3 rose combs: 3 pea combs : 1 single comb.

Which of the following would best explain these results? Underline means any allele could be present; e.g., R_ could be RR or Rr.

A) B) C) D) E)

walnut = RrPp, single = RRPP, rose = R_ pp, pea = rrP_ walnut = R_ P_, single = rrpp, rose = R_pp, pea = rrP_ walnut = rrpp, single = rrP_, rose = R_P_, pea = R_pp r is epistatic to P. P is epistatic to r .

52) Two white-flowered true-breeding plants with genotypes AAbb and aaBB are crossed. All of the F1 are AaBb and have purple flowers. Select the molecular pathway that will result in purple flowers in the F1.

Version 1

16

A)

B)

C)

D)

Version 1

17

Answer Key Test name: Chap 04_7e 1) FALSE 2) FALSE 3) FALSE 4) TRUE 5) FALSE 6) TRUE 7) TRUE 8) TRUE 9) TRUE 10) FALSE 11) [B, C, D, E, F] 12) D 13) E 14) A 15) B 16) D 17) D 18) A 19) E 20) E 21) D 22) C 23) C 24) E 25) C 26) C Version 1

18

27) C 28) B 29) C 30) C 31) D 32) B 33) E 34) D 35) C 36) E 37) C 38) A 39) D 40) E 41) C 42) C 43) A 44) C 45) D 46) A 47) D 48) A 49) B 50) A 51) B 52) B

Version 1

19

CHAPTER 5 CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

1) In which of the following organisms does an X chromosome not get inactivated? Select all that apply.

A) B) C) D)

Placental mammals Drosophila C. elegans Marsupials

2) If a lethal allele is found on an X chromosome, in which organisms is it predicted that there will be a distorted ratio (not 1:1) of males to females in adults if a heterozygous female is mated to a normal male? Select all that apply.

A) B) C) D)

Drosophila Humans Caenorhabitis Mice

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

3) Which of the following is primarily responsible for the maternal effect as seen in snail shell coiling?

A) B) C) D)

Sperm cells Oocytes Nurse cells Placenta

4) In snail shell coiling, which of the following is responsible for the phenotype of the offspring?

Version 1

1

A) B) C) D)

5)

Who originally identified a highly condensed structure in the interphase of nuclei?

A) B) C) D)

6)

Paternal Maternal Both maternal and paternal Neither allele is expressed

Which nucleotide modification occurs in imprinting a gene?

A) B) C) D)

8)

Lyon Barr Ohno Morgan

In the Igf2 gene, which allele is expressed?

A) B) C) D)

7)

Mother's phenotype Father's phenotype Mother's genotype Father's genotype

Acetylation Nitration Phosphorylation Methylation

Which diseases are associated with imprinting?

Version 1

2

A) B) C) D)

Angelman Syndrome LHON Alzheimer's Disease All of these choices are are correct.

9) In which cells do erasure and re-establishment of nucleotide imprinting modifictions typically not occur?

A) B) C) D)

10)

Where is extranuclear DNA located in mammalian cells?

A) B) C) D)

11)

Endoplasmic reticulum Mitochondria Ribosome Plasma membrane

What type of inheritance is observed with extranuclear DNA? A) B) C) D) E)

12)

Nurse cells Sperm cells Oocytes Somatic cells

Mendelian inheritance Sex-linked inheritance Paternal inheritance Maternal inheritance Maternal effect

What is a disease associated with extra nuclear inheritance?

Version 1

3

A) B) C) D)

13)

What is thought to be the origin of mitochondria and chloroplasts?

A) B) C) D)

14)

Angelman Syndrome Prader-Willi Syndrome LHON Muscular Dystrophy

Cyanobacteria for mitochondria, purple bacteria for chloroplasts Purple bacteria for mitochondria, fungi for chloroplasts Purple bacteria for mitochondria, cyanobacteria for chloroplasts Algae for mitochondria, cyanobacteria for chloroplasts

Who is largely responsible for proposing the endosymbiosis theory?

A) B) C) D)

Schimper, Wallin, Margulis Lyon, Margulis, Schimper Schimper, Wallin, Barr Barr, Lyon, Margulis

15) In which type of inheritance does a change in phenotype of the offspring not rely on a change in the DNA sequence?

A) B) C) D)

16)

Maternal inheritance Epigenetic inheritance Maternal effect Paternal inheritance

How many Barr bodies would an individual with a XXY genotype possess?

Version 1

4

A) B) C) D)

17)

The coat color of calico cats is a result of __________.

A) B) C) D)

18)

X-inactivation genomic imprinting maternal inheritance extranuclear inheritance

Monoallelic expression is associated with which of the following?

A) B) C) D)

20)

maternal inheritance X-inactivation imprinting extranuclear inheritance

The Lyon hypothesis attempts to explain the molecular mechanism of __________.

A) B) C) D)

19)

0 1 2 None of these choices are correct.

X-inactivation Genomic imprinting Maternal inheritance Extranuclear inheritance

Which of the following is false regarding human mtDNA?

Version 1

5

A) B) C) D)

21)

It is around 17,000 bp in length.

It is a linear chromosome.

Multiple copies exist in each mitochondria.

It mostly contains rRNA and tRNA genes, and genes for mitochondrial function.

Which of the following categories of genes is typically NOT encoded in cpDNA? A) B) C) D)

Genes encoding rRNA. Genes encoding tRNA. Genes for photosynthetic pathway enzymes.

Genes encoding nuclear proteins.

22) The inheritance of leaf pigmentation in the four-o'clock plant Mirabilis jalapa is an example of __________.

A) B) C) D)

maternal effect maternal inheritance epigenetic inheritance imprinting

23) In maternal effect, the __________ of the mother determines the __________ of the offspring.

A) B) C) D)

phenotype; genotype genotype; phenotype rRNA; tRNA imprinting; genotype

24) A modification that occurs to a nuclear gene that alters gene expression without modifying the DNA sequence is called __________ inheritance.

Version 1

6

A) B) C) D) E)

extranuclear cytoplasmic maternal effect epigenetic nuclear

25) Dosage compensation offsets the problems associated with differences in the number of __________ chromosomes in many species.

A) B) C) D) E)

cytoplasmic autosome sex extranuclear mitochondrial

26) The inheritance patterns of genetic material that is not contained in the nucleus of the cell is called __________.

A) B) C) D) E)

27)

extranuclear inheritance maternal effect imprinting nuclear epigenetic

mtDNA stands for __________ and cpDNA stands for __________.

A) B) C) D) E)

Version 1

extranuclear DNA; cytoplasmic DNA maternal DNA; paternal DNA marked DNA; copied DNA nuclear; cytoplasmic mitochondrial DNA; chloroplast DNA

7

28)

Heteroplasmy is associated with inheritance patterns involving __________.

A) B) C) D) E)

29)

nuclear paternal DNA chloroplasts ribosomes imprinted

If the sperm cell contributes mitochondria to the oocyte, it is called __________.

A) B) C) D) E)

paternal leakage maternal leakage paternal inheritance mitochondria imprinting

30) A symbiotic relationship where one organism lives inside another species is called __________.

A) B) C) D)

cytoplasmic inheritance heteroplasmy paternal leakage endosymbiosis

31) What would be the genotype of the mother of a female snail that has a Dd genotype and a shell with a left hand twist?

Version 1

8

A) dd B) DD C) Dd D) Cannot tell since the shell twist phenotype of any offspring depends on the genotype of the father as well as the mother.

32) What is the geneotype of the father for a snail that has the genotype Dd and has a left hand twist shell?

A) B) C) D)

dd Dd DD It cannot be determined.

33) If a snail that has a right hand twist and is DD is mated to a snail that has a left hand twist and is dd what is the expected ratio of progeny?

A) B) C) D)

34)

3 left hand to 1 right hand 3 right hand to 1 left hand It depends on which snail is female and which is male.

1 left hand to 1 right hand

What is the phenotype of the father of a woman who has Prader-Willi syndrome?

A) The father has Prader-Willi syndrome.

B) The father could have two normal copies of chromosome 15 and therefore wouldn't have either syndrome.

C) The father has either Prader-Willi or Angelman syndrome depending on the parent from which he inherited his deleted chromosome 15.

D) The father has Angleman syndrome.

Version 1

9

35) A man with Prader-Willi syndrome has children with a woman that has Angelman syndrome what is the expected ratio of progeny?

A) B) C) D)

1 Prader-Willi : 1 Angelman : 2 normal 1 Prader-Willi : 1 Angelman : 1 normal : 1 both Angelman and Prader-Willi 1 normal : 1 both Angelman and Prader-Willi 1 Prader-Willi (all males) : 1 Angelman (all female)

36) Yeast can reproduce either by mitosis or they undergo a mating process whereby two haploid cells fuse to make a diploid cell and mix their cytoplasms before they undergo meiosis to form spores. There are several yeast strains that are known as petites that grow more slowly than their normal counterparts and they have mitochondria that perform more poorly than normal mitochondria. Some petite strains and normal yeast cell matings result in the haploid progeny being all normal and some result in their being a 1:1 ratio of normal to petite haploid progeny.

What is the explanation for this?

A) Petite mutations all arise in mitochondrial genes.

B) Petite mutations all arise from mutations in nuclear genes.

C) Some petite mutations occur in nuclear genes and some occur in mitochondrial genes.

D) Petite progeny all arise from random mutations.

37) If a man who has a syndrome has children with a woman who is normal and the children have a 1syndromic : 1 normal ratio what can be concluded about the mode of inheritance?

Remember that most syndromes are quite rare so it can be assumed that those with the syndrome are heterozygotes if the gene is located on a nuclear chromosome.

A) B) C) D)

38)

It is extranuclear.

It is maternal effect.

It is imprinting.

It has a Mendelian pattern consistent with dominant/recessive alleles.

Which of the following is an example of epigenetic inheritance?

Version 1

10

A) B) C) D)

Version 1

Expression of the Igf-2 gene based on methylation of the ICR and DMR regions Inheritance of flower color as studied by Mendel Leaf coloration based on mitochondrial inheritance Snail shell twist patterns

11

Answer Key Test name: Chap 05_7e 1) [B, C] 2) [A, B, C, D] 3) C 4) C 5) B 6) A 7) D 8) A 9) D 10) B 11) D 12) C 13) C 14) A 15) B 16) B 17) B 18) A 19) B 20) B 21) D 22) B 23) B 24) D 25) C 26) A Version 1

12

27) E 28) C 29) A 30) D 31) A 32) D 33) C 34) B 35) B 36) C 37) C 38) A

Version 1

13

CHAPTER 6 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) The process of recombination may rarely occur during mitosis. ⊚ ⊚

2)

true false

A genetic linkage map indicates that precise distance between two genes of interest. ⊚ ⊚

true false

3) Genetic linkage is the rearrangement of alleles that is achieved by the process of crossing over. ⊚ ⊚

true false

4) Map distance is equal to the number of recombinant offspring divided by the total number of nonrecombinant offspring. ⊚ ⊚

true false

5) Following crossing-over, chromosomes with genetic combinations that resemble the parents' chromosomes are called nonrecombinant. ⊚ ⊚

6)

true false

A map unit or centimorgan is equal to a 10% recombination frequency. ⊚ ⊚

Version 1

true false

1

7) Map distances above 50 are considered unreliable due to the occurrence of doublecrossovers between the genes. ⊚ ⊚

8)

true false

The locus is the physical place of a gene on a chromosome. ⊚ ⊚

true false

9) The percentage of recombination associated with independent assortment should approximate 50%. ⊚ ⊚

true false

10) The genotype hsp+ HSP- is something that you could easily expect to find in the fungus Neurospora crassa. ⊚ ⊚

11)

If two loci are extremely linked, then no recombination is expected. ⊚ ⊚

12)

true false

true false

Stern was able to demonstrate crossing over by using the X chromosomes in corn. ⊚ ⊚

true false

13) Gene mapping is useful because a genetic counselors can use a genetic map to determine if an individual will express a particular allele of a gene.

Version 1

2

⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

14) Which of the following defines the principle of linkage? Check all that apply.

A) Two or more genes that are physically connected on a chromosome.

B) Genes that are transmitted to the next generation as a group.

C) The process by which genetic information is exchanged between homologous chromosomes.

15) Assume that genes C and D are located on the same chromosome. On one chromosome, alleles C and D are found, while the homolog contains alleles c and d. Which of the following would be evidence of a recombination event? Check all that apply.

A) B) C) D)

Alleles C and D together on one chromosome.

Alleles c and d together on one chromosome.

Alleles C and d together on one chromosome.

Alleles c and D together on one chromosome.

16) Select each true statement regarding sexual reproduction in ascomycetes. Check all that apply.

A) In fungi likeNeurospora crassa, the diploid structures are called spores.

B) The end result of meiosis in fungi is a tetrad of spores.

C) A fungal reproductive structure that contains all of the products of a single meiotic division is called the ascus.

D) In fungal gene mapping, the abbreviation NPD stands for new parental ditype.

E) An ascus that contains two parental spores and two nonparental spores is called a tetratype.

Version 1

3

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

17) The first observational evidence that genes may be inherited together rather than by simple Mendelian inheritance was provided by __________.

A) B) C) D) E)

Mendel Morgan and Bridges Bateson and Punnett Boveri and Sutton None of these choices are correct.

18) Experimental evidence that crossing over occurs between the X chromosomes of female Drosophila was provided by __________.

A) B) C) D)

Morgan Punnett Darwin Bateson

19) Which of the following statistical tests is used to determine if two genes are linked or assorting independently?

A) B) C) D)

Sum rule Binomial expansion Product rule Chi-square test

20) In a chi-square test to determine if two genes are linked or assorting independently, what is the default (null) hypothesis that is tested?

Version 1

4

A) B) C) D) E)

The genes are linked to one another.

The genes are assorting independently.

The genes are located on the sex chromosomes.

No crossing over occurs.

The distance between the genes is very small.

21) The visual proof that chromosomes exchange pieces of information during crossing over was provided by __________.

A) B) C) D)

22)

Bateson and Punnett Morgan and Bridges Creighton and McClintock Watson and Crick

Twin spotting provides evidence of what genetic event?

A) B) C) D) E)

Meiotic recombination Mitotic recombination Linkage Mutation Biological evolution

23) An organism that contains patches of tissue that vary for a specific characteristic such as a pigment, can be an example of which of the following?

A) B) C) D)

Version 1

Linkage Meiotic recombination Mitotic recombination Translocations

5

24) Crossing over is more likely to occur between genes that are __________ on a chromosome.

A) close together B) far apart

25) A testcross is always performed between the individual that is heterozygous for the genes to be mapped and an individual who is ____________.

A) B) C) D)

heterozygous for the genes homozygous dominant for the genes homozygous recessive for the genes lacking the genes

26) While mapping two genes in Drosophila, you observe 30 recombinants among 200 total offspring. What is the distance between these genes?

A) B) C) D)

27)

30 map units 6.67 map units 200 map units 15 map units

A map distance of 23.6 between two genes indicates which of the following?

A) B) C) D)

The genes are 23.6 millimeters apart.

There are 23.6 other genes between the two genes of interest.

23.6% of the offspring exhibit recombination between the two genes.

23.6% of the offspring do not survive.

28) In a mapping experiment with three linked genes, which phenotype should occur most often in the F2 offspring?

Version 1

6

A) B) C) D)

Parental phenotypes.

Phenotypes of individuals with single crossover events.

Phenotypes of individuals with double crossover events.

All of the phenotypes should occur equally in the F2 generation.

29) The middle gene of a three gene mapping experiment can be determined by examining the genotypes of which of the following?

A) Offspring that resemble the parents.

B) Offspring that exhibit a single crossover event.

C) Offspring that exhibit double crossover events.

30) In a given mapping experiment, you expect that incidence of double crossovers is 3.5%, but you only observe 2.5%. This can be explained by ________________.

A) B) C) D)

interference linkage coincidence segregation

31) You have calculated the interference value for a given mapping experiment to be 30%.

What does this mean?

A) B) C) D)

30% more double crossovers occurred than expected.

30% fewer double crossovers occurred than expected.

70% more double crossovers occurred than expected.

70% fewer double crossovers occurred than expected.

32) Which of the following is not one of the principles of linkage that Morgan obtained from his experiments?

Version 1

7

A) Genes that are on the same chromosome may be inherited together.

B) Crossing over exchanges pieces of chromosomes and creates new allele combinations.

C) The likelihood of crossing over occurring between two genes is dependent on the distance of the genes from one another.

D) Genes that are on the same chromosome are always transmitted together as a unit.

33) In humans, there are __________ autosomal linkage groups, plus a linkage group for each sex chromosome.

A) B) C) D)

23 46 22 92

34) Another name for a chromosome is a __________, since it contains genes that are often inherited together.

A) B) C) D)

35)

linkage group crossing over group genetic recombinant bivalent

Two genes that are located on the same chromosome are said to be __________.

A) B) C) D)

Version 1

physically linked recombinant parental-like nonparental-like

8

36) Creighton and McClintock worked with _______ and their model system to show that homologous chromosomes physically exchange genetic information during crossing over.

A) B) C) D)

fruit flies peas corn tobacco

37) In certain algae and in most ascomycete fungi, the nuclei in the cells present in the majority of their life cycle are in the __________ condition.

A) B) C) D)

diploid haploid triploid tetraploid

38) Which of the following procedures may be used to map genes in a fungi with an unordered tetrad ascus?

A) B) C) D) E)

Testcross Monohybrid cross Dihybrid cross Chi-square analysis Analysis of interference

39) The diploid garden pea plant has 14 chromosomes. The haploid fungus Neurospora crassa has 7 chromosomes. Neither organism has separate male and female individuals. Which of the following correctly identifies the number of linkage groups in each organism?

Version 1

9

A) B) C) D)

Garden pea has 14 linkage groups, and Neurospora has 7.

Garden pea has 7 linkage groups, and Neurospora has 7.

Garden pea has 8 linkage groups, and Neurospora has 8.

Gardent pea has 15 linkage groups, and Neurospora has 8.

40) The number of linkage groups in an organism with a single type of sex chromosome equals __________, where n equals the haploid number of autosomes.

A) B) C) D)

1n 2n +1 1n + 1 2n + 2

41) The number of linkage groups in a species that does not have sex chromosomes equals __________, wheren equals the haploid number of autosomes.

A) B) C) D)

1n 1n + 1 2n 2n + 2

42) The locus B on the X chromosome of a malaria-carrying mosquito shows a 49% recombination rate with respect to the locus M. Since a recombination rate of 50% is essentially indistinguishable from independent assortment, you might be tempted to look for a locus that falls between B and M. Before you decide to do all that work, you run a chi square test to determine the P value of your experiment. Which of the following P values would be most likely to tell you that you should accept the conclusion that locus B and locus M are, indeed, 49mu apart and that another locus is not necessary?

Version 1

10

A) B) C) D)

P = 0.45 P = 0.01 P = 0.005 P = 0.0007

43) In a mapping cross, you determine that the recombination frequency between theQ and P is 12% and betweenloci Q and L is 15%. If locus Q is in between loci P and L, then the recombination frequency between P and L should be approximately __________.

A) B) C) D)

3% 27% 50% 75%

44) You notice that in most biology and genetics textbooks, the authors show that Gregor Mendel used flower color as one of his pairs of traits. The purple flower phenotype is dominant to the white flower phenotype. However, if you go back to Mendel's experiments, you see that he actually studied seed coat color. The purple seed coat phenotype was dominant to the white seed coat phenotype. Mendel did note that plants with purple seed coats had purple flowers and plants with white seed coats had white flowers. Is the gene for seed coat color pleiotropic because it also affects flower color, or are the seed coat color gene and the flower color gene very closely linked? To find out the answer to this question, you assume that the genes for flower color and seed coat color are different genes, and your null hypothesis is that they assort independently.

You designate the flower color gene wf and the seed coat color gene sw. Plants that are WF__, SW___ have purple flowers and purple seed coats. Plants that are wf wf, ws ws have white flowers and white seed coats. You do the testcross WF wf, SW sw X wf wf, sw sw and collect 15,206 offspring. What result would tell you that the wf and sw loci are probably the same, pleiotropic locus?

A) One of the offspring had white flowers and purple seed coats.

B) About half of the offspring had purple flowers and purple seed coats, and all the rest had white flowers and white seed coats.

C) All of the offspring had purple flowers and purple seed coats.

D) None of the offspring had white flowers and white seed coats.

Version 1

11

45) If you want to determine how the alleles of different loci interact in their various combinations, it is best to have a system where you do not have to worry about dominance and recessiveness. Which of the following would represent a system where you do not have to worry about dominance and recessiveness?

A) B) C) D)

Homo sapiens Garden peas Drosophila melanogaster Chlamydomonas reinhardtii

46) Mitotic recombination occurs between homologous chromosomes. In which of the following would you not expect to encounter mitotic recombination?

A) B) C) D)

The fungus, Aspergillus nidulans Tobacco plants Homo sapiens Drosophila melanogaster

47) Pintail is a dominant trait in mice in which individuals present with shorter tails than their wildtype counterparts. Mice with the clasper phenotype displaywhole body tremor followed by clasping of the paws while suspended by the tail. A cross between a female mouse showing only the pintail phenotype and a male mouse showing only the clasper phenotype yields two offspring: a female mouse showing only the pintail phenotype and a wildtype male. Each trait is controlled by one gene, and the two genes are located 10 mu apart from one another on chromosome 4. What is the probability that an offspring produced by a mating of the two F1 progeny will show both traits?

A) B) C) D) E)

Version 1

0% 2.5% 5% 10% 25%

12

48) In Drosophila, the genes reduced (rd) bristles and withered (whd) wing are both found on chromosome 2, with their respective positions indicated on the chromosome map depicted below. A female with reduced bristles and normal wings was mated to a male with normal bristles and withered wings. All of the F1 offspring were phenotypically wild-type. What proportion of the progeny resulting from a testcross of an F1 female is expected to be

phenotypically wild-type?

A) B) C) D) E)

Version 1

0% 5% 10% 45% 100%

13

49) In Drosophila, the genes reduced (rd) bristles and withered (whd) wing are both found on chromosome 2. You have isolated a new recessive mutation in Drosophila that results in corrugated (corr) veins. χ2-analysis has revealed that corr is linked to the genes rd and whd on Chr. 2. You perform a three-point cross to determine the relative order of the three genes. Two pure-breeding mutant lines were crossed to produce an F1 female that is normal in appearance for all three traits. The phenotypes of 1000 progeny resulting from a testcross of an F1 female are summarized below.380withered, reduced 385 corregated 44 withered, corregated41 reduced 7 withered 8 corregated, reduced 65 wildtype70 withered, corregated, reduced Which gene is in the middle?

A) corr B) rd C) whd

50) In Drosophila, the genes reduced (rd) bristles and withered (whd) wing are both found on chromosome 2. You have isolated a new recessive mutation in Drosophila that results in corrugated (corr) veins. χ2-analysis has revealed that corr is linked to the genes rd and whd on Chr. 2. You perform a three-point cross to determine the relative order of the three genes. Two pure-breeding mutant lines were crossed to produce an F1 female that is normal in appearance for all three traits. The phenotypes of 1000 progeny resulting from a testcross of an F1 female are summarized below. 380 withered, reduced 385 corregated 44 withered, corregated41 reduced 7 withered 8 corregated, reduced 65 wildtype70 withered, corregated, reduced What is the distance between corr and whd?

A) B) C) D) E)

10 mu 15 mu 20 mu 25 mu 30 mu

51) In Drosophila, the linked genes black (b) body, reduced (rd) bristles, and withered (whd) wing are arranged on chromosome 2 as follows:b-2.5 mu--rd-----10 mu-----whdYou testcross a female heterozygous at all three loci with a homozygous recessive male and obtain 2000 testcross progeny. When the progeny are analyzed, you find 2 double-crossover offspring. What is the interference value shown by this cross?

Version 1

14

A) B) C) D) E)

Version 1

0.025 0.1 0.2 0.4 0.6

15

Answer Key Test name: Chap 06_7e 1) TRUE 2) FALSE 3) FALSE 4) FALSE 5) TRUE 6) FALSE 7) TRUE 8) TRUE 9) TRUE 10) FALSE 11) TRUE 12) FALSE 13) FALSE 14) [A, B] 15) [C, D] 16) [B, C, E] 17) C 18) A 19) D 20) B 21) C 22) B 23) C 24) B 25) C 26) D Version 1

16

27) C 28) A 29) C 30) A 31) B 32) D 33) C 34) A 35) A 36) C 37) B 38) C 39) B 40) C 41) A 42) A 43) B 44) B 45) D 46) A 47) B 48) B 49) B 50) D 51) E

Version 1

17

CHAPTER 7 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) During conjugation, one strand of the F factor DNA remains in the donor cell and one strand is transferred to the recipient cell. ⊚ ⊚

true false

2) The process of conjugation may introduce new alleles into the recipient strain, altering its genotype. ⊚ ⊚

3)

true false

A minute is the basic unit of map distance in bacterial conjugation studies. ⊚ ⊚

true false

4) An episome is a segment of bacterial DNA that can exist as a plasmid or be integrated into the bacterial chromosome. ⊚ ⊚

5)

true false

Competent cells are those used in studies of conjugation. ⊚ ⊚

true false

6) Acquired antibiotic resistance between two different species is an example of vertical gene transfer. ⊚ ⊚

Version 1

true false

1

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

7) What are the mechanisms by which bacteria preferentially take up DNA from individuals of the same species? Check all that apply.

A) A specific sequence in the species' DNA allows for uptake of DNA fragments that carry that sequence.

B) Peptides that are secreted by the bacteria reach a high concentration when members of the same species are close to one another and these peptides stimulate cells to produce competence proteins.

C) Some species require a specific calcium level for uptake and the levels of calcium are correlated with the number of bacteria in localized area.

8)

Select the true statements about conjugation. Choose all that apply.

A) B) C) D) E)

The bacteria must be in physical contact.

Strains called donor strains can transfer genetic information.

Donor strains can convert recipient strains into donor strains.

Bacteriophages are required.

Competent cells are used.

9) You are in a lab and are planning to grow bacteria with the genotype met- bio- thr- leuthi+on agar plates. What amino acids or vitamins must you include on the plates in order for this bacteria to grow? Check all that apply.

A) B) C) D) E)

Version 1

Methionine Biotin Threonine Leucine Thiamine

2

10) Among the plasmid types listed here, which two have the most direct relevance to human health?

A) B) C) D) E)

F factors R factors Degradative plasmids Col-plasmids Virulence plasmids

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

11) Which of the following is true regarding bacterial genetics?

A) Bacteria are usually diploid organisms.

B) Bacteria primarily reproduce sexually.

C) The patterns of inheritance in bacteria are studied using different mechanisms than eukaryotes.

D) Bacteria generally have linear chromosomes.

12)

Which of the following represents a mechanism of genetic transfer in bacteria?

A) B) C) D)

Transformation Transduction Conjugation All of these choices are correct.

13) Which of the following uses a bacteriophage as an intermediary for the genetic information?

Version 1

3

A) B) C) D)

Transformation Transduction Conjugation All of these choices are correct.

14) Which of the following mechanisms refer to when a bacteria assimilates genetic material (DNA) directly from the environment?

A) B) C) D)

Transformation Transduction Conjugation All of these choices are correct.

15) Which of the following mechanisms of genetic transfer utilizes a physical connection between two bacteria?

A) B) C) D)

Transformation Transduction Conjugation All of these choices are correct.

16) Which of the following mechanisms of genetic transfer was first observed by Lederberg and Tatum (1946) in Escherichia coli?

A) B) C) D)

17)

Transformation Transduction Conjugation All of these choices are correct.

Which mechanism of genetic transfer utilizes a sex pilus?

Version 1

4

A) B) C) D)

18)

What is a mechanism of genetic transfer that uses competent cells?

A) B) C) D)

19)

Transformation Transduction Conjugation All of these choices are correct.

Which of the following is correct concerning F factors?

A) B) C) D) E)

20)

Transformation Transduction Conjugation All of these choices are correct.

It may integrate into the host chromosome.

It stands for fertility factor.

It allows conjugation to occur.

F+ bacteria act as donor strains in conjugation.

All of these choices are correct.

A histidine, methionine auxotroph _________.

A) B) C) D) E)

can synthesize only histidine and methionine can only use histidine and methionine as nutrition sources cannot synthesize histidine and methionine is killed by histidine and methionine lacks proteins with histidine or methionine

21) The protein complex that initiates the process of conjugation following contact between two bacteria is called the _________.

Version 1

5

A) B) C) D)

origin of transfer T DNA relaxosome nucleoprotein

22) In conjugation the DNA that will be transferred from the donor cell to the recipient cell is __________.

A) B) C) D)

single-stranded double-stranded triple-stranded a mixture of single and double stranded

23) The enzyme that allows the reforming of a circular plasmid following conjugation is called _________.

A) B) C) D) E)

relaxosome relaxase F' factor nucleoprotein pili protein

24) The site on a plasmid that is digested, producing a single strand of DNA, to allow conjugation to occur is called the ____________.

A) B) C) D)

25)

origin of transfer relaxase nucleoprotein T DNA

Interrupted mating is defined as ____________.

Version 1

6

A) B) C) D)

26)

the inability of a bacteriophage to transfer genetic material a mechanism of transformation a process of asexual reproduction in bacteria a process by which conjugation is stopped using a blender

The process of interrupted mating may be used to do which of the following?

A) B) C) D)

Inhibit transduction Convert the recipient cell to F + Determine the relative position of bacterial genes Alter the genotype of the donor cell

27) The units of genetic distance derived from bacterial conjugation studies are called __________.

A) B) C) D) E)

seconds map units centimorgans recombination units minutes

28) During conjugation, one gene (A) is found to transfer to the recipient bacteria 26 minutes following the start of conjugation, while a second gene (M) is found to transfer 37 minutes following the start of conjugation. A third gene (T) transfers 45 minutes following the start of conjugation. Based on this information, which of the following is true?

A) B) C) D) E)

Version 1

The genetic distance between genes A and M is 11 minutes.

The genetic distance between genes A and T is 19 minutes.

The genetic distance between genes M and T is 8 minutes.

The order of the genes is A M T. All of these choices are correct.

7

29)

Who was the first to discover the process of natural transformation?

A) B) C) D)

30)

Which of the following conditions must be correct for transformation to occur?

A) B) C) D)

31)

Morgan Sturtevant Griffith Avery

Temperature Ionic conditions Correct nutrient balance All of these choices are correct.

Competence factors do which of the following?

A) B) C) D)

Allow the formation of a sex pilus.

Promote bacteriophages binding for transduction.

Allow DNA in the environment to bind to the cell surface.

Inhibit genetic transfer between donor and recipient cells.

32) A structure called a/an __________ allows the transfer of genetic information during conjugation.

A) B) C) D)

33)

F factor plasmid sex pilus transformation bridge

A cell with an F factor integrated into the bacterial chromosome is called __________.

Version 1

8

A) Hfr B) F+ C) conjugative plasmid

34) Which of the following matings would have the highest frequency of chromosomal gene transfer?

A) F + x F B) F' x F C) Hfr x F -

35) Small circular pieces of DNA that are not associated with the bacterial chromosome are called __________.

A) heteroduplex B) plasmids C) relaxosome

36) The general term for the process by which an organism incorporates genetic material from another organism and is not the offspring of that organism is called __________.

A) B) C) D) E)

Version 1

vertical gene transfer conjugation sexual reproduction binary fission horizontal gene transfer

9

37) In the experiment performed by Lederberg and Tatum bacteria of different genotypes had to be mixed together to obtain genetic transfer. However, Davis performed the experiment in a slightly different manner by separating cells with a filter incapable of allowing bacteria to pass.

What possibility did the experiment by Davis exclude that could have occurred by the protocol used by Lederberg and Tatum?

A) Transformation B) Conjugation C) Transduction

38)

Although there are several different types of plasmids they all __________.

A) conditions B) C) D)

39)

can induce a mating phenotype result in horizontal transfer make cells resistant to antibiotics

An Hfr strain is produced when __________.

A) B) C) D)

40)

can confer some kind of selective growth advantage depending on environmental

an F factor integrates into the E. coli chromosome an F factor leaves the E. coli chromosome an F factor is transferred to a new cell an F factor leaves the host chromosome and removes some of the host chromosome

What is the correct order for the steps in transduction?

Version 1

10

A) (1) Phage infects cell. (2) Phage transported DNA recombines with chromosome of new cell. (3) Host DNA digested into fragments. (4) Some phage accidentally carry host DNA fragment. (5) Phage infects new cell.

B) (1) Phage infects cell. (2) Phage transported DNA recombines with chromosome of new cell. (3) Host DNA digested into fragments. (4) Phage infects new cell. (5) Some phage accidentally carry host DNA fragment.

C) (1) Phage infects cell. (2) Host DNA digested into fragments. (3) Some phage accidentally carry host DNA fragment. (4) Phage infects new cell. (5) Phage transported DNA recombines with chromosome of new cell.

D) (1) Phage infects cell. (2) Phage transported DNA recombines with chromosome of new cell. (3) Some phage accidentally carry host DNA fragment. (4) Phage infects new cell. (5) Host DNA digested into fragments.

41)

Based on this graph, during which time period did did the % of S. aureusresistant to

methicillin increase the most?

A) B) C) D)

Version 1

1984-1985 1990-1991 1993-1994 1999-2000

11

42)

What is the approximate distance in minutes between the argR and pyrB genes on the E.

coli chromosome?

A) B) C) D)

Version 1

16 minutes 96 minutes 26 minutes 70 minutes

12

43) If the origin of transfer was located directly to the right of the galE gene on this map of the E. coli chromosome, and gene transfer proceeded counterclockwise, how many minutes after the galE gene was transferred would the dnaB gene be transferred in an interrupted mating

experiment?

A) B) C) D)

25 minutes 75 minutes 107 minutes 16 minutes

44) During a phage life cycle sometimes a phage is packaged carrying a portion of the host cell chromosome, which results in transduction. During conjugation, which plasmid can most directly be compared to the phage that carries a fragment of the host cell chromosome?

A) B) C) D)

F factor F' factor R factor Col-plasmid

45) During transformation, if the extracellular endonuclease was not functioning properly, at which stage would transformation be halted?

Version 1

13

A) B) C) D)

During heteroduplex repair During DNA transport into the cell During homologous recombination After DNA fragment binding to a cell surface receptor on the bacterium

46) You are in a lab that studies ways to fight infections by the bacteria H. influenzae. The lab has designed a plasmid with a gene that causes rapid and effective cell death once the plasmid is inside of the cell. You are charged with finding a way to get the plasmid into the cell.

What strategy will you use?

A) B) C) D)

Placing a DNA uptake signal sequence into the plasmid Placing a gene that encodes the competence-stimulating peptide into the plasmid Placing an antibiotic resistance gene into the plasmid Making sure the H. influenzae to be treated are competent

Version 1

14

Answer Key Test name: Chap 07_7e 1) TRUE 2) TRUE 3) TRUE 4) TRUE 5) FALSE 6) FALSE 7) [A, B] 8) [A, B, C] 9) [A, B, C, D] 10) [B, E] 11) C 12) D 13) B 14) A 15) C 16) C 17) C 18) A 19) E 20) C 21) C 22) A 23) B 24) A 25) D 26) C Version 1

15

27) E 28) E 29) C 30) D 31) C 32) C 33) A 34) C 35) B 36) E 37) A 38) A 39) A 40) C 41) B 42) C 43) A 44) B 45) D 46) A

Version 1

16

CHAPTER 8 MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

1) Which type of chromosome has the longest p arm of the chromosome?

A) B) C) D)

2)

Acrocentric Metacentric Telocentric Submetacentric

A loss of an internal piece of a chromosome is called a __________.

A) B) C) D)

reciprocal translocation terminal deficiency interstitial deletion gene duplication

3) Human genetic diseases such a Cri-du-chat, Angelman syndrome and Prader-Willi syndrome are the result of which type of chromosomal change?

A) B) C) D)

Translocations Duplications Deletions Inversions

4) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. (The * indicates the centromere.) before A B C D * E F G H after A C D * E F G H

Version 1

1

A) B) C) D)

Terminal deletion Interstitial deletion Inversion Gene duplication

5) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. (The * indicates the centromere.) before A B C D * E F G H after A B C D * E F E F G H A) B) C) D)

6)

Gene duplications may be caused by __________.

A) B) C) D) E)

7)

Terminal deficiency Interstitial deficiency Inversion Gene duplication

the crossing over of misaligned chromosomes deletion of important genetic information reciprocal translocations position effect None of these choices are correct.

The production of gene families, such as the globin genes is the result of ________.

A) B) C) D) E)

Version 1

inversions deficiencies gene duplications simple translocations None of these choices are correct.

2

8) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. (The * indicates the centromere.) before A B C D * E F G H after A B G F E * D C H A) B) C) D) E)

9)

Inversions are contained within what percent of the human population?

A) B) C) D)

10)

Less than 1% Approximately 2% Approximately 5% Greater than 10%

Inversion loops can occur in __________.

A) B) C) D) E)

11)

Reciprocal translocation Pericentric inversion Paracentric inversion Gene duplication None of these choices are correct.

paracentric inversions pericentric inversions gene duplications reciprocal translocations both paracentric inversions and pericentric inversions

An inversion heterozygote contains __________.

A) B) C) D)

Version 1

two homologous chromosomes with inversions two normal chromosomes one normal chromosome and one chromosome with an inversion None of these choices are correct.

3

12)

Familial Down syndrome is a result of __________.

A) B) C) D)

inversion deficiency gene duplication translocation

13) Which chromosomal change rarely has an effect on the phenotype of the individual who carries it?

A) B) C) D)

14)

Robertsonian translocations usually occur between what types of chromosomes?

A) B) C) D)

15)

Metacentric Acrocentric Telocentric Submetacentric

A translocation cross may occur in an individual that has a/an __________.

A) B) C) D)

16)

Robertsonian translocation Unbalanced translocation Balanced translocation Chromosome loss

reciprocal translocation unbalanced translocation simple translocation All of these choices are correct.

Which of the following is not an example of euploidy?

Version 1

4

A) B) C) D) E)

17)

Which algebraic expression would be used to denote a trisomic organism?

A) B) C) D)

18)

3n 2n− 1 2n + 1 2n + 2

Edward and Patau syndromes are examples of __________.

A) B) C) D)

19)

Tetraploid Polyploid Triploid Diploid Aneuploid

aneuploidy allopolyploidy autopolyploidy translocations

Klinefelter and Turner syndromes are examples of __________.

A) B) C) D)

sex chromosome aneuploidy autosomal aneuploidy reciprocal translocations paracentric inversions

20) Trisomy 8 usually leads to early miscarriage of a fetus. However, adult individuals have been found with cells that have three copies of chromosome 8 in them. How can this be?

Version 1

5

A) B) C) D)

21)

The trisomic 8 adults likely have a mosaic region with trisomy 8.

The trisomic cells underwent complete nondisjunction.

The trisomic cells underwent a meiotic nondisjunction.

This individual must be triploid.

Which syndrome is not correctly matched to its aneuploid condition?

A) B) C) D)

Down syndrome—trisomy 21 Edward syndrome—trisomy 18 Klinefelter syndrome—XO Jacobs syndrome—XYY

22) In meiotic nondisjunction, meiotic products can be n+1, n-1, or n depending on when nondisjunction occurs. If non disjunction occurs in Meiosis I, what is the outcome?

A) B) C) D)

23)

Which human cells exhibit endopolyploidy?

A) B) C) D) E)

24)

Two trisomic and two monosomic products One trisomic and three monosomic products One trisomic, one monosomic, and two normal products None of these choices are correct.

Sex cells Nerve cells All somatic cells Liver cells Red blood cells

The polytene chromosomes of Drosophila are an example of _________.

Version 1

6

A) B) C) D) E)

25)

What type of plants are usually seedless?

A) B) C) D)

26)

aneuploidy polyploidy translocations inversion loops None of these choices are correct.

Aneuploid Diploid Triploid Tetraploid

The failure of chromosomes to separate during anaphase is called __________.

A) B) C) D)

synapsis maternal effect epistasis nondisjunction

27) What term describes an organism with two complete sets of chromosomes from two different species?

A) B) C) D)

Tetraploid Aneuploid Allodiploid Allotetraploid

28) The short arm of a chromosome is denoted by the letter __________ and the long arm by the letter __________.

Version 1

7

A) B) C) D)

p; q s; l q; p c; d

29) A photographic representation of the chromosomes of an organism is called a/an __________.

A) B) C) D)

allele variation chromosomal spreading chromosome picture karyotype

30) A diploid organism has a total of 36 chromosomes. Assuming all possible chromosome combinations are viable, if a mutant tetraploid version of this organism was created how many chromosomes would it have? If a mutant version of this organism was monosomic for chromosome 9 how many chomosomes would it have?

A) B) C) D)

144; 35 72; 35 144; 37 72; 37

31) Hemophilia A is an X-linked recessive blood clotting disorder. A normal man and a woman with hemophilia A have a child with Turner Syndrome (XO). This child does not have hemophilia. In whom did non-disjunction occur? In meiosis I or meiosis II? rev: 10_16_2017_QC_CS-105512

Version 1

8

A) Woman; meiosis I B) Woman; meiosis II C) Man; meiosis I D) Man; meiosis II E) Woman; there is not enough information to tell if the nondisjunction happened in meiosis I or II

32) A _______ translocation represents when a piece of one chromosome is attached to another chromosome.

A) B) C) D)

33)

simple complex reciprocal balanced

_______ is a drug that is used to experimentally produce polyploidy in organisms.

A) B) C) D)

Penicillin Colchicine Polymosca Karyocine

34) The salivary amylase gene (AMY1) is present in two diploid copies in chimpanzees.

Humans are known to have between 6-15 copies, an adaptation that is thought to be related to the high-starch diet of humans. This difference among humans is an example of __________.

A) B) C) D)

Version 1

G banding copy number variation a simple translocation a reciprocal translocation

9

35) SMAD4 is a tumor suppressor gene located on chromosome 18 that is known to be homozygously deleted in human lung cancer. If you were to perform comparative genomic hybridization using tissue from a lung cancer patient with a homozygous negative SMAD4 tumor, what ratio of green to red fluorescence would you expect?

A) A ratio of 1 on all of chromosome 18.

B) A ratio of 2 on the part of chromosome 18 containing the SMAD4 gene, with a value of 1 on the remainder of the chromosome.

C) A ratio of 0 on all of chromosome 18.

D) A ratio of 0 on the part of chromosome 18 containing the SMAD4 gene, with a value of 1 on the remainder of the chromosome.

E) A ratio of 1 on the part of chromosome 18 containing the SMAD4 gene, with a value of 0 on the remainder of the chromosome.

F) A ratio of 0.5 on the part of chromosome 18 containing the SMAD gene, with a value of 1 on the remainder of the chromosome.

36) The common goldfish Carassius auratus has 100 chromosomes and is tetraploid. The goldfish therefore has __________ sets of chromosomes containing __________ chromosomes each.

A) B) C) D)

4; 25 2; 50 4; 100 1; 100

37) The African clawed frog ( Xenopus laevis) is allotetraploid, likely as a result of an interspecies mating long ago, followed by a duplication of the entire genome. Xenopus laevis is fertile and has a normal life cycle. In contrast, mules, the allodiploid offspring of a male donkey and a female horse, are generally sterile. Why can Xenopus reproduce and mules cannot?

Version 1

10

A) Frogs are less sensitive to multiple copies of the genome than mammals.

B) In allotetraploid organisms each chromosome has a chromosome to pair up with in meiosis, whereas in allodiploid organisms they do not.

C) The two frogs that interbred to form the Xenopus laevis must have been more closely genetically related than the donkey and horse are.

D) The mule must have a genetic mutation that prevents it from reproducing.

38) You perform comparative genomic hybridization. You correctly synthesize your red and green DNA, but you forget to treat the DNA with heat before you apply the samples to metaphase chromosomes. What will the ratio of green fluorescence to red fluorescence be?

A) B) C) D)

0 1 2 There will be no signal

39) A wholphin is a rare hybrid animal born from mating a female bottlenose dolphin with a male false killer whale. Wholphins are diploid. Interestingly, wholphins are fertile. What can you conclude from the fact that wholphins are fertile?

A) B) C) D)

Wholphins are allotetraploid.

Dolphins and false killer whales likely have the same number of chromosomes.

Dolphins and false killer whales are actually the same species.

One of the parents must have been aneuploid.

40) When scientists apply colchicine to plants to induce polyploidy, often tetraploid. Is it possible that these tetraploids to be fertile, hence becoming a new species?

A) No, because all autotetraploids are sterile.

B) Yes, the tetraploids can produce diploid eggs and pollen.

Version 1

11

41)

Chromosomal deletions and duplications are frequently the result of __________.

A) B) C) D)

failure to separate chromosomes during anaphase abnormal crossover events the use of cholchicine non-homologous chromosomes exchanging pieces

42) The karyotypes of two organisms are performed and it is discovered that individual #1 has the 4 complete chromosomal sets while individual #2 has 4 copies of all chromosomes except for one chromosome where there is only 3 copies. What would be the designation for these two individuals?

A) B) C) D)

43)

Aneuploidy may have a detrimental effect on individuals due to __________.

A) B) C) D)

44)

chromosomal imbalance too much DNA in the nucleus too much tRNA being produced misalignment of chromosomes during prophase

Bees, ants, and wasps typically exhibit __________.

A) B) C) D)

45)

Both individuals are aneuploid.

Both individuals are polyploid.

Individual #1 is aneuploid and individual #2 is polyploid.

Individual #1 is polyploid and individual #2 is aneuploid.

diploidy haplodiploidy tetraploidy haploidy

Polytene chromosomes arise from __________.

Version 1

12

A) B) C) D)

multiple rounds of DNA replication but not chromosomal separation multiple fusions of diploid cells meiotic non-disjunction fusion of tetraploid cells

46) To detect a pericentric inversion in a chromosome the most useful technique would be __________.

A) karyotype B) finding the order of the bases in a single gene (DNA sequencing) C) determination of the amount of mRNA produced from an affected DNA segment D) the study of the biochemistry of the cell that is affected and comparing that to a cell that is normal

47) There are two chromsomes in a normal cell (the asterix indicates a centromere and the letters different genes):Chromosome 1: ABCDEFG*HIJKLMNChromosome 2: OPQRST*UVWXAnd in an abnormal cell they are now:Chromosome 1: ABCDEFG*HIWXChromosome 2: OPQRST*UVJKLMNWhat type of mutation has occured?

A) B) C) D)

48)

Reciprocal translocation Paracentric inversion Simple translocation Deletion

Translocations are caused by __________.

A) B) C) D)

crossingover between two homologous chromosomes crossingover between two non-homologous chromosomes chromosomes not separating appropriately during metaphase deletion in one chromosome followed by an inversion in another chromosome

Version 1

13

Version 1

14

Answer Key Test name: Chap 08_7e 1) B 2) C 3) C 4) B 5) D 6) A 7) C 8) B 9) B 10) E 11) C 12) D 13) C 14) B 15) A 16) E 17) C 18) A 19) A 20) A 21) C 22) A 23) D 24) B 25) C 26) D Version 1

15

27) D 28) A 29) D 30) B 31) E 32) A 33) B 34) B 35) A 36) A 37) B 38) D 39) B 40) B 41) B 42) D 43) A 44) B 45) A 46) A 47) A 48) B

Version 1

16

CHAPTER 9 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) In the Hershey-Chase experiments, the protein coat of the bacteriophage was labeled with 32 the P radioisotope. ⊚ ⊚

2)

A nucleoside consists of only a five-carbon sugar and a phosphate group. ⊚ ⊚

3)

true false

true false

B DNA is recognized as a left-handed molecule. ⊚ ⊚

true false

4) A purine on one strand of the DNA is always paired with a pyrimidine on the other strand. ⊚ ⊚

true false

5) The DNA helix contains major and minor grooves, which assist in the regulating of gene expression. ⊚ ⊚

6)

true false

A DNA strand can be described as antiparallel but uncomplementary. ⊚ ⊚

Version 1

true false

1

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

7) Frederick Griffith is responsible for discovering what process?

A) B) C) D)

Replication Transmission Transformation Transduction

8) The fact that the type R and S strains of Streptococcus pneumoniae that Griffith worked with possessed small differences in capsule structure satisfies which of the following criteria for genetic material?

A) B) C) D)

Transmission Replication Information Variation

9) The individuals who determined that Griffith's transforming principle was DNA were __________.

A) B) C) D)

Hershey and Chase Avery, Macleod, and McCarty Watson and Crick Creighton and McClintock

10) The individuals who determined that DNA was responsible for the process of transduction in T2 phage were __________.

Version 1

2

A) B) C) D)

11)

What is a characteristic of T2 bacteriophage?

A) B) C) D)

12)

Their results suggested the presence of a transforming principle.

Their results suggested that DNA is a double helix.

Their results suggested that A+G=T+C. Their results suggested that the DNA is the genetic material.

The building blocks of DNA are called _________.

A) B) C) D)

14)

It does not require a host cell for replication.

The phage attaches to the cell wall of a target eukaryotic cell.

The phages injects its DNA into the host cell.

The new phages are formed outside the host cell.

What was the conclusion of the Hershey-Chase experiments?

A) B) C) D)

13)

Hershey and Chase Avery, Macleod, and McCarty Watson and Crick Creighton and McClintock

amino acids codons nucleotides alleles

What is a component of a single nucleotide?

Version 1

3

A) A phosphate group B) A six carbon sugar C) All five nitrogenous bases

15)

How does DNA differ from RNA? A) B) C) D)

16)

Which base is not found in DNA? A) B) C) D) E)

17)

RNA uses only purines.

RNA uses a different five-carbon sugar.

RNA contains different sized phosphate groups.

RNA has multiple bases attached to the sugar.

Cytosine Guanine Thymidine Adenine Uracil

The backbone of the DNA molecule is formed by ________.

A) B) C) D)

peptide bonds ribose sugars nitrogenous bases phosphodiester bonds

18) The individual(s) who used ball and stick models to identify the three-dimensional structure of proteins was __________.

Version 1

4

A) B) C) D) E)

Franklin Watson and Crick Hershey and Chase Pauling Chargaff

19) The researcher(s) who initially used X-ray diffraction to gather information on the DNA molecule was __________.

A) B) C) D) E)

20)

Franklin Watson and Crick Hershey and Chase Pauling Chargaff

What was the conclusionof Franklin's work regarding the structure of DNA? A) B) C) D)

It did not have a helical structure.

The helix had more than one strand.

The helix contained about 1 bases per turn.

The helix had only one strand.

21) According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain?

A) B) C) D)

Version 1

20% 30% 50% 75%

5

22) The first group of researchers to correctly identify the double-helix structure of DNA were __________.

A) B) C) D)

McClintock and Franklin Hershey and Chase Pauling and Avery Watson and Crick

23) In a double-helix DNA strand, the adenine on one strand forms hydrogen bonds with a/an __________ on the other strand.

A) B) C) D)

adenine guanine thymine cytosine

24) How many bases are necessary to complete three complete twists (1080 degrees) of a DNA helix?

A) B) C) D)

5 10 30 60

25) The fact that the helixes of the DNA strand are arranged in opposite directions gives DNA its __________ characteristics.

A) B) C) D)

Version 1

antiparallel complementary redundant water-soluble

6

26)

One strand of DNA is 5'–AGGCCTTA–3'. What is the sequence of the opposite strand?

A) B) C) D)

27)

5'–AGGCCTTA–3' 5'–TCCGGAAT–3' 3'–AGGCCTTA–5' 3'–TCCGGAAT–5'

What DNA form is most common in living organisms?

A) B DNA B) Z DNA C) H DNA

28)

Which DNA molecule form is a left-handed?

A) B DNA B) Z DNA C) R DNA

29) Avery, MacLeod and McCarty used the enzyme __________ to remove the proteins from the cell extracts.

A) B) C) D)

protease DNase RNase All of these choices are correct.

30) T2 phage _______ was labeled using the radioisotope experiments.

Version 1

32

P in the Hershey-Chase

7

A) B) C) D)

RNA DNA protein carbohydrates

31) Cells are treated with a drug that blocks purine synthesis. Which bases would not be made in those treated cells?

A) B) C) D)

32)

Cytosine, thymine, and uracil Adenine and guanine Adenine and thymine Cytosine and guanine

The pyrimidine bases are _______.

A) B) C) D)

cytosine, thymine, and uracil adenine and guanine adenine and thymine cytosine and guanine

33) The idea that the adenine and thymine bases of the DNA interact in some manner was first proposed by __________.

A) B) C) D)

Watson and Crick Franklin Pauling Chargaff

34) Adenine and thymine form __________ hydrogen bonds between them, while cytosine and guanine form __________ hydrogen bonds.

Version 1

8

A) B) C) D)

35)

What is one of the criteria that all genetic material must meet?

A) B) C) D)

36)

2; 3 3; 4 3; 2 4; 3

It does not contain the information necessary to construct the entire organism.

It must be passed from offspring to parent.

It must be able to be copied.

It must have a limited amount of variation.

Which of the following is a correct matching of the researcher with their discovery?

A) Pauling provided information on primary structure in biological molecules.

B) Franklin suggested that DNA was a helix with more than one strand and that there were about 10 bases per turn of the DNA. C) Watson and Crick collected a large amount of X-ray data on the structure of DNA. D) Chargaff demonstrated that the adenine and cytosine bases and the uracil and guanine bases interacted in some manner.

37)

DNA and RNA are types of __________.

A) B) C) D)

Version 1

proteins nucleic acids nucleotides nucleosides

9

38) An enormous variety of genomic structures can be seen among viruses, with a given virus having either a DNA or an RNA genome. The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Based on this information equine influenza is a __________ virus.

A) B) C) D)

Version 1

single-stranded RNA double-stranded RNA single-stranded DNA double-stranded DNA

10

39)

The arrow points to which type of structure on the RNA molecule depicted below?

</span></p> A) B) C) D)

Version 1

Bulge loop Internal loop Multibranched junction Stem-loop

11

40) A nucleoside analog is a synthetic compound that is structurally similar to a naturally occurring nucleoside. Such compounds typically interfere with DNA or RNA synthesis, and are accordingly used as antiviral and anticancer drugs. Illustrated below is the structure of drug used

to treat Ebola infection. _____ analog.

A) B) C) D)

Based on its structure, this drug is a(n)

adenosine deoxycytidine deoxythymidine guanosine

41) DNA intercalators are molecules capable of fitting between nucleic acid base pairs. A DNA molecule must unwind in order to create a space between consecutive base pairs to allow a given intercalator to insert itself. The intercalator doxorubicin is used in the treatment of Hodgkin’s lymphoma. Treatment of lymphocytes with doxorubicin would disrupt which level of DNA complexity?

A) B) C) D)

Nucleotide formation DNA strand formation DNA double-helix formation 3D structure (i.e., DNA folding & bending)

42) With 248,956,422 bp, chromosome 1 is the longest chromosome in the human genome.

How long is chromosome 1?

Version 1

12

A) B) C) D) E)

46 cm 85 mm 83 µm 67 nm 9 pm

43) The following sequence forms a stem-loop in the poliovirus (PV) RNA that is bound by PCBP, an RNA-binding protein that functions in both the translation and replication of the PV genomic RNA: 5’-UGGGGUUGUACCCACCCCA-3’. Once formed, how many hydrogen bonds stabilize the stem in this structure?

A) B) C) D) E)

Version 1

6 12 14 16 20

13

Answer Key Test name: Chap 09_7e 1) FALSE 2) FALSE 3) FALSE 4) TRUE 5) TRUE 6) FALSE 7) C 8) D 9) B 10) A 11) C 12) D 13) C 14) A 15) B 16) E 17) D 18) D 19) A 20) B 21) B 22) D 23) C 24) C 25) A 26) D Version 1

14

27) A 28) B 29) A 30) B 31) B 32) A 33) D 34) A 35) C 36) B 37) B 38) A 39) B 40) A 41) C 42) B 43) D

Version 1

15

CHAPTER 9 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) One would expect heterochromatic regions of DNA to be more compacted than euchromatic regions. ⊚ ⊚

true false

2) Overwinding of the DNA decreases the number of turns in the double helix, and thus results in supercoils in the DNA. ⊚ ⊚

true false

3) The term genome refers to the complete complement of genetic material that an organism possesses. ⊚ ⊚

4)

The majority of bacterial DNA is negatively supercoiled. ⊚ ⊚

5)

true false

true false

The 30-nm fiber is formed from arrays of nucleosomes. ⊚ ⊚

true false

6) The different DNA configurations that are generated by supercoiling are called topoisomers of one another. ⊚ ⊚ Version 1

true false 1

7)

The DNA-protein complex in eukaryotic chromosomes is called the genome. ⊚ ⊚

8)

The is a strong relationship between organism complexity and genome size in eukaryotes. ⊚ ⊚

9)

true false

true false

High numbers of LINEs and SINEs may be due to transposable element activity. ⊚ ⊚

true false

10) Transposase is involved with removing the transposable element from its current location. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

11) Select the two primary components of chromatin.

A) B) C) D) E)

Version 1

DNA Proteins RNA Lipids Carbohydrates

2

12) You wish to repeat the Noll experiment. However, after you run your gel for an appropriate amount of time, you are dismayed to find that all of the DNA is present at the very top of the agarose gel. What mistakes might you have made in your experiment? (Check all that apply.)

A) B) C) D)

You forgot to add DNase I to your DNA. You didn't sufficiently isolate your DNA from the attached proteins.

You forgot to stain the gel with ethidium bromide.

You added too much DNase I to your DNA.

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

13) How many origins of replication are there on a bacterial chromosome?

A) B) C) D)

14)

Where is the bacterial chromosome located?

A) B) C) D)

15)

0 1 2 More than two

Nucleus Nucleolus Nucleoid Nuclear envelope

What is a mechanism of condensation shared by both prokaryotes and eukaryotes?

A) B) C) D)

Version 1

Nucleosomes Loop domains 30 nm fiber None of these choices are correct.

3

16)

Loop domains in prokaryotes involve how many base pairs?

A) B) C) D)

17)

Negative supercoiling in bacteria __________.

A) B) C) D)

18)

10,000 100,000 1000 50,000

makes the chromosomal DNA more compact creates tension because of the underwinding of the DNA can promote DNA strand separations in small regions All of these choices are correct.

Turning the DNA helix to the right causes __________.

A) positive supercoiling B) overwinding C) All of these choices are correct.

19)

DNA topoisomerase I does which of the following?

A) B) C) D)

20)

Relaxes negative supercoils Relaxes positive supercoils Introduces negative supercoils More than one of these choices are correct.

Quinolone-based drugs are used as antibiotics. How do they kill bacteria?

Version 1

4

A) B) C) D)

They inhibit DNA gyrase.

They inhibit DNA compaction.

They inhibit DNA replication.

They inhibit eukaryotic topoisomerases.

21) Why do some amphibians have so much more DNA in their haploid genome than humans?

A) B) C) D)

22)

Where do kinetochores form onchromosomes?

A) B) C) D)

23)

Telomeres Specific genes on the chromosome Centromeres They don't attach to DNA

Which of the following is found at the end of a eukaryotic chromosome?

A) B) C) D)

24)

Amphibians have more repetitive sequences than do humans.

Amphibians are more biologically complex than mammals.

Amphibians have more genes than do humans.

Amphibians are tetraploid, while humans are diploid.

Telomeres Centromeres Kinetochores Origins of replication

An Alu sequence is an example of what?

Version 1

5

A) B) C) D)

Retroelement Transposable element Highly repetitive DNA All of these choices are correct.

25) The majority of the nonrepetitive genes in an organism are found in which of the following?

A) B) C) D)

26)

Unique sequences make up approximately what percent of the human genome?

A) B) C) D)

27)

5% 25% 41% 81%

How many types of histone proteins are there?

A) B) C) D)

28)

Unique sequences Moderately repetitive sequences Highly repetitive sequences None of these choices are correct.

4 5 7 8

What types of amino acids are most responsible for the binding of histones to DNA?

Version 1

6

A) B) C) D)

29)

Hydrophobic amino acids Polar amino acids Positively charged amino acids Negatively charged amino acids

About how many bases of DNA wrap around a histone complex?

A) B) C) D)

< 50 150 200 > 1,000

30) Digesting chromatin with a high concentration of DNAse I would yield fragments of what approximate size?

A) B) C) D)

200 400 600 1100

31) The two processes of wrapping DNA on nucleosomes and arranging them into a 30-nm fiber shorten the DNA by how much?

A) B) C) D)

32)

30-fold 50 fold 1 million-fold 3 million-fold

Areas of the chromosome that remain highly condensed are called __________.

Version 1

7

A) B) C) D)

33)

Which of the following is critical in thealignment of sister chromatids during metaphase?

A) B) C) D) E)

34)

Radial loop domains Cohesin Centromeres Nucleosomes Condensin

Which of the following represents the lowest level of chromosome condensation?

A) B) C) D) E)

35)

euchromatin facultative heterochromatin constitutive heterochromatin chromosome territories

Radial loop domain 30 nm fibers Heterochromatin Nucleosome Euchromatin

The function of condensin is to __________.

A) cause the chromosomes to decondense following mitosis B) coat the chromosomes and condense them into heterochromatin through the compaction of radial loops C) hold the DNA to the histone proteins in the nucleosome core particle D) trigger DNA to be compacted in a nucleosome core particle E) None of these choices are correct.

36)

Which of the following is not part of the structure of the nucleosome core particle?

Version 1

8

A) B) C) D) E)

37)

It is composed of an octamer of proteins.

There is a linker region between two nucleosomes of between 20 and 100 bp.

There are two copies each of H2A, H2B, H3 and H4.

The DNA is wrapped around the core slightly over two complete turns.

The DNA wrapped around the core contains 146-147 base pairs.

Which of the following is correctly matched with its description?

A) Highly repetitive DNA contains transposable elements and genes that are expressed in abundance and thus have many copies.

B) Moderately repetitive DNA contains unique sequences, such as genes found in one or a few copies.

C) Nonrepetitive DNA is composed of thousands of copies of many short repeats.

D) Moderately repetitive DNA contains retro elements, such as the Alu sequence.

E) Moderately repetitive DNA contains transposable elements and genes that are expressed in abundance and thus have many copies.

38)

Which of the following is not a mechanism used bybacteria to condense their DNA? A) B) C) D) E)

Supercoiling Packaging the DNA with histone proteins Looping of the DNA Increasing or decreasing the number of turns in the DNA Forming micro and macrodomains using nucleoid-associated proteins

39) The DNA of a bacterial cell must be compacted about _______ fold to fit within the confines of the cell.

Version 1

9

A) B) C) D) E)

40)

1010015010001,000,000-

The zig-zag model is associated with the __________ level of DNA organization.

A) B) C) D) E)

histone 11-nm fiber beads-on-a-string 30-nm fiber scaffold protein

41) The origins of replication in eukaryotic chromosomes are spaced about every _______ base pairs.

A) B) C) D) E)

42)

100,000 1000 100 10 500

A nucleosome is a combination of __________ and __________.

A) B) C) D) E)

Version 1

histone proteins; scaffold proteins RNA; transcription proteins DNA; histone proteins RNA; histone proteins DNA; scaffold proteins

10

43)

Why do positively charged amino acids appear more often than usual in histone proteins?

A) Histones have a higher molecular mass, which improves DNA compaction.

B) Histones are strongly attracted to the positively charged phosphate backbone of

DNA. C) Histones and DNA have opposite charges, which improves the compaction of DNA into nucleosomes.

D) Histones and DNA have the same charge, which improves the compaction of DNA into nucleosomes.

44) The individual who first proposed the existence of transposable elements was __________.

A) B) C) D) E)

Sturtevant Morgan McClintock Franklin Watson

45) Which of the following genes was mobile in McClintock's experiments with mutable sites in corn?

A) B) C) D) E)

46)

Ds C Sh Wx All of these choices are correct.

Transposons that utilize an RNA intermediate for transposition are called __________.

Version 1

11

A) B) C) D)

47)

Which enyme catalyzes the transposition event when a transposon moves?

A) B) C) D)

48)

Presence of an integrase enzyme High level of mutation Presence of inverted repeats at the end of the sequence Presence of a reverse transcriptase enzyme

Long-terminal repeats are unique to which group of transposons?

A) B) C) D) E)

50)

Integrase Jumpase Splicase Transposase

Insertion sequences can be identified by which of the following?

A) B) C) D)

49)

IS elements retroviruses retrotransposons non-transposable elements

Composite transposon Non-viral retro element Viral-like retro element Replicative transposon Insertion sequence

Direct repeats __________.

Version 1

12

A) B) C) D)

51)

Which enzyme is unique to the retro elements?

A) B) C) D) E)

52)

Reverse transcriptase Reverse resolvase Transposase Integrase Reverse integrase

Which of the following is an example of a transposable element in humans?

A) B) C) D)

53)

are also called target-site duplications are oriented in the same direction are adjacent to both ends of any TE All of these choices are correct.

Alu P elements Mu Ty

What is the selfish DNA theory?

A) A theory that explains how DNA point mutations are repaired within the genome.

B) A theory that explains how transposable elements are repaired within the genome.

C) A theory that attempts to explain the proliferation of transposable elements in a genome by comparing it to the action of a parasite.

D) A theory that attempts to explain how the proliferation of transposons improves the evolutionary advantage of the host organism.

54)

A chromosome territory is defined as __________.

Version 1

13

A) B) C) D)

a region in the nucleus that is occupied by a single chromosome a region on a chromosome that is devoid of nucleosomes a region on a chromosome that has no protein encoding genes a region in the nucleus that may have several chromosomes

55) The correct order of compaction from least compacted to most compacted would be __________.

A) B) C) D)

naked DNA, 30-nm fiber, nucleosome, loop domain, metaphase chromosome naked DNA,loop domain, 30-nm fiber, nucleosome, metaphase chromosome naked DNA, nucleosome, 30-nm fiber, loop domain, metaphase chromosome naked DNA, metaphase chromosome, loop domain, 30-nm fiber, nucleosome

56) A transposon is inserted into the sequence 5' GACTC 3'. Following simple transposition into this site, what sequences flank the transposon?

A) B) C) D)

5' GACTC 3'; 5' GACTC 3' 5' GACTC 3'; 5' CTCAG 3' 5' CTCAG 3'; 5' GACTC 3' 5' CTCAG 3'; 5' CTCAG 3'

57) You have discovered a new gene in corn. The wild type allele of this gene ( S) is dominant and makes corn kernels have a smooth surface, whereas the recessive allele ( s) makes the corn kernel appear to be wrinkled. You breed a corn strain that has genotype SSS (recall that the endosperm of corn kernels is triploid). If the Ds transposon is present in one of the S alleles in the cells of the kernel, what will be the phenotype of the corn kernel?Assume the transposon can continue to move during kernel growth.

A) B) C) D)

All wrinkled All smooth Smooth with a few wrinkled spots from cells where the transposon was inserted Wrinkled with a few smooth spots from cells where the transposon excised

Version 1

14

58) You have discovered a new gene in corn. The wild type allele of this gene ( S) is dominant and makes corn kernels have a smooth surface, whereas the recessive allele ( s) makes the corn kernel appear to be wrinkled. You breed a corn strain that has genotype Sss(recall that the endosperm of corn kernels is triploid). If the Dstransposon is present in the S allele in the cells of the kernel, what will be the phenotype of the corn kernel? Assume the transposon can continue to move during kernel growth.

A) B) C) D)

All wrinkled All smooth Smooth with a few wrinkled spots from cells where the transposon was inserted Wrinkled with a few smooth spots from cells where the transposon excised

59) You are studying a protein in the frog Xenopus laevis. This organism has a high percentage of transposable elements (TEs) in its genome. After several months of experiments, you start experiencing strange results. It appears that your protein is no longer being made! You look at the chromosomes from the cells where the protein is not being produced, and they all appear normal. You also sequence the coding region of your gene and it has a normal sequence.

What is the most likely explanation for your missing protein?

A) A chromosomal breakage has occurred due to excision of a TE. B) A mutation has occurred due to incorrect excision of a TE from your gene.

C) A TE has inserted in the regulatory sequences for your gene, altering gene regulation.

D) Exon shuffling has occurred, and there is a new exon in your gene.

60) You are working in a lab and isolate a mammalian cohesin mutant that is unable to be cleaved by separase. What will be the result of this mutation?

A) B) C) D)

Version 1

The cells will be stuck in anaphase, unable to separate sister chromatids.

The cells will be stuck in metaphase, unable to properly align chromosomes.

The cells will be stuck in S phase, unable to form sister chromatids.

The cells will proceed through the cell cycle normally.

15

Answer Key Test name: Chap 10_7e 1) TRUE 2) FALSE 3) TRUE 4) TRUE 5) TRUE 6) TRUE 7) FALSE 8) FALSE 9) TRUE 10) TRUE 11) [A, B] 12) [A, B] 13) B 14) C 15) B 16) A 17) D 18) C 19) A 20) A 21) A 22) C 23) A 24) D 25) A 26) C Version 1

16

27) B 28) C 29) B 30) A 31) B 32) C 33) B 34) D 35) B 36) D 37) E 38) B 39) D 40) D 41) A 42) C 43) C 44) C 45) A 46) C 47) D 48) C 49) C 50) D 51) A 52) A 53) C 54) A 55) C 56) A Version 1

17

57) B 58) D 59) C 60) A

Version 1

18

CHAPTER 11 MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

1) Which of the following best describes the double-helix of DNA? A) B) C) D)

2)

It has directionality The strands are arranged in an anti-parallel arrangement The strands are complementary All of these choices are correct.

The purpose of DNA replication is to produce __________.

A) B) C) D)

two daughter strands two parental strands two template strands None of these choices are correct.

3) Which of the following best describes the mechanism of DNA replication in which both parental strands remain together following replication?

A) B) C) D)

Dispersive Semiconservative Conservative All of these choices are correct.

4) What is the name for the mechanism of DNA replication in whichone parental strand and one daughter strand are combined following replication?

Version 1

1

A) B) C) D)

Dispersive Semiconservative Conservative All of these choices are correct.

5) The first round of replication in the Meselson and Stahl experiment disproved which theory of replication?

A) B) C) D)

Semiconservative Conservative Dispersive None—it took more than one round to disprove the theory

6) You have isolated what appears to be alien DNA. While studying its replication, you performed the exact experiment Meselson and Stahl did. After three generations, the DNA is subjected to a CsCl gradient and only one band appears. What type of replication does this DNA undergo?

A) Semiconservative B) Conservative C) Dispersive

7)

Bacterial DNA has how many origins of replication per chromosome?

A) B) C) D)

8)

0 1 10 Depends on the size of the DNA

Which of the following is not correct concerning the initiation of bacterial replication?

Version 1

2

A) B) C) D)

9)

It involves a region of the DNA called oriC DnaA proteins bind to the DNA to begin separation of the strands The strands are initially separated at GC-rich regions of DNA Following initial separation, DNA helicase enzymes continue to unwrap the DNA

DNA helicase enzymes move in what direction along the DNA during DNA replication?

A) 5' to 3' B) 3' to 5' C) They remain stationary

10)

Which of the following removes supercoiling ahead ofthe replication fork?

A) B) C) D) E)

11)

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

Which enzyme synthesizes a 10-12 base segment of RNA that is used by DNA pol III? A) B) C) D) E)

DNA ligase Primase Topoisomerase DNA polymerase I DNA polymerase III

12) Which of the following fills in small regions of DNA where the RNA primers were located?

Version 1

3

A) B) C) D) E)

13)

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

Which of the following is responsible for the majority of DNA replication?

A) B) C) D) E)

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

14) Which of the following attaches adjacent Okazaki fragments, forming a continuous DNA strand?

A) B) C) D) E)

15)

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

Which enzyme synthesizes most of the lagging strand of the DNA? A) B) C) D) E)

Version 1

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

4

16)

How many DNA polymerases are found in prokaryotes?

A) B) C) D)

17)

5 7 9 12

DNA polymerases add new nucleotides in what direction?

A) 5' to 3' B) 3 ' to 5' C) Both directions

18) You have discovered a strain of E. coli that has a higher mutation rate than the normal parental strain from which the mutated strain was created. Upon further investigation, you find a mutation in the DNA polymerase III gene. What subunit of the holoenzyme does this mutation probably NOT affect?

A) B) C) D)

19)

α β ε Θ

Okazaki fragments do which of the following?

A) B) C) D) E)

Version 1

Assist in forming the replication fork Bind to the oriC region Assist in the synthesis of DNA from the lagging strand Reform the double-helix following replication None of these choices are correct.

5

20)

Which of the following is an example of a processive enzyme?

A) B) C) D)

21)

Which of the following stops the replication of DNA in prokaryotes?

A) B) C) D)

22)

DNA A protein DNA polymerase III DNA ligase Single stranded DNA binding protein

Tus proteins DNA ligase Okazaki fragments The end of the chromosome

What functions are accomplished by the primosome?

A) Tracking along DNA B) Tracking along DNA, separating double stranded DNA C) Tracking along DNA, separating double stranded DNA, synthesizing RNA primers D) Tracking along DNA, separating double stranded DNA, synthesizing RNA primers, adding nucleotides

23)

The proofreading of newly synthesized DNA by DNA Pol III occurs in __________.

A) the 5' to 3' direction B) the 3' to 5' direction C) both directions

24) You extract DNA from an E. coli cell and observe it is hemimethylated (only methylated on one strand). Which strand of DNA is older?

Version 1

6

A) The methylated strand.

B) The strand that is not methylated.

C) Neither—they are the same "age."

25)

What types of mutants were essential to the discovery of new replication enzymes?

A) B) C) D)

26)

Gain-of-function mutations Lethal mutations Temperature-sensitive mutations None of these choices are correct.

In eukaryotes, which of the following is similar to the oriC region of prokaryotes?

A) B) C) D)

Dam ARS elements Promoters Telomeres

27) DNA polymerase is a primer-dependent enzyme that functions only in the 5'-3' direction.

These are the two most fundamental concepts to understanding this enzyme. Based on this, which of the following enzyme pairs are analogous in prokaryotes and eukaryotes?

A) B) C) D)

28)

DNA pol I : DNA pol α DNA pol II : DNA pol β DNA pol III : DNA pol δ All of these choices are correct.

Translesion-replicating polymerases are _________.

Version 1

7

A) B) C) D)

only active in skin cells used to replicate damaged DNA used to induce genetic diversity None of these choices are correct.

29) Which of the following is NOT a reason for the high fidelity of DNA synthesis of DNA Pol III? A) The hydrogen bonding between purines and pyrimidines is stable.

B) The DNA polymerase is unlikely to form bonds between nucleotides if they are mismatched.

C) The DNA polymerase has exonuclease functions.

D) The DNA polymerase has the ability to change the structure of the base in order to form the correct bond.

30)

Which of the following is a restriction placed on DNA polymerase?

A) B) C) D)

31)

DNA polymerase can attach new nucleotides only in the 5' to 3' direction.

DNA polymerases must begin synthesis using an RNA primer.

DNA polymerases must have a template strand to copy from.

All of these choices are restrictions of DNA polymerase.

DNA polymerases are unable to replicate what areas of the chromosome?

A) Centromeres B) 3' end of telomeres C) Origins of replication

32) If eukaryotic cells evolved such that lagging strand DNA synthesis could occur continuously (without the use of Okazaki fragments), what enzyme would likely no longer be needed for DNA replication?

Version 1

8

A) B) C) D)

Flap endonuclease Helicase Primase Topoisomerase

33) You are performing a biochemical purification of enzymes involved in DNA replication.

You have purified thereplisome. You wish to purify the primosome. You perform further separation techniques on your purified replisome. How will you test to determine that you have purified the primosome?

A) You should confirm that your sample hashelicase and primase activity, but not the ability to synthesize DNA. B) You should confirm that your sample has the ability to synthesize DNA and hasprimase activity, but no helicaseactivity.

C) You should confirm that your sample has helicase and primase activity. This is the only test that is needed.

D) You should confirm that your sample has primase activity and can synthesize DNA. This is the only test that is needed.

34) You are in the lab trying to synthesize DNA in vitro. You are upset because the lab seems to be out of dNTPs (deoxynucleosidetriphosphates) but you find a tube of dNMPs(deoxynucleoside monophosphates) in the freezer. You add this to your replication reaction instead of dNTPs. Will your reaction work? Why or why not?

A) No, cleavage of dNTP drives the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand.

B) Yes, only the nucleoside monophosphate ultimately is incorporated into the growing DNA strand.

C) No, all three phosphates on the nucleoside triphosphateare incorporated into the growing DNA strand.

D) Yes, the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand is energetically favorable.

Version 1

9

35) If the piece of partially double stranded DNA below was added to a reaction mixture that contained DNA pol III and all the reaction components necessary to synthesize DNA what would be the next base added?5' AGCATGACGATCCAT 3'3' ACTGCTAG 5' A) B) C) D)

A G C T

36) DNA is isolated from the nucleus of an organism and the base composition is determined.

Which answer would best represent an organism that has double stranded DNA for its genome?

A) B) C) D)

20% A20% G30% C30% T 20% A20% G20% C40% T 30% A15% G15% C30% T 15% A25% G15% C35% T

37) If the partially double stranded DNA piece seen below was placed in a reaction with DNA pol III that contained all the necessary components for DNA synthesis except that the deoxynucleotide triphosphate A was replaced with a dideoxynucleotide triphosphate A, what would happen?5ʹ GATCATGGACTAGCTT 3ʹ3ʹ GTACCTG 5ʹ A) B) C) D)

38)

No bases would be added.

The dideoxynucleotide would be added but then DNA synthesis would stop.

DNA synthesis would occur normally and the upper strand would be copied.

DNA synthesis would occur normally and the lower strand would be copied.

DNA polymerase II is a processive enzyme because it __________.

Version 1

10

A) B) C) D)

does not release the strand of DNA after nucleotide addition does release the strand of DNA after nucleotide addition needs a primer in order to begin synthesis has a 3ʹto 5ʹexonuclease function

39) If in a Dictyostelium cell, the telomerase RNA was replaced with a human telomerase RNA what would happen?

A) B) C) D)

Telomere length would increase.

The telomeres would not be synthesized but the telomere lengths would not change.

Telomeres would be synthesized and remain the same length.

Telomeres would not be synthesized and so they would shorten.

40) Several temperature sensitive mutant strains of bacteria that are defective in DNA replication are isolated. To study what genes might be affected, the mutant strains are cultured along with the normal parental strain at the permissive temperature and then shifted at 10 minute intervals to the non permissive temperature. The amount of DNA at each step is measured by determining the amount of labeled nucleotides that have been incorporated into the DNA. The numbers refer to the relative amount of labeled nucleotides that have been incorporated. The following results are obtained.

Strain

5 min

10 min

15 min

30 min

Normal

10

20

30

60

Strain A

10

20

25

25

Strain B

10

20

28

45

Strain C

10

20

30

55

Strain D

10

20

30

60

Strain E

10

20

30

50

Which strain most likely has a mutation in the dnaE gene?

Version 1

11

A) B) C) D) E)

Version 1

A B C D E

12

Answer Key Test name: Chap 11_7e 1) D 2) A 3) C 4) B 5) B 6) C 7) B 8) C 9) A 10) C 11) B 12) D 13) E 14) A 15) E 16) A 17) A 18) B 19) C 20) B 21) A 22) C 23) B 24) A 25) C 26) B Version 1

13

27) B 28) B 29) D 30) D 31) B 32) A 33) A 34) A 35) D 36) C 37) B 38) A 39) D 40) A

Version 1

14

CHAPTER 12 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) RNaseP is not a protein but a ribozyme. ⊚ ⊚

true false

2) In prokaryotes elongation requires the release of the sigma factor, while in eukaryotes the mediator is involved in the switch to elongation. ⊚ ⊚

true false

3) The RNA polymerase forms a closed complex during the process of elongation during transcription. ⊚ ⊚

true false

4) The Pribnow box contains a 5' CACAAC 3' consensus sequence located in the -100 region of the promoter. ⊚ ⊚

true false

5) During the initiation phase of transcription the sigma (σ) factor, which is bound to RNA polymerase, binds into the major groove of DNA and recognizes sequence elements at the promoter. This process forms a closed complex. ⊚ ⊚

true false

6) The formation of an open complex occurs at GC rich regions of DNA due to the decreased number of hydrogen bonds.

Version 1

1

⊚ ⊚

7)

true false

In eukaryotes, enhancers must be close to the promoter to have an effect. ⊚ ⊚

true false

8) The process of RNA editing can alter the base sequence of the mRNA following transcription. ⊚ ⊚

9)

The term ribozyme is given to catalytic RNA molecules. ⊚ ⊚

10)

true false

In bacterial RNA polymerase, the catalytic subunits are Beta and Beta'. ⊚ ⊚

11)

true false

true false

Because of alternative splicing, a pre-mRNA could generate a dozen different mRNAs. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

12) In the process of RNA editing adenine or cytosine may be deaminated and the result is __________. (Check all that apply.)

Version 1

2

A) cytosine is changed to uracil B) adenine is changed to hypoxanthine C) cytosine is changed to hypoxanthine D) adenine is changed to uracil E) although both bases are covalently changed, there is no alteration in the tRNAs the modified bases may engage F) the new bases effectively result in new codons

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

13) Where does the process of transcription initiate?

A) B) C) D)

14)

The RNA transcript is complementary to __________.

A) B) C) D)

15)

Promoter Terminator Regulation sequences Transcription factors

regulatory sequences termination sequences the coding strand of DNA the template strand of DNA

Which molecules are not part of the closedcomplex?

A) B) C) D)

Version 1

RNA polymerase Transcription factors Double helix DNA Single-stranded DNA

3

16)

Which RNA encodes the sequence of amino acids for a functional protein?

A) B) C) D) E)

17)

The holozyme is formed when the core enzyme associates with __________.

A) B) C) D) E)

18)

start codons b b' σ a

What sequences are not considered to be regulatory elements?

A) B) C) D) E)

19)

tRNA snRNA mRNA rRNA scRNA

Enhancers Silencers Core promoters Cis-acting elements General transcription factors

What RNAs do each eukaryotic RNA polymerase produce?

A) B) C) D)

Version 1

RNA pol I - mRNARNA pol II - tRNA and 5s rRNARNA pol III - rRNA RNA pol I - rRNARNA pol II - tRNA and 5s rRNARNA pol III - mRNA RNA pol I - mRNARNA pol II - rRNARNA pol III - tRNA and 5s rRNA RNA pol I - rRNARNA pol II - mRNARNA pol III - tRNA and 5s rRNA

4

20) What is the difference between the allosteric and torpedo models of eukaryotic transcriptional termination?

A) In the allosteric model, RNA pol II becomes destabilized after transcription of the poly A signal sequence, while in the torpedo model the polymerase is physically removed from the DNA. B) In the torpedo model, RNA pol II becomes destabilized after transcription of the poly A signal sequence, while in the allosteric model the polymerase is physically removed from the DNA. C) In the allosteric model, RNA pol II becomes destabilized after transcription of the stop codon sequence, while in the torpedo model the polymerase is physically removed from the DNA. D) In the torpedo model, RNA pol II becomes destabilized after transcription of the stop codon, while in the allosteric model the polymerase is physically removed from the DNA. E) The only difference between the two models is the proteins that are involved in removing the RNA pol II from the DNA.

21)

Which region of DNA contains the coding information for a protein in a eukaryote?

A) B) C) D)

22)

Exons Introns Enhancers Promoters

What modification acts to stabilize eukaryotic mRNA? A) B) C) D) E)

Alternative splicing RNA editing RNA interference Polyadenylation Trimming

23) If a nucleotide in a eukaryotic mRNA coding sequence does not appear in the genomic DNA sequence, the most likely modification to have occurred is __________.

Version 1

5

A) B) C) D) E)

alternative splicing RNA editing 5' capping polyadenylation trimming

24) In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S, and 28S rRNA occurs where?

A) B) C) D) E)

In the cytoplasm In the nucleolus In the endoplasmic reticulum In the Golgi body Throughout the cell

25) The consensus sequences at a bacterial promoter are 5' TTGACA 3' and 5' TATAAT 3' at -35 and -10 respectively. Which of the following sequences would be most easily recognized by σ factor?

A) B) C) D)

5' TTGAAA 3' 5' TAAATT 3' 5' TATATA 3' 5' TTCAGA 3'

26) A gene that undergoes rho-dependent termination has a mutation in the rut site. How will this influence transcriptional activity?

Version 1

6

A) Transcription will terminate normally as Rho termination relies on the rut site to enhance termination; it is not essential for termination B) Transcription will stop immediately because RNA polymerase will sense there is a mutation C) Transcription will continue until another termination sequence, either Rho dependent or independent is reached D) There will be no transcription initiation

27) What region in eukaryotic genes usually contains the majority of regulatory elements such as GC and CAAT boxes?

A) B) C) D)

28)

0 to 50 -50 to 0 -50 to -100 -100 to -150

What basal transcription factor is a helicase?

A) B) C) D)

TFIID TFIIH TFIIF TFIIB

29) Prokaryotic genes are colinear with their proteins, but this is not true for many eukaryotic genes.

A) True B) False C) It is unknown at this time

30)

What enables the splicing of group I and II introns?

Version 1

7

A) B) C) D)

Spliceosomes Ribozymes snRNA Poly-A tail

31) What do both the rho-dependent and rho-independent mechanisms of termination have in common?

A) B) C) D)

32)

Terminate transcription immediately after the stop codon A sequence rich with A-U base pairs Both require a helicase to separate the DNA-RNA complex Formation of a stem-loop structure

What is the purpose of phosphorylating the carboxy terminal domain (CTD)?

A) Convert from initiation to the elongation stage B) To aid in transcriptional initiation C) Phosphorylate transcription factors D) To aid in promoter recognition

33)

A main function of TFIID is __________.

A) B) C) D)

to recognize the TATA box to act as a helicase to terminate RNA polymerase II binding to phosphorylate the CTD of RNA polymerase II

34) What snRNP binds to the 5' splice site and is released after the 5' end of the intron is attached to the branch site?

Version 1

8

A) B) C) D)

35)

U1 U2 U5 U6

What is a mechanism by which tRNA is processed in E. coli?

A) B) C) D)

RNaseP acts as an endonuclease.

The tRNA is spliced.

RNAseD acts as an endonuclease. tRNA is not processed in E. coli.

36) What is the correct order of elements that comprise a functional protein encoding gene in a prokaryote?

A) B) C) D)

37)

Promoter, regulatory region, transcribed region, terminator Regulatory region, promoter, transcribed region, terminator Regulatory region, promoter, terminator, transcribed region Promoter, transcribed region, regulatory region, terminator

What is unusual about the 5' cap found on almost all eukaryotic mRNAs?

A) The nucleotide added is a guanine methylated at N7 and the bond is created between the phosphate group on the guanine and the phosphate on the terminal nucleotide B) The nucleotide added is a guanine methylated at N7 and the bond is a typical phosphodiester bond with the terminal nucleotide C) The nucleotide added is an adenine methylated at N7 and the bond is created between the phosphate group on the guanine and the phosphate on the terminal nucleotide D) The nucleotide added is an adenine methylated at N7 and the bond is typical phosphodiester bond with the terminal nucleotide

Version 1

9

38)

What occurs in both prokaryotic and eukaryotic tRNA maturation?

A) B) C) D)

39)

The pre tRNA molecule is trimmed by exo and endonucleases The pre tRNA is spliced The mature tRNA is capped at the 5' end There is extensive RNA editing

What percentage of human pre-mRNA is alternatively spliced?

A) B) C) D)

70% 23% 5% 2%

40) This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splicesome. In addition, a splicing repressor prevents the recognition of the 3' splice site in exon 7. What exons will be present in the mature mRNA?

A) B) C) D) E)

Version 1

1, 2, 3, 5, 6, 8 1, 2, 3, 4, 5, 6, 7, 8 1, 2, 3, 4, 5, 6, 8 1, 2, 3, 5, 6, 7, 8 1, 2, 3, 5, 6

10

41) You are working in a lab studying mRNAs from many different species. You need to distinguish between mRNAs in a mixed sample. You begin by having all of the mRNAs sequenced, including the mitochondrial mRNAs. You notice a high number of C to U conversions in the mitochondrial mRNAs from a certain portion of the sample. You conclude that this portion of the sample is from __________.

A) B) C) D) E)

mammals plants slime mold Drosophila Trypanosomes

42) A mutation occurs in one of the general transcription factors necessary for eukaryotic transciption. A pre-intiation complex forms, but the open complex does not form. Further, TFIIB, TFIIE, and TFIIH are not released from the DNA. The mutation is most likely in which general transcription factor?

A) B) C) D) E)

TFIIB TFIID TFIIE TFIIF TFIIH

43) You have an RNA molecule that contains introns. You wish to carry out an in vitro splicing reaction with this RNA and cellular extracts. You want to determine if splicing is occuring via self-splicing or through the spliceosome. What enzyme could you add to the reaction to make this determination?

A) B) C) D)

Version 1

Protease DNase RNase Lipase

11

Answer Key Test name: Chap 12_7e 1) TRUE 2) TRUE 3) FALSE 4) FALSE 5) TRUE 6) FALSE 7) FALSE 8) TRUE 9) TRUE 10) TRUE 11) TRUE 12) [A, B, F] 13) A 14) D 15) D 16) C 17) D 18) E 19) D 20) A 21) A 22) D 23) B 24) B 25) A 26) C Version 1

12

27) C 28) B 29) A 30) B 31) D 32) A 33) A 34) A 35) A 36) B 37) A 38) A 39) A 40) A 41) B 42) E 43) A

Version 1

13

CHAPTER 13 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) The genetic code is nearly universal in nuclear DNA from bacteria to mammals. ⊚ ⊚

2)

All mature polypeptides contain a methionine at the N-terminus. ⊚ ⊚

3)

true false

The structure of the ribosome is uniform throughout a eukaryotic cell. ⊚ ⊚

5)

true false

61 different tRNAs are required for translation both in vivo and in vitro. ⊚ ⊚

4)

true false

true false

The anticodon on the mRNA recognizes the codon on the tRNA. ⊚ ⊚

true false

6) During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site. ⊚ ⊚

7)

true false

Transcription and translation may occur simultaneously in prokaryotic cells.

Version 1

1

⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

8) Select the statements that are true regarding the experiments by Beadle and Tatum.

(Check all that apply.)

A) B) C) D)

9)

They used the mold Neurospora as a model organism.

They isolated strains that could not grow on minimal media.

They established the link between a gene and an enzyme or protein.

They were able to create loss-of-function mutations in any enzyme they chose.

Select all stop codons.

A) B) C) D) E)

UGA UAA UAG AUG UUA

10) Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'-UAC-3'. (Check all that apply.)

A) B) C) D) E)

5'-AUG-3' 5'-IUA-3' 5'-AUA-3' 5'-GUA-3' 5'-GUI-3'

11) Based on our modern understanding, what revisions are necessary to the original onegene / one-enzyme hypothesis? (Check all that apply.)

Version 1

2

A) Alternative splicing allows one gene to encode multiple polypeptides.

B) Some genes encode RNAs, not enzymes.

C) Some genes encode lipids, not enzymes.

D) Some genes encode polypeptides that are not enzymes, such as structural proteins.

E) Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.

F) Enzymes are not encoded by genes after all — they are constructed through separate biochemical processes.

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

12) What is true according to the adaptor hypothesis?

A) The anticodon and amino acid have no relationship.

B) A given tRNA can carry any of the twenty amino acids.

C) The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.

D) An amino acid recognizes the codon in mRNA.

13)

Select the codon that is not synonymous with CUU. A) B) C) D) E)

14)

CUC UUG CUA AUU UUA

The primary structure of a protein is directly associated with __________.

Version 1

3

A) B) C) D)

15)

α-helices and β-sheets are examples of what level of protein structure?

A) B) C) D)

16)

Primary structure Secondary structure Tertiary structure Quaternary structure

An anticodon is located on __________.

A) B) C) D) E)

17)

regular repeating shapes, such as beta-sheets the three-dimensional shape of the protein the linear sequence of the amino acids the interaction of two or more peptide chains

DNA mRNA rRNA tRNA snRNA

A tRNA that has an amino acid attached is called __________.

A) B) C) D)

an rRNA a degenerate tRNA a coding tRNA a charged tRNA

18) Kozak's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at -35 and -10. Where is the consensus sequence for translational initiation according to Kozak's rules?

Version 1

4

A) B) C) D)

19)

Select the amino acid that has been activated by aminoacyl-tRNA synthetase.

A) B) C) D)

20)

-6 to +4 -12 to -2 +1 to +10 -9 to +1

Amino acid · ATP · aminoacyl-tRNA synthetase Amino acid · aminoacyl-tRNA synthetase Amino acid + AMP + PPi Amino acid · AMP

What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A B) E C) P

21)

What site does the initiator tRNA bind to on the ribosome?

A) A B) E C) P

22)

What is responsible for binding the initiator tRNA in eukaryotes?

Version 1

5

A) B) C) D)

eIF2 EF-Tu eIF3 EF-G

23) How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' A) B) C) D)

24)

Where are the ribosomal subunits assembled in eukaryotes?

A) B) C) D)

25)

Nucleus Nucleoid Nucleolus Nuclear envelope

A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?

A) B) C) D)

26)

7 8 10 13

Glycine Proline Alanine Arginine

Where does mRNA/tRNA codon-anticodon recognition take place?

Version 1

6

A) B) C) D)

27)

What typically terminates the process of translation?

A) B) C) D) E)

28)

the 16S rRNA tRNA mRNA snRNA aminoacyl-tRNA synthetase

The peptidyl transferase is a component of __________.

A) B) C) D) E)

30)

Rho proteins Aminoacyl tRNA synthase rRNA Stop codons Introns

The decoding function of the ribosome is conducted by __________.

A) B) C) D) E)

29)

30S 40S 50S The surface between the two ribosomal subunits

DNA tRNA the ribosome the protein being translated mRNA

The C-terminus of a polypeptide always contains __________.

Version 1

7

A) B) C) D) E)

31)

a stop codon a carboxyl group an amino group carbon dioxide None of these choices are correct.

RF1 and RF2 are active during _______.

A) B) C) D)

initiation elongation termination peptidyl transfer

32) You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)

A) B) C) D) E)

This person will exhibit symptoms of alkaptonuria.

This person will exhibit symptoms of tyrosinosis.

This person will exhibit symptoms of phenylketonuria.

This person will exhibit symptoms of alkaptonuria and phenylketonuria.

This person will be phenotypically normal.

33) In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?

Version 1

8

A) B) C) D) E) F)

Cell shape or organization Transport Movement Cell signaling Cell surface recognition Enzymes

34) You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA? A) B) C) D) E)

35)

Equal amounts of A, C, U, and G 50% C and 50% A 70% C and 30% A 50% C and 50% U 50% A and 50% G

What is the name of the enzyme that adds CCA to the 3' end of tRNAs? A) B) C) D)

tRNA nucleotidyltransferase Aminoacyl-tRNA synthetase RNA polymerase Peptidyl transferase

36) Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from?5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

Version 1

9

A) B) C) D)

1st 2nd 3rd 4th

37) What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

A) B) C) D)

1 2 3 4

38) You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A) B) C) D)

36% 22% 14% 28%

39) Suppose you performed a triplet binding assay with the triplet 5'-UAA-3'. What radiolabeled amino acids do you expect to find bound to the filter?

A) B) C) D)

Version 1

Tyrosine Asparagine Methionine None

10

40) You have cloned a gene for a mammalian mitochondrial protein that is rich in tryptophan.

If you translate this protein in the cytoplasm rather than the mitochondria, what result do you expect?

A) The protein will be shorter than its mitochondrial counterpart.

B) The protein will be longer than its mitochondrial counterpart.

C) The protein will be the same as its mitochondrial counterpart.

D) The protein will contain completely different amino acids when compared to its mitochondrial counterpart.

Version 1

11

Answer Key Test name: Chap 13_7e 1) TRUE 2) FALSE 3) FALSE 4) FALSE 5) FALSE 6) TRUE 7) TRUE 8) [A, B, C] 9) [A, B, C] 10) [B, C, D] 11) [A, B, D, E] 12) C 13) D 14) C 15) B 16) D 17) D 18) A 19) D 20) C 21) C 22) A 23) B 24) C 25) C 26) D Version 1

12

27) D 28) A 29) C 30) B 31) C 32) C 33) F 34) B 35) A 36) B 37) B 38) A 39) D 40) A

Version 1

13

CHAPTER 14 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) In the lac operon, the operator is an example of a trans-effect genetic regulation. ⊚ ⊚

2)

Constitutive genes are those that have constant levels of expression. ⊚ ⊚

3)

true false

Negative transcriptional regulation is conducted by activator proteins. ⊚ ⊚

4)

true false

true false

Repressor proteins are responsible for negative transcriptional regulation. ⊚ ⊚

true false

5) The term enzyme adaptationis used to describe an enzyme that appears in a living cell following exposure to a specific substrate. ⊚ ⊚

true false

6) DNA that contains instructions for two or more structural genes produces monocistronic mRNA. ⊚ ⊚

7)

true false

In the lac operon, the operator site is recognized by an activator protein.

Version 1

1

⊚ ⊚

true false

8) The regulation of the CAP complex using cAMP is an example of inducible genetic regulation. ⊚ ⊚

9)

Operons that code for catabolic enzyme systems are typically regulated by repressors. ⊚ ⊚

10)

true false

true false

Operons that code for anabolic enzyme systems are typically regulated by inducers. ⊚ ⊚

true false

11) The form of regulation that involves a physical change in the shape of an enzyme is called allosteric regulation. ⊚ ⊚

12)

true false

A riboswitch only affects translation of an operon. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

13) Regulation of gene expression may occur at which of the following levels? (Check all that apply.)

Version 1

2

A) B) C) D)

14)

Post translation Constitutive expression Translation Transcription

Which of the following encode polycistronic mRNA? (Check all that apply.)

A) B) C) D)

Lac operon Operator site Trp operon CAP site

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

15) A gene is inducible and under negative control. Which of the following pairs will allow expression of this gene?

A) B) C) D)

Activator + repressor Activator + inhibitor Repressor + inducer Repressor + co-repressor

16) An activator is present and results in the increase in transcription of the target gene. This is an example of _______________.

A) B) C) D)

17)

termination positive control negative control feedback inhibition

How many promoters are in an operon?

Version 1

3

A) B) C) D)

1 2 3 It depends on how many genes are present in the operon

18) A deletion in an operon removes the terminator. How will that affect the transcript that is produced from the operon?

A) B) C) D) E)

The transcript will be produced and normal in length The transcript will be produced, but shorter than normal The transcript will be produced, but longer than normal The transcript will produced, but will contain a deletion The transcript will not be produced

19) A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon?

A) B) C) D) E)

20)

The transcript will be produced and normal in length The transcript will be produced, but shorter than normal The transcript will be produced, but longer than normal The transcript will produced, but will contain a deletion The transcript will not be produced

Allosteric regulation is accomplished by __________.

A) B) C) D)

a small molecule that fits into an enzyme's active site a large protein that blocks an enzyme's active site a small molecule that fits into a site on the enzyme that is not the active site a small molecule that covalently modifies a site on the enzyme that is not the active

site

Version 1

4

21)

What is the gene responsible for attenuation in the trp operon?

A) B) C) D)

22)

trpL trpR trpD trpC

What stem-loop conformations favor attenuation?

A) B) C) D)

1-2 1-2 and 2-3 2-3 1-2 and 3-4

23) If CAP could not bind to its CAP site, then what would be the result? Assume lactose is present in each scenario.

A) Transcription would be difficult to repress in the presence of glucose B) Transcription would be difficult to activate in the presence of glucose C) Transcription would be difficult to activate in the absence of glucose

24) In Jacob, Monod, and Pardee's experiment, how many functional copies of lacI were there in the merozygote?

A) B) C) D)

0 1 2 3

25) In Jacob, Monod, and Pardee's experiment, what would have been the conclusion if all four tubes produced a yellow color when b-ONPG was added?

Version 1

5

A) B) C) D)

Expression of the lac operon is constitutive whether LacI provides the binding site for the repressor LacI encodes a diffusible repressor The researcher added too much b-ONPG

lacI is functional or not

26) In the lac operon, the CAP site is located next to the __________. When both lactose and glucose are present, this leads to a rate of transcription that is __________.

A) B) C) D)

terminator; low promoter; high terminator; high promoter; low

27) What would be the result if the U-rich sequence after the 3/4 stem loop in the trp operon was replaced by a UG-rich sequence?

A) Attenuation would occur if tryptophan was high B) Attenuation would occur if tryptophan is low C) Attenuation would not occur if tryptophan was high

28)

Which of the following is an example of post translational regulation in prokaryotes?

A) B) C) D)

29)

Sterically blocking the ribosome Phosphorylation of an enzyme Incorporation of antisense RNA Altering the structure of the mRNA

Enzymes involved in metabolism are most likely regulated via __________.

Version 1

6

A) B) C) D)

feedback inhibition acetylation methylation None of these choices are correct.

30) If a bacteria is placed in an environment that contains both glucose and lactose, the regulation of the lac operon will allow which nutrient to be processed first?

A) B) C) D)

31)

The regulation of protein function is called __________.

A) B) C) D)

32)

posttranslational regulation transcriptional regulation translational regulation posttranscriptional regulation

Translational regulatory proteins recognize specific areas of what molecule?

A) B) C) D)

33)

Glucose Lactose Both will be processed equally Neither will be processed in this environment

tRNA Ribosome rRNA mRNA

Antisense RNA does which of the following?

Version 1

7

A) B) C) D)

Inhibits the formation of the open complex in transcription Occupies the A and P sites of the ribosome Binds to the mRNA and prevents translation Prevents the correct folding of a newly formed peptide

34) A mutation in the lacI gene prevents the gene product from binding allolactose. What will the expression level of the operon be in the absence of lactose?

A) B) C) D)

No transcription Positive regulation Constitutively active Transcription will occur only in the presence of glucose

35) An enzyme catalyzes a substrate into a final product. When the concentration of the final product is high enough, it binds to a regulatory site on the enzyme. This binding at the regulatory site changes the shape of the enzyme, which prevents it from binding the substrate and prevents formation of more final product. This is an example of a/an __________.

A) B) C) D)

posttranslational modification allosteric enzyme translational repressor methylation

36) In a particular E. coli strain, a mutation in the thiMD operon results in improper formation of the stem loop secondary structure making it impossible to bind TPP. There are two enzymes encoded by the thiMD operon. How many of the enzymes encoded in the thiMD operon are translated?

A) B) C) D)

Version 1

Two Zero Three One

8

37) If the Trp codons in the trpL gene were mutated to encode another amino acid, what would the result be?

A) B) C) D)

The The The The

trp operon would never be transcribed. trp operon would always be transcribed. trp operon would only be transcribed when tryptophan in the cell was low. trp operon would only be transcribed when tryptophan in the cell was high.

38) You are studying riboswitches in different bacterial strains and you mix up two of your samples! One sample is from E. coli and the other is from B. subtilis. You have an assay in the lab that allows you measure the levels of the enzymes encoded by the thi/thiMD operon (assume the enzymes from the two organisms are similar). Would this assay allow you to distinguish between the two strains?

A) B) C) D) E)

Version 1

Yes - if TPP levels are low and the proteins are produced, the strain is E. coli.

Yes - if TPP levels are low and the proteins are produced, the strain is B. subtilis.

Yes - if TPP levels are high and the proteins are produced, the strain is E. coli.

Yes - if TPP levels are high and the proteins are produced, the strain is B. subtilis.

No - it would be difficult to distinguish between the strains using this assay.

9

Answer Key Test name: Chap 14_7e 1) FALSE 2) TRUE 3) FALSE 4) TRUE 5) TRUE 6) FALSE 7) FALSE 8) TRUE 9) FALSE 10) FALSE 11) TRUE 12) FALSE 13) [A, C, D] 14) [A, C] 15) C 16) B 17) A 18) C 19) E 20) C 21) A 22) D 23) C 24) B 25) A 26) D Version 1

10

27) C 28) B 29) A 30) A 31) A 32) D 33) C 34) A 35) B 36) A 37) A 38) E

Version 1

11

CHAPTER 15 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences. ⊚ ⊚

true false

2) If a portion of a transcription factor's domain is structurally similar in a variety of organisms, it is called a motif. ⊚ ⊚

true false

3) A heterodimer occurs when two identical transcription factors interact on a sequence of DNA. ⊚ ⊚

true false

4) A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter. ⊚ ⊚

true false

5) Steroid hormones are an example of an effectorwhich regulates regulatory transcription factor activity. ⊚ ⊚

true false

6) Prior to hormone binding, receptors for steroid hormones are usually found in the nucleus of the cell.

Version 1

1

⊚ ⊚

true false

7) DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration. ⊚ ⊚

true false

8) Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling. ⊚ ⊚

9)

DNA methylation usually activates gene expression. ⊚ ⊚

10)

true false

Housekeeping genes are unmethylated and active in most cells. ⊚ ⊚

11)

true false

true false

A transactivation domain is an example of a motif found in transcription factors. ⊚ ⊚

true false

12) Methylation of DNA bases is one way that regulatory transcription factors may influence gene expression. ⊚ ⊚

Version 1

true false

2

13)

The activity of some transcription factors can be regulated by covalent modifications. ⊚ ⊚

14)

true false

When a glucocorticoid hormonebinds to the glucocorticoid receptor, HSP90 is released. ⊚ ⊚

true false

15) Insulators exert their effects on gene expression through histone acetyltransferase, histone deacetylase, and RNA polymerase. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

16) Select all structural motifs that promote protein dimerization.

A) B) C) D)

17)

Leucine zipper Helix-loop-helix Helix-turn-helix Zinc finger

How are eukaryotic transcription factors regulated? (Check all that apply.)

A) B) C) D)

Version 1

Covalent modification Binding to cytoskeletal elements Binding of an effector molecule Protein-protein interaction

3

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

18) Which DNA sequence would also work in place ofthe following bi-directional enhancer?

5' GTTC 3'3' CAAG 5' A) B) C) D)

19)

5' GAAC 3'3' CTTG 5' 5' CTTG 3'3' GAAC 5' 5' CAAG 3'3' GTTC 5' 5' CTTC 3'3' GAAG 5'

Which of the following is a region in DNA that binds to a steroid receptor?

A) B) C) D)

GRE IRE CRE CREB

20) A mutation in which of the following would result in little or no effect on the expression of a gene regulated by a CRE? A) B) C) D) E)

21)

G protein Adenylyl cyclase Protein kinase A CREB Glucocorticoid receptor

What activates CREB?

Version 1

4

A) B) C) D) E)

Binding of cAMP Phosphorylation Dimerization Lowering of cAMP concentration Binding to GRE

22) What would be the result of a mutation in Hsp90that prevented its binding to the glucocorticoid receptor?

A) B) C) D)

Glucocorticoid receptor could not form a dimer.

The nuclear localization signal would no longer function.

Expression of the regulated genes would become constitutive.

The hormone would not be able to bind to the glucocorticoid receptor.

23) What general transcription factor is most often affected by regulatory transcription factors?

A) B) C) D)

TFIIB TFIID TFIIE TFIIF

24) Which of the following recognizes response elements, control elements, and regulatory elements?

A) B) C) D)

Version 1

General transcription factors Regulatory transcription factors Mediator Transactivation domains

5

25) Which one of the following directly interacts with the DNA as a transcriptional regulator?

A) B) C) D) E)

26)

Histone acetyltransferases are directly involved in which of the following?

A) B) C) D) E)

27)

Nucleosome location DNA methylation Steroid hormone activity cAMP pathway

Genomic imprinting is a result of ___________.

A) B) C) D)

29)

Removal of histones from chromatin Movement of nucleosomes Chemical modification of histones Termination of gene expression Insertion of variant histone proteins

CpG islands are associated with which of the following?

A) B) C) D)

28)

cAMP G protein Protein kinase A CREB protein dimer Glucocorticoid response element

nucleosome location histone activation DNA methylation serine to leucine changes in the genetic code

For which of the following histones has variant forms not yet been identified?

Version 1

6

A) B) C) D) E)

H1 H2A H2B H3 H4

30) In ChIP-Seq, the DNA fragments to be sequenced are around 150 bp in length. What does this size of DNA represent?

A) B) C) D) E)

The length of a promoter The amount of DNA wrapped around a nucleosome The average length of a gene The average distance between genes The amount of DNA between nucleosomes

31) A particular cell contains all of the standard histones but lacks several histone variants.

Which of the following MAY be true of this cell?

A) B) C) D) E)

32)

The cell will be completely unable to remodel its chromatin.

The cell will have an enhanced ability to chemically modify its histones.

The cell will be unable to express any of its genes at all.

The cell will express different sets of genes than other cells in the same organism.

The cell will not be able to divide.

Which of the following might complicate the interpretation of ChIP-Seq data?

A) Because histones can be moved around or ejected from the chromatin,DNA that is only sometimes wrapped around a histone might not be sequenced.

B) DNA wrapped around nucleosomes can never be sequenced.

C) The regions of DNA wrapped around a histone is too long to be sequenced with current technologies.

D) The DNA between nucleosomes are too compacted to be sequenced.

Version 1

7

33) A particular gene has a mutation in its NFR that causes it to bind abnormally tightly to histones. What effect would you expect this mutation has on the expression of this gene?

A) The expression of the gene would be abnormally high.

B) The effect on gene expression is impossible to predict.

C) The gene would encode a different protein instead.

D) The expression of the gene would be abnormally low or absent.

E) The promoter of the gene will be constantly available to transcription factors and RNA polymerase.

34) Which DNA sequence important for gene expression is usually contained within the NFR? A) B) C) D) E)

35)

Core promoter CREB binding site Histone binding site Transcription termination sequence Hormone response element

What might happen if the insulator between two genes is missing?

A) Without the insulator, neither gene can be transcribed.

B) Transcription factors influencing one gene’s expression may abnormally influence a neighboring gene’s expression.

C) Transcription factors will not be able to influence the expression of either gene.

D) Without insulation, both genes will be expressed at maximal levels.

E) Transcription factors will not be able to bind to the insulator.

36)

Which of the following is the most likely location of an insulator sequence?

Version 1

8

A) B) C) D) E)

37)

At the end of a gene In the middle of a gene At the beginning of a gene Between two genes Within an intron

Which of the following is a major finding from the ENCODE project?

A) B) C) D)

More than 80% of the human genome sequence is linked to a biological function.

In humans, one gene encodes exactly one protein.

Genes were identified for all known diseases.

There are more than 10 million regulatory sites in human DNA.

38) In the presence of abundant iron in the cell, the iron binds IRP. The complex is then released from IREs leading to __________.

A) an increase in ferritin mRNA translation and a decrease in transferrinreceptor mRNA stability B) an increase in transferrin receptor mRNA stability and a decrease in ferritin mRNA translation C) an increase intransferrin receptor mRNA stability andferritin mRNA translation D) an decreaseintransferrin receptor mRNA stability andferritin mRNA translation

39) In numerous studies that investigate gene expression, the mRNA levels of proteins are examined. If one is interested in the amount of protein being produced, is this the best approach to use?

Version 1

9

A) No, directly determining the amount of protein produced would be best because many steps are involved in regulating protein levels.

B) Yes, this is the best approach because all mRNA is eventually translated into protein.

C) No, examining the transport of mRNA from the nucleus would provide more reliable data since mRNA must be transported to the cytoplasm for translation.

D) No, examining mRNA processing would be more reliable since that is the limiting step for protein production.

40) If a DNA tempate is being transcribed in vitro what would be the effect on RNA production if an inhibitor of TFIID was added?

A) Transcription would stop immediately.

B) Transcripts being produced would continue but there would be no new initiation.

C) Transcription would stop immediately but there would be one more round of initiation.

D) Transcription rates of templates already being transcribed would increase but there would be no new initiation.

41) In apoptosis, a process of programmed cell death, the cell undergoes controlled degradation of cellular components including nuclear DNA. Researchers have noted that if the DNA is isolated from an apoptotic cell, it appears as distinct bands of multiples of approximately 145 bases in length. Why does this occur?

A) B) C) D)

There is a specific DNase that digests DNA every 145 base pairs.

DNA sequences that appear every 145 base pairs allows for easier DNA breakage.

DNA that is wrapped around the histones is not being degraded.

DNA is coated with transcription factors every 145 base pairs.

42) A mutation in the iron response protein (IRP) that made it incapable of binding iron would result in __________.

Version 1

10

A) B) C) D)

no expression of either ferritin and transferrin receptor constituitive transferrin receptor and ferritin expression consituitve transferrin receptor and no ability to stimulate ferritin expression an increase in transferrin receptor and ferritin expression

43) Researchers frequently wish to produce proteins in cells in a regulated fashion so that they effects of the protein can be studied undercontditions twhen and when it is not present.

Which of the strategies outlined below would be best sutied for these types of studies?

A) Creating a piece of DNA where the gene for their protein of interest is under the control of a house keeping gene promoter.

B) Creating a piece of DNA where the gene for the protein of interest is under control of a glucocorticoid response element.

C) Creating a piece of DNA where the gene for the protein of interest lacks any regulatory regions and only has a core promoter.

D) Creating a piece of DNA where the gene for the protein of interest is not changed from how it is in the genome.

Version 1

11

Answer Key Test name: Chap 15_7e 1) FALSE 2) TRUE 3) FALSE 4) FALSE 5) TRUE 6) FALSE 7) FALSE 8) TRUE 9) FALSE 10) TRUE 11) FALSE 12) FALSE 13) TRUE 14) TRUE 15) FALSE 16) [A, B] 17) [A, C, D] 18) A 19) A 20) E 21) B 22) C 23) B 24) B 25) D 26) C Version 1

12

27) B 28) C 29) E 30) B 31) D 32) A 33) D 34) A 35) B 36) D 37) A 38) A 39) A 40) B 41) C 42) C 43) B

Version 1

13

CHAPTER 16 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Both parents usually imprint the same gene. ⊚ ⊚

true false

2) The red1'allele is said to beparamutagenic,because it can change the expression of another allele. ⊚ ⊚

true false

3) After the paramutable allele is altered, its expression is the same or similar to the paramutagenic allele. ⊚ ⊚

4)

In maize red1' is a strongly expressed allele that is paramutable. ⊚ ⊚

5)

true false

true false

In Arabidopsis, the FLC gene is necessary to promote flower development. ⊚ ⊚

true false

6) The trimethylation of lysine 27 in histone H3(H3k27) causes the repression of the FLC gene. ⊚ ⊚

Version 1

true false

1

7)

Covalent histone modification is sometimes involved in cell differentiation. ⊚ ⊚

true false

8) Research suggests that the silencing of paramutagenic may involve short RNAs incorporated into RNA-induced silencing complexes. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

9) Select the events that are part of the mechanism for epigenetic regulation of the Igf2 gene. (Choose all that apply.)

A) B) C) D)

Methylation of the H19 locus Methylation of the ICR and DMR domains Binding of CTCFs to methylated sequences Methylation of CTCFs

10) Feeding a specific diet to female mice may result in an increased proportion of pseudoagouti offspring if __________.

A) the female carries the Avy allele B) the offspring have the genotype Avya C) the transposon at the Avylocus in the progeny is hypermethylated

11)

How might heterochromatin silence the expression of genes? (Check all that apply.)

Version 1

2

A) B) C) D)

Limiting the access of activators to the DNA Limiting the access of general transcription factors to the DNA Limiting the access of coactivators to the DNA Limiting the access of repressors to the DNA

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

12) What gene(s) is/are encoded in the Xic? A) B) C) D)

13)

Xist are genes are in the Xic region

What genes appear to be controlled by the Xic? A) B) C) D)

14)

Xce Xist Tsix Both the Tsix and

Xist and Xist TsiX Xic

Tsix

Expression of ______ would inhibit X-inactivation.

A) Xic B) Xist C) Tsix

15)

What gene is most responsible for X-inactivation?

Version 1

3

A) B) C) D)

16)

In the Igf-2 allele, which chromosome is imprinted? Which is expressed?

A) B) C) D)

17)

Acetylation Nitration Phosphorylation Methylation

Most imprinted genes are silenced. What is one exception to this rule?

A) B) C) D)

19)

Paternal; paternal Paternal; maternal Maternal; paternal Maternal; maternal

What is the molecular mechanism for imprinting a gene?

A) B) C) D)

18)

Xic Xist Tsix Xce

H19 Igf-2 Xist Tsix

Epigenetic inheritance may occur at which of the following stages?

Version 1

4

A) B) C) D)

20)

The expression of a single allele is associated with which of the following?

A) B) C) D)

21)

Oogenesis Spermatogenesis Embryogenesis All of these choices are correct.

X-inactivation Genomic imprinting Vernalization Heterochromatin

The differentially methylated region (DMR) is associated with which of the following?

A) B) C) D) E)

X-inactivation Genomic imprinting Paramutation Heterochromatin All of these choices are correct.

22) A modification that occurs to a nuclear gene that alters gene expression, but not permanently, is called _______ inheritance.

A) B) C) D)

23)

extranuclear cytoplasmic epigenetic nuclear

Which of the following are molecular mechanisms used in epigenetic gene regulation?

Version 1

5

A) B) C) D)

DNA methylation Covalent histone modification Chromatin remodeling All of these choices are correct.

24) If a cell is fused with another cell, which of the following would be the best example of a trans-mechanism of epigenetic control?

A) A gene that is originally silenced in one cell but expressed in the other is silenced in the hybrid.

B) A gene that is originally silenced in one cell but expressed in the other is still expressed in the hybrid.

C) The methylation pattern of the same gene from either cell is not altered.

D) There are no examples that could conform to a trans-mechanism.

25)

Which of the following statements are correct?

A) Changes in gene expression based on environmental conditions are not considered normal while developmental changes are.

B) Environmental epigenetic changes can vary due to the exposure of the organism to different environmental conditions, while those programmed during development are the result of stimuli generated by the organism itself.

C) Environmental epigenetic gene regulation only occurs in reptiles and insects, while developmental epigenetic regulation occurs in all animals.

D) Environmental epigenetic gene regulation is typically reversible while developmental epigenetic gene regulation is typically not reversible.

26)

Which of the following is part of the process of X chromosome inactivation?

Version 1

6

A) Expression of Xist from both chromosomes at the start of the process B) Binding of multiple Xist transcripts to Xic on the X chromosome that will be inactivated C) Compaction of the active X chromosome into a Barr body D) Binding of Tsix transcripts to the X chromosome to be inactivated after the Xist transcripts binds to Xic

27) What is the difference between the trithorax (TrxG) and polycomb (PcG) complexes of proteins?

A) TrxG proteins methylate lysine 27 on histone H3 while PcG complexes methylate lysine 4 on H3.

B) Methylation of lysine at position 4 on H3 results in silencing of gene expression.

C) TrxG complex proteins activate gene expression by methylating lysine 4 on H3, while PcG complex proteins repress gene expression by methylating lysine 27 on H3.

D) Methylation of H3 on lysine 27 can result in activation of transcription.

28) Gene methylation can be detected through the use of restriction endonucleases. Usually these are used in pairs where one enzyme will digest only unmethylated DNA in its recognition sequence while the other is insensitive to methylation. Which of the following statements is correct?

A) The enzyme that is insensitive to methylation serves as a control to make sure the inability of the other enzyme to digest DNA is not due to a mutation.

B) These are used in pairs since experiments have to be replicated and this one way of performing a replication of the experiment.

C) The experimental design is flawed since there should be a third enzyme that would serve as a positive control.

D) This experimental design is able to detect most of the methylated C residues in a particular region of DNA.

29)

CpG islands are associated with which of the following?

Version 1

7

A) B) C) D)

Nucleosome location DNA methylation Steroid hormone activity Termination of translation

30) In a 2008 experiment, researchers fed bee larvae a diet that should produce worker bees, but also injected the larvae with a DNA methyltransferase inhibitor. Most of the larvae became what type of bee?

A) B) C) D)

Queen bees Worker bees Nurse bees Male bees

31) You are studying a winter-annual Arabidopsisplants. You identify a strain with a mutation in the VIN3 gene that renders it inactive. When do you expect this plant to flower?

A) The plant will always be able to flower.

B) The plant will never be able to flower.

C) These plants will flower when conditions are favorable, but will not require vernalization.

D) These plants will flower once vernalization has occurred, but will not require favorable conditions.

32) You are studying a winter-annual Arabidopsisplants. You identify a strain in which the COLDAIR RNA is unstable and is degraded immediately after synthesis. When do you expect this plant to flower?

Version 1

8

A) The plant will always be able to flower.

B) The plant will never be able to flower.

C) These plants will flower when conditions are favorable, but will not require vernalization.

D) These plants will flower once vernalization has occurred, but will not require favorable conditions.

33) You are studying a summer-annual Arabidopsisplants. You identify a strain with a mutation in the VIN3 gene that renders it inactive. When do you expect this plant to flower?

A) You expect the plant to flower normally.

B) You do not expect the plant to flower.

C) The plant will grow from fall to spring instead of spring to fall.

D) These plants will flower once vernalization has occurred, but will not require favorable conditions.

34) Regions of chromatin that are more compact are called __________; they are usually found __________ in the nucleus.

A) B) C) D)

heterochromatin; at the periphery euchromatin; centrally heterochromatin; centrally euchromatin; at the periphery

35) You are studying a chromosome in a new animal species. The presence of what element would make you most confident that a region is facultative heterochromatin and not constitutive heterochromatin?

A) B) C) D)

Version 1

DNA methylation LINE-type repeat sequences PTMs of histones Satellite sequences

9

36) Following mitosis, the two daughter cells usually have __________ pattern of facultative heterochromatin and __________ pattern of constitutive heterochromatin as was present in the mother cell.

A) B) C) D)

the same; the same the same; a different a different; the same a different; a different

37) ICF syndrome can be caused by a mutation in the Dnmt3 gene which encodes _________.

A) B) C) D)

DNA methyltransferase acetyltransferase histone variant histone methyltransferase

38) Imagine all the histone H3 molecules in the cell have a mutation that changes their lysine-9 residue to an alanine. Assuming this cell could still live, what would be the result?

A) The ability of the cell to form heterochromatin would be hindered.

B) The ability of the cell to form euchromatin would be hindered.

C) There would not be much of an effect because lysine and alanine are similar amino acids.

D) The ability of the cell to imprint genes would be hindered.

39) Mice with a paramutagenic allele of the kit gene (here called kit' ) have white feet and white spots on their tails. Mice with the paramutable kit allele have brown feet and a brown tail.

If you cross mice that are homozygous for the paramutagenic allele with those that are homozygous for the paramutable allele, what will be the phenotype of the progeny? Assume that the kit' allele is very stable and very paramutagenic.

Version 1

10

A) All mice will have white feet and white spots on their tails.

B) All mice will have brown feet and tails.

C) Mice will be in a 3:1 ratio of white feet and white spots on their tails : brown feet and brown tails.

D) Mice will be in a 1:1 ratio of white feet and white spots on their tails : brown feet and brown tails.

40) You discover a new paramutagenic allele in mice that causes them to have spiky fur. You call this gene spi. Mice with the paramutagenic allele of theof the spi gene (here called spi' ) have spiky fur. Mice with the paramutable spi allele have normal flat fur. You also find that the paramutation rate of this allele is only 40%, that is, it only causes paramutation 40% of the time.

If you cross mice that are homozygous for the paramutagenic allele with those that are homozygous for the paramutable allele, what will be the phenotype of the progeny? Assume that the spi' allele is very stable, and that, if not paramutated, spi is dominant to spi'.

A) B) C) D)

Version 1

All of the mice will have spiky fur.

All of the mice will have flat fur.

40% of the mice will have spiky fur and 60% will have flat fur.

60% of the mice will have spiky fur and 40% will have flat fur.

11

Answer Key Test name: Chap 16_7e 1) FALSE 2) TRUE 3) TRUE 4) FALSE 5) FALSE 6) TRUE 7) TRUE 8) TRUE 9) [B, C] 10) [B, C] 11) [A, B, C] 12) D 13) A 14) C 15) B 16) A 17) D 18) B 19) D 20) B 21) B 22) C 23) D 24) A 25) B 26) B Version 1

12

27) C 28) A 29) B 30) A 31) B 32) B 33) A 34) A 35) B 36) A 37) A 38) A 39) A 40) C

Version 1

13

CHAPTER 17 CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

1) Select the four most common types of molecules to which ncRNAs bind.

A) B) C) D) E) F) G)

2)

Select functions that ncRNAs can perform. Choose all that apply.

A) B) C) D) E) F) G)

3)

DNA RNA Proteins Small molecules Lipids Ions Water

Scaffold Guide Ribozyme Blocker Decoy Generation of cellular energy Alteration of protein function or stability

Select the features that made protobiontspossible precursors of living cells.

A) A boundary separating the internal contents of the protobiont from the external environment B) Polymers inside the protobiont contained information C) Polymers inside the protobionthad catalytic functions D) Capability of self-replication E) Presence of organelles F) Polymers inside the protobiont could generate energy

Version 1

1

4) Select the ways in which modifications to the chromatin brought about by HOTAIR and associated proteinsare proposed to inhibit transcription.

A) Direct inhibition of RNA polymerase binding B) Attraction of other chromatin-modifying enzymes C) Formation of a double-stranded RNA structure between HOTAIR and the mRNA preventing translation D) Recruitment of repressors to the DNA

5) Select possible outcomes after RISC binds to an mRNA during RNA interference.

Choose all that apply.

A) B) C) D) E)

Inhibition of translation without mRNA degradation mRNA degradation Movement of theRISC-mRNA complex to a P-body Expulsion of the RISC-mRNA complex from the cell Cell death

6) You are working in a lab that studies snoRNAs. You mutate the antisense sequences in a C/D box snoRNA to completely different sequences. What results do you expect compared to wild type snoRNA? Check all that apply.

A) B) C) D) E) F)

Reduced binding of the snoRNA to the rRNA Reduced methylated ribose in the rRNA Reduced psuedouracil in the rRNA Increased binding of the snoRNA to the rRNA Increased methylated ribose in the rRNA Increased pseudouracilin the rRNA

7) Select the sequences that could serve as the H box in a H/ACA box snoRNA. Choose all that apply.

Version 1

2

A) B) C) D) E) F) G)

8)

5' AGAGCA 3' 5' ACGAGA 3' 5' ACA 3' 5' AUGAUGA 3' 5' AGUAGUA3' 5' AUAACA 3' 5' ACAAUA3'

Select functions that are mainly carried out by proteins in modern cells.

A) B) C) D)

Catalytic functions Structural roles Uptake of substances into cells Storage of information

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

9) In order of their occurrence what are the steps in RNA interference?

A) Processing of RNA transcript by Drosha and DGCR8, transport to cytoplasm, processing by Dicer, binding to proteins to form a RISC, binding to target mRNA B) Processing by Dicer, processing of RNA transcript by Drosha and DGCR8, transport to cytoplasm, binding to proteins to form a RISC, binding to target mRNA C) Processing of RNA transcript by Drosha and DGCR8, processing by Dicer, transport to cytoplasm, binding to proteins to form a RISC, binding to target mRNA D) Processing of RNA transcript by Drosha and DGCR8, binding to proteins to form a RISC, transport to cytoplasm, processing by Dicer, binding to target mRNA

10) In an in vitro translation assay radioactive amino acids can be incorporated into proteins and the proteins separated from the unincorporated amino acids (higher counts per minute indicates more protein synthesis). Given the following data what are the conclusions that you would come to?

Version 1

3

RNA added to reaction

Amount of radioactivity in protein in counts per minute

Insulin mRNA alone

10,000

Insulin mRNA with antisense insulin RNA

3,000

Insulin mRNA with antisense fibronectin RNA

11,000

No mRNA

150

Insulin mRNA with double-stranded insulin RNA

500

A) Double-stranded RNA is more efficient at inhibiting translation than antisense RNA. B) Antisense RNA is more efficient at inhibiting translation than double-stranded RNA. C) No conclusion about the efficiency of translation inhibition can be made as the positive and negative controls did not perform appropriately.

D) The experiment did not work since the antisense fibronectin did not have an effect on amino acid incorporation.

11) You are working in a lab that studies ncRNAs. You develop an assay to isolate ncRNAs and any associated molecules. You must then identify the molecules you have isolated. You find a molecule that is associated with an ncRNA that is not changed by protease, RNase, or DNase.

The associated molecule is most likely __________.

A) B) C) D)

a small molecule a protein an mRNA DNA

12) A bacterial ncRNA called OxySregulates translation by binding to the ShineDalgarnosequence, which preventsribosome binding. What is the function of this ncRNA? A) B) C) D)

13)

Blocker Decoy Ribozyme Scaffold

Ribozymes are RNA molecules with what type of activity?

Version 1

4

A) B) C) D)

14)

Catalytic Binding Protease Decoy

An RNA molecule with catalytic activity is called a/an __________.

A) B) C) D)

ribozyme ncRNA snRNA miRNA

15) Select the ncRNA that facilitates the binding of telomerase to the telomere and acts as a template for DNA replication.

A) B) C) D)

TERC snRNA SRP RNA XistRNA

16) SmY RNAs are a family of ncRNAsin nematodes that are thought to be involved in a special type of RNA splicing. Based on this function, SmY RNAsaremost likely members of which category of ncRNAs? A) B) C) D)

snRNA tRNA snoRNA siRNA

17) What ability, which modern eukaryotic cells also possess, did cells in an RNA world probably acquire that explains the existence of DNA? Version 1

5

A) B) C) D)

18)

Reverse transcription DNA replication Translation RNA splicing

The ncRNAHOTAIR recruits what type of proteins to target genes?

A) B) C) D)

Histone-modifyingcomplexes Transcription factors RNA polymerase Histone acetyltransferase

19) With which injection did Mello and Fire observe the lowest amount of mex-3 probe staining?

A) Injected with double-stranded RNA B) Injected with mex-3 antisense RNA C) Uninjected

20) Consider the two key roles that have been identified for SRP RNA. You have isolated a mutant SRP RNA. This RNA is able to perform its role as a scaffold for SRP proteins, but has lost its other function. How will this affect translation of SRP-containing proteins?

A) B) C) D)

21)

Partially translated proteins will be stuck in the cytosol.

Partially translated proteins will be stuck in the ER lumen.

Partially translated proteins will be stuck in the nucleus.

Translation will proceed normally.

What is the makeup of the bacterial and eukaryotic SRP, respectively?

Version 1

6

A) B) C) D)

Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 1 ncRNA, 6 proteins Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 6ncRNAs, 1 protein Bacterial: 1 ncRNA, 6 proteins; Eukaryotic: 1 ncRNA, 6 proteins Bacterial: 6ncRNAs, 1 protein; Eukaryotic: 1 ncRNA, 1 protein

22) Into which gene of the CRISPR-Cas system are fragments of bacteriophage DNA inserted?

A) B) C) D) E)

23)

Crispr tracr Cas9 Cas1 Cas2

The CRISPR-Cas system in bacteria is most similar to what system in vertebrates?

A) B) C) D)

Immune system Circulatory system Nervous system Digestive system

24) Based on what you know about cartilage-hair hypoplasia, which strategy involving ncRNAsdo you anticipate might be useful in treating this disease?

A) B) C) D)

Version 1

A viral vector to restore a particular ncRNA Anti-miRNA oligonucleotides Targeting of the miRNA-processing machinery Use of DNA demethylating agents and histone deacetylase inhibitors

7

25) You work in a lab that is studying PIWI proteins. You have isolated PIWI proteins from a cell, and they are in complexes. You wish to determine whether the complexes are piRITSs or piRISCs. What would be one way to differentiate between the two?

A) B) C) D)

26)

One of the proteins in the pRITS should have a nuclear localization signal.

One of the proteins in the pRITS should have nuclease activity.

One of the proteins in the pRITS should have acetylation activity.

One of the proteins in the pRITS should function as a transcription factor.

piRNA sequences are complementary to __________.

A) B) C) D)

RNA from a transposable element another RNA within the piRISC the Crispr gene bacteriophage DNA

27) Abnormal levels of miRNAs are associated with nearly all forms of what type of human disease?

A) B) C) D)

28)

Neurological disorders Cancer Cardiovascular disease Gastrointestinal disease

What humandisease is associated with mutations in Drosha?

A) B) C) D)

Version 1

Familial amyotrophic lateral sclerosis Alzheimer disease Heart arrhythmias Lung cancer

8

29) What is the name of the type of chemical modification on anti-miRNA oligonucleotides used to inhibit miRNA function that involves ribose sugars with an extra bridge connecting the 2' oxygen and the 4' carbon?

A) B) C) D)

30)

What effect would disabling exportin 5 have on RNA interference?

A) B) C) D)

31)

Locked nucleic acids Antagomirs Enoxacin RNaseMRP

In the absence of exportin 5 activity, no RNA interference could occur.

RNA interference would be unaffected by the lack of exportin 5 function. siRNAs could still carry out RNA interference, but miRNAs would not be made. miRNAs could still carry out RNA interference, but siRNAs would not be made.

ncRNAs are broadly categorized based on their __________.

A) B) C) D)

length function target molecule order of discovery

32) Which ncRNAs work to inhibit the epithelial-mesenchymal transition in adult cells, thus acting as tumor suppressors?

A) B) C) D)

Version 1

miR-200 family mi-R10a, miR-145, and miR-143 piRNAs snoRNAs

9

Answer Key Test name: Chap 17_7e 1) [A, B, C, D] 2) [A, B, C, D, E, G] 3) [A, B, C, D] 4) [A, B] 5) [A, B, C] 6) [A, B] 7) [A, F] 8) [A, B, C] 9) A 10) A 11) A 12) A 13) A 14) A 15) A 16) A 17) A 18) A 19) A 20) A 21) A 22) A 23) A 24) A 25) A 26) A Version 1

10

27) A 28) A 29) A 30) C 31) A 32) A

Version 1

11

CHAPTER 18 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Most biologists consider viruses to be living organisms, which are classified with bacteria. ⊚ ⊚

true false

2) Because tobacco mosaic virus has an RNA genome, it must encode a reverse transcriptase. ⊚ ⊚

3)

The HIV genome contains nine genes and therefore encodes just nine proteins. ⊚ ⊚

4)

true false

true false

Both Phage Lambda and HIV use tail fibers to bind to their receptor proteins. ⊚ ⊚

true false

5) Since both Phage Lambda and HIV can integrate into a chromosome of the host cell, their viral genomes encode integrase. ⊚ ⊚

6)

true false

Both Phage Lambda and HIV use reverse transcriptase. ⊚ ⊚

Version 1

true false

1

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

7) Select the viruses that can infect humans. (Check all that apply.)

A) B) C) D) E) F)

8)

Select all features that are true about emerging viruses. (Check all that apply.)

A) B) C) D) E) F)

9)

Tobacco mosaic virus Baculovirus Parvovirus Influenza virus Epstein-Barr virus Adenovirus

They are viruses that are not particularly dangerous.

They are more likely to cause infections than previous strains.

They often arise as a result of mutations.

H1N1 influenza, SARS, and HIV are examples.

Healthy people do not contract them.

Some emerging viruses began as viruses that infected other species.

Select the phage λ proteins that function as antiterminators. (Check all that apply.)

A) B) C) D)

cII N Q cro

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

10) A bacteriophage that is physically integrated into the host chromosome is called a __________.

Version 1

2

A) B) C) D)

episome virulent phage prophage capsid

11) A _______ uses the lytic cycle to begin the immediate production of new phages in the host cells.

A) B) C) D)

virulent phage temperate phage bacterium eukaryotic cell

12) A _______ frequently integrates into the host genome, forming prophages and utilizing a lysogenic cycle to manufacture new phages.

A) B) C) D)

virulent phage temperate phage bacteria eukaryotic cell

13) Infectious mononucleosis is caused by the Epstein-Barr virus, and patients often exhibit a fever, sore throat, swollen glands, and fatigue for several weeks. In some patients, the virus can reactivate later and cause physical symptoms once again. This is likely because __________.

Version 1

3

A) they were misdiagnosed the first time, and only really were infected by the virus the second time they became sick B) the virus was latent in these patients, and then switched to the active form and began making new virus particles C) the patients had the virus initially, and they became sick again at the time the virus became latent D) the Epstein-Barr virus is an emerging virus so we do not know much about its infectious life cycle

14)

Latency in HIV occurs when __________.

A) B) C) D)

15)

The HIV genome is especially prone to mutation because __________.

A) B) C) D)

16)

the virus switches back to an active form new viral particles are made the viral genome forms an episome and remains dormant the virus integrates into the host genome and remains dormant

it is made of DNA it is an emerging virus it is copied by reverse transcriptase, which lacks a proofreading function of the many different drugs HIV patients must take

When phage λ enters the lytic cycle

A) many new copies of the phage genetic material and coat proteins are assembled to make new phages. The host cell is lysed.

B) many new copies of the phage genetic material and coat proteins are assembled to make new phages. The host cell remains intact.

C) the genetic material of the phage is integrated into the chromosome of the bacterium.

D) it immediately lyses the host cells without producing any new viruses.

Version 1

4

17) If you created a strain of bacteria that overexpressed protease inhibitors, and then infected this bacteria with phage λ, would you expect the phage to follow the lytic or lysogenic cycle?

A) Lytic B) Lysogenic C) The protease inhibitors would have no bearing on which life cycle is chosen.

18) Many scientists and drug companies have worked hard to produce drugs to stop various stages of the HIV life cycle. Some drugs have been tested that inhibit the function of Vpu. What stage of the HIV life cycle would such a drug inhibit?

A) B) C) D)

19)

Synthesis of double stranded DNA Virus assembly Virus budding Integration into the host chromosome

The Gag polyprotein is cleaved into __________.

A) B) C) D)

Vif and Vpu HIV protease, reverse transcriptase, and integrase matrix protein, capsid protein, nucleocapsid protein, and p6 Vpr, Rev, Tat, and Nef

20) Vaccines have been very useful in preventing viral diseases. In fact they have lead to the erradication of small pox from the world's human population. Most vaccines result in the host producing antibodies (proteins that bind to specific amino acid sequences) that bind to specific viral proteins. What might be a reason why a vaccine for HIV has been so difficult to develop?

Version 1

5

A) B) C) D)

The low mutation rate of HIV The fact that HIV genome is found as both DNA and RNA in a cell The high mutation rate of HIV The HIV virion is coated with cellular proteins

21) What piece of the RNA HIV genome is used as a primer during the synthesis of doublestranded DNA from HIV RNA? A) B) C) D)

22)

tRNA U3 gag PPT

Reverse transcriptase copies __________.

A) B) C) D)

DNA to DNA DNA to RNA RNA to DNA RNA to RNA

23) Gierer and Schramm isolated __________ from tobacco mosaic virus and applied it to plant tissue, which caused the same types of lesions that occurred when plants were exposed to intact tobacco mosaic virus.

A) B) C) D)

Version 1

RNA DNA proteins capsids

6

24) You are working in a lab that studies tobacco mosaic virus (TMV). You wish to perform follow up experiments to the Fraenkel-Conrat/Singer experiments. You use the Holmes ribgrass (HR) strain of TMV that they used, which produces streaks along the veins and contains histidine and methionine in the TMV capsid protein. You also use a second TMV strain that you've isolated, called Purp, that causes purple lesions on the leaves, and lacks histidine and methionine in the TMV capsid protein. If you use Purp RNA and HR proteins to create reconstituted viruses, what lesions do you expect will form, and what will the amino acid composition of the capsid protein be?

A) B) C) D)

25)

Purple lesions, histidine and methionine in the capsid protein Purple lesions, no histidine and methionine in the capsid protein Streaks on the veins, no histidine and methionine in the capsid protein Streaks on the veins, histidine and methionine in the capsid protein

What is the correct order of the reproductive cycle of viruses?

A) Attachment→Entry→Viral assembly→Integration→Synthesis of viral components→Release B) Viral Assembly→Attachment-Entry-→Integration→Synthesis of viral components→Release C) Attachment-→Entry→Integration→Synthesis of viral components→Viral assembly→Release D) Integration→Attachment→Entry→Viral assembly→Synthesis of viral components→Release

26) In phage λ, the relative affinities of the lambda repressor and the cro protein to the three binding sites in the OR region are __________.

A) the same B) inversely proportional C) unrelated

Version 1

7

27) Azidothymidine (AZT) is an HIV drug. AZT is a reverse transcriptase inhibitor. That means AZT is only effective during the __________ stage of the viral life cycle.

A) B) C) D)

entry integration viral assembly release

28) The virus that causes chickenpox can also cause __________ decades later when it switches from the latent state and starts making new viral particles.

A) B) C) D)

29)

shingles herpes cold sores mononucleosis

The ________ is an enveloped virus with spikes.

A) B) C) D)

tobacco mosaic virus adenovirus influenza virus T4 bacteriophage

30) What structure on bacteriophage λ plays an analogous role to the spike glycoproteins in HIV? A) B) C) D)

Version 1

Capsid Shaft Base plate Tail fibers

8

31)

What is the function of tetherin in HIV replication?

A) B) C) D)

To keep HIV particles in place until they are ready to bud To stop the spread of HIV in the body by inhibiting HIV release To help in HIV assembly To help with the maturation of HIV particles

32) Why is AZT (a nucleoside analog) able to suppress HIV infection but does not cure HIV infections?

A) It prevents viral budding but does not inhibit replication of viral nucleic acid.

B) It inhibits proviral replication but does not inhibit reverse transcritpase.

C) It prevents viral RNA from replicating but does not rid nuclear DNA of the provirus.

D) It stops proviruses in the nucleus from producing viral RNA but does not inhibit integration of viral DNA.

33) A researcher wishes to use the lambda phage promoter P Land operator in a synthetic gene they are creating. They want this to be an inducible transcript meaning that they would like to turn transcription on and off at will. What should they do?

A) They should create a cell in which they can turn cro expression on and off and place thier synthetic gene in the cell.

B) They should create a cell where they can turn expression of the Q gene on and off and then place their construct in the cell.

C) They should select a cell that lacks the att site to place their construct in.

D) They should create a cell that overexpresses the xis gene product.

34) A researcher has discovered a new compound that appears to affect the amount of HIV that they obtain from infecting cells. When cells are treated with the drug and then infected there are proviruses in the nuclear genome and viral RNA in the cytoplasm but no virus particles form.

What is the most likely protein that the drug inhibits?

Version 1

9

A) B) C) D)

Version 1

Spike protein Reverse transcriptase Gag proteins Integrase

10

Answer Key Test name: Chap 18_7e 1) FALSE 2) FALSE 3) FALSE 4) FALSE 5) FALSE 6) FALSE 7) [C, D, E, F] 8) [B, C, D, F] 9) [B, C] 10) C 11) A 12) B 13) B 14) D 15) C 16) A 17) B 18) C 19) C 20) C 21) D 22) C 23) A 24) B 25) C 26) B Version 1

11

27) B 28) A 29) C 30) D 31) B 32) C 33) A 34) C

Version 1

12

CHAPTER 19 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) The process of replica plating was designed to test if mutations occurred in response to a selective agent or if mutations were naturally present in the population before selection. ⊚ ⊚

2)

The mutation frequency would be the same for all genes in a given culture. ⊚ ⊚

3)

true false

Silent mutations are possible due to the degenerate nature of the genetic code. ⊚ ⊚

7)

true false

A change in the chromosome number is called a point mutation. ⊚ ⊚

6)

true false

A heritable change in the genetic material is called a mutation. ⊚ ⊚

5)

true false

The Ames test may be used to determine if an agent is a mutagen. ⊚ ⊚

4)

true false

true false

Ethyl methanesulfonate (EMS) is an example of a deaminating agent.

Version 1

1

⊚ ⊚

8)

true false

The most common genotype in a population is called the mutant genotype. ⊚ ⊚

true false

9) The mutation frequency for a geneis the ratio of the number of mutant genes to the total number of copies of that gene in a given population. ⊚ ⊚

true false

10) Breakpoints in chromosomes can lead to mutant phenotypes when they occur in the middle of a gene. ⊚ ⊚

true false

11) A mutation in one gene that compensates for a mutation in another gene to result in the wild-type phenotype is called an intergenic suppressor mutation. ⊚ ⊚

true false

12) A mutation in a promoter region that causes the promoter sequence to more closely resemble the consensus sequence is called an up promoter mutation and results in a decrease in transcription. ⊚ ⊚

true false

13) TNRE repeats frequently result in the addition of extra histidine amino acids to the protein.

Version 1

2

⊚ ⊚

14)

HRR usually uses a sister chromatid. ⊚ ⊚

15)

true false

An individual that is a genetic mosaic would be the result of a germ cell mutation. ⊚ ⊚

17)

true false

Somatic cells are those that give rise to sperm and egg cells. ⊚ ⊚

16)

true false

true false

A heteroduplex is a DNA double helix that contains mismatches. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

18) Consider the following DNA sequence, which codes for the first portionof a long proteinbeginning at the ATG (AUG in mRNA) start codon.5' ATG CCC CGC AGTAGG GGG TGG AGA3'A mutation occurs changing this sequence to:5'ATG CCC CGC AGTAGG GAG TGG AGA3'What type of mutation is this? (Check all that apply.)

Version 1

3

A) B) C) D) E) F) G)

Point mutation Transition Transversion Silent mutation Missense mutation Nonsense mutation Frameshift mutation

19) Consider the following DNA sequence, which codes for the first portionof a long protein beginning at the ATG (AUG in mRNA) start codon.5' ATG CCC CGC AGTAGG GGG TGG AGA3'A mutation occurs changing this sequence to:5'ATG CCC CGC AGTAGG GGG TGAAGA3'What type of mutation is this? (Check all that apply.)

A) B) C) D) E) F) G)

Point mutation Transition Transversion Silent mutation Missense mutation Nonsense mutation Frameshift mutation

20) Consider the following DNA sequence, which codes for the first portionof a long protein beginning at the ATG (AUG in mRNA) start codon.5' ATG CCC CGC AGTAGG GGG TGG AGA3'A mutation occurs changing this sequence to:5'ATG CCGCGC AGTAGG GGG TGGAGA3'What type of mutation is this? (Check all that apply.)

A) B) C) D) E) F) G)

Version 1

Point mutation Transition Transversion Silent mutation Missense mutation Nonsense mutation Frameshift mutation

4

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

21) In the following sequence of DNA, the italicized base has been mutated. What type of mutation is this?

5' - G A T C T C C G A A T T - 3' original strand 5' - G A T C T C C C A A T T - 3' mutated strand A) Transition B) Transversion C) Neither

22) The wild-type eye color of Drosophila is red. A single-base mutation can occur that produces a white eye color. What statement is correct regarding this mutation?

A) B) C) D)

It is an example of a mutation that likely alters protein function.

Individuals with white eyes have a reversion mutation.

It is an example of a silent mutation.

It isan example of a neutral mutation.

23) Mutations that change the configuration of a protein at a specific temperature are called __________ mutations.

A) B) C) D)

24)

neutral beneficial deleterious conditional

Anticipation is associated with which type of mutation?

Version 1

5

A) B) C) D) E)

25)

Most TNRE repeats involve expansion of which codon?

A) B) C) D) E)

26)

Nonsense mutations Up-promoter mutations Intergenic suppressors TNRE mutations None of these choices are correct.

GAA CAG ATG CCC Any codon containing three of the same bases

Translocations and inversions may result in __________.

A) B) C) D)

TNRE anticipation position effect genome mutations

27) A translocation that moves a gene from an area of euchromatin to heterochromatin would typically cause a/an __________ in the expression of the gene.

A) reduction B) increase C) Gene expression would remain the same.

28)

Select the example of an induced mutational mechanism.

Version 1

6

A) B) C) D) E)

DNA replication errors Tautomeric shifts of nucleic acid bases Aberrant recombination UV light Transposable elements

29) A culture of E. coli bacteria is used to establish several subcultures. Each subculture is then plated and individual colonies that grow on the agar plates are then tested for their sensitivity to the bacteriophage T1. There is a spectrum of sensitivities where some plates have a high number of resistant colonies and some plates had very few. This data supports which theory?

A) B) C) D)

30)

The results of the replica plating experiments by the Lederbergs supported which theory?

A) B) C) D)

31)

Physiological adaptation theory Random mutation theory Both theories Neither theory

Random mutation theory Physical adaptation theory Both theories Neither theory

Select the correct statement regardingrate of mutation.

A) Rates of spontaneous mutation per cell generation typically range from 10

-5

to 10

-9

B) Mutation rates are consistent across species C) Mutation rates are not influenced by environmental conditions D) Mutation rates are constant

Version 1

7

32) After screening a colony of bacteria for mutations in a given gene, you discover 100 mutant colonies out of 3 million total colonies. What is the mutation frequency for this gene in the population?

A) B) C) D)

33)

1.0 x 10 5 1.0 x 10 -5 3.0 x 10 5 3.3 x 10 -5

The conversion of cytosine to uracil in DNA is an example of __________.

A) B) C) D)

depurination tautomeric shifts deamination demethylation

34) The complete loss of either a guanine or adenine from DNA is an example of __________.

A) B) C) D)

35)

depurination tautomeric shifts deamination demethylation

A temporary change in the conformation of a nitrogenous base is called __________.

A) B) C) D)

Version 1

depurination a tautomeric shift deamination None of these choices are correct.

8

36) An example of a mutagen that integrates into the double-helix of DNA resulting in the inhibition of DNA replication would be __________.

A) B) C) D) E)

37)

An example of a base analog would be __________.

A) B) C) D) E)

38)

EMS nitrous acid 5BU nitrogen mustards acridine dyes

Which DNA repair mechanism uses DNAN-glycosylases?

A) B) C) D) E) F)

39)

EMS nitrous acid 5BU 2-amino purine acridine dyes

Recombinational repair Direct repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

Which repair mechanism is responsible for repairing damage from UV light?

Version 1

9

A) B) C) D) E)

40)

Photolyase in yeast is an example of what kind of DNA repair mechanism?

A) B) C) D) E) F)

41)

Recombinational repair Direct repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

Which repair mechanism utilizes MutL, MutH, and MutS proteins in E. coli?

A) B) C) D) E) F)

42)

Recombinational repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

Recombinational repair Direct repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

Which repair mechanism often leads to deletions in chromosomes?

A) B) C) D) E) F)

Version 1

Recombinational repair Direct repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

10

43)

Which repair mechanism identifies daughter strands by methylation?

A) B) C) D) E) F)

44)

Recombinational repair Direct repair Base excision repair Mismatch repair Nucleotide excision repair Nonhomologous end joining (NHEJ)

How does position effect influence gene expression?

A) Point mutations in promoters frequently occur by this mechanism.

B) Translocations may result in a promoter that is normally used for one gene now controlling an entirely different gene.

C) Since this mechanism relies on recombination it relies on the positioning of one allele so that it is under the control of the other allele.

D) Translocations always result in a gene being recombined into an area of heterochromatin.

45) In the nucleotide excision repair system, which of the following proteins is responsible for recognizing a thymine dimer to be repaired?

A) B) C) D)

46)

UvrA/UvrB UvrC UvrD UvrE

What would be a set of anticipated results from a "Lederberg" experiment?

Version 1

11

A) Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 15 B) Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 1500 C) Total number of colonies on a plate: 500 Total number of resistant colonies on replica plate with T1: 1500 D) Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 0

47)

Spontaneous mutations include __________.

A) B) C) D)

48)

depurination, deamination, and errors in DNA replication UV light, radiation, deamination, and depurination UV light, radiation, deamination, and errors in replication UV light, errors in DNA replication, deamination, and depurination

The mechanism for reactive oxygen species to cause mutation is __________.

A) bases are oxidized to a variety of different products which might pair with a different base than the original base would have B) thymine bases are dimerized which causes a break in the DNA which is not repaired correctly C) the reactive oxygen species stabilize different tautomeric forms of the bases causing inappropriate pairing D) guanine is depurinated by the reactive oxygen species and if it is not repaired can result in any base being inserted

49)

A mutagen is __________.

Version 1

12

A) B) C) D)

an agent that can alter the structure of DNA and cause mutations a depurinated base a DNA polymerase without a 5' to 3' exonuclease a deaminated base

50) The difference between the polymerases used in translesion synthesis repair and general DNAreplication is A) the polymerase used in translesion synthesis has a pocket that can accommodate the lesions while DNA pol III's pocket cannot.

B) there is no real difference between the polymerases except that the translesional polymerase is not part of the replication complex.

C) the polymerase used in translesion synthesis has a pocket that cannot accommodate the lesions, that is part of the mechanism by which the lesions are removed.

D) the polymerase used to remove the lesion has a modified nucleotide binding pocket allowing for mispairing of nucleotides.

51) There is a spectrum of syndromes in humans known as Xeroderma pigmentosum. The individuals that have XD most commonly have mutations in their nucleotide excision DNA repair mechanisms that make them particularly susceptible to environmental mutagens such as UV light. Individuals have to be careful with how much sunlight they are exposed to since they have an extremely elevated chance for developing skin cancer. There have been several cell lines that have been established from XD patients that can be studied in tissue culture. In an experiment several different cell lines of unknown origin were tested for their ability to undergo unscheduled DNA synthesis (UDS), an assay for DNA repair. In this assay the amount of radioactive nucleotides that are incorporated into DNA after the cell sustains a mutagenic event are measured. The amount of radioactivity incorporated is measured by the number of counts per minute (CPM). Below is a table from such an experiment. Which cell line is most likely from XD patient(s)?

Cell line

CPM in UDS assay

CPM if no mutagenic event

A

2,500

2,750

B

300,000

5,000

C

45,000

25,000

D

275,000

50,000

Version 1

13

Wild-type control

A) B) C) D)

750,000

75,000

A B C D

52) Beechdrops is a parasitic plant that cannot perform photosynthesis but relies on its host the Beech tree. However, beechdrops still retains many if not all of the genes for photosynthesis.

Snapdragons and gladiolas are common garden flowers that rely on their ability to perform photosynthesis. If you were to compare the gene sequences for these three plants for ribulose1,5-bisphosphate carboxylase/oxygenase (RuBisCO) a protein necessary for photosynthesis what would you predict?

A) The differences between gladiolas and snapdragons would most likely be silent mutations while those in beechdrops may be silent or missense B) Since these three plants are not highly related the sequences for RuBisCO would be very different between them C) The differences between gladiolas and snapdragons would most likely be in the second nucleotide of codons while beechdrops would have a higher number of mutations in the third nucleotide of the different codons D) The differences between gladiolas and snapdragons would most likely be missense mutations while those in beechdrops may be silent or missense

53)

Which types of mutations are least likely to be subjected to natural selection?

A) B) C) D)

54)

Silent Missense Nonsense Insertion

The Holliday model is used to explain which of the following?

Version 1

14

A) B) C) D) E)

Recombination between homologous chromosomes Recombination between sister chromatids The migration of transposons The replication of transposons The generation of antibody diversity

55) Which of the following most likely accounts for the majority of the recombination events during both DNA repair and meiosis?

A) B) C) D)

A nick in only one strand of the DNA Double-stranded breaks in DNA DNA gap repair synthesis Heteroduplex formation

56) The formation of a D-loop is associated with which of the following models of recombination?

A) Double-stranded break model B) Holliday model C) Single-stranded break model

57) In E. coli, a mutation in the genes encoding which of the following proteins would disable the ability of the cell to recognize double-stranded breaks and conduct recombination during meiosis?

A) B) C) D)

Version 1

RecG RecA RecBCD RuvABC

15

58) Which of the following best describes the function of the RecA protein in E. coli recombination?

A) B) C) D)

59)

Promotes strand invasion and formation of the D loop Recognizes double-stranded breaks in the DNA Is involved in the initial formation of the Holliday junctions Resolves Holliday junctions into separate chromosomes

Which of the following may account for the process of gene conversion?

A) B) C) D)

DNA mismatch repair Retrotransposition Photolyase activity Nucleotide excision repair

60) Consider the following DNA sequence, which codes the first portionof a long proteinbeginning at the ATG (AUG in mRNA) start codon.5' ATG CCC CGC AGTAGG GGG TGG AGA 3'Which of the mutatedsequences listed is most likely to be a deleterious mutation?

A) 5'ATG CCC CGC AGTAGG GAG TGG AGA3' B) 5'ATG CCC CGC AGTAGG GGG TGAAGA3' C) 5'ATG CCGCGC AGTAGG GGG TGGAGA3'

61) You are a doctor tasked with diagnosing a patient that comes to you with mental impairment. Upon performing genetic tests, you find he has approximately 300 repeats of GCC in one of his genes. His father and grandfather had similar mental impairment but were never diagnosed with a condition prior to their death. His grandmother, mother, and sisters are unaffected. What disease do you predict that this patient has?

Version 1

16

A) B) C) D) E)

Version 1

SBMA HD SCA1 FRAXA FRAXE

17

Answer Key Test name: Chap 19_7e 1) TRUE 2) FALSE 3) TRUE 4) TRUE 5) FALSE 6) TRUE 7) FALSE 8) FALSE 9) TRUE 10) TRUE 11) TRUE 12) FALSE 13) FALSE 14) TRUE 15) FALSE 16) FALSE 17) TRUE 18) [A, B, E] 19) [A, B, F] 20) [A, C, D] 21) B 22) A 23) D 24) D 25) B 26) C Version 1

18

27) A 28) D 29) B 30) A 31) A 32) D 33) C 34) A 35) B 36) E 37) C 38) C 39) D 40) B 41) D 42) F 43) D 44) B 45) A 46) A 47) A 48) A 49) A 50) A 51) A 52) A 53) A 54) A 55) B 56) A Version 1

19

57) C 58) A 59) A 60) B 61) E

Version 1

20

CHAPTER 20 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Restriction endonucleases recognize specific sequences in the DNA. ⊚ ⊚

true false

2) cDNA is made from mRNA therefore, it lacks introns and contains only the coding sequence for the functional protein. ⊚ ⊚

3)

The isolation and copying of a gene, usually in large quantities is called gene cloning. ⊚ ⊚

4)

true false

A vector is a small segment of DNA that a gene of interest is inserted into for cloning. ⊚ ⊚

5)

true false

true false

R factors typically contain genes for antibiotic resistance. ⊚ ⊚

true false

6) Molecular biologists use restriction enzymesto amplify a specific section ofDNA within the genome. ⊚ ⊚

7)

true false

The DNA Pol IIIenzyme can use mRNA to make a cDNA strand.

Version 1

1

⊚ ⊚

true false

8) The polymerase used in PCR reactions is derived from the thermophile organism Thermus aquaticus. ⊚ ⊚

true false

9) Cloned genes may be mutated outside of a cell by a process calledsite-directed mutagenesis. ⊚ ⊚

10)

true false

Mutations generated during site-directed mutagenesis occur randomly in the genome. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

11) Select the sequences that would be recognized by a restriction enzyme. (Check all that apply.)

A) B) C) D)

3ʹ-TAGCTA-5ʹ 5ʹ-CGATTC-3ʹ 5ʹ-GAATTC-3ʹ 5ʹ-GAGCTC-3ʹ

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

12) Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called __________.

Version 1

2

A) B) C) D)

phages viruses plasmids chromosomes

13) A plasmid that contains separate origins of replication for two different species is called a/an __________.

A) B) C) D)

R factor expression vector viral vector shuttle vector

14) The presence of a specific plasmid in a bacterial cell may be determined if the plasmid __________.

A) B) C) D)

15)

What is the origin of restriction endonucleases?

A) B) C) D)

16)

is exceptionally large is an expression vector contains pieces of a viral genome contains a selectable marker

They are part of DNA repair mechanisms in eukaryotic cells They are a defense mechanism against viruses in bacteria They are replication enzymes of yeast They are transposable elements of Drosophila

Which of the following is an example of a palindromic DNA sequence?

Version 1

3

A) B) C) D)

17)

What is the purpose of DNA ligase in a cloning experiment?

A) B) molecule.

C) D)

18)

The purpose is to proofread the vector for mistakes.

The purpose is to reestablish the stable sugar-phosphate backbone of the DNA The purpose is to allow the vector to enter into the cell.

The purpose is to function as a selectable marker.

What function does a competent cell have that makes it useful in cloning experiments?

A) B) C) D)

19)

5' - ATCGAC - 3'3' - TAGCAG - 5' 5' - ATCATC - 3'3' - ATCATC - 5' 5' - GCCGCC - 3'3' - CGGCGG - 5' 5' - CTGCAG - 3'3' - GACGTC - 5'

Competent cells resist transfection by a viral vector.

Competent cells repair DNA strands without the aid of DNA ligase.

Competent cells utilize transposons as a vector.

Competent cells take up DNA from the external environment.

What contains both vector DNA and chromosomal DNA? A) Recircularized vectors B) Recombinant vectors C) Open vectors

20) In a cloning experiment, you use a vector that contains a lacZ gene near the unique restriction site. If the competent cells are grown on X-Gal and IPTG, which colonies would contain chromosomal DNA?

Version 1

4

A) B) C) D)

21)

cDNA is made using what as the starting material?

A) B) C) D)

22)

It copies the mRNA into a complementary DNA strand.

It reforms the sugar-phosphate backbone.

It generates short RNAs that are used as primers.

It proofreads the cDNA for errors.

Who developed the process of the polymerase chain reaction?

A) B) C) D)

24)

Plasmid vectors Viral DNA Chromosomal DNA mRNA

What is the purpose of RNaseH in the making of cDNA? A) B) C) D)

23)

The white colonies The blue colonies Half the total colonies None of the colonies

Watson and Crick McClintock Mullis Pauling

What is one component that is needed to perform a PCR?

Version 1

5

A) B) C) D)

25)

What occurs during the annealing stage of a PCR reaction?

A) B) C) D)

26)

Conduct a PCR reaction without the use of primers Generate mRNA Quantify expression of a specific gene in a cell Nonspecific DNA amplification

What is a DNA library?

A) B) C) D)

28)

The DNA strands separate The DNA polymerase copies the template DNA The primers bind to complementary sequences of the template DNA The reaction stops

Real-time PCR can be used for which of the following?

A) B) C) D)

27)

Primers DNA ligase RNA polymerase Restriction enzymes

A collection of vectors, each containing a fragment of the original genome A complete sequence of the genetic material in an organism An electronic file that may be used for additional genetic analysis A collection of mRNA from a given cell

A cDNA library differs from a genomic DNA library in which way?

Version 1

6

A) B) C) D)

It consists solely of RNA molecules It contains many copies of the gene of interest It contains only coding sequences, not introns It is typically 10-100 times the size of a DNA library

29) What is one technique that is used to identify a specific RNA sequence of a sample from a library?

A) B) C) D)

Western blotting Northern blotting Southern blotting Eastern blotting

30) What is one technique that is used to identify a specific protein in a mixture of different proteins?

A) B) C) D)

31)

Antibodies can be used as a probe for which technique?

A) B) C) D)

32)

Western blotting Northern blotting Southern blotting Eastern blotting

Western blotting Northern blotting Southern blotting Eastern blotting

What technique can be used to determine DNA-protein interactions?

Version 1

7

A) B) C) D)

33)

Dideoxy nucleotides are used in which technique?

A) B) C) D) E)

34)

Western blotting PCR DNAse I foot printing Restriction enzyme analysis

RT-PCR DNA sequencing DNAse I foot printing Restriction mapping Gene cloning

Which of the following is a step in a PCR? A) DNA is cooled to a temperature at which the hydrogen bonds holding the strands

break.

B) The primers anneal to the complementary sequences on the template DNA. C) DNA gyrase enzyme relieves the supercoiling ahead of the replication fork.

D) The DNase I synthesizes a new strand of DNA that is complementary to the template DNA.

35) A scientist does not have an antibody to detect the protein of interest, but wants to know if the gene is expressed at low levels. What technique could the researcher use to detect, but not quantify the expression of the gene of interest?

Version 1

8

A) B) C) D)

Western Blotting Real-time PCR Cloning Reverse transcriptase PCR

36) A researcher is interested in whether or not a transcription factor binds to a specific site on a strand of DNA. However, the samples accidentally contain SDS. What will the electrophoretic mobility shift assay results show?

A) The protein will bind the DNA and retard the movement of the DNA through the gel.

B) The protein will not bind to the DNA and the movement of the DNA through the gel will not be affected.

C) The protein will bind the DNA and the movement of the DNA through the gel will not be affected.

D) The protein will not bind the DNA and the movement of the DNA through the gel will be affected.

37) You are using CRISPR-Cas technology to introduce a single nucleotide change in a gene of interest in living cells. You are designing your experiment. In which component of the reaction will you engineer the single nucleotide change?

A) B) C) D) E)

Donor DNA Spacer RNA Repeat RNA Linker RNA tracrRNA

38) In cloning a specific fragment from a mixture of different fragments of DNA, three classes of plasmids can be produced: vector containing the desired fragment (gene of interest), vector containing other fragments, and re-ligated vector containing no inserted DNA. What class of vector would you expect to find at the highest frequency?

Version 1

9

A) B) C) D)

All three types of vector will be found in approximately equal proportions Vector containing random genomic DNA fragments Vector containing the gene of interest Vector with no insert

39) Human diseases caused by what type of mutations can be modeled using site-directed mutagenesis?

A) B) C) D)

Point mutations Aneuploidy Gene deletions Duplications

40) You are performing a mobility shift assay with a protein complex that is composed of proteins A, B, C, & D, each of which can bind to the DNA of interest. You run the gel with the lanes as follows:Lane 1: Protein A + DNALane 2: Proteins A + B + DNALane 3: Proteins A + B + C + DNALane 4: Proteins A + B + C + D + DNAIn which lane will the DNA run closest to the top of the gel?

A) B) C) D)

Lane 4 Lane 3 Lane 2 Lane 1

41) You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT -5'.

Assume the annealing primer binds immediately prior to this sequence. What nucleotide will be found closest to the bottom of the sequencing gel?

A) B) C) D)

Version 1

G A C T

10

42) You are carrying out a sequencing reaction. You remember to add ddNTPs, but forget to add dNTPs. What will the outcome of your sequencing reaction be?

A) Sequencing will proceed normally.

B) No sequencing will take place at all.

C) Sequencing will begin, but will not be able to proceed past the first nucleotide because the ddNTPs cannot be used for chain extension.

D) Four fragments will be made corresponding to the first A, T, C, and G in the sequence, but after that no more fragments will be made.

43) Prior to the discovery of Taq polymerase, PCR could be carried out in a more laborious manner by adding a non-thermostable polymerase to each round of the reaction. In order for this reaction to work, when should the non-thermostable polymerase be added?

A) Before denaturation B) After primer annealing C) After primer extension

Version 1

11

Answer Key Test name: Chap 20_7e 1) TRUE 2) TRUE 3) TRUE 4) TRUE 5) TRUE 6) FALSE 7) FALSE 8) TRUE 9) TRUE 10) FALSE 11) [A, C, D] 12) C 13) D 14) D 15) B 16) D 17) B 18) D 19) B 20) A 21) D 22) C 23) C 24) A 25) C 26) C Version 1

12

27) A 28) C 29) B 30) A 31) A 32) C 33) B 34) B 35) D 36) B 37) A 38) D 39) A 40) A 41) C 42) C 43) B

Version 1

13

CHAPTER 21 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Unipotent cells may differentiate into all other cell types of the body. ⊚ ⊚

true false

2) The use of microorganisms or their products to alleviate plant disease is called biological control. ⊚ ⊚

3)

true false

Biotransformation results in biodegradation. ⊚ ⊚

true false

4) A transgenic organism has recombinant DNA from another species integrated into its genome. ⊚ ⊚

5)

true false

An organism that can be regenerated by somatic cells is called multipotent. ⊚ ⊚

true false

6) The process by which an electrical charge is used to introduce DNA into a cell to produce a transgenic organism is called electroporation. ⊚ ⊚

Version 1

true false

1

7) The fact that in mammalian systems multiple genes may compensate for the loss of a gene is called gene redundancy. ⊚ ⊚

true false

8) Reproductive cloningis used to produce large amounts of mammalian proteins from transgenic agricultural animals such as cattle. ⊚ ⊚

true false

9) In gene addition, homologous recombination is used to remove the original gene and replace it with the cloned gene. ⊚ ⊚

true false

10) A possible explanation for a lack of observable phenotypic change in a knockout mouse may involve gene redundancy. <!--Markup Copied from Habitat--> ⊚ ⊚

true false

11) By creating gene knockouts, researchers can study how the loss of normal gene's function affects the organism. ⊚ ⊚

true false

12) When researchers produced a gene knockin by introducing the mutant human β-globin gene into mice, the resulting mice showed very severe symptoms of the disease. ⊚ ⊚

Version 1

true false

2

13)

All stem cells have the potential to differentiate. ⊚ ⊚

14)

true false

A bone marrow transplant involves the transfer of multipotent stem cells. ⊚ ⊚

true false

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

15) The first hormone to be made by recombinant bacteria was __________.

A) B) C) D)

insulin glucagon somatostatin testosterone

16) You are charged with the task of expressing a protein in bacteria that will be used to treat a disease in humans. This will require the expression of the desired protein and then its purification from bacteria. What is a suitable strategy to efficienty express and purify the protein of interest?

A) Add a methionine codon into the middle of the coding sequence of the gene of interest so that you can follow its synthesis with radioactive methionine that is added to the growth media.

B) Clone the gene so that it is under the control of the Beta-gal promoter.

C) Create a chimeric gene that has the coding sequences of the desired protein fused to the gene of a protein that is easily isolated.

D) Add several codons to the end of the gene of interest to increase its mass.

17) What is the purpose of the cyanogen bromide (CNBr) in the manufacture of insulin by recombinant bacteria?

Version 1

3

A) B) C) D)

18)

Allows for the uptake of the plasmid Enhances the activity of the restriction enzymes Creates sticky ends for integration into the plasmid Cleaves the protein from the beta-galactosidase protein

Bioremediation has been used to treat which of the following?

A) B) C) D) E)

Oil spills Sewage Pesticides Heavy metals All of these choices have been successfully remediated.

19) In sickle cell anemia individuals are homozygous for a mutant allele of beta hemoglobin.

If individuals are heterozygous for the mutant allele they do not have as severe a disease but will still experience complications. Would this disease best be treated with gene replacement or gene addition?

A) B) C) D)

Gene replacement Gene addition Both approaches would be able to cure individuals Neither approach would result in cure for the disease

20) Which of the following organisms is used by molecular biologists to produce transgenic plants?

A) B) C) D)

Version 1

E. coli Lambda phage Bacteriophage l Agrobacterium tumefaciens

4

21) In the production of transgenic plants, the gene that confers resistance to which antibiotic is most commonly used to indicate that a cell has taken up the T DNA that includes the cloned gene?

A) B) C) D)

Ampicillin Neomycin Streptomycin Kanamycin

22) Which of the following mechanisms uses high-velocity microprojectiles, coated with DNA, to produce a transgenic plant?

A) B) C) D)

A. tumefaciens Electroporation Microinjection Biolistic gene transfer

23) Although Dolly was only three years old, her chromosomes had the length of a 9-10 year old sheep. Which of the following best describes why this occurred?

A) B) C) D) E)

The cell line that created Dolly was aged prematurely in the lab.

The chromosomes underwent nonhomologous recombination.

A mutation enhanced the rate of aging.

Dolly was not a clone.

The telomeres of the somatic cells that Dolly originated from were shortening.

24) Which of the following terms represents a cell that can form any other cell of the organism?

A) Pluripotent B) Totipotent C) Unipotent

Version 1

5

25)

Which of the following cells is not pluripotent?

A) B) C) D)

26)

Hematopoietic stem cells are _________.

A) B) C) D)

27)

ES cells EG cells None of these choices are pluripotent Both ES and EG are pluripotent

Pluripotent Totipotent Unipotent Multipotent

Bone marrow transplants typically use what type of cells?

A) B) C) D)

Embryonic stem cells Embryonic germ cells Embryonic carcinoma cells Hematopoietic stem cells

28) The origins of which of the following cell types creates the least amount of ethical debate?

A) B) C) D)

29)

EG cells EC cells Hematopoietic stem cells ES cells

Which of the following is NOT an advantage of a transgenic plant?

Version 1

6

A) B) C) D)

30)

Widely accepted by the public Increased resistance to disease and pests Adaptability to harsh environments Improved shelf life

Which of the following is an example of a pluripotent cell?

A) B) C) D) E)

Embryonic stem cells Red blood cells Fetal heart cells B cells of the lymphatic system Nerve cells

31) In creating transgenic animals it a frequent occurence for there to be different levels of expression of the transgene in animals derived from different embryos. What is the most likely explanation for this?

A) The transgene promoters have been mutated.

B) The transgenes have integrated at different places in the genome.

C) The DNA becomes fragmented when it is injected into the ES cells and some transgenes are damaged.

D) The RNA is modified differently for the different injections of transgenes.

32) Some diseases or syndromes have been modeled in mice using transgenic techniques.

However for some of these models, drugs that seem to be successful in treating mice in regard to changing their symptomology have been failures in human trials. What is the most likely reason for this?

Version 1

7

A) The genes that are selected to create the transgenic animals are not involved in the disease process.

B) The process by which mice utilize the drugs biochemically is different than how humans utilize the drugs.

C) Humans have a longer life span.

D) The symptomology in the mice is not due to the transgenes.

33) Researchers wants to overexpress a protein and purify it from bacteria. In order for their DNA construct to express the desired protein, they use a beta-galactosidase promoter to regulate transcription of the cDNA clone of their gene. When they check for protein expression they find that it is lower than they want. What would be one thing they could try to boost their protein yield?

A) B) C) D)

Add ampicillin to the media Lower the incubation temperature for the bacteria Add allolactose to the media Increase the incubation temperature for the bacteria

34) Why should it be easier to treat sickle cell disease as opposed to Duchenne muscular dystrophy?

A) B) C) D)

Sickle cell disease could be treated by replacing the hematopoetic stem cells.

The normal gene for sickle cell is small and the Duchenne's gene is very large.

Duchenne's is an X-linked disease, while sickle cell is not.

They both should be equally treatable.

35) If the ewe that donated the nucleus to create Dolly had had a mitochondrial disease what would have been the outcome?

Version 1

8

A) Dolly would have had the disease if the gene that was responsible for the disorder was in the mitochondral genome.

B) Dolly would not have had the disease if the mutated gene was in the mitochondrial genome.

C) Dolly would have had the disorder whether or not the gene that was mutated was in the mitochondrial or in the nuclear genome.

D) The experiment would not have worked at all if Dolly's nuclei came from an ewe that had defective mitochondria.

36) A researcher set up an experiment to express a protein in both a eukaryotic cell and a prokaryotic cell and isolates the protein from both sources. When tested, the eukaryotic derived protein is active but the prokaryotic protein is not. What do you think the researcher should do to get an active protein from the prokaryotic cell?

A) B) C) D)

Refold it Run the experiment again because it was probably due to a mistake Try expressing higher levels in the prokaryotic cell Try using a different promoter to express the gene in the prokaryotic cell

37) Genetically modified glyphosate-resistant crops are being planted at increasing rates with a concomittant increase in glyphosate use. What is a potential problem would you predict from this practice?

A) B) C) D)

Decreased population levels of honey bees Increased rates of weeds that are glyphosate resistant Decreased yields of crops Increased rates of insect predation on crop plants

38) Researchers wish to increase the efficiency of chloroplasts using a chloroplast encoded gene they have modified. Using the Agrobacterium method, plants are created that carry the transgene of interest but there is no effect on chloroplast efficiency. Using biolistic transfer, however, results in plants that do have increased chloroplast efficiency. What is the probable explanation?

Version 1

9

A) B) C) D)

Version 1

The transgene is toxic to the cell if it is coupled to T DNA. Biolistic gene transfer can introduce DNA into chloroplasts.

Agrobacterium mutates the transgene.

The researcher does not know how to use Agrobacterium properly.

10

Answer Key Test name: Chap 21_7e 1) FALSE 2) TRUE 3) FALSE 4) TRUE 5) FALSE 6) TRUE 7) TRUE 8) FALSE 9) FALSE 10) TRUE 11) TRUE 12) FALSE 13) TRUE 14) TRUE 15) A 16) C 17) D 18) E 19) A 20) D 21) D 22) D 23) E 24) B 25) D 26) D Version 1

11

27) D 28) C 29) A 30) A 31) B 32) B 33) C 34) A 35) B 36) A 37) B 38) B

Version 1

12

CHAPTER 22 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Map units correspond to fixed physical distances. ⊚ ⊚

true false

2) An RFLP marker may be used to predict the likelihood that an individual carries a trait for a specific disease. ⊚ ⊚

3)

Metagenomics refers to the molecular analysis of the entire genome of a species. ⊚ ⊚

4)

true false

Cytogenetic mapping is accurate to within 500,000 base pairs, but not over this value. ⊚ ⊚

7)

true false

In a FISH procedure, the probe being used is labeled with a fluorescent tag. ⊚ ⊚

6)

true false

BAC stands for bacterial artificial chromosome. ⊚ ⊚

5)

true false

true false

Comparative genomics attempts to define evolutionary relationships.

Version 1

1

⊚ ⊚

true false

8) Shotgun sequencing is precise enough to achieve a complete genomic sequence without the need for other mapping methods. ⊚ ⊚

true false

9) In sequencing by synthesis (SBS) methods, the sequence of a sample is directly determined as nucleotides are incorporated into a DNA strand by DNA polymerase. ⊚ ⊚

true false

10) Metagenomics is a common approach for studying the genes of a clonal population of bacteria in the laboratory. ⊚ ⊚

11)

true false

YAC stands for yeast artificial cosmid. ⊚ ⊚

true false

12) To map a gene by chromosome walking, the sequence of the gene to be mapped is required. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

13) What would you expect to find in a metagenomic library? (Check all that apply.)

Version 1

2

A) B) C) D) E) F)

14)

Peer-reviewed research articles on disease and the environment The complete genome from a new species Bits of DNA from numerous species Many copies of a cloning vector with different inserts A composite genome from several related species Some DNA representing genes that are similar but differin exact sequence

Which researcher(s) are using a metagenomic approach? (Check all that apply.)

A) A medical researcher studies the DNA of mixed bacterial populations from the intestines of patients with different diseases.

B) A plant biologist sequences the genomes of broccoli, cauliflower, and other Brassica species to determine which genes are responsible for their different features.

C) A developmental geneticist clones the mutated gene from a Drosophila strain with disrupted wing development.

D) An environmental researcher sequences DNA from collections of microbes living in polluted coastal waters, which cannot be cultured in the lab.

E) A pharmaceutical developer screens through DNA found in soil samples for novel antibiotics.

15) A woman has a child and wants to determine who the father of the child is. There are four possible fathers. This group of individuals is analyzed with regard to three different STSs: STS-1 is 215 bp and 199 bp, STS-2 is 144 bp and 122 bp, and STS-3 is 101 bp and 85 bp. The child (C), mother (M), and 4 potential dads (D1-D4) show the following results. Select the individual(s) who are heterozygous for STS-3. (Check all that apply.)

Version 1

3

A) B) C) D) E) F)

C M D1 D2 D3 D4

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

16) Which of the following procedures best determines the relative order, but not precise location, of a series of genes on a chromosome?

A) Physical mapping B) Cytogenetic mapping C) Linkage mapping

17) ________ uses the unique banding patterns of a chromosome to determine the general location of a gene.

A) Physical mapping B) Cytogenetic mapping C) Linkage mapping

18)

What does physical mapping provide that the other types of genetic mapping do not?

A) Recombination distances between genes B) Number of nucleotide base-pairs between genes C) Relationship of the gene to specific chromosomal banding patterns

19)

The process of in situ hybridization is used for which of the following?

Version 1

4

A) Cytogenetic mapping B) Physical mapping C) Linkage mapping

20)

Which of the following acronyms describes a technique used in chromosome painting?

A) B) C) D) E)

21)

RFLP VNTR STR FISH STS

A site that has variation within the members of the population is said to be __________.

A) monomorphic B) polymorphic C) trimorphic

22)

The most common microsatellite in humans is __________.

A) B) C) D)

(AT) 100 (CA) n (TG) n (CAT) n

23) The method of sequencing genomic fragments that are randomly generated from larger DNA fragments is called __________.

Version 1

5

A) B) C) D)

24)

The human genome project's first draft took approximately _______ years.

A) B) C) D) E)

25)

100,000 1 million 1 billion 3 billion 2 trillion

A series of clones that contain overlapping pieces of a chromosome are called a _______.

A) B) C) D) E)

27)

5 13 20 50 2

The human genome consists of approximately _______ base pairs of DNA. A) B) C) D) E)

26)

cytogenetic mapping shotgun sequencing Southern blotting polymerase chain reaction

contig artificial chromosome cosmid positional clone transposable element

A _______ is a combination of a plasmid vector and phage λ.

Version 1

6

A) B) C) D) E)

28)

contig artificial chromosome cosmid positional clone transposable element

In shotgun sequencing, how is a complete sequence of a genome reconstructed?

A) The entire genome is directly sequenced chromosome by chromosome.

B) The genome is fragmented and sequences of each fragment are arranged so that overlapping regions are identified.

C) The sequences of a large number of individuals is obtained and “averaged” to obtain the complete sequence.

D) The position of each marker and gene are first mapped relative to regions for which the genomic sequence is not known.

29)

Which of the following is the most direct benefit of high-throughput Sanger sequencing?

A) B) C) fragments.

D)

Bases can be identified as soon as they are added to the template.

RNA can be directly sequenced without first reverse transcribing it into DNA. An entire chromosome can be sequenced without disrupting it into smaller Many DNA samples can be sequenced simultaneously.

30) Which of the following samples would NOT be suitable for a metagenomics-based approach?

Version 1

7

A) Water samples from different bodies of water with different temperatures, salinities, and acidities B) A soil sample from a farm where a new planting schedule has been implemented C) A water sample from an industrial site that has been contaminated with pollutants D) A fecal sample from a patient with irritable bowel syndrome E) A homogeneous population of skin cancer cells collected from a patient biopsy

31) In positional cloning, which method is used to identify clones that are progressively closer to a gene of interest?

A) B) C) D)

Chromosome painting Cytogenetic mapping Microsatellite analysis Chromosome walking

32) The experimental process of determining the relative location of genes or other segments of DNA along individual chromosomes is called __________.

A) B) C) D)

mapping metagenomics DNA sequencing proteomics

33) You are sequencing the genome of the yeast S. cerevisiae, with a genome size of 12,100,100 bp, using shotgun sequencing. Your sequencer malfunctions when only 24,200,000 bp in total have been sequenced. How much of the genome should have been sequenced at this point?

Version 1

8

A) B) C) D) E) F)

100% 0% 13.5% 86.5% 0.135% 0.865%

34) A woman has a child and wants to determine who the father of the child is. There are four possible fathers. This group of individuals is analyzed with regard to three different STSs: STS-1 is 215 bp and 199 bp, STS-2 is 144 bp and 122 bp, and STS-3 is 101 bp and 85 bp. The child (C), mother (M), and 4 potential dads (D1-D4) show the following results. Which individual is the father of the child?

A) B) C) D)

D1 D2 D3 D4

35) You are carrying out a chromosome painting experiment. You have single-stranded DNAs that bind to 6 different regions of the X chromsomsome. You inadvertantly label the DNA probes all with the same colored fluorescent molecule, which happens to be red in this experiment. What will be the result of your experiment?

Version 1

9

A) The DNA probes will be unable to bind.

B) The probes will bind, but you will not be able to tell which spot corresponds to which sequence.

C) The entire X chromosome will be labeled red along its entire length.

D) The probes will bind normally, and you will still be able to distinguish between the probes.

36) Imagine that when shotgun sequencing was intially used to sequence the H. influenzae genome, the sonicator didn't work. How would this affect the sequencing experiment?

A) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, no sequence would be obtained.

B) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, there would likely be sequences missing in the sequencing results due to difficulties with DNA replication.

C) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, sequencing would occur more quickly than usual.

D) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, there would likely be sequences missing in the sequencing results due to difficulties with DNA replication.

E) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, no sequence would be obtained.

F) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, sequencing would occur more quickly than usual.

Version 1

10

Answer Key Test name: Chap 22_7e 1) FALSE 2) TRUE 3) FALSE 4) TRUE 5) TRUE 6) FALSE 7) TRUE 8) FALSE 9) TRUE 10) FALSE 11) FALSE 12) FALSE 13) [C, D, F] 14) [A, D, E] 15) [A, E, F] 16) C 17) B 18) B 19) A 20) D 21) B 22) B 23) B 24) B 25) D 26) A Version 1

11

27) C 28) B 29) D 30) E 31) D 32) A 33) D 34) C 35) B 36) B

Version 1

12

CHAPTER 23 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) In two dimensional gel electrophoresis, proteins are first treated with SDS, separated according to molecular mass, and then separated by their net charge at a specific pH. ⊚ ⊚

true false

2) A pattern recognition algorithm examines a string of nucleotides for sections that match a specific sequence parameter. ⊚ ⊚

3)

Two genes that share a common ancestral gene will probably have significant homology. ⊚ ⊚

4)

true false

true false

cDNA uses chromosomal DNA as its template. ⊚ ⊚

true false

5) A functional protein microarray can be used to establish the function or substrates for a given group of proteins. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

6) A researcher isolates mRNA from healthy and diseased liver biopsies. Each mRNA sample is converted into cDNA and subjected to next-generation sequencing. Select all statements that describe this experiment and the possible results.

Version 1

1

A) The researcher can identify transcripts that are more abundant in healthy liver than in diseased liver, which are candidate genes for further study.

B) The researcher can identify transcripts that are less abundant in healthy liver than in diseased liver, which are candidate genes for further study.

C) This is an RNA-Seq experiment.

D) This is a DNA microarray analysis.

E) Some genes' transcriptsmay be present in both samples but have different splice forms in healthy and diseased liver.

F) The intron sequences will be more abundant in the diseased liver samples.

G) The researcher should have combined the healthy and diseased mRNA samples before making cDNA, so that only one sample would need to be sequenced.

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

7) What field of study of genetics applies statistics and mathematical tools to genetic sequences in order to better understand the genetic information?

A) B) C) D)

8)

Structural genomics Functional genomics Proteomics Bioinformatics

What can gene chips be used for?

A) B) C) D)

To examine patterns of protein expression under various environmental conditions To establish levels of genetic variation To determine the mass of a gene To identify the amount of a specific transcription factor in a cell

9) What does detection of a fluorescent signal from one of the spots of a DNA microarray indicate?

Version 1

2

A) B) C) D)

The probe hybridized to the sequences present in that spot The probe did not hybridize to that particular gene The experiment was not conducted correctly That the probe was non-specifically trapped by the material present in the spot

10) _________ make it possible for researchers to study how an entire genome responds to an environmental stimulus.

A) B) C) D)

11)

Bioinformatics PCR reactions DNA microarrays The BLAST program

Why is the proteome larger than the genome?

A) Different cell types contain different subsets of genes, making the proteome larger than the genome.

B) Not all genes are expressed in all cells at the same time, making the proteome larger than the genome.

C) Alternative splicing can lead to the production of several or many different polypeptides from the same pre-mRNA, increasing the number of proteins in the proteome.

D) The total amount of protein in a cell as measured by mass is always greater than the total amount of DNA.

12)

What technique is used to separate cellular proteins for analysis?

A) B) C) D)

Version 1

PCR Antibody microarrays Two-dimensional gel electrophoresis Functional protein microarrays

3

13) In a two-dimensional gel electrophoresis experiment, proteins are generally separated vertically by __________.

A) B) C) D)

net charge molecular mass abundance isoelectric point

14) In a two-dimensional gel electrophoresis experiment, proteins are separated horizontally by __________.

A) B) C) D)

amino acid sequence molecular mass abundance isoelectric point

15) The purpose of sodium dodecyl sulfate (SDS) in a two-dimensional gel electrophoresis experiment is that it allows proteins to separated __________.

A) B) C) D)

by charge only primarily by molecular mass by size only by net charge

16) Which technique can be used to identify a protein of interest after a two-dimensional gel electrophoresis experiment?

A) B) C) D)

Version 1

DNA microarray Treatment with reverse transcriptase to isolate the DNA of interest BLAST analysis Mass spectrometry

4

17)

What technique can be used to identify a protein's function?

A) B) C) D)

18)

The program BLAST would bebest used for what purpose?

A) B) C) D)

19)

Functional protein microarray Antibody microarray DNA microarray RNA microarray

Determining what restriction sites are present in a fragment of DNA Identifying a promoter sequence Identifying splice donor and acceptor sites Identify related sequences to a given DNA sequence in a database

What type of molecule is used in a protein microarray to measure protein expression?

A) B) C) D)

cDNA mRNA Single-stranded DNA Antibodies

20) What type of computer based search methodology would most likely be used to identify a potential promoter for a gene in a nucleotide sequence?

A) B) C) D)

Search-by-signal Search-by-content Search-by-identity Search-by-recognition

21) What is the term for two genes from two different species that are similar in sequence and serve the same function in each species?

Version 1

5

A) B) C) D)

Related genes Paralogs Gene family Orthologs

22) The genes of a gene family that consist of two or more homologous genes are called __________.

A) B) C) D)

23)

A database is defined as __________.

A) B) C) D)

24)

orthologs paralogs polylogs homologs

a large collection of files stored in one place a small collection of files that are stored in different places files that are only used by the BLAST program a large collection of files that are not annotated

_______ can be used to determine the amino acid sequence of a protein or peptide.

A) B) C) D)

X-ray crystallography Nuclear magnetic resonance Mass spectrometry The ChIP assay

25) DNA microarrays may be paired with chromatin immunoprecipitation (ChIP) to __________.

Version 1

6

A) B) C) D)

26)

assay the use of substrates by different enzymes determine mRNA folding patterns identify DNA sequences bound by specific proteins identifyprotein-protein interactions

Gene knockouts in mice can be useful because __________.

A) they can be used to develop models of human disease B) they identify DNA binding proteins C) they limit mRNA production both from the knockout as well as the normal allele in diploids D) only genes that are actively transcribed in the embryo are susceptible to being knocked out

27) What would be the most reasonable technique to use to determine if a drug is capable of inhibiting the binding of a transcription factor?

A) B) C) D)

ChIP assay Mass spectrometry of proteins in the cell 2-D gel electrophoresis Antibody microarray

28) A population of cells is treated with a polypeptide hormone that induces mitosis and the hormone's cell surface receptor is isolated after 15 minutes and subjected to fragmentation and mass spectrometry. Several of the peaks show a slight shift as compared to the same protein from cells not treated with the hormone. What is the most likely explanation of this phenomenon?

A) B) C) D)

Version 1

Phosphorylation of some amino acid residues mRNA editing resulting in a slightly different amino acid sequence Alternative exon usage Proteolytic processing

7

29) The term that best describes how the components of a genome interact to produce an organism's traits is __________.

A) B) C) D)

proteomics functional genomics structural genomics genomics

30) _________ involves an examination of how the proteins encoded by genes interact to produce cell and tissue types.

A) B) C) D)

Proteomics Functional genomics Structural genomics Genomics

31) A multiple sequence alignment is shown for a kinase that is highly conserved among species. What amino acid do you predict is essential for function of the kinase? Dots are indicative of gaps where the sequences do not line up.Species 1 SGPEDPAFTWRAAVTTNQGWEDTTNVAYSpecies 2 SGLEDPAFTWR.............NQGWEDTTNVAQSpecies 3 AAPEDPAFTWRAAVTTLLGWEDTTNVAYSpecies 4 ...........DPLSCWRAAVTTN.............TTNVAYSpecies 5 SGPEDEAFTCCAAVTTNQGWEDSSNVCYSpecies 6 SGPEDPAFTWRAAVTTNQGWEDTT...........

A) B) C) D) E)

Version 1

D in position 5 S in position 1 W in position 10 T in position 23 V in position 26

8

32) Amino acids froma hypothetical proteasefromHomo sapiensare compared to the same protease in other species using the BLAST program.The following results are obtained. The sequence from whichspecies has the highest E value?H. sapiens SSTNQLLKHRRAALSTMVIITNQKRSAA P. catodon SSTNQLLKHRSAALSTMVIITNQKRSAA M. mulatta SSTNQIIKHRRAALSTMVLLTNQKRSAK F. cattus ASTNQLLKHRSAALSTMVIITNQKRSAK C. cristata SSTNQLLKHRRAALSTMVIITNQKRSAA A) P. catodon B) M. mulatta C) F. cattus D) C. cristata

Version 1

9

Answer Key Test name: Chap 23_7e 1) FALSE 2) FALSE 3) TRUE 4) FALSE 5) TRUE 6) [A, B, C, E] 7) D 8) B 9) A 10) C 11) C 12) C 13) B 14) D 15) B 16) D 17) A 18) D 19) D 20) A 21) D 22) B 23) A 24) C 25) C 26) A Version 1

10

27) A 28) A 29) B 30) A 31) A 32) B

Version 1

11

CHAPTER 24 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Prions can contain either DNA or RNA as their genetic material. ⊚ ⊚

2)

true false

A pedigree analysis is the study of family trees to establish patterns of inheritance. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

3) Select the factors that would indicate that a disease had a genetic, rather than an environmental, cause. (Check all that apply.)

A) B) C) D)

The disease spreads from person to person.

The disease has a specific age of onset.

There is a high level of the disease's concordance among monozygotic twins.

The disease does not spread to people sharing similar environmental situations.

4) Select the statements that are associated with an autosomal dominant pattern of inheritance. (Check all that apply.)

A) B) C) affected.

D)

5)

An affected offspring has one or more affected parents.

An affected offspring has two unaffected parents.

An affected individual with one affected parent will have 50% of its offspring Two affected heterozygous individuals will have 25% of their offspring unaffected.

What diseases are caused by prions? (Check all that apply.)

Version 1

1

A) B) C) D)

Phenylketonuria Creutzfeldt-Jacob disease Gerstmann-Straussler-Scheinker disease Familial fatal insomnia

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

6) In a disease that is caused by a single gene, the concordance among monozygotic twins should be __________.

A) B) C) D) E)

0% 25% 50% 75% 100%

7) In a disease that is associated with a single recessive allele, the concordance among dizygotic twins should be __________, assuming both parents are heterozygous carriers.

A) B) C) D) E)

0% 25% 50% 75% 100%

8) You are analyzing a human pedigree for a new disease and discover that the disease occurs with the same frequency in both sexes and that 25% of the children from two unaffected heterozygous parents have the disease. This disease is displaying __________ inheritance.

Version 1

2

A) B) C) D)

autosomal recessive autosomal dominant sex-linked recessive sex-linked dominant

9) In the analysis of a family, you notice that males are more likely to contract a certain disease and the daughters of affected males produce 50% of their sons affected with the disease.

This disease is displaying what pattern of inheritance?

A) B) C) D)

10)

X-linked recessive Autosomal recessive Autosomal dominant X-linked dominant

Which test provides the earliest indication of genetic problems in a fetus?

A) Amniocentesis B) Chorionic villus sampling C) Both provide reliable indications at the same stage of development

11)

What prion conformation may result in a prion-related infection?

A) PrP Sc B) PrP C C) Both can cause disease

12)

Dizygotic twins share _______ of their genetic information.

Version 1

3

A) B) C) D)

13)

25% 50% 75% 100%

The age at which a disease appears in an organism is called the _______.

A) B) C) D)

null age critical age age of incubation age of onset

14) The process of _______ removes amniotic fluid from a pregnant mother to examine fetal cells for genetic problems.

A) B) C) D)

amniocentesis chorionic villus sampling preimplantation genetic diagnosis in vitro fertilization

15) You are working in a lab where you are studying a disease that isknown to be caused by a single nucleotide change, although the effect this change ultimately has on the protein's structure/function is unknown. You have DNA samples from multiple patients that you suspect of having this disease. What is the most efficient way to test the samples for the relevant mutation?

A) B) C) D)

Version 1

Western blotting DNA sequencing Karyotyping Amniocentesis

4

16) In the United States, most newborns undergo a test for primary congenital hypothyroidism, a condition where people are unable to produce enough thyroid hormone. On a nationwide basis, this is an example of __________.

A) B) C) D)

genetic testing genetic screening amniocentesis preimplantation genetic diagnosis

17) Herceptin is a drug that is given to treat certain breast cancers. However, it is most effective on tumors that are overexpressing HER2. Therefore, patients are tested for HER2 overexpression before being given Herceptin. This is an example of __________.

A) B) C) D)

concordance a haplotype personalized medicine karyotyping

18) The general approach in which researchers and clinicians use methods that enable them to understand the molecular changes that occur in diseases such as cancer is called _________.

A) B) C) D)

molecular profiling personalized medicine DNA microarrays cluster analysis

19) Haplotypes between homologs in the same individual __________; haplotypes for the same chromosome in different individuals __________.

Version 1

5

A) B) C) D)

are always the same; are always different can be the same or different; can be the same or different are always the same; can be the same or different can be the same or different; are always different

20) When a scientist is attempting to use haplotype analysis to link a disease-causing allele to a molecular marker, it is important for the marker to be close to the disease-causing allele, otherwise __________ may occur.

A) B) C) D)

additional mutation crossing over linkage disequilibrium founder effect

21) If mutations in two different genes give rise to a single disease then the disease exhibits __________.

A) B) C) D)

22)

multiallelic variation locus dimorphism locus heterogeneity an inheritance pattern that looks as though it is autosomal dominant

Genome wide association studies are used __________.

A) B) C) D)

to identify the mutation that causes a disease to identify single nucleotide polymorphisms that are near disease causing genes to find the total variation that occurs in human genomes to describe the number of alleles for a specific gene

23) The best term for trying to introduce genes into or modify genes in somatic cells to treat a disease is __________.

Version 1

6

A) B) C) D)

24)

haplotype treatment personalized medicine molecular medicine gene therapy

Microarrays can be used to __________.

A) B) C) D)

create a molecular profile perform GWAS studies identify the presence of tumors in the body indentify if twins are monozygotic or dizygotic

25) Although the treatment of patients with ADA with gene therapy was encouraging, what is needed to conclude that this approach should become a standard of care that would be used for all patients with ADA? A) Showing that the therapy is not toxic for many patients B) Showing that the therapy is effective in many patients C) Showing that the therapy could be performed in vivo and not just ex vivo D) Demonstrating that a viral vector was not necessary and that liposomes could be used as well

26)

What is one possible problem with some gene therapy approaches?

A) The protein products from the genes that are used for therapy may cause an immune response from the treated individual.

B) The proteins produced by the introduced genes may be mutated by the cell they are introduced into.

C) Vectors used to introduce the therapeutic genes may also accidentally cause disease.

D) The liposomes that are used may damage the cellular membrane.

Version 1

7

27)

What is a benefit for using a personalized medicine approach to treating disease?

A) B) C) D)

There will be a greater understanding of how medicines work.

Treatments will be more effective in treating diseases.

Patients should only receive treatments that will be effective.

The cost of producing pharmaceuticals will decline.

28) Would you predict that Kuru would be able to be treated by gene therapy using the nomral PrP c gene?

A) B) C) D)

No Yes if the PrP c expression is high Yes if the PrP c expression is low Yes if the PrP c expression matches the expression already happening in the nerve

cell

29)

Haplotype mapping would be least useful in the study of __________.

A) B) C) D)

dizygotic twins monozygotic twins brothers and sisters grandparents and grandchildren

30) Achondroplasia is caused by a dominant allele of the fibroblast growth factor receptor-3 (FGF-3) gene that expresses an overactive version of the growth factor receptor. Would you be able to treat achondroplasia with gene therapy using a normal version of the FGF-3 gene?

Version 1

8

A) No B) Yes if the ratio of expression of the normal to mutant was sufficiently high C) Yes if you could introduce many copies of the normal FGF-3 receptor gene into the cell D) Yes if the individual is a heterozygote for the normal and mutant allele of FGF-3 receptor gene

31) A mother who is a carrier for a mutation in one copy of her factor VIII genes has children with a non-hemophiliac male. None of the male children have hemophilia but one of the daughters does. What might this be an example of?

A) B) C) D)

Genomic imprinting X linked dominant gene Locus heterogeneity X linked recessive gene

32) A founder has a mutation on an autosomal chromosome that is located between the haplotypes 3Band 4Bthat results in a new disease. This is the order of haplotypes on the founders chromosome 1A 2C 3B 4BThe haplotypes of 4grandchildren of this founder are as follows:Grandchild 1: 1A 2B 3C 4B/1A 2B 3A 4CGrandchild 2: 1A 2C 3B 4B/1B 2A 3B 4AGrandchild 3: 1B 2A 3A 4B/1C 2B 3A 4AGrandchild 4: 1B 2C 3B 4A/1A 2B 3A 4CWhich grandchild is most likely to carry the mutsation that occured in the founder?

A) B) C) D)

Grandchild 1 Grandchild 2 Grandchild 3 Grandchild 4

33) What type of genetic disease would most likely be screened for as opposed to testing just high risk individuals?

Version 1

9

A) B) C) D)

Version 1

Diseases that are caused by X linked recessive alleles Diseases that are relatively rare in a population Diseases that are relatively common within a population Diseases that are caused by autosomal dominant alleles

10

Answer Key Test name: Chap 24_7e 1) FALSE 2) TRUE 3) [B, C, D] 4) [A, C, D] 5) [B, C, D] 6) E 7) B 8) A 9) A 10) B 11) A 12) B 13) D 14) A 15) B 16) B 17) C 18) A 19) B 20) B 21) C 22) B 23) D 24) A 25) B 26) C Version 1

11

27) C 28) A 29) B 30) A 31) C 32) B 33) C

Version 1

12

CHAPTER 25 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) An oncogene may promote cancer by keeping the cell growth pathway in the off position. ⊚ ⊚

2)

true false

Programmed cell death is called genome maintenance. ⊚ ⊚

true false

3) Cancer is considered clonal because daughter cells from a cancer cell have the same genetic makeup as the parent cell. ⊚ ⊚

4)

true false

DNA damage is sensed by E2F at the G 1 and G 2 checkpoints. ⊚ ⊚

true false

5) Expression of a tumor suppressor gene can be impaired if its promoter is hypermethylated. ⊚ ⊚

6)

true false

A promoter mutation can turn a proto-oncogene into an oncogene. ⊚ ⊚

Version 1

true false

1

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

7) Select the events that can convert a proto-oncogene into an oncogene. (Check all that apply.)

A) B) C) D) E)

Viral integration near the proto-oncogene Missense mutations Translocation Aneuploidy Gene amplification

8) After genetic testing, a person is identified with an inherited mutation associated with a specific class of cancer. Select the statements that are true about this person. (Check all that apply.)

A) B) C) D)

9)

The person will definitely develop cancer in his or her lifetime.

The person is predisposed to the development of cancer.

The mutation is probably in a tumor suppressor gene.

The person may pass the trait on to his or her offspring.

How can a tumor suppressor gene lose its function? (Check all that apply.)

A) B) C) D)

Gene mutation Duplication Aberrant DNA methylation Aneuploidy leading to loss of the tumor suppressor gene

10) Select the events that must occur for inherited retinoblastoma to develop. (Check all that apply.)

Version 1

2

A) B) C) D)

11)

An individual must have two mutated copies of the Rb gene.

The p53 gene must be mutated.

E2F is no longer regulated by Rb. The cell proceeds uncontrolled through cell division.

Indicate the roles of growth factors in the cell cycle. (Check all that apply.)

A) B) C) D)

They act as repair proteins that fix DNA damage in the cell.

Growth factors bind to a receptor and initiate a signal cascade in the cell.

Their binding changes gene transcription.

They allow the cell to progress through the cell cycle.

12) You are studying the role of a novel histone demethylase in cancer. This histone demethylase normally functions to "close" the chromatin. A loss-of-function mutation in the gene for this histone demethylase has been linked to a number of tumor types. You decide to look at the expression of a number of known tumor-suppressor genes and oncogenes in cells that carry this mutation. Select the genes whose expression is likely to be affected by this mutation in a way that could lead to cancer. (Check all that apply.)

A) B) C) D) E)

BRCA-2 APC fos src myc

13) Select the genetic changes that are associated with the development of colorectal cancer.

(Check all that apply.)

Version 1

3

A) B) C) D) E) F)

Loss of APC Activation of ras Loss of DCC Loss of p53 Loss of myc Activation of NF1

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

14) The term that indicates that cancer has begun to migrate to other parts of the body is __________.

A) B) C) D) E)

15)

The majority of human cancers are caused by __________.

A) B) C) D)

16)

malignant benign metastatic invasive clonal

viral infections inherited mutations spontaneous mutations carcinogens

A gene that promotes the development of cancer is called a/an __________.

A) B) C) D) E)

Version 1

clone tumor suppressor gene mutagen carcinogen oncogene

4

17)

The first cancer-causing virus to be isolated was __________.

A) B) C) D) E)

18)

An oncogene form of Ras would have ___________.

A) B) C) D)

19)

RSV in chickens Hepatitis B in humans SSV in monkeys ALV in mice SV40 in humans

decreased GTPase activity an inability to bind GTP increased susceptibility to growth factors inability to bind Raf-1

When GTP is bound to Ras, it is in the __________ form.

A) active B) inactive

20) Chronic myelogenous leukemia is an example of a proto-oncogene activation by __________.

A) B) C) D) E)

21)

the action of a virus a missense mutation a translocation gene amplification None of these choices are correct.

What is p53?

Version 1

5

A) B) C) D) E)

22)

When are caspases active?

A) B) C) D)

23)

oncogenes growth factors proto-oncogenes tumor-suppressor genes

A _______ is a cellular gene that has the potential to become an oncogene.

A) B) C) D)

25)

During the normal cell cycle In apotosis Following viral integration During DNA replication

Checkpoint proteins are encoded by ________.

A) B) C) D)

24)

A caspase A proto-oncogene A transcription factor A tumor-suppressor gene None of these choices are correct.

carcinogen proto-oncogene tumor-suppressor genes caspase gene

An environmental agent that causes cancer is called a __________.

Version 1

6

A) B) C) D)

carcinogen malignant agent invasive agent metastatic agent

26) A common way of studying methylation in cells is to sequence DNA samples before and after modification with sodium bisulfite. The sodium bisulfite deaminates cytosine residues, generating uracil residues, therefore resulting in a change in the sequence as compared to the non-modified DNA. Sodium bisulfite does not react with 5-methylcytosine so there will be no change in the sequence of those modified bases. When tumors are sequenced to study methylation patterns and epigenetic control, what would be the best control for sequencing using this technique?

A) Non-cancerous tissue DNA from a different individual but from the same organ B) Liver DNA from the same individual that the cancer sample is from C) DNA from non-cancerous tissue from the same individual's organ as the cancer D) A combination of DNA from liver, brain, and muscle from the same individual that has the cancer

27) In cancer cells one allele of the tumor suppressor gene p53 is frequently mutated so that the protein is inactive, not produced, or deleted. The other allele will usually have a normal sequence and the promoter remains intact but the gene is not expressed. Sequencing with sodium bisulfite modification of DNA can be used to detect which cytosines are methylated. If the cancer cell DNA is sequenced what would be the anticipated results?

A) Cytosines in or near the promoter region will be methylated.

B) Cytosines in or near the promoter will not be methylated.

C) Cytosines in the coding region will have an increased methylation.

D) There will be no differences in the methylation pattern of the promoter of p53 from a cancer cell and a normal cell.

Version 1

7

28) You have sequenced the genome of tumor cells from a cancer patient and compared it to the genome of normal cells from the same patient. You find that in the tumor cells, a gene contains a nonsense mutation. The function of the protein encoded by this gene is not known.

What can you predict about this gene?

A) This gene is likely to encode a tumor-suppressor.

B) The gene is likely to encode a proto-oncogene.

C) The gene could encode either a tumor-suppressor gene or a proto-oncogene.

29) You have sequenced the genome of tumor cells from a cancer patient and compared it to the genome of normal cells from the same patient. You find that in the tumor cells, a gene contains a number of changes in its promoter region. The function of the protein encoded by this gene is not known. What can you predict about this gene?

A) This gene is likely to encode a tumor-suppressor.

B) The gene is likely to encode a proto-oncogene.

C) The gene could encode either a tumor-suppressor gene or a proto-oncogene.

30) You have sequenced the genome of tumor cells from a cancer patient and compared it to the genome of normal cells from the same patient. You find that in the tumor cells, a histone acetyltransferase is deactivated. What can you accurately predict from this finding?

A) As a result of the mutant histone acetyltransferase, an oncogene was activated.

B) As a result of the mutant histone acetyltransferase, a tumor suppressor was deactivated.

C) As a result of the mutant histone acetyltransferase, a tumor suppressor may have been deactivated or an oncogene activated.

Version 1

8

Answer Key Test name: Chap 25_7e 1) FALSE 2) FALSE 3) TRUE 4) FALSE 5) TRUE 6) TRUE 7) [A, B, C, E] 8) [B, C, D] 9) [A, C, D] 10) [A, C, D] 11) [B, C, D] 12) [C, D, E] 13) [A, B, C, D] 14) C 15) D 16) E 17) A 18) A 19) A 20) C 21) D 22) B 23) D 24) B 25) A 26) C Version 1

9

27) A 28) A 29) C 30) C

Version 1

10

CHAPTER 26 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) In Drosophila embryos, the anterior compartment of a segment overlaps with the posterior compartment of a parasegment. ⊚ ⊚

2)

true false

A C. elegans with a heterochronic mutation in lin-14 will lay eggs normally. ⊚ ⊚

true false

3) Studies of invertebrate and vertebrate development suggest that there is a universal body plan for bilateral animal development. ⊚ ⊚

true false

4) HoxC-6 is always expressed posterior to vertebrae 7 during the development of every vertebrate. ⊚ ⊚

5)

true false

One of the four types of cellular events that occur in animal development is apoptosis. ⊚ ⊚

true false

6) In Arabidopsis, the CLV3 gene is expressed in the organizing center and induces the cells in the central zone to become undifferentiated stem cells. ⊚ ⊚

Version 1

true false

1

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

7) You are studying a compound in C. elegans that prevents formation of the skin. You wish to inject it all cells that develop into skin, but you wish to avoid injecting as many non-skin cells as possible. Among the list below, what cell(s) should you inject the compound into?

(Check all that apply.)

A) B) C) D) E) F)

AB P 1 EMS P 2 MS E

8) You are working in a Drosophila lab. Imagine you are able to introduce new mutations immediately after fertilization. You introduce these mutations in each of the following genes in individual developing flies. Select the mutations that will affect the progeny of the flies in which you introduced the mutation but not in the fly in which you introduced the mutation.

A) B) C) D) E) F) G)

bicoid nanos pipe snake gooseberry engrailed gurken

9) You are working in a Drosophila lab. Imagine you are able to introduce new mutations immediately after fertilization. You introduce these mutations in each of the following genes in individual developing flies. Select the mutations that will affect the fly in which you introduced the mutation.

Version 1

2

A) B) C) D) E) F) G)

deformed trunk hedgehog runt labial orthodenticle cactus

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

10) The ectoderm, mesoderm, and endoderm are formed during the __________ stage of embryogenesis.

A) B) C) D)

11)

Pole cells are responsible for forming what structures in an adult organism?

A) B) C) D)

12)

fertilization cellular blastoderm syncytial blastoderm gastrulation

Liver cells Gametes Nerve cells Hematopoietic stem cells

Gap genes and pair-rule genes are examples of genes that determine __________.

A) B) C) D)

Version 1

the formation of body segments the formation of the primary cell layers the formation of cellular adhesion the formation of the major body axis

3

13)

Morphogens, induction, and cell adhesion provide __________ to a developing organism.

A) B) C) D)

14)

positional information maternal effect genes homeodomains lineage tracing

What is the first stage of embryonic pattern development in Drosophila?

A) B) C) D)

Limb position Body axes Segmentation patterns Metamorphosis

15) A Drosophila larva that develops from an oocyte that has no bicoid mRNA will have what developmental defect?

A) B) C) D)

16)

The bicoid gene has what pattern of inheritance?

A) B) C) D)

17)

Only ventral structures No dorsal structures Only anterior structures Only posterior structures

Sex-linked Incomplete penetrance Maternal-effect Autosomal

Which segment gene is activated first in the Drosophila embryo?

Version 1

4

A) B) C) D)

18)

A homeotic mutation results in which of the following?

A) B) C) D)

19)

loss-of-function mutation gain-of-function mutation zygotic mutation segmentation mutation

What is one characteristic of a homeodomain?

A) B) C) D)

21)

Incorrect formation of the body axes Replacement of segments with parasegments Replacing one body part with another Apotosis

Antennapedia in Drosophila is an example of a __________.

A) B) C) D)

20)

Pair-rule genes Segment-polarity genes Gap genes Myogenic bHLH genes

It is a transmembrane protein It can bind to the minor groove of DNA It is a protein domain encoded by a homeobox.

It binds to DNA at random sequences.

Homeotic genes activate other genes that determine the ____________ of each segment.

Version 1

5

A) B) C) D)

22)

orientation parasegment morphological characteristics zygotic

Cell lineage diagrams are most easily prepared in which model organisms?

A) B) C) D)

Drosophila melanogaster C. elegans Xenopus laevis Arabidopsis thaliana

23) A mutation in which the fate of cell lineages is not synchronized in an organism is called a __________.

A) B) C) D)

24)

Hox complexes in mammals are homologous to invertebrate __________.

A) B) C) D)

25)

heterochronic mutation apoptotic mutation homeotic mutation homeobox mutation

zygotic genes segmentation genes homeotic genes maternal effect genes

The model organism for the study of plant development is __________.

Version 1

6

A) B) C) D)

26)

Drosophila melanogaster C. elegans Xenopus laevis Arabidopsis thaliana

What is one way in which plant development differs from animal development?

A) Plants can develop only from somatic cells.

B) Plants lack morphogens.

C) Cell migration occurs in plants.

27) A mutation in the B genes of Arabidopsis would result in the incorrect formation of what structure?

A) B) C) D)

28)

What gene must be expressed in a Drosophila for it to develop into a female fly?

A) B) C) D)

29)

Apical meristem Flowers Stems Roots

SRY Hox Sxl sex-1

In humans, what gene determines maleness?

Version 1

7

A) B) C) D)

DSX sex-1 SRY Sxl

30) An XY human individual with a deletion that has inactivated SRY will developmentally be what sex?

A) Male B) Female

31)

What gene in humans prevents male development?

A) B) C) D)

32)

The spatial arrangement of different regions in the body is called a __________.

A) B) C) D)

33)

SRY DAX1 SOX9 Sxl

pattern morphogen induction segment

Genes that specify the final identity of a body region are called __________.

Version 1

8

A) B) C) D)

bicoid homeobox genes homeotic lineage genes

34) Molecules that convey positional information and promote developmental changes are called __________.

A) B) C) D)

35)

Programmed cell death is called _______.

A) B) C) D)

36)

morphogens determined totipotent apical

destruction initiation apoptosis myogenesis morphogens

The _______ of a morphogen determines its effect on development.

A) B) C) D)

size homeodomain color concentration

37) The morphological features that a group of cells will eventually adopt is called the _______.

Version 1

9

A) B) C) D)

38)

The consensus coding sequence of homeotic genes is called a _______.

A) B) C) D)

39)

homeobox basic domain Hox myogenic bHLH

The ABC model explains the process of _______.

A) B) C) D)

41)

TATA box Pribnow box homeobox parasegment

Skeletal muscle cell development is controlled by _______ proteins.

A) B) C) D)

40)

positional information cell fate cell adhesion model embryogenesis

brain development flower development sex determination muscle development

During what stage of development do homeotic genes begin to establish cell fate?

Version 1

10

A) B) C) D)

Formation of body axes Segmentation of the body Determination of structures within the segments Cell differentiation

42) You are carrying out T-cell lineage tracing in wild type C. elegans. You inject a nondegradable lin-14 transcript into the T.a cell during L1. This will allow the lin-14 protein to be made in this cell, and all of its cellular descendants. Assume the lin-14 protein will not be degraded in these cells. What do you predict the outcome to be?

A) The worm will have normal numbers of neurons and epidermal cells.

B) The worm will have abnormal numbers of neurons but the correct number of epidermal cells.

C) The worm will not have neurons or epidermal cells.

D) The worm will have abnormal numbers of epidermal cells but the correct number of neurons.

E) The worm will have abnormal numbers of epidermal cells and neurons.

43) You are working in an Arabidopsis lab. You identify a mutant strain of plants that grows curly leaves. You now need to determine what gene is mutated in these mutant plants. This is an example of __________.

A) B) C) D)

forward genetics reverse genetics gene knockout heterochronic mutations

44) You are studying sex determination in Drosophila. You engineer a version of the msl-2 transcript that is not inactivated by the Sxl protein and introduce this construct into XX flies.

What will the sex of these flies be?

Version 1

11

A) The flies will be male.

B) The flies will be female but will likely have problems due to increased expression of genes on the X chromosomes.

C) The flies will be female but will likely have problems due to decreased expression of genes on the X chromosomes.

D) The flies will be male but will likely have problems due to increased expression of genes on the Y chromosome.

Version 1

12

Answer Key Test name: Chap 26_7e 1) TRUE 2) FALSE 3) TRUE 4) FALSE 5) TRUE 6) FALSE 7) [A, D] 8) [A, B, C, D, G] 9) [A, C, D, E, F] 10) D 11) B 12) A 13) A 14) B 15) D 16) C 17) C 18) C 19) B 20) C 21) C 22) B 23) A 24) C 25) D 26) B Version 1

13

27) B 28) C 29) C 30) B 31) B 32) A 33) C 34) A 35) B 36) D 37) B 38) C 39) D 40) B 41) C 42) E 43) A 44) B

Version 1

14

CHAPTER 27 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Random genetic drift is due to chance events that alter the allele frequency in a population. ⊚ ⊚

2)

The measure of the reproductive success of a genotype is called Darwinian fitness. ⊚ ⊚

3)

true false

New genetic variation in a population is a critical aspect of microevolution. ⊚ ⊚

4)

true false

true false

Migration is a key evolutionary mechanism by which microevolution occurs. ⊚ ⊚

true false

5) Horizontal gene transfer between individuals in a population, while not a mutation, is a source of genetic variation. ⊚ ⊚

6)

true false

Horizontal gene transfer is limited to between prokaryotic bacteria of the same species. ⊚ ⊚

Version 1

true false

1

7) In exon shuffling, the duplicated or rearranged exons appear as new domains in different genes. ⊚ ⊚

true false

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

8) A group of individuals from the same species that occupy the same region and can interbreed with one another is the definition of a ________.

A) B) C) D) E)

9)

species population race community kingdom

The characteristics of a given population over time are ________.

A) dynamic B) static

10)

In humans, the gene for eye color is an example of a ________ trait.

A) monomorphic B) polymorphic

11) In a given population of Drosophila, curly wings (c) is recessive to the wild-type condition of straight wings (c +). You isolate a population of 35 curly winged flies, 70 flies that are heterozygous for straight wings and 45 that are homozygous for straight wings. What is the total number ofalleles in the gene pool?

Version 1

2

A) B) C) D) E)

2 150 230 300 140

12) In a given population of Drosophila, curly wings (c) is recessive to the wild-type condition of straight wings (c+). You isolate a population of 35 curly winged flies, 70 flies that are heterozygous for straight wings and 45 that are homozygous for straight wings. What is the frequency of alleles in this population?

A) B) C) D) E)

13)

The formula p 2 + 2pq + q 2 = 1 is associated with which of the following?

A) B) C) D)

14)

35% c; 45% c + 46.7% c; 53.3% c + 50% c; 50% c + 55% c; 45% c + The frequencies cannot be calculated from the provided information.

Calculations of heterozygosity Hardy-Weinberg equilibrium Calculations of recombination frequencies Degrees of freedom

In this equation p 2 + 2pq + q 2 = 1, what does the term 2pq represent?

A) B) C) D)

Version 1

The genotype frequency of homozygous recessive individuals The genotype frequency of homozygous dominant individuals The genotype frequency of heterozygous individuals The sum of the phenotype frequencies in the population

3

15) If the allele frequency of the dominant allele is 0.4, what value is used for the term p2 in the equation p2+ 2pq + q2= 1?

A) B) C) D)

0.4 0.2 0.16 16

16) Which of the following is not true concerning a population in equilibrium according to the Hardy-Weinberg rule?

A) B) C) D) E)

There is no migration into or out of the population.

Individuals of the population mate randomly.

The population size is very large.

Selection is favoring the dominant allele.

There is no mutation in the population.

17) If two individuals of a population, who vary in their phenotype, preferentially mate, it is called __________.

A) B) C) D)

18)

outbreeding inbreeding negative assortative mating positive assortative mating

The degree of relatedness of two members of a pedigree is calculated using __________.

A) B) C) D)

Version 1

the calculation of average heterozygosity the Hardy-Weinberg rule the inbreeding coefficient the chi-square test

4

19)

The inbreeding coefficient (F) tells us what about an individual?

A) The probability that they are homozygous due to inheritance from a common ancestor B) Their genotype C) The probability of obtaining a certain allele from the gene pool

20)

Which of the following will alter the frequency of alleles in the population the least?

A) B) C) D) E)

21)

Mutation Natural selection Genetic drift Migration All of these choices are equal.

Genetic drift has a greater influence on __________ populations.

A) small B) large C) It affects both equally.

22) Migration of a random few individuals from one population to a new area to establish a new population is an example of __________.

A) B) C) D)

bottleneck effect mutation founder effect selection

23) Which of the following types of selection favors one extreme of a phenotypic distribution?

Version 1

5

A) Disruptive selection B) Stabilizing selection C) Directional selection

24) Which of the following types of selection favors the survival of individuals with the intermediate phenotype?

A) Disruptive selection B) Stabilizing selection C) Directional selection

25)

Which of the following is true regarding a balanced polymorphism?

A) B) C) D)

26)

A SNP would best be described as __________.

A) B) C) D)

27)

The frequency of alleles is not changing over time The homozygous condition for the alleles is not advantageous to the organism An example in humans is sickle-cell anemia All of these choices are correct.

a gene that comes in multiple different alleles a balanced polymorphism system a single nucleotide difference between two DNA sequences the most likely mutation to affect protein function

Which type of selection would lead to two distinct phenotypes?

Version 1

6

A) B) C) D) E)

Stabilizing selection Phenotype selection Fitness selection Disruptive selection Directional selection

28) The prevalence of the allele for sickle cell anemia in some populations is an example of __________.

A) B) C) D) E)

heterogeneous environments balancing selection inverted selection non-Darwinian selection nonrandom mating

29) Which of the following is NOT a characteristic by which a population is in equilibrium according to Hardy-Weinberg equation?

A) B) C) D) E)

30)

The population is large There is no migration into or out of the population There is no selection against a given genotype There is no mutation in the gene being studied There is nonrandom mating

Which of the following is NOT a step to calculate a coefficient of inbreeding?

A) B) C) ancestor D) E)

Version 1

Determine the mutation rate Determine the total number of common ancestors Determine the shortest inbreeding path between the individual and the common Calculate the inbreeding path for each common ancestor Place values in the inbreeding coefficient formula

7

31) The accumulation of new mutations in a population is usually a __________ factor against the fitness of the population.

A) negative B) positive C) neutral

32) In a certain population, the frequency of allele A is 0.3 and the frequency of allele a is 0.7. The population inbreeds such that f = 0.1. What is the frequency of each genotype in the population?

A) B) C) D) E)

AA: 0.09, Aa: 0.42, aa: 0.49 AA: 0.49, Aa: 0.42, aa: 0.09 AA: 0.01, Aa: 0.90, aa: 0.09 AA: 0.111, Aa: 0.378, aa: 0.511 AA: 0.21, Aa: 0.42, aa: 0.37

33) You are preparing to perform DNA fingerprinting by PCR for the first time. Select the reagent that would result in complications in the interpretation of your results.

A) B) C) D)

PCR primers that anneal to the repetitive region of the microsatellites PCR primers that anneal to regions flanking the microsatellites Human DNA Taq polymerase

34) The best term for changes in allele frequency from one generation to the next would be __________.

Version 1

8

A) B) C) D)

Hardy-Weinberg disequilibrium evolution microevolution macroevolution

35) For gene flow to occur members of one population must migrate to another population and __________.

A) B) C) D)

36)

the migrants must return to thier original population the migrants must survive for many generations without interbreeding the migrants must interbreed to produce sterile offspring the migrants be able to hybridize to produce fertile offspring

The term for the probability that a gene will be altered by a new mutation is __________.

A) B) C) D)

mutation rate evolution rate microevolution rate selection rate

37) If a population is tested to see if the 2 alleles for a gene are in Hardy-Weinberg equilibrium and the chi square for the population is 22 what is your conclusion?

A) B) C) D)

The chi square value is too low to make any conclusive statement about equilibrium.

The alleles are in equilibrium.

The alleles are not in equilibrium.

More individuals in the population need to be sampled.

38) If the frequency of allele A is0.8 and the frequency of a is 0.2 within a population given the fitness values below what will be the relative frequencies for the different genotypes in the next generation?Fitness values:AA 1.0Aa 0.75aa 0.25 Version 1

9

A) B) C) D)

AA 0.64/Aa 0.32/aa 0.04 AA 0.8/Aa 0.12/ aa 0.05 AA 0.8/ Aa0.16/ aa 0.2 AA 0.64/ Aa 0.24/ aa 0.01

39) If the frequency of the A allele is 0.6 and the frequency of the a allele is 0.4 given the fitness values for the various genotypes what is the mean fitness of the population?Fitness valuesAA 1.0Aa 0.6aa 0.4 A) B) C) D)

0.712 0.66 0.356 1.0

40) If in a population the selection coefficients are S AA 0, S Aa 0.7 and S aa 0.2 which genotype is being selected for?

A) B) C) D)

AA Aa aa None of the genotypes are being selected for or against

41) What is the probability of fixation of a gene in a population of 30 individuals (assume no selection for or against a mutation)?

A) B) C) D)

Version 1

3.3% 3% 1.6% 0.16%

10

42) Given a population of 1,000 individuals what is the average number of generations it will take to fix a new mutation assuming no selection for or against the new mutation?

A) B) C) D)

100,000 1,000 4,000 25,000

43) Given a population size of 500 individuals what is the probability of the elimination of a mutation assuming that there is no selection for or against the mutation?

A) B) C) D)

20% 99.9% 50% 1%

44) What is the frequency of an allele in a conglomerate population if 50 individuals from a population where the allele has a frequency of 0.6 migrates into a population of 450 individuals where the allele frequency is 0.3?

A) B) C) D)

0.3 0.33 0.9 0.18

45) For forensic purposes, DNA fingerprinting analysis uses 13 or more microsatellites for examination. What is the most likely reason for this?

Version 1

11

A) Sometimes one or more of the microsatellites may not be present in human DNA. B) Sometimes the DNA isolation fails to isolate all of the microsatellites.

C) The PCR typically fails to work on all the microsatellites.

D) The probability of finding a specific combination of 13 specific variants in a single individual is extremely low.

Version 1

12

Answer Key Test name: Chap 27_7e 1) TRUE 2) TRUE 3) TRUE 4) TRUE 5) TRUE 6) FALSE 7) TRUE 8) B 9) A 10) B 11) D 12) B 13) B 14) C 15) C 16) D 17) C 18) C 19) A 20) A 21) A 22) C 23) C 24) B 25) D 26) C Version 1

13

27) D 28) B 29) E 30) A 31) A 32) D 33) A 34) C 35) D 36) A 37) C 38) D 39) A 40) A 41) C 42) C 43) B 44) B 45) D

Version 1

14

CHAPTER 28 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Heritability is the amount of genetic variation in a particular population and a particular environment. ⊚ ⊚

true false

2) Heritability values can be compared between populations if there is variation in the environmental conditions. ⊚ ⊚

3)

true false

Traits that fall into discrete categories are called continuous traits. ⊚ ⊚

true false

4) The sum of all of the values for a trait, divided by the total number of individuals, is called the standard deviation. ⊚ ⊚

5)

true false

QTL stands for quantitative trait loci and is an example of monogenic inheritance. ⊚ ⊚

true false

6) The amount of phenotypic variation in a group that is due to genetic variation is called heritability. ⊚ ⊚

Version 1

true false

1

7)

Many organisms used in modern agriculture are a result of artificial selection. ⊚ ⊚

8)

The process of mating between genetically unrelated individuals is called inbreeding. ⊚ ⊚

9)

true false

true false

Realized heritability may be determined from artificial selection experiments. ⊚ ⊚

true false

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

10) What is true concerning a quantitative trait?

A) B) C) D)

11)

Individuals fall into distinct classes for comparison The phenotypic variation for the trait is continuous The phenotypic variation for the trait falls into two to three classes The frequency distribution of the trait will have an asymmetrical shape

The square root of the variance is called the __________.

A) B) C) D)

Version 1

mean standard deviation standard error covariance

2

12) When analyzing two variables, the strength of the association between the variables is called the __________.

A) B) C) D)

covariance standard deviation correlation coefficient variance

13) In calculations of the degrees of freedom for a correlation coefficient, what value does the degrees of freedom take?

A) B) C) D)

(n - 1) (n - 2) (n - 1)/2 2(n - 1)

14) After calculating a correlation coefficient you discover that the value is not significant at the 5% level. What can be done to produce a significant difference?

A) Increase the sample size B) Decrease the sample size C) Nothing, the value will remain the same regardless of sample size

15)

What is a typical characteristic of a quantitative trait?

A) B) C) D)

No environmental influence on the trait Polygenic basis Discontinuous distribution of phenotypic trait Usually the graph of trait versus frequency has two distinct peaks

16) QTL mapping can rely on the relationship between genes for quantitative traits and which of the following?

Version 1

3

A) B) C) D)

The centromere Transposon sites Structural genes Molecular markers such as RFLPs

17) In QTL mapping, the parental strains are crossed and the F 1 generation backcrossed to which of the following?

A) B) C) D)

18)

The F 2 generation The parental generation A strain that is homozygous recessive for all markers A wild-type organism

A heritability value of 0.997 indicates which of the following?

A) B) C) D)

The majority of the phenotypic variation has a genetic basis.

The majority of the phenotypic variation has an environmental basis.

The trait is polygenic.

There is a significant difference between the two strains.

19) For a quantitative trait, the total variance of the population is due to which of the following?

A) B) C) D)

20)

The amount of variance due to genetic factors only The amount of variance due to environmental factors only The difference between the variance attributed to genetic and environmental factors The sum of the genetic and environmental variances

Inbreeding reduces which of the following variances to near zero?

Version 1

4

A) B) C) D)

21)

Heritability may be calculated as which of the following?

A) B) C) D)

22)

Genetic variance Environmental variance Both variances Neither variance

The total variance minus environmental variance Total variance minus genetic variance Genetic variance divided by environmental variance Genetic variance divided by total variance

The first step inthebackcross mating strategy for QTL mapping is that __________.

A) two inbred parental strains that differ in a quantitative trait are crossed to produce an

F1 B) the F1 offspring are crossed with each other C) the F2 offspring must contain chromosomes that are recombinant between the markers and the genes involved in the trait D) each parent should contain the same alleles at each QTL

23) After several generations of artificial selective breeding, a plateau is reached where artificial selection is no longer effective. This is called the __________.

A) B) C) D)

24)

realized limit realized heritability selection coefficient selection limit

Heterosis is __________.

Version 1

5

A) B) C) D)

the combination of lethal alleles due to inbreeding an increased vigor of hybrids resulting from the crossing of inbred strains a measurement of the variance due to environmental factors the result of homozygosity of multiple, dominant, detrimental alleles

25) It is possible for a genetically homozygous plant population to show a bell-shapedheight distribution because __________.

A) of environmental factors B) the trait isdiscrete C) of genetic variation

26)

Polygenic inheritance may result in a continuum of phenotypes because __________.

A) as the number of genes controlling a trait increases and the influence of environment variation becomes greater, there is a blurring of discreteness <!--Markup Copied from Habitat-> B) the alleles for each gene are either completely dominant or recessive C) additive genes mean the characters are meristic D) correlations among various traits are always positive

27) The equation that describes the relationship between phenotypic variance, genetic variance and environmental variance is __________.

A) B) C) D)

28)

VP = VG + VE 1 = VG + VE + VP VE = VG + VP VG = VP + VE

The best definition for genotype-environment interactions is __________.

Version 1

6

A) B) C) D)

environmental effects on the phenotype differ with genotype environment does not affect phenotype phenotypes will always be affected by the environment no matter what the genotype genotypes and phenotypes do not change with environmental conditions

29) Calculate the narrow-sense heritability of height between aunts and nieces if the observed phenotypic correlation coefficient is 0.1.

A) B) C) D)

0.4 2.5 4 0.25

30) A selective breeding program is trying to develop an agricultural plant with decreased stem length to aid in mechanical harvesting. The mean stem height of the population is 36 cm while the mean stem height of the parents is 30 cm and the mean stem height of the offspring is 33 cm. What is the realized heritability for stem height in this crop?

A) B) C) D)

0.5 1 .33 0

31) Hybrids resulting from matings of inbred strains often show heterosis, explained by two different hypotheses, overdominance and dominance. Which statement is correct regardingthese hypotheses?

A) The overdominance hypothesis relies on dominant/recessive alleles.

B) The dominance hypothesis relies on the fact that in the F1s, the deleterious effects of recessive alleles are masked by dominant ones.

Version 1

7

32) If in breeding selection the difference between the mean of the offspring and the mean of the starting population is 3.8 and the difference between the mean of the parents and the mean of the starting population is 5.3 then the realized heritability is approximately __________.

A) B) C) D)

0.72 1.4 1.5 20.3

SECTION BREAK. Answer all the part questions.

33) The heights of mothers and their female children are measured (in inches) with the following results Height of mother

Height of offspring at maturity

64

72

56

63

63

62

67

61

71

74

70

69

78

70

65

70

33.1) A) B) C) D)

33.2)

Version 1

What is the mean height for the mothers and daughters?

Mothers: 66.75 inDaughters: 67.63 in Mothers: 65.75 inDaughters: 67.63 in Mothers: 66.75 inDaughters: 66.52 in Mothers: 65.67 inDaughters: 66.45 in

What is the variance for the mother's and daughter's heights?

8

A) B) C) D)

33.3) A) B) C) D)

Version 1

Mothers: 42.21 in2Daughters: 24.27 in2 Mothers: 41.32 in2Daughters: 23.71 in2 Mothers: 43.78 in2Daughters: 24.27 in2 Mothers: 42.21 in2Daughters 23.78 in2

What is the standard deviation for the mother's and daughter's heights?

Mothers: 6.50 inDaughters: 4.93 in Mothers: 1781.68 inDaughters: 589.03 in Mothers: 42.21 inDaughters: 24.27 in Mothers: 5.50 inDaughters: 5.93 in

9

Answer Key Test name: Chap 28_7e 1) TRUE 2) FALSE 3) FALSE 4) FALSE 5) FALSE 6) TRUE 7) TRUE 8) FALSE 9) TRUE 10) B 11) B 12) C 13) B 14) A 15) B 16) D 17) B 18) A 19) D 20) A 21) D 22) A 23) D 24) B 25) A 26) A Version 1

10

27) A 28) A 29) A 30) A 31) B 32) A 33) Section Break 33.1) A 33.2) A 33.3) A

Version 1

11

CHAPTER 29 TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Microevolution is the term given to evolutionary changes that produce new species and groups of species. ⊚ ⊚

true false

2) One definition of species is a group of individuals whose members have the potential to interbreed and produce viable, fertile offspring. ⊚ ⊚

3)

The production of sterile offspring is an example of a prezygotic isolation mechanism. ⊚ ⊚

4)

true false

Human alpha hemoglobin and horse alpha hemoglobin are orthologs. ⊚ ⊚

6)

true false

Homologous genes are derived from the same ancestral gene. ⊚ ⊚

5)

true false

true false

A graphic illustration of the relationships between species is called a phylogenetic tree. ⊚ ⊚

Version 1

true false

1

7) At the microevolutionary level, natural selection is based on genetic differences that give an individual a selective advantage. ⊚ ⊚

true false

8) Researchers who study molecular evolution often analyze DNA sequences using computer programs which identify homologous sequences. ⊚ ⊚

true false

9) A gene family consists of two or more paralogs within the genome of a particular species. <!--Markup Copied from Habitat--> ⊚ ⊚

10)

true false

Neutral mutations can be acted on by natural selection. ⊚ ⊚

true false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

11) Select the prezygotic isolating mechanisms. (Check all that apply.)

A) B) C) D) E)

Temporal isolation Habitat isolation Mechanical isolation Hybrid inviability Sexual isolation

12) Analysis of rRNA sequences led to the proposal of what main branches of life? (Check all that apply.)

Version 1

2

A) B) C) D) E)

Bacteria Animalia Archaea Eukaryotes Protists

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

13) The changing composition of a gene pool with regard to a particular allele over a measurable period of time is called __________.

A) B) C) D)

14)

microevolution macroevolution molecular evolution None of these choices are correct.

The biological species concept was introduced by __________.

A) B) C) D) E)

Dobzhansky Darwin Mayr Mendel Wallace

15) Differences in sexual attraction between males and females based on behavior, physiology, or morphology is an example of a __________ isolation mechanism.

A) prezygotic B) postzygotic

Version 1

3

16) Which concept of speciation uses multiple criteria to determine if a population is part of an independent evolutionary lineage, and thus a species, which is distinct from others?

A) B) C) D)

Ecological species concept General lineage concept Biological species concept Evolutionary species concept

17) What type of cladogenesis occurs when a new species arises in the same habitat as the species from which it was derived?

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

18)

What type of cladogenesis can occur through the founder effect?

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

19)

What is the most common form of cladogenesis?

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

20)

In which form of cladogenesis do hybrid zones exist?

Version 1

4

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

21)

What form of cladogenesis occurs due to geographic separationdividing a population?

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

22)

The formation of polyploids in plants is an example of which model of cladogenesis?

A) Parapatric speciation B) Allopatric speciation C) Sympatric speciation

23)

Homologous genes that are found in different species are called __________.

A) B) C) D)

24)

paralogs orthologs gene families clades

Molecular clocks are based on __________ mutations.

A) B) C) D)

Version 1

advantageous lethal deleterious neutral

5

25) Based on rRNA analysis, all life on Earth can be grouped into how many major branches?

A) B) C) D)

26)

1 3 5 6

Horizontal gene transfer is most common among what group of organisms?

A) B) C) D)

Humans Bacteria Fungi Plants

27) Regions of a chromosome that contain groups of linked genes in several species are called __________.

A) B) C) D)

28)

linkage groups synteny groups regression groups homology groups

Molecular paleontology __________.

A) studies the morphology of extinct species B) studies the DNA of extinct species C) cannot use rRNA

Version 1

6

29) In the construction of a phylogenetic tree, a __________ considers the overall similarities among a group of species without trying to understand their evolutionary history, whereas a __________ considers the possible pathways of evolution to find the best possible tree.

A) B) C) D)

cladistic approach; phenetic approach phenetic approach; cladistic approach shared derived character; ancestral character ancestral character; shared derived character

30) Many species of cats (including big cats like lions, tigers, etc.) have tails. For cats, tails are likely to be a __________.

A) B) C) D)

synapomorphy shared derived character ancestral character clade

31) Proteins that are functionally less important for the survival of an organism generally evolve __________ more important proteins.

A) more slowly than B) more quickly than C) at the same rate as

32) In the frog genus, when certain species attempts to mate with other species, embryo development is halted at various stages including zygotic segmentation, blastula formation, gastrulation, or in the final phases of embryo development. The stage where the developing frog arrests depends on the species involved in the cross. This is an example of __________.

Version 1

7

A) B) C) D)

hybrid breakdown hybrid sterility hybrid inviability sexual isolation

33) It is currently believed that apple maggot flies are undergoing a divergence into two separate species. Two hundred years ago these maggot flies laid their eggs only on the hawthorn fruit, but after apples were introduced in the Americas, some maggot flies started laying their eggs on apples. Today, females generally lay their eggs on the type of fruit they grew up in, and male flies end up mating on the type of fruit they grew up in. Therefore hawthorn flies mate with hawthorn flies and apple flies mate with apple flies. If genetic changes between the hawthorn maggot flies and the apple maggot flies continue until the flies are different species, this would be an example of ___________.

A) allopatric speciation B) parapatric speciation C) sympatric speciation

34) One theory of human evolution suggests that Homo erectus evolved directly into Homo sapiens (humans), after which point Homo erectus became extinct. If this is true, humans arose by __________.

A) B) C) D)

Version 1

cladogenesis anagenesis allopatric speciation parapatric speciation

8

35)

In this phylogenetic tree, select the change that is a shared derived character for sequences A, B, and C. A) B) C) D)

A6→T T5→G G2→A A7→T

36) You are studying a new strain of bacteria. You discover that its genome contains some genes that are not found in any form in its most recent ancestor. You suspect __________.

A) B) C) D)

37)

anagenesis an extremely high rate of mutation horizontal gene transfer cladogenesis

Select the protein that you think will evolve the fastest.

A) B) C) D)

Version 1

A protein essential for DNA replication A subunit of the ribosome A protein involved in skin and hair pigmentation A cell membrane protein that is important for ion transfer

9

38) The plant species Erythranthe peregrina arose from a duplication of all of the chromosomes of a sterile triploid hybrid called E. x robertsii. E. peregrina most likely arose by __________.

A) allopatric speciation B) parapatric speciation C) sympatric speciation

39) The Galápagos finches described by Darwin evolved into many different species primarily based on different food sources on the island. These finches evolved by __________.

A) allopatric speciation B) parapatric speciation C) sympatric speciation

40) You are constructing a phylogenetic tree using the UPGMA method. In a homologous region containing 10,000bp you observe the following number of substititions when comparing species D to species A, B, and C:Species A: 362Species B: 400Species C: 412What is the percentage of nucleotide differences in species D versus species A/B/C? A) B) C) D)

Version 1

3.91 391 1174 11.74

10

Answer Key Test name: Chap 29_7e 1) FALSE 2) TRUE 3) FALSE 4) TRUE 5) TRUE 6) TRUE 7) TRUE 8) TRUE 9) TRUE 10) FALSE 11) [A, B, C, E] 12) [A, C, D] 13) A 14) C 15) A 16) B 17) C 18) B 19) B 20) A 21) B 22) C 23) B 24) D 25) B 26) B Version 1

11

27) B 28) B 29) B 30) C 31) B 32) C 33) C 34) B 35) C 36) C 37) C 38) C 39) C 40) A

Version 1

12