Gtmb vol 13 by Niko Boulikas

GENE THERAPY & MOLECULAR BIOLOGY

Volume 13 Number 1 June 2009 Published by Gene Therapy Press ISSN 1529-9120

Instructions to authors: Gene Therapy and Molecular Biology (GTMB) OPEN ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org. The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages. Charges, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication. The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for GTMB.

Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-mail), Summary, key words , running title and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cellfree cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures. Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs. Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission. Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Citation in MedLine Articles accepted for publication by GTMB or Cancer Therapy can be included in MedLine (PubMed) as full articles upon the request of authors provided that the authors have completed their published work under a government grant by NIH (or EU/Japan government grant). If this is you case, please consult the NIH Manuscript Submission System http://www.nihms.nih.gov/.

Editorial Office Teni Boulikas, Ph.D./ Maria Koutoudi, B.A. , M.A. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria.koutoudi@cancer-therapy.org The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Gene Therapy and Molecular Biology (GTMB) is covered in the following Thomson Scientific services: ! Science Citation Index Expanded (also known as SciSearch" ) ! Biotechnology Citation Index" Journals Citation Reports/Science Edition

Gene Therapy & Molecular Biology is acknowledged by the National Library of Medicine http://www.ncbi.nlm.nih.gov/sites/entrez search field: Gene ther mol biol search: journals http://www.ncbi.nlm.nih.gov/sites/entrez?Db=nlmcatalog&doptcmdl=Expanded&cmd=search&Term=9815849[NlmId]

Table of contents

Gene Therapy and Molecular Biology Vol 13 Number 1, June 2009

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-9

Review Article

New trends in aptamer-based electrochemical biosensors

Maria N. Velasco-Garcia, Sotiris Missailidis

10-14

Research Article

Mapping of MHC class binding nonamers from lipid binding protein of Ascaridia galli

Virendra S Gomase, Somnath B Waghmare, Baba Jadhav, Karbhari V Kale

15-19

Review Article

Perspectives in vector development for systemic cancer gene therapy

Arash Hatefi, Brenda F. Canine

20-25

Research Article

Curcumin is not a ligand for peroxisome proliferator-activated receptor-!

26-35

Review Article

FAK as a target for cancer therapy

Venkata R. Narala, Monica R. Smith, Ravi K. Adapala, Rajesh Ranga, Kalpana Panati, Bethany B. Moore, Todd Leff, Vudem D. Reddy, Anand K. Kondapi, Raju C. Reddy Steven N. Hochwald, Vita M. Golubovskaya

36-52

Review Article

Jian Xu, Xiao Song Liu, Shu-Feng Zhou, Ming Q Wei

53-63

Review Article

64-70

Research Article

71-81

Review Article

82-90

Review Article

Combination of immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours Non-viral and local gene medicine for improvement of cutaneous wound healing Functional analysis of the binding ability of neuropeptide f (NPF) form Moniezia expansa Differential expression of 14-3-3" during physiological, pathological cardiac hypertrophy and chronic heart failure in mice Delivery of opioid analgesics to the brain: the role of blood-brain barrier

91-129

Review Article

Genes and Happiness

Kenneth Blum, Amanda LC Chen, Thomas JH Chen, Abdalla Bowirrat3, B.William Downs, Roger L. Waite4, Jeffrey Reinking, Mallory Kerner, Dasha Braverman, Nicholas DiNubile, Patrich Rhoades, Eric R. Braverman, Stella M. Savarimuthu, Seth H. Blum, Marlene Oscar-Berman, Tomas Palomo, Eric Stice, Mark Gold, David E. Comings

Markus Rimann, Heike Hall

Virendra S Gomase, Somnath B Waghmare, Baba Jadhav, Karbhari V Kale Jianyong Qi, Ming Xu, Zhizhen Lu, Youyi Zhang

Sebastiano Mercadante, Edoardo Arcuri

130-143

Review Article

Signaling and epigenetic mechanisms regulating stem cells

Sangeetha Hareendran, Salar Abbas, Prithi Rajan

144-151

Research Article

Human primary chondrocytes exhibit an anti-angiogenic effect despite of high secretion of VEGF

Peter Camaj, Ivan Ischenko, Brian Ziegelaar, Dagmar Faktorova, Markus Guba, Karl-Walter Jauch, Christiane J. Bruns

152-157

Research Article

Chi-Un Pae, Antonio Drago, Alberto Chiesa, Laura Mandelli, Alessandro Serretti, Tae-Youn Jun

158-185

Review Article

186-193

Research Article

194-204

Review Article

205-213

Research Article

Association analysis of the Tumor necrosis factor gene polymorphisms (TNFA 238 and 302) in the development of schizophrenia: Impact on the antipsychotic treatment response Learning from Cancer: The adaptive Growth, Wound and Immune Responses The aberrant expression of bone morphogenetic protein 12 (BMP-12) in human breast cancer and its potential prognostic value Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions A Comparative Study on Different Characteristics between Prostate Cancer Model and BPH Model of BALB/c Mice

214-230

Research Article

Putative targeting of Dopamine D2 receptor function in Reward Deficiency Syndrome (RDS) by Synaptamine Complexâ&#x201E;˘ Variant (KB220): Clinical trial showing anti-anxiety effects

Kenneth Blum, Amanda LC Chen, Thomas JH Chen, Abdalla Bowirrat, Roger L Waite, Mallory Kerner, Seth H. Blum, B. William Downs, Stella Savarimuthu, Patrick Rhoades, Jeffrey Reinking, Eric R. Braverman, Dasha Braverman, Nicholas DiNubile, Marlene Oscar-Berman

231-243

Review Article

Maintenance of a functional higher order chromatin structure: The role of the nuclear matrix in normal and disease states

Amelia K. Linnemann, Stephen A. Krawetz

244-253

Research Article

Suppression of adenoviral-induced host immune response by TGFĂ&#x;1 expression

Yi Lu, Ying Wang, Guimin Chang

Gary Robert Smith, Sotiris Missailidis

Jin Li, Lin Ye, Christian Parr, Anthony Douglas-Jones, Howard G. Kynaston, Robert E. Mansel, Wen G. Jiang Hima Vangapandu, Walden Ai

Sun Weigui, Gan Yiping, Ye Zhangqun, Yu Qiangguo, Mi Zhenguo, Song Xiaosong, Fan Zhaoyin, Wang Quanhong, Han Chunzhi

Gene Therapy and Molecular Biology Vol 13, page 1 Gene Ther Mol Biol Vol 13, 1-9, 2009

New trends in aptamer-based electrochemical biosensors Review Article

Maria N. Velasco-Garcia*, Sotiris Missailidis Department of Chemistry and Analytical Sciences, Faculty of Science, The Open University, Walton Hall, Milton Keynes, United Kingdom, MK7 6AA

__________________________________________________________________________________ *Correspondence: Maria N. Velasco-Garcia, Department of Chemistry and Analytical Sciences, Faculty of Science, The Open University, Walton Hall, Milton Keynes, United Kingdom, MK7 6AA; e-mail: m.n.velasco@open.ac.uk Sotiris Missailidis, Department of Chemistry and Analytical Sciences, Faculty of Science, The Open University, Walton Hall, Milton Keynes, United Kingdom, MK7 6AA; e-mail: s.missailidis@open.ac.uk Key words: Aptamer, Biosensor, Aptasensor, Electrochemical detection, SELEX Abbreviations: Platelet-derived growth factor BB (PDGF-BB); reverse-transcription PCR (RT PCR); self-assembled monolayers (SAMs); Systematic Evolution of Ligands by EXponential enrichment, (SELEX) Received: 28 January 2009; Revised: 6 February 2009 Accepted: 6 February 2009; electronically published: 8 February 2009

Summary The analytical characteristics of aptamers are comparable with those of antibodies for the development of biosensor technology. However, aptamers offer some crucial advantages over antibodies such as selection capability for a variety of targets, easy synthesis, improved reproducibility and stability, simple modification for immobilization to solid supports and enhanced selectivity. This article reviews aptamer technology as well as aptamer-based assay configurations and goes on to explore reported applications in electrochemical aptasensors.

applications where the later are not compatible (Tombelli et al, 2005, 2007). Despite the fact that development of aptasensors has been boosted by using optical and acoustic transducers, this review summarizes the recent developments in the design of electrochemical aptamer-based affinity sensors. In comparison with other detection systems, the electrochemical detection combines a high sensitivity, direct electronic signal production, fast response, robustness, low cost, the possibility of miniaturization and simultaneous multianalyte detection.

I. Introduction Biosensor technology holds a great promise for the healthcare market, the security sector, the food industry, environmental and veterinary diagnostic; harnessing the specificity and sensitivity of biological-based assays packaged into portable and low cost devices which allow for rapid analysis of complex samples in out-of-laboratory environments. However the application of biosensors lags far behind the fundamental research; the challenges facing this basic technology are associated with sensitive detection of specific molecules in samples, stability issues, quality assurance, instrumentation design and cost considerations (Velasco-Garcia and Tottram, 2003). The main biological sensing materials used in biosensor development are the couples enzyme/substrate and antibody/antigen. These are limited by temperature, sensitivity, stability, batch-to-batch variation, large size and difficulty in production. Recent advances and developments in the aptamer area offer a powerful alternative approach involving the use of small RNA or DNA molecules that bind to specific targets with very high affinity and specificity. Aptamer receptors are a novel entity of undeniable potential in analytical applications and can complement or substitute antibodies or offer

II. Aptamers As aptamers approach 20 years since they were originally described (Ellington and Szostak, 1990; Tuerk and Gold, 1990), they are currently receiving a wider recognition in the literature as research reagents, inhibitors, imaging or diagnostic agents (Luzi et al, 2003; Hamula et al, 2006). Aptamers are short, single stranded oligonucleotides, which inherently adopt stable three dimensional sequence-dependent structures. This intrinsic property makes them efficient binding molecules, capable of binding to an array of molecular targets ranging from small ions and organic molecules to large glycoproteins

Velasco-Garcia and Missailidis: New trends in aptamer-based electrochemical biosensors and mucins (Ferreira et al, 2006). Aptamers are a novel and particularly interesting targeting modality, with the ability to bind to a variety of targets including proteins, peptides, enzymes, antibodies and cell surface receptors, as well as small molecules ranging from glucose and caffeine, to steroids to TNT. Aptamers are single stranded oligonucleotides that vary in size between 25-90 bases long and adopt complex secondary and tertiary structures, which facilitate specific interactions with other molecules. They are derived from vast combinatorial libraries through selective targeting and competitive binding. There are two different configurations of aptamers: (i) linear and (ii) molecular beacon. Aptamers with a linear configuration maintain in certain physicochemical conditions a typical 3D conformation with specific binding sites for the target molecule. On the other hand aptamers with a molecular beacon configuration initially form a loop that changes conformation following binding to the analyte of interest. Aptamers offer unique benefits compared to other targeting agents; not only they bind specific ligands with high affinity and selectivity, but aptamers can be easily selected using in vitro techniques and are chemically synthesized, overcoming the use of animal for their production. In comparison to antibodies, aptamers are purified to a very high degree of purity, which eliminates the batch-to-batch variation found in antibodies. Aptamers have higher temperature stability (stable at room temperature) and because of their small size, denser receptor layers could be generated. The animal-free production of aptamers is especially advantageous in cases where the immune response can fail when the target molecule (e.g. a protein) has a structure similar to endogenous proteins or when the antigen consists of toxic or non-immunogenic compounds. Aptamers are relatively

stable under a wide range of buffer conditions and resistant to chemical degradation, although, due to their DNA or RNA constitution, they are sensitive to hydrolytic digestion by nucleases. Aptamers have been modified into nuclease-resistant moieties by modification of the ribose ring at the 2â&#x20AC;&#x2122;-position or by the specific modification of the pyrimidine nucleotide (Pieken et al, 1991; Heidenreich and Eckstein, 1992; Kusser, 2000). It is also possible to chemically modify aptamers to facilitate covalent conjugation to reporters and nanoparticles with 5â&#x20AC;&#x2122; or 3â&#x20AC;&#x2122; amino, biotin or thiol groups. These characteristics make them extremely attractive as alternatives to antibodies and peptides for use in assays, or as diagnostic agents.

A. The SELEX process Aptamers are typically isolated from combinatorial libraries by a process of in vitro evolution, termed SELEX (Systematic Evolution of Ligands by EXponential enrichment). This procedure is an in vitro evolutionary selection process that allows the isolation of aptamer(s), with unique binding properties, from a large library of oligonucleotides through iterative cycles of (i) interaction of a large library of aptamers with the target molecule, (ii) separation of bound from unbound aptamer species, (iii) elution of bound aptamers and (iv) PCR amplification of the binding aptamers for further selection rounds (Figure 1 for an example of the process). An aptamer library usually consists of a variable region (20-40 nucleotides) flanked by known primer sequences on either end for the amplification during the SELEX procedure. The variable region makes up to 1015 different sequences which, combined with the innate ability of oligonucleotides to form stable sequence-

Figure 1. The SELEX process

Gene Therapy and Molecular Biology Vol 13, page 3 dependent structures, provide an array of molecular shapes available for the selection process (Khan and Missailidis, 2008). In the selection steps, the library is incubated with the immobilised target. Unbound or weak-binding species are removed and bound aptamers are eluted using high salt, temperature, chaotropic agents or other such conditions that would affect molecular structure or disrupt molecular interactions. Eluted aptamers are subsequently amplified by PCR (DNA) or reverse-transcription PCR (RT PCR) using primers complementary to the flanking sequences in the aptamer library. The enriched pool of binding species forms the pool for the next round of selection. Repeated selection and amplification steps allow identification of the highest binding species, through competitive binding. The selection and amplification step constitutes one round or cycle in a typical SELEX procedure, with anything between 1 and 15 cycles often described in the literature. Counter- or negative selection steps can ensure that the finally selected aptamers are very specific for their target and do not interact with homologous proteins or chemically closely-related molecular targets (Missailidis, 2008). Selected aptamers are subsequently cloned and sequenced to identify the sequence of the binding species and their interactions are usually characterised by a variety of analytical methodologies, prior to move into the various applications they were originally destined for. Selected aptamer can be easily produced by solid phase synthesis and appropriate modifications can be introduced at this stage to confer additional properties to the selected aptamers, such as nuclease resistance (Figure 2), crosslinking ability or improved pharmacokinetic properties. Although SELEX has been the initial methodology associated with aptamer selection and has remained a robust and powerful technique, which has been adapted to various systems and targets, a number of other methodologies have also emerged for the selection of aptamers. Such “non-SELEX” based methods for the selection of aptamers include capillary electrophoresis methodologies (Berezovski et al, 2005; Drabovich et al, 2005), isolation of aptamers with predefined kinetic and thermodynamic properties of their interaction with the target, without the need for amplification, allowing the use of libraries which are difficult or cannot be amplified, or computational methods, which are particularly important in selecting aptamers with inhibitory activities or sequences that undergo ligand dependent conformational changes (Ikebukuro et al, 2005). The SELEX procedure and subsequent technologies for aptamer selection have offered the tools for the designing of aptamers that have found a range of diagnostic applications (Khan and Missailidis, 2008). Such applications include Photo-SELEX (www.somalogic.com) and SELEX NADIR (Winters-Hilt, 2006) using optical probe reporting or nanopore reporting mechanisms respectively, aptamer microarrays (Cho et al., 2005), currently in the market by LC Sciences (www.lcsciences.com), fluorescent aptamers in chips and microspheres (Kirby et al, 2004; Potyrailo et al., 1998), fluorescent sensors for small molecule recognition (Ozaki et al, 2006; Yamana et al, 2003), quantum dots (Liu et al,

2007; Levy et al, 2005; Choi et al, 2006; Ivanovic et al, 2007), colorimetric detection (Liu and Lu, 2004; Cho et al, 2006; Liu and Lu, 2006), electrochemical detection (Lai et al, 2007; Xiao et al, 2005; Papamichael et al, 2007; Mir et al, 2006) and piezoelectric quartz crystal sensors (Bini et al, 2007). The above methods, fluorescent, electrochemical and colorimetric detection, have also been used in molecular switch type sensors or modular sensor assemblies, where the aptamers usually change conformation upon binding to either emit a fluorescent signal based on an aptamer beacon on sensor, or through non-covalent interaction with the fluorescent label, triggering an electrochemical sensor or leading to change of colour (Stojanovic and Kolpashchikov, 2004; Stojanovic et al, 2001; Baker et al, 2006; Zuo et al, 2007; Stojanovic and Landry, 2002; Frauendorf and Jaschke, 2001), with particular sensitivities in the recognition of small analytes. Aptamers have also been used in enzymatic sensing, without the use of any label or signal related directly to the aptamer. These applications remain based on changes in the conformation of bifunctional aptamers that recognise the target ligand and an enzyme or ribosome. The binding of the aptamer to the ligand results in conformational changes that affect enzymatic activity or protein expression, and it is the later that is subsequently measured (Ogawa and Maeda, 2007; Yoshida et al, 2006; Yoshida et al, 2006) or utilises an enzyme to ligate proximally bound aptamers to large protein targets and allow their subsequent PCR amplification (Fredriksson et al, 2002).

III. Aptamer immobilisation Aptamers can certainly be used as molecular recognition elements in affinity sensing. The small size of aptamers provides advantages over antibodies: (i) a greater

Figure 2. An amino or fluoro modification at the 2’ position of the sugar can confer the oligonucleotide aptamer stability against nuclease degradation. An alternative to using modifications at the 2’ of the sugar (whether at the 3’ or 5’ end of the aptamer, or both) for nuclease resistance is to use a flipped base added to the end of the aptamer.

Velasco-Garcia and Missailidis: New trends in aptamer-based electrochemical biosensors surface density of receptors and (ii) multiple binding to target molecules for sandwich assays. The method of immobilization of aptamers to a solid support affects the sensitivity of the aptamer to the target molecule. Thus, the selected method should maintain the binding affinity and selectivity that the aptamers display in solution (Balamurugan et al, 2008). Aptamers can be attached to the solid support at either the 5’-end or the 3’ end. Both positions have been reported as being used for aptasensor development. However, there are very few studies looking at the effect of the two types of end attachment. Recent work suggests that it depends on the particular aptamer (Cho et al, 2006), although for biological targeting it may be that the 3’ end is more suitable, since the 3’ end is the primary target for exonucleases, and thus its coupling to the solid support would simultaneously confer resistance to nucleases. Gold is used for many electrochemical measurements. Direct attachment of aptamers to gold surfaces could be achieved by using a thiol-alkane linked to the aptamer sequence. The gold surface could also be functionalized and the type of chemistry selected is dependent on what type of terminal functional group is linked to the aptamer (amine, thiol or biotin termini; Figure 3). Gold surfaces functionalized with self-assembled monolayers (SAMs) can address the nonspecific adsorption of aptamer to the surface, which is a particular problem for long oligonucleotides with larger numbers of amine groups. Avidin-biotin technology has also been exploited for aptamer immobilization. Strepavidin can be physically adsorbed or covalently immobilized onto the support and the method mainly requires incubation of the biotin-tethered aptamer with the modified substrate. Studies of the anti-thrombin aptamer revealed this biocoating method gives best results regarding sensitivity compared to other immobilization strategies (Hianik et al, 2007).

Figure 3. Standard nucleic acid modifications used for aptamer immobilisation. Most of the common modifications are linked via the phosphate group of the oligonucleotide aptamer. Various lengths carbon chains are used that can offer higher or lower flexibility.

molecule. One aptamer is immobilized on a suitable solid support to capture the target while the other aptamer for detection is conjugated to a catalytic label. Enzymes, inorganic or organic catalysts or nanoparticles are often used for electrochemical detection. In some cases, when there is only one aptamer for the molecule of interest, antibodies have been reported to be used instead of the second aptamer (Ferreira et al, 2008). If the target protein contains two identical binding sites, the selection of a single aptamer still allows the development of a sandwich assay. Displacement assays have been also proposed to overcome the more challenging detection of small molecules. Affinity interactions between aptamers and small ligands are weaker than interaction with large molecules (with dissociation constants in the µM range, in comparison with constants for large molecules that are in the pM-nM range). The presence of the small target could induce the separation of two strands of a duplex nucleic acid (one strand being the aptamer immobilised to a solid support). Another strategy could rely on the displacement of the aptamer from its complex with the immobilised target molecule when the molecule is present in solution (De-los-Santos-Alvarez et al, 2008). Induced-fit conformational changes of the aptamer after binding to the target molecule can also be used to monitor a bio-recognition event by tagging the aptamer (Figure 4). The use of labels requires precise knowledge of the aptamer folding mechanism after binding to the target and the binding sites. In the case of a redox active marker, the accessibility of the label to the conducting support is associated with the tertiary structure of the aptamer before and after the binding event. However, for small molecules, this strategy is not always viable,

IV. Electrochemical assays In principle, aptamers can be selected for any given target, ranging from small molecules to large proteins and even cells. When aptamers bind small molecular targets, these get incorporated into the nucleic acid structure, buried within the binding pockets of aptamer structures. On the other hand, large molecules (e.g. proteins) are structurally more complicated, allowing aptamer interactions at various sites via hydrogen bonding, electrostatic interactions and shape complementarity. The use of aptamers as bio-recognition elements for small molecules has not been reported as extensively as for protein targets. Mainly two different assay configurations have been reported to transduce these target-binding aptamer events: (i) single-site binding and (ii) dual-site binding (Song et al, 2008). Small molecules are often assayed using the singlesite binding configuration. Protein targets can be assayed via both single-site and dual-site binding. The dual-site binding assay is commonly known as the sandwich assay. Normally, the target molecule is sandwiched between a pair of aptamers that bind to different regions of the large 4

Gene Therapy and Molecular Biology Vol 13, page 5 because the aptamer 3D structure could only be slightly perturbed after the ligand interaction. Redox-active reporting labels could not be covalently tethered to aptamers. Methylene blue has been intercalated into the double-stranded DNA domain of a hairpin configuration aptamer. The binding of the target with the aptamer opens the hairpin structure and releases the intercalated methylene blue. As a result, the amperometric response decreased with the addition of the analyte. This approach is known as â&#x20AC;&#x153;label-freeâ&#x20AC;? method (Figure 5). Related approaches use cationic redox-active reporting units bound to the electrode via electrostatic interactions with the DNA aptamer phosphate backbone. The binding of the target molecule with the aptamer blocked the binding of the cationic reporting units and the electrochemical response decreased. The main disadvantage of these latter approaches is a negative detection signal. Recently, nanomaterials are also providing novel electrochemical sensing approaches. Single-walled carbon nanotube field-effect transistor sensors were developed to monitor aptamer-protein binding studies. Aptamers are well suited for FET sensing due to their small size (1-2 nm) and recognition occurs inside the electrical doublelayer associated with the gate (within the Debye length). The single-walled carbon nanotubes were assembled between source and drain electrodes and the aptamers were immobilized to these nanomaterials. In this label-free approach, the binding of the target molecule to the aptamers altered conductance through the device. The ease

of miniaturization of these sensing devices opens up the feasibility of high-throughput assays in microarrays. Nanoparticles have also been reported as catalytic labels, instead of enzymes, and carriers for ultrasensitive electrochemical detection; because one nanoparticle contains a large number of aptamers, the target binding process is amplified. Impedance spectroscopy has been the most frequently used electrochemical method in the development of electrochemical aptasensors and has shown excellent sensitivity, achieving limit of detection of fM. However, despite the fact that the analytical technique is simple to perform, the data fitting remains a bit complicated. Easier data processing and faster response could be achieved with chonoamperometry, but the limit of detection will be higher and in the nM range.

IV. Applications of electrochemical aptasensors Aptamer publications have now appeared in the literature using most of the electrochemical transducers. The majority of aptamer work on electrochemical sensors is focused on amperometric transducers, but there have been references on aptamers used in impedimetric, FET and recently potentiometric sensors. Furthermore, a lot of the work on the aptamers in electrochemical sensors has been on the model protein, thrombin, which is one of the best characterised complexes in the aptamer literature.

Figure 4. Assays based on induced-fit conformational changes of aptamers.

Figure 5. Label-free electrochemical assays based on: (A) methylene blue intercalated into the DNA aptamer and (B) cationic redoxactive reporting units bound to DNA aptamer phosphate backbone.

Velasco-Garcia and Missailidis: New trends in aptamer-based electrochemical biosensors These have provided proof of principle concepts as to how aptamers could be developed in novel sensors. However, a number of other systems have also now been described, which will be presented in this review.

prepared following formation of 11-mercaptoundecanoic acid self-assembled monolayer on gold electrode. Methylene blue was intercalated on the aptamer by the interaction with two guanine bases. Binding of the thrombin is correlated with the decrease in electrical current intensity in voltammetry. The estimated detection limit of the target thrombin was 11 nM (Bang et al, 2005). The modification of antibodies is difficult, costly and time consuming; however researchers have been using conventional polyclonal antibodies as a capturing probe and labelled-aptamers as the detection probe in new sandwich approaches for protein detection. Kang and colleagues reported in 2008 a modified electrochemical sandwich model for thrombin, based on capturing antibody immobilized onto glassy carbon electrodes with nanogold-chitosan composite film and Methylene blue labelled aptamer as the electrochemical detection probe. Lu and colleagues described in 2008 an electrochemical aptasensor for thrombin that is not based on the target binding-induced conformational change of aptamers. The thrombin-binding aptamer is first assembled onto a gold electrode and then hybridized with a ferrocene labelled short aptamer-complementary DNA oligonucleotide. The binding of the thrombin to the aptamer destroys the double-stranded DNA oligonucleotide and leads to the dissociation of the label short complementary DNA oligonucleotide from the electrode surface, resulting in a decrease in the differential pulse voltammetry responses at the electrode (Lu et al, 2008). This strategy is based on the stronger binding affinity of the aptamers towards their targets rather than to the short aptamer-complementary DNA oligonucleotide labelled with electroactive moieties. The majority of the work performed on aptamerbased electrochemical biosensors is based on aptamers labelled using redox compounds, such as methylene blue, and catalysts such as horseradish peroxidase. However, nanoparticle-based materials offer excellent prospects for a new signal amplification strategy for ultrasensitive electrochemical aptasensing. Platinum nanoparticles have been reported as catalytic labels when linked to a thiolated aptamer. The nanoparticles catalysed the electrochemical reduction of H2O2 and the resulting current enabled the amplified detection of thrombin sandwiched between the aptamer on the electrode surface and the aptamer labelled with the nanoparticles (Polsky et al, 2006). Gold nanoparticles offer several advantages such as electrical conductivity, biocompatibility, ease of self-assembly through a thiol group, increase electrode surface area and amount of immobilized capturing probe. Gold nanoparticles have been used as an electrochemical sensing platform for direct detection of thrombine. The aptamer was immobilised on a screen-printed electrode modified with gold-nanoparticles by avidin-biotin technology. The gold-nanoparticles surface status is evaluated by the Au/Au oxide film formation with cyclic and stripping voltammetry. Gold nanoparticles signal changed with the deposition of biolayers due to differences in electron transfer efficacy and availability of buffer oxygen. Aptamers prefer to adopt the G-quarter structure when binding with thrombin and the

A. Electrochemical aptasensors for the model protein The thrombin-binding aptamer (15-mer, 5â&#x20AC;&#x2122;GGTTGGTGTGGTTGG-3â&#x20AC;&#x2122;) was the first one selected in 1992 by Block and colleagues and its structure has been well characterized and studied. The folded structure in solution is composed of two guanine quartets connected by two T-T loops spanning the narrow grooves at one end and a T-G-T loop spanning a wide groove at the other end (known as the G-quartet structure). This anti-thrombin aptamer has been extensively used as the model oligonucleotide by many researchers to demonstrate the wide applicability of aptamers as bio-recognition elements in biosensors. In the literature, many different electrochemical aptasensors for thrombin detection have been reported. The most straightforward configuration is based on the immobilization of a thiol terminated aptamer on a gold electrode. The aptamer-thrombin interaction is transduced by the electrochemical quantification of p-nitroaniline produced by the thrombinâ&#x20AC;&#x2122;s enzymatic reaction. Thrombin has two electropositive exosites both capable of binding the aptamer, allowing the development of an electrochemical sensor system in a sandwich manner. The thiolated aptamer was immobilized on a gold electrode and, after incubation with the thrombin, a second incubation step with an HRP labelled aptamer took place. Electrochemical detection of HRP was performed using H2O2 and a diffusional osmium based mediator. A similar aptasensor system in sandwich manner for thrombin was developed based on the aptamer for detection, labelled with pyrroquinoline quinine glucose dehydrogenase, and the electric current generated from glucose addition after the formation of the complex on a gold electrode (Ikebukuro et al, 2005). Another strategy for the thrombin sensing is the direct immobilization of the protein on the electrode surface. After the incubation with biotin-labelled aptamer and then with streptavidin-HRP, the electrochemical detection is performed using H2O2 and a diffusional osmium-based mediator. The latter approach achieved the lower limit of detection, 3.5 nM (Mir et al, 2006). Mir and colleagues also developed in 2008 a chronoamperometric beacon biosensor based on a ferrocene-labelled thiol-aptamer. The aptamer adopts a 3D conformational change after binding the thrombin, allowing the ferrocene label to approach to the gold electrode. The interaction is detected via a microperoxidase mediated electron transfer between the label and the electrode surface. The system was demonstrated with impedance spectroscopy and chronoamperometry measurements, achieving a limit of detection of 30 fM with the impedance spectroscopy (Mir et al, 2008). Methylene blue has also been used as an electrochemical marker. The beacon aptamer surface was

Gene Therapy and Molecular Biology Vol 13, page 7 conformational changes made double strand DNA zones appear and facilitated the electron transfer from solution to the electrode surface, based on the double stranded DNAâ&#x20AC;&#x2122;s ability to transport charge along the nucleotide stacking (Suprun et al, 2008). The detection limit of this novel approach is in the nM range. However, the aptasensor measured directly binding events and opened 4 orders of magnitude the operating range of protein concentration. Assays coupling aptamers with magnetic beads for the aptamer or target immobilisation before the electrochemical transduction have also been proposed (Centi et al, 2008). The use of magnetic beads improved the assay kinetics due to the beads being in suspension and also minimized matrix effect because of better washing and separation steps. An ultrasensitive electrochemical aptasensor for thrombin in a sandwich format of magnetic nanoparicleimmobilized aptamer, thrombin and gold nanoparticlelabelled aptamer was reported by Zheng and colleagues in 2007. The magnetic nanoparticle-immobilized aptamer was used for capturing and separating the target protein. The gold nanoparticle-labelled aptamer offered the electrochemical signal transduction. The signal was amplified by forming a network like thiocyanuric acid/ gold nanoparticles to cap more nanoparticles per assay, lowering the detection limit to the aM range

with an RNA aptamer and 1 pM with a DNA aptamer probe (Min et al, 2008). Electrochemical aptasensors for 17-" estradiol have also been reported. The selected biotinylated DNA aptamer was immobilized on a streptavidin-modified gold electrode. The chemical binding of the hormone to the aptamer was monitored by cyclic and square wave voltammetry. When the 17-" estradiol interacted with the aptamer, the current decreased due to the interference of the bound target molecule with the electron flow produced by a redox reaction between ferrocyanide (the mediator) and ferricyanide. The linear range of this aptasensing device was 1-0.01 nM of 17-" estradiol (Kim et al, 2007). Cocaine has been detected by an electrochemical aptasensor incorporating gold nanoparticles onto the surface of a gold electrode. The thiol-derivative aptamer was self-assembled onto the gold nanoparticles. The aptamer was also functionalized at the other termini of the strand with a redox-active ferrocene moiety. The cocaine binding to the aptamer induces the conformational change of the aptamer, bringing the redox tag in close proximity to the electrode, leading to an increase in the current (Li et al, 2008). Methylene blue tagged aptamer has been also explored for the detection of cocaine (Baker et al, 2006). A novel adenosine aptasensor was reported based on the structure change of an aptamer probe immobilized on a gold electrode. After the binding aptamer-target nucleoside, a higher surface charge density and an increasing steric hindrance were obtained that reduce the diffusion of [Fe(CN)6]3-/[Fe(CN)6]4- towards the electrode surface, resulting in a decrease of the current. The biosensing surface was easily regenerated and the aptasensor limit of detection was 10 nM (Zheng et al, 2008).

B. Other targets Aptamer have been selected against a wide range of targets with typical binding affinities in the nanomolar to picomolar range. Recently, electrochemical aptasensors have been reported to detect proteins, hormones and drugs. Papamichael and colleagues described in 2007 a disposable electrochemical aptasensor for Immunoglobulin E, a key marker of atopic diseases (such as asthma, dermatitis and pollenosis). The sensor incorporates a competitive format for IgE detection using a biotinylated form of the aptamer. A standard, indirect method was used where competition between surfacebound IgE and IgE in solution proceeded for the aptamer. The electrochemical detection is achieved by the use of an extravidin-alkaline phosphatase label. After careful optimization of conditions (buffer pH, ionic strength, additional ions and proteins), the aptasensor was performing at levels suitable for human testing (>300ng ml-1). Platelet-derived growth factor BB (PDGF-BB) is one important cytokine involved in neural inflammation and was selected as target for the development of an electrochemical aptasensor based on capacitance change induced by aptamer-protein specific binding, measured by non-faradic impedance spectroscopy. The biosensor detection limit was 40 nM. Electrochemical impedance spectroscopy is a very attractive method for in vivo diagnostics, due to its high sensitivity and label free characteristics (Liao and Cui, 2007). A similar electrochemical detection was also reported to a tuberculosis-related cytokine, the interferon-!. The aptamer-based electrochemical impedance biosensor successfully detected interferon-! to a level of 100 fM

C. Aptasensor arrays Some of the aptamer-based biosensor technology described in this review could be transferred from singleanalyte devices to electrochemical methods offering the possibility of simultaneous measurements of a panel of targets. Wang reviewed the use of metal nanoparticles as tracers for the analysis of nucleic acid hybridization. Magnetic nanoparticles were linked to different probe DNAs and incubated with samples containing different DNA targets. Semiconductor quantum dots were functionalized each with different nucleic acids complementary to the free chain of the target DNA. After dissolution of the metal nanoparticles, the identification of the metal ions by stripping voltammetry enabled the analysis of the different DNA targets (Wang, 2003). Thrombin and lysozyme were detected in parallel using a competitive assay in which thrombin and lysozyme were modified with different semiconductor quantum dots (Hansen et al, 2006). Specific aptamers were immobilized on a gold electrode and bound to the respective labelled protein. In the presence of unlabelled protein in the sample, the quantum-dot functionalized protein is displaced from the electrode into solution. The dissolution of the remaining metal ions on the surface and the electrochemical detection of the released ions enabled the quantitative detection of the proteins.

Velasco-Garcia and Missailidis: New trends in aptamer-based electrochemical biosensors Drabovich A, Berezovski M, Krylov SN (2005) Selection of Smart Aptamers by Equilibrium Capillary Electrophoresis of Equilibrium Mixtures (ECEEM). J Am Chem Soc 127, 11224-11225. Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822. Ferreira CSM, Matthews CS, Missailidis S (2006) DNA aptamers that bind to MUC1 tumour marker: Design and characterization of MUC1-binding single stranded DNA aptamers. Tumor Biol 27, 289-301. Ferreira CSM, Papamichael K, Guilbault G, Schwarzacher T, Gariepy J, Missailidis S (2008) Design of aptamer-antibody sandwich ELISA for early tumour diagnosis. Anal Bioanal Chem 390, 1039-1050. Frauendorf C, Jaschke A (2001) Detection of small organic analytes by fluorescing molecular switches. Bioorg Med Chem 9, 2521-2524. Fredriksson S, Gullberg M, Jarvius J, Olsson C, Pietras K, Gustafsdottir SM, Ostman A, Landegren U (2002) Protein detection using proximity-dependent DNA ligation assays. Nature Biotechnol 20, 473-477. Hamula CLA, Guthrie JW, Zhang H, Li XF, Le XC (2006) Selection and analytical applications of aptamers. Trends Anal Chem 25, 681-691. Hansen JA, Wang J, Kawde AN, Xiang Y, Gothelf KV, Collins G (2006) Quantum-dot/aptamer-based ultrasensitive multianalyte electrochemical biosensor. J Am Chem Soc 128, 2228-2229. Heidenreich O, Eckstein F (1992) Hammerhead ribozymemediated cleavage of the long terminal repeat RNA of human immunodeficiency virus type 1. J Biol Chem 267, 1904-1909. Hianik T, Ostatna V, Sonlajtnerova M, Grman I (2007) Influence of ionic strength, pH and aptamer configuration for binding affinity to thrombin. Bioelectrochemistry 70, 127133. Ikanovic M, Rudzinski WE, Bruno JG, Allman A, Carrillo MP, Dwarakanath S, Bhahdigadi S, Rao P, Kiel JL, Andrews CJ (2007) Fluorescence Assay Based on Aptamer-Quantum Dot Binding to Bacillus thuringiensis Spores. J Fluoresc 17, 193199. Ikebukuro K, Kiyohara C, Sode K (2005) Novel electrochemical sensor system for protein using the aptamers in sandwich manner. Biosens Bioelec 20, 2168-2172. Ikebukuro K, Okumura Y, Sumikura K, Karube I (2005) A novel method of screening thrombin-inhibiting DNA aptamers using an evolution-mimicking algorithm. Nucleic Acids Res 33, e108. Kang Y, Feng KJ, Chen JW, Jiang JH, Shen GL, Yu RQ (2008) Electrochemical detection of thrombin by sandwich approach using antibody and aptamer. Bioelectrochemistry 73, 76-81. Khan H, Missailidis S (2008) Aptamers in oncology: a diagnostic perspective. Gene Ther Mol Biol 12, 111-128. Kim YS, Jung HS, Matsuura T, Lee HY, Kawai T, Gu MB (2007) Electrochemical detection of 17beta-estradiol using DNA aptamer immobilized gold electrode chip. Biosens Bioelec 22, 2525-2531. Kirby R, Cho EJ, Gehrke B, Bayer T, Park YS, Neikirk DP, McDevitt JT, Ellington AD (2004) Aptamer-based sensor arrays for the detection and quantification of proteins. Anal Chem 76, 4066-4075. Kusser W (2000) Chemically modified nucleic acid aptamers for in vitro selections: evolving evolution. Rev Mol Biotechnol 74, 27-38. Lai RY, Plaxco KW, Heeger AJ (2007) Aptamer-based electrochemical detection of picomolar platelet-derived growth factor directly in blood serum. Anal Chem 79, 229233.

IV. Conclusions Aptamers have been widely used in a variety of diagnostic and sensor applications, offering a variety of possibilities for aptamer-based sensors in early disease diagnosis and prognosis, substance control, environmental measurements or national security applications on measurements of explosives or potential infectious agents. Yet, despite the advances and the huge body of literature documenting the success of the technology, the commercial application of aptamers in the field of diagnostics remains relatively undeveloped, not least due to the exclusive IP portfolio, and the fact that there is a vast antibody-based diagnostic market and a certain degree of hesitation to move to a new type of product, unless aptamers offer verifiably significant improvements on current technologies that warrant substitution of antibodies in some current assay formats. In this review, different types of electrochemical aptamer-based biosensors have been discussed. Although the optical and mass-sensitive aptasensors have been the most commonly described in the literature, electrochemical transducers have enormous potential and offer simple, rapid, cost-effective and easy to miniaturize sensing in many diagnostic fields. Emerging nanomaterials have also brought new possibilities for developing novel ultrasensitive electrochemical aptasensors.

References Baker BR, Lai RY, Wood MCS, Doctor EH, Heeger AJ, Plaxco KW (2006) An electronic, aptamer-based small-molecule sensor for the rapid label-free detection of cocaine in adulterated samples and biological fluids. J Am Chem Soc 128, 3138-3139. Balamurugan S, Obubuafo A, Soper SA, Spivak DA (2008) Surface immobilization methods for aptamer diagnostic applications. Anal Bioanal Chem 390, 1009-1021. Bang GS, Cho S, Kim BG (2005) A novel electrochemical detection method for aptamer biosensors. Biosens Bioelec 21, 863-870. Berezovski M, Drabovich A, Krylova SM, Musheev M, Okhonin V, Petrov A, Krylov SN (2005) Nonequilibrium Capillary Electrophoresis of Equilibrium Mixtures: A Universal Tool for Development of Aptamers. J Am Chem Soc 127, 3165-3171. Bini A, Minunni M, Tombelli S, Centi S, Mascini M (2007) Analytical performances of aptamer-based sensing for thrombin detection. Anal Chem 79, 3016-3019. Centi S, Messina G, Tombelli S, Palchetti I, Mascini M (2008) Different approaches for the detection of thrombin by an electrochemical aptamer-based assay coupled to magnetic beads. Biosens Bioelec 23, 1602-1609. Cho EJ, Collett JR, Szafranska AE, Ellington AD (2006) Optimization of aptamer microarray technology for multiple protein targets. Anal Chim Acta 564, 82-90. Cho S, Kim JE, Lee BR, Kim JH, Kim BG (2005) Bis-aptazyme sensors for hepatitis C virus replicase and helicase without blank signal. Nucleic Acids Res 33, e177. Choi JH, Chen KH, Strano MS (2006) Aptamer-Capped Nanocrystal Quantum Dots: A New Method for Label-Free Protein Detection. J Am Chem Soc 128, 15584-15585. De-los-Santos-Alvarez N, Lobo-Casta帽贸n MJ, MirandaOrdieres AJ, Tu帽贸n-Blanco P (2008) Aptamers as recognition elements for label-free analytical devices. Trends Anal Chem 27, 437-446.

Gene Therapy and Molecular Biology Vol 13, page 9 Levy M, Cater SF, Ellington AD (2005) Quantum-Dot Aptamer Beacons for the Detection of Proteins. ChemBioChem 6, 2163-2166. Li X, Qi H, Shen L, Gao Q, Zhang C (2008) Electrochemical Aptasensor for the Determination of Cocaine Incorporating Gold Nanoparticles Modification. Electroanalysis 20, 14751482. Liao W, Cui XT (2007) Reagentless aptamer based impedance biosensor for monitoring a neuro-inflammatory cytokine PDGF. Biosens Bioelec 23, 218-224. Liu J, Lee JH, Lu Y (2007) Quantum Dot Encoding of AptamerLinked Nanostructures for One-Pot Simultaneous Detection of Multiple Analytes. Anal Chem 79, 4120-4125. Liu J, Lu Y (2004) Adenosine-dependent assembly of aptazyme-functionalized gold nanoparticles and its application as a colorimetric biosensor. Anal Chem 76, 1627-1632. Liu J, Lu Y (2006) Fast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticles. Angew Chem Int Ed 45, 90-94. Lu Y, Zhu N, Yu P, Mao L (2008) Aptamer-based electrochemical sensors that are not based on the target binding-induced conformational change of aptamers. Analyst 133, 1256-1260. Luzi E, Minunni M, Tombelli S, Mascini M (2003) New trends in affinity sensing: aptamers for ligand binding. Trends Anal Chem 22, 810-818. Min K, Cho M, Han SY, Shim YB, Ku J, Ban C (2008) A simple and direct electrochemical detection of interferogamma using its RNA and DNA aptamers. Biosens Bioelec 23, 1819-1824. Mir M, Vreeke M, Katakis I (2006) Different strategies to develop an electrochemical thrombin aptasensor. Electrochem Comm 8, 505-511. Mir M, Vreeke M, Katakis I (2008) Ultrasensitive detection based on an aptamer beacon electron transfer chain. Electrochem Comm 10, 1533-1536. Missailidis S (2008) Combinatorial Approach to Anticancer Drug Design, In-Anticancer Therapeutics (Eds: S. Missailidis), Wiley & Sons Ltd. Ogawa A, Maeda M (2007) Aptazyme-based riboswitches as label-free and detector-free sensors for cofactors. Bioorg Med Chem Letters 17, 3156-3160. Ozaki H, Nishihira A, Wakabayashi M, Kuwahara M, Sawai H (2006) Biomolecular sensor based on fluorescence-labeled aptamer. Bioorg Med Chem Letters 16, 4381-4384. Papamichael KI, Kreuzer MP, Guilbault GG (2007) Viability of allergy (IgE) detection using an alternative aptamer receptor and electrochemical means. Sens Actuat B-Chem 121, 178186. Pieken W, Olsen DB, Benseler F, Aurup H, Eckstein HF (1991) Kinetic characterization of ribonuclease-resistant 2â&#x20AC;&#x2122;-modified hammerhead ribozymes. Science 253, 314-317. Polsky R, Gill R, Willner I (2006) Nucleic Acid-Functionalized Pt Nanoparticles: Catalytic Labels for the Amplified Electrochemical Detection of Biomolecules. Anal Chem 78, 2268-2271. Potyrailo RA, Conrad RC, Ellington AD, Hieftje GM (1998) Adapting selected nucleic acid ligands (aptamers) to biosensors. Anal Chem 70, 3419-3425. Song S, Wang L, Li J, Zhao J, Fan C (2008) Aptamer-based biosensors. Trends Anal Chem 27, 108-117. Stojanovic MN, Kolpashchikov DM (2004) Modular aptameric sensors. J Am Chem Soc 126, 9266-9270.

Stojanovic MN, Landry DW (2002) Aptamer-based colorimetric probe for cocaine. J Am Chem Soc 124, 9678-9679. Stojanovic MN, Prada PD, Landry DW (2001) Aptamer-based folding fluorescent sensor for cocaine. J Am Chem Soc 123, 4928-4931. Suprun E, Shumyantseva V, Bulko T, Rachmetova S, Radâ&#x20AC;&#x2122;ko S, Bodeoev N, Archakov A (2008) Au-nanoparticles as an electrochemical sensing platform for aptamer-thrombin interaction. Biosens Bioelec 24, 831-836. Tombelli S, Minunni M, Mascini M (2005) Analytical applications of aptamers. Biosens Bioelec 20, 2424-2434. Tombelli S, Minunni M, Mascini M (2007) Aptamers- based assays for diagnostics, environmental and food analysis. Biomol Eng 24, 191-200. Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment - RNA ligands to bacteriophage-T4 DNA-polymerase. Science 249, 505-510. Velasco-Garcia MN, Mottram TT (2003) Biosensor Technology addressing Agricultural Problems Biosys Eng 84, 1-12. Wang J (2003) Nanoparticle-based electrochemical DNA detection. Anal Chim Acta 500, 247-257. Winters-Hilt S (2006) Nanopore Detector based analysis of single-molecule conformational kinetics and binding interactions. BMC Bioinformatics 7, S21. www.lcsciences.com , accessed January 2009. www.somalogic.com, accessed January 2009. Xiao Y, Lubin AA, Heeger AJ, Plaxco KW (2005) Label-free electronic detection of thrombin in blood serum by using an aptamer-based sensor. Angew Chem Int Ed 44, 5456-5459. Yamana K, Ohtani Y, Nakano H, Saito I (2003) Bis-pyrene labeled DNA aptamer as an intelligent fluorescent biosensor. Bioorg Med Chem Letters 13, 4329-4331. Yoshida W, Sode K, Idebukuro K (2006b) Homogeneous DNA sensing using enzyme-inhibiting DNA aptamers. Biochem Biophys Res Comm 348, 245-252. Yoshida W, Sode K, Ikebukuro K (2006a) Aptameric Enzyme Subunit for Biosensing Based on Enzymatic Activity Measurement. Anal Chem 78, 3296-3303. Zheng F, Wu ZS, Zhang SB, Guo MM, Chen CR, Shen GL, Yu RQ (2008) Aptamer-based Electrochemical Biosensors for Highly Selective and Quantitative Detection of Adenosine. Chem Res Chinese Universities 24, 138-142. Zheng J, Feng W, Lin L, Zhang F, Cheng G, He P, Fang Y (2007) A new amplification strategy for ultrasensitive electrochemical aptasensor with network-like thiocyanuric acid/gold nanoparticles. Biosens Bioelec 23, 341-347. Zuo X, Song S, Zhang J, Pan D, Wang L, Fan C (2007) A target-responsive electrochemical aptamer switch (TREAS) for reagentless detection of nanomolar ATP. J Am Chem Soc 129, 1042-1043.

Maria N. Velasco-Garcia and Sotiris Missailidis

Gomase et al: Mapping of MHC class binding nonamers from lipid binding protein of Ascaridia galli Gene Ther Mol Biol Vol 13, 10-14, 2009

Mapping of MHC class binding nonamers from lipid binding protein of Ascaridia galli Research Article

Virendra S Gomase1,*, Somnath B Waghmare2, Baba Jadhav2, Karbhari V Kale1 1

Department of Computer Science and Information Technology, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad, 431004, (MS), India 2 Department of Zoology, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad, 431004, (MS), India

__________________________________________________________________________________ *Correspondence: Virendra S Gomase, Department of Computer Science and Information Technology, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad, 431004 (MS), India; Mobile- +91-9987770696; e-mail: virusgene1@yahoo.co.in Key words: lipid binding protein, MHC, epitope, solvent accessibility, peptide vaccine Abbreviations: Major histocompatibility complex (MHC); Position Specific Scoring Matrices, (PSSMs); Support Vector Machine, (SVM) Received: 3 March 2009; Revised: 12 March 2009 Accepted: 16 March 2009; electronically published: March 2009

Summary Ascaridia galli involved multiple antigenic components to direct and empower the immune system to protect the host from infection. MHC molecules are cell surface proteins, which take active part in host immune reactions and involvement of MHC class in response to almost all antigens and it give effects on specific sites. Predicted MHC binding regions acts like red flags for antigen specific and generate immune response against the parent antigen. So a small fragment of antigen can induce immune response against whole antigen. This theme is implemented in designing subunit and synthetic peptide vaccines. In this study, we analyzed lipid-binding protein of Ascaridia galli and is allows potential drug targets to identify active sites, which form antibodies against or infection. The method integrates prediction of peptide MHC class binding; proteosomal C terminal cleavage and TAP transport efficiency. Antigenic epitopes of lipid binding protein are important antigenic determinants against the various toxic reactions and infections.

using neural networks trained on C terminals of known epitopes. In analysis predicted MHC/peptide binding is a log-transformed value related to the IC50 values in nM units (Gomase et al, 2008b). This approach is based on the phenomenon of cross-protection, whereby a host infected with a Ascaridia galli is protected against a more severe strain of the same lipid binding protein of Ascaridia galli. The phenotype of the resistant transgenic hosts includes fewer centers of initial infection, a delay in symptom development, and low accumulation. Lipid binding protein of Ascaridia galli is necessary for new paradigm of synthetic vaccine development and target validation (Gomase, 2008a,b).

I. Introduction Ascaridia galli parasitic nematodes produce at least two structurally novel classes of small helix-rich retinoland fatty-acid-binding proteins that have no counterparts in their plant or animal hosts and thus represent potential targets for new nematicides. Nematode-specific fatty-acid family of proteins localises to the surface of the organism, placing it in a strategic position for interaction with the host. Their function as a broad-spectrum and it is thought that it is involved in the evasion of primary host plant defence systems. Prediction of peptide fragments from lipid binding protein of Ascaridia galli involved multiple antigenic components to direct and empower the immune system to protect the host from infection (Timanova et al, 1999; Jordanova et al, 2005a,b). Major histocompatibility complex (MHC) molecules are cell surface proteins, which take active part in host immune reactions and involvement of MHC class-I & II in response to almost all antigens. The predicted binding affinity is normalized by the 1% fractil. The MHC peptide binding is predicted

II. Methodology Antigenic epitopes of lipid binding protein of Ascaridia galli is determined using the Gomase in 2007, Welling, Parker antigenicity methods (Gomase et al, 2007a, b). We also found the Abraham & Leo hydrophobicity, Bull & Breese hydrophobicity, Guy hydrophobicity, Miyazawa hydrophobicity, Roseman hydrophobicity, Wolfenden hydrophobicity, scales. Theses scales

Gene Therapy and Molecular Biology Vol 13, page 11 are essentially a hydrophilic index, with polar residues assigned negative values (Gomase et al, 2008a). The MHC peptide binding of lipid binding protein is predicted using neural networks trained on C terminals of known epitopes. In analysis predicted MHC/peptide binding of lipid binding protein is a logtransformed value related to the IC50 values in nM units. MHC2Pred predicts peptide binders to MHCI and MHCII molecules from protein sequences or sequence alignments using Position Specific Scoring Matrices (PSSMs). Support Vector Machine (SVM) based method for prediction of promiscuous MHC class II binding peptides. SVM has been trained on the binary input of single amino acid sequence (Reche et al, 2002; Buus et al, 2003; Nielsen et al, 2003; Bhasin and Raghava, 2005). In addition, we predict those MHC ligands from whose Cterminal end is likely to be the result of proteosomal cleavage.

MHCII- RT1.B peptide regions, which represented predicted binders from lipid binding protein. The predicted binding affinity is normalized by the 1% fractil. We describe an improved method for predicting linear epitopes (Table 2). The region of maximal hydrophilicity is likely to be an antigenic site, having hydrophobic characteristics, because terminal regions of lipid binding protein is solvent accessible and unstructured, antibodies against those regions are also likely to recognize the native protein (Figures 1-4). It was shown that lipid binding protein is hydrophobic in nature and contains segments of low complexity and high-predicted flexibility (Figures 58). Predicted antigenic fragments can bind to MHC molecule is the first bottlenecks in vaccine design.

III. Results and Interpretation

IV. Conclusion

Lipid binding protein is 508 residues long, having antigenic MHC binding peptides. MHC molecules are cell surface glycoproteins, which take active part in host immune reactions and involvement of MHC class-I and MHC II in response to almost all antigens. BepiPrep Server antigenicity determinant shows epitopes present in the Ascaridia galli the desired immune response. PSSM based server predict the peptide binders to MHCI molecules of lipid binding protein to MHCII molecules of lipid binding protein sequence as H2_Db, I_Ab, I_Ag7, I_Ad, analysis found antigenic epitopes region in lipid binding protein (Tables 1, 2). We also found the SVM based MHCII-IAb; MHCII-IAd; MHCII-IAg7 and

Lipid binding protein of Ascaridia galli peptide nonamers are from a set of aligned peptides known to bind to a given MHC molecule as the predictor of MHCpeptide binding. MHCII molecules bind peptides in similar yet different modes and alignments of MHCIIligands were obtained to be consistent with the binding mode of the peptides to their MHC class, this means the increase in affinity of MHC binding peptides may result in enhancement of immunogenicity of lipid binding protein. These predicted of lipid binding protein antigenic peptides to MHC class molecules are important in vaccine development from Ascaridia galli.

Table 1. PSSM based prediction of MHC ligands, from whose C-terminal ends are proteosomal cleavage sites. MHC-I 8mer_H2_Db 8mer_H2_Db 8mer_H2_Db 8mer_H2_Db 8mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 9mer_H2_Db 10mer_H2_Db 10mer_H2_Db 10mer_H2_Db 10mer_H2_Db 10mer_H2_Db 10mer_H2_Db 10mer_H2_Db 11mer_H2_Db 11mer_H2_Db 11mer_H2_Db 11mer_H2_Db 11mer_H2_Db 11mer_H2_Db

POS. 254 277 64 117 338 253 53 447 157 276 408 260 420 37 427 125 370 457 276 148 253 259 369 419 445 291 325 298

N NLR QSS LLE KAL LSE ENL RDP HKT HSY KQS LKE NAI YIL IAK DHV PTK KII HLI KQS ELI ENL ENA KKI YYI FFH LEK KAM HAR

Sequence SEENAISL SYASWDTL KSPEKMDI SKGSHPTK DEHSKHDI RSEENAISL MLYDNVTKL VTFPNALHL LKDENIHAL SSYASWDTL VKAKNEKLY SLVNGFTEV FLINDHVAM KKARSFAHV AMLRRYNEL EEMTNLAKEL SSMSFYSECI QRYANTTEEY SSYASWDTLI NALFAGHSYL RSEENAISLV ISLVNGFTEV ISSMSFYSECI LFLINDHVAML KTVTFPNALHL APRSHARAVIL SAILGLLKVML AVILRDIHRCL

C VNG IAS MML EEM DAA VNG LEK IQR QEV IAS YIL CKA LRR LSK SDP SAK ITP HHQ ASL KDE NGF CKA ITP RRY IQR RDI SED VKK

MW (Da) 843.9 900.98 929.1 822.91 961.99 1000.09 1078.28 993.17 1034.18 988.06 1074.28 947.05 1041.23 1025.22 1147.37 1159.32 1135.29 1256.3 1101.22 1074.21 1099.22 1060.21 1248.45 1267.55 1222.44 1172.41 1139.5 1290.6

Gomase et al: Mapping of MHC class binding nonamers from lipid binding protein of Ascaridia galli

Table 2. SVM based prediction of promiscuous MHC class II binding peptides from lipid binding protein. MHC ALLELE I-Ab I-Ab I-Ab I-Ab I-Ad I-Ad I-Ad I-Ad I-Ag7 I-Ag7 I-Ag7 I-Ag7 RT1.B RT1.B RT1.B RT1.B

Rank

Sequence

1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4

PAHPVHLKR PMLYDNVTK HALAPDVKK PAEAFFHKT LINALFAGH NAISLVNGF HALQEVAAA AISLVNGFT SDPAEAFFH DIDAAIEEV QEVAAAHVH HGKPAHPAH TWARSLRTS TFPNALHLI KKAMSAILG TEVCKALKQ

Figure 1. Antigenicity plot of lipid binding protein by Welling et al, scale.

Figure 2. Antigenicity plot of lipid binding protein by HPLC / Parker et al, scale.

Residue No. 91 52 482 438 146 257 163 258 436 344 166 85 16 448 321 266

Peptide Score 1.622 1.403 1.360 1.325 0.618 0.586 0.563 0.553 1.678 1.613 1.576 1.451 1.252 1.189 0.912 0.854

Gene Therapy and Molecular Biology Vol 13, page 13

Figure 3. Hydrophobicity plot of lipid binding protein by Wolfenden et al, scale.

Figure 4. Hydrophobicity plot of lipid binding protein by Bull and Breese scale.

Figure 5. Hydrophobicity plot of lipid binding protein by Gut scale.

Figure 6. Hydrophobicity plot of lipid binding protein by Miyazawa et al, scale.

Gomase et al: Mapping of MHC class binding nonamers from lipid binding protein of Ascaridia galli

Figure 7. Hydrophobicity plot of lipid binding protein by Roseman scale.

Figure 8. Hydrophobicity plot of lipid binding protein by Abraham and Leo scale.

Bankov I, Boteva R (2005a) Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli. FEBS J 272, 180-9. Jordanova R, Radoslavov G, Fischer P, Torda A, Lottspeich F, Boteva R, Walter RD, Bankov I, Liebau E (2005b) The highly abundant protein Ag-lbp55 from Ascaridia galli represents a novel type of lipid-binding proteins. J Biol Chem 280, 41429-38. Nielsen M, Lundegaard C, Worning P, Lauemøller SL, Lamberth K, Buus S, Brunak S, Lund O (2003) Reliable prediction of T-cell epitopes using neural networks with novel sequence representations. Protein Sci 12, 1007-1017. Reche PA, Glutting JP, Reinherz EL (2002) Prediction of MHC class I binding peptides using profile motifs. Hum Immunol 63, 701-709. Timanova A, Müller S, Marti T, Bankov I, Walter RD (1999) Ascaridia galli fatty acid-binding protein, a member of the nematode polyprotein allergens family. Eur J Biochem 261, 569-76.

References Bhasin M, Raghava GP (2005) P cleavage: an SVM based method for prediction of constitutive proteasome and immunoproteasome cleavage sites in antigenic sequences. Nucleic Acids Res 33, W202-207. Buus S, Lauemøller SL, Worning P, Kesmir C, Frimurer T, Corbet S, Fomsgaard A, Hilden J, Holm A, Brunak S. (2003) Sensitive quantitative predictions of peptide-MHC binding by a 'Query by Committee' artificial neural network approach. Tissue Antigens 62, 378-384. Gomase VS, Kale KV, Shyamkumar K, Shankar S (2008a) Computer Aided Multi Parameter Antigen Design: Impact of Synthetic Peptide Vaccines from Soybean Mosaic Virus. ICETET 2008, IEEE Computer Society in IEEE Xplore, Los Alamitos, California, 629-634. Gomase VS, Tagore S, Shyamkumar K (2008b) Prediction of antigenic binders from c-terminal domain Human papillomavirus oncoprotein e7. Gene Ther Mol Biol 12, 147-166. Gomase VS (2008a) Computer aided multi parameter antigen design: Impact of synthetic peptide vaccines from Latrodectus tredecimguttatus. Int J Bioinformatics 1, 53-54. Gomase VS (2008b) In silico prediction of antigenic epitope of neurotoxin M14 from Buthus eupeus. Int J Bioinformatics 1, 47-51. Gomase VS, Kale KV, Jyotiraj A, Vasanthi R (2007a) Identification of mhc ligands from alfalfa mosaic virus. Med Chem Res 15, 160. Gomase VS, Kale KV, Chikhale NJ, Changbhale SS (2007b) Prediction of MHC Binding Peptides and Epitopes from Alfalfa mosaic virus. Curr Drug Discov Technol 4, 1171215. Jordanova R, Radoslavov G, Fischer P, Liebau E, Walter RD,

Virendra Gomase and Somnath B Waghmare

Gene Therapy and Molecular Biology Vol 13, page 15 Gene Ther Mol Biol Vol 13, 15-19, 2009

Perspectives in vector development for systemic cancer gene therapy Review Article

Arash Hatefi*, Brenda F. Canine Department of Pharmaceutical Sciences, Center for Integrated Biotechnology, Washington State University, Pullman, WA, USA

__________________________________________________________________________________ *Correspondence: Arash Hatefi, Department of Pharmaceutical Sciences, Center for Integrated Biotechnology, Washington State University, P.O. Box 646534, Pullman, WA, 99164, USA; Tel: 509-335-6253; Fax: 509-335-5902; e-mail: ahatefi@wsu.edu Key words: non-viral vectors, cancer gene therapy, vector development, viral vectors Abbreviations: adenovirus, (Ad); coxsackievirus and adenovirus receptor, (CAR); fibroblast growth factor 2, (FGF2); fibroblast growth factor receptor, (FGFR); herpes simplex virus, (HSV); multiplicity of infection, (MOI); ornithine transcarbamylase, (OTC) Received: 10 February 2009; Revised: 25 March 2009 Accepted: 26 March 2009; electronically published: April 2009

Summary Gene therapy is perceived as a revolutionary technology with the promise to cure almost any disease, provided that we understand its genetic basis. However, enthusiasm has rapidly abated as multiple clinical trials have failed to show efficacy. The limiting factor seems to be the lack of a suitable delivery system to carry the therapeutic genes to the target tissue safely and efficiently. Therefore, advancements in cancer gene therapy in general depend on the development of novel vectors with maximum therapeutic efficacy at the target site and minimal toxicity to normal tissues. This mini-review highlights both the major fortes and the unique challenges associated with the state-ofâ&#x20AC;&#x201C;theart gene carriers currently being used in cancer gene therapy.

2003; Shen and Nemunaitis, 2006). What has been long desired is a technology which combines the biocompatibility, efficiency and the ability to engineer an effective gene-transfer technology. Since internalization of both viral and non-viral vectors is the first step in their transfection pathway, knowledge and understanding of their entry mechanisms is of major importance for the design of efficient viral and non-viral vehicles for cancer gene therapy.

I. Introduction Gene therapy is perceived as a ground-breaking technology with the promise to cure almost any disease, provided that we understand the genetic and molecular basis of the malady being treated. However, enthusiasm has rapidly abated as multiple clinical trials have failed to show efficacy. The limiting factor seems to be the lack of a suitable delivery system to carry the therapeutic genes safely and efficiently to the target tissue (Louise, 2006). Gene-transfer technology is still in a nascent stage owing to several inherent limitations in the existing delivery methods. While lipid-based vectors (liposomes) provide high transfection efficiency, their large scale production, reproducibility and cytotoxicity remain a major concern (Lv et al, 2006). On the other hand, cationic polymers are robust and relatively biocompatible, but they suffer from poor gene-transfer efficiency (Pack et al, 2005). Adenoviruses are the vehicles of choice for cancer gene therapy at this point particularly due to their ability to overcome the intracellular barriers and the enormous possibility for recombinant engineering. However, nonspecific binding to all cells that over-express coxsackievirus and adenovirus receptor (CAR), potential immunogenicity, high costs of production, and the fact that the majority of cancer cells do not express CAR has limited their use for cancer gene therapy (Thomas et al,

II. Strengths and weaknesses of current vectors A. Viral vectors for systemic cancer gene therapy Viruses have evolved to efficiently infect their host, overcome the cellular barriers and transfer their genetic material into the cellâ&#x20AC;&#x2122;s nucleus. One viral vector that has received considerable attention in cancer gene therapy is adenovirus. The basic elements of the trafficking pathway for adenovirus include high affinity binding of the capsid to receptors on the cell surface, internalization by endocytosis, lysis of the endosomal membrane resulting in escape to the cytosol, trafficking along microtubules, binding to the nuclear envelope, and insertion of the viral

Hatefi and Canine: Perspectives in vector development for systemic cancer gene therapy genome through the nuclear pore (Leopold and Crystal, 2007). Adenoviruses have high affinity for the CAR and use it to enter the cells. Although they are highly efficient in transducing cells that over-express CAR on their surface, they are considered poor gene delivery systems in cells that have low expression of CAR (Li et al, 1999). In addition, CAR is expressed on many normal cells which undermines the ability of this vector to specifically reach target cancer cells when administered systemically. Thus, adenovirus is not considered a universal efficient vehicle for cancer gene therapy as the majority of cancer cells do not over-express CAR (Shen and Nemunaitis, 2006). Another virus, Herpes Simplex Virus overcomes this deficiency by utilizing a different receptor to enter cancer cells. The initial attachment of HSV involves the interaction of viral envelope glycoproteins with the glycosaminoglycan moieties of cell surface heparan sulfates (Spear et al, 1992). However, like CAR, expression of heparin sulfates is not unique to cancer cells and can be found routinely in normal cells. As a result, systemic administration of HSV could also be problematic. Attachment of a targeting ligand to the viral capsid has been used as a means to make adenovirus specifically bind cancer cells and internalize via receptor mediated endocytosis. One example is attachment of the ligand, fibroblast growth factor 2 (FGF2) which has affinity for the basic fibroblast growth factor receptor (FGFR) (Green et al, 2008) (Figure 1). This receptor is over-expressed in subpopulations of lung, prostate and breast cancer (Chandler et al, 1999). While promising, the attachment of the ligand to the virus capsid involves chemical conjugation during which a significant portion of viruses could become inactive. As a result, obtaining high titers of active virus for delivery becomes expensive. Alternatively, retargeted viruses can be genetically engineered through the abrogation of CAR binding (e.g., Y477A mutation in adenoviral fiber protein) and insertion of a receptor-

specific binding peptide in the HI loop of the fiber protein (Piao et al, 2009). In this approach, no chemical conjugation step is involved. However, one potential problem with this approach is that targeting peptides with considerable 3D structure could interfere with the proper packaging of the viral capsid proteins and result in reduced transduction efficiency. Furthermore, such alterations in receptor targeting could impact transduction efficiency of viruses due to the change in trafficking routes and internalization pathways (Varga et al, 2000).

B. Are viral vectors highly immunogenic? There are five main classes of viral vectors which can be categorized into two groups (Table 1) according to whether their genomes integrate into host cellular chromatin (oncoretroviruses and lentiviruses) or persist in the cell nucleus predominantly as extrachromosomal episomes (AAVs, adenoviruses and herpes viruses).

Figure 1. Schematic representation of cell transfection by adenoviruses (Ad). While CAR represents coxsackie adenovirus receptor, FGFR represents fibroblast growth factor receptor (FGFR).

Table 1. Characteristics of major classes of viral vectors.

Immunogenic Potential

Specificity

Limitation

Retrovirus

Low

Dividing Cells only

Integration may induce oncogenesis

Lentivirus

Low

Broad

Integration may induce oncogenesis

AAV

Low

Broad

Herpes Simplex Virus

High

High in neurons

Adenovirus

High

Broad (CAR receptor)

Vector

Major Advantage

Integrated Persistent gene transfer in dividing cells Persistent gene transfer in most cells

Episomal Small packaging capacity Transient expression in some non-neuronal cells Capsid may induce inflammatory response

Non-inflammatory and non-pathogenic Large packaging capacity Efficient transduction of most cells

Gene Therapy and Molecular Biology Vol 13, page 17

D. Are viral vectors more efficient than non-viral vectors?

Out of these five, only herpes simplex virus (HSV) and adenovirus (Ad) have been shown to be highly immunogenic. In general, introduction of any non-self molecule, including viruses, into the body has the potential to trigger an immune response. However, the level of immune response to the foreign entity is dependent on the dose, the structure and any previous exposures. For example, a patient (Jesse Gelsinger) who suffered from a partial deficiency of ornithine transcarbamylase (OTC) took part in a gene therapy clinical trial conducted at the University of Pennsylvania in 1999. OTC is a liver enzyme that is required for the safe removal of excessive nitrogen from amino acids and proteins. Gelsinger received the highest dose of vector in the trial (3.8 ! 1013 particles). After 4 hours of treatment Gelsinger developed a high fever and within four days of treatment he died from multiorgan failure. A female patient who received a similar dose (3.6 ! 1013 particles) experienced no unexpected side effects. It has been speculated that previous exposure to a wild-type virus infection might have sensitized Gelsingerâ&#x20AC;&#x2122;s immune system to the vector (Bostanci, 2002). If a lowered dose of the adenovirus was administered, Gelsingerâ&#x20AC;&#x2122;s symptoms may not have been as catastrophic. Therefore, drawing a firm conclusion that viral vectors are highly immunogenic and deadly is premature.

1. Viral vectors versus targeted non-viral vectors From the available literature, it is apparent that the efficiency of non-viral vectors is usually compared with the adenoviral vector which arguably is the most efficient viral vector (Thomas et al, 2003). As a result of this comparison, it is generally believed that non-viral vectors are less efficient. This comparison may not be completely reliable in all situations as adenoviral vectors are targeted systems which utilize abundant CAR receptors to enter the cells (Wickham et al. 1993). When CAR receptors are not abundant the transfection levels are markedly decreased (Li et al, 1999). Targeted non-viral vectors are usually equipped with ligands that are intended to bind to overexpressed receptors. These include growth factor receptors (e.g., FGFR and HER2) and transferrin. The abundance of these receptors on the surface of the cells and their affinities towards their corresponding ligands may not be as high as CAR. Therefore, non-viral vectors that could be as efficient as adenoviruses in trasfecting dividing cells will show less efficiency when internalizing through receptors because of the difference in receptor number and binding affinity. The question then is how viral and targeted non-viral vectors can be fairly compared in terms of gene transfer efficiency. One potential solution would be evaluation of transfection efficiency normalized to the abundance of the receptor being utilized. This is to remove the bias associated with the receptor numbers. Another answer could be as simple as comparison of FGF2 targeted non-viral vector with FGF2 retargeted adenovirus. In this approach, the bias associated with receptor binding affinity and internalization pathway can be eliminated. Alternatively, adenovirus can be compared with non-viral vectors that are equipped with CAR ligands to target cells. In this way the bias associated with the number of entry gates as well as receptor binding affinity will be eliminated. It is also noteworthy that the number of viral or non-viral particles delivered needs to be kept equal to achieve the same multiplicity of infection (MOI). To date no study has been reported that has considered the abovementioned factors in order to appropriately compare viral versus targeted non-viral vectors.

C. Are non-viral vectors biocompatible? Polymeric or liposomal based non-viral vectors are utilized to complex plasmid DNA forming stable nanoparticles. This complexation protects the DNA from serum endonucleases and also condenses the DNA into nanosize particles suitable for cellular uptake. Non-viral polymeric vectors are generally believed to be nonimmunogenic mostly due to their lack of structural hierarchy. Although there has been reports on the toxicity of such vectors (e.g., PEI or liposomes) (Lv, Zhang et al, 2006), in general they are assumed to have low immunogenic potential. Polymers such as poly (ethylene glycol), for example, have been utilized to sterically stabilize the surface of particles reducing the interaction of particles with the elements of the immune system (Chekhonin et al, 2005). However, two separate groups recently reported that repeated injection of PEGylated liposomes in rats and mice elicits PEG-specific IgM/IgG (Ishida et al, 2006; Judge et al, 2006). These studies highlight the potential that even a presumably safe polymer such as PEG can invoke an immune response if injected in high doses and repeatedly. This in turn may undermine the ability of PEG to be used as surface stabilizer in drug delivery systems that need multiple injections to achieve significant therapeutic response. As a result, drawing a general conclusion that non-viral vectors are less immunogenic than viral vectors is also premature at this point. Therefore, there is a continuing need for the development of more biocompatible and bio-interactive polymers that can reduce immunogenicity. This in turn enhances blood circulation time of drug delivery systems maximizing their therapeutic efficacy at the target site.

2. Viral vectors versus non-targeted non-viral vectors For non-targeted non-viral vectors, the surface charge of the nanoparticles usually dictates the binding efficiency to the surface of the cells. Once complexed with pDNA, the nanoparticles are formulated to have a slight positive surface charge (e.g., 10-40 mV). This facilitates binding to the negatively charged phosphate groups on the surface of the cell membranes resulting in internalization via caveolae or clathrin mediated endocytosis (Midoux et al, 2008). In this scenario, comparison of viral with nontargeted non-viral vectors would not be appropriate as they utilize entirely different internalization pathways. Transfection efficiency, in this case, will be dependent on the cell type not the vector. In one cell line (e.g., CAR

Hatefi and Canine: Perspectives in vector development for systemic cancer gene therapy positive), the viral vector will be more efficient than the non-viral vector, while in another cell line (e.g., CAR negative), the non-viral vector will show higher efficiency. Therefore, drawing any conclusion regarding the efficiency of viral vectors versus non-targeted non-viral vector may not be appropriate.

Acknowledgement This work was supported in part by the NIH biotechnology training fellowship (GM008336) to Canine and Reeves

References Bostanci A (2002) Gene therapy. Blood test flags agent in death of Penn subject. Science 295, 604-5. Canine BF, Wang Y, Hatefi A (2008) Evaluation of the effect of vector architecture on DNA condensation and gene transfer efficiency. J Control Release 129, 117-123. Chandler LA, Sosnowski BA, Greenlees L, Aukerman SL, Baird A, Pierce GF (1999) Prevalent expression of fibroblast growth factor (FGF) receptors and FGF2 in human tumor cell lines. Int J Cancer 81, 451-8. Chekhonin VP, Zhirkov YA, Gurina OI, Ryabukhin IA, Lebedev SV, Kashparov IA, Dmitriyeva TB (2005) PEGylated immunoliposomes directed against brain astrocytes. Drug Deliv 12, 1-6. Dreher MR, Liu W, Michelich CR, Dewhirst MW, Yuan F, Chilkoti A (2006) Tumor vascular permeability, accumulation, and penetration of macromolecular drug carriers. J Natl Cancer Inst 98, 335-44. Furgeson DY, Dreher MR, Chilkoti A (2006) Structural optimization of a "smart" doxorubicin-polypeptide conjugate for thermally targeted delivery to solid tumors. J Control Release 110, 362-9. Green NK, Morrison J, Hale S, Briggs SS, Stevenson M, Subr V, Ulbrich K, Chandler L, Mautner V, Seymour LW, Fisher KD (2008) Retargeting polymer-coated adenovirus to the FGF receptor allows productive infection and mediates efficacy in a peritoneal model of human ovarian cancer. J Gene Med 10, 280-9. Hatefi A, Cappello J, Ghandehari H (2007) Adenoviral gene delivery to solid tumors by recombinant silk-elastinlike protein polymers. Pharm Res 24, 773-9. Hatefi A, Megeed Z, Ghandehari H (2006) Recombinant polymer-protein fusion: a promising approach towards efficient and targeted gene delivery. J Gene Med 8, 468-76. Ishida T, Ichihara M, Wang X, Yamamoto K, Kimura J, Majima E, Kiwada H (2006) Injection of PEGylated liposomes in rats elicits PEG-specific IgM, which is responsible for rapid elimination of a second dose of PEGylated liposomes. J Control Release 112, 15-25. Judge A, McClintock K, Phelps JR, Maclachlan I (2006) Hypersensitivity and loss of disease site targeting caused by antibody responses to PEGylated liposomes. Mol Ther 13, 328-37. Krajcik R, Jung A, Hirsch A, Neuhuber W, Zolk O (2008) Functionalization of carbon nanotubes enables non-covalent binding and intracellular delivery of small interfering RNA for efficient knock-down of genes. Biochem Biophys Res Commun 369, 595-602. Lacerda L, Bianco A, Prato M, Kostarelos K (2006) Carbon nanotubes as nanomedicines: from toxicology to pharmacology. Adv Drug Deliv Rev 58, 1460-70. Leopold PL, Crystal RG (2007) Intracellular trafficking of adenovirus: many means to many ends. Adv Drug Deliv Rev 59, 810-21. Li D, Duan L, Freimuth P, O'Malley BW Jr (1999) Variability of adenovirus receptor density influences gene transfer efficiency and therapeutic response in head and neck cancer. Clin Cancer Res 5, 4175-81. Liu Y, Yu ZL, Zhang YM, Guo DS, Liu YP (2008) Supramolecular architectures of beta-cyclodextrin-modified chitosan and pyrene derivatives mediated by carbon

III. Emerging new technologies In recent years there has been a great deal of interest on the development of recombinant polymers (biopolymers) with applications in tissue engineering, drug delivery and gene therapy (Dreher et al, 2006; Furgeson et al, 2006; Hatefi et al, 2006, 2007; Canine et al, 2008; Nettles et al, 2008). The major advantage of the polymers that are genetically engineered versus chemical synthetic methods is the homogeneity, control over sterotacticity and full control over the architecture (Urry, 1997). These biopolymers bear the potential to hybridize the strengths of both viral and non-viral vectors in order to overcome the extra- and intracellular barriers to efficient, safe and cost-effective gene delivery. This is due to their versatility, flexibility, unlimited capacity and most importantly ability to bioengineer at the molecular level. In addition to genetically engineered polymers with well-defined architecture, synthetic inorganic gene carriers (e.g., nanorods and tubes) are exciting, emerging technologies that would allow precise control of composition, size and multifunctionality of the delivery system (Krajcik et al, 2008; Liu et al, 2008). For example, Leongâ&#x20AC;&#x2122;s group recently reported a non-viral gene-delivery system based on multi-segment bimetallic nanorods with the ability to simultaneously bind condensed plasmid DNA and targeting ligands in a spatially defined manner (Salem et al, 2003). Although promising, there are some concerns related to the toxicity and pharmacological fate of inorganic nanocarriers (Lacerda et al, 2006). Nonetheless, synthetic inorganic gene carriers have great potential to make a significant impact on the science of cancer gene therapy.

IV. Conclusion Lack of an efficient, non-toxic and non-immunogenic gene delivery system remains the major limiting factor to advancements in cancer gene therapy. Adenovirus while efficient in some cell lines (CAR positive) raises concerns about safety as well as targetability. Non-viral vectors while potentially less immunogenic than viral vectors have not been studied thoroughly enough to reliably state that they do not trigger major immune responses. Further studies need to be done in terms of long term administration, dose scheduling, and treatment thresholds to examine these effects. The efficiency of non-viral vectors also needs to be reinvestigated taking into account the model system being used before blanket comparisons between non-viral and viral efficiency levels can be made. In both non-specific viral and non-viral vectors the use of targeting ligands is an attractive alternative to non-specific delivery particularly in cancer therapy. No matter which system, viral or non-viral, improvements in current technologies continue to be needed.

Gene Therapy and Molecular Biology Vol 13, page 19 nanotubes and their DNA condensation. J Am Chem Soc 130, 10431-9. Louise C (2006) Nonviral vectors. Methods Mol Biol 333, 20126. Lv H, Zhang S, Wang B, Cui S, Yan J (2006) Toxicity of cationic lipids and cationic polymers in gene delivery. J Control Release 114, 100-9. Midoux P, Breuzard G, Gomez JP, Pichon C (2008) Polymerbased gene delivery: a current review on the uptake and intracellular trafficking of polyplexes. Curr Gene Ther 8, 335-52. Nettles DL, Kitaoka K, Hanson NA, Flahiff CM, Mata BA, Hsu EW, Chilkoti A, Setton LA (2008) In situ crosslinking elastin-like polypeptide gels for application to articular cartilage repair in a goat osteochondral defect model. Tissue Eng Part A 14, 1133-40. Pack DW, Hoffman AS, Pun S, Stayton PS (2005) Design and development of polymers for gene delivery. Nat Rev Drug Discov 4, 581-93. Piao Y, Jiang H, Alemany R, Krasnykh V, Marini FC, Xu J, Alonso MM, Conrad CA, Aldape KD, Gomez-Manzano C, Fueyo J (2009) Oncolytic adenovirus retargeted to DeltaEGFR induces selective antiglioma activity. Cancer Gene Ther 16, 256-65. Salem AK, Searson PC, Leong KW (2003) Multifunctional nanorods for gene delivery. Nat Mater 2, 668-71. Shen Y, Nemunaitis J (2006) Herpes simplex virus 1 (HSV-1) for cancer treatment. Cancer Gene Ther 13, 975-92. Spear PG, Shieh MT, Herold BC, WuDunn D, Koshy TI (1992) Heparan sulfate glycosaminoglycans as primary cell surface

receptors for herpes simplex virus. Adv Exp Med Biol 313, 341-53. Thomas CE, Ehrhardt A, Kay MA (2003) Progress and problems with the use of viral vectors for gene therapy. Nat Rev Genet 4, 346-58. Urry DW (1997) Physical chemistry of biological free energy transduction as demonstrated by elastic protein-based polymers. J Phys Chem B 101, 11007-11028. Varga CM, Wickham TJ, Lauffenburger DA (2000) Receptormediated targeting of gene delivery vectors: insights from molecular mechanisms for improved vehicle design. Biotechnol Bioeng 70, 593-605. Wickham TJ, Filardo EJ, Cheresh DA, Nemerow GWickham TJ, Filardo EJ, Cheresh DA, Nemerow GR (1993) Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-19.

Arash Hatefi

Narala et al: Curcumin is not a ligand for PPAR-! Gene Ther Mol Biol Vol 13, 20-25, 2009

Curcumin is not a ligand for peroxisome proliferator-activated receptor-! Research Article

Venkata R. Narala1, Monica R. Smith1, Ravi K. Adapala1, Rajesh Ranga1, Kalpana Panati2, Bethany B. Moore1, Todd Leff3, Vudem D. Reddy2, Anand K. Kondapi4, Raju C. Reddy1,* 1

Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, University of Michigan Medical Center, Ann Arbor, MI 48109, USA 2 Center for Plant Molecular Biology, Osmania University, Hyderabad 500 007, India 3 Center for Integrative Metabolic and Endocrine Research, Wayne State University School of Medicine, Detroit, MI 48201, USA 4 Department of Biotechnology, School of Life Sciences, University of Hyderabad, Hyderabad 500 046, India

__________________________________________________________________________________ *Correspondence: Raju C. Reddy M.D., University of Michigan, Division of Pulmonary and Critical Care Medicine, 109 Zina Pitcher Place, 4062 BSRB, Ann Arbor, MI 48109-2200, USA; Tel: (734) 615-2871; Fax: (734) 615-2111; e-mail: rajuc@umich.edu Key words: PPAR-!, TGF-", rosiglitazone, ciglitazone, PPRE, preadipocyte, fibroblast, turmeric, peroxisome, curcumin Abbreviations: dithiothreitol, (DTT); glutathione-S-transferase, (GST); glyceraldehyde-3-phosphate dehydrogenase, (GAPDH); isopropyl-1-"-D-galactopyranoside, (IPTG); peroxisome proliferator response element, (PPRE); peroxisome proliferator-activated receptor-!, (PPAR-!); #-smooth muscle actin, (#-SMA) Received: 24 February 2009; Revised: 14 March 2009 Accepted: 16 March 2009; electronically published: April 2009

Summary Curcumin, a compound found in the spice turmeric, has been shown to possess a number of beneficial biological activities exerted through a variety of different mechanisms. Some curcumin effects have been reported to involve activation of the nuclear transcription factor peroxisome proliferator-activated receptor-! (PPAR-!), but the concept that curcumin might be a PPAR-! ligand remains controversial. Results reported here demonstrate that, in contrast to the PPAR-! ligands ciglitazone and rosiglitazone, curcumin is inactive in five different reporter or DNAbinding assays, does not displace [3H]rosiglitazone from the PPAR-! ligand-binding site, and does not induce PPAR-!-dependent differentiation of preadipocytes, while its ability to inhibit fibroblast-to-myofibroblast differentiation is not affected by any of four PPAR-! antagonists. These multiple lines of evidence conclusively demonstrate that curcumin is not a PPAR-! ligand and indicate the need for further investigation of the mechanisms through which the compound acts.

signaling pathways. These varied beneficial effects have led to investigation of curcumin as a potential therapeutic agent in a number of disease conditions (Reddy et al, 2005; Thangapazham et al, 2006; Aggarwal et al, 2007). Peroxisome proliferator-activated receptor-! (PPAR!) is a member of the nuclear receptor family of transcription factors, a large group of proteins that mediate ligand-dependent transcriptional activation and transrepression (Issemann and Green, 1990). PPAR-! is highly expressed in adipose tissue and plays a crucial role in adipocyte differentiation (Lemberger et al, 1996). It is also expressed in a variety of other tissue and cell types, where it plays key roles in the regulation of metabolism and inflammation. Ligands for PPAR-! include a variety

I. Introduction The polyphenol curcumin (diferuloylmethane; 1,7bis(4-hydroxy-3-methoxy-phenyl)1,6-heptadiene-3,5dione) is an orange-yellow compound with limited water solubility that is obtained from the turmeric plant, Curcuma longa. Curcumin has been shown to exhibit a variety of biological effects (Maheshwari et al, 2006) such as anti-oxidant, anti-inflammatory, anti-tumor and woundhealing properties (Srivastava et al, 1995). These activities are exerted through an equally wide variety of signaling pathways, which may involve either inhibition (Chen and Tan, 1998; Gaedeke et al, 2004; Zhou et al, 2007) or activation (Hu et al, 2005) of specific intracellular

Gene Therapy and Molecular Biology Vol 13, page 21 of natural and synthetic compounds. Most of the natural ligands are fatty acids or fatty acid derivatives. Synthetic ligands include the thiazolidinediones, which are used as insulin sensitizing agents for treatment of type 2 diabetes (Berger and Moller, 2002). Curcumin has been reported to activate PPAR-! (Xu et al, 2003; Zheng and Chen, 2004; Chen and Xu, 2005; Lin and Chen, 2008). It remains unclear, however, whether this activation reflects curcumin binding to the receptor, as has been suggested (Chen and Xu, 2005; Jacob et al, 2007), or is entirely the result of indirect effects. The present study, utilizing multiple molecular and cellular assays, is the first to directly investigate the ability of curcumin to act as a PPAR-!-activating ligand.

C. Nuclear protein preparation and PPAR-!DNA binding assay CV-1 and IMR-90 cells were plated in 100 mm dishes at 70% confluence. The cells were treated with curcumin or rosiglitazone for 3 h, after which nuclear protein was isolated (Cayman nuclear protein extraction kit). Protein concentrations were estimated using the Bio-Rad (Hercules, CA) DC protein assay. PPAR-! DNA-binding activity in the nuclear protein was detected by an ELISA-based PPAR-! transcription factor assay (Cayman) that detects PPAR-! bound to PPRE-containing double-stranded DNA sequences.

D. Ligand binding by PPAR-!-GST The ligand binding domain of PPAR-! was introduced into the pGEX-2T bacterial expression vector (Amersham Pharmacia; Buckinghamshire, UK). Expression of glutathione-S-transferase (GST)-tagged PPAR-! in Escherichia coli strain BL21-DE3 (Novagen; San Diego, CA) was induced by the addition of 1 mM isopropyl-1-"-D-galactopyranoside (IPTG) to the growth medium. Bacterial extracts were prepared using standard methods and the fusion proteins were purified using Glutathione Sepharose 4B (GE Healthcare; Piscataway, NJ). GST-PPAR-! protein induction and receptor binding was assessed as described (Fu et al, 2003). Briefly, 5 %g of GST-PPAR-! protein, [3H]rosiglitazone (specific activity, 5 Ci/mmol), and various concentrations of curcumin or unlabeled rosiglitazone were incubated for 2 h at 25°C in a buffer containing 10 mM Tris HCl (pH 8.0), 50 mM KCl, and 10 mM dithiothreitol (DTT). Bound [3H]rosiglitazone was separated from free [3H]rosiglitazone by centrifugation at 8000 rpm for 1 min. The radioactivity of the bound [3H]rosiglitazone fraction was determined by liquid scintillation counting.

II. Material and Methods A. Reagents DMEM and DMEM/F12 were purchased from Gibco-BRL Life Technologies (Grand Island, NY). High purity curcumin was obtained from Sigma Chemical Co. (St. Louis, MO), Bioprex (Pune, Maharashtra, India), and Alfa Aesar (Ward Hill, MA); all experiments were repeated using each formulation. Fetal bovine serum (FBS) was obtained from HyClone (Logan, UT). PPAR-! antagonists GW9662 and BADGE were purchased from Cayman Chemical (Ann Arbor, MI), while PPAR-! Antagonist III (G3335), and T0070907 were purchased from Calbiochem (La Jolla, CA). The PPAR-! agonists ciglitazone and rosiglitazone were purchased from Cayman. Aliquots of agonists and antagonists were dissolved in DMSO (SigmaAldrich, St. Louis, MO) at 100 mM and stored at -30°C until use. [3H]rosiglitazone was obtained from American Radiolabeled Chemicals (St. Louis, MO). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mouse monoclonal antibody was obtained from Abcam (Cambridge, UK), while anti-#-smooth muscle actin (#-SMA) mouse antibody, clone 1A4, was obtained from Dako Automation (Carpentaria, CA), and TGF-"1 was obtained from R&D Systems (Minneapolis, MN). GAL4-PPAR! plasmid was a kind gift from YE Chen, University of Michigan, Ann Arbor. The aP2-luc plasmid (Camp et al, 2001) and the FATP-PPRE-luc plasmid (Monajemi et al, 2007) were constructed as previously described.

E. 3T3-L1 differentiation and Oil Red O staining 3T3-L1 preadipocytes were grown and maintained in DMEM containing 10% FBS. Differentiation of preadipocytes was studied in cells 2 days following confluence (designated day 0). These cells were cultured for 14 d in DMEM containing 10% FBS and either curcumin or rosiglitazone. The medium was changed every 2 d. The differentiated adipocytes were stained by Oil Red O (Sigma) as described previously (Song et al, 2007). Briefly, cells were washed with PBS and fixed in 4% paraformaldehyde for 1 h, followed by rinsing with PBS and with water. After the rinsing, cells were stained with 0.1% Oil Red O for 1 h. Plates were rinsed with water and images of cells on the plate were taken in water.

B. Cell culture and transfection CV-1 and 3T3-L1 cells were obtained from American Type Culture Collection (Manassas, VA). IMR-90 cells were obtained from the Coriell Institute for Medical Research (Camden, NJ). CV-1 cells were grown to 70% confluence in DMEM/F12 supplemented with 10% FBS and 1% penicillinstreptomycin. Cells were then transiently co-transfected with pRL-SV40 and a PPAR-dependent luciferase reporter, pFATPluc. In separate experiments, cells were co-transfected with pRLSV40 plus a luciferase gene under the control of four Gal4 DNAbinding elements (UASG $ 4 TK-luciferase) and a plasmid containing the ligand-binding domain for PPAR-! fused to the Gal4 DNA-binding domain. All transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Twenty-four h after transfection, cells were treated with test compounds and incubated for an additional 24 h in medium with 10% FBS. The resulting luciferase activity was measured with reporter luciferase assay kits (Promega; Madison, WI) employing a Modulus 9201 luminometer (Turner Biosystems; Sunnydale, CA) and normalized by comparison to Renilla luciferase.

F. RNA isolation and real-time PCR Total RNA was extracted using TRI-Reagent (Sigma) according to the manufacturer’s instructions. cDNA was generated from 1 %g of total RNA and real-time quantitative PCR was performed using Sybr Green PCR Master Mix (Applied Biosystems; Foster City, CA) according to the manufacturer’s protocol. Quantitative changes were expressed relative to "-actin. Primers used were: PPAR-!: (F) 5'-ATTCTGGCCCACCAACTTCGG-3' (R) 5'-TGGAAGCCTGATGCTTTATCCCCA-3' "-actin: (F) 5'-GTGGGGCGCCCCCAGGCACCA-3' (R) 5'-GCTCGGCCGTGGTGGTGAAGC-3'

G. Western immunoblotting Cells were lysed in radioimmunoprecipitation (RIPA) buffer and whole-cell protein was quantified. Ten %g of protein was subjected to 12% Tris-glycine SDS-PAGE (Invitrogen).

Narala et al: Curcumin is not a ligand for PPAR-! After transfer to a polyvinylidene fluoride membrane (Millipore), #-SMA and GAPDH were detected using appropriate dilutions of primary mouse monoclonal antibodies followed by a horseradish peroxidase-conjugated anti-mouse IgG. Protein was visualized using the ECL chemiluminescent detection system (Amersham Pharmacia).

We then examined the ability of curcumin to stimulate binding of PPAR-! to DNA using a commercially available transcription factor assay that measures binding of PPAR-! to double stranded DNA probe containing a PPRE sequence. Cells were treated with curcumin (10-40 %M), rosiglitazone (10 %M), or vehicle (DMSO) for 3 h, after which nuclear extracts were prepared and subjected to PPAR-! binding assay. In order to investigate the possibility that curcumin up-regulates PPAR-! expression, we employed IMR-90 as well as CV1 cells. Curcumin gave results similar to those with vehicle, demonstrating no activation of PPAR-! in either CV-1 cells (Figure 2B) or IMR-90 cells (Figure 2C). Rosiglitazone (10 %M), as expected, increased PPAR-! binding.

H. Statistical analysis Data are represented as mean Âą SE and were analyzed with the Prism 5.0 statistical program (GraphPad Software Inc.; San Diego, CA). Comparisons between experimental groups were performed using one-way ANOVA followed by Dunnettâ&#x20AC;&#x2122;s post hoc test. All data shown are averages from at least 3 independent experiments. Differences were considered significant if P was less than .05.

III. Results A. Curcumin does not activate PPAR reporter constructs Previous studies have reported that curcumin activates PPAR-!. To test this, we transfected CV-1 cells with FATP-PPRE-luc plasmid in which the peroxisome proliferator response element (PPRE) from fatty acid transport protein controls expression of firefly luciferase. After 24 h, cells were treated with curcumin at different concentrations (1-20 %M) and following an additional 24-h incubation, cells were lysed and luciferase activity was measured. Curcumin did not increase the relative transcriptional activity of PPAR-! in CV-1 cells at any dose tested (Figure 1A). By contrast, the positive control ciglitazone (10 %M) increased transcriptional activity ~7fold. To increase the robustness of the reporter assay, CV1 cells were co-transfected with a PPAR-! expression plasmid (TR100-PPAR-!) in addition to FATP-PPRE-luc. Curcumin (1-20 %M) did not induce detectable PPAR-! activation even in the presence of elevated amounts of receptor, whereas transcriptional activity induced by ciglitazone (10 %M) was greater than that observed in the absence of the expression plasmid (Figure 1B). Similar results were obtained with curcumin and rosiglitazone in NIH/3T3 cells with an aP2-PPRE-luc reporter plasmid in the presence of TR100-PPAR-! (data not shown). We also performed reporter assays using the highly specific Gal4-luc system, in which the PPAR-! ligandbinding domain is fused to the Gal4 DNA-binding domain and a luciferase reporter gene is under the control of four Gal4 DNA-binding elements. In this case also, we did not observe activation of PPAR-! by curcumin (Figure 1C).

B. Curcumin does not bind to the ligandbinding domain of PPAR-! or stimulate binding of PPAR-! to DNA

Figure 1. Curcumin is inactive in reporter assays. CV-1 cells were transiently transfected with pRL-SV40 and with one of the following constructs: (A) PPAR-dependent luciferase reporter, pFATP-luc; (B) PPAR-! expression plasmid, pTR100-PPAR-!, along with pFATP-luc; (C) PPAR-! GAL4 reporter system, UASG $ 4 TK-luciferase + GAL4-PPAR-!. Cells were then incubated with vehicle (DMSO), curcumin (Cur; 1-20 %M) or ciglitazone (Cig; 10 %M). After 24 h, the relative luciferase activity was calculated by normalizing firefly luciferase activity to that of Renilla luciferase. *P < 0.05 vs. vehicle.

To directly determine whether curcumin binds to the PPAR-! activating site, we quantified displacement of bound [3H]rosiglitazone by unlabeled rosiglitazone or curcumin. The Ki for rosiglitazone was found to be ~50 nM, consistent with reported values (Schopfer et al, 2005). By contrast, curcumin displayed no competition for the binding site at concentrations up to 10 %M (Figure 2A) or even as high as 40 %M (data not shown).

Gene Therapy and Molecular Biology Vol 13, page 23

D. PPAR-! antagonists do not block curcumin inhibition of TGF-"-induced fibroblast-to-myofibroblast differentiation As a further test of the extent to which biological effects of curcumin may be mediated by PPAR-! activation, we examined inhibition of the TGF-"-induced differentiation of human lung fibroblasts into myofibroblasts. PPAR-! activation has been shown to inhibit this differentiation, signaled by appearance of #smooth muscle actin (#-SMA) (Burgess et al, 2005; Milam et al, 2008). We treated serum-starved IMR-90 fibroblasts with curcumin (10 %M) for 1 h followed by TGF-" (2 ng/ml), finding that curcumin inhibited the expression of #-SMA. To determine whether this inhibition is mediated through PPAR-!, we added one of four different PPAR-! antagonists 1 h prior to curcumin. #-SMA expression was assessed by Western immunoblotting and quantified by densitometric scanning of the blots (Figure 3C). None of the antagonists reduced the ability of curcumin to inhibit myofibroblast differentiation.

IV. Discussion Previous studies have suggested that certain curcumin effects involved an increase in PPAR-! activity. Some investigators have suggested that this increased activity may represent direct ligand-binding activation of the receptor by curcumin, although this remains controversial. Our results conclusively address this issue utilizing a variety of rigorous assays. At the molecular level, ligand-induced activation of PPAR-! is reflected in increased binding to its response elements. We find, however, that incubation with curcumin does not increase binding to the consensus PPRE in a transcription factor assay, nor does it increase transcriptional activity in any of four different reporter assays. Furthermore, definitively, curcumin does not displace a standard synthetic PPAR-! ligand from the receptorâ&#x20AC;&#x2122;s binding site. At the cellular level, we investigated the ability of curcumin to induce PPAR-!mediated differentiation of preadipocytes to adipocytes. Whereas synthetic PPAR-! ligands induced differentiation, as expected, curcumin did not. Furthermore, although curcumin reduces the ability of TGF-" to induce fibroblast differentiation, as do PPAR-! ligands, a variety of different PPAR-! antagonists have no effect on curcuminâ&#x20AC;&#x2122;s inhibitor activity. Thus, at both the molecular and cellular levels, our results support the conclusion that the known biological activities of curcumin do not involve binding to, and activation of, the nuclear transcription factor PPAR-!. Studies in hepatic stellate cells (Xu et al, 2003; Zheng and Chen, 2004; Lin and Chen, 2008), in a rodent model of sepsis (Siddiqui et al, 2006), and in Moser colon cancer cells (Chen and Xu, 2005) have suggested that PPAR-! signaling is required for curcumin to exert the effects observed. In Moser cells, it was found that curcumin reduced phosphorylation and consequent inactivation of PPAR-! (Chen and Xu, 2005).

Figure 2. Curcumin does not bind to or activate PPAR-!. (A) Competitive binding assay was performed using GST-PPAR-! ligand-binding domain and [3H]rosiglitazone in the presence of unlabeled curcumin (Cur) or rosiglitazone (Rosi). In a separate experiment, PPAR-! activation was analyzed by DNA-binding assay in (B) CV-1 and (C) IMR-90 cells. *P < 0.05 vs. vehicle.

C. Curcumin does not induce differentiation of 3T3-L1 preadipocytes To investigate PPAR-!-mediated biological effects of curcumin, we employed a well established model of adipocyte differentiation. PPAR-! plays an essential role in the differentiation of adipocytes (Tontonoz et al, 1994), with selective disruption of PPAR-! resulting in impaired development of adipose tissue (Evans et al, 2004). 3T3-L1 preadipocytes were treated with curcumin (5 and 10 %M) or rosiglitazone (5 %M) for 2 weeks. Adipocyte differentiation was assessed both morphologically and by means of Oil Red O staining, which reveals the accumulation of intracellular lipids (Figure 3A). Expression of PPAR-!, which is up-regulated during differentiation, was also assessed (Figure 3B). On both assessments, vehicle and curcumin did not induce differentiation, while rosiglitazone treatment produced the expected PPAR-!-dependent differentiation.

Narala et al: Curcumin is not a ligand for PPAR-!

Figure 3. Curcumin has no effect on preadipocyte differentiation and effects on fibroblast differentiation are not blocked by PPAR-! antagonists. (A, B) 3T3-L1 preadipocytes were treated with curcumin (Cur; 5 and 10 %M) or rosiglitazone (Rosi; 5 %M) for 2 weeks. Adipocyte differentiation was assessed (A) both morphologically and via oil red O staining and (B) by relative expression of PPAR-! mRNA. The MDI differentiation protocol (isobutylmethylxanthine + dexamethasone for 48 h, followed, after their removal, by insulin + the test compound) was used in all experiments. *P < 0.05 vs. vehicle. (C) Confluent, serum-deprived human fetal lung fibroblasts (IMR-90) were pretreated with PPAR-! antagonists (GW: GW9662, T007: T0070907, and Ant. III: Antagonist III) for 1 h, then with curcumin for 1 h, after which cells were stimulated with TGF-" (2 ng/ml). After an additional 24 h, cell lysates were subjected to SDSPAGE and Western blotting. Membranes were probed first with antiâ&#x20AC;&#x201C;#-SMA antibody, then reprobed with anti-GAPDH antibody to confirm equal protein loading. The blots were scanned densitometrically. *P < 0.05 vs. vehicle.

Up-regulation of PPAR-! expression has been demonstrated in hepatic stellate cells (Cheng et al, 2007; Lin and Chen, 2008; Xu et al, 2003; Zheng and Chen, 2004; Zhou et al, 2007), in a macrophage cell line (Siddiqui et al, 2006), and in colonic mucosal cells from a rodent model of colitis induced by trinitrobenzene sulfonic acid (Zhang et al, 2006). One study found that this upregulation of PPAR-! expression was secondary to inhibition of PDGF and EGF signaling pathways (Zhou et al, 2007). Furthermore, in the rat model of colitis induced by trinitrobenzene sulfonic acid, curcumin was observed to increase levels of the endogenous PPAR-! ligand 15dPGJ2 (Zhang et al, 2006). None of these studies directly examined possible binding of curcumin to the PPAR-! ligand-binding site, however. Although the reported increases in amount of receptor, and possibly of its endogenous ligands, appear to be plausible explanations for the results obtained, the possibility that curcumin also bound to and directly activated PPAR-! had been suggested (Chen and Xu, 2005; Jacob et al, 2007). In direct contrast to our results, one group has specifically asserted that curcumin is a PPAR-! ligand (Kuroda et al, 2005; Nishiyama et al, 2005). This group reported increased activity in a GAL4-PPAR-! chimeric assay in CV-1 cells. These researchers also noted that curcumin induced differentiation of preadipocytes, which we did not observe, although these were primary human preadipocytes rather than the standard 3T3-L1 cells that were employed in this study. Furthermore, while we repeated all experiments with three different commercially

available high-purity curcumin formulations (data not shown), this group conducted preadipocyte differentiation studies and some ligand-binding studies with ethanolic extracts of turmeric. Other ligand-binding studies were performed with curcumin purified in their laboratories. Because these curcumin preparations were not standardized, the possible role of other compounds present in these formulations cannot be ruled out. Recently, it has also been shown that curcumin down-regulates PPAR-! expression in preadipocytes, thus actively inhibiting their differentiation (Lee et al, 2009). This observation further supports our conclusions. In summary, our results conclusively show that curcumin is not a PPAR-! ligand. Thus, any observed PPAR-!-mediated effects of curcumin must be indirect and mediated through effects of receptor expression or levels of endogenous ligands that are mediated through other pathways. Since we have now ruled out one suggested mechanism for curcumin, further study of alternative mechanisms is warranted.

Acknowlegements Supported by National Institutes of Health grants HL070068 and AI079539, a University of Michigan Global REACH International Grant, and the Martin E. Galvin Fund and Quest for Breath Foundation (all to R.C.R.).

Gene Therapy and Molecular Biology Vol 13, page 25 Maheshwari RK, Singh AK, Gaddipati J, Srimal RC (2006) Multiple biological activities of curcumin: a short review. Life Sci 78, 2081-2087. Milam JE, Keshamouni VG, Phan SH, Hu B, Gangireddy SR, Hogaboam CM, Standiford TJ, Thannickal VJ, Reddy RC (2008) PPAR-gamma agonists inhibit profibrotic phenotypes in human lung fibroblasts and bleomycin-induced pulmonary fibrosis. Am J Physiol Lung Cell Mol Physiol 294, L891901. Monajemi H, Zhang L, Li G, Jeninga EH, Cao H, Maas M, Brouwer CB, Kalkhoven E, Stroes E, Hegele RA, Leff T (2007) Familial partial lipodystrophy phenotype resulting from a single-base mutation in deoxyribonucleic acidbinding domain of peroxisome proliferator-activated receptor-gamma. J Clin Endocrinol Metab 92, 1606-1612. Nishiyama T, Mae T, Kishida H, Tsukagawa M, Mimaki Y, Kuroda M, Sashida Y, Takahashi K, Kawada T, Nakagawa K, Kitahara M (2005) Curcuminoids and sesquiterpenoids in turmeric (Curcuma longa L.) suppress an increase in blood glucose level in type 2 diabetic KK-Ay mice. J Agric Food Chem. 53, 959-963. Reddy RC, Vatsala PG, Keshamouni VG, Padmanaban G, Rangarajan PN (2005) Curcumin for malaria therapy. Biochem Biophys Res Commun 326, 472-474. Schopfer FJ, Lin Y, Baker PRS, Cui T, Garcia-Barrio M, Zhang J, Chen K, Chen YE, Freeman BA (2005) Nitrolinoleic acid: an endogenous peroxisome proliferator-activated receptor ! ligand. Proc Natl Acad Sci U S A 102, 2340-2345. Siddiqui AM, Cui X, Wu R, Dong W, Zhou M, Hu M, Simms HH, Wang P (2006) The anti-inflammatory effect of curcumin in an experimental model of sepsis is mediated by up-regulation of peroxisome proliferator-activated receptor!. Crit Care Med 34, 1874-1882. Song DH, Getty-Kaushik L, Tseng E, Simon J, Corkey BE, Wolfe MM (2007) Glucose-dependent insulinotropic polypeptide enhances adipocyte development and glucose uptake in part through Akt activation. Gastroenterology 133, 1796-1805. Srivastava KC, Bordia A, Verma SK (1995) Curcumin, a major component of food spice turmeric (Curcuma longa) inhibits aggregation and alters eicosanoid metabolism in human blood platelets. Prostaglandins Leukot Essent Fatty Acids 52, 223-227. Thangapazham RL, Sharma A, Maheshwari RK (2006) Multiple molecular targets in cancer chemoprevention by curcumin. AAPS J 8, E443-449. Tontonoz P, Hu E, Spiegelman BM (1994) Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipidactivated transcription factor. Cell 79, 1147-1156. Xu J, Fu Y, Chen A (2003) Activation of peroxisome proliferator-activated receptor-! contributes to the inhibitory effects of curcumin on rat hepatic stellate cell growth. Am J Physiol Gastrointest Liver Physiol 285, G20-30. Zhang M, Deng C, Zheng J, Xia J, Sheng D (2006) Curcumin inhibits trinitrobenzene sulphonic acid-induced colitis in rats by activation of peroxisome proliferator-activated receptor !. Int Immunopharmacol 6, 1233-1242. Zheng S, Chen A (2004) Activation of PPAR! is required for curcumin to induce apoptosis and to inhibit the expression of extracellular matrix genes in hepatic stellate cells in vitro. Biochem J 384, 149-157. Zhou Y, Zheng S, Lin J, Zhang QJ, Chen A (2007) The interruption of the PDGF and EGF signaling pathways by curcumin stimulates gene expression of PPAR! in rat activated hepatic stellate cell in vitro. Lab Invest 87, 488498.

References Aggarwal BB, Sundaram C, Malani N, Ichikawa H (2007) Curcumin: the Indian solid gold. Adv Exp Med Biol 595, 175. Berger J, Moller DE (2002) The mechanisms of action of PPARs. Annu Rev Med 53, 409-435. Burgess HA, Daugherty LE, Thatcher TH, Lakatos HF, Ray DM, Redonnet M, Phipps RP, Sime PJ (2005) PPARgamma agonists inhibit TGF-beta induced pulmonary myofibroblast differentiation and collagen production: implications for therapy of lung fibrosis. Am J Physiol Lung Cell Mol Physiol 288, L1146-1153. Camp HS, Chaudhry A, Leff T (2001) A novel potent antagonist of peroxisome proliferator-activated receptor gamma blocks adipocyte differentiation but does not revert the phenotype of terminally differentiated adipocytes. Endocrinology 142, 3207-3213. Chen A, Xu J (2005) Activation of PPAR! by curcumin inhibits Moser cell growth and mediates suppression of gene expression of cyclin D1 and EGFR. Am J Physiol Gastrointest Liver Physiol 288, G447-456. Chen Y-R, Tan T-H (1998) Inhibition of the c-Jun N-terminal kinase (JNK) signaling pathway by curcumin. Oncogene 17, 173-178. Cheng Y, Ping J, Xu LM (2007) Effects of curcumin on peroxisome proliferator-activated receptor ! expression and nuclear translocation/redistribution in culture-activated rat hepatic stellate cells. Chin Med J (Engl) 120, 794-801. Evans RM, Barish GD, Wang YX (2004) PPARs and the complex journey to obesity. Nat Med 10, 355-361. Fu J, Gaetani S, Oveisi F, Lo Verme J, Serrano A, Rodriguez De Fonseca F, Rosengarth A, Luecke H, Di Giacomo B, Tarzia G, Piomelli D (2003) Oleylethanolamide regulates feeding and body weight through activation of the nuclear receptor PPAR-alpha. Nature 425, 90-93. Gaedeke J, Noble NA, Border WA (2004) Curcumin blocks multiple sites of the TGF-" signaling cascade in renal cells. Kidney Int 66, 112-120. Hu M, Du Q, Vancurova I, Lin X, Miller EJ, Simms HH, Wang P (2005) Proapoptotic effect of curcumin on human neutrophils: activation of the p38 mitogen-activated protein kinase pathway. Crit Care Med. 33, 2571-2578. Issemann I, Green S (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347, 645-650. Jacob A, Wu R, Zhou M, Wang P (2007) Mechanism of the Anti-inflammatory Effect of Curcumin: PPAR-gamma Activation. PPAR Res 2007, 89369. Kuroda M, Mimaki Y, Nishiyama T, Mae T, Kishida H, Tsukagawa M, Takahashi K, Kawada T, Nakagawa K, Kitahara M (2005) Hypoglycemic effects of turmeric (Curcuma longa L. rhizomes) on genetically diabetic KK-Ay mice. Biol Pharm Bull 28, 937-939. Lee YK, Lee WS, Hwang JT, Kwon DY, Surh YJ, Park OJ (2009) Curcumin exerts antidifferentiation effect through AMPKalpha-PPAR-gamma in 3T3-L1 adipocytes and antiproliferatory effect through AMPKalpha-COX-2 in cancer cells. J Agric Food Chem. 57, 305-310. Lemberger T, Desvergne B, Wahli W (1996) Peroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev Biol 12, 335-363. Lin J, Chen A (2008) Activation of peroxisome proliferatoractivated receptor-! by curcumin blocks the signaling pathways for PDGF and EGF in hepatic stellate cells. Lab Invest 88, 529-540.

Hochwald and Golubovskaya: FAK and cancer therapy Gene Ther Mol Biol Vol 13, 26-35, 2009

FAK as a target for cancer therapy Review Article

Steven N. Hochwald*, Vita M. Golubovskaya Department of Surgery, University of Florida College of Medicine, Gainesville, Florida

__________________________________________________________________________________ *Correspondence: Steven N. Hochwald MD, Department of Surgery, University of Florida College of Medicine, 1600 SW Archer Road, P.O. Box 100109, Gainesville, FL 32609, USA; Tel: 352-265-0761, Fax: 352-265-0262, e-mail: Steven.Hochwald@surgery.ufl.edu Key words: ocal Adhesion Kinase; malignancy; cancer; Y15 Abbreviations: FAK, (Focal Adhesion Kinase); FERM, (Focal Adhesion Kinase Ezrin/Radixin/Moesin; FRNK, (FAK-related non kinase) This work was supported by the following NIH grant: CA113766 (S.N.H.) Received: 20 March 2009; Accepted: 24 March 2009; electronically published: April 2009

Summary We have learned that malignant cells are similar to normal cells in the signaling pathways that they use. However, cancer cells acquire aberrations that favor their growth in the complex environments of living tissues. This includes their ability to invade and metastasize and their ability to grow and divide indefinitely. The progression of human cancer is characterized by a process of tumor cell motility, invasion, and metastasis to distant sites, requiring the cancer cells to be able to survive the apoptotic pressures of anchorage-independent conditions. One of the main tyrosine kinases that are linked to this malignant phenotype is the Focal Adhesion Kinase (FAK). FAK is overexpressed in many types of tumors and recently has been proposed to be a target for anti-cancer therapy. In this review, we will review the FAK structure, its role in signaling, and FAK targeted therapy approaches in malignancy.

surface receptor) signaling. The FAK gene was first isolated from chicken embryo fibroblasts transformed by v-src (Schaller et al, 1992). Subsequently, the FAK gene was identified in human tumors, and FAK mRNA has been shown to be up-regulated in invasive and metastatic human breast and colon cancer samples as compared to normal tissues (Weiner et al, 1993). This was the first evidence that FAK might be regulated at the level of gene transcription. Subsequently, up-regulation of FAK has been demonstrated at the protein level in a wide variety of human tumors, including breast cancer, colon cancer, ovarian cancer, thyroid cancer, melanoma, and sarcoma (Owens et al, 1995, 1996; Judson et al, 1999; Cance et al, 2000). Recently, the regulatory promoter region of the FAK gene was cloned and confirmed transcriptional upregulation in cancer cell lines (Golubovskaya et al, 2004).

I. Introduction Despite recent advances in surgery, chemotherapy and radiation treatment, survival of patients with advanced malignancy remains suboptimal. Fortunately, our understanding of the origins of cancer has changed dramatically over the last twenty-five years, owing in large part to the revolution in molecular biology that has changed all biomedical research. Powerful experimental tools are available to cancer biologists and have made it possible to uncover and dissect the complex molecular machinery operating inside normal and malignant cells. In addition, these tools have allowed researchers to pinpoint the defects that cause cancer cells to signal and proliferate abnormally. Focal Adhesion Kinase (FAK) was discovered about 15 years ago as a tyrosine phosphorylated protein kinase. Investigations in several laboratories have shown that this protein plays a critical role in intracellular processes of cell adhesion, motility, survival, and cell cycle progression. The FAK gene encodes a non-receptor tyrosine kinase that localizes at contact points of cells with extracellular matrix and is activated by integrin (cell

II. Molecular structure of focal adhesion kinase The human FAK (also known as PTK2a) gene has been mapped to chromosome 8 (Fiedorek, Jr. and Kay, 1995; Agochiya et al, 1999), and there appears to be a high

Gene Therapy and Molecular Biology Vol 13, page 27 degree of homology between vertebrate species. Human complete FAK mRNA sequence (NCBI Accession number: L13616) is 3791 bases long and includes a 5’untranslated 233 base pair region (Whitney et al, 1993). Human FAK cDNA was first isolated from primary sarcoma tissue and increased FAKmRNA was seen in tumor samples compared with normal tissue samples (Weiner et al, 1993). Subsequently, Xenopus laevis FAK cDNA (Zhang et al, 1995) and rat FAK cDNA (Burgaya and Girault, 1996) were identified. Recently, Drosophila FAK cDNA (Dfak56) was isolated (Fujimoto et al, 1999). FAK cDNA is closely related to the homologous prolinerich calcium dependent tyrosine kinase (45% amino-acid identity) that is also located on human chromosome 8, locus p21.1, named PYK2 (RAFTK (related adhesion focal tyrosine kinase), CADTK (calcium-dependent tyrosine kinase), CAK (cell adhesion kinase) b, PTK 2b (protein tyrosine kinase 2b) (Avraham et al, 1995; Lev et al, 1995; Sasaki et al, 1995). The gene coding FAK contains 34 exons (NCBI Gene ID: 5747), and genomic sequence spans 230 kb (Corsi et al, 2006). The FAK gene contains four 5’ noncoding exons and 34 coding exons and has been shown to have multiple alternatively spliced forms. Comparison of the mouse and human FAK genes detected conservative and non-conservative 5’-untranslated exons that suggests a complex regulation of FAK expression. Exons (Sasaki et al, 1995; Burgaya and Girault, 1996; Fujimoto et al, 1999; Golubovskaya et al, 2002) are highly conserved among vertebrate species, suggesting their critical function in gene regulation (Corsi et al, 2006). It is known that alternative splicing often occurs and plays an important role in cancer (Caballero et al, 2001; Venables, 2006). Alternative splicing most often results from different exon inclusion, but can also occur from intron retention or alternative choice between two splice sites leading to changes in protein localization, structure, removal of phosphorylation sites, or proteasomal degradation (Venables, 2006). There were several cases of alternatively spliced genes that are involved in invasion and metastasis (Rac 1, !-catenin, Crk) or angiogenesis (VEGFR-2, VEGFR-3 (Flt-4)). Thus, detailed study of alternatively spliced forms of FAK that are overexpressed in pre- and metastatic cancers will be critical for understanding mechanisms and regulation of FAK expression in carcinogenesis, either by changes in mRNA, by changes in the coding sequence (exon inclusion/exclusion), or by changes in protein levels (stability, etc.). The human FAK promoter regulating FAK expression contains 600 base pairs and includes many transcription binding sites, such as AP-1, AP-2, SP-1, PU.1, GCF, TCF-1, EGR-1, NF-!B and p53 (Golubovskaya et al, 2004). Interestingly, two transcription binding sites for p53 have been identified in the FAK promoter, and p53 can block FAK promoter activity (Golubovskaya et al, 2004). Recently, the mouse promoter has been cloned and found to be highly homologous to the human promoter and contains the same binding sites (Corsi et al, 2006). In addition, the FAK gene has an internal FRNK promoter or C-terminal, FAK-CD

promoter that has been recently cloned by Parsons group (Hayasaka et al, 2005), regulating expression of autonomously expressed FRNK protein.

A. FAK protein structure The FAK protein is a 125 kDa tyrosine kinase (p125FAK) with a large amino-N-terminal domain, exhibiting homology with a FERM (protein 4.1, ezrin, radixin and moesin) domain with an autophosphorylation site (Y-397), a central catalytic domain, and a large carboxy-C-terminal domain that contains a number of potential protein interacting sites, including two prolinerich domains and FAT domain (Schaller and Parsons, 1994; Schaller et al, 1994; Hanks and Polte, 1997) (Figure 1).

B. The kinase domain The central kinase domain of FAK (amino acids 424676) contains the Y576 and Y577, major phosphorylation sites, and also K454, which is the ATP binding site (Figure 1). Phosphorylation of FAK by Src on Y576 and Y577 is an important step in the formation of an active signaling complex and is required for maximal FAK enzymatic activity (Calalb et al, 1995). The crystal structure of the FAK kinase domain reveals an open conformation similar to other kinases (Nowakowski et al, 2002). The FAK kinase domain structure has an unusual bisulphite bond between the conserved cysteines 456 and 459, suggesting a possible role in protein-protein interactions and kinase function (Nowakowski et al, 2002). The ATP binding site of protein kinases is the most common target for the small-molecule inhibitors, although the design and specificity of these inhibitors can be complicated by structural similarities between kinase domains. Thus, finding small structural differences between the ATP binding site of kinases is crucial in the design of small molecule kinase inhibitors. For example, the side chain of glutamic acid, E506 forms a bifurcated hydrogen bond to the 2’ and 3’ hydroxyl groups of the ribose (Nowakowski et al, 2002). The corresponding side chains in EphA2 and Aurora-A kinases are smaller and do not contact with sugar (Nowakowski et al, 2002).

C. The N-terminal domain The first function of the N-terminal, homologous to FERM domain was linked to the binding of integrins, via their ! subunits (Schaller et al, 1995). The N-terminal domain of FAK protein contains the major autophosphorylation site Y397-tyrosine, that in its phosphorylated form becomes a binding site of the SH-2 domain of Src, leading to its conformational changes and activation (Hanks and Polte, 1997). Tyrosine phosphorylation of FAK and binding of Src leads to tyrosine phosphorylation of other tyrosine phosphorylation sites of FAK: Y407; Y576,Y577- major phosphorylation sites in the catalytic domain of FAK; Y861 and Y925 (Hanks and Polte, 1997; McLean et al, 2005), and to phosphorylation of FAK binding proteins, such as paxillin and Cas (Schaller et al, 1999). This leads to subsequent cytoskeletal changes and activation of RAS-MAPK (mitogen-activated protein kinase) signaling pathways 27

Hochwald and Golubovskaya: FAK and cancer therapy (Hanks et al, 2003; McLean et al, 2005). Thus, the FAKSrc signaling complex activates many signaling proteins involved in survival, motility and metastatic, invasive phenotype in cancer cells (Figures 1 and 2). Phosphorylated Y397 FAK is able to recruit important signaling molecules, p85 PI3-kinase (phosphoinositide 3kinase), growth factor receptor bound protein Grb 7, phospholipase C" (PLC") and others. Crystal structure of the N-terminal domain of avian FAK, containing the FERM domain, has been recently reported (Ceccarelli et al, 2006). Of note, negative regulation of FAK function by FERM domain was revealed (Cooper et al, 2003), where the N-terminal domain had an autoinhibitory effect through interaction with the kinase domain of FAK.

Recently, several novel binding partners in cancer cells of the FAK N-terminus, such as EGFR ( Sieg et al, 2000; Golubovskaya et al, 2002), RIP (Kurenova et al, 2004) and p53 (Golubovskaya et al, 2005) have been reported (Figure 1). The N-terminal domain of FAK has been shown to cause apoptosis in breast cancer cells (Beviglia et al, 2003) and can be localized to the nucleus (Lobo and Zachary, 2000; Jones et al, 2001; Stewart et al, 2002; Jones and Stewart, 2004). Thus, the N-terminal domain of FAK binds to the extracellular matrix receptors, integrins, growth factor receptors, and important cytoplasmic, cytoskeletal and nuclear proteins, mediating signaling from the extracellular matrix to the cytoplasm and nucleus and controlling cytoskeletal changes, survival, motility, and invasion.

Figure 1. Structure of FAK molecule with multiple interacting partners. FAK has multiple important functions including an impact on cell survival pathways and apoptosis.

Figure 2. FAK expression in human pancreatic cancers. (A, top) Immunohistochemical staining of FAK in human pancreatic adenocarcinomas. Intensity of FAK staining is higher in metastases than in primary tumor. (Mean±SE: 3.5±0.2 vs 4±0, p=0.001). (B, bottom) FAK staining in pancreatic cancer. Representative example demonstrating staining of FAK in primary and metastatic pancreatic cancer.

Gene Therapy and Molecular Biology Vol 13, page 29

D. The C-terminal domain

now there are total of 30 sites of phosphorylation of FAK, including those reported before, requiring detailed analysis of their biological functioning in vivo.

Different proteins can bind to the C-terminal domain of FAK (amino acids 677-1052), including paxillin, p130cas, PI3-kinase, and GTP-ase-activating protein Graf, leading to changes in the cytoskeleton and to activation of the Ras-MAP kinase pathway (Schaller and Parsons, 1994; Windham et al, 2002; Hanks et al, 2003; Parsons, 2003). The carboxy-terminal domain of FAK contains sequences responsible for its targeting to focal adhesions, also known as the FAT domain. Alternative splicing of FAK results in autonomous expression of the C-terminal part of FAK, FAK-related non-kinase (FRNK) (Richardson and Parsons, 1995). The crystal structure of the C-terminal domain of FAK, FAT, has been determined recently by several groups (Hayashi et al, 2002; Prutzman et al, 2004) and structure analysis demonstrates that it can exist as a dimer or monomer, allowing binding of several binding partners.

III. FAK functioning in cells Attachment to the underlying extracellular matrix provides cells with both a means of anchorage needed for traction during migration via a link to the actin cytoskeleton and also with intracellular structures that house membrane-associated signaling proteins. This leads to the transmission of biochemical signals into the cell interior to induce multiple biological responses. Loss of regulation of the process of adhesion formation or turnover, or of downstream signaling is likely to contribute to primary tumor development and/or tumor dissemination. Signaling via adhesion-associated kinases controls the changes that are necessary for cell migration including regulation of cell-matrix adhesion turnover and coordination of remodeling of the actin cytoskeleton network (Cance et al, 2000). FAK has numerous functions in cell survival, motility, metastasis, invasion, and angiogenesis. FAK has also been shown to be important for cell motility (Hauck et al, 2001; Schaller, 2001; Hanks et al, 2003; Schlaepfer and Mitra, 2004). FAK-null embryos exhibit decreased motility in vitro (Ilic et al, 1995). Furthermore, forced expression of FAK stimulated cell migration (Hildebrand et al, 1993; Sieg et al, 1999). Cell migration is initiated by protrusion at the leading edge of the cell, by the formation of peripheral adhesions, exertion of force on these adhesions, and then the release of the adhesions at the rear of the cell (Tilghman et al, 2005). FAK has been shown to be required for the organization of the leading edge in migrating cells by coordinating integrin signaling in order to direct the correct activation of membrane protrusion (Tilghman et al, 2005). SH2 domain of Src, targeting Src to focal adhesions and Y397 activity has been shown to be important for motility (Yeo et al, 2006). PI3 kinase has been also shown to be critical for FAK-mediated motility in Chinese hamster ovary (CHO) cells (Reiske et al, 1999). Tumor suppressor gene PTEN, encoding phosphatase has been shown to interact with FAK, causing its dephosphorylation and blocked motility (Tamura et al, 1998). Moreover, Y397FAK was important for PTEN interaction with FAK (Tamura et al, 1999). Overexpression of FAK reversed the inhibitory effect of PTEN on cell migration (Tamura et al, 1998). Activation of FAK is linked to invasion and metastasis signaling pathways. FAK was important in Erb2/Erb3-induced oncogenic transformation and invasion (Benlimame et al, 2005). Inhibition of FAK in FAKproficient invasive cancer cells prevented cell invasion and metastasis processes (Benlimame et al, 2005). In addition, FAK has been shown to be activated in invading fibrosarcoma and regulated metastasis (Hanada et al, 2005). Inhibition of FAK with dominant-negative FAKCD disrupted invasion of cancer cells (Hauck et al, 2001). We have also shown high FAK expression in breast cancers associated with an aggressive tumor phenotype (Lark et al, 2005). Subsequently, we analyzed FAK expression in pre-invasive ductal carcinoma in situ, DCIS

E. Post-translational protein modifications FAK function is altered by post-translational modifications including phosphorylation of tyrosines or serines. FAK has numerous tyrosine phosphorylated sites: Y397, Y407, Y576/Y577, Y861 and Y925. Phosphorylation of Y397, creates a binding site for Src, PI3K, PLC-g, Grb-7 and Grb-2-SOS. Phosphorylation of tyrosine 407, as well as Y397, correlated with differentiation and with the level of gastrin-releasing peptide and its receptor in colon cancer cells (Matkowskyj et al, 2003). Phosphorylation of Y576 and Y577 correlated with maximal activity of FAK (Calalb et al, 1995). Srcdependent phosphorylation of Y861 was induced by VEGFR in HUVEC endothelial cells (bu-Ghazaleh et al, 2001). FAT domain mediates signaling through Grb-2 binding to Y925 site of FAK (Arold et al, 2002). Inhibition of FAK that resulted in decreased Y925 phosphorylation of FAK resulted in decreased FAK-Grb2MAPK signaling and VEGFR-induced tumor growth of 4T1 breast carcinoma cells (Mitra et al, 2006). In addition to tyrosine phosphorylation, several serine phosphorylation sites have been reported to play a major role in FAK function, such as serines 722, 732, 843 and 910. The role of serine phosphorylation is less described than phosphorylation of tyrosines but was suggested to play a role in binding/stability of proteins (Parsons, 2003). In addition, recent mass spectrometry analysis of chicken FAK revealed 19 new sites of phosphorylation with some sites reported before: 15 serine, 5 threonine, and 5 tyrosine residues (Grigera et al, 2005). The authors suggested that coordinated phosphorylation of FAK by tyrosine and serine/threonine-specific kinases may be critical a step in regulation of FAK function (Grigera et al, 2005). Some of the sites were present only in chicken FAK, such as S386, T388 and T393, but several chicken phosphorylation sites were conserved in human, mouse, and frog species, such as S29, Y155, S390, S392, T394, Y397, T406, Y407, Y570, T700, S708, S722, S725, S726, S732, S766, S845 (S843 in human), S894, Y899 and S911 (S910 in human and mouse) (Grigera et al, 2005). Thus, 29

Hochwald and Golubovskaya: FAK and cancer therapy tumors and detected protein overexpression in preinvasive tumors (Lightfoot, Jr. et al, 2004), suggesting that FAK survival function occurs as an early event in breast tumorigenesis. FAK plays a major role in survival signaling and has been linked to detachment-induced apoptosis or anoikis (Frisch et al, 1996). It has been shown that constitutively activated forms of FAK rescued epithelial cells from anoikis, suggesting that FAK can regulate this process (Frisch et al, 1996; Frisch and Ruoslahti, 1997; Frisch, 1999; Frisch and Screaton, 2001; Windham et al, 2002). Similarly, both FAK antisense oligonucleotides (Xu et al, 1996; Smith et al, 2005), as well as dominant-negative FAK protein (FAK-CD), caused cell detachment and apoptosis in tumor cells (Xu et al, 1996, 1998, 2000; van de et al, 2001; Golubovskaya et al, 2002, 2003; Beviglia et al, 2003; Gabarra-Niecko et al, 2003; Park et al, 2004b). The anti-apoptotic role of FAK was also demonstrated in FAK-transfected FAK/HL60 cells that were highly resistant to apoptosis induced with etoposide and hydrogen peroxide compared with the parental HL-60 cells or the vector-transfected cells (Sonoda et al, 2000; Kasahara et al, 2002). HL-60/FAK cells activated the AKT pathway and NF-!B survival pathways with the induction of inhibitor-of-apoptosis proteins, IAPs (Sonoda et al, 2000). We have demonstrated that EGFR and Src signaling cooperate with FAK survival signaling in colon and breast cancer cells (Golubovskaya et al, 2002, 2003; Park et al, 2004a,b). We have also demonstrated that simultaneous inhibition of Src and FAK or EGFR and FAK pathways was able to increase apoptosis in cancer cells (Golubovskaya et al, 2002, 2003). Thus, cancer cells use the cooperative function of kinases and growth factor receptor signaling to increase survival. Vascular endothelial growth factor (VEGF) is one of the known angiogenic growth factors, stimulating formation of new blood vessels or angiogenesis. FAK has been shown to play a major role in vasculogenesis. It has been shown that VEGF induced tyrosine phosphorylation of FAK in human umbilical vein endothelial cells (HUVEC) and other endothelial cell lines (Abedi and Zachary, 1997). VEGF-induced stimulation of FAK phosphorylation was also demonstrated in cultured rat cardiac myocytes that was accompanied by subcellular translocation of FAK from perinuclear sites to the focal adhesions and increased association with the adaptor proteins Shc, Grb-2 and c-Src (Takahashi et al, 1999). VEGF-induced phosphorylation of FAK was inhibited by the tyrosine kinase inhibitors tyrphostin and genistein (Takahashi et al, 1999). VEGF-induced phosphorylation of FAK was induced in human brain microvascular endothelial cell (HBMEC) (Avraham et al, 2003). Furthermore, inhibition of FAK with the dominantnegative inhibitor FRNK (FAK-related non-kinase) or the C-terminal FAK (FAK-CD) significantly decreased HBMEC spreading and migration (Avraham et al, 2003, 2004). In addition, angiogenic inhibitor endostatin blocked VEGF-induced activation of FAK (Kim et al, 2002). Recently, we have shown that FAK binds to VEGFR-3 (Flt-4) protein in cancer cell lines (Garces et al, 2006), suggesting an important role of FAK in lymphogenesis in

addition to angiogenesis. We have shown that the Cterminal domain of FAK binds to VEGFR-3. Disruption of this binding with VEGFR peptides caused apoptosis in breast cancer cells, allowing novel therapeutic approaches in breast tumors (Garces et al, 2006). The detailed interaction of FAK and VEGFR signaling and its mechanisms remain to be discovered in the future.

IV. FAK as a target for therapy Recently, several reports describe the properties of FAK inhibitors in vitro and in vivo. FAK has been proposed to be a new therapeutic target (McLean et al, 2005). Initial studies which evaluated the effects of FAK inhibition in preclinical models focused on dominant negative mutants of FAK, antisense oligonucleotides and siRNAs (Parsons et al, 2008). More recently, scientists at Novartis Pharmaceuticals designed and synthesized a series of 2-amino-9-aryl-7H-pyrrolo[2,3-d]pyrimidines to inhibit FAK using molecular modeling in conjunction with a co-crystal structure (Choi et al, 2006). Chemistry was developed to introduce functionality onto the 9-aryl ring, which resulted in the identification of potent FAK inhibitors. We and others have published reports on the use of such FAK inhibitors that have targeted the ATP binding site in the kinase domain. In human pancreatic cancer, we have shown widespread expression of FAK in primary pancreatic adenocarcinoma. In addition, we have shown significant upregulation of FAK protein expression in metastatic lesions (Figure 2, unpublished data). In human pancreatic cancer cells, we have identified that the FAK kinase inhibitor, TAE226, decreases viability, increases cell detachment and increases apoptosis (Liu et al, 2008). Other studies have shown that TAE226 readily induced apoptosis in human breast cancer cells with overexpressed Src or EGFR. Of note, these cells were resistant to adenoviral FAK dominant negative treatment, indicating that kinase inhibition was important for downregulation of FAK function and the observed phenotypic changes (Golubovskaya et al, 2008b). Subsequent studies have studied the in vivo effects of TAE226. The expression status of FAK in Barrett’s esophageal adenocarcinoma has been recently reported. FAK expression was studied in frank adenocarcinoma, areas of Barrett’s epithelia, squamous epithelia, and gastric epithelia. FAK expression was increased in cancerous parts compared to non-cancerous areas and strong expression (>50% positive staining cells per area) were observed in 94% of Barrett’s esophageal adenocarcinoma compared with 18% of Barrett’s epithelia. In a subcutaneous model of human esophageal cancer, TAE226 given orally at 30 mg/kg significantly decreased tumor volume and weight compared with placebo (Watanabe et al, 2008). Similar results from in vivo studies have confirmed the ability of TAE226 to decrease the growth of ovarian and glioma xenografts (Shi et al, 2007). While initial results with kinase inhibition of FAK has shown anti-neoplastic effects, TAE226 has been shown to also inhibit the activity of IGF-1R at nanomolar concentrations (Liu et al, 2007). Therefore, the activities against multiple tumor types likely reflect its dual 30

Gene Therapy and Molecular Biology Vol 13, page 31 inhibition of adhesion and growth promoting pathways. Recently, Pfizer pharmaceuticals have published results on an ATP competitive reversible inhibitor of FAK that has bioavailability suitable for preclinical animal and human studies. PF-562,271 was shown to exhibit >100 fold selectivity for FAK when assayed against a panel of unrelated kinases. Treatment of cancer cells lines showed a dose dependent decrease in FAK phosphorylation at the Y397 site. The IC50 for FAK phosphorylation was reported to be 5 nmol/L. Anti-tumor efficacy was observed in multiple human subcutaneous xenograft models with minimal weight loss or mortality (Parsons et al, 2008; Roberts et al, 2008). PF-562,271 is currently in phase 2 clinical trials. Phase 1 study results with this drug in patients with advanced solid malignancy have been reported in abstract form (Siu ll et al, 2008). Studies have been performed in 2 centers in the United States and one center in Canada and Australia with oral dosing as a single agent. Thirty two patients received from 5 mg up to 105 mg twice a day. Adverse events possibly related to the drug in over 10% were nausea, vomiting, fatigue, anorexia, abdominal pain, diarrhea, headache, sensory neuropathy, rash, constipation, and dizziness. Adverse events were generally grade 1-2

and reversible. Doses over 15 mg twice a day produced steady state plasma concentrations exceeding target efficacious levels predicted from preclinical models. Prolonged disease stabilization was observed in several tumor types. Phase 1 results indicated good tolerability of this drug with favorable pharmacokinetics and pharmacodynamics (Siu ll et al, 2008). This drug represents the sole FAK inhibitor being tested in humans to date. Another approach to inhibit FAK function can be to target protein-protein interactions between FAK and its binding partners such as p53, VEGFR-3 or EGFR or targeting sites of FAK phosphorylation (Golubovskaya et al, 2008a). Tyrosine 397 is an autophosphorylation site of FAK that is a critical component in downstream signaling, providing a high-affinity binding site for the SH2 domain of Src family kinases (Figure 3). Y397 is also a site of binding of PI3 kinase, growth factor receptor binding Grb7, Shc and other proteins. Thus, the Y397 site is one of the main phosphorylation sites that can activate FAK signaling in cells. We recently demonstrated that computer modeling and screening can be performed to identify novel small molecules that inhibit protein-protein interactions at the Y397 site (Golubovskaya et al, 2008a). Figure 3. The Y397 autophosphorylation site of FAK has several binding proteins and is critical for survival signaling.

Figure 4. (A, Left) Molecular modeling of Y15 compound in the Y397 pocket of FAK. Y15 is shown in purple and the FAK pocket in green. (B, right) Structure of Y15. Reproduced from Golubovskaya et al, 2008 with kind permission from Journal of Medicinal Chemistry.

Hochwald and Golubovskaya: FAK and cancer therapy

Figure 5. Y15 significantly blocks tumor growth in vivo and its effects are synergistic with gemcitabine treatment. Mice (n=5/group) were subcutaneously injected with Panc-1 cells. The day after injection, mice were treated with daily intraperitoneal PBS, intraperitoneal Y15 (30mg/kg), intraperitoneal gemcitabine alone (30mg/kg) or Y15 (30mg/kg) + gemcitabine (30mg/kg). The combination of Y15 + gemcitabine significantly decreased tumor volume compared to Y15 or gemcitabine (Gen) alone. *p<0.05 vs. Y15 or gemcitabine alone.

focal adhesions of focal adhesion kinase and paxillin in endothelial cells. J Biol Chem 272, 15442-15451. Agochiya M, Brunton VG, Owens DW, Parkinson EK, Paraskeva C, Keith WN, Frame MC (1999) Increased dosage and amplification of the focal adhesion kinase gene in human cancer cells. Oncogene 18, 5646-5653. Arold ST, Hoellerer MK, Noble ME (2002) The structural basis of localization and signaling by the focal adhesion targeting domain. Structure 10, 319-327. Avraham HK, Jiang S, Lee TH, Prakash O, Avraham S (2004) HIV-1 Tat-mediated effects on focal adhesion assembly and permeability in brain microvascular endothelial cells. J Immunol 173, 6228-6233. Avraham HK, Lee TH, Koh Y, Kim TA, Jiang S, Sussman M, Samarel AM, Avraham S (2003) Vascular endothelial growth factor regulates focal adhesion assembly in human brain microvascular endothelial cells through activation of the focal adhesion kinase and related adhesion focal tyrosine kinase. J Biol Chem 278, 36661-36668. Avraham S, London R, Fu Y, Ota S, Hiregowdara D, Li J, Jiang S, Pasztor LM, White RA, Groopman JE (1995) Identification and characterization of a novel related adhesion focal tyrosine kinase (RAFTK) from megakaryocytes and brain. J Biol Chem 270, 27742-27751. Benlimame N, He Q, Jie S, Xiao D, Xu YJ, Loignon M, Schlaepfer DD, aoui-Jamali MA (2005) FAK signaling is critical for ErbB-2/ErbB-3 receptor cooperation for oncogenic transformation and invasion. J Cell Biol 171, 505516. Beviglia L, Golubovskaya V, Xu L, Yang X, Craven RJ, Cance WG (2003) Focal adhesion kinase N-terminus in breast carcinoma cells induces rounding, detachment and apoptosis. Biochem J 373, 201-210. bu-Ghazaleh R, Kabir J, Jia H, Lobo M, Zachary I (2001) Src mediates stimulation by vascular endothelial growth factor of the phosphorylation of focal adhesion kinase at tyrosine 861, and migration and anti-apoptosis in endothelial cells. Biochem J 360, 255-264. Burgaya F, Girault JA (1996) Cloning of focal adhesion kinase, pp125FAK, from rat brain reveals multiple transcripts with

In this approach, more than 140,000 small molecule compounds were docked into the N-terminal domain of the FAK crystal structure in 100 different orientations. Those compounds with the greatest energy of interaction based on van der Waals and electrostatic charges were identified as lead compounds. One compound, 1,2,4,5benzenetetraamine tetrahydrocholoride (Y15) significantly decreased viability in most cancer cells and specifically and directly blocked phosphorylation of Y397-FAK in a dose and time dependent manner (Figure 4). Furthermore, it inhibited cell adhesion and effectively caused breast tumor regression in vivo (Golubovskaya et al, 2008a). Finally, we have shown that it inhibits pancreatic cancer growth in vivo both alone and in combination with gemcitabine chemotherapy (Figure 5, unpublished data). One potential advantage of this approach utilized to identify small molecules through in silico screening is increased target specificity. Y15 did not affect phosphorylation of the FAK homologue, Pyk-2, which can be explained by only 43% amino acid identity between Nterminal domains of FAK and Pyk-2. Other kinase inhibitors of FAK have shown inhibition of Pyk-2 autophosphorylation and likely are less specific for inhibition of FAK function.

V. Conclusions FAK is an emerging target for therapy. A FAK inhibitor is currently in Phase II clinical trials in cancer patients. Novel approaches to FAK inhibition are needed and offer directed molecular therapy. This work was supported by NIH grant number CA113766.

References Abedi H, Zachary I (1997) Vascular endothelial growth factor stimulates tyrosine phosphorylation and recruitment to new

Gene Therapy and Molecular Biology Vol 13, page 33 different patterns of expression. Brain Res Mol Brain Res 37, 63-73. Caballero OL, de Souza SJ, Brentani RR, Simpson AJ (2001) Alternative spliced transcripts as cancer markers. Dis Markers 17, 67-75. Calalb MB, Polte TR, Hanks SK (1995) Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases. Mol Cell Biol 15, 954-963. Cance WG, Harris JE, Iacocca MV, Roche E, Yang X, Chang J, Simkins S, Xu L (2000) Immunohistochemical analyses of focal adhesion kinase expression in benign and malignant human breast and colon tissues: correlation with preinvasive and invasive phenotypes. Clin Cancer Res 6, 2417-2423. Ceccarelli DF, Song HK, Poy F, Schaller MD, Eck MJ (2006) Crystal structure of the FERM domain of focal adhesion kinase. J Biol Chem 281, 252-259. Choi HS, Wang Z, Richmond W, He X, Yang K, Jiang T, Karanewsky D, Gu XJ, Zhou V, Liu Y, Che J, Lee CC, Caldwell J, Kanazawa T, Umemura I, Matsuura N, Ohmori O, Honda T, Gray N, He Y (2006) Design and synthesis of 7H-pyrrolo[2,3-d]pyrimidines as focal adhesion kinase inhibitors. Part 2. Bioorg Med Chem Lett 16, 2689-2692. Cooper LA, Shen TL, Guan JL (2003) Regulation of focal adhesion kinase by its amino-terminal domain through an autoinhibitory interaction. Mol Cell Biol 23, 8030-8041. Corsi JM, Rouer E, Girault JA, Enslen H (2006) Organization and post-transcriptional processing of focal adhesion kinase gene. BMC Genomics 7, 198. Fiedorek FT, Jr., Kay ES (1995) Mapping of the focal adhesion kinase (Fadk) gene to mouse chromosome 15 and human chromosome 8. Mamm Genome 6, 123-126. Frisch SM (1999) Evidence for a function of death-receptorrelated, death-domain-containing proteins in anoikis. Curr Biol 9, 1047-1049. Frisch SM, Ruoslahti E (1997) Integrins and anoikis. Curr Opin Cell Biol 9, 701-706. Frisch SM, Screaton RA (2001) Anoikis mechanisms. Curr Opin Cell Biol 13, 555-562. Frisch SM, Vuori K, Ruoslahti E, Chan-Hui PY (1996) Control of adhesion-dependent cell survival by focal adhesion kinase. J Cell Biol 134, 793-799. Fujimoto J, Sawamoto K, Okabe M, Takagi Y, Tezuka T, Yoshikawa S, Ryo H, Okano H, Yamamoto T (1999) Cloning and characterization of Dfak56, a homolog of focal adhesion kinase, in Drosophila melanogaster. J Biol Chem 274, 29196-29201. Gabarra-Niecko V, Schaller MD, Dunty JM (2003) FAK regulates biological processes important for the pathogenesis of cancer. Cancer Metastasis Rev 22, 359-374. Garces CA, Kurenova EV, Golubovskaya VM, Cance WG (2006) Vascular endothelial growth factor receptor-3 and focal adhesion kinase bind and suppress apoptosis in breast cancer cells. Cancer Res 66, 1446-1454. Golubovskaya V, Beviglia L, Xu LH, Earp HS, III, Craven R, Cance W (2002) Dual inhibition of focal adhesion kinase and epidermal growth factor receptor pathways cooperatively induces death receptor-mediated apoptosis in human breast cancer cells. J Biol Chem 277, 38978-38987. Golubovskaya V, Kaur A, Cance W (2004) Cloning and characterization of the promoter region of human focal adhesion kinase gene: nuclear factor kB and p53 binding sites. Biochim Biophys Acta 1678, 111-125. Golubovskaya VM, Finch R, Cance WG (2005) Direct interaction of the N-terminal domain of focal adhesion kinase with the N-terminal transactivation domain of p53. J Biol Chem 280, 25008-25021.

Golubovskaya VM, Gross S, Kaur AS, Wilson RI, Xu LH, Yang XH, Cance WG (2003) Simultaneous inhibition of focal adhesion kinase and SRC enhances detachment and apoptosis in colon cancer cell lines. Mol Cancer Res 1, 755764. Golubovskaya VM, Nyberg C, Zheng M, Kweh F, Magis A, Ostrov D, Cance WG (2008a) A small molecule inhibitor, 1,2,4,5-benzenetetraamine tetrahydrochloride, targeting the y397 site of focal adhesion kinase decreases tumor growth. J Med Chem 51, 7405-7416. Golubovskaya VM, Virnig C, Cance WG (2008b) TAE226induced apoptosis in breast cancer cells with overexpressed Src or EGFR. Mol Carcinog 47, 222-234. Grigera PR, Jeffery ED, Martin KH, Shabanowitz J, Hunt DF, Parsons JT (2005) FAK phosphorylation sites mapped by mass spectrometry. J Cell Sci 118, 4931-4935. Hanada M, Tanaka K, Matsumoto Y, Nakatani F, Sakimura R, Matsunobu T, Li X, Okada T, Nakamura T, Takasaki M, Iwamoto Y (2005) Focal adhesion kinase is activated in invading fibrosarcoma cells and regulates metastasis. Clin Exp Metastasis 22, 485-494. Hanks SK, Polte TR (1997) Signaling through focal adhesion kinase. Bioessays 19, 137-145. Hanks SK, Ryzhova L, Shin NY, Brabek J (2003) Focal adhesion kinase signaling activities and their implications in the control of cell survival and motility. Front Biosci 8, d982d996. Hauck CR, Sieg DJ, Hsia DA, Loftus JC, Gaarde WA, Monia BP, Schlaepfer DD (2001) Inhibition of focal adhesion kinase expression or activity disrupts epidermal growth factor-stimulated signaling promoting the migration of invasive human carcinoma cells. Cancer Res 61, 7079-7090. Hayasaka H, Simon K, Hershey ED, Masumoto KH, Parsons JT (2005) FRNK, the autonomously expressed C-terminal region of focal adhesion kinase, is uniquely regulated in vascular smooth muscle: analysis of expression in transgenic mice. J Cell Biochem 95, 1248-1263. Hayashi I, Vuori K, Liddington RC (2002) The focal adhesion targeting (FAT) region of focal adhesion kinase is a fourhelix bundle that binds paxillin. Nat Struct Biol 9, 101-106. Hildebrand JD, Schaller MD, Parsons JT (1993) Identification of sequences required for the efficient localization of the focal adhesion kinase, pp125FAK, to cellular focal adhesions. J Cell Biol 123, 993-1005. Ilic D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T (1995) Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 377, 539-544. Jones G, Machado J, Jr., Merlo A (2001) Loss of focal adhesion kinase (FAK) inhibits epidermal growth factor receptordependent migration and induces aggregation of nh(2)terminal FAK in the nuclei of apoptotic glioblastoma cells. Cancer Res 61, 4978-4981. Jones G, Stewart G (2004) Nuclear import of N-terminal FAK by activation of the FcepsilonRI receptor in RBL-2H3 cells. Biochem Biophys Res Commun 314, 39-45. Judson PL, He X, Cance WG, Van LL (1999) Overexpression of focal adhesion kinase, a protein tyrosine kinase, in ovarian carcinoma. Cancer 86, 1551-1556. Kasahara T, Koguchi E, Funakoshi M, izu-Yokota E, Sonoda Y (2002) Antiapoptotic action of focal adhesion kinase (FAK) against ionizing radiation. Antioxid Redox Signal 4, 491499. Kim YM, Hwang S, Kim YM, Pyun BJ, Kim TY, Lee ST, Gho YS, Kwon YG (2002) Endostatin blocks vascular endothelial growth factor-mediated signaling via direct interaction with KDR/Flk-1. J Biol Chem 277, 27872-27879.

Hochwald and Golubovskaya: FAK and cancer therapy Kurenova E, Xu LH, Yang X, Baldwin AS, Jr., Craven RJ, Hanks SK, Liu ZG, Cance WG (2004) Focal adhesion kinase suppresses apoptosis by binding to the death domain of receptor-interacting protein. Mol Cell Biol 24, 4361-4371. Lark AL, Livasy CA, Dressler L, Moore DT, Millikan RC, Geradts J, Iacocca M, Cowan D, Little D, Craven RJ, Cance W (2005) High focal adhesion kinase expression in invasive breast carcinomas is associated with an aggressive phenotype. Mod Pathol 18, 1289-1294. Lev S, Moreno H, Martinez R, Canoll P, Peles E, Musacchio JM, Plowman GD, Rudy B, Schlessinger J (1995) Protein tyrosine kinase PYK2 involved in Ca(2+)-induced regulation of ion channel and MAP kinase functions. Nature 376, 737745. Lightfoot HM, Jr., Lark A, Livasy CA, Moore DT, Cowan D, Dressler L, Craven RJ, Cance WG (2004) Upregulation of focal adhesion kinase (FAK) expression in ductal carcinoma in situ (DCIS) is an early event in breast tumorigenesis. Breast Cancer Res Treat 88, 109-116. Liu TJ, LaFortune T, Honda T, Ohmori O, Hatakeyama S, Meyer T, Jackson D, de GJ, Yung WK (2007) Inhibition of both focal adhesion kinase and insulin-like growth factor-I receptor kinase suppresses glioma proliferation in vitro and in vivo. Mol Cancer Ther 6, 1357-1367. Liu W, Bloom DA, Cance WG, Kurenova EV, Golubovskaya VM, Hochwald SN (2008) FAK and IGF-IR interact to provide survival signals in human pancreatic adenocarcinoma cells. Carcinogenesis 29, 1096-1107. Lobo M, Zachary I (2000) Nuclear localization and apoptotic regulation of an amino-terminal domain focal adhesion kinase fragment in endothelial cells. Biochem Biophys Res Commun 276, 1068-1074. Matkowskyj KA, Keller K, Glover S, Kornberg L, Tran-Son-Tay R, Benya RV (2003) Expression of GRP and its receptor in well-differentiated colon cancer cells correlates with the presence of focal adhesion kinase phosphorylated at tyrosines 397 and 407. J Histochem Cytochem 51, 10411048. McLean GW, Carragher NO, Avizienyte E, Evans J, Brunton VG, Frame MC (2005) The role of focal-adhesion kinase in cancer - a new therapeutic opportunity. Nat Rev Cancer 5, 505-515. Mitra SK, Mikolon D, Molina JE, Hsia DA, Hanson DA, Chi A, Lim ST, Bernard-Trifilo JA, Ilic D, Stupack DG, Cheresh DA, Schlaepfer DD (2006) Intrinsic FAK activity and Y925 phosphorylation facilitate an angiogenic switch in tumors. Oncogene 25, 5969-5984. Nowakowski J, Cronin CN, McRee DE, Knuth MW, Nelson CG, Pavletich NP, Rogers J, Sang BC, Scheibe DN, Swanson RV, Thompson DA (2002) Structures of the cancer-related Aurora-A, FAK, and EphA2 protein kinases from nanovolume crystallography. Structure 10, 1659-1667. Owens LV, Xu L, Craven RJ, Dent GA, Weiner TM, Kornberg L, Liu ET, Cance WG (1995) Overexpression of the focal adhesion kinase (p125FAK) in invasive human tumors. Cancer Res 55, 2752-2755. Owens LV, Xu L, Dent GA, Yang X, Sturge GC, Craven RJ, Cance WG (1996) Focal adhesion kinase as a marker of invasive potential in differentiated human thyroid cancer. Ann Surg Oncol 3, 100-105. Park HB, Golubovskaya V, Xu L, Yang X, Lee JW, Scully S, Craven RJ, Cance WG (2004b) Activated Src increases adhesion, survival and alpha2-integrin expression in human breast cancer cells. Biochem J 378, 559-567. Park HB, Golubovskaya V, Xu L, Yang X, Lee JW, Scully S, Craven RJ, Cance WG (2004a) Activated Src increases adhesion, survival and alpha2-integrin expression in human breast cancer cells. Biochem J 378, 559-567.

Parsons JT (2003) Focal adhesion kinase: the first ten years. J Cell Sci 116, 1409-1416. Parsons JT, Slack-Davis J, Tilghman R, Roberts WG (2008) Focal adhesion kinase: targeting adhesion signaling pathways for therapeutic intervention. Clin Cancer Res 14, 627-632. Prutzman KC, Gao G, King ML, Iyer VV, Mueller GA, Schaller MD, Campbell SL (2004) The focal adhesion targeting domain of focal adhesion kinase contains a hinge region that modulates tyrosine 926 phosphorylation. Structure 12, 881891. Reiske HR, Kao SC, Cary LA, Guan JL, Lai JF, Chen HC (1999) Requirement of phosphatidylinositol 3-kinase in focal adhesion kinase-promoted cell migration. J Biol Chem 274, 12361-12366. Richardson A, Parsons JT (1995) Signal transduction through integrins: a central role for focal adhesion kinase? Bioessays 17, 229-236. Roberts WG, Ung E, Whalen P, Cooper B, Hulford C, Autry C, Richter D, Emerson E, Lin J, Kath J, Coleman K, Yao L, Martinez-Alsina L, Lorenzen M, Berliner M, Luzzio M, Patel N, Schmitt E, LaGreca S, Jani J, Wessel M, Marr E, Griffor M, Vajdos F (2008) Antitumor activity and pharmacology of a selective focal adhesion kinase inhibitor, PF-562,271. Cancer Res 68, 1935-1944. Sasaki H, Nagura K, Ishino M, Tobioka H, Kotani K, Sasaki T (1995) Cloning and characterization of cell adhesion kinase beta, a novel protein-tyrosine kinase of the focal adhesion kinase subfamily. J Biol Chem 270, 21206-21219. Schaller MD (2001) Biochemical signals and biological responses elicited by the focal adhesion kinase. Biochim Biophys Acta 1540, 1-21. Schaller MD, Borgman CA, Cobb BS, Vines RR, Reynolds AB, Parsons JT (1992) pp125FAK a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proc Natl Acad Sci U S A 89, 5192-5196. Schaller MD, Hildebrand JD, Parsons JT (1999) Complex formation with focal adhesion kinase: A mechanism to regulate activity and subcellular localization of Src kinases. Mol Biol Cell 10, 3489-3505. Schaller MD, Hildebrand JD, Shannon JD, Fox JW, Vines RR, Parsons JT (1994) Autophosphorylation of the focal adhesion kinase, pp125FAK, directs SH2-dependent binding of pp60src. Mol Cell Biol 14, 1680-1688. Schaller MD, Otey CA, Hildebrand JD, Parsons JT (1995) Focal adhesion kinase and paxillin bind to peptides mimicking beta integrin cytoplasmic domains. J Cell Biol 130, 1181-1187. Schaller MD, Parsons JT (1994) Focal adhesion kinase and associated proteins. Curr Opin Cell Biol 6, 705-710. Schlaepfer DD, Mitra SK (2004) Multiple connections link FAK to cell motility and invasion. Curr Opin Genet Dev 14, 92101. Shi Q, Hjelmeland AB, Keir ST, Song L, Wickman S, Jackson D, Ohmori O, Bigner DD, Friedman HS, Rich JN (2007) A novel low-molecular weight inhibitor of focal adhesion kinase, TAE226, inhibits glioma growth. Mol Carcinog 46, 488-496. Sieg DJ, Hauck CR, Ilic D, Klingbeil CK, Schaefer E, Damsky CH, Schlaepfer DD (2000) FAK integrates growth-factor and integrin signals to promote cell migration. Nat Cell Biol 2, 249-256. Sieg DJ, Hauck CR, Schlaepfer DD (1999) Required role of focal adhesion kinase (FAK) for integrin-stimulated cell migration. J Cell Sci 112 ( Pt 16), 2677-2691. Siu ll, Burris HA, Mileshkin L, Camidge DR, Rishchin D, Chen EX, Jones S, Tin D, Fingert H (2008) Journal of Clinical Oncology, 2007 ASCO Annual Meeting Proceedings Part 1. J Clin Oncol 25, 3527.

Gene Therapy and Molecular Biology Vol 13, page 35 Smith CS, Golubovskaya VM, Peck E, Xu LH, Monia BP, Yang X, Cance WG (2005) Effect of focal adhesion kinase (FAK) downregulation with FAK antisense oligonucleotides and 5fluorouracil on the viability of melanoma cell lines. Melanoma Res 15, 357-362. Sonoda Y, Matsumoto Y, Funakoshi M, Yamamoto D, Hanks SK, Kasahara T (2000) Anti-apoptotic role of focal adhesion kinase (FAK). Induction of inhibitor-of-apoptosis proteins and apoptosis suppression by the overexpression of FAK in a human leukemic cell line, HL-60. J Biol Chem 275, 1630916315. Stewart A, Ham C, Zachary I (2002) The focal adhesion kinase amino-terminal domain localises to nuclei and intercellular junctions in HEK 293 and MDCK cells independently of tyrosine 397 and the carboxy-terminal domain. Biochem Biophys Res Commun 299, 62-73. Takahashi N, Seko Y, Noiri E, Tobe K, Kadowaki T, Sabe H, Yazaki Y (1999) Vascular endothelial growth factor induces activation and subcellular translocation of focal adhesion kinase (p125FAK) in cultured rat cardiac myocytes. Circ Res 84, 1194-1202. Tamura M, Gu J, Danen EH, Takino T, Miyamoto S, Yamada KM (1999) PTEN interactions with focal adhesion kinase and suppression of the extracellular matrix-dependent phosphatidylinositol 3-kinase/Akt cell survival pathway. J Biol Chem 274, 20693-20703. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM (1998) Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280, 16141617. Tilghman RW, Slack-Davis JK, Sergina N, Martin KH, Iwanicki M, Hershey ED, Beggs HE, Reichardt LF, Parsons JT (2005) Focal adhesion kinase is required for the spatial organization of the leading edge in migrating cells. J Cell Sci 118, 26132623. van de WB, Houtepen F, Huigsloot M, Tijdens IB (2001) Suppression of chemically induced apoptosis but not necrosis of renal proximal tubular epithelial (LLC-PK1) cells by focal adhesion kinase (FAK). Role of FAK in maintaining focal adhesion organization after acute renal cell injury. J Biol Chem 276, 36183-36193. Venables JP (2006) Unbalanced alternative splicing and its significance in cancer. Bioessays 28, 378-386. Watanabe N, Takaoka M, Sakurama K, Tomono Y, Hatakeyama S, Ohmori O, Motoki T, Shirakawa Y, Yamatsuji T, Haisa M, Matsuoka J, Beer DG, Nagatsuka H, Tanaka N, Naomoto Y (2008) Dual tyrosine kinase inhibitor for focal adhesion kinase and insulin-like growth factor-I receptor exhibits anticancer effect in esophageal adenocarcinoma in vitro and in vivo. Clin Cancer Res 14, 4631-4639.

Weiner TM, Liu ET, Craven RJ, Cance WG (1993) Expression of focal adhesion kinase gene and invasive cancer. Lancet 342, 1024-1025. Whitney GS, Chan PY, Blake J, Cosand WL, Neubauer MG, Aruffo A, Kanner SB (1993) Human T and B lymphocytes express a structurally conserved focal adhesion kinase, pp125FAK. DNA Cell Biol 12, 823-830. Windham TC, Parikh NU, Siwak DR, Summy JM, McConkey DJ, Kraker AJ, Gallick GE (2002) Src activation regulates anoikis in human colon tumor cell lines. Oncogene 21, 77977807. Xu LH, Owens LV, Sturge GC, Yang X, Liu ET, Craven RJ, Cance WG (1996) Attenuation of the expression of the focal adhesion kinase induces apoptosis in tumor cells. Cell Growth Differ 7, 413-418. Xu LH, Yang X, Bradham CA, Brenner DA, Baldwin AS, Jr., Craven RJ, Cance WG (2000) The focal adhesion kinase suppresses transformation-associated, anchorageindependent apoptosis in human breast cancer cells. Involvement of death receptor-related signaling pathways. J Biol Chem 275, 30597-30604. Xu LH, Yang X, Craven RJ, Cance WG (1998) The COOHterminal domain of the focal adhesion kinase induces loss of adhesion and cell death in human tumor cells. Cell Growth Differ 9, 999-1005. Yeo MG, Partridge MA, Ezratty EJ, Shen Q, Gundersen GG, Marcantonio EE (2006) Src SH2 arginine 175 is required for cell motility: specific focal adhesion kinase targeting and focal adhesion assembly function. Mol Cell Biol 26, 43994409. Zhang X, Wright CV, Hanks SK (1995) Cloning of a Xenopus laevis cDNA encoding focal adhesion kinase (FAK) and expression during early development. Gene 160, 219-222.

Steven N. Hochwald and Vita M. Golubovskaya

Gene Therapy and Molecular Biology Vol 13, page 36 Gene Ther Mol Biol Vol 13, 36-52, 2009

Combination of immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours Review Article

Jian Xu1, Xiao Song Liu 2*, Shu-Feng Zhou3, Ming Q Wei1* 1

Division of Molecular and Gene Therapies, Griffith Institute for Health and Medical research, School of Medical Science, Griffith University, Gold Coast campus, Southport, Queensland 4215 2 Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, Princess Alexandra Hospital, Wollongabba, Queensland 410 3 School of Health Sciences, RMIT, Victoria 3083, Australia *Correspondence: A/Prof Ming Q Wei, Director of Division of Molecular and Gene Therapies, Griffith Institute for Health and Medical research, School of Medical Science, Griffith University, Gold Coast campus, Qld 4215, Australia. Tel: 617 5678 0745; Mobile: 61 422888780; Email: m.wei@Griffith.edu.au Dr Xiao Song Liu, Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, Princess Alexandra, Hospital, Wollongabba, Qld 4102, Australia, Email: X.liu1@uq.edu.au Key words: Tumour microenvironment, Immunotherapy, Anaerobic bacteria, Hypoxia, Clostridial spores Received: 16 December 2009; Revised 2009; Accepted: 14 April 2009; electronically published: 22 April 2009

Summary Solid tumours possess unique microenvironment characterised by defective vessels, heterogeneous tumour cell, hypoxic regions, and anaerobic metabolisms. These often become intrinsic and acquired barriers to current therapeutical approaches, but they also create an ideal condition for the growth of anaerobic bacteria, which have shown specificity in their germination and multiplication. Spores from the strictly anaerobic clostridial had demonstrated ability in tumour specific colonisation and induction of tumour lysis following intravenous delivery. Clostridial strains genetically modified to act as â&#x20AC;&#x153;Trojan horseâ&#x20AC;? gene therapy vectors have been developed. Similarly, recent development in immunotherapy strategies for cancer also utilizes gene transfer to facilitate a dormant host immune response directed against the tumour. Combination of anaerobic bacteria for cancer gene therapies with immunotherapy will probably be the most promising approach that can potentially generate a prolonged anti-tumour effect beyond the immediate treatment period of gene therapy, allowing for treatment of advanced primary tumours and disseminated disease. In this review, we introduce the recent understanding of tumour microenvironment and detail the advances in the use of anaerobic bacteria for cancer gene therapies and recent studies in immuno therapy for cancers. We believe that the use of combined treatment modalities of such will provide a rational paradigm to improve upon the clinical efficacy of cancer therapy. in developing countries where diagnostic facilities are suboptimal. Conventional therapies include surgical operation, radiation and chemotherapy. Single or a combination of methods may be used, depending on various factors such as the type and location of the cancer. Unfortunately, current cancer treatments are limited to effect. Furthermore they also cause severe side effects. The search for new cancer therapies is one of the most pressing tasks of medical science. Cancer development results from constant battle between tumour cells and host defence system. Once it establish by itself. Its microenvironments are hostile to therapeutic including immunotherapy as well as gene

I. Introduction Cancer is one of the major health problems of mankind, accounting for 7.6 million of death worldwide. Cancer mortality is expected to increase further, with an estimated 9 million people dying from cancer in 2015. This figure will rise to 11.4 million in 2030 (WHO 2006) (Cho, 2007). Of all cancer diagnosed, 90% of these are solid tumours. As they do not have particular noticeable symptom or signs for early detection, a significant percentage of the patients with newly diagnosed disease have regional or advanced, inoperable disease, especially

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours therapy. In this paper, we review current understanding of tumour microenvironments and recent advances in therapy of solid tumour and explore potential combinations of immunization and anaerobic bacteria for cancer management.

tumour vessels leaky, although their permeability varies both within and among tumours.

C. Tumour hypoxia and acidity Most solid tumours contain regions of hypoxia (Wu et al, 2006). The limited vasculature of tumours results in insufficient blood supply and chronic or diffusion-limited hypoxia. Tumour cells in hypoxic regions may be viable, but they are often adjacent to regions of necrosis. Tumour cells in regions proximal to blood vessels can migrate into hypoxic areas and become necrotic, presumably because of nutrient deprivation. If cells close to blood vessels are killed by treatment, the nutrient supply to previously hypoxic cells may improve, allowing those cells to survive and regenerate the tumour (Trédan et al, 2007). Transient hypoxia is also common in tumours and results from the temporary shutdown of blood vessels. Hypoxic regions of tumours are likely to have a decreased supply of nutrients such as glucose and essential amino acids (Pouysségur et al, 2006). The presence of hypoxia in tumours is known to lead to the activation of genes associated with angiogenesis and cell survival that is mediated by the transcription factor hypoxia-inducible factor 1(Bos R et al, 2004). Expression of these genes may result in the expansion of populations of cells with altered biochemical pathways that may have a drug-resistant phenotype. Transient hypoxia has been reported to cause amplification and increased expression of the genes encoding Pglycoprotein and dihydrofolate reductase, which induce drug resistance to substrates of P-glycoprotein and to folate antagonists, respectively. Transient hypoxia that is associated with glucose deprivation can also disrupt protein folding in the endoplasmic reticulum; this effect may confer resistance to topoisomerase II–targeted drugs and enhance P-glycoprotein expression and multidrug resistance (Chen et al, 2003). The pH in the tumour microenvironment can influence the cytotoxicity of anticancer drugs (Philip et al, 2005). Molecules diffuse passively across the cell membrane most efficiently in the uncharged form. The extracellular pH in tumours is low and the intracellular pH of tumour cells is neutral to alkaline, weakly basic drugs that have an acid dissociation constant of 7.5–9.5 are protonated and display decreased cellular uptake. Alkalinization of the extracellular environment enhances the uptake and cytotoxicity of some of these drugs (Trédan et al, 2007). By contrast, weakly acidic drugs concentrate some in the relatively neutral intracellular space. The acidic microenvironment may also inhibit active transport of some drugs (Mahoney et al, 2003).

II. The unique microenvironment of solid tumours A. Overview All solid tumours, when they grow more than 2 mm diameter in size, undergo angiogenesis that results in biological changes and adaptive metabolisms, i.e.: formation of defective vessels, appearance of hypoxic areas, and emergence of heterogeneous tumour cell population. Thus, solid tumours are organ-like structures that are heterogeneous and structurally complex, consisting cancer cells and stromal cells (i.e., fibroblasts and inflammatory cells) that are embedded in an extracellular matrix and nourished by a vascular network; each of these components may vary from one location to another in the same tumour. Compared with normal tissues, the tumour stroma is associated with an altered extracellular matrix and an increased number of stromal that synthesize growth factors, chemokines, and adhesion molecules (Aznavoorian et al, 1990). The extracellular matrix can vary greatly among tumours, both in amount and in composition (Ohtani, 1998). Also the tumour stroma can influence malignant transformation (Tlsty 2001) plays an important role in the ability of tumours to invade and metastasize, and affects the sensitivity of tumour cells to drug treatment. The amount composition and structure of stromal components in tumours also contribute to an increase in interstitial fluid pressure, which hinders the penetration of macromolecules through tissue (Croker, 2008). Also, the three-dimensional structure of tissue itself can influence the sensitivity of constituent cells to both radiation and chemotherapy (Shicang 2007).

B. Tumour vasculature and blood flow Solid tumours at advanced stages have abnormal vasculature, which influences the sensitivity of the tumour to therapies. Anticancer drugs gain access to tumours via the blood and limited supply of nutrients in tumours leads to metabolic changes (including hypoxia) and gradients of cell proliferation that influence drug sensitivity (Tatum et al, 2006). Also, blood vessels in tumours are often dilated and convoluted. Compared with normal tissues, tumour blood vessels have branching patterns that feature excessive loops and arteriolar–venous shunts, in some tumours they are not organized into arterioles, capillaries, and venules but instead share features of all of these structures. The walls of tumour vessels may have fenestrations, discontinuous or absent basement membranes that may lack perivascular smooth muscle (Hallmann et al, 2005) and fewer pericytes than walls of normal vessels. In addition, cancer cells may be integrated into the vessel wall. These abnormalities tend to make

D. Tumour immunosuppression During the constant battle between tumour and immune system, tumour cells developed multiple ways to fight back the immune system.

Gene Therapy and Molecular Biology Vol 13, page 38 (Petrulio et al, 2006). It is not clear whether the T regulatory cells were boosted from existing T regulatory cells or vaccine induced. However, immunotherapy has shown to amplify tumour specific T regulatory cells, thus impede effective immunotherapy in a mouse tumour model (Reilly et al, 2000); moreover, similar results were also observed clinically. Patients with resected HPV16-positive cervical cancer were vaccinated with an overlapping set of long peptides comprising the sequences of the HPV16 E6 and E7 oncoproteins emulsified in Montanide ISA-51. The vaccine-induced responses were dominated by effector type CD4(+)CD25(+)Foxp3(-) type 1 cytokine IFN gamma-producing T cells but also included the expansion of T cells with a CD4(+)CD25(+)Foxp3(+) phenotype (Welters et al, 2008).

1. Avoidance of effectors T cell killing One of well-established strategies is down regulation of antigen presentation by tumour cells, especially through MHC class I restricted antigen presentation pathway. Tumour cells can down regulation, even loss of MHC class I molecules on their cell surface (Frey, 2006), mutation of proteins associated with this pathway, such as TAP and LMP2 and LMP7. Tumour or stromal cells also secrete factors that damp immune responses. TGF (tumour growth factor), IL10 are two cytokines with immune suppressive functions usually found with high levels within tumour. TGF levels are associated with poor prognoses of cancers including prostate, gastric and bladder carcinoma (Biswas et al, 2007). TGF inhibits T cell activation and differention of cytotoxic T cells and promotes NKT cells mediated inhibition of CTL responses together with IL-13 (Biswas et al, 2007). IL-10 down regulates antigen presentation by dendritic cells and promotes the generation of Tr1 regulatory T cell generation (Suciu-Foca et al, 2003) and Inhibit CTL response in antigen-experienced host (Tamada et al, 2002). High levels of prostaglandin E2 (PGE2) have been shown in colorectal, lung and bladder cancer (Akasaki et al, 2006). It has been demonstrated that PGE2 promotes the generation of IL-10 secreting CD4 T cells through the induction of IL-10 secreting dendritic cells (Cools et al, 2007). Different tumour types have also been expressed PDL1, an immune suppressive molecule. Tissue histology study showed that freshly isolated carcinomas of human lung, ovarian, colon, melanoma, head and neck cancers, and breast cancers can express PD-L123. PD-L1 a suppressive molecule, engagement of PD-L1 with PD-1 of effector T cells causes T cell apoptosis (Yang et al, 2008). B7-H1 positive melanoma cells were also more resistant to specific CTL, while nearly all B7-H1 negative tumour cells were eliminated in the cultures (Dong and Chen, 2003), these results suggest that expression of suppressive molecule is another strategy used by tumour cells to avoid from killing by effector cells.

3. Abnormal antigen presentation cells Antigen presentation cells include dendritic cells (DC), macropaghes and B cells. Matured DCs play key roles for the priming of naive T cells, including CD8+ T cells, which is critical for the killing of tumour cells. Tumour microenvironments usually have less functional competent matured but more immature DCs, which can not effectively activate T cells. Furthermore, it has been reported that in tumour tissues, there are subset of DCs that suppress T cell function. This T cell suppression has been shown in cancer patients as well as animal tumour models. Immune cells in the tumour microenvironment are dysfunctional, generally fail to control tumour growth and may even promote its progression. Molecular mechanisms responsible for tumour-induced local and systemic immune suppression are currently under intense discussed. It appears that tumours can deregulate recruitment, effector functions and survival of immune cells, interfering with all stages of antitumour response. Suppressive mechanisms targeting key signalling pathways in immune cells have been identified. Strategies for reversal of tumour-mediated immunsuppression are being developed. Confirmation of multiple and varied mechanisms used by tumours to escape immune surveillance is crucial for the future design in antitumour therapies.

2. Regulation of immunoresponses by regulatory T cells Regulatory T cells are groups of T cells that regulatory immune response, different compartments of T regulatory cells including CD4+, CD8+ and NKT cells have been identified. CD4+CD25+ Foxp3+ thymus derived T regulatory cells and antigen induced IL-10 secreting CD4 T cells are the 2 main types identified. NKT cells have also been shown to have regulatory function during tumour development (Berzofsky et al, 2008). However, the number of T regulatory cells with human ovary cancer is related to poor prognosis of cancer (Koido et al, 2005). Also, it has been shown that myeloma cells promote the generation of IL-10 secreting Tr1 T cells (Battaglia et al, 2006). Tr1 cells can be isolated from tumour infiltrating lymphocytes in B16 tumour model (Seo et al, 2001). Human bladder cancer tissues contain high number of Foxp3+ cells and mRNA level of IL-10

III. Current cancer gene therapy and immunotherapy approaches A. Current development in gene therapy of solid tumour Cancer is, at present, the disease most frequently targeted by gene therapy because its promise of potential for selective potency. To achieve this aim, cancer gene therapy strategies attempt to exploit the biological uniqueness of each particular tumour. Cancer gene therapy may be defined as the transfer of recombinant DNA into human cells to achieve an anti-tumour effect. Gene therapy will have a major impact on the healthcare of our

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours population only when vectors are developed that can safely and efficiently be injected directly into patients as drugs. One of the most strategies of vector development is that of non-viral vectors, which consist of liposomes, molecular conjugates, and naked DNA delivered by mechanical methods. The modifying viral vectors should be focused to reduce toxicity and immunogenic, increasing the transduction efficiency of non-viral vectors, enhancing vector targeting and specificity, regulating gene expression, and identifying synergies between gene-based agents and other cancer therapeutics. A universal gene delivery system has yet to be identified, but the further optimization of each of these vectors should result in each having a unique application.

expression. In preliminary experiments, this vector was able to transfect ovarian cancer cells isolated from ascites fluid, and confer tumour-specific expression of betagalactosidase. This method creates the possibility of targeting expression of certain genes in specific tissues

3. Herpes simplex virus thymidine kinase gene To broaden the effect of gene therapy, vectors employing both the thymidine kinase gene and the genes for immunomodulatory cytokines such as IL-2 or granulocyte-macrophage colony-stimulating factor (GMCSF) have been developed (Iwadate et al, 1997). In mice, injection of these vectors into tumours and treatment with ganciclovir had both a direct anti-tumour effect in the liver, as well as a systemic effect in generating tumourspecific immune responses. As a result, these mice are resistant to subsequent tumour challenge. This system establishes the principle that localized gene therapy might ultimately have systemic protective or therapeutic effect by stimulating immune mechanisms which can act throughout the organism. A phase I trial for patients that would include treatment with a thymidine kinase and cytokine (IL-2) vector is being planned. The principle endpoint of the study will be the determination of an antitumour immune response.

1. Pro-Drug activation vectors Several experimental models relying on pro-drug activation vectors (Kanai et al, 2008). One such a model involves local injection of gene therapy vectors into tumour sites. This model may benefit from the so-called "bystander effect," a reflection of the biological observation that pro-drug activation to 5-fluorocysteine (5FU) releases this chemotherapeutic not just in the tumour cells, but in the surrounding cell environment as well. In fact, using in vitro systems, it has been found that only 5% of tumour cells need to be infected by the delivery vector for anti-tumour effect to be seen throughout the whole tumour cell population. An adenovirus vector expressing the cytosine deaminase enzyme will be injected into the prostate bed using similar techniques as those now used for radiation implants. These patients will then be given the pro-drug, which in principle will be activated to 5-FU in the prostate gland. This should allow localized cytotoxic therapy to the prostate and possible synergistic benefit between 5-FU and the concurrent radiation therapy. The other model system, which is used in clinical trials, deals with autologous transplantation for metastatic breast cancer. In this system, harvested bone marrow is exposed to the viral vector, which infects the epithelial tumour cells efficiently, but normal marrow stem cells less efficiently. After intensive chemotherapy, patients are then given this modified marrow population. Once engrafted, patients are treated with the pro-drug 5-FC, which in principle should be toxic only to the infected tumour cells. This trial is open to women with known marrow involvement by tumour cells, and who are therefore not candidates for standard high-dose therapy.

4. Dendritic cells as targets for cancer gene therapy DCs are the most potent APCs in the immune system and are central to the success of these genetically engineered tumour vaccine strategies. Activated DCs can present prostate tumour vaccine-associated antigens; they have processed to both CD4 (helper) and CD8 (cytolytic) T cells in the draining lymph node of the vaccination sites, activating a systemic tumouricidal immune response. The possibility of obtaining large numbers of DCs in vitro has boosted research on their ontogeny and functions. The unique ability of DCs to take up, process, and present antigens, and to activate naive CD4+ and CD8+ T cells, makes them appropriate candidates for the immunotherapeutic approach. In a mouse model, DCs are harvested and then transfected with adenoviral vectors. These vectors expressed a foreign protein, beta-galactosidase. The dendritic cells were then injected into mice, and served to prime an immune response against that protein. This ex vivo gene therapy has many potential human applications. Three major myeloid DC populations have been identified in vivo: (1) epidermal Langerhansâ&#x20AC;&#x2122; cells (LC); (2) interstitial (or dermal) immature DC; and (3) mature interdigitating DC, found in secondary lymphoid organs. In the early stages of DC research, the limited accessibility of these cells in vivo as well as their difficult ex vivo culture hampered attempts to study this particular cell type in more detail. In the 1990s, this problem was solved by the efforts of various research teams which revealed the hematopoietic lineages through which DC differentiate, and established in vitro expansion protocols to obtain

2. Tumour-specific gene promoters The L-plastin gene (Akbulut et al, 2003), as another means of conferring tumour-specific expression which encodes an actin-binding protein, show the new vector model with a tumour specific gene promoter. The estrogen-dependent tissues such as ovary and breast were selectively expressed in ovarian and breast cancer. The promoter for this gene is added to the adenoviral vector, and a reporter enzyme, such as beta-galactosidase, is linked to the promoter to allow for assessment of 39

Gene Therapy and Molecular Biology Vol 13, page 40 sufficient quantities of DC for clinical use (Caux et al, 1992; Sallusto, 1994). The unique ability of DC to stimulate primary immune responses stems from several factors. The immature DC type uses elegant systems, including macropinocytosis, mannose receptor-mediated uptake, Fcg receptor III (FcgRIII)-mediated uptake and phagocytosis to efficiently take up exogenous antigens, either self or non-self, from the periphery (Steinman et al, 1999). After antigen capture, DC leaves the peripheral tissue and migrates via blood or lymphatic vessels to the draining lymph nodes where they activate T cells Given their central role in controlling immunity and their link with the innate immune system, DC are often called natureâ&#x20AC;&#x2122;s adjuvant. Therefore, DC is logical targets for immunotherapy of cancer. The fact that tumours do not elicit a therapeutic T cell response may be due to the absence of competent DC at the tumour site.

To establish efficient and safe gene delivery in vivo, a number of new techniques and concepts have been introduced with improvements in targeted or controlled delivery of genes. But we have come a long way in understanding the cellular barriers which prevent proper delivery of DNA or viral vectors. Cancer gene therapy has still a long way to go in the basic and clinical sciences.

C. Anaerobic bacteria for cancer treatment Interest in microbe-based approaches to cancer therapy has recently re-emerged with the development of methods to genetically engineer bacteria, reducing their toxicity and arming them with genes encoding pro drugmetabolizing enzymes.

1. Anaerobic bacteria as tumour target vector

B. Cancer gene therapy existing problems Currently, there are many different approaches to fight cancer with gene therapy. Morgan et al report has revealed encouraging results for the use of gene therapy as a treatment for cancer (Morgan et al, 2006). However; two principal obstacles continue to limit further advances in gene therapy. The first is a technical problem, the development of an appropriate delivery system -- a reliable, safe, and effective means for introducing genetic material into the target cells or tissues. The second problem is a biological one -- developing an understanding of the molecular basis underlying cancer in order to determine where single alterations in genetic expression might allow effective anti-cancer therapy. In viral vector, the efficiency of transduction is not sufficient for therapeutic measures (Marina et al, 2003). One important parameter is whether the genetic alteration has to be lasting or temporary (stable or transient transfection). Of overall importance is the question of biological safety, which means that the vector itself does not create a novel threat to the patient's health. The key to a successful gene therapy is the vector system. Various vectors have been developed with unique features, including viral and nonviral based therapy systems (Wagner, 2007). However, due to the complex nature of cancers, these vectors suffer from several deficiencies: firstly the majority of vectors currently in use require intratumoural injection to elicit an effect, far from ideal as many tumours are inaccessible and spread to other areas of the body making them difficult to locate and treat. Second, most vectors do not have the capacity to efficiently enter and kill every tumour cell. The emerging challenges of cancer gene therapy: i) which better route of administration is best for improving gene delivery; iii) optimizing new vector best suited to the target type of tissue and reducing toxicity, Although as with many gene-therapy approaches, considerable barriers will need to be overcome to make the technique more reliable and widely applicable - achieving long-term expression of therapeutic genes is a particular problem these results are nevertheless a heartening 'proof-ofprinciple' demonstration of the potential power of gene therapy to combat cancers.

The unique solid tumour micro-milieu, though, provides a haven for anaerobic bacteria. Anaerobic and facultative anaerobes tested so far fell into three classes. (1) the lactic acid, Gram-positive anaerobic bacteria; (2) the intracellular, Gram-negative facultative anaerobes, and (3) the strictly anaerobic, Gram-positive saccharolytic/ proteolytic Clostridia. At the molecular level, bacterial infections like those of Clostridia novyi (C. novyi) are associated with the release of pathogen-associated molecular patterns (PAMPs) from bacteria and Hsp70 from necrotic cells (Gelman, 2003). Hsp70 induces maturation of DCs, professional antigen-presenting cells that are essential for the production of potent immune responses. PAMPs interact with Toll-like receptors, leading to up-regulation of costimulatory molecules such as CD40 and proinflammatory cytokines such as IL-12. These in turn induce the production of IFN-! and initiate a Th1-dependent cell-mediated response, primarily affected by CD8+ cytolytic T cells (Kay, 2001). The demonstration that CD8+ T cells from C. novyi-NT-cured mice can confer adoptive immunity in a tumour-specific fashion is consistent. Clostridium is strictly anaerobic, sporulating Grampositive bacteria. This genus is one of the largest genera comprising of about 80 species. Up to 10 species of Clostridia have been studied and as strictly anaerobic bacteria they all require an anaerobic environment to grow but their oxygen tolerance and biochemical profile varies considerably among different species. Clostridial spores had been used to induce tumour lysis following intravenous delivery and shown a distinct advantage over Bifidobacterium and Salmonella in terms of easy production, hardy storage and impressive oncolytic effects. Both proteolytic and saccharolytic Clostridia have been tested for cancer therapy. When C. novyi-NT spores are injected intravenously into immunodeficient mice bearing human xenografts, the spores quickly germinate within necrotic regions of the tumours. Hypoxic and necrotic regions are generally localized within the central parts of tumours, with well-perfused tumour cells occupying the rim. Because of the exquisite sensitivity of 40

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours C. novyi-NT to oxygen (Dang et al, 2001), bacterial germination and spread halt when the bacteria reach the well oxygenated rim. It was shown that conventional chemotherapy and radiation therapy could be used to destroy the well oxygenated cells in this rim, and that the combination of C. novyi-NT provided substantial antitumour activity in several xenograft models.

when delivered systemically and has resulted in high percentage of "cures" of experimental tumours. A phase I clinical trial combining spores of a non-toxic strain (C. novyi-NT) with an antimicrotubuli agent has been initiated. The recombinant DNA technology reignited the field, enabling genetic improvement of Clostridia’s innate oncolytic capability. It provides a possible alternative to overcome the hitch of using wild type strains Anaerobic bacteria, such as Clostridia have now been convincingly shown to selectively colonise and regerminate in the hypoxic/necrotic regions of solid tumours and can be delivered systemically. Furthermore, existing plasmidbased gene modification strategy harbours several safety concerns regarding possible horizontal plasmid transfer and spread of plasmid-associated antibiotic resistant genes.

2. Anaerobic bacteria and immune response C. novyi is well known for its capacity to induce massive leukocytosis and inflammation (Agrawal et al, 2004), whereas many other species of Clostridia do not induce this level of response. The inflammatory reaction is classic in many ways, including the observed increase in neutrophil-directed cytokines in serum and the cellular nature and time course of the infiltrate. The antitumour effects of inflammation are well documented. Systemically administered C. novyi-NT spores are distributed throughout the body, but due to their strict anaerobic growth requirements, germinate only within anoxic or markedly hypoxic regions of tumours. Once germinated, the bacteria destroy adjacent cancer cells through the secretion of lipases, proteases, and other degradative enzymes. At the same time, the host reacts to this localized infection, producing cytokines such as IL-6, MIP-2, GCSF, TIMP-1, and KC that attract a massive influx of inflammatory cells, initiated largely by neutrophils and followed within a few days by monocyte and lymphocyte infiltration. The inflammatory reaction restrains the spread of the bacterial infection, providing a second layer of control in addition to that provided by the requisite anaerobic environment. The inflammation may also directly contribute to the destruction of tumour cells through the production of reactive oxygen species, proteases, and other degradative enzymes. Moreover, it stimulates a potent cellular immune response that can subsequently destroy residual tumour cells not lysed by the bacteria. The cure rate is determined by the balance between bacteriolysis, angiogenesis, regrowth of residual tumour cells, and the rate of development of the immune response. During these years, bacteriological research on tumour associated anaerobic spore forming bacteria has accumulated a considerable amount of information and a variety of new concepts in experimental and clinical oncology (Agrawal et al, 2004). Of great importance was the systematic elucidation, which convincingly demonstrated that the growth of anaerobes can be strictly interconnected with tumour growth. A whole series of experimental studies have been performed to elucidate the mechanisms which governed the selective, temporarily unrestricted clostridial growth and which formed the basis for the liquefaction of tumour tissue. Since tumour lysis with Clostridium oncolyticum spores is incomplete and, possibly, subject to non-specific systemic incompatibility [‘acute tumour lysis syndrome’]. Clostridia became significant in pursuing the concept of engineered Clostridia to produce anti-cancer drugs (Jennifer et al, 2006). The strictly anaerobic clostridia, on the other hand, have been shown to selectively colonise in solid tumours

IV. Current approaches for immunotherapy of cancer A. Overview The aim of cancer immunotherapy is to activate patient’s immune system to eradiate tumour cells. It was expected that when appropriately primed, the activated host immune cells, especially tumour antigen specific CD4+ and CD8+ T cells, can specifically kill tumour cells. Tumour antigens are usually self antigens, both central and peripheral tolerance apply to tumour antigens. Central tolerance occurs in the thymus, T cells with strong self reactivity are eliminated. Peripheral tolerance make tumour specific T cells anergy or suppressive. Cancer vaccine will activate T cells purged of strong activity and influenced by different peripheral tolerance mechanisms. Different approaches have been employed to overcome the tolerance, in order to achieve better T cell responses, including immunization with different routs and with different adjuvant, providing co-stimulating signals while inhibiting signals such as CTLA-4. Neutralizing IL-10 at the same time of immunization has been show to generate better CTL response in antigen experienced host, which is important for cancer immunotherapy; as patients with cancer are tumour antigens experienced.

B. Combining immunostimulation with gene-silencing by siRNA The innate immune system recognizes pathogens by means of germ line-encoded pattern recognition receptors (PRRs) (Gro F, 2006). A subfamily of PRRs is the Tolllike receptors (TLRs), which is important for initiation of an immune response. siRNAs can activate innate immunity through the activation of Toll-like receptor (Sioud et al, 2007). These findings suggest potential prophylactic and therapeutic use of immunostimulatory siRNAs as adjuvant. In addition, to immune stimulation, gene-silencing through RNAi is another potency of immunostimulatory siRNAs. RNAi is a widely conserved post-transcriptional gene-silencing mechanism where

Gene Therapy and Molecular Biology Vol 13, page 42 double-stranded (ds) RNAs trigger the degradation of homologous mRNA sequences and certain siRNA sequences can activate immune cells to secrete proinflammatory cytokines and type I interferons in immune cells. As a consequence of these findings any therapeutic siRNA should be tested in human blood cells prior to use in (Gelman, 2003). However, if we view the activation of innate immunity by siRNAs as beneficial for cancer therapy and infectious diseases, then immuostimulatory siRNAs could emerge as useful agents to knockdown gene expression and activate innate and adaptive immunity against tumour cells. This observation prompted us to design bifunctional siRNAs, which combine gene-silencing and immunostimulation in one single siRNA molecule (Gro F, 2006).

Current efforts in cancer immune therapy and bacteria therapy are largely aimed at stimulating antitumour immune responses by using various tumour antigens and adjuvants. The involvement of TLR-activated pathways in immune response is supported by the induction of DC maturation and secretion of various cytokines (Palucka et al, 2007), leading to the induction of innate and adaptive immunity.

E. Targeting cancer stem/progenitor cells for anticancer therapy The cancer recurrence phenomenon has been associated with the accumulating genetic or epigenic alterations in cancer cells which may contribute to their uncontrolled growth, survival and invasion as well as their intrinsic or acquired resistance to clinical treatments (Lowenberg et al, 2003; Mimeault et al, 2005). Recent investigations have revealed that the most aggressive cancers may originate from the malignant transformation of embryonic or adult stem/progenitor cells into cancer progenitor cells (Mimeault, 2006). The cancer progenitor cells can provide critical functions in cancer initiation and progression into metastatic and recurrent disease states. Numerous investigations have provided evidence that the genetic and/or epigenic alterations occurring in the multipotent tissue-specific adult stem cells, the most cancers may arise from the malignant transformation of multipotent tissue-specific adult stem cells and/or their early progenitors into cancer progenitor cells, the accumulation of different genetic and/or epigenic alterations in cancer progenitor cells during cancer progression also seems to be associated with the occurrence of highly aggressive cancer subtypes. The functional properties of cancer progenitor cells may be influenced through external signals mediated by other further differentiated cancer cells and host stromal cells including activated fibroblasts and infiltrating immune cells, such as macrophages and endothelial cells (Kopp et al, 2006). Among the diverse growth factors, chemokines and angiogenic substances released by stromal cells (Kopp, 2006). All these soluble factors can influence, of autocrine or paracrine manner, the tumour cell behaviour and neovascularization process during cancer progression. The intrinsic or acquired resistance of poorly differentiated and tumourigenic cancer progenitor cells to current clinical therapies may lead to their persistence in primary and secondary neoplasms after treatments, and thereby contribute to cancer recurrence (Mimeault, 2007; de Jonge-Peeters et al, 2007). The cancer stem/progenitor cell model of carcinogenesis may also explain the differences of response of distinct cancer subtypes to current therapies as well as the dormancy phenomenon and disease relapse, which may be associated with a higher resistance of cancer progenitor cells to conventional therapies under specific conditions prevalent in primary and/or secondary neoplasms relative to their further differentiated progeny (Mimeault, 2007). Based on these observations, the new cancer therapeutic strategies should be based on targeting of different oncogenic cascades activated in tumourigenic cancer progenitor cells, and which must now be

C. Development of strategies to promote effector cell recruitment into tumour One strategy is to promote effector cell recruitment into metastases when it fails spontaneously (Shakhar, 2003). Intratumoural introduction of chemokines through the use of viral vectors would serve as a proof of concept. Transduction of tumour cells to express specific chemokines has shown benefit in some experimental murine models. Similarly, introduction of the TNF superfamily member LIGHT (homologous to lymphotoxins, inducible expression, competes with HSV glycoprotein D for HVEM, a receptor expressed on T lymphocytes) has been expressed at tumour sites with dramatic results (Kunz M et al, 1999). However, direct intratumoural injection of recombinant viral vectors will only serve as a proof of concept, and development of agents that can be delivered systemically yet target tumour metastases would have to be pursued for practical application.

D. Modulating tumour cell biology to alter the tumour microenvironment Once the oncogenic signals present in tumour cells that determine the nature of the tumour microenvironment are defined, then it should be possible to target those pathways directly to eliminate the underlying basis for immunosuppression at tumour sites. For example, Stat can drive the expression of vascular endothelial growth factor (VEGF) (Burdelya et al, 2005), which in addition to promoting neoangiogenesis has been reported to be inhibitory for dendritic cell generation in vivo (Della et al, 2005). The interface between tumour biology and the creation of the immunosuppressive tumour microenvironment is an area ripe for additional research. Another strategy in the immunotherapy of tumours is the use of mRNA-encoding tumour antigens to induce Tand B-cell immunity to the encoded antigens. In vivo application of mRNA induced cytotoxic T-cell activity and specific antibodies in mice. Furthermore, human DCs transfected ex vivo with mRNA induced an antigenspecific immune response both in vitro to a viral antigen and in vivo to a tumour-associated antigen in patients with cancer. 42

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours considered for improving the current therapeutic treatments. The molecular targeting of tumourigenic cancer progenitor cells must be considered for improving the efficacy of the current cancer therapies.

strategies involve both ex vivo and in vivo approaches (Glick et al, 2006). Increasing the capacity of the immune system to mediate tumour regression has been a major goal for tumour immunologists. Progress towards tumour vaccines has been recently made by the molecular identification of novel tumour-associated antigens (TAA) and by a better understanding of cellular signals required for efficient T cell activation (Pule et al, 2002). Cancer vaccination is of therapeutic rather than prophylactic nature, involving attempts to activate immune responses against TAA to which the immune system has already been exposed. To date, advances in gene delivery technology have led to the development of immuno-gene therapy strategies to augment host-immune responses to tumours. These approaches include (1) the use of tumour cells genetically modified with genes encoding costimulatory ligands, cytokines or HLA molecules to enhance their immunogenicity and (2) the genetic modification of immune-competent cells with TAA in order to enhance their anti-tumour response. Despite the continuous increase in clinical gene therapy protocols for immunotherapy of cancer, many aspects of gene transfer are still far from ideal. A basic requirement, not yet adequately and routinely fulfilled, is to introduce the gene of interest with sufficient efficiency into the target cells in order to achieve therapeutic benefit in cancer patients.

F. Gene-based tumour immunization For any gene therapy application including genetic immunization, the goal is to deliver genes into therapeutically-relevant cells while avoiding other cells that cannot contribute to immunization or therapeutic effects. While this is the goal, particularly for in vivo gene therapy, current gene delivery vectors cannot specifically deliver genes to the cells we want and frequently deliver genes into non-target tissues reducing therapy and increasing dangerous side effects. Generally, the level of gene transfer into tumour cells and immune effector cells determined the level of immunogenetics, they have been shown to be limited, and this has been thought to account for the poor results obtained by cancer gene immunotherapy. Therefore, vector design is one of the most critical areas for future research (Logan et al, 2002). Gene delivery vectors thus are required fall into three areas: 1) identification of celltargeting ligands using random peptide-presenting phage libraries; 2) engineering viral and non-viral gene delivery vectors to accept cell-targeting ligands; and 3) developing effective methods to image gene and vector delivery in vivo to determine the efficacy of targeted vectors in the complex tumour environment. The different vector systems can have strengths or weaknesses, depending on their use. For ex vivo gene delivery and clinical use in cancer protocols, design of optimized transduction protocols and development of improved vectors, exhibiting improved gene transfer efficiency and stability for large-scale production, have just begun to be evaluated. Nonviral gene delivery systems are cost- and time-effective and large-scale manufacturing of clinicalgrade plasmid vectors is logistically simple. The major disadvantages are the low transfection efficiency and the transient expression in target cells. As already mentioned earlier, one of the attractive features of immunological gene therapy approaches is that they capitalize on the ability to amplify the outcome of the gene transfer (â&#x20AC;&#x2DC;genetic immunopotentiationâ&#x20AC;&#x2122;). Consequently, high efficiency gene transfer may not be an essential requirement in these protocols. Given this problem, we are interested in developing gene delivery with recombinant engineer bacteria vectors that can be tuned to target specific cells in vivo for gene therapy and immunization applications. As recombinant engineer bacteria are so far the best characterized bacteria vectors, they are most frequently used vectors for immuno-gene therapy of cancer. Immunogene therapies have the theoretical advantage of inducing a systemic anti-tumour response associated with immunologic memory. Such a response potentially allows for treatment of disseminated disease and a prolonged anti-tumour effect that persists beyond the immediate treatment period. Immunogene therapy

G. Breakdown of immune tolerance to tumours The current rationale lies in the local recruitment of inflammatory cells that can destroy a fraction of the tumour cells directly or indirectly, thereby releasing tumour antigens. These antigens can be taken up in the form of peptides, proteins or apoptotic bodies by professional antigenpresenting cells (APC) by a process known as cross-priming (i.e. indirect presentation of tumour antigens to the immune system by a host-derived APC), that travel to the draining lymph nodes where they will activate naive antigen-specific T cells and initiate a primary cellular immune response. The new approach enlists the help of the immune system to target and kill tumour blood vessel cells, through an unprecedented recruitment of the immune system; they were able to generate a strong anti-tumour effect by targeting the central component of what tumours need most-a blood supply (Niethammer et al, 2002). According to the classical paradigm in tumour immunology, immune responses are believed to follow a model of discrimination between self and non-self. Consequently, tumours should be considered as non-self, like viruses or bacteria. Therefore, an important task of the immune system is to search for and destroy tumour cells as they arise, in concordance with the original proposals of Burnetâ&#x20AC;&#x2122;s immunological surveillance hypothesis. However, the limited successes of cancer immunotherapy approaches based on these concepts, prompted a revision of tumour immunology (Luis et al, 2005). Ultimately, it appears that the immune response at the T cell level is

Gene Therapy and Molecular Biology Vol 13, page 44 based on the presence of the appropriate costimulatory molecules on APC that promote T cell activation. DCs (DC) form a complex network of antigen-capturing and presenting cells (APC) defined by morphological, phenotypical and functional criteria, which distinguish them from monocytes and macrophages (Elke et al, 2002). Immunity against cancer is necessary if gene transfer is going to be applied in a clinically relevant way. Instead of exploiting the increasing knowledge on cytokines and their plethora of actions in the immune response, immunology may provide a more fundamental mechanism to explain the immunological unresponsiveness to cancer than the classical self/non-self paradigm. At a later stage, we will focus on a new gene-based tumour immunization that seems to fit within this conceptual framework.

surface molecules not presented by MHC molecules (Keith et al, 2002). These more elaborate forms of adoptive transfer of killer cells are being studied in ongoing clinical trials. A second approach in preclinical development involves genetic modification of DCs with the gene for interleukin-7 (IL-7). IL-7 stimulates cytotoxic Tlymphocyte responses and down-regulates tumour production of the immunosuppressive growth factor, TGF!.

V. Cancer vaccine A. Overview In the past two decades, adoptive immunotherapy, based on tumour-infiltrating lymphocytes or lymphokineactivated killer cells, has been used in clinical trials (Rosenberg et al, 1986; Rosenberg et al, 1987). These early results gave first evidence that the manipulation of the immune system represents a promising tool in cancer immunotherapy. The main rationale of genetic immunopotentiation protocols is the possibility of enlisting the immune system for a potentially vast amplification of gene therapy, thereby enhancing therapeutic benefit. The recognition that most tumours encode TAA and are capable of inducing protective immunity in preclinical models has reinvigorated the field of cancer immunotherapy (Pule et al, 2002). It has been hypothesized that the immune system of tumour patients, characterized by tolerance, can be modified to mount an immunological response against the tumour and thus facilitate tumour rejection. This ‘cancer vaccination’ is to be accomplished through exposure of TAA in a more favourable context to the immune system (Christian et al, 2006). Despite ongoing efforts to define and characterize TAA and, more importantly, clinically relevant TAA, little is known about TAA for the majority of human cancers and the largest part of clinical experience with tumour vaccines has been obtained in melanoma patients. Therefore, most cancer vaccines, to date, use tumour cells as a source of TAA. The molecular identification of antigens expressed by tumour cells that can be recognized by specific CD8+ cytotoxic T lymphocytes (CTLs) has provided a means by which to explore anti-tumour T-cell parameters in patients and also to develop antigen-specific immunotherapies.

H. Stimulation to illicit an active immunoresponse in a solid tumour environment Van Pel and Boon (1982) demonstrated that a protective immune response could be generated against a ‘non-immunogenic’ murine tumour, providing the first experimental evidence that the lack of tumour immunity was not due to the absence of TAA but rather to the inability to stimulate the immune system. Factors that can explain the failure of the immune system in tumourbearing hosts are numerous, and it is not clear which of them are critical in the clinical context. We all know that tumour cells are poor stimulators of immune responses and capable of inducing immune tolerance. Alternatively, it may well be that the lack of costimulatory molecules (e.g. CD80, CD86) on the surface of tumour cells accounts for the immune tolerance which keeps the tumour from being rejected. Deficiency of the immune system could be responsible for the lack of immunity and induction of T cell tolerance (von Euler et al, 2008). In this case; the tumour actively suppresses host antigen presentation and immune effect or functions by expression of a variety of local inhibitory molecules, such as VEGF and IL-10, especially when large tumour burdens are involved. Antigen-specific cytotoxic cells that do specifically recognize tumour cells can be generated by cell cloning techniques ex vivo or can be genetically engineered by the stable transfection of a TCR that specifically recognizes a certain MHC-tumour antigen complex (Keith et al, 2002). This has been made possible by the use of defined tumour antigens to stimulate lymphocytes in vitro, and the ability to clone lymphocytes derived from a single, antigenspecific T cell (Pule et al, 2002). Adoptive transfer of clonally expanded lymphocytes to lymphopenic hosts after nonmyeloablative conditioning chemotherapy has resulted in cell proliferation and persistent clonal repopulation correlated with tumour regressions in patients with melanoma (Keith et al, 2002). Ex vivo–expanded clonal populations of tumour antigen–specific lymphocytes can be derived from a natural or genetically engineered initiating cell. Moreover, the TCR of cytotoxic T cells can be substituted with an immunoglobulin-like surface molecule, which allows the binding to tumour-specific

B. Current vaccines 1. Antigen Presentation to the Immune System The immune system responds to intracellular events in target cells by the recognition of intracellularly derived protein fragments presented on the cell surface by major histocompatibility complex (MHC) molecules. Circulating T lymphocytes can potentially engage these peptide-MHC complexes through their T-cell receptors (TCR). This mechanism allows the immune system to differentiate abnormal intracellular processes from normally functioning cells expressing so-called self proteins. The key steps in the generation of an immune response to 44

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours cancer cells include loading of tumour antigens onto antigen-present cells in vitro or in vivo (Figure 1).

prepare vaccines for each patient. To avoid this problem, other tumour cell vaccines have been formulated as lysates of allogeneic laboratory cell lines containing shared tumour antigens (Sondak et al, 2002).

2. Intratumoral bacillus Calmette-GuĂŠrin (BCG)

5. Naked DNA and gene-modified tumour vaccines

This strategy may be one of the earliest forms of cellular immunotherapy tested by the Intratumoral injection of the BCG in cancer (Mathe et al, 1973). The immunologic basis is that BCG generates an inflammatory process ideal for the attraction of APCs, which pick up tumour antigens released by the tumour cells, damaged by the bacterial infection and cross-present them in a socalled danger environment. This form of treatment generates occasional antitumor immune responses.

Intramuscular injection of naked DNA sequences results in gene expression and the generation of immune responses (Wolff et al, 1990; Kumar et al, 1996). These DNA plasmids, which consist of an antigen gene regulated by a promoter with constitutive activity can be conjugated with gold particles and propelled into the skin using a helium gas gene gun. The protein antigen produced by the target cells is taken up by host APCs, processed, and crosspresented to the immune system in the draining lymph nodes. Gene-modified tumour vaccines have been tested in clinical trials for many years, the paracrine expression of cytokines such as IL-2 or IFN!, would allow the tumour cell to provide all of the signals for direct cytotoxic T cell activation, bypassing the need for host APCs and CD4+ T lymphocyte assist (Fearon et al, 1990). However, comparison of the antitumor capacity of gene-modified tumour vaccines in preclinical models was surprising in that the introduction of GM-CSF into tumour cells produced the most active vaccine (Dranoff et al, 1993). Bone marrow chimeras were used to show that the GMCSF gene-modified tumour vaccines attracted host APCs, which picked up tumour antigens and cross-presented them to the host immune system (Huang et al, 1994).

3. Intratumoral HLA-B7 The intratumoral injection of BCG, the recognition of a powerful alloantigen by cells with NK activity allows the recruitment of APCs, among other inflammatory cells, which will pick up tumour antigens released by the HLAB7â&#x20AC;&#x201C;transfected cells and cross-present them to cytotoxic effector cells. These tumours antigen-specific CD8+ CTLs would then be permitted to attack other tumour cells without the requirement of the presence of the alloantigen HLA-B7 on tumour cells.

4. Whole-cell tumour vaccines Whole-cell autologous tumour vaccines are personalized vaccines, and it can be assumed that they contain the relevant tumour antigens; however, the logistic drawback is that it is difficult to obtain and individually

Figure1: Cross-presentation of tumour antigens derived from cancer vaccines. Several immunologic manipulations lead to a common pathway of cross presentation of proteins derived from tumour antigens. a) in vivo APC-Based Vaccines; b) ex Vivo APC-Based Vaccines; c) augment the number of APC; d) non-T cell-DC. These host antigen-presenting cells (APCs), the most powerful of which are the DCs, circulate through the afferent lymphatic vessels to the T-cell areas of lymph nodes. There they cross-present the tumour antigen to T lymphocytes.

Gene Therapy and Molecular Biology Vol 13, page 46 pathway of anticancer immune activation is the recruitment and activation of host APCs to cross-present tumour antigens to effector CD8+ cytotoxic T cells (Figure1). Cytokines such as GM-CSF have been used as vaccine adjuvants with the hope of attracting and activating DCs locally at the site of vaccination. Other strategies are aimed at systemically expanding the dendritic cell pool in the hosts, which may be achieved by the administration of cytokines such as the combination of GM-CSF and IL-4 (Roth et al, 2000). In retrospective studies of tumour biopsies, a greater number of APCs infiltrating the cancer have been correlated with improvements in survival of patients (Lotze, 1997). This increase in the availability of intratumoral APCs may allow more efficient cross-presentation of tumour antigens.

6. Microbe-based vaccines A variety of microbiology vectors have been adapted to cancer immunotherapy. Tumour antigen DNA sequences can be inserted into attenuated pox viruses that are unable to replicate in mammalian hosts or tumour antigen gene segments have been introduced into bacteria such as Salmonella and Listeria, resulting in protective immunity in animal models (Huang et al, 1994). Other vectors include recombinant replication-incompetent viral vectors (adenovirus, retrovirus, lentivirus), which are modified viruses that have been specifically mutated to be incapable of self-replication into infectious progeny virions after infection of a single target cell, but that efficiently express the foreign gene inserted in the vector. This form of genetic immunization has also resulted in weak immunologic responses in humans (Rosenberg et al, 1998), enhancing the immune potency of viral vector. Immunization can be achieved by the coexpression of cytokines or costimulatory molecules in the viral vector because these viral vectors usually have a large capacity to carry and express multiple genes (Rosenberg et al, 1998). Several anaerobic bacteria vectors are testing in lab now. Advantages may include the ability to use the oral route for immunization and the strong inflammatory milieu created by bacterial products, leading to the attraction of APCs, and a preferential Th1 cytokine polarizing pattern stimulated by certain bacteria such as Listeria.

C. Ex vivo APC-based vaccines 1. DCs and exosomes The crucial role of DCs was discovered for the induction of primary T-cellâ&#x20AC;&#x201C;dependent immune responses. DCs are now considered to be the best adjuvant for antitumor immunity. Different antigen loading procedures have been used for dendritic cell antigen presentation. For well-characterized antigens, synthetic HLA-binding peptide epitopes or the complete DNA sequence in a viral vector can be used to load the dendritic cell vaccines. DCs pulsed with peptide epitopes and genetically-modified with recombinant viral or bacteria vectors are conceptually similar to the vaccination with peptides in immunologic adjuvants or the direct administration of recombinant viruses, respectively, in which the DCs should be perceived as powerful immunologic adjuvants for the tumour antigen. Also, DCs can be loaded with defined antigens to take advantage of antigen uptake surface receptors, such as FC receptors to take up immune complexes carrying a tumour antigen (Rafiq et al, 2002). The nanometer vesicles derived from late endosomes are released differentiated in vitro by DCs , which contain most of the appropriate molecules to adequately present MHC-antigen complexes to the immune system (Wolfers et al, 2001; Zitvogel et al, 1998). These exosomes can be isolated by filtration of dendritic cell culture media and then loaded with custom antigens. Their use alone as vaccines or as vehicles to transfer back preassembled MHC-peptide complexes to DCs is under clinical investigation

7. The prime-boost strategy The sequential administration of naked DNA and a viral vector has resulted in synergistic immune activation; it is a potent method of generating immune responses to tumour antigens in what is now known as the prime-boost strategy. The initial injection of a plasmid allows the activation of infrequent T cells without other immune cells competing for the antigen because the naked DNA has a limited inflammatory potential. After a rest period, these antigen-specific high-avidity lymphocytes are boosted by the re-exposure to the same antigen, now in a more inflammatory milieu generated by the highly immunogenic viral proteins from the recombinant viral vector. Preclinical murine and primate models have shown that this heterologous prime-boost regimen induces 10- to 100-fold higher frequencies of T cells than do naked DNA or recombinant viral vectors alone (Ramshaw et al, 2000). A modification of this strategy is the sequential administration of two different viral vectors carrying the same tumour antigen gene, which bypasses the limitation of the development of neutralizing antibodies to the viral backbone by boosting with a different vector without shared viral epitopes (Mincheff et al, 2000; Marshall et al, 2000). These strategies, which avoid the need of cell culture common to the majority of highly immunologically active vaccine strategies, are rapidly undergoing clinical testing for infectious disease and cancer.

2. Nonâ&#x20AC;&#x201C;T-cellâ&#x20AC;&#x201C;directed cancer vaccines Monoclonal antibodies to surface receptors, such as trastuzumab or rituximab, have complex mechanisms of action leading to effective tumour regressions. One such mechanism is the stimulation of antibody-dependent cellmediated cytotoxicity. This immune-based effect, together with the recognized ability of immune complexes to allow antigen cross-presentation in DCs (Clynes et al, 2000), may contribute to their antitumour effects by a coordinated humoral and cellular response. Several other cancer vaccines are in different phases of clinical testing. Most of these strategies rely on the activation of humoral (antibody) responses to a peptide or nonpeptide antigen.

8. Augmentation of the number of APCs As can be noted by the mechanism of action of most of the prior immunologic maneuvers, the common 46

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours Resultant tumour cell damage and cross-presentation of antigen by host APCs may allow the transfer of the immunologic stimulus to cellular immune responses. Advances in the understanding of the mechanisms of action of cellular antitumour immune responses have allowed the development of new generations of cancer vaccines, in which the key step is the recognition of the need for professional APCs to cross-present the antigen to the host immune system. The most immunologically active vaccines usually require costly and laborious ex vivo cellular cultures, whereas the cell-free vaccines that can be directly administered from an easily stored and transported vial are usually less immunologically active but more suitable for widespread clinical testing. New advances in the formulation of cancer vaccines brought by a more precise knowledge of the requirements for the generation of cellular immune responses to tumour antigens, together with the current ability to closely monitor cellular immune responses, will likely provide powerful, nonindividualized, cell-free vaccines in the near future.

who have had their tumour surgically removed but who have a high risk of relapse. In these categories of patients, disease stabilisation, frequency of relapse, time-span to relapse and length of survival are the most rational parameters for evaluating cancer immunization effectiveness. Even if optimal gene delivery is achieved, the success of gene therapy, like conventional therapy, may be impeded by tumour cell resistance and intratumoural cell heterogeneity. The use of combined treatment modalities provides a rational paradigm to improve upon the clinical efficacy of cancer gene therapy (Klencke et al, 2002). Within the modality of gene therapy itself, multiple therapies may be combined in an attempt to benefit from additive or synergistic efficacy. Multi-gene therapy approaches already under evaluation include the transduction of dual immunostimulatory molecules for immunotherapy, and anaerobic bacteria therapy (Figure 2). A major limitation in the use of gene therapy in solid tumours in vivo is the diffusion-limited tissue penetration into the target tissue. The ability of immunotherapy and anaerobic bacteria therapy has been observed in vitro and in vivo. The effects we observed in animals are contingent on both bacteriolysis and immunity. There are three reasons to believe that systemic injection of Clostridium. Novyi-NT (C. novyi-NT) into humans would lead to bacteriolysis of tumours. First, C. novyi-NT germinates within the tumours of all three species tested (rabbits, rats, and mice), whether the tumours are s.c., intramuscular, or intrahepatic. Second, C. novyi-NT can germinate within human tumour xenografts in the nude mouse host (although complete regressions and cures are not generally observed as there is minimal T cell-mediated immunity). And third, there are many case reports of C. novyi germination and gangrene developing in penetrating wounds or after illicit drug injection. These reports demonstrate that the parental strain of C. novyi, differing from C. novyi-NT only in that the latter is devoid of the lethal "-toxin gene, can proliferate within hypoxic regions in humans. C. novyi-NT infection of cancers in humans will induce tumour immunity is more difficult to predict (Dang et al, 2004). There are many studies indicating that human tumours are immunogenic, as assessed by the presence of specific antibodies or reactive T cells in untreated patients. Furthermore, it has been shown that stronger immune responses can be elicited through the administration of various vaccines in several clinical trials. But there are also many studies indicating that human tumour cells can protect themselves against potential immune responses through a variety of direct and indirect mechanisms.

VI. Combined multi-modality therapy: immunization with anaerobic bacteria therapy for tumour Immunotherapy strategies for cancer gene therapy utilize gene transfer to facilitate a dormant host immune response directed against the tumour. Evasion of autologous host cellular immunity is a common feature of tumour cell neoantigens. Tumour cells are poor antigen presenting cells. â&#x20AC;&#x2DC;Cancer vaccineâ&#x20AC;&#x2122; strategies are based on optimization of the context in which tumour antigens or tissue-specific antigens are presented to the host immune system (Sobol et al, 1995). Utilizing gene therapy to optimize tumourantigen presentation is through the targeted expression of cytokines in tumour cells. Targeted paracrine expression eliminates the toxicities associated with systemic cytokine administration. The transduced cytokines result in a combination of improved tumour cell vaccine antigen presentation, and activation of APCs, both essential for effective priming of the cellular immune response. The vector-induced inflammatory/immune response functions as an adjuvant to the transduced antigen, resulting in local release of cytokines and influx of APCs to the vaccine site. The immunotherapy of cancer is now being assessed in the clinics. An immune response has a potentially long-term clinical impact on the course of the disease by stabilising the condition and thus prolonging survival rather than by performing massive tumour elimination, those with minor tumour burden or patients

Gene Therapy and Molecular Biology Vol 13, page 48

Figure 2: Anaerobic bacteria-mediated immunologic therapy for solid tumour Anaerobic bacteria therapy has been observed these effects in treatment of solid tumour: a) nonspecific immunologic therapy which the characterization of cytokines produced by immune system cells and their production by genetic recombinant techniques, such as IL-2 and IFN, the significant toxicity of high-dose systemic cytokine therapy is the major drawback; b) specific immunisation represent which allow the stimulation of an immune response while avoiding the high toxicity of systemic administration of recombinant anaerobic bacteria vectors and gene modification of tumour cells, which allows an initial direct cytotoxic effect on the cancer cell by antibody dependent cellular cytotoxicity, thereby releasing tumour antigens; c) the adoptive transfer of immune effector cells from the immune system, T cell, DCs pulsed with genetically-modified with recombinant anaerobic bacteria vectors are conceptually similar to the vaccination with peptides in immunologic adjuvant.

become a realistic treatment modality for cancer, several barriers have yet to be overcome. First, improved (bacteria) vectors should lead to higher gene delivery rates and transgene expression. Therefore, carefully designed clinical studies are necessary to assess gene transfer efficiency, safety and toxicity, and eventually to establish the clinical efficacy of the tumour immunization. With regard to gene-modified tumour cells, another major issue still unsolved at the clinical level is to determine what is the best cytokine the tumour cells to release in order to recruit the immune system. Second, it will be imperative to break down the immunological tolerance against the tumour through reversal of T cell ignorance, anergy or tumour-induced immunosuppression in order to achieve a therapeutic outcome. Use of DCs, whether gene-modified or not, in the context of danger signals could provide a means to initiate a cellular immune response against the tumour. An additional general feature to be considered when designing immuno-gene therapy of cancer is the complex redundancy of the immune system. Its effectiveness in protecting the body from harmful infections demands a sophisticated network to control the pathways of activation and termination of an immune response, as well as maintenance of life-long tolerance. This suggests that a combination of multiple strategies, gene-based or not, acting at different levels may be advantageous to boost the immune system against the tumour. Moreover, it is believed that the breakdown of tolerance to tumours will require, in addition to the

As similar observations, both with respect to the potential of tumours to elicit an immune response and their ability to evade such responses, have been recorded in animals, there is reason to hope that the immune therapeutic effects stimulated by C. novyi-NT germination might be obtainable in carefully selected patients. In experimental setting, the strictly anaerobic Clostridia have demonstrated several advantages over others as clostridial spores specifically colonise and germinate into vegetative cells in the hypoxic regions of solid tumours, causing tumour lysis and destruction. Early trials in the 70's of non pathogenic strains in human had shown plausible safety (Carey et al, 1976).

VII. Conclusions Current innovative approaches for cancer therapy hold significant potentials for effective cancer management; bacteria therapies and immunotherapies will probably be the most promising, especially when genetic manipulation of bacteria to improve its potential have applied. Recent understanding of tumour microenvironment, detailed characterization of tumour antigens and the increased revealing of the immunological pathways involved in tumour immunity have paved the way for the design of gene-immune therapies (Ribas et al, 2000). To this end, three cellular sources can be envisaged for genetic modification: tumour cells, effector T cells and DCs. However, before ex vivo immuno-gene therapy can 48

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours strategies discussed in this review, complementary strategies that specifically counteract the active tumourinduced immunosuppression.

VIII. Future directions The challenges facing the implementation of successful gene therapeutic strategies will be better understood as the early clinical trials for cancer gene therapy begin to return more results. Vector development with increased transgene size capacity, optimized immunogenic properties, and improved gene transfer efficiency and targeting will facilitate the next generation of gene therapy strategies (Kanai et al, 1998). The burgeoning field of genomics provides an exciting new resource for the design of tumour-specific gene therapy strategies. Harnessing these tumour gene products and others for use as immunization offers exciting prospects for a whole new class of cancer gene therapy strategies. As the diversity of molecular lesions underlying tumourigenesis is better characterized, new targets for corrective and cytoreductive approaches will emerge. Effective anticancer gene therapy may ultimately require individualized molecular profiles. Solid tumours meet their demands for nascent blood vessels and increased glycolysis, to combat hypoxia, by activating multiple genes involved in angiogenesis and glucose metabolism. Hypoxia inducible factor-1(HIF-1) is a constitutively expressed basic helix-loop-helix transcription factor, formed by the assembly of HIF-1alpha and HIF-1beta, which is stabilized in response to hypoxia, and rapidly degraded under normoxic conditions (Kanai et al, 1998). It activates the transcription of genes important for maintaining oxygen homeostasis but failed to stimulate systemic T-cell-mediated antitumour immunity, and synergized with B7-1-mediated immunotherapy. This approach holds promise to form the foundation for the transition between the traditional anticancer therapies and the molecular antineoplastic gene therapy of the future. Other approaches are to develop new gene therapy vectors whose expression is selectively activated by hypoxia (Rosenberg et al, 1998). As VEGF is upregulated by hypoxia, such regulatory mechanisms would enable us to achieve hypoxia-inducible expression of therapeutic genes. The unique pathophysiology of solid tumours presents a huge problem for the conventional therapies. Thus, the outcomes of current therapies are so far disappointing. Several new approaches aiming at developing effective treatments are on the horizon. These include a variety of bacteria-based therapy systems. Amongst all these, anaerobic bacteria vector-mediated cancer therapy is most promising and expected to generate new data and new protocols for cancer gene therapy.

Acknowledgements This work is partly supported by a project grant from the NHMRC/Cancer Council Queensland (Grant ID No. 401681) and the Dr. Jian Zhou smart state fellowship from the State Government of Queensland to MQW.

References Agrawal N, Bettegowda C, Cheong I, et al (2004). Bacteriolytic therapy can generate a potent immune response against experimental tumors. Proc Natl Acad Sci U S A 101, 15172-7. Akasaki Y, Liu G, Matundan HH, et al (2006). A peroxisome proliferator-activated receptor-gamma agonist, troglitazone, facilitates caspase-8 and -9 activities by increasing the enzymatic activity of protein-tyrosine phosphatase-1B on human glioma cells. J Biol Chem 281, 6165-74. Aznavoorian S, Stracke ML, Krutzsch H, Schiffmann E, Liotta LA (1990). Signal transduction for chemotaxis and haptotaxis by matrix molecules in tumor cells. J Cell Biol; 110, 1427-38. Akbulut L, Zhang Y, Deisseroth A (2003). Cytotoxic effect of replication-competent adenoviral vectors carrying L-plastin promoter regulated E1A and cytosine deaminase genes in cancers of the breast, ovary and colon, Cancer Gene Ther 10, 388â&#x20AC;&#x201C;95. Bubenik J, Vonka V (2003). MHC class I status of tumours and design of immunotherapeutic strategies. Immunol Lett 90, 1778. Biswas S, Guix M, Rinehart C, et al (2007). Inhibition of TGF-beta with neutralizing antibodies prevents radiation-induced acceleration of metastatic cancer progression. J Clin Invest 117, 1305-13. Bos R vDP, van der Groep P, Shvarts A, Greijer AE, van der Wall E (2004). Expression of hypoxia-inducible factor-1alpha and cell cycle proteins in invasive breast cancer are estrogen receptor related. Breast Cancer Res 6: R450-9. Burdelya L, Kujawski M, Niu G, et al (2005). Stat3 activity in melanoma cells affects migration of immune effector cells and nitric oxide-mediated antitumor effects. J Immunol 174, 392531. Berzofsky JA, Terabe M (2008). NKT cells in tumor immunity: opposing subsets define a new immunoregulatory axis. J Immunol 180, 3627-35. Battaglia M, Gregori S, Bacchetta R, Roncarolo MG (2006). Tr1 cells: from discovery to their clinical application. Semin Immunol 18, 120-7. Bonizzi RP (2007). Welfare and immune response. Veterinary Research Communications 31, 97-102. Cho W. Contribution of oncoproteomics to cancer biomarker discovery (2007). Mol Cancer 6, 25-9. Croker AK, Allan AL (2008). Cancer stem cells: implications for the progression and treatment of metastatic disease. J Cell Mol Med 12, 374-90. Chen ZS, Robey RW, Belinsky MG, et al (2003). Transport of methotrexate, methotrexate polyglutamates, and 17beta-estradiol 17-(beta-D-glucuronide) by ABCG2: effects of acquired mutations at R482 on methotrexate transport. Cancer Res 63, 4048-54. Cools N, Ponsaerts P, Van Tendeloo VF, Berneman ZN (2007). Balancing between immunity and tolerance: an interplay between dendritic cells, regulatory T cells, and effector T cells. J Leukoc Biol 82, 1365-74. Caux CD, Schmitt D, Banchereau J (1992). GM-CSF and TNFalpha cooperate in the generation of dendritic Langerhans cells. Nature 360, 258-61. Clynes RA, Towers TL, Presta LG, et al (2000). Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nat Med 6, 443â&#x20AC;&#x201C;6, Carey RW, Holland JF, Whang HY, Neter E (1967), Bryant B: Clostridial oncolysis in man. Euro J Can 3, 37-46.

Gene Therapy and Molecular Biology Vol 13, page 50 Christian A Petrulio SK-S, Howard L Kaufman (2006). The tumour microenvironment and implications for cancer immunotherapy. Expert Opinion on Biological Therapy 6, 671-84. Dong H, Chen L (2003). B7-H1 pathway and its role in the evasion of tumor immunity. J Mol Med 81, 281-7. Della Porta M, Danova M, Rigolin GM, et al (2005). Dendritic cells and vascular endothelial growth factor in colorectal cancer: correlations with clinicobiological findings. oncology 68, 27684.

Kay A (2001). Allergy and allergic diseases. First of two parts. N Engl J Med 344, 30-7.

Dean M, Fojo T, Bates S (2005). Tumour stem cells and drug resistance. Nat Rev Cancer 5, 275-84 Dranoff G, Jaffee E, Lazenby A, et al (1993). Vaccination with irradiated tumor cells engineered to secrete murine granulocytemacrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc Natl Acad Sci U S A 90, 3539–43. Dang LH, Bettegowda C, Huso DL, Kinzler KW, Vogelstein B (2001). Combination bacteriolytic therapy for the treatment of experimental tumors. Proc Natl Acad Sci U S A 98, 15155-60. Dang LH, Bettegowda C, Agrawal N, et al. (2004). Targeting vascular and avascular compartments of tumors with C. novyiNT and anti-microtubule agents. Cancer Biol. Ther. 3, 326-337

Kanai F, Kawakami T, Hamada H, et al (1998). Adenovirusmediated transduction of Escherichia coli uracil phosphoribosyltransferase gene sensitizes cancer cells to low concentrations of 5-fluorouracil. Cancer Res 58, 1946-51. Kunz M TA, Goebeler M, Engelhardt E, Bröcker E, Gillitzer R (1999). Strong expression of the lymphoattractant C-X-C chemokine Mig is associated with heavy infiltration of T cells in human malignant melanoma. J Pathol 189, 552-8. Kopp HG, Ramos CA, Rafii S (2006). Contribution of endothelial progenitors and proangiogenic hematopoietic cells to vascularization of tumor and ischemic tissue. Curr Opin Hematol 13, 175-81. Kumar V, Sercarz E (1996). Genetic vaccination: The advantages of going naked. Nat Med 2, 857–9. Logan AC, Lutzko C, Kohn DB (2002). Advances in lentiviral vector design for gene-modification of hematopoietic stem cells. Curr Opin Biotechnol 13, 429-36. Lotze MT (1997). Getting to the source: Dendritic cells as therapeutic reagents for the treatment of patients with cancer. Ann Surg 226, 1–5, Lowenberg B, Griffin JD, Tallman MS (2003). Acute myeloid leukemia and acute promyelocytic leukemia. Hematology Am Soc Hematol Educ Program 82-101. Luis SF, Eckhard RP (2005). Lung Cancer Immunotherapy. Clin Med Res 3, 221-28. Mahoney BP, Baggett B, Gillies RJ (2003). Tumor acidity, ion trapping and chemotherapeutics. I. Acid pH affects the distribution of chemotherapeutic agents in vitro. Biochem Pharmacol 66, 1207-18. Morgan RA, Dudley ME, Wunderlich JR (2006). Cancer regression in patients after transfer of genetically engineered lymphocytes. Science. 314(5796), 126-9 Marina Mata JCG, David J. Fink (2003). Gene Transfer to the Nervous System: Prospects for Novel Treatments Directed at Diseases of the Aging Nervous System. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 58, M1111-18

de Jonge-Peeters SD, Kuipers F, de Vries EG, Vellenga E (2007). ABC transporter expression in hematopoietic stem cells and the role in AML drug resistance. Crit Rev Oncol Hematol 62, 21426. Elke Jäger DJ, Alexander Knuth (2002). Clinical cancer vaccine trials. Current Opinion in immunology 14, 178-82. Frey AB (2006). Myeloid suppressor cells regulate the adaptive immune response to cancer. J Clin Invest 116, 2587-90. Fearon ER, Pardoll DM, Itaya T, et al (1990). Interleukin-2 production by tumour cells bypasses T helper function in the generation of an antitumor response. Cell 60, 397–403. Gro F MS (2006). Design of bifunctional siRNAs: Combining immunostimulation and gene-silencing in one single siRNA molecule. Biochemical and Biophysical Research Communications 352, 642-9. Ganss R (2006). Tumor stroma fosters neovascularization by recruitment of progenitor cells into the tumor bed. J Cell Mol Med 10, 857-65. Glick RP LT, Lin H, Tarlock K, Cohen EP (2006). Immunogene therapy as a treatment for malignant brain tumors in young mice. J Neurosurg 105, 65-70. Gelman AE (2003). Autoimmunity heats up. Nat Med 9, 1465-6. Hallmann R, Horn N, Selg M, Wendler O, Pausch F, Sorokin LM (2005). Expression and function of laminins in the embryonic and mature vasculature. Physiol Rev 85,979-1000. Huang AY, Golumbek P, Ahmadzadeh M, et al (1994). Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens. Science 264, 961–5. Iwadate Y, Namba H, Tagawa M, et al (1997). Induction of acquired immunity in rats that have eliminated intracranial gliosarcoma cell by the expression of herpes simplex virus thymidine kinase gene and ganciclovir administration. Oncology 54, 329-34 Jennifer A L, Philipp K (2006). Recent developments in antibacterial drug discovery: microbe-derived natural products – from collection to the clinic. Expert Opinion on Investigational Drugs 15, 211-26. Koido S, Nikrui N, Ohana M, et al (2005). Assessment of fusion cells from patient-derived ovarian carcinoma cells and dendritic cells as a vaccine for clinical use. Gynecol Oncol 99, 462-71.

Keith LK BA, David A M, Kathy S, Mary LD (2002). Adoptive Tcell therapy for the treatment of solid tumours. Expert Opinion on Biological Therapy 2, 55-66. Klencke B, Matijevic M, Urban RG, et al (2002). Encapsulated plasmid DNA treatment for human papillomavirus 16-associated anal dysplasia: A phase I study of ZYC101. Clin Cancer Res 8, 1028–37,

Mimeault M, Batra SK (2006). Concise review: recent advances on the significance of stem cells in tissue regeneration and cancer therapies. Stem Cells 24, 2319-45. Mimeault M, Batra SK (2007). Interplay of distinct growth factors during epithelial mesenchymal transition of cancer progenitor cells and molecular targeting as novel cancer therapies. Ann Oncol 18, 1605-19. Mathe G, Halle-Pannenko O, Bourut C (1973). BCG in cancer immunotherapy: Results obtained with various BCG preparations in a screening study for systemic adjuvants applicable to cancer immunoprophylaxis or immunotherapy. Natl Cancer Inst Monogr 39, 107–13. Martin-Orozco N, Dong C (2006). New battle fields for costimulation. J Exp Med 203, 817-20. Mimeault M, Brand RE, Sasson AA, Batra SK(2005). Recent advances on the molecular mechanisms involved in pancreatic cancer progression and therapies. Pancreas 31, 301-16.

Xu J et al: immunotherapy with anaerobic bacteria for immunogene therapy of solid tumours Mimeault M, Batra SK (2006). Recent advances on multiple tumorigenic cascades involved in prostatic cancer progression and targeting therapies. Carcinogenesis 27, 1-22. Marshall JL, Hoyer RJ, Toomey MA, et al (2000). Phase I study in advanced cancer patients of a diversified prime-and-boost vaccination protocol using recombinant vaccinia virus and recombinant nonreplicating avipox virus to elicit anticarcinoembryonic antigen immune responses. J Clin Oncol 18, 3964–73, Mincheff M, Tchakarov S, Zoubak S, et al (2000). Naked DNA and adenoviral immunizations for immunotherapy of prostate cancer: A phase I/II clinical trial. Eur Urol 38, 208–17. Mabjeesh N J, Simons J W (2002). Gene therapy of prostate cancer: current and future directions. Endocrine-Related Cancer 9, 115-39. Nuyts S VML, Theys J, Landuyt W, Lambin P, Anné J (2002). Clostridium spores for tumor-specific drug delivery. Anticancer Drugs 13, 115-25. Niethammer AG, Xiang R, Becker JC, et al (2002). A DNA vaccine against VEGF receptor 2 prevents effective angiogenesis and inhibits tumor growth. Nat Med 8, 1369-75. Ohtani H (1998). Stromal reaction in cancer tissue: pathophysiologic significance of the expression of matrixdegrading enzymes in relation to matrix turnover and immune/inflammatory reactions. Pathol Int 48,1-9. Pouysségur J DF, Mazure NM (2006). Hypoxia signalling in cancer and approaches to enforce tumour regression. Nature 441, 43743. Petrulio CA, Kim-Schulze S, Kaufman HL (2006). The tumour microenvironment and implications for cancer immunotherapy. Expert Opin Biol Ther 6, 671-84. Pule BC, Heslop HE (2002). Genetically engineered T-cells for adoptive immunotherapy. Curr Opin Mol Ther ; 4, 467-75. Philip W, Wong CL, Ian F (2005). Tannock Reduction of Intracellular pH as a Strategy to Enhance the pH-Dependent Cytotoxic Effects of Melphalan for Human Breast Cancer Cells Clinical Cancer Research 11, 3553-7. Palucka AK, Joseph W F, Jacques B (2007). Taming cancer by inducing immunity via dendritic cells. Immunological Reviews 220, 129-50. Roth MD, Gitlitz BJ, Kiertscher SM, et al (2000). Granulocyte macrophage colony-stimulating factor and interleukin 4 enhance the number and antigen-presenting activity of circulating CD14+ and CD83+ cells in cancer patients. Cancer Res 60, 1934–41. Rafiq K, Bergtold A, Clynes R (2002). Immune complex-mediated antigen presentation induces tumor immunity. J Clin Invest 110, 71–79. Reilly RT, Gottlieb MB, Ercolini AM, et al (2000). HER-2/neu is a tumor rejection target in tolerized HER-2/neu transgenic mice. Cancer Res 60, 3569-76. Rosenberg SA, Zhai Y, Yang JC, et al (1998). Immunizing patients with metastatic melanoma using recombinant adenoviruses encoding MART-1 or gp100 melanoma antigens. J Natl Cancer Inst 90, 1894–1900. Ramshaw IA, Ramsay AJ (2000). The prime-boost strategy: Exciting prospects for improved vaccination. Immunol Today 21, 163–5. Rosenberg SA, Spiess P, Lafreniere R (1986). A new approach to the adoptive immunotherapy of cancer with tumor-infiltrating lymphocytes. Science 233, 1318–1321. Rosenberg SA, Lotze MT, Muul LM, et al (1987). A progress report on the treatment of 157 patients with advanced cancer using

lymphokine-activated killer cells and interleukin-2 or high-dose interleukin-2 alone. N Engl J Med 316, 889–97. Ribas A, Butterfield LH, Economou JS (2000). immunotherapy for cancer. Oncologist 5, 87–98.

Genetic

Shicang Y, Guijun H, Guisheng Q, Yuying L, Guoming W, Ruiling G (2007). Efficacy of chemotherapeutic agents under hypoxic conditions in pulmonary adenocarcinoma multidrug resistant cell line. J Chemother 19, 203-11. Suciu-Foca N, Manavalan JS, Cortesini R (2003). Generation and function of antigen-specific suppressor and regulatory T cells. Transpl Immunol 11, 235-44. Sallusto FA (1994). Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 179, 1109-18. Steinman RM, Turley S, Pierre P, Mellman I (1999). Antigen capture, processing, and presentation by dendritic cells: recent cell biological studies. Hum Immunol 60,562-7. Seo N, Hayakawa S, Takigawa M, Tokura Y (2001). Interleukin-10 expressed at early tumour sites induces subsequent generation of CD4(+) T-regulatory cells and systemic collapse of antitumour immunity. Immunology 103, 449-57. Sioud M FG, Cekaite L (2007). Suppression of immunostimulatory siRNA-driven innate immune activation by 2'-modified RNAs. Biochem Biophys Res Commun 361, 122-6. Shakhar Guy B-ES (2003). Potential Prophylactic Measures Against Postoperative Immunosuppression: Could They Reduce Recurrence Rates in Oncological Patients? . Annals of Surgical Oncology 10, 972-92. Sondak VK, Liu PY, Tuthill RJ, et al (2002). Adjuvant immunotherapy of resected, intermediate-thickness, nodenegative melanoma with an allogeneic tumour vaccine: Overall results of a randomized trial of the Southwest Oncology Group. J Clin Oncol 20, 2058–66, Sobol RE, Fakhrai H, Shawler D, et al (1995). Interleukin-2 gene therapy in a patient with glioblastoma. Gene Ther 2, 164–7. Shibata T GAJ, Brown J M (2000). Development of a hypoxiaresponsive vector for tumor-specific gene therapy. Gene therapy 7, 493-8. Tatum JL, Kelloff GJ, Gillies RJ, et al (2006). Hypoxia: importance in tumor biology, noninvasive measurement by imaging, and value of its measurement in the management of cancer therapy. Int J Radiat Biol 82, 699-757. Tlsty TD, Hein PW (2001). Know thy neighbor: stromal cells can contribute oncogenic signals. Curr Opin Genet Dev 11, 54-9. Trédan O GC, Patel K, Tannock IF (2007). Drug resistance and the solid tumor microenvironment. J Natl Cancer Inst 99, 144154. Tamada K, Tamura H, Flies D, et al (2002). Blockade of LIGHT/LTbeta and CD40 signaling induces allospecific T cell anergy, preventing graft-versus-host disease. J Clin Invest 109,549-57. Van Pel A, Boon T (1982). Protection against a nonimmunogenic mouse leukemia by an immunogenic variant obtained by mutagenesis. Proc Natl Acad Sci USA 79, 4718-22 von Euler H, Sadeghi A, Carlsson B, et al (2008). Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma. J Immunother 31, 377-84. Wu W, Luo Y, Sun C, et al (2006). Targeting cell-impermeable prodrug activation to tumor microenvironment eradicates multiple drug-resistant neoplasms. Cancer Res 66:970-80.

Gene Therapy and Molecular Biology Vol 13, page 52 Welters MJ, Kenter GG, Piersma SJ, et al (2008). Induction of tumor-specific CD4+ and CD8+ T-cell immunity in cervical cancer patients by a human papillomavirus type 16 E6 and E7 long peptides vaccine. Clin Cancer Res 14, 178-87. Wagner E (2007). Converging Paths of Viral and Non-viral Vector Engineering. Molecular Therapy 16, 1-2. Wolff JA, Malone RW, Williams P, et al (1990). Direct gene transfer into mouse muscle in vivo. Science 247, 1465–8,.

Wolfers J, Lozier A, Raposo G, et al (2001). Tumor-derived exosomes are a source of shared tumor rejection antigens for CTL cross-priming. Nat Med 7, 297–303. Yang W, Chen PW, Li H, Alizadeh H, Niederkorn JY (2008). PDL1: PD-1 Interaction Contributes to the Functional Suppression of T-Cell Responses to Human Uveal Melanoma Cells In Vitro. Invest Ophthalmol Vis Sci 49, 2518-25. Zitvogel L, Regnault A, Lozier A, et al (1998). Eradication of established murine tumors using a novel cell-free vaccine: Dendritic cell-derived exosomes. Nat Med 4, 594–600.

Gene Therapy and Molecular Biology Vol 13, page 53 Gene Ther Mol Biol Vol 13, 53-63, 2009

Non-viral and local gene medicine for improvement of cutaneous wound healing Review Article

Markus Rimann1, Heike Hall1* 1

Cells and BioMaterials, Department of Materials, ETH Zurich, Zurich, Switzerland

__________________________________________________________________________________ *Correspondence: Heike Hall, ETH Zurich, Department of Materials, HCI E415, Cells and BioMaterials, Wolfgang-Pauli-Strasse 10, CH-8093 Zurich, Switzerland; Tel: +41 44 633 69 75; Fax: +41 44 632 10 73; email: heike.hall@mat.ethz.ch Key words: wound healing, local gene therapy, gene medicine, non-viral gene delivery systems, matrix-mediated gene delivery, PLL-gPEG nanoparticles Abbreviations: adeno-associated viruses, (AAV); early endosome antigen-1, (EEA-1); extracellular matrix, (ECM); hypoxia-inducible factor, (HIF); HIF-1! lacking the oxygen-sensitive degradation domain (HIF-1!!ODD); Low-level laser therapy, (LLLT); matrix metalloproteinases, (MMPs); negative pressure wound therapy, (NPWT); platelet-derived growth factor, (PDGF); poly(ethylene glycol), (PEG); poly(lactide-co-glycolide), (PLGA); polyethylenimine, (PEI); poly-L-lysine, (PLL); transferrin receptor, (TFR); US Food and Drug Administration, (FDA); vacuum-assisted closure, (VAC); vascular endothelial growth factor-A, (VEGF-A) Received: 23 March 2009; Revised: 01 April 2009 Accepted: 03 April 2009; electronically published: April 2009

Summary Deficient vascularisation is a major clinical incidence and affects wound healing especially in elderly people as well as in diabetes patients. Many studies and different technologies aim to locally increase blood perfusion and improve the endogenous wound healing capacity and thereby ameliorate the patientâ&#x20AC;&#x2122;s life quality. Gene therapy has gained a lot of attention for treatment of chronic diseases, cancer and genetic disorders. It is also considered as a valuable alternative for conventional protein therapy, since it overcomes inherent problems that are associated with administration of protein drugs in terms of bioavailability, systemic toxicity, in vivo clearance rate and manufacturing costs. For this reason safe and efficient delivery systems for therapeutic DNA are developed. Polycationic substances have been shown to form complexes with DNA and are widely used as an attractive alternative to viral vectors in gene therapy. One promising approach consists in the usage of grafted copolymers of poly-L-lysine (PLL) and poly(ethylene glycol) (PEG) that forms stable complexes with plasmid DNA, which are highly transfection-efficient and are suitable to deliver DNA from 3D-fibrin wound healing matrices. A gene of interest to be delivered should stimulate endogenous wound healing and may consist of a stabilized form of hypoxiainducible factor-1! (HIF-1!!ODD), a transcription factor that ultimately leads to the increase in vascular endothelial growth factor-A (VEGF-A) expression that in turn activates angiogenesis followed by wound healing. Local administration of a matrix-mediated DNA delivery system on cutaneous wounds will be a big step in the direction of specific gene medicine and might represent a powerful tool in clinical wound therapy.

al, 2004; Anscher and Vujaskovic, 2005), (for review: Branski et al, 2007; Eming et al, 2007; Jensen, 2007). Since these risk factors affect large proportions of the aging population, the need of an adequate approach to treat impaired wound healing e.g. by locally increasing the blood perfusion seems essential. Worldwide approximately twenty million people suffer from chronic wounds caused by diabetes (alone > 7 million diabetic ulcers), circulatory problems and many other conditions such as surgical site infections that generate huge demands on the health care systems (http://www.prlog.org /10076809-wound-types-and-advanced-wound-products-

I. Introduction For most people, wound healing is a natural process of repair, which follows injuries of the skin and other soft tissues. For diseased individuals, however, it becomes a complex medical problem requiring specialized treatment and care. Together with many local factors that impede the healing process such as trauma, edema and infections, many systemic factors also contribute to impair wound healing processes. Among them are age, chronic diseases, such as diabetes mellitus, vascular insufficiencies, immunosuppressant and radiation therapy (Gosain and DiPietro, 2004; Hausman and Rinker, 2004; Jeffecoate et 53

Rimann and Hall: Gene therapy in wound healing market-worldwide). In Europe only, diabetic patients exceed 30 million people and cause 5-10 % of the total health care costs (www.idf-europe.org). Therefore, therapeutic improvements of wound healing especially by increasing the patientsâ&#x20AC;&#x2122; endogenous wound healing potentials are highly appreciated by the patients themselves and by the entire society.

platelet-derived growth factor (PDGF). Therefore the chronic wound displays a destructive environment that is not favorable for wound healing.

III. Treatment of chronic wounds Treatment of wounds can be divided into physical and biological methods. The physical treatments include surgical debridement, vacuum-assisted closure (VAC) therapy and low level laser treatments. Surgical debridement involves the removal of necrotic tissue out of the wound bed. This may eventually lead to a reset of the disturbed sequence of wound healing processes (Falanga, 2004, 2005). Clinical success of these methods is assigned to a reduction of excess of wound fluid, edema and exudate. Furthermore the putative bacterial burden and phenotypically abnormal cells are removed. In vacuumassisted closure therapy also termed negative pressure wound therapy (NPWT), a controlled level of negative pressure of -80 to -125 mmHg is applied on the wounds leading to accelerated debridement and promotion of healing in many different types of wounds (Saxena et al, 2004; Lindstedt et al, 2006; Jones et al, 2005; Kanakaris et al, 2007; KĂśrber et al, 2008; Labanaris et al, 2008). The underlying mechanisms of NPWT suggest mechanical deformation of cells in and around the wound resulting in increased matrix synthesis, which ultimately leads to an improved wound healing (Saxena et al, 2004; Wilkes et al, 2007; Eneroth and van Houtum, 2008; Ennis et al, 2008; Jacobs et al, 2008). Low-level laser therapy (LLLT) has been introduced by Mester and colleagues in 1968 and uses a single, coherent, monochromatic wavelength of light. The power varies from 5 to 500 mW and the emission wavelength is between 600 to 1000 nm. It has been shown that LLLT led to increased production of procollagen by human skin fibroblasts, increased fibroblast and keratinocyte proliferation, increased angiogenesis, tension resistance of scars and improved epithelialization (Sobanko and Alster, 2008). Another way to treat wounds and improve their healing capacities is to use specialized and bioactive wound dressings either made of molecules from the ECM or of synthetic polymers. Many dressings are already commercially available and are composed of collagen, hyaluronic acid, amelogenins, chondroitin-6-sulphate and fibrin. The compositions, functionalities and their applications have been recently reviewed in (Agren and Werthen, 2007). Some of the dressings combine ECM molecules with exogenously applied cells, such as human fibroblasts, autologous human keratinocytes and allogenic human fibroblasts. These bioactive dressings have been recently reviewed in (Boateng et al, 2008). Today more and more dressings are composed of polymeric molecules either artificial or of natural origin. The idea is to simulate the native ECM of the wound site and adjacent tissue using water swollen, gas permeable and fibrillar polymer structures that allow gas and nutrient exchange. Often used polymers are poly(lactide-co-glycolide) (PLGA), poly(vinyl pyrrolidone), poly(vinyl alcohol), polyurethane foams, hydrocolloid and alginate dressings (reviewed in (Boateng et al, 2008)). Other hydrogel dressings are made of native polymers such as hyaluronic acid, collagen,

II. Wound healing Wound healing is a highly dynamic process related to growth and tissue regeneration and involves complex interactions of extracellular matrix (ECM) molecules, soluble mediators, various resident cells and infiltrating cells to reachieve tissue integrity (Singer and Clark, 1999; Baum and Arpey, 2005; Gurtner et al, 2008). Wound healing comprises four overlapping phases: hemostasis and inflammation, migration, proliferation and maturation (Gurtner et al, 2008). Details about the overlapping phases of wound healing are available in excellent recent reviews (Baum and Arpey, 2005; Barrientos et al, 2008; Gurtner et al, 2008) and will not be repeated here. The focus of this review will be on elucidating impaired wound healing that results when the well-orchestrated sequence of events is disturbed or stopped and non-healing or chronic wounds develop.

A. Impaired wound healing Wounds can be categorized into two different types distinguished by their healing properties: i) The acute wound follows the well-orchestrated phases of inflammation, new tissue formation and remodeling leading to tissue repair and scar formation, whereas ii) chronic wounds fail to heal within the expected time frame, which arises from the disruption of the orderly sequence of events at one or more stages in the wound healing process. In order to ensure an effective wound repair, interfering factors such as diseases (e.g. diabetes mellitus), drug therapies (e.g. growth factor delivery) and patient circumstances (e.g. pressure sores because of neuropathy), wounds in immunocompromised people (after systemic chemotherapy and/or radiation therapy, chronic steroid use) must be all taken into considerations (Boateng et al, 2008). In addition, aged people often show slowed or impaired wound healing even without an underlying disease (Swift et al, 2001). On the molecular level chronic wounds display a deficiency of endogenous growth factors (Pierce et al, 1995; Jeffecoate et al, 2004; Whitney, 2005) or an excessive production of exudate and expression of high levels of tissue-degrading proteases creating a destructive non-healing-promoting wound environment (Fahey et al, 1991; Loots et al, 1998). Often prolonged inflammation, impaired neovascularization, decreased synthesis of collagen, increased levels of proteases and defective macrophage function are observed (Fahey et al, 1991; Loots et al, 1998; Branski et al, 2007; Bao et al, 2008). In the case of prolonged inflammation the upregulation of neutrophils leads to increased secretion of matrix metalloproteinases (MMPs) that are imbalanced because of the lack of their natural inhibitors. Furthermore the mitogenic activity of cells is suppressed because of missing growth factors that promote proliferation such as 54

Gene Therapy and Molecular Biology Vol 13, page 55

A. Gene delivery systems

chitosan and fibrin (reviewed in (Boateng et al, 2008)). Hydrogel dressings can be loaded with therapeuticallyactive substances in order to achieve a controlled and sustained release thereby avoiding multiple interventions by changing the wound dressing several times. Commonly used are bactericides such as silver ions, antibiotics, or antimicrobial peptides and different growth factors. In order to support physical wound therapies significant efforts have been made to develop protein growth factors as wound healing therapeutics. First clinical trials were performed with exogenous application of growth factors like platelet-derived growth factor (PDGF) and others (Robson et al, 2001; Steed, 2006; Viswanathan et al, 2006). So far only PDGF-BB has received approval by the US Food and Drug Administration (FDA) but solely for the treatment of diabetic foot ulcers (Margolis et al, 2004; Robson et al, 2001; Steed, 2006; Viswanathan et al, 2006). Unfortunately, these efforts have not produced clinically significant improvements. The overall lack of success with protein growth factors has been attributed in part to short persistence of the growth factor in the protease-rich environment of the wound bed as only 1-9 % of the applied growth factor dose reached a depth of 1-3 mm (Trengove et al, 1999; Yager and Nwomeh, 1999). This required repeated applications of growth factors that are very costly to produce. Further difficulties are associated with the wound healing process itself as it is very complex and involves many different growth factors acting in concert and need to succeed one after the other thus being very difficult to simulate by application of single therapeutics.

Viral gene delivery systems use recombinant viruses, such as retroviruses (including lentiviruses), adenoviruses and adeno-associated viruses (AAV) containing therapeutic DNA (Breckpot et al, 2007; Flotte, 2007; Stender et al, 2007). Due to their inherent cell infection ability these gene delivery systems are very efficient and transduce dividing and some of them also non-dividing cells. Thus most of the clinical trials used viral delivery systems for gene therapy (http://www.wiley.co.uk/genetherapy/clinical/). Recent reviews summarize applications of viral vectors for cutaneous wound healing in animal and human studies (Branski et al, 2007; Eming et al, 2007; Jensen, 2007). Unfortunately viruses have several drawbacks such as high immunogenicity, packaging size limitations and some of them show random integration into the host genome, which leads to non-controllable side effects (Wu and Burgess, 2004). Therefore, many non-viral gene delivery vehicles have been designed to overcome the inherent limitations of viral vectors. Non-viral gene delivery systems may consist of naked DNA transfer, lipid-mediated, peptidemediated and polymer-mediated condensation of therapeutic DNA that lead to an improved cellular uptake (Panyam and Labhasetwar, 2003; Wells, 2004; Trentin et al, 2005; Park et al, 2006; Jeon et al, 2006; Gao et al, 2007; Shigeta et al, 2007). The major limits of these nonviral vectors are their poor in vivo transfection efficiencies resulting in low protein production, as well as their transient gene expression profile, which in some cases such as in wound healing, is desirable. The benefits of non-viral gene delivery vehicles are their safety and their unlimited gene size transportation capacity (Tal, 2000). Currently three different strategies for non-viral applications of therapeutic DNA are pursued. The simplest way is the use of naked DNA, which is either injected directly into the target tissue (Liu et al, 2007), applied via electroporation or ultrasound (Kusumanto et al, 2007) or loaded onto nano-sized particles of heavy metal and brought into the cell by gene gun applications (Kuriyama et al, 2000). Alternatively, microseeding delivers DNA directly into target cells by solid microneedles (Eriksson et al, 1998). However, enzymatic degradation of the unprotected DNA and poor cell transfection efficiencies are the major drawbacks (Liu et al, 2007). Another approach is the use of lipoplexes that are lipid-based DNA vehicles, entering the cytoplasm by cell membrane fusion (Felgner et al, 1987; Lv et al, 2006). Many different modifications for specific cell targeting and intracellular routing have been developed (Kawakami et al, 2000; Vandenbroucke et al, 2007). However, the primary drawback of lipid-based DNA delivery systems is their rapid clearance from the blood stream and their short-term stability (Lai and van Zanten, 2002). Another group of DNA-complexing substances consists of polycationic molecules such as PLL, poly-Lornithine or polyethylenimine (PEI) that have been previously demonstrated to be used as gene delivery vehicles (Ramsay et al, 2000; Pichon et al, 2001; Davis, 2002; Zaitsev et al, 2004) for review see: (Park et al,

IV. Gene therapy/gene medicine to improve wound healing In recent years, gene therapy has been evaluated as an alternative approach in wound therapy (Chandler et al, 2000; Petrie et al, 2003; Eriksson and Vranckx, 2004; Keswani et al, 2004; Theopold et al, 2004; Yla-Herttuala et al, 2004; Glover et al, 2005). Two different strategies are distinguished concerning the introduction and time of foreign gene expression: gene therapy that refers to the permanent substitution of a defect or missing gene whereas gene medicine leads to transient transformation and short term expression of a gene product (Morgan and Anderson, 1993; Khavari et al, 2002). As genes encoding for a growth factor or a defective protein could be placed into the wound milieu (reviewed by: (Hirsch et al, 2007; Davidson, 2008)), sustained local production of the growth factor might yield improvements over purely proteinbased therapies. Advantages of gene-based as compared to protein-based therapies are longer life times of applied genes and therefore prolonged expression of the therapeutic protein, immunological tolerance and faster and easier production and storage of the components that might finally lead to a reduction in costs for the health care systems. Gene therapy and gene medicine use a number of different DNA delivery systems that can be divided into two major groups: namely viral and non-viral delivery systems.

Rimann and Hall: Gene therapy in wound healing 2006). Although polymers with high cationic charge density condense the DNA into structures amenable to cellular internalization via endocytosis, the high charge density is one factor that contributes to their cytotoxicity (Wagner et al, 1998; Lee et al, 2002). To reduce cytotoxicity different block-copolymers between PEG and PLL, PEG and PEI as well as PEG and poly-aspartic acid were used to form DNA-vehicles (Choi et al, 1998; Ramsay et al, 2000; Davis, 2002; Lee et al, 2002; Mishra et al, 2004; Zaitsev et al, 2004; Dhanikula and Hildgen, 2006; Park et al, 2006; Walsh et al, 2006). Moreover, peptide-based DNA-vectors or covalent complexes between PEG-peptides and PEG-glycopeptides were developed (Pichon et al, 2001; Kwok et al, 2003; Trentin et al, 2006; Chen et al, 2007). On the other hand, low cationic charge density can reduce or eliminate DNA condensation capability. The balance between cationic charge density and DNA condensation is complicated even further when endosomal escape moieties and nuclear membrane translocation sites are considered. However, inherent cytotoxicity of polycationic PLL-DNA condensates can be circumvented by forming polymerDNA nanoparticles using grafted copolymers of PLL and PEG to increase biocompatibility and stealth properties. PLL-g-PEG-DNA nanoparticles were demonstrated to be a promising tool for effective transport and delivery of therapeutic DNA as they show long-term stability, a hydrodynamic diameter of 80-90 nm and high transfection efficiency of ~ 40 % combined with low cytotoxicity (> 95 % of cell viability) in COS-7 cells (Rimann et al, 2008) (Figure 1).

Currently, however, the greatest hurdle to actual realization of in vivo gene therapy is the development of efficacious delivery systems. Gene expression only results when DNA is transported inside the nucleus of the target cell. On its way the DNA needs to cross several biological barriers beginning with the plasma membrane, followed by intracellular pathways, escaping endosomal degradation and finally entering the nucleus to be at the location where mRNA-transcription takes place in eukaryotic cells. PEGylation of PLL-g-PEG-DNA nanoparticles contributes to DNA-nanoparticle uptake as cellular uptake into COS-7 cells was found to be strongly dependent on PEG-grafting. PLL-g-PEG-DNA nanoparticles entered COS-7 cells by an energy-dependent mechanism in the first 2 h of transfection and later the nanoparticles accumulated in the perinuclear region preceding nuclear uptake (Figure 2a, b). Furthermore, PLL-g-PEG-DNA nanoparticles were found within the cytoplasm at least for 24 h and no colocalization with endosomal compartments, as indicated by fluorescence staining against early endosome antigen-1 (EEA-1) or by colocalization with markers for known endocytotic pathways such as GM1, transferrin receptor (TFR) and caveolin-1 was observed (Figure 2c; Luhmann et al, 2008). These experiments indicate that PLL-g-PEG-DNA nanoparticles translocate efficiently to the nucleus and eventually enter to express the gene of interest. However, the exact uptake mechanism and intracellular pathway(s) remain still unclear. In spite of that PLL-g-PEG-DNA nanoparticles are considered as fast and

Figure 1. (a) Schematic of a PLL-grafted with PEG side chains used to form DNAcontaining nanoparticles; (b) Negative staining transmission electron micrograph of PLL20-g5PEG5-DNA nanoparticles; (c) Left: Transfection efficiency of PLL20-g5-PEG5-DNA nanoparticles in COS-7 cells, middle: Cell viability of COS-7 cells that were transfected with PLL20-g5-PEG5-DNA nanoparticles and right: Hydrodynamic diameter of PLL20-g5-PEG5-DNA nanoparticles with time. Adapted from Rimann et al, 2008 with kind permission.

Gene Therapy and Molecular Biology Vol 13, page 57

Figure 2. (a) Relative transfection efficiency of PLL20-g5-PEG5-DNA nanoparticles in COS-7 cells. The uptake is temperaturedependent. (b) Colocalization of PLL20-g5-PEG5-FITC and CX-rhodamine-labeled pEGFP-N1 (DNA-CX-rh) in COS-7 cells. Blue: Hoechst-stained nuclei, green: PLL20-g5-PEG5-FITC and red: DNA-CX-rh, yellow: Colocalization of PLL20-g5-PEG5-FITC and DNACX-rh (c) Colocalization of PLL20-g5-PEG5-DNA nanoparticles with GM1, TFR, caveolin-1 or EEA-1, respectively. Nanoparticles were prepared and applied on COS-7 cells between 30 min and 24 h as indicated. Later cells were fixed and analyzed by confocal microscopy. Blue: Hoechst-stained nuclei, green: different endocytosis markers and red: DNA-CX-rh, Scale bars are 10 Âľm, Adapted from Luhmann et al, 2008 with kind permission.

efficient delivery vehicles of plasmid DNA combined with low cytotoxicity and might be used to deliver relevant therapeutic DNA to improve local wound healing.

matrices such as fibrin, chitosan, hyaluronan, gelatine or collagen were used in various applications to increase wound repair and angiogenesis by releasing growth factors and other bioactive molecules (Zisch et al, 2003; Ishihara et al, 2006b; Masayuki et al, 2006a; Pike et al, 2006) reviewed in: (Ruszczak and Friess, 2003; Wallace and Rosenblatt, 2003; Young et al, 2005; Ishihara et al, 2006a). 3D-Fibrin matrices are among the most often used native hydrogels to induce angiogenesis and/or as drug delivery systems. Although fibrin is derived from human blood, it is FDA-approved because of its very favourable wound healing-inductive capacities (Zilla, 1991; Zilla et al, 1994; Currie et al, 2001; Horch et al, 2001). In the healthy body, fibrinogen circulates as an inactive precursor in the blood stream and is recruited to the site of the injured vasculature where it leaks out into the surrounding tissue. Fibrin clots are formed by initial physical association followed by covalent cross-linking through the concerted activity of thrombin and factor XIIIa (Weisel et al, 1985; Ariens et al, 2002; Lorand and Graham, 2003; BlombĂ¤ck and Bark, 2004; Mosesson, 2005). The fibrin clot is a complex network, composed of fibrils with different diameter and strength and provides a natural wound healing matrix that is remodelled through cellular activities to form the tissue-specific mature ECM. Because of its favourable wound healing-inducing properties and its clinical availability fibrin has been used

B. Matrix-released gene delivery Hydrogel matrices are highly swollen threedimensional cross-linked structures. They are mechanically flexible and can simulate the natural ECM to a certain extent. These matrices provide a versatile platform for molecular interactions with target tissues since they are composed of native or synthetic monomers that can be covalently modified with biologically active signals such as adhesion sequences or growth factors (Zisch et al, 2003; Pike et al, 2006). Moreover, hydrogel matrices are usually composed of soluble precursor solutions that can be applied at the site of injury by minimal invasive methods. They are induced to polymerize in situ under very mild conditions. In addition to their structural similarity to the native ECM, hydrogel matrices can be used as depots for drugs that are released by hydrolytic degradation of the hydrogel or on specific cellular demand (Drury and Mooney, 2003; Zisch et al, 2003; Ehrbar et al, 2005) reviewed in (Lutholf and Hubbell, 2005). Hydrogel release systems have been explored for delivery of bFGF from peptide amphiphiles to increase subcutaneous neovascularization (Hosseinkhani et al, 2006). Moreover, native hydrogel 57

Rimann and Hall: Gene therapy in wound healing as a drug delivery matrix. Different forms of VEGF alone or in combination with bFGF have been included into fibrin sealant products and were examined for their potential to induce neovascularization in vitro and in vivo (Wong et al, 2003). Growth factor release from fibrin hydrogels was controlled by using different fibrin concentrations, various cross-link densities, precipitation of growth factors by heparin or growth factor-containing heparin-conjugated poly(L-lactide-co-glycolide) nanospheres or other polymer microspheres (Keshet and Ben-Sasson, 1999; Royce et al, 2004; Jeon et al, 2005, 2006). Moreover, fibrin matrices were also used as adenoviral gene transfer and controlled delivery matrices (Breen et al, 2008a, b, 2009). Here, PLL-g-PEG-DNA nanoparticles were included into 3D-fibrin matrices and released over 7 days. The released PLL-g-PEG-DNA nanoparticles were collected and used for transfection of COS-7 cells (Figure 3). Transfection efficiency with released PLL-g-PEG-DNA nanoparticles was very similar to freshly prepared PLL-g-PEG-DNA nanoparticles suggesting that inclusion and release of these nanoparticles did not affect functionality.

PLGF, angiopoietins (ANGPT1, ANGPT2), and plateletderived growth factor B (PDGF-B; (Kelly et al, 2003; Pugh and Ratcliffe, 2003; Paul et al, 2004; Patel et al, 2005; Mace et al, 2007). Heterodimers of HIF-1! and HIF-1" subunits are constitutively expressed. HIF-1" is translocated into the nucleus, whereas HIF-1! possesses an oxygen-sensitive degradation domain (ODD), spanning from residues 401 to 603 (Huang et al, 1998). This domain is prolyl-hydroxylated in an oxygen-dependent manner (Bruick and McKnight, 2001) leading to binding of the von Hippel-Lindau protein, which then targets HIF-1! for ubiquitination and degradation in the proteosome (Huang et al, 1998). As such, under normoxia, HIF-1! is rapidly degraded in the cytoplasm and its nuclear localization is competitively inhibited, whereas under hypoxia, the factor is free to enter the nucleus and dimerizes with HIF-1" to induce gene expression leading to induction of proangiogenic proteins. Interference with the process of HIF-1! degradation under normoxia can induce effects related to hypoxia. HIF-1! expression is induced during wound healing (Albina et al, 2001; Elson et al, 2001) and is impaired in dermal fibroblasts and endothelial cells exposed to increased glucose concentrations (Catrina et al, 2004). HIF-1! expression was impaired during the healing of large cutaneous wounds in young db/db mice and HIF-1! gene therapy accelerated wound healing and angiogenesis in this model (Mace et al, 2007). Based on the important role of HIF-1! in expression of proangiogenic proteins, plasmid DNA encoding a stabilized variant HIF-1!"ODD (HIF-1! lacking the oxygen-sensitive degradation domain) was cloned and was shown to stimulate production of

C. Transcription factor HIF-1! to induce wound healing Until now most approaches used physical entrapment of bioactive molecules to be delivered from 3D-fibrin matrices whereas our laboratory included cellular activity for local and controlled release of DNA-nanoparticles directly into the wound site. Transcription factor hypoxiainducible factor (HIF) plays a central role in the induction of angiogenesis since it is primarily responsible for the detection of hypoxia and induces production of VEGF-A,

Figure 3. PLL-g-PEG-DNA nanoparticle release from 3D-fibrin wound healing matrices. (a) 2 mg/ml 3D-fibrin matrices were produced and visualized by confocal microscopy using Oregon-green-conjugated fibrinogen in a ratio of 1:50. The scale bar is 8 Âľm. In green, schematics of PLL-g-PEG-DNA nanoparticles included into such matrices (not to scale); (b) PLL20-g5-PEG5-DNA nanoparticle release over time as compared to release of naked plasmid DNA; (c) Transfection efficiency of PLL20-g5-PEG5-DNA nanoparticles released from fibrin matrices. Reproduced from Masters Thesis, Yanhong Wen, ETH Zurich, HS08.

Gene Therapy and Molecular Biology Vol 13, page 59 VEGF-A from HEK 293T cells in vitro (Trentin et al, 2006). Another study used a different variant of HIF-1! encoding a constitutively active form, designated HIF1!CA5, which induces HIF-1-regulated gene expression also under non-hypoxic conditions (Kelly et al, 2003; Patel et al, 2005; Mace et al, 2007). The study demonstrated that transfection with HIF-1!CA5 by electroporation into cutaneous wounds corrected the age-dependent reduction of HIF-1 expression, angiogenic cytokine expression, and the number of circulating angiogenic cells that contribute to the age-dependent impairment of wound healing in db/db mice (Liu et al, 2008). When HIF-1!!ODD was complexed by peptides that contained an N-terminal transglutaminase substrate sequence (TG-peptide) the entire TG-peptide-DNA condensate could be covalently incorporated into fibrin matrices through the activity of transglutaminase factor XIIIa. For covalently-immobilized TG-peptide-DNA condensates prolonged release profiles were observed as compared to released naked HIF1!!ODD plasmid DNA (Trentin et al, 2006). Moreover, when TG-peptide-DNA condensates were applied to full thickness dermal wounds on normal mice, 50 % more newly formed blood vessels as compared to native 3Dfibrin matrices, were observed and nearly 50 % of these vessels were surrounded by smooth muscle cells indicating a high degree of differentiation and maturation (Figure 4, Trentin et al, 2006). These experiments suggest that depot and release of angiogenesis-stimulating substances from modified 3D-fibrin matrices are indeed able to affect the number and the quality of newly formed blood vessels in vivo. As formation of new differentiated blood vessels are a prerequisite for successful wound healing, this approach might be a potential avenue to go towards improvement of wound healing.

transfection efficiencies combined with low cytotoxicity and long shelf live, which is a requirement for potential clinical use. The use of naked DNA is mainly hampered because of the need of special equipment to introduce it into the wound site, such as electroporation and ultrasound devices, gene guns and special needles for microseeding, furthermore naked DNA is not stable in the destructive wound environment and often degrades very fast. Most of the non-viral gene delivery systems also suffer from the short persistence in the wound environment due to fast clearance as long as they are not protected and/or embedded in a 3D-hydrogel matrix thus mimicking the native ECM. Therefore several approaches combine matrix-mediated delivery of naked DNA, DNA-containing condensates or of viral delivery systems. The idea is to obtain a sustained and controlled release of DNA over an extended period of time within the destructive environment of the chronic wound. Such matrix-mediated gene delivery systems might be a solution to overcome the very short live span of directly applied protein growth factors as well as the problem of dosage. When therapeutic DNA is released only by matrix degradation an initial burst-release can be avoided and might not lead to overshooting initial responses, which have been shown for burst-released therapeutics. Moreover, several rodent animal models were developed to test normal and impaired wound healing in vivo (reviewed by (Branski et al, 2007; Eming et al, 2007). The success seems encouraging and might lead to transfer into human clinical trials. However, more general considerations have to be made when turning to the bedside of human patients. Preclinical models often rely on young, healthy animals or artificially induced diseased animals, which might have a biological response that is fundamentally different from that in elderly human patients with advanced stages of arteriosclerosis, diabetes mellitus or other kinds of

V. Conclusions Many studies are ongoing in developing numerous non-viral gene delivery systems that gain more and more complexity. In vitro and in vivo studies show increased

Figure 4. Non-viral delivery of HIF-1#!ODD plasmid DNA increases formation and differentiation of newly formed blood vessels in cutaneous wounds in the back skin of normal mice. Wounds were placed and filled with 3D-fibrin matrices containing either TGpeptide-condensates with HIF-1#!ODD plasmid DNA or VEGF-A165 as a protein. Native fibrin was used as a control. The wounds were left for healing for 1 week prior to histological analysis. (a) Quantity of newly formed blood vessels by assessing the number of CD31positive vascular structures; (b) Differentiation of vascular structures was assumed when vascular structures were both: positive for CD31 and !-smooth muscle actin (!-sma). Adapted from Trentin et al, 2006 with kind permission.

Rimann and Hall: Gene therapy in wound healing underlying systemic diseases. In addition, the question remains whether in vitro models can be compared with in vivo experiments in rodent animal models and if the results obtained can then be transferred to human patients. When a comparison between different DNA delivery vehicles in vitro and in vivo was performed, Lipofectamine 2000 and DOTAP/Chol lipoplexes showed significantly enhanced gene transfer in vitro, whereas no transfection was detected for naked DNA. In contrast, naked DNA was found to be most efficient in gene transfer in experimental burn wounds in rats (Steinstraesser et al, 2007). Therefore, it has to be taken into consideration that in vitro test systems offer very limited predictability for subsequent in vivo gene therapy/gene medicine approaches especially when diseased human tissues are addressed. Moreover, transfer from small animal models where cardiovascular diseases such as diabetes mellitus or old age can only be simulated by genetic manipulation, medication or specific inbreeding of several strains, the etiology of impaired wound healing might look comparable to human wounds but the underlying mechanisms can not be compared so easily.

regulatory factors need to be activated at what time. Moreover, it requires joining forces from interdisciplinary researchers coming from medicine, life sciences, pharmaceutical sciences and engineering.

Acknowledgments This study was supported by Gebert R체f Foundation (GRS-053/05), Switzerland.

References Agren MS, Werthen M (2007) The extracellular matrix in wound healing: a closer look at therapeutics for chronic wounds. Int J Low Extrem Wounds 6, 82-97. Albina JE, Mastrofrancesco B, Vessella JA, Louis CA, Henry WL, Jr., Reichner JS (2001) HIF-1 expression in healing wounds: HIF-1alpha induction in primary inflammatory cells by TNF-alpha. Am J Physiol Cell Physiol 281, C1971-1977. Anscher MS, Vujaskovic Z (2005) Mechanisms and potential targets for prevention and treatment of normal tissue injury after radiation therapy. Semin Oncol 32, S86-91. Ariens RAS, LAi TS, Weisel JW, Greenberg CS, Grant PJ (2002) Role of factor XIII in fibrin clot formation and effects of genetic polymorphisms. Blood 100, 743-754. Bao P, Kodra A, Tomic-Canic M, Gelinko MS, Ehrlich HP, Brem H (2008) The role of vascular endothelial growth factor in wound healing. J Surg Res, in press. Barrientos S, Stojadinovic O, Golinko MS, Brem H, TomicCanic M (2008) Growth factors and cytokines in wound healing. Wound Repair Regen 16, 585-601. Baum CL, Arpey CJ (2005) Normal cutaneous wound healing: clinical correlation with cellular and molecular events. Dermatol Surg 31, 674-686; discussion 686. Blomb채ck B, Bark N (2004) Fibrinopeptides and fibrin gel structure. Biophys Chem 112, 147-151. Boateng JS, Matthews KH, Stevens HN, Eccleston GM (2008) Wound healing dressings and drug delivery systems: a review. J Pharm Sci 97, 2892-2923. Branski LK, Pereira CT, Herndon DN, Jeschke MG (2007) Gene therapy in wound healing: present status and future directions. Gene Ther 14, 1-10. Breckpot K, Aerts JL, Thielemans K (2007) Lentiviral vectors for cancer immunotherapy: transforming infectious particles into therapeutics. Gene Ther 14, 847-862. Breen A, Dockery P, O'Brien T, Pandit A (2008a) Fibrin scaffold promotes adenoviral gene transfer and controlled vector delivery. J Biomed Mater Res A, in press. Breen A, O'Brien T, Pandit A (2009) Fibrin as a Delivery System for Therapeutic Drugs and Biomolecules. Tissue Eng Part B Rev, in press. Breen AM, Dockery P, O'Brien T, Pandit AS (2008b) The use of therapeutic gene eNOS delivered via a fibrin scaffold enhances wound healing in a compromised wound model. Biomaterials 29, 3143-3151. Bruick RK, McKnight SL (2001) A conserved family of prolyl4-hydroxylases that modify HIF. Science 294, 1337-1340. Catrina SB, Okamoto K, Pereira T, Brismar K, Poellinger L (2004) Hyperglycemia regulates hypoxia-inducible factor1alpha protein stability and function. Diabetes 53, 32263232. Chandler LA, Gu DL, Ma C, Gonzalez AM, Doukas J, Nguyen T, Pierce GF, Phillips ML (2000) Matrix-enabled gene transfer for cutaneous wound repair. Wound Repair Regen 8, 473-479.

VI. Future perspectives It is well understood that one single growth factor gene therapy/gene medicine cannot stimulate all interlinked phases of wound healing in an orchestrated manner as required. In order to address the complexity of succeeding active factors (growth factors, cytokines and enzymes) acting in normal wound healing processes the strategies must go towards the direction of multiple gene delivery or address key control genes that stimulate entire cascades of complex processes. It was demonstrated in a partial thickness wound healing model that the combination of PDGF and IGF-I was more effective than either growth factor alone (Lynch et al, 1987). Moreover a combination of PDGF and FGF-2 increased the DNA content of wounds in the rat more than any single growth factor alone (Sprugel et al, 1987) and transfection of KGF cDNA in combination with IGF-I cDNA compared to the same genes individually seems to be more efficient than the single genes (Jeschke and Klein, 2004). Alternatively, it was described that specific and local transfection of single key-transcription factor genes such as HIF-1! at strategic time points of wound healing might substitute a sequential growth factor therapy (Trentin et al, 2006; Liu et al, 2008). This single transcription factor might be able to switch on the entire cascade of angiogenesis followed by proper wound healing such that a self-regulating system is activated. Upon such stimulation ideally the patients' endogenous regulatory system would take over and a natural healing response would follow. Another very important aspect for future gene therapy and gene medicine will be to formulate safe and efficient delivery systems that can be controlled by endogenous regulation such as by cellular demand, in addition it might be therapeutically interesting to be able to support the release of therapeutic DNA by external stimuli e.g. by slight temperature or pH change or light of specific wavelengths. However, in order to define such key-genes a lot of basic research is still necessary to find out which 60

Gene Therapy and Molecular Biology Vol 13, page 61 Chen CP, Kim JS, Liu D, Rettig GR, McAnuff MA, Martin ME, Rice KG (2007) Synthetic PEGylated glycoproteins and their utility in gene delivery. Bioconjug Chem 18, 371-378. Choi YH, Liu F, Kim JS, Choi YK, Park JS, Kim SW (1998) Polyethylene glycol-grafted poly-L-lysine as polymeric gene carrier. J Control Release 54, 39-48. Currie LJ, Sharpe JR, Martin R (2001) The use of fibrin glue in skin grafts and tissue-engineered skin replacements: a review. Plast Reconstr Surg 108, 1713-1726. Davidson JM (2008) First class delivery: getting growth factors to their destination. J Invest Dermatol 128, 1360-1362. Davis ME (2002) Non-viral gene delivery systems. Curr Opin Biotechnol 13, 128-131. Dhanikula RS, Hildgen P (2006) Synthesis and evaluation of novel dendrimers with a hydrophilic interior as nanocarriers for drug delivery. Bioconjug Chem 17, 29-41. Drury JL, Mooney DJ (2003) Hydrogels for tissue engineering: scaffold design variables and applications. Biomaterials 24, 4337-4351. Ehrbar M, Metters A, Zammaretti P, Hubbell JA, Zisch AH (2005) Endothelial cell proliferation and progenitor maturation by fibrin-bound VEGF variants with differential susceptibilities to local cellular activity. J Control Release 101, 93-109. Elson DA, Thurston G, Huang LE, Ginzinger DG, McDonald DM, Johnson RS, Arbeit JM (2001) Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor1alpha. Genes Dev 15, 2520-2532. Eming SA, Krieg T, Davidson JM (2007) Gene therapy and wound healing. Clin Dermatol 25, 79-92. Eneroth M, van Houtum WH (2008) The value of debridement and Vacuum-Assisted Closure (V.A.C.) Therapy in diabetic foot ulcers. Diabetes Metab Res Rev 24 Suppl 1, S76-80. Ennis WJ, Meneses P, Borani M (2008) Push-pull therory: using mechanotransduction to achieve tissue perfusion and wound healing in complex cases. Gynecol Oncol 111, S81-S86. Eriksson E, Vranckx J (2004) Wet wound healing: from laboratory to patients to gene therapy. Am J Surg 188, 3641. Eriksson E, Yao F, Svensjo T, Winkler T, Slama J, Macklin MD, Andree C, McGregor M, Hinshaw V, Swain WF (1998) In vivo gene transfer to skin and wound by microseeding. J Surg Res 78, 85-91. Fahey TJ, 3rd, Sadaty A, Jones WG, 2nd, Barber A, Smoller B, Shires GT (1991) Diabetes impairs the late inflammatory response to wound healing. J Surg Res 50, 308-313. Falanga V (2004) The chronic wound: impaired healing and solutions in the context of wound bed preparation. Blood Cells Mol Dis 32, 88-94. Falanga V (2005) Wound healing and its impairment in the diabetic foot. Lancet 366, 1736-1743. Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, Danielsen M (1987) Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci U S A. 84, 7413-7417. Flotte TR (2007) Gene therapy: The first two decades and the current state-of-the-art. J Cell Physiol 213, 301-305. Gao X, Kim KS, Liu D (2007) Nonviral gene delivery: what we know and what is next. AAPS J 9, E92-104. Glover DJ, Lipps HJ, Jans DA (2005) Towards safe, non-viral therapeutic gene expression in humans. Nat Rev Genet 6, 299-310. Gosain A, DiPietro LA (2004) Aging and wound healing. World J Surg 28, 321-326. Gurtner GC, Werner S, Barrandon Y, Longaker MT (2008) Wound repair and regeneration. Nature 453, 314-321.

Hausman MR, Rinker BD (2004) Intractable wounds and infections: the role of impaired vascularity and advanced surgical methods for treatment. Am J Surg 187, 44S-55S. Hirsch T, Spielmann M, Yao F, Eriksson E (2007) Gene therapy in cutaneous wound healing. Front Biosci 12, 2507-2518. Horch RE, Bannasch H, Stark GB (2001) Transplantation of cultured autologous keratinocytes in fibrin sealant biomatrix to resurface chronic wounds. Transplant Proc 33, 642-644. Hosseinkhani H, Hosseinkhani M, Khademhosseini A, Kobayashi H, Tabata Y (2006) Enhanced angiogenesis through controlled release of basic fibroblast growth factor from peptide amphiphile for tissue regeneration. Biomaterials 27, 5836-5844. Huang LE, Gu J, Schau M, Bunn HF (1998) Regulation of hypoxia-inducible factor 1alpha is mediated by an O2dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A 95, 7987-7992. Ishihara M, Kiyohaya O, Nakamura SMF, Masuoka K, Kanatani H, Morimoto Y, Ishihara M, Machara T, Kikuchi M (2006a) Chitosan hydrogel as a drug delivery carrier to control angioenesis. J Artif Organs 9, 8-16. Ishihara M, Masanori F, Kiyohaya O, Hattori H, Kikuchi M, Maehara T (2006b) Controlled release of FGF-2 and paclitaxol from chitosan hdrogels and their subsequent effects on wound repair, angiogenesis, tumor growth. Curr Drug Deliv 3, 351-358. Jacobs S, Simhaee DA, Marsano A, Fomovsky GM, Niedt G, Wu JK (2008) Efficacy and mechanisms of vacuum-assisted closure (VAC) therapy in promoting wound healing: a rodent model. J Plast Reconstr Aesthet Surg, in press. Jeffecoate WJ, Price P, Harding KG (2004) Wound healing and treatments for people with diabetic foot ulcers. Diabetes Metab Res Rev 20(suppl. 1), S79-89. Jensen TG (2007) Cutaneous gene therapy. Ann Med 39, 108115. Jeon O, Kang SW, Lim HW, Chung JH, Kim BS (2006) Longterm and zero order release of basic fibroblast growth factor from heparin-conjugated poly(L-lactide-co-glycolide) nanospheres and fibrin gel. Biomaterials 27, 1598-1607. Jeon O, Ryu SH, Chung JH, Kim BS (2005) Control of basic fibroblast growth factor release from fibrin gel with heparin and concentrations of fibrinogen and thrombin. J Contr Rel 105, 249-259. Jeschke MG, Klein D (2004) Liposomal gene transfer of multiple genes is more effective than gene transfer of a single gene. Gene Ther 11, 847-855. Jones SM, Banwell PE, Shakespeare PG (2005) Advances in wound healing: topical negative pressure therapy. Postgrad Med J 81, 353-357. Kanakaris NK, Thanasas C, Keramaris N, Kontakis G, Granick MS, Giannoudis PV (2007) The efficacy of negative pressure wound therapy in the management of lower extremity trauma: Review of clinical evidence. Injury, Int J Care Injured 38S, S8-S17. Kawakami S, Sato A, Nishikawa M, Yamashita F, Hashida M (2000) Mannose receptor-mediated gene transfer into macrophages using novel mannosylated cationic liposomes. Gene Ther 7, 292-299. Kelly BD, Hackett SF, Hirota K, Oshima Y, Cai Z, Berg-Dixon S, Rowan A, Yan Z, Campochiaro PA, Semenza GL (2003) Cell type-specific regulation of angiogenic growth factor gene expression and induction of angiogenesis in nonischemic tissue by a constitutively active form of hypoxia-inducible factor 1. Circ Res 93, 1074-1081. Keshet E, Ben-Sasson SA (1999) Anticancer drug targets: approaching angiogenesis. J Clin Invest 104, 1497-1501. Keswani SG, Katz AB, Lim FY, Zoltick P, Radu A, Alaee D, Herlyn M, Crombleholme TM (2004) Adenoviral mediated

Rimann and Hall: Gene therapy in wound healing gene transfer of PDGF-B enhances wound healing in type I and type II diabetic wounds. Wound Repair Regen 12, 497504. Khavari PA, Rollman O, Vahlquist A (2002) Cutaneous gene transfer for skin and systemic diseases. J Intern Med 252, 110. Kรถrber A, Franckson T, Grabbe S, Dissemond J (2008) Vacuum Assisted Closure Device Improves the Take of Mesh Grafts in Chronic Leg Ulcer Patients. Dermatology 218, 250-256. Kuriyama S, Mitoro A, Tsujinoue H, Nakatani T, Yoshiji H, Tsujimoto T, Yamazaki M, Fukui H (2000) Particlemediated gene transfer into murine livers using a newly developed gene gun. Gene Ther 7, 1132-1136. Kusumanto YH, Mulder NH, Dam WA, Losen MH, Meijer C, Hospers GA (2007) Improvement of In vivo Transfer of Plasmid DNA in Muscle: Comparison of Electroporation versus Ultrasound. Drug Deliv 14, 273-277. Kwok KY, Park Y, Yang Y, McKenzie DL, Liu Y, Rice KG (2003) In vivo gene transfer using sulfhydryl cross-linked PEG-peptide/glycopeptide DNA co-condensates. J Pharm Sci 92, 1174-1185. Labanaris AP, Polykandriotis E, Horch RE (2008) The effect of vacuum-assisted closure on lymph vessels in chronic wounds. J Plast Reconstr Aesthet Surg, in press. Lai E, van Zanten JH (2002) Evidence of lipoplex dissociation in liquid formulations. J Pharm Sci 91, 1225-1232. Lee H, Jeong JH, Park TG (2002) PEG grafted polylysine with fusogenic peptide for gene delivery: high transfection efficiency with low cytotoxicity. J Control Release 79, 283291. Lindstedt S, Malmsjรถ M, Gesslein G, Ingemansson R (2006) Topical negative pressure effects on coronary blood flow in a sternal wound model. Int Wound J 5, 503-509. Liu F, Shollenberger LM, Conwell CC, Yuan X, Huang L (2007) Mechanism of naked DNA clearance after intravenous injection. J Gene Med 9, 613-619. Liu L, Marti GP, Wei X, Zhang Z, Zhang H, Liu YV, Nastai M, Semenza GL, Harmon JW (2008) Age-Dependent Impairment of HIF-1! Expression in Diabetic Mice: Correction With Electroporation-Facilitated Gene Therapy Increases Wound Healing, Angiogenesis, Circulating Angiogenic Cells. J Cell Physiol217, 319-327. Loots MA, Lamme EN, Zeegelaar J, Mekkes JR, Bos JD, Middelkoop E (1998) Differences in cellular infiltrate and extracellular matrix of chronic diabetic and venous ulcers versus acute wounds. J Invest Dermatol 111, 850-857. Lorand L, Graham RM (2003) Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 4, 140-156. Luhmann T, Rimann M, Bittermann AG, Hall H (2008) Cellular uptake and intracellular pathways of PLL-g-PEG-DNA nanoparticles. Bioconjug Chem 19, 1907-1916. Lutholf MP, Hubbell JA (2005) Synthetic biomaterials as instructive extracellular microenvironments for morphogenesis in tissue engineering. Nat Biotechnol 23, 4753. Lv H, Zhang S, Wang B, Cui S, Yan J (2006) Toxicity of cationic lipids and cationic polymers in gene delivery. J Control Release 114, 100-109. Lynch SE, Nixon JC, Colvin RB, Antoniades HN (1987) Role of platelet-derived growth factor in wound healing: synergistic effects with other growth factors. Proc Natl Acad Sci USA 84, 7696-700. Mace KA, Yu DH, Paydar KZ, Boudreau N, Young DM (2007) Sustained expression of Hif-1alpha in the diabetic environment promotes angiogenesis and cutaneous wound repair. Wound Repair Regen 15, 636-645.

Margolis DJ, Cromblehome T, Herlyn M, Cross P, Weinberg L, Filip J, Propert K (2004) Clinical protocol. Phase I trial to evaluate the safety of H5.020CMV.PDGF-b and limb compression bandage for the treatment of venous leg ulcer: trial A. Hum Gene Ther 15, 1003-1019. Masayuki I, Masanori F, Kiyohaya O, Hidemi H, Shigo N, Masaki N, Tomoharu K, Yasuhiro K, Bonpei T, Makoto K, Tadaaki M (2006a) Controlled release of FGF-2 and paclitaxol from chitosam hydrogels and their subsequent effects on wound repair, angiogenesis, tumor growth. Curr Drug Del 2, 351-358. Mester E, Juhasz J, Varga P, Karika G (1968) Lasers in clinical practice. Acta Chir Acad Sci Hung 9, 349-357. Mishra S, Webster P, Davis ME (2004) PEGylation significantly affects cellular uptake and intracellular trafficking of nonviral gene delivery particles. Eur J Cell Biol 83, 97-111. Morgan RA, Anderson WF (1993) Human gene therapy. Annu Rev Biochem 62, 191-217. Mosesson MW (2005) Fibrinogen and fibrin structure and functions. J Thromb Haemost 3, 1894-1904. Panyam J, Labhasetwar V (2003) Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv Drug Deliv Rev 55, 329-347. Park TG, Jeong JH, Kim SW (2006) Current status of polymeric gene delivery systems. Adv Drug Deliv Rev 58, 467-486. Patel TH, Kimura H, Weiss CR, Semenza GL, Hofmann LV (2005) Constitutively active HIF-1alpha improves perfusion and arterial remodeling in an endovascular model of limb ischemia. Cardiovasc Res 68, 144-154. Paul SAM, Simons JW, Mabjeesh NJ (2004) HIF at the crossroads between ischemia and carcinogenesis. J Cell Physiol 200, 20-30. Petrie NC, Yao F, Eriksson E (2003) Gene therapy in wound healing. Surg Clin North Am 83, 597-616. Pichon C, Goncalves C, Midoux P (2001) Histidine-rich peptides and polymers for nucleic acids delivery. Adv Drug Deliv Rev 53, 75-94. Pierce GF, Tarpley JE, Tseng J, Bready J, Chang D, Kenney WC, Rudolph R, Robson MC, Vande Berg J, Reid P, Kaufman S, Farrell CL (1995) Detection of platelet-derived growth factor (PDGF)-AA in actively healing human wounds treated with recombinant PDGF-BB and absence of PDGF in chronic nonhealing wounds. J Clin Invest 96, 1336-1350. Pike DB, Cai S, Pomraning KR, Firpo MA, Fisher RJ, Shu X, Z., Prestwich GD, Peattie RA (2006) Heparin-regulated release of growth factors in vitro and angiogenic response in vivo to implanted hyaluronic hydrogels containing VEGF and bFGF. Biomaterials 27, 5242-5251. Pugh CW, Ratcliffe PJ (2003) Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 9, 677-684. Ramsay E, Hadgraft J, Birchall J, Gumbleton M (2000) Examination of the biophysical interaction between plasmid DNA and the polycations, polylysine and polyornithine, as a basis for their differential gene transfection in-vitro. Int J Pharm 210, 97-107. Rimann M, Luhmann T, Textor M, Guerino B, Ogier J, Hall H (2008) Characterization of PLL-g-PEG-DNA nanoparticles for the delivery of therapeutic DNA. Bioconjug Chem 19, 548-557. Robson MC, Phillips TJ, Falanga V, Odenheimer DJ, Parish LC, Jensen JL, Steed DL (2001) Randomized trial of topically applied repifermin (recombinant human keratinocyte growth factor-2) to accelerate wound healing in venous ulcers. Wound Repair Regen 9, 347-352. Royce SM, Askari M, Marra KG (2004) Incorporation of polymer microspheres within fibrin scaffolds for the controlled delivery of FGF-1. J Biomater Sci Polymer Edn 15, 1327-1336.

Gene Therapy and Molecular Biology Vol 13, page 63 Ruszczak R, Friess W (2003) Collagen as a carrier for on-site delivery of antibacterial drugs. Adv Drug Delivery Rev 55, 1679-1689. Saxena V, Hwang C-W, Huang S, Eichbaum Q, Ingber D, Orgill DP (2004) Vacuum-Assisted Closure: Microdeformations of Wounds and Cell Proliferation. Plast Reconstr Surg 114, 1086-1096. Shigeta K, Kawakami S, Higuchi Y, Okuda T, Yagi H, Yamashita F, Hashida M (2007) Novel histidine-conjugated galactosylated cationic liposomes for efficient hepatocyteselective gene transfer in human hepatoma HepG2 cells. J Control Release 118, 262-270. Singer AJ, Clark RA (1999) Cutaneous wound healing. N Engl J Med 341, 738-746. Sobanko JF, Alster TS (2008) Efficacy of low-level laser therapy for chronic cutaneous ulceration in humans: a review and discussion. Dermatol Surg 34, 991-1000. Sprugel KH, McPherson JM, Clowes AW, Ross R (1987) Effects of growth factors in vivo. I. Cell ingrowth into porous subcutaneous chambers. Am J Pathol 129, 601-613. Steed DL (2006) Clinical evaluation of recombinant human platelet-derived growth factor for the treatment of lower extremity ulcers. Plast Reconstr Surg 117, 143S-149S. Steinstraesser L, Hirsch T, Beller J, Mittler D, Sorkin M, Pazdierny G, Jacobsen F, Eriksson E, Steinau HU (2007) Transient non-viral cutaneous gene delivery in burn wounds. J Gene Med 9, 949-955. Stender S, Murphy M, O'Brien T, Stengaard C, Ulrich-Vinther M, Soballe K, Barry F (2007) Adeno-associated viral vector transduction of human mesenchymal stem cells. Eur Cell Mater 13, 93-99. Swift ME, Burns AL, Gray KL, DiPietro LA (2001) Age-related alterations in the inflammatory response to dermal injury. J Invest Dermatol 117, 1027-1035. Tal J (2000) Adeno-associated virus-based vectors in gene therapy. J Biomed Sci 7, 279-291. Tal R, Shaish A, Bangio L, Peled M, Breitbart E, Harats D (2008) Activation of C-transactivation domain is essential for optimal HIF-1 alpha-mediated transcriptional and angiogenic effects. Microvasc Res 76, 1-6. Theopold C, Yao F, Eriksson E (2004) Gene therapy in the treatment of lower extremity wounds. Int J Low Extrem Wounds 3, 69-79. Trengove NJ, Stacey MC, MacAuley S, Bennett N, Gibson J, Burslem F, Murphy G, Schultz G (1999) Analysis of the acute and chronic wound environments: the role of proteases and their inhibitors. Wound Repair Regen. 7, 442-452. Trentin D, Hall H, Wechsler S, Hubbell JA (2006) Peptidematrix-mediated gene transfer of an oxygen-insensitive hypoxia-inducible factor-1alpha variant for local induction of angiogenesis. Proc Natl Acad Sci U S A. 103, 2506-2511. Trentin D, Hubbell J, Hall H (2005) Non-viral gene delivery for local and controlled DNA release. J Control Release 102, 263-275. Vandenbroucke RE, De Smedt SC, Demeester J, Sanders NN (2007) Cellular entry pathway and gene transfer capacity of TAT-modified lipoplexes. Biochim Biophys Acta 1768, 571-579. Viswanathan V, Pendsey S, Sekar N, Murthy GSR (2006) A phase III study to evaluate the safety and efficacy of recombinant human epidermal growth factor (REGEN-Dâ&#x201E;˘ 150) in healing diabetic foot ulcers. Wounds 18, 186-196. Wagner E, Ogris M, Zauner W (1998) Polylysine-based transfection systems utilizing receptor-mediated delivery. Adv Drug Deliv Rev 30, 97-113. Wallace DG, Rosenblatt J (2003) Collagen gel systems for sustained delivery and tissue engineering. Adv Drug Delivery Rev 55, 1631-1649.

Walsh M, Tangney M, O'Neill MJ, Larkin JO, Soden DM, McKenna SL, Darcy R, O'Sullivan GC, O'Driscoll CM (2006) Evaluation of cellular uptake and gene transfer efficiency of pegylated poly-L-lysine compacted DNA: implications for cancer gene therapy. Mol Pharm 3, 644653. Weisel JW, Stauffacher CV, Bullitt E, Cohen C (1985) A model for fibrinogen: domains and sequence. Science 230, 13881391. Wells DJ (2004) Gene therapy progress and prospects: electroporation and other physical methods. Gene Ther 11, 1363-1369. Whitney JD (2005) Overview: acute and chronic wounds. Nurs Clin North Am 40, 191-205. Wilkes RP, McNulty AK, Feeley TD, Schmidt MA, Kieswetter K (2007) Bioreactor for Application of Subatmospheric Pressure to Three-Dimensional Cell Culture. Tissue Eng 13, 3003-3010. Wong C, Imman E, Spaethe R, Helgerson S (2003) Fibrin-based biomaterials to deliver human growth factors. Thromb Haemost 89, 573-582. Wu X, Burgess SM (2004) Integration target site selection for retroviruses and transposable elements. Cell Mol Life Sci 61, 2588-2596. Yager DR, Nwomeh BC (1999) The proteolytic environment of chronic wounds. Wound Repair Regen 7, 433-441. Yla-Herttuala S, Markkanen JE, Rissanen TT (2004) Gene therapy for ischemic cardiovascular diseases: some lessons learned from the first clinical trials. Trends Cardiovasc Med 14, 295-300. Young S, Wong M, Tabata Y, Mikos AG (2005) Gelatin as a delivery vehicle for the controlled release of bioactive molecules. J Control Release 109, 256-274. Zaitsev S, Cartier R, Vyborov O, Sukhorukov G, Paulke BR, Haberland A, Parfyonova Y, Tkachuk V, Bottger M (2004) Polyelectrolyte nanoparticles mediate vascular gene delivery. Pharm Res 21, 1656-1661. Zilla P (1991) Endothelialization of vascular grafts. Curr Opin Cardiol 6, 877-886. Zilla P, Deutsch M, Meinhart J, Puschmann R, Eberl T, Minar E, Dudczak R, Lugmaier H, Schmidt P, Noszian I, Fischlein T (1994) Clinical in vitro endothelialization of femoropopliteal bypass grafts: an actuarial follow-up over three years. J Vasc Surg 19, 540-548. Zisch AH, Lutolf MP, Hubbell JA (2003) Biopolymeric delivery matrices for angiogenic growth factors. Cardiovasc Pathol 12, 295-310.

Heike Hall and Markus Rimann

Gene Therapy and Molecular Biology Vol 13, page 64 Gene Ther Mol Biol Vol 13, 64-70, 2009

Functional analysis of the binding ability of neuropeptide f (NPF) form Moniezia expansa Research Article

Virendra S Gomase1, 3*, Somnath B Waghmare2, Baba Jadhav2, Karbhari V Kale3 1

Department of Bioinformatics, Padmashree Dr. D. Y. Patil University, Plot No-50, Sector-15, CBD Belapur, Navi Mumbai, 400614, MS, India 2 Department of Zoology, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad, 431004, (MS), India 3 Department of Computer Science and Information Technology, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad, 431004, (MS), India

__________________________________________________________________________________ *Correspondence: Dr. Virendra S Gomase, Department of Bioinformatics, Padmashree Dr. D. Y. Patil University, Plot No-50, Sector15, CBD Belapur, Navi Mumbai, 400614, MS, India; Mobile- +91-9987770696; e-mail: virusgene1@yahoo.co.in Key words: neuropeptide f, MHC, epitope, solvent accessibility, SV M, peptide vaccine Abbreviations: Major Histocompatibility Complex (MHC); Position Specific Scoring Matrices, (PSSMs); Support Vector Machine, (SVM)

Summary Moniezia expansa involved multiple antigenic components to direct and empower the immune system to protect the host from infection. MHC molecules are cell surface proteins, which take active part in host immune reactions and involvement of MHC class in response to almost all antigens and it give effects on specific sites. Predicted MHC binding regions acts like red flags for antigen specific and generate immune response against the parent antigen. So a small fragment of antigen can induce immune response against whole antigen. This theme is implemented in designing subunit and synthetic peptide vaccines. In this study, we analyzed neuropeptide f protein of Moniezia expansa and is allows potential drug targets to identify active sites, which form antibodies against or infection. The method integrates prediction of peptide MHC class binding; proteosomal C terminal cleavage and TAP transport efficiency. Antigenic epitopes of lipid binding protein are important antigenic determinants against the various toxic reactions and infections.

myogenic effect on muscle preparations of parasitic flatworms (Figure 3). NPF displays structural similarities to peptides from molluscs and vertebrate members of the neuropeptide Y (NPY)-superfamily of peptides (Mair et al, 1993; Larhammar et al, 1993). Also NPF receptors play pivotal roles in neuropeptide signalling have been uncovered; these enzymes, involved in the biosynthesis and processing of flatworm neuropeptides, have recently been described and offer other distinct and attractive targets for therapeutic interference (McVeigh et al, 2005). Major histocompatibility complex (MHC) molecules are cell surface proteins, which take active part in host immune reactions and involvement of MHC class-I & II in response to almost all antigens. The predicted binding affinity is normalized by the 1% fractil. The MHC peptide binding is predicted using neural networks trained on C terminals of known epitopes. In analysis predicted MHC/peptide binding is a log-transformed value related to the IC50 values in nM units (Gomase et al, 2008b). This approach is based on the phenomenon of cross-protection, whereby a host infected with a M. expansa is protected against a more severe strain of the same neuropeptide F

I. Introduction Tapeworms often cause more infections among sheep and goats than stomach worms (nematodes), whereas they cannot see stomach worms, only their symptoms. Moniezia expansa is a goat tapeworm, which lives in the intestine, expels packets of eggs onto the pasture (Elliott 1986). Sheep and goats serve as intermediate hosts for several other species of tapeworms. M. expansa is the tapeworm, which commonly affects sheep and goats (Figures 1, 2). The symptoms of M. expansa extreme tapeworm infection are similar to the symptoms of other roundworm infection: diarrhea, emaciation, pot belly, and weight loss. In sufficient numbers, tapeworms can obstruct the bowel and cause death. Sheeps, goats seem to develop an immunity to tapeworms relatively early in life (3-4 months of age) (Figure 3). Neuropeptide f (NPF) is the native flatworm regulatory peptide, is seen in the cestode M. expansa (Miskolzie et al, 2002; Mair et al, 1997; Maule et al, 1992; Maule et al, 1993). Neuropeptide F (NPF) protein is an abundantly expressed neuropeptide in platyhelminth nervous systems and exhibits a moderate,

Gomase et al: Functional analysis of the binding ability of neuropeptide f (NPF) form Moniezia expansa

Figure 1. Infected goats from form M. expansa

Figure 2. Infected Sheep from form M. expansa

Figure 3. Infection of M. expansa in goat

protein of M. expansa. The phenotype of the resistant transgenic hosts includes fewer centers of initial infection, a delay in symptom development, and low accumulation. Neuropeptide f protein M. expansa is necessary for new paradigm of synthetic vaccine development and target validation (Gomase, 2008a, b).

Matrices (PSSMs). Support Vector Machine (SVM) based method for prediction of promiscuous MHC class II binding peptides. SVM has been trained on the binary input of single amino acid sequence (Reche et al, 2002; Buus et al, 2003; Nielsen et al, 2003; Bhasin and Raghava, 2005). In addition, we predict those MHC ligands from whose C-terminal end is likely to be the result of proteosomal cleavage.

II. Methodology Antigenic epitopes of neuropeptide f protein of M. expansa is determined using the Gomase in 2007, Hoop & Woods, Welling, Parker antigenicity methods (Gomase et al, 2007a, b). We also found the Manavalan et al, Sweet et al, Kyte & Doolittle, Abraham & Leo, Bull & Breese, Guy, Miyazawa et al, Roseman, Wolfenden et al , Wilson et al, Cowan at pH 3.4, Eisenberg et al, Black, Fauchere et al, Janin, Rao & Argos, Tanford, Cowan at pH 7.5 hydrophobicity scales. Theses scales are essentially a hydrophilic index, with polar residues assigned negative values (Gomase et al, 2008a). The MHC peptide binding of neuropeptide F protein is predicted using neural networks trained on C terminals of known epitopes. In analysis predicted MHC/peptide binding of neuropeptide F protein is a log-transformed value related to the IC50 values in nM units. MHC2Pred predicts peptide binders to MHCI and MHCII molecules from protein sequences or sequence alignments using Position Specific Scoring

III. Results and Interpretation Helper T cell epitopes are subset of MHC class ligands and play important role in initiation and maintenance of immune functions. Neuropeptide f protein is 39 residues long, having antigenic MHC binding peptides. MHC molecules are cell surface glycoproteins, which take active part in host immune reactions and involvement of MHC class-I and MHC II in response to almost all antigens. Antigenicity determinant shows epitopes present in the M. expansa the desired immune response (Figures 4-6). For the conformational and structural analysis, we also determined the Ramachandran plot, solvent accessible surface activity of neuropeptide f from M. expansa (Figures 13-15). PSSM based server predict the peptide binders to MHCI molecules of neuropeptide f protein to MHCII molecules of neuropeptide f protein sequence as H2_Db, analysis found 65

Gene Therapy and Molecular Biology Vol 13, page 64 antigenic epitopes region in neuropeptide F protein (Tables 1, 2). We also found the SVM based MHCII-IAb; MHCII-IAd; MHCII-IAg7 and MHCII- RT1.B peptide regions, which represented predicted binders from neuropeptide f protein. The predicted binding affinity is normalized by the 1% fractil. We describe an improved method for predicting linear epitopes (Table 2). The region of maximal hydrophilicity is likely to be an antigenic site, having hydrophobic characteristics, because terminal regions of neuropeptide f protein is solvent accessible and unstructured, antibodies against those regions are also likely to recognize the native protein (Figures 7-12). Fragment identified through this approach tend to be high-efficiency binders, which is a lagers percentage of their atoms are directly involved in binding as compared to larger molecules. The sequence analysis method is allows potential drug targets to identify active sites, which form antibodies against diseases. It was shown that neuropeptide f protein is hydrophobic in nature and contains segments of low complexity and highpredicted flexibility. Predicted antigenic fragments can

bind to MHC molecule is the first bottlenecks in vaccine design.

IV. Conclusion The MHC prediction is useful in cellular immunology, new vaccine design, immunodiagnostics and molecular function understanding of autoimmune susceptibility. Neuropeptide f protein of M. expansa peptide nonamers are from a set of aligned peptides known to bind to a given MHC molecule as the predictor of MHC-peptide binding. MHCII molecules bind peptides in similar yet different modes and alignments of MHCIIligands were obtained to be consistent with the binding mode of the peptides to their MHC class, this means the increase in affinity of MHC binding peptides may result in enhancement of immunogenicity of neuropeptide f protein. These predicted of neuropeptide f protein antigenic peptides to MHC class molecules are important in vaccine development from M. expansa.

Table 1. PSSM based prediction of MHC ligands, from whose C-terminal ends are proteosomal cleavage sites. MHC-I 8mer_H2_Db 9mer_H2_Db 10mer_H2_Db 11mer_H2_Db

POS. 26 12 15 4

N YLR PSD LVL PDK

Sequence QINEYFAI LVLDNKAAL DNKAALRDYL DFIVNPSDLVL

C IGR RDY RQI DNK

MW (Da) 979.11 938.13 1160.3 1213.4

Table 2. SVM based prediction of promiscuous MHC class II binding peptides from neuropeptide f protein. MHC ALLELE I-Ab I-Ab I-Ab I-Ab I-Ad I-Ad I-Ad I-Ad I-Ag7 I-Ag7 I-Ag7 I-Ag7 RT1.B RT1.B RT1.B RT1.B

Rank 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4

Sequence AALRDYLRQ KAALRDYLR DYLRQINEY SDLVLDNKA QINEYFAII EYFAIIGRP PSDLVLDNK YFAIIGRPR EYFAIIGRP LVLDNKAAL QINEYFAII VLDNKAALR DNKAALRDY INEYFAIIG AALRDYLRQ FIVNPSDLV

Residue No. 18 17 22 10 26 29 9 30 29 12 26 13 15 27 18 5

Peptide Score 0.586 0.452 0.277 0.242 0.371 0.189 0.187 0.170 1.343 1.166 1.137 1.113 0.777 0.298 -0.042 -0.048

Gomase et al: Functional analysis of the binding ability of neuropeptide f (NPF) form Moniezia expansa

Figure 4. Antigenicity plot of neuropeptide f protein by Hoop & Woods scale

Figure 5. Antigenicity plot of neuropeptide f protein by Welling et al scale

Figure 6. Antigenicity plot of neuropeptide f protein by Parker et al scale

Figure 7. Hydrophobicity plot of neuropeptide f protein by Manavalan et al scale

Gene Therapy and Molecular Biology Vol 13, page 64

Figure 8. Hydrophobicity plot of neuropeptide f protein by Sweet et al scale

Figure 9. Hydrophobicity plot of neuropeptide f protein by Kyte & Doolittle scale

Figure 10. Hydrophobicity plot of neuropeptide f protein by Abraham & Leo scale

Figure 11. Hydrophobicity plot of neuropeptide f protein by Bull & Breese scale

Gomase et al: Functional analysis of the binding ability of neuropeptide f (NPF) form Moniezia expansa

Figure 12. Hydrophobicity plot of neuropeptide f protein by Guy scale

Figure 13. Confirmation analysis using Ramachandran plot of neuropeptide f from M. expansa

Figure 14. Study of solvent accessibility and surface activity of neuropeptide f from M. expansa

Gene Therapy and Molecular Biology Vol 13, page 64

Figure 15. Structure of neuropeptide f from M. expansa Alfalfa mosaic virus. Curr Drug Discov Technol 4, 1171215. Larhammar D, Blomqvist AG, Söderberg C (1993) Evolution of neuropeptide Y and its related peptides. Comp Biochem Physiol C, 106(3), 743-52. Mair GR, Maule AG, Halton DW, Orr D, Johnston RN, Johnston CF, Shaw C (1997) Comparative analysis of the distribution of bradykinin-, GYIRFamide- and neuropeptide F-like immunoreactivities in the monogenean, Diclidophora merlangi. Parasitology, 114 ( 5), 467-73. Mair GR, Halton DW, Shaw C, Maule AG. (2000) The neuropeptide F (NPF) encoding gene from the cestode, Moniezia expansa. Parasitology, 120 (1), 71-7. Maule AG, Shaw C, Halton DW, Brennan GP, Johnston CF, Moore S (1992) Neuropeptide F (Moniezia expansa): localization and characterization using specific antisera. Parasitology, 105 (3), 505-12. Maule A, Shaw C, Halton D, Thim L (1993) GNFFRFamide: a novel FMRFamide-immunoreactive peptide isolated from the sheep tapeworm, Moniezia expansa. Biochem Biophys Res Commun., 193(3),1054-60. Miskolzie M, Kotovych G (2002) The NMR-derived conformation of neuropeptide F from Moniezia expansa. J Biomol Struct Dyn. 19(6), 991-8. McVeigh P, Kimber MJ, Novozhilova E, Day TA (2005) Neuropeptide signalling systems in flatworms. Parasitology, 131 Suppl:S41-55. Nielsen M, Lundegaard C, Worning P, Lauemøller SL, Lamberth K, Buus S, Brunak S, Lund O (2003) Reliable prediction of T-cell epitopes using neural networks with novel sequence representations. Protein Sci 12, 1007-1017. Reche PA, Glutting JP, Reinherz EL (2002) Prediction of MHC class I binding peptides using profile motifs. Hum Immunol 63, 701-709.

References Bhasin M, Raghava GP (2005) P cleavage: an SVM based method for prediction of constitutive proteasome and immunoproteasome cleavage sites in antigenic sequences. Nucleic Acids Res 33, W202-207. Buus S, Lauemøller SL, Worning P, Kesmir C, Frimurer T, Corbet S, Fomsgaard A, Hilden J, Holm A, Brunak S. (2003) Sensitive quantitative predictions of peptide-MHC binding by a 'Query by Committee' artificial neural network approach. Tissue Antigens 62, 378-384. Elliott DC (1986) Tapeworm (Moniezia expansa) and its effect on sheep production: the evidence reviewed. N Z Vet J., 34(5), 61-5. Gomase VS, Kale KV, Shyamkumar K, Shankar S (2008a) Computer Aided Multi Parameter Antigen Design: Impact of Synthetic Peptide Vaccines from Soybean Mosaic Virus. ICETET 2008, IEEE Computer Society in IEEE Xplore, Los Alamitos, California, 629-634. Gomase VS, Tagore S, Shyamkumar K (2008b) Prediction of antigenic binders from c-terminal domain Human papillomavirus oncoprotein e7. Gene Ther Mol Biol 12, 147-166. Gomase VS (2008a) Computer aided multi parameter antigen design: Impact of synthetic peptide vaccines from Latrodectus tredecimguttatus. Int J Bioinformatics 1, 53-54. Gomase VS (2008b) In silico prediction of antigenic epitope of neurotoxin M14 from Buthus eupeus. Int J Bioinformatics 1, 47-51. Gomase VS, Kale KV, Jyotiraj A, Vasanthi R (2007a) Identification of mhc ligands from alfalfa mosaic virus. Med Chem Res 15, 160. Gomase VS, Kale KV, Chikhale NJ, Changbhale SS (2007b) Prediction of MHC Binding Peptides and Epitopes from

Dr. Virendra Gomase, Mr. Somnath B Waghmare, Dr. Baba Jadhav and

Dr. Karbhari V Kale

Gene Therapy and Molecular Biology Vol 13, page 71 Gene Ther Biol Vol 13, 71-81, 2009

Differential expression of 14-3-3! during physiological, pathological cardiac hypertrophy and chronic heart failure in mice Research Article

Jianyong Qi1, Ming Xu1, Zhizhen Lu1, Youyi Zhang1* 1

Institute of Vascular Medicine, Peking University Third Hospital and Key Laboratory of Molecular Cardiovascular Science, Ministry of Education, Beijing 100191, P.R. China

_____________________________________________________________________________________________ *Correspondence: Y. Zhang, Institute of Vascular Medicine, Peking University Third Hospital and Key Laboratory of Molecular Cardiovascular Science, Ministry of Education, Beijing 100191, PR China; Tel: 86-10-82802306; Fax: 86-10-62361450; E-mail: zhangyy@bjmu.edu.cn Keywords: 14-3-3! protein, Cardiac hypertrophy, Swimming training, Transverse aortic constriction Abbreviations: (CHF), chronic heart failure, (TAC), transverse aortic constriction, (LVIDd), inner dimension of diastolic LV, (LVIDs), inner dimension of systolic LV, (LVPWd), LV end-diastolic posterior wall thickness, (LVPWs), LV end-systolic posterior wall thickness, (LVAWd), LV end-diastolic anterior wall thickness, (LVAWs), LV end-systolic anterior wall thickness, (EDV), end-diastolic volume, (ESV), end-systolic volume, (FS), fractional shortening, (EF), eject fraction Running Title: 14-3-3! and cardiac hypertrophy Received: 16 March 2009; Revised: 21 April 2009 Accepted: 19 May 2009; electronically published: 4 June 2009

Summary Physiological cardiac hypertrophy associated with regular exercise is usually beneficial, in marked contrast to pathological hypertrophy associated with disease. 14-3-3 proteins play a critical antiapoptotic function in cardiomyocytes. Whether it or other genes activated in the athleteâ&#x20AC;&#x2122;s heart might have an impact on cardiac function and survival in a setting of heart failure is unknown. To examine whether different changes of 14-3-3 proteins expression in physiological cardiac hypertrophy, pathological cardiac hypertrophy and chronic heart failure (CHF), we constructed mouse models of physiological cardiac hypertrophy to swim training, pathological cardiac hypertrophy to transverse aortic constriction (TAC) for 4 weeks and chronic heart failure to TAC for 16 weeks. In response to swimming training and TAC, mice showed significant increases in left ventricular diastolic posterior wall thickness (LVPWd), heart weight and normalized heart weight to body weight ratio. However, in CHF mice, LVPWd decreased, end-diastolic volume (EDV) increased and marked cardiac fibrosis was formed. Thus, pressure overload induced decompensate heart failure and eccentric hypertrophy. Moreover, 14-3-3! protein expression of hearts was increased in response to swimming training but decreased in CHF mice. However, other isoforms (", #) of 14-3-3 proteins were no obvious changes in these three models. Therefore, our results suggest that the expressions of 14-3-3! are different in physiological and pathological hypertrophy, which may provide a potential gene strategy for the treatment of heart failure.

I. Introduction

increased interstitial fibrosis and heart failure (Levy et al, 1990;Cohn et al, 1997). A paradoxical exception is the cardiac hypertrophy that occurs in the athlete (physiological hypertrophy), which is induced by physiological stimuli (e.g., developmental growth, exercise training) (Iemitsu et al, 2001). In contrast to pathological hypertrophy in disease states, which is associated with fibrosis, dysfunction, altered cardiac gene expression, and increased morbidity and mortality, physiological hypertrophy shows a normal organization of sarcomeres and fibers, normal or enhanced cardiac function, and a relatively normal pattern of cardiac gene expression (Heineke et al, 2006;McMullen et al, 2007). 14-3-3 proteins were first found in fetal bovine brain

Cardiovascular disease remains the number one cause of mortality in the world, with heart failure representing the fastest growing subclass over the past decade (Kannel et al, 2000; Levy et al, 2002; Hobbs et al, 2004). Cardiac hypertrophy is characteristics of most forms of heart failure, and is induced by pathological stimuli (e.g., pressure or volume overload) (Izumo et al, 1988; Iemitsu et al, 2001). When disease causes pressure or volume overload (e.g., hypertension, valvular disorders) of the heart, the resulting cardiac hypertrophy is initially a compensatory response to the increased load. However, function in the hypertrophied heart eventually decompensates, leading to left ventricle (LV) dilation, 71

Zhang et al: 14-3-3! and cardiac hypertrophy in 1967 and this class of proteins has been found in all eukaryotic organisms studied so far (van Hemert et al, 2001; Daniela et al, 2003). There are seven known mammalian 14-3-3 isotypes (", #, !, $, %, & and '/() (Martin et al, 1993). 14-3-3 monomers have a molecular weight of approximately 30 kDa and an isoelectric point of about 5, but functional 14-3-3 exists as a dimer. 14-3-3 Proteins specifically recognize phosphoserine⁄threonine-containing sequence motifs on target proteins, such as RSXpSXP, RXSX (S⁄T) XP or RX (Y⁄F) XpSXP. In addition, they can bind to unphosphorylated motifs: GHSL and WLDLE (Petosa et al, 1998; Hallberg, 2002; Berg et al, 2003). 14-3-3 proteins have been shown to interact with an array of partners, ranging from enzymes to structural proteins. Often, these proteins are important in vital cellular processes including cell cycle control and apoptosis. Through its interaction, 14-3-3 either regulates the catalytic activity of its bound enzymes, determine the subcellular localization of target proteins, or both (Fu et al, 2000; Tzivion et al, 2002). For example, 14-3-3 inhibits ASK1 (apoptosis signal regulating kinase-1) activity by binding to specific residues surrounding Ser967 (Zhang et al, 1999; Goldman et al, 2004). This interaction also controls the subcellular distribution of ASK1 (Subramanian et al, 2004; Zhang et al, 2003). The binding of 14-3-3 with phosphoinositide 3-kinase (PI3K), protein kinase C (PKC) and Raf can either inhibit or enhance the activities of these enzymes (Hekman et al, 2004; Light et al, 2002). 14-3-3 Proteins associate with cdc25c, FKHRL1 (also called FOXO3a), histone deacetylase5/7(HDAC5⁄7), nuclear factor of activated T cells (NFATc), p27 and PKUa, preventing their entry into the nucleus (Timothy et al, 2001; Sekimoto et al, 2004). 14-3-3 Proteins can also modulate protein–protein interactions. For example, 14-3-3 interacts with the apoptosispromoting protein BAD, preventing BAD from binding to and inhibiting the antiapoptotic function of Bcl-XL (Datta et al, 2000; Yang et al, 2001). 14-3-3 proteins have been found to be up- or down regulated in human disease, but their direct role in disease progression has not been clearly established. In neuronal system, 14-3-3% gene has been implicated in neurological disorders (Zanusso et al, 2005); 14-3-3# isoform in the cerebrospinal fluid (CSF) can be used as a marker for sporadic Creutzfeldt-Jakob disease (CJD) (Peoc’h et al, 2001; Van Everbroeck et al, 2005). Moreover, 14-3-3", ! and $ genes are also found in the CSF of CJD patients (Wiltfang et al, 1999); In addition to their possible role in neuronal function, 14-3-3 proteins have attracted much recent interest owing to their possible involvement in the pathophysiology of various cancer diseases. The 14-3-3& gene expression is much lower in breast carcinoma cells than in normal breast epithelium resulting from high frequency of hypermethylation at the 14-3-3& locus leads to gene silencing in breast cancer (Anne et al, 2000); however, 14-3-3", # and ' gene expression levels are increased in lung cancer as compared with the equivalent normal tissues (Qi et al, 2005). The mechanism underlying the development of pathological hypertrophy versus

physiological hypertrophy in the adult is poorly understood and whether 14-3-3 proteins are involved in physiological, pathological cardiac hypertrophy and chronic heart failure (CHF) are little known. In preliminary studies of our lab, using a gene micro assay, we found the gene of 14-3-3! mRNA was up-regulated in hypertrophic rat heart induced by continuous norepinephrine (NE) infusion (Li et al, 2003). Subsequently, we constructed a recombinant adenovirus which encoding R18, a general 14-3-3 peptide inhibitor, to disrupt 14-3-3 functions in cardiomyocytes and cardiac fibroblasts. We found that 14-3-3 proteins inhibited cardiomyocyte hypertrophy induced by norepinephrine in rats and serum-induced proliferation of cardiac fibroblast (Liao et al, 2005; Du et al, 2005). These data suggested that 14-3-3 proteins were involved in cardiac hypertrophy. However, whether 14-3-3 proteins are different expressed in physiological cardiac hypertrophy, pathological cardiac hypertrophy and heart failure are still unclear. To examine the expression of 14-3-3 proteins in the hearts under physiological and pathological conditions, we carried out studies in mice which were subjected to chronic swimming training for 8 weeks induced to physiological cardiac hypertrophy, or pressure overload by transverse aortic constriction (TAC) for 4 weeks induced to pathological cardiac hypertrophy and 16 weeks induced to chronic heart failure.

II. Materials and methods A. Experiments protocols

The animal care and experimental protocols were in compliance with the Animal Management Rule of the People’s Republic of China (Ministry of Health, P. R. China, document no. 552001), and the study was approved by the Animal Care Committee of the Third Hospital, Peking University.

Protocol I For aortic banding, mice were subjected to transverse aortic constriction or a sham operation by the same surgeon as described previously (Ding et al, 1999). Briefly, transverse aortic constriction was performed in 8–10-week-old male C57/BL6 mice (weight 15–20 g). Animals were anesthetized with intraperitoneal tribromethanol 0.2 ml/mg and atropine 1 )l/mg, and aortic constriction was created via a center thoracotomy by placing a ligature securely around the transverse aorta and a 26-gauge needle and then removing the needle. Animals with TAC were allowed access to food and water ad libitum for 4 weeks, and age-matched sham-operated animals served as controls (SHAM1). CHF was made by TAC for longer time to 16 weeks, also age-matched sham-operated animals served as controls (SHAM2).

Protocol II Swimming training was performed as previously described (McMullen et al, 2003). Briefly, 8–10-week-old male C57/BL6 mice weighing 15–20 g were made to swim in water tanks with a surface area of 225 cm2 and a depth of 15 cm for 90 min and water temperature of 30–32 °C. Animals were initially exercised for 20 min twice daily, and the duration of exercise was increased in 20-min increments daily, reaching 90 min, twice daily. This duration of exercise was maintained until the end of the study. Mice were trained 6 days a week and age-matched animals served as controls. All animals were allowed access to food and water ad libitum. Two of eight animals were unable to complete 72

Gene Therapy and Molecular Biology Vol 13, page 73

E. Citrate Synthase Activity

this course of exercise, but all other animals were conditioned successfully.

Citrate synthase (CS) analysis was performed as described before (Srere et al, 1969; McMullen et al, 2003). Briefly, the tibialis anterior and gastrocnemius were dissected, weighed, and rapidly frozen in liquid nitrogen. Frozen tissue was then homogenized with a glass homogenizer on ice in 100 mM Tris-HCl. Muscle homogenate protein concentration was determined by using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Sample homogenate was then added to a reaction mix of 100mM Tris-HCl, 1.0mM dithio-bis (2-nitrobenzoic acid), and 3.9mM acetyl coenzyme A. After an addition of 1.0mM oxaloacetate, absorbance at 412 nm was recorded for a 2-min period. Mean absorbance change per minute was recorded for each sample, and CS activity (in µmol/mg protein/min) was then calculated by using the mercaptide ion extinction coefficient of 13.6.

B. Echocardiography Before euthanasia, in vivo left ventricular (LV) function and LV hypertrophy were assessed by measuring fraction shortening (FS), and left ventricular diastolic posterior wall thickness (LVPWd), recorded by echocardiography using a Vevo 770 echocardiography system (Visual Sonics, Toronto, Canada) with a 30 MHz linear array transducer (McMullen et al, 2007). Briefly, Animals were anesthetized with inhaling isoflurane/oxygen, once the short-axis two-dimensional (2D) image of the left ventricle was obtained at the papillary muscle level, 2D guided M-mode images crossing the anterior and posterior walls were recorded. Parameters measured digitally on the M-mode trace were the LVPWd and inner dimension of diastolic or systolic left ventricles (LVIDd and LVIDs), and FS = (LVIDd–LVIDs)/LVIDd], EDV= ((7.0 / (2.4 + LVIDd))*LVIDd3, ESV= ((7.0 / (2.4 + LVIDs)) *LVIDs3. For aortic banding studies, to evaluate the degree of stenosis, the pressure gradient across the constriction was assessed using Doppler echocardiography (McMullen et al, 2004). A no imaging Doppler pencil transducer (continuous wave) was placed at the apex and orientated towards the proximal ascending aorta. The peak velocity (in meters per second) was measured, and the maximum instantaneous gradient (millimeters of Hg) was calculated using the following Bernoulli equation: pressure gradient = 4 * (velocity)2.

F. Western blot analysis Western blot was performed as previously described (Yin et al, 2003). Briefly, cell samples were lysed in 100 µl buffer containing 20 mM Tris-HCl (pH 7.4), 100 mM NaCl, 10 mM sodium pyrophosphate, 5 mM EDTA, 50 mM NaF, 1 mM sodium vanadate, 0.1% SDS, 10% glycerol, 1% Triton X-100, 1% sodium deoxycholate, 1 mM leupeptin, 0.1 mM aprotinin and 1 mM PMSF. Protein concentration was determined with a BCA protein assay kit (Pierce Biotechnology, Inc, Rockford, IL, USA), and proteins were separated on a 10% SDS-polyacrylamide gel and then electrophoretically transferred to nitrocellulose membranes (Pall Corporation, East Hill, NY, USA). eIF5 was used as a loading control (Du et al, 2005) . Results are expressed as the changed fold over the control (Con) or sham (SHAM1 of TAC group and SHAM2 of CHF group). Anti-14-3-3!, "!#!%, and anti-eIF-5 were purchased from Santa Cruz (Delaware, CA, USA).The sheets were analyzed with antibodies according to the supplier’s protocol, and visualized with peroxidase and an enhanced-chemiluminescence system (ECL kit, Pierce Biotechnology, Inc.). Bands were visualized by use of a super western sensitivity chemiluminescence detection system (Pierce, IL). Autoradiographs were quantitated by densitometry (Science Imaging system, Bio-Rad, Hercules, CA).

C. Measurement of BP and HR Swim-training mice along with their age-matched control siblings at 4 months were used for blood pressure (BP) and heart rate (HR) measurement. The systolicBP, diastolic BP and HR were measured by a programmable sphygmomanometer (BP-98A; Softron, Japan) using the tail-cuff method as described previously (Fukamizu et al, 1993). Anaesthetized mice were introduced into a small holder mounted on a thermostatically controlled warming plate and maintained at 37 °C during measurement.

D. HW assessment and histologic examination

G. Statistical analysis

At the completion of the experiment, animals were euthanized and their hearts were removed, the left ventricle was quickly separated from the atria and right ventricular free wall and their heart [left ventricle + right ventricle] weights (HW) and body weights (BW) were determined. Then, left ventricles were fixed overnight in 4% paraformaldehyde before embedding in paraffin. Sections of 7.5 )m were prepared, and stained with hematoxylin-eosin (HE) or Sirius red for evaluation of myocyte hypertrophy and collagen content, respectively. Cardiomyocytes from LV cross sections were stained with hematoxylin-eosin, and mean values from each mouse were calculated by use of the measurements from 60 to 80 cells from an individual mouse using light microscopy at * 400 magnification. Sirus-stained sections were quantitatively analyzed using light microscopy at * 40 magnification to evaluate myocardial fibrosis using the difference in color (red fibrotic area as opposed to yellow myocardium). Digital photographs were obtained by using a color image analyzer (QWin Colour Binary 1, LEICA).

Data are presented as mean ± S.D. Statistical analysis was performed by one-way analysis of variance followed by Tukey’s method or unpaired two-tailed Student’s t-tests. Correlations between groups of values were evaluated, calculating the best fit based on least squares regression analysis, and the coefficient of correlation (r2) was estimated. Results were considered statistically significant at p < 0.05.

III. Results

A. Cardiac hypertrophy and no fibrosis in mice response to swimming training To analyze the role of 14-3-3 proteins in physiological cardiac hypertrophy, we copied the model by swimming training for 8 weeks in mice. The mice were adept at swimming for increasingly longer intervals after a few days of acclimatization. Body weight and cardiac wall thickness determinations were made throughout the course of study to assess the development of cardiac hypertrophy. The swimming mice failed to gain weight relative to the controls since 2wk whereas increased LVPWd at 6-8wk (Figure 2D, 2F). Animals were randomized by body 73

Zhang et al: 14-3-3! and cardiac hypertrophy weight at the outset, at the end of 8 wk of exercise, the swimmers manifested a significant (12%) increase in heart weight whereas failed to gain weight significantly at the same time, resulting in a 32% increase in heart weight-to-body weight ratio (P < 0.001, Table 1). The swimming mice showed cardiac hypertrophy and no fibrosis (Figure 1A-C). Furthermore, we measured FS to detect LV systolic function. As shown in Figure 2E, there was no significant change in FS in swimming mice compared with control, which meant swimming training did not reduce cardiac systolic function. In addition to the development of cardiac hypertrophy, two other measures of exercise conditioning were assessed: heart rate response to a work load and skeletal muscle CS activity (Kaplan et al, 1994). Figure 2A shows the mean heart rate response to swimming training in rest was significantly decreased (449 beats/min) compared with the control (599 beats/min) at 8wk (P < 0.01), whereas the systolic blood pressure (SBP) and diastolic blood pressure (DBP) did not decrease significantly (Figure 2B). Citrate synthase activity, an index of muscle oxidative capacity and hence physical training, was measured in mixed gastrocnemius muscle of mice that underwent swimming training. After 8 weeks of exercise, citrate synthase activity was significantly elevated in skeletal muscle of swimming mice compared with control (P < 0.001, Figure 2C). Both measures indicated that the animals had become conditioned during the course of training.

LVPWd was increased most significantly in the first 4 weeks, with time passing by, LVPWd decreased mildly, till there was no significant change when FS was decreased at 16wk (Figure 3D). Thus, pressure overload induced decompensated heart failure in CHF mice.

C. Different changes in comparison with three cardiac hypertrophy models To investigate the different changes in three models of cardiac hypertrophy, we compared the data of echocardiography and anatomy in swimming training, TAC and CHF mice (Table. 1). As we showed in Figure 4, there were no obvious changes of FS in swimming training and TAC mice whereas FS decreased in CHF mice. LVPWd increased mild in response to swimming training and marked increased in response to TAC, whereas decreased in CHF mice. These revealed that mice compensated to the pressure load of swimming training and TAC, whereas decompensated in CHF mice. Furthermore, there was obviously increased magnitude of hypertrophy in CHF mice compared with TAC mice, and also the functional response was dramatically different between these groups. TAC mice compensated to the pressure load without change in LV function, LV diameter, or lung weight (Table 1). In contrast, CHF mice developed severe LV dysfunction, as measured by FS and inner dimension of diastolic LV (LVIDd). At the end of 16wk of CHF mice, the heart became dilated, with LVIDd of 4.25±0.17mm, compared with 4.00±0.10 mm in SHAM2 mice (P<0.05; Figure 4D), and EDV (end-diastolic volume) of 80.86±7.78 µl, compared with 70.12±4.13 µl in SHAM2 mice (P<0.05; Table 1). CHF mice developed severe LV systolic dysfunction, as measured by FS and eject fraction (EF) in response to pressure overload (Figure 4A, Table 1). When analyzed cardiac morphology, we found that there were no fibrosis in swim-training mice, mild fibrosis in TAC mice and marked fibrosis in CHF mice (Figure 1A, 1D). Therefore, these results reflected the changes from adaptive cardiac hypertrophy to compensate and decompensate maladaptive hypertrophy.

B. Pathological hypertrophy after TAC and cardiac dysfunction in CHF mice At the same time, we copied the models of TAC and CHF respectively. There was no difference in body weight among the groups. To determine that the magnitude of systolic load was comparable in both TAC groups, in vivo aortic pressure gradient (AoPg) measurements were performed. AoPg was elevated significantly both in TAC and CHF group compared with SHAM1 and SHAM2 (p<0.01, Figure 3A). At the end of 4wk in TAC mice, detected by echocardiography, LVPWd was increased whereas FS was normal compared with SHAM1 (Figure 4B, Table 1), and there is a positive linear correlation between the weights of echocardiographic left ventricular myocardium (Echo LVM) and anatomy LVM in TAC and CHF mice (Figure 3B). Moreover, hearts removed from TAC mice displayed mild fibrosis (Figure 1A). To copy the model of chronic heart failure (CHF), we performed the mice of TAC for a long time to 16 weeks. In CHF mice, there was no obvious change of cardiac systolic function in the compensatory stage of TAC from 0wk to 15wk (Figure 3C). When pressure was persistent, the cardiac systolic function of mice depressed, fraction shortening (FS) decreased to 21.21±2.61 %, compared with 31.58±3.17% in sham2 mice at 16wk(P< 0.05; Figure 3C and Table 1). In addition, This LV dysfunction was associated with pulmonary edema, with lung weight in CHF mice increasing to 170 ± 16.33 mg compared with 142.5 ± 20.62mg in sham2 mice (P<0.05; Table 1). Also,

D. 14-3-3! is increased in hearts of swimming-training mice, whereas decreased in CHF mice Subsequently, we detected protein expression of 14-3-3 isoforms (", % and !) in hearts of mice from physiological, pathological hypertrophy and heart failure respectively. As we showed in Figure 5A-D, it manifested that 14-3-3" protein expression increased in swimming mice and TAC mice, and the same tendency as 14-3-3% in TAC mice, but there were no obvious changes in statistics. Interestingly, the expression of 14-3-3! was increased 2-fold above control in swimming-training mice (p<0.01), and no obvious changes in TAC mice, whereas decreased 2.5-fold compared with sham2 group in CHF mice (p<0.05, Figure 5E, F). Therefore, these results suggest that differential expression of 14-3-3! may play an important role in cardiac hypertrophy.

Gene Therapy and Molecular Biology Vol 13, page 75 Table. 1: Anatomical and echocardiographic data of three models (SWIM, TAC and CHF mice). TAC, transverse aortic constriction; CHF, chronic heart failure; BW, body weight; HW, heart weight; LW, lung weight; TL, tibial length; LVIDd, inner dimension of diastolic LV; LVIDs, inner dimension of systolic LV; LVPWd, LV end-diastolic posterior wall thickness; LVPWs, LV end-systolic posterior wall thickness; LVAWd, LV end-diastolic anterior wall thickness; LVAWs, LV end-systolic anterior wall thickness; EF, eject fraction; FS, fractional shortening; EDV, end-diastolic volume; ESV, end-systolic volume.*p<0.05, **p<0.005, *p<0.001 compared to control or SHAM1 or SHAM2 from the same group.

Figure 1: Histological sections and echocardiograms from the left ventricular (LV) wall of three models (SWIM, TAC and CHF mice). (A) The LV cross sections of the three models stained with hematoxylin-eosin (*400 magnification, Scale bar, 20 )m) and Sirius red (red staining, * 40 magnifications, Scale bar, 200 )m). (B) Representative echocardiograms used to measure the LV wall thickness in three models (swim training, TAC and CHF mice) during cardiac cycles. (C) Mean cross-sectional area of cardiomyocytes in three models was measured. ** p<0.01,*** p<0.001. (D) The area fraction of fibrotic tissue of hearts was compared among three models (SWIM, TAC and CHF mice). *** p<0.001.

Zhang et al: 14-3-3! and cardiac hypertrophy

Figure 2: The stress of swim training in mice results in physiological cardiac hypertrophy. (A) Heart rate (HR), (B) Blood pressure (BP, including systolic blood pressure, SBP and diastolic blood pressure, DBP) and (C) Citrate synthase (CS) was assayed at the end of 8wk in control (CON) and swim-training (SWIM) mice. * p<0.05, ** p<0.01 compared to control from the same group. (D) Body weight (BW), (E) Fraction shortening (FS),(F) Left ventricular end-diastolic posterior wall thickness (LVPWd) were observed dynamically from 0wk,2wk,4wk,6wk,8wk. * p<0.05, ** p<0.01,*** p<0.001 compared to control at the same time.

Figure 3: The changes of AoPg and LVM in three models and dynamic changes of LVPWd and FS observed by echocardiography in CHF mice. (A) Aortic pressure gradient (AoPg) was detected in three models (SWIM, TAC and CHF mice). ** p<0.01, *** p<0.001 compared to SHAM1 or SHAM2 from the same group. (B) Positive linear correlation between the weights of echocardiographic left ventricular myocardium (Echo LVM) and Anatomy LVM in three models (SWIM, TAC and CHF mice). (C) FS (D) LVPWd were observed dynamically for every 2 weeks over the 16-week study period in CHF mice. * p<0.05, ** p<0.01, *** p<0.001 compared to SHAM2 at the same time.

Gene Therapy and Molecular Biology Vol 13, page 77

Figure 4: Different changes in comparison with three models (SWIM, TAC and CHF mice). (A) FS, (B) LVPWd, (C) LVIDs, (D)LVIDd were compared among SWIM, TAC and CHF mice. * p<0.05, ** p<0.01, *** p<0.001 compared to control (CON) or SHAM1 or SHAM2 from the same group.

Figure 5: 14-3-3! is increased in hearts of swim-training mice whereas decreased in CHF mice. (A) 14-3-3", (C) 14-3-3% and (E) 14-3-3! were detected by Western blot in the myocardium of swim training, TAC and CHF mice respectively; eIF5 was used as a loading control. A representative western blot for each treatment from three independent experiments is shown. Quantitative analysis of 14-3-3" (B), 14-3-3% (D) and14-3-3! (F), Results are represented as mean Âą S.D. (n = 3). *p < 0.05, **p < 0.01 compared to control or SHAM2 from the same group.

V. Discussion

These differences are particularly evident clinically, for pathological hypertrophy often progresses to heart failure, especially when pathological stimuli are persistent, whereas physiological hypertrophy usually does not. Regular aerobic exercise has many effects that are important in the prevention and treatment of cardiovascular disease (Belardinelli et al, 1999; Giannuzzi et al, 2003). To develop more effective gene therapies to treat cardiac hypertrophy and failure it is critical to

Examples of stimulus-dependent hypertrophic responses can be found in both physiological and pathological hypertrophy. Exercise-induced cardiac hypertrophy is a good example of physiological hypertrophy, which is a favorable adaptive response of the heart to increases in bodily demand. In comparison, pathological hypertrophy is a maladaptive response to pathological stimuli, such as pressure or volume overload. 77

Zhang et al: 14-3-3! and cardiac hypertrophy understand the genes and proteins involved in the development of pathological versus physiological cardiac hypertrophy. Although previous studies have shown that physiologic and pathologic hypertrophies have distinct functional characteristics, it was not clear whether these two forms of hypertrophy were mediated by common or distinct proteins. This work suggests that 14-3-3! is involved in the induction of cardiac hypertrophy including physiological (swimming induced), pathological and heart failure (pressure overload induced). Of clinical relevance with regard to the transition from hypertrophy to heart failure, mice displayed marked cardiac dysfunction in response to pressure overload, also we show that 14-3-3! is up-regulated in swimming-training mice in contrast to down-regulated in mice of chronic heart failure. Homodynamic overload initially results in an adaptive concentric hypertrophy in the heart, normalizing wall tension. Sustained pressure overload will override these adaptive mechanisms, leading to eccentric hypertrophy, decreased contractile function, and the development of heart failure (Chien et al, 1999). Molecular pathways involved in cardiac hypertrophy can be specifically studied in vivo by exposing mice to either biomechanical stress through TAC (Rockman et al,1991) or hormonally induced hypertrophy (Brancaccio et al, 2003; Oudit et al, 2003). This approach led to the identification of many signal transduction pathways involved in these processes (Frey and Olson 2003; Olson and Schneider 2003). As we showed in this study, swimming-training stress result in physiological cardiac hypertrophy, which shows normal cardiac function, hypertrophic myocytes and no fibrosis. In contrast, TAC firstly results in concentric hypertrophy with hearts weight and LVPWd increased mild fibrosis. When pressure overload are persistent, LVIDs, LVIDd, EDS and EDV increased, FS decreased, marked fibrosis formed, leading to decompensate cardiac hypertrophy and heart failure (Figure 1). 14-3-3! is a member of the 14-3-3 protein family, which binds diverse proteins and functions as a scaffold to facilitate or attenuate the activities of the binding proteins (Tzivion et al, 2002). Recent studies demonstrated that brain 14-3-3! was highly up-regulated in rats treated with rosiglitazone, 14-3-3! bind to ligand-activated peroxisome proliferator–activated receptor-#, and enhance sequestration of phosphorylated Bad and thereby suppress apoptosis to protect against ischemic cerebral infarction and neuronal apoptosis. Different signaling cascades may be important for the induction of 14-3-3 proteins in these two forms of hypertrophy is supported by other reports in the literature. Cardiac-specific over-expression of G+q, which is activated by a number of ligands, including angiotensin II (Ang II), NE and endothelin-1 (ET-1), induced cardiac hypertrophy akin to pathological hypertrophy (D’Angelo et al, 1997). Furthermore, pressure overload-induced hypertrophy but not swimming-induced hypertrophy was inhibited by Ang II receptor blockade (Geenen et al, 1996; Devereux et al, 2000). Downstream of Gq, p38, c-Jun NH (2)-terminal kinase (JNK), and

PKC" all have been implicated in mediating pathological hypertrophy (Bowman et al, 1997; Cook et al, 1999; Choukroun et al,1999). Calcineurin, another important hypertrophic mediator, has been implicated for the induction of pathological hypertrophy, but not resulted in physiological cardiac hypertrophy (Wilkins et al, 2004). Recent studies suggest that p38 plays a critical role in the development of fibrosis in response to pathological stimuli but not to cardiac growth itself (Zhang et al, 2003;Braz et al, 2003). Furthermore, using mice with cardiac-specific expression of dominant-negative (DN) mutants of 14-3-3 (DN 14-3-3/TG) and p38alpha/beat MAPK (DNp38alpha and DNp38") mice, it was shown that 14-3-3 protein along with p38 MAPK mediated in left ventricular remodeling associated with swimming stress (Watanabe K et al, 2007). The most likely candidate responsible for mediating exercise-induced cardiac hypertrophy is insulin-like growth factor-I (IGF-I), which activates PI3K (p110+) coupled to receptor tyrosine kinases. Cardiac-specific over-expression of the IGF-I receptor in transgenic mice resulted in cardiac hypertrophy that was characteristic of physiological hypertrophy, and the increase in heart weight was suppressed when these mice were crossed with dnPI3K transgenic mice. By contrast, cardiac formation of Ang II was increased in hypertrophied hearts of patients with heart failure (Serneri et al, 2001). It has been suggested that glycogen synthase kinase-3" (GSK-3") provides a mechanism for cross talk between the Akt and calcineurin pathways (Antos et al, 2002). Akt directly phosphorylates GSK-3", resulting in its inactivation. It was reported that mice expressing a constitutive-active form of GSK-3"did not develop exercise-induced hypertrophy, thereby, indicating the importance of the PI3K/Akt/GSK-3"pathway in physiological hypertrophy. Our laboratory previously reported that constructing AdR18, a recombinant adenovirus which encoding R18, a general 14-3-3 peptide inhibitor, to disrupt 14-3-3 functions. We found that 14-3-3 proteins inhibits norepinephrine-induced cardiomyocytes hypertrophy through regulation of the PI3K ⁄PKB⁄GSK3" and NFAT pathway. Further, 14-3-3 proteins inhibit proliferation of cardiac fibroblasts, via p70 S6 kinase (p70S6K) phosphorylation and PI3 kinase activition, not through extra-cellular signal-regulated kinase (ERK) phosphorylation. Therefore, 14-3-3! maybe promote physiological cardiac hypertrophy via IGF-I/PI3K/AKT pathway and inhibit pathological cardiac hypertrophy via signaling molecules downstream of GPCRs activated by pathological stimuli (eg. NE, Ang II, ET-I. etc). The cardiac function in mice are based on echocardiography in vivo, further evaluated can be performed by invasive hemodynamic measurements. Combined with anatomy data in mice, it is possible to analyze objectively. The use of isoform-specific inhibitors of 14-3-3 isoforms has generated great interest in oncology. Further studies are required to elucidate the mechanisms responsible for the depressed function in 14-3-3! transgenics in response to TAC (e.g., increased 78

Gene Therapy and Molecular Biology Vol 13, page 79 fibrosis, necrosis, depressed excitation-contraction coupling). However, 14-3-3 proteins are ubiquitous proteins that are highly conserved from bacteria to humans and plants. Mice did not survive embryonic development when knockout ! isoform of 14-3-3 proteins. In consequent study, we may concentrate on knocking down the function of 14-3-3! by using siRNA in vitro. In summary, our findings suggest that exercise training and increased 14-3-3! expressions have a favorable impact on physiological cardiac hypertrophy. The cardio-protective role of 14-3-3! may be caused, at least in part, by promotion of physiological signaling cascades and inhibition of pathological signaling cascades. It may be of benefit to selectively target 14-3-3! as a potential gene strategy for the treatment of heart failure.

Cohn JN, Bristow MR, Chien KR, Colucci WS, Frazier OH, Leinwand LA, Lorell BH, Moss AJ, Sonnenblick EH, Walsh RA, Mockrin SC, and Reinlib L (1997) Report of the National Heart, Lung, and Blood Institute Special Emphasis Panel on Heart Failure Research. Circulation 95, 766-770. Cook SA, Sugden PH, and Clerk A (1999) Activation of c-Jun N-terminal kinases and p38-mitogen-activated protein kinases in human heart failure secondary to ischaemic heart disease. J Mol Cell Cardiol 31, 1429-1434. D'Angelo DD, Sakata Y, Lorenz JN, Boivin GP, Walsh RA, Liggett SB, and Dorn GW (1997) Transgenic Galphaq overexpression induces cardiac contractile failure in mice. Proc Natl Acad Sci USA 94, 8121-8126. Datta SR, Katsov A, Hu L, Petros A, Fesik SW, Yaffe MB, Greenberg ME (2000) 14-3-3 Proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 6, 41-51. Delneri D, Colson I, Grammenoudi S, Roberts IN, Louis EJ, Oliver SG (2003)Engineering evolution to study speciation in yeasts. Nature 422,68-72. Devereux RB, Roman MJ, Palmieri V, Okin PM, Boman K, Gerdts E, Nieminen MS,Papademetriou V, Wachtell K, Dahlöf B (2000) Left ventricular wall stresses and wall stress-mass-heart rate products in hypertensive patients with electrocardiographic left ventricular hypertrophy: the LIFE study. Losartan Intervention For Endpoint reduction in hypertension. J Hypertens 18,1129-38. Ding B, Price RL, Borg TK, Weinberg EO, Halloran PF, and Lorell BH (1999)Pressure overload induces severe hypertrophy in mice treated with cyclosporine, an inhibitor of calcineurin. Circ Res 84, 729-734. Du JH, Liao WQ, Wang YY, Han CD, and Zhang YY (2005) Inhibitory effect of 14-3-3 proteins on serum-induced proliferation of cardiac fibroblasts. Eur J Cell Biol 84, 843-852. Frey N£¨and Olson EN (2003) Cardiac hypertrophy: The good, the bad, and the ugly. Annu Rev Physiol 65, 45-79. Fu H, Subramanian RR, Masters SC (2000) 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol 40, 617-647. Fukamizu A, Sugimura K, Takimoto E, Sugiyama F, Seo MS, Takahashi S, Hatae T,Kajiwara N, Yagami K, Murakami K (1993) Chimeric renin-angiotensin system demonstrates sustained increase in blood pressure of transgenic mice carrying both human renin and human angiotensinogen genes.J Biol Chem 268,11617-21 Geenen DL, Malhotra A, and Buttrick PM (1996) Angiotensin receptor 1 blockade does not prevent physiological cardiac hypertrophy in the adult rat. J Appl Physiol 81,816-821. Giannuzzi P, Mezzani A, Saner H, Björnstad H, Fioretti P, Mendes M, Cohen-Solal A, Dugmore L, Hambrecht R, Hellemans I, McGee H, Perk J, Vanhees L, and Veress G (2003) Physical activity for primary and secondary prevention. Position paper of the Working Group on Cardiac Rehabilitation and Exercise Physiology of the European Society of Cardiology. Eur J Cardiovasc Prev Rehabil 10,319-327. Goldman EH, Chen L, Fu H (2004) Activation of apoptosis signal-regulating kinase 1 by reactive oxygen species through dephosphorylation at serine 967 and 14-3-3 dissociation. J Biol Chem 279, 10442-10449.

Acknowledgments This work was supported by grants from the Foundation of National Key Basic Research and Development Project (No. 2006CB503806) and the National Natural Science Foundation of China (Nos. 30672466, 30821001).

References Anne TF, Ella E, Christopher BU, Tej KP, Timothy AC, Heiko H,Jeffrey RM, Anouk RL, Andrew PF, Martha RS, and Saraswati SI (2000) High frequency of hypermethylation at the 14-3-3 s locus leads to gene silencing in breast cancer. Proc Natl Acad Sci USA 97, 6049-6054. Antos CL, McKinsey TA, Frey N, Kutschke W, McAnally J, Shelton JM, Richardson JA, Hill JA, and Olson EN (2000) Activated glycogen synthase-3 " suppresses cardiac hypertrophy in vivo. Proc Natl Acad Sci USA 99,907-912. Belardinelli R, Georgiou D, Cianci G, and Purcaro A (1999) Randomized, controlled trial of long-term moderate exercise training in chronic heart failure: effects on functional capacity, quality of life, and clinical outcome. Circulation 99, 1173-1182. Bowman JC, Steinberg SF, Jiang T, Geenen DL, Fishman GI, and Buttrick PM (1997) Expression of protein kinase C " in the heart causes hypertrophy in adult mice and sudden death in neonates. J Clin Invest 100, 2189-2195. Brancaccio M, Fratta L, Notte A, Hirsch E, Poulet R, Guazzone S, De Acetis M, Vecchione C, Marino G, Altruda F, Silengo L, Tarone G, and Lembo G (2003) Melusin, a muscle-specific integrin _1-interacting protein, is required to prevent cardiac failure in response to chronic pressure overload. Nat Med 9, 68-75. Braz JC, Bueno OF, Liang Q, Wilkins BJ, Dai YS, Parsons S, Braunwart J, Glascock BJ, Klevitsky R, Kimball TF, Hewett TE, and Molkentin JD (2003) Targeted inhibition of p38 MAPK promotes hypertrophic cardiomyopathy through upregulation of calcineurin-NFAT signaling. J Clin Invest 111, 1475-1486. Chien KR (1999) Stress pathways and heart failure. Cell 98,555-558. Choukroun G, Hajjar R, Fry S, del Monte F, Haq S, Guerrero JL, Picard M, Rosenzweig A, and Force T (1999) Regulation of cardiac hypertrophy in vivo by the stress-activated protein kinases/c-Jun NH(2)-terminal kinases. J Clin Invest 104,391-398.

Zhang et al: 14-3-3! and cardiac hypertrophy Hallberg B (2002) Exoenzyme S binds its cofactor 14-3-3 through a non-phosphorylated motif. Biochem Soc Transactions 30, 401-405. Heineke J, and Molkentin JD (2006) Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol 7,589-600. Hekman M, Wiese S, Metz R, Albert S (2004) Dynamic changes in C-Raf phosphorylation and 14-3-3 protein binding in response to growth factor stimulation: differential roles of 14-3-3 protein binding sites. J Biol Chem 279, 14074-14086. Hobbs RE (2004) Guidelines for the diagnosis and management of heart failure. Am J Ther11, 467-472. Iemitsu M, Miyauchi T, Maeda S, Sakai S, Kobayashi T, Fujii N, Miyazaki H, Matsuda M, and Yamaguchi I (2001) Physiological and pathological cardiac hypertrophy induce different molecular phenotypes in the rat. Am J Physiol Regul Integr Comp Physiol 281, R2029-R2036. Izumo S, Nadal-Ginard B, and Mahdavi V (1988) Protooncogene induction and reprogramming of cardiac gene expression produced by pressure overload. Proc Natl Acad Sci USA 85,339-43. Kannel WB (2000) Vital epidemiologic clues in heart failure. J Clin Epidemiol 53, 29-235. Kaplan ML, Cheslow Y, Vikstrom K, Malhotra A, Geenen DL, Nakouzi A, Leinwand LA, and Buttrick PM (1994) Cardiac adaptations to chronic exercise in mice. Am J Physiol 267, H1167-H1173 . Li P, Li J, Feng X, Li Z, Hou R, Han C, and Zhang Y (2003) Gene expression profile of cardiomyocytes in hypertrophic heart induced by continuous norepinephrine infusion in the rats. Cell Mol Life Sci 60, 2200-2209. Liao WQ, Wang SY, Han CD, and Zhang YY (2005) 14-3-3 proteins regulate glycogen synthase 3_ phosphorylation and inhibit cardiomyocyte hypertrophy. FEBS Journal 272, 1845-1854. Levy D, Garrison RJ, Savage DD, Kannel WB, and Castelli WP (1990) Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med 322,1561-1566. Levy D, Kenchaiah S, Larson MG, Benjamin EJ, Kupka MJ, Ho KK, Murabito JM, and Vasan RS (2002) Long-term trends in the incidence of and survival with heart failure. N Engl J Med 347,1397-1402. Libera A, Capaldi S, Monaco HL, Rizzuto N, and Monaco S (2005) Phosphorylated 14-3-3% protein in the CSF of neuroleptic-treated patients. Neurology 64, 1618-1620. Berg D, Holzmann C, Riess O (2003) 14-3-3 Proteins in the nervous system. Nature 4, 752-762. Light Y, Paterson H, Marais R (2002) 14-3-3 antagonizes Ras-mediated Raf-1 recruitment to the plasma membrane to maintain signaling fidelity. Mol Cell Biol 22, 4984-4996. Martin H, Patel Y, Jones D, Howell S, Robinson K, and Aitken A (1993) Antibodies against the major brain isoforms of 14-3-3 protein. An antibody specific for the N-acetylated amino-terminus of a protein. FEBS Lett 331,296-303. McMullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Kang PM, Izumo S (2003) Phosphoinositide 3-kinase (p110alpha) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy. Proc

Natl Acad Sci USA 100, 12355-60. McMullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Dorfman AL, Longnus S, Pende M, Martin KA, Blenis J, Thomas G, Izumo S (2004) Deletion of ribosomal S6 kinases does not attenuate pathological, physiological, or insulin-like growth factor 1 receptor-phosphoinositide 3-kinase-induced cardiac hypertrophy.Mol Cell Biol 24,6231-40. McMullen JR, and Jennings GL (2007) Differences between pathological and physiological cardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clin Exp Pharmacol Physiol 34, 255-262. McMullen JR, Amirahmadi F, Woodcock EA, Schinke-Braun M, Bouwman RD, Hewitt KA, Mollica JP, Zhang L, Zhang Y, Shioi T, Buerge AR, Izumo S, Jay PY, and Jennings GL (2007) Protective effects of exercise and phosphoinositide 3-kinase(p110) signaling in dilated and hypertrophic cardiomyopathy. Proc Natl Acad Sci USA 104, 612-617. Olson EN, and Schneider MD (2003) Sizing up the heart: Development redux in disease. Genes & Dev 17, 1937-1956. Oudit GY, Crackower MA, Eriksson U, Sarao R, Kozieradzki I, Sasaki T, Irie-Sasaki J, Gidrewicz D, Rybin VO, Wada T, Steinberg SF, Backx PH, and Penninger JM (2003) Phosphoinositide 3-kinase _-deficient mice are protected from isoproterenol-induced heart failure. Circulation 108, 2147-2152. Peoc'h K, SchrĂśder HC, Laplanche J, Ramljak S, and MĂźller WE (2001) Determination of 14-3-3 protein levels in cerebrospinal fluid from Creutzfeldt-Jakob patients by a highly sensitive capture assay. Neurosci Lett 301,167-170. Petosa C, Masters SC, Bankston LA, Pohl J, Wang BC, Fu H & Liddington RC (1998) 14-3-3f Binds a phosphorylated Raf peptide and an unphosphorylated peptide via its conserved amphipathic groove. J Biol Chem 273, 16305-16310. Qi W, Liu X, Qiao D, and Martinez JD (2005) Isoform-specific expression of 14-3-3 proteins in human lung cancer tissues. Int J Cancer 113,359-363. Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross JJ, and Chien KR (1991) Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci 88, 8277-8281. Serneri GG, Boddi M, Cecioni I, Vanni S, Coppo M, Papa ML, Bandinelli B, Bertolozzi I, Polidori G, Toscano T, Maccherini M, and Modesti PA (2001) Cardiac angiotensin II formation in the clinical course of heart failure and its relationship with left ventricular function. Circ Res 88,961-968. Sekimoto T, Fukumoto M, Yoneda Y (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27 (Kip1). EMBO J 23, 1934-1942. Srere PA (1969) Citrate synthase. Methods Enzymol13, 3-5. Subramanian RR, Zhang H, Wang H, Ichijo H, Miyashita T, Fu H (2004) Interaction of apoptosis signal-regulating kinase 1 with isoforms of 14-3-3 proteins. Exp Cell Res 294, 581-591. Timothy A, Zhang CL (2001) Identification of a signal-responsive nuclear export sequence in class II histone deacetylases. Mol Cell Biol 21, 6312-6321. Tzivion G, Avruch J (2002) 14-3-3 Proteins: Active cofactors in cellular regulation by serine/threonine phosphorylation. J Biol Chem 277, 3061-3064. 80

Gene Therapy and Molecular Biology Vol 13, page 81 Van Everbroeck BR, Boons J, and Cras P (2005) 14-3-3 {#}-isoform detection distinguishes sporadic Creutzfeldt-Jakob disease from other dementias. J Neurol Neurosurg Psychiatry 76,100-102. Van Hemert MJ, Steensma HY, and van Heusden GP (2001) 14-3-3 proteins: key regulators of cell division, signalling and apoptosis. Bioessays 23,936-946. Watanabe K, Ma M, Hirabayashi K, Gurusamy N, Veeraveedu PT, Prakash P, Zhang S, Muslin AJ, Kodama M, and Aizawa Y (2007)Swimming stress in DN 14-3-3 mice triggers maladaptive cardiac remodeling: role of p38 MAPK. Am J Physiol Heart Circ Physiol 292, H1269-H1277 Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, Jones F, Kimball TR, Molkentin JD (2004) Calcineurin-NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res 94:110-118. Wiltfang J, Otto M, Baxter HC, Bodemer M, Steinacker P, Bahn E, Zerr I, Kornhuber J, Kretzschmar HA, Poser S, R端ther E, and Aitken A (1999) Isoform pattern of 14-3-3 proteins in the cerebrospinal fluid of patients with Creutzfeldt-Jakob disease. J Neurochem 73, 2485-2490. Yang HZ, Masters SC, Wang HN, Fu H (2001) The proapoptotic protein Bad binds the amphipathic groove of 14-3-3f. Biochimica Biophysica Acta 1547, 313-319. Yin F, Li P, Zheng M, Chen L, Xu Q, Chen K, Wang YY, Zhang YY, and Han C (2003) Interleukin-6 family of cytokines mediates isoproterenol-induced delayed STAT3 activation in mouse heart. J Biol Chem 278, 21070-21075. Zanusso G, Fiorini M, Farinazzo A, Gelati M, Benedetti MD, Ferrari S, Dalla Libera A, Capaldi S, Monaco HL, Rizzuto

N, Monaco S (2005) Phosphorylated 14-3-3% protein in the CSF of neuroleptic-treated patients.Neurology 64,1618-20. Zhang L, Chen J, Fu H (1999) Suppression of apoptosis signal-regulating kinase 1-induced cell death by 14-3-3 proteins. Proc Natl Acad Sci USA 96, 8511-8515. Zhang R, He XR, Liu WM (2003) AIP1 mediates TNF-a-induced ASK1 activation by facilitating dissociation of ASK1 from its inhibitor 14-3-3. J Clin Invest 111, 1933-1943. Zhang S, Weinheimer C, Courtois M, Kovacs A, Zhang CE, Cheng AM, Wang Y, and Muslin AJ (2003) The role of the Grb2-p38 MAPK signaling pathway in cardiac hypertrophy and fibrosis. J Clin Invest 111,833-841.

Gene Therapy and Molecular Biology Vol 13, page 82 Gene Ther Biol Vol 13, 82-90, 2009

Delivery of opioid analgesics to the brain: the role of blood-brain barrier Review Article

Sebastiano Mercadante1*, Edoardo Arcuri2 1

Pain Relief and Palliative Care Unit, La Maddalena Cancer Center, Palermo Pain therapy and Intensive Care, National Cancer Institute, Rome _____________________________________________________________________________________________ 2

*Correspondence: Dr Sebastiano Mercadante, MD, Pain Relief and Palliative Care Unit, La Maddalena Cancer Center, Via San Lorenzo 312, 90146 Palermo, Italy, Tel: 39 0916806521; Fax: 39 0916806110; e-mail: terapiadeldolore@lamaddalenanet.it Key words: Opioids, brain-blood-barrier, and pain Received: 26 May 2009; Revised: 1 June 2009; Accepted: 26 May 2009; electronically published: June 2009

Summary The Blood-brain-barrier (BBB) has been found to have multiple functions rather than being a simple anatomic structure. The BBB provides a stable milieu, essential for the complex integrative functions of the CNS, and has also a protective action against potentially damaging neuroactive substances and other neurotransmitters with highly variable changes in systemic extracellular fluids, blocking their entry or actively transforming by hydrolyzing and conjugating enzymes, and removing them from brain via active efflux transporters. A large number of transporters are present in the BBB, most of them being designed to carry polar substances into the brain that would otherwise have minimal access to the CNS. All the observations regarding the unpredictability of traditional factors influencing the drug passage through the BBB may be partially explained by recent investigations regarding membrane-bound drug transporters capable of actively pumping a variety of drugs out of the CNS. The most characterized transporter system is represented by P-glycoprotein (P-gp), a saturable transporting system systemically expressed widely in several tissues, impeding the delivery of therapeutic agents. Many drugs, including opioids, which are potentially effective at their site of action, may have a decreased effect due to a failure to deliver them in sufficient amount to the CNS. Opioid transport is often the result of the concerted action of efflux and uptake pumps located in the BBB. Polymorphisms affecting drug transporters are of interest for opioid analgesia, as altered function or expression of transporters might cause differences in the extracellular brain concentrations of opioids. Given such an important role of P-gp in the drug disposition process, it is not surprising to see increasing interest on the role of polymorphisms in this transporter as a potential determinant of interindividual variability in opioid response.

comprehensive reading, before describing how opioids may be delivered to brain, the characteristics of the BBB will be described, as well as some specific conditions most frequently encountered in clinical daily practice when using opioids, like cancer or chronic pain conditions, able to modify BBB function.

I. Introduction Opioids analgesics produce analgesia at peripheral and central sites. However, the principal target of action remains the central nervous system (CNS). The presence of the blood brain barrier (BBB) presents a challenge for effective delivery of analgesics to the CNS. In recent years, it has become evident that a complex group of interacting cells constituting the BBB have other properties, influencing solute transportation and metabolic activity, other than offering an anatomical barrier to the free passage of drugs (Begley, 2004a). Many drugs, including opioids, which are potentially effective at their site of action, may have a decreased effect due to a failure to deliver them in sufficient amount to the CNS. The aims of this review were multiple. Thus, to provide a

II. Anatomy and physiology of BBB The function of the BBB is twofold. The BBB has either an anatomic and neuroprotective function. A stable milieu is essential for CNS activity to perform its complex integrative activity. BBB enables the creation of a stable compartment of intracerebral extracellular fluid, distinct from the systemic extracellular fluid. The somatic extracellular fluid contains many substances at variable

Mercadante et al: Delivery of opioid analgesics to the brain concentrations that cannot be tolerated in the CNS, which operates in an extremely stable background. The BBB has also a protective action against potentially damaging neuroactive substances and other neurotrasmitters with highly variable changes in systemic extracellular fluids, blocking their entry or actively transforming by hydrolyzing and conjugating enzymes, and removing them from brain via active efflux transporters. For example, amino acids present in high plasma concentrations are potent excitatory neurotransmitters in CNS. A typical example of metabolic function of the BBB is represented by the model of successful treatment of Parkinsonâ&#x20AC;&#x2122;s disease. L-Dopa crosses the BBB via a neutral amino acid transporter and is then converted by dopa-decarboxylase to biologically active dopamine (Neuwelt, 2004). Furthermore, there is an enzymatic barrier at the cerebral endothelia, capable of metabolizing drugs and nutrients, and include gamma-glutamyl transpeptidase, alkaline phosphatase and decarboxylases. Finally, drug efflux transporters, such as P-glycoprotein, are mainly present on the luminal membrane surface (see below). The BBB is a thin, membraneous structure formed by the cerebral endothelial cells of brain and spinal cord capillaries, astrocytes, basement membrane, pericytes, and neurones in physical proximity to the endothelium. Endothelial cells are connected by tight junctions produced by the interaction of transmembrane proteins, which interact to impede free diffusion for polar solutes. Despite the capability of endocytosis is lower in comparison with peripheral endothelial cells, this mechanism is significant for transportation across BBB of macromolecules, such as peptides and proteins. Endothelial cells express transport proteins in the two interfaces, in both sides (bidirectional) or one side (unidirectional). Endothelial cells, adjacent pericytes, and the end-feet of astroglia induce the tight junction formation, the expression of transport proteins, and differentiation of cerebral endothelium, and contribute to the proteins of the surrounding extracellular matrix, which in turn influence the differentiation of the cells constituting the BBB, also named neurovascular unit. The interaction of these junctional proteins blocks free diffusion for polar solutes from blood. These transmembraneous proteins include occludin, claudins, junctional adhesion molecules, and membrane-associated guanylate kinase-like proteins (Persidsky et al, 2006). Some substances can be transported into the brain, and others out. As tight junctions seal off the brain to polar solutes, endothelial cells are required to maintain high level of expression of transport proteins for essential polar metabolites to facilitate their efflux (Begley 2004b). The endothelial cells forming BBB also exhibit a polarized expression of transport proteins, so that the transport of some solutes can be facilitated in either direction depending on the direction of gradient concentration. Finally, perivascular macrophages and microglia are part of the BBB and contribute differentiating and modulatory signals (Zenker et al, 2002). A similar barrier, the blood-cerebrospinal fluid barrier (B-CSF-B) is present in the epithelium of the choroid plexus and circumventricular organs, although

these structures result to be more permeable. The total surface area of circumventricular organs is smaller than that of the BBB and results to be less efficient than expected to delivery substances, other than for several pharmacokinetic considerations (Bickel et al, 2001). Choroid plexus produces CSF and regulates the movement of solutes in a bidirectional way, while circumventricular organs are fenestrated to allow a restricted volume of extracellular fluid to rapidly equilibrate with plasma, the composition resembling a plasma ultrafiltrate. Dendritic processes and receptors on neurons within this area can interact with blood-borne solutes and their nervous activity can be modulated. The cells forming the avascular arachnoid membrane enveloping the whole CNS also possess tight junctions, that effectively seal the paracellular diffusional pathway between these cells (Begley, 2004a). CSF drains proteins and other metabolites from the interstitial fluid. The volume of CSF that leaves the CNS via pseudolymphatic pathways may nearly equal the volume of CSF that leaves via arachnoid granulations. Because of these blood-CNS barriers and the lack of a true lymphatic vessels, the CNS is often considered immunologically privileged, although a slow influx of white cells has been noted in some circumstances and may subject to changes in disease states (see below) (Neuwelt, 2004).

III. Passage of drugs through the BBB Physicochemical characteristics of drugs are determinant for passing BBB, the molecular weight being between 150 and 500 Da and a log octanol-water partition coefficient between 0.5 and 6. Only the uncharged fraction of drugs partially ionized determines the diffusion gradient for a passive diffusion across BBB. The ability of drugs to cross the BBB has long been recognized to be predicted by molecular weight, degree of ionization, protein binding, and lipid solubility. Some small solutes with high lipophilicity are observed to poorly penetrate the BBB and show lower permeability into the brain than expected (Hamabe et al, 2006). In contrast, some substances may have an even larger CNS entry, not commensurate with that predicted on the basis of their lipid solubility penetration. These molecules, which are mainly essential metabolites for the brain, are facilitated by a carrier-mediated or energy-dependent concentrative mechanism entry dependent on specific proteins inserted in the membranes of the capillary endothelial cells. Transport is often asymmetric. Passive paracellular transport of hydrophilic compounds is restricted by tight junctions between endothelial cells of the BBB (Fromm, 2004). A transport lipidic vector interacts with a cell surface receptor initiating transcytosis. After tissue enzymes cleaves the peptide from its vector, the free substance will be then available for interaction with its specific receptor in brain cells (Bickel et al, 2001) or converted into an active metabolite at their site of action (Bodor and Buchwald, 2003). Other than lipid solubility, favouring CNS penetration, stable plasma concentration associated with long half-life helps maintaining the diffusion gradient over an extended period. 83

Gene Therapy and Molecular Biology Vol 13, page 84 Other than direct instillation of chemotherapeutic agents, spinal therapies are increasingly used for chronic pain, both malignant and non-malignant. In general, there is a positive correlation between the degree of water solubility and both the spread of analgesia and adverse effects. Highly water-soluble opioids like morphine administered intrathecally exhibit a greater degree of rostral spread in comparison with lipophilic opioids like fentanyl, offering better supraspinal analgesia and more extensive coverage (Cohen and Dragovich, 2007). Transmucosal route is a viable and interesting possibility for the delivery of some drugs to the brain. In fact olfactory neurons, surrounded by arachnoid membrane, containing CSF, terminates penetrating the olfactory mucosa (Dale et al, 2002). Alternately, nasally administered drugs are taken up by the olfactory nerves and transported by retrograde axonal cytoplasmic flow back into CSF (Begley, 2004a). Thus, CSF has direct communication with olfactorial mucosa via perineuronal space, and drugs may enter the CSF without restrictions usually linked to the BBB.

P-gp interacts with a diverse set of hydrophilic and amphiphatic compounds as well as lipophilic compounds and confers resistance to tumor cells by extruding cytotoxic natural product hydrophobic drugs using the energy of ATP hydrolysis. Other complex interactions are known to occur with modulators of the multidrug resistance phenotype (Sauna and Ambudkar, 2001). P-gp acts as an energy-dependent efflux pump, which transports a wide array of structurally divergent compounds, including chemotherapeutic agents, calcium channel blockers, antiarrythmics, immunosuppressants, HIV preotease-inhibitors, and many opioid analgesics, from the intracellular to the extracellular compartment (Ambudkar et al, 1999). As the system is saturable, various compounds can compete with each other, including many drugs that currently in clinical use, such as quinidine, verapamil, and ketokonazole. Some substances, like probenecid, cyclosporine and verapamil, may inhibit the activity of these transporters and could improve delivery across BBB (Neuwelt, 2004). P-gp inhibitors reverse drug resistance in cancer patients and improve treatment outcome (Gottesman, 2002), although P-gp modulators might increase toxicity to the CNS. Antisense approach showed a down regulation of P-gp, which in turn, reduced the efflux of the compounds from the brain into circulation (King et al, 2001).

IV. BBB transporters A large number of transporters are present in the BBB, most of them being designed to carry polar substances into the brain that would otherwise have minimal access to the CNS. The large neutral aminoacid carrier is the transport system that appears to accept the widest variety of substrates (Begley et ao, 2004a). All the observations regarding the unpredictability of traditional factors influencing the drug passage through the BBB may be partially explained by recent investigations regarding membrane-bound drug transporters capable of actively pumping a variety of drugs out of the CNS. Most of the BBB transporters are from the superfamily of ATPbinding cassette (ABC) proteins, which mediate cellular extrusion of substances with diverse structures. The most characterized of the ABC transporters is the ABCB1 (MDR1, P-glycoprotein) (P-gp). P-gp is a saturable transporting system systemically expressed widely in several tissues, having a protective role and conferring drug-resistance by impeding the delivery of therapeutic agents. Together with xenobiotic-metabolizing enzymes, P-gp expression is believed to be an important protective mechanism against potentially toxic xenobiotics. P-gp limits drug entry as a result of its expression in enterocytes, hepatocytes, proximal tube cells in the kidneys, and at BBB level. Thus, P-gp is an important component of the BBB that limits accumulation of many compounds in brain via active flux across the luminal membrane of capillary endothelium. P-gp is also expressed in the spinal cord and choroids plexus (Dagenais et al, 2004). A reduction of this functional protein could lead to highly increased brain distribution of P-gp substrates (Taylor, 2002). P-gp-knockout experiments have contributed significantly to understanding of the importance of P-gp in limiting drug transfer to the brain. Limited penetration through the BBB could be an obstacle to adequate drug therapy, and a state of P-gp over expression may be one mechanism underlying pharmaco-resistance.

V. Factors impairing BBB integrity in cancer Several diseases may produce relevant changes in BBB, and transport of some specific substances can be impaired (Neuwelt 2004). The efficacy of BBB may decline with age, although it is not clearly demonstrated (Preston, 2001). The importance of P-gp was first recognized in cancer cells, where it is responsible for the development of resistance to cytotoxic agents. Brain tumors may affect BBB function due to changes in microvessels morphology with some discontinuation and development of fenestration (Schlageter et al, 1999). The degree of BBB integrity is variable in the different areas of the tumor, and these different permeabilities result in sharply reduced concentrations of chemotherapeutic agents (Siegal and Zylber-Katz, 2002). Moreover BBB integrity often recovers when the bulk of a tumor decrease with treatment. Finally, some glial tumors demonstrated increased levels of P-gp (Neuwelt, 2004). In damaged brain tissue after traumatic injury, an increased BBB permeability to morphine has been reported in the penumbra zone surrounding a focal mass lesion and in apparently normal brain regions in patients with general brain swelling (Ederoth et al, 2003). Extravasation into the brain through the BBB may be influenced by weak inflammatory stimuli such as pain, or stronger stimuli such as infection and other immunological factors. The BBB compromise and cell extravasation with modulation by cytokines and chemokines, are key events in the changes of BBB permeability. Corticosteroids and other therapeutic agents decrease the passage of immune cells across the BBB (Gasperini et al, 1998). Peripheral inflammatory hyperalgesia has been found to produce an 84

Mercadante et al: Delivery of opioid analgesics to the brain up-regulation P-gp in BBB endothelial cells, restricting the passage of morphine across the BBB (Seelback et al, 2007). This information suggests that pathophysiological states, such as inflammation and infection can impact drug availability (McRae et al, 2003).

of opioids across the BBB could be an important step in permitting opioids to exert a centrally mediated analgesic effect. Many opioids have been identified as P-gp substrates with variable degrees (Graff and Pollack, 2004, Skorpen et al, 2008, Waldel et al, 2002, Kalvas et al, 2007). Both efflux and uptake carrier systems have been implicated in the transport of opioid drugs. Transporter expression at the BBB has the potential to significantly influence the clinical efficacy and safety of opioids, whose major site of action lies within the CNS. The two major families of drug transporters of relevance to opioid pharmacokinetics are the ABC superfamily of efflux transporters, and the solute carrier (SLC) superfamily of influx transporters. P-gp expression at the BBB is of particular importance to opioids, regulating the access to their site of action and consequently affecting efficacy. Opioid analgesics given systematically have limited distribution into the brain because of their interaction with P-gp, with the brain uptake and the antinociceptive effects of opioids being dependent on P-gp function. Opioids activate P-gp ATPase, producing energy requisite for P-gp transport. The relative dependence of opioids of P-gp is an important determinant for opioid action. Among opioid analgesics there are some differences in substrate specificity for P-gp. Morphine and fentanyl have been found to activate P-gp ATPase in the brain capillary endothelial cell membranes and showed higher analgesic potencies in P-gp-deficient mice suggesting that their analgesic effects are considerably dependent on P-gp expression. In contrast meperidine did not show antactivating effect of P-gp ATPase (Hamabe et al, 2006). Studies have indicated that the presence of P-gp reduces both the magnitude and duration of analgesia produced by morphine, methadone, and fentanyl, whereas the analgesic efficacy of M6G and meperidine is less affected (Thompson et, 2002), suggesting that some opioids may be weak substrates for P-gp. However, in another experiment assessing the initial bran uptake, increased brain accumulation was demonstrated only for morphine. It can be expected that the effect under steadystate conditions would be more significant also for other opioids (Dagenais et al, 2004). Factors interacting with Pgp functioning may alter the response to opioids. Drugs that are not themselves substrates for P-gp but may inhibit P-gp are a potential source of important drug interactions, allowing the increased penetration into CNS of concomitant drugs. The inhibition of P-gp results in substantial alteration of drug tissue availability of concomitantly administered drugs, with unexpected more clinical effects, but also producing a potential to cause adverse effects of those with a narrow safety margin. Loperamide, which has a prevalent peripheral effect, is a high affinity P-gp substrate that is effectively pumped out of the CNS that pharmacologically effective concentrations are not achieved in the brain, despite being a potent opioid (Wandel et al, 2002). Morphine is an effective analgesic, which requires high plasma concentrations to penetrate to enter in small amount the BBB, due to its hydrophilicity. Data regarding modulation of P-gp modulation are contrasting. The active

VI. Pain and BBB Pain is a complex phenomenon involving endocrine and immunological responses. The immune response is characterized by the release of inflammatory mediators in response to a stimulus and is typified by increased vascular permeability, edema formation and leukocyte migration. Other kinins, prostaglandins, matrix metalloproteinases, cellular adhesion molecules, excitatory peptides and aminoacids, numerous cytochines, both excitatory and inhibitory, are involved in the immune response when microglia, neurons, astroglia, perivascular cells are activated. Levels of cytochine expression depend on the brain region. Chemokines recruit leukocytes to the site of inflammation playing inflammatory and homeostatic roles. Cytochines have also been shown to activate hypothalamic-pituitary-adrenal (HPA) axis producing a stress cascade response down to corticosteroids, which in turn modulate the expression of cytochines, chemiotaxis, and production of inflammatory mediators (Wolka et al, 2003). Inflammatory mediators have also been shown to alter receptor-mediated endocytic reuptake at the BBB. Cytochines appear to play a role in BBB disruption, increasing endothelial permeability due to loss of the tight junction proteins. Adhesions of leukocytes induced by chemokines, produce similar damage. Mast cell activation in response to hormonal stress also influences BBB permeability. One consequence of BBB disruption has been shown to be increased drug delivery to the brain. This altered delivery may be detrimental, resulting in unexpected toxicity, or beneficial, resulting in improved therapeutic outcome. On the other hand, the ability of the brain to secrete active peptides into circulation may be a mechanism providing neurochemical links to peripheral sites. Evidence suggests that BBB may be unidirectional, and able to secrete a wide range of structurally diverse compounds from the brain to circulation. Some cytokines, for example, do not pass into the brain to an appreciable degree in normal condition when given intravenously. Yet, they are rapidly excreted from the brain to the blood (King et al, 2001).

VII. Opioid passage through BBB It is well known that the doses of opioids needed for pain relief clinically vary between individuals. The response to opioids depends on several factors, including variable bioavailability, differences in pain mechanism, differences in pharmacodynamics at the !-receptor, in drug metabolism, and genetics (Mercadante and Portenoy, 2001). Recent studies revealed that inherited differences in drug-metabolizing enzymes, opioid receptors, and drugtransporters, might affect the effectiveness of opioid drugs in individual patients (Klepstad et al, 2005). Although there are many factors that can influence the pharmacokinetics-pharmacodynamics of a drug, transport 85

Gene Therapy and Molecular Biology Vol 13, page 86 efflux of morphine across the BBB has been demonstrated, also producing a delay of the clinical effects (Mantione et al, 2005). But an acute inhibition of P-gp did not affect pharmacokinetics of morphine in volunteers (Drewe et al, 2000). Individual differences in morphine analgesia were negatively correlated with relative cortical P-gp expression levels and basal P-gp ATP-ase activity (Hamabe et al, 2005). This effect was not observed with high doses of morphine, possibly due to the saturation of morphine-P-gp coupling, leading to the increment of non-specific permeation across the BBB. Of interest, although morphine injection may increase P-gp ATP-ase activity, this returns to the basal level after elimination of substrate drug, suggesting that this mechanism is not relevant for developing antinociceptive tolerance (Al-Shavi et al, 2003). However, other studies supported that down regulation of P-gp enhanced both the potency and duration of action of systemic morphine, and blocked the development of tolerance (King et al, 2001). Induction of P-gp may be one mechanism involved in the development of morphine tolerance. Chronic morphine exposure appeared to induce P-gp in rat brain, enhancing the morphine efflux from the brain (Aquilante et al, 2000). Down-regulation of P-gp enhanced both the potency and duration of action of systemic morphine, and blocked the development of tolerance (King et al, 2001). On chronic administration the up-regulated P-gp would be expected to result in lower brain concentration of morphine and thereby exacerbating tolerance to the central analgesic effects (Mercier et al, 2007). It has also been suggested that P-gp transport system may provide a mechanism of communication between the CNS and the periphery throughout the secretion of peripherally acting peptides and hormones. P-gp active transport of morphine out of the brain into circulation could be crucial in providing a synergistic interaction between peripheral and central opioid systems (King et al, 2001). In MDR-1 knockout mice there was a two-fold increased net brain uptake of morphine, lending support to the notion that P-gp may affect the brain morphine disposition (Schinkel et al, 1996). Down regulating P-gp expression with antisense reduced the brain to blood transport of morphine and other opioids resulting in significantly enhanced systemic morphine analgesia. However, analgesic analgesia of centrally administered morphine decreased, suggesting that supraspinal analgesia depends on a combination of central and peripheral mechanisms activated by morphine transported from the brain to the blood. Similar effects were produced disrupting the MDR1 gene (King et al, 2001). M6G is a metabolite of morphine that appears to have a greater analgesic potency than morphine. M6G has a higher potency when administered by intracerebroventricular route and produce a longer antinociceptive effect than morphine. It is highly hydrophilic and has BBB permeability 57 times lower than morphine. However the brain uptake rate is only 32 times lower suggesting that an active transport mechanism might exist (Mantione et al, 2005). Although efflux transporters act on M6G at the BBB, the probenecid-sensitive transporters seem to be not involved in the brain efflux, as

the ratio was unaltered when probenecid was coadministered (Tumblad et al, 2005), and possibly is trapped by other transporters (Bourasset et al, 2006). Chemical lipidization may increase brain penetration of morphine. A lipophilic drug with limited activity, able to penetrate the BBB, can be converted in an active substance within CNS, and get more polar to be effectively retained in the CNS. For example, in codeine, the hydroxyl groups of morphine are substituted, the molecule increases lipid solubility and increases brain uptake. Codeine is rapidly transported into the brain and quickly reached distribution equilibrium with the same unbound concentrations in blood and brain. Therefore the influx is identical to efflux, which suggests that only passive process participate in codeine BBB transport (Xie and ammarlund-Udenaes, 2005). Substituting acetyl groups to form dyacethylmorphine (heroin), it is possible to substantially increase CNS penetration, providing an excellent example of chemical manipulation. However, dyacethylmorphine is also rapidly metabolized back to the parent drug, and this form, after the typical flash clinically observed, prevalently interacts with opioid receptors. Morphine maintains CNS levels, as it cannot easily back diffuse across the BBB. Drugs with high octanol-water partition ratios, like fentanyl, tend to have high tissue/blood partition ratios. This is evidence for both inward and outward vectors of transport relative to the microvascular lumen. At the BBB, P-gp actively pumps a variety of lipophilic drugs away from the brain tissue, thus reducing the tissue/blood partition ratio that would exist by passive diffusion alone. The active p-gp-mediated extrusion of fentanyl, however, is overshadowed by an active inward transport process, mediated by an unidentified transporter. Moreover studies also showed that fentanyl may act as P-gp inhibitor (Hentorn et al, 1999). Despite a lower affinity to opioid receptor, oxycodone and morphine have a similar potency. This observation is explained by the finding that oxycodone is actively influxed at the BBB, in comparison with morphine and its metabolites, and codeine. It has been shown that the influx clearance is 3-fold greater than the efflux clearance, resulting in a higher concentration for oxycodone than could be anticipated from plasma concentrations (Bolstrom et al, 2006). The concentration of unbound oxycodone in brain ISF was six times higher than that of morphine for the same unbound plasma concentrations, meaning that the rate of transport of oxycodone is very high compared with morphine (Bolstrom et al, 2008). This is probably due to transport proteins with saturable mechanisms (Bolstrom et al, 2006). These transporters are energy-dependent, proton-coupled antiporter (Okura et al, 2008). Methadone is characterized by the large variability in response, which has been related to the complex pharmacodynamics and pharmacokinetics, or activity of Pgp. Methadone has been shown to be a substrate of P-gp, suggesting a possible role of this efflux protein in methadoneâ&#x20AC;&#x2122;s individual variability. P-gp in BBB greatly limits the brain entry of (R) and (S) methadone to their central nervous system acting sites (Wang et al, 2004).

Mercadante et al: Delivery of opioid analgesics to the brain The polymorphic expression of P-gp in BBB may represent a source of variation for the access and effects of methadone in the brain. Oral methadone potency was increased three fold in patients treated with a P-gpinhibitor, valspodar (Rodriguez et al, 2004). Methadone dosage requirement has been reported to be influenced by ABCB1 haplotypes in opioid dependent subjects in methadone maintenance treatment (Persidsky et al, 2006). This finding was not confirmed in a similar group of patients (Coller et al, 2006), possibly for the different dose used, which saturated P-gp (Crettol et al, xxxx). P-gp was found to mediate brain to blood efflux transport of buprenorphine across the BBB, at least in part. The use of inhibitors, such as cyclosporine A, quinidine, and verapamil, enhanced uptake of buprenorphine by 1.5fold (Suzuki et al, 2007). The potential exists for drug interactions to result during chronic opioid therapy because of P-gp inhibition for other drugs. P-gp substrates may competitively inhibit P-gp, resulting in an increased uptake of opioids into brain. For example, cyclosporine and verapamil are both inhibitors and substrates for P-gp, digoxin, loperamide, vincristine, and dexamathasone are substrates for P-gp, whereas quinidine and ketoconazole are inhibitors but not substrates for P-gp (Waldel et al, 2002). While P-gpinducers such as rifampicin and St Johnâ&#x20AC;&#x2122;s wort cause a substantial increase in withdrawal symptoms (Coller et al, 2006), P-gp-inhibitors verapamil, quinidine, and probenecid have been shown to reduce the efflux clearance of morphine (King et al, 2001, Tumblad et al, 2005). Valspodar, an analogue of cyclosporine D, has been developed for its high potency to reverse the resistance to chemotherapy of cancer cells by inhibiting P-gp. However, in humans, where direct measurements of changes in brain disposition of morphine and M6G were not possible, and relied on peripheral blood measurements, the coadministration of valspodar with morphine did not significantly affect the pharmacokinetic and pharmacodynamic profile of morphine (Drewe et al, 2000). While most inhibitors are not particularly potent at clinically concentrations, some drugs, such as corticosteroids may reach concentrations that are high enough to affect the distribution and clearance of opioids, such as morphine, methadone, and fentanyl (Thompson et al, 2000). P-gp-inhibition as a way of increasing the concentrations of drugs in the brain and thus increasing the central effects was tested in studies using loperamide. Loperamide, an opioid presumed to not producing central effects, elicits potent centrally mediated opioid-like effects and evidences increased brain accumulation in P-gpdeficient mice (Xie and Hammarlund-Udenaes, 1998). When administered with quinidine, a known relatively selective P-gp-inhibitor, loperamide produced respiratory depression, independently from the plasma concentration of the drug (Begley, 2004b). Moreover, in P-gp knockout mice, doses of loperamide that are normally without effect in wild mice were lethal (Schinkel et al, 1996).

VIII. P-gp pharmacogenomics and opioids Many studies have increased our knowledge and understanding of how pharmacogenetics can influence the opioid response and contribute to interpatient variability. However, the importance of pharmacogenomics at present is at the level of explaining variability in drug response and toxicity, and not necessarily its immediate translation into clinical practice (Skorpen et al, 2008). Drug transport is often the result of the concerted action of efflux and uptake pumps located both in the basolateral and apical membranes of epithelial cells. Polymorphisms affecting drug transporters are of interest for opioid analgesia, as altered function or expression of transporters might cause differences in the extracellular brain concentrations of opioids. Although there are many transporters that theoretically could be involved in transport of opioids, most studies have focused on P-gp. P-gp functions as a transmembrane efflux pump that translocates its substrates from its intracellular domain to its extracellular domain. Given such an important role of P-gp in the drug disposition process, it is not surprising to see increasing focus on the role of polymorphisms in this transporter as a potential determinant of interindividual variability in pharmacological response. Differences in opioid potencies may also be due to structure-activity relationship (Mercier et al, 2007). The ABCB1 gene encoding P-gp is highly polymorphic, with more than 50 single nucleotide polymorphisms, and possesses the potential to affect the expression and function of the transporter. Genetic or chemical disruption of P-gp has been shown to enhance the antinociceptive and toxic effects of some opioids, although the extent of this phenomenon has yet to be better understood. Genetic polymorphisms of P-gp may affect opioid pharmacokinetics by changing the levels of P-gp expression. Many polymorphisms have been identified in the ABCB1 gene and several have been associated with differences in protein expression and function (Skorpen et al, 2008). Animal and human studies have produced conflicting results regarding the functional consequences of polymorphisms in terms of opioid activity, although there is some evidence that the brain distribution of morphine, which is transported by these systems with less efficiency than loperamide, may be affected by 3435 genotype. This polymorphism did not influence the pharmacodynamic effects of methadone (Lotsch et al, 2006). No association between morphine dose requirements and polymorphisms 2677G/A or 3435C>T was found (Coulbault et al, 2006). However, highly significant association between variability of pain relief and genotypes of the 3435C>T polymorphism was recently found (Campa et al, 2008). The effect of haplotypes, meaning significant linkage disequilibrium across ABCB1 gene, is more likely to predict P-gp expression and function. For example, employing ABCB1 haplotypes, subjects for the wild-type haplotypes required significant higher dose of methadone than heterozygous or non-carriers, and carriers of AGCTT haplotype required lower doses compared with noncarriers (Somogyi et al, 2007). Similarly, the ABCB1 87

Gene Therapy and Molecular Biology Vol 13, page 88 GG2677/CC3435 diplotype has been found to predict morphine adverse effects than either of the two analyzed separately (Coulbault et al, 2006). Genotypes susceptible to fentanyl were associated with early decrease of respiration rate as compared with resistant genotypes (Park et al, 2006). Adverse effects were not correlated to 3435C>T genotype in morphinetreated cancer patients (Campa et al, 2008). The hypothetical effects of two polymorphic genes, one involved in pharmacokinetics (ABCB1, MDR1, encoding P-gp), and another involved in pharmacodynamics (OPRM1, encoding for !-opioid receptor), have been evaluated. Pain relief variability was associated with both polymorphism, the single-nucleotide polymorphism C3435T of ABCB1 and A80G of OPRM1, and combining the extreme genotypes of both genes, the association between patient polymorphism and pain relief improved (Campa et al, 2008). The commonest adverse effects that limit dose titration are drowsiness and confusion. The occurrence of these central adverse effects is the main reason to switch from one opioid to another. In a study of markers of the need of opioid switching in cancer patients with pain who poorly responded to morphine, genetic variation in MDR-1 has been found to be independently associated with moderate-severe drowsiness and confusion or hallucinations, with G2677T/A showing the strongest association. Of interest, no differences were observed in serum morphine levels between genotypes, reflecting the poor correlation between serum and CNS levels f morphine (Ross et al, 2008). The discrepancies among the results of the various studies of ABCB1 genetic polymorphisms or haplotypes on the function of P-gp variants include small study population, lack of standardization for the determination of P-gp expression, interethnic differences, and unknown roles of other transporters (Fromm, 2004). Of the multidrug resistance-associated proteins in the ABCC family, ABCC1, ABCC2, and ABCC3 are the most likely to be involved in opioid transport and a number of glucuronide conjugates (Somogyi et al, 2007). Several polymorphisms have been identified, but functional consequences to the transport of opioids have not been determined yet. The organic anion transporting popypeptides (SLCO) family consists of different isoforms. SLCO1A2 is predominantly expressed in the brain capillary endothelial cells, differently from SLCO1B3, which is almost expressed in the liver. The identification of functionally relevant genetic polymorphisms warrants further investigation (Somogyi et al, 2007).

peripheral sites, for example intestinal, liver, and kidney P-gp, different metabolic genotypes, pharmacological interactions, receptor polymorphisms, may also minimize the influence of BBB P-gp functioning, which should be considered as a part of the complex framework determining the final response to opioids in individuals. The polymorphisms that affect the response to opioids are likely to be complex and multigenetic, with a number of alleles each making a modest contributes to the overall phenotype. In addition, environmental and behavioural factors combine with pharmacokinetic and pharmacodynamic factors. This information may help in the development of an effective strategy for customization of opioid therapy.

References Al-Shavi MK, Polar MK, Omote H, Figler RA. (2003) Transition state analysis of the coupling of drug transport to ATP hydrolisis by P-glycoprotein. J Biol Chem 278;52629-52640. Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I, Gottesman MM. (1999) Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Ann Rev Pharmacol Toxicol 39:361-398 Aquilante C, Leternt S, Pollack G, Brouwer (2000) Increased brain P-glycoprotein in morphine tolerant rats. Pharmacol Let 66:47-51. Begley DJ. (2004a) Delivery of therapeutic agents to the central nervous system: the problems and possibilities. Pharmacol Ther 104:29-45. Begley DJ. (2004b) ABC transporters and the blood-brain barrier. Curr Pharm Res 10:1295-1312. Bickel U, Yoshikawa T, Pardridge W. (2001) Delivery of peptides and proteins through the blood-brain barrier. Advanc Drug Del 46:247-279. Bodor N, Buchwald P. (2003) Brain-targeted drug delivery: experience to date. Am J Drug Targ 1:13-16. Bolstrom E, Simonsson U, Hammarlund-Udenaes M. (2006) In vivo blood-brain barrier transport of oxycodone in the rat: indications for active influx and implications for pharmacokinetics/pharmacodynamics. Dru Met Disp 34:16241631. Bolstrom E, Hammarlund-Udenaes M, Simonsson U. (2008) Blood-brain barrier transport helps to explain discrepancies in invivo potency between oxycodone and morphine. Anesthesiology 108:495-505. Bourasset F, Schermann JM. (2006) Carrier-mediated processes at several rat brain interfaces determine the neuropharmacokinetics of morphine and morphine 6-beta-DGlucuronide. Life Sci 78:2302-2314. Campa D, Gioia A, Tomei A, Poli P, Barale R. (2008) Association of ABCB1/MDR1 and OPRM1 gene polymorphisms with morphine pain relief. Clin Pharmacol Ther 83;559-566. Cohen S, Dragovich A. (2007) Intrathecal analgesia. Med Clin N Am 91:251-270. Coller JK, Barratt DT, Dahlen K, Loennechen MH, Somogyi AA. (2006) ABCB1 genetic variability and methadone dosage requirements in opioid-dependent individuals. Clin Pharmacol Ther 80:682-690. Crettol S, Deglon JJ, Besson J et al. (2006) No influence of ABCB1 haplotypes on methadone dosage requirement. Clin Pharmacol Ther 83:668-669. Coulbault L, Beaussier M, Verstuyft C, et al. (2006) Environmental and genetic factors associated with morphine

IX. Conclusions Different models and experimental conditions have been used, including inhibition of binding or transport of another substrate, use of non-specific inhibitors, antinociceptive response without concurrent measurement of brain accumulation, making it difficult to assess quantitatively the interaction of opioids with P-gp. Moreover, other factors, such as plasma protein binding, affinity for brain tissue, egress component, other 88

Mercadante et al: Delivery of opioid analgesics to the brain response in the postoperative period. Clin Pharmacol Ther 79:316-324. Dagenais C, Graff CL, Pollack GM. (2004) Variable modulation of opioid bain uptake by P-glycoprotein in mice. Bioch Pharmacol 67:269-276. Dale O, Hjortkjaer R, Kharasch ED. (2002) Nasal administration of opioids for pain management in adults. Acta Anaesthesiol Scand 46:759-770. Drewe J, Ball H, Beglinger C, et al. (2000) Effect of Pglycoprotein on the clinical pharmacokinetics and adverse effects of morphine. Br J Clin Pharmacol 50:237-246. Ederoth P, Tunblad K, Bouw R, et al. (2003) Blood-brain barrier transport of morphine in patients with severe brain trauma. Br J Clin Pharmacol ;57:427-435. Fromm MF. (2004) Importance of P-glycoprotein at blood-tissue barriers. Trends Pharmacol Sci 25:423-429. Gasperini C, Pozzilli C, Bastianello S, et al. (1998) Effects of steroids on Gp-enhancing lesions before and during recombinat B-interferon treatment in relapsing remitting multiple sclerosis. Neurology 50:403-405. Gottesman MM. (2002) Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2:48-58. Graff CL, Pollack GM. (2004)Drug transport at the blood-brain barrier and the choroid plexus. Curr Drug Metab 5:95-108. Hamabe W, Maeda T, Kiguchi N, Yamamoto C, Tokuyama S, Kishioka S. (2007) Negative relationship between morphine analgesia and P-Glycoprotein expression levels in the brain. J Pharmacol Sci 105:353-360. Hamabe W, Maeda T, Fukuzawa Y, et al. (2006) P-glycoprotein ATPase activating effect of opioid analgesics and their Pglycoprotein-dependent antinociception in mice. Parmacol Biochem Behav 85:629-636. Henthorn TK, Liu Y, Mahapatro M, Ng KY. (1999) Active transport of fentanyl by the blood-brain barrier. J Pharmacol Exp Ther 289:1084-1089. Kalvass JC, Olson ER, Cassidy MP, Selley DE, Pollack GM. (2007) Pharmacokinetics and pharmacodynamics of seven opioids in P-glycoprotein-competent mice: assessment of unbound brain EC50, and correlation of in vitro, preclinical, and clinical data. J Pharmacol Exp Ther. 323:346-55 King M, Su W, Chang A, Zuckerman A, Pasternak G. (2001) Transport of opioids from the brain to the periphery by Pglycoprotein: peripheral actions of central drugs. Nat Neurosci 4:268-274. Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. (2005) Genetic variability and clinical efficacy of morphine. Acta Anaesthesiol Scand 49:902-908. LĂśtsch J, Skarke C, Wieting J, et al. (2006) Modulation of the central nervous effects of levomethadone by genetic polymorphisms potentially affecting its metabolism, distribution, and drug action. Clin Pharmacol Ther 79:72-89 Mantione KJ, Goumon Y, Esch T, Stefano GB. (2005) Morphine 6beta glucuronide: fortuitous morphine metabolite of preferred peripheral regulatory opiate? Med Sci Monit 11:MS43-46. McRae MP, Brouwer KL, Kashuba AD. (2003) Cytokine regulation of P-glycoprotein. Drug Metabol Rev 35:19-33. Mercadante S, Portenoy RK. (2001) Opioid poorly-responsive cancer pain. Part 1: clinical considerations. J Pain Symptom Manage 21:144-150. Mercier S, Hassan H, Cunningham C, Eddington N, Coop A. (2007) Opioids and efflux transporters. Part 1. P-glycoprotein substrate activity of N-substituted analogues of meperidine. Biorg Med Chem Let 17:1160-1162. Neuwelt EA. (2004) Mechanisms of disease: the blood-brain barrier. Neurosurgery 54:131-142. Okura T, Hattori A, Takano Y et al. (2008) Involvement of the pyrilamine transporter, a putative organic cation transporter,

in blood-brain barrier transport of oxycodone. Drug Metab Dispos 36:2005-2013. Park HJ, Shinn HK, Ryu SH, et al. (2006) Genetic polymorphism in the ABCB1 gene and effects of fentanyl in koreans. Clin Pharmacol Ther 81:539-546. Persidsky Y, Ramirez S, Haorah J, Kanmogue G. (2006) Bloodbrain barrier: structural components and function under physiologic and pathologic conditions. J Neuroimmune Pharmacol 1:223-236. Preston JE. (2001) Ageing choroids plexus-cerebrospinal fluid system. Microsc Res 52:31-37. Rodriguez M, Ortega I, Soengas I, Suarez E, Lukas JC, Calvo R. (2004) Effect of P-glycoprotein inhibition on methadone analgesia and brain distribution in the rat. J Pharm Pharmacol 56:367-374. Ross JR, Riley J, Taegetmeyer A, et al. (2008) Genetic variation and response to morphine in cancer patients. Cancer 112:1390-1403. Sauna ZE, Ambudkar S. (2001) Characterization of the catalytic cycle of ATP hydrolysis by human P-glycoprotein. J Biol Chem 276:11653-11661. Schlageter K, Molnar P, lapin GD, Groothuis R. (1999) Microvessel organization and structure in experimental brain tumors: microvessels populations with distinctive structural and functional properties. Microvascular Res 58:312-328. Schinkel AH, Wagenaar E, Mol C, Deemter LV. (1996) Pglycoprotein in the blood-brain barrier of mice influences the brain penetration and pharmacological activity of many drugs. J Clin Invest 97:2517-2524. Seelbach MJ, Brooks T, Egleton R, Davis T. (2007) Peripheral inflammatory hyperalgesia modilates morphine delivery to the brain: a role for P-glycoprotein. J Neurochem 102;16771690. Siegal T, Zylber-Katz E. (2002) Strategies for increasing drug delivery to the brain. Clin Pharmacokinet 41:171-186. Skorpen F, Laugsand EA, Klepstad P, Kaasa S. (2008) Variable response to opioid treatment: any genetic predictors within sight? Palliat Med 22:310-327. Somogyi A, Barratt DT, Coller JK. (2007) Pharmacogenetics of opioids. Clin Pharmacol Ther 81:429-444. Suzuki T, Zaima C, Moriki Y, Fukami T, Tomomo K. (2007) Pglycoprotein mediates brain-to-blood efflux tra sport of buprenorphine across the blood-brain barrier. J Drug Target 15:67-74. Taylor EM. (2002) The impact of efflux transporters in the brain on the development of drugs for CNS disorders. Clin Pharmacokinet 41:81-92. Thompson SJ, Koszdin K, Bernards CM. (2000) Opiate-induced analgesia is increased and prolonged in mice lacking Pglycoprotein. Anesthesiology 92:1392-1399. Tunblad K, Hammarlund-Udenaes M, Jonsson EN. (2005) Influence of probenecid on the delivery of morphine-6glucuronide to the brain. Eur J Pharm Sci 24:49-57. Zenker D, Begley D, Bratzke H, Rubsamen-Waigman H, von Briesen H. (2003) Human blood-derived macrophages enhance barrier function of cultured primary bovine and human brain capillary endothelial cells. J Physiol 531:10231032. Wandel C, Kim R, Wood M, Wood A. (2002) Interaction of morphine, fentanyl, sufentanyl, alfentanyl, and loperamide with the efflux drug transporter P-glycoprotein. Anesthesiology 96:913-920. Wang J, Ruan Y, Taylor RM et al, (2004) Brain penetration of methadone ÂŽ and (S)- enantiomers is greatly increased by Pglycoprotein deficiency in the blood-brain barrier of Abcb1a gene knockout mice. Psychopharmacol 173:132-138.

Gene Therapy and Molecular Biology Vol 13, page 90 Wolka AM, Huber JD, Davis TP. (2003) Pain and the bloodbrain barrier: obstacles to drug delivery. Adv Drug Del Rev 55:987-1006. Xie R, Hammarlund-Udenaes M. (1998) Blood-brain barrier equilibration of codeine in rats studied with microdialysis. Pharm Res 15:570-575.

Mercadante and Arcuri

Gene Therapy and Molecular Biology Vol 13, page 91 Gene Ther Mol Biol Vol 13, 91-129, 2009

Genes and Happiness Review Article

*Kenneth Blum1, 4, 5,10, Amanda LC Chen2, Thomas JH Chen**2, Abdalla Bowirrat3, B.William Downs4, Roger L. Waite4, Jeffrey Reinking5, Mallory Kerner6, Dasha Braverman6, Nicholas DiNubile7, Patrich Rhoades8, Eric R. Braverman5, 9, Stella M. Savarimuthu,6 Seth H. Blum10, Marlene Oscar-Berman11, Tomas Palomo12, Eric Stice13, Mark Gold14, David E. Comings15 1

Department Physiology & Pharmacology, Wake Forest University School of Medicine, Winston–Salem, North Carolina Chang Jung Christian University, Tainan, Taiwan 3 Clinical Neuroscience & Population Genetics, Ministry of Science, Israel 4 Department of Nutrigenomics, LifeGen Inc, San Diego, California 5 Department of Rehabilitative Medicine, University of California Medical School, Davis, California 6 Department of Clinical Neurology, PATH Research Foundation, New York, New York 7 Department of Orthopedic Surgery, Hospital of the University of Pennsylvania, Philadelphia, Pennsylvania 8 Department of Clinical Medicine, Modesto Pain Clinic, Modesto, California 9 Department of Neurological Surgery, Weill Cornell Medical College, New York 10 Department of Nutrional Genetics, Synaptamine, Inc., San Antonio, Texas 11 Boston University School of Medicine and VA Healthcare System, Boston, Massachusetts 12 Hospital Universitario 12 de Octubre, Madrid, Spain, 13 Oregon Research Institute, Eugene, Or. 14 Department of Psychiatry, University of Florida, Gainesville, Fl. 15 Emeritus; Department of Medical Genetics, City of Hope Medical Center, Duarte, CA _____________________________________________________________________________________________ 2

*Correspondence: Kenneth Blum, Ph. D. Department of Physiology & Pharmacology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina 27157; Tel + 619-890-2167; Email: drd2gene@aol.com and Thomas JH Chen Ph.D., Department of Engineering, Chang Jung Christian University, Tainan, Taiwan; Email: tjhchen@yahoo.com.tw. Key words: Happiness, Genospirituality, Reward Deficiency Syndrome (RDS), Gene Map, Dopamine Received: 22 May 2009; Revised: 25 May 2009; Accepted: 31 May 2009; electronically published: 4 June 2009

Summary Since the discovery of the double helix, the study of brain function, in terms of both physiology and behavioral traits, has resulted in a plethora of research linking these activities to the genetic basis of neurotransmitter function. Knowledge about how genes are expressed, as well as their potential impairment due to polygenic inheritance, can shed light on predispositions to addiction and self-destructive behaviors. Genetic information derived from scientific explorations of genetic traits may have important links to understanding the basis for feelings of well-being and potentially the phenomena associated with human happiness. While non-genetic oriented research of social, political, and biological studies have addressed the impact of social and institutional environments on mass political attitudes and behaviors, there is a paucity of solid research on the interrelation and influence of genetic and environmental factors on these parameters. The separate fields of psychology and molecular biology are subject to inherent limitations that may only be resolved through collaboration across disciplines. Certainly areas relating to spirituality (“Genospirituality”) and political science are just two that are beginning to emerge as fruitful grounds for identification of specific polymorphic gene associations and may pave the way to advance a new science of human nature. We address the issue of “Nature vs. Nurture” as it relates to questions regarding the definition of happiness, its causes, and its promotion. These questions are central to understanding human nature and are emerging as an important target of research, especially in the area of nutrigenomics. The present commentary attempts to identify key “vector influences” that link genes, the brain, nutrition, and social behavior to a most desired, but misunderstood, and potentially fragile experience known as “happiness.” Specifically, we propose that successful changes in body composition/body mass index (BMI)/ percentage of body fat will increase not only positive self-image, but overall wellness that produces a state of happiness. We provide preliminary evidence that utilization of a customized dopaminergic agonist LG839 DNA directed 91

Blum et al: Genes and Happiness nutraceutical, significantly increased happiness in obese subjects. We detail genotypes that may play a role in determining happiness, based on current knowledge. additional income does little to raise your sense of satisfaction with life. How about a good education? Sorry Mom and Dad, neither education nor, for that matter, a high IQ paves the road to happiness. Youth? No, again. In fact, older people are more consistently satisfied with their lives than the young. And they're less prone to dark moods. A recent survey by the Centers for Disease Control and Prevention found that people ages 20 to 24 are sad for an average of 3.4 days a month, as opposed to just 2.3 days for people ages 65 to 74. The earlier notion – “where you live makes you happy”, has recently been challenged by the work of North and others (North et al. 2008). They suggest that happiness can change and underscore the importance of exploring more deeply the role that family relationships play in facilitating such change and this is not related to economic status (Wenz, 1977). Similarly, the idea that marriage increases happiness has been challenged by the evidence that married people may have been happier than single people because the former were happier to begin with. What about the relationship between sunny climate and happiness? Although evidence does not support this view, a 1998 study showed that Midwesterners think folks living in balmy California are happier, and that Californians incorrectly believe this about themselves too.

I. Psychology of Happiness For most of its history, psychology has concerned itself with all that ails the human mind: anxiety, depression, neurosis, obsessions, paranoia, delusions, etc., and the behaviors they produce. The goal of practitioners has been to bring patients from a negative ailing state to a neutral normal state. Or, as University of Pennsylvania psychologist Martin Seligman puts it, "from a minus five to a zero" (Seligman 2002). In Seligman’s’ work he and his colleagues studied very happy people. In a sample of 222 undergraduates screened for high happiness, using multiple confirming assessment filters, they compared the upper 10% of consistently very happy people with average and very unhappy people. The very happy people were highly social, and had stronger romantic and other social relationships than less happy groups. They were more extraverted, more agreeable, and less neurotic, and scored lower on several psychopathology scales of the Minnesota Multiphasic Personality Inventory. Compared with the less happy groups, the happiest respondents did not exercise significantly more, participate in religious activities significantly more, or experience more objectively defined good events. No variable was sufficient for happiness, but good social relations were necessary. Members of the happiest group experienced positive, but not ecstatic, feelings most of the time, and they reported occasional negative moods. This suggests that very happy people do have a functioning emotion system that can react appropriately to life events (Diener and Seligman, 2002).

A. Genospirituality On the positive side, there is “genospirituality,” the coupling of genes and spirituality. That is, religious faith seems genuinely to lift the spirit, although it is difficult to determine whether it's the God part or the community aspect that does the heavy lifting. Charlton (2008) believes that it is possible that genospirituality could explain why some people are unable to have the kind of spiritual or religious experiences they want (or perhaps even need) in order to lead the kind of life to which they aspire. Further, according to Charlton (2008), “While greater religiousness may be associated with greater happiness, more altruistic behaviors and higher fertility (Stark, 2007), and these may turn-out to be significantly causal, it is possible that geneticallyenhanced religiousness might lead to other problems. Perhaps churches would get too powerful and attempt to control science, technology, and the economy with disastrous effects. Or perhaps church members might become fanatically loyal and too easily manipulated into dangerous behaviors. On the other hand, it is also possible that highly moral, altruistic, peaceable, and principled behaviors might become more prevalent; and the energy and joyousness of the best churches might spread and be strengthened”. Moreover, Nilsson et al. (2007) found that among boys, self-transcendence and spiritual acceptance were negatively correlated with the short5-HTTLPR genotype and positively correlated with the short AP-2beta geotype.

II. Happiness Characteristics Over many decades, psychological researchers have begun to place more and more emphasis on understanding influences upon mental and emotional health and well-being. Some of Seligman's own research, for instance, had focused on optimism, a trait shown to be associated with good physical health, less depression and mental illness, longer life, and, yes, greater happiness. Perhaps the most eager explorer of this terrain was University of Illinois psychologist Edward Diener, a.k.a. Dr. Happiness. For more than two decades, Diener had been examining what does and does not make people feel satisfied with life. Seligman's goal was to shine a light on such work and encourage much, much more of it. So, what has science learned about what makes the human heart sing? More than one thing you might imagine, along with some surprising things about what doesn't ring our inner chimes. Take wealth, for instance, and all the delightful things that money can buy. The age-old belief that people seek wealth to achieve power, which is then expected to produce pleasure and happiness, may be wrong. In agreement with Kahneman, research by Diener, among others, has shown that once your basic needs are met,

Gene Therapy and Molecular Biology Vol 13, page 93 Both among boys and girls, significant interactive effects were found between 5-HTTLPR and AP-2beta genotypes, with regard to Self-Transcendence and Spiritual acceptance. Boys and girls with the combination of presence of the short 5-HTTLPR, and homozygosity for the long AP2beta genotype scored significantly lower on SelfTranscendence and Spiritual Acceptance. In this regard, Comings and associates have found gene polymorphic associations with spirituality (Comings et al. 2000). It is noteworthy that using a spiritual inventory as part of clinical history is important as an additional tool for medical treatment and diagnosis (Braverman, 1987). Although controversial, clinical studies are beginning to clarify how spirituality and religion can contribute to the coping strategies of many patients with severe, chronic, and terminal conditions (Post et al. 2000). One interesting notion has received considerable attention distinguishing religion from spirituality, especially in dying patients (Sulmasy, 2006). Twin studies of spirituality showed that genes accounted for 50 percent of the variance, the unique environment for 50 percent, and the common environment, including cultural influences, zero percent (Kirk et al. 1999). This suggests that spirituality may be an intrinsic biological trait. By contrast, common environment and cultural transmission accounted for a significant percent of the variance of church attendance suggesting that religion is transmitted, at least in part, by non-genetic transmission from generation to generation (called meme) (Kirk et al. 1999). There are certain advantages that favor spirituality in terms of achieving well-being for both genders and these include but are not limited to – “spirituality alleviates man’s fears of his own death and of mortality”; “Spirituality gives man control over a threatening world”; spirituality and near death experiences”; spirituality and optimism”; spirituality, religion and social cohesiveness”; “spirituality as a defense mechanism”; “inborn spirituality as a moral watchdog”; and “finding a spiritual mate”. The concept of spirituality having significant benefits for the human “psyche”, potentially leading to both optimism and happiness may be independent of the existence or non-existence of God (Comings, 2008). Hamer in his popular book “The God Gene” suggested that the selection for dopaminergic spirituality genes was driven by their ability to produce an innate sense of “feel good” optimism. Accordingly, this would have selective value in the sense that optimism relates to the will to keep on living and procreating, despite the fact that death is inevitable (Comings, 2008). Moreover, studies have shown that optimism seems to promote better health and quicker recovery from disease, features that would have positive selective value. Newberg et al (2001) suggested a different kind of association of spirituality with a “feel good” sensation. They suggested, “the neurological machinery of spiritual transcendence may have arisen from neural circuitry [limbic system] that evolved for mating and sexual experience. We find this very interesting especially in light of work on dopaminergic genes and dopamine function

suggesting that the substance dopamine is now considered to be both the “pleasure and anti-stress molecule” (Comings and Blum 2000). Newberg and associates proclaimed, “It is no coincidence that mystics of all times and cultures have used the same expressive terms to describe their ineffable sexual experience: bliss, rapture, ecstasy and exaltation.” They further suggested that the feel-good sensation was linked to the very neurological structures and pathways involved in transcendent experience-including the arousal, quiescent, and limbic systems –evolved primarily to link sexual pleasures to the powerful sensations of orgasm; the dopamine jackpot! Finally as Comings (2008) suggests, “Spirituality can be defined as a feeling of a connection with something greater than oneself including any form of social order. Perhaps the greatest factor in the evolution of spirituality is that such a trait would maximize the development of man as a social animal”. While the former concept is true, behavioral scientists suggest that the connection to “higher power” is morphed by man’s greatest fear, which is death. In consideration of one’s spirituality pondering the unattainable notion of our immortality and the doom of being a mortal man, ultimately leads to feelings of doom with no escape at hand. We have witnessed it in the form of comedy as viewed in the film “What About Bob?, which explores the subject of “death therapy” and the never-ending question of inescapable death as observed by a prepubescent child. In this regard Deepak Chopra in his New York Times best-selling book “Life After Death” (2006), clearly explains the many facets of peoples beliefs as they relate to the possibilities of life after death. He emphatically asserts, “Those who have the least freedom of choice are driven by obsessions, compulsions, addictions, and unconscious impulses. To the extent that you become free of these, you have more choice. The same is true of a soul contemplating its next physical incarnation”. The thought and most of all, the belief that through a series of rules man will emerge into a higher plane never going back in terms of their spiritual wisdom (soul). According to Chopra, this is a very positive psyche attribute especially to those who actually believe that death is not just dissolution and the end. However, incontrast to this belief David E. Comings in his book “Did Man Create God” (2008) points out that if consciousness is a prerequisite for the soul, and consciousness is extinguished when brain damage causes the loss of core consciousness, it would also cause the loss of the soul. According to Comings, “While the concept of a soul representing the essence of an individual and living on after death is central to many religions, its existence is not supported by modern neuroscience which states that consciousness, the spirit and the soul are the product of neuronal activity and die when the person dies. This has major consequences for religion since without a soul there is no cosmic consciousness, no afterlife, no hell, no heaven and thus no reward in heaven for good behavior.” It is not the intent of this scientific treatisee to address the existence or 93

Blum et al: Genes and Happiness non-existence of God. It is, however, important to realize that the quality of and dependence on the cognizant connection to such a belief system can be significantly influential in an individual’s ability to achieve a state of peace and happiness. Other points of view may have this to say about this conjecture and it is these two independent views that have significant impact on ones happiness. According to one of us (BWD) it is not the existence or non-existence of God that is at issue in this matter. It is an individual’s state of mind that dictates their ‘synaptic’ reality. It has been pointed out that this philosophical terrain is based on excessive psychoreligious speculation and psycho-neuro-genomic conjecture to explain how we created God. This is similar to determining whether other dimensions exist based on the mental competence of people. It exists or it doesn’t exist. Whether or not we grasp it is irrelevant. We believe the key points can be made about the psycho-genomic mechanisms of how “we” connect to the concept of God and an afterlife without delving into atheistic hyperbole. The existence or non-existence of God is an entirely different issue than that of whether we do or do not have a conscious connection to a God-presence. To base the existence of God on a healthy state of brain chemistry is a very sophomoric premise, and dangerously eclipsing the boundaries and capabilities of science. In terms of a few specific genes, Comings and associates (2001) were the first group to identify the role of a specific gene in spirituality. The gene was the dopamine D4 receptor gene (DRD4) gene, which was found to play a role in novelty seeking, one of the personality traits in Cloninger’s Temperament and Character Inventory (Cloninger et al. 1993), and has been associated with compromised dopamine signaling in an in vitro study (Asghari et al., 1995). Comings and associates did identify genetic correlates of self-transcendence, but the association of this gene and novelty seeking linked to dopaminergic circuits did not emerge in a sample of substance abusers (Cohen et al. 2009). Specifically, there was a borderline association with a self-forgetful sub-score but a strong association with spiritual acceptance. Other genes included the dopamine vesicular transporter gene (VMAT2), which was reported to be associated with spirituality. The fact that two different genes, DRD4 and VMAT2 have been found to associate with spirituality, and the fact that dopamine is the “feel good” neuro-chemical, may help explain why spirituality plays a powerful role in the human condition and why the majority of people derive great comfort and happiness from a belief in a God. It is of further interest that in the Comings et al study (2001), those individuals that scored high on selftranscendence are less likely to abuse alcohol or drugs. Accordingly, this may be because individuals whose reward pathways, and possibly other interacting pathways (serotonergic) activated by spirituality, would have less need to artificially activate their reward circuitry with foreign molecules like ethanol and cocaine. This is, indeed, the

central pillar of Alcoholics Anonymous 12 Steps (Gold & Dackis, 1984). Moreover, Borg and associates at the Karolinska Institute in Sweden found that the binding of ethanol was lowest in those with the highest scores for selftranscendence, suggesting, “Such individuals had higher levels of brain serotonin”. They showed that the HTRIA gene [serotonin1A receptor gene] was significantly associated with the self-transcendence scale and with the substance of spiritual acceptance. It is noteworthy that the lysergic moiety as in LSD is similar structurally to serotonin having modifying effects through psychedelic spiritual experiences. Finally, many different plants around the world contain a range of psychedelic drugs (serotonergic, opioid and catecholaminergic), which are capable of strongly enhancing man’s spirituality and/or spiritual awareness. It is suggested that this is accomplished by providing a “powerful feeling of communication with a supernatural power” (Shultes et al. 1998). Comings (2008) further points out that these entheogens (good-producing substances) played a profound and critical role in facilitating human’s early belief in a god or gods and in the development of religion.

B. Friends, Love Partners and Mariage: Birds of a Feather Flock Together A 2002 study conducted at the University of Illinois by Diener and Seligman found that the most salient characteristics shared by the 10% of students with the highest levels of happiness and the fewest signs of depression were their strong ties to friends and family and commitment to spending time with them. "Word needs to be spread," concludes Diener. "It is important to work on social skills, close interpersonal ties and social support in order to be happy." (Diener et al. 2006). More recently our laboratory found evidence for family members carrying multiple Reward Deficiency Syndrome (RDS) types of behaviors (i.e. drug and alchol addiction, smokinging, sex addiction, pathological gambling, violence behavior, juvenile delinquency, criminal behavior, ADHD, etc.) to marry other individuals possessing the A1 allele of the DRD2 gene 100% of the time. This lends further support to the old folk concept especially observed in addiction rehab clinics and Psych hospitals that many individuals hook up with other drug addicted persons. This has been referred to as “Birds of a Feather Flock Together”. Have we found the genetic basis for this behavior? Of course, happiness is not a static state. Even the happiest of people--the cheeriest 10%--feel blue at times. And even the bluest still has their moments of joy (Bruijnzeel, Repetto, & Gold, 2004). That has presented a challenge to social scientists trying to measure happiness. That, along with the simple fact that happiness is inherently subjective makes the challenge even more difficult. In a questionnaire detailing everything they did on the previous day, and whom they were with at the time, and rating a range of feelings during each episode (happy, impatient, depressed, worried, tired, etc.), on a seven-point scale a

Gene Therapy and Molecular Biology Vol 13, page 95 group of 900 women in Texas was tested with some surprising results. It turned out that the five most pleasurable and rewarding (positive) activities for these women were (in descending order) sex, socializing, relaxing, praying or meditating, and eating. Exercising and watching TV were not far behind. But way down the list was "taking care of my children," which ranked below cooking and only slightly above housework. The results of this rating should not be interpreted as meaning these activities were viewed as the most beneficial, productive or important; just activities associated with greatest feelings of pleasure. Our overall happiness is not merely the sum of our happy moments minus the sum of our angry or sad ones. In other work, Kahneman proposed that the belief that high income is associated with good mood is widespread but mostly illusory. People with above-average income are relatively satisfied with their lives but are barely happier than others in moment-to-moment experience, tend to be tenser, and do not spend more time in particularly enjoyable activities. Moreover, the effect of income on life satisfaction seems to be transient. It has been argued that people exaggerate the contribution of income to happiness because they focus, in part, on conventional achievements when evaluating their life or the lives of others (Kahneman et al. 2006) Happiness goes deeper than that, Kahneman argues in his 2002 book “Authentic Happiness”. As a result of his research, he finds three components of happiness: pleasure ("the smiley-face piece"), engagement (the depth of involvement with one's family, work, romance and hobbies) and meaning (using personal strengths to serve some larger end). Of those three roads to a happy satisfied life, pleasure is the least consequential. He insists, "This is newsworthy because so many Americans build their lives around pursuing pleasure. It turns out that engagement and meaning are much more important." However if one would ask the “man on the street” a different response may turn up. One of us (KB) decided to test this notion and found that the response was not surprising. One such respondent was a bus operator from Sydney Australia, Mr. William A. C. Fraser who when asked about what made him happy stated “While we need a balance in our life, I am always seeking for love not just sex. But if it was only sex, what a way to go!”

with stress; and feeling low levels of anxiety and depression). Lykken found that circumstantial factors like income, marital status, religion and education contribute only about 8% to one's overall well being. He attributes the remaining percentage to "life's slings and arrows." Because of the large influence of our genes, Lykken proposed the idea that each of us has a happiness set point much like our set point for body weight. No matter what happens in our life--good, bad, spectacular, horrific--we tend to return in short order to our set range. According to Lykken "It may be that trying to be happier is as futile as trying to be taller" (Lykken 2007). Seligman in a New York Times article on the Psychology of Happiness (1997) argues, "but the cerebral virtues--curiosity, love of learning--are less strongly tied to happiness than interpersonal virtues like kindness, gratitude and capacity for love." The real question we must ask: Can a dyed-in-the-wool pessimist learn to see the glass as half full? The answer to some degree may reside in simple molecular rearrangement of certain genes called polymorphisms and the interaction of these polymorphic genes with environmental elements like love. There is evidence mounting that genes may play a role in everything from spirituality to politics and even to love styles. In terms of politics, our understanding of bridging of scientists and public policy together has its beginnings under the Third Reich in Nazi Germany. During the Nazi period, the symbiotic relationship between human genetics and politics served to radicalize both. The dynamic between the science of human heredity and Nazi politics changed the research practice of some of the biomedical sciences housed at the Kaiser Wilhelm Institute for Anthropology, Human Heredity and Eugenics (KWIA). It also simultaneously made it easier for the Nazi state to carry out its barbaric racial program leading, finally, to the extermination of millions of so-called racial undesirables.

IV. Can’t Get No Satisfaction: “Missing the Dopamine Jackpot” When we talk about politics and social behaviors we must reflect on the song “Can’t get no satisfaction”. What do Janis Joplin, Charlie Parker (the “Bird”), Billy Holiday, and Jimmy Hendrix have in common? If you want to find examples of people whose brain reward circuits have gone haywire, the world of jazz and rock stars is probably a good place to look. Earlier work supporting the “dopamine hypothesis” related to craving behavior (Davis and Walsh, 1970; Blum et al. 1973) came as a result of work with progessional athletes, rock n’ roll musicians, and other celebrities (Gold & Dackis, 1984; Dackis & Gold, 1985). Our first paper on the identification of polymorphisms of the dopamine D2 receptor gene and severe alcoholism led the way for the understanding of deficiencies in brain dopamine and sensation seeking (Blum et al.1990). Thus, the A1 allele yields receptors that don’t work as well, and that translates into less dopamine firing up the reward circuits, which can

III. Biology, Politics, and Human Nature One of the biggest issues in happiness research is the question of how much our happiness is under our control. In 1996, University of Minnesota researcher David Lykken published a paper looking at the role of genes in determining one's sense of satisfaction in life. Lykken, now over 76, gathered information on 4,000 sets of twins born in Minnesota from 1936 through 1955. After comparing happiness data on identical vs. fraternal twins, he came to the conclusion that about 50% of one's satisfaction with life comes from genetic programming (genes influence such traits as having a sunny, easygoing personality; dealing well

Blum et al: Genes and Happiness lead to a tendency to abuse drugs and engage in impulsive, sensation–seeking or anti-social behavior. This includes problems forming relationships leading to low neuroticism and high extroversion (Ozkaragoz and Noble EP 2000; Weiss et al. 2008). Eisenberg and associates (2007) found that carriers of the A1 allele of the dopamine D2 receptor gene were more likely to engage in early sexual activity but were less inclined to develop steady relations. This is further explained by additional work on the relationship of the DRD2 A1 allele and love styles. Others have shown that statistical analysis revealed a significant association between the DRD2 TaqI A genotypes and "Eros" (a loving style characterized by a tendency to develop intense emotional experiences based on the physical attraction to the partner), as well as between the C516T 5HT2A polymorphism and "Mania" (a possessive and dependent romantic attachment, characterized by self-defeating emotions) (Emanuele et al. 2007). This putative role in attachment has attracted the attention of political scientists. Fowlers group recently published on the association of the dopamine DRD2 gene polymorphisms and the tendency to affiliate with a political party (Dawes and Fowler 2009). They hypothesized that people with more effective DRD2 receptors — that is, with one or more A2 alleles would be more trusting and therefore more likely to join a political party. Utilizing information from the National Longitudinal Study of Adolescent Health (NLSAH), they reported that indeed, people with two A2 alleles (and no A1 allele) were 8% mote more likely to form political attachments. In his landmark paper Fowler called it “the first gene ever associated with partisan attachment”. Guo et al (2007) looked for a link between social behavior (morality) and the dopamine D2 receptor gene by assessing delinquency rates in teenagers. The study was based on a cohort of more than 2,500 adolescents and young adults in the National Longitudinal Study of Adolescent Health in the United States. For DRD2, the trajectory of serious delinquency for the heterozygotes (A1/A2) is about 20% higher than the A2/A2 genotype and about twice as high as the A1/A1 genotype, a phenomenon sometimes described as heterosis (LR test, P = 0.005, 2 df). The findings on violent delinquency closely resemble those on serious delinquency and depression (Haeffel et al.2008). While we are cognizant of free will, we must not be so naive that we underestimate the relationship between our basic social behaviors including political persuasion and biology. The study of genes potentially promises a better understanding of the constraints imposed on basic political behavior (See Aristotle 1996). Thus, we agree with Fowler and associates and also argue that biologists and political scientists must work together to advance a new science of human nature (Fowler and Schreiber, 2008). In simple terms, can we as scientists reduce the state of happiness to molecular rearrangements leading to gene polymorphisms? If this was that simple, then why not consider the following: Love relationships relate to

polymorphisms of the DRD2 gene whereby carriers of A1 alleles lead to an inability to form lasting relationships involving only EROS kind of love. However carriers with the appropriate serotonin polymorphism would be potentially happier because they can form lasting relationships having romantic love styles. If that isn’t enough, consider the fact that DRD2 A2 carriers are more likely to have social attachments compared to A1 carriers. This is further supported by earlier work from our lab showing the significant association of schizoid/avoidant behaviors in A1 carriers compared to A2 carriers (Blum et al 1997). It is well established that schizoid/avoidant behavior occurs in people that are less passionate and cannot form meaningful relationships or attachment. Couple this with genospirituality and the probability, albeit small, of genospirituality engineering, and other as yet unidentified gene polymorphisms, and what emerges is a complex map of human nature tied to the unconscious state of happiness. There are multiplegenes involved in the state of happiness that are interactive and thus affect reward type of behaviors (see Figures 2,3).

V. Body Size and Happiness Certainly in Western society “thin is in” and this concept more than many other more important meaningful health orientated doctrines drives the western world thoughts about self-image especially in females. The scientific support relating to nutraceuticals, dopamine gene polymorphisms, obesity and aberrant craving behavior is well established (Althaus et al. 2009, Stice et al, 2008, Blum et al. 2007, Rothman et al. 2008, Chen et al. 2007a,b). With this in mind our laboratory embarked on a series of studies to determine a potential link of body image and wellness, specifically happiness, by administering a customized DNA directed nutraceutical designed to reduce weight and increase well being (Blum et al 2008a, Blum et.al. 2008b, Blum et al. 2008c) One study systematically assessed the weight management effects of a novel experimental DNAcustomized nutraceutical, LG839 (LifeGen, Inc., San Diego, CA, USA). A total of 1058 subjects who participated in the overall D.I.E.T. study were genotyped and administered an LG839 variant based on polymorphic outcomes. A subset of 27 self-identified obese subjects of Dutch descent, having the same DNA pattern of four out of the five candidate genes tested (chi-square analysis) as the entire data set, was subsequently evaluated. Simple t-tests comparing a more systemic range of physical, biochemical, emotional and behavioral parameters related to weight management, before and after 80 days of treatment with LG839, were performed. Statistically significant results were observed for weight loss, sugar craving reduction, appetite suppression, snack reduction, reduction of late night eating, increased perception of overeating, enhanced quality of sleep, increased happiness, and increased energy. Polymorphic correlates were obtained for a number of genes (LEP, PPAR-gamma2, MTHFR, 5-HT2A, and DRD2 genes) with 96

Gene Therapy and Molecular Biology Vol 13, page 97 positive clinical parameters tested in this study. Of all the outcomes and gene polymorphisms, only the DRD2 gene polymorphism (A1 allele) had a significant Pearson correlation with days on treatment (r=0.42, P=0.045). If these results are confirmed in additional rigorous, controlled studies, we carefully suggest that DNA-directed targeting of certain regulator genes, along with customized nutraceutical intervention, provides a unique framework and strategic modality to not only combat obesity but induce a state of happiness in the individual (Blum et al. 2008c; Blum et al 2008d). Comparisons between obese patients and drug-addicted patients have been made for decades. More recently, scientific progress (i.e., better imaging technology) has allowed direct comparisons and evidence points to hedoniceating resembling drug-taking in many ways from both neurological and psychosocial perspectives (Volkow & Wise, 2005) (Joranby, Frost-Pineda & Gold, 2005). In a recent article involving brain dopaminergic pathways and implications for understanding obesity, Wang and coworkers provided a succinct and compelling argument for the role of the dopamine D2 receptor and obesity. Brain imagining studies in humans implicate the involvement of dopamine (DA) modulated circuits in pathologic eating behaviors(s). Food cues increase striatal extracellular DA, providing evidence for the involvement of DA in the nonhedonistic motivational properties of food. Similar to drug–addicted subjects, striatal DA D2 receptor availability is reduced in obese individuals, which predispose obese subjects to seek food as a means to temporarily compensate for understimulated reward circuits. Obese subjects have increased metabolism in the somatosensory cortex, which suggests an augmented sensitivity to the sensory properties of food. The reduction in DA D2 receptors in obese subjects coupled with the enhanced sensitivity to food palatability could make food their most “salient” reinforcer putting them at risk for compulsive eating and obesity. Moreover, in addition to amplifying the consequences of the dopaminergic genetic predisposition, the authors hypothesize that the development of dopamine resistance, possibly due to lost dopamine sensitivity in a similar manner as insulin, leptin and other endocrine hormones, plays a role in catalyzing the excessive drive to stimulate dopamine-based reward sensations. To date much research has been accomplished concerning the potential of sugar solutions on the neurogenetics and neurochemistry of brain as it relates to its addiction liability. The consensus of this research is that glucose, fructose and sucrose may act differently in the brain but are all addicting substances (Davis et al. 2008; Rada et al. 2005; Chang et al. 2008; Blass, 2003; Hodgekins et al. 2004; Grimm et al.2008; Serre et al. 2007; Gearhardt et al. 2009). The identification of a specific gene that imparts risk leads to information about the method of causation of any disease. Being cognizant about the role of polygenic inheritance in complex diseases such as obesity, it is necessary to make note of certain singular discoveries. For

example, the FTO gene (discovered by a genome–wide association study using the HapMap) is unquestionably important in relation to inheritance of BMI (Scuteri et al. 2007) and could be targeted by administering omega 3 fatty acid. It is this type of information that holds promise for future research and potential gene guided nutritional targets that provide information to develop scientifically sound nutrigenomic solutions (Blum et al. 2009). The results from these studies suggest that multiple but similar circuits are disrupted (genetically) in obesity and drug addiction (under the rubric of RDS) and further suggest that strategies aimed at improving DA function (Stice et al 2008) might not only be beneficial in the treatment of and prevention of obesity but also improve one’s mood and thus their state of happiness (Wang et al. 2009).

VI. The Pleasure Brain A major question associated with Deepak Chopra’s view that humans lose free will because of the frailty of becoming obsessed or addicted to some substance and/or behavior, is why humans are so susceptible to becoming addicted to tobacco, alcohol, drugs, sex and gambling. There are at least three major motivations in life “hunger, thirst and sex.” If we want to keep from starving, we have to eat. To ensure that we do, the brain sets up a mechanism whereby we feel hunger, thus signaling the time to eat. Moreover, if we want our species to survive, we must reproduce, to ensure that happens, the process has also been made pleasurable. Certainly eating, sex and love are called natural rewards and are critical to the survival of the species. It is further understood that neuronal pathways are rich in dopamine. Thus the reason we become easily addicted to drugs, alcohol, gambling, sex and other activities is that these substances and activities also commonly stimulate the same pleasure-producing dopamine reward pathways. While the fact that drugs of abuse such as alcohol, cocaine, speed and nicotine stimulate the release of dopamine explains part of the question of why humans become addicted to things, this does not explain why some people have serious problems with addictions. While environmental factors play a role, there is a significant variation in addictive potential among individuals exposed to the same environment or even substances (Hoebel, Avena, Borcarsly, & Rada, 2009, Avena, Rada & Hoebel, 2009). Genetic factors may also contribute to the drug abusederived pleasureform; in one genomic study on rats exposed to chronic methamphetamine abuse, the SLC6A gene and its variants were shown to be altered upon exposure to methamphetamine (Kobeissy, et al., 2008)(Gold, et al., 2009). The SLC6A gene is involved in cocaine abuse, alcohol dependence, smoking behavior, juvenile delinquency, pathological aggression, bipolar disorder, schizophrenia, ADHD, impulsive aggression, cognitive impulsity and is a major component in the happiness gene map (see Figure 4 and Table 2). In 1995 one of us (KB) coined the term “RDS (Blum et al. 1996; Comings et al 2000; Blum et al. 2000). This disorder is due to genetic 97

Blum et al: Genes and Happiness defects in the dopamine reward pathways. As a result of such defects the natural rewards are no longer sufficient to improve mood and provide pleasure, and affected individuals pursue an excessive amount of “unnatural rewards” such as from alcohol, nicotine, drugs, gambling, sex and risk taking in the form of dangerous sports, such bungie and base jumping, sky diving, extreme skiing, race car driving, video gaming and others to stimulate their reward pathways A test of this hypothesis has been successfully carried out by others in two strains of rodents. One strain liked drinking alcohol more than drinking water; the other strain did not. If the preference for alcohol was due to a defect in the dopamine D2 receptor, then increasing the level of D2 receptor in the reward pathways should eliminate the alcohol preference. This was accomplished by injecting copies of the D2 receptor gene directly in the nucleus accumbens. This resulted in a temporary over expression of the D2 receptors that lasted several days. The over expression of the D2 receptor gene reduces alcohol intake demonstrating that high levels of the D2 receptor gene are protective against alcohol abuse (Thanos et al 2001).

“being in control”. Langer (1989) carried out a landmark study that suggested that “being in control” resulted in greater longevity. In his study performed in a nursing home for the elderly, one group of subjects was given a plant and told to look after it, they were responsible for the plant’s health. Another group was also given a plant but told that the staff would look over the plant. Over the next 18 months twice as many of those who were not “in control” of their plants died compared to those “in control” of their plants. As we stated earlier, wealth does not necessarily correlate with happiness. In fact, as pointed out in Comings book “Did Man Create God,” a major reason for the lack of correlation between Gross National Product (GNP) and happiness is that people quickly adapt to a wide range of circumstances. He stated, “Someone inheriting or winning a great deal of money may be temporarily be happier, but they soon settle back to their previous innate level of happiness. The same holds for those with progressively increasing yearly incomes.” In support of this notion Allen Parducci (1995) suggested that after each raise, people adapt and return to a previous level of happiness (a set point genetically programmed), a phenomena he termed “hedonic treadmill.”

VII. The Happiness Brain

VIII. Proposed Happiness Gene Map

There are many theories as to what constitutes the state of happiness in humans, as we have discussed earlier. We believe that Richard Bolstad (2006) best summed it up –“ Success means getting what you want: happiness means wanting what you get “ Over the past 10,000 years Homo sapiens have evolved as much as 100 times faster than at any other time. Human beings have evolved an emotional system that leads them to be generally happy, to think positively, and to quickly adjust to both positive and negative events. A strong and supportive social network of friends, family, and helping others are among the greatest contributors to happiness. Helping others may provide a significant contribution to the positive effects of religion on longevity and health. In fact, Christian, Jewish, Buddhist, Islamic, and Native American spiritual traditions all emphasize the happiness benefits of helping people. Post (2005) suggests that altruism and volunteerism are associated with happiness, improved mood, enhanced selfesteem, and better mental and physical health; and that helping others, per se, may be a major part of the increased longevity seen in religious versus non-religious individuals. However others have rejected the idea that religion was a key factor. They concluded in their studies of over 8,832 subjects that volunteering, rather than its religious context, explained the beneficial effects and happiness (Musick et al. 1999). These findings are not so simple and cannot be taken without understanding that we really cannot determine whether a confound drives an observed correlation. That is, that correlational data is always vulnerable to potential thirdvariable confounds. Another facet of certain environmental elements that may affect one’s happiness and ultimately longevity is

In this commentary we have taken the opportunity to at least propose a schematic of a number of potential genes (a sampling) and their polymorphisms including SNPs to encourage others to investigate this very intriguing and important area of neuroscience. The genes listed have not all been tied to happiness per se. But, we believe that because of the effects these gene polymorphisms have on both the Central Nervous System (CNS) and peripheral systems, targeting these loci will have profound influence on health and wellness for the organism (See Figure 1) This will ulitamately impact the happiness experience (Table 1). Our view is that since many of aberrant behaviors are a consequence of and fall under RDS, one initial goal in the scientific pursuit of happiness in the human would be to first identify those gene polymorphisms associated with RDS and then utilize genomic principles to develop novel tailored made pro-happiness agonists utilizing immunological compatible (‘body friendly’) natural substances (Blum et al. 1996; Blum et al.2009). It is important to realize that everything that our brain does is ultimately the result of an interaction between our genes and our environment. For some traits, our genes play a major role, for some others environment is a primary factor, and for most it is a combination of the two. On average, depending upon the trait, the genetic contribution accounts for 40 to 90 percent of a trait. In the latter case it is a combination of many genes, referred to as “polygenic inheritance” (Stern 1973). To reiterate, it is well established that “polygenic inheritance” is due to the additive and epistatic interaction of many genes, each accounting for only a small percent of the total trait and interacting with the environment (Comings 2003).

Gene Therapy and Molecular Biology Vol 13, page 99

Table 1: Proposed Happiness Gene Map with gene denoted, the SNPs involved and references. Gene DRD2

SNP CTGGACGTCCAGCTGGG CGCCTGCCT[C/T]GACCA GCACTTTGAGGATGGCT GTG

Reference Van der Zwaluw CS, Engels RC, Vermulst AA, Franke B, Buitelaar J, Verkes RJ, Scholte RH (2009) Interactions between dopamine D2 receptor genotype and parental rule-setting in adolescent alcohol use: evidence for a gene-parenting interaction. Mol Psychiatry. Feb 24 Ikeda M, Yamanouchi Y, Kinoshita Y, Kitajima T, Yoshimura R, Hashimoto S, O’Donovan MC, Nakamura J, Ozaki N, Iwata N. (2008) Variants of dopamine and serotonin candidate genes as predictors of response to reseridone treatment in firstepisode schizophrenia. Pharamcogenomics 9(10), 1437-43 Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample. Neuropsychopharmacology 34(2), 319-30 Ballon N, Leroy S, Roy C, Bourdel MC, Olie JP, Charles-Nicolas A, Krebs MO, Poirier MF. (2007) Polymorphisms TaqI A of the DRD2, Ball of the DRD3, exon III, repeat of the DRD4, and 3’ UTR VNTR of the DAT: association with childhood ADHD in male African-Caribbean cocaine dependents? Am J Med Genet B Neuropsychiatr Genet. 144B(8), 1034-41

AGGAACTCCTTGGCCTA GCCCACCCT[G/T]CTGCC TTCTGACGGCCCTGCAA TGT CTGCTTCCCACCTCCCT GCCCAGGCC[A/G]GCCA GCCTCACCCTTGCGAAC CGTG GTCACTATTATGGTTTTT ATTACTAT[G/T]GCTCTT TTTGAGGAATTGGGAAA TT CTGACTCTCCCCGACCC GTCCCACCA[C/T]GGTCT CCACAGCACTCCCGACA GCC

CCACCAGCTGACTCTCC CCGACCCGT[C/G]CCAC CACGGTCTCCACAGCAC TCCC ACCCATCTCACTGGCCC CTCCCTTTC[A/C]CCCTC TGAAGACTCCTGCAAAC ACC

TTTTGCTGAGTGACCTT AGGCAAGTT[G/T]CTTAC CTTCTATGAGCCTGTTT CCT

Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample Neuropsychopharmacology. 34(2), 319-30 Lucht M, Barnow S, Schroeder W, Grabe HJ, Rosskopf D, Brummer C, John U, Freyberger HJ, Hermann FH. (2007) Alcohol consumption is associated with an interaction between DRD2 exon 8 A/A genotype and self-directedness in males Neuropsychobiology 56(1), 24-31 Preuss UW, Zill P, Koller G Bondy B, Sokya M. (2007) D2 dopamine receptor gene haplotypes and their influence on alcohol and tobacco consumption magnitude in alcohol-dependent individuals Alcohol Alcohol. 42(3), 258-66 Wu SN, Gao R, Xing QH, Li HF, Shen YF, Gu NF, eng GY, He L (2006) Association of DRD2 polymorphisms and chlorpromazine-induced extrapyramidal syndrome in Chinese schizophrenic patients Acta Pharmacol Sin. 27(8), 966-70 Monakhov MV, Golimbet VE, Chubabriia KV, Zykov VV, Kovtun AL, Karpov VL. (2007). The association study of the DRD2 gene C939T polymorphism and schizophrenia Zh Nevrol Psikhiatr Im S S Korsakova 107 (10),58-60 Shi J, Gershon ES, Liu C. (2008) Genetic associations with schizophrenia: Metaanalysis of 12 candidate genes Schizophr Res 104(1-3), 96-107

Sasabe T, Furukawa A, Matsusita S, Higuchi S, Ishiura S. (2007) Association analysis of the dopamine receptor D2 (DRD2) SNP rs1076560 in alcoholic patients Neurosci Lett. 412(2), 139-42 Bertolino A, Fazio L, Caforio G, Blasi G, Rampino A, Romano R, DiGiorgio A, Taurisano P, Papp A, Pinsonneault J, Want D, Nardini M, Popolizio T, Sadee W. (2009) Functional variants of the dopamine receptor D2 gene modulate prefrontostriatal phenotypes in schizophrenia Brain 132(Pt 2), 417-25 Glatt SJ, Faraone SV, Lasky-Su JA, Kanazawa T, Hwu HG, Tsuang MT. (2008) Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan Mol Psychiatry (in press)

Blum et al: Genes and Happiness TGTGATGAATGGGTGCC AAATACACA[A/G]ATAC AGAATCTAAGAAAACA CATGG ctagaggaagtgatgttcaacagaca[ A/G]acaactgaaggatgtgtaggaa tta TGGAAGTCATGTGCTTT GTATGAAAC[A/G]CCTT GGAATGCTGATAAGTTT AATT GTCTAAAGCAAATGGA ACCTTTAGGG[A/G]GAG AGATTTGTGTTTGCTGT GTCCC GAGGGGACTGGGGTCA GGCCTCATTC[A/G]GGTT CCCTAGAGTGGAAAGG ATTGG GTATcagacagatctaggctcaaat a[A/C]cagcttcagttctcaccacctg tgt CCTGAGTGCACAGGATG CTGGAGCCT[C/T]CCAGT TTCTCTGGCTTTCATCTC GT AATCCCCCAACCCCTCC TACCCGTT[/C]CAGGCCGGGGATCGC CGAGGAGGTA

5HT2A

GAGGACCCAGCCTGCA ATCACAGCTT[A/G]TTAC TCTGGGTGTGGGTGGGA GCGC GCTCAATGGTTGCTCTA GGAAAGCAG[C/T]ATTC TGAAGAGGCTTCTAAAG ACAA CTGTGAACTCAGGAGCA AGTGCACAC[A/G]TTGC TTATCACTTACCAGAAG CATT CTCTGGTTTTAAGCAAG TCATTTAAT[/C/T]GGAGTTTTTTTTCT CCCATAAAATG

aaatggtcctaccatctatccagata[C /T]acagcttaaaaacttaggagtctct

Glatt SJ, Faraone SV, Lasky-Su JA, Kanazawa T, Hwu HG, Tsuang MT (2008) Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan Mol Psychiatry (in press) Xing Q, Qian X, Li H, Wong S, Wu S, Feng G, Duan S, Xu M, Gao R, Qin W, Gao J, Meng J, He L. (20070 The relationship between the therapeutic response to reisperidone and the dopamine D2 receptor polymorphism in Chinese schizophrenia patients Int J Neuropsychopharmacol 10(5),631-7 Hwang R, Shinkai T, De Luca V, Muller DJ, Ni X, Macciardi F, Potkin S, Lieberman JA, Meltzer HY, Kennedy JL. (2005) Association study of 12 polymorphisms spanning the dopamine D (2) receptor gene and clozapine treatment response in two treatment refractory/intolerant populations Psychopharmacology (Berl) 181(1), 179-87 Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample Neuropsychopharmacology. 34(2), 319-30 Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample Neuropsychopharmacology. 34(2), 319-30 Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample Neuropsychopharmacology. 34(2), 319-30 Laucht M, Becker K, Frank J, Schmidt MH, Esser G, Treutlein J, Skowronek MH, Schumann G Genetic variation in dopamine pathways differentially associated with smoking progression in adolescence. J Am Acad Child Adolesc Psychiatry 2008 Jun; 47(6): 673-81 Shi J, Gershon ES, Liu C. (2008) Genetic associations with schizophrenia: Metaanalyses of 12 candidate genes. Schizophr Res. 104(1-3), 96-107. Ton TG, Rossing MA, Bowen DJ, Srinouanprachan S, Wicklund K, Farin FM. (2007) Genetic polymorphisms in dopamine-related genes and smoking c essation in women: a prospective cohort study. Behav Brain Funct. 28, 3:22 Parsons MJ, Mata I, Beperet M, Iribarren-Iriso F, Arroyo B, Sainz R, Arranz MJ, Kerwin R A. (2007) Dopamine D2 receptor gene-related polymorphism is associated with schizophrenia in a Spanish population isolate Psychiatr Genet. 17(3), 159-63 Ikeda M, Yamanouchi Y, Kinoshita Y, Kitajima T, Yoshimura R, Hashimoto S, Oâ&#x20AC;&#x2122;Donovan MC, Nakamura J, Ozaki N, Iwata N. (2008) Variants of dopamine and serotonin candidate genes as predictors of response to reseridone treatment in firstepisode schizophrenia Pharmacogenomics 9(10), 1437-43 Hawi Z, Segurado R, Conroy J, Sheehan K, Lowe N, Kirley A, Shields D, Fitzgerald M, Gallagher L, Gill M. (2009) Preferential transmission of paternal alleles at risk genes in attention-deficit/hyperactivity disorder Am J Human Genet. 77(6), 958-65 Unschuld PG, Ising M, Erhardt A, Lucae S, Kloiber S, Kohli M, Salyakina D, Welt T, Kern N, Lieb R, Uhr M, Binder EB, Muller-Mysok B, Holsboer F, Keck ME. (2007) Polymorphisms in the serotonin receptor gene HT2RA are associated with quantitative traits in panic disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 424-9 Oades RD, Lasky-Su J, Christiansen H, Faragone SV, Sonuga-Barke EJ, Banaschewski T, Chen W, Anney RJ, Buitelaar JK, Ebstein RP, Franke B, Gill M, Miranda A, Roeyers H, Rothenberger A, Sergeant JA, Steinhausen HC, Taylor EA, Thompson M, Asherson P. (2008) The influence of serontonin- and other genes on impulsive behavioral aggression and cognitive impulsivity in children with attentiondeficit/hyperactivity disorder (ADHD): Findings froma family-based association test (FBAT) analysis. Behav Brain Funct. 4, 48 Oades RD, Lasky-Su J, Christiansen H, Faragone SV, Sonuga-Barke EJ, Banaschewski T, Chen W, Anney RJ, Buitelaar JK, Ebstein RP, Franke B, Gill M, Miranda A, Roeyers H, Rothenberger A, Sergeant JA, Steinhausen HC, Taylor EA, Thompson M, Asherson P. (2008) The influence of serontonin- and other genes on impulsive behavioral aggression and cognitive impulsivity in children with attentiondeficit/hyperactivity disorder (ADHD): Findings froma family-based association test

100

Gene Therapy and Molecular Biology Vol 13, page 101

TGCTATTTGTAATGCTG CTTATTAGA[G/T]ACATC GCTGATCCTCCTGTCAA CTC ATGAACCAAATTGCATG AGCTCTATT[A/G]TGTGC CCCTCTTGTAATATAAA AAT CAGGCAGAATTTCCACA AATGAAATG[C/G]AAAT TCAGATATATATCTCTT AATC TCACTCATAACTGAAGA TCATTTCAC[C/T]TTTGA ATGAGAATTTGTCTCTG AAG TGGGCAGAGGAGGGGA AGGGTCACTG[C/T]ACTC AGGGACAAGAGAAGGG GTGGG ATCAGTGTGGTCACTTC ACTGCTTGC[C/G]AAGG ATTCCATCTAATTCTGA GGAA AGGCTCTACAGTAATGA CTTTAACTC[C/T]GGAGA AGCTAACACTTCTGATG CAT

(FBAT) analysis. Behav Brain Funct. 4,48 Unschuld PG, Ising M, Erhardt A, Lucae S, Kloiber S, Kohli M, Salyakina D, Welt T, Kern N, Lieb R, Uhr M, Binder EB, Muller-Mysok B, Holsboer F, Keck ME. (2007) Polymorphisms in the serotonin receptor gene HT2RA are associated with quantitative traits in panic disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 424-9 Giegling I, Hartmann AM, Moller RJ, Rujescu D (2006) Anger- and aggression-related traits are associated with polymorphisms in the 5-HT-2A gene J Affect Disord. 96(12), 75-81 Unschuld PG, Ising M, Erhardt A, Lucae S, Kloiber S, Kohli M, Salyakina D, Welt T, Kern N, Lieb R, Uhr M, Binder EB, Muller-Mysok B, Holsboer F, Keck ME. (2007) Polymorphisms in the serotonin receptor gene HT2RA are associated with quantitative traits in panic disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 424-9 McMahon FJ, Buervenich S, Charney D, Lipsky R, Rush AJ, Wilson AF, Sorant AJ, Papanicolaou GJ, Laje G, Fava M, Trivedi MH, Wisniewski SR, Manji H. (2006) Variation in the gene encoding the serotonin 2A receptor is associated with outcome of antidepressant treatment Am J Hum Genet 78(5), 804-14 Unschuld PG, Ising M, Erhardt A, Lucae S, Kloiber S, Kohli M, Salyakina D, Welt T, Kern N, Lieb R, Uhr M, Binder EB, Muller-Mysok B, Holsboer F, Keck ME Polymorphisms in the serotonin receptor gene HT2RA are associated with quantitative traits in panic disorder Am J Med Genet B Neuropsychiatr Genet. 2007 Jun 5; 144B(4):424-9 Giegling I, Hartmann AM, Moller RJ, Rujescu D.(2006) Anger- and aggression-related traits are associated with polymorphisms in the 5-HT-2A gene J Affect Disord. 96 (12), 75-81 Benedetti F, Barbini B, Bernasconi A, Fulgosi MC, Colombo C, Dallaspezia S, Gavinelli C, Marino E, Pirovano A, Radaelli D, Smeraldi E . (2008) Serotonin 5-HT2A receptor gene variants influence antidepressant response to repeated total sleep deprivation in bipolar disorder. Prog Neuropsychopharmacol Biol Psychiatry. 32(8),1863-6 Saiz PA, Garcia-Portilla MP, Paredes B, Arango C, Morales B, Alvarez V, Coto E, Bascaran MT, Bousono M, Bobes. J. (2008) Association between the A-1438G polymorphism of the serotonin 2A receptor gene and nonimpulsive suicide attempts Psychiatr Genet 18(5), 213-8 Tander B, Gunes S, Boke O, Alayli G, Kara N, Bagchi H, Canturk F. (2008) Polymorphisms of the serotonin-2A receptor and catechol-O-methyltransferase genes: a study on fibromyalgia susceptibility Rheumatol Int 28(7), 685-91 Saiz PA, Garcia-Portilla MP, Arango C, Morales B, Bascaran MT, Martinez-Barrondo S, Florez G, Sotomayor E, Paredes B, Alvarez C, San Narciso G, Carreno E, Bombin I, Alvarez V, Coto E, Fernandez JM, Bousono M, Bobes J. (2008) Association study between obsessive-compulsive disorder and serotonergic candidate genes Prog Neuropsychopharmacol Biol Psychiatry. 32(3), 7 65-70 Unschuld PG, Ising M, Erhardt A, Lucae S, Kloiber S, Kohli M, Salyakina D, Welt T, Kern N, Lieb R, Uhr M, Binder EB, Muller-Mysok B, Holsboer F, Keck ME. (2007) Polymorphisms in the serotonin receptor gene HT2RA are associated with quantitative traits in panic disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 424-9 Ni X, Bismil R, Chan K, Sicard T, Bulgin N, McMain S, Kennedy JL. (2006) Serotonin 2A receptor gene is associated with personality traits, but not to disorder, in patients with borderline personality disorder Neurosci Lett. 408(3), 214-9 McMahon FJ, Buervenich S, Charney D, Lipsky R, Rush AJ, Wilson AF, Sorant AJ, Papanicolaou GJ, Laje G, Fava M, Trivedi MH, Wisniewski SR, Manji H. (2006) Variation in the gene encoding the serotonin 2A receptor is associated with outcome of antidepressant treatment Am J Hum Genet 78(5), 804-14 Huang S, Cook DG, Hinks LJ, Chen XH, Ye S, Gilg JA, Jarvis MJ, Whincup PH, Day IN. (2005) CYP2A6, MAOA, DBH, DRD4, and 5HT2A genotypes, smoking behaviour

101

Blum et al: Genes and Happiness and cotinine levels in 1518 UK adolescents Pharmacogenet Genomics 15(12), 839-50 Wei J, Hemmings GP.(2005) The KPNA3 gene may be a susceptibility candidate for schizophrenia Neurosci Res 52(4),342-6

ANKK1

TATGTCCTCGGAGTGCT GTGAGTGTC[C/T]GGCA CTTCCATCCAAAGCCAA CAGT

Saiz PA, Garcia-Portilla MP, Paredes B, Arango C, Morales B, Alvarez V, Coto E, Bascaran MT, Bousono M, Bobes J. (2008) Association between the A-1438G polymorphism of the serotonin 2A receptor gene and nonimpulsive suicide attempts Psychiatr Genet 18(5), 213-8

GGAGGGGGGTCTTGCCC TCAGCCTCA[C/T]GCAG GTTGGGGTCAGCCTGAC GGGA GGAGGGGGGTCTTGCCC TCAGCCTCA[C/T]GCAG GTTGGGGTCAGCCTGAC GGGA

Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample Neuropsychopharmacology. 34(2), 319-30 Van der Zwaluw CS, Engels RC, Vermulst AA, Franke B, Buitelaar J, Verkes RJ, Scholte RH. (2009) Interactions between dopamine D2 receptor genotype and parental rule-setting in adolescent alcohol use: evidence for a gene-parenting interaction. Mol Psychiatry (in press) Ikeda M, Yamanouchi Y, Kinoshita Y, Kitajima T, Yoshimura R, Hashimoto S, O’Donovan MC, Nakamura J, Ozaki N, Iwata N. (2008) Variants of dopamine and serotonin candidate genes as predictors of response to reseridone treatment in firstepisode schizophrenia. Pharamcogenomics 9(10), 1437-43 Huang W, Payne TJ, Ma JZ, Beuten J, Dupont RT, Inohara N, Li MD. (2009) Significant association of ANKK1 and detection of a functional polymorphism with nicotine dependence in an African-American sample. Neuropsychopharmacology. 34(2), 319-30 Shi J, Gershon ES, Liu C. (2008) Genetic associations with schizophrenia: Metaanalyses of 12 candidate genes Schizophr Res. 104(1-3), 96-107 Neville MJ, Johnstone EC, Walton RT. (2004) Identification and characterization of ANKK1: a novel kinase gene closely linked to DRD2 on chromosome band 11q23.1 Hum Mutat. 23(6), 540-5.

OPRK1

OPRM1

CCTGCAAGCTGTCGCTG CGCCAGCCC[A/G]GGGA GGTGAGTGTGTGGGCTG GGCA ACTTTGCAGCCCAGAAT GGGGATGAC[C/G]GCAC TGCGCGCCTGCTCCTGG ACCA AATTTCCCAAAAACTAC AGTTTTTTT[/T]TCTTAGCATGCTATTC AGGTAAACA TTTGCTAGGTAAGGTTC AGCACCCAT[C/T]TGCTG TGGCCTTCCTATGAAAC GTA ATGACTAGTCGTGGAGA TGTCTTCGT[A/C]CAGTT CTTCGGGAAGAGAGGA GTTC GAAAACACAAGTGTGA TCAAATGCCA[C/T]GGA CCCACAGGAAGCTGGTG GCTCT TATATGGCATTTCACAT TCACATGTA[A/G]TATTT GAATATACACATCAACA

McAllister TW, Flashman LA, Harker Rhodes C, Tyler AL, Moore JH, Saykin AJ, McDonald BC, Tosteson TD, Tsongalis GJ. (2008) Single nucleotide polymorphisms in ANKK1 and the dopamine D2 receptor gene affect cognitive outcome shortly after traumatic brain injury: a replication and extension study. Brain Inj. 22(9), 705-14 McAllister TW, Flashman LA, Harker Rhodes C, Tyler AL, Moore JH, Saykin AJ, McDonald BC, Tosteson TD, Tsongalis GJ. (2008) Single nucleotide polymorphisms in ANKK1 and the dopamine D2 receptor gene affect cognitive outcome shortly after traumatic brain injury: a replication and extension study. Brain Inj. 22(9), 705-14 Edenberg HJ, Wang J, Tian H, Pochareddy S, Xuei X, Wetherill L, Goate A, Hinrichs T, Kuperman S, Nurnberger JI Jr, Schukit M, Tischfield JA, Foroud T. (2008) A regulatory variation in OPRK1, the gene encoding the kappa-opioid receptor, is associated with alcohol dependence. Hum Mol Genet. 17(12), 1273-9 Edenberg HJ, Wang J, Tian H, Pochareddy S, Xuei X, Wetherill L, Goate A, Hinrichs T, Kuperman S, Nurnberger JI Jr, Schukit M, Tischfield JA, Foroud T. (2008) A regulatory variation in OPRK1, the gene encoding the kappa-opioid receptor, is associated with alcohol dependence. Hum Mol Genet. 17(12), 1273-9 Edenberg HJ, Wang J, Tian H, Pochareddy S, Xuei X, Wetherill L, Goate A, Hinrichs T, Kuperman S, Nurnberger JI Jr, Schukit M, Tischfield JA, Foroud T. (2008) A regulatory variation in OPRK1, the gene encoding the kappa-opioid receptor, is associated with alcohol dependence. Hum Mol Genet. 17(12), 1273-9 Levran O, Londono D, O’Hara K, Nielsen DA, Peles E, Rotrosen J, Casadonte P, Linzy S, Randesi M, Ott J, Adelson M, Kreek MJ. (2008) Genetic susceptibility to heroin addiction: a candidate gene association study. Genes Brain Behav 7(7), 729-9 Sherva R, Wilhelmsen K, Pomerleau CS, Chasse SA, Rice JP, Snedecor SM, Bierut LJ, Neuman RJ, Pomerleau OF. (2008) Association of a single nucleotide polymorphism in neuronal acetylcholine receptor subunit alpha 5 (CHRNA5) with smoking status and

102

Gene Therapy and Molecular Biology Vol 13, page 103 CCA

with ‘pleasurable buzz’ during early experimentation with smoking Addiction 103(9), 1544-52 Levran O, Londono D, O’Hara K, Nielsen DA, Peles E, Rotrosen J, Casadonte P, Linzy S, Randesi M, Ott J, Adelson M, Kreek MJ. (2008) Genetic susceptibility to heroin addiction: a candidate gene association study. Genes Brain Behav 7(7), 729-9 Saccone SF, Hinrichs AL, Saccone NL, Chase GA, Konvicka K, Madden PA, Breslau N, Johnson EO, Hatsukami D, Pomerleau O, Swan GE, Goate AM, Rutter J, Bertelsen S, Fox L, Fugman D, Martin NG, Montgomery GW, Wang JC, Ballinger DG, Rice JP, Bierut LJ. (2007) Cholinergic nicotinic receptor genes implicated in a nicotine dependence association study targeting 348 candidate genes with 3713 SNPs Hum Mol Genet. 16(1), 36-49

CTAATTAGGATATTTTG TGGGTTTTA[A/G]AAAA GTGAATTTTATTAATAT TTGA acaccacacctggcagttcagAGC AC[A/G]CTCACTCTTTCT CCCTTTGACAGAA

ATCAGGTTGGCCTAATT TACGTAAAC[A/G]TTAA TTTAAATCACACTAATG GTTT

Xu L, Zhang F, Zhang DD, Chen XD, Lu M, Lin RY, Wen H, Jin L, Wang XF. (2009) OPRM1 gene is associated with BMI in Uyghur population Obesity (Silver Spring 17(1), 121-5

AAGAAATTGTCTGCATA TAAACAAAT[A/G]CATC ACATTTCCACAAAAGAC TTTG TGAGAGCTAATGTTTCA AAGAAACTT[G/T]AAAT TCCCAAGATTAAAATTA TTGT CCCAGTAAGTGAATTAA ATACTTTCA[C/T]AGACA CTCTCCATCTAGTAGAA CAA TGATAGGCACTGGTTCT ACAGTGAGA[C/T]ATAT CTCTCCTAAGTCTGGTG ACAA

acagtggcacgatctcggctcactgc[ A/C]acctccacctcccgggtttaagt ga ttacctggctaacagttttctatctc[C/T ]cacacgagcctggtgggaggcagtg AGCTCTTGTTATCTTAC

Zhang D, Shao C, Shao M, Yan P, Wang Y, Liu Y, Liu W, Xie Y, Zhao Y, Lu D, Li Y, Jin L. (2007) Effect of mu-opioid receptor gene polymorphisms on heroin-induced subjective responses in a Chinese population Biol Psychiatry 61(11), 1244-51 Zhang D, Shao C, Shao M, Yan P, Wang Y, Liu Y, Liu W, Xie Y, Zhao Y, Lu D, Li Y, Jin L. (2007) Effect of mu-opioid receptor gene polymorphisms on heroin-induced subjective responses in a Chinese population Biol Psychiatry 61(11), 1244-51 Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

Xu L, Zhang F, Zhang DD, Chen XD, Lu M, Lin RY, Wen H, Jin L, Wang XF. (2009) OPRM1 gene is associated with BMI in Uyghur population Obesity (Silver Spring 17(1), 121-5 Zhang L, Kendler KS, Chen X.(2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28 Max MB, Wu T, Atlas SJ, Edwards RR, Haythornthwaite JA, Bollettino AF, Hipp HS, McKnight CD, Osman IA, Crawford EN, Pao M, Nejm J, Kingman A, Aisen DC, Scully MA, Keller RB, Goldman D, Belfer I. (2006) A clinical genetic method to identify mechanisms by which pain causes depression and anxiety. Mol Pain. 19,2:14 Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Ehlers CL, Lind PA, Wilhelmsen KC. (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Zhang L, Kendler KS, Chen X.(2006) The mu-opioid receptor gene and smoking

103

Blum et al: Genes and Happiness CATTCCCAC[A/G]TTGAT TCTCATTTTTATCCCTCT CC TCAAGATAGCTAATTGA GAACAAGCA[C/T]GAGA CTCCACTCCTGGTCCCC AAGC

CCATTTTCTTTTCTTCTT TGCTTGTC[G/T]Tttttttctgtt tgtttttcttttc AGAAAATAACTTTTGCT AGATTCACC[A/G]TTGGT TATAGACCTGCATGATC TAA GTGATGTTACCAGCCTG AGGGAAGGA[A/G]GGTT CACAGCCTGATATGTTG GTGA AGTTAGCTCTGGTCAAG GCTAAAAAT[C/G]AATG AGCAAAATGGCAGTATT AACA

initiation and nicotine dependence Behav Brain Funct 2,28

Levran O, Londono D, O’Hara K, Nielsen DA, Peles E, Rotrosen J, Casadonte P, Linzy S, Randesi M, Ott J, Adelson M, Kreek MJ. (2008) Genetic susceptibility to heroin addiction: a candidate gene association study. Genes Brain Behav 7(7), 729-9 Zhang D, Shao C, Shao M, Yan P, Wang Y, Liu Y, Liu W, Xie Y, Zhao Y, Lu D, Li Y, Jin L. (2007) Effect of mu-opioid receptor gene polymorphisms on heroin-induced subjective responses in a Chinese population Biol Psychiatry 61(11), 1244-51 Ehlers CL, Lind PA, Wilhelmsen KC. (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Ehlers CL, Lind PA, Wilhelmsen KC. (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

AATTTTATTAGATTAAA CAATTTTTA[A/G]CAGAC CTCATGCTTGTTGGAGA TAA GGTCCAGGGTACACAAC CAAGCAGCC[A/T]TGCT CTAGAGCCCAGCAAGA CAGGG ACTGAAGAATAATCATG CTTAACTCA[A/G]GAGA AATGCTCCACCAGACGG GCTG GCACATTTACTGTTTTG TCTAACCTG[C/T]CTAGC CATTTCAGTCAAGCTGA TTG GCAATCAGAAAGAAAT TCAGTTATTA[C/T]AGTA TATGCAAGTCACACTGC AAGC

AATGAAACACAAATCAT AATCTCTGA[A/G]GCAA ATAAGAATGGAAGGAC TCCTG tttagggcaagtcagaaagtccaaaa[ A/G]tgcctcagatattctgtgtgagtg a

AAAAACTGGGCCTGAG CTCAGATGAA[C/T]TGG AGAACTGAACTTTGGCT TAGAA

Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

Smith RJ, Doyle GA, Han AM, Crowley JJ, Oslin DW, Patkar AA, Mannelli P, Demaria PA Jr, O’brien CP, Berrettini WH. (2005) Novel exonic mu-opioid receptor gene (OPRM1) polymorphisms not associated with opioid dependence. Am J Med Genet B Neuropsychiatr Genet. 133B(1), 105-9 Smith RJ, Doyle GA, Han AM, Crowley JJ, Oslin DW, Patkar AA, Mannelli P, Demaria PA Jr, O’brien CP, Berrettini WH. (2005) Novel exonic mu-opioid receptor gene (OPRM1) polymorphisms not associated with opioid dependence. Am J Med Genet B Neuropsychiatr Genet. 133B(1), 105-9 Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Gallagher CJ, Gordon CJ, Langefeld CD, Mychaleckyi JC, Freedman BI, Rich SS, Bowden DW, Sale MM. (2006) Association of the mu-opioid receptor gene with type 2 diabetes mellitus in an African American population Mol Genet Metab. 87(1), 54-60 Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

104

Gene Therapy and Molecular Biology Vol 13, page 105 GAGTCATCAGCTCCCAA GGTTTTCTG[C/T]ATGGC TCTGTTTTTATGATTTCT GT gtgtgtactgcagtctggtcccatcg[C /T]attgccttgtgggatttgggagtag

Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Ehlers CL, Lind PA, Wilhelmsen KC . (2008) Association between single nucleotide polymorphisms in the mu opioid receptor gene (OPRM1) and self-reported response to alcohol in American Indians. BMC Med Genet. 9, 35 Zhang L, Kendler KS, Chen X. (2006) The mu-opioid receptor gene and smoking initiation and nicotine dependence Behav Brain Funct 2,28

COMT

GCTCCTACGGTCCCTCA GGCTTGGAG[A/G]GTCA CTTTAAACAATAAAAAG CAAC TGTGGTTACTTTCTGGA GAGAGCATG[C/T]GGCA TGCAGGAGCTGGAGGG GGGGT aaaagttacgcttaataatgaatgtt[G/ T]cagcactttcttctcttcaggtatt

Funke BH, Lencz T, Finn CT, DeRosse P, Poznik GD, Plocik AM, Kane J, Rogus J, Malhotra AK, Kucherlapati R.(2007) Analysis of TBX1 variation in patients with psychotic and affective disorders. Mol Med. 13(7-8), 407-14

CTGTGAGGCACTGAGGA TGCCCTCAC[A/G]CGTGC ATCTGCATGTGGCGTGC ATG

Dionne RA. (2006) Genetic polymorphisms in show only weak assocation with post-surgical

Beuten J, Payne TJ, Ma JZ, Li MD. (2006) Significant association of catechol-Omethyltransferase (COMT) haplotypes with nicotine dependence in male and female smokers of two ethnic populations. Neuropsychopharmacology. 31(3), 675-84 Kim H, Lee H, Rowan J, Brahim J, monoamine neurotransmitter systems pain in humans. Mol Pain. 2,24 Kim H, Lee H, Rowan J, Brahim J, monoamine neurotransmitter systems pain in humans. Mol Pain. 2,24

Dionne RA. (2006) Genetic polymorphisms in show only weak assocation with post-surgical

Beuten J, Payne TJ, Ma JZ, Li MD. (2006) Significant association of catechol-Omethyltransferase (COMT) haplotypes with nicotine dependence in male and female smokers of two ethnic populations. Neuropsychopharmacology. 31(3), 675-84 CTGGTTTGTGTATGTTCT TGGTAAAC[C/T]AGCCCT TGGTCTTACACATCATT TC GCTTCCCTGTTCTCTTCT GCTCTGTC[C/T]TCTGGT GCCCTGAGGCTGGCCTC CA GGCATTTCTGAACCTTG CCCCTCTGC[A/G]AACA CAAGGGGGCGATGGTG GCACT

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24 Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24 Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24 Vargas-Alarcon G, Fragoso JM, Cruz-Robles D, Vargas A, Vargas A, Lao-Villadoniga JI, Garcia-Fructuoso F, Ramos-Kuri M, Hernandez F, Springall R, Bojalil R, Vallejo M, Martinez-Lavin M. (2007) Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia Arthritis Res Ther. 9(5), R110 Bialecka M, Kurzawski M, Klodowska-Duda G, Opala G, Tan EK, Drozdzik M. (2008) The association of functional catechol-O-methyltransferase haplotypes with risk of Parkinsonâ&#x20AC;&#x2122;s disease, levodopa treatment response, and complications. Pharmacogenet Genomics. 18(9), 815-21

ATAAGTAACTGTCGAGA AGATTCTCA[C/T]AGGA GACCACGTGGGTTGCCT GAAG

Halleland H, Lundervold AJ, Halmoy A, Haavik J, Johansson S. (2009) Associatoin between Catechol-O-methyltransferase (COMT) haplotypes and severity of hyperactivity symptoms in Adults Am J Med Genet B Neuropsychiatr Genet.150B (3), 403-10. Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24 Beuten J, Payne TJ, Ma JZ, Li MD. (2006) Significant association of catechol-O-

105

Blum et al: Genes and Happiness methyltransferase (COMT) haplotypes with nicotine dependence in male and female smokers of two ethnic populations. Neuropsychopharmacology. 31(3), 675-84

SLC6A3

AATGTCCTCAGCTGGTT CTTCCCCCA[A/G]TGCCC TGATCCTGGGCTCACAT GTG

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24

GAGACGAAGACCCCAG GAAGTCATCC[C/T]GCA ATGGGAGAGACACGAA CAAACC

Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A. 103(12), 4552-7 Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24

AAAATCAAGTAATGATT GATTTGTAG[A/G]AGTTT GAGTGAGGCATCGGATC CCC

Preuss UW, Zill P, Koller G, Bondy B, Sokya M. (2007) D2 dopamine receptor gene haplotypes and their influence on alcohol and tobacco consumption magnitude in alcohol-dependent individuals Alcohol Alcohol. 42(3), 258-66 Haeffel GJ, Getchell M, Koposov RA, Yrigollen CM, Deyoung CG, Klinteberg BA, Oreland L, Ruchkin VV, Grigorenko EL. (2008) Association between polymorphisms in the dopamine transporter gene and depression: evidence for a gene-environment interaction in a sample of juvenile detainees. Psychol Sci. 19(1), 62-9

ACCGTGCCCAGCCCTGT GTGGGCATC[A/G]GAGG TGGTTCCCTCTGGTCCT GTCG GTCCAGGCCCCAGGAGC TGCCGCAGC[A/G]GGCA GTGGAAGGAAGGCACG TTCAG CAGCTTCCCCTCCCAAC ACAGAGGCG[A/C]GGCC CAAGTGCAGGACTCACA ACGG AAGACACAGTGACGGT ATACTCATGA[C/T]GGA ATATGATTCGGCCTTAA AACAA AAGGCGAAGCCGGCGA TGGTACGTAC[A/G]TTG GTGACGCAGAACAGGG ACAGGA GCCATCGCCACGCTCCC TCTGTCCTC[A/G]GCCTG GGCCGTGGTCTTCTTCA TCA TGCTTCCTGCTACCAGC AGGCAGACT[C/T]GGAT GGAGGTGGAGGGGACG AGAGT

Mick E, Kim JW, Biederman J, Wozniak J, Wilens T, Spencer T, Smoller JW, Faraone SV. (2008) Family based associaton study of pediatric bipolar disorder and the dopamine transporger gene (SLC6A3) Am J Med Genet B Neuropsychiatr Genet. 147 B (7), 1182-5 Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A. 103(12), 4552-7 Mick E, Kim JW, Biederman J, Wozniak J, Wilens T, Spencer T, Smoller JW, Faraone SV. (2008) Family based associaton study of pediatric bipolar disorder and the dopamine transporger gene (SLC6A3) Am J Med Genet B Neuropsychiatr Genet. 147 B (7), 1182-5 Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A. 103(12), 4552-7 Mick E, Kim JW, Biederman J, Wozniak J, Wilens T, Spencer T, Smoller JW, Faraone SV. (2008) Family based associaton study of pediatric bipolar disorder and the dopamine transporger gene (SLC6A3) Am J Med Genet B Neuropsychiatr Genet. 147 B (7), 1182-5 Talkowski ME, Bamne M, Mansour H, Nimgaonkar VL. (2007) Dopamine genes and schizophrenia: case closed or evidence pending? Schizophr Bull. 33(5), 1071-81

Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A. 103(12), 4552-7 Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A.

106

Gene Therapy and Molecular Biology Vol 13, page 107 103(12), 4552-7 Le Strat Y, Ramoz N, Pickering P, Burger V, Boni C, Aubin HJ, Ades J, Batel P, Gorwood P. (2008) The 3’ part of the dopamine transporter gene DAT1/SLC6A3 is associated with withdrawal seizures in patients with alcohol dependence. Alcohol Clin Exp Res. 32(1), 27-35 CACGGTAAAAATACAA GGACAGTGTG[A/T]GCA GCAGAATGGCCAGGCA GACCAC

AGGGTTATTAGGATGCT GTGGTCATG[C/T]CGTGT GTGGATGAGTCCATGCT GTT GCCAGGCAGGGGCTGG TGGAGGTGCA[C/G]GGC CTGGAGGAACACAGAG CCCAGC

AGGAGAGGACGTTTGC GCGATTCTCC[C/G]CAG ATCCAGTGTTTCCCGTC AGCCA

GGCTCGTGGCCCTGCGG GCGGATCTT[G/T]GGAA GAGCTTGTTCACACTCA CCTA

TCGAGGCAGGGCCACC GGGGACGTCC[A/G]AGA ACATTGGTGATCCCTTC CCAGG AATGCAGGCGTGGGAC AAGGCAGCTC[C/T]GAG TCCTGCTCAATGGTTTT GTGAC

GAGCTCATCCTTGTCAA GGAGCAGAA[C/T]GGAG TGCAGCTCACCAGCTCC ACCC GTGGGGAGGGGTGCAG GGGAAGGAGG[A/G]GCA AACCAGAGTGTCTGTCT TGAGG AAACACGCTGCTGCTGG ATCCAAATG[A/C]CAGA AGTCGCCCTGGCTGGGG CGGT

Preuss UW, Zill P, Koller G, Bondy B, Sokya M. (2007) D2 dopamine receptor gene haplotypes and their influence on alcohol and tobacco consumption magnitude in alcohol-dependent individuals Alcohol Alcohol. 42(3), 258-66 Shi J, Badner JA, Hattori E, Potash JB, Willour VL, McMahon FJ, Gershon ES, Liu C. (2008) Neurotransmission and bipolar disorder: a systematic family-based association study. Am J Med Genet B Neuropsychiatr Genet. 147B(7), 1270-7 Shi J, Badner JA, Hattori E, Potash JB, Willour VL, McMahon FJ, Gershon ES, Liu C. (2008) Neurotransmission and bipolar disorder: a systematic family-based association study. Am J Med Genet B Neuropsychiatr Genet. 147B(7), 1270-7 Mick E, Kim JW, Biederman J, Wozniak J, Wilens T, Spencer T, Smoller JW, Faraone SV. (2008) Family based associaton study of pediatric bipolar disorder and the dopamine transporger gene (SLC6A3) Am J Med Genet B Neuropsychiatr Genet. 147 B (7), 1182-5

Friedel S, Saar K, Sauer S, Dempfle A, Walitza S, Renner T, Romanos M, Freitag C, Seitz C, Palmason H, Scherag A, Windemuth-Kieselbach C, Schimmelmann BG, Wewetzer C, Meyer J, Warnke A, Lesch KP, Reinhardt R, Herpertz-Dahlmann B, Linder M, Hinney A, Remschmidt H, Schafer H, Konrad K, Hubner N, Hebebrand J. (2007) Association and linkage of allelic variants of the dopamine transporter gene in ADHD Mol Psychiatry 12(10), 923-33 Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24

Preuss UW, Zill P, Koller G, Bondy B, Sokya M. (2007) D2 dopamine receptor gene haplotypes and their influence on alcohol and tobacco consumption magnitude in alcohol-dependent individuals Alcohol Alcohol. 42(3), 258-66 Oades RD, Lasky-Su J, Christiansen H, Faraone SV, Sonuga-Barke EJ, Banaschewski T, Chen W, Anney RJ, Buitelaar JK, Ebstein RP, Franke B, Gill M, Miranda A, Roeyers H, Rothenberger A, Sergeant JA, Steinhausen HC, Taylor EA, Thompson M, Asherson P. (2008) The influence of serotonin- and other genes on impulsive behavioral aggression and cognitive impulsivity in children with attendiotndeficity/hyperactivity disorder (ADHD): Findings from a family-based association test (FBAT) analysis Behav Brain Funct.4,48 Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak assocation with post-surgical pain in humans. Mol Pain. 2,24 Genro JP, Polanczyk GV, Zeni C, Oliveira AS, Roman T, Rohde LA, Hutz MH. (2008) A common haplotype at the dopamine transporter gene 5’ region is associated with attention-deficit/hyperactivity disorder. Am J Med Genet B Neuropsychiatr Gene. 147B(8), 1568-75 Guindalini C, Howard M, Haddley K, Laranjeira R, Collier D, Ammar N, Craig I, O’Gara C, Bubb VJ, Greenwood T, Kelsoe J, Asherson P, Murray RM, Castelo A, Quinn JP, Vallada H, Breen G. (2006) A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample Proc Natl Acad Sci U S A. 103(12), 4552-7

107

Blum et al: Genes and Happiness

HTR3B

CTGCGCGCTGGTGCTCT GGGCAGGGC[G/T]GGGA GGCCGGGCGAGGACTC GCCAG

GGAGCCAGGACGCGAG GGCGACCCCG[A/T]CGG CGGGAGGGCGGGGCGG GGCGGA CCTTTACAGCCTTTACC TAAGGCAGT[A/G]CTCTT GCTGACATTCAGGACAC TAA

‘Talkowski ME, Bamne M, Mansour H, Nimgaonkar VL. (2007) Dopamine genes and schizophrenia: case closed or evidence pending? Schizophr Bull. 33(5), 1071-81

TTTGGCCTTCTCTCTTGG GCCAAGGA[A/G]TTTCT GCTCTATTGCATGTTCT CAT GAGAGCTCCTTGGAGAT GGAATAGGC[C/T]CCAA GGTTAGCCTGTAATTGC CTCC

Ruano G, Thompson PD, Windemuth A, Seip RL, Dande A, Sorokin A, Kocheria M, Smith A, Holford TR, Wu AH. (2007) Physiogenomic association of statin-related myalgia to serotonin receptors. Muscle Nerve 36(3), 329-35

Ducci F, Enoch MA, Yuan Q, Shen PH, White KV, Hodgkinson C, Albaugh B, Virkkunen M, Goldman D. (2009) HTR3B is associated with alcoholism with antisocial behavior and alpha EEG power—an intermediate phenotype for alcoholism and comorbid behaviors. Alcohol. 43(1), 73-84 Oades RD, Lasky-Su J, Christiansen H, Faraone SV, Sonuga-Barke EJ, Banaschewski T, Chen W, Anney RJ, Buitelaar JK, Ebstein RP, Franke B, Gill M, Miranda A, Roeyers H, Rothenberger A, Sergeant JA, Steinhausen HC, Taylor EA, Thompson M, Asherson P. (2008) The influence of serotonin- and other genes on impulsive behavioral aggression and cognitive impulsivity in children with attendiotndeficity/hyperactivity disorder (ADHD): Findings from a family-based association test (FBAT) analysis Behav Brain Funct.4,48

NOS3

CCTTAGCACCTGTGTGT CTATCATtc[C/T]gggcagga aaacttgcacaattaaa

Oades RD, Lasky-Su J, Christiansen H, Faraone SV, Sonuga-Barke EJ, Banaschewski T, Chen W, Anney RJ, Buitelaar JK, Ebstein RP, Franke B, Gill M, Miranda A, Roeyers H, Rothenberger A, Sergeant JA, Steinhausen HC, Taylor EA, Thompson M, Asherson P. (2008) The influence of serotonin- and other genes on impulsive behavioral aggression and cognitive impulsivity in children with attendiotndeficity/hyperactivity disorder (ADHD): Findings from a family-based association test (FBAT) analysis Behav Brain Funct.4,48

CTTCATCCGGGGGTAAG TGAGATGGA[A/G]GACT TGGTGGGGAGCTGCCCA GGGT

Kullo IJ, Greene MT, Boerwinkle E, Chu J, Turner ST, Kardia SL. (2008) Association of polymorphisms in NOS3 with the ankle-brachial index in hypertensive adults Atherosclerosis. 196(2), 905-12

ACTATAGCTCCCAGAGC CAGAGCTGG[G/T]ATCA AACCGGCTGGCCCTGTG GCTT ACCAGGGCATCAAGCTC TTCCCTGGC[C/T]GGCTG ACCCTGCCTCAGCCCTA GTC AGGGTGGGGGTGGAGG CACTGGAAGG[C/T]AGC TTCCTGCTCTTTTGTGTC CCCC

108

Gene Therapy and Molecular Biology Vol 13, page 109

PPARG

GACTCCCTTCAGGCAGT CCTTTAGTC[A/C]CCAGC CTCACCTTTGCTCTCAA TGT AAACTCTGGGAGATTCT CCTATTGAC[C/G]CAGA AAGCGATTCCTTCACTG ATAC AGGATTTTCTTACATTT AAAGCAGAA[C/T]GACA CTACTGATACACAAAAG TAAA GAGAAATCTTCGGAGG GCTCACCAGC[A/G]TCA CAAGTAGGTAGACCAG AAGAGG GTTTACAGACCTTGTCA GAGTTGGTA[C/G]TAATT CCAGAATATAATCATTT CAA TGGTTGACACAGAGATG CCATTCTGG[C/G]CCACC AACTTTGGGATCAGCTC CGT GATTTATTTAAATCATC TCTAATTCT[C/T]ACAAC TCCGAAAAGATAAGAA AACA AGGATTTTCTTACATTT AAAGCAGAA[C/T]GACA CTACTGATACACAAAAG TAAA

Sanghera DK, Ortega L, Han S, Singh J, Ralhan SK, Wander GS, Mehra NK, Mulvihill JJ, Ferrell RE, Nath SK, Kamboth MI. (2008) Impact of nine common type 2 diabetes risk polymorphisms in Asian Indian Sikhs: PPARG2 (Pro12AIa), IGF2BP2, TCF7L2, and FTO variants confer a significant risk. BMC Med Genet. 9,59 Chen L, Velasco Mondragon HE, Lazcano-Ponce E, Collins A, Shugart YY. (2006) Effect of the peroxisome proliferators-activated receptor (PPAR) gamma 3 gene on BMI in 1,210 school students from Morelos, Mexico. Pac Symp Biocomput. 467-77

Kilpelainen TO, Lakka TA, Laakasonen DE, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Lindi V, Tuomilehto J, Uusitupa M, Laakso M. (2008) SNPs in PPARG associate with type 2 diabets and interact with physical activity. Med Sci Sports Exerc 40 (1), 25-33 Hancock AM, Witonsky DB, Gordon AS, Eshel G, Pritchard JK, Coop G, Di Rienzo A. (2008) Adaptations to climate in candidate genes for common metabolic disorders. PLoS Genet. 4(2), e32 Gallicchio L, Chang H, Christo DK, Thuita L, Huang HY, Strickland P, Ruczinski I, Hoffman SC, Helzlsouer KJ. (2008) Single nucleotide polymorphisms in inflammationrelated genes and mortality in a community-based cohort in Washingtom County, Maryland Am J Epidemiol. 167(7), 807-13 Saez ME, Grilo A, Moron FJ, Manzano L, Martinez-Larrad MT, Gonzalez-Perez A, Serrano-Hernando J, Ruiz A, Ramirez-Lorca R, Serrano-Rios M. (2008) Interaction between Calpain 5, Peroxisome proliferator-activated receptor-delta genes: a polygenic approach to obesity Cardiovasc Diabetol. 7,23 Fox CS, Heard-Costa N, Cupples LA, Dupuis J, Vasan RS, Atwood LD. (2007) Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100K project BMC Med Genet.8, Suppl 1:S18. Kiel DP, Demissie S, Dupuis J, Lunetta KL, Murabito JM, Karasik D. (2007) Genomewide association with body mass and geometry in the Framingham Heart Study BMC Med Genet. 8, Suppl 1:S14

GTTGGGGATCCAGTTGG CCTCATTCT[A/G]AGCTG GCTGTGGATTCACAGAA GAA AAGATACGGGGGAGGA AATTCACTGG[A/G]TTTT ACAATATATTTTTCAAG GCAA

ChREBP

GAGAAATCTTCGGAGG GCTCACCAGC[A/G]TCA CAAGTAGGTAGACCAG AAGAGG GACAAAAAGCAATTGA

Chen L, Velasco Mondragon HE, Lazcano-Ponce E, Collins A, Shugart YY. (2006) Effect of the peroxisome proliferators-activated receptor (PPAR) gamma 3 gene on BMI in 1,210 school students from Morelos, Mexico. Pac Symp Biocomput. 467-77 Fox CS, Heard-Costa N, Cupples LA, Dupuis J, Vasan RS, Atwood LD. (2007) Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100K project BMC Med Genet.8, Suppl 1:S18. Gallicchio L, Chang H, Christo DK, Thuita L, Huang HY, Strickland P, Ruczinski I, Hoffman SC, Helzlsouer KJ. (2008) Single nucleotide polymorphisms in inflammationrelated genes and mortality in a community-based cohort in Washingtom County, Maryland Am J Epidemiol. 167(7), 807-13 Huang HY, Thuita L, Strickland P, Hoffman SC, Comstock GW, Helzlsouer KJ. (2006) Frequencies of single nucleotide polymorphisms in genes regulating inflammatory responses in a community-based population BMC Med Genet. 8,7 Chen L, Velasco Mondragon HE, Lazcano-Ponce E, Collins A, Shugart YY. (2006) Effect of the peroxisome proliferators-activated receptor (PPAR) gamma 3 gene on BMI in 1,210 school students from Morelos, Mexico. Pac Symp Biocomput. 467-77 Kooner JS, Chambers JC, Aguilar-Salinas CA, Hinds DA, Hyde CL, Warnes GR,

109

Blum et al: Genes and Happiness GGTCCAGGAG[C/G]TGC CGCCCACCCGGCTCCTC CTCTG

FTO

GCTGTCAGCACCTGGTA CAAATACCA[A/G]GATA GGGTTTTTGGGGCCACA TTTT

GCATGCCAGTTGCCCAC TGTGGCAAT[A/C]AATA TCTGAGCCTGTGGTTTT TGCC

Gomez Perez FJ, Frazer KA, Elliott P, Scott J, Milos PM, Cox DR, Thompson JF (2008) Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides Nat Genet 40(2), 149-51 Vrablik M, Ceska R, Adamkova V, Peasey A, Pikhart H, Kubinova R, Marmot M, Bobak M, Hubacek JA. (2008) MLXIPL variant in individuals with low and high triglyceridemia in white population in Central Europe Hum Genet. 124(5), 553-5 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Haupt A, Thamer C, Staiger H, Tschritter O, Kirchhoff K, Machicao F, Haring HU, Stefan N, Fritsche A. (2008) Variation in the FTO Gene Influences Food Intake but not Energy Expenditure Exp Clin Endocrinol Diabets (in press). Song Y, You NC, Hsu YH, Howard BV, Langer RD, Manson JE, Nathan L, Niu T, F Tinker L, Liu S. (2008) FTO polymorphisms are associated with obesity but not diabetes risk in postmenopausal women Obesity (Silver Spring) 16(11), 2472-80

AGGTTCCTTGCGACTGC TGTGAATTT[A/T]GTGAT GCACTTGGATAGTCTCT GTT

Kloting N, Schleinitz D, Ruschke K, Berndt J, Fasshauer M, Tonjes A, Schon MR, Kovacs P, Stumvoll M, Bluher M. (2008) Inverse relationship between obesity and FTO gene expression in visceral adipose tissue in humans Diabetologia 51(4), 641-7 Hennig BJ, Fulford AJ, Sirugo G, Rayco-Solon P, Hattersley AT, Frayling TM, Prentice AM. (2009) FTO gene variation and measures of body mass in an African population BMC Med Genet 10(1), 21 Cecil JE, Tavendale R, Watt P, Hetherington MM, Palmer CN. (2008) An obesityassociated FTO gene variant and increased energy intake in children N Engl J Med 359(24), 2558-66 Fisher E, Schulze MB, Stefan N, Haring HU, Doring F, Joost HG, Al-Hasani H, Boeing H, Pischon T. (2009) Association of the FTO rs9939609 Single Nucleotide Polymorphism With C-reactive Protein Levels Obesity (Silver Spring). 17(2),330-4

GATGACAACATGCAAA CTTTATGGCC[A/G]GAA ACCAAAGAGTCAGGCA AAATAT aaaagaaaGTAAACATATTT AAGGTC[A/G]TAAATAA GGCCATGTCTAATAGTG A

aggaatgttctgatggcttggcccag[ G/T]tggtgactgtgcagatagactga ag

tcagcacccaagggaccatcaaagag [A/G]ctgttgtggagagggaatccg aagg

Zabena C, Gonzalez-Sanchez JL, Martinez-Larrad MT, Torres-Garcia A, AlvarezFernandez-Represa J, Corbaton-Anchuelo A,Perez-Barba M, Serrano-Rios M. (2009) The FTO obesity gene. Genotyping and gene expressionanalysis in morbidly obese patients. Obes Surg. 19(1), 87-95 Rampersaud E, Mitchell BD, Pollin TI, Fu M, Shen H, Oâ&#x20AC;&#x2122;Connell JR, Ducharme JL, Hines S, Sack P, Naglieri R, Shuldiner AR, Snitker S. (2008) Physical activity and the association of common FTO gene variants with body mass index and obesity. Arch Intern Med. 168(16), 1791-7 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Hinney A, Nguyen TT, Scherag A, Friedel S, Bronner G, Muller TD, Grallert H, Illig

110

Gene Therapy and Molecular Biology Vol 13, page 111

TGGAGTGTTTTTCCTTC ACCTTTTCC[A/G]GTCTC TGGGTTGCATCGCCAGA CTG

T, Wichmann HE, Rief W, Schafer H, Hebebrand J. (2007) Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One; 2(12), e1361 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Hinney A, Nguyen TT, Scherag A, Friedel S, Bronner G, Muller TD, Grallert H, Illig T, Wichmann HE, Rief W, Schafer H, Hebebrand J. (2007) Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One; 2(12), e1361

TGTCTAGCCCTGTGGGT TTACATTAG[A/T]TAGGG TAGGTTATTGCTGCAAC GTA CTATCCAGGATGGCTCT AAAGGGACT[C/T]CGCT ATAGGTTGGGGCTATGA TAGA GCTTATATTCAAAGCTC CAGGTAAAT[A/G]TAAG ATGTTGCTATAATTACC TAAG GGTAGGCAGGTGGATCT GAAATCTCA[C/T]ATAGT ACCAAGACACGTGACTA GGA

ttgattcttatacttttttgtttagt[C/T]g ttgaaatatgttgttttggttgaa

Hinney A, Nguyen TT, Scherag A, Friedel S, Bronner G, Muller TD, Grallert H, Illig T, Wichmann HE, Rief W, Schafer H, Hebebrand J. (2007) Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One; 2(12), e1361 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Rampersaud E, Mitchell BD, Pollin TI, Fu M, Shen H, Oâ&#x20AC;&#x2122;Connell JR, Ducharme JL, Hines S, Sack P, Naglieri R, Shuldiner AR, Snitker S. (2008) Physical activity and the association of common FTO gene variants with body mass index and obesity. Arch Intern Med. 168(16), 1791-7 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Hinney A, Nguyen TT, Scherag A, Friedel S, Bronner G, Muller TD, Grallert H, Illig T, Wichmann HE, Rief W, Schafer H, Hebebrand J. (2007) Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One; 2(12), e1361 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Hinney A, Nguyen TT, Scherag A, Friedel S, Bronner G, Muller TD, Grallert H, Illig T, Wichmann HE, Rief W, Schafer H, Hebebrand J. (2007) Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One;2(12), e1361

AATTAGGAAGATTTGAG TAGCTAAAA[A/G]TTCC AAGAGTGGAATAATAG TTTTA TTTGGTGCACTCCCAAT TTACTCTAA[A/T]CTTCT ACGGGCTTCCTTGGAGA

Berentzen T, Kring SI, Holst C, Zimmermann E, Jess T, Hansen T, Pedersen O, Toubro S, Astrup A, Sorensen TI. (2008) Lack of association of fatness-related FTO gene variants with energy expenditure or physical activity. J Clin Endocrinol Metab 93(7), 2904-8 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao

111

Blum et al: Genes and Happiness AAC

K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53

GACCTGAAAATAGGTG AGCTGTCAAG[G/T]TGTT GGCAGGGAGAGGCTCC TCTGG

Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746

tggttcactgcatattcccagtaatt[C/ G]gaacaatgcctgacatgaagtaga c

TTAGAATGTCTGAATTA TTATTCTAG[A/G]TTCCT TGCGACTGCTGTGAATT TTG

TTGATTTCGGTAGTCAT AACACCACC[C/T]TGGA AGGCACCCTAGATAGA GGTCA TTCATTCTACCTGTCTTT AGTATCAT[A/G]GGGGT AGTTACCTCAGCGGGGG TAG

ttgctcaaggtcacacagtaacctta[A /G]gtaggcaggataagctctggttctg

TATGATGGTTAGGTTAG GTTGCAAGT[C/T]TTGGA ATATATGCAGAGGAATA ACT

Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orru M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakkata E, Abecasis GR. (2007) Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits PLoS Genet. 3(7), e115 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orru M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakkata E, Abecasis GR. (2007) Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits PLoS Genet. 3(7), e115 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Hotta K, Nakata Y, Matsuo T, Kamohara S, Kotani K, Komatsu R, Itoh N, Mineo I, Wada J, Masuzaki H, Yoneda M, Nakajima A, Miyazaki S, Tokunaga K, Kawamoto M, Funahashi T, Hamaguchi K, Yamada K, Hanafusa T, Oikawa S, Yoshimatsu H, Nakao K, Sakata T, Matsuzawa Y, Tanaka K, Kamatani N, Nakamura Y. (2008) Variations in the FTO gene are associated with severe obesity in the Japanese J Hum Genet 53(6), 546-53 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746

112

Gene Therapy and Molecular Biology Vol 13, page 113 TTATAAACCTCTAAAAT AGTTACTAA[A/G]TAAG TTATTCTTTTAGGTATTT TTC TTTTATTTCCGCAATCA CTCCCTAAT[C/G]TTTAT TTCTTTTTTGCTTCGCAT CA

TAGCATTTTTCTGGAGC GTAATTTCA[C/T]AATGT GAATCAGAAGTCTTAAT AGT

GAGCACAGGTGGAGAG AAAGGGGAGT[A/G]AGA GAAGCAAAGAAGAAAA GCCTTT

TAGGGACACAAAAAGG GACATACTAC[A/G]TGA ATTACTaatatctaagaaaata

ATGAATTACTAATATCT AAGAAAATA[C/T]GATA Catttgagaacttagatgaag

GAAATGTGGTGTAGACG TGACCCAGG[A/G]GGAA ATGAGTTTTGTTGGACA GATT

CTACATCTCCTACTTAG CCGAGGTCT[C/T]TTCAC TCTCTGGGCAAGTCTCC TCA

ACACGGCTGAAGAGTC AGGAGTGGGA[C/T]GAA AAATACACTTCATTTGT AGGTG

GCACATTTATGCCTTTT ATATGCCAC[A/G]TACA CACGAAAACTccatatattct

113

Blum et al: Genes and Happiness

agagtgaataaaattatttctaaatt[C/ T]atgcttcataccgtgtgtaatttag

tgttgcaacagagatgatggcagttt[C /T]ggccacggtgtaagaagcagagg tg

ACATCTGCCTTCCCAGA GAAAGGAAA[A/G]TCAA TGTTTAAAGTCTATTTA AAAA

TNF Alpha

GGGAAGCAAAGGAGAA GCTGAGAAGA[C/T]GAA GGAAAAGTCAGGGTCT GGAGGG GGAGGCAATAGGTTTTG AGGGGCATG[A/G]GGAC GGGGTTCAGCCTCCAGG GTCC

Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Grant SF, Li M, Bradfield JP, Kim SE, Annaiah K, Santa E, Glessner JT, Casalunovo T, Frackelton EC, Otieno FG, Shaner JL, Smith RM, Imielinski M, Eckert AW, Chiavacci RM, Berkowitz RI, Hakonarson H. (2008) Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP PLoS ONE 3(3), e1746 Sherva R, Wilhelmsen K, Pomerleau CS, Chasse SA, Rice JP, Snedecor SM, Bierut LJ, Neuman RJ, Pomerleau OF. (2008) Association of a single nucleotide polymorphism in neuronal acetylcholine receptor subunit alpha 5 (CHRNA5) with smoking status and with ‘pleasurable buzz’ during early experimentation with smoking Addiction 103(9), 1544-52 Bierut LJ, Madden PA, Breslau N, Johnson EO, Hatsukami D, Pomerleau OF, Swan GE, Rutter J, Bertelsen S, Fox L, Fugman D, Goate AM, Hinrichs AL, Konvicka K, Martin NG, Montgomery GW, Saccone NL, Saccone SF, Wang JC, Chase GA, Rice JP, Ballinger DG. (2007) Novel genes identified in a high-density genome wide association study for nicotine dependence Hum Mol Genet. 16(1), 24-35 Gallicchio L, Chang H, Christo DK, Thuita L, Huang HY, Strickland P, Ruczinski I, Hoffman SC, Helzlsouer KJ. (2008) Single nucleotide polymorphisms in inflammationrelated genes and mortality in a community-based cohort in Washington County, Maryland. Am J Epidemiol. 167(7), 807-13 Czerski PM, Rybabowski F, Kapelski P, Rybabowski JK, Dmitrzak-Weglarz M, Leszcynska-Rodziewicz A, Slopien A, Skibinska M, Kaczmarkiewicz-Fass M, Hauser J. (2008) Association of tumor necrosis factor -308G/A promoter polymorphism with schizophrenia and bipolar affective disorder in a Polish population Neuropsychobiology 57(1-2), 88-94 Wang SS, Cerhan JR, Hartge P, Davis S, Cozen W, Severson RK, Chatterjee N, Yeager M, Chanock SJ, Rothman N. (2006) Common genetic variants in proinflammatory and other immunoregulatory genes and risk for non-Hodgkin lymphoma Cancer Res. 66(19), 9771-80

TGGCCCAGAAGACCCCC CTCGGAATC[A/G]GAGC AGGGAGGATGGGGAGT GTGAG

TCTTTCTGCATCCCCGTC TTTCTCCA[C/T]GTTTTTT TCTCTCCATCCCTCCCTA

MANEA

Leptin OB

GTTGAATGCCTGGAAGG TGAATACAC[A/G]GATG AATGGAGAGAGAAAAC CAGAC CATTTTACAATAGATAA ATGCTTGTG[C/T]TACCT AAAGCACTTAGCACACA GTT gctctgggaatgtctatcctatgcaa[C /T]ggagataaggactgagatacgcc ct

Loza MJ, McCall CE, Li L, Isaacs WB, Xu J, Chang BL. (2007) Assembly of inflammation-related genes for pathway-focused genetic analysis PLoS ONE. 2(10), e1035 Podgoreanu MV, White WD, Morris RW, Mathew JP, Stafford-Smith M, Welsby IJ, Grocott HP, Milano CA, Newman MF, Schwinn DA. (2006) Perioperative Genetics and Safety Outcomes Study (PEGASUS) Investigative Team Circulation 114(1 Suppl), I275-81 Podgoreanu MV, White WD, Morris RW, Mathew JP, Stafford-Smith M, Welsby IJ, Grocott HP, Milano CA, Newman MF, Schwinn DA. (2006) Perioperative Genetics and Safety Outcomes Study (PEGASUS) Investigative Team Circulation 114(1 Suppl), I275-81 Israni AK, Li N, Cizman BB, Snyder J, Abrams J, Joffe M, Rebbeck T, Feldman HI. (2008) Association of donor inflammation- and apoptosis-related genotypes and delayed allograft after kidney transplantation Am J Kidney Dis. 52(2), 331-9 Yu Y, Kranzler HR, Panhuysen C, Weiss RD, Poling J, Farrer LA, Gelernter J. (2008) Substance dependence low-density whole genome association study in two distinct American populations. Hum Genet. 123(5), 494-506

114

Gene Therapy and Molecular Biology Vol 13, page 115 atgcaatggagataaggactgagata[ C/T]gccctggtctcctgcagtaccct ca

PEMT

MAO-A

GGAGCCCCGTAGGAATC GCAGCGCCA[A/G]CGGT TGCAAGGTAAGGCCCCG GCGC

Jiang Y, Wilk JB, Borecki I, Williamson S, DeStefano AL, Xu G, Liu J, Ellison RC, Province M, Myers RH. (2004) Common variants in the 5’ region of the leptin gene are associated with body mass index in men from the National Heart, Lung, and Blood Institute Family Heart Study Am J Hum Genet. 75(2), 220-30 Jiang Y, Wilk JB, Borecki I, Williamson S, DeStefano AL, Xu G, Liu J, Ellison RC, Province M, Myers RH. (2004) Common variants in the 5’ region of the leptin gene are associated with body mass index in men from the National Heart, Lung, and Blood Institute Family Heart Study Am J Hum Genet. 75(2), 220-30

AAGTTCCTGACCTCTGA ATGAGAGGG[A/G]CTGT GTAAGGCCAATGCCTGG GAGG

aataaaaataaaTGTTCTTCCT TGCA[A/T]TGAAGTTAA ATATGTAAATTCTCAA ACTTAGGTATTAGAGGG TGGCCATTA[C/T]TTGAG AGTGACTATGACCACAG TTA

TGGGTGAATGTGTTATG CTCTCTCCC[A/G]CCACC ATGTCTTTATACCCCCT GAT

CTCCCAGTGGGTGGGAG AGAAAGGAC[A/G]TAAG GAAGCAAGTGGTAAAG GCCCT

atcccttcaccAGAGTGATTT CCTCG[A/C]GGCAGGTG CCTGGGGTAGCCACTGG

Liu Y, Zhang H, Ju G, Zhang X, Xu Q, Liu S, Yu Y, Shi J, Boyle S, Wang Z, Shen Y, Wei J. (2007) A study of the PEMT gene in schizophrenia Neurosci Lett 424(3), 203-6

GGACTGCCTGGTTGTGC TTCGGACCC[A/G]GAGG CAGACAGAGGAGGCCT TTGAA

Liu Y, Zhang H, Ju G, Zhang X, Xu Q, Liu S, Yu Y, Shi J, Boyle S, Wang Z, Shen Y, Wei J. (2007) A study of the PEMT gene in schizophrenia Neurosci Lett 424(3), 203-6

CCCACTAGGCAAGCCTC CTAAAAGCA[A/G]TATG GTTGTAGATCACTGGAA AATA

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

GTAAACATGCAAACTGA AACATTAGC[A/G]CCCA TTTATTCAGCATCTTAG AAGA

Lin YM, Davamani F, Yang WC, Lai TJ, Sun HS. (2008) Association analysis of monoamine oxidase A gene and bipolar affective disorder in Han Chinese Behav Brain Funct. 4,21

GAGTGAAGGCCAGGTA CAGAGGAAAT[A/G]AAG CATTCCAAATAATGCCA GGTAA CCAAAGTTAACTTGTGA ACCCTTCTA[A/G]TAAAC TGCTCCAAGATATGACA AAA

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

GTTTGCCATGGATGAAC CACCAGGAT[A/G]GTGG

Rommelse NN, Altink ME, Arias-Vasquez A, Buschgens CJ, Fliers E, Faraone SV, Buitelaar JK, Sergeant JA, Oosterlaan J, Franke B. (2008) Differential association

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

115

Blum et al: Genes and Happiness GGGAGACAGAAAAGGT TGATG

between MAOA, ADHD and neuropsychological functioning in boys and girls. Am J Med Genet B Neuropsychiatr Genet. 147B(8), 1524-30

GGAAAATTCCCCTTCCC CTAAGACAT[C/T]CACCC TTCTGGTTTGGGTAATT CCT

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

GCAGAGAGAAACCAGT TAATTCAGCG[G/T]CTTC CAATGGGAGCTGTCATT AAGT

Lin YM, Davamani F, Yang WC, Lai TJ, Sun HS. (2008) Association analysis of monoamine oxidase A gene and bipolar affective disorder in Han Chinese Behav Brain Funct. 4,21

GTGCATGATGTATTACA AGGAGGCC[G/T]TCTGG AAGAAGAAGGGTAGGC TGCT

Ni X, Sicard T, Bulgin N, Bismil R, Chan K, McMain S, Kennedy JL. (2007) Monoamine oxidase a gene is associated with borderline personality disorder. Psychiatr Genet 17(3), 153-7 Lin YM, Davamani F, Yang WC, Lai TJ, Sun HS. (2008) Association analysis of monoamine oxidase A gene and bipolar affective disorder in Han Chinese Behav Brain Funct. 4,21 Li J, Kang C, Zhang H, Wang Y, Zhou R, Wang B, Guan L, Yang L, Faraone SV. (2007) Monoamine oxidase A gene polymorphism predicts adolescent outcome of attention-deficit/hyperactivity disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 430-3

AGAGAAGGAAGTGGTG TCCCCACAAA[G/T]GAA TTGCTAAGGAGTTCCAC AGCCT

AAGAGAAAACAAAGCT GAAATGCTGC[A/G]AGT CAATAATATCGTTGCTT TAACA

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

TTTGACAACTATTTCTA GAATTTGCA[C/T]TGAAC TCTGCTTTTCCTTTTAAA TT

Kim H, Lee H, Rowan J, Brahim J, Dionne RA. (2006) Genetic polymorphisms in monoamine neurotransmitter systems show only weak association with acute postsurgical pain in humans. Mol Pain 2,24

GGTCTCGGGAAGGTGAC CGAGAAAGA[C/T]ATCT GGGTACAAGAACCTGA ATCAA

Rommelse NN, Altink ME, Arias-Vasquez A, Buschgens CJ, Fliers E, Faraone SV, Buitelaar JK, Sergeant JA, Oosterlaan J, Franke B. (2008) Differential association between MAOA, ADHD and neuropsychological functioning in boys and girls. Am J Med Genet B Neuropsychiatr Genet. 147B(8), 1524-30 Li J, Kang C, Zhang H, Wang Y, Zhou R, Wang B, Guan L, Yang L, Faraone SV. (2007) Monoamine oxidase A gene polymorphism predicts adolescent outcome of attention-deficit/hyperactivity disorder Am J Med Genet B Neuropsychiatr Genet. 144B(4), 430-3

CRH

CTGTCCCACAACATGGG GTCTTACAG[C/T]TCTTT GATGTATCCCCCCACAG GGG

Huang S, Cook DG, Hinks LJ, Chen XH, Ye S, Gilg JA, Jarvis MJ, Whincup PH, Day IN. (2005) CYP2A6, MAOA, DBoH, DRD4, and 5HT2A genotypes, smoking behaviour and cotinine levels in 1518 UK adolescents Pharmacogenet Genomics 15(12), 839-50 Binder EB, Bradley RG, Liu W, Epstein MP, Deveau TC, Mercer KB, Tang Y, Gillespie CF, Heim CM, Nemeroff CB, Schwartz AC, Cubells JF, Ressler KJ. (2008) Association of FKBP5 polymorphisms and childhood abuse with risk of posttraumatic stress disorder symptoms in adults JAMA 299(11), 1291-305 Bradley RG, Binder EB, Epstein MP, Tang Y, Nair HP, Liu W, Gillespie CF, Berg T, Evces M, Newport DJ, Stowe ZN, Heim CM, Nemeroff CB, Schwartz A, Cubells JF, Ressler KJ. (2008) Influence of child abuse on adult depression: moderation by the corticotropin-releasing hormone receptor gene. Arch Gen Psychiatry 65(2), 190-200

116

Gene Therapy and Molecular Biology Vol 13, page 117 GCCTCTGGGGTCACCAG GTACATCTT[C/T]GATCT TGGCCACACTGGAGAGT CAA

TTTCTAAACACAGAGGA CTGGTGTTG[C/T]GTTAT GCAAAGAAAAATGCTTC TTA

Wasserman D, Sokolowski M, Rozanov V, Wasserman J. (2008) The CRHR1 gene: a marker for suicidality in depressed males exposed to low stress. Genes Brain Behav 7(1), 14-9 Bradley RG, Binder EB, Epstein MP, Tang Y, Nair HP, Liu W, Gillespie CF, Berg T, Evces M, Newport DJ, Stowe ZN, Heim CM, Nemeroff CB, Schwartz A, Cubells JF, Ressler KJ. (2008) Influence of child abuse on adult depression: moderation by the corticotropin-releasing hormone receptor gene. Arch Gen Psychiatry 65(2), 190-200

AAGACACTCAGGTGCA GGGACCCTCT[A/C]CATT TTTGCCCAGCAGCAGCC ATGC

Bradley RG, Binder EB, Epstein MP, Tang Y, Nair HP, Liu W, Gillespie CF, Berg T, Evces M, Newport DJ, Stowe ZN, Heim CM, Nemeroff CB, Schwartz A, Cubells JF, Ressler KJ. (2008) Influence of child abuse on adult depression: moderation by the corticotropin-releasing hormone receptor gene. Arch Gen Psychiatry 65(2), 190-200 Binder EB, Bradley RG, Liu W, Epstein MP, Deveau TC, Mercer KB, Tang Y, Gillespie CF, Heim CM, Nemeroff CB, Schwartz AC, Cubells JF, Ressler KJ. (2008) Association of FKBP5 polymorphisms and childhood abuse with risk of posttraumatic stress disorder symptoms in adults JAMA 299(11), 1291-305

AGGGCCAGGAACCATG AACCAGCGCG[G/T]GTG GGGGCAGCCTCTTCAGG CCTGG

Liu Z, Zhu F, Wang G, Xiao Z, Wang H, Tang J, Wang X, Qiu D, Liu W, Cao Z, Li W. (2006) Association of corticotropin-releasing hormone receptor1 gene SNP and haplotype with major depression Neurosci Lett 404(3), 358-62

GGCACACCAGTCCTTTT GAGCCCCAG[C/T]GTCC CCAGGTTAATAACCTAG AATT

TGAACACGGAGGCCAC ACAAGAGTGG[A/G]TTC CAAGTGAAGGAGTGAC CAACTC

Liu Z, Zhu F, Wang G, Xiao Z, Tang J, Liu W, Wang H, Liu H, Wang X, Wu Y, Cao Z, Li W. (2007) Association study of corticotropin-releasing hormone receptor1 gene polymorphisms and antidepressant response in major depressive disorders Neurosci Lett 414(2), 155-8 Liu Z, Zhu F, Wang G, Xiao Z, Wang H, Tang J, Wang X, Qiu D, Liu W, Cao Z, Li W. (2006) Association of corticotropin-releasing hormone receptor1 gene SNP and haplotype with major depression Neurosci Lett 404(3), 358-62

TCCTTTCCTGGGATCAC AGAGGGAAG[C/T]GCGG GGGAGCCTAGAGAGCA CCACA

TACAGGTGAAGGAAAG TGATTCTTTC[C/T]CCGT TAACTTTGTTTCACGCC AGAT

CCCCCAACCAGAGATGA TGATGGGGG[A/G]CAGG GGAGGCACCAAACCCT

Blomeyer D, Treutlein J, Esser G, Schmidt MH, Schumann G, Laucht M. (2008) Interaction between CRHR1 gene and stressful life events predicts adolescent heavy alcohol use Biol Psychiatry 63(2), 146-51

117

Blum et al: Genes and Happiness GGGCC AGCAGCATACCCCTAGG GACCTAGGA[A/G]CAGG GAGGGAGAGAGGCAGC CCTGG

CTGCTTCCCACCAATCA GCACAGCTC[A/C]TGCCT GGGGCTGGGACACACTC CCG

Licinio J, O’Kirwan F, Irizarry K, Merriman B, Thakur S, Jepson R, Lake S, Tantisira KG, Weiss ST, Wong ML. (2004) Association of a corticotropin-releasing hormone receptor 1 haplotype and antidepressant treatment response in Mexican-Americans Mol Psychiatry 9(12), 1075-82 Keck ME, Kern N, Erhardt A, Unschuld PG, Ising M, Salyakina D, Muller MB, Knorr CC, Lieb R, Hohoff C, Krakowitzky P, Maier W, Bandelow B, Fritze J, Deckert J, Holsboer F, Muller-Myhsok B, Binder EB. (2008) Combined effects of exonic polymorphims in CRHR1 and AVPR1B genes in a case/control study for panic disorder Am J Med Genet B Neuropsychiatr Genet 147B(7), 1196-204 Keck ME, Kern N, Erhardt A, Unschuld PG, Ising M, Salyakina D, Muller MB, Knorr CC, Lieb R, Hohoff C, Krakowitzky P, Maier W, Bandelow B, Fritze J, Deckert J, Holsboer F, Muller-Myhsok B, Binder EB. (2008) Combined effects of exonic polymorphims in CRHR1 and AVPR1B genes in a case/control study for panic disorder Am J Med Genet B Neuropsychiatr Genet 147B(7), 1196-204 Bradley RG, Binder EB, Epstein MP, Tang Y, Nair HP, Liu W, Gillespie CF, Berg T, Evces M, Newport DJ, Stowe ZN, Heim CM, Nemeroff CB, Schwartz A, Cubells JF, Ressler KJ. (2008) Influence of child abuse on adult depression: moderation by the corticotropin-releasing hormone receptor gene. Arch Gen Psychiatry 65(2), 190-200

ATCAGAATGTGTGGCTT GCAAGAACC[A/G]GCTC AGATCCTGCCCTTCAAA AACA

Goyenechea E, Collins LJ, Parra D, Abete I, Crujeiras AB, O’Dell SD, Martinez JA. (2009) The 11391 G/A polymorphism of the adiponectin gene promoter is associated with metabolic syndrome traits and the outcome of an energy-restricted diet in obese subjects Horm Metab Res. 41(1): 55-61

CAGCTGGCACTGACAGC CTGGGGGGG[/C/G]CGCTCTCCCCCTGC AGCCGTGCAGG GAGCACAAGAAGGCCA GCCCACTGGG[C/G]CCT GGGGCTGCCCTCGGCAA CCGTG

ADIPOQ

STS

VDR

Cauchi S, Nead KT, Choquet H, Horber F, Potoczna N, Balkau B, Marre M, Charpentier G, Froguel P, Meyre D. (2008) The genetic susceptibility to type 2 diabetes may be modulated by obesity status: implications for association studies BMC Med Genet. 9,45 Ahituv N, Kavaslar N, Schackwitz W, Ustaszewska A, Martin J, Hebert S, Doelle H, GTTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG Ersoy B, Kryukov G, Schmidt S, Yosef N, Ruppin E, Sharan R, Vaisse C, Sunyaev S, Dent R, Cohen J, McPherson R, Pennacchio LA. (2007) Medical sequencing at the extremes of human body mass Am J Hum Genet. 80(4), 779-91 GATGACAAGCCAGGCA Brookes KJ, Hawi Z, Kirley A, Barry E, Gill M, Kent L. (2008) Association of the GGGAGGAATG[A/G]ACC steroid sulfatase (STS) gene with attention deficit hyperactivity disorder Am J Med TGGATTCCTGGTGAAGG Genet B Neuropsychiatr Genet 147B(8), 1531-5 ACGTG GTCAGCGATTCTTAATA Jiang H, Xiong DH, Guo YF, Shen H, Xiao P, Yang F, Chen Y, Zhang F, Recker RR, TAAGAAAAA[A/G]TGGT Deng HW. (2007) Association analysis of vitamin D-binding protein gene GAAATGTGTTTAGAGTG polymorphisms with variations of obesity-related traits in Caucasian nuclear families TGCT Int J Obes (Lond). 31(8), 1319-24 CCTGGGGTGCAGGACGC CGCGCTGAT[C/T]GAGG CCATCCAGGACCGCCTG TCCA

Handoko HY, Nancarrow DJ, Mowry BJ, McGrath JJ. (2006) Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures Am J Hum Biol. 18(3), 415-7

GTTCCTGGGGCCACAGA CAGGCCTGC[A/G]CATT CCCAATACTCAGGCTCT GCTC CATAAGACCTACGACCC CACCTACTC[C/T]GACTT

Dvornyk V, Long JR, Xiong DH, Liu PY, Zhao LJ, Shen H, Zhang YY, Liu YJ, RochaSanchez S, Xiao P, Recker RR, Deng HW. (2004) Current limitations of SNP data from the public domain for studies of complex disorders: a test for ten candidate genes for obesity and osteoporosis BMC Genet. 25,5:4 Dvornyk V, Long JR, Xiong DH, Liu PY, Zhao LJ, Shen H, Zhang YY, Liu YJ, RochaSanchez S, Xiao P, Recker RR, Deng HW. (2004) Current limitations of SNP data from

118

Gene Therapy and Molecular Biology Vol 13, page 119 CTGCCAGTTCCGGCCTC CAG

the public domain for studies of complex disorders: a test for ten candidate genes for obesity and osteoporosis BMC Genet. 25,5:4

TGGCCTGCTTGCTGTTC TTACAGGGA[C/T]GGAG GCAATGGCGGCCAGCA CTTCC

Dvornyk V, Long JR, Xiong DH, Liu PY, Zhao LJ, Shen H, Zhang YY, Liu YJ, RochaSanchez S, Xiao P, Recker RR, Deng HW. (2004) Current limitations of SNP data from the public domain for studies of complex disorders: a test for ten candidate genes for obesity and osteoporosis BMC Genet. 25,5:4 Handoko HY, Nancarrow DJ, Mowry BJ, McGrath JJ. (2006) Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures Am J Hum Biol. 18(3), 415-7

DBI

TGTGGGGGTGGGCCAGC CCAGCTTAG[A/G]TTATC TTGGCTCATTGTCCACT AGT

TCTGTCCTCAGGCCAGG GCTTCGCTG[A/C]AGCCC CGGCCACTCCCTAGTGC CTG

Thoeringer CK, Binder EB, Salyakina D, Erhardt A, Ising M, Unschuld PG, Kern N, Lucae S, Brueckl TM, Mueller MB, Fuchs B, Puetz B, Lieb R, Uhr M, Holsboer F, Mueller-Myhsok B, Keck ME. (2007) Association of a Met88Val diazepam binding inhibitor (DBI) gene polymorphism and anxiety disorders with panic attacks J Psychiatr Res 41(7), 579-84

TACGAACTCACTGTAAA ACTCACCTT[C/T]GCCAT AAGACCTTCTTCAACTA AGT ACAGAGTTTACGAACTC ACTGTAAAA[C/T]TCACC TTCGCCATAAGACCTTC TTC GGAGAGAAAACAAAGT CAATGGGGCA[C/T]GTG TGGGAAACCAGCCTGAC CTGTG TTACAGGGACTTCCAAG GAAGATGCC[A/G]TGAA AGCTTACATCAACAAAG TAGA

GABRA6

TTGGGAAAGGAGAGTCT GAAGGGACA[A/G]TGCA TGGTCGGAGAGCAGTG ACAAT AAATTGGAAATCTGTAA CGCAGCTTC[C/T]GTAAG CATGTGTGGGCAAAAA AGCA TTCTTTCCATCTGGCAC CTATTTATT[C/G]ACTAT TTATGCATTCGTTGAAT TAT CTCTTTCACCATTGACA AATATTTAT[G/T]GACGA CTTACTTTCTATGTAAG GTC

Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, Pericak-Vance MA. (2005) Identification of significant association and gene-gene interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 Uhart M, McCaul ME, Oswald LM, Choi L, Wand GS. (2004) GABRA6 gene polymorphism and an attenuated stress response Mol Psychiatry 9(11), 998-1006

Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, Pericak-Vance MA. (2005) Identification of significant association and gene-gene interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, Pericak-Vance MA. (2005) Identification of significant association and gene-gene interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788

119

Blum et al: Genes and Happiness GABRB3

MTHFR

MLXIPL (carbohydr ate binding element)

Hogart A, Nagarajan RP, Patzel KA, Yasui DH, Lasalle JM. (2007) 15q11-13 GABAA receptor genes are normally biallelically expressed in brain yet are subject to epigenetic CGTTCAGTTTAGTAAGCAAAGGCTTC[C/T]TGGCTTCTCTGGTGATGGGGTTTGT dysregulation in autism-spectrum disorders Hum Mol Genet 16(6), 691-703 AGCTTACCATTTAAGTA Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie GAACTGTTT[A/G]AGAT MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, GCTGGACATTCTAATAC Pericak-Vance MA. (2005) Identification of significant association and gene-gene AATC interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 CCAAATCTGAAATTTAC Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie TTGTCACTT[C/T]AGAGT MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, TGTCTTTGAACGGAAAG Pericak-Vance MA. (2005) Identification of significant association and gene-gene ATT interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 TCTGTTGAGTGATAATC Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie TTTCTCGCA[A/G]ATAAC MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, TCACAATATTTAAAAAT Pericak-Vance MA. (2005) Identification of significant association and gene-gene TGT interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 AAGAACTCTTCCATGAT Kim SA, Kim JH, Park M, Cho IH, Yoo HJ. (2006) Association of GABRB3 TGAAATGGT[A/C]GCAC polymorphisms with autism spectrum disorders in Korean trios Neuropsychobiology ATGGAATAACATCGATA 54(3), 160-5 AGTT ACAGCAGGTTGGAGCA CAGGGCCTAA[A/G]TGG GAGGCCAGGGAGGTGG GCAGAG

Kim SA, Kim JH, Park M, Cho IH, Yoo HJ. (2006) Association of GABRB3 polymorphisms with autism spectrum disorders in Korean trios Neuropsychobiology 54(3), 160-5

ATTGCTGATTTTCAGGC AAACTATGT[A/T]ACAT GGCTTTCAATGGGTGCT TGGC

Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, Pericak-Vance MA. (2005) Identification of significant association and gene-gene interaction of GABA receptor subunit genes in autism Am J Hum Genet. 77(3), 37788 Liu X, Zhao LJ, Liu YJ, Xiong DH, Recker RR, Deng HW. (2008) The MTHFR gene polymorphism is associated with lean body mass but not fat body mass Hum Genet. 123(2), 189-96

GAAGCAGTTAGTTCTGA CACCAACAA[A/G]TGGT GATAAGAGGTTGATAGC CTAG GTGGGGGGAGGAGCTG ACCAGTGAAG[A/C]AAG TGTCTTTGAAGTCTTTGT TCTT

Shi J, Gershon ES, Liu C. (2008) Genetic associations with schizophrenia: Metaanalyses of 12 candidate genes Schizophr Res 104(1-3), 96-107

CTTGAAGGAGAAGGTGT CTGCGGGAG[C/T]CGAT TTCATCATCACGCAGCT TTTC AGATGTTCCACCCCGGG CCTGGACCC[C/T]GAGC GGCATGAGA

Shi J, Gershon ES, Liu C. (2008) Genetic associations with schizophrenia: Metaanalyses of 12 candidate genes Schizophr Res 104(1-3), 96-107

GACAAAAAGCAATTGA GGTCCAGGAG[C/G]TGC CGCCCACCCGGCTCCTC CTCTG

Kooner JS, Chambers JC, Aguilar-Salinas CA, Hinds DA, Hyde CL, Warnes GR, Gomez Perez FJ, Frazer KA, Elliott P, Scott J, Milos PM, Cox DR, Thompson JF. (2008) Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides Nat Genet. 40(2), 149-51

CAGGTAACTGACCCTTC ACACATTTA[C/T]GGTGC CCATCTGACATTCATAG CAT

Liu X, Zhao LJ, Liu YJ, Xiong DH, Recker RR, Deng HW. (2008) The MTHFR gene polymorphism is associated with lean body mass but not fat body mass Hum Genet. 123(2), 189-96

Vrablik M, Ceska R, Adamkova V, Peasey A, Pikhart H, Kubinova R, Marmot M, Bobak M, Hubacek JA. (2008) MLXIPL variant in individuals with low and high trigylceridemia in white population in Central Europe Hum Genet. 124(5), 553-5 Wang J, Ban MR, Zou GY, Cao H, Lin T, Kennedy BA, Anand S, Yusuf S, Huff MW, Pollex RL, Hegele RA. (2008) Polygenic determinants of severe hypertriglyceridemia Hum Mol Genet. 17(18), 2894-9

120

Gene Therapy and Molecular Biology Vol 13, page 121 VEGF

GCGCGCGGGCGTGCGA GCAGCGAAAG[C/G]GAC AGGGGCAAAGTGAGTG ACCTGC AGACATGTCCCATTTGT GGGAACTGT[A/G]ACCC TTCCTGTGTGAGCTGGA GGCA AGACATGTCCCATTTGT GGGAACTGT[A/G]ACCC TTCCTGTGTGAGCTGGA GGCA ACATCCTGAGGTGTGTT CTCTTGGGC[C/T]TGGCA GGCATGGAGAGCTCTGG TTC AGCATTCCCGGGCGGGT GACCCAGCA[C/T]GGTC CCTCTTGGAATTGGATT CGCC ATCCTCTTCCTGCTCCCC TTCCTGGG[A/G]TGCAG CCTAAAAGGACCTATGT CCT

Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43 Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43 Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43 Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43 Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43 Harris SE, Fox H, Wright AF, Hayward C, Starr JM, Whalley LJ, Deary IJ. (2007) A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition BMC Genet. 8,43

Table 2: Hapiness genes GENE DRD2

ANNKI 5HT2A

OPRK1 (kappa –opioid receptor) OPRM1 (mu opioid receptorreceptor) COMT SLC6A3 HTR3B NOS3 PPARG

ASSOCIATIONS Alcoholism, Substance abuse, craving behavior, cocaine dependence, smoking, ADHD, parenting, Obesity, video gaming, sexual activity, posttraumatic stress disorder schizophrenia, Parkinson’s, brain metabolism, BMI, executive functioning, love styles (EROS) pathological gambling. Pathological aggression, schizoid/avoidant behavior, criminal activity, politics party attachment. Energy, hypertension. Hyperphagia, growth, sexual maturation, brain development, depression, anorexia, bulimia, fibromyalgia, pain sensitivity, hunger, novelty seeking, extraversion, early onset sexual intercourse, defense style (lying), oppositional defiant disorder, panic disorder, developmental personality, Tourette Syndrome, Parkinson’s, executive dysfunctioning, pleasure “buzz” Smoking dependence, parental rule-setting, Schizophrenia, cognition deficit, alcohol and opiate dependence, pleasurable “buzz”, Eating disorders, obesity, Insulin resistance, love styles (romantic), suicide, ADHD, Panic disorders, impulsive aggression, cognitive impulsivity, anger, sweet tooth, antidepressant treatment outcomes, fibromyalgia, obsessive-compulsive disorder, borderline personality, smoking behavior, cocaine dependence, BMI. Alcohol and heroin dependence. Pain mechanisms and tolerance.

Pleasure “buzz”, smoking addiction, heroin addiction, alcoholism, pain sensitivity, BMI, type 2 diabetes mellitus. Psychiatric and affective disorders, alcoholism, substance use disorder, smoking, post-surgical pain, fibromyalgia, Parkinson’s disease, ADHD. Post-surgical pain, cocaine abuse, alcohol dependence, smoking behavior, juvenile delinquency, pathological aggression, bipolar disorder, schizophrenia, ADHD, impulsive aggression, cognitive impulsivity. Heroin addiction, migraine, impulsive behavioral aggression, cognitive –impulsivity, ADHD, alcoholism. Pain mechanism, healing mechanisms, circulation, hypertension, cardiovascular. Type 2 diabetes, Obesity, Insulin sensitivity, Body composition, eating disorders, BMI, physical exercise, common metabolic disorders, body mass, waist circumference, inflammatory response, immune system.

121

Blum et al: Genes and Happiness CHREBP FTO TNFalpha PEMT MANEA LEPTIN-OB

MAO-A

ADIPOQ STS VDR DBI GABRA6 GABRB3 MTHFR MLXIPL (CARBOHYDRATE BINDING ELEMENT) VEGF DRD4

Plasma triglycerides, triglyceridemia, obesity ,,improves plasma glucose, Severe obesity, food intake, adiposity, body mass, energy intake, BMI, fat mass, pleasurable “buzz”. Inflammation, mortality, schizophrenia, bipolar disorder, BMI, Immune response. Proinflamamtory, immunoregulation, apotosis, substance use disorder. Substance dependence BMI, Schizophrenia, stress, obesity risk, food intake, craving behavior, diabetes, insulin sensitivity, adiposity, body composition, linear growth, metabolic factors, hyperphagia, cocaine dependence, lipogenesis, modulation of sweet substances, anorexia, bulimia, cardiovascular effects, fertility, sexual maturation, brain development, depression, fatty acid metabolism, hunger, Pain sensitivity, bipolar affective disorder, ADHD, alcoholism, Substance Use Disorder, violent behavior, juvenile delinquency, smoking, child abuse, suicide, criminal activity, posttraumatic stress disorder, antidepressant treatment response, alcoholism, panic disorder, schizophrenia, pathological gambling. Metabolic syndrome, adiposity, fat mass, energy intake, obesity, lipogenesis, type 2 diabetes, BMI. ADHD Obesity, BMI, overeating, metabolic syndrome, anthropometric measures, schizophrenia, temporal lobe epilepsy, immune system, type 2 diabetes, physical activity, BONE DENSITY (OSTEOPOROSIS). ANXIETY DISORDERS Autism, alcoholism, stress response. Autism, alcoholism, stress. Cardiovascular disease, Homocysteine levels, obesity, fat mass, Schizophrenia. Plasma triglycerides, glucose craving behavior, obesity.

CLOCK MELETONIN

Angiogenesis factor, cognition, tissue healing, pain sensitivity, oxidative stress. Financial risk taking, nicotine withdrawal, ADHD, novelty seeking, Alcoholism, aggression, impulsivity, delinquency, memory deficits, anger, temperament, schizophrenia, sexual intercourse, drug abuse, extraversion, obesity, stress, emotional reactivity, infant attachment, oppositional defiant disorder, fibromyalgia, hyperphagia, alcohol craving, pathological gambling, panic disorder, developmental personality, Tourette Syndrome, Parkinson’s. Antidepressant treatment outcome, Parkinson’s, ADHD, cocaine and methamphetamine dependence, spirituality “GOD Gene”. Circadian system, mood, bipolar, endocrine and metabolic rhythms, stress, reproduction, morphine dependence Sleep anxiety, alcoholism

OREXIN

Hyperphagis and energy regulation

VMAT2

122

Gene Therapy and Molecular Biology Vol 13, page 123

Figure 1: Five Generation of Dopaminergic Polymorphic genotyping in humans

Figure 2: Neurotransmitters and Happiness

123

Blum et al: Genes and Happiness

Figure 3: Neurotransmitters share emotional states leading to Happiness

Figure 4: Proposed Happiness Gene Map

124

Gene Therapy and Molecular Biology Vol 13, page 125

Figure 5: Schematic of genetic and environmental interactions leading to a reduction of â&#x20AC;&#x153;dopamine resistanceâ&#x20AC;? leading to a sdtate of Happiness

125

Blum et al: Genes and Happiness

Figure 6: Schematic of Psychological Wealth (Published with Diener & Deiner (2008) permission)

assess happiness in an individual (Diener and Seligman 2002). Happiness is a transient state, but there are those who exude the positive while others dwell on the negative. It is not so simple as just being genetically programmed or hard wired at birth (Eisenberg et al .2007). In essence, it is always the interaction of genes and environment that provides a Bayesian view of predictability (Blum et al 1996). With that said, our laboratory focused its attention to the exploration of potential genetic antecedents and nutrigenomic solutions to achieve “gene guided precision nutrition” of obesity, for example. As we stated earlier, solve the obesity epidemic (over 30% of US population) and this will increase wellness in an individual. Figure 5 provides a schematic that illustrates the various interactions involved in the ultimate release of Dopamine in the limbic system of the brain. We are cognizant that there may be other pathways involved in this very complex human trait. Moreover, an understanding of the dynamic relationships between the various pathways offers a potential new therapeutic paradigm on how to more effectively achieve optimal wellness; and this will better enable the improvement of cellular health, fat reduction, and overall improved body composition. In terms of wellness little is known about the genes that may regulate personality traits involved in the overall phenotype “well-being”. Weiss et al. (2008) used a representative sample of 973 twin pairs to test the hypothesis that heritable differences in subjective well being are entirely accounted for by the genetic architecture of the Five-Factor Model's personality domains. Results supported this model. Subjective well being was accounted for by unique genetic influences from Neuroticism, Extraversion, and Conscientiousness, and by a common genetic factor that

IX. Conclusions We merely have touched the surface of the complex relation between genes and happiness. We realize that over time many more gene polymorphisms will be tied to human emotions, including happiness. Table 2 and Figure 4 simply summarizes the current knowledge. Based on a number of social science studies, it is well established that the behavioral characteristic known as attachment is tied to happiness (Fowler and Schreiber, 2008). In their book, “Loneliness: Human Nature and the Need for Social Connection” (2008), modern day philosophers John T. Carioppo and William Patrick suggested that isolation can be harmful to your health, just as is smoking or a sedentary lifestyle. A large part of this effect is driven by the subjective sense of social isolation we call loneliness. New research shows that human beings are far more intertwined, hardwired, and interdependent physiologically as well as psychologically than our cultural prejudices have allowed us to acknowledge. “If you want to go fast,” says an African proverb, “go alone. If you want to go far, go together.” Furthermore, it seems that spirituality also may be important for happiness (Charlton, 2008). In the latter scenario, it would be important to assess “genospitituality” polymorphisms as in the case of adrenergic and dopaminergic genes (Nilsson et al. 2007, Comings et al. 2008, Hamer, 2004, Benjamin 1996) (see Table 1). Keeping this in mind, if we add the associations between a number of genes, metabolic syndrome X, and/or obesity, including aberrant carbohydrate craving behavior (Stice et al. 2008) as a constraint against free will, then this will add another important barrier to happiness (Chopra 2007). Certainly there is no simple winning formula to

126

Gene Therapy and Molecular Biology Vol 13, page 127 AMP levels by different human dopamine D4 receptor variants. Journal of Neurochemistry, 65, 1157-1165 Avena NM, Rada P, Hoebel BG. (2009). Sugar and fat bingeing have notable differences in addictive-like behavior. J Nutr, 139(3): 623-628. Benjamin J, Li L, Patterson C, Greenberg BD, Murphy DL, Hamer DH. (1996) Population and familial association between the D4 dopamine receptor gene and measures of Novelty Seeking.Nat Genet.12, 81-84 Blass EM. 2003 Biological and Environmental determinants of childhood obesity. Nutr Clin Care. 6, 13-19. Blum K, Calhoun W. Merritt W, Wallace JE. (1973) L-Dopa: effect on ethanol narcosis and brain amines in mice. Nature 242 : 407-409. Blum K, Chen TJ, Meshkin B, Downs BW, Gordon CA, Blum S, Mangucci JF, Braverman ER, Arcuri V, Deutsch R, Pons MM. (2008a) Genotrim, a DNA-customized nutrigenomic product, targets genetic factors of obesity: hypothesizing a dopamineglucose correlation demonstrating reward deficiency syndrome (RDS). Med Hypotheses 68, 844-852. Blum K, Chen AL, Chen TJ, Rhoades P, Prihoda TJ, Downs BW, Waite RL, Williams L, Braverman ER, Braverman D, Arcuri V, Kerner M, Blum SH, Palomo T.(2008b) LG839: anti-obesity effects and polymorphic gene correlates of reward deficiency syndrome. Adv Ther. 25, 894-913. Blum K , Chen TJH, Williams L, Chen ALC, Downs BW, Waite RL, Huntington T, Sims S, Prihoda t, Rhoads P, Reinking J, Braverman D, Kerner M, Blum SH, Quirk B, Braverman ER. ( 2008c) A short term pilot open label study to evaluate efficacy and safety of LG839, a customized DNA directed nutraceutical in obesity: Exploring Nutrigenomics. Geen Therapy & Mol Biol. 12, 371-382. Blum K, Chen ALC, Chen TJH, Rhoades P, Prihoda T, Downs BW, Baghi D, Bagch M,, Blum SH, Williams L, Braverman ER, Kerner M, Waite RL, Quirk B, White L. ( 2008d) Dopamine D2 Receptor Taq A1 allele predicts treatment compliance of LG839 in a subset analysis of a pilot study in the Netherlands. Gene Therapy & Mol Biol 12, 129-140. Blum K, Cull J G., Braverman ER, Comings DE.(1996) Reward Deficiency Syndrome. American Scientist 84, 132-145. Blum K and Braverman ER.(2000) Reward Deficiency Syndrome (RDS): A biogeneic model for the diagnosis and treatment of impulsive, addictive, compulsive behaviors. J. Psychoactive Drugs 32, supplement 1-112. Borg J., Andree B., Soderstrom H and Farde I.(2003) The serotonin system and spiritual experiences. Am J Psychiatry 160, 19651969. Braverman ER. (1987) The religious medical model: holy medicine and the Spiritual Behavior Inventory. South Med J 80,415- 425. Bruijnzeel AW, Repetto M, Gold MS. (2004). Neurobiological mechanisms in addictive and psychiatric disorders. Psychiatr Clin North Am 27(4): 661-674. Chang GO, Gaysinskaya V, Karatayev O , Leibowitz SF.2008 Maternal high –fat diet and fetal programming: increased proliferation of Hypothalmic pepetide-producing neurons that increase risk for overeating and obesity. J. Neurosci. 28, 1210712119. Charlton BG. (2008) Genospirituality: genetic engineering for spiritual and religious enhancement. Med Hypotheses 71:825828. Chen TJ, Blum K, Waite RL, Meshkin B, Schoolfield J, Downs BW, Braverman EE, Arcuri V, Varshavskiy M, Blum SH, Mengucci J, Reuben C, Palomo T. (2007a) Gene \Narcotic

influenced all five personality domains in the directions of low Neuroticism and high Extraversion, Openness, Agreeableness, and Conscientiousness. These findings indicate that subjective well being is linked to personality by common genes and that personality may form an "affective reserve" relevant to set-point maintenance and changes in set point over time. Other results also support a differentiated view of subjected well-being -health relations, and imply that both genes and environment play important roles in the associations between well being and health (Røysamb et. al. 2003). The Psychology of Wealth has been proposed by others (Diener and Diener 2008) and can be summarized best by Figure 6. While we are not suggesting that the percentage of the various portions of the pie represent a true and accurate value the depiction of the enterties that impact our life have real meaning. Finally it is very interesting that older cultures such as Bhutan, believe that enlightenment through multiple paths, including Mediatation, Yoga and Budhist spiritual teachings, lead the way to satistisfaction and ulfillment. In 1972 the then King of the country proclaimed that instead of measuring success by wealth or the “Gross National Product” it should be measured by “Gross National Happiness.” Through many incarnations one may become enlightened and reach the ultimate state of Nirvana. Buddha described nirvana as the perfect peace of the state of mind that is free from craving, anger and other afflictive states (kilesa). The subject is at peace with the world, has compassion for all and gives up obsessions and fixations. This peace is achieved when the existing volitional formations are pacified, and the conditions for the production of new ones are eradicated. In Nibbana the root causes of craving and aversion have been extinguished such that one is no longer subject to human suffering (dukkha) or further states of rebirths in samsara. With this in mind and being grateful for having this uplifting cultural mandate one could make a suggestion that NIRVANA is indeed an important acronym whereby it could be defined as “Neurotransmitter Interaction at Reward Ventral tegmental Accumbens leading to Neuronal Adaptation (NIRVANA)” Or Happiness.

Acknowledgements The authors would like to thank the editorial input of Margaret Madigan.

References Althaus M, Groen Y, Wijers AA, Mulder LJ, Minderaa RB, Kema IP, Dijck JD, Hartman CA, Hoekstra PJ. (2009). Differential effects of 5-HTTLPR and DRD2/ANKK1 polymorphisms on electrocortical measures of error and feedback processing in children. Clin Neurophysiol. 120:93-107. Aristole, (1996) in “Cambridge Texts in the History of Political Thought” S. Everson Ed. Cambridge Univ. Press, Cambridge. Asghari, V., Sanyal, S., Buchwaldt, S., Paterson, A., Jovanovic, V., & Van Tol, H. H. (1995). Modulation of intracellular cyclic

127

Blum et al: Genes and Happiness Attenuation Program attenuates substance use disorder, a clinical subtype of reward deficiency syndrome. Adv Ther. 24, 402-414. Chen TJH, Blum K, Kaats G, Braverman ER, Eisenberg A, Sherman M, Davis K, Comings DE, Wood R, Pullin D, Arcuri V, Varshavskiy M, Mengucci JF, Blum SH, Downs BW, Meshkin B, Waite RL, Williams L, Schoolfield J, White L (2007b) Chromium Picolinate (CrP) a putative anti-obesity nutrient induces changes in body composition as a function of Taq1 dopamine D2 receptor polymorphisms in a randomized double-blind placebo controlled study. Gene Ther Mol Biol 11, 161-170. Chopra D. (2006) Life After Death. Crown Publishing Group (a division of Randomhouse) New York. Cloninger CR, Svrakic DM, Przybeck TR (1993). A psychobiological model of temperament and character. Arch Gen Psychiatry 50, 975-990. Cohen MX, Schoene-Bake JC, Elger CE, Weber B.(2009) Connectivity-based segregation of the human striatum predicts personality characteristics.Nat Neurosci. 12, 32-34. Comings DE.(2003) In : Nature Encyclopedia of the Genome. MacMillan,. Comings DE.(2008) Did man create God? Hope Press, Duarte, California, Comings DE and Blum K. (2000) Reward Deficiency Syndrome: genetic aspects of behavioral disorders. In: Uylings,H.B.M. Van Eden , C.G. DeBruin, J.C.P. Feenstra, M.G. P. and Pennatz, C.M.A. Progress in Brain Res. Elsevier Science BV, Amsterdam. Comings DE, Gade-Andavolu R, Gonzalez N, Wu S, Muhleman D, Blake H, Mann MB, Dietz G, Saucier G, MacMurray JP.(2000) A multivariate analysis of 59 candidate genes in personality traits: the temperament and character inventory. Clin Genet. 58:375-385. Dackis CA, Gold MS. (1985). New concepts in cocaine addiction: the dopamine depletion hypothesis. Neurosci Biobehav Rev, 9(3): 469-477. Davis VE, Walsh MJ.(1970) Alcohol addiction and tetrahydropapaveroline. Science. 169:1105-1106. Davis CA, Levitan RD, Reid C, Carter JC, Kaplan AS, Patte AS, King N, Curtis C, Kennedy JL. (2009) Dopamine for Wanting” and Opioids for “Liking’: A comparison of Obese adults with and without Binge Eating”. Obesity (Silver Springs) (in press). Dawes CT and Fowler JH. (2008) Two Genes Predict Voter Turnout. Journal of Politics 70, 579–594 (July 2008)Diener E, Lucas RE, Scollon CN.( 2006)Beyond the hedonic treadmill: revising the adaptation theory of well-being. Am Psychol. 61, 305-314. Diener E, Seligman ME. (2002)Very happy people. Psychol Sci. 13, 81-84. Eisenberg DT, Campbell B, Mackillop J, Lum JK, Wilson DS. (2007) Season of birth and dopamine receptor gene associations with impulsivity, sensation seeking and reproductive behaviors. PLoS ONE. 2 : e1216. Emanuele E, Brondino N, Pesenti S, Re S, Geroldi D.(2007) Genetic loading on human loving styles. Neuro Endocrinol Lett.28:815-21. Fowler JH, Schreiber D. (2008) Biology, politics, and the emerging science of human nature. Science. 322: 912-914. Gearhardt AN, Corbin WR, Brownell KD.2009 Preliminary validation of the Yale Food Addiction Scale. Appetite 52:,439436.

Gold MS, Dackis CA. (1984). New insights and treatments: opiate withdrawal and cocaine addiction. Clin Ther., 7(1): 6-21. Gold MS, Kobeissy FH, Wang KK, Merlo LJ, Bruijnzeel AW, Krasnove IN, Cadet JL. (2009, Apr 2). Methamphetamine- and trauma-induced brain injuries: Comparative cellular and Molecular Neurobiological substrates. Bio Psych [ Epub ahead of print].Grimm JW, Osincup D, Wells B, Manaois M, Fyall A, Buse C, Harkness JH.2008 Environmental enrichment attenuates cue-induced reinforcement of sucrose seeking in rats. Behav Pharmacol., 19, 777-785. Guo G, Roettger ME, Shih JC. (2007) Contributions of the DAT1 and DRD2 genes to serious and violent delinquency among adolescents and young adults. Hum Genet. 121(1):125-136. Haeffel GJ, Getchell M, Koposov RA, Yrigollen CM, Deyoung CG, Klinteberg BA, Oreland L, Ruchkin VV, Grigorenko EL.(2008) Association between polymorphisms in the dopamine transporter gene and depression: evidence for a geneenvironment interaction in a sample of juvenile detainees. Psychol Sci.19, 62-69. Hamer D. (2004) The God Gene: How faith is hardwired in our genes. Doubleday, New York. Hodgkins CC, CaHill KS, Seraphine AE, Frost-Pineda K, Gold MS.2004 Adolescent drug addiction treatment and weight gain. JAddict Dis 23, 55-65. Hoebel BG, Avena NM, Borcarsly ME, Rada P. (2009). Natural Addiction: A behavioral and circuit model based on sugar addiction in rats. J Addict Med, 3(1): 33-41. Joranby L, Frost-Pineda K, Gold MS. (2005). Addiction to Food and Brain Reward Systems. Sex Addict Compuls, 12(2): 201217. Kirk KM, Eaves LJ, Martia NG. (1999) Self –transcendence as a measure of spirituality in a sample of older Australian twins. Twin Res. 2, 81-87. Kirk KM et al. (1999) Frequency of church attendance in Austrailia and the United Sates models of family resemblance. Twin Res. 2, 99-107. Kobeissy FH, Baker HV, Husty T, Krasnova I, Cadet JL, Gold MS. (2008). Genomic analysis of chronic methamphetamine abuse in rat striatum. The Society for Neuroscience 38th Annual Meeting, Washington DC, Krueger AB, Schkade D, Schwarz N, Stone AA. (2006)Would you be happier if you were richer? A focusing illusion. Science 312, 1908-910. Langer E.J. (1997) Mindfulness. Addison-Wesley, Reading, MA. Lykken DT.(2007) A more accurate estimate of heritability. Twin Res Hum Genet. 10:168-173. Musick M.A., Herzog A.R. and House J.S. (1999) Volunteering and mortality among older adults: findings from a national sampling. Journal Gerontol B Psychol Sci Soc Sci 54, S173180. Newberg A., D’Aquill E and Rause V. (2001) Why God Won’t go Away . Baltimore Books,New York. Nilsson KW, Damberg M, Ohrvik J, Leppert J, Lindström L, Anckarsäter H, Oreland L.(2007) Genes encoding for AP-2beta and the Serotonin Transporter are associated with the Personality Character Spiritual Acceptance. Neurosci Lett. 2007 411:233-237. North RJ, Holahan CJ, Moos RH, Cronkite RC.(2008) Family support, family income, and happiness: a 10-year perspective.J Fam Psychol. 22 , 475-483. Ozkaragoz T, Noble EP.(2000) Extraversion. Interaction between D2 dopamine receptor polymorphisms and parental alcoholism. Alcohol. 22, 139-146.

128

Gene Therapy and Molecular Biology Vol 13, page 129 Parducci A. (1995) Happiness , Pleasure ,and Judgment: The Contexual Theory and its Application. Lawrence Erlbaum Associates. Mahwah, New Jersey Hove, UK. Post S.G. (2005) Altrusim, happiness and health: it’s good to be good. Int J Behav Med.59, 66-77. Post SG, Puchalski CM, Larson DB.(2000) Physicians and patient spirituality: professional boundaries, competency, and ethics. Ann Intern Med. 132, 578-583. Rada P, Avena NM, Hoebel BG. 2005 Daily bingeing on sugar repeatedly releases dopamine in the accumbens. Neuroscience 134, 737-744. Rothman RB, Blough BE, Baumann MH. (2008) Dual dopamine/serotonin releasers: potential treatment agents for stimulant addiction. Exp Clin Psychopharmacol. 16, 458-474. Røysamb E, Tambs K, Reichborn-Kjennerud T, Neale MC, Harris JR.(2003) Happiness and health: environmental and genetic contributions to the relationship between subjective well-being, perceived health, and somatic illness.J Pers Soc Psychol. 85, 1136-46. Shultes R.E. Hoffman A. and Ratsch C. (1998) Plants of the Gods. Their Sacred Healing and Hallucinogenic Powers. Healing Arts Press, Rochester , NY. Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orrú M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR. (2007) Genome-wide association scan shows genetic variants in the FTO gene are associated with obesityrelated traits. PLoS Genet. 3, e115.

Serre l. Cantin F L . Ahmed SH.2007 Intense sweetness surpasses cocaine reward. Plos One 2 , e698. Seligman ME. (2002) How to see the glass half full. Newsweek. 140(12):48-49. Stark R.(2007) Discovering God: the origins of the great religions and the evolution of belief. London: Harper One. Stern C. (1973) Principles of Human Genetics. W.H. Freedman, San Fransico. Stice E, Spoor S, Bohon C, Small DM. (2008) Relation between obesity and blunted striatal response to food is moderated by TaqIA A1 allele. Science 322, 449-452. Sulmasy DP.(2006) Spiritual issues in the care of dying patients: ". . . it's okay between me and god".JAMA. 296,1385-1392. Thanos PK.et al.(2001) Overexpression of dopamine D2 receptor reduces alcohol –self-administration. J Neurochem 78, 10941103. Volkow ND, Wise RA. (2005). How can drug addiction help us understand obesity? Nat Neurosci, 8(5): 555-560. Wang G-J, Volkow ND, Thanos PK, Fowler JS. (2009) Imaging of Brain Dopamine Pathways: implications for understanding Obesity. J. Addict Medicine 3, 8-18. Weiss A, Bates TC, Luciano M. (2008) Happiness is a personality thing: the genetics of personality and well-being in a representative sample. Psychol Sci 19:205-210. Wenz FV. (1977) Neighborhood type, social disequilibrium, and happiness. Psychiatr Q. 49, 187-96.

129

Gene Therapy and Molecular Biology Vol 13, page 130!

Gene Ther Mol Biol Vol 13, 130-143, 2009

Signaling and epigenetic mechanisms regulating stem cells Review Article

Sangeetha Hareendran1, Salar Abbas1 and Prithi Rajan1, 2 * 1

Center for Stem Cell Research, Christian Medical College, Bagayam, Vellore 632 002, India Department of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037, USA __________________________________________________________________________________________ * Correspondence: Prithi Rajan, Center for Stem Cell Research, Christian Medical College, Bagayam, Vellore 632 002, India; 2

Phone: +91 416 2284115; Fax: +91 416 2284103; Email: prajan@cmcvellore.ac.in, prajan@scripps.edu Keywords: stem cells, embryonic, somatic, pluripotency, multipotency, and mechanisms Running Title: Mechanisms of pluripotency and multipotency

Received: 8 May 2009; Revised: 15 May 2009; Accepted: 18 May 2009; electronically published: 2 June 2009

Summary The enormous potential of stem cells in human therapeutics heightens the relevance of studies addressing the cellular mechanisms, which control their proliferation and fate choice decisions. While embryonic stem cells retain the ability to differentiate into most if not all the cell types of the adult, somatic stem cells retain a restricted potential to differentiate into most or all the mature cell types of the tissue that they are derived from. In this report we review the literature and concepts related to cytoplasmic and nuclear regulatory mechanisms, which confer the properties of pluripotency or multipotency on stem cells. The recent flurry of activity related to the induction of pluripotency in fibroblasts and other relatively mature cells has given us pause in considering the actual nature of the two extremes of terminal differentiation and 'stemness', and the apparent reversibility of both phenomena. An analysis of the current literature on mechanisms of pluripotency and multipotency could lead to a better understanding of the possibilities by which a cell may be maintained in a preferred state of differentiation or dedifferentiation at will.

differentiation into a mature fate. Intrinsic to this definition is the idea that the greater the potential of the cell to differentiate into various fates, the greater is its capacity to respond to various stimuli that could direct it to differentiate along particular lineages. This enhanced responsiveness in a stem cell could be due to the expression of a greater cohort of proteins enabling the cell to respond to various diverse stimuli, which gets culled down to a much more defined set of proteins as commitment occurs and the cell acquires the capacity to respond only to a specific set of stimuli. This reduction in global gene expression could be brought about by epigenetic modifications, which exert control of gene expression by regulating the accessibility of gene promoters through modifications to chromatin structure. Thus the signaling and epigenetic states of the stem/progenitor/mature cell define the context in which signals provided by the environment are received and interpreted, making the environment or 'niche' in which the cell is maintained yet another facet of this complex continuum. The recent observations relating to the induction of pluripotency in mature cells seem to complete the circle of the so-called continuum where given the correct set of stimuli 'mature' cells may be rendered seemingly pluripotent again.

I. Introduction While stem cells provide extremely interesting scientific platforms in which important questions in biology are being unraveled, they have achieved unparalleled notoriety because of the immense potential they present for human disease therapies. In this review we will attempt to highlight some of the mechanisms by which mammalian embryonic and somatic stem cells maintain their pluri- or multi-potential nature respectively. A concerted effort is being directed towards configuring methods for the differentiation of these cells to specific mature phenotypes. It is also of practical importance to determine the cellular pathways and mechanisms, which allow these cells to maintain their capacity to differentiate along a few to several lineages, depending on the pedigree of the stem cell in question. The processes of maintenance and differentiation of a stem cell may be considered a continuum wherein several individual and overlapping events define the status that the cell is in at any instant. The mechanisms dictating this continuum could be based on a constant crosstalk between competing or augmenting events (including signaling complexes in the cytoplasm and nucleus), the results of which become progressively more irreversible as the stem cell heads towards commitment and

130

Hareendran et al: Mechanisms of pluripotency and multipotency

Stem cells are generally defined by their dual properties of pluripotency/multipotency and self-renewal. Embryonic stem cells (ESCs) are derived from the inner cell mass of the blastocyst stage of a mammalian embryo (Evans MJ and Kaufman MH, 1981), and somatic stem cells (SSCs) are derived from various developing and mature tissues in which they are resident. While ESCs are pluripotent as defined by their property of multilineage differentiation into any cell type in the body, SSCs are generally more restricted in their potential and give rise to all or some of the cells characteristic of their tissue of origin, termed multipotency. An understanding of the intracellular signaling pathways involved in maintaining pluripotency of ESCs will help in the more effective utilisation of ESCs for cellular therapy and regenerative medicine as this could lead to the design of more reliable methods to establish ESC cultures. Also it would enable the development of better strategies for directed differentiation of ESCs to cell populations of our interest. In this review, we look into the various cellular molecules that are involved in controlling the self renewal and pluripotency of ESCs, which thereby facilitate ways to harness the therapeutic potential of ESCs in transplantation therapies and drug discovery (McNeish J, 2004). The ultimate effect of signaling and epigenetic interactions is realized at the level of gene expression, wherein distinct transcription factors and epigenetic modifications play critical roles in determining the gene expression profiles and other characteristic properties of ESCs (Boyer LA et al., 2005, Loh YH et al., 2006). Epigenetic mechanisms have been implicated in the regulation of gene activation and silencing at the level of transcription. They regulate the manner in which genomic DNA is packaged along with histones into chromatin. ESCs have a distinct gene expression profile as compared to differentiated cells, and have potential to activate all, or most, of the gene expression programs that are found in embryonic and adult cell lineages (Chambers I and Smith A, 2004). Transcriptional profiling studies have been performed to understand the molecular mechanisms of stemness and pluripotency of ESCs (Armstrong L et al., 2006, Ramalho-Santos M et al., 2002).

beneficial effects, potentially facilitating a means of bypassing the necessity of activating signaling pathways at the level of ligand/receptor interactions at the cell surface. One of the best established signaling mechanisms effecting pluripotency of murine ESCs (mESCs), acts through the janus associated tyrosine kinase (JAK), the direct target of which is the signal transducer and activator of transcription 3 (STAT3) protein. In mESCs, leukemia inhibitory factor (LIF) is indispensible for the self renewal and pluripotency, and mediates its effects via the JAKSTAT pathway (Smith AG et al., 1988). LIF belongs to the interleukin-6 cytokine family and binds to heterodimeric receptor, which includes LIF receptor ! and gp130, whereby it activates the pathway. LIF can also activate the mitogen activated protein kinase (MAPK) or ERK (Extracellular signal regulated kinase) pathway, which has an opposing role to STAT3, i.e., it promotes differentiation (Burdon T et al., 1999) in mESCs. Thus LIF can regulate pluripotency of mESCs by striking a balance between JAK-STAT3 and MAPK effects. However, it has been shown that the maintenance of pluripotency of human ESCs (hESCs) is STAT3 independent (Humphrey RK et al., 2004) and does not require the presence of LIF. Intriguingly, the expressionof LIF receptor and signaling subunit gp130 has been shown in human ESCs, along with LIF mediated phosphorylation of STAT3 and nuclear translocation. Despite these, LIF does not seem to have any significant role in human ESC pluripotency. LIF is known to function in murine embryonic diapause, i.e., the temporary arrest of blastocyst development. This facilitates multiple and repetitive pregnancies in lactating female mice. In addition, LIF acts as an anti-differentiation factor for cells of the inner cell mass in mouse development (Daheron L et al., 2004). Absence of such functions for LIF in human embryonic development could account for its lack of primary involvement in human ESC maintenance. However, the exact difference in the cellular context in which the LIF stimulus is received by mouse and human ESCs is unclear. Among the various transcription factors implicated with the regulation of self renewal and pluripotency of ESCs, most of the important ones have either a direct or indirect link to LIF/STAT3 pathway. Figure 1 summarizes some of these interactions. Of the transcription factors which induce pluripotency, the POU family transcription factor, Oct3/4, NK-2 class homeobox transcription factor Nanog and Sox2, member of SOX (SRY-related HMG box) family are the best characterized. Oct3/4 is a master regulator of pluripotency, which blocks the ESC differentiation towards trophoectoderm by interacting with Cdx2 to form a repressor complex (Niwa H et al., 2005). However, the overexpression of Oct3/4 in ESCs leads them to endoderm lineage (Niwa H et al., 2000). Sox2 plays a significant role in governing pluripotency of ESCs, by blocking their differentiation into multiple lineages, including trophoectoderm (Ivanova N et al., 2006). Sox2 acts in concert with Oct3/4 in activating the Oct3/4 target genes (Yuan H et al., 1995). The self renewal genes, c-Myc, Klf4 and Nanog serve as direct downstream targets of STAT3 protein (Cartwright P et al., 2005, Li Y et al.,

II. Some mechanisms of pluripotence in ESCs A. Cytoplasmic signaling and transcription factors ESCs are generated, maintained and used in culture. As a result most maintenance and differentiation protocols arise by the manipulation of the culture environment, which includes the addition of growth and differentiation factors and modification of the substratum and the gases in the culture milieu. Extensive effort is being directed towards understanding the intracellular signaling pathways which are activated downstream of these extracellular stimuli, and towards understanding the kinases and transcription factors which act as important modulators of the final outcome. The most successful of these studies permit the manipulation of specific intracellular intermediates, providing very specific and sometimes

131

Gene Therapy and Molecular Biology Vol 13, page 132!

2005, Suzuki A et al., 2006). c-Myc is a well characterized accelerator of cell cycle, which drives the G1-S transition by the transcriptional activation of cyclin E expression (Hooker CW and Hurlin PJ, 2006). JAK-STAT3 does not directly regulate Oct3/4 expression, however genes regulated by STAT3 have Oct3/4 binding sites (Rao M, 2004). The LIF/STAT3 pathway also targets the Nanog promoter region. Nanog is found to prevent ESC differentiation to Gata6 positive endoderm like cells (Mitsui K et al., 2003), block neuronal differentiation (Ying QL et al., 2003) and reverse mesoderm specification (Suzuki A et al., 2006) of ESCs. Recently it has been reported that Sall4 is another pivotal regulator of pluripotency in mouse ESCs. It forms a complex with Oct4, Sox2, Klf4 and c-Myc, the four genes which were employed in the generation of induced pluripotent stem cells (iPSC) from somatic cells (Takahashi K and Yamanaka S, 2006). Hence Sall4 is also implicated to be a key regulator for the cell reprogramming process, and is thought to be regulated by STAT3 at its promoter (Yang J et al., 2008). In contrast to mESCs, FGF2 (fibroblast growth factor) replaces LIF in hESCs, for the maintenance of their pluripotency. It acts by binding to FGF receptor (Ginis I et al., 2004, Sperger JM et al., 2003). In addition to its inherent tyrosine kinase activity, activated FGF receptor signals by phosphorylating the docking protein FRS2, which complexes with Grb2 proteins and the nucleotide exchange factor SOS. The FRS2-Grb2-SOS complexes inturn activate the Ras-Raf-MAPK signaling pathway. Apart from hESCs, it has been implicated as important for maintaining stemness of other tissue specific stem cells as

well. (Dvorak P et al, 2006). A model was proposed by Bendall and coworkers, suggesting that FGF 2 may crosstalk with IGF2 pathway, in maintaining hESC self renewal (Bendall SC et al., 2007). To further augment the role of FGF in ESC pluripotency, it has been shown that Activin/Nodal signaling through Smad2/3 maintains human ESCs in pluripotent state, where FGF2 acts as a competence factor (Vallier L et al., 2005). Inhibition of the FGF signaling via the FGFR1 tyrosine kinase, represses Oct3/4 expression, suppresses downstream kinases and drives ESCs into differentiation (Bendall SC et al., 2007, Dvorak P et al., 2005). FGF4, another member of the FGF family has been implicated in embryogenesis of mouse and is found to have restricted expression in undifferentiated ESC and embryonal carcinoma (EC) cell lines. Notably, Fgf4 gene is found to be a direct target of Oct3 and Sox2 (Yuan H et al., 1995). Members of TGF! (transforming growth factor) family of transcription factors, particularly TGF!, BMP (Bone morphogenetic proteins), Growth and differentiation factors (GDFs), Activin and Nodal are known to sustain self renewal and pluripotency of ESCs. TGF! signaling involves the binding of the ligand and activation of the Type II receptor, which is a serine/threonine kinase, which then activates the Type I receptor and that in turn phosphorylates Smad (mothers against decapentaplegic related) proteins which regulate targeted gene expression. BMP binds to receptor-regulated Smads (R-Smads: Smad1, Smad5 and Smad8) and activates them, which then form heteromeric complexes with Smad4.

Figure 1: Signals regulating pluripotency in mouse ESCs. The figure outlines some of the best-studied pathways regulating pluripotency. LIF acts through the JAK/STAT3 pathway to activate three important pluripotency factors, Nanog, Klf4 and c-Myc as shown. Further it can also channel into PI3K and SFK (Hck/Yes) pathways to promote pluripotency by activating Nanog and Oct3/4â&#x20AC;&#x201C;Sox2. PI3 K activation by ligands such as EGF, bFGF, PDGF and LIF facilitate mES proliferation, cell survival and self-renewal by promoting Nanog expression. Wnts act through !-Catenin and cause targeted activation of c-Myc, which is also involved in maintaining pluripotency. BMP4, a member of TGF! family, signals via Smad 1/5 to induce expression of Id genes, which inhibit differentiation of ES cells. BMP4 suppresses the blocking effects of the MAPK/ERK \pathway on mESC pluripotency. LIF appears to inhibit pluripotency by signaling via MAPK/ERK pathway and two other SFK members, Src/Fyn.

132

Hareendran et al: Mechanisms of pluripotency and multipotency

The Smad complexes translocate to the nucleus, and act as transcription factors. Bone morphogenetic protein 4 (BMP) is known to co-operate with LIF in maintaining the undifferentiated state of mESCs, in serum free conditions. BMP4 enhances the self renewal of mESCs by inducing the expression of members of Id (inhibitor of differentiation) gene family (Ying QL et al., 2003) and suppression of ERK signaling pathway in mESCs (Qi X et al., 2004). However in human ESCs, BMP4 induces mesodermal and ectodermal differentiation while BMP2 induces extraembryonic endoderm differentiation (Schuldiner M et al., 2000). TGF!/Activin/Nodal signaling promotes pluripotency of human ESCs along with Wnt signaling, especially in the earlier stages of cell fate determination (James D et al., 2005). Another major signal transduction pathway required for the self renewal of ESCs, particularly in mESCs, is the Wnt/ !-catenin/CBP pathway (Miyabayashi T et al., 2007). The cytoplasmic levels of !-catenin, an intermediate effector molecule of canonical Wnt pathway, is kept under control by a destruction complex, comprising of adenomatous polyposis coli gene (APC), Axin, and glycogen synthase kinase (GSK) 3!. Binding of Wnt to its receptors, Frizzled and LRP5/6 causes the inactivation of GSK3!, which results in the accumulation of !-catenin in the cytoplasm, and its nuclear translocation. Within the nucleus, it associates with transcription factors lymphoid enhancer factor (LEF)/Tcell factor (TCF). A pharmacological inhibitor of GSK3!, 6-bromoindirubin3â&#x20AC;&#x2122;-oxime (BIO), is reported to promote murine ESC pluripotency even in the absence of LIF (Sato N et al., 2004). Interestingly, BIO is also an effector of human ESC self renewal, and induces the expression of pluripotency markers, Oct3/4, Rex1, and Nanog. However the role of Wnt in maintenance of mESC pluripotency is a debatable issue as there is evidence that it promotes neural and mesodermal differentiation of ESCs (Yamaguchi TP et al., 1999). Wnt signaling is demonstrated to have a synergistic effect with LIF-STAT3 in maintenance of pluripotency of human and murine ESCs, as Wnt can upregulate STAT3 and also both Wnt and STAT3 tend to converge on c-Myc (Cartwright P et al., 2005, Sato N et al., 2004). Phosphoinositide 3- kinase/AKT signaling is required for efficient self renewal of murine ESCs, by facilitating proliferation and survival of ESCs. This is mediated partly by the ability of PI3K signaling to maintain the expression of Nanog, a transcription factor which is indispensible for the maintenance of pluripotency of ESCs (Welham MJ et al., 2007). PI3K /AKT signaling participates in maintaining ESC pluripotency, upon activation by growth factors like LIF, bFGF, EGF and PDGF (Jirmanova L et al., 2002, Xu C et al., 2005). Class 1A PI3 kinases upon activation, generate second messenger phosphatidylinositol-3, 4, 5-tris-phosphate (PIP3). Akt1, which is a serine/threonine kinase, binds to PIP3 and translocates to the inner cell membrane, where it is activated by another serine/threonine kinase, PDK1. Inhibition of PI3 kinase activity in mouse ESCs affects the cell cycle progression from G1 to S phase, causing decreased cell proliferation (Jirmanova L et al., 2002). The deletion of Pten, a negative regulator of PI3K triggers ESC

viability and proliferation (Sun H et al., 1999). Further it has been reported that artificial activation of AKT, can supplement the requirement of LIF, in governing pluripotency (Watanabe S et al., 2006). The Src family of cytoplasmic protein-tyrosine kinases (SFKs) are another class of kinases, which play distinct roles in ES self renewal and differentiation pathways. It has been reported that regulation of self renewal property of mESCs by LIF requires the activation of these kinases (Meyn MA, 3rd et al., 2005). With regard to the SFKs, of the 7 members which are expressed in ESCs, Hck and Yes promote self renewal in ESCs by way of down-regulating the expression of orphan nuclear receptor Gcnf, which is known to repress Oct3/4 expression and by increasing Nanog expression (Anneren C et al., 2004, Blake RA et al., 2000, Meyn MA, 3rd et al., 2005). Two other SFK members, Src and Fyn play conflicting roles by fostering ESC differentiation (Meyn MA, 3rd et al., 2005). Insulin like Growth Factor 1 Receptor (IGF1R), a tyrosine kinase, which is activated by IGF2 is relevant to hESC pluripotency (Bendall SC et al., 2007). The expression of IGF1R in hESCs correlates with the pluripotency markers Oct3/4, SSEA4 (Stage specific embryonic antigen4), TRA 1-60 (tumour recognition antigen 1-60) and TRA 1-81 expressions. The IGF2 pathway synergises with LIF to promote self renewal of rat ESCs (Takahashi A et al., 1995). The Stem Cell Factor (SCF) receptor cKit, a tyrosine kinase has been shown to participate in maintaining pluripotent state of mESCs (Lu M et al., 2007, Palmqvist L et al., 2005) and hence could be used as a possible marker for undifferentiated mESCs. The cKit expression is found to positively correlate with levels of pluripotent genes BMP4 and Nanog (Lu M et al., 2007). Expression of serine/threonine kinases, Pim-1 and Pim-3 is demonstrated to be upregulated by LIF/gp130dependent signaling and the STAT3 transcription factor and thus they may be participating in the control of self renewal of mESCs (Aksoy I et al., 2007). Other pathways including NF!B have also been implicated in ESC renewal; however we have restricted our discussion only to the better described signaling pathways.

B. Epigenetic factors Epigenetic regulation of the cellular genome includes post-translational modifications to the histones, DNA methylation of CpG nucleotides, and ATP-dependent chromatin remodeling. These events may be inherited along with the genomic sequence. Quantitative single cell in vivo imaging and biochemical analysis of endogenous proteins in undifferentiated mESCs have revealed that several major architectural histone proteins such as Histone 1 (H1), Histone 2b (H2B), Histone 3 (H3) and Histone P1 (HP1!) bind with less affinity to chromatin. This allows the chromatin to be more hyperdynamic in ESCs than in differentiated cells (Meshorer E and Misteli T, 2006) and remain open thus facilitating rapid genetic regulation, which may account for the pluripotency of mESCs. Heterochromatic DNA is highly methylated and condensed and not available for transcription, while

133

Gene Therapy and Molecular Biology Vol 13, page 134!

euchromatic DNA is lightly condensed and amenable for transcription. Heterochromatic markers have been shown to be dispersed in mESC whereas they occur as more concentrated distinct foci in differentiated cells. Two of the most significant heterochromatic markers are increased trimethylated lysine 9 H3 (TriMeK9 H3), and decreased acetylated histones H3 and H4 (AcH3 and AcH4) (Kimura H et al., 2004, Lee JH et al., 2004). Both these conditions, when global, cause gene repression. Differentiation leads to a decrease in the euchromatic nature of the chromosome making it more condensed and heterochromatic leading to loss of pluripotency. The histone modifications and the chromatin patterns can spread over kilobase lengths of genomic DNA, which are then faithfully transmitted to daughter cells to maintain pluripotency and stemness giving rise to the concept of epigenetic inheritance (Cavalli G and Paro R, 1999, Hall IM et al., 2002). Chromatin immunoprecipitation (ChIP) assays in mESCs have found large areas of chromosomes exhibiting methylation of Lysine 27 histone H3 (MeK27 H3) which represses transcription (Cao R and Zhang Y, 2004), alongside smaller regions of MeK4 H3 which is permissive for gene transcription (Bernstein BE et al., 2005, Schubeler D et al., 2004). These are present at highly conserved noncoding elements, which are associated with regions concentrated for genes encoding developmentally important transcription factors. These regions have been termed “bivalent” domains. They coincide with differentiation-associated transcription factor genes,

expressed at extremely low levels in the ESC. Thus it is proposed that they act not only to silence such genes in ESCs in order to maintain pluripotency, but also to allow them to remain in standby mode for transcription so that they can be rapidly activated upon differentiation. These changes in chromatin structure and its constituents at different stages of ESCs are brought about by several proteins. Some of these are discussed here very briefly (see Table 1, Figure 2). In mouse and human ESCs, Polycomb-Group (PcG) complex proteins mainly act to stabilize a repressive chromatin structure. PcG proteins comprise two functionally and biochemically distinct multimeric Polycomb repressive complexes called PRC1 and PRC2 (Levine SS et al., 2004). Polycomb repressive complex 2 (PRC2), which consists of EZH2, EED and SUZ12 in ESCs, functions as a histone methyltransferase that causes tri-methylation of lysine 27 (K27) of histone H3 (H3K27me3) (O'Carroll D et al., 2001). The complexes PRC1 and PRC2 co-occupy 512 genes, many of which encode transcription factors with important roles in development, indicating that repression of developmental pathways by Polycomb complexes may be required for maintaining ESC pluripotency and plasticity (Boyer LA et al., 2006, Lee TI et al., 2006). Histone demethylases participate in complex interactions which lead to up-regulation or downregulation of gene transcription. Among the histone demethylases, a member of the Jumonji protein family, JARID1, specifically catalyze the demethylation of H3K4me3 and H3K4me2 (Christensen J et al., 2007).

Table 1: Known epigenetic events in ESCs The table provides a brief review of epigenetic events, which have been shown to occur in ESCs. Epigenetic modifications 1) Histone modifications

Enzymes a) Methyltransferases Polycomb-Group (PcG) of proteins b) Histone demethylases Jarid1a

Jmjd1& Jmjd2c

2) DNA modifications

Modifications

Function

Reference

Trimehylation on H3K27me3

Transcriptional repression

O’Carroll, et al., 2001

Demethylation of H3K4me1/2

Transcriptional repression when complexed with PcG

Pasini, et al., 2007

Demethylation of H3K9me1 at Nanog promoter

Prevent transcriptional repression of Nanog

Loh, et al., 2007

c) Acetyltransferases p300

Binding at promoters of Oct4, Nanog

Transcriptional activation

Chen, et al., 2008 Jin & Zhong, 2009

d) Histone deacetylases Nucleosome Remodeling Deacetylase (NuRD) complexes

ATP-dependent chromatin remodeling and histone deacetylation

Entire complex required for deactylation which leads to repression

Kaji, et al., 2006

DNA methyl transferases Dnmt3a Dnmt3b

Methylation of cytosine of CpG islands in promoter regions

Transcriptional repression

Li, et al., 2007

134

Hareendran et al: Mechanisms of pluripotency and multipotency

The PRC2 complex recruits JARID1 to PcG target genes in order to enhance PcG mediated gene repression during ESC differentiation (Pasini D et al., 2008). Other reports suggest that JARID1b enhances ESC proliferation by a similar repressive effect (Dey BK et al., 2008). Jmjd1a and Jmjd2c, members of the Jumonji protein family, act in concert with the pluripotency factors Oct-4 and Nanog to regulate expression of genes that encode chromatinremodeling enzymes. Depletion of Jmjd1a results in cellular differentiation, decreased expression of the pluripotency factors like Tcl1, Tcfcp2l1, and Zfp57, and induction of lineage specific genes. JMJD2c is required to inhibit H3K9 methylation at the Nanog promoter and prevent the transcriptional repressors HP1 and KAP1 from binding to it (Loh YH et al., 2007). Histone acetyltransferases (HAT) and deacetylases (HDAC) also regulate ESC pluripotency. HAT, p300, was shown to be recruited to sites which bind multiple pluripotency factors including Nanog, Oct4, and Sox2 (Chen X et al., 2008). Epigenetic modification of histone acetylation at the distal regulatory region of Nanog was found to be dependent on the presence of p300 (Zhong X and Jin Y, 2009). It was shown that ESCs depleted of the HAT Tip60-p400 subunits, which are involved in Histone H4 acetylation, exhibit altered morphology and are impaired in their ability to self renew and fully differentiate (Fazzio TG et al., 2008). Components of the Nucleosome Remodeling Deacetylase (NuRD) complexes play important roles in gene regulation and are uniquely characterized by the possession of both ATP dependent chromatin remodeling and histone deacetylase properties.

Methyl DNA-binding protein MBD3, a component of NuRD, is shown to be required for pluripotency because ESCs lacking MBD3 exhibit a growth defect and cannot commit to developmental lineages (Kaji K et al., 2006). DNA methyltransferases (Dnmts) are a family of proteins involved in the establishment and maintenance of DNA methylation and are separated into two functional classes: the de novo and the maintenance methyltransferases. DNMT3a and DNMT3b are de novo methyltransferases responsible for remethylation in postimplantation mouse embryos and in germ cells (Okano M et al., 1999). The maintenance methyltransferase DNMT1 (Bestor T et al., 1988) is required for maintaining maternal and paternal methylation imprints in the early embryo. Inactivation of both Dnmt3a and Dnmt3b in mouse ESCs results in progressive loss of methylation in various repetitive sequences and single-copy genes. In embryonic stem cells, Dnmt3a and Dnmt3b are shown to be stably associated with each other (Li JY et al., 2007). These two enzymes directly interact and function to methylate the promoters of the Oct4 and Nanog genes. Inadequate methylation caused by ablating DNMT3a and DNMT3b is associated with dysregulated expression of Oct4 and Nanog during the differentiation of pluripotent cells and mouse embryonic development (Li JY et al., 2007). DNA methylation, induced by Dnmt3a and Dnmt3b, has also been shown to be important for the methylation of the Xlinked homeobox gene cluster Rhox in ESCs (Oda M et al., 2006).

Figure 2: Cytoplasmic and epigenetic signals regulating pluripotency in ESCs. The cartoon focuses on epigenetic events in ESCs. The chromatin in ESC is more euchromatic than heterochromatic in nature. In this schematic Oct4, Myc, Nanog genes, the markers of pluripotency, are represented within the nucleus of the ESC by the green (promoter region) and red (coding region) coloured DNA strand. Increased cellular levels of these transcription factors may regulate several events within the cell to promote pluripotency. They could regulate expression of themselves and other pluripotency markers, regulate other genes including epigenetic enzymes and miRNAs which promote pluripotency indirectly, and regulate the bivalent domains (such as ME K27 H3/MeK4H3) which would repress differentiation associated genes and increase expression of pluripotency genes. Gene repression is also achieved by modifications on histones such as methylation by the polycomb group of proteins (H3K27), and other methylation events on H3K9. These two modifications are represented in heterochromatic regions, which are not easily accessible to transcription. Transcription may be selectively enhanced by acetylation, which is brought about by acetyltransferases such as p300. DNA methylation also plays a very important role in maintaining pluripotency of ESCs. Hypomethylation at promoters of the pluripotency genes and methylation of promoters of developmentally important genes is the hallmark of ESCs. OCT4 levels in the cell may be increased either by cytoplasmic signals mediated by FGF2, Activin/Nodal, IGF2 and Wnts (largely shown in human ESCs), or by the introduction of these genes/proteins by transduction/transfection methods.

135

Gene Therapy and Molecular Biology Vol 13, page 136!

Although DNA methylation has been studied extensively, hypomethylation patterns cannot be designated as sole master switches for controlling gene expression and the maintenance of pluripotency in mESC. However, an increase in DNA methylation has been noted in selected CpG islands, in a few hESC lines during longterm passages (Allegrucci C et al., 2007). Comparison of promoter DNA methylation in mESCs with histone modifications, binding of transcription factors such as Oct4, Nanog, and polycomb group of proteins on gene promoters, has been performed to analyse if epigenetic regulators act independently or in concert with each other. Consequently, it was found that promoter DNA methylation is the only marker found on more than 30% of genes, many of which are silenced in mESCs (Meissner A et al., 2008). Genome-wide analysis of DNA methylation of promoters in mESCs and pMEFs (primary mouse embryonic fibroblasts) showed differences in methylation involving 69 gene promoters predicted to be hypomethylated in ESCs, and methylated in pMEFs (Farthing CR et al., 2008). These studies suggest that methylation patterns in ESCs may be distinctly different from differentiated somatic cells. Some of the interactions described in the above section are unique to ESCs and are possibly instrumental in maintaining the stem cell state. Of the cytoplasmic signals, the Activin/Nodal/FGF2 pathways are thought to maintain hESCs, while LIF/STAT3 is necessary for mESCs. Epigenetically the repression of gene promoters related to differentiation in spite of the chromosomes being largely euchromatic seems to be a characteristic. This along with expression of relatively high levels of proteins related to pluripotence including Oct4, c-Myc and Nanog are hallmarks of the undifferentiated state of ESCs.

might contribute to the multipotentiality of SSCs, they might include maintenance of quiescence, which could promote the maintenance of a stable stem-like phenotype in a mature tissue, cell proliferation, cell survival, and inhibition of commitment and differentiation. The niche that SSCs reside in is largely comprised of some relevant cell types native to the region and their intrinsic and secreted principles, the blood vessels which carry soluble factors, and the extra cellular matrix which possibly contains immobilized cues (Alvarez-Buylla A and Lim DA, 2004, Kiel MJ and Morrison SJ, 2008). While there is a possibility that there are two niches for HSCs, one osteoblastic and the other vascular, it is also possible that these two niches actually serve to maintain distinct functions of the HSCs during its life as a stem cell. The osteoblastic niche may serve to maintain the cell at its peak of quiescence, while the vascular niches might play a greater role during proliferation and mobilization of these cells as and when required. The Tie-2 receptor along with its ligand angiopoietin is thought to be one of the major regulators of quiescence of HSCs (Arai F and Suda T, 2007, Fukuhara S et al., 2008). This receptor has intrinsic tyrosine kinase activity and functions through the PI3kinase pathway to maintain p21 levels thus maintaining quiescence. Osteopontin also serves to inhibit differentiation in the niche (Nilsson SK et al., 2005, Stier S et al., 2005). The mammalian target of rapamycin (mTOR) pathway could mediate HSC quiescence and maintenance by regulating reactive oxygen species (Chen C et al., 2008). Wnt and Jagged are expressed on osteoblasts and react with their respective receptors Frizzled and Notch on HSCs and are involved in controlling the maintenance of HSCs (Fleming HE et al., 2008, Li L et al., 1998). Interestingly Notch 1 is downregulated in HSCs lacking Smad 4, which could be a possible mechanism by which smad4 is one of the factors involved in the maintenance and self-renewal of HSCs (Karlsson G et al., 2007). The calcium calmodulin dependent kinase (CaM Kinase) present in HSCs appears to participate in their maintenance by regulating bcl-2 levels through phosphorylation of CREB and CBP (Kitsos CM et al., 2005). Other molecules which regulate the niche include sonic hedgehog (Shh), CXCR4/CXCL12, and SCF/c-Kit (Kiel MJ and Morrison SJ, 2008). While the NSC niche is in the process of being defined (Riquelme PA et al., 2008), the molecules that seem to be required for maintaining a pool of stem cells include Shh, Notch, Wnt, and FGF. GFAP positive neural stem cells were reduced in the sub-ventricular zone of Gli deficient animals, suggesting that Shh regulated the number of stem cells in vivo. In addition, the number of dividing cells as determined by BrdU staining, was also decreased (Palma V and Ruiz i Altaba A, 2004). Basic FGF (bFGF) is sufficient as a mitogen in monolayer cultures of NSCs, and is used in combination with EGF for neurosphere cultures (Johe KK et al., 1996, Reynolds BA and Weiss S, 1996). Both signal through the Ras/MAPK pathway, although EGF activates several other pathways in these cells including PI3kinase. In addition to these growth factor mediated effects, the polycomb protein Bmi1 is thought to function in the regulation of both the

III. Lessons from somatic stem cells Unlike embryonic stem cells, somatic stem cells are restricted in their potential and reside in tissues of developing or mature organs. Among the best studied of the SSCs are hematopoietic stem cells (HSCs), neural stem cells (NSCs), and mesenchymal stem cells (MSCs). While HSCs reside in bone marrow NSCs as the name suggests, reside largely in the nervous system. Stem cells may also be identified in other tissues including epidermis, intestine, breast, and retinal tissue, and potentially in muscle and pancreas. As discussed in the previous section ESCs retain the potential to differentiate into most, if not all, the tissues which constitute the adult organism, hence pluripotent. SSCs on the other hand are multipotent and have restricted differentiation potential. They usually retain the capacity to differentiate into some, or all, of the cell types, which constitute the tissue that they reside within. Typically they reside in 'niches' within the tissue which provide the necessary environment to maintain a regulated number of stem cells in a state of quiescence, and which can be effectively mobilized when appropriately stimulated. Unraveling the factors and mechanisms which maintain niches will allow us to configure appropriate culture conditions and further the practical use of these cells. When one considers the various biological events, which 136

Hareendran et al: Mechanisms of pluripotency and multipotency

HSC and NSC population in the adult (Molofsky AV et al., 2003, Park IK et al., 2003). Recently Wnts have been shown to be relevant to the self renewal of stem cells in the brain (Kalani MY et al., 2008). Notch could mediate possible density-related effects in NSC cultures (Kamakura S et al., 2004), while both Notch and BMPs cause differentiation effects, the latter of which are rather complex and yield three fates depending on the culture conditions: neurons, glia and smooth muscle (Rajan P et al., 2003). Manipulation of differentiation signals could also promote the maintenance of multipotency. Signals which activate neurogenin appear to cause neuronal fate choice, while we and others have shown that the activation of STAT3 is required for glial differentiation (Bonni A et al., 1997, Rajan P and McKay RD, 1998, Sun Y et al., 2001). Activation of STAT3, and glial differentiation, could be brought about by JAK downstream of CNTF/LIF, mTOR downstream of BMP, and possibly MAPK downstream of CNTF and EGF. Other studies have shown that p300 works cooperatively with STAT3 and Smad to cause glial differentiation under BMP treatment (Nakashima K et al., 1999). While several of the signaling studies have been performed on rodent systems for ease of work, some of these have been verified in human cells, particularly when there is relevance to cancer. Some of these pathways and their interactions have been recently reviewed (Rajan P and Snyder E, 2009). MSCs were originally isolated and cultured from bone marrow, and are fibroblastic cells which have the potential for differentiation into adipocytic, chondrocytic and osteoblastic lineages, and also into muscle and tendons (Pittenger MF et al., 1999). MSC-like cells have subsequently been cultured from adipose tissue, umbilical cord, Wharton's jelly and placenta. They are arguably the stem cells which are the easiest to culture and manipulate, and several cell surface markers are used in the characterization of these cells (Majumdar MK et al., 1998). Stro1 is sometimes used as a prospective marker for these cells, although it is not unique to them, and recently other markers have been suggested for MSCs (Roche S et al., 2009, Simmons PJ et al., 1994). Although serum is the most commonly used culture additive, bFGF, LIF, HGF, Wnt, EGF and PDGF contribute to the maintenance of MSCs (Kolf CM et al., 2007). Alternative approaches are yielding some windows into the complex methods, which are operational in SSCs and stem cells in general. Systems biology has proved to be an excellent tool for generating hypotheses relating to molecules which may be associated with, or characteristic of, a particular fate or event (Muller FJ et al., 2008, UlloaMontoya F et al., 2007). Some such studies have implicated molecules such as Gata2 as being instrumental in de-differentiation of mature somatic cells into a SSC like state (Huang TS et al., 2008). Other molecules which are associated with the somatic stem cell state include Angiopoietin1, Kit, Sox9, Timp3, and several genes which are also present in ESCs (Forsberg EC et al., 2005, Huang TS et al., 2008). Creative methods to activate specific receptor and downstream kinases have yielded interesting insights. Dimerisation of the thrombopoietin receptor,

mpl1, by an artificial crosslinking method causes HSCs to proliferate for appreciable longer periods than is achieved in culture with known means, and certainly more than is obtained with receptor dimerisation with the natural ligand (Abdel-Azim H et al., 2008). The factors and active principles which maintain other stem cells including epidermal, intestinal and breast are in the process of being defined (Blanpain C and Fuchs E, 2009, Sato T et al., 2009, Scoville DH et al., 2008). Recently transcription factors such as Achaete-Scute have been implicated in intestinal stem cell maintenance (van der Flier LG et al., 2009). While Oct 4, Nanog, Sox2, and other genes are largely associated with the pluripotent state of ESCs, they have also been seen to be expressed in NSCs, MSCs and HSCs to varying degrees. One study showed that the lack of Oct4 does not compromise the maintenance of somatic stem cells (Lengner CJ et al., 2007, Lengner CJ et al., 2008), while others showed that the suppression of Oct4 is a step in the generation of a NSC like cell from ESCs (Akamatsu W et al., 2009). Sox2 is a marker for NSCs and is thought to regulate the proliferation and maintenance of NSCs, and their differentiation into neurons (Episkopou V, 2005). Thus, to recapitulate the above discussion of SSCs, the developmentally important molecules Shh, Notch, Wnt/b catenin, and the BMP family of receptors/ligands are important for maintaining self-renewal and the multipotency phenotype. In the case of NSCs and MSCs extensive culture work has revealed several soluble growth factors, which may be used to manipulate the stem-like, and differentiation end points. Due to limitations in the culture methods of HSCs the bulk of the experimental work is performed in in vivo models.

IV. Conclusions and projections A circumspect study of the signals which mediate pluripotency and multipotency in ESCs and HSCs respectively could permit the design of reagents and protocols which will result in the stable differentiation of SSCs and mature cells from ESCs, and perhaps all other desired combinations. Figure 1 and Figure 2 summarize some of our thoughts on the salient cellular signals and events, which maintain the pluripotent state of mouse and human ESCs. It has recently been possible to dedifferentiate cells which are thought to be of mature origin to cells which are reminiscent of ESCs by the induced expression of the transcription factors Oct4, Myc and Klf4 in combination with other transcription factors. It is possible that other procedures could use signaling intermediates and activated cytoplasmic and nuclear proteins. The relatively recent progress in the creation of induced pluripotent stem cells (iPSCs) (Takahashi K et al., 2007, Takahashi K and Yamanaka S, 2006), and to a lesser extent nuclear reprogramming by cell fusion (Cowan CA et al., 2005), has challenged several of our notions regarding pluripotent, differentiating and mature differentiated states. It appears from the cell fusion studies that principles present in the cytoplasm of the ESC can reprogram the mature differentiated nucleus into an 137

Gene Therapy and Molecular Biology Vol 13, page 138!

undifferentiated 'pluripotent' one (Cowan CA et al., 2005). The surprising observation that the simple overexpression of about four genes, which are usually expressed in ESCs, has the capacity to reprogram a 'mature' cell has elicited great interest. The genes usually used for the induction of pluripotency are Oct4, Klf4, Sox2 and Myc, in the absence or presence of other genes such as Large-T and Nanog (Park IH et al., 2008, Yu J et al., 2007). The frequency with which iPS occurs is low, and it must be mentioned that the exact nature of the 'mature' cell which is being dedifferentiated is not entirely clear. iPS seems to be much more efficient when performed in cells which are more stem-like than mature (Aasen T et al., 2008). Several refinements are now being rapidly reported where iPSCs are being generated with varying efficiencies using small molecules (Shi Y et al., 2008), micro RNAs (Judson RL et al., 2009), protein transductions (Zhou H et al., 2009), plasmid transfections (Okita K et al., 2008), adenoviral vectors (Stadtfeld M et al., 2008), transposons (Woltjen K et al., 2009) and other cell signaling manipulations (Feng B et al., 2009) instead of the original retro/lentiviral transductions. HDAC inhibitors such as valproate have been shown to greatly increase the efficiency of iPSC generation even with just 2 of the original reprogramming genes (Huangfu D et al., 2008), suggesting the involvement of epigenetic modifications in the regulation and/or maintenance of pluripotence. Lluis et al have shown that cyclic activation of Wnt/! catenin signaling can enhance the reprogramming of somatic cells upon fusion with ESCs, whereby the differentiated cells undergo the process of dedifferentiation (Lluis F et al., 2008). These supposedly 'safer' methods of generation could be an advance to potentially using these cells in autologous and allogeneic cellular transplantation therapies, as they are not induced to pluripotence with the aid of lentiviruses. While the promise of these cells in regenerative medicine still remains to be realized, their power in the establishment of in vitro models of disease and in screening models is obvious. While the initial stimulus for iPSC formation is the forced expression of Oct4, Myc, Klf4, and other selected genes, the eventual transformation of the cell to its stemlike state is due to reprogramming of the nuclear architecture such that the cell starts to express endogenous Oct4, Myc, Nanog, etc. The exact mechanism by which Oct4, Myc, etc. brings about these epigenetic modifications to the cell, such that it is reprogrammed, is under study (Figure 2). While it has been recently possible to de-differentiate cells which are thought to be of mature origin to cells which are reminiscent of ESCs, the conversion of mature cells to SSCs remains to be achieved (Figure 3). One may also use the knowledge reviewed here to stably cause the differentiation of an ESC to an HSC or NSC (Bajpai R et al., 2009, Matsumoto K et al., 2009). This has been achieved by the selective addition of various growth factors and manipulation of tissue culture conditions. It may also be achieved by other more direct means including the manipulation of levels and interactions of specific transcription factors (as implied in the Gata2 study (Huang TS et al., 2008), or by directing the epigenetic modification of specific promoters to

achieve the MSC, NSC or a pre-insulin producing "-cell state. Such manipulations would be of immense use in regenerative medicine, perhaps in the generation of specific cell types for regenerative medicine and for the generation of in vitro experimental models. The recent literature would appear to suggest that differentiation of cells towards the mature end phenotype is not a one way phenomenon, and that the appropriate stimuli will cause ESCs, SSCs and mature differentiated cells to flip between states (Figure 3). As a case in point, iPSCs derived from skin fibroblasts have been differentiated into cells of the central nervous system (Dimos JT et al., 2008). While all these experiments have been performed in vitro, the possibilities of these types of dynamic shifts in a general sense, and in vivo, remain to be detected. The idea represented in Figure 3 begs the question of whether the fully differentiated status of mature cellular phenotypes is actively maintained in the adult organism, as are stem cells.

Figure 3: Are all cells in a dynamic equilibrium with respect to their 'fate choice' decisions? The current status of ESC generation and differentiation suggests that ESCs, SSCs and mature differentiated cells may be interconvertible given the correct stimuli. Somatic stem cells such as neural stem cells and keratinocyte precursors have been used successfully for iPSC generation. Mouse embryo fibroblast cultures, which are used for iPSC generation, are a heterogeneous population of cells, which may well contain MSC like cells. Adult fibroblasts and blood have also been used with varying levels of success for iPSC. By all recognizable criteria, iPSCs closely resemble ESCs. ESCs have been differentiated into NSC and HSCs. Of the other options possible in the continuum shown in the figure, ESCs and SSCs have been differentiated into the several types of mature cells. The successful de-differentiation of mature cells into their respective SSCs could be possible if the correct cohort of cytoplasmic, nuclear, and epigenetic signals were expressed in sufficient quantities, and with correct timing.

138

Hareendran et al: Mechanisms of pluripotency and multipotency

Bestor T, Laudano A, Mattaliano R, and Ingram V (1988) Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. The carboxyl-terminal domain of the mammalian enzymes is related to bacterial restriction methyltransferases. J Mol Biol 203(4), 971-983. Blake RA, Broome MA, Liu X, Wu J, Gishizky M, Sun L, and Courtneidge SA (2000) SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling. Mol Cell Biol 20(23), 9018-9027. Blanpain C, and Fuchs E (2009) Epidermal homeostasis: a balancing act of stem cells in the skin. Nat Rev Mol Cell Biol 10(3), 207-217. Bonni A, Sun Y, Nadal-Vicens M, Bhatt A, Frank DA, Rozovsky I, Stahl N, Yancopoulos GD, and Greenberg ME (1997) Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway. Science 278(5337), 477483. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar RM, Murray HL, Jenner RG, Gifford DK, Melton DA, Jaenisch R, and Young RA (2005) Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122(6), 947-956. Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Tajonar A, Ray MK, Bell GW, Otte AP, Vidal M, Gifford DK, Young RA, and Jaenisch R (2006) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441(7091), 349-353. Burdon T, Stracey C, Chambers I, Nichols J, and Smith A (1999) Suppression of SHP-2 and ERK signalling promotes selfrenewal of mouse embryonic stem cells. Dev Biol 210(1), 30-43. Cao R, and Zhang Y (2004) The functions of E(Z)/EZH2mediated methylation of lysine 27 in histone H3. Curr Opin Genet Dev 14(2), 155-164. Cartwright P, McLean C, Sheppard A, Rivett D, Jones K, and Dalton S (2005) LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132(5), 885-896. Cavalli G, and Paro R (1999) Epigenetic inheritance of active chromatin after removal of the main transactivator. Science 286(5441), 955-958. Chambers I, and Smith A (2004) Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene 23(43), 7150-7160. Chen C, Liu Y, Liu R, Ikenoue T, Guan KL, Liu Y, and Zheng P (2008) TSC-mTOR maintains quiescence and function of hematopoietic stem cells by repressing mitochondrial biogenesis and reactive oxygen species. J Exp Med 205(10), 2397-2408. Chen X, Xu H, Yuan P, Fang F, Huss M, Vega VB, Wong E, Orlov YL, Zhang W, Jiang J, Loh YH, Yeo HC, Yeo ZX, Narang V, Govindarajan KR, Leong B, Shahab A, Ruan Y, Bourque G, Sung WK, Clarke ND, Wei CL, and Ng HH (2008) Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell 133(6), 1106-1117. Christensen J, Agger K, Cloos PA, Pasini D, Rose S, Sennels L, Rappsilber J, Hansen KH, Salcini AE, and Helin K (2007) RBP2 belongs to a family of demethylases, specific for tri-and dimethylated lysine 4 on histone 3. Cell 128(6), 10631076. Cowan CA, Atienza J, Melton DA, and Eggan K (2005) Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science 309(5739), 1369-1373. Daheron L, Opitz SL, Zaehres H, Lensch MW, Andrews PW, Itskovitz-Eldor J, and Daley GQ (2004) LIF/STAT3 signaling fails to maintain self-renewal of human embryonic stem cells. Stem Cells 22(5), 770-778.

Acknowledgements We gratefully acknowledge the financial support of the Department of Biotechnology of the Ministry of Science and Technology, India. We thank Dr. R.V. Shaji for commenting on the manuscript.

References Aasen T, Raya A, Barrero MJ, Garreta E, Consiglio A, Gonzalez F, Vassena R, Bilic J, Pekarik V, Tiscornia G, Edel M, Boue S, and Belmonte JC (2008) Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat Biotechnol 26(11), 1276-1284. Abdel-Azim H, Zhu Y, Hollis R, Wang X, Ge S, Hao QL, Smbatyan G, Kohn DB, Rosol M, and Crooks GM (2008) Expansion of multipotent and lymphoid-committed human progenitors through intracellular dimerization of Mpl. Blood 111(8), 4064-4074. Akamatsu W, DeVeale B, Okano H, Cooney AJ, and van der Kooy D (2009) Suppression of Oct4 by germ cell nuclear factor restricts pluripotency and promotes neural stem cell development in the early neural lineage. J Neurosci 29(7), 21132124. Aksoy I, Sakabedoyan C, Bourillot PY, Malashicheva AB, Mancip J, Knoblauch K, Afanassieff M, and Savatier P (2007) Self-renewal of murine embryonic stem cells is supported by the serine/threonine kinases Pim-1 and Pim-3. Stem Cells 25(12), 2996-3004. Allegrucci C, Wu YZ, Thurston A, Denning CN, Priddle H, Mummery CL, Ward-van Oostwaard D, Andrews PW, Stojkovic M, Smith N, Parkin T, Jones ME, Warren G, Yu L, Brena RM, Plass C, and Young LE (2007) Restriction landmark genome scanning identifies culture-induced DNA methylation instability in the human embryonic stem cell epigenome. Hum Mol Genet 16(10), 1253-1268. Alvarez-Buylla A, and Lim DA (2004) For the long run: maintaining germinal niches in the adult brain. Neuron 41(5), 683-686. Anneren C, Cowan CA, and Melton DA (2004) The Src family of tyrosine kinases is important for embryonic stem cell self-renewal. J Biol Chem 279(30), 31590-31598. Arai F, and Suda T (2007) Maintenance of quiescent hematopoietic stem cells in the osteoblastic niche. Ann N Y Acad Sci 110641-53. Armstrong L, Hughes O, Yung S, Hyslop L, Stewart R, Wappler I, Peters H, Walter T, Stojkovic P, Evans J, Stojkovic M, and Lako M (2006) The role of PI3K/AKT, MAPK/ERK and NFkappabeta signalling in the maintenance of human embryonic stem cell pluripotency and viability highlighted by transcriptional profiling and functional analysis. Hum Mol Genet 15(11), 18941913. Bajpai R, Coppola G, Kaul M, Talantova M, Cimadamore F, Nilbratt M, Geschwind DH, Lipton SA, and Terskikh AV (2009) Molecular stages of rapid and uniform neuralization of human embryonic stem cells. Cell Death Differ. Bendall SC, Stewart MH, Menendez P, George D, Vijayaragavan K, Werbowetski-Ogilvie T, Ramos-Mejia V, Rouleau A, Yang J, Bosse M, Lajoie G, and Bhatia M (2007) IGF and FGF cooperatively establish the regulatory stem cell niche of pluripotent human cells in vitro. Nature 448(7157), 1015-1021. Bernstein BE, Kamal M, Lindblad-Toh K, Bekiranov S, Bailey DK, Huebert DJ, McMahon S, Karlsson EK, Kulbokas EJ, 3rd, Gingeras TR, Schreiber SL, and Lander ES (2005) Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120(2), 169-181.

139

Gene Therapy and Molecular Biology Vol 13, page 140!

Dey BK, Stalker L, Schnerch A, Bhatia M, TaylorPapidimitriou J, and Wynder C (2008) The histone demethylase KDM5b/JARID1b plays a role in cell fate decisions by blocking terminal differentiation. Mol Cell Biol 28(17), 5312-5327. Dimos JT, Rodolfa KT, Niakan KK, Weisenthal LM, Mitsumoto H, Chung W, Croft GF, Saphier G, Leibel R, Goland R, Wichterle H, Henderson CE, and Eggan K (2008) Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321(5893), 12181221. Dvorak P, Dvorakova D, and Hampl A (2006) Fibroblast growth factor signaling in embryonic and cancer stem cells. FEBS Lett 580(12), 2869-2874. Dvorak P, Dvorakova D, Koskova S, Vodinska M, Najvirtova M, Krekac D, and Hampl A (2005) Expression and potential role of fibroblast growth factor 2 and its receptors in human embryonic stem cells. Stem Cells 23(8), 1200-1211. Episkopou V (2005) SOX2 functions in adult neural stem cells. Trends Neurosci 28(5), 219-221. Evans MJ, and Kaufman MH (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292(5819), 154-156. Farthing CR, Ficz G, Ng RK, Chan CF, Andrews S, Dean W, Hemberger M, and Reik W (2008) Global mapping of DNA methylation in mouse promoters reveals epigenetic reprogramming of pluripotency genes. PLoS Genet 4(6), e1000116. Fazzio TG, Huff JT, and Panning B (2008) An RNAi screen of chromatin proteins identifies Tip60-p400 as a regulator of embryonic stem cell identity. Cell 134(1), 162-174. Feng B, Jiang J, Kraus P, Ng JH, Heng JC, Chan YS, Yaw LP, Zhang W, Loh YH, Han J, Vega VB, Cacheux-Rataboul V, Lim B, Lufkin T, and Ng HH (2009) Reprogramming of fibroblasts into induced pluripotent stem cells with orphan nuclear receptor Esrrb. Nat Cell Biol 11(2), 197-203. Fleming HE, Janzen V, Lo Celso C, Guo J, Leahy KM, Kronenberg HM, and Scadden DT (2008) Wnt signaling in the niche enforces hematopoietic stem cell quiescence and is necessary to preserve self-renewal in vivo. Cell Stem Cell 2(3), 274-283. Forsberg EC, Prohaska SS, Katzman S, Heffner GC, Stuart JM, and Weissman IL (2005) Differential expression of novel potential regulators in hematopoietic stem cells. PLoS Genet 1(3), e28. Fukuhara S, Sako K, Minami T, Noda K, Kim HZ, Kodama T, Shibuya M, Takakura N, Koh GY, and Mochizuki N (2008) Differential function of Tie2 at cell-cell contacts and cellsubstratum contacts regulated by angiopoietin-1. Nat Cell Biol 10(5), 513-526. Ginis I, Luo Y, Miura T, Thies S, Brandenberger R, Gerecht-Nir S, Amit M, Hoke A, Carpenter MK, Itskovitz-Eldor J, and Rao MS (2004) Differences between human and mouse embryonic stem cells. Dev Biol 269(2), 360-380. Hall IM, Shankaranarayana GD, Noma K, Ayoub N, Cohen A, and Grewal SI (2002) Establishment and maintenance of a heterochromatin domain. Science 297(5590), 2232-2237. Hooker CW, and Hurlin PJ (2006) Of Myc and Mnt. J Cell Sci 119(Pt 2), 208-216. Huang TS, Hsieh JY, Wu YH, Jen CH, Tsuang YH, Chiou SH, Partanen J, Anderson H, Jaatinen T, Yu YH, and Wang HW (2008) Functional network reconstruction reveals somatic stemness genetic maps and dedifferentiation-like transcriptome reprogramming induced by GATA2. Stem Cells 26(5), 11861201. Huangfu D, Maehr R, Guo W, Eijkelenboom A, Snitow M, Chen AE, and Melton DA (2008) Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat Biotechnol 26(7), 795-797.

Humphrey RK, Beattie GM, Lopez AD, Bucay N, King CC, Firpo MT, Rose-John S, and Hayek A (2004) Maintenance of pluripotency in human embryonic stem cells is STAT3 independent. Stem Cells 22(4), 522-530. Ivanova N, Dobrin R, Lu R, Kotenko I, Levorse J, DeCoste C, Schafer X, Lun Y, and Lemischka IR (2006) Dissecting selfrenewal in stem cells with RNA interference. Nature 442(7102), 533-538. James D, Levine AJ, Besser D, and Hemmati-Brivanlou A (2005) TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in human embryonic stem cells. Development 132(6), 1273-1282. Jirmanova L, Afanassieff M, Gobert-Gosse S, Markossian S, and Savatier P (2002) Differential contributions of ERK and PI3-kinase to the regulation of cyclin D1 expression and to the control of the G1/S transition in mouse embryonic stem cells. Oncogene 21(36), 5515-5528. Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, and McKay RD (1996) Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev 10(24), 3129-3140. Judson RL, Babiarz JE, Venere M, and Blelloch R (2009) Embryonic stem cell-specific microRNAs promote induced pluripotency. Nat Biotechnol. Kaji K, Caballero IM, MacLeod R, Nichols J, Wilson VA, and Hendrich B (2006) The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat Cell Biol 8(3), 285-292. Kalani MY, Cheshier SH, Cord BJ, Bababeygy SR, Vogel H, Weissman IL, Palmer TD, and Nusse R (2008) Wnt-mediated self-renewal of neural stem/progenitor cells. Proc Natl Acad Sci U S A 105(44), 16970-16975. Kamakura S, Oishi K, Yoshimatsu T, Nakafuku M, Masuyama N, and Gotoh Y (2004) Hes binding to STAT3 mediates crosstalk between Notch and JAK-STAT signalling. Nat Cell Biol 6(6), 547-554. Karlsson G, Blank U, Moody JL, Ehinger M, Singbrant S, Deng CX, and Karlsson S (2007) Smad4 is critical for selfrenewal of hematopoietic stem cells. J Exp Med 204(3), 467474. Kiel MJ, and Morrison SJ (2008) Uncertainty in the niches that maintain haematopoietic stem cells. Nat Rev Immunol 8(4), 290-301. Kimura H, Tada M, Nakatsuji N, and Tada T (2004) Histone code modifications on pluripotential nuclei of reprogrammed somatic cells. Mol Cell Biol 24(13), 5710-5720. Kitsos CM, Sankar U, Illario M, Colomer-Font JM, Duncan AW, Ribar TJ, Reya T, and Means AR (2005) Calmodulin-dependent protein kinase IV regulates hematopoietic stem cell maintenance. J Biol Chem 280(39), 33101-33108. Kolf CM, Cho E, and Tuan RS (2007) Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation. Arthritis Res Ther 9(1), 204. Lee JH, Hart SR, and Skalnik DG (2004) Histone deacetylase activity is required for embryonic stem cell differentiation. Genesis 38(1), 32-38. Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM, Chevalier B, Johnstone SE, Cole MF, Isono K, Koseki H, Fuchikami T, Abe K, Murray HL, Zucker JP, Yuan B, Bell GW, Herbolsheimer E, Hannett NM, Sun K, Odom DT, Otte AP, Volkert TL, Bartel DP, Melton DA, Gifford DK, Jaenisch R, and Young RA (2006) Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125(2), 301-313. Lengner CJ, Camargo FD, Hochedlinger K, Welstead GG, Zaidi S, Gokhale S, Scholer HR, Tomilin A, and Jaenisch R (2007) Oct4 expression is not required for mouse somatic stem cell self-renewal. Cell Stem Cell 1(4), 403-415.

140

Hareendran et al: Mechanisms of pluripotency and multipotency

Lengner CJ, Welstead GG, and Jaenisch R (2008) The pluripotency regulator Oct4: a role in somatic stem cells? Cell Cycle 7(6), 725-728. Levine SS, King IF, and Kingston RE (2004) Division of labor in polycomb group repression. Trends Biochem Sci 29(9), 478-485. Li JY, Pu MT, Hirasawa R, Li BZ, Huang YN, Zeng R, Jing NH, Chen T, Li E, Sasaki H, and Xu GL (2007) Synergistic function of DNA methyltransferases Dnmt3a and Dnmt3b in the methylation of Oct4 and Nanog. Mol Cell Biol 27(24), 87488759. Li L, Milner LA, Deng Y, Iwata M, Banta A, Graf L, Marcovina S, Friedman C, Trask BJ, Hood L, and Torok-Storb B (1998) The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1. Immunity 8(1), 43-55. Li Y, McClintick J, Zhong L, Edenberg HJ, Yoder MC, and Chan RJ (2005) Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc finger transcription factor Klf4. Blood 105(2), 635-637. Lluis F, Pedone E, Pepe S, and Cosma MP (2008) Periodic activation of Wnt/beta-catenin signaling enhances somatic cell reprogramming mediated by cell fusion. Cell Stem Cell 3(5), 493-507. Loh YH, Wu Q, Chew JL, Vega VB, Zhang W, Chen X, Bourque G, George J, Leong B, Liu J, Wong KY, Sung KW, Lee CW, Zhao XD, Chiu KP, Lipovich L, Kuznetsov VA, Robson P, Stanton LW, Wei CL, Ruan Y, Lim B, and Ng HH (2006) The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 38(4), 431-440. Loh YH, Zhang W, Chen X, George J, and Ng HH (2007) Jmjd1a and Jmjd2c histone H3 Lys 9 demethylases regulate selfrenewal in embryonic stem cells. Genes Dev 21(20), 2545-2557. Lu M, Glover CH, Tien AH, Humphries RK, Piret JM, and Helgason CD (2007) Involvement of tyrosine kinase signaling in maintaining murine embryonic stem cell functionality. Exp Hematol 35(8), 1293-1302. Majumdar MK, Thiede MA, Mosca JD, Moorman M, and Gerson SL (1998) Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J Cell Physiol 176(1), 57-66. Matsumoto K, Isagawa T, Nishimura T, Ogaeri T, Eto K, Miyazaki S, Miyazaki J, Aburatani H, Nakauchi H, and Ema H (2009) Stepwise development of hematopoietic stem cells from embryonic stem cells. PLoS ONE 4(3), e4820. McNeish J (2004) Embryonic stem cells in drug discovery. Nat Rev Drug Discov 3(1), 70-80. Meissner A, Mikkelsen TS, Gu H, Wernig M, Hanna J, Sivachenko A, Zhang X, Bernstein BE, Nusbaum C, Jaffe DB, Gnirke A, Jaenisch R, and Lander ES (2008) Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454(7205), 766-770. Meshorer E, and Misteli T (2006) Chromatin in pluripotent embryonic stem cells and differentiation. Nat Rev Mol Cell Biol 7(7), 540-546. Meyn MA, 3rd, Schreiner SJ, Dumitrescu TP, Nau GJ, and Smithgall TE (2005) SRC family kinase activity is required for murine embryonic stem cell growth and differentiation. Mol Pharmacol 68(5), 1320-1330. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, and Yamanaka S (2003) The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113(5), 631642. Miyabayashi T, Teo JL, Yamamoto M, McMillan M, Nguyen C, and Kahn M (2007) Wnt/beta-catenin/CBP signaling maintains long-term murine embryonic stem cell pluripotency. Proc Natl Acad Sci U S A 104(13), 5668-5673.

Molofsky AV, Pardal R, Iwashita T, Park IK, Clarke MF, and Morrison SJ (2003) Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation. Nature 425(6961), 962-967. Muller FJ, Laurent LC, Kostka D, Ulitsky I, Williams R, Lu C, Park IH, Rao MS, Shamir R, Schwartz PH, Schmidt NO, and Loring JF (2008) Regulatory networks define phenotypic classes of human stem cell lines. Nature 455(7211), 401-405. Nakashima K, Yanagisawa M, Arakawa H, Kimura N, Hisatsune T, Kawabata M, Miyazono K, and Taga T (1999) Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 284(5413), 479-482. Nilsson SK, Johnston HM, Whitty GA, Williams B, Webb RJ, Denhardt DT, Bertoncello I, Bendall LJ, Simmons PJ, and Haylock DN (2005) Osteopontin, a key component of the hematopoietic stem cell niche and regulator of primitive hematopoietic progenitor cells. Blood 106(4), 1232-1239. Niwa H, Miyazaki J, and Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24(4), 372-376. Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, and Rossant J (2005) Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123(5), 917-929. O'Carroll D, Erhardt S, Pagani M, Barton SC, Surani MA, and Jenuwein T (2001) The polycomb-group gene Ezh2 is required for early mouse development. Mol Cell Biol 21(13), 4330-4336. Oda M, Yamagiwa A, Yamamoto S, Nakayama T, Tsumura A, Sasaki H, Nakao K, Li E, and Okano M (2006) DNA methylation regulates long-range gene silencing of an Xlinked homeobox gene cluster in a lineage-specific manner. Genes Dev 20(24), 3382-3394. Okano M, Bell DW, Haber DA, and Li E (1999) DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99(3), 247-257. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, and Yamanaka S (2008) Generation of mouse induced pluripotent stem cells without viral vectors. Science 322(5903), 949-953. Palma V, and Ruiz i Altaba A (2004) Hedgehog-GLI signaling regulates the behavior of cells with stem cell properties in the developing neocortex. Development 131(2), 337-345. Palmqvist L, Glover CH, Hsu L, Lu M, Bossen B, Piret JM, Humphries RK, and Helgason CD (2005) Correlation of murine embryonic stem cell gene expression profiles with functional measures of pluripotency. Stem Cells 23(5), 663-680. Park IH, Arora N, Huo H, Maherali N, Ahfeldt T, Shimamura A, Lensch MW, Cowan C, Hochedlinger K, and Daley GQ (2008) Disease-specific induced pluripotent stem cells. Cell 134(5), 877-886. Park IK, Qian D, Kiel M, Becker MW, Pihalja M, Weissman IL, Morrison SJ, and Clarke MF (2003) Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature 423(6937), 302-305. Pasini D, Hansen KH, Christensen J, Agger K, Cloos PA, and Helin K (2008) Coordinated regulation of transcriptional repression by the RBP2 H3K4 demethylase and PolycombRepressive Complex 2. Genes Dev 22(10), 1345-1355. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, and Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284(5411), 143-147. Qi X, Li TG, Hao J, Hu J, Wang J, Simmons H, Miura S, Mishina Y, and Zhao GQ (2004) BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc Natl Acad Sci U S A 101(16), 60276032.

141

Gene Therapy and Molecular Biology Vol 13, page 142!

Rajan P, and McKay RD (1998) Multiple routes to astrocytic differentiation in the CNS. J Neurosci 18(10), 36203629. Rajan P, Panchision DM, Newell LF, and McKay RD (2003) BMPs signal alternately through a SMAD or FRAPSTAT pathway to regulate fate choice in CNS stem cells. J Cell Biol 161(5), 911-921. Rajan P, and Snyder E (2009) Neural stem cells and their manipulation. Methods Enzymol - Reprinted in Best of Series Edition Essential Stem Cell Methods 23-51. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, and Melton DA (2002) "Stemness": transcriptional profiling of embryonic and adult stem cells. Science 298(5593), 597-600. Rao M (2004) Conserved and divergent paths that regulate self-renewal in mouse and human embryonic stem cells. Dev Biol 275(2), 269-286. Reynolds BA, and Weiss S (1996) Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell. Dev Biol 175(1), 1-13. Riquelme PA, Drapeau E, and Doetsch F (2008) Brain micro-ecologies: neural stem cell niches in the adult mammalian brain. Philos Trans R Soc Lond B Biol Sci 363(1489), 123-137. Roche S, Delorme B, Oostendorp RA, Barbet R, Caton D, Noel D, Boumediene K, Papadaki HA, Cousin B, Crozet C, Milhavet O, Casteilla L, Hatzfeld J, Jorgensen C, Charbord P, and Lehmann S (2009) Comparative proteomic analysis of human mesenchymal and embryonic stem cells: towards the definition of a mesenchymal stem cell proteomic signature. Proteomics 9(2), 223-232. Sato N, Meijer L, Skaltsounis L, Greengard P, and Brivanlou AH (2004) Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 10(1), 55-63. Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ, and Clevers H (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. Schubeler D, MacAlpine DM, Scalzo D, Wirbelauer C, Kooperberg C, van Leeuwen F, Gottschling DE, O'Neill LP, Turner BM, Delrow J, Bell SP, and Groudine M (2004) The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev 18(11), 1263-1271. Schuldiner M, Yanuka O, Itskovitz-Eldor J, Melton DA, and Benvenisty N (2000) Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 97(21), 11307-11312. Scoville DH, Sato T, He XC, and Li L (2008) Current view: intestinal stem cells and signaling. Gastroenterology 134(3), 849-864. Shi Y, Desponts C, Do JT, Hahm HS, Scholer HR, and Ding S (2008) Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3(5), 568-574. Simmons PJ, Gronthos S, Zannettino A, Ohta S, and Graves S (1994) Isolation, characterization and functional activity of human marrow stromal progenitors in hemopoiesis. Prog Clin Biol Res 389271-280. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, and Rogers D (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336(6200), 688-690. Sperger JM, Chen X, Draper JS, Antosiewicz JE, Chon CH, Jones SB, Brooks JD, Andrews PW, Brown PO, and Thomson JA (2003) Gene expression patterns in human embryonic stem cells and human pluripotent germ cell tumors. Proc Natl Acad Sci U S A 100(23), 13350-13355.

Stadtfeld M, Nagaya M, Utikal J, Weir G, and Hochedlinger K (2008) Induced pluripotent stem cells generated without viral integration. Science 322(5903), 945-949. Stier S, Ko Y, Forkert R, Lutz C, Neuhaus T, Grunewald E, Cheng T, Dombkowski D, Calvi LM, Rittling SR, and Scadden DT (2005) Osteopontin is a hematopoietic stem cell niche component that negatively regulates stem cell pool size. J Exp Med 201(11), 1781-1791. Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, and Wu H (1999) PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A 96(11), 61996204. Sun Y, Nadal-Vicens M, Misono S, Lin MZ, Zubiaga A, Hua X, Fan G, and Greenberg ME (2001) Neurogenin promotes neurogenesis and inhibits glial differentiation by independent mechanisms. Cell 104(3), 365-376. Suzuki A, Raya A, Kawakami Y, Morita M, Matsui T, Nakashima K, Gage FH, Rodriguez-Esteban C, and Belmonte JC (2006) Maintenance of embryonic stem cell pluripotency by Nanog-mediated reversal of mesoderm specification. Nat Clin Pract Cardiovasc Med 3 Suppl 1S114-122. Suzuki A, Raya A, Kawakami Y, Morita M, Matsui T, Nakashima K, Gage FH, Rodriguez-Esteban C, and Izpisua Belmonte JC (2006) Nanog binds to Smad1 and blocks bone morphogenetic protein-induced differentiation of embryonic stem cells. Proc Natl Acad Sci U S A 103(27), 10294-10299. Takahashi A, Takahashi Y, Matsumoto K, and Miyata K (1995) Synergistic effects of insulin-like growth factor II (IGFII) with leukemia inhibiting factor (LIF) on establishment of rat pluripotential cell lines. J Vet Med Sci 57(3), 553-556. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, and Yamanaka S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131(5), 861-872. Takahashi K, and Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126(4), 663-676. Ulloa-Montoya F, Kidder BL, Pauwelyn KA, Chase LG, Luttun A, Crabbe A, Geraerts M, Sharov AA, Piao Y, Ko MS, Hu WS, and Verfaillie CM (2007) Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity. Genome Biol 8(8), R163. Vallier L, Alexander M, and Pedersen RA (2005) Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 118(Pt 19), 4495-4509. van der Flier LG, van Gijn ME, Hatzis P, Kujala P, Haegebarth A, Stange DE, Begthel H, van den Born M, Guryev V, Oving I, van Es JH, Barker N, Peters PJ, van de Wetering M, and Clevers H (2009) Transcription factor achaete scute-like 2 controls intestinal stem cell fate. Cell 136(5), 903-912. Watanabe S, Umehara H, Murayama K, Okabe M, Kimura T, and Nakano T (2006) Activation of Akt signaling is sufficient to maintain pluripotency in mouse and primate embryonic stem cells. Oncogene 25(19), 2697-2707. Welham MJ, Storm MP, Kingham E, and Bone HK (2007) Phosphoinositide 3-kinases and regulation of embryonic stem cell fate. Biochem Soc Trans 35(Pt 2), 225-228. Woltjen K, Michael IP, Mohseni P, Desai R, Mileikovsky M, Hamalainen R, Cowling R, Wang W, Liu P, Gertsenstein M, Kaji K, Sung HK, and Nagy A (2009) piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458(7239), 766-770. Xu C, Rosler E, Jiang J, Lebkowski JS, Gold JD, O'Sullivan C, Delavan-Boorsma K, Mok M, Bronstein A, and Carpenter MK (2005) Basic fibroblast growth factor supports

142

Hareendran et al: Mechanisms of pluripotency and multipotency

undifferentiated human embryonic stem cell growth without conditioned medium. Stem Cells 23(3), 315-323. Yamaguchi TP, Takada S, Yoshikawa Y, Wu N, and McMahon AP (1999) T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm specification. Genes Dev 13(24), 3185-3190. Yang J, Chai L, Fowles TC, Alipio Z, Xu D, Fink LM, Ward DC, and Ma Y (2008) Genome-wide analysis reveals Sall4 to be a major regulator of pluripotency in murine-embryonic stem cells. Proc Natl Acad Sci U S A 105(50), 19756-19761. Ying QL, Nichols J, Chambers I, and Smith A (2003) BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115(3), 281-292. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R,

Slukvin, II, and Thomson JA (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318(5858), 1917-1920. Yuan H, Corbi N, Basilico C, and Dailey L (1995) Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes Dev 9(21), 2635-2645. Zhong X, and Jin Y (2009) Critical roles of coactivator p300 in mouse embryonic stem cell differentiation and Nanog expression. J Biol Chem 284(14), 9168-9175. Zhou H, Wu S, Joo JY, Zhu S, Han DW, Lin T, Trauger S, Bien G, Yao S, Zhu Y, Siuzdak G, Scholer HR, Duan L, and Ding S (2009) Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell.

143

Gene Therapy and Molecular Biology Vol 13, page 144 Gene Ther Biol Vol 144-151, 2009

Human primary chondrocytes exhibit an antiangiogenic effect despite of high secretion of VEGF Research Article

Peter Camaj1*, Ivan Ischenko1*, Brian Ziegelaar2, Dagmar Faktorova3, Markus Guba1, Karl-Walter Jauch1, Christiane J. Bruns1 1

Department of Surgery, Munich University Medical Center, Campus Großhadern, Marchioninistr 15, 81377 Munich, Germany 2 Department of ENT, Munich University Medical Center, Campus Großhadern, Marchioninistr 15, 81377 Munich, Germany 3 Department of Measurement and Applied Electrical Engineering, University of Zilina, Zilina, Slovak Republic *Correspondence: Peter Camaj and Ivan Ischenko, Department of Surgery, Munich University Medical Center, Campus Großhadern, Marchioninistr. 15, 81377 Munich, Germany; Tel: +49-89-7095-6443; Fax: +49-89-7095-6433; e-mail: Peter.Camaj@med.unimuenchen.de Keywords: anti-angiogenic effect, chondrocytes, chondrosarcoma, VEGF Abbreviations: ELISA: Enzyme-linked immunosorbent assay; FCS: foetal calf serum; HIF: Hypoxia inducible factor; HRP: horseradish peroxidase; HUVEC: human umbilical vein endothelial cells; MTT: 3-(4, 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide; OD: optical density; PHC: primary human chondrocytes; SMC: smooth muscle cells; VEGF: vascular endothelial growth factor. Received: 20 March 2009; Revised: 12 May 2009 Accepted: 21 May 2009; electronically published: May 2009

Summary Cartilage tissue is one of the few avascular tissues in humans. This fact suggests that healthy cartilage is capable to prevent the influence of angiogenesis driven by environmental stimuli such as low oxygen partial pressure and changes in pH. The aim of this work was to demonstrate and to quantify the anti-angiogenic potential of normal human chondrocytes in comparison to de-differentiated human chondrocytes and chondrosarcoma cells. We found that conditioned medium of primary human chondrocytes exhibits strong anti-angiogenic properties (inhibition of human umbilical vein endothelial cell proliferation and sprouting). The effect was specific to differentiated chondrocytes, whereas it was absent in conditioned medium from de-differentiated chondrocytes. Furthermore, we revealed that the effect was specifically anti-angiogenic but not generally anti-proliferative, when we compared the effect of the above mentioned conditioned media on proliferation of human umbilical vein endothelial cell versus smooth muscle cell. In addition, we found that the inhibition of HUVEC proliferation caused by conditioned medium of differentiated chondrocyte was even stronger than the anti-proliferative effect of Rapamycin treatment. In contrast, we could demonstrate that conditioned medium of chondrosarcoma cells SW1353 exhibits proangiogenic effects. The results from vascular endothelial growth factor ELISA revealed that the inhibition of HUVEC proliferation and sprouting caused by conditioned medium of chondrocytes was not a result of a decreased amount of secreted VEGF. In contrast to our expectations, the results demonstrated that these anti-proliferative effects of conditioned medium of differentiated chondrocytes were present despite of a very high content of VEGF together with other bioactive substances secreted by differentiated chondrocytes. This fact indicates that there might exist potential anti-angiogenic substances secreted by differentiated chondrocytes that are able to overcome the pro-angiogenic effect of VEGF. Such factors might be a very beneficial source as natural anti-angiogenic compounds bearing minimal side effects.

endochondral bone formation, is resistant to vascular invasion from surrounding tissues. Hypoxia is an essential environment for cartilage existence and development because it leads to an increased accumulation of cartilagespecific matrix chondroitin 4-sulfate in human dermal fibroblasts (Mizuno and Glowacki, 2005). A hypoxic environment leads to a proportional increase in glucose utilization and an increment of lactate synthesis in cultured

I. Introduction Angiogenesis belongs to crucial physiological processes running in the normally developing organism as well as the pathological angiogenesis as part of carcinogenesis or inflammation processes. Some tissues in the human body such as cartilage and cornea are generally avascular. Cartilage is normally devoid of capillary networks and, with the exception of 144

Camaj and Ischenko et al: Anti-angiogenic effect of human primary chondrocytes

B. Preparation of conditioned media of chondrocytes

chondrocytes. The described metabolic adaptation is evidently reflected on the change of gene expression patterns induced by different hypoxic regulators such as HIF-1!. The formation of new blood vessels is a prerequisite to bone fracture healing and generally to formation of bone from cartilage and its further growth. Blood vessel invasion of cartilage is the earliest crucial step in endochondral ossification (Harper and Kalgsbrun, 1999). In the above mentioned process chondrocytes undergo well-ordered and controlled phases of proliferation, hypertrophic differentiation, mineralization of the surrounding matrix, death, blood vessel invasion, and finally replacement of cartilage by bone. Hypertrophic chondrocytes on the epiphyseal growth plate express VEGF therefore inducing angiogenesis followed by ossification (Gerber et al., 1999). Despite of the fact that some proteins responsible for the anti-angiogenic properties of cartilage were identified, the mechanisms of such effect remain unclear. The main aim of our work was to investigate the anti-angiogenic properties of chondrocyte-conditioned medium with a special emphasize on its effects on endothelial cell proliferation, sprouting and growth factor dependent survival. Here, we showed anti-angiogenic effect of the chondrocyte-conditioned medium its specificity on HUVEC cells as a target, its dependence on differential status of chondrocytes, using monitoring proliferation and sprouting of HUVEC as readout. The chondrocyte effect was semi-quantitative compared with anti-angiogenic effect of Rapamycin. Effect of malignant transformation on Antinagiogenic effect of chondrocyte was demonstrated on comparison of primary cells with proangiogenic effect of chondrosarcoma cells. Surprisingly, the strongest antinagiogenic effect was observed parallel with highest production of VEGF.

PHCs or SW1363 cells were cultivated in the appropriate medium over 3 days until the cell number has reached the confluence of 5"106 per culturing flask. One ml of medium was conditioned by 300.000 cells.

C. MTT cell proliferation assay 1 x 104 HUVECs or SMCs were plated on 96-well plates and incubated under serum-starved conditions for 24 hours to adhere. After 24 hours of attachment the original culturing medium was exchanged to conditioned or “unconditioned” medium (50% D-MEM + 50% F12 supplemented with ITS liquid media supplement) or endothelial cell growth medium supplemented with different growth factors. The “unconditioned” medium was taken in our study as a negative control of proliferation; the growth factor supplemented endothelial cell growth medium was used as a positive control of proliferation, respectively. Proliferation activities of HUVECs or SMCs were assayed 48 hour after the beginning of treatment. MTT proliferation assay was performed using the TACS MTT Cell Proliferation and Viability Assay kit (R&D Systems, Minneapolis, USA) according to the manufacturer’s recommendations. Briefly, medium was exchanged to endothelial cell growth medium supplemented with the supplement pack (Promocell, Germany) containing 2% FCS. The MTT Reagent was added according to the manufacturer’s recommendations to each well including controls. The plates were returned to cell culture incubator for 2 to 4 hours, and when the purple precipitate was clearly visible under the microscope the MTT Detergent was added to all wells including controls. The plates were left covered in the dark for 2 to 4 hours at room temperature. The absorbance in each well OD was measured at 570 nm in a microplate spectrophotometer.

D. Sprouting assay Spheroids were generated as it has been described elsewhere (Korff et al., 2001). Briefly, 1x103 HUVECs per well were plated on non-adherent plates suspension culture plate 96 wells U-shape (Greiner, Frickenhausen, Germany). Endothelial Cell Medium (2% FCS, Promocell Heidelberg, Germany) supplemented with 0.25% carboxymethylcellulose was used. Cells were incubated overnight at 37°C, 5% CO2 to create spheroids. 500 spheroids suspended in PBS were mixed with acidic collagen IV 2 mg/ml (Becton-Dickinson) and 10x medium l79 (Sigma, Germany). The pH was adjusted to 7.4. A half ml of this stock solution was mixed with 0.5 ml of Endothelial Cell Medium supplemented 40% FCS and 0.5% carboxymethylcellulose. This HUVEC suspension was put into 12-well plates in the presence of collagen matrix to generate a gel. Either conditioned medium or “unconditioned medium” (negative control) or different growth factors diluted in PBS were applied onto the gel surface. Sprouting was microscopically evaluated as the cumulative length of sprouts after overnight incubation at 37°C, 5% CO2.

II. Materials and Methods A. Cell lines and culture conditions Primary human chondrocytes were isolated from healthy human nasal septum samples obtained from surgery. The cells were released by treatment of nasal septum samples with collagenase (5,6 µg/ml) overnight and maintained in medium containing 50% D-MEM (4,5 g glucose/ml) and 50% F12 (Invitrogen, Germany) supplemented with ITS liquid media supplement (Sigma Aldrich, Germany). Human umbilical vein endothelial cells were purchased from Promocell (Germany) and cultivated in endothelial cell growth medium supplemented with an appropriate Supplement Kit (Promocell, Germany). HUVECs were maximally passaged three times after their receipt from the supplier. Smooth muscle cells were purchased from Promocell (Germany) and cultivated in endothelial cell growth medium supplemented with an appropriate Supplement Kit (Promocell, Germany). The SW1353 human bone chondrosarcoma cell line was purchased from ATCC (LGC Promochem GmbH, Germany) and cultivated in RPMI-1640 medium (Invitrogen, Germany) supplemented with 10% FCS including antibiotics. Experiments were performed in the same medium as used for the cultivation of human primary chondrocytes. All cell lines were cultivated at 37°C and 5% CO2.

E. Determination of human vascular endothelial growth factor concentrations in cell culture supernants The level of VEGF was measured in either conditioned media or in “unconditioned” negative control media. Different concentrations of conditioned media were taken. The assay was performed according to the manufacturer’s recommendations (Quantikine human VEGF ELISA kit, R&D Systems, Minneapolis, USA). VEGF concentrations were then calculated

145

Gene Therapy and Molecular Biology Vol 13, page 146 according to the parameters of the calibration curve. Calibration curves with a correlation coefficient at least 0.998 were used.

and not by medium itself. These results are statistic significant. Inhibition of spheroid sprouting is dependent by differentiation status of conditioning cells as it is demonstrated by treatment with medium conditioned by chondrocytes from passage 3. Photos on Figure 3b show the representative spheroids from all treatment groups.

F. Statistical analysis The results of ELISA tests, proliferation and sprouting assays were analyzed using the paired Student’s t-test (Microcal Origin, version 6.0, Microcal Software, MA, USA) with p < 0.05 considered to be significant.

D. Quantification of antinagiogenic effect The next experiment (Figure 4) shows that chondrocyte conditioned medium inhibits sprouting of HUVEC-spheroids activated by 10, 25 and 50 ng/ml VEGF or 50 ng/ml EGF respectively. Qualitatively exhibited antinagiogenic effect of chondrocyte medium was partially quantified, relatively in comparison to antinagiogenic effect of Rapamycin. Relative proliferation of HUVEC was used as readout. Concentration dependency of inhibitory effect of Rapamycin on HUVEC proliferation exhibit typical U-shape curve. Parallel with this MTTmeasurement, proliferation activity of HUVEC treated with conditioned medium was determined. Treatment with unconditioned medium was used as a negative control. Results showed that antinagiogenic effect of chondrocyteconditioned medium is stronger than effect of Rapamycin under its optimal concentration.

III. Results A. Anti-angiogenic properties of chondrocyte-conditioned medium As first we used relative proliferation activity as readout of angiogenesis. Our data showed that treatment of HUVEC with conditioned medium leads to substantial reduction of their proliferation activity (Figure 1). Already 10% content of conditioned medium leads to strong inhibition of HUVEC proliferation (Figure 1b). All these results are statistically very significant. Specificity of this effect was demonstrated on the smooth muscle cells. Treatment with both, concentrated or diluted conditioned medium does not lead to significant inhibition of the growth of these cells. Specific and statistically significant inhibition of HUVEC proliferation due to treatment with chondrocyte-conditioned medium was observed in absence of HUVEC activation as well as under activation with VEGF or EGF respectively.

E. Effect of malignant transformation on antinagiogenic effect of chondrocytes Angiogenesis is necessary for tumor growth. Therefore chondrocyte-derived cancer cells have to change their phenotype from anti- toward pro-angiogenic. To demonstrate this, effect of the medium conditioned by chondrosarcoma cells on HUVEC proliferation was compared with effect of chondrocytes. Proliferation of HUVEC in medium supplemented with 2% FCS was used as a positive control. Our results demonstrated proangiogenic effect of the medium conditioned by chondrosarcoma cell line SW1353. Already 10% content of this conditioned medium in medium (0,5% FCS) leads to substantial activation of HUVEC proliferation. 50% content of SW1353 conditioned medium leads to so strong activation of HUVEC proliferation that saturation was already reached. Further addition of conditioned medium does not lead to increased proliferation of HUVEC.

B. Specificity of antinagiogenic properties of chondrocytes Our data (Figure 2) show that the chondrocytes losing their differentiation phenotype due to passaging in the same time loose also their antinagiogenic abilities. Dedifferentiated chondrocytes from 3rd passage show in some cases even proangiogenic features. All these features were observed in case of undiluted as well as 10-fold diluted conditioned medium in the absence as well as in the presence of VEGF-activation. The results are highly statistically significant.

C. Sprouting of HUVEC spheroids Spheroids containing 10000 HUVECs were generated, embedded in collagen matrix and subjected to different treatments. VEGF in concentration 10, 25, 50 ng/ml was used for activation of sprouting as a positive control (Figure 3a). In majority of our previous experiments, activation with 25 ng/ml exhibit saturation of this effect and further increase of VEGF concentration did not lead to further activation of sprouting. Therefore 25 ng/ml VEGF was used for activation of sprouting to demonstrate effect of chondrocyte-conditioned medium on sprouting. Treatment with unconditioned medium having the marginal effect on sprouting was used as a negative control. The results of measurement of cumulative sprouts show that activation of sprouting caused by VEGF can be substantially diminished by treatment with 50 µl or almost completely abrogated by treatment with 100 µl of chondrocyte conditioned medium. Treatment with unconditioned medium negative control showed that inhibition of sprouting is caused by medium conditioning

F. Production of VEGF VEGF production by chondrocytes of passage 1, 3 as well as by chondrosarcoma cells SW1353 was determined by ELISA. Unconditioned medium containing no detectable VEGF was used as a negative control. Primary human chondrocytes produced more than 3000 pg/ml VEGF per million cells. This massive VEGF production was significantly reduced during cell dedifferentiation due to cell culture passaging. Interestingly, chondrosarcoma cells SW1353 used as proangiogenic positive control produced the lowest amount of VEGF from all investigated cell cultures. Surprisingly, the cells exhibiting the highest antinagiogenic potential produce the highest amount of proangiogenic VEGF at the same time.

146

Camaj and Ischenko et al: Anti-angiogenic effect of human primary chondrocytes

Figure 1a: Inhibition of HUVEC and SMC proliferation by conditioned medium of chondrocytes under VEGF- or EGFinduced conditions. The cells were treated with complete conditioned or unconditioned chondrocyte medium (a) or with medium contained 90% of conventional HUVEC medium and 10% of conditioned or unconditioned chondrocyte medium.

Figure 2: Relative proliferation of HUVECs treated with medium conditioned by chondrocytes at different passages. The effect of medium conditioned by de-differentiated chondrocytes at the passage 3 was compared with that caused by chondrocyteconditioned medium taken from the cells at first passage. Our results demonstrate that the anti-angiogenic properties of cultivated primary human chondrocytes were cell-passagedependent. Furthermore, same loosing in the anti-angiogenic properties of de-differentiated chondrocytes was found when starved endothelial cells or cells stimulated with 25 ng/ml VEGF were used

Figure 1b: Inhibition of HUVEC and SMC proliferation by conditioned medium of chondrocytes under VEGF- or EGFinduced conditions. The cells were treated with complete conditioned or unconditioned chondrocyte medium (b) SMCs were taken to demonstrate the specificity of the antiproliferative effects of conditioned medium of chondrocytes on endothelial cells.

Figure 3a: Inhibition of endothelial cell sprouting by conditioned medium of chondrocytes under different cell culture conditions (a). Sprouting was microscopically evaluated as the cumulative length of sprouts after overnight incubation at 37째C, 5% CO2. Treatment with PBS served as a negative control. Treatment of spheroids with conditioned medium of chondrocytes in the presence of 25 ng/ml VEGF led to a statistically significant inhibition of HUVEC spheroid sprouting; the effect was proportional to the volume of conditioned medium used. Furthermore, the anti-angiogenic properties of cultivated primary human chondrocytes were cell-passage-dependent.

147

Gene Therapy and Molecular Biology Vol 13, page 148

Figure 5: Quantification of conditioned medium-induced inhibition of HUVEC proliferation. Inhibitory properties of conditioned medium of chondrocytes as well as Rapamycin were compared using the same experimental setting. The influence of conditioned medium of chondrocytes on HUVEC proliferation was as strong as that of Rapamycin when the drug was applied at clinically relevant doses (1Âľg/ml).

Figure 3b: Inhibition of endothelial cell sprouting by conditioned medium of chondrocytes under different cell culture conditions Representative pictures of spheroids are presented (b), the arrows delineate spheroid sprouting. A-E indicates the corresponding in vitro conditions.

Figure 4: Inhibition of endothelial cell sprouting by conditioned medium of chondrocytes under VEGF- or EGF-stimulation. Spheroids embedded in collagen gel were treated with conditioned medium of chondrocytes or with unconditioned control medium. Sprouting was microscopically evaluated as the cumulative length of sprouts after overnight incubation at 37Â°C, 5% CO2.

Figure 6: Proliferation of HUVECs under SW1353-conditioned medium treatment. SW1353-conditioned medium was used in a pure form or mixed with serum-reduced HUVEC medium as shown. Serum-reduced HUVEC medium or complete medium supplemented with all growth factors served as a negative or positive control of HUVEC proliferation, respectively. The proliferation of HUVECs following treatment with conditioned medium of SW1353 cells was significantly increased and the effect was proportional to the percentage of conditioned medium. #p < 0.05 versus serumreduced HUVEC medium.

148

Camaj and Ischenko et al: Anti-angiogenic effect of human primary chondrocytes content is sufficient to reach similar efficacy on HUVEC proliferation. Moreover, these results suggest that the antiproliferative effects on HUVECs by conditioned medium of chondrocytes were not caused by depletion of nutrients. Furthermore, we demonstrated anti-angiogenic effects of conditioned medium of chondrocytes on starved HUVECs following activation with VEGF or EGF treatment, respectively (Figure 1). These results allow us to hypothesize that the principle of action of some compounds within the conditioned media of chondrocytes does not have to be based on blockade of receptors, since even in the presence of at least two different activated receptors the anti-angiogenic properties of the conditioned medium of chondrocytes remain similar. Smooth muscle cells are usually present in an intimate contact with endothelial cells in their natural environment. However, treatment of SMCs with conditioned medium from primary human chondrocytes led only to minor changes in their proliferation rate (Figure 1a, b). Therefore we can conclude that the antiproliferative effects of conditioned medium of chondrocytes are not based on unspecific inhibition of the proliferative activity of cells in general, the inhibitory effects are particularly attributable to endothelial cells. It is well established in the previous studies that primary human chondrocytes lack their natural phenotype under in vitro conditions after multiple passages of cultivation (Schnabel et al., 2002). Our results showed that the anti-angiogenic properties of cultivated primary human chondrocytes were cell-passage-dependent when examined by HUVEC proliferation (Figure 2). Changing differentiation status of passaged chondrocytes was confirmed by monitoring the substantial changes of collagen-pattern and the cell morphology towards fibroblastic phenotype (data not shown). This observation led us to conclude that the anti-angiogenic activity of chondrocytes is coupled to gene expression that is specific to the differentiation status of the cells. We assume that dedifferentiated cells loose the anti-angiogenic potential and even the opposite pro-angiogenic activity can occur. Furthermore, lost of anti-angiogenic properties of dedifferentiated chondrocytes was found as well when starved endothelial cells or cells stimulated with 25 ng/ml VEGF were used. To further evaluate the anti-angiogenic properties of conditioned medium of chondrocytes in a physiological three-dimensional model we chose the endothelial cell spheroid-sprouting assay in vitro. Interestingly, the effect of conditioned medium of chondrocytes on spheroid sprouting was less pronounced than that found on HUVEC proliferation. Treatment of HUVEC spheroids with 50 ng/ml VEGF increased the sprouting of endothelial cells compared to that observed with 25 ng/ml VEGF, however, the difference did not reach significance (Figure 3a). Furthermore, treatment of spheroids with conditioned medium of chondrocytes in the presence of 25 ng/ml VEGF led to a statistically significant inhibition of sprouting, and the effect was proportional to the volume of conditioned medium used (Figure 3, a and b). The inhibitory effect on spheroid sprouting was nearly absent when the highest volume (100 Âľl) of conditioned medium

Figure 7: Vascular endothelial growth factor levels in differently conditioned or non-conditioned media. The VEGF concentrations were determined in various media conditioned by chondrocytes at passage 1 or 3, conditioned by chondrosarcoma cells, or in the unconditioned control medium. The chondrosarcoma cell line SW1353 secreted the lowest amount of VEGF. However, the primary human chondrocytes bearing clear anti-angiogenic properties expressed simultaneously the highest amount of VEGF.

IV. Discussion The aim of this work was to demonstrate the antiangiogenic properties of normal human chondrocytes based on the capability to modulate endothelial cell proliferation and sprouting. The anti-angiogenic property of conditioned medium of chondrocytes was compared to that found in the media from human chondrosarcoma cells. To demonstrate the anti-angiogenic properties of substances produced by cartilage we performed an in vitro model consisting of cell culture of primary human chondrocytes isolated from pieces of human cartilage and HUVECs as cell sensors for the quantification of angiogenesis. First, the proliferative activity of HUVECs treated with conditioned medium from primary human chondrocytes was compared to that of HUVECs treated with unconditioned medium. The results revealed that the treatment of HUVECs with 100% of conditioned medium of chondrocytes led to a statistically significant reduction in their proliferation (Figure 1a). We hypothesized that such findings might be the result of reduced glucose, nutrients or growth factor levels in conditioned medium. To exclude this nutrient-dependent reduction in HUVEC proliferation, the cells were treated with a mixture of 90% HUVEC medium and 10% conditioned medium of chondrocytes, the unconditioned medium was included as a negative control. Indeed, the effect of such media mixture on HUVEC proliferation was found to be similar to that observed after the treatment of HUVECs with 100% conditioned medium (Figure 1b). Based on these findings, we can conclude that even 10% of conditioned medium 149

Gene Therapy and Molecular Biology Vol 13, page 150 of chondrocytes from cells at passage 3 was taken. Interestingly, the difference between the sprouting of spheroids treated with unconditioned medium or with medium conditioned by chondrocytes at passage 3 was negligible (Figure 3, a and b). Finally, the results obtained from the more biologically credible spheroid model fully confirmed our previous findings that chondrocytes loose their anti-angiogenic properties after cell culture passaging. The same assay showed that antinagiogenic properties of chondrocytes are obvious after both activations with VEGF or EGF respectively (Figure 4). Using MTT proliferation assay we found that the anti-angiogenic effect of conditioned medium of chondrocytes as shown by HUVEC proliferation was as strong as the anti-angiogenic capacity of the mTOR inhibitor Rapamycin when the drug was applied at the clinically relevant doses (1Âľg/ml; Figure 5). To date, the U-shaped therapeutic curve of Rapamycin is widely known as a typical dose-dependent bend of efficacy of antiangiogenic compounds (Tjin et al., 2006). We assume that conditioned medium of chondrocytes includes a lot of unknown anti-angiogenic substances which should be further identified, isolated and characterized. The usage of other anti-angiogenic substances such as VEGF-blocking antibodies or antibodies against the VEGF receptor might be a useful strategy to analyse the anti-angiogenic properties of conditioned medium of chondrocytes. It is widely accepted that tumor progression is always associated with pathological angiogenesis and that this process is highly dependent on the levels of nutrients and oxygen. This statement is valid for progressing tumors originating from chondrocytes as well, although it is known that these cells do have strong anti-angiogenic properties. To examine the angiogenic/anti-angiogenic properties of chondrocyte-derived tumor cells we used conditioned medium of SW1353 chondrosarcoma cells and again analysed the proliferative activity of HUVECs by MTT proliferation assay. Interestingly, the proliferation of HUVECs following treatment with conditioned medium of SW1353 cells was significantly higher when compared to the proliferation of HUVECs under non-conditioned terms (Figure 6). Furthermore, the anti-proliferative effect on HUVECs was directly proportional to the concentration of conditioned medium of SW1353 cells, however, more than 50% conditioned medium of SW1353 cells did not lead to a further increase in HUVEC proliferation (Figure 6). On the other hand, a 10% content of conditioned medium of SW1353 cells in HUVEC medium did already lead to an evident activation of HUVEC proliferation. Furthermore, serum-reduced HUVEC medium (0.5% FCS) mixed 1:1 with conditioned medium of chondrosarcoma cells induced HUVEC proliferation even stronger than that being FCSand growth factor-supplemented and was used as a positive control (Figure 6). Our results support the hypothesis that transformation of primary human chondrocytes into chondrosarcoma cells lead to a change of inhibition of angiogenesis towards a rather pro-angiogenic phenotype. Since VEGF is known as one of the most important regulators of angiogenesis we evaluated the VEGF concentrations in various media conditioned by chondrocytes at passage 1 or 3, conditioned by

chondrosarcoma cells, or in unconditioned control medium. Interestingly, the results from the VEGF ELISA showed an absolutely inverse picture in comparison to the results of HUVEC proliferation or the sprouting assays. The chondrosarcoma cell line secreted the lowest amount of VEGF. However, the primary human chondrocytes bearing clear anti-angiogenic properties expressed simultaneously the highest amount of VEGF (Figure 7). If these cells were passaged, they loose the ability to secrete VEGF. Thus, our next aim will be to identify these genes, which are responsible for the anti-angiogenic properties of chondrocytes reflected in our experiments. Furthermore, it seems important to describe changes in gene expression in cells present at transitional state, in which the antiangiogenic phenotype of normal cartilage has been changed to pro-angiogenic one of hypertrophic cartilage or chondrosarcoma. During this process the anti-angiogenic genes are turned off and the expression of pro-angiogenic genes is activated. Such analyses in gene expression leading to a better understanding of global regulation of cartilage physiology might be helpful in the development of anti-angiogenic drugs natural origin exhibiting minimal side effects.

V. Conclusion Conditioned medium of primary human chondrocytes exhibits strong anti-angiogenic properties. The effect was specific to differentiated chondrocytes, whereas it was absent in conditioned medium from de-differentiated chondrocytes. Antiproliferative effect of conditioned medium is specifically directed toward HUVEC and no effect on smooth muscle cells was observed. In addition, we found that this effect was even stronger than the antiproliferative effect of Rapamycin treatment. By contrast, we could demonstrate that conditioned medium of chondrosarcoma cells SW1353 exhibits pro-angiogenic effects. The results from ELISA revealed that the inhibition of HUVEC proliferation and sprouting caused by conditioned medium of chondrocytes was not a result of a decreased amount of secreted VEGF.

Acknowledgements The authors thank Prof. Alexander Berghaus and Dr. Andreas Naumann for the providing with cartilage tissue samples. We thank Dr. Gerald Schmid for the help with spheroid assay. We also thank Michael BrĂźckel for the excellent technical assistance. This research was supported by the grant of the clinical research group KFO 128/1-1 of the Deutsche Forschungsgemeinschaft (DFG), the Wilhelm-Sander-Stiftung (Nr. 2003.133.1) and the research grant BR 1614/3-1of the Deutsche Forschungsgemeinschaft (DFG).

References Mizuno S, Glowacki J (2005) Low oxygen tension enhances chondroinduction by demineralised bone matrix in human dermal fibroblasts in vitro. Cells Tissues Organs 180(3): 151158 Harper J, Kalgsbrun M (1999) Cartilage to bone-angiogenesis leads the way. Nat Med 5(6): 617-618

150

Camaj and Ischenko et al: Anti-angiogenic effect of human primary chondrocytes Gerber HP, Vu TH, Ryan AM, Kowalski J, Werb Z, Ferrara N (1999) VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat Med 5(6): 623-628 Korff T, Kimmina S, Martiny-Baron G, Augustin HG (2001) Blood vessel maturation in a 3-dimensional spheroidal coculture model: direct contact with smooth muscle cells regulates endothelial cell quiescence and abrogates VEGF responsiveness. The FASEB Journal 15:447-457 Schnabel M, Marlovits S, Eckhoff G, Fichtel I, Gotzen L, Vecsei V, Schlegel J (2002) Dedifferentiation-associated changes in

morphology and gene expression in primary human articular chondrocytes in cell culture. Osteoarthritis Cartilage 10(1): 62-70 Tjin Tham Sjin RM, Naspinski J, Birsner AE, Li C, Chan R, Lo KM, Gillies S, Zurakowski D, Folkman J, Samulski J, Javaherian K (2006) Endostatin therapy reveals a U-shaped curve for antitumor activity. Cancer Gene Ther 13(6): 619627

151

Gene Therapy and Molecular Biology Vol 13, page 152!

Gene Ther Mol Biol Vol 13, 152-157, 2009

Association analysis of the Tumor necrosis factor gene polymorphisms (TNFA 238 and 302) in the development of schizophrenia: Impact on the antipsychotic treatment response Research Article

Chi-Un Pae1,2*, Antonio Drago3, Alberto Chiesa3, Laura Mandelli3, Alessandro Serretti3, Tae-Youn Jun1 1

Department of Psychiatry, The Catholic University of Korea College of Medicine, Bucheon, Kyounggi-Do, Republic of Korea 2 Department of Psychiatry and Behavioral Sciences, Duke University Medical Center, Durham, NC, USA 3 Institute of Psychiatry, University of Bologna, Bologna, Italy __________________________________________________________________________________________________ *Correspondence: Chi-Un Pae, MD, PhD, Department of Psychiatry, Holy Family Hospital, The Catholic University of Korea College of Medicine, 2 Sosa-Dong, Wonmi-Gu, Bucheon, Kyeonggi-Do 420-717, Republic of Korea; E-mail: pae@catholic.ac.kr Key Words: schizophrenia, tumor necrosis factor-! gene, and clinical variables. Received: 25 May 2009; Revised: 2 June 2009; Accepted: 4 June 2009; electronically published: 5 June 2009

Summary This study investigated the tumor necrosis factor-! gene (TNFA; -238 G/A and -308 G/A polymorphisms) on the development of schizophrenia, as well as the interaction of the two polymorphisms in relation to symptomatology, family history, onset age and antipsychotic treatment response. Genomic DNA analyses with polymerase chain reaction (PCR) were used for the genotyping. One hundred and fifty-two (152) patients with schizophrenia and 152 normal controls participated in the study. Any associations between the individual polymorphism and schizophrenia were not found. However, marginal association between subjects with TNFA -238 A allele (genotype AA plus AG) and presence of family history was found (p=0.023). No significant interaction effects between TNFA â&#x20AC;&#x201C;238 and -308 polymorphisms either on the development of schizophrenia or on clinical variables such as antipsychotics treatment response and psychopathology were found, although a significant interaction effect for subjects carrying TNFA -238 AG and -308 AA genotypes on a positive family history was observed (p=0.017). These results suggest that the interaction effects between TNFA â&#x20AC;&#x201C;238 and -308 polymorphisms gives no significant contribution to the susceptibility to schizophrenia, and is not associated with clinical variables, antipsychotic treatment response and psychopathological features, except for family history of disease, at least in Korean population.

I. Introduction

been related to abnormal behaviors, anxiety, decreased appetite, emotions, sleep disturbances, recognition and other psychiatric symptoms highly expressed also in schizophrenia (Holden and Pakula, 1999;Kubota et al., 2001;Reichenberg et al., 2001;Strieter et al., 1993). In addition, the serum concentration of TNF-! in schizophrenic patients has been reported to be elevated in comparison with the control group. Moreover, after the administration of antipsychotic drugs, an alteration of its concentration has been detected, and thus its involvement not only in the development of schizophrenia but also in the response to treatment has been suggested (Erbagci et

Various cytokines have been known to form the network between the immune system and the central nervous system. These cytokines show a change not only in the peripheral immune system but also in the central nervous system, and they exert their effects on the proliferation and death of immune cells; they are associated with neurotransmitters metabolism, neuronal development and degeneration (Muller and Ackenheil, 1998). TNF-! is a very important pro-inflammatory cytokine involved in the regulation of immune system and in the initial stage of inflammatory reaction, and it has

152

Pae et al:

Association analysis of the Tumor necrosis factor gene polymorphisms

! al., 2001;Monteleone et al., 1997;Naudin et al., 1997). TNF-! gene (TNFA) is located on chromosome 6p21.3 and was reported to be associated with schizophrenia (Schwab et al., 2000); the TNFA –238 (G/A) and –308 (G/A) polymorphisms are involved in the regulation of TNF-! activation, by influencing TNF-! transcription, thus being involved directly in the production of TNF-! (Kaluza et al., 2000;Wilson et al., 1994). According to the association of the TNFA polymorphism and schizophrenia, a correlation has been reported in literatures, with conflicting results (Boin et al., 2001;Czerski et al., 2008;Duan et al., 2004;Handoko et al., 2003;Hanninen et al., 2005;Hashimoto et al., 2004;Kampman et al., 2005;Meira-Lima et al., 2003;Morar et al., 2007;Pae et al., 2003;Riedel et al., 2002;Saviouk et al., 2005;Schwab et al., 2003;Shirts et al., 2006;Tan et al., 2003;Tsai et al., 2003;Watanabe et al., 2007;Zai et al., 2006), although a recent meta-analyses including 2512 cases and 3223 controls showed that the AA genotype was weakly associated with schizophrenia susceptibility in Caucasoids (Odd Ratio OR=1.65, 95% CI=1.00-2.71 Z=1.98 p=0.05) (Sacchetti et al., 2007). To our knowledge, however, investigations about the association between TNF-! polymorphism and antipsychotic treatment response have been still inadequate to date. The aim of this study is to investigate the presence of an interaction effect of the TNF-! –308 and -238 polymorphisms on the development of schizophrenia and on the clinical symptomatology. Firstly we investigated the association between individual polymorphisms and the vulnerability to schizophrenia and to diverse clinical variables. Then, we compared and analyzed the influence of the interaction effects of the two polymorphisms on the affection status and various clinical variables.

admission and 8 6weeks after antipsychotic administration (responder: defined as 20% decrease of PANSS score after 8week treatment compared to that of PANSS score at the time of admission). Any antipsychotics regardless of class were given for the treatment of psychotic symptoms for 8 weeks. Risperidone (n=71) was the most frequently administered antipsychotic and then olanzapine (n=39), quetiapine (17), chlorpromazine (13) and haloperidol (12) were followed. One hundred and thirty-one (86.2%) patients completed the 8-week treatment. Thus, the 21 patients’ last data was obtained by a method of the last observation carried forward (LOCF).

B. Genotyping with Restriction Fragment Length Polymorphism (RFLP) The DNA was extracted from whole blood using the standard method. Amplification of the target site of the TNF-! gene (TNFA –238, rs 361525 and –308, rs1800629) was carried out by PCR using forward (F) and reverse (R) primers (TNFA – 238: F5'-ATC TGG AGG AAG CGG TAG TG-3' and R5'-AGA AGA CCC CCC TCG GAA CC-3'; TNFA –308: F5'AGGCAATAGGTTTTGAGGGCCAT-3' and R5'TCCTCCCTGCTCCGATTCCG-3') and conditions as described elsewhere (Wilson et al., 1994). The PCR products were digested at 37°C with NcoI (Boehringer Mannheim, Mannheim, Germany) to detect the TNFA –308 allele and with MspI (Boehringer Mannheim, Mannheim, Germany) to detect the TNFA –238 allele and then subjected to 8% acrylamide gel and stained with ethidium bromide. As for TNFA –238, Large 7(152bp) and small (132 bp/20 bp) fragments were identified as MspI site negative (TNFA –238 A allele) and positive (TNFA – 238 G allele), respectively. As for TNFA –308, Large (107bp) and small (87 bp/20 bp) fragments were identified as Nco" site negative (TNFA –308 A allele) and positive (TNFA –308 G allele), respectively.

C. Statistical Analyses

II. Methods

Differences in the allele and genotype frequencies of the TNFA-238 and -308 polymorphisms between the patients and the controls were calculated using a Chi-square test. HardyWeinberg equilibrium at each polymorphism was examined by a goodness-of-fit Chi-square. To compare numerical variable such as age and the number of admission, nonparametric t-test, Univariate Analysis of Variance (ANOVA) and ANCOVA were used where appropriate. The Monte Carlo method with the CLUMP program v 1.9 (10,000 simulations) (Sham and Curtis, 1995) was used when small cell count observed in case of categorical comparison. Multiple regression analysis was applied to detect the possible interaction effects between the TNFA –238 and -308 polymorphisms in their influences on the affection status and other clinical variables (Serretti et al., 1999). The Linkage Disequilibrium (LD) was tested using a two-locus LD calculator (2 LD) (Zhao, 2004). The haplotypes were constructed using the EH program (Xie and Ott, 1993). P values <0.05 were considered significant. All the statistical tests were performed using the SPSS v10.0 software (SPSS Inc., Chicago, IL). The power of a sample to detect the differences between the alleles was calculated by considering an alpha value of 0.05, two tailed. Using these parameters, the sample was estimated to have the power (0.80) to detect a small to medium effect size (w=0.16),

A. Subjects

One hundred and fifty-two (152) inpatients with schizophrenia and the 152 healthy controls participated in this study. The diagnosis was made on the basis of consensus between two board-certified psychiatrists according to the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV) (American, 1994). The Structured Clinical Interview for DSM-IV Axis I Disorders-Clinician Version (SCID-I-CV) (First et al., 1997) was administered to all patients. Other available resources such as clinical course, family information and medical records were also used. Patients with a diagnosis of other mental or neurological disorders other than schizophrenia were excluded from the study. The control group consisted of volunteers from the paramedical- and medical-staffs or students who showed no family or personal history of major mental disorders and neurological diseases. The control group was also evaluated by board certified-psychiatrists to exclude current or a past history of psychiatric problems. A written informed-consent form was obtained from all subjects after a full description of the study. The Positive and Negative Syndrome Scale (PANSS) (Kay et al., 1988) was assessed for examining the antipsychotics treatment response in patients with schizophrenia at the time of

153

Gene Therapy and Molecular Biology Vol 13, page 154! Table 2: Clinical parameters in patients with schizophrenia according to TNFA -238 polymorphism

which corresponded to a difference of approximately 15% between the two groups in the two alleles.

III. Results Seventy-three (48.0%) patients with schizophrenia were male and 69 (45.4%) normal controls were male. No difference was present in the gender distribution between the two groups (p=0.730). The average age was older in the patient group (mean ± SD, 36.9±11.6 years) than in the control group (32.0±10.7 years) (p < 0.05). The frequencies of TNFA -238 and -308 genotypes were not different from the expected values of HardyWeinberg equilibrium in the patients group (p=0.170 and p=0.883, respectively) and in the control group (p=0.112 and p=0.091, respectively, Table 1). Neither TNFA -238 nor TNFA -308 polymorphism variants were associated with the development of schizophrenia (Table 1). The description of the patients’ characteristics with schizophrenia according to polymorphisms of TNFA -238 and TNFA -308 is shown in Tables 2 and 3. Subjects carrying TNFA -238 A allele had more frequent familial history [genotype AA and AG, p=0.023, odds ratio (OR)=5.156, 95% confidence intervals (CI)=1.46318.107] (Table 2). Neither TNFA –238 polymorphism nor TNFA -308 variants were associated with the antipsychotic treatment response as a categorical variable (Tables 2 and 3). Other clinical variables such as onset age, suicide history, past admission number and duration of illness were not associated with the two polymorphisms. When analyzing with the multiple regression approach all possible interactions between all the possible combinations of the two polymorphisms, significant interaction effects were not found with the development of schizophrenia as well as with several clinical variables such as family history, attempted suicide history, age at onset, duration of illness and antipsychotic treatment response. However, interaction effect between TNFA -238 AG genotype and –308 AA genotype was found to be associated with family history (beta=-0.432, p=0.017). The D! coefficient for the TNFA -238 and -308 polymorphisms was not indicative of significant LD (D! =0.564) so that the haplotype analysis was not presented.

Table 3: Clinical parameters in patients with schizophrenia according to TNFA -308 polymorphism

Table 1: The distribution of genotypeand allele in patients with schizophrenia and the controls

154

Pae et al:

Association analysis of the Tumor necrosis factor gene polymorphisms

IV. Discussion

2003) reported that TNFA –308 polymorphism might not be associated with clozapine response. Our study also failed to find any significant association of the two polymorphisms and antipsychotic response. This may suggest the TNFA -238 and -308 polymorphisms would not be associated with the improvement of psychopathology, although, we need more pharmacogenetic data with TNFA polymorphisms. In fact a recent study showed a marginal association of TNFA with antipsychotic response (Zai et al., 2006), indicating a need of more data in this area. We tried to find possible interactions effects, unfortunately, we failed to find significant interactions except for positive association of the TNFA -238 AG and – 308 AA with positive family history. As previously stated, the subjects with TNFA -238 allele A (genotype AA and AG) were associated with positive familial history, which may indicate the strong effect of TNFA –238 polymorphism on the familial aggregation for the development of schizophrenia considering the result of interaction and individual effects. Other interaction effects of the two polymorphisms on the other clinical variables were not found to be associated in patients with schizophrenia. The interaction between the two polymorphisms may not play a major role in development of schizophrenia and major clinical manifestations, or has only weak genetic influence. Different ethnic background for the two polymorphisms should be considered (Boin et al., 2001;Duan et al., 2004;Handoko et al., 2003;MeiraLima et al., 2003;Pae et al., 2003;Tsai et al., 2003). Casecontrol association study has inherent pitfall of population stratification. More SNPs from the two genes should provide more accurate information. The multiple comparison issue should also be noted because the two polymorphisms were compared with regard to the genotype frequency and the allele distribution as well as the correlation with clinical variables including numerical and categorical parameters. We should consider the small sample number considering conventional sample size needed in the case-control association study (Sham and Curtis, 1995) which is related to the possibility of false negative finding with regard to sample size. Finally this study has only investigated the possibility of immunogenetical perspective in relation to pathophysiologies of schizophrenia but not tried to find other pathophysiological aspects such as neurotransmitters or neuroendocrine factors. Although, interaction effects may also partly reveal the potential role of specific genes for certain multi-factorial disorders, epistatic interaction among candidate genes for certain mental disorders might have us more chance to understand their genetic backgrounds and molecular underpinnings than simple interaction study. In conclusion, the present study suggest that the interaction effects between TNFA -238 and -308 polymorphisms gives no significant contribution to the susceptibility to schizophrenia, and are not associated with clinical variables such as antipsychotic treatment response, except for family history, at least in Korean population.

As for the association of TNFA polymorphism with schizophrenia, there have been mixed results, some studies supported (mainly with TNFA –308 polymorphism) (Czerski et al., 2008;Meira-Lima et al., 2003;Sacchetti et al., 2007;Saviouk et al., 2005;Schwab et al., 2000;Tan et al., 2003), while others failed to replicate the association of TNFA polymorphism with schizophrenia (Duan et al., 2004;Handoko et al., 2003;Hashimoto et al., 2004;Pae et al., 2003;Riedel et al., 2002;Shirts et al., 2006;Tsai et al., 2003;Watanabe et al., 2007;Zai et al., 2006). Since Boin et al. (Boin et al., 2001) found that TNFA –308 A allele was highly associated with a susceptibility to schizophrenia, which were replicated in other studies with different ethnicities (Caucasian and Brazilian and only one for Chinese) (Meira-Lima et al., 2003;Schwab et al., 2000;Tan et al., 2003). Among the positive studies, interestingly, some found the positive association with TNFA -308 A allele with the susceptibility to schizophrenia, while others reported the positive association with TNFA -308 G allele, suggesting a complicated role of TNFA –308 polymorphism for schizophrenia. Furthermore, a pooled analysis with 2,399 patients with schizophrenia and 3,261 controls found that the TNFA –308 polymorphism was not associated with the development of schizophrenia, same result was given when the sample was stratified into different ethnics by the geographical origin though (i.e, Asian vs. Caucasian), which implicate the ethnic heterogeneity of the polymorphism (Duan et al., 2004). Taken former studies together, our present findings regarding the TNFA –238 and -308 polymorphisms would be in the line with the majorities that did not prove the association of the TNFA -238 and -308 polymorphisms with schizophrenia (Boin et al., 2001;Duan et al., 2004;Handoko et al., 2003;Hanninen et al., 2005;Hashimoto et al., 2004;Meira-Lima et al., 2003;Pae et al., 2003;Riedel et al., 2002;Schwab et al., 2003;Tan et al., 2003;Tsai et al., 2003). Considering the lower frequency of A alleles in the two polymorphisms, we may need to collect larger samples and to conduct family-based studies. It should be also noted that the LD between TNFA –238 and -308 polymorphisms were not found in the present study, which is in line with the previous study (Duan et al., 2004), indicating less information of haplotype construction of the two polymorphisms for the development of schizophrenia until now, although available information on the LD on the TNFA polymorphisms would enhance the knowledge about the possible causative genes (Duan et al., 2004;Handoko et al., 2003;Tan et al., 2003). We found the subjects carrying TNFA -238 A allele (genotype AA or AG) were associated with positive familial history, suggesting this polymorphism would be an indicator for familial tendency of schizophrenia. However, the sub-analyses were performed with very small samples so that we need to be cautious in the interpretation of this finding. There have been little studies in relation to TNFA polymorphisms and antipsychotic treatment response. Recent study (Tsai et al., 155

Gene Therapy and Molecular Biology Vol 13, page 156! Consecutive studies with larger sample would be needed to draw any confirmative conclusion.

Kaluza W, Reuss E, Grossmann S, Hug R, Schopf RE, Galle PR, Maerker-Hermann E, and Hoehler T (2000) Different transcriptional activity and in vitro TNF-alpha production in psoriasis patients carrying the TNF-alpha 238A promoter polymorphism. J Invest Dermatol 114, 1180-3. Kampman O, Anttila S, Illi A, Mattila KM, Rontu R, Leinonen E, and Lehtimaki T (2005) Interaction of tumor necrosis alpha G308A and epidermal growth factor gene polymorphisms in early-onset schizophrenia. Eur Arch Psychiatry Clin Neurosci 255, 279-83. Kay SR, Opler LA, and Lindenmayer JP (1988) Reliability and validity of the positive and negative syndrome scale for schizophrenics. Psychiatry Res 23, 99-110. Kubota T, Fang J, Guan Z, Brown RA, and Krueger JM (2001) Vagotomy attenuates tumor necrosis factor-alpha-induced sleep and EEG delta-activity in rats. Am J Physiol Regul Integr Comp Physiol 280, R1213-20. Meira-Lima IV, Pereira AC, Mota GF, Floriano M, Araujo F, Mansur AJ, Krieger JE, and Vallada H (2003) Analysis of a polymorphism in the promoter region of the tumor necrosis factor alpha gene in schizophrenia and bipolar disorder: further support for an association with schizophrenia. Mol Psychiatry 8, 718-20. Monteleone P, Fabrazzo M, Tortorella A, and Maj M (1997) Plasma levels of interleukin-6 and tumor necrosis factor alpha in chronic schizophrenia: effects of clozapine treatment. Psychiatry Res 71, 11-7. Morar B, Schwab SG, Albus M, Maier W, Lerer B, and Wildenauer DB (2007) Evaluation of association of SNPs in the TNF alpha gene region with schizophrenia. Am J Med Genet B Neuropsychiatr Genet 144B, 318-24. Muller N, and Ackenheil M (1998) Psychoneuroimmunology and the cytokine action in the CNS: implications for psychiatric disorders. Prog Neuropsychopharmacol Biol Psychiatry 22, 1-33. Naudin J, Capo C, Giusano B, Mege JL, and Azorin JM (1997) A differential role for interleukin-6 and tumor necrosis factoralpha in schizophrenia? Schizophr Res 26, 227-33. Pae CU, Chae JH, Bahk WM, Han H, Jun TY, Kim KS, Kwon YS, and Serretti A (2003) Tumor necrosis factor-alpha gene polymorphism at position -308 and schizophrenia in the Korean population. Psychiatry Clin Neurosci 57, 399-403. Reichenberg A, Yirmiya R, Schuld A, Kraus T, Haack M, Morag A, and Pollmacher T (2001) Cytokine-associated emotional and cognitive disturbances in humans. Arch Gen Psychiatry 58, 445-52. Riedel M, Kronig H, Schwarz MJ, Engel RR, Kuhn KU, Sikorski C, Sokullu S, Ackenheil M, Moller HJ, and Muller N (2002) No association between the G308A polymorphism of the tumor necrosis factor-alpha gene and schizophrenia. Eur Arch Psychiatry Clin Neurosci 252, 232-4. Sacchetti E, Bocchio-Chiavetto L, Valsecchi P, Scassellati C, Pasqualetti P, Bonvicini C, Corsini P, Rossi G, Cesana BM, Barlati S, and Gennarelli M (2007) -G308A tumor necrosis factor alpha functional polymorphism and schizophrenia risk: meta-analysis plus association study. Brain Behav Immun 21, 450-7. Saviouk V, Chow EW, Bassett AS, and Brzustowicz LM (2005) Tumor necrosis factor promoter haplotype associated with

Acknowledgment This study was supported by a grant of the Korean Health 21 R & D Project, Ministry of Health and Welfare, Republic of Korea (03-PJ10-PG13-GD01-0002 or A030001) and a support from the Medical Research Center, Korea Science and Engineering Foundation, Republic of Korea (R13-2002-005-04001-0).

References American PA (1994). "Diagnostic and Statistical Manual of Mental Disorder, fourth ed.,." American Psychiatric Press, Washington DC. Boin F, Zanardini R, Pioli R, Altamura CA, Maes M, and Gennarelli M (2001) Association between -G308A tumor necrosis factor alpha gene polymorphism and schizophrenia. Mol Psychiatry 6, 79-82. Czerski PM, Rybakowski F, Kapelski P, Rybakowski JK, Dmitrzak-Weglarz M, Leszczynska-Rodziewicz A, Slopien A, Skibinska M, Kaczmarkiewicz-Fass M, and Hauser J (2008) Association of tumor necrosis factor -308G/A promoter polymorphism with schizophrenia and bipolar affective disorder in a Polish population. Neuropsychobiology 57, 8894. Duan S, Xu Y, Chen W, Liu Z, Guo T, Gao J, Bian L, Zhen Y, Li X, Zhang X, Pan Y, Gu N, Feng G, and He L (2004) No association between the promoter variants of tumor necrosis factor alpha (TNF-alpha) and schizophrenia in Chinese Han population. Neurosci Lett 366, 139-43. Erbagci AB, Herken H, Koyluoglu O, Yilmaz N, and Tarakcioglu M (2001) Serum IL-1beta, sIL-2R, IL-6, IL-8 and TNF-alpha in schizophrenic patients, relation with symptomatology and responsiveness to risperidone treatment. Mediators Inflamm 10, 109-15. First MB, Spitzer RL, Gibbon M, and Williams JBW (1997). "Structured Clinical Interview for DSM-IV-Clinician Version (SCID-CV)." American Psychiatric Press, Washington DC. Handoko HY, Nancarrow DJ, Hayward NK, Ohaeri JU, Aghanwa H, McGrath JJ, Levinson DF, Johns C, Walters MK, Nertney DA, Srinivasan TN, Thara R, and Mowry BJ (2003) Tumor necrosis factor haplotype analysis amongst schizophrenia probands from four distinct populations in the Asia-Pacific region. Am J Med Genet B Neuropsychiatr Genet 121B, 16. Hanninen K, Katila H, Rontu R, Mattila KM, Hurme M, and Lehtimaki T (2005) Tumor necrosis factor-alpha --G308A polymorphism in schizophrenia in a Finnish population. Neurosci Lett 385, 76-81. Hashimoto R, Yoshida M, Ozaki N, Yamanouchi Y, Iwata N, Suzuki T, Kitajima T, Tatsumi M, Kamijima K, and Kunugi H (2004) Association analysis of the -308G>A promoter polymorphism of the tumor necrosis factor alpha (TNF-alpha) gene in Japanese patients with schizophrenia. J Neural Transm 111, 217-21. Holden RJ, and Pakula IS (1999) Tumor necrosis factor-alpha: is there a continuum of liability between stress, anxiety states and anorexia nervosa? Med Hypotheses 52, 155-62.

156

Pae et al:

Association analysis of the Tumor necrosis factor gene polymorphisms

! schizophrenia reveals a linked locus on 1q44. Mol Psychiatry 10, 375-83. Schwab SG, Hallmayer J, Albus M, Lerer B, Eckstein GN, Borrmann M, Segman RH, Hanses C, Freymann J, Yakir A, Trixler M, Falkai P, Rietschel M, Maier W, and Wildenauer DB (2000) A genome-wide autosomal screen for schizophrenia susceptibility loci in 71 families with affected siblings: support for loci on chromosome 10p and 6. Mol Psychiatry 5, 638-49. Schwab SG, Mondabon S, Knapp M, Albus M, Hallmayer J, Borrmann-Hassenbach M, Trixler M, Gross M, Schulze TG, Rietschel M, Lerer B, Maier W, and Wildenauer DB (2003) Association of tumor necrosis factor alpha gene -G308A polymorphism with schizophrenia. Schizophr Res 65, 19-25. Serretti A, Macciardi F, Cusin C, Lattuada E, Lilli R, Di Bella D, Catalano M, and Smeraldi E (1999) No interaction of GABA(A) alpha-1 subunit and dopamine receptor D4 exon 3 genes in symptomatology of major psychoses. Am J Med Genet 88, 44-9. Sham PC, and Curtis D (1995) Monte Carlo tests for associations between disease and alleles at highly polymorphic loci. Ann Hum Genet 59, 97-105. Shirts BH, Bamne M, Kim JJ, Talkowski M, Wood J, Yolken R, and Nimgaonkar VL (2006) A comprehensive genetic association and functional study of TNF in schizophrenia risk. Schizophr Res 83, 7-13. Strieter RM, Kunkel SL, and Bone RC (1993) Role of tumor necrosis factor-alpha in disease states and inflammation. Crit

Care Med 21, S447-63. Tan EC, Chong SA, Tan CH, Teo YY, Peng K, and Mahendran R (2003) Tumor necrosis factor-alpha gene promoter polymorphisms in chronic schizophrenia. Biol Psychiatry 54, 1205-11. Tsai SJ, Hong CJ, Yu YW, Lin CH, and Liu LL (2003) No association of tumor necrosis factor alpha gene polymorphisms with schizophrenia or response to clozapine. Schizophr Res 65, 27-32. Watanabe Y, Muratake T, Kaneko N, Fukui N, Nara Y, and Someya T (2007) No association between the tumor necrosis factor-alpha gene promoter polymorphisms and schizophrenia in a Japanese population. Psychiatry Res 153, 1-6. Wilson AG, Gordon C, di Giovine FS, de Vries N, van de Putte LB, Emery P, and Duff GW (1994) A genetic association between systemic lupus erythematosus and tumor necrosis factor alpha. Eur J Immunol 24, 191-5. Xie X, and Ott J (1993) Testing linkage disequilibrium between a disease gene and marker loci. Am. J. Hum. Genet. 53, (Suppl) 1107. Zai G, Muller DJ, Volavka J, Czobor P, Lieberman JA, Meltzer HY, and Kennedy JL (2006) Family and case-control association study of the tumor necrosis factor-alpha (TNFalpha) gene with schizophrenia and response to antipsychotic medication. Psychopharmacology (Berl) 188, 171-82. Zhao JH (2004) 2LD, GENECOUNTING and HAP: Computer programs for linkage disequilibrium analysis. Bioinformatics 20, 1325-6.

157

Gene Therapy and Molecular Biology Vol 13, page 158 Gene Ther Mol Biol Vol 13, 158-185, 2009

Learning from cancer: The adaptive growth, wound and immune responses Review Article

Gary Robert Smith1* and Sotiris Missailidis2 1

Research Department, Perses Biosystems Limited, University of Warwick Science Park, Coventry, CV4 7EZ, UK Department of Chemistry and Analytical Sciences, The Open University, Walton Hall, Milton Keynes, MK7 6AA _____________________________________________________________________________________________ 2

*Correspodence: Gary Robert Smith, Research Department, Perses Biosystems Limited, University of Warwick Science Park, Coventry, CV4 7EZ, UK; e-mail: gary.smith@persescomms.com Keywords: Cancer, inflammation, immunity, angiotensin, AT1 receptors, AT1 inhibitors, ACE inhibitors, Oxidative Stress, Hypoxia, Wound, Growth Received: 2 February 2009; Revised: 25 February 2009 Accepted: 22 May 2009; electronically published: 5 June 2009

Summary The life cycle of cancer, and solid tumours in particular, can be usefully simplified into two phases of the disease; the earlier phase where change in intracellular processes is required for carcinogenesis and the later phase, malignancy, where the continued development of the cancer relies on the support of extra-cellular processes. From this systems view of cancer and the failure modes of healthy biological processes associated with it, a three-vector portrayal of cellular dynamics is abstracted. This overarching framework for the direction of biosystem responses places the categorisation of disease at the extreme points of these vectors and provides an explanation for their cause. Furthermore, laboratory and clinical evidence suggests that a synergistic systems approach to disease management, based on the manipulation of these vectors, could lead to new paradigms in treatment.

Inflammation is regarded as a key component of the immune system, which ensures that tissues of the body are free of invading organisms and pathogens. When an area is infected, it becomes red, swollen, hot and painful. Another function of inflammation is to support the healing process, by removing cells that have been damaged through injury or by infection. In disease conditions, it is thought that the immune system malfunctions and, instead of attacking invaders and destroying damaged tissue, inflammation starts to destroy healthy tissue, causing biological dysfunction, immune suppression and ultimately death. Chronic inflammation is a critical feature of most diseases; and regardless of the underlying cause, it is the chronic inflammation that ultimately does the damage. There are limited options for treating chronic inflammation; these include Steroids, Non Steroid AntiInflammatory Drugs (NSAIDs) and Disease Modifying Anti-Rheumatoid Drugs (DMARDs). Furthermore, Steroids and DMARDs in particular have side effects and mechanisms of action that are not completely understood. In the developed countries, cancer is becoming the top killer, outpacing the circulatory diseases that cause strokes and heart attacks. One reason for this is the understanding of the importance of “bad” cholesterol and the establishment of statin drugs to treat it. Clinical studies and epidemiological data have additionally led many to suggest that statins (Health News, 2008; Shafiq et al,

I. Background In 1900, Lord Kelvin famously stated, "There is nothing new to be discovered in physics now. All that remains is more and more precise measurement." Whilst the accumulation of knowledge can benefit from a reductionist approach, to provide insight into system component behaviour, being able to consider the “big picture” remains of vital importance. This ability to step back objectively from the detail is restricted or even prevented by “established wisdom”, and, as a result, great leaps in understanding are sometimes achieved through unexpected sources and events. Five years after Lord Kelvin’s statement, Albert Einstein published his paper on special relativity, which challenged the very simple set of rules laid down by Newtonian mechanics that had been used to describe force and motion for over two hundred years. One could argue that all that Einstein had done was to provide a new way of looking at established data, but the legacy of Einstein’s thinking has revolutionised our world. In 1970, T. S. Kuhn, in The Structure of Scientific Revolutions, argued that scientists work by creating a comprehensive "paradigm". He stated that one of the first signs that a paradigm is shifting is the discovery of facts that seem significant and indisputably true, but cannot be explained by the current model (Kaufman, 1987). One such case is the puzzling role of inflammation: 158

Smith and Missailidis: Learning from cancer 2005; John Hopkins Medical Letters, 2002), like aspirin before them, may be wonder drugs with benefits perceived in many diseases (cancer, infections, degenerative disorders etc). The mechanisms, once again, are not currently fully understood or accepted, however, an antiinflammatory link in both cases has been proposed (Athyros et al., 2009; Villard and Mach, 2002). Despite a substantial methodological revolution, the discovery of the human genome and the ascendancy of advanced techniques in bioinformatics, the rate of introduction of new drugs into the market continues to decline steadily since the mid 1980s. Much of modern drug discovery starts at basic chemistry, described as “lead finding” and is the identification of molecules that have the potential to interfere with biochemical processes. The depth of this targeting has now reached the genetic code itself and to the intricate details of interaction that would be unobtainable without these emerging genetic techniques, the vast majority of drug targeting being now within the circuitry of the cell itself. Certainly the low productivity in new drugs is not limited by finance or lack of market, as budgets and research intensity have increased 30-fold since the 1970s (Cuatrecasas, 2006). Falling productivity has been blamed on factors such as increased regulatory hurdles and high attrition of drug candidates. At the heart of the problem, however, might be the more profound underlying business and management dynamics that reinforce a silo approach in research and development. An example of the encouragement of this reductionist approach to research can be seen in cancer. Cancer is no longer considered from a research perspective as a systemic disease, but instead those who fund, research and investigate it specialise in a particular type, for instance lung or breast cancer. It seems also that the majority of effort delves deep into the genetics of the cell in an attempt to put right, that which has gone wrong. There is a sound logic behind this specialisation, as the scientific method employed in trials and the need to standardise the patients being treated as much as is practically possible supports statistical analysis. The downside to this, of course, is that the encouragement of specialisation inadvertently discourages a systems approach. “There are more than 200 types of cancer, each with different causes, symptoms and treatments.” – Cancer Research UK. http://info.cancerresearchuk.org/cancerstats/incidenc e/?a=5441 The purpose of this paper has intent in some way to offer a different view of cancer and its potential treatments.

inhibitors, Growth Receptor Blockers and immune boosting agents such as vaccines, only marginal benefits have so far been realised. The focus for patients then turns to palliative care with, unfortunately, no realistic hope of recovery. In the 'Hallmarks of Cancer', the authoritative work by (Hanahan and Weinberg 2000), a new approach was described that analysed the evolutionary-acquired capabilities necessary for cancer cells to become lifethreatening tumours. Figure 1, adapted from ‘Hallmarks of Cancer’ below, highlights (in red) some of those common defects in growth, anti-growth and death controls that are necessary for normal cells to become cancerous and tumours to form. Inflammation has strong links with Cancer in promoting these changes in cells, increasing the risk of genetic damage. Inflammation from infection, injury and stress or aggravators, such as smoking or asbestos, is known to create cancers and is recognized in the literature (Anand et al, 2008; Azad et al, 2008; Munteanu and Didilescu, 2007; Brody and Spira, 2006; Smith et al, 2006). The most compelling case for the use of NSAIDs as a preventative regimen is shown in colorectal cancers, where a recent large cohort study (Jacobs et al, 2007) of cancer incidence populations, among whom colorectal, prostate, and breast cancers are common, indicates that long-term daily use of adult-strength aspirin is associated with modestly reduced overall cancer incidence. The US Preventative Services Task Force in their recommendation statement (US Preventive Services Task Force, 2007) regarding routine aspirin or NSAIDs for the primary prevention of colorectal cancer, concluded that aspirin appears to be effective at reducing the incidence of colonic adenoma and colorectal cancer, especially if used in high doses for more than 10 years. However, considering the possible harms of such a practice, on balance, the benefits do not appear, as yet, significant enough. In a subsequent study of aspirin-associated reduction in colorectal cancer, risk protection appeared to be limited to COX-2– expressing cancers (Chan et al, 2007) and wider understanding of the role of inflammation in cancer suggests that this study actually identifies a potential subset of patients who would benefit from NSAIDs as a treatment. Furthermore, it is now emerging that the role of inflammation in cancer is just as significant, if not even more so, in the advancement of cancers to metastatic disease (Smith and Missailidis, 2004; Whiteside, 2008; Menke et al, 2008; Dalgleish and O’Byrne, 2006). This would seem to occur because once cancer cells evolve to ignore programmed cell death, the uncontrolled proliferation of cells causes a micro-environmental stress that provokes an inflammatory response (Sica et al, 2008; Witeside, 2006; Lee et al, 2008). The resultant influx of inflammatory cells (Sica et al, 2008) and immune cells (Whiteside, 2006) into the microenvironment is ineffective against the cancer, due to its cells having developed resistance to death signals. The inflammation, instead, exerts its effect on the healthy tissue and promotes many essential environmental support processes, necessary for the cancer to flourish and disseminate (Lee et al, 2008; Peebles et al, 2007):

II. Visualising cancer – its two defining processes In malignant disease there is still little effective treatment for metastatic cancer once all known options, cytotoxic agents, radiotherapy, hormone therapy, cysteine and monoclonal antibodies (dependent on tumour type), for limiting disease are exhausted (Dolle et al, 2006). Despite significant investment in new targeting agents such as Vascular Endothelium Growth Factor (VEGF) 159

Gene Therapy and Molecular Biology Vol 13, page 160 • Apoptosis (programmed cell death) of the surrounding normal cells (Drakopanagiotakis et al, 2008). • Angiogenesis (growth of new blood vessels in an attempt to relieve oxygen deprivation) (Kundu and Surh, 2008). • Invasion, through a breaking down of the extra cellular matrix and increased cell motility (Marastoni et al, 2008).

• Progressive immune suppression as the inflammation becomes chronic and systemic (Whiteside, 2008). • Metastasis, through the release of cancerous cells into the bloodstream of the immune suppressed organism.

Figure 1: The key control signals which ensure that normal cells are maintained in homeostasis with their environment are presented. The figure also highlights some of the common genetic changes that have to occur for cells to circumvent these controls and for carcinogenesis to occur.

This is reflected in a direct relationship between systemic and chronic inflammation and patient mortality (Erlinger et al, 2004; Shankar et al, 2006; Taranova et al, 2008). Indeed it has been proposed that the reversal of these processes by improving the microenvironment would provide a new therapeutic approach (Smith and Missailidis, 2004; Ingber, 2008). A number of studies support, directly or indirectly the proposed hypothesis. The establishment of the link between chronic inflammation and cancer has result some great therapeutic successes, as is the case with Helicobacter Pylori in its

evasion of the immune system and progression in peptic ulcer disease, for which Marshall and Warren were awarded the 2005 Nobel Prize http://nobelprize.org/nobel_prizes/medicine/laureates/2005 /press.html. Furthermore, the invasiveness and immune suppression of many cancers appears dependent on induced chronic inflammation. Work by Slaviero et al (2003) suggests that the effectiveness of conventional drug treatments is impeded by the inflammatory response. Thus, strategies to resolve cancer induced inflammation and wounding must form a vital component in therapy. 160

Smith and Missailidis: Learning from cancer This has been tested in various clinical trials so far, both as preventatives and as curative strategies, with more planned for 2009. Cyclooxygenase-2 (COX-2) over expression is seen in many malignancies, including lung, breast, prostate, colorectal, oesophageal and pancreatic cancer, which has led to growing interest in the therapeutic potential of NSAIDs (and more recently specific PGE2 inhibitors) as an adjunct to existing radiotherapy and chemotherapy (Mann et al, 2005). Furthermore, Ferrari et al (2006) have reported that Gemcitabine, in combination with celecoxib, during a Phase II trial showed low toxicity, good clinical benefit rate and good disease control. Reckamp et al reported that Erlotinib (an EGFR tyrosine kinase inhibitor) in combination with celecoxib, during a Phase I trial (Reckamp et al, 2006), demonstrated objective responses with an acceptable toxicity profile in non–small cell lung cancer. In the Altorki et al (2003) phase II trial, the patients were treated with two preoperative cycles of paclitaxel and carboplatin, as well as daily celecoxib, followed by surgical resection. The results suggested that the addition of a selective COX-2 inhibitor enhanced the response to preoperative paclitaxel and carboplatin in patients with NSCLC, although Lilenbaum et al (2006) report that the addition of celecoxib failed to deliver any additional benefits when combined with Docetaxel/Irinotecan or Gemcitabine/Irinotecan during a phase II trial in the Second-Line Treatment of Non–Small-Cell Lung Cancer. In a study of 586 patients with prostate cancer who have had radiotherapy (Khor et al, 2007), an association of COX-2 expression with patient outcome was found. The association of increasing COX-2 expression with biochemical failure, distant metastasis, and failure in treatment, also suggests that COX-2 inhibitors might improve patient response to radiotherapy. Another principal mediator of inflammation, tumour Necrosis Factor Alpha (TNF-a), is also under investigation and early clinical results using TNF-a blockers are encouraging in advanced cancer, showing some improvement in disease stability (Brown et al, 2008; Harrison et al, 2007). The importance of the relationship between inflammation and mortality has also led to the development of the “Glasgow prognosis score” GPS. The GPS (derived from an elevated C-reactive protein concentration and hypoalbuminaemia) has been validated and evaluated as an independent factor in more than 1,000 patients with a variety of advanced cancers including lung (Forrest et al, 2004), gastro-oesophageal (Deans et al, 2009; Sharma et al, 2008; Kobayashi et al, 2008), pancreatic, colorectal (Neal et al, 2009; Sharma et al, 2008), breast, ovarian (Sharma et al, 2008) and renal cancers. Due to its success in evaluating risk of cancer progression and survival, it is now becoming widely adopted in the routine assessment and stratification of patients with advanced cancer. Surprisingly, however, perhaps the best hope for the treatment of metastatic cancer is with an existing drug whose potent pleiotropic anti-inflammatory properties are only just becoming more widely recognized (Hunyady and Catt, 2006).

III. Systems thinking – Angiotensin, a new role in cancer Angiotensin II (Ang II) is a peptide hormone within the Renin-Angiotensin System (RAS), overviewed in Figure , generated from the precursor protein angiotensinogen, by the actions of renin-angiotensin converting enzyme, chymases and various carboxy- and amino-peptidases. The RAS plays a part in maintaining blood pressure, water and electrolyte homeostasis, and drugs have been developed to manipulate this system and lower blood pressure in the treatment of cardiovascular diseases. Angiotensin Converting Enzyme (ACE) Inhibitors, now in widespread use, block the production of Ang II, though in some cases they cause coughing due to activated Bradykinin. Angiotensin Receptor Blockers were specifically developed to avoid this side effect by blocking the Ang II Type 1 receptor (AT1), highlighted in Figure . In humans, insertion/deletion polymorphisms in the Angiotensin Converting Enzyme gene, which affect the efficiency of the enzyme in cleaving Angiotensin I, have been found to have an important influence on the progression of cancers and other diseases (Moskowitz and Johnson, 2004). The Deletion/Deletion (DD) phenotype, which is the most efficient in producing Ang II, has been noted to increase invasion, metastasis and decrease survival in a variety of solid tumours in comparison to Insertion/Deletion (I/D) and Insertion/Insertion (II) phenotypes: gastric (Rocken et al, 2007), oral (Vairaktaris et al, 2007), prostrate (Yigit et al, 2007), NSCLC, colorectal (Rocken et al, 2007) and breast cancer (Yaren et al, 2007). Furthermore, in a recent study of 172 advanced cancer patients (NSCLC and gastrointestinal) a positive correlation between white blood cell count, CRP, ACE concentration and ACE phenotype (DD>ID>II) has been found (Vigano et al, 2009).

Figure 2: An overview of the classically defined Renin Angiotensin System

161

Gene Therapy and Molecular Biology Vol 13, page 162

B. AT1 receptor expression in ovarian cancer patients In the tissue of 67 ovarian cancer patients, AT1 receptors were found in 85% of the cases examined, and 55% were strongly positive (Ino et al, 2006). In patients who had positive tissue staining for AT1, the overall survival and progression-free survival were significantly poor (P = 0.041 and 0.017, respectively) as compared to those in patients who had negative staining for AT1. Overall five-year survival of patients (Chart A below) with negative expression AT1 (-) was 100% (n=10), AT1 (+) (positive expression) 45.8% (n=18) and AT1 (++) (very strong expression) 55.7% (n=30). Tumour progression in the five-year period had associated simultaneous VEGF (Figure 5, Chart D) and AT1 expression (Figure 5, Charts A&B) measured by immunohistochemical staining of the ovarian cancer tissue. ACE polymorphisms were not considered in this study.

C. AT1 receptor expression in cervical cancer patients

Figure 3: Schematic outline of the local angiotensin system. Angiotensin I (Ang I) is cleaved by ACE into Ang II (Ang II), which then binds to angiotensin receptor type 1 (AT1R) and type 2 (AT2R).

Expression of AT1 receptor in normal and neoplastic tissues was measured by immunohistochemistry by Kikkara et al in their study of Cervical cancer patients (Kikkawa et al, 2004). Mean staining intensity level was stronger in invasive carcinoma cells than in normal dysplasia, and carcinoma in situ tissues. Ang II induced the secretion of VEGF from Siha cells and promoted their invasive potential. Laio et al (Liao et al, 2007) have also obtained similar conclusions to Kikkara et al (2004), in another study, where the clinical significance of AT1 was investigated in cervical cancer progression. AT1 mRNA expression was examined by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) in paraffin-embedded tissues from 35 cases of cervical squamous cell carcinoma, 15 cases of cervical intraepithelial neoplasia, and 15 cases of normal cervix. The rate of AT1 expression mRNA was 77.1%, 40.0% and 0, respectively, in squamous cell carcinomas, cervical intraepithelial neoplasia and normal cervical tissues, while their mRNA quantities were 0.3863 +/- 0.041, 0.0768 +/0.035 and 0, respectively. There was a statistically significant difference between them (P < 0.01). The average staining intensity of AT1 protein was found to be stronger in invasive carcinoma cells than that in dysplasia tissues and normal ones (P < 0.01).

A. AT1 receptor expression in gastric cancer patients In 100 patients, the combination of AT1 expression in tumour epithelial cells and ACE gene polymorphism, directly correlated with nodal spread and decreased patient survival (Rocken et al, 2007). Figure , below, shows the Keplan-Meier survival curve for this patient population, where patients with AT1 expression had no survival beyond 4 years and those lacking AT1 expression approached 60% survival at 7 years.

D. AT1 receptor expression in brain cancer patients In 133 tumours from patients with astrocytoma (Arrieta et al, 2008), 10% of low-grade astrocytomas were found to be positive for AT1, whereas grade III and IV astrocytomas were positive in 67% (P<0.001). AT1positive tumours showed higher cellular proliferation and vascular density and had a lower survival rate than those with AT1-negative (P<0.001). Patients with AT1 receptor positive had less survival compared to the negative ones, 9.5 months versus 16.5 months. AT1 expression also correlated with increased expression of VEGF and PDGF.

Figure 4: Kaplan-Meier survival curves for the presence (positive) or absence (negative) of AT1R in gastric cancer cells. Patients with AT1R+ gastric cancer cells had significantly shorter survival times than patients with AT1Râ&#x20AC;&#x201C; tumour cells.

162

Smith and Missailidis: Learning from cancer

Figure 5: Overall survival and progression-free survival of 67 ovarian cancer patients over a five-year study with respect to AT1 and VEGF expression

E. AT1 receptor expression in pancreatic cancer patients

concluded that the growth of the cancer in mice lacking AT1 was significantly impaired in comparison to wildtype mice and that associated VEGF expression and angiogenesis was reduced. In the AT1 knock out mice (those that lacked the genes for AT1), tumour derived AT1 expression (the tumour still having the genes for AT1) still occurred, although to a lesser degree, and administration of Candesartan showed further reductions of tumour growth. The key message from this study is that AT1 derived, both in the surrounding host tissue and in the cancer cells, is important for the progression of the tumour.

In 19 of the 25-neoplastic tissues examined in patients (approximately 75%), ACE and AT1 mRNA and protein levels were significantly upregulated when compared to healthy tissue (Shibata et al, 2005). ACE/AT1-negative tumours were found in only 2 cases (8%). VEGF expression was significantly higher in the tissues that expressed high levels of AT1 and ACE and these were co-localized in the malignant ducts and the surrounding tissue.

F. AT1 receptor expression in endometrial cancer patients

H. ACE inhibitor reduces tumour growth in a mouse model

In 94 cases, a positive correlation between Ang II expression and surgical stage (p = 0.01) was found (Shibata et al, 2005). Of the 94 cases, 56 (59.6%) expressed AT1 and 73 (77.7%) VEGF. The presence of Ang II and AT1 expression was associated with a significantly poorer prognosis.

In another mouse model using implanted cancer forming LNM35 human lung cells (Attoub et al, 2008), treatment with ACE Inhibitor Captopril (2.8 mg/mouse) for 3 weeks resulted in a remarkable reduction of tumour growth (58%, P < 0.01) and lymph node metastasis (50%, P= 0.088). There were no undesirable effects of Captopril treatment on animal behaviour and body weight.

G. Mouse model confirms the role of both host and tumour derived AT1 in the progression of disease

I. Candesartan dramatically reduces cancer metastasis in a mouse model

Using a mouse model of Lewis lung carcinoma (a mouse derived experimental transportable lung carcinoma also known as 3LL or LLC) (Imai et al, 2007), the study

The protective effects of Candesartan, an AT1 antagonist, (10 mg/kg) in a 16-day mouse renal cancer 163

Gene Therapy and Molecular Biology Vol 13, page 164 lung metastasis model have been demonstrated by Miyajima et al (2002). In the model, metastases to the lung showed prominent AT1 expression and Candesartan treatment dramatically prevented the formation of additional nodules (14.9 ± 1.8; P < 0.0001; n = 12) compared with control metastatic mice (123.3 ± 8.6; n = 13). It was noted that the use of Candesartan also resulted in the inhibition of VEGF expression and neovascularization.

Kickenig et al, 1997; Hu et al, 2008). The expression and activation of AT1 receptors is thus coordinating a stress (or injury/wound) response (Figure 6) (Smith, 2008). In addition to the mediators reviewed by Smith and Missailidis (2004) and Suzuki et al (2003), a full spectrum of important molecules involved in the cellular response to stress are induced by the AT1 receptor (Figure 7). These include the pro-inflammatory mediators Interleukin-1 beta (IL-1b), tumour Necrosis Factor-alpha (TNF-!), Interleukin-6 (IL-6) and cyclooxygenase-2 (COX-2), in addition to many other agents that promote the influx and migration of immune and inflammatory cells, the growth of new blood vessels (notably VEGF) and tissue remodelling (notably Matrix Metalloproteinases and Transforming Growth Factor-Beta (TGF-B)). With the role of AT1 in cancer and cardiovascular disease established, when the literature of other diseases is reviewed, it is reasonable to anticipate that the role of this receptor is system-wide with regard to chronic inflammation and injury. Fortunately, interest in the wider implications of the AT1 receptor within disease is increasing and these studies together, summarised in Table 1, further substantiate its systemic role. Searches across the literature for ACE gene polymorphisms also substantiate this relationship with disease and injury, with a positive correlation found in Alzheimer’s disease (Yand and Liu, 2008), Rheumatoid Arthritis (Uppal et al, 2007), Parkinson’s (Lin et al, 2002), Tuberculosis (Ogarkov et al, 2008), Lupus (Rabbani et al, 2008), Sarcoidosis (Tahir et al, 2007), COPD (Busquets et al, 2007), Asthma (Gao et al, 2000), Ulcerative colitis (but not Crohn’s) (Saibeni et al, 2007), Myalgic Encephalomyelitis (Chronic Fatigue Syndrome) (Vladutiu and Natelson, 2004), Depression (Bondy et al, 2005), suicidal behaviours (Sparks et al, 2009), late respiratory complications of mustard gas exposure (Hosseini-Khalili et al, 2008), long term effects of radiation poisoning (Kehoe et al, 2009), and Type II Diabetes (Ramachandran et al, 2008). Some inflammatory diseases, such as Crohn’s, appear neutral with respect to ACE polymorphism. However, this may be due to the presence and activity of the AT2 receptor or wider aspects of the Angiotensin System that still require further exploration (such as the ACE2 and Ang pathways (Kaufman, 1987; Health News, 2008; Shafiq et al, 2005; Hohn Hopkins Medical Letters, 2002; Athyros et al, 2009; Veillard and Mach, 2002; Cuatrecasas et al, 2006).

IV. AT1, the pathway to the injury response The question that then arises is why should manipulation of the Angiotensin system have such a profound effect on the progression of tumours. If one was to consider that the mechanism might be antiinflammatory, then the answer suggests that blockade of AT1 leads to a fundamental change in the mechanism of the disease and not merely tinkering with one component. In ‘Atherosclerosis - an inflammatory disease’ the seminal work by Russell Ross that explained an injury response as the cause of this disease, he also explained that the cellular interactions in atherogenesis are fundamentally no different from those in chronic inflammatory fibroproliferative diseases such as cirrhosis, rheumatoid arthritis, glomerulosclerosis, pulmonary fibrosis, and chronic pancreatitis (Ross, 1999). Additionally Ross et al in their review of atherosclerosis and cancer suggest that there are common molecular pathways of disease development and progression in these diseases (Ross et al, 2001). They conclude that a series of molecular pathways of disease development and progression are also common to atherosclerosis and cancer; that the world's two most common diseases are far more closely aligned than previously believed and that emerging anti-inflammatory and antiproliferative therapeutic strategies may ultimately be efficacious in both conditions. The role and benefits of Angiotensin Receptor Blockade in the treatment of Cardiovascular disease and Atherosclerosis is now widely accepted. Furthermore, the mechanism of not just how, but also, more importantly, why is now understood. TGF-beta, a powerful cytokine commonly found in blood plasma, has important regulation, inflammation, healing and repair functions. The ability of TGF-Beta to suppress carcinogenesis is recognised to be of great importance; however, tumour cells do ultimately evolve to avoid its growth inhibitory and apoptotic effects. Malignant tumours themselves express TGF-beta to their advantage, promoting angiogenesis, the remodelling and destruction of surrounding healthy tissue, and also immune suppression. Efforts through journal literature review to discover the means by which cancers are able to generate TGF-beta, allowed the authors to conclude that it was in fact through increased extracellular presentation of Angiotensin II Type 1 receptor (Smith and Missailidis, 2004). AT1 expression is an endemic reaction by all cells that are under stress: hypoxia (Krick et al, 2005), sheer stress (Yasuda et al, 2008; Hitomi et al, 2006; Delli et al, 2008) and oxidative stress via oxidized LDL acting on the LOX-1 receptor (Watanabe et al, 2001; Li et al, 1999;

V. Developing a cellular response model Inflammation has long been considered a vital defence against invaders and attempts have been made to understand how and why this process becomes selfdestructive in disease processes. The ‘Chronic Inflammation and Angiotensin model’, serves as a useful tool to understand the perceived contradictory nature of inflammation and perhaps suggests why certain ‘overactive immune responses’, characterised by chronic inflammation, could be viewed more appropriately as destruction of the body by the infection, rather than destruction of the infection by the body (Meduri, 2002; 164

Smith and Missailidis: Learning from cancer

Figure 6: AT1 expression is upregulated in tissue stress and injury by the action of Oxidised LDL on scavenger receptors, such as the Lectin-Like Oxidised LDL receptor intracellular hypoxia sensing mechanisms, such as HIF-alpha, and mechanical and physical cellular stress.

Stress Response / wound signalling: Role of AT1

Figure 7: The involvement of not just the cancer cells, but also those normal cells co-opted to support cancer progression in producing and releasing a full spectrum of â&#x20AC;&#x2DC;stress and wound responseâ&#x20AC;&#x2122; mediators is presented.

165

Gene Therapy and Molecular Biology Vol 13, page 166 Table 1: Overview of the diseases in which expression of AT1 is known to be significant. Those markers of the disease affected by AT1 expression are also noted. Organ/Disease

Mediators inhibited by AT1 blockade

Reference

Kidney disease

COX-2, 12-lipooxygenase, MCP-1, and PAI-

Franscini et al, 2002; Vaziri et al, 2007; Esteban et al,

1, activation of NFK", VEGF

2006; Kitayama et al, 2006; Janiak et al, 2006

(Key markers of the disease, including IL-6

Tsang et al, 2004a; Tsang et al, 2004b; Chan and Leung,

Pancreatitis

2009 Type 2 diabetes

NAD(P)H oxidase and increased oxidative

Nakayama et al, 2005

stress in islets of Type 2 diabetes Liver fibrosis cirrhosis

and

TNF-alpha, IL-6 and TGF-beta, NFK"

Yoshiji et al, 2009; Oakley et al, 2009; Iwata et al, 2008; Debernardi-Venon et al, 2007; Ikura et al, 2005; Toblli et al, 2008

Skin

None noted in these studies.

Abiko et al, 1996; Steckelings et al, 2004

Eye, Uveitis, diabetic retinopathy

TNF-alpha, MCP-1 and ICAM-1.

Miyazaki et al, 2008; Nagai et al, 2005; Nakamura et al,

Alzheimer’s, Huntington’s Parkinson’s

None noted in these studies.

Ge and Barnes, 1996

Alzheimer’s,

None noted in these studies.

Ozacmak et al, 2007; Savaskan et al, 2001; Gard, 2004

Parkinson’s

NAPDH Oxidase, microglial activation

Joglar et al, 2009; Rodriguez-Pallares et al, 2008;

2005

and

Grammatopoulos et al, 2007 None noted in this study.

Arganaraz et al, 2008

Muscle and Muscular dystrophy

TGF- "

Sun et al, 2009; Bedair et al, 2008;

Lung Diseases

TNF-alpha, IL-6, and IL-1beta

Shen et al, 2008; Chen et al, 2007; Bullock et al, 2001

Preeclampsia

None noted in these studies.

Irani and Xia, 2008; Xia et al, 2007

Adrenal Gland

LPS-induced aldosterone, COX-2 and IL-6

Sanchez-Lemus et al, 2008

Stomach (gastric ulcers)

‘antiinflammatory response’

Laudanno and Cesolari, 2006

Marfan syndrome

TGF-beta

Habshi et al, 2006

Alcoholism

Reduced alcohol intake

Maul et al, 2005

Bone, haematopoiesis

Arachidonic acid release and MCSF by bone

Richmond et al, 2004

Mesial sclerosis

temporal

marrow stromal cells Colitis

‘Protects against potent ischemia/reperfusion induced pro-inflammatory effects in the colonic microcirculation

166

Riaz et al, 2004

Smith and Missailidis: Learning from cancer Kuhn and Ghannoum, 2003; Lalani et al, 2000; Menaker and Jones, 2003; Nicod et al, 2001). Acceptance of the Injury/Wound Response mechanism as distinct from the Immune Response may provide a possible explanation, since, if cancer is able to generate immune suppression through injury and wounding, then it would seem likely that other invaders or diseases are doing the same. The implication being that Injury/Wound responses act against effective immune responses, and that these processes may therefore be diametrically opposed. The supposition that cells may have dimensional behaviour is not new. Diseases are often considered in terms of a TH1/TH2 imbalance and although this model has since been found to have limitations, it has provided a framework for disease treatment strategy and discussion. Ibragimov et al (2005), describe a mathematical model of atherogenesis as an inflammatory response and more recently, computer modelling has been used as a tool to determine how signal transduction pathways control cellular responses to stimuli. The model derived two groupings of intracellular signals that constitute fundamental dimensions (molecular "basis axes") within the apoptotic-signalling network (Janes et al, 2005). Initial speculation by the authors that cells may have additional dimensional behaviour, beyond the Injury and Immune Responses, led to the consideration of a third candidate: a Growth response and later a central Innate response. A hypothetical model has thus been developed based on the founding principle that cells can change their behaviour in order to respond to changes in their environment. Cells are, however, only able to carry out any one response effectively at a time, such that efforts towards any one will detract from their ability towards the others. The most critical factors in the influence of cell response are considered in this paper and candidates, those that seem currently most likely based on analysis of the available literature, identified as key controlling factors. Three types of factors have been considered, firstly those providing the force or key-driver behind the responses, secondly an accelerator, an agent that directs or speeds up the effect, and lastly a brake, an agent whose role is to regulate the effect. Of course there are many other influencers and supporters of these processes that have their own pleiotropic roles that help to guide and provide feedback. However, what has been attempted here is to identify candidates for the absolute essential core for modelling this process. Despite its simplicity, the resultant model, which is an overarching framework for describing cellular responses, places diseases at the extremes of these responses and provides a useful tool that is capable of predicting disease aetiology and also new possibilities for treatment through the manipulation of the candidate drivers, accelerators and brakes identified.

Histocompatibility Complex (MHC) recognition. MHC proteins supporting antigen presentation on cell's surfaces and TLRs established for early recognition of Pathogen Associated Molecular Patterns. TLRs have been described as the link between innate and adaptive immunity (Pasare and Medzhitov, 2005). However, evidence now supports a broader role for TLR in the recognition and repair of cell damage induced by heat-shock and wounding (Kluwe et al, 2009; Anders et al, 2004; Maung et al, 2005; Jiang et al, 2005; Paterson et al, 2003; Schwacha and Daniel, 2008; Cairns et al, 2008; Breslin et al, 2008; Mollen et al, 2006). Of note is that manipulation of TLR has been demonstrated as a means of immune suppression (Krutzik and Modlin, 2004; Pasare and Medzhitov, 2003; Wu et al, 2009) and postulated to have a controlling role in moderating Regulatory T cells (Sutmuller et al, 2007). In the majority of circumstances, these innate responses (that includes inflammatory mediators such as TNF-alpha) are adequate to deal with the dangers of invaders and damage. None the less, in the course of evolution, necessity has led to the provision of adaptive immune and wound responses.

B. Adaptive process: the wound response The adaptive Wound Response is driven by stresses (including physical, hypoxic and oxidative) and can be considered to provide the motive force behind the response. However, the go signal itself is the AT1 receptor and without the acceleration of the AT1 signal, the wound response will be undertaken at a sedate pace. Indeed, it is foreseen that wound healing will still take place, but in the absence of fibrosis, with complete AT1 blockade. Importantly, it should be noted that although the AT1 receptor promotes TNF-! and COX-2, blockade of the AT1 receptor would not be expected to completely suppress their expression. TNF- !, for instance, is expressed through the activation of TLR2/4 as part of a potentially beneficial innate response (Garay et al, 2007). As the brake, the AT2 receptor is the most natural candidate, as in many studies it has been shown to have antagonistic properties to the AT1 receptor (Heymes and Levy, 1998; Schulman and Raij, 2008). Regarding AT2, although there has been increased research and interest in its role, the area still appears little explored. What is known is that, whilst the AT1 receptor is distributed ubiquitously and abundantly in adult tissues, expression of the AT2 receptor is high in the foetus but low in adult tissues. Mounting evidence also indicates that AT2 receptor expression increases in response to injury, AT1 receptor blocker therapy, and has a significant modulating effect in the wound healing process (Schulman and Raij, 2008; Mizoue et al, 2006; Carey, 2005; Steckelings et al, 2005; Kawajiri et al, 2008). The expression of AT1 and AT2 receptors on fibroblasts present in cardiac fibrosis has been investigated (Tamura et al, 1999). These types of fibroblast are noted for their expression of both AT1 and AT2 receptors and have been used as the basis of a model to learn more about AT2 expression. In this model, the presence of IL-1b, TNF-! and lipopolysaccharides, through induction of NO and cGMP, all down-regulate AT2 with no effect on AT1, leading to a quicker progression of fibrosis. Interestingly,

VI. Healthy Responses A. Homeostasis: the innate response In consideration of the model, the innate response is placed at the centre and represents the starting point for responses by cells in homeostasis. In this state, cells will monitor their environment through cell-mediated signalling such as Toll-Like receptors (TLR) and Major 167

Gene Therapy and Molecular Biology Vol 13, page 168 the continuing presence of pro-inflammatory signals served to delay expression of AT2. This was confirmed in a separate study of AT2 expression in proliferating cells. TGF- "1 and bFGF are shown as powerful inhibitors of AT2 expression, whilst IGF-1, liberated by activated fibroblasts, was shown to significantly induce the expression of AT2 (Li et al, 1998). A recent review/hypothesis paper from Castellon and Hamdi â&#x20AC;&#x2DC;Demystifying the ACE polymorphism: from genetics to biologyâ&#x20AC;&#x2122; (Castellon and Hamdi, 2007), summarizes the current information on the ACE polymorphism and explains its function in the context of cell survival. Castellon and Hamdi also provide a model to understand the role of the ACE enzyme in biology and disease at the organism and population levels that is not inconsistent with the response model proposed in this work. An analysis of the literature thus suggests that the balance of AT1 and AT2 receptors is important in the coordination of the wound responses and that an imbalance of these receptors can lead to disease conditions (Figure 8).

The premise that tissue repair and embryo development share similar processes has also been made by Paul Martin and Suas M Parkhurst (2004) in their review of the parallels between repair and embryo morphogenesis. It is proposed that Retinoic Acid Receptors play the crucial role in signalling when growth and replication should come to a conclusion. Its broad effects are seen not just in the control of disease, notably in various cancers, but also in foetal development (Chytil et al, 1996). Retinoic Acid has also been found to antagonise the wound recognition suppression actions of Glucocorticoids (Lee et al, YEAR) and to down-regulate lung repair processes promoted by IGF-1 (Chetty and Nielsen, 2002). The synergistic inhibitory effects of 1,25(OH)2D3 with Retinoic acid on the growth of epithelial prostrate cells was most marked when Hydrocortisone was eliminated (Peehl et al, 1995). A recent review by Wolf suggests that, in addition to its cell growth inhibition though the Retinoic Acid Receptor, Retinoic acid can also be a cause of cell proliferation through the orphan nuclear receptor peroxisome proliferator-activated receptor (Wolf, 2008). This would support the proposal that it is the receptor and not the ligand that provides the brake in growth.

C. The growth response The growth response is driven by the presence of IGF-1 and without the presence of IGF-1 cells will simply not progress normally through the cell cycle. IGF-1 plays a pivotal role in growth, development and repair of normal and diseased tissue (Joseph Dâ&#x20AC;&#x2122;Ercole and Ye, 2008; Dupont et al, 2003; Giustina et al, 2008). The model proposes that the proliferation of cells is accelerated and guided by steroid receptors such as glucocorticoid receptors and sex steroid receptors (Cheskis et al, 2007). The fact that the activities of many of these candidate accelerators are wider than classically thought is in keeping with this proposal. Glucocorticoid receptor expression, for instance, has been studied in foetal lung development (Gnanalingham et al, 2005) and plays a defining role in tissue development and growth (Seckl and Meaney, 2004). Additionally, Sex Steroid Receptors have been shown to be important in the health and development of non-classically associated systems and organs such as cardiovascular, immune, GI tract liver and skin (Murphy and Korach, 2006; Pelletier and Ren, 2004; GoldmanJohnson et al, 2008). Sex steroids also play a part in tissue wound healing (Gilliver et al, 2008; Gilliver et al, 2007), for example in the skin. Androgens retard repair through the inhibition of re-epithelialization (Gilliver et al, 2009), whilst Estrogens accelerate it. In contrast, Androgens have been reported to promote bone repair (Maus et al, 2008) and both Androgen and Estrogen are recognised factors in long term bone health (Lerner, 2006).

D. Adaptive process: the immune response The adaptive immune response is driven by antigen presentation and this process has been well described (Reis e Sousa, 2004). The host's cells express "self" antigens. These antigens are different from those on the surface of bacteria or on the surface of virally infected host cells or cancer cells. With the exception of non-nucleated cells (including erythrocytes), all cells are capable of presenting antigen and of activating the adaptive response. Some cells are specially equipped to present antigen, and to prime naive T cells. Dendritic cells and B-cells (and to a lesser extent macrophages) are equipped with special immunostimulatory receptors that allow for enhanced activation of T cells, and are termed professional antigen presenting cells (APC). A key step in the adaptive immune response is conditioning or maturing of the APC, where it develops the ability to communicate the antigen to T Cells in the lymph nodes. Several T cell subgroups can be activated by professional APCs, and each type of T cell is specially equipped to deal with each unique toxin or bacterial and viral pathogen. The type of T cell activated, and the type of response generated depends, in part, on the context in which the APC first encountered the antigen.

168

Smith and Missailidis: Learning from cancer

Figure 8: Hypothetical representations contrasting the expression of AT1 and AT2 receptors in the course of healthy wound recovery and disease conditions.

A. Disease state: chronic wound response

Many cytokines have pleiotropic properties that steer either the early (innate) or adaptive (antigen derived) response. Notably, IL-4 is associated with TH2 phenotype and B cell activity, IFN-a with TH1 and macrophages, IL17 with TH17 (Iwakura et al, 2008) and IL-12 with TH0 and CD8. Commonly IL-2 is regarded as having an overarching presence in supporting immune cell population and function, be they ‘inflammatory’ or ‘regulatory’ (Hoyer et al, 2008), whilst IL-10 is generally seen as having an overarching suppressive role.Within this complexity, IL-2 is postulated as the key candidate accelerator of the Adaptive Immune Response, having a significant effect on the progression of the Dendritic Cell lifecycle (Granucci et al, 2003), and IL-10 is proposed as the brake due to its very broad role in regulation (Mocellin et al, 2004; Schneider et al, 2004). Of particular interest is the relationship between dendritic cells and regulatory T cells (Mahnke et al, 2007). Only mature/activated dendritic cells stimulate T cell proliferation, and vice versa, T Regulatory cells are able to affect dendritic cell development, preventing maturation and inducing IL-10. Interestingly, major injury has been reported to induce increased production of interleukin-10 and decreased levels of IL-2 by cells of the immune system, with a negative impact on resistance to infection (Lyons et al, 1997; Miller et al, 2007). The majority of studies also indicate that burn, injury and trauma all reduce the presence of capable dendritic cells as well as cause immune suppression (Muthy et al, 2008; D’Arpa et al, 2009).

The extreme of the wound response lies in the domain of ‘wounds that will not heal’. The type of inflammation associated with cancerinduced wounding is clearly immunosuppressive and many bacteria, fungal and parasitic infections similarly promote wounding as a means of immune suppression. Infection is a recognised risk and progressive factor in cardiovascular disease (Ben-Haim et al, 2009). Suspicion and speculation has also been long ongoing regarding infectious components to many diseases whose causes have been attributed to genetics, failure of the immune system or even psychological causes on the part of the patient. This model may serve as a more logical explanation for autoimmune diseases (Toussirot and Roudier, 2008; Cooke et al, 2008; Pordeus et al, 2008), Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (Lorusso et al, 2009), Autism, Irritable Bowel Syndrome (Boorom, 2007) and neurodegenerative diseases (Arai et al, 2006; Kamer et al, 2008). The model is suggesting that these infections have evolved to promote wounding and chronic inflammation in order to suppress the adaptive immune system. Furthermore, the model would predict that once the host’s immune system is compromised in this way, the individual is then susceptible to additional coinfections and cancer. The question must then arise, why would biosystems evolve what appears to be a blind side in the immune system, such that injury switches off adaptive immunity? The logical answer might be that this compromise has evolved in order to avoid genuine ‘autoimmune’ reactions during wound clearance and remodelling. Ageing is a further promoter of diseases in this domain, as a growing lack of systemic and locally derived IGF-1 leads to susceptibility to invaders and unresolved stresses (Martens et al, 2003; Kjaer et al, 2006). During

VIII. Failure modes in the system: disease states With this three-dimensional framework in place, the categorisation of diseases at the extremes of these vectors is now considered. 169

Gene Therapy and Molecular Biology Vol 13, page 170 normal wound healing, local IGF-1 is released to supplement systemic IGF-1 and generate sufficient AT2 to counteract the activities of AT1. Local IGF-1 is released from the extra-cellular matrix by macrophages (released by the activity of Matrix Metalloproteinases) and is also produced locally via stimulation by activated fibroblasts, monocytes (Todorovic et al, 2008) and T cells (Toulon et al, 2009). Notably, in the Toulon et al study, IGF-1 production could not be detected in T cells isolated from chronic wounds.

In addition to viral strategies that directly stimulate factors for immune suppression through the growth response, it is postulated that the chronic inflammation that arises from liberated viral toxins, particularly when their host cells are destroyed, is also an evolved mechanism to suppress the adaptive immune response (thereby protecting future generations of the virus). A review by Zúñiga MC (2003), ‘Lessons in Détente or know thy host: The immunomodulatory gene products of myxoma virus’, highlights that the virus has evolved to stimulate innate responses and apoptosis of surrounding host cells through the generation of a number of products such as TNF-alpha.

B. Disease state: chronic growth response Beyond lessons in the wound response, much more can be learnt from the behaviour of cancer, in particular, where extremes in growth response can be observed. There are, for instance, many hormone-dependent 'benign' forms of growth, including those that can later become hormone-independent, and malignant. The action of IGF-1 and acceleratory steroids, not only promote the growth of the tumour, but also appear to provide an alternative means of immune suppression (Castro Cabezas et al, 1998; Maruo et al, 2004; Muller and von Werder, 1992; Platet et al, 2004; Sengupta and Wasylyk, 2004; Turney et al, 2004; Giannitrapani et al, 2006). The transition to malignancy through AT1 expression and wound response is most likely marked by growth of the tumour beyond the limits of its environment. In addition, the model serves to explain the increased risk of a cancer becoming malignant, following tissue damage through surgery, chemotherapy or radiotherapy (Baum et al, 2005; Fowble et al, 2001; Kara et al, 2001; Everett et al, 2008; Demicheli et al, 2007). Baum et al, thus, proposes that breast cancer surgery can induce angiogenesis and proliferation of distant dormant micrometastases, especially in young patients with positive nodes. In the category of chronic Growth Response is also Cushing’s syndrome, commonly associated as a side effect of steroid use, and notably, in some cases, caused by tumour-stimulated production of Adrenocorticotropin (Castro Cabezas et al, 1998; Muller and von Werder, 1992; Turney et al, 2004). It would be also logical to expect many viral diseases to be found in this domain, and this is evident in the scientific literature (Brooke and Sapolsky, 2000; Congote, 2005; Iwakiri et al, 2005; Katagiri et al, 2006; Silverman et al, 2005; Sonnex, 1998; Tseng et al, 2005) of the induced Growth Response promoting viral replication and immune suppression. Lawson et al also propose that hormone responsive viruses such as Human papillomaviruses, mouse mammary tumour virus and Epstein-Barr virus may the prime candidate causes of breast cancer (Lawson et al, 2006). Many viruses offer an additional risk to carcinogenesis. All viruses (even those considered benign) have to hijack and promote host cell growth in order to replicate. Numerous mechanisms are employed, DNA and RNA sequences are inserted into the host, growth factors are stimulated and anti-growth factors are suppressed. Viral infections, thus, increase the risk of cell mutation and population growth, and for these reasons provide another target of interest for cancer prevention, with some well known examples shown in Table 2.

Table 2: The marked association between a number of specific cancers and viral infections is highlighted. (http://info.cancerresearchuk.org/cancerstats/causes/in fectiousagents/virusesandcancer/?a=5441#basicmech)

C. Disease state: chronic immune response Perhaps best described as diseases of hypersensitivity and allergy, conditions like Asthma, COPD and Allergic Rhinitis belong in this domain. These diseases often feature tissue that contains a preponderance of sensitised Esonophils, Mast cells and Basophils. Although at the extreme end of chronic immune responses, IL-4 plays undoubtedly an important role in sustaining disorders in this area. On reflection, the affected tissue could again be recognised as wounds that will not heal and that an exaggerated wound response has become manifest as a result of prolonged stress (Bullock et al, 2001). The relationship between asbestos and lung diseases likely falls into this category. Of particular note is that Angiotensin Converting Enzyme (ACE) levels have been reported to increase in line with increasing levels of inflammation in asbestos workers (Owczarek and Lewczuk, 1991).The cause of these allergic diseases is currently explained as genetic susceptibility and environmental exposures. However, many invaders take advantage of the benefits of the environment and exacerbate the course of the disease 170

Smith and Missailidis: Learning from cancer

A. Early clinical use of Angiotensin receptor blockers in treating cancers

(Tamari et al, 2009; Murphy, 2006; Sethi, 2006; Pelaia et al, 2006; Pinto Mendes, 2008; Tauro et al, 2008). It is thus possible that some invaders not only promote, but also actually cause this state in order to evade innate responses that might otherwise be effective. A review by Walton RP and Johnston SL, “Role of respiratory viral infections in the development of atopic conditions”, is one paper that supports this possibility (Walton and Johnston, 2008), with human rhinoviruses being shown to be the most prevalent cause of lower respiratory tract viral infections in infants, along with associated asthma development. Wu et al, also propose that a delay of exposure or prevention of winter viral infection during early infancy could prevent asthma (Wu et al, 2008). Respiratory Syncytial Virus has also been implicated as a cause of allergic type responses although the mechanism has yet to be defined (BelinoStudzinska and Pancer, 2008). Even the behaviour of HIV/AIDs has been compared to an allergic disease (Becker, 2004) due to raised levels of IgE and IL-4 in sera of HIV-1 infected and AIDS patients. Becker further proposes that a treatment that employs both antivirals and anti-allergen drugs may very well defeat the AIDS syndrome. Blackburn and Wherry (2007) in their review, ‘IL10, T cell exhaustion and viral persistence’ (Blackburn and Wherry, 2007), highlight the emerging role that IL10 has in the progression of viral diseases. They explain that viral infections can have one of two outcomes: control of viral replication and acute infection or viral persistence and chronic infection and that both pathogen and host characteristics influence the acute versus chronic outcome of viral infection. They highlight that blockade of IL-10R converted a chronic lymphocytic choriomeningitis virus infection into a rapidly controlled acute infection and prevented the functional exhaustion of memory T cells. Also of interest is that ACE polymorphism has, in some studies, been found to play a role in the development of allergies too, with the DD phenotype being associated with more progressive and severe disease (Zhou et al, 2004; Urhan et al, 2004) and ACE polymorphism also being associated with aspirin intolerance in asthmatics (Kim et al, 2008). This intolerance might possibly be another bacterial toxin effect, given that staphylococcal superantigen-specific IgE antibodies have also been implicated in this area (Lee et al, 2006).

1. Advanced Hormone Refractory Prostate Cancer, (Advanced HRPC) The first clinical results published using Angiotensin Receptor Blockade in the treatment of cancer are made by Uemura et al (Uemura et al, 2005) in their pilot study in advanced hormone-refractory prostate cancer. Twentythree patients who had already received secondary hormonal therapy using dexamethasone, and who were no longer receiving conventional therapy, were enrolled (patient characteristics shown in Table 3 below). Change in prostate-specific antigen (PSA), being an important marker of the disease, was determined as the primary endpoint. The secondary end-point was change in performance status (measured by the ability to perform daily tasks). Table 3: Characteristics of the patients enrolled in the pilot study in advanced hormone-refractory prostate cancer No of Patients Entered Median age (range), years Performance Status 0 Performance Status 1 Performance Status 2 Prior Hormone Treatment Prior Radiotherapy Prior Chemotherapy Retropubic prostatectomy Bone only metastasis Soft Tissue only metastasis Bone and Soft tissue metastasis

23 75.9 (59-92) 12 8 3 23 7 5 1 13 2 8

All of the patients received Candesartan 8 mg per day, being the maximum allowed dose for normal cardiovascular treatment in Japan, and androgen ablation (Orchiectomy or with blockade for luteinizing hormonereleasing hormone (LH-RH)). The Uemura group explained that they had not expected this low dose of an ARB (Angiotensin Receptor (Type 1) Blocker) to stop disease progression completely, especially in patients with advanced HRPC with widespread metastases, but they had hoped to delay it. Of the 23 patients enrolled in the current study, 1 patient did show an objective response on this low dose, with a 12.5% reduction in size of lung metastases. This patient had undergone total prostatectomy for welldifferentiated adenocarcinoma. Unfortunately, PSA started to increase 2 years after the operation, and multiple lung metastases were found in July 1999. Although he had received Candesartan treatment since April 2001, his PSA increased continuously for 6 months after he started on the study. However, from November 2001, his bulky lung metastases showed shrinkage, associated with a decline in PSA from 267 to 177 ng/ml. He finally died of recurrence of lung metastases in May 2002, 36 months after the relapse of prostate cancer. With regard to the change in PS in the study, five patients showed an improvement in PS after starting Candesartan treatment. Although most

IX. Treating diseases In our current hypothesis, the response model is, of necessity, highly simplified. It provides, nevertheless, a conceptual framework for the consideration of disease treatment strategy. An understanding of the bigger picture regarding cellular responses, and the potential manipulation of these responses by invaders seems to provide an insight into potentially novel, effective, disease treatment strategies. Although the main focus in this paper is towards cancer and the use of agents that manipulate the Angiotensin system, the application and examination of supporting evidence is extended into other diseases.

171

Gene Therapy and Molecular Biology Vol 13, page 172 patients had multiple metastases involving bone and lymph nodes, intriguingly, they did not require higher doses of opioid analgesics, or required only a minimal dose. PS was stable in another five patients with minimal use of analgesic agents (Uemura et al, 2005). In summary, eight patients (34.8%) showed an effect on PSA levels; six showing a decrease immediately after starting administration and two showing a stable level of PSA. The six men with a PSA decline of more than 50% showed an improvement in performance status. The mean time to PSA progression across all responders was 8.3 months and one half of these patients showed stable or improved performance status during treatment. With regard to adverse effects, only one patient showed hypotension during treatment. Tissue analysis using realtime quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) staining showed that AT1 receptor expression in well-differentiated adenocarcinoma was higher than that in poorly differentiated adenocarcinoma (Uemura et al, 2005).

CT scan showed a 1.5 cm mass in the right adrenal. No hot spots were found on 123ImIBG scan or selective venous sampling. The patient was therefore managed medically. Blood pressure was controlled by phenoxybenzamine, but there was a progressive increase in plasma norepinephrine to 3.3 ng/L. Additional therapy with an ARB, Irbesartan 150 mg, was started in 1999. In view of the rising plasma norepinephrine levels, the dose of Irbesartan was increased to 300 mg daily in 2001. Plasma norepinephrine peaked at 4 ng/mL and then appeared to decline in Figure . Over 4 years from 1998 to 2002, the adrenal mass grew approximately 50% in diameter but from 2002, the size of tumour remained static, as judged by the results of the CT scans (shown in Figure 10).

Case 2 A 63-year-old man presented in 2000 with a large left adrenal phaeochromocytoma, confirmed with MRI scans and surgically removed. At follow-up over the next year, the patient remained well and normotensive, but in August 2004 the patient re-presented with a CT scan confirming local recurrence in the left adrenal bed and 18F-FDG scanning revealed both local and distal metastases. Surgical exploration revealed multiple peritoneal seedlings and no tumour was excised except for histological confirmation. Phenoxybenzamine was changed to doxazosin, which was better tolerated in this patient, and ARB therapy started with Candesartan 16 mg daily. Over the next year, plasma norepinephrine declined, Figure , and the mass of tumour in the adrenal bed appeared unchanged or slightly reduced through analysis of serial CT scans.

2. Treatment in Pheochromocytoma More recently, Brown et al describes two patients with pheochromocytoma in whom treatment with higher dose angiotensin receptor blocker was associated with cessation of growth. Dosage of 300 mg Irbesartan (another AT1 blocker) per day was utilised in one patient and 16 mg Candesartan per day in the other (Brown et al, 2006).

Case 1 In 1984, a 32-year-old man presented with pheochromocytoma and the patient proceeded to surgical adrenalectomy with successful cure of his symptoms and hypertension. In 1997, he re-presented with hypertension, his plasma norepinephrine (a marker of progression) was elevated and did not suppress with pentolinium 2.5 mg. A

Figure 9: Serial plasma catecholamines in Case 1. The results for plasma norepinephrine (filled columns) and epinephrine (hatched columns) are shown relative to the dose of irbesartan, which was 150 mg daily between 1998 and 2001, and 300 mg daily thereafter.

172

Smith and Missailidis: Learning from cancer

Figure 10: Serial CT scans in Case 1. In 1998, the diameter of the right adrenal pheochromocytoma, arrowed, is smaller than the length of the attached medial limb of normal adrenal, and than the diameter of the aorta. In 2002, the tumour is a similar size to these adjacent tissues, but there is no further increase in 2004.

Figure 11: Serial plasma norepinephrine in Case 2. Introduction of Candesartan is associated with a decline in plasma norepinephrine levels over the subsequent year.

173

Gene Therapy and Molecular Biology Vol 13, page 174

Both approaches appeared well tolerated with no adverse effects. The paper also highlights the observation that, in a patient with carcinoid syndrome and hypertension, introduction of Candesartan at 16â&#x20AC;&#x201C;32 mg for his hypertension has been associated with an arrest of growth and 5HIAA excretion over a 3-year period. The purpose of their report was to encourage other physicians to consider high-dose ARB therapy, as a prelude to the design of a prospective, comparative trial.

remission was achieved Figure . He has remained well without progression for 16 months.

3. Treatment in Advanced Renal Cancer In three cases of metastatic renal cell carcinoma, Tatokoro et al (2008) found that a combination treatment of cimetidine (a Histamine Receptor II Antagonist), COX2 inhibitor and RAS inhibitor (angiotensin converting enzyme inhibitor or angiotensin II type 1 receptor antagonist) (CCA therapy) was effective.

Figure 13: Results from Case 2. Computed tomography of the chest before (left) and a year after (right) the start of CCA therapy.

Case 1 Describes a 47-year-old man, CT scan revealing a 12-cm right renal mass invading the iliopsoas muscle with multiple pulmonary metastases, a large amount of pleural effusion and large hepatic metastases, providing a diagnosis of cT4N0M1 RCC. A combination therapy consisting of cimetidine 800 mg, etodolac, a selective COX-2 inhibitor, 10 mg and Candesartan 12 mg orally was provided. After he started CCA therapy, all the symptoms gradually disappeared and eight months later, the metastatic lesions reduced markedly in size, achieving a partial remission (> 50% reduction in tumour size) Figure 12. After a year, metastatic lesions enlarged again and he died another year later.

Case 3 Describes a 64-year-old man presented with a 10-cm left renal tumour with multiple pulmonary metastases (pT3aN0M1). The patient underwent a left radical nephrectomy and IFN-a treatment commenced for six months until liver dysfunction. Since metastatic sites grew, CCA therapy of cimetidine 400 mg, meloxicam 10 mg and perindopril, ACE inhibitors, 4 mg orally was commenced. Metastatic lesions gradually reduced in size over two years, thus achieving a partial remission, Figure 14. Brain metastases appeared 31 months later, however, and he died 41 months after the commencement of CCA therapy. None of the three patients experienced any appreciable side effects associated with CCA therapy. Tatokoro et al (2008) report that is was highly unlikely that these tumour shrinkages in these cases were spontaneous regression of RCC. The reported incidence of spontaneous tumour regressions in RCC is extremely low (less than 1%), and most spontaneous regressions have been observed following the treatment of the primary tumours such as surgical removal, radiotherapy, or Embolisation.

Figure 12: Results from Case 1. Computed tomography of the abdomen before (left) and eight months after (right) the start of CCA therapy.

Case 2 Describes a 62-year-old man presented with a metastatic left radial tumour from clear cell RCC. The patient, whose renal tumour was staged as T1bN0M1, underwent a left radical nephrectomy and resection of radial tumour followed by IFN-a subcutaneous for a year. The patient developed multiple pulmonary metastases eighteen months after the surgery and the metastatic lesions grew despite immune therapy (IFN-a and IL-2). When CCA therapy was started, all of the metastatic lesions gradually reduced in size and a nearly complete

Figure 14: Results from Case 3. Computed tomography of the chest before (left) and 14 months after (right) the start of combination treatment of CCA therapy.

174

Smith and Missailidis: Learning from cancer Dobbs et al have hypothesised ongoing microbial insults as a progressive cause of idiopathic parkinsonism (Dobbs et al, 2008), their early studies have indeed shown that eradication of Helicobacter pylori infection has, on the whole, been proven beneficial to patients. Some patients, however, did react quite badly to treatment and had to be withdrawn from the study as a result of the toxic shock of the dying infections. In the case of the study by Dobbs et al (2008), it might be argued that these patients may well have been those with the greatest degree of infection (and the greatest need of infection eradication) and that a combination approach with AT1 blockade again might prove beneficial to avoid the side effects of an otherwise useful treatment. In fact, AT1 blockade has previously been demonstrated, in a number of animal studies, to ameliorate inflammation induced by endotoxins in a range of organs, including adrenal (Sanchez-Lemus et al, 2008), eye (Miyazaki et al, 2008) and lung (Zhang and Sun, 2006), as well as systemically (Laesser et al, 2004).

4. Combination approaches in treating cancer and other invaders promoting wound response Bacteria have also been shown to cause cancer to be more aggressive and patients with skin lymphoma could benefit from antibiotic treatments used for bacterial infections in lymphatic cancer (Woetmann et al, 2007). Ferreri et al (2006) have explored the association between ocular adnexal MALT lymphoma (OAL) and Chlamydia psittaci (Cp) infections (Ferreri et al, 2006), aiming to confirm reports suggesting that doxycycline treatment causes tumour regression in patients with Cp-related OAL. In this study, doxycycline proved a fast, safe, and active therapy for Cp DNA-positive OAL, effective even in patients with multiple failures, involving previously irradiated areas or regional lymphadenopathies. Also of significant interest is that spontaneous tumour regression has been known to follow certain bacterial, fungal, viral, and protozoal infections. Dr. William Coley (1862–1936) was one of the first to capitalise on this characteristic and was reputed to have quite some success by injecting a cocktail of dead Streptococcus pyogenes and dead Serratia marcescens bacteria into tumours (Hoption Can et al, 2003). The approach, that still continues to date, leads to high fever and is associated with tumour regression. Advocates of the approach suggest tumour associated leucocytes display reparative functions that support tumour growth, but that intratumoural infections may reactivate defensive functions, causing tumour regression. The work by Tsung K, and Norton JA (2006), “Lessons from Coley's Toxin”, suggests that the effect is due to an increase in IL-12 (Tsung and Norton, 2006). Examination of the model would suggest that in these cases innate responses are being provoked. It would be a most interesting experiment to combine Angiotensin Receptor Blockade with Coley’s toxin to see if there is an enhanced effect. Similarly, although the literature is absent with regard to any attempt, the introduction of IL-2 in combination with AT1 blockers to treat not only cancer but also infections may prove to be beneficial. Due to strong growth responses, it would seem likely that the application of agents that activate Retinoic Acid Receptors might be beneficial in cancer. Indeed a number of studies confirm this, especially when used in combination with other agents. Long-term results from children with high-risk neuroblastoma treated in a randomized trial with standard therapy followed by treatment with 13-cis-retinoic acid show that overall survival is significantly increased at the five-year point (Matthay et al, 2009). Clinical studies have also found combination therapies of interleukin-2 and 13-cis retinoic acids to be beneficial in the treatment of several cancers (Recchia et al, 2007; Recchia et al, 2005; Recchia et al, 2006; Recchia et al, 2008; Gilman et al, 2009), although dosage is important to optimise benefits Vs side effects. The additional effect of an Angiotensin Receptor Blocker to studies such as this might prove additionally synergistic.

5. Approaches for the resolution of hypersensitivity In this area, the diseases demonstrate an allergenbased chronic immune response as the cause; with also a resultant derived chronic injury response (wounding that does not heal). Potential means to treat such diseases might include either singly or in combination the use of the following approaches: ! IL-4 antagonists and ARBs might be beneficial, as they will relieve the chronic nature of the diseases as well as potentially stimulating improved innate responses. ! IL-10, IL-2 antagonists, IGF-1 and steroids might also appear beneficial and give short-term relief. However, the use of these agents will impair adaptive immune responses. If there is indeed an invader, such as a virus, promoting an allergic response, or other invaders taking advantage of the wound environment, then these may continue to propagate. It is proposed that the use of ARBs would be a suitable alternative to IGF-1 and steroids. Yamagata and Ichinose in their review ‘Agents against cytokine synthesis or receptors’ (Yamagata and Ichinose, 2006), express disappointment that studies concerning the inhibition of interleukin (IL)-4 have been discontinued despite promising early results in asthma. They also suggest that ‘anti-inflammatory’ cytokines such as IL-10 may have a therapeutic potential. However, systemic delivery, as discussed earlier, may lead to longerterm deleterious effects. Tarantini et al (2007), in their paper ‘Asthma treatment: magic bullets which seek their own targets' (Tarantini et al, 2007), provide an analysis of many of the different ways of interfering along the course of the cascade of the allergic reaction (including IL-4 and IL-10) and suggest that, at present, anti-IgE appear to be the only 'magic bullet' for the treatment of allergic asthma. Regarding HIV, it has been reported that IL-10secreting T cells from HIV-infected pregnant women down-regulate HIV-1 replication. An effect, which is enhanced by antiretroviral treatment (Bento et al, 2009).

175

Gene Therapy and Molecular Biology Vol 13, page 176

Figure 15: The Cell Response Model portrays a conceptual representation of the key drivers and mediators of cellular responses. Healthy response states lie within the green and amber domains. The red domains are disease states brought about by aging or through infection.

6. Resolution of age related non-resolving wounds

hormone (GH) and insulin-like growth factor-1 (IGF-1) levels. Preclinical studies have shown that infusion of angiotensin II produced a marked reduction in body weight, accompanied by decreased serum and muscle levels of IGF-1. In addition, IGF-1 serum levels have been shown to increase following ACE inhibitor treatment (Giovannini et al, 2008; Maggio et al, 2006). In the InCHIANTI study, in particular, of 745 subjects, it was found that treatment with ACE inhibitors for <3 years is associated with significantly higher levels of IGF-1. This association between the Angiotensin System and ageing has been considered for some time. This has been postulated to be associated with oxidative stress (Ferder et

Diseases in this category demonstrate a chronic immune response as the result of an inability to resolve wounding. Many of these diseases will likely progress with the aid of infections, however susceptibility increases due to aging as a result of the reduced availability of systemic and locally derived IGF-1. The use of both AT1 blockers and IGF-1 in diseases of ageing may promote repair, growth and healing. Once again, steroids will have a short-term benefit but will promote immune suppression. In the ageing population, sarcopenia represents a progressive worsening of skeletal muscle mass and function, which is associated with declining growth 176

Smith and Missailidis: Learning from cancer al, 2002) and specifically with changes in mitochondrial function (de Cavanagh et al, 2007).

authors have contributed to the authoring of this manuscript.

X. Concluding remarks

Acknowledgements

A great System Engineer was reputed to say "Everything should be made as simple as possible, but not simpler." http://en.wikiquote.org/wiki/Albert_Einstein The Cellular Response Model (shown in Figure 15) lies at the very edge of this concept. Cellular responses are indeed extremely complex and the biological system processes involve not only a great deal of redundancy but also synergistic behaviour in its components. Despite this and its simplicity the proposed model appears to be a powerful tool in considering disease management strategy and a means to explain the puzzle of inflammation and the perversion of healthy responses by cancer and infections. A logical summary for the placement of the TH1 and TH2 model of diseases within the response model is also possible. Such that TH1 might be more appropriately viewed as an innate inflammatory response to a stimulus (driven by TLRs) to a pathogen that is resistant to this non-specific immune response. TH2 is an allergic response driven by sensitivity to an allergen, but again an ineffective one, with the adaptive immune system being effectively distracted. This model might also explain, in part, the mechanism by which the human foetus (which is considered "non-self") is protected from attack by the adaptive immune system. As a final note, the prospects for Angiotensin Receptor Blockade, in particular for the treatment of wounds that will not heal, are profound and two clinical trials are currently in preparation by the authors to test the effects of established angiotensin receptor blockers in conjunction with standard chemotherapeutic and immunotherapeutic approaches to verify their efficacy in cancer.

Gary R Smith would like to acknowledge family and friends, who have significantly contributed to this hypothesis through their experiences and questioning, notably Paul Jaep, a long term ME sufferer, Catherine O'Driscoll and especially Garyâ&#x20AC;&#x2122;s wife Alison. He would also like to make a special mention of his grandfather Thomas William Flowers to whom he would like to dedicate this paper. Sotiris Missailidis would like to acknowledge the Open University for their financial support.

References Abiko M, Rodgers KE, Campeau JD, Nakamura RM, Dizerega GS: Alterations of angiotensin II Receptor levels in sutured wounds in rat skin. J Invest Surg 1996, 9:447-453. Altorki NK, Keresztes RS, Port JL, Libby DM, Korst RJ, Flieder DB, Ferrara CA, Yankelevitz DF, Subbaramaiah K, Pasmantier MW, Dannenberg AJ: Celecoxib, a selective cyclo-oxygenase-2 inhibitor, enhances the response to preoperative paclitaxel and carboplatin in early-stage nonsmall-cell lung cancer. J Clin Oncol 2003, 21:2645-2650. Anand P, Kunnumakkara AB, Sundaram C, Harikumar KB, Tharakan ST, Lai OS, Sung B, Aggarwal BB: Cancer is a preventable disease that requires major lifestyle changes. Pharm Res 2008, 25:2097-2116. Anders H-J, Banas B, Schlondorff D: Signaling Danger: TollLike Receptors and their Potential Roles in Kidney Disease. J Am Soc Nephrol 2004, 15:854-867. Arafat HA, Gong Q, Chipitsyna G, Rizvi A, Saa CT, Yeo CJ: Antihypertensives as novel antineoplastics: angiotensin-Iconverting enzyme inhibitors and angiotensin II type 1 receptor blockers in pancreatic ductal adenocarcinoma. J Am Coll Surg 2007, 204:996-1005; discussion 1005-1006. Arai H, Furuya T, Mizuno Y, Mochizuki H: Inflammation and infection in Parkinson's disease. Histol Histopathol 2006, 21:673-678. Arganaraz GA, Konno AC, Perosa SR, Santiago JF, Boim MA, Vidotti DB, Varella PP, Costa LG, Canzian M, Porcionatto MA, et al: The renin-angiotensin system is upregulated in the cortex and hippocampus of patients with temporal lobe epilepsy related to mesial temporal sclerosis. Epilepsia 2008, 49:1348-1357. Arrieta O, Pineda-Olvera B, Guevara-Salazar P, HernandezPedro N, Morales-Espinosa D, Ceron-Lizarraga TL, Gonzalez-De la Rosa CH, Rembao D, Segura-Pacheco B, Sotelo J: Expression of AT1 and AT2 angiotensin receptors in astrocytomas is associated with poor prognosis. Br J Cancer 2008, 99:160-166. Athyros VG, Kakafika AI, Tziomalos K, Karagiannis A, Mikhailidis DP: Pleiotropic effects of statins--clinical evidence. Curr Pharm Des 2009, 15:479-489. Attoub S, Gaben AM, Al-Salam S, Al Sultan MA, John A, Nicholls MG, Mester J, Petroianu G: Captopril as a potential inhibitor of lung tumor growth and metastasis. Ann N Y Acad Sci 2008, 1138:65-72. Azad N, Rojanasakul Y, Vallyathan V: Inflammation and lung cancer: roles of reactive oxygen/nitrogen species. J Toxicol Environ Health B Crit Rev 2008, 11:1-15. Baum M, Demicheli R, Hrushesky W, Retsky M: Does surgery unfavourably perturb the "natural history" of early breast cancer by accelerating the appearance of distant metastases? Eur J Cancer 2005, 41:508-515.

XI. Competing interests Gary R Smith is a founding director of Perses Biosystems Ltd. The Initial focus is to establish technical reputation through testing of the hypothesis by clinical trials purely in the interests of extending scientific understanding and without financial motivation. In the longer term, Persesâ&#x20AC;&#x2122;s ambition is to identify additional drug targets and agents to work in combination with AT1 blockers to treat a variety of diseases. Sotiris Missailidis is a lecturer at the Department of Chemistry and Analytical Sciences of the Open University and is interested in understanding the molecular processes behind disease states for the potential development of more successful therapeutics in the future, and has no commercial interests in this work.

XII. Authors' contributions Gary R Smith proposed the hypothesis through a holistic and objective approach backed by scientific literature review. Sotiris Missailidis has been the academic collaborator in the development of these ideas. Both

177

Gene Therapy and Molecular Biology Vol 13, page 178 Becker Y: HIV-1 induced AIDS is an allergy and the allergen is the Shed gp120--a review, hypothesis, and implications. Virus Genes 2004, 28:319-331. Bedair HS, Karthikeyan T, Quintero A, Li Y, Huard J: Angiotensin II receptor blockade administered after injury improves muscle regeneration and decreases fibrosis in normal skeletal muscle. Am J Sports Med 2008, 36:15481554. Belino-Studzinska P, Pancer K: [Respiratory syncytial virus: as an etiological agent of respiratory tract infection in children and adults]. Przegl Epidemiol 2008, 62:767-775. Ben-Haim S, Gacinovic S, Israel O: Cardiovascular infection and inflammation. Semin Nucl Med 2009, 39:103-114. Bento CA, Hygino J, Andrade RM, Saramago CS, Silva RG, Silva AA, Linhares UC, Brindeiro R, Tanuri A, Rosenzwajg M, et al: IL-10-secreting T cells from HIV-infected pregnant women downregulate HIV-1 replication: effect enhanced by antiretroviral treatment. Aids 2009, 23:9-18. Blackburn SD, Wherry EJ: IL-10, T cell exhaustion and viral persistence. Trends Microbiol 2007, 15:143-146. Bondy B, Baghai TC, Zill P, Schule C, Eser D, Deiml T, Zwanzger P, Ella R, Rupprecht R: Genetic variants in the angiotensin I-converting-enzyme (ACE) and angiotensin II receptor (AT1) gene and clinical outcome in depression. Prog Neuropsychopharmacol Biol Psychiatry 2005, 29:10941099. Boorom KF: Is this recently characterized gastrointestinal pathogen responsible for rising rates of inflammatory bowel disease (IBD) and IBD associated autism in Europe and the United States in the 1990s? Med Hypotheses 2007, 69:652659. Breslin JW, Wu MH, Guo M, Reynoso R, Yuan SY: Toll-like receptor 4 contributes to microvascular inflammation and barrier dysfunction in thermal injury. Shock 2008, 29:349355. Brody JS, Spira A: State of the art. Chronic obstructive pulmonary disease, inflammation, and lung cancer. Proc Am Thorac Soc 2006, 3:535-537. Brooke SM, Sapolsky RM: The effects of steroid hormones in HIV-related neurotoxicity: a mini review. Biological Psychiatry 2000, 48:881. Brown ER, Charles KA, Hoare SA, Rye RL, Jodrell DI, Aird RE, Vora R, Prabhakar U, Nakada M, Corringham RE, et al: A clinical study assessing the tolerability and biological effects of infliximab, a TNF-alpha inhibitor, in patients with advanced cancer. Ann Oncol 2008, 19:1340-1346. Brown MJ, Mackenzie IS, Ashby MJ, Balan KK, Appleton DS: AT2 receptor stimulation may halt progression of pheochromocytoma. Ann N Y Acad Sci 2006, 1073:436-443. Bullock GR, Steyaert I, Bilbe G, Carey RM, Kips J, De Paepe B, Pauwels R, Praet M, Siragy HM, de Gasparo M: Distribution of type-1 and type-2 angiotensin receptors in the normal human lung and in lungs from patients with chronic obstructive pulmonary disease. Histochem Cell Biol 2001, 115:117-124. Busquets X, MacFarlane NG, Heine-Suner D, Morla M, TorresJuan L, Iglesias A, Llado J, Sauleda J, Agusti AG: Angiotensin-converting-enzyme gene polymorphisms, smoking and chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis 2007, 2:329-334. Cairns BA, Barnes CM, Mlot S, Meyer AA, Maile R: Toll-like receptor 2 and 4 ligation results in complex altered cytokine profiles early and late after burn injury. J Trauma 2008, 64:1069-1077; discussion 1077-1068. Carey RM: Update on the role of the AT2 receptor. Curr Opin Nephrol Hypertens 2005, 14:67-71.

Castellon R, Hamdi HK: Demystifying the ACE polymorphism: from genetics to biology. Curr Pharm Des 2007, 13:11911198. Castro Cabezas M, Vrinten DH, Burgers JA, Croughs RJM: Central diabetes insipidus and Cushing's syndrome due to ectopic ACTH production by disseminated small cell lung cancer: A case report. The Netherlands Journal of Medicine 1998, 53:32. Chan AT, Ogino S, Fuchs CS: Aspirin and the risk of colorectal cancer in relation to the expression of COX-2. N Engl J Med 2007, 356:2131-2142. Chan YC, Leung PS: Involvement of Redox-Sensitive Extracellular-Regulated Kinases in Angiotensin II-Induced Interleukin-6 Expression in Pancreatic Acinar Cells. J Pharmacol Exp Ther 2009, 329: 450-458. Chen FP, Gong LK, Zhang L, Wang H, Qi XM, Wu XF, Xiao Y, Cai Y, Liu LL, Li XH, Ren J: Early lung injury contributes to lung fibrosis via AT1 receptor in rats. Acta Pharmacol Sin 2007, 28:227-237. Cheskis BJ, Greger JG, Nagpal S, Freedman LP: Signaling by estrogens. J Cell Physiol 2007, 213:610-617. Chetty A, Nielsen HC: Regulation of Cell Proliferation by Insulin-like Growth Factor 1 in Hyperoxia-Exposed Neonatal Rat Lung. Molecular Genetics and Metabolism 2002, 75:265. Chytil F: Retinoids in lung development. FASEB J 1996, 10:986-992. Congote LF: Monitoring insulin-like growth factors in HIV infection and AIDS. Clin Chim Acta 2005, 361:30-53. Cooke A, Ferraccioli GF, Herrmann M, Romani L, Schulze C, Zampieri S, Doria A: Induction and protection of autoimmune rheumatic diseases. The role of infections. Clin Exp Rheumatol 2008, 26:S1-7. Cuatrecasas P: Drug discovery in jeopardy. J Clin Invest 2006, 116:2837-2842. Dalgleish AG, O'Byrne K: Inflammation and cancer: the role of the immune response and angiogenesis. Cancer Treat Res 2006, 130:1-38. D'Arpa N, Accardo-Palumbo A, Amato G, D'Amelio L, Pileri D, Cataldo V, Mogavero R, Lombardo C, Napoli B, Conte F: Circulating dendritic cells following burn. Burns 2009, 35:513-518. de Cavanagh EM, Piotrkowski B, Fraga CG: The interaction between the renin-angiotensin system and peroxisome proliferator activated receptors: a hypothesis including the participation of mitochondria in aging. Front Biosci 2007, 12:1049-1062. Deans DA, Tan BH, Wigmore SJ, Ross JA, de Beaux AC, Paterson-Brown S, Fearon KC: The influence of systemic inflammation, dietary intake and stage of disease on rate of weight loss in patients with gastro-oesophageal cancer. Br J Cancer 2009, 100:63-69. Debernardi-Venon W, Martini S, Biasi F, Vizio B, Termine A, Poli G, Brunello F, Alessandria C, Bonardi R, Saracco G, et al: AT1 receptor antagonist Candesartan in selected cirrhotic patients: effect on portal pressure and liver fibrosis markers. J Hepatol 2007, 46:1026-1033. Delli Gatti C, Osto E, Kouroedov A, Eto M, Shaw S, Volpe M, Luscher TF, Cosentino F: Pulsatile stretch induces release of angiotensin II and oxidative stress in human endothelial cells: effects of ACE inhibition and AT1 receptor antagonism. Clin Exp Hypertens 2008, 30:616-627. Demicheli R, Retsky MW, Hrushesky WJ, Baum M: Tumor dormancy and surgery-driven interruption of dormancy in breast cancer: learning from failures. Nat Clin Pract Oncol 2007, 4:699-710. Dobbs RJ, Dobbs SM, Weller C, Charlett A, Bjarnason IT, Curry A, Ellis DS, Ibrahim MA, McCrossan MV, O'Donohue J, et

178

Smith and Missailidis: Learning from cancer al: Helicobacter hypothesis for idiopathic parkinsonism: before and beyond. Helicobacter 2008, 13:309-322. Dolle L, Depypere HT, Bracke ME: Anti-invasive/antimetastasis strategies: new roads, new tools and new hopes. Curr Cancer Drug Targets 2006, 6:729-751. Drakopanagiotakis F, Xifteri A, Polychronopoulos V, Bouros D: Apoptosis in lung injury and fibrosis. Eur Respir J 2008, 32:1631-1638. Dupont J, Pierre A, Froment P, Moreau C: The insulin-like growth factor axis in cell cycle progression. Horm Metab Res 2003, 35:740-750. Erlinger TP, Muntner P, Helzlsouer KJ: WBC Count and the Risk of Cancer Mortality in a National Sample of U.S. Adults: Results from the Second National Health and Nutrition Examination Survey Mortality Study. Cancer Epidemiol Biomarkers Prev 2004, 13:1052-1056. Esteban V, Gallego-Delgado J, Lazaro A, Osende J, Mezzano S, Egido J, Ruiz-Ortega M: Long-term treatment with an ACE inhibitor or an AT1 antagonist avoids hypertension-induced inflammation in the kidney. J Nephrol 2006, 19:725-731. Everett M, Gutman H: Surgical management of gastrointestinal stromal tumors: analysis of outcome with respect to surgical margins and technique. J Surg Oncol 2008, 98:588-593. Ferder LF, Inserra F, Basso N: Advances in our understanding of aging: role of the renin-angiotensin system. Curr Opin Pharmacol 2002, 2:189-194. Ferrari V, Valcamonico F, Amoroso V, Simoncini E, Vassalli L, Marpicati P, Rangoni G, Grisanti S, Tiberio GA, Nodari F, et al: Gemcitabine plus celecoxib (GECO) in advanced pancreatic cancer: a phase II trial. Cancer Chemother Pharmacol 2006, 57:185-190. Ferreri AJ, Ponzoni M, Guidoboni M, Resti AG, Politi LS, Cortelazzo S, Demeter J, Zallio F, Palmas A, Muti G, et al: Bacteria-eradicating therapy with doxycycline in ocular adnexal MALT lymphoma: a multicenter prospective trial. J Natl Cancer Inst 2006, 98:1375-1382. Forrest LM, McMillan DC, McArdle CS, Angerson WJ, Dunlop DJ: Comparison of an inflammation-based prognostic score (GPS) with performance status (ECOG) in patients receiving platinum-based chemotherapy for inoperable non-small-cell lung cancer. Br J Cancer 2004, 90:1704-1706. Fowble B, Hanlon A, Freedman G, Nicolaou N, Anderson P: Second cancers after conservative surgery and radiation for stages I-II breast cancer: identifying a subset of women at increased risk. International Journal of Radiation Oncology*Biology*Physics 2001, 51:679. Franscini LM, Von Vigier RO, Pfister R, Casaulta-Aebischer C, Fossali E, Bianchetti MG: Effectiveness and safety of the angiotensin II antagonist irbesartan in children with chronic kidney diseases. Am J Hypertens 2002, 15:1057-1063. Gao J, Lin Y, Xiao Y, Xu K, Xu W, Zhu Y, Ma Y, Bai Y: Polymorphism of angiotensin-converting enzyme gene and genetic susceptibility to asthma with familial aggregation. Chin Med Sci J 2000, 15:24-28. Garay RP, Viens P, Bauer J, Normier G, Bardou M, Jeannin JF, Chiavaroli C: Cancer relapse under chemotherapy: why TLR2/4 receptor agonists can help. Eur J Pharmacol 2007, 563:1-17. Gard PR: Angiotensin as a target for the treatment of Alzheimer's disease, anxiety and depression. Expert Opin Ther Targets 2004, 8:7-14. Ge J, Barnes NM: Alterations in angiotensin AT1 and AT2 receptor subtype levels in brain regions from patients with neurodegenerative disorders. Eur J Pharmacol 1996, 297:299-306. Giannitrapani L, Soresi M, La Spada E, Cervello M, D'Alessandro N, Montalto G: Sex hormones and risk of liver tumor. Ann N Y Acad Sci 2006, 1089:228-236.

Gilliver SC, Ashcroft GS: Sex steroids and cutaneous wound healing: the contrasting influences of estrogens and androgens. Climacteric 2007, 10:276-288. Gilliver SC, Ruckshanthi JP, Hardman MJ, Nakayama T, Ashcroft GS: Sex dimorphism in wound healing: the roles of sex steroids and macrophage migration inhibitory factor. Endocrinology 2008, 149:5747-5757. Gilliver SC, Ruckshanthi JP, Hardman MJ, Zeef LA, Ashcroft GS: 5alpha-dihydrotestosterone (DHT) retards wound closure by inhibiting re-epithelialization. J Pathol 2009, 217:73-82. Gilman AL, Ozkaynak MF, Matthay KK, Krailo M, Yu AL, Gan J, Sternberg A, Hank JA, Seeger R, Reaman GH, Sondel PM: Phase I study of ch14.18 with granulocyte-macrophage colony-stimulating factor and interleukin-2 in children with neuroblastoma after autologous bone marrow transplantation or stem-cell rescue: a report from the Children's Oncology Group. J Clin Oncol 2009, 27:85-91. Giovannini S, Marzetti E, Borst SE, Leeuwenburgh C: Modulation of GH/IGF-1 axis: potential strategies to counteract sarcopenia in older adults. Mech Ageing Dev 2008, 129:593-601. Giustina A, Mazziotti G, Canalis E: Growth hormone, insulinlike growth factors, and the skeleton. Endocr Rev 2008, 29:535-559. Gnanalingham MG, Mostyn A, Dandrea J, Yakubu DP, Symonds ME, Stephenson T: Ontogeny and nutritional programming of uncoupling protein-2 and glucocorticoid receptor mRNA in the ovine lung. J Physiol (Lond) 2005, 565:159-169. Goldman-Johnson DR, de Kretser DM, Morrison JR: Evidence that androgens regulate early developmental events, prior to sexual differentiation. Endocrinology 2008, 149:5-14. Grammatopoulos TN, Jones SM, Ahmadi FA, Hoover BR, Snell LD, Skoch J, Jhaveri VV, Poczobutt AM, Weyhenmeyer JA, Zawada WM: Angiotensin type 1 receptor antagonist losartan, reduces MPTP-induced degeneration of dopaminergic neurons in substantia nigra. Mol Neurodegener 2007, 2:1. Granucci F, Zanoni I, Feau S, Ricciardi-Castagnoli P: Dendritic cell regulation of immune responses: a new role for interleukin 2 at the intersection of innate and adaptive immunity. Embo J 2003, 22:2546-2551. Habashi JP, Judge DP, Holm TM, Cohn RD, Loeys BL, Cooper TK, Myers L, Klein EC, Liu G, Calvi C, et al: Losartan, an AT1 antagonist, prevents aortic aneurysm in a mouse model of Marfan syndrome. Science 2006, 312:117-121. Hanahan D, Weinberg RA: The hallmarks of cancer. Cell 2000, 100:57-70. Harrison ML, Obermueller E, Maisey NR, Hoare S, Edmonds K, Li NF, Chao D, Hall K, Lee C, Timotheadou E, et al: Tumor necrosis factor alpha as a new target for renal cell carcinoma: two sequential phase II trials of infliximab at standard and high dose. J Clin Oncol 2007, 25:4542-4549. Health News: The continuing genius of statins. These wonder drugs appear to prevent heart attack, stroke, and Alzheimer's, as well as lung function decline. Health News 2008, 14:3-4. Heymes C, Levy BI: [Functions of AT2 receptors of angiotensin II]. Therapie 1998, 53:213-216. Hitomi H, Fukui T, Moriwaki K, Matsubara K, Sun GP, Rahman M, Nishiyama A, Kiyomoto H, Kimura S, Ohmori K, et al: Synergistic effect of mechanical stretch and angiotensin II on superoxide production via NADPH oxidase in vascular smooth muscle cells. J Hypertens 2006, 24:1089-1095. Hoption Cann SA, van Netten JP, van Netten C: Dr William Coley and tumour regression: a place in history or in the future. Postgrad Med J 2003, 79:672-680. Hosseini-Khalili AR, Thompson J, Kehoe A, Hopkinson NS, Khoshbaten A, Soroush MR, Humphries SE, Montgomery H, Ghanei M: Angiotensin-converting enzyme genotype and late

179

Gene Therapy and Molecular Biology Vol 13, page 180 respiratory complications of mustard gas exposure. BMC Pulm Med 2008, 8:15. Hoyer KK, Dooms H, Barron L, Abbas AK: Interleukin-2 in the development and control of inflammatory disease. Immunol Rev 2008, 226:19-28. Hu C, Dandapat A, Sun L, Marwali MR, Inoue N, Sugawara F, Inoue K, Kawase Y, Jishage K, Suzuki H, et al: Modulation of angiotensin II-mediated hypertension and cardiac remodeling by lectin-like oxidized low-density lipoprotein receptor-1 deletion. Hypertension 2008, 52:556-562. Hunyady L, Catt KJ: Pleiotropic AT1 receptor signaling pathways mediating physiological and pathogenic actions of angiotensin II. Mol Endocrinol 2006, 20:953-970. Ibragimov AI, McNeal CJ, Ritter LR, Walton JR: A mathematical model of atherogenesis as an inflammatory response. Math Med Biol 2005, 22:305-333. Ikura Y, Ohsawa M, Shirai N, Sugama Y, Fukushima H, Suekane T, Hirayama M, Ehara S, Naruko T, Ueda M: Expression of angiotensin II type 1 receptor in human cirrhotic livers: Its relation to fibrosis and portal hypertension. Hepatol Res 2005, 32:107-116. Imai N, Hashimoto T, Kihara M, Yoshida S, Kawana I, Yazawa T, Kitamura H, Umemura S: Roles for host and tumor angiotensin II type 1 receptor in tumor growth and tumorassociated angiogenesis. Lab Invest 2007, 87:189-198. Ingber DE: Can cancer be reversed by engineering the tumor microenvironment? Semin Cancer Biol 2008, 18:356-364. Ino K, Shibata K, Kajiyama H, Yamamoto E, Nagasaka T, Nawa A, Nomura S, Kikkawa F: Angiotensin II type 1 receptor expression in ovarian cancer and its correlation with tumour angiogenesis and patient survival. Br J Cancer 2006, 94:552560. Irani RA, Xia Y: The functional role of the renin-angiotensin system in pregnancy and preeclampsia. Placenta 2008, 29:763-771. Iwakiri D, Sheen TS, Chen JY, Huang DP, Takada K: EpsteinBarr virus-encoded small RNA induces insulin-like growth factor 1 and supports growth of nasopharyngeal carcinomaderived cell lines. Oncogene 2005, 24:1767-1773. Iwakura Y, Nakae S, Saijo S, Ishigame H: The roles of IL-17A in inflammatory immune responses and host defense against pathogens. Immunol Rev 2008, 226:57-79. Iwata K, Sohda T, Irie M, Takeyama Y, Anan A, Shakado S, Sakisaka S: Angiotensin II type 1 receptor antagonist improves the prognosis in rats displaying liver cirrhosis induced by a choline-deficient diet. J Gastrointestin Liver Dis 2008, 17:21-25. Jacobs EJ, Thun MJ, Bain EB, Rodriguez C, Henley SJ, Calle EE: A large cohort study of long-term daily use of adultstrength aspirin and cancer incidence. J Natl Cancer Inst 2007, 99:608-615. Janes KA, Albeck JG, Gaudet S, Sorger PK, Lauffenburger DA, Yaffe MB: A systems model of signaling identifies a molecular basis set for cytokine-induced apoptosis. Science 2005, 310:1646-1653. Janiak P, Bidouard JP, Cadrouvele C, Poirier B, Gouraud L, Grataloup Y, Pierre F, Bruneval P, O'Connor SE, Herbert JM: Long-term blockade of angiotensin AT1 receptors increases survival of obese Zucker rats. Eur J Pharmacol 2006, 534:271-279. Jiang D, Liang J, Fan J, Yu S, Chen S, Luo Y, Prestwich GD, Mascarenhas MM, Garg HG, Quinn DA, et al: Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nat Med 2005, 11:1173-1179. Joglar B, Rodriguez-Pallares J, Rodriguez-Perez AI, Rey P, Guerra MJ, Labandeira-Garcia JL: The inflammatory response in the MPTP model of Parkinson's disease is

mediated by brain angiotensin: relevance to progression of the disease. J Neurochem 2009, 109:656-669. Johns Hopkins Med Lett Statins: true wonder drugs? Health After 50 2002, 14:1-2, 7. Joseph D'Ercole A, Ye P: Expanding the mind: insulin-like growth factor I and brain development. Endocrinology 2008, 149:5958-5962. Kamer AR, Craig RG, Dasanayake AP, Brys M, GlodzikSobanska L, de Leon MJ: Inflammation and Alzheimer's disease: possible role of periodontal diseases. Alzheimers Dement 2008, 4:242-250. Kara M, Alver G, Dizbay Sak S, Kavukcu S: Implantation metastasis caused by fine needle aspiration biopsy following curative resection of stage IB non-small cell lung cancer. European Journal of Cardio-Thoracic Surgery 2001, 20:868. Katagiri D, Hayashi H, Victoriano AF, Okamoto T, Onozaki K: Estrogen stimulates transcription of human immunodeficiency virus type 1 (HIV-1). Int Immunopharmacol 2006, 6:170181. Kaufman RP: Dealing with a shifting paradigm. Physician Exec 1987, 13:10-14. Kawajiri M, Mogi M, Osoegawa M, Matsuoka T, Tsukuda K, Kohara K, Horiuchi M, Miki T, Kira JI: Reduction of angiotensin II in the cerebrospinal fluid of patients with multiple sclerosis. Mult Scler 2008, 14:557-560. Kehoe AD, Nikiforov AM, Alexanin SS, Neronov EG, Tikhomirova OV, Shun'kov VB, Makarova NV, Rabinovich E, Usmanova NM, Kazakov VI, et al: Angiotensin-converting enzyme genotype and encephalopathy in Chernobyl cleanup workers. Eur J Neurol 2009, 16:95-100. Khor LY, Bae K, Pollack A, Hammond ME, Grignon DJ, Venkatesan VM, Rosenthal SA, Ritter MA, Sandler HM, Hanks GE, et al: COX-2 expression predicts prostate-cancer outcome: analysis of data from the RTOG 92-02 trial. Lancet Oncol 2007, 8:912-920. Kikkawa F, Mizuno M, Shibata K, Kajiyama H, Morita T, Ino K, Nomura S, Mizutani S: Activation of invasiveness of cervical carcinoma cells by angiotensin II. Am J Obstet Gynecol 2004, 190:1258-1263. Kim TH, Chang HS, Park SM, Nam BY, Park JS, Rhim T, Park HS, Kim MK, Choi IS, Cho SH, et al: Association of angiotensin I-converting enzyme gene polymorphisms with aspirin intolerance in asthmatics. Clin Exp Allergy 2008, 38: 1727: 1737. Kitayama H, Maeshima Y, Takazawa Y, Yamamoto Y, Wu Y, Ichinose K, Hirokoshi K, Sugiyama H, Yamasaki Y, Makino H: Regulation of angiogenic factors in angiotensin II infusion model in association with tubulointerstitial injuries. Am J Hypertens 2006, 19:718-727. Kjaer M, Magnusson P, Krogsgaard M, Moller JB, Olesen J, Heinemeier K, Hansen M, Haraldsson B, Koskinen S, Esmarck B, Langberg H: Extracellular matrix adaptation of tendon and skeletal muscle to exercise. J Anat 2006, 208:445-450. Kluwe J, Mencin A, Schwabe RF: Toll-like receptors, wound healing, and carcinogenesis. J Mol Med 2009, 87:125-138. Kobayashi T, Teruya M, Kishiki T, Endo D, Takenaka Y, Tanaka H, Miki K, Kobayashi K, Morita K: Inflammationbased prognostic score, prior to neoadjuvant chemoradiotherapy, predicts postoperative outcome in patients with esophageal squamous cell carcinoma. Surgery 2008, 144:729-735. Krick S, Hanze J, Eul B, Savai R, Seay U, Grimminger F, Lohmeyer J, Klepetko W, Seeger W, Rose F: Hypoxia-driven proliferation of human pulmonary artery fibroblasts: crosstalk between HIF-1alpha and an autocrine angiotensin system. Faseb J 2005, 19:857-859.

180

Smith and Missailidis: Learning from cancer Krutzik SR, Modlin RL: The role of Toll-like receptors in combating mycobacteria. Seminars in Immunology 2004, 16:35. Kuhn DM, Ghannoum MA: Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective. Clin Microbiol Rev 2003, 16:144-172. Kundu JK, Surh YJ: Inflammation: gearing the journey to cancer. Mutat Res 2008, 659:15-30. Laesser M, Oi Y, Ewert S, Fandriks L, Aneman A: The angiotensin II receptor blocker candesartan improves survival and mesenteric perfusion in an acute porcine endotoxin model. Acta Anaesthesiol Scand 2004, 48:198-204. Lalani AS, Barrett JW, McFadden G: Modulating chemokines: more lessons from viruses. Immunology Today 2000, 21:100. Laudanno OM, Cesolari JA: [Angiotensin II AT1 receptor antagonists as antiinflammatory and gastric protection drugs]. Acta Gastroenterol Latinoam 2006, 36:76-80. Lawson JS, Gunzburg WH, Whitaker NJ: Viruses and human breast cancer. Future Microbiol 2006, 1:33-51. Lee B, Vouthounis C, Stojadinovic O, Brem H, Im M, TomicCanic M: From an Enhanceosome to a Repressosome: Molecular Antagonism between Glucocorticoids and EGF Leads to Inhibition of Wound Healing. Journal of Molecular Biology, 345:1083. Lee JM, Yanagawa J, Peebles KA, Sharma S, Mao JT, Dubinett SM: Inflammation in lung carcinogenesis: new targets for lung cancer chemoprevention and treatment. Crit Rev Oncol Hematol 2008, 66:208-217. Lee JY, Kim HM, Ye YM, Bahn JW, Suh CH, Nahm D, Lee HR, Park HS: Role of staphylococcal superantigen-specific IgE antibodies in aspirin-intolerant asthma. Allergy Asthma Proc 2006, 27:341-346. Lerner UH: Bone remodeling in post-menopausal osteoporosis. J Dent Res 2006, 85:584-595. Li DY, Zhang YC, Philips MI, Sawamura T, Mehta JL: Upregulation of endothelial receptor for oxidized low-density lipoprotein (LOX-1) in cultured human coronary artery endothelial cells by angiotensin II type 1 receptor activation. Circ Res 1999, 84:1043-1049. Li JY, Avallet O, Berthelon MC, Langlois D, Saez JM: Effects of growth factors on cell proliferation and angiotensin II type 2 receptor number and mRNA in PC12W and R3T3 cells. Mol Cell Endocrinol 1998, 139:61-69. Liao YD, Xu H, Han Q, Lei J, Zhang YY, Wang ZH: [Expression of angiotensin II type 1 receptor in cervical squamous cell carcinoma and its clinical significance]. Zhonghua Zhong Liu Za Zhi 2007, 29:360-364. Lilenbaum R, Socinski MA, Altorki NK, Hart LL, Keresztes RS, Hariharan S, Morrison ME, Fayyad R, Bonomi P: Randomized phase II trial of docetaxel/irinotecan and gemcitabine/irinotecan with or without celecoxib in the second-line treatment of non-small-cell lung cancer. J Clin Oncol 2006, 24:4825-4832. Lin JJ, Yueh KC, Chang DC, Lin SZ: Association between genetic polymorphism of angiotensin-converting enzyme gene and Parkinson's disease. J Neurol Sci 2002, 199:25-29. Lorusso L, Mikhaylova SV, Capelli E, Ferrari D, Ngonga GK, Ricevuti G: Immunological aspects of chronic fatigue syndrome. Autoimmun Rev 2009, 8:287-291. Lyons A, Kelly JL, Rodrick ML, Mannick JA, Lederer JA: Major injury induces increased production of interleukin-10 by cells of the immune system with a negative impact on resistance to infection. Ann Surg 1997, 226:450-458; discussion 458-460. Maggio M, Ceda GP, Lauretani F, Pahor M, Bandinelli S, Najjar SS, Ling SM, Basaria S, Ruggiero C, Valenti G, Ferrucci L: Relation of angiotensin-converting enzyme inhibitor treatment

to insulin-like growth factor-1 serum levels in subjects >65 years of age (the InCHIANTI study). Am J Cardiol 2006, 97:1525-1529. Mahnke K, Johnson TS, Ring S, Enk AH: Tolerogenic dendritic cells and regulatory T cells: a two-way relationship. J Dermatol Sci 2007, 46:159-167. Mann JR, Backlund MG, DuBois RN: Mechanisms of disease: Inflammatory mediators and cancer prevention. Nat Clin Pract Oncol 2005, 2:202-210. Marastoni S, Ligresti G, Lorenzon E, Colombatti A, Mongiat M: Extracellular matrix: a matter of life and death. Connect Tissue Res 2008, 49:203-206. Martens JW, Sieuwerts AM, Bolt-deVries J, Bosma PT, Swiggers SJ, Klijn JG, Foekens JA: Aging of stromal-derived human breast fibroblasts might contribute to breast cancer progression. Thromb Haemost 2003, 89:393-404. Martin P, Parkhurst SM: Parallels between tissue repair and embryo morphogenesis. Development 2004, 131:3021-3034. Maruo T, Ohara N, Wang J, Matsuo H: Sex steroidal regulation of uterine leiomyoma growth and apoptosis. Hum Reprod Update 2004, 10:207-220. Matthay KK, Reynolds CP, Seeger RC, Shimada H, Adkins ES, Haas-Kogan D, Gerbing RB, London WB, Villablanca JG: Long-term results for children with high-risk neuroblastoma treated on a randomized trial of myeloablative therapy followed by 13-cis-retinoic acid: a children's oncology group study. J Clin Oncol 2009, 27:1007-1013. Maul B, Krause W, Pankow K, Becker M, Gembardt F, Alenina N, Walther T, Bader M, Siems WE: Central angiotensin II controls alcohol consumption via its AT1 receptor. Faseb J 2005, 19:1474-1481. Maung AA, Fujimi S, L. Miller M, MacConmara MP, Mannick JA, Lederer JA: Enhanced TLR4 reactivity following injury is mediated by increased p38 activation. J Leukoc Biol 2005:jlb.1204698. Maus U, Andereya S, Schmidt H, Zombory G, Gravius S, Ohnsorge JA, Niedhart C: [Therapy effects of testosterone on the recovery of bone defects]. Z Orthop Unfall 2008, 146:5963. Meduri GU: Clinical review: A paradigm shift: the bidirectional effect of inflammation on bacterial growth. Clinical implications for patients with acute respiratory distress syndrome. Critical Care 2002, 6:24 - 29. Menaker RJ, Jones NL: Fascination with bacteria-triggered cell death: the significance of Fas-mediated apoptosis during bacterial infection in vivo. Microbes and Infection 2003, 5:1149-1158. Menke MN, Menke NB, Boardman CH, Diegelmann RF: Biologic therapeutics and molecular profiling to optimize wound healing. Gynecol Oncol 2008, 111:S87-91. Miller AC, Rashid RM, Elamin EM: The "T" in trauma: the helper T-cell response and the role of immunomodulation in trauma and burn patients. J Trauma 2007, 63:1407-1417. Miyajima A, Kosaka T, Asano T, Asano T, Seta K, Kawai T, Hayakawa M: Angiotensin II type I antagonist prevents pulmonary metastasis of murine renal cancer by inhibiting tumor angiogenesis. Cancer Res 2002, 62:4176-4179. Miyazaki A, Kitaichi N, Ohgami K, Iwata D, Jin XH, Iwabuchi K, Morohashi T, Ohno S, Onoe K: Anti-inflammatory effect of angiotensin type 1 receptor antagonist on endotoxininduced uveitis in rats. Graefes Arch Clin Exp Ophthalmol 2008, 246:747-757. Mizoue S, Iwai M, Ide A, Suzuki J, Horiuchi M, Shiraishi A, Ohashi Y: Role of angiotensin II receptor subtypes in conjunctival wound healing. Curr Eye Res 2006, 31:129-136. Mocellin S, Marincola F, Riccardo Rossi C, Nitti D, Lise M: The multifaceted relationship between IL-10 and adaptive

181

Gene Therapy and Molecular Biology Vol 13, page 182 immunity: putting together the pieces of a puzzle. Cytokine & Growth Factor Reviews 2004, 15:61. Mollen KP, Anand RJ, Tsung A, Prince JM, Levy RM, Billiar TR: Emerging paradigm: toll-like receptor 4-sentinel for the detection of tissue damage. Shock 2006, 26:430-437. Moskowitz DW, Johnson FE: The central role of angiotensin Iconverting enzyme in vertebrate pathophysiology. Curr Top Med Chem 2004, 4:1433-1454. Muller OA, von Werder K: Ectopic production of ACTH and corticotropin-releasing hormone (CRH). The Journal of Steroid Biochemistry and Molecular Biology 1992, 43:403. Munteanu I, Didilescu C: [Chemistry and toxicology of cigarette smoke in the lungs]. Pneumologia 2007, 56:41, 43-46. Murphy E, Korach KS: Actions of estrogen and estrogen receptors in nonclassical target tissues. Ernst Schering Found Symp Proc 2006:13-24. Murphy TF: The role of bacteria in airway inflammation in exacerbations of chronic obstructive pulmonary disease. Curr Opin Infect Dis 2006, 19:225-230. Muthu K, He LK, Melstrom K, Szilagyi A, Gamelli RL, Shankar R: Perturbed bone marrow monocyte development following burn injury and sepsis promote hyporesponsive monocytes. J Burn Care Res 2008, 29:12-21. Nagai N, Oike Y, Noda K, Urano T, Kubota Y, Ozawa Y, Shinoda H, Koto T, Shinoda K, Inoue M, et al: Suppression of ocular inflammation in endotoxin-induced uveitis by blocking the angiotensin II type 1 receptor. Invest Ophthalmol Vis Sci 2005, 46:2925-2931. Nakamura H, Inoue T, Arakawa N, Shimizu Y, Yoshigae Y, Fujimori I, Shimakawa E, Toyoshi T, Yokoyama T: Pharmacological and pharmacokinetic study of olmesartan medoxomil in animal diabetic retinopathy models. Eur J Pharmacol 2005, 512:239-246. Nakayama M, Inoguchi T, Sonta T, Maeda Y, Sasaki S, Sawada F, Tsubouchi H, Sonoda N, Kobayashi K, Sumimoto H, Nawata H: Increased expression of NAD(P)H oxidase in islets of animal models of Type 2 diabetes and its improvement by an AT1 receptor antagonist. Biochem Biophys Res Commun 2005, 332:927-933. Neal CP, Mann CD, Sutton CD, Garcea G, Ong SL, Steward WP, Dennison AR, Berry DP: Evaluation of the prognostic value of systemic inflammation and socioeconomic deprivation in patients with resectable colorectal liver metastases. Eur J Cancer 2009, 45:56-64. Nickenig G, Sachinidis A, Seewald S, Bohm M, Vetter H: Influence of oxidized low-density lipoprotein on vascular angiotensin II receptor expression. J Hypertens Suppl 1997, 15:S27-30. Nicod LP, Pache JC, Howarth N: Fungal infections in transplant recipients. Eur Respir J 2001, 17:133-140. Oakley F, Teoh V, Ching ASG, Bataller R, Colmenero J, Jonsson JR, Eliopoulos AG, Watson MR, Manas D, Mann DA: Angiotensin II activates IkappaB kinase phosphorylation of RelA at Ser536 to promote myofibroblast survival and liver fibrosis. Gastroenterology 2009 [Epub ahead of print]. Ogarkov OB, Sin'kov VV, Medvedeva TV, Gutnikova M, Nekipelov OM, Raevskaia L, Kuptsevich N, Kostiunin K, Skvortsova RG: [Polymorphism of genes of the reninangiotensin system ACE, AT1R, and AT2R in patients with pulmonary tuberculosis]. Mol Gen Mikrobiol Virusol 2008:12-18. Owczarek H, Lewczuk E: Serum peptide III-procollagen and ACE in asbestos workers. Pol J Occup Med Environ Health 1991, 4:127-133. Ozacmak VH, Sayan H, Cetin A, Akyildiz-Igdem A: AT1 receptor blocker candesartan-induced attenuation of brain injury of rats subjected to chronic cerebral hypoperfusion. Neurochem Res 2007, 32:1314-1321.

Pasare C, Medzhitov R: Toll-like receptors: balancing host resistance with immune tolerance. Current Opinion in Immunology 2003, 15:677. Pasare C, Medzhitov R: Toll-like receptors: linking innate and adaptive immunity. Adv Exp Med Biol 2005, 560:11-18. Paterson HM, Murphy TJ, Purcell EJ, Shelley O, Kriynovich SJ, Lien E, Mannick JA, Lederer JA: Injury primes the innate immune system for enhanced Toll-like receptor reactivity. J Immunol 2003, 171:1473-1483. Peebles KA, Lee JM, Mao JT, Hazra S, Reckamp KL, Krysan K, Dohadwala M, Heinrich EL, Walser TC, Cui X, et al: Inflammation and lung carcinogenesis: applying findings in prevention and treatment. Expert Rev Anticancer Ther 2007, 7:1405-1421. Peehl DM, Wong ST, Cramer SD, Gross C, Feldman D: Suramin, hydrocortisone, and retinoic acid modify inhibitory effects of 1,25-dihydroxyvitamin D3 on prostatic epithelial cells. Urologic Oncology: Seminars and Original Investigations 1995, 1:188. Pelaia G, Vatrella A, Gallelli L, Renda T, Cazzola M, Maselli R, Marsico SA: Respiratory infections and asthma. Respir Med 2006, 100:775-784. Pelletier G, Ren L: Localization of sex steroid receptors in human skin. Histol Histopathol 2004, 19:629-636. Pinto Mendes J: The role of infection in asthma. Rev Port Pneumol 2008, 14:647-675. Platet N, Cathiard AM, Gleizes M, Garcia M: Estrogens and their receptors in breast cancer progression: a dual role in cancer proliferation and invasion. Critical Reviews in Oncology/Hematology 2004, 51:55. Pordeus V, Szyper-Kravitz M, Levy RA, Vaz NM, Shoenfeld Y: Infections and autoimmunity: a panorama. Clin Rev Allergy Immunol 2008, 34:283-299. Rabbani MA, Mahmood MS, Mekan SF, Frossard PM: Association of angiotensin-converting enzyme gene dimorphisms with severity of lupus disease. Saudi J Kidney Dis Transpl 2008, 19:761-766. Ramachandran V, Ismail P, Stanslas J, Shamsudin N, Moin S, Mohd Jas R: Association of insertion/deletion polymorphism of angiotensin-converting enzyme gene with essential hypertension and type 2 diabetes mellitus in Malaysian subjects. J Renin Angiotensin Aldosterone Syst 2008, 9:208-214. Recchia F, Saggio G, Cesta A, Alesse E, Gallo R, Necozione S, Rea S: Phase II randomized study of interleukin-2 with or without 13-cis retinoic acid as maintenance therapy in patients with advanced cancer responsive to chemotherapy. Anticancer Res 2005, 25:3149-3157. Recchia F, Saggio G, Cesta A, Candeloro G, Di Blasio A, Amiconi G, Lombardo M, Nuzzo A, Lalli A, Alesse E, et al: Phase II study of interleukin-2 and 13-cis-retinoic acid as maintenance therapy in metastatic colorectal cancer. Cancer Immunol Immunother 2007, 56:699-708. Recchia F, Saggio G, Nuzzo A, Biondi E, Di Blasio A, Cesta A, Candeloro G, Alesse E, Rea S: Multicenter phase 2 study of interleukin-2 and 13-cis retinoic acid as maintenance therapy in advanced non-small-cell lung cancer. J Immunother 2006, 29:87-94. Recchia F, Sica G, Candeloro G, Necozione S, Bisegna R, Bratta M, Rea S: Maintenance immunotherapy in metastatic breast cancer. Oncol Rep 2008, 20:1173-1179. Reckamp KL, Krysan K, Morrow JD, Milne GL, Newman RA, Tucker C, Elashoff RM, Dubinett SM, Figlin RA: A phase I trial to determine the optimal biological dose of celecoxib when combined with erlotinib in advanced non-small cell lung cancer. Clin Cancer Res 2006, 12:3381-3388.

182

Smith and Missailidis: Learning from cancer Reis e Sousa C: Activation of dendritic cells: translating innate into adaptive immunity. Current Opinion in Immunology 2004, 16:21. Riaz AA, Wang Y, Schramm R, Sato T, Menger MD, Jeppsson B, Thorlacius H: Role of angiotensin II in ischemia/reperfusion-induced leukocyte-endothelium interactions in the colon. Faseb J 2004, 18:881-883. Richmond RS, Tallant EA, Gallagher PE, Ferrario CM, Strawn WB: Angiotensin II stimulates arachidonic acid release from bone marrow stromal cells. J Renin Angiotensin Aldosterone Syst 2004, 5:176-182. Rocken C, Neumann K, Carl-McGrath S, Lage H, Ebert MP, Dierkes J, Jacobi CA, Kalmuk S, Neuhaus P, Neumann U: The gene polymorphism of the angiotensin I-converting enzyme correlates with tumor size and patient survival in colorectal cancer patients. Neoplasia 2007, 9:716-722. Rocken C, Rohl FW, Diebler E, Lendeckel U, Pross M, CarlMcGrath S, Ebert MP: The angiotensin II/angiotensin II receptor system correlates with nodal spread in intestinal type gastric cancer. Cancer Epidemiol Biomarkers Prev 2007, 16:1206-1212. Rodriguez-Pallares J, Rey P, Parga JA, Munoz A, Guerra MJ, Labandeira-Garcia JL: Brain angiotensin enhances dopaminergic cell death via microglial activation and NADPH-derived ROS. Neurobiol Dis 2008, 31:58-73. Ross JS, Stagliano NE, Donovan MJ, Breitbart RE, Ginsburg GS: Atherosclerosis and cancer: common molecular pathways of disease development and progression. Ann N Y Acad Sci 2001, 947:271-292; discussion 292-273. Ross R: Atherosclerosis--an inflammatory disease. N Engl J Med 1999, 340:115-126. Saibeni S, Spina L, Virgilio T, Folcioni A, Borsi G, de Franchis R, Cugno M, Vecchi M: Angiotensin-converting enzyme insertion/deletion gene polymorphism in inflammatory bowel diseases. Eur J Gastroenterol Hepatol 2007, 19:976-981. Sanchez-Lemus E, Murakami Y, Larrayoz-Roldan IM, Moughamian AJ, Pavel J, Nishioku T, Saavedra JM: Angiotensin II AT1 receptor blockade decreases lipopolysaccharide-induced inflammation in the rat adrenal gland. Endocrinology 2008, 149:5177-5188. Savaskan E, Hock C, Olivieri G, Bruttel S, Rosenberg C, Hulette C, Muller-Spahn F: Cortical alterations of angiotensin converting enzyme, angiotensin II and AT1 receptor in Alzheimer's dementia. Neurobiol Aging 2001, 22:541-546. Schneider CP, Schwacha MG, Chaudry IH: The role of interleukin-10 in the regulation of the systemic inflammatory response following trauma-hemorrhage. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 2004, 1689:22. Schulman IH, Raij L: The angiotensin II type 2 receptor: what is its clinical significance? Curr Hypertens Rep 2008, 10:188193. Schwacha MG, Daniel T: Up-regulation of cell surface Toll-like receptors on circulating gammadelta T-cells following burn injury. Cytokine 2008, 44:328-334. Seckl JR, Meaney MJ: Glucocorticoid Programming. Ann NY Acad Sci 2004, 1032:63-84. Sengupta S, Wasylyk B: Physiological and Pathological Consequences of the Interactions of the p53 Tumor Suppressor with the Glucocorticoid, Androgen, and Estrogen Receptors. Ann NY Acad Sci 2004, 1024:54-71. Sethi S: Coinfection in exacerbations of COPD: a new frontier. Chest 2006, 129:223-224. Shafiq N, Malhotra S, Pandhi P, Grover A: The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst. J Negat Results Biomed 2005, 4:3. Shankar A, Wang JJ, Rochtchina E, Yu MC, Kefford R, Mitchell P: Association Between Circulating White Blood Cell Count

and Cancer Mortality: A Population-Based Cohort Study. Arch Intern Med 2006, 166:188-194. Sharma R, Hook J, Kumar M, Gabra H: Evaluation of an inflammation-based prognostic score in patients with advanced ovarian cancer. Eur J Cancer 2008, 44:251-256. Sharma R, Zucknick M, London R, Kacevska M, Liddle C, Clarke SJ: Systemic inflammatory response predicts prognosis in patients with advanced-stage colorectal cancer. Clin Colorectal Cancer 2008, 7:331-337. Shen L, Mo H, Cai L, Kong T, Zheng W, Ye J, Qi J, Xiao Z: LOSARTAN PREVENTS SEPSIS-INDUCED ACUTE LUNG INJURY AND DECREASES ACTIVATION OF NFkappaB AND MAPKs. Shock 2009, 31: 500-506. Shibata K, Kikkawa F, Mizokami Y, Kajiyama H, Ino K, Nomura S, Mizutani S: Possible involvement of adipocytederived leucine aminopeptidase via angiotensin II in endometrial carcinoma. Tumour Biol 2005, 26:9-16. Sica A, Allavena P, Mantovani A: Cancer related inflammation: the macrophage connection. Cancer Lett 2008, 267:204-215. Silverman MN, Pearce BD, Biron CA, Miller AH: Immune Modulation of the Hypothalamic-Pituitary-Adrenal (HPA) Axis during Viral Infection. Viral Immunology 2005, 18:4178. Slaviero KA, Clarke SJ, Rivory LP: Inflammatory response: an unrecognised source of variability in the pharmacokinetics and pharmacodynamics of cancer chemotherapy. Lancet Oncol 2003, 4:224-232. Smith CJ, Perfetti TA, King JA: Perspectives on pulmonary inflammation and lung cancer risk in cigarette smokers. Inhal Toxicol 2006, 18:667-677. Smith GR, Missailidis S: Cancer, inflammation and the AT1 and AT2 receptors. J Inflamm (Lond) 2004, 1:3. Smith GR: Treatment of Cancer in Conjunction with Other Agents. In Anticancer Therapeutics (Missailidis, ed); 2008: 349-364 Sonnex C: Influence of ovarian hormones on urogenital infection. Sex Transm Infect 1998, 74:11-19. Sparks DL, Hunsaker JC, 3rd, Amouyel P, Malafosse A, Bellivier F, Leboyer M, Courtet P, Helbecque N: Angiotensin I-converting enzyme I/D polymorphism and suicidal behaviors. Am J Med Genet B Neuropsychiatr Genet 2009, 150B:290-294. Steckelings UM, Henz BM, Wiehstutz S, Unger T, Artuc M: Differential expression of angiotensin receptors in human cutaneous wound healing. Br J Dermatol 2005, 153:887-893. Steckelings UM, Wollschlager T, Peters J, Henz BM, Hermes B, Artuc M: Human skin: source of and target organ for angiotensin II. Exp Dermatol 2004, 13:148-154. Sun G, Haginoya K, Dai H, Chiba Y, Uematsu M, Hino-Fukuyo N, Onuma A, Iinuma K, Tsuchiya S: Intramuscular reninangiotensin system is activated in human muscular dystrophy. J Neurol Sci 2009, 280:40-48. Sutmuller R, Garritsen A, Adema GJ: Regulatory T cells and toll-like receptors: regulating the regulators. Ann Rheum Dis 2007, 66 Suppl 3:iii91-95. Suzuki Y, Ruiz-Ortega M, Lorenzo O, Ruperez M, Esteban V, Egido J: Inflammation and angiotensin II. Int J Biochem Cell Biol 2003, 35:881-900. Tahir M, Sharma SK, Ashraf S, Mishra HK: Angiotensin converting enzyme genotype affects development and course of sarcoidosis in Asian Indians. Sarcoidosis Vasc Diffuse Lung Dis 2007, 24:106-112. Tamari M, Harada M, Hirota T, Nakamura Y: Host molecular defense mechanisms against Chlamydophila pneumoniae and genetic studies of immune-response-related genes in asthma. Recent Pat Inflamm Allergy Drug Discov 2009, 3:17-25. Tamura M, Chen YJ, Howard EF, Tanner M, Landon EJ, Myers PR: Lipopolysaccharides and cytokines downregulate the

183

Gene Therapy and Molecular Biology Vol 13, page 184 angiotensin II type 2 receptor in rat cardiac fibroblasts. Eur J Pharmacol 1999, 386:289-295. Taranova AG, Maldonado D, 3rd, Vachon CM, Jacobsen EA, Abdala-Valencia H, McGarry MP, Ochkur SI, Protheroe CA, Doyle A, Grant CS, et al: Allergic pulmonary inflammation promotes the recruitment of circulating tumor cells to the lung. Cancer Res 2008, 68:8582-8589. Tarantini F, Baiardini I, Passalacqua G, Braido F, Canonica GW: Asthma treatment: 'magic bullets which seek their own targets'. Allergy 2007, 62:605-610. Tatokoro M, Fujii Y, Kawakami S, Fukui N, Komai Y, Saito K, Koga F, Morimoto S, Fukui I, Kihara K: Favorable response to combination treatment of cimetidine, cyclooxygenase-2 inhibitor and renin-angiotensin system inhibitor in metastatic renal cell carcinoma: Report of three cases. Int J Urol 2008, 15:848-850. Tauro S, Su YC, Thomas S, Schwarze J, Matthaei KI, Townsend D, Simson L, Tripp RA, Mahalingam S: Molecular and cellular mechanisms in the viral exacerbation of asthma. Microbes Infect 2008, 10:1014-1023. Toblli JE, Munoz MC, Cao G, Mella J, Pereyra L, Mastai R: ACE inhibition and AT1 receptor blockade prevent fatty liver and fibrosis in obese Zucker rats. Obesity (Silver Spring) 2008, 16:770-776. Todorovic V, Pesko P, Micev M, Bjelovic M, Budec M, Micic M, Brasanac D, Ilic-Stojanovic O: Insulin-like growth factor-I in wound healing of rat skin. Regul Pept 2008, 150:7-13. Toulon A, Breton L, Taylor KR, Tenenhaus M, Bhavsar D, Lanigan C, Rudolph R, Jameson J, Havran WL: A role for human skin-resident T cells in wound healing. J Exp Med 2009, 206: 743-750. Toussirot E, Roudier J: Epstein-Barr virus in autoimmune diseases. Best Pract Res Clin Rheumatol 2008, 22:883-896. Tsang SW, Cheng CH, Leung PS: The role of the pancreatic renin-angiotensin system in acinar digestive enzyme secretion and in acute pancreatitis. Regul Pept 2004a, 119:213-219. Tsang SW, Ip SP, Leung PS: Prophylactic and therapeutic treatments with AT 1 and AT 2 receptor antagonists and their effects on changes in the severity of pancreatitis. Int J Biochem Cell Biol 2004b, 36:330-339. Tseng RJ, Padgett DA, Dhabhar FS, Engler H, Sheridan JF: Stress-induced modulation of NK activity during influenza viral infection: role of glucocorticoids and opioids. Brain, Behavior, and Immunity 2005, 19:153. Tsung K, Norton JA: Lessons from Coley's Toxin. Surg Oncol 2006, 15:25-28. Turney MK, Nicholson WE, Kovacs WJ: Gene expression phenotyping of an ACTH-producing small cell lung cancer line. Molecular and Cellular Endocrinology 2004, 219:105. U.S. Preventive Services Task Force recommendation statement. Routine aspirin or nonsteroidal anti-inflammatory drugs for the primary prevention of colorectal cancer. Ann Intern Med 2007, 146:361-364. Uemura H, Hasumi H, Kawahara T, Sugiura S, Miyoshi Y, Nakaigawa N, Teranishi J, Noguchi K, Ishiguro H, Kubota Y: Pilot study of angiotensin II receptor blocker in advanced hormone-refractory prostate cancer. Int J Clin Oncol 2005, 10:405-410. Uppal SS, Haider MZ, Hayat SJ, Abraham M, Sukumaran J, Dhaunsi GS: Significant association of insertion/deletion polymorphism of the angiotensin-converting enzyme gene with rheumatoid arthritis. J Rheumatol 2007, 34:2395-2399. Urhan M, Degirmenci I, Harmanci E, Gunes HV, Metintas M, Basaran A: High frequency of DD polymorphism of the angiotensin-converting enzyme gene in Turkish asthmatic patients. Allergy Asthma Proc 2004, 25:243-247. Vairaktaris E, Yapijakis C, Tsigris C, Vassiliou S, Derka S, Nkenke E, Spyridonidou S, Vylliotis A, Vorris E, Ragos V, et

al: Association of angiotensin-converting enzyme gene insertion/deletion polymorphism with increased risk for oral cancer. Acta Oncol 2007, 46:1097-1102. Vaziri ND, Bai Y, Ni Z, Quiroz Y, Pandian R, Rodriguez-Iturbe B: Intra-renal angiotensin II/AT1 receptor, oxidative stress, inflammation, and progressive injury in renal mass reduction. J Pharmacol Exp Ther 2007, 323:85-93. Veillard NR, Mach F: Statins: the new aspirin? Cell Mol Life Sci 2002, 59:1771-1786. Vigano A, Trutschnigg B, Kilgour RD, Hamel N, Hornby L, Lucar E, Foulkes W, Tremblay ML, Morais JA: Relationship Between Angiotensin-Converting Enzyme Gene Polymorphism and Body Composition, Functional Performance, and Blood Biomarkers in Advanced Cancer Patients. Clin Cancer Res 2009, 15: 2442-2447. Vladutiu GD, Natelson BH: Association of medically unexplained fatigue with ACE insertion/deletion polymorphism in Gulf War veterans. Muscle Nerve 2004, 30:38-43. Walton RP, Johnston SL: Role of respiratory viral infections in the development of atopic conditions. Curr Opin Allergy Clin Immunol 2008, 8:150-153. Watanabe T, Pakala R, Katagiri T, Benedict CR: Mildly oxidized low-density lipoprotein acts synergistically with angiotensin II in inducing vascular smooth muscle cell proliferation. J Hypertens 2001, 19:1065-1073. Whiteside TL: The role of immune cells in the tumor microenvironment. Cancer Treat Res 2006, 130:103-124. Whiteside TL: The tumor microenvironment and its role in promoting tumor growth. Oncogene 2008, 27:5904-5912. Woetmann A, Lovato P, Eriksen KW, Krejsgaard T, Labuda T, Zhang Q, Mathiesen A-M, Geisler C, Svejgaard A, Wasik MA, Odum N: Nonmalignant T cells stimulate growth of Tcell lymphoma cells in the presence of bacterial toxins. Blood 2007, 109:3325-3332. Wolf G: Retinoic acid as cause of cell proliferation or cell growth inhibition depending on activation of one of two different nuclear receptors. Nutr Rev 2008, 66:55-59. Wu J, Meng Z, Jiang M, Pei R, Trippler M, Broering R, Bucchi A, Sowa JP, Dittmer U, Yang D, et al: Hepatitis B virus suppresses toll-like receptor-mediated innate immune responses in murine parenchymal and nonparenchymal liver cells. Hepatology 2009, 49:1132-1140. Wu P, Dupont WD, Griffin MR, Carroll KN, Mitchel EF, Gebretsadik T, Hartert TV: Evidence of a causal role of winter virus infection during infancy in early childhood asthma. Am J Respir Crit Care Med 2008, 178:1123-1129. Xia Y, Zhou CC, Ramin SM, Kellems RE: Angiotensin receptors, autoimmunity, and preeclampsia. J Immunol 2007, 179:3391-3395. Yamagata T, Ichinose M: Agents against cytokine synthesis or receptors. Eur J Pharmacol 2006, 533:289-301. Yang YH, Liu CK: Angiotensin-converting enzyme gene in Alzheimer's disease. Tohoku J Exp Med 2008, 215:295-298. Yaren A, Turgut S, Kursunluoglu R, Oztop I, Turgut G, Degirmencioglu S, Kelten C, Erdem E: Insertion/Deletion polymorphism of the Angiotensin I-converting enzyme gene in patients with breast cancer and effects on prognostic factors. J Investig Med 2007, 55:255-261. Yasuda N, Akazawa H, Qin Y, Zou Y, Komuro I: A novel mechanism of mechanical stress-induced angiotensin II type 1-receptor activation without the involvement of angiotensin II. Naunyn Schmiedebergs Arch Pharmacol 2008, 377:393399. Yigit B, Bozkurt N, Narter F, Yilmaz H, Yucebas E, Isbir T: Effects of ACE I/D polymorphism on prostate cancer risk, tumor grade and metastatis. Anticancer Res 2007, 27:933936.

184

Smith and Missailidis: Learning from cancer Yoshiji H, Noguchi R, Fukui H: [RAAS inhibitors as therapeutic alternatives in the treatment of chronic liver diseases]. Nippon Rinsho 2009, 67:799-806. Zhang H, Sun GY: Expression and regulation of AT1 receptor in rat lung microvascular endothelial cell. J Surg Res 2006, 134:190-197. Zhou J, Tian X, Xu Q: Angiotensin-converting enzyme gene insertion/deletion polymorphism in children with Henoch-

Gary Robert Smith

Schonlein purpua nephritis. J Huazhong Univ Sci Technolog Med Sci 2004, 24:158-161. Zuniga MC: Lessons in detente or know thy host: the immunomodulatory gene products of myxoma virus. J Biosci 2003, 28:273-285.

Sotiris Missailidis

185

Gene Therapy and Molecular Biology Vol 13, page 186! Gene Ther Mol Biol Vol 13, 186-193, 2009

The aberrant expression of bone morphogenetic protein 12 (BMP-12) in human breast cancer and its potential prognostic value Research Article

Jin Li1, Lin Ye1, Christian Parr1, Anthony Douglas-Jones1, Howard G. Kynaston1, Robert E. Mansel1, Wen G. Jiang1* 1

Metastasis & Angiogenesis Research Group, Cardiff University School of Medicine, Heath Park, Cardiff, CF14 4XN

_____________________________________________________________________________________________ *Correspondence: Wenguo Jiang, Metastasis & Angiogenesis Research Group, Department of Surgery, Cardiff University School of Medicine, Heath Park, Cardiff, CF14 4XN, UK; Tel: 0044 (0) 29 2074 2895; Fax: 44 29 2074 2896; E-mail:!jiangw@cf.ac.uk Keywords: Bone morphogenetic protein-12 and breast cancer Received: 10 June 2009; Revised: 11 June 2009; Accepted: 10 June 2009; electronically published: 15 June 2009

Summary Background and aims: Bone morphogenetic proteins (BMPs) play important roles in the development and progression of breast cancer via the regulation of cellular proliferation, differentiation, apoptosis, motility of tumor cells and angiogenesis. BMP-12 is a new member of the BMP family and has been implicated in the development of certain tissues. However, its role in breast cancer is largely unknown. The current study investigated the expression pattern of BMP-12 in a breast cancer cohort and evaluated the possible correlation between BMP-12 and clinical and pathological features. Method: BMP-12 transcripts were examined in a variety of breast cancer cell lines using RT-PCR. The expression of BMP-12 transcripts in primary breast cancer tissues (n=112) and normal mammary tissues (n=31) was determined using quantitative real time PCR. The expression and cellular distribution of BMP12 was further examined using immunohistochemical staining. The transcript level of BMP-12 was analysed against the clinical, pathological and follow-up (10 years) data. Results: BMP-12 transcript was detected at a lower level in breast cancer cell lines and breast tumour tissues. Immunohistochemical staining revealed significantly lower levels of BMP-12 staining in breast tumors than in normal tissues. It showed a trend that BMP-12 transcript levels were higher in tumors from patients with a good prognosis compared with those with a poor prognosis. Tumors from patients with longer overall survival also had a higher level of the transcript than those from patients with a shorter survival. Conclusion: BMP-12 expression is decreased in breast tumors, and is correlated with poor prognosis. It suggests that BMP-12 may be an inhibitory factor during the disease progression and may have potential prognostic implications in breast cancer.

conditions, including embryonic development, organogenesis, bone formation, reproduction, adult tissue homeostasis, bone development and bone metastasis. They are highly related molecules, which form a subgroup of the transforming growth factor-! (TGF-!) super family. BMPs comprise an amino-terminal pro-region and a carboxy-terminal ligand of 110-140 amino acids in length, which are synthesized as large precursor proteins, processed into mature proteins, and secreted as homo- or heterodimers (Ozkaynak et al, 1990; Wozney et al, 1990; Wozney et al, 1988). BMPs regulate target gene transcription by signalling through specific serinethreonine receptors and intracellular Smad proteins (Itoh et al, 2000). Six of the Type-I receptors and three of the Type-II receptors have been indicated in the BMP signalling, with BMPR-IA, BMPR-IB (Type-I) and

I. Introduction In Europe and in the USA, 1 in 10 women will be affected by breast cancer in their lifetime. Despite recent advances in the diagnosis and treatment of breast cancer, this disease continues to be a major cause of death in females (Jemal et al, 2008). The clinical outcome is dependent upon a number of factors including the size of primary tumor, histological type, grade, lymph node involvement, and distant metastasis. The most common site of breast cancer metastasis is bone. This leads us to focus on the mechanism of bone metastasis, which involves the interactions between cancer cells and bone marrow endothelial cells, osteoblasts, osteoclasts, and their microenvironment. Bone Morphogenic Proteins (BMPs) are osteogenic factors abundant in bone matrix and also play important roles in various physiological and pathophysiological

186

Li et al: BMP-12 in breast cancer! pathologist (ADJ) using H&E staining of frozen sections. Clinical details of patients are provided in Table 1.

BMPR-II (Type-II) being specific for BMPs (Shi and Massague, 2003). BMP and BMP signalling have been indicated in the tumorigenesis and progression of various solid tumors (Ye et al, 2007). Aberrations in BMPs’ expression and signalling have also been indicated in breast cancer and are associated with disease progression and prognosis. For example, decreased expressions of BMP-2, BMP-7, GDF9a and BMP-15 have been seen in primary breast tumours and are correlated with poor prognosis (Buijs et al, 2007; Davies et al, 2008; Hanavadi et al, 2007). Most interestingly, a decrease in BMP-7 expression in primary breast tumors associates with bone metastasis. Experimental data from an in vivo bone metastasis model further supports an inhibitory role of BMP-7 in bone metastasis from breast cancer (Buijs, Henriquez et al, 2007). In contrast to these observations, elevated expression of some BMPs, such as BMP-4, BMP-5 and BMP-7 has also been implicated in breast cancer (Alarmo et al, 2008; Alarmo et al, 2007; Alarmo et al, 2006; Bobinac et al, 2005; Raida et al, 2005). Collectively, these evidences suggest that BMPs play important roles during the disease progression and bone metastasis. Apart from the aberrant expression of BMPs in breast, perturbed expression of BMP receptors and downstream signalling were also indicated in the development and progression of breast cancer, particularly the disease specific bone metastasis (Bokobza et al, 2009; Helms et al, 2005; Katsuno et al, 2008). Bone morphogenetic protein-12 (BMP-12), also known as growth differentiation factor 7 (GDF-7), was first identified in 1994 (Storm et al, 1994). It shares high identity in amino acid sequence at carboxyl terminal with GDF-5 and GDF-6. GDF-7 has been indicated in the development and maintenance of various tissues, including bone, cartilage, tendon, neural tissue and tooth (Lee et al, 1998; Lo et al, 2005; Maloul et al, 2006; Mikic et al, 2008; Morotome et al, 1998). However, the role played by BMP12 in cancer remains unknown. Present study aimed to examine the expression of BMP-12 in human breast cancer and assess the correlations with pathological features and clinical outcomes.

C.Tissue processing and preparation of RNA and cDNA Tissue samples were homogenized in RNA extraction reagent (TRI reagent, Sigma-Aldrich Ltd, Poole, England, UK) to extract total RNA. The concentration of RNA was determined using a spectrophotometer. 0.5µg RNA was used in a 20µl reverse transcription reaction to generate cDNA using a RT kit (AbGene Laboratories, Essex, England).

D. Screening of BMP-12 transcripts expression in breast cell lines using PCR Primers were designed using the Beacon Designer software (version 2, Biosoft International, Palo Alto, California, USA), to amplify regions of human BMP-12 that have no significant overlap with other known sequences and that the amplified products span over at least one intron, based on sequence accession number AB158468. The primers used were: 5' GCAGAGGAAAGAGAGCTTAT 3’ and 5' GATGTAGAGGATGCTGATGG 3’. Reactions were carried out at the following conditions: 94°C for 5 minutes, 36 cycles of 94°C for 1 minute, 55°C for 40 seconds and 72°C for 1 minute, followed by a final extension at 72°C for 10 minutes. PCR products were separated on a 2% agarose gel and photographed using a digital camera mounted over a UV transluminator. !actin was used as a housekeeping gene: 5' ATGATATCGCCGCGCTCG 3’ and 5' CGCTCGTGTAGGATCTTCA 3’.

E. Determination of BMP-12 Transcripts in Breast Tissues Using Quantitative PCR The real time quantitative PCR was carried out to determine the levels of BMP-12 transcripts in the breast cancer cohort. The assay was based on the Amplifuor technology and primers were designed by Beacon Designer software which included complementary sequence to universal Z probe (Intergen Inc., Oxford, United Kingdom), as we previous reported (Jiang et al, 2005; Parr et al, 2004) Primers used for BMP-12 quantitation were 5’ GATCACCGGCTTCACAGA 3’ and 5’ ACTGAACCTGACCGTACAGTCGTTAAGGCT 3’ and for housekeeping GAPDH 5’ GGCTGCTTTTAACTCTGGTA 3’ and 5’ GACTGTGGTCATGAGTCCTT 3’. Each 10µl reaction contains 5µl of Hot-start Q-master mix (Abgene), 10 pmol of specific forward primer, 1 pmol reverse primer which has the Z sequence, 10 pmol of FAM-tagged universal Z probe (Intergen Inc., Oxford, United Kingdom), and 50ng cDNA. The Q-PCR was carried out on IcyclerIQ™ (Bio-Rad, Hemel Hemstead, England, UK), which is equipped with an optic unit that allows real time detection of 96 reactions. The following condition was used in the reaction: 94°C for 12 minutes, 60 cycles of 94°C for 15 seconds, 55°C for 40 seconds (the data capture step) and 72°C for 20 seconds. The levels of the transcripts were generated from an internal standard that was simultaneously amplified with the samples. Cytokeratin-19 (CK19) was used to normalise cellularity during the analysis and primers for CK19 were 5'CAGGTCCGAGGTTACTGAC 3’; and 5'ACTGAACCTGACCGTACACACTTTCTGCCAGTGTGTCT TC 3’, respectively. Data are shown here as either the number of transcripts (mean number of BMP-12 transcript per 50ng total RNA) or as BMP-12: CK19 ratio.

II. Materials and methods A. Cell culture Breast cancer cell lines were purchased from the European Collection of Animal Cell Cultures (ECACC, Salisbury, England). Cells were routinely cultured in DMEM / Ham’s F12 with L-Glutamine (PAA Laboratories, Somerset, UK) supplemented with streptomycin, penicillin and 10% foetal bovine serum (PAA Laboratories, Somerset, UK), in an incubator at 37.0oC, 5% CO2 and 95% humidity.

B. Tissues and patients Breast cancer tissues (n=112) and normal background tissues (n=31) were collected during operation and stored in deep freezer until use. Patients were routinely followed clinically. The median follow up for the cohort was 10 years. The presence of tumor cells in the collected tissues was verified by a consultant

187 !

Gene Therapy and Molecular Biology Vol 13, page 188! Table 1. Demographic information of the study cohort

F. Immunohistochemical Staining of BMP-12 in Breast Specimen

G.Statistical Analysis Statistical analysis was performed using the Minitab statistical software package (version 14). Non-normally distributed data was assessed using the Mann-Whitney test, while the two samples t-test was used for normally distributed data. Kaplan-Meier survival analysis and Cox hazardous proportion analysis were performed using SPSS statistical software (version 12, SPSS Inc. Chicago, IL, USA). Differences were considered to be statistically significant at p<0.05.

This was based on the method previous described (Kang et al, 2005; Martin et al, 2003). Briefly, frozen breast tissues were cut into 5Âľm sections using a cryostat (Leica Microsystems (UK) Ltd., Bucks, UK). The sections were mounted on super frost plus microscope slides, fixed in a 1:1 mixture of acetone and methanol for 20 minutes and air-dried. The sections were stored at -20oC. Staining for each molecule was conducted on all the slides at the same time in a single batch to avoid variance in experimental conditions. The sections were then placed in Optimax wash buffer (BioGenex, San Ramon, USA) for 5 â&#x20AC;&#x201C; 10 minutes to rehydrate. Sections were incubated for 20 mins in a blocking solution that contained 10% horse serum and probed with the primary antibody (rabbit antihuman BMP-12), at a concentration of 1:100, for 60 minutes). The dilution chosen here was based on an evaluation test, during which the antibody was tested over a range of dilution from 1:10 to 1:1000. Primary antibodies were omitted in the negative controls. Unbound primary antibody was then removed by washing the sections 4 times in wash buffer. A universal secondary antibody (Vectorstain ABC Kit, Vector Laboratories Inc., Burlingame, USA) was then applied for 30 minutes at room temperature. Following washings, Avidin Biotin Complex (Vector Laboratories) was then applied to the sections followed by extensive washings. Diaminobenzidine chromogen (Vector Labs) was then added to the sections, which were incubated in the dark for 5 minutes. Sections were then counter-stained in Gill's Haematoxylin and dehydrated in ascending grades of methanol before clearing in xylene and mounting under a cover slip.

III. Results A. The Expression of BMP-12 in breast cancer cell lines and tissues The presence of the BMP-12 transcript was examined in a panel of breast cancer cell lines and normal human breast tissue using conventional RT-PCR. We found that BMP-12 transcripts were expressed in normal human breast tissue, but not detectable in most breast cancer cell lines except for MDA-MB-157, which weakly expressed the gene transcript. There was no significant difference in the levels of BMP-12 transcripts in the more aggressive breast cancer cell lines (MDA-MB-231), in comparison with the less aggressive cell lines (MCF-7, ZR-7 51, MDA-MB-436, MDA-MB-157, BT549) (Figure 1). To verify the expression of BMP-12 in breast tissue, we examined its protein expression using immunohistochemistry. The immunochemical staining of BMP-12 revealed stronger staining in normal breast tissues compared to breast cancer tissue. Figure-2 displays BMP-12 staining in normal tissues (Figure 2A), and its distribution was mainly confined to the cytoplasm of mammary epithelial cells. Compared to the normal cells, the expression of BMP-12 was very weak in cancer cells 188

Li et al: BMP-12 in breast cancer! of tumor tissues (Figure 2A). The staining of BMP-12 protein, as shown by staining intensity was significantly decreased in breast cancer tissues, p=0.0041 vs. normal tissues (Figure 2B). The levels of BMP-12 transcript were also determined in the breast cancer cohort using quantitative PCR. There was no significant difference seen between breast cancer tissues (82.8+/-648.5) and normal tissues (60.8+/-233.7), p=0.19..

disease free (17.8±16.4 vs 113.9±92.5), however the difference is not statistically significant (p=0.69).

D. BMP-12 transcripts level and Estrogen Receptor Status We also quantified the BMP-12 expression levels in the patients sub grouped as ER-" and ER-! negative or positive. The ratio of BMP-12 and CK19 showed a trend that BMP-12 reduced in the patients with ER-" negative (15.54+9.59) or ER-! positive tumors (0.7+0.54), respectively compared to the ER-" positive (213+205) and ER-! negative (102+86.1), although the differences were yet to reach statistical significance (p=0.34, p=0.24 respectively).

B. BMP-12 transcripts level and lymph nodal status, pathological types, tumor grade and TNM staging We further analysed the levels of BMP-12 transcript in connection with other indicators of prognosis: the nodal status of patients, Tumor Node Metastasis staging (TNM) and tumor grade. There was no significant difference shown by the data, but a trend is seen in reference to nodal status. The patients with lymphatic metastases had lower levels of BMP-12 (8.9±33.8), p=0.26 compared to the node negative group (159±920). The same trend was also observed in the connection to TNM status. BMP-12 transcripts levels were decreased in the advanced breast cancer, particularly in TNM 3 and TNM 4, which were 0.441±0.978 and 7.06±14.11, p=0.23 and p=0.29 in comparison with that of TNM1 (147±884) respectively (Figure 3).

IV. Discussion BMP-12, also known as GDF-7 plays profound role in regulating development and homeostasis of a variety tissues, such as bone, tendon, tooth and nerve. In the present study, we first examined its expression in breast cancer, including breast cancer cell lines and human breast cancer tissues. BMP-12 was expressed at lower level or absent in most examined breast cancer cell lines in comparison with the normal breast tissue and placenta. The expression of BMP-12 mRNA was first revealed in human breast tissue, the existence of BMP-12 in the breast tissue was further confirmed by immunohistochemical staining of BMP-12 in human breast tissue, which was confined to cytoplasm of mammary epithelial cells. IHC also demonstrated a decreased staining of BMP-12 in breast tumors compared to normal background tissues. This is consistent with the decreased or loss of BMP-12 expression in breast cancer cell lines. It suggests that BMP-12 is reduced/lost in breast cancer cell lines and in mammary tumours, a pattern of expression arguing a potential role played by BMP-12 in breast cancer. BMPs have been implicated in the disease progression and bone metastasis of breast cancer. During the disease progression, certain BMPs are decreased, which indicate these BMPs may be inhibitory factors against breast cancer cells. For example, the BMP-2, BMP-6, BMP-7, GDF-9a and BMP-15, are shown to be decreased in the primary tumors of the breast, and their reduced expression associate with disease progression and poor prognosis (Buijs, Henriquez et al, 2007; Davies, Watkins et al, 2008; Hanavadi, Martin et al, 2007). It is noteworthy that the decreased BMP-7 expression is also linked to the disease specific bone metastasis, which is further supported by in vivo bone model experimental evidence. In contrast, some BMPs are up regulated in the breast cancer, and may contribute to the disease progression and bone metastasis, such as BMP-4, BMP-5 and BMP-7 (Alarmo, Korhonen et al, 2008; Alarmo, Kuukasjarvi et al, 2007; Alarmo, Rauta et al, 2006; Bobinac, Maric et al, 2005; Raida, Clement et al, 2005). In the current study, we first noted that BMP-12 was decreased in the breast cancer.

C. Potential correlation of reduced BMP12 expression with poor prognosis We analysed the levels of BMP-12 transcript against predicted prognosis of the patients, which used Nottingham Prognostic Index (NPI) as an indicator. Based on the NPI scores, patients can be divided into three groups; with good prognosis (NPI 1, <3.4), moderate (NPI 2, 3.4-5.4) and poor prognosis (NPI 3, >5.4). It showed that the patients with moderate and poor prognosis had lower levels of BMP-12 expression; 11.57±39.63 of NPI-2 group and 2.18±7.83 of NPI-3 group, p=0.27 and p=0.24 compared with that of good prognosis group (159±920), respectively (Figure 3). The association of BMP-12 transcript expression with clinical outcomes of the patients was also analysed based on the follow-up data. It showed decreased BMP-12 transcript levels (7.42±30.95) in patients with poor prognosis, including those with local recurrence, metastases and died of breast cancer, p=0.25 compared to that of patients remained disease free (113.9±768.2) (Figure 3). The Kaplan-Meier survival model was used to analyze the overall survival status of patients with breast cancer. It was found that patients with higher BMP-12 transcript levels had a longer overall survival (148.4 months, 95% CI 134.1-162.6) compared to those with low levels (119.9 months, 95%CI 107.9-132.1), although this is yet to reach statistical significance (p=0.179) (Figure 4). It is interesting to note that 9 of the patients in the present cohort developed bone metastasis. The tumours from patients with bone metastasis had a lower levels of BMP12 transcripts when compared with those who remained

189 !

Gene Therapy and Molecular Biology Vol 13, page 190!

Figure 1: Screening for BMP-12 transcript expression in a range of human cancer cell lines, with normal human mammary tissues as a positive control. MCF-7 cell line was derived in 1970 from pleural effusion. MDA-MB-435 has been shown to be from a melanoma. MDA-MB-453 is tetraploid cell line from mammary gland breast. BT549 is a breast cancer cell line, though by expression analysis is atypical. Actin was used as the house keeping control. O and N indicate cells of different passages. MDA-MB-157 and normal mammary tissues showed the corrected sized products. A clear band at larger size appeared in BT474 and BT549 cells. The nature of the product as a possible expression variant is currently under investigation.

Figure 2: A. Immunohistochemical staining of human breast specimens. Left, normal breast tissue. BMP-12 was found to be well stained in the normal mammary epithelial cells. Right, breast cancer tissue. Staining of breast cancer cells for BMP-12 is seen to be weakly positive in the breast tumor specimens when compared to the normal ones. B. Staining intensity for BMP-12 in tumor tissues (relative density 16.4Âą17.2) was significantly decreased (p=0.0041, indicated by * in B), compared to normal tissues (30.895Âą14.8). Insert: negative control for IHC staining. Arrows indicate BMP-12 positive cells.

190

Li et al: BMP-12 in breast cancer!

Figure 3: Quantitative analysis of BMP-12 in human mammary tissues, using quantitative RT-PCR. Shown in the figures are mean numbers of BMP-12 transcript per 50ng total RNA. A. Quantitative PCR analysis of BMP-12 expression in human breast cancer. BMP-12 expression is increased in breast cancer tissue compared with normal tissue, though P-value is not significant (p=0.19). B. NPI. Patients with a good prognosis have more BMP-12 expressed in tumors than the tumors of patients with poor prognosis; p-value is not significant (p=0.12). C. Comparison of BMP-12 expression between the TNM classification groups. A decreased trend was seen in the advanced TNM status, particularly in TNM 3 and TNM 4, which were 0.441±0.978 and 7.06±14.11, p=0.23 and p=0.29 in comparison with that of TNM1 (147±884) respectively. D. Tumor grade. There’s no significant relationship between tumor grade and BMP-12 (p=0.23). E. Correlation between BMP-12 and clinical outcome. The patients with poor outcome express lower level of BMP12 compared with those with good outcome, and p-value is 0.067. F. Correlation between BMP-12 and node status. The mean copy number of group with negative node status was 159, while the positive group had lower level at 8.9 (P=0.26). Shown is BMP-12 transcripts levels, which have been normalised against the corresponding CK19 levels.

Decreased BMP-12 transcript levels were seen in patients with advanced diseases (TNM3 and TNM4) compared to those with early stage of breast cancer. This indicates lower level of BMP-12 expression may associate with lymph node metastasis and distant metastasis of the disease. It was further confirmed when compared BMP-12 transcript levels of patients with nodal metastases to that of patients without lymph node involvement, in that lower levels of BMP-12 transcript was seen in nodal negative group. This suggests an inhibitory function of BMP-12 against the disease progression, particularly during tumor cells disseminate to local lymph nodes and distant sites. Aberrations in expression of certain BMPs have been associated with poor prognosis in breast cancer. In the

current study, we also analysed the BMP-12 transcript levels against the NPI score and follow-up data. Lower levels of BMP-12 transcript were seen in the patients with poor prognosis, including local recurrence, metastasis and die of breast cancer, compared with that of patients remaining disease free. In term of overall survival, patients with higher levels of BMP-12 expression have longer survival. The current study has also observed a potential link between BMP-12 and ER status. Expression of ER-! in breast cancer is a predictive marker for anti-hormonal treatment and generally associated with better prognosis and the level of ER-! is significantly decreased in highergrade tumors, which is opposite to ER-". In this study, the 191 !

Gene Therapy and Molecular Biology Vol 13, page 192! BMP-12 reduced in ER-" negative group, which is consistent with the reduction in ER-! positive group. It indicates that BMP-12 could be regulated by estrogen and its reduction may have some relationship with prognosis.

References Alarmo, E. L., Korhonen, T., Kuukasjarvi, T. et al, (2008) Bone morphogenetic protein 7 expression associates with bone metastasis in breast carcinomas. Ann Oncol 19, 308-14. Alarmo, E. L., Kuukasjarvi, T., Karhu, R. and Kallioniemi, A. (2007) A comprehensive expression survey of bone morphogenetic proteins in breast cancer highlights the importance of BMP4 and BMP7. Breast Cancer Res Treat 103, 239-46. Alarmo, E. L., Rauta, J., Kauraniemi, P. et al, (2006) Bone morphogenetic protein 7 is widely overexpressed in primary breast cancer. Genes Chromosomes Cancer 45, 411-9. Bobinac, D., Maric, I., Zoricic, S. et al, (2005) Expression of bone morphogenetic proteins in human metastatic prostate and breast cancer. Croat Med J 46, 389-96. Bokobza, S., Ye, L., Kynaston, H., Mansel, R. E. and Jiang, W. G. (2009) Reduced expression of BMPR-IB correlates with poor prognosis and increased proliferation of breast cancer cells. Cancer Genomics Proteomics in press. Buijs, J. T., Henriquez, N. V., van Overveld, P. G. et al, (2007) Bone morphogenetic protein 7 in the development and treatment of bone metastases from breast cancer. Cancer Res 67, 8742-51. Davies, S. R., Watkins, G., Douglas-Jones, A., Mansel, R. E. and Jiang, W. G. (2008) Bone morphogenetic proteins 1 to 7 in human breast cancer, expression pattern and clinical/prognostic relevance. J Exp Ther Oncol 7, 327-38. Hanavadi, S., Martin, T. A., Watkins, G., Mansel, R. E. and Jiang, W. G. (2007) The role of growth differentiation factor9 (GDF-9) and its analog, GDF-9b/BMP-15, in human breast cancer. Ann Surg Oncol 14, 2159-66. Helms, M. W., Packeisen, J., August, C. et al, (2005) First evidence supporting a potential role for the BMP/SMAD pathway in the progression of oestrogen receptor-positive breast cancer. J Pathol 206, 366-76. Itoh, S., Itoh, F., Goumans, M. J. and Ten Dijke, P. (2000) Signaling of transforming growth factor-beta family members through Smad proteins. Eur J Biochem 267, 6954-67. Jemal, A., Siegel, R., Ward, E. et al, (2008) Cancer statistics, 2008. CA Cancer J Clin 58, 71-96. Jiang, W. G., Davies, G., Martin, T. A. et al, (2005) Targeting matrilysin and its impact on tumor growth in vivo: the potential implications in breast cancer therapy. Clin Cancer Res 11, 6012-9. Kang, H., Watkins, G., Parr, C. et al, (2005) Stromal cell derived factor-1: its influence on invasiveness and migration of breast cancer cells in vitro, and its association with prognosis and survival in human breast cancer. Breast Cancer Res 7, R40210. Katsuno, Y., Hanyu, A., Kanda, H. et al, (2008) Bone morphogenetic protein signaling enhances invasion and bone metastasis of breast cancer cells through Smad pathway. Oncogene 27, 6322-33. Lee, K. J., Mendelsohn, M. and Jessell, T. M. (1998) Neuronal patterning by BMPs: a requirement for GDF7 in the generation of a discrete class of commissural interneurons in the mouse spinal cord. Genes Dev 12, 3394-407. Lo, L., Dormand, E. L. and Anderson, D. J. (2005) Lateemigrating neural crest cells in the roof plate are restricted to a sensory fate by GDF7. Proc Natl Acad Sci U S A 102, 7192-7. Maloul, A., Rossmeier, K., Mikic, B., Pogue, V. and Battaglia, T. (2006) Geometric and material contributions to whole bone structural behavior in GDF-7-deficient mice. Connect Tissue Res 47, 157-62.

Figure 4: Levels of BMP-12 transcript and patients long-term survival, using Kaplan-Meier survival analysis. Patients with higher BMP-12 transcript levels had a longer overall survival (148.4 months, 95% CI 134.1-162.6) compared with those with lower levels (119.9 months, 95% CI 107.9-132.1), p=0.179.

Thus, the present study presents evidence for the first time that BMP-12 is expressed at a low level in breast tumour and particular in aggressive breast tumors. To date, there is little knowledge on the molecular and cellular impact of BMP-12 on breast cancer cells. BMP-12 was initially described as a differentiation factor for certain cell types, i.e.oocytes. Presently, there is no report on a direct impact of BMP-12 on breast cancer cells and indeed on any other solid tumour cell types. One reason is the lack of available recombinant BMP-12 for investigation. We are currently exploring ways of generating human recombinant BMP-12 in order to conduct in vitro investigations. In conclusion, the current study shows decreased expression of BMP-12 in human breast cancer compared to normal breast tissue. This reduction in BMP-12 expression may associate with disease progression and poor prognosis. It suggests BMP-12 may be a putative inhibitory factor in breast cancer. However, further investigation is needed to fully understand the role played by BMP-12 in breast cancer and evaluate the prognostic and therapeutic potentials. Furthermore, a larger tumor cohort may further help to decipher a clearer correlation between BMP-12 and disease progression, for which we are currently investigating.

Acknowledgements The authors would like to thank Cancer Research Wales and The Fong Family Foundation for supporting their work.

192

Li et al: BMP-12 in breast cancer! Martin, T. A., Parr, C., Davies, G. et al, (2003) Growth and angiogenesis of human breast cancer in a nude mouse tumour model is reduced by NK4, a HGF/SF antagonist. Carcinogenesis 24, 1317-23. Mikic, B., Ferreira, M. P., Battaglia, T. C. and Hunziker, E. B. (2008) Accelerated hypertrophic chondrocyte kinetics in GDF-7 deficient murine tibial growth plates. J Orthop Res 26, 986-90. Morotome, Y., Goseki-Sone, M., Ishikawa, I. and Oida, S. (1998) Gene expression of growth and differentiation factors-5, -6, and -7 in developing bovine tooth at the root forming stage. Biochem Biophys Res Commun 244, 85-90. Ozkaynak, E., Rueger, D. C., Drier, E. A. et al, (1990) OP-1 cDNA encodes an osteogenic protein in the TGF-beta family. Embo J 9, 2085-93. Parr, C., Watkins, G. and Jiang, W. G. (2004) The possible correlation of Notch-1 and Notch-2 with clinical outcome and tumour clinicopathological parameters in human breast cancer. Int J Mol Med 14, 779-86.

Raida, M., Clement, J. H., Ameri, K. et al, (2005) Expression of bone morphogenetic protein 2 in breast cancer cells inhibits hypoxic cell death. Int J Oncol 26, 1465-70. Shi, Y. and Massague, J. (2003) Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685700. Storm, E. E., Huynh, T. V., Copeland, N. G. et al, (1994) Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature 368, 639-43. Wozney, J. M., Rosen, V., Byrne, M. et al, (1990) Growth factors influencing bone development. J Cell Sci Suppl 13, 149-56. Wozney, J. M., Rosen, V., Celeste, A. J. et al, (1988) Novel regulators of bone formation: molecular clones and activities. Science 242, 1528-34. Ye, L., Lewis-Russell, J. M., Kyanaston, H. G. and Jiang, W. G. (2007) Bone morphogenetic proteins and their receptor signaling in prostate cancer. Histol Histopathol 22, 1129-47.

From left to right: Dr Jin Li, Dr Lin Ye, Dr Christian Parr, Dr Anthony Douglas-Jones, Professor Howard Kynaston, Professor Robert E. Mansel, Professor Wen G Jiang

193 !

Gene Therapy and Molecular Biology Vol 13, page 194!

Gene Ther Mol Biol Vol 13, 194-204, 2009

Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions Review Article

Hima Vangapandu1, Walden Ai1* 1

Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, 6439 Garners Ferry Road, Building 2, Room B18, Columbia, SC 29209, USA __________________________________________________________________________________________________ *Correspondence: Dr. Walden Ai, Assistant Professor, Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, 6439 Garners Ferry Road, Building 2, Room B18, Columbia, SC 29209, USA, Tel: 1-803-253-5850, Fax: 1-803-733-1515, Email: walden.ai@uscmed.sc.edu Key words: KLF4, tumor suppressor, oncogene, Notch signaling, induced pluripotent stem cells (iPS cells) Received: 4 June 2009; Revised: 17 June 2009; Accepted: 18 June 2009; electronically published: June 2009

Summary Kruppel like factor 4 (KLF4) is a zinc finger containing transcription factor, which is expressed in a variety of tissues and regulates numerous biological processes including proliferation, differentiation, development, inflammation, and apoptosis. Thereby, it helps in maintaining homeostasis. As a transcription factor KLF4 both activates and represses the transcription of different genes depending on the cellular context. Physiologically, KLF4 can function both as a tumor suppressor and an oncogene. A recent study reported that p21 status may be a switch that determines the tumor suppressive or oncogenic function of KLF4. Over expression of KLF4 has been found to promote embryonic stem cell renewal. In addition, KLF4 plays an important role in reprogramming both mouse and human differentiated fibroblasts into induced pluripotent stem cells (iPS cells), which highly resemble embryonic stem cells, along with other three transcription factors including Oct4, Sox2, and c-Myc. This review discusses the function of KLF4 in cancer development and the underlying mechanisms. The role of KLF4 in stem cell biology and the future directions of KLF4 studies in this area have also been speculated.

! GC – and CACCC- boxes of DNA (Kaczynski et al., 2003). The fingers are connected by the characteristic Kruppel-link, a seven amino acid spacer TGEKP (Y/F) X sequence, highly conserved among family members (Dang et al., 2000b). Each zinc finger in KLF4 chelates a zinc ion, coordinated by 2 cysteine and 2 histidine residues. The critical residues that determine sequence specificity are largely conserved, so that while individual KLFs have slightly varying specificities they all recognize related sequences (Pearson et al., 2008). KLF4 was first identified and characterized in mice in the year 1996 independently by two groups followed by identification of human KLF4 from human umbilical vein endothelial cell cDNA library (Yet et al., 1998). It was given two different names - GKLF (gut enriched kruppel like factor) due to the fact that it was found to be highly expressed in the intestine (Shields et al., 1996) and EZF (epithelial zinc finger) because of its high expression in differentiated epithelial cells of the skin (Garrett-Sinha et al., 1996). It was later renamed as KLF4 as it was found to be expressed also in lung, testis (Garrett-Sinha et al., 1996; Shields et al., 1996), thymus (Panigada et al., 1999), cornea (Chiambaretta et al., 2004), cardiac myocytes (Cullingford et al., 2008) and lymphocytes (Fruman et al.,

I. Introduction Kruppel like factor 4 (KLF4) is a zinc finger containing transcription factor expressed in a wide range of tissues in mammals, which plays a critical role in regulating diverse array of cellular processes like proliferation, differentiation, development, maintenance of normal tissue homeostasis and apoptosis. It is reported to have a dual function as a tumor suppressor and as an oncogene depending on the type of tissue in which it is expressed. KLF4 is a member of Kruppel like factor family. The KLF family members were named so because of the strong homology with the Drosophila gene product Kruppel (‘cripple’ in German), which plays an important role in the segmentation of developing embryo. The deletion of this gene caused a “crippled” phenotype (Wieschaus et al., 1984). The feature that distinguishes the KLF family from other zinc finger containing transcriptional factors, such as Sp1 and Krox, is the presence of three highly conserved zinc finger motifs at their C-terminus (Bieker, 2001; Philipsen and Suske, 1999; Turner and Crossley, 1999). Zinc fingers 1 and 2 contain 23 amino acid residues, while the third finger has only 21 residues. These fingers enable KLFs to bind to the related

194!

Ai et al: Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions 2002). The human KLF4 gene locus is located on chromosome 9q31 whereas mouse KLF4 is located on chromosome 4B3. KLF4 has 5 exons, and the size of KLF4 transcript is ~3.5kb as detected by northern blot analysis of RNA in human umbilical vein endothelial and other cells (Shie et al., 2000b; Yet et al., 1998). It has been shown that adult mouse testis has multiple KLF4 transcripts (Godmann et al., 2005; Shields et al., 1996). The human and mice KLF4 sequences are shown to have 91% sequence similarity at the amino acid level. The human KLF4 cDNA encodes a protein containing 470 amino acids with a predicted molecular mass 50 kDa. Several functional domains have been characterized in mouse KLF4 protein, which include an acidic N-terminal transcriptional activation domain (1-157 a.a), a repressor domain next to it (158-385) followed by an NLS (nuclear localization signal) sequence (386-401 a.a) having PKRGRR repeats and the carboxyl DNA binding domain which comprises 81 highly conserved a.a (402-483)

(Figure 1). The activation domain is found to interact with p300/CBP (Evans et al., 2007). The repressor domain is reported to have two lysine residues (K225, K229), which are acetylated by p300/CBP (Dang et al., 2002). The DNA binding domain has three zinc fingers, each of which contains an anti- parallel !-pleated sheet, followed by an " helix. The Cys2/His2 residues are located within the "helix that bind a zinc ion and help in stabilizing the fold. In addition to these domains, a PEST sequence is reported to be located between the activation and inhibitory domains. This suggests KLF4 may be subjected to ubiquitin-mediated proteosomal degradation. Thus the presence of both activation and repressor domains might allow KLF4 to switch between its positive and negative transcriptional effects on its targets depending upon the type of tissue in which it is expressed (Evans and Liu, 2008; Garrett-Sinha et al., 1996; Geiman et al., 2000; McConnell et al., 2007; Shie et al., 2000b; Wei et al., 2006; Yet et al., 1998; Zheng et al., 2009).

Figure 1: Structure of KLF4. KLF4 has an N-terminal transcriptional activation domain, followed by a transcriptional repression domain, containing two lysine residues K225 and K229. These residues are acetylated by p300/CBP, which interacts with the activation domain. There lies a potential PEST sequence between the activation and repression domains. The C-terminus has a DNA binding domain containing three zinc fingers, which recognize and bind to the GC/CACCC target sequences in the nucleus. A Nuclear Localization Signal (NLS) (6 a.a.) is placed between the DNA binding and repression domains, which facilitates the transport of KLF4 into the nucleus. Please note that the size of each domain is not exactly proportional.

that KLF4 promotes differentiation. In KLF4 knockout mice, the numbers of goblet cells considerably decreased, suggesting that KLF4 may be required for goblet cell differentiation (Katz et al., 2002). The KLF4 knockout mice die from dehydration soon after birth due to the failure of late stage differentiation in the epidermis of the skin, resulting in a loss of normal barrier formation (Katz et al., 2002; Segre et al., 1999). This implies the role of KLF4 as an important factor in formation of skin epithelium. In the thymus, KLF4 is expressed during cortical differentiation (Panigada et al., 1999). KLF4 is also expressed in the corneal epithelium of the eye. Deletion of KLF4 in the eye leads to corneal fragility,

II. Expression and functions A. Expression KLF4 is highly expressed in the differentiated, post mitotic cells of the gut and skin epithelium (Dang et al., 2000b). In the intestinal epithelium, KLF4 is expressed in terminally differentiated epithelial cells at the villus borders of the mucosa (McConnell et al., 2007). Actively proliferating cells, which are situated at the base of the crypts, migrate toward the luminal surface as they differentiate to be sloughed off. KLF4 expression is found to be highest near the luminal surface as compared to the base of the crypts. From this observation, it can be inferred

195!

Gene Therapy and Molecular Biology Vol 13, page 196!

stromal edema and lack of goblet cells in the conjunctiva (Swamynathan et al., 2007). KLF4 has also been reported to be expressed in testis, specifically in the post mitotic germ cells and somatic Sertoliâ&#x20AC;&#x2122;s cells, indicating its importance in testicular differentiation (Behr and Kaestner, 2002). KLF4â&#x20AC;&#x2122;s role has been implied in development of vasculature - studies in zebra fish and mammals showed that KLF4 is important in blood vessel development in addition to hematopoiesis and epidermal development. It is induced by shear stress (McCormick et al., 2001; Oates et al., 2001). KLF4 is expressed in the dorsal epithelium of the developing tongue, tooth bud and palate and in the mesenchymal cells of the skeletal primordia and metanephric kidney (Garrett-Sinha et al., 1996). It has also been reported to be expressed in the respiratory tract, meninges and cartilaginous skeleton (Ohnishi et al., 2000).

on the p21 promoter upon DNA damage and in turn p53 up regulates KLF4 promoter activity in Chinese hamster ovary cells. It has been shown that the levels of KLF4 mRNA increased in a p53 dependent manner, which coincides with the increased expression of p21, when treated with menthanosulfate or when subjected to # radiation (Zhang et al., 2000). KLF4 also mediates selenium (Liu et al., 2008b) or butyrate (Chen et al., 2004) induced growth arrest.

2. Promotion of cell differentiation As previously discussed, KLF4 plays a vital role in goblet cell differentiation in the intestine (Katz et al., 2005; Katz et al., 2002), conjunctiva (Swamynathan et al., 2008) and also in the formation of the epithelial barrier of the skin (Katz et al., 2002; Segre et al., 1999). Its expression has been detected to be more in well-differentiated cells than in actively proliferating cells. The knockout mice phenotypes provided this evidence. Microarray analysis showed that many keratin genes were up regulated on KLF4 induction, an observation suggestive of its role in epithelial differentiation. KLF4 has been reported to transactivate promoters of epithelial genes like CYP1A1 (Zhang et al., 1998), laminin " 3A (Miller et al., 2001), laminin 1 (Higaki et al., 2002), keratin 4 (Brembeck and Rustgi, 2000) in the esophagus, keratin 19 (Okano et al., 2000) in the pancreas and Keratin 12 and Aqp5 in the cornea (Swamynathan et al., 2008). KLF4 has been shown to repress TGF! dependent increase of smooth muscle cell differentiation marker genes which includes "-smooth actin and SM22" (Adam et al., 2000), which somewhat contradicts its well established role in the differentiation of cells. A recent study has shown that KLF4, which is normally not expressed in differentiated SMC in vivo, was rapidly upregulated in response to vascular injury (Yan et al., 2008). Taken together, these results indicated that KLF4 represses SMC genes both by down-regulating myocardin expression and preventing myocardin from associating with SMC gene promoters, and suggested that KLF4 may be a key effector of PDGF-BB and injury-induced phenotypic switching of SMC (Liu et al., 2005). A recent study suggests that the expression of KLF4 is closely correlated to the growth-arrest and the first step of odontoblast and ameloblast differentiation in murine tooth (Chen et al., 2009). This study shows that both KLF4 and KLF5, a closely related Kruppel like factor, are important for murine tooth development.

B. Major functions 1. Inhibition of cell proliferation KLF4 is known to induce growth arrest, inhibiting cell proliferation by regulating the expression of key cell cycle genes (Figure 2). In actively proliferating NIH3T3 fibroblast cells, KLF4 is little expressed. When these cells are subjected to serum starvation, KLF4 levels are found to be significantly expressed and the ectopic expression of KLF4 in NIH3T3 cells resulted in inhibition of DNA synthesis (Shields et al., 1996). Over expression of KLF4 in COS-1 has also been shown to inhibit DNA synthesis in those cells. Progression through cell cycle is driven by Cyclins and their dependent kinases - Cdks which phosphorylate and inactivate the cell cycle inhibitors like p16, p21, p27 and p57 (Matsuoka et al., 1995; Sherr and Roberts, 1999; Vidal and Koff, 2000) and allow the cells to go through the cell cycle. Microarray analysis confirms that KLF4 activates a number of genes, which function as negative regulators of cell cycle as well as suppresses genes that promote cell cycle progression. KLF4 has been shown to inhibit cell proliferation by blocking G1/S progression in cell cycle and to mediate p53 dependent G1/S cell cycle arrest in response to DNA damage (Bunz et al., 1998; Yoon et al., 2003; Yoon and Yang, 2004). While wild type HCT 116 colon cancer cells on UV irradiation were arrested at the G2/M phase checkpoint, p53 knockout cells were able to continue the cell cycle by entering into M phase even on irradiation. It was observed that upon over expression of KLF4 in these knockout mice, the mitotic indices were considerably reduced and the Cyclin B levels were also reinstated (Yoon et al., 2003). These studies suggest that KLF4 is a critical factor in regulating entry of the cells into the mitotic phase. The CDKN1A gene encoding the cyclin dependent kinase inhibitor p21 is a transcriptional target for tumor suppressor signaling pathways, which include p53, TGF! and APC. A number of evidence supports that KLF4 plays a vital role in regulating p21 gene expression. When p21 is activated, it down regulates the expression of cyclin D and cyclin B, thereby, restricting the entry of the cells from G1 to S and G2 to M respectively (Chen et al., 2001a; Chen et al., 2001b; Nandan et al., 2004; Shie et al., 2000a; Yoon and Yang, 2004). KLF4 mediates p53 transactivation activity

C. Other functions KLF4 is essential for differentiation of mouse inflammatory monocytes, and is involved in the differentiation of resident monocytes (Alder et al., 2008; Feinberg et al., 2007). KLF4 was previously shown to mediate proinflammatory signaling in human macrophages in vitro (Feinberg et al., 2005; Liu et al., 2008a). KLF4 was also shown to regulate the expression of interleukin-10 in RAW264.7 macrophages (Chung et al., 2007; Liu et al., 2007). The bone marrow monocytes from KLF4 (-/-) chimeras expressed lower levels of key trafficking molecules and were more apoptotic and show 196!

Ai et al: Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions that KLF4 is necessary for differentiation of monocytes (Alder et al., 2008). In addition, inducible expression of KLF4 in the HL60 (human acute myeloid leukemia cell line) stimulated monocyte differentiation and enhanced 12-O-tetradecanoylphorbol 13-acetate induced macrophage differentiations, but blocked all-trans-retinoic acid induced granulocytic differentiation of HL60 cells. The inflammation-selective effects of loss-of-KLF4 and gain-of-KLF4-induced monocytic differentiation in HL60 cells identify KLF4 as a key regulator of monocytic differentiation and a potential target for translational immune modulation (Alder et al., 2008). KLF4 positively regulates human ghrelin expression (Lee et al., 2009). Ghrelin is expressed in the gastrointestinal tract, predominantly the stomach, as is KLF4. Treatment with butyrate, an inducer of KLF4 expression, stimulates ghrelin expression and fasting, which induces ghrelin expression, also increased KLF4 expression, suggesting that ghrelin expression is associated with KLF4. In AGS stomach cancer cells, KLF4 expression specifically stimulated human ghrelin promoter activity in a dosedependent manner. In addition, it was found that KLF4 is an immediate early gene for Nerve Growth Factor (Dijkmans et al., 2009). A recent study showed that

glutamatergic stimulation can trigger rapid elevation of KLF4 mRNA and protein levels, and that the over expression of KLF4 can regulate neuronal cell cycle proteins and sensitize neurons to NMDA-induced caspase3 activity (Zhu et al., 2009). Another study demonstrated that KLF4 is involved in regulating the proliferation of CD8+ cells (Yamada et al., 2009). The transcription factor ELF4 directly activated the tumor suppressor KLF4 'downstream' of T cell antigen receptor signaling to induce cell cycle arrest in naive CD8 (+) T cells (Yamada et al., 2009). KLF4 has been implicated in the regulation of apoptosis (Ghaleb et al., 2007; Wei et al., 2005). During DNA damage, cells can take two routes - either passes into the next phase overcoming the checkpoint or gets arrested at the checkpoint and activates the repair machinery. As discussed previously, over expression of KLF4 in RKO colon cancer cells, when subjected to UV radiation, reduced the percentage of apoptotic cells (Dang et al., 2003). In esophageal cancer cell lines, KLF4 has been shown to bind to the promoter and repress the activity of surviving gene in vivo (Zhang et al., 2009), which is necessary for caspase inactivation and therefore acts as a negative regulator of apoptosis.

Figure 2: Multiple context-dependent functions of KLF4. Up regulation or over expression of KLF4 promotes cell differentiation, inhibits cell proliferation, and induces cell cycle arrest, down-regulates apoptosis for maintaining tissue homeostasis. It functions as a tumor suppressor in cancers of some tissues and as an oncogene in some tissues like those of breast. KLF4 is instrumental in stem cell renewal and generation of induced pluripotent stem cells (iPS cells).

role in cancer progression and development. KLF4 is proved to induce growth arrest, so it can be assumed to have an anti cancerous activity. KLF4 expression is shown to be downregulated in a number of cancers and it was said to have tumor suppressive activity. However its role

III. Role and regulation of KLF4 in cancer KLF4 plays a critical role as transcription factor in regulating cell proliferation. Since cancers display uncontrolled cell growth, KLF4 is thought to play a key

197!

Gene Therapy and Molecular Biology Vol 13, page 198!

in cancers is not fully conclusive as it is also identified to act as an oncogene in some specific cancers in tissues.

transfection has reportedly shown to increase cell proliferation and decrease cell adhesion stability (Ohnishi et al., 2003). Functional analysis of the alteration in the expression of KLF4 suggested that KLF4 might be able to regulate the expression of squamous cell differentiation associated genes like SPRR1A, SPRR2A and KRT4 in ESCC (Choi et al., 2006). In the tumors of the gastrointestinal tract, KLF4 expression was found to be decreased in the prostate gland in case of prostate cancer and benign prostate hypertrophy (Foster et al., 2000; Luo et al., 2002). KLF4 expression has also been reported to be reduced in lung cancers (Bianchi et al., 2004). KLF4 is a candidate tumor suppressor gene in B-lymphocytes. The RNA and protein expression of murine KLF4 has been shown to decrease following B cell activation. Forced expression of KLF4 in proliferating B cells caused a G1 cell cycle arrest (Kharas et al., 2007; Yusuf et al., 2008). This effect requires the DNA binding and transactivation domains of KLF4 and correlates with changes in the expression of known KLF4 target genes. KLF4 is a target gene for FOXO transcription factors, which also suppress B cell proliferation (Yusuf et al., 2008). KLF4 (-/-) mice with B cell-specific deletion of the KLF4 gene exhibited normal B cell development and function with no evidence of a lowered activation threshold. This indicates that KLF4 has growth-suppressive properties in B cells but, might be redundant with other members of the KLF family in maintaining B cell quiescence (Yusuf et al., 2008). KLF4 expression is silenced in adult T-cell leukemia cells, when compared with normal T cells (Yasunaga et al., 2004). The expression of KLF4 is also significantly repressed in human glioma associated vascular endothelial cells when compared to non neoplastic control vascular endothelial cells, indicating that KLF4 may also be involved in antiangiogenic pathway (Madden et al., 2004). In all the above-discussed tumors, KLF4 expression is significantly reduced, consistent with its activity of cell cycle checkpoint and growth arrest. Thus, it can be said that KLF4 plays an active role as a tumor suppressor.

A. Evidence of its tumor suppressor activity 1. Observations Many studies have revealed the role of KLF4 as a tumor suppressor in various human cancers. KLF4 expression was significantly down regulated in the cancer of the bladder epithelium (Ohnishi et al., 2003). The transduction of KLF4 into the bladder cancer cell lines using adenoviral vectors suppressed growth and induced apoptosis. This study suggests that inactivation of KLF4 is one of the frequent steps taken toward bladder carcinogenesis. In human colorectal carcinoma, KLF4 expression is down regulated due to hypermethylation and loss of heterozygosity (Choi et al., 2006; Xu et al., 2008). Mutational analysis revealed that the KLF4 gene is silenced by being subjected to deletion, mutation and methylation in significant number of colon and gastric cancers (Wei et al., 2006; Zhao et al., 2004). KLF4 expression has drastically decreased colonic adenomas in patients with familial adenomatous polyposis when compared with adjacent normal mucosa (Dang et al., 2000a; Ton-That et al., 1997). The KLF4 mRNA levels are decreased in colonic carcinoma and adenomatous polyps when compared to normal colon (Choi et al., 2006). KLF4 expression in mouse models of colorectal cancer yielded similar observations. The APCmin/+ mice developed a number of intestinal adenomas at an early stage (Moser et al., 1990; Xu et al., 2008). Reverse transcription-PCR showed an inverse correlation between adenoma size and KLF4 mRNA levels in both KLF4 (+/-)/ Apc(Min/+) and Apc(Min/+) mice (Ghaleb et al., 2007b). This study indicated the role of KLF4 as a tumor suppressor in vivo. In studies using a KLF4 (-/-) mice specific for gastric epithelium, loss of KLF4 resulted in increased proliferation and altered differentiation of epithelial cells in the stomach, leading to precancerous lesions (Katz et al., 2005; Wei et al., 2005). The APCmin/+ mice expressing a truncated form of the APC protein deregulated the Wnt signaling pathway in their intestine (Korinek et al., 1997; Morin et al., 1997). Induction of KLF4 mRNA and protein expression by interferon-gamma treatment showed a marked reduction of ornithine decarboxylase (ODC) gene expression and enzyme activity in colon cancer HT-29 cells (Chen et al., 2002). Over expression of KLF4 in HT-29 cells significantly reduced ODC mRNA and protein levels as well as enzyme activity and resulted in growth arrest, indicating that ODC might be a downstream target of KLF4. This conclusion was further supported by observation that KLF4 mRNA and protein concentrations were the highest at the G1/S boundary of the cell cycle, where ODC mRNA and protein levels were the lowest and that over expression of KLF4 resulted in cell arrested at the G1 phase (Chen et al., 2002). KLF4 expression was reduced in human esophageal squamous cell carcinomas, when compared to the levels of expression in the normal esophageal tissue (Luo et al., 2004; Wang et al., 2002). Decreased expression of KLF4 in an esophageal cancer cell line by antisense KLF4

2. Underlying mechanisms 2.1. Wnt signaling and KLF4 APC (adenomatous polyposis coli) protein plays an important role in many cellular processes that determine whether a cell develops into a tumor. It is a critical component of the Wnt/!-catenin signaling pathway (Nathke, 1999), which plays an important role in normal intestinal homeostasis and colorectal cancers (Giles et al., 2003; Moon et al., 2004). KLF4 binds !-catenin and inhibits its function, thereby inhibiting !-catenin mediated tumor genesis (Zhang et al., 2006). It has also been postulated that a cross talk between KLF4 and !-catenin regulates intestinal homeostasis (Zhang et al., 2006). This might be another possible way of KLF4 regulation in intestinal crypts, at the bottom, where KLF4 expression is low and !-catenin signaling is active, which results in proliferation of stem cells and progenitor cells. With cells migrating upward, cells become more differentiated. This might be due to the interaction between KLF4 and !catenin, resulting in the inhibition of expression of downstream Wnt-responsive genes (Zhang et al., 2006; 198!

Ai et al: Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions Zheng et al., 2009). A recent study showed that lower levels of KLF4 expression in the proliferative compartment of the intestinal epithelium are regulated by the transcription factors TCF4 and SOX9, an effector and a target, respectively, of Wnt/!-catenin (Flandez et al., 2008). This substantiates the finding that reduced levels of KLF4 tumor suppressor activity in colon tumors may be driven by elevated Wnt/!-catenin signaling.

KLF4 mRNA was observed in morphologically normal breast epithelium adjacent to tumor cells. Ductal carcinoma in situ exhibited similar expression as invasive carcinoma, suggesting that KLF4 is activated prior to invasion through the basement membrane (Zhao et al., 2004). Recent evidence suggests that the role of KLF4 may depend on the genetic context it is functioning (Rowland et al., 2005). The functioning of KLF4 as an oncogene was discovered by the mechanism in which KLF4 allows the overrides of oncogenic RASV12-induced senescence in primary fibroblasts, through suppressing the expression of p53 by directly acting on its promoter. This would allow RASV12- mediated transformation and provide resistance to DNA damage induced apoptosis. To test this hypothesis, KLF4 was knocked down which resulted in an increase in the levels of p53 and induced apoptosis. These results also present KLF4 as a regulator of p53 that oncogenically transforms cells as a function of p21Cip1 status. p21 protein has been reported to function as a switch in KLF4-mediated tumor genesis. p21 is a CDK inhibitory protein and is a transcriptional target of p53, which results in cell cycle arrest (Gu et al., 1993; Harper et al., 1993; Sherr and Roberts, 1999; Xiong et al., 1993). It was found that the inactivation of cyclin D1 or cell cycle inhibitor p21 not only abolishes the cytostatic effect of KLF4, but also mediates KLF4 in oncogenic transformation of cells (Rowland et al., 2005). Over expression of KLF4 alone increases expression of p21Cip1/WAF1 and results in cell cycle arrest. However, the addition of RasV12 resulted in inhibition of p21Cip1/WAF1 expression, allowing KLF4â&#x20AC;&#x2122;s ability to repress p53 to predominate. Thus, KLF4 has multiple, context-dependent roles in cancer development. These data support a model in which KLF4 can switch from a tumor suppressor to an oncogene, depending on the status of p21 (Evans and Liu, 2008; Rowland and Peeper, 2006). KLF4 and p21 may utilize the same signaling pathway to function as a tumor suppressor or an oncogene. However, the oncogenic function of KLF4 apparently is independent of p21, as KLF4 can transform primary cells in the absence of p21 at least in vitro (Rowland et al., 2005). It is likely that p21 level is under a tight control so that growth arrest and transformation is well balanced. In the absence of p21, p21-mediated growth arrest by KLF4 is abolished as well as p21-mediated transformation. Under this condition, KLF4 may reveal its transformation activity by inhibition of p53 that is activated by oncogenic RasV12. KLF4 has been reported to suppress apoptosis through down regulation of the Bax promoter (Ghaleb et al., 2007). Overall, KLF4 might act either as a tumor suppressor or as an oncogene depending on the cellular context, expression patterns of other genes and the chromatin environment of individual cells.

2.2. Notch signaling and KLF4 Goblet cell differentiation is regulated by the Notch signaling pathway (Jensen et al., 2000). The Notch signaling pathway suppresses goblet cell formation and is up regulated in tumors (Ghaleb et al., 2008). Notch genes encode evolutionarily conserved transmembrane receptors that control a broad range of cell fate decisions in development (Artavanis-Tsakonas et al., 1999; Baron, 2003). KLF4 is proposed as the downstream target of Notch signaling pathway and the formerâ&#x20AC;&#x2122;s promoter activity is inhibited by Notch (Ghaleb et al., 2008; Zheng et al., 2009). These studies also showed that Notch inhibition increases KLF4 gene expression. A constitutively active version of Notch, ICN1 (a COOHterminal region of human Notch1) was used to assess the inhibition of KLF4 promoter activity in vitro (Zheng et al., 2009). An ICN1 responsive element was mapped between -151 to -122 of the hKLF4 promoter (Zheng et al., 2009). The inhibition of KLF4 promoter is also thought to occur indirectly through a transcription factor that binds to the ICN1 responsive element. Nevertheless KLF4 inhibition by Notch will be consistent with the tumor suppressor role of KLF4 and up regulation of Notch in tumors. In addition, cross talk between KLF4 and !-catenin and inhibition of KLF4 gene expression by Notch provide another link between the Wnt and Notch signaling pathways that play a critical role in maintaining homeostasis of the normal intestine and in tumor genesis of colorectal cancers (Nakamura et al., 2007).

B. Evidence of its oncogenic activity Though KLF4 was initially described for its role as a tumor suppressor, three different studies identified KLF4 as an oncogene by unbiased genetic screens. E1A immortalized rat kidney epithelial cells were used to screen for KLF4, which induces transformation in those cells (Foster et al., 1999). In oral squamous epithelium of RK3E cells, KLF4 expression was detected in the upper, differentiating cell layers. In dysplastic epithelium, expression was prominently increased and was detected diffusely throughout the entire epithelium, indicating that KLF4 is misexpressed in the basal compartment early during tumor progression. KLF4-transformed rat kidney epithelial cells produced tumors in xenografted mice. Increased expression of KLF4 was also reported in the ductal carcinoma of the breast cancer cells. In situ hybridization, Northern blot analysis, and immunohistochemistry techniques were used to detect KLF4 at various stages of tumor progression in the breast, prostate, and colon. Overall, the expression of KLF4 mRNA was detected by in situ hybridization in 68% of carcinoma of the breast, whereas low-level expression of

IV. KLF4 in stem cell biology Stem cells are characterized by the ability to renew themselves through mitotic cell division and to differentiate into a diverse range of specialized cell types. The two key characteristic properties of stem cells are self-renewal and pluripotency. These properties can be utilized to cure a number of human diseases (Audet, 2004; 199!

Gene Therapy and Molecular Biology Vol 13, page 200!

Constantinescu, 2003; Thomson et al., 1998). ES cells are considered to be pluripotent, so the factors thought to be responsible for the pluripotency of ES cells have been screened in mouse embryonic fibroblasts (Takahashi and Yamanaka, 2006; Yamanaka and Takahashi, 2006). While twenty four factors were screened, they concluded that mouse embryonic fibroblasts can be reprogrammed to a pluripotent state similar to that observed in ES cells, by retroviral transduction of four genes Oct4, Sox2, c-Myc, and KLF4. This discovery opened exciting new vistas in the field of stem cell biology. The discovery of these â&#x20AC;&#x2DC;induced pluripotent stem (iPS) cellsâ&#x20AC;&#x2122; was regarded as a major development in stem cell research and gave new insights into the pathways involved in the maintenance of pluripotency. iPS cells are similar to ES cells in morphology, proliferation, and pluripotency, considering teratoma formation and chimera contribution (Yamanaka, 2008). Out of the four genes mentioned, c-Myc and KLF4 are oncogenes, which are thought to contribute to the increased proliferative capacity of iPS cells. Later, the generation of iPS cells from human dermal fibroblasts with the same four factors was demonstrated (Takahashi et al., 2007). Human iPS cells are a potential source of patient-specific pluripotent stem cells that would bypass immune rejection. iPS cells can also be used to study diseases for which there are no adequate human in vitro or animal models. A recent study using murine embryonic stem cells showed that ES cells over expressing KLF4 have a greater capacity to self-renew based on secondary embryoid body (EB) formation. ES cells overexposing SOCS-3 showed an increased capacity to differentiate to hematopoietic progenitors, rather than to self-renew. KLF4-transduced d6 EBs expressed higher levels of Oct-4, consistent with the notion that KLF4 promotes ES cell self-renewal. These findings reveal that murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by KLF4 (Li et al., 2005). Mechanistically KLF4 has also been found to activate Lefty1 gene expression along with Oct3/4 and Sox2, and is proposed to act as a mediating factor that specifically binds to the proximal element of the Lefty1 promoter (Nakatake et al., 2006). But, recent discoveries have shown that, KLF4 in reprogramming the cells to a pluripotent state to be dispensable. Valproic acid, a histone deacetylase inhibitor, enables reprogramming of primary human fibroblasts with only two factors, Oct4 and Sox2, without the need for the oncogenes c-Myc or KLF4 (Huangfu et al., 2008). Very recently, a group described the use of Kenpaullone, a molecule identified to activate Nanog expression, replacing KLF4 in producing iPS cells similar to murine ES cells (Lyssiotis et al., 2009). However, the iPS cells are different from the ES cells with regards to gene expression, DNA methylation patterns, and failure to produce adult chimaeras (Okita et al., 2007). Selection for Nanog expression resulted in a germline-competent iPS cells with increased ES-cell-like gene expression and DNA methylation patterns compared with Fbx15 iPS (Okita et al., 2007). The use of oncogenes and retrovirus in the current iPS cell establishment protocol raised safety concerns. For

example, reactivation of the c-Myc retrovirus, increased tumorigenicity in the chimeras and progeny mice, hindering clinical applications (Nakagawa et al., 2008). To overcome this drawback, plasmids are used to transfect mouse embryonic fibroblasts in place of retroviruses (Kaji et al., 2009; Okita et al., 2008). Another problem is that iPS cells are refractory to differentiation and thereby increase the risk of immature teratoma formation after directed differentiation and transplantation into patients. Even if only a small portion of cells within each iPS cell clone shows impaired differentiation, then those cells might be sufficient to produce immature teratomas (Yamanaka, 2009). If somatic stem or progenitor cells can directly generated from fibroblasts or other types of somatic cells, then there would not be a need of iPS cells. Nevertheless, the iPS cell technology potentially can overcome two important obstacles associated with human ES cells: immune rejection after transplantation and ethical concerns regarding the use of human embryos (Yamanaka, 2009). The advantage of iPS cell technology is that iPS cells can be generated using a few programming factors in any laboratory using standard techniques and equipment. To generate clinical quality iPS cells, the development of novel reprogramming methods that avoid permanent genetic modification is highly desired. But, the molecular mechanisms that mediate reprogramming are essentially unknown. Establishment of a stable and self-sustainable ES-specific transcriptional regulatory network is essential for reprogramming (Zhao and Daley, 2008). iPS cells still have the scope for clinical applications provided that proper ways are established to precisely evaluate each iPS cell clone and to select appropriate sub clones prior to clinical application (Yamanaka, 2009).

V. Future directions Though much have been found out about KLF4, the exact molecular mechanisms by which KLF4 works is yet to be discovered. So far it has been described that KLF4 functions as a transcriptional activator, repressor, tumor suppressor and an oncogene depending on the genetic context. However, there is not much direct evidence to show how KLF4, as a transcription factor, interacts with its downstream targets to carry out the formerly mentioned functions. Its position in the signaling cascade is also ambiguous. For example, KLF4 is sometimes placed downstream of p53 and sometimes upstream. Also, whether it represses the activity of p21 through p53 or along with p53 is not clearly defined. p21 is proposed to contribute to the switching of KLF4 function between a tumor suppressor or an oncogene in vitro (Rowland et al., 2005). However, there is no experimental evidence to support this notion in vivo. We may possibly determine this by knocking out p21 in the setting of KLF4 knockout mice and examine whether KLF4 functions as an oncogene. Furthermore, why KLF4 has a dual-role in different tissues in cancer development, either as a tumor suppressor or oncogene, is still unknown. Identification of it binding partners, effectors and downstream targets to some extent might reason its behavior in different tissues (p21 knockout mice). 200!

Ai et al: Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions Bianchi F, Hu J, Pelosi G, Cirincione R, Ferguson M, Ratcliffe C, Di Fiore PP, Gatter K, Pezzella F, and Pastorino U (2004) Lung cancers detected by screening with spiral computed tomography have a malignant phenotype when analyzed by cDNA microarray. Clin Cancer Res. 10, 6023-6028 Bieker JJ (2001) Kruppel-like factors: three fingers in many pies. J Biol Chem. 276, 34355-34358 Brembeck FH, and Rustgi AK (2000) The tissue-dependent keratin 19 gene transcription is regulated by GKLF/KLF4 and Sp1. J Biol Chem. 275, 28230-28239 Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, Sedivy JM, Kinzler KW, and Vogelstein B (1998) Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science. 282, 1497-1501 Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC, Martin RP, Schipani E, Divieti P, Bringhurst FR, Milner LA, Kronenberg HM, and Scadden DT (2003) Osteoblastic cells regulate the haematopoietic stem cell niche. Nature. 425, 841-846 Chen X, Johns DC, Geiman DE, Marban E, Dang DT, Hamlin G, Sun R, and Yang VW (2001a) Kruppel-like factor 4 (gutenriched Kruppel-like factor) inhibits cell proliferation by blocking G1/S progression of the cell cycle. J Biol Chem. 276, 30423-30428 Chen XH, Gao RL, and Xu WH (2001b) [Effect of ginsenosides in inducing proliferation and transcription factor of erythrocytic, granulo-monocytic and megakarocytic cell lines]. Zhongguo Zhong Xi Yi Jie He Za Zhi. 21, 40-42 Chen Z, Couble ML, Mouterfi N, Magloire H, and Bleicher F (2009) Spatial and temporal expression of KLF4 and KLF5 during murine tooth development. Arch Oral Biol. 54, 403411 Chen ZY, Rex S, and Tseng CC (2004) Kruppel-like factor 4 is transactivated by butyrate in colon cancer cells. J Nutr. 134, 792-798 Chen ZY, Shie JL, and Tseng CC (2002) Gut-enriched Kruppellike factor represses ornithine decarboxylase gene expression and functions as checkpoint regulator in colonic cancer cells. J Biol Chem. 277, 46831-46839 Chiambaretta F, De Graeve F, Turet G, Marceau G, Gain P, Dastugue B, Rigal D, and Sapin V (2004) Cell and tissue specific expression of human Kruppel-like transcription factors in human ocular surface. Mol Vis. 10, 901-909 Choi BJ, Cho YG, Song JW, Kim CJ, Kim SY, Nam SW, Yoo NJ, Lee JY, and Park WS (2006) Altered expression of the KLF4 in colorectal cancers. Pathol Res Pract. 202, 585-589 Chung EY, Liu J, Homma Y, Zhang Y, Brendolan A, Saggese M, Han J, Silverstein R, Selleri L, and Ma X (2007) Interleukin10 expression in macrophages during phagocytosis of apoptotic cells is mediated by homeodomain proteins Pbx1 and Prep-1. Immunity. 27, 952-964 Constantinescu S (2003) Stemness, fusion and renewal of hematopoietic and embryonic stem cells. J Cell Mol Med. 7, 103-112 Cullingford TE, Butler MJ, Marshall AK, Tham el L, Sugden PH, and Clerk A (2008) Differential regulation of Kruppel-like factor family transcription factor expression in neonatal rat cardiac myocytes: effects of endothelin-1, oxidative stress and cytokines. Biochim Biophys Acta. 1783, 1229-1236 Dang DT, Bachman KE, Mahatan CS, Dang LH, Giardiello FM, and Yang VW (2000a) Decreased expression of the gutenriched Kruppel-like factor gene in intestinal adenomas of multiple intestinal neoplasia mice and in colonic adenomas of familial adenomatous polyposis patients. FEBS Lett. 476, 203-207 Dang DT, Chen X, Feng J, Torbenson M, Dang LH, and Yang VW (2003) Overexpression of Kruppel-like factor 4 in the

KLF4 as discussed is thought to play a significant role in ES cell self-renewal and generating iPS cells. A lot of questions need to be answered before moving ahead with reprogramming. What is the exact role of KLF4 in epigenetic reprogramming process and how does it collaborate with other transcription factors including Oct4, Sox2 and c-Myc in generation of iPS cells? A more comprehensive analysis of the underlying molecular mechanisms will provide a further insight into its function in stem cell biology. As KLF4 is one of the major transcription factors responsible for transformation of mouse embryonic fibroblasts to stem cell like cells, KLF4 can be speculated to have similar functions in cancer stem cells (Schoenhals et al., 2009). Since KLF4 has been reported to function as an oncogene, we might want to investigate if KLF4 contributes to the tumorigencity of the cancer stem cells. If it is so, the deregulation of KLF4 in cancer stem cell population may provide a way to destroy cancer stem cells and to some extent eradicate cancer. Mechanistically, Notch signaling pathway has been shown to control stem cell self-renewal and pluripotency (Calvi et al., 2003; Hansen et al., 2004). The ability of Notch to promote self-renewal is probably due to its ability to inhibit cell differentiation under some circumstances (Henrique et al., 1997). Therefore it is critical to determine the relative functioning of Notch and KLF4 in stem cells. From the studies of goblet cell differentiation in the mouse gastrointestinal tract (Ghaleb et al., 2008; Zheng et al., 2009), KLF4 and Notch work antagonistically, but studies on mammary stem/progenitor cells show that Notch promotes self renewal of mammary stem cells (Dontu et al., 2004), which is line with the function of KLF4 in stem cells. This becomes another major concern regarding KLF4 in stem cell biology, and we need to address through which pathway KLF4 promotes stem cell renewal and how it exerts its action - through a simple pathway or by integration of different pathways. Therefore it is expected that KLF4 functions and the potential mechanisms in stem cell biology will be under active investigation in the next few years to come.

References Adam PJ, Regan CP, Hautmann MB, and Owens GK (2000) Positive- and negative-acting Kruppel-like transcription factors bind a transforming growth factor beta control element required for expression of the smooth muscle cell differentiation marker SM22alpha in vivo. J Biol Chem. 275, 37798-37806 Alder JK, Georgantas RW, 3rd, Hildreth RL, Kaplan IM, Morisot S, Yu X, McDevitt M, and Civin CI (2008) Kruppellike factor 4 is essential for inflammatory monocyte differentiation in vivo. J Immunol. 180, 5645-5652 Artavanis-Tsakonas S, Rand MD, and Lake RJ (1999) Notch signaling: cell fate control and signal integration in development. Science. 284, 770-776 Audet J (2004) Stem cell bioengineering for regenerative medicine. Expert Opin Biol Ther. 4, 631-644 Baron M (2003) An overview of the Notch signalling pathway. Semin Cell Dev Biol. 14, 113-119 Behr R, and Kaestner KH (2002) Developmental and cell typespecific expression of the zinc finger transcription factor Kruppel-like factor 4 (Klf4) in postnatal mouse testis. Mech Dev. 115, 167-169

201!

Gene Therapy and Molecular Biology Vol 13, page 202!

human colon cancer cell line RKO leads to reduced tumorigenecity. Oncogene. 22, 3424-3430 Dang DT, Pevsner J, and Yang VW (2000b) The biology of the mammalian Kruppel-like family of transcription factors. Int J Biochem Cell Biol. 32, 1103-1121 Dijkmans TF, van Hooijdonk LW, Schouten TG, Kamphorst JT, Fitzsimons CP, and Vreugdenhil E (2009) Identification of new Nerve Growth Factor-responsive immediate-early genes. Brain Res. 1249, 19-33 Dontu G, Jackson KW, McNicholas E, Kawamura MJ, Abdallah WM, and Wicha MS (2004) Role of Notch signaling in cellfate determination of human mammary stem/progenitor cells. Breast Cancer Res. 6, R605-615 Evans PM, and Liu C (2008) Roles of Krupel-like factor 4 in normal homeostasis, cancer and stem cells. Acta Biochim Biophys Sin (Shanghai). 40, 554-564 Feinberg MW, Cao Z, Wara AK, Lebedeva MA, Senbanerjee S, and Jain MK (2005) Kruppel-like factor 4 is a mediator of proinflammatory signaling in macrophages. J Biol Chem. 280, 38247-38258 Feinberg MW, Wara AK, Cao Z, Lebedeva MA, Rosenbauer F, Iwasaki H, Hirai H, Katz JP, Haspel RL, Gray S, Akashi K, Segre J, Kaestner KH, Tenen DG, and Jain MK (2007) The Kruppel-like factor KLF4 is a critical regulator of monocyte differentiation. EMBO J. 26, 4138-4148 Flandez M, Guilmeau S, Blache P, and Augenlicht LH (2008) KLF4 regulation in intestinal epithelial cell maturation. Exp Cell Res. 314, 3712-3723 Foster KW, Frost AR, McKie-Bell P, Lin CY, Engler JA, Grizzle WE, and Ruppert JM (2000) Increase of GKLF messenger RNA and protein expression during progression of breast cancer. Cancer Res. 60, 6488-6495 Foster KW, Ren S, Louro ID, Lobo-Ruppert SM, McKie-Bell P, Grizzle W, Hayes MR, Broker TR, Chow LT, and Ruppert JM (1999) Oncogene expression cloning by retroviral transduction of adenovirus E1A-immortalized rat kidney RK3E cells: transformation of a host with epithelial features by c-MYC and the zinc finger protein GKLF. Cell Growth Differ. 10, 423-434 Fruman DA, Ferl GZ, An SS, Donahue AC, Satterthwaite AB, and Witte ON (2002) Phosphoinositide 3-kinase and Bruton's tyrosine kinase regulate overlapping sets of genes in B lymphocytes. Proc Natl Acad Sci U S A. 99, 359-364 Garrett-Sinha LA, Eberspaecher H, Seldin MF, and de Crombrugghe B (1996) A gene for a novel zinc-finger protein expressed in differentiated epithelial cells and transiently in certain mesenchymal cells. J Biol Chem. 271, 31384-31390 Geiman DE, Ton-That H, Johnson JM, and Yang VW (2000) Transactivation and growth suppression by the gut-enriched Kruppel-like factor (Kruppel-like factor 4) are dependent on acidic amino acid residues and protein-protein interaction. Nucleic Acids Res. 28, 1106-1113 Ghaleb AM, Aggarwal G, Bialkowska AB, Nandan MO, and Yang VW (2008) Notch inhibits expression of the Kruppellike factor 4 tumor suppressor in the intestinal epithelium. Mol Cancer Res. 6, 1920-1927 Ghaleb AM, Katz JP, Kaestner KH, Du JX, and Yang VW (2007) Kruppel-like factor 4 exhibits antiapoptotic activity following gamma-radiation-induced DNA damage. Oncogene. 26, 2365-2373 Giles RH, van Es JH, and Clevers H (2003) Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta. 1653, 1-24 Godmann M, Kromberg I, Mayer J, and Behr R (2005) The mouse Kruppel-like Factor 4 (Klf4) gene: four functional polyadenylation sites which are used in a cell-specific manner as revealed by testicular transcript analysis and multiple processed pseudogenes. Gene. 361, 149-156

Gu Y, Turck CW, and Morgan DO (1993) Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit. Nature. 366, 707-710 Hansen D, Wilson-Berry L, Dang T, and Schedl T (2004) Control of the proliferation versus meiotic development decision in the C. elegans germline through regulation of GLD-1 protein accumulation. Development. 131, 93-104 Harper JW, Adami GR, Wei N, Keyomarsi K, and Elledge SJ (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell. 75, 805-816 Henrique D, Hirsinger E, Adam J, Le Roux I, Pourquie O, IshHorowicz D, and Lewis J (1997) Maintenance of neuroepithelial progenitor cells by Delta-Notch signalling in the embryonic chick retina. Curr Biol. 7, 661-670 Higaki Y, Schullery D, Kawata Y, Shnyreva M, Abrass C, and Bomsztyk K (2002) Synergistic activation of the rat laminin gamma1 chain promoter by the gut-enriched Kruppel-like factor (GKLF/KLF4) and Sp1. Nucleic Acids Res. 30, 22702279 Huangfu D, Osafune K, Maehr R, Guo W, Eijkelenboom A, Chen S, Muhlestein W, and Melton DA (2008) Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat Biotechnol. 26, 1269-1275 Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, Kageyama R, Guillemot F, Serup P, and Madsen OD (2000) Control of endodermal endocrine development by Hes-1. Nat Genet. 24, 36-44 Kaczynski J, Cook T, and Urrutia R (2003) Sp1- and Kruppellike transcription factors. Genome Biol. 4, 206 Kaji K, Norrby K, Paca A, Mileikovsky M, Mohseni P, and Woltjen K (2009) Virus-free induction of pluripotency and subsequent excision of reprogramming factors. Nature. 458, 771-775 Katz JP, Perreault N, Goldstein BG, Actman L, McNally SR, Silberg DG, Furth EE, and Kaestner KH (2005) Loss of Klf4 in mice causes altered proliferation and differentiation and precancerous changes in the adult stomach. Gastroenterology. 128, 935-945 Katz JP, Perreault N, Goldstein BG, Lee CS, Labosky PA, Yang VW, and Kaestner KH (2002) The zinc-finger transcription factor Klf4 is required for terminal differentiation of goblet cells in the colon. Development. 129, 2619-2628 Kharas MG, Yusuf I, Scarfone VM, Yang VW, Segre JA, Huettner CS, and Fruman DA (2007) KLF4 suppresses transformation of pre-B cells by ABL oncogenes. Blood. 109, 747-755 Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, and Clevers H (1997) Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science. 275, 1784-1787 Lee HJ, Kang YM, Moon CS, Joe MK, Lim JH, Seo YH, Song J, and Jung MH (2009) Kruppel-like factor 4 (KLF4) positively regulates human ghrelin expression. Biochem J Li Y, McClintick J, Zhong L, Edenberg HJ, Yoder MC, and Chan RJ (2005) Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc finger transcription factor Klf4. Blood. 105, 635-637 Liu J, Liu Y, Zhang H, Chen G, Wang K, and Xiao X (2008a) KLF4 promotes the expression, translocation, and releas eof HMGB1 in RAW264.7 macrophages in response to LPS. Shock. 30, 260-266 Liu J, Zhang H, Liu Y, Wang K, Feng Y, Liu M, and Xiao X (2007) KLF4 regulates the expression of interleukin-10 in RAW264.7 macrophages. Biochem Biophys Res Commun. 362, 575-581 Liu S, Zhang H, Zhu L, Zhao L, and Dong Y (2008b) Kruppellike factor 4 is a novel mediator of selenium in growth inhibition. Mol Cancer Res. 6, 306-313

202!

Ai et al: Kruppel like factor 4 (KLF4): a transcription factor with diverse context-dependent functions Liu Y, Sinha S, McDonald OG, Shang Y, Hoofnagle MH, and Owens GK (2005) Kruppel-like factor 4 abrogates myocardininduced activation of smooth muscle gene expression. J Biol Chem. 280, 9719-9727 Luo A, Kong J, Hu G, Liew CC, Xiong M, Wang X, Ji J, Wang T, Zhi H, Wu M, and Liu Z (2004) Discovery of Ca2+relevant and differentiation-associated genes downregulated in esophageal squamous cell carcinoma using cDNA microarray. Oncogene. 23, 1291-1299 Luo J, Dunn T, Ewing C, Sauvageot J, Chen Y, Trent J, and Isaacs W (2002) Gene expression signature of benign prostatic hyperplasia revealed by cDNA microarray analysis. Prostate. 51, 189-200 Lyssiotis CA, Foreman RK, Staerk J, Garcia M, Mathur D, Markoulaki S, Hanna J, Lairson LL, Charette BD, Bouchez LC, Bollong M, Kunick C, Brinker A, Cho CY, Schultz PG, and Jaenisch R (2009) Reprogramming of murine fibroblasts to induced pluripotent stem cells with chemical complementation of Klf4. Proc Natl Acad Sci U S A Madden SL, Cook BP, Nacht M, Weber WD, Callahan MR, Jiang Y, Dufault MR, Zhang X, Zhang W, Walter-Yohrling J, Rouleau C, Akmaev VR, Wang CJ, Cao X, St Martin TB, Roberts BL, Teicher BA, Klinger KW, Stan RV, Lucey B, Carson-Walter EB, Laterra J, and Walter KA (2004) Vascular gene expression in nonneoplastic and malignant brain. Am J Pathol. 165, 601-608 Matsuoka S, Edwards MC, Bai C, Parker S, Zhang P, Baldini A, Harper JW, and Elledge SJ (1995) p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene. Genes Dev. 9, 650-662 McConnell BB, Ghaleb AM, Nandan MO, and Yang VW (2007) The diverse functions of Kruppel-like factors 4 and 5 in epithelial biology and pathobiology. Bioessays. 29, 549-557 McCormick SM, Eskin SG, McIntire LV, Teng CL, Lu CM, Russell CG, and Chittur KK (2001) DNA microarray reveals changes in gene expression of shear stressed human umbilical vein endothelial cells. Proc Natl Acad Sci U S A. 98, 89558960 Miller KA, Eklund EA, Peddinghaus ML, Cao Z, Fernandes N, Turk PW, Thimmapaya B, and Weitzman SA (2001) Kruppellike factor 4 regulates laminin alpha 3A expression in mammary epithelial cells. J Biol Chem. 276, 42863-42868 Moon RT, Kohn AD, De Ferrari GV, and Kaykas A (2004) WNT and beta-catenin signalling: diseases and therapies. Nat Rev Genet. 5, 691-701 Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, and Kinzler KW (1997) Activation of betacatenin-Tcf signaling in colon cancer by mutations in betacatenin or APC. Science. 275, 1787-1790 Moser AR, Pitot HC, and Dove WF (1990) A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, 322-324 Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, Okita K, Mochiduki Y, Takizawa N, and Yamanaka S (2008) Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol. 26, 101-106 Nakamura T, Tsuchiya K, and Watanabe M (2007) Crosstalk between Wnt and Notch signaling in intestinal epithelial cell fate decision. J Gastroenterol. 42, 705-710 Nakatake Y, Fukui N, Iwamatsu Y, Masui S, Takahashi K, Yagi R, Yagi K, Miyazaki J, Matoba R, Ko MS, and Niwa H (2006) Klf4 cooperates with Oct3/4 and Sox2 to activate the Lefty1 core promoter in embryonic stem cells. Mol Cell Biol. 26, 7772-7782 Nandan MO, Yoon HS, Zhao W, Ouko LA, Chanchevalap S, and Yang VW (2004) Kruppel-like factor 5 mediates the

transforming activity of oncogenic H-Ras. Oncogene. 23, 3404-3413 Nathke IS (1999) The adenomatous polyposis coli protein. Mol Pathol. 52, 169-173 Oates AC, Pratt SJ, Vail B, Yan Y, Ho RK, Johnson SL, Postlethwait JH, and Zon LI (2001) The zebrafish klf gene family. Blood. 98, 1792-1801 Ohnishi S, Laub F, Matsumoto N, Asaka M, Ramirez F, Yoshida T, and Terada M (2000) Developmental expression of the mouse gene coding for the Kruppel-like transcription factor KLF5. Dev Dyn. 217, 421-429 Ohnishi S, Ohnami S, Laub F, Aoki K, Suzuki K, Kanai Y, Haga K, Asaka M, Ramirez F, and Yoshida T (2003) Downregulation and growth inhibitory effect of epithelialtype Kruppel-like transcription factor KLF4, but not KLF5, in bladder cancer. Biochem Biophys Res Commun. 308, 251256 Okano J, Opitz OG, Nakagawa H, Jenkins TD, Friedman SL, and Rustgi AK (2000) The Kruppel-like transcriptional factors Zf9 and GKLF coactivate the human keratin 4 promoter and physically interact. FEBS Lett. 473, 95-100 Okita K, Ichisaka T, and Yamanaka S (2007) Generation of germline-competent induced pluripotent stem cells. Nature. 448, 313-317 Okita K, Nakagawa M, Hyenjong H, Ichisaka T, and Yamanaka S (2008) Generation of mouse induced pluripotent stem cells without viral vectors. Science. 322, 949-953 Panigada M, Porcellini S, Sutti F, Doneda L, Pozzoli O, Consalez GG, Guttinger M, and Grassi F (1999) GKLF in thymus epithelium as a developmentally regulated element of thymocyte-stroma cross-talk. Mech Dev. 81, 103-113 Pearson R, Fleetwood J, Eaton S, Crossley M, and Bao S (2008) Kruppel-like transcription factors: a functional family. Int J Biochem Cell Biol. 40, 1996-2001 Philipsen S, and Suske G (1999) A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res. 27, 2991-3000 Rowland BD, Bernards R, and Peeper DS (2005) The KLF4 tumour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene. Nat Cell Biol. 7, 10741082 Rowland BD, and Peeper DS (2006) KLF4, p21 and contextdependent opposing forces in cancer. Nat Rev Cancer. 6, 1123 Schoenhals M, Kassambara A, De Vos J, Hose D, Moreaux J, and Klein B (2009) Embryonic stem cell markers expression in cancers. Biochem Biophys Res Commun. 383, 157-162 Segre JA, Bauer C, and Fuchs E (1999) Klf4 is a transcription factor required for establishing the barrier function of the skin. Nat Genet. 22, 356-360 Sherr CJ, and Roberts JM (1999) CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13, 1501-1512 Shie JL, Chen ZY, Fu M, Pestell RG, and Tseng CC (2000a) Gut-enriched Kruppel-like factor represses cyclin D1 promoter activity through Sp1 motif. Nucleic Acids Res. 28, 2969-2976 Shie JL, Chen ZY, O'Brien MJ, Pestell RG, Lee ME, and Tseng CC (2000b) Role of gut-enriched Kruppel-like factor in colonic cell growth and differentiation. Am J Physiol Gastrointest Liver Physiol. 279, G806-814 Shields JM, Christy RJ, and Yang VW (1996) Identification and characterization of a gene encoding a gut-enriched Kruppellike factor expressed during growth arrest. J Biol Chem. 271, 20009-20017 Swamynathan SK, Davis J, and Piatigorsky J (2008) Identification of candidate Klf4 target genes reveals the

203!

Gene Therapy and Molecular Biology Vol 13, page 204!

molecular basis of the diverse regulatory roles of Klf4 in the mouse cornea. Invest Ophthalmol Vis Sci. 49, 3360-3370 Swamynathan SK, Katz JP, Kaestner KH, Ashery-Padan R, Crawford MA, and Piatigorsky J (2007) Conditional deletion of the mouse Klf4 gene results in corneal epithelial fragility, stromal edema, and loss of conjunctival goblet cells. Mol Cell Biol. 27, 182-194 Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, and Yamanaka S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 Takahashi K, and Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, and Jones JM (1998) Embryonic stem cell lines derived from human blastocysts. Science. 282, 1145-1147 Ton-That H, Kaestner KH, Shields JM, Mahatanankoon CS, and Yang VW (1997) Expression of the gut-enriched Kruppel-like factor gene during development and intestinal tumorigenesis. FEBS Lett. 419, 239-243 Turner J, and Crossley M (1999) Mammalian Kruppel-like transcription factors: more than just a pretty finger. Trends Biochem Sci. 24, 236-240 Vidal A, and Koff A (2000) Cell-cycle inhibitors: three families united by a common cause. Gene. 247, 1-15 Wang N, Liu ZH, Ding F, Wang XQ, Zhou CN, and Wu M (2002) Down-regulation of gut-enriched Kruppel-like factor expression in esophageal cancer. World J Gastroenterol. 8, 966-970 Wei D, Gong W, Kanai M, Schlunk C, Wang L, Yao JC, Wu TT, Huang S, and Xie K (2005) Drastic down-regulation of Kruppel-like factor 4 expression is critical in human gastric cancer development and progression. Cancer Res. 65, 27462754 Wei D, Kanai M, Huang S, and Xie K (2006) Emerging role of KLF4 in human gastrointestinal cancer. Carcinogenesis. 27, 23-31 Wieschaus E, Nusslein-Volhard C, and Kluding H (1984) Kruppel, a gene whose activity is required early in the zygotic genome for normal embryonic segmentation. Dev Biol. 104, 172-186 Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, and Beach D (1993) p21 is a universal inhibitor of cyclin kinases. Nature. 366, 701-704 Xu J, Lu B, Xu F, Gu H, Fang Y, Huang Q, and Lai M (2008) Dynamic down-regulation of Kruppel-like factor 4 in colorectal adenoma-carcinoma sequence. J Cancer Res Clin Oncol. 134, 891-898 Yamada T, Park CS, Mamonkin M, and Lacorazza HD (2009) Transcription factor ELF4 controls the proliferation and homing of CD8+ T cells via the Kruppel-like factors KLF4 and KLF2. Nat Immunol. 10, 618-626 Yamanaka S (2008) Induction of pluripotent stem cells from mouse fibroblasts by four transcription factors. Cell Prolif. 41 Suppl 1, 51-56 Yamanaka S (2009) A fresh look at iPS cells. Cell. 137, 13-17 Yamanaka S, and Takahashi K (2006) [Induction of pluripotent stem cells from mouse fibroblast cultures]. Tanpakushitsu Kakusan Koso. 51, 2346-2351 Yan FF, Liu YF, Liu Y, and Zhao YX (2008) KLF4: a novel target for the treatment of atherosclerosis. Med Hypotheses. 70, 845-847 Yasunaga J, Taniguchi Y, Nosaka K, Yoshida M, Satou Y, Sakai T, Mitsuya H, and Matsuoka M (2004) Identification of aberrantly methylated genes in association with adult T-cell leukemia. Cancer Res. 64, 6002-6009

Yet SF, McA'Nulty MM, Folta SC, Yen HW, Yoshizumi M, Hsieh CM, Layne MD, Chin MT, Wang H, Perrella MA, Jain MK, and Lee ME (1998) Human EZF, a Kruppel-like zinc finger protein, is expressed in vascular endothelial cells and contains transcriptional activation and repression domains. J Biol Chem. 273, 1026-1031 Yoon HS, Chen X, and Yang VW (2003) Kruppel-like factor 4 mediates p53-dependent G1/S cell cycle arrest in response to DNA damage. J Biol Chem. 278, 2101-2105 Yoon HS, and Yang VW (2004) Requirement of Kruppel-like factor 4 in preventing entry into mitosis following DNA damage. J Biol Chem. 279, 5035-5041 Yusuf I, Kharas MG, Chen J, Peralta RQ, Maruniak A, Sareen P, Yang VW, Kaestner KH, and Fruman DA (2008) KLF4 is a FOXO target gene that suppresses B cell proliferation. Int Immunol. 20, 671-681 Zhang G, Zhu H, Wang Y, Yang S, Liu M, Zhang W, Quan L, Bai J, Liu Z, and Xu N (2009) Kruppel-like factor 4 represses the transcription of survivin gene in esophageal cancer cell lines. Biol Chem Zhang W, Chen X, Kato Y, Evans PM, Yuan S, Yang J, Rychahou PG, Yang VW, He X, Evers BM, and Liu C (2006) Novel cross talk of Kruppel-like factor 4 and beta-catenin regulates normal intestinal homeostasis and tumor repression. Mol Cell Biol. 26, 2055-2064 Zhang W, Geiman DE, Shields JM, Dang DT, Mahatan CS, Kaestner KH, Biggs JR, Kraft AS, and Yang VW (2000) The gut-enriched Kruppel-like factor (Kruppel-like factor 4) mediates the transactivating effect of p53 on the p21WAF1/Cip1 promoter. J Biol Chem. 275, 18391-18398 Zhang W, Shields JM, Sogawa K, Fujii-Kuriyama Y, and Yang VW (1998) The gut-enriched Kruppel-like factor suppresses the activity of the CYP1A1 promoter in an Sp1-dependent fashion. J Biol Chem. 273, 17917-17925 Zhao R, and Daley GQ (2008) From fibroblasts to iPS cells: induced pluripotency by defined factors. J Cell Biochem. 105, 949-955 Zhao W, Hisamuddin IM, Nandan MO, Babbin BA, Lamb NE, and Yang VW (2004) Identification of Kruppel-like factor 4 as a potential tumor suppressor gene in colorectal cancer. Oncogene. 23, 395-402 Zheng H, Pritchard DM, Yang X, Bennett E, Liu G, Liu C, and Ai W (2009) KLF4 gene expression is inhibited by the notch signaling pathway that controls goblet cell differentiation in mouse gastrointestinal tract. Am J Physiol Gastrointest Liver Physiol. 296, G490-498 Zhu S, Tai C, MacVicar BA, Jia W, and Cynader MS (2009) Glutamatergic stimulation triggers rapid Krupple-like factor 4 expression in neurons and the overexpression of KLF4 sensitizes neurons to NMDA-induced caspase-3 activity. Brain Res. 1250, 49-62

Walden Ai and Hima Vangapandu

204!

Gene Therapy and Molecular Biology Vol 13, page 205 Gene Ther Biol Vol 13, 205-213, 2009

A Comparative Study on Different Characteristics between Prostate Cancer Model and BPH Model of BALB/c Mice Research Article

Sun Weigui1*, Gan Yiping1, Ye Zhangqun2, Yu Qiangguo1, Mi Zhenguo3*, Song Xiaosong1, Fan Zhaoyin1, Wang Quanhong3, Han Chunzhi3 1

Department of Urology, the 2nd People’s Hostipal of Nanhai, Guangdong 528251, China Department of Urology, Tongji Medical College, Huazhong University of Science & Technology, Wuhan 430031, China 3 Shanxi Cancer Research Institute, Taiyuan 030013, China. _____________________________________________________________________________________________ 2

*Correspondence: Sun Weigui, Ph.D, Professor of Urology. Department of Urology, the 2nd People’s Hostipal of Nanhai, Guangdong 528200, China; email: docswg@sina.com; docswg@hotmail.com and Mi Zhenguo, Shanxi Cancer Research Institute, Taiyuan 030013, China Key Words: Mouse, Model, Method, Prostate Cancer, PIN, BPH, and Characteristics Received: 5 December 2008; Revised: 10 June 2009; Accepted: 11 June 2009; electronically published: 30 June 2009

Summary Objective: To comparatively study the different characteristics between spontaneous PCa (prostate cancer) and BPH (benign prostatic hyperplasia) of mice, we improved methods to simultaneously build their models. Methods: 75 BALB/c male mice were randomly divided into 5 groups: the control mice (A), the castrated mice (B), the castrated mice with T (testosterone) treatment (C), the castrated mice with MNU (N-methyl-N-nitrosourea) treatment (D), and the castrated mice with both T and MNU treatments (E). As to T treatment, 12.5mg·kg-1 T solution was injected into a mouse’s abdominal cavity once every two days. As regards MNU treatment, 100mg.kg-1 MNU solution was injected into a mouse’s prostate once every two weeks. The whole experiment was finished in the ninth weekend and all mice were sacrificed. Their blood-samples were collected from eyeballs for the purpose of serous proteins, cytokines and sexual hormones analyses, while their prostates were studied on anatomy and pathology. Results: The prostates in-group A were normal whereas those in group B appeared atrophy. The group C showed BPH model which had the highest serous T and T/E2 (testosterone / estradiol) (P>0.05). The group D supplied us with mild PIN (prostatic intraepithelial neoplasia) model of 40% incidence, while the group E provided us with severe PIN and early cancers of 92.86% incidence, which had the highest serous VEGF (vascular endothelial growth factor) (P>0.05). In addition, groups CDE had apparently higher serous T and T/E2 than groups AB (P<0.05), however, serous E2 had no distinct difference among 5 groups (P>0.05). With regard to serous proteins analyses by SELDI-TOF-MS as contrasted with BPH model, 12 abnormal proteins in-group E had been discovered which probably have a lot to do with cancerous. Conclusion: Homeochronous models of prostatic BPH, PIN and early cancer could have been quickly obtained in 9 weeks, which would be possibly helpful for us to comparatively study on their mechanisms, characteristics, relationships and differential diagnoses in future.

I. Introduction At present, prostatic PCa and PIN rates in clinical patients are gradually rising, but the researches on their aetiological agent and pathogenesis are still on the way. Owing to clinical data always have limitations that different patients always have different cancer stages, internal diseases and individual medical conditions, let alone we can not directly perform trial therapies and new medicines on human bodies. So, it is important for us to pursue animal experiments instead. Moreover, more effectual and easier animal models should be tried for than

205

previous ones. Therefore, we launched the following experiment, not only for building more feasible models, but also for homochronously comparatively studying prostates on normal, atrophy, BPH, PIN and PCa glands.

II. Materials and Methods A. Animals and Groups 75 BALB/c male mice, SPF-grade, 20±2g, 6 weeks old, were from Beijing Animal Research Institute (CHN). They were completely randomized into 5 groups (Table 1), 15 mice in each group.

Weigui and Zhenguo et al: Prostate Cancer Model and BPH Model of BALB/c Mice Table 1: Methods of animal grouping Group Castration Testosterone MNU A ! ! ! B " ! ! C " ! ! D " ! E " ! “!” : Negative or sham treatment; “"” : Surgical castration (the 1st week); “ ! ” : Intraabdominal testosterone injection; “ ” : Intraprostatic MNU injection.

gland, and seminal vesicals. etc, and individually weighed by analytical balance (0.0001g). What’s more, pathological HE and immuno-histochemical stains of prostates were especially studied. Besides, other organs, such as lung, liver, renal, spine and pelvic lymph nodes, etc, were also observed.

H. SELDI-TOF-MS The serous samples of all mice were analyzed for proteinic analyses by SELDI instruments, according to the American manual book and instructions.

. Statistical Analysis All data were statistically analyzed by SPSS 13.0 (One-Way ANOVA).

B. Material MNU powders: Sigma Inc (USA). Testosterone (T) propionate solutions: 1ml (25mg T): Tianjin Jinyao Inc (CHN). Rat-anti-mouse testosterone ELISA kit (QRCT-311221EIA\UTL) and Rat-anti-mouse estradiol ELISA kit (QRCT-311303EIA\ UTL): ADL Inc (USA). VEGF ELISA Kit: Biosource Inc (USA). SELDI-TOF-MS, IMAC3-Cu and the software (3.2.0.904): Ciphergen Biosystems lnc (USA).

C. Castration Bilateral orchectomy was operated through mouse’s scrotal incision under the anesthesia of intraabdominal pentobarbital sodium (50mg.kg-1) in the first experimental week.

D. MNU Injection

Intraprostatic MNU treatment, 100mg.kg-1per mice for every time, was operated through a 5-mm-long lower-abdominal incision. In the 2nd!9th week (8 weeks), every mouse had suffered 4 times of MNU treatments, once every two weeks. In every time operation, the MNU-powders were dissolved into sodium citrate solutions (PH6.0, 10mmol.L-1) and the MNU solutions (2mg.ml-1) were prepared beforehand. Because the body weight of each mouse was about 20g, and the MNU dose of 100mg.kg-1 could be approximately calculated as 2mg, so every time MNU treatment on per mouse was 1ml MNU solutions (2mg.ml-1). The 1ml MNU solutions were evenly injected into both of the paired lobes of the dorsal and ventral prostatic glands with a mini-injector. After injection, the ventral and dorsal lobes were both wholly swollen. It was very important that accurate punctures and mini-invasive injections should be emphasized in case that MNU solution would leak out from prostate.

E. T Injection Testosterone solutions were directly injected into mouse’s abdominal cavity, once every two days for also continuous 8 weeks (the 2nd!9th week). However, T injections were given up in the same days of having injected MNU since mouse was very feeble after intraday operation, for fear that T could possibly aggravate acute medicine toxicity of MNU and cause it death. The dose of every time T injection was 12.5mg.kg-1 per mouse. Since one mouse was weighed as 20±2g, so the dosage could also be calculated as about 0.01ml T solutions (0.25mg, 25mg.ml-1), and we could very easily handled with a 1ml mini-injector owning every 0.01ml marks.

F. Serological Study Till the 9th weekend, all mice were sacrificed by eyeball-extracted methods and their serous samples were collected, centrifuged (4!, 3000rpm"5 minutes), stored (! 80!) and studied for serous T, E2, T/E2, VEGF and SELDI-TOF-MS proteomic analyses, etc.

G. Pathological Study All mice were studied under operative microscope. Their ventral and dorsal prostatic lobes were anatomized and dissected from the other tissues, such as bladder, urethral, coagulating

206

III. Results

A. General Situations of Mice In the early stage, mice in groups CE always had bigger body-weights than the others because of the effect of protein synthesis of overdose T treatments (Table 2), and they were usually more active and aggressive. Three mice (one in group C and two in group E) were died of biting each other. What’s more, one mouse in-group E lost its prostate specimen because it was eaten up by the others except its ghost. However, in the later experiment, most of the mice in-group E was gradually in lower spirits, and they became thinner and weak with hedgehog-like hairs in the end. Nevertheless, their body-weights were still slightly bigger than the others, because their abdominal cavities usually had some residual T solutions that could increase their total body-weights, owing to their poor conditions could not wholly absorb abdominal T.

B. Macro-pathology Prostates in-group A was normal (Figure1), while those in group B were atrophy covered with a few fats and fasciae (Figure 2). In-group C, prostates were enlarged (BPH), especially in ventral glands (Figure 3). In groups DE, prostates were big, tough and coarse (no visible nodes) in grayish-white colors. No positive changes were found in their pelvic lymph nodes, livers, lungs, and lumbar bones. In addition, most of bladders in groups DE were also white and enlarged in which were full of abundant cloudy urines, urinary sediments and bladder stones (Figure 4). Unlike those in human bladders, the stones were white, smooth and waxy with a few brown blots due to infected urines (Figure 5).

C. Micro-pathology Prostates of groups ABCDE in microscope(40") were illustrated in Figure 6! 12 respectively. Six mice (6/15, 40%) in group D were found #! $PIN, while thirteen mice in group E (13/14, 92.86%) (one mouse was eaten up including its prostate by other mice) had suffered %#& PIN and potentially early-stage cancers. These murine PIN of prostate were usually unifocal in group D, while were mostly multifocal and diffusely present in group E. The method of #!& PIN- grading was referred $ % to the reports of Jae-Hak Park, etc. 1

Gene Therapy and Molecular Biology Vol 13, page 205 Gene Ther Biol Vol 13, 205-213, 2009

A Comparative Study on Different Characteristics between Prostate Cancer Model and BPH Model of BALB/c Mice Research Article

Sun Weigui1*, Gan Yiping1, Ye Zhangqun2, Yu Qiangguo1, Mi Zhenguo3*, Song Xiaosong1, Fan Zhaoyin1, Wang Quanhong3, Han Chunzhi3 1

205

H. SELDI-TOF-MS The serous samples of all mice were analyzed for proteinic analyses by SELDI instruments, according to the American manual book and instructions.

. Statistical Analysis All data were statistically analyzed by SPSS 13.0 (One-Way ANOVA).

C. Castration Bilateral orchectomy was operated through mouse’s scrotal incision under the anesthesia of intraabdominal pentobarbital sodium (50mg.kg-1) in the first experimental week.

D. MNU Injection

206

III. Results

Blum et al: Targeting of Dopamine D2 receptor function Gene Ther Mol Biol Vol 13, 214-230, 2009

Putative targeting of Dopamine D2 receptor function in Reward Deficiency Syndrome (RDS) by Synaptamine Complex™ Variant (KB220): Clinical trial showing anti-anxiety effects Research Article

Kenneth Blum*1,4, Amanda LC Chen2, Thomas JH Chen**2, Abdalla Bowirrat3, Roger L Waite4, Mallory Kerner5, Seth H. Blum6, B. William Downs4, Stella Savarimuthu5, Patrick Rhoades7, Jeffrey Reinking8, Eric R. Braverman5,9, Dasha Braverman5, Nicholas DiNubile10, Marlene Oscar-Berman11 1

Department of Physiology & Pharmacology, Wake Forest University School Of Medicine, Winston-Salem, NC and Department of Psychiatry, University of Florida College of Medicine, Gainesville, Florida, USA. 2 Chang Jung Christian University, Taiwan, Republic of China 3 Clinical Neuroscience & Population Genetics, Ziv Government Medical Center, Israel 4 Department of Molecular Nutrition and Genetics, LifeGen, Inc. La Jolla, CA 5 Department of Clinical Neurology and Nutrition, Path Research Foundation, New York, NY 6 Department of Nutrigenomics, Synaptamine, Inc. San Antonio, TX 7 Department of Research, Comprehensive Pain Clinic of Modesto, Modesto, CA 8 Department of Rehabilitative Medicine, University of California Medical School, Davis, CA 9 Department of Neurological Surgery, Weill Cornell Medical College, NY 10 Department of Orthopedic Surgery, Hospital of the University of Pennsylvania, Philadelphia, PA 11 Boston University School of Medicine and VA Healthcare System, Boston, MA *Correspondence: Kenneth Blum, PhD. Department of Physiology & Pharmacology, Wake Forest University, School Of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina, 27157-1083, USA; e-mail: drd2gene@aol.com and TJH Chen, Department of Occupational Health and Safety, Chang Jung Christian University, Taiwan, Republic Of China tjhchen@yahoo.com.tw Key words: Dopaminergic genetics, anxiety, Substance Use Disorder, Reward Deficiency Syndrome, Synaptamine Complex™

Received: 22 June 2009; Revised 4 July 2009 Accepted 6 July 2009; Electronically published July 2009

Summary Since 1990, researchers have proposed that genetic variants of dopaminergic genes and other "reward genes" are important common determinants of Reward Deficiency Syndrome (RDS). RDS refers to the breakdown of a cascade of neurotransmitters in the brain in which one reaction triggers another — the reward cascade — and resultant aberrant conduct. Association studies have amassed strong evidence implicating the D (2) dopamine receptor (DRD2) gene in harmful conditions such as alcoholism, and the DRD2 gene also has been found to be involved in other substance use disorders including cocaine, nicotine, and opioid dependence, as well as obesity. Brain dopamine has been implicated as the so-called “anti-stress molecule.” The present study investigated antianxiety effects of Synaptamine Complex [KB220], a dopaminergic activator, in a randomized double-blind placebo controlled study in alcoholics and in polydrug abusers attending an in-patient chemical dependency program. In this randomized double-blind placebo controlled study of 62 alcoholic and polydrug abusers, we utilized skin conductance level (SCL) to evaluate stress responses. Patients receiving Synaptamine Complex [KB220] had a significantly reduced stress response as measured by SCL, compared to patients receiving placebo. Two factor ANOVA yielded significant differences as a function of Time (p<0.001), and Treatment (p<0.025) as well as a Time– by-Treatment interaction (p< 0.01). The results of this study suggest that the Synaptamine Complex™ [KB220] may improve treatment response in an in-patient treatment setting by reducing stress related behaviors and warrants further investigation.

214

Gene Therapy and Molecular Biology Vol 13, page 215

I. Introduction Since 1990, association studies have amassed strong evidence implicating the D (2) dopamine receptor (DRD2) gene in the etiology of alcoholism (Blum et al. 1990; Blum et al. 2000). The DRD2 gene also has been found to be involved in other substance use disorders including cocaine, nicotine, and opioid dependence, as well as in obesity. These many disorders often are considered to have a common characteristic: Reward Deficiency Syndrome (RDS) (Blum et al. 1996; Chen et al. 2007). RDS refers to the breakdown of a cascade of neurotransmitters in the brain in which one reaction triggers another — the reward cascade — and resultant aberrant conduct. The relation of dopaminergic neurotransmission to various stress reactions also has been known for many years. The current understanding is that multiple genes interacting with dopaminergic pathways are emerging as potential therapeutic targets, especially in the treatment of addictions. Thus, because brain dopamine has been implicated as the so called “anti-stress molecule,” (Bowirrat and Oscar-Berman 2005) we sought to investigate anti-anxiety effects of Synaptamine Complex [KB220], a dopaminergic activator, in a randomized double-blind placebo controlled study of two groups of patients with RDS. One group consisted of alcoholics, and the other group consisted of polydrug abusers. We reasoned that since nearly 400 different genes may work in concert to impact dopamine and glutamine release in addictions, (Li et al. 2008) our findings potentially could provide insight regarding the involvement of dopamine in the addiction process, which in turn could lead to therapies based on influencing dopaminergic signaling (Blum et al. 2007).

A. Dopamine D2 receptor neuro-genetics and autoreceptor function One of the major pitfalls in the approach to dampen the dopamiergic system to induce a form of drug extinction, we believe is counter-productive and may lead to mood changes including suicide ideation. Recently, our laboratory suggested that activation of dopamine receptors in the long term will induce a potential “normalization” of an aberrant genetically induced reduced dopamine D2 receptor density (Downs et al. 2009). Interestingly, members of our laboratory have promoted the long–term utilization of dopaminergic agonist therapy to reduce craving behavior of all substances including glucose. This was based on the understanding that carriers of the DRD2 Taq A1 A1 allele have compromised DAD2 receptor density (Downs et al. 2009). In this regard, positron emission tomography (PET) studies have revealed significant inter-individual variation in dopamine D2 receptor density in vivo in human striatum. Low D2 receptor binding in vivo has been found to associate with alcohol/substance dependence. It has been suggested that the A1 allele of the human D2 receptor gene might be associated to a specific type of alcoholism and possibly to a reduced D2 receptor density in vitro. Pohjalainen et al. (1998) have determined D2

dopamine receptor-binding density (Bmax), affinity (Kd) and availability (Bmax/Kd) in 54 healthy Finnish volunteers using PET and [11C] raclopride in order to determine whether the A1 allele is associated with a baseline difference in D2 receptor characteristics in vivo. A statistically significant reduction in D2 receptor availability reflecting an alteration in receptor density was observed in the A1/A2 genotype group compared to the A2/A2 group. There was no difference in apparent Kd between the two groups. In conclusion, the association between the A1 allele and low D2 receptor availability in healthy subjects suggested that the A1 allele of the TaqIA polymorphism might be in linkage disequilibrium with a mutation in the promoter/regulatory gene element that affects dopamine D2 receptor expression. This study provides an in vivo neurobiological correlate to the A1 allele in healthy volunteers Pohjalainen et al. (1998). This important work supported the work of Noble et al. (1991), and others (Comings 1999) also showing low D2 receptor density in A1 allele carriers. The understanding of why D2 receptor density was lower in A1 allele carriers provided impetus to suggest that raising D2 receptor density may reduce aberrant craving behavior providing a homeostatic state toward normalization (Blum et al. 2008a). This concept was first supported by Boundy et al (1995) involving studies with radiolabeled agonists. This seminal work has revealed that both agonists induce up-regulation of D2 dopamine receptors in cells transfected to express D2receptors. Their results suggest that the increase in agonist binding after brief exposure to an antagonist is due to interactions of the receptor with one or more G proteins that are not coupled to inhibition of adenylyl cyclase, whereas the increase in agonist binding at later time points is associated with the antagonist-induced up-regulation. Thus, agonistic therapy results in a proliferation of Dopamine D2 receptors over time if provided in a slow fashion (Boundy et al. 1996). This takes on therapeutic importance when one considers the use of the complex Synaptamine™ claimed to be a dopaminergic agonist used to treat RDS behaviors including addiction to drugs and alcohol (Blum et al. 1987). While there is support for a higher likelihood of treatment response and compliance using dopaminergic agonist therapy in carriers of the DRD2 A1 allele (utilizing nutrigenomic principles) compared to DRD2 A2 allele genotype by several investigators the actual mechanism for positive clinical outcomes remained a mystery (Chen et al. 2007; Chen et al. 2007; Blum et al. 2008b; Blum et al. 2008c; Blum et al. 2008d). However, for the first time in the history of this work involving dopaminergic genetics Laakso et al (2005) has provided a clue. Accordingly, the A1 allele of the TaqI restriction fragment length polymorphism (RFLP) of the human dopamine D2 receptor gene (DRD2) is associated with a low density of D2 dopamine receptors in the striatum. Because of the important role of D2 autoreceptors in regulating dopamine synthesis, they aimed to examine whether subjects with the A1 allele have altered presynaptic dopamine function in the brain. They also studied the effects of two other DRD2 215

Blum et al: Targeting of Dopamine D2 receptor function polymorphisms, C957 T and--141C Ins/Del, which have been suggested to affect D2 receptor levels in brain. The relation between the Taq IA RFLP, C957 T and --141C Ins/Del polymorphisms and striatal dopamine synthesis in 33 healthy Finnish volunteers was studied using PET scans and [18F] fluorodopa ([18F] FDOPA), a radiolabelled analog of the dopamine precursor L-DOPA. Heterozygous carriers of the A1 allele (A1/A2; 10 subjects) had significantly higher (18%) [18F] FDOPA uptake in the putamen than subjects without the A1 allele (A2/A2; 23 subjects). C957 T and --141C Ins/Del polymorphisms did not significantly affect [18F] FDOPA Ki values. These results demonstrated that the A1 allele of the DRD2 gene is associated with increased striatal activity of aromatic L-amino acid decarboxylase, the final enzyme in the biosynthesis of dopamine and the ratelimiting enzyme for trace amine (e.g., betaphenylethylamine) synthesis. The finding can be explained by lower D2 receptor expression leading to decreased autoreceptor function, and suggests that dopamine and/or trace amine synthesis rate is increased in the brains of A1 allele carriers to compensate. We are proposing that with an increased striatal activity of aromatic L-amino acid decarboxylase, the final enzyme in the biosynthesis of dopamine and the rate-limiting enzyme for trace amine (e.g. beta-phenylethylamine), dopamine synthesis should occur with a more natural and less powerful agonistic compound relative to L-Dopa. This would support the use of Synaptamine complex, a precursor amino acid and enkephalinase inhibition therapy, as a powerful dopamine agonist. It is postulated that a lower dopamine quanta release at presynatic neurons in the nucleus accumbens (NAc) should result in an upregulation of D2 receptors in A1 carriers, which will ultimately result in a reduction of craving behavior.

1997). In that study the researchers reported evidence that the local action of GLUT on the NAc dopamine stress response is mediated by NMDA receptors located on NAc output neurons that project to the VTA. Part of this output system comprises GABA neurons that project to the VTA either directly or indirectly via the ventral pallidum (Kalivas and Churchill 1993; Walaas and Fonnum 1989; Yim and Mogenson 1980). In the VTA, GABA is known to hyperpolarize dopamine cells, inhibiting their activity by a direct GABAB receptor-mediated action (Chen et al. 2005; Erhardt et al. 2002). The activity of VTA dopamine cells is also regulated by GABA acting at GABAA receptors although here the evidence indicates both a direct inhibitory action as well as a predominant indirect disinhibitory action presumably mediated presynaptically by GABAA receptors on non-dopamine interneurons (Churchill et al. 1992; Johnson and North 1992; Kalivas et al. 1990; Klitenick et al. 1992; Oâ&#x20AC;&#x2122;Brien and White 1987; Sugita et al. 1992; Westerink et al. 1996). Local VTA GABAA and GABAB receptor activation has been shown previously to modulate dopamine transmission in NAc and VTA. However, to our knowledge, similar information has not been obtained for the NAc dopamine response to stress. Recent results indicate that the NAc dopamine stress response is regulated by GABA afferents to VTA dopamine cells and that this action is differentially mediated by GABAA and GABAB receptors. The data suggest that the relevant GABAB receptors are located on dopamine neurons, whereas the GABAA receptors are located on GABA inter-neurons and perhaps also on dopamine cells. The finding related to stress reduction by Synapatamineâ&#x201E;˘ in polysubstance abusers as seen in the current study is consistent with the idea that the corticofugal GLUT input to NAc indirectly regulates stress-induced dopamine release in this region through the GABA feedback pathway to VTA. Moreover, in the past decade, it has also become clear that vulnerability for substance use disorders is influenced by complex interactions between genetic and environmental determinants (Xi and Stein 1998; Barr et al. 2004; Bau et al. 2000; Caspi et al. 2003; Gunzerath and Goldman 2003; Madrid et al. 2001). Interestingly, impulsive behaviors often increase under conditions of heightened arousal or stress (Barr et al. 2004). Associations between stress and substance abuse have also been well documented (Morgan et al. 2002; Swann 2003; Gilbert et al. 2004; Karlsgodt et al. 2003; Laudet et al. 2004; Ota et al. 2004). Recent preclinical findings suggest that the dopamine system may be an important vulnerability substrate in this relation (Sinha 2001; Soderpalm et al. 2003; Cadoni et al. 2003; Matuszewich and Yamamoto 2004). Nevertheless, the exact nature of stress-induced alterations on dopamine neurotransmission, the conditions under which these alterations occur, and the ability to generalize the preclinical findings to humans remains to be determined. Since the findings of Blum et al (1990) associating the dopamine D2 receptor gene polymorphisms and severe alcoholism, many studies have also associated a number of

B. Underlying psychiatric mechanisms of stress Stress will stimulate dopamine transmission in both the medial prefrontal cortex and the NAc (Abercrombie et al. 1989). It appears, however, that the NAc dopamine response to stress is modulated by a dopamine-sensitive mechanism in prefrontal cortex such that increased dopamine transmission in this cortical region acts to dampen the NAc dopamine response to a variety of stimuli including stress (Abercrombie et al. 1989; Deutch et al. 1990; Doherty and Gratton 1996). There is evidence implicating also prefrontal cortex glutamate- (GLUT-) containing neurons some of which are known to project to NAc and to the ventral tegmental area (VTA) where the mesocorticolimbic dopamine system originates (Vezina et al. 1991; Carr and Sesack 2000; Carr et al. 1999). In addition to stimulating dopamine transmission, stress will also increase prefrontal cortex and NAc levels of GLUT (Sesack and Pickel 1992) and there is evidence indicating that the NAc dopamine response to stress is modulated locally by a GLUT-sensitive mechanism (Moghaddam 1993; Keefe et al. 1993; Saulskaya and Marsden 1995; Wheeler et al. 1995). It has been reported that the NAc dopamine stress response is potentiated by local NMDA receptor blockade (Doherty and Gratton 216

Gene Therapy and Molecular Biology Vol 13, page 217 No further blood or urine tests were conducted. The groups were: substance A (alcoholics) with KB220 (AI), substance A (alcoholics) with placebo (AP), substance B (polydrug abusers) with KB220 (BI), and substance B (polydrug abusers) with placebo (BP). Substance B users typically had used or abused at least three and up to 13 substances on a regular basis. Exclusion criteria included pregnant women, as well as any patients suffering from a prediagnosis of liver damage (i.e., anyone having abnormal liver enzyme levels as measure by the CBS/SMAC -24 analysis). Sixty-two patients were randomly divided into appropriate treatment arms and without foreknowledge of diagnosis by the hospital pharmacist. Four individuals left the program immediately after detoxification within the first six days. Eight more individuals left the program, one at staff request, before completing treatment. For the repeated measure analyses, four patients were dropped because of missing data. Thus, the base set consisted of 50 individuals, divided into two groups: 28 on the intervention KB220 (AI or BI) and 22 on placebo at the initiation of the study (AP or BP). The substance A subset consisted of 25 individuals, 15 and 10 each in the KB220 and placebo subgroups, respectively who abused alcohol. The substance B subset consisted of 25 individuals who were abusing several drugs including alcohol, cocaine, barbiturates, tranquilizers, amphetamines, hallucinogens, and marijuana. This subset was similarly divided so that 13 used the intervention KB220, and 12 were provided with placebo. The patient demographics are shown in Table 1.

DRD2 gene polymorphisms with various forms of stress both acute and chronic (Voisey et al. 2009). In the present study, we analyzed in a double-blinded placebo controlled randomized fashion, the stress relieving effects of Synaptamine Complexâ&#x201E;˘[KB220](LifeGen, Inc. San Diego,CA), a novel nutraceutical with putative dopaminergic activation properties, in patients attending an inpatient treatment facility. This nutraceutical was designed to mimic the natural release of VTA dopamine from the NAc, resulting in a reduction of substance seeking behavior based on dopaminergic genetics (Saal et al. 2003; Tidey and Miczek 1997; Noble et al. 1993; Uhl et al. 1993).

II. Methods A. Group selection and dosage regimen Inclusion/exclusion In this IRB-approved (IRB Registration # IRB00002334) prospective randomized, double-blinded placebo-controlled study, four groups of consenting adult patients signed a consent forms approved by the IRB. Inclusion into this study consisted of all patients that were assessed using the Minnesota Multiphasic Personality Inventory (MMPI) and blood analyses (CBC/SMAC24) carried out upon admission. These were all serious polysubstance abusers with a history of multiple failures based on a one-hour structured interview by the attending physician.

Table 1: Patient Characteristics Characteristic

BAL (mg%)

Substance A (Alcohol) Intervention Placebo 39.5 + 16.3 36.2 + 16.6 3F (20%) 12M 2F (20%) 8M (80%) (80% 2B (13%) 13W 2B (20%) 8W (87% (80%) 0.135 0.056

Substance B (Polydrug) Intervention Placebo 29.6 + 12.8 30.3 + 14.7 4F (31%) 9M 4F (33%) 8M (69% (67%) 13W (100%) 1B (8%) 11W (92%) 0.016 0.012

Substance A Total Substance A Total Substance B Total Intervention Total Placebo

15 25 25 28 22

Mean Age Gender Race

B. Blinded randomized procedure Age, weight, sex, race, and entry blood alcohol level (BAL) were tested as possible covariates for the dependent measures. BAL upon entry is shown for each of the groups, and despite great differences in BAL, it proved not to be a significant covariate by statistical analysis. None were found to be significantly different, substantiating the fact that, in terms of these measures, the groups are equivalent. No one in the Chemical Dependent Unit, physicians, nurses and subjects, or the data collector, knew which individuals were receiving KB220, and which were receiving the methylcellulose placebo. Each patient received a research number and the data was collected by a research assistant working at the clinic. All the information was secured and was not available to any investigator in the unit. At the termination of the study the file was immediately submitted

to the independent paid statistical person for subsequent analysis. KB the director of the study did not see the data until the analysis was complete thereby maintaining complete blindness. The KB220 capsules and the placebo capsules were identical in appearance and the patients were randomized to receive either placebo or KB220. Two KB220 or placebo capsules were given three times daily for 21 days to the first 50 patients enrolled. These subjects were observed for an additional seven days without KB220 or placebo. The purpose of the last seven days (without KB220 or placebo) was to verify that use of KB220 did not produce dependency.

217

Blum et al: Targeting of Dopamine D2 receptor function

C. Skin Conductance Level (SCL)

E. Statistical analyses

The electrical properties of the skin have been widely utilized in the assessment of emotional response. This technique has proven quite reliable as a measure of stress levels in the patient (for example, extent of anxiety or anger). As such, this is an indirect measure of stress levels in the patient. The SCL, the inverse of the galvanic skin resistance (GSR), monitors absolute skin conductance level as measured in micromhos (Edelberg 1972). A correlation exists between orienting and anxiety responses, which by sympathetic activation results in increase in skin conductance. Thus, a decrease in conductance is associated with a decrease in autonomic arousal (Luthe 1969; Martin and Venables 1967). To make these measurements, an Autogen 3000 (Autogenic Systems) was attached to the middle three fingers of the dominant hand of each patient, and a reading obtained. Measurements were carried out approximately 16 times for each patient who completed treatment. Readings were taken on a nonscheduled basis, including weekends, between 5:00 and 6:00 p.m.

Effects of the Synaptamine Complex intervention (KB220) treatment were analyzed for substance A and B groups alone and in combination. In addition to highlighting differences in response of these populations, this approach addressed the question of commonality of the neurobiological mechanisms (George 1991; Blum et al. 1978). In addition, combining the samples increased the statistical power of the analyses. Student t-tests were used to compare the mean scores of the KB220 vs. placebo data. The cumulative effects of treatment regimen were seen by analyzing the sum of all prior recordings as windowed on days three [1-3], 10 [1-10], 21 [1-21], and 28 [128]. The consequence of this approach is that the discrete trend differences were emphasized. By this method, each recorded measure was treated as a separate entity or "case." This method is statistically more liberal in its analysis than the repeated measure analysis described below. When many t-tests are used, the alpha criterion for any test is no longer 0.05 and a smaller value should be employed to avoid Type 1 errors, i.e., imputing significance inappropriately. To compensate for this potential error, the t-test significance values were adjusted using the Bonferroni protocol, which yields an alpha protection level for SCL of 0.0042. Repeated measures analyses of variance (ANOVA) were carried out for the first 21 days, the period in which all patients received KB220. We utilized a statistical analysis involving repeated measures to allow for statistical dependency of the subject response over time and to test for differences between groups. The ANOVA compensates for successive case measures by incrementing the value needed for significance. Two-factor analysis of variance was used to examine the skin conductance level (SCL), BESS Score as well as the blood pressure. By this approach the group status at each of the analysis days is viewed as if frozen in time. Time factors were analyzed starting on day 5 when the dropout rate achieved a plateau (8 patients left during the first 5 days) and the sample variance was more stable. As the analysis program used is very sensitive to missing observations within subjects, values for post day five missing data were substituted by the group average for that day. Analyses were limited to days 5, 7, 9, 11, 13, and 17, since the sample size did not support extensive within group degree of freedom contrasts. All ANOVAs were calculated on a VAX 8650 computer using the BMDP Bio-Medical Statistical Analysis Programs. For this statistical analysis a total of 50 patients were evaluated. The data are reported in Figure 1, 2.

D. Ingredients in Synaptamineâ&#x201E;˘ Complex [KB220] The following list outlines the selected ingredients per capsule and their expected effects: D-phenylalanine--230 mg: This amino acid inhibits enkephalinase A and increases the availability of enkephalin in the brain, thereby decreasing craving and depression (Ehrenpreis 1983; Fischer et al. 1975). The LD50 of D-phenylalanine in rodents is 5,452 mg/kg. L-phenylalanine--230 mg: This isomer of phenylalanine tends to increase levels of dopamine, which is closely associated with the brain reward system. A second effect is to increase norepinephrine levels, which leads to a decrease in depression (Yamanaka and Kono 1974). The LD50 of L-phenylalanine in rodents is 5,287 mg/kg. L-Tyrosine â&#x20AC;&#x201C;83.3 mg: The substrate for the rate limiting enzyme Tyrosine hudroxylase to synthesize dopamine in the neuron (Yamanaka and Kono 1974). A daily dosage for a clinical test supported in the literature is about 100 mg/kg for an adult which amounts to about 6.8 Grams at 150 lbs. (Gelenberg et al 2008). The usual dosage amounts to 500-1500 mg per day (dose suggested by most manufacturers; usually an equivalent to 1-3 capsules of pure tyrosine). It is not recommended to exceed 12000 mg (12 g) per day. In fact, too high doses result in reduced levels of dopamine (Chinevere et al 2002). Tyrosine may decrease the absorption of other amino acids in high or chronic doses. It decreases absorption of l-dopa. L-tryptophan--25 mg: This precursor to the neurotransmitter serotonin plays a role in reducing craving and improving the quality of sleep (Yamanaka and Kono 1974). The LD50 of L-tryptophan in rodents is 1,600 mg/kg. L-glutamine--25 mg: Its effect is to increase brain GABA levels, thereby reducing both craving and anxiety (Rogers and Pelton 1957). The LD50 of L-glutamine in the mouse is 7,000 mg/kg. The amount of L-Glutamine is small to allow for adequate dopamine neuronal release. Pyridoxal 5'-phosphate--5 mg: This activated form of vitamin B-6 is a cofactor in the production of aminergic neurotransmitters, and enhances the gastrointestinal absorption of amino acids (Virk et al. 1999). Each participant utilized 6 capsules per day in equal divided doses per day. The capsules were manufactured by Marlyn Natural Products Corporation (Phoenix,Arizona)

III. Results In analyzing skin conductance levels (SCL) measures analyses were performed for between-group comparisons, and repeated measures analyses were applied to evaluate within-group effects. Table 2 illustrates the differences observed between KB220 and placebo groups on the SCL stress measurement test at 3, 10, 21, and 28 days of the program. For the substance A subjects, there was a clear trend to progressively higher scores for both the KB220 and placebo groups with a peak at day 21. Then, with KB220 discontinued, the values declined. SCL was consistently lower in the KB220 group, with the greatest difference between the groups at day 10. Using the stringent alpha acceptance value of 0.0042, significance was not reached. The pattern for the substance B groups showed progressive decline in SCL for both the KB220 and placebo sets, but a substantial and significant difference between them was evident at day 10 and proceeded to increase with time. These data indicated that 218

Gene Therapy and Molecular Biology Vol 13, page 219 the use of KB220 results in clear improvement for the substance B group early in the program. When the data from all the patients were combined, significant differences were evident beginning at day 10 and continuing through day 28, despite discontinuance of KB220 at day 21. The KB220 effect was evident by a decreasing difference between the groups at day 28 as compared with day 21. A two-factor ANOVA (Time and Group) yielded significant main effects of Time (p < 0.001), and Group (p < 0.025) as well as a Group-by-Time interaction (p < 0.0I). Over the 21-day test period there were significant differences among the four groups. Further, for each group there was a significant change over the treatment period. Single factor ANOVAs within each group over time showed significant time-dependent effects for all but the AP group. The progressive time-dependent effects for the other three groups were examined using multiple paired ttests with the alpha acceptance level adjusted to 0.0042. Figure 1 illustrates a significant difference (p < 0.025) between the AI and AP/BP groups on day 7. While the AP/BP groups demonstrated higher SCL measures, the AI/BI group had markedly lower levels. Further, as early as day 7 there was a significant decrease in SCL within the

AI/BI group alone. This day is significantly different from all other days. In contrast with the AI/BI group, the AP/BP group had no time-dependent within-group significant differences. Thus, early in the program, in what appears to be a detoxification related event, the AI/BI patients showed reduced stress responses. The profile of timedependent changes in the substance B subset SCL is mirrored in the two groups. Thus, all patients appear to respond similarly to environmental, program-dependent stimuli. With this stringent form of analysis, no differences emerged between groups. Examining the total AI/BI vs. total AP/BP population (Fig. 2), we found that the intervention group (AI/BI) had consistently lower SCL scores. Between-group differences approach significance overall (p < 0.08), especially for the first 11 days (p < 0.06). Finally, no evidence of dependency in these subjects was observed. This was assessed by evaluating craving behavior (self-reported analog scale) through the Physical and Behavioral Emotional Stress Scores (BESS Score) filled out by the attending staff following the 21-day period whereby each patient no longer received the experimental product.

Table 2: illustrates the differences observed between KB220 and placebo groups on the SCL stress measurement test. Treatment Group Day 3 10 21 28 Substance A NS NS NS NS AI 5923 + 478 6798 + 396 7500 + 312 7340 +262 AP 7551 + 150 9013 + 948 9152+ 722 8434 +595 Substance B BI BP Total AI/BI AP/BP

NS 9470 + 911 14280 + 162 NS 8051 + 645 10661 + 118

P<0.001 9048 + 386 12738 + 870 P<0.001 7954 + 291 10827 + 640

NS = not significant Alpha acceptance value â&#x20AC;&#x201C; p < 0.0042

219

P<0.001 8727 +285 11686 + 519 P<0.001 8007 +217 10506 + 429

P<0.001 8693 + 257 11295 + 447 P<0.001 7902 + 186 9987 + 365

Blum et al: Targeting of Dopamine D2 receptor function

AP n = 12, AI n=15 Day 7, between groups at p < 0.025, within groups at p < 0.025 Figure 1: The SCL value for the total (substance A and substance B groups together) KB220 and placebo groups. After the effect of the first seven days, the striking finding is that the curves for the two groups mirror one another, though the KB220 groups are lower. This may indicate a commonality in response to the dynamics of the treatment program, or it may indicate characteristic changes in the population with recovery groups. In contrast, distinctive changes occur within groups. By day nine, the polydrug-KB220 group shows a marked time-dependent significant improvement. At day 13 a second significant change occurs with respect to days 11, 17 and 21. In contrast to the AP group, the BP group showed a significant change, which occurred later at day 13, and continued through day 21.

Intervention (I) n = 28, Placebo (P) n = 22 Figure 2: The SCL value for the total (substance A and substance A and B groups together) KB220 and placebo groups. After the effect of the first seven days, the striking finding is that the curves for the two groups mirror one another, though the KB220 groups are lower. This may indicate a commonality in response to the dynamics of the treatment program or it may indicate characteristic changes in the population with recovery groups. In contrast, distinctive changes occur within groups. By day nine the BI group shows a marked timedependent significant improvement. At day 13 a second significant change occurs with respect to days 11, 17, and 21. In contrast to the AP group, the BP group showed a significant change, which occurred later, at day 13, and continued through day 21.

220

Gene Therapy and Molecular Biology Vol 13, page 221

IV. Discussion Data were presented for two groups of substance abusers in a 28-day inpatient treatment setting. The SCL, a measure of autonomic function and a known correlate of anxiety level, revealed significant improvement for the substance B group at day 10 and for the combined groups (Total). The 10-day period is known for peak postdetoxification problems associated with inpatient hospitalization (i.e., higher rates of premature patient departure). For both substance A and B groups, the KB220 groups had lower (improved) scores. These values were statistically significant using the repeated measures but just missed significance for the substance A group when the strict alpha acceptance value was imposed. The significant improvement for the substance B and total drug groups continues throughout the remainder of treatment. Thus, these data suggest that KB220 is a particularly useful adjunct to reduce stress (e.g., as associated with anxiety and craving). It is noteworthy that in each individual situation tested the score was consistently lower for the KB220 patients than for those receiving placebo. Seven days after KB220 and placebo were eliminated from the program (measurements through day 28) the SCL response for all groups declined with the greatest decline coming in the substance A group. Autogen 3000 SCL effects were measured using a single factor ANOVA with a Student-Newman-Keuls test for post hoc analysis of any significant ANOVA. Statistically significant differences were obtained for the different groups on day 7 (for substance A) and day 11 (for substance B). In addition, the substance B groups showed parallel curves with the KB220 patients exhibiting less stress. These findings suggest that KB220 reduces response to the situational-induced stresses evident throughout the program and particularly prevalent with the detoxification-transfer-group assimilation events occurring from days 7 to 10. Two clinical observations lend support to this conclusion. First, the patients' disciplinary problems are diminished and, second, the number of calls for the physicians is decreased. We believe that the results of this experiment provide significant evidence that KB220 is a strong anti-anxiety agent and can provide clinical benefits as a stress reducing agent. There are a number of limitations to this study: 1. One important caveat of this study especially in an in-patient setting, is that modest amounts of certain aminoacids might be in doses that are sufficient to permit subjects to discriminate between an inert placebo and a compound with subtle but still discernable properties. Expectations, attitudes of staff, prior information about the study, rumors in the treatment center, and so forth may have operated to sensitize placebo control and KB220 subjects to try to guess the condition (KB220 or control) to which they had been assigned. Thus once subjects categorized themselves as KB220 or placebo, and then it is possible that they behaved accordingly.

2. Another important caveat is that since these patients were not evaluated for generalized anxiety disorder using such standardized scales such as GAD (DSM-IV), and a Hamilton Anxiety Rating Scale (HAMA), Clinical Global Impression of Severity of Illness (CGI-S) Scale; and the Montgomery-Asberg Depression Rating Scale (MADRS) one cannot generalize these findings to GAD per se and may be the subject of additional investigation. 3. Since the actual work of this study was done some years ago, newer and more powerful statistical preferred methods have emerged to handle missing data and dropout such as full information likelihood imputation. 4. Another caveat of this current study involves the lack of some type of growth curve models that first test whether change over time in the outcomes differs across experimental conditions taken the form of time-bycondition interaction. 5. We must caution any interpretation of this study, albeit double blind randomized –placebo controlled because of the small sample size. We focused on specific days because it is well known that in most 30-day in-patient treatment facilities, day 7 is stressful because that is the one-week anniversary of group entry following drug and alcohol detoxification. Figures 3, 4, 5, and 6 illustrate the brain’s reward circuitry and associated neurotransmitters. We are confident that delivery of Synaptamine Complex™ due to precursor amines and enkephalinase inhibition should result in both the enhanced synthesis and release of dopamine. In this regard we are cognizant that the brain is designed to provide homeostatic mechanisms in dopamine synthesis and release. In fact, it is known that the cystosolic concentration of dopamine is quite low, and the concentration of l-dopa is extremely low (Feldman et al. 1997). It has been calculated by others at steady state, cytosolic dopamine = 2.65µM, and the concentration of ldopa is 0.36 µM. Interestingly, it has been calculated that 27.3 µM. of cytosolic dopamine are manufactured from tyrosine per hour .81 µM /hr of dopamine are put into the vesicles by the monoamine transporter and 80.1 µM are put back into the cytosol from extracellular space by DATs. Moreover, 26.5 µM/hr of dopamine is catabolized in the cytosol (Reed et al. 2009). It is important to realize that only about 10% of the cellular tyrosine input goes to dopamine synthesis, with the remainder going to the tyrosine pool (80%) or being catabolized (10%) as seen experimentally (Bongiovanni et al. 2006). Importantly cellular tyrosine itself has a steady state concentration of 126 µM (Reed et al. 2009; Bongiovanni et al. 2005). It is known that even when taken with meals, brain tyrosine levels can double (Fernstrom and Fernstrom 1994). Therefore, by administering to a subject between 350 mg750mg per day of tyrosine (dependent on DRD2 gene polymorphisms), especially in carriers of the DRD2 A1 whereby L-aromatic decarboxylase activity is significantly above normal, the resultant synthesis of cytosolic dopamine is likely (Laakso et al. 2005).

221

Blum et al: Targeting of Dopamine D2 receptor function

Figure 3. Brain circuitry involved in reward. This is a mid-sagittal view of the brain. The major structures of the reward pathway are the ventral tegmental area (VTA), the nucleus accumbens (NAc), and the prefrontal cortex. When one is engaged in something pleasurable, this circuitry of the brain is activated; causing the experience of pleasure and thus making it more likely that one will repeat a pleasurable activity. The NAc plays a central role in the reward circuit. It functions mainly through the action of two essential neurotransmitters: dopamine, which promotes desire, and serotonin, whose effects include satiety and inhibition. Nonhuman animal studies have shown that drugs can increase the production of dopamine in the NAc, but reduce serotonin. The NAc maintains close relations with the VTA, a primitive part of the brain that synthesizes dopamine. VTA axons send dopamine to the NAc. The VTA is also influenced by endorphins whose receptors are targeted by opiate drugs such as heroin and morphine. The substantia nigra also synthesizes dopamine and projects dopamine to the basal ganglia. Dopamine release is inhibited by the neurotransmitter GABA. Another structure involved in pleasure mechanisms is the prefrontal cortex, which plays a role in planning and motivating action. The prefrontal cortex is a relay in the reward circuit and also is modulated by dopamine.

222

Gene Therapy and Molecular Biology Vol 13, page 223

Figure 4. Different areas involved in reward circuits. This Figure illustrates how neurons from different regions of the brain communicate with each other to influence the effects of positive and negative reinforcements. The main areas involved in positive reinforcement (reward) are colored with Green: NAc - nucleus accumbens, VTA â&#x20AC;&#x201C; ventral tegmental area, OFC â&#x20AC;&#x201C; orbitofrontal cortex. The lateral amygdala nucleus (yellow) is involved in pleasure and receives signals from the OFC and also sends inhibitory signals to the medial amygdala. The amygdala (yellow) is a center of many activities; it receives negative signals (blockade) and it functions as a fear and panic center to enhance the action of reinforcements. Negative signals can arrive from the dorsolateral prefrontal cortex, the hippocampus, and the lateral amygdala to stabilize the medial amygdala. Positive signals are transmitted from the medial amygdala to the hypothalamus (orange). The hypothalamus triggers the adrenal gland (blue) to release adrenaline and cortisol. Adrenaline triggers the hippocampus (pink), and cortisol inhibits the hippocampus by its negative signal. The dorsolateral prefrontal cortex (DLPFC) (blue) oversees information about rewards and punishment. It inhibits emotional fear actions including those from the medial amygdala, and it receives positive stimulation from the NAc.

223

Blum et al: Targeting of Dopamine D2 receptor function

Figure 5. Brain reward pathway: Regions and neurotransmitters involved. Figure 5 illustrates different neurotransmitters and brain regions involved in reward circuitry. On the top, the hypothalamus (gray) is involved; serotonin is released triggering the enkephalin and opiate receptors that inhibit the action of GABA B receptors. This action triggers the release of dopamine from the ventral tegmental area (yellow-right). Dopamine triggers the amygdala (gray), thereby affecting the hippocampus (pink). The end result of dopamine release is a pleasurable sensation (Reward-green). On the left side of the figure the interventions of neuropeptidases and enkephalins cause inhibition to the GABA receptor, and the result is production of dopamine in the nucleus accumbens (NAc-blue). Who occupy the D2 â&#x20AC;&#x201C;Receptor that leads to the manifestation of Reward also within the Nucleus Accumbens (Blue). However, at least two other neurotransmitters are also influenced by drug abuse and addiction: GABA and glutamate. The figure illustrate two of the brain-signaling pathways targeted by drugs of abuse transmit dopamine and serotonin. The mean regions involved are NAc â&#x20AC;&#x201C; nucleus accumbens and Ventral Tegmental area in addition to the substantia nigra.

Dopamine and the D2 receptor gene has been correlated with susceptibility to depressive symptoms during stressful life events (Hill et al. 1999), more severe stress or stress disorders (Comings et al. 1996; Comings et al. 2000). Moreover, our research and that of others throughout the years have provided evidence that pharmacogenetic and/or nutrigenetic testing prior to administration of any agent to treat psychiatric based disorders should significantly improve treatment outcomes (Lawford et al. 1995; Blum et al. 2006). In fact, Kirsch et al (2006) in a double-blind crossover study with 24 participants found an increase of reward system activation from placebo to bromocriptine only in subjects carrying the A1 allele. This work supports the work of Nobleâ&#x20AC;&#x2122;s group (Lawford et al. 1995). Furthermore, only A1 carrier showed an increase of performance under bromocriptine. The results are interpreted as reflecting a specific sensitivity for dopamine agonists in persons carrying an A1 allele and may complement actual data and theories of the development of addiction disorders postulating a higher genetic risk for

substance abuse and proneness to stress in carrier of the A1 allele. This work is in agreement with the work cited earlier concerning treatment compliance (Chen et al. 2007; Blum et al. 2008b). Finally, stress is a well-known risk factor in the development of addiction and in addiction relapse vulnerability. A series of population-based and epidemiological studies have identified specific stressors and individual-level variables that are predictive of substance use and abuse. Preclinical research also shows that stress exposure enhances drug self-administration and reinstates drug seeking in drug-experienced animals. The deleterious effects of early life stress, child maltreatment, and accumulated adversity on alterations in the corticotropin releasing factor and hypothalamicpituitary-adrenal axis (CRF/HPA), the extrahypothalamic CRF, the autonomic arousal, and the central noradrenergic systems are considered important. Noradrenergic activation is tantamount to ones extent of the severity of stressful events (Comings et al. 1996). The effects of these alterations on the corticostriatal-limbic motivational, 224

Gene Therapy and Molecular Biology Vol 13, page 225 learning, and adaptation systems that include mesolimbic dopamine, glutamate, and gamma-amino-butyric acid (GABA) pathways are all associated with the underlying pathophysiology linked with stress-related risk of addiction (Suemaru et al. 1985). Furthermore, the corticotropin-releasing factor (CRF)-like peptides, which include the mammalian peptides CRF, urocortin 1, urocortin 2, and urocortin 3, play an important role in orchestrating behavioral and physiological responses that may increase an organism's chance of survival when confronted with internal or external stressors. There is, however, evidence that a chronic overactivity of brain CRF systems under basal conditions may play a role in the etiology and maintenance of psychiatric disorders such as depression and anxiety disorders. Bruijnzeel and Gold (2005) suggest evidence of a role for CRF-like peptides in acute and protracted drug abstinence syndromes and relapse to drugtaking behavior. They suggest that there is a high comorbidity between stress-associated psychiatric disorders and drug dependence. Interestingly, in one study, stress was assessed in 36 inpatient treatment-engaged cocaine dependent individuals and 36 demographically matched healthy control participants using the Perceived Stress Scale and repeated morning salivary cortisol levels over three consecutive days. The Rey Auditory Verbal Learning Test was conducted to measure verbal learning, memory, and executive function. Prospective assessment of cocaine use outcomes during 90 days following discharge from inpatient treatment was also conducted. Fox et al. (2009) found that cocaine dependent patients showed higher levels of distress compared to controls in Perceived Stress Scale scores and cortisol levels. They also demonstrated a significantly reduced learning curve, and fewer correct responses and more errors on recognition. Elevated cortisol was significantly associated with worse Rey Auditory Verbal Learning test performance in cocaine dependent patients. Poor memory scores, but not distress measures, were significantly associated with greater cocaine use after inpatient treatment. The authors suggest that their findings are the first to demonstrate that learning and memory deficits in cocaine dependent individuals are associated with enhanced cortisol and with cocaine use outcomes after inpatient treatment. The findings are consistent with recent addiction models suggesting that chronic cocaine-related neuroadaptations affect learning and memory function, which in turn, influence drug use outcomes. Moreover, relapse to drug taking induced by exposure to cues associated with drugs of abuse is a major challenge to the treatment of drug addiction. Previous studies indicate that drug seeking can be inhibited by disrupting the reconsolidation of a drug-related memory. Stress plays an important role in modulating different stages of memory including reconsolidation. Wang et al. (2008). Determined the role of glucocorticoid receptors in the basolateral amygdala (BLA) in modulating the effects of stress on reconsolidation of this memory. The disruptive effect of stress on reconsolidation of morphine related memory was prevented by inhibition of

corticosterone synthesis with metyrapone or basolateral amygdala, but not central amygdala, injections of the glucocorticoid antagonist RU38486 [(11,17)-11-[4(dimethylamino) phenyl]-17-hydroxy-17-(1propynyl)estra-4,9-dien-3-one]. Finally, the effect of stress on drug related memory reconsolidation was mimicked by systemic injections of corticosterone or injections of RU28362 [11,17-dihydroxy-6-methyl-17-(1propynyl)androsta-1,4,6-triene-3-one] (a glucocorticoid receptor agonist) into basolateral amygdala, but not the central amygdala. These results show that stress blocks reconsolidation of a drug-related memory, and this effect is mediated by activation of glucocorticoid receptors in the basolateral amygdala. These findings may have important clinical implications especially in inpatients undergoing treatment. In fact, it may have profound influence on the well-known treatment phenomena called AMA rate (Withdrawal Against Medical Advice). It is of note that stress may induce AMA rates by virtue of disrupting reconciliation of drug-related memory. In other studies our laboratory has shown the significant decrease in AMA rate in “in-patient” cocaine dependent patients administered a Synaptamine™ variant (KB220) (Blum et al. 1998; Blum et al. 1988). Thus, one proposed mechanism is that KB220 prevented AMA rate because of its putative anti-stress property, thereby allowing for normalized reconciliation drug-related memory to occur. Stress associated effects with dopamine D2 receptor polymorphisms have been intensely studied. Gilbert et al. (2009), found that Nicotine Replacement Therapy (NRT) reduced personality traits related to negative affect (NA). The NA was found to a greater extent in DRD2 A1 carriers than in A2A2 individuals during the first two weeks of treatment (when on the 21-mg patch); however, A1 carriers experienced a renewal of NA symptoms when switched to the 7-mg patch and when off the patch, while A2A2 individuals continued to benefit from NRT. Other work by Coming’s group (Madrid et al. 2001) found a significant interaction between DRD2 genotype and stress score as a predictor of MAST score in alcoholics. Additionally, this difference was found to be largely accounted by the HSI occupational/economic stress score, which interacted significantly with DRD2 genotype as a predictor of MAST score. This stress score was the only one of four that showed levels of stress as high as HSI scores in a US population. The MAST scores of A2A2 genotype participants were found to be nearly identical in low stress and high stress participants, whereas the MAST scores of A1A2 participants increased modestly with stress, and that of A1A1 participants increased markedly with stress. There have been controversies as to the actual DRD2 gene polymorphim being located in the 3’ untranslated region of the gene. However, in a recent article in Scientific American entitled "The Price of Silent Mutations" by Chamary and Hurst (2009) the authors suggested that small changes to DNA that were once considered innocuous enough to be ignored are proving to be important in human diseases, evolution, and biotechnology. Interestingly, this article discusses the role of silence in the DNA code. It turns out that mutations 225

Blum et al: Targeting of Dopamine D2 receptor function sitting outside of the gene regulatory intron may be very important for how a gene can code for translation to a protein. Over the years, there have been studies, which tied the 3' untranslated region to mRNA activity. Chamary and Hurst pointed out that in the dopamine D2 gene, which encodes a cell-surface receptor that detects the presence of the neurotransmitter dopamine, one silent mutation causes the mRNA to be degraded more rapid than normal. As a result, less of the encoded protein is made, and this may affect certain disease states. This suggests, in turn, that the DRD2 Taq A1 allele association in the 3' region by Grandy and our subsequent association studies are due to synonymous mutations (silent), which affect mRNA stability and thus synthesis of the receptor.

Mutations such as -957T have now been shown to be linked to Taq A1 allele (Duan et al 2003). These results call into question some assumptions made about synonymous variation in molecular population genetics and gene-mapping studies of diseases with complex inheritance, like stress and RDS, and indicate that synonymous variation can have effects of potential pathophysiological and pharmacogenetic importance. Accordingly, these findings support the hypothesis that DRD2 genotype-phenotype associations depend on the magnitude of stress exposure, and they lend support to the view that variability in DRD2 study outcomes may in part be explained by this gene-environment interaction.

Figure 6. Summary of neurocircuitry involved in addictions. This figure shows three potential circuits active during addiction and drug abuse. These are: (1) Reward Circuit, consisting of the nucleus accumbens and extended amygdala (bed nucleus of the stria terminalis and central nucleus of the amygdala); (2) “Craving” Circuit, consisting of the dorsal prefrontal cortex, and basolateral amygdala; and (3) “Compulsivity” Circuit, consisting of a loop connections involving the ventral striatum, ventral pallidum, medial thalamic, and orbitofrontal cortex. The circuitry is interconnected and interactive.

connectivity patterns in chronic heroin users and regulation of stress), (Liu et al, 2009) and Wang et al. (2004). (For Substance Use Disorder). Nutrigenetic and pharmacogentic testing (Meshkin and Blum 2007) are tantamount to improved outcomes (stress related) particularly in individuals having compromised dopaminergic (Duan et al. 2003) and/or serotonergic genetics (Geller and Blum 1970; Bruening et al. 2006).

V. Conclusions The results of the present study support the view that the Synaptamine Complex™ [KB220] may improve treatment response in an inpatient treatment setting by reducing stress related behaviors. We believe that such treatment warrants further investigation, especially as it relates to work of Stice et al (2004,2008) (with respect to food addiction), Gold’s group (relating to dysfunctional 226

Gene Therapy and Molecular Biology Vol 13, page 227 Interestingly the heritabilities of symptoms of posttraumatic stress disorder (PTSD), anxiety, depression, and the shared genetic component of these symptoms among family members exposed to the 1988 Spitak earthquake in Armenia were evaluated by Goenjian et al. (2008). Two hundred members of 12 multigenerational families exposed to the Spitak earthquake were studied using a battery that assessed earthquake exposure and symptoms of PTSD, anxiety, and depression. The heritabilities found in this multigenerational family study indicate that the genetic make-up of some individuals renders them substantially more vulnerable than others to develop symptoms of PTSD, anxiety, and depression. While there are many research gaps in furthering our understanding of the association between stress and addiction (Koob 2008), the present preliminary findings provide a novel non-pharmacological alternative (nutritional) that in our opinion following confirmation in larger perspective studies could significantly influence new prevention and treatment strategies to address vulnerability to addiction especially when coupled with genetic testing. Future studies from our laboratory will address stress-reliving effects of Synaptamine™ in chemical dependence rehabilitation treatment in relation to dopaminergic and serotonergic genetics.

Acknowledgements The author’s acknowledge the staff of LifeGen, Inc., La Jolla, California, and Path Research Foundation. MO-B acknowledges the support of NIAAA (R01- A07112 & K05-AA00219) and the VA Healtcare System’s Medical Research Service.

Conflict of interest Kenneth Blum, Roger L. Waite, and William Downs, are Officers in LifeGen, Inc. San Diego, CA. LifeGen, Inc. has the worldwide distribution rights of the Synaptamine Complex [KB220™}.

References Abercrombie ED, Keefe KA, DiFrischia DS et al. (1989) Differential effects of stress on in vivo dopamine release in striatum, nucleus accumbens, and medial prefrontal cortex, J. Neurochem. 52, 1655-1658. Barr CS, Newman TK, Schwandt M et al. (2004) Sexual dichotomy of an interaction between early adversity and the serotonin transporter gene promoter variant in rhesus macaques. Proc. Natl. Acad. Sci. 101, 12358-12363. Bau CH, Almeida S, Hutz MH. (2000) The TaqI A1 allele of the dopamine D2 receptor gene and alcoholism in Brazil: association and interaction with stress and harm avoidance on severity prediction. Am. J. Med. Genet. 96, 302-306. Blum, K. Allison, D., Trachtenberg, M.C., Williams, R.W. and Loeblich, L.A. (1998) Reduction of both drug hunger and withdrawal against advice rate of cocaine abusers in a 30 day inpatient treatment program by the neuronutrient Tropamine' Curr.Ther. Res. 43,1204 1214. Blum K, Braverman ER, Holder JM et al. (2000) Reward deficiency syndrome: a biogenetic model for the diagnosis and treatment of impulsive, addictive, and compulsive behaviors. J Psychoactive Drugs.32 Suppl:i-iv, 1-112.

Blum K, Briggs AH, Trachtenberg MC et al. (1987) Enkephalinase inhibition: regulation of ethanol intake in genetically predisposed mice. Alcohol. 4, 449-56. Blum K, Chen AL, Chen TJ, et al. (2008a) Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary.Theor Biol Med Model. 15,24-39 Blum K, Chen ALC, Chen TJH, Rhoades P, Prihoda T, Downs BW, Baghi D, Bagch M,, Blum SH, Williams L, Braverman ER, Kerner M, Waite RL, Quirk B, White L. (2008d) Dopamine D2 Receptor Taq A1 allele predicts treatment compliance of LG839 in a subset analysis of a pilot study in the Netherlands. Gene Therapy & Mol Biol. 12, 129-140. Blum K, Chen AL, Chen TJ, Rhoades P, Prihoda TJ, Downs BW, Waite RL, Williams L, Braverman ER, Braverman D, Arcuri V, Kerner M, Blum SH, Palomo T. (2008b) LG839: anti-obesity effects and polymorphic gene correlates of reward deficiency syndrome. Adv Ther. 25, 894-913. Blum K, Chen TJH, Downs BW, et al. (2007) Synaptamine (SG8839),TM An Amino-Acid Enkephalinase Inhibition Nutraceutical Improves Recovery of Alcoholics, A Subtype of Reward Deficiency Syndrome(RDS). Trends in Applied Sciences Research 2 , 132-13. Blum K, Chen TJH, Williams L, Chen ALC, Downs BW, Waite RL, Huntington T, Sims S, Prihoda t, Rhoads P, Reinking J, Braverman D, Kerner M, Blum SH, Quirk B, Braverman ER. (2008c) A short term pilot open label study to evaluate efficacy and safety of LG839, a customized DNA directed nutraceutical in obesity: Exploring Nutrigenomics. Gene Therapy & Mol Biol. 12, 371-382. Blum K, Hamilton MG, Hirst M, Wallace JE. (1978) Putative role of isoquinoline alkaloids in alcoholism: a link to opiates. Alcohol Clin Exp Res. 2, 113-120. Blum K, Meshkin B, Downs BW. (2006) DNA based customized nutraceutical "gene therapy" utilizing a genoscore: a hypothesized paradigm shift of a novel approach to the diagnosis, stratification, prognosis and treatment of inflammatory processes in the human. Med Hypotheses. 66, 1008-1018. Blum K, Noble EP, Sheridan PJ et al. (1990) Allelic association of human dopamine D2 receptor gene in alcoholism. JAMA 263, 2055-2060. Blum K, Sheridan PJ, Wood RC, Braverman ER, Chen TJ, Cull JG, Comings DE. (1996) The D2 dopamine receptor gene as a determinant of reward deficiency syndrome. J. R Soc Med.1996 89,396-400. Blum K, Trachtenberg MC, Ramsay JC. (1988) Improvement of inpatient treatment of the alcoholic as a function of neurotransmitter restoration: a pilot study. Int J Addict. 23,991-998. Bongiovanni R, Kirkbride B, Walmire P, Jaskiw E. (2005) Tyrosine administration does not affect desipromine -induced dopamine levels as measured in vivo in prefrontal cortex. Brain Res. 1054, 203-206. Bongiovanni R, Young D, Newbould E, Jaskiw E. (2006) Increased striatal dopamine synthesis is associated with decreased tissue levels of tyrosine. Brain Res. 115, 26-36. Boundy VA, Lu L, Molinoff PB. (1996) Differential coupling of rat D2 dopamine receptor isoforms expressed in Spodoptera frugiperda insect cells.J Pharmacol Exp Ther. 276,784-94. Boundy VA, Pacheco MA, Guan W, Molinoff PB. (1995) Agonists and antagonists differentially regulate the high affinity state of the D2L receptor in human embryonic kidney 293 cells. Mol Pharmacol. 48,956-64. Bowirrat A, Oscar-Berman M. (2005) Relationship between dopaminergic neurotransmission, alcoholism, and Reward Deficiency syndrome. Am J Med Genet B Neuropsychiatr

227

Blum et al: Targeting of Dopamine D2 receptor function Genet. 132B, 29-37Bruening S, Oh E, Hetzenauer A, Escobar-Alvarez S, Westphalen RI, Hemmings HC Jr, Singewald N, Shippenberg T, Toth M. (2006) The anxietylike phenotype of 5-HT receptor null mice is associated with genetic background-specific perturbations in the prefrontal cortex GABA-glutamate system.J Neurochem. 99,892-899. Bruijnzeel AW, Gold MS. (2005) The role of corticotropinreleasing factor-like peptides in cannabis, nicotine, and alcohol dependence. Brain Res Brain Res Rev. 49,505-528. Cadoni C, Solinas M, Valentini V et al. (2003) Selective psychostimulant sensitization by food restriction: differential changes in accumbens shell and core dopamine. Eur. J. Neurosci. 18, 2326-2334. Carr DB, O'Donnell PJP, Card JP. et al. (1999) Dopamine terminals in the rat prefrontal cortex synapse on pyramidal cells that project to the nucleus accumbens, J. Neurosci. 19, 11049-11060 Carr DB, Sesack SR. (2000) Projections from the rat prefrontal cortex to the ventral tegmental area: target specificity in the synaptic associations with mesocortical and mesoaccumbens neurons, J. Neurosci. 20, 3864-3873. Caspi A, Sugden K, Moffitt TE et al. (2003) Influence of life stress on depression: moderation by a polymorphism in the 5HTT gene. Science 301, 386-389. Chamary JV and Hurst D. (2009) The Price of Silent Mutations. Scientific American 300,46-53 Chen TJ, Blum K, Waite RL et al. (2007) Gene \Narcotic Attenuation Program attenuates substance use disorder, a clinical subtype of reward deficiency syndrome. Adv Ther. 24, 402-414. Chen TJ, Blum K, Waite RL, Meshkin B, Schoolfield J, Downs BW, Braverman EE, Arcuri V, Varshavskiy M, Blum SH, Mengucci J, Reuben C, Palomo T. (2007) Gene \Narcotic Attenuation Program attenuates substance use disorder, a clinical subtype of reward deficiency syndrome. Adv Ther. 24, 402-414. Chen TJH, Blum K, Kaats G, Braverman ER, Eisenberg A, Sherman M, Davis K, Comings DE, Wood R, Pullin D, Arcuri V, Varshavskiy M, Mengucci JF, Blum SH, Downs BW, Meshkin B, Waite RL, Williams L, Schoolfield J, White L. (2007) Chromium Picolinate (CrP) a putative anti-obesity nutrient induces changes in body composition as a function of Taq1 dopamine D2 receptor polymorphisms in a randomized double-blind placebo controlled study. Gene Ther Mol Biol 11, 161-170. Chen Y, Phillips K, Minton G, Sher E.(2005) GABAB receptor modulators potentiate baclofen-induced depression of dopamine neuron activity in the rat ventral tegmental area. Br. J. Pharmacol. 144, 926-932. Churchill L, Dilts RP, Kalivas PW. (1992) Autoradiographic localization of gamma-aminobutyric acid-A receptors within the ventral tegmental area. Neurochem. Res. 17, 101-106. Comings DE. (1999) Molecular heterosis as the explanation for the controversy about the effect of the DRD2 gene on dopamine D2 receptor density. Mol Psychiatry. 4,213-215. Comings DE, Blum K. (2000) Reward deficiency syndrome: genetic aspects of behavioral disorders. Prog Brain Res. 126, 325-341. Comings DE, Muhleman D, Gysin R. (1996) Dopamine D2 receptor (DRD2) gene and susceptibility to posttrpaumatic stress disorder: a study and replication. Biol Psychiatry. 401, 368-372. Deutch AY, Clark WA, Roth RH. (1990) Prefrontal cortical dopamine depletion enhances the responsiveness of mesolimbic dopamine neurons to stress. Brain Res. 521, 311315. Doherty MD, Gratton A. (1996) Medial prefrontal cortical D1 receptor modulation of the meso-accumbens dopamine

response to stress: an electrochemical study in freelybehaving rats, Brain Res. 715, 86-97. Doherty MD, Gratton A. (1997) NMDA receptors in nucleus accumbens modulate stress-induced dopamine release in nucleus accumbens and ventral tegmental area. Synapse 26, 225-234. Downs BW, Chen AL, Chen TJ, Waite RL, et al. (2009) Nutrigenomic targeting of carbohydrate craving behavior: Can we manage obesity and aberrant craving behaviors with neurochemical pathway manipulation by Immunological Compatible Substances (nutrients) using a Genetic Positioning System (GPS) Map? Med Hypotheses. Published May 16. Duan J, Wainwright MS, Comeron JM,et al. (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet. 12,205-216 Edelberg R. Electrical activity of the skin: Its measurement and uses in psychophysiology. In: Greenfield, N.S.; Sternback, R. A. eds. (1972) Handbook of psychophysiology. 367-418. [Publisher - Steinkopff; issue: Vol. 7(1), 1997] Ehrenpreis S. (1983) D-phenylalanine and other enkephalinase inhibitors as pharmacological agents: implications for some important therapeutic applications. Subs. Alcohol Action Misuse. 3, 231-239. Erhardt S, MathĂŠ JM, Cergui K, Engberg G, Svensson TH. (2002) GABAB receptor-mediated modulation of the firing pattern of ventral tegmental area dopamine neurons in vivo. Naunyn-Schmiedeberg's Arch. Pharmacol. 365, 173-180. Feldman R, Meyer J, Quenzer L (1997) Principles of Neuroharmacology. Sundrland, MA.: Sinauer Associates, Inc.. Fernstrom J, Fernstrom M. (1994) Dietary effects on tyrosine availability and catecholamine synthesis in the central nervous system: possible relevance to the control of protein intake. Proc. Nutr. 53, 419-429. Fischer E, Heller B, Nachon M et al.(1975) Therapy of depression by phenylalanine . Preliminary note. Arzneimittelforschung. 25, 132. Fox HC, Jackson ED, Sinha R. (2009) Elevated cortisol and learning and memory deficits in cocaine dependent individuals: Relationship to relapse outcomes.Psychoneuroendocrinology. 2009 (in press). Geller I., Blum K. (1970) The effects of 5-HTP on paraChlorophenylalanine (p-CPA) attenuation of "conflict" behavior. Eur J Pharmacol. 9,319-324 George FR. (1991) Is there a common biological basis for reinforcement from alcohol and other drugs? J Addict Dis. 10, 127-139. Gilbert D, McClernon J, Rabinovich N, et al. (2004)Effects of quitting smoking on EEG activation and attention last for more than 31 days and are more severe with stress, dependence, DRD2 A1 allele, and depressive traits. Nicotine Tob. Res. 6, 249-267. Gilbert DG, Zuo Y, Rabinovich NE, Riise H, Needham R, Huggenvik JI. (2009) Neurotransmission-related genetic polymorphisms, negative affectivity traits, and gender predict tobacco abstinence symptoms across 44 days with and without nicotine patch. J Abnorm Psychol. 118,322-334. Gunzerath L, Goldman D. G. (2003) A NIAAA workshop on gene-environment interactions. Alcohol., Clin. Exp. Res. 27, 540-562. Hill SY, Zezza N, Wipprecht G et al.(1999) Personality traits and dopamine receptors (D2 and D4): linkage studies in families of alcoholics. Am J Med Genet. 15, 634-641. Johnson SW, North RA. (1992) Two types of neurones in the rat ventral tegmental area and their synaptic inputs .J. Physiol. (London) 450, 455-468.

228

Gene Therapy and Molecular Biology Vol 13, page 229 Kalivas PW, Churchill L,. (1993) Klitenick MA. GABA and enkephalin projection from the nucleus accumbens and ventral pallidum to the ventral tegmental area. Neuroscience. 57, 1047-1060. Kalivas PW, Duffy P, Eberhardt H. (1990) Modulation of A10 dopamine neurons by gamma-aminobutyric acid agonists. J. Pharmacol. Exp. Ther. 253, 858-866. Karlsgodt KH, Lukas SE, Elman I. (2003) Psychosocial stress and the duration of cocaine use in non-treatment seeking individuals with cocaine dependence. Am. J. Drug Alcohol Abuse 29, 539-551. Keefe KA, Zved AF, Zigmond MJ, Abercrombie ED.(1993) Stress-induced dopamine release in the neostriatum: evaluation of the role of action potentials in nigrostriatal dopamine neurons or local initiation by endogenous excitatory amino acids, J. Neurochem. 61, 1943-1952. Kirsch P, Reuter M, et al. (2006) Imaging gene-substance interactions: the effect of the DRD2 TaqIA polymorphism and the dopamine agonist bromocriptine on the brain activation during the anticipation of reward. Neurosci Lett. 25,196-20. Klitenick MA, DeWitte P, Kalivas PW. (1992) Regulation of somatodendritic dopamine release in the ventral tegmental area by opioids and GABA: an in vivo microdialysis study. J. Neurosci. 12,2623-2632. Koob GF. (2008) Brain stress systems in the amygdala and addiction. Brain Res. 2009 (in pressStice E, Spoor S, Bohon C, Small DM. Relation between obesity and blunted striatal response to food is moderated by TaqIA A1 allele. Science. 322, 449-452. Laakso A, Pohjalainen T, Bergman J,et al. (2005) Links the A1 allele of the human D2 dopamine receptor gene is associated with increased activity of striatal L-amino acid decarboxylase in healthy subjects. Pharmacogenet Genomics. 15,387-391. Laudet AB, Magura S, Vogel HS et al. Perceived reasons for substance misuse among persons with a psychiatric disorder, Am. J. Orthopsychiatr.2004; 74 : 365-375. Lawford BR, Young RM, Rowell JA et al. (1995) Bromocriptine in the treatment of alcoholics with the D2 dopamine receptor A1 allele. Nat Med. 1, 1337-341. Li CY, Mao X, Wei L. (2008) Genes and (common) pathways underlying drug addiction. PLoS Comput Biol 4(1),e2. Luthe W. (1969) Autogenic therapy. New York and Stratton. 1V11 Madrid GA, MacMurray J, Lee JW, Anderson BA, Comings DE. (2001) Stress as a mediating factor in the association between the DRD2 TaqI polymorphism and alcoholism.Alcohol. 23,117-122. Martin I, Venables PA. (1967) A manual of psychophysiological methods. New York: American Elsevier Matuszewich L, Yamamoto BK.(2004) Chronic stress augments the long-term and acute effects of methamphetamine. Neuroscience 124, 637-646. Meshkin B, Blum K. (2007) Folate Nutrigenetics: A Convergence of Dietary Folate Metabolism, FolicAcid Supplementation, and Folate Antagonist Pharmacogenetics Drug Metabolism Letters 1, 55-60. Moghaddam B. (1993) Stress preferentially increases extraneuronal levels of excitatory amino acids in the prefrontal cortex: comparison to hippocampus and basal ganglia. J. Neurochem. 60, 1650-1657. Morgan D,Grant KA, Gage HD et al. (2002) Social dominance in monkeys: dopamine D2 receptors and cocaine selfadministration. Nat. Neurosci. 5, 169-174. Noble EP, Blum K, Khalsa ME et al. (1993) Allelic association of the D2 dopamine receptor gene with cocaine dependence. Drug Alcohol Depend. 33, 271-85.

Noble EP, Blum K, Ritchie T, Montgomery A, Sheridan PJ. (1991) Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism. Arch Gen Psychiatry. 48, 648-654. O'Brien PD, White FJ. (1987) Inhibition on non-dopamine cells in the ventral tegmental area by benzodiazepines: relationship to dopamine cell activity. Eur. J. Pharmacol. 142, 343-354. Ota A, Yasuda N, Okamoto Y. et al.(2004) Relationship of job stress with nicotine dependence of smokers-a cross-sectional study of female nurses in a general hospital, J. Occup. Health. 46, 220-224. Pohjalainen T, Rinne JO, N책gren K, Lehikoinen P, Anttila K, Syv채lahti EK, Hietala J. (1998) The A1 allele of the human D2 dopamine receptor gene predicts low D2 receptor availability in healthy volunteers, Mol Psychiatry. 3,256-60. Reed M, Best J, Nijhout H. (2009) Passive and active stabilization of dopamine in the striatum. Biosciences Hypotheses (in press). Rogers IL, Pelton RB. (1957) Glutamine in the treatment of alcoholism: a preliminary note. Q. J. Stud. Alcohol 18,58158. Saal D, Dong Y, Bonci A et al. (2003) Drugs of abuse and stress trigger a common synaptic adaptation in dopamine neurons. Neuron 37 , 577-582. Saulskaya N, Marsden CA. (1995) Conditioned dopamine release: dependence upon N-methyl-d-aspartate receptors. Neuroscience 67, 57-63. Sesack SR, Pickel VM. (1992) Prefrontal cortical efferents in the rat synapse on unlabeled neuronal targets of catecholamine terminals in the nucleus accumbens septi and on dopamine neurons in the ventral tegmental area. J. Comp. Neurol. 320, 145-160. Sinha R. (2001) How does stress increase risk of drug abuse and relapse? Psychopharmacology (Berlin). 158, 343-359. Soderpalm A, Nikolayev L, de Wit H. (2003) Effects of stress on responses to methamphetamine in humans, Psychopharmacology (Berlin) 170,188-199. Stice E, Fisher M, Lowe MR, (2004) Are Dietary Restraint Scales Valid Measures of Acute Dietary Restriction? Unobtrusive Observational Data Suggest Not - Psychological Assessment. 16(1), 51-59. Suemaru S, Hashimoto K, Ota Z. (1985) Brain corticotropinreleasing factor (CRF) and catecholamine responses in acutely stressed rats. Endocrinol Jpn. 32,709-718. Sugita S, Johnson SW, North RA. (1992) Synaptic inputs to GABAA and GABAB receptors originate from discrete afferent neurons. Neurosci. Lett. 434, 207-211. Swann AC. (2003) Neuroreceptor mechanisms of aggression and its treatment. J. Clin.Psychiatry 64, (Suppl. 4) 26-35. Tidey JW and Miczek KA. (1997) Acquisition of cocaine selfadministration after social stress: role of accumbens dopamine. Psychopharmacology (Berlin) 130, 203-212. Uhl G, Blum K, Noble EP et al. (1993) Substance abuse vulnerability and D2 receptor genes. Trends Neurosci. 16, 83-8. Vezina P, Blanc G, Glowinski J et al. (1991) Opposed behavioral outputs of increased dopamine transmission in prefrontocortical and subcortical areas: a role for cortical D1 receptor. Eur. J. Neurosci. 3, 1001-1007. Virk RS, Dunton NJ,.Young JC, et al. (1999) Effect of vitamin B-6 supplementation on fuels, catecholamines, and amino acids during exercise in men. Med Sci Sports Exerc. 31, 400408. Voisey J, Swagell CD, Hughes IP, Morris CP, van Daal A, Noble EP, Kann B, Heslop KA, Young RM, Lawford BR. (2009) The DRD2 gene 957C>T polymorphism is associated with posttraumatic stress disorder in war veterans. Depress Anxiety. 26, 28-33.

229

Blum et al: Targeting of Dopamine D2 receptor function Walaas I, Fonnum F. (1989) Biochemical evidence for gammaaminobutyrate containing fibers from the nucleus accumbens to the substantia nigra and ventral tegmental area in the rat. Neuroscience. 5, 325-336. Wang GJ, Volkow ND, Thanos PK, Fowler JS. (2004) Similarity between obesity and drug addiction as assessed by neurofunctional imaging: a concept review. J Addict Dis. 23,39-53. Wang XY, Zhao M, Ghitza UE, Li YQ, Lu L. (2008) Stress impairs reconsolidation of drug memory via glucocorticoid receptors in the basolateral amygdala. J Neurosci. 28,56025610. Westerink BHC, Kwint HF, deVries JV. (1996) The pharmacology of mesolimbic dopamine neurons: a dual-probe

microdialysis study in the ventral tegmental area and nucleus accumbens of the rat brain.J. Neurosci. 16, 2605-2611. Wheeler D, Boutelle MD, Fillenz M.(1995) The role of Nmethyl-d-aspartate receptors in the regulation of physiologically released dopamine,.Neuroscience. 65, 767774. Xi ZX, Stein EA. (1998) Nucleus accumbens dopamine release modulation by mesolimbic GABAA receptors-an in vivo electrochemical study. Brain Res. 798, 156-165. Yamanaka Y, Kono S. (1974) Brain serotonin turnover in alcoholic mice. J Phramacol. 24, 247-252. Yim CY, Mogenson GJ. (1980) Effect of picrotoxin and nipecotic acid on inhibitory response of dopaminergic neurons in the ventral tegmental area to stimulation of the nucleus accumbens. Brain Res. 199, 466-472.

Kenneth Blum, PhD.

230

Gene Therapy and Molecular Biology Vol 13, page 231 Gene Ther Mol Biol Vol 13, 231-243, 2009

Maintenance of a functional higher order chromatin structure: The role of the nuclear matrix in normal and disease states Review Article

Amelia K. Linnemann1#, Stephen A. Krawetz1,2,3* 1

The Center for Molecular Medicine and Genetics Department of Obstetrics and Gynecology 3 Institute for Scientific Computing, Wayne State University School of Medicine _________________________________________________________________________________________________ 2

*Correspondence: Wayne State University School of Medicine, C.S. Mott Center for Human Growth and Development, 275 E Hancock, Detroit, MI 48201; Phone: (313)-577-6770; Fax: (313)-577-8554; Email: steve@compbio.med.wayne.edu # Present Address: University of Wisconsin, Cardiovascular Research Center and Department of Pharmacology, 389 Medical Sciences Center, 1300 University Ave., Madison, WI 53706 Key words: S/MAR attachment, Nuclear Matrix, disease, scaffold, model, gene regulation, LIS, NaCl Received: 14 May 2009; Revised: 29 June 2009; Accepted: 14 May 2009; electronically published: July 2009

Summary The ordered packaging of DNA within the nucleus of somatic cells reflects a dynamic supportive structure that facilitates stable transcription interrupted by intermittent cycles of extreme condensation. This dynamic mode of packing and unpacking chromatin is intimately linked to the ability of the genome to specifically complex with both histones and non-histone proteins. Understanding the underlying mechanism that governs the formation of higher order chromatin structures is a key to understanding how local architecture modulates transcription. In part, the formation of these structures appears to be regulated through genomic looping that is dynamically mediated by attachment to the nuclear scaffold/matrix at S/MARs, i.e., Scaffold/Matrix Attachment Regions. Although the mechanism guiding the formation and use of these higher-ordered structures remains unknown, S/MARs continue to reveal a multitude of roles in development and the pathogenesis of disease.

dozens of sites [reviewed in (Bernstein et al. 2007)] provides long-term epigenetic memory. These modifications contribute to cellular differentiation by marking loci for multi-generational activation or silencing (Jenuwein and Allis 2001). Working in concert as part of a combinatorial mechanism they only influence ~25% of gene expression (Wang et al. 2008). The question remains: what other controls participate to determine cell- specificity through transcription? The mechanics of transitioning between different states of condensation contributing to transcriptional control must be carefully orchestrated to maintain order and inhibit the intertwining of DNA fibers. Functional condensation is aided considerably because chromatin can be periodically constrained by a dynamic mesh of non- histone nuclear scaffold or matrix proteins. The nuclear scaffold/matrix was described well over 50 years ago (Zbarskii and Debov 1951), however its

I. Introduction While the sequencing of the human genome has provided an invaluable resource for high throughput genomic studies, sequence alone has not been able to explain how the genome encodes the cellular program. This ability appears to be linked to the pushâ&#x20AC;&#x201C;pull of compaction and potentiation, i.e., the formation of an open chromatin domain from a closed state. These changes in state are intimately linked to the ability of the DNA to form regulatory protein complexes. The ordered packaging of DNA within the nucleus must reflect a dynamic mechanism that supports stable transcription interrupted by intermittent cycles of condensation. On one hand, the four core histones and linker act to physically organize the eukaryotic DNA. On the other hand, they provide a medium to epigenetically reflecting the interphase condensation states that are recapitulated through many cycles of replication. The addition of modifiers at

231!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure characterization has remained elusive. As a result, the regions of the genome that bind to the nuclear scaffold/matrix, also known as S/MARs, are poorly defined at a genomic level. It has been suggested that S/MARs function to help maintain chromatin states while demarcating points of transition between states (Berezney and Coffey 1974; Mirkovitch et al. 1984). Interactions of the genome within this nuclear framework may coordinately act with histone modifications to generate the stable chromatin states that maintain expression or silencing. In concert they could ensure that this differentiated state is replicated.

higher order folding of the 10 nm fiber becomes evident in the presence of the HI linker (Yaneva et al. 1995) appearing as a 30 nm fiber (Shen et al. 1995). Several models of genome packaging are presented in Figure 1, although the one start and two start helical structures are still debated (Wu et al. 2007). The one-start helix, or solenoid, models are characterized by interactions between neighboring nucleosomes. This determines the dimensions of the coiled fiber as the DNA is bent into a solenoid (Finch and Klug 1976). The two start helix models are based on a nucleosomal arrangement that appears as a zigzag at low ionic strength (Worcel et al. 1981; Woodcock et al. 1984) with the linker maintaining a straight extended conformation (Williams et al. 1986; Smith et al. 1990). Recent evidence supporting the solenoid model suggests that nucleosome interdigitation among neighboring helical gyres creates a high-density nucleosome fiber (Robinson et al. 2006). However, these models fail to consider the effect of additional changes that are imposed upon condensation. For example, the effect of N-terminal acetylation of histone H4 that is necessary for the formation of the 30 nm fiber [reviewed in (Tremethick 2007)]. Irrespective, the 30 nm fiber is further condensed into a series of chromatin loops that are attached at their bases to non-histone nuclear scaffold or matrix proteins. The first evidence for constrained looping of the 30 nm fiber in mammalian cells was based on sedimentation rates of nucleoids, i.e., nuclei depleted of proteins, through sucrose gradients (Cook and Brazell 1976). A similar study in Drosophila melanogaster suggested that there were approximately 400 nucleosomes or ~80 kb of DNA per loop (Benyajati and Worcel 1976). Looping was visualized by electron microscopy of histone depleted metaphase nuclei (Paulson and Laemmli 1977; McCready et al. 1979).

II. Genome organization from nucleosome to chromosome territory In somatic cells, the first order of DNA packaging is achieved by nucleosomes that wrap 146 bp in ~1.7 helical turns around an octamer of H2A2, H2B2, H32 and H42 proteins (Kornberg 1974; Luger et al. 1997). The nucleosomes are separated by 10 to 50 bp stretches of histone H1 bound linker DNA. Nucleosome positioning is influenced by several factors. These include the ability of the DNA to stretch and/or bend sharply around the histone core (Richmond and Davey 2003; Ong et al. 2007) and the direction of the bend of the major groove (Drew and Travers 1985). The energy of packaging is reduced within flexible AT rich regions and these sites of maximum curvature provide a means to precisely position nucleosomes. Local sequence composition can also influence nucleosome positioning despite the absence of a consensus binding sequence. Even with this level of understanding, only ~50% of the nucleosomal interactions can be predicted by sequence characteristics alone (Segal et al. 2006; Valouev et al. 2008). In solutions of low ionic strength, nucleosomes for a 10 nm fiber that is visualized as â&#x20AC;&#x2DC;beads on a stringâ&#x20AC;&#x2122;. The

Figure 1: Folding of the 10 nm Fiber. In the presence of linker histone H1, the 10 nm fiber folds into the 30 nm a fiber. Several models of folding have been proposed. The one start helix model (bottom) requires the coiling of the 10 nm fiber around a central protein core into a solenoid. In comparison, the two-start helix model (top) requires two 10 nm fibers to associate, and form a secondary 30 nm fiber.

232!

Gene Therapy and Molecular Biology Vol 13, page 233 Several models have been proposed for the native organization of the chromosomal loops into higher order metaphase structures including the radial loop model of metaphase chromosome organization (Marsden and Laemmli 1979). Electron micrographs clearly showed the attachment of radially arranged loops to a central scaffold. Building upon this model, others proposed minibands formed as the 30 nm solenoid filaments were organized into 60 kb loops grouped 18 per turn (Pienta and Coffey 1984). Each mitotic chromatid was then derived from ~106 minibands arranged along a central axis. It is now well-accepted that individual interphase chromosomes are organized into discrete territories [reviewed in (Cremer and Cremer 2001)] but the structural organization within the chromosome territories remains to be discerned. Figure 2 summarizes several models including the chromonema model (Belmont and Bruce 1994), the random walk/giant loop model (Sachs et al. 1995) and the multi-loop sub compartment model (Munkel et al. 1999). The chromonema model of organization was derived by following the various states of condensation and intermediates of interphase chromatin through G1. As G1

proceeded, folded structures of chromonema fibers of approximately 100-130 nm in diameter decondensed to 6080 nm. It was suggested that condensed chromonema fibers created looped domains that are stabilized by attaching to either specific non-histone nuclear scaffold proteins or to condensed chromatin within adjacent chromonema fibers. The random walk/giant loop model considered the largescale aggregation of chromatin into DNA foci. It was developed by assessing the distances between defined genomic sequences visualized by fluorescence in situ hybridization (Sachs et al. 1995). This mathematical model assumed that a series of flexible 3 million base-pair chromatin domains were randomly attached to a nonchromatin nuclear substructure. However, this did not consider the presence of smaller loops addressed in the multi-loop sub compartment model of chromosome territories (Munkel et al. 1999). Among the random walks/giant loops, the multi-120 kb loop sub compartment model considered the intertwining of fibers. This would promote long-range interactions that were constrained by requiring that individual sub compartments provide a high level of specification within each chromosome territory.

Figure 2: Models of Chromosomal Looping. Several models have been proposed for the looping of the 30 nm fibers. The chromonema model proposes the formation of a higher order structure through the progressive compaction of the 30 nm fiber into ~130 nm chromonema fibers. Each chromonema fiber is composed of condensed ~28 kb zig-zags of DNA. The chromonema fibers are then coiled to create looped domains that may be attached to the nuclear scaffold/matrix (dots). The random walk/giant loop model suggests that large condensed chromatin loops of 3-5 Mb are randomly attached to a non-DNA backbone (green dots) within the nucleus. The multi-loop sub compartment model is based on individual ~120 kb chromatin loops anchored to the nuclear scaffold/matrix (green dots). They are organized into rosettes that contain a total of 1-2 Mb of DNA connected to one another by linker DNA

233!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure structure is not well understood. Perhaps this reflects the poor understanding of chromatin organization beyond the level of the 30 nm fiber. As summarized in Figure 3, it is well established that chromosomes occupy distinct territories within the nucleus (Cremer and Cremer 2001) and genes undergoing active transcription can loop out away from their respective chromosome territories into structurally distinct interchromatin compartments (Albiez et al. 2006). On one hand, looping has been shown to coincide with the activation of the major histocompatibility locus (Volpi et al. 2000) and the HoxB gene cluster (Chambeyron and Bickmore 2004). Perhaps chromosomal looping may be a result of the local density of expressed genes (Mahy et al. 2002) reflecting the aggregation of transcriptionally active genes into transcription factories [reviewed in (Marenduzzo et al. 2007)]. On the other hand, X inactivation activates multiple domains of higher order looping. These may form separate chromatin hubs at the noncoding Xite and Tsix loci as part of the sex-specific X inactivation center induced developmental chromosomal looping (Tsai et al. 2008). There is a large body of evidence for transcription factories [reviewed in (Jackson 2005)], i.e., complex centers of transcription where active genes from distant locations on the same or different chromosomes are clustered together (Osborne et al. 2007). Joining non- linear regions of the genome within the same transcription factory suggests that chromatin may physically relocate to the factory. One of the most well studied examples of looping is that of the !-globin locus. Activation of this gene cluster relies on the developmentally timed interaction of the locus control region with specific promoters by looping of the intervening DNA (Tolhuis et al. 2002). Looping appears to be mediated by the attachment of at least one hypersensitive site within the LCR to the nuclear matrix (Ostermeier et al. 2003). Similar to the concept of a transcription factory, where distant genomic regions are brought together within one nuclear complex, the !-globin locus provided a key developmental example of an active chromatin hub. Active chromatin hubs that are part of transcription factories are assembled through looping to promote the interactions of distant elements to facilitate tissue specific expression [reviewed in (de Laat and Grosveld 2003)]. The positioning of specific genes and or chromosomes relative to the boundaries of the nucleus may also affect transcription. For example, gene dense chromosomes are often located towards the nuclear interior while gene poor chromosomes are located peripherally, just interior to the nuclear lamina (Bridger et al. 2000; Tanabe et al. 2002). Interestingly, genes targeted to the inner nuclear membrane and nuclear laminas are silenced (Reddy et al. 2008). Tethering of genomic regions to the nuclear lamina may serve as a silencing mechanism as lamin B1 associated domains (LADs) appear preferentially bound in gene poor regions (Guelen et al. 2008). Silencing may also be achieved by specific promoter region binding to type A lamins (Lee et al. 2009). While recruitment of genes to the nuclear periphery can alter expression, its effect is not always

III. Nucleosome remodeling, modification and transcription It is well established that post-translational modifications of the amino terminal tails of the core histone proteins that are typified by, but certainly not limited to, acetylation, methylation and phosphorylation, can alter DNA structure. These individual modifications serve to mark regions for active transcription or silencing. It appears that a dynamic balance between multiple histone modifications maintains a chromatin environment that is either permissive or restrictive to transcription (for a review, see Jenuwein and Allis 2001). For example, a histone modification module consisting of a combination of 17 modifications has been defined. This module tends to be overrepresented within the promoters of the highly expressed genes in human CD4+ T cells (Wang et al. 2008). However, these histone modifications do not uniquely determine expression, as other modifications are required to coordinately regulate structure and poise a gene for transcription. The regions immediately surrounding active genes can be completely devoid of nucleosomes. Several studies have shown that nucleosome presence may not be conducive to transcription (Wasylyk et al. 1979; Lorch et al. 1987) requiring their removal for transcriptional activation (Han and Grunstein 1988). For example, chromatin-remodeling complexes such as the multiprotein SWI/SNF complex can alter nucleosome positioning to reduce steric hinderence to promote recognition of specific sequences by transcription factors (Richmond and Davey 2003). This can be achieved through several mechanisms including sliding/moving the histone octamer to a new position to expose the DNA (Hamiche et al. 1999; Langst et al. 1999; Whitehouse et al. 1999), ejecting the octamer (Lorch et al. 1999; Boeger et al. 2003; Reinke and Horz 2003; Boeger et al. 2004), removing the H2A-H2B dimer (Bruno et al. 2003; Yang et al. 2007) and/or replacing dimers with histone variants e.g., exchanging H2A-H2B with H2B-H2A.Z (Mizuguchi et al. 2004). Transcriptional regulation by structure must also be considered. For example, regions of Z DNA upstream of yeast promoters demarcate the boundaries of neighboring nucleosome rich regions (Wong et al. 2007). These alternative conformations provide a means to absorb torsional stress thereby relieving local super coiling induced by active transcription. This highlights one specific mechanism for altering DNA structure. Additional mechanisms have been identified including the binding of high mobility group proteins (Javaherian et al. 1978) as well as the action of enzymes such as topoisomerase II to stabilize and/or relax the DNA [reviewed in (Giaever et al. 1988)].

IV. Higher order levels of organization and transcription The regulation of gene expression by higher order

234!

Gene Therapy and Molecular Biology Vol 13, page 235 measurable (Finlan et al. 2008). The seemingly conflicting data of gene silencing at the nuclear periphery suggests that other factors may play a role. For example, Ikaros regulates lymphocyte cell expression by developing interphase heterochromatinization foci (Brown et

al. 1997). As expected, inactive genes were associated with heterochromatic foci whereas active genes were located elsewhere. This is consistent with the view that genes are selectively recruited to repressive foci of heterochromatization.

Figure 3: Induction of Gene Expression Coordinates with Looping. Groups of genes that are poised for expression are located at the periphery of the chromosome territory, but not necessarily expressed (‘silent genes’). Upon induction of gene expression, the domain loops out away from the chromosome territory, perhaps into a transcription factory (‘expressed genes’).

diiodosalicylate, was introduced as a “milder” means to extricate the non-histone nuclear protein fraction. When applied, this procedure also revealed a nonrandom interphase loop structure organized by the residual extracted proteins (Mirkovitch et al. 1984). However, lamins along with their corresponding sites of attachment were absent from LIS scaffold preparations (Mirkovitch et al. 1988). Nevertheless other protein complexes (4 of the 6 sites remained attached to both metaphase and interphase scaffolds) appeared constant throughout the cell cycle (Mirkovitch et al. 1988). The terms nuclear scaffold referring to LIS extraction and nuclear matrix referring to extraction with 2M NaCl have since been adopted. The methodology of nuclear matrix isolation continues to develop (Fey et al. 1986; Wan et al. 1999) as part of the toolset to study both replication (Vogelstein 1980) and transcription (Jackson et al. 1981). This includes ‘physiological’ methods that encapsulate cells in agarose beads prior to hypotonic lysis followed by the gentle salt extraction of histones that resolves the nucleoskeleton (Jackson et al. 1988). Studies comparing some of these methods have shown method dependent resolution of sites of attachment (Donev 2000) suggesting that the various extraction methods may isolate different subgroups of proteins. However, throughout the literature the various methods are often interchangeably used without addressing the implications. This has fueled the debate of the existence of a matrix/scaffold within the nucleus (Pederson 2000). It has recently been resolved (Heng et al. 2004) with the aid of a comprehensive description of the biological role of the sites of nuclear matrix and scaffold attachment (Linnemann and Krawetz 2009; Linnemann et al. 2009).

V. The Nuclear scaffold, matrix and nucleoskeleton The proteinacious nuclear matrix was first observed when interphase nuclei were treated with high salt solutions (Zbarskii and Debov 1951). The protein components of the residual body of the interphase nuclear matrix were subsequently characterized from rat liver nuclei (Berezney and Coffey 1974). This clearly showed that the protein constituents of the high salt extracted nuclear matrix could be differentiated from that of untreated nuclei. Looping constrained by a residual protein body was subsequently verified (Cook and Brazell 1976). This structure was shown to persist in metaphase nuclei after histones were depleted by extraction with 2 M NaCl (Paulson and Laemmli 1977; McCready et al. 1979). Subsequent removal of the DNA component revealed a protein scaffold (Adolphs et al. 1977) suggesting attachment to a static structure. Similarly, isolation of the interphase nuclear matrix was visualized as loops of super coiled DNA that appeared as a halo of DNA constrained by the nuclear matrix (Vogelstein 1980). This respectively defined the nuclear scaffold and nuclear matrix. As expected, their protein constituents differed and their nuclear constituents were classified into three components: the peripheral nuclear lamina, an internal network of proteins and residual nucleoli upon which the nuclear scaffold composed primarily SC1, i.e., Topoisomerase II (Earnshaw et al. 1985; Gasser et al. 1986) and SC2 (Lewis and Laemmli 1982) was overlaid. It was suggested that the ability to resolve sites of attachment may be compromised by sliding or the rearrangement of the sites of DNA attachment to the nuclear matrix when prepared with high salt. To address this limitation, extraction with LIS, or 25 mM lithium

235!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure yielded peripheral nuclear matrix components including proteins of the lamina and nuclear pore complexes. Similarly, it has been shown that MARs do specifically bind to type II matrix components of the nuclear lamina (Luderus et al. 1992). In comparison the protein constituents of the type I or inner nuclear matrix have been characterized with the use of cation/heat stabilization. The array of proteins characteristic of type I nuclear matrices is similar to those isolated as part of the LIS nuclear scaffold. Electron microscopy showed intermediate like filaments that span clusters of globular type proteins (Jackson and Cook 1988) suggesting clustered foci of additional functional non-histone proteins. At least 200 proteins have been detected by 2D gel electrophoresis (Capco et al. 1982) and over 300 by tandem mass spectrometry (Ishii et al. 2008). The wide range of proteins that have been identified as constituents of the nuclear scaffold/matrix attests to its complex nature. However, the distribution of proteins present in relatively small proportions begs the question: does this merely represent a snapshot of dynamic interactions such as the induction of expression of a group of functionally related genes? One of the most thoroughly investigated nuclear matrix proteins with functional impact is SATB1. This protein is expressed predominantly in the cells of the thymus, where it binds to MARs at the bases of chromatin loops to regulate global gene expression during T cell development (Dickinson et al. 1992; de Belle et al. 1998; Alvarez et al. 2000). SATB1 has recently been shown to direct a significant increase in the number of loops present at the cytokine locus upon T-helper type 2-cell activation and is necessary for the activation of the locus (Cai et al. 2006). Another protein that has gained interest as a potential nuclear matrix interacting protein is CTCF. Interestingly, the binding of CTCF insulates discrete regions of a genome (Antes et al. 2001; Magdinier et al2004; Yusufzai and Felsenfeld 2004). However, CTCF may not be a nuclear matrix protein (Goetze et al. 2005) requiring reconciliation. Additional proteins such as scaffold attachment factors A and B [SAF-A (Romig et al. 1992) and SAF-B (Renz and Fackelmayer 1996)] also bind both SARs and MARs in vitro, but are only extracted as a part of the nuclear scaffold. SAF-A is analogous to hn-RNPU and analysis of the two protein isoforms has indicated that they both bind to SAR elements with similar affinity (Fackelmayer and Richter 1994). Several transcription factors, such as the pit-1 and the histone acetyltransferase/ transcriptional coactivator CBP, have also been isolated as part of the cadre of nuclear matrix proteins [reviewed in (Hendzel et al. 2001)]. Characterization of the nuclear substructure has established a link between the local physical packing of DNA and the global reorganization of chromosomes during cellular differentiation (Mayer et al. 2005; Martins and Krawetz 2007). It has been suggested that homeotic proteins (Boulikas 1992) like the homeobox domain containing protein Oct-1, may anchor the genome to the nuclear lamina (Imai et al. 1997). RUNX, or Runt-related transcription

VI. Specific constituents of the nuclear scaffold/matrix Isolation of the metaphase scaffold by different methods of extraction does not appear to affect the types of proteins that are isolated. Initial characterization of the scaffold proteins revealed that the major constituents are the protein scaffold component 1 (SC1), i.e., topoisomerase II (Earnshaw et al. 1985; Gasser et al. 1986) and scaffold component 2 (SC2) (Lewis and Laemmli 1982). Although at a reduced level to metaphase cells, topoisomerase II persists in interphase cells as a part of the nuclear scaffold/matrix (Berrios et al. 1985; Berrios and Fisher 1988; Mirkovitch et al. 1988). Multiple variants of topoisomerase II have been shown to differentially mark potentiation of the protamine gene domain during mouse spermatogenesis (Martins and Krawetz 2007). This includes sites of matrix attachment that position the locus within a small looped region coincident with expression. Some, but not all, of the non-histone proteins identified from interphase nuclei differ based on the type of isolation method used. Visualization of the interphase nuclear matrix and nucleoskeleton has revealed proteins that appear to have a structural role in the nucleus. Electron microscopy of thick resin less sections of HeLa cells revealed that residual chromatin loops were associated with a network of proteins that appeared as intermediate filaments (Jackson and Cook 1988; He et al. 1990). Interestingly, cytoplasmic type intermediate filaments also interact with SARs and are isolated as a part of the nuclear scaffold (Tolstonog et al. 2002). The presence of nuclear lamins supporting the nuclear envelope as well as their dispersion throughout the nucleus suggests that these proteins may play a significant structural role as a part of the nuclear scaffold/matrix [reviewed in (Goldman et al. 2002)]. The lamins that dominate and define the nuclear lamina are resistant to high salt solubilization while the more diffusely organized lamins throughout the nucleus are less resistant. For example, lamin B1 is widely distributed throughout the nucleus as a part of the nucleoskeleton. It was recently shown to be necessary for RNA synthesis (Tang et al. 2008). The relative ease that the lamins can be extracted with solutions of high salt suggests that this method can be used to differentiate proteins that appear fixed and static from those serving a more dynamic role. It is likely that these intermittently attached proteins specifically function as needed during dynamic processes like transcription. Thus their differential isolation may provide insight into the direct role of these nuclear scaffold/matrix components of transcription. As depicted in Figure 4, the inner and peripheral networks within the nucleus appear physically continuous but remain functionally distinct. Their differential isolation by high salt extraction with or without cation/heat stabilization has led to their description as either the Type I or Type II nuclear matrix respectively (Lebkowski and Laemmli 1982a; Lebkowski and Laemmli 1982b). The isolation of the type II nuclear matrix without stabilization

236!

Gene Therapy and Molecular Biology Vol 13, page 237 factors, are also associated with the nuclear matrix. Their targeting to discrete foci within the nucleus essential to regulate RUNX dependent genes and in turn tissue specific differentiation during embryonic development (Choi et al. 2001). This intranuclear targeting to transcriptionally active foci occurs in partnership with Smad, which attaches to the

nuclear matrix as a RUNX- Smad protein complex (Zaidi et al. 2002). Recently it was suggested that the sperm nuclear matrix is necessary for zygotic development (Shaman et al. 2007). Curiously, it is enriched in RNAs (Lalancette et al. 2008).

Figure 4: The Nuclear Matrix. Within the nucleus, the nuclear matrix can be subdivided into the outer/peripheral, or type II nuclear matrix. This can be isolated without the use of heat or cation stabilization. The type II nuclear matrix includes proteins of the nuclear lamina as well as proteins of the nuclear pore complexes. The inner, or type I nuclear matrix can be isolated after nuclei stabilization with heat or the addition of cations such as Cu2+. This portion of the nuclear matrix is complex, comprised of hundreds of different types of proteins. These appear to form clusters on a backbone of filaments of similar diameter as the intermediate filaments.

would also correspond to ~64,000 sites of attachment in the sperm genome. Several studies have suggested that MARs are not evenly distributed throughout the mammalian genome. For example, loops as small as 1 kb have been observed at telomeres (Luderus et al. 1996). Similarly, the imprinted region on mouse distal chromosome 7 resolves 52 MARs in a 1 Mb domain (Purbowasito et al. 2004). Although the average MAR spacing was ~20 kb, the majority of attachments clustered into almost equal groups of 58 kb and 169 kb regions flanked by MARs. These observations have now been reconciled following the recent genome- wide analysis (Linnemann and Krawetz 2009; Linnemann et al. 2009). This has shown that S/MARs segment the genome into a wide range of cell-type dependent differentially sized loops. Taken together, the estimates of the number of

VII. Attachment of the genome to the nuclear scaffold/matrix The human genome is organized into loop domains attached at their bases to the nuclear scaffold/matrix by S/MARs that exhibit a range of sizes depending on extraction method (Jackson et al. 1990). Considering an average loop size of approximately 100 kb, it can be estimated that there are 32,000 looped domains throughout the human genome. If each looped domain is demarcated by an attachment site on either side, this would correspond to approximately 64,000 MARs throughout the human genome. In mature spermatozoa, toroid loops are estimated to be approximately 50 kb in length (Brewer et al. 1999), or half that of somatic cells. If every toroid loop were attached to the nuclear matrix in the intervening linker DNA, this

237!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure S/MARs are merely predictions. It is important to note that both cellular environment and cell type likely influence the number of attachments observed at any given point in time.

IX. The multifactorial nature of MARs S/MARs can be classified as constitutive or facultative, perhaps possessing either structural or functional characteristics respectively. In this respect, the human epsilon globin gene has been shown to have both facultative and constitutive MARs (Yan and Qian 1998). Additionally, several MARs within a 1 Mb region of human chromosome 19 have been identified and classified as either structural or regulatory (Chernov et al. 2002). What is perhaps of note is that the S/MARs are merely a snapshot of a dynamic environment. Differences in conditions or the time of measurement could yield varying levels of attachment for an individual S/MAR. Thus their observed roles, be that constitutive or facultative, may not be easily subdivided through the study of a single point in time, environment or cell type. As a function of both the cell cycle and cell type specificity, only a subset of potential S/MARs are expected to be observed at any given time. In specific cases S/MARs have been shown to regulate conformation in both a cell type specific and cell cycle context specific manner (Britanova et al. 2005; Koina and Piper 2005; Martins and Krawetz 2007). Evidence for cell type specific nuclear scaffold/matrix attachment suggests facultative and constitutive attachment can be differentiated. For example, MARs of the osteocalcin gene are tissue specific and transiently associated with the nuclear matrix (Bidwell et al. 1993) while the tyrosine hydroxylase MARs bind the nuclear matrix independent of tissue type (Lenartowski et al. 2003). Removal of the chicken lysozyme MARs increases ectopic expression (Bonifer et al. 1994) confirming their role in tissue specific gene expression. Recent genome wide surveys have shown that SARs and MARs provide complementary activities that either facilitate or suppress gene expression (Linnemann et al. 2009). In this manner cell type specific attachment mediates identity (Linnemann and Krawetz 2009).

VIII. Sequence specificity and in-silico prediction of nuclear scaffold / matrix attachment Although many S/MARs that have been identified in vitro and in vivo have been studied in depth by sequence analysis, the identification of an obvious consensus sequence for scaffold/matrix attachment has proven difficult. Perhaps this reflects the many different protein interactions that appear to contribute to the operational definition of an S/MAR. While to date no consensus has been derived, S/MARs have displayed several reiterative characteristics. Initial observations based on a small subset of all genomic sites suggest that S/MARs are approximately 300 to 1000 bp in length, AT enriched, containing both oligo d[A] and d[T] tracks (Gasser and Laemmli 1986) as well as ATATAT boxes (Cockerill and Garrard 1986). As S/MARs are preferentially bound and cleaved by topoisomerase II both in vitro (Adachi et al. 1989; Razin et al. 1991) and in vivo (Kas and Laemmli 1992), many are expected to contain topoisomerase II binding sites. While S/MARs have often been generally characterized as AT rich regions or sequences containing topoisomerase II (Platts et al. 2006), there is evidence that these two characteristics alone are not sufficient for nuclear matrix binding (Das et al. 1993; Bode et al. 2006). Perhaps this simply reflects the lack of examples or a conformational dependence (Yamamura and Nomura 2001). For example, there is direct evidence of an intrinsically curved structure in the tobacco S/M II MAR where the nuclear proteins appear to bind to the MAR because of structure and not sequence (Fukuda 2000). A body of evidence is also accumulating to suggest that mammalian MARs coincide with Base Unpairing Regions (BURs) that alleviate the torsional strain induced by transcription of nearby regions (Bode et al. 2006). These general characteristics have been used in silico to independently and in combination predict the locations of S/MARs [reviewed in (Platts et al. 2006)]. The application of these algorithms often yields weak and/or seemingly over predictive models of nuclear scaffold/matrix attachment. However, because S/MARs are known to display cell type specificity, what appears as an over prediction may represent potential attachment in other cell types. Additionally the sequence characteristics identified thus far may work in combination with structural features such as BURs and perhaps additional unidentified sequences or local chromatin modifications to direct attachment to the nuclear scaffold/matrix are required. Recent evidence suggests that in some cases the inclusion of structural elements can lead to stronger prediction algorithms (Girod et al. 2007).

X. The role of MARs in disease pathogenesis Epigenetic contributions to disease have been long suspected in studies of monozygotic and dizygotic twins (Wong et al. 2005). The linkage of the epigenetic control of gene expression, often via aberrant methylation and acetylation, to disease is well appreciated (Kalebic 2003). While little is known about the direct effect of S/MARs on tissue specific genes in a normal or diseased state, changes in nuclear scaffold/matrix attachment by either the loss of association or through binding to a previously cryptic site have been implicated in the onset of several genetic disorders. Even synonymous mutations that might not affect protein sequence could result in changes in scaffold/matrix binding resulting in disease if the local structure is perturbed. However, in this case they would perhaps be better characterized as non-synonymous. For example, the loss of a MAR may arrest expression of a male factor and present as infertility (Kramer et al. 1997). Similarly, in vitro 238!

Gene Therapy and Molecular Biology Vol 13, page 239 loss of a MAR has been correlated with the onset of FSHD, Fascioscapulohumeral muscular dystrophy (Petrov et al. 2006). Deletions in conserved noncoding sequences of heritable diseases (Kleinjan and van Heyningen 2005; Sjakste and Sjakste 2005) are often underscored by regions containing MARs and insulators. Although the nuclear lamins bind to S/MARs, the key laminopathies resulting from defects in the A/C type lamins, most often muscular dystrophy and cardiomyopathy, are not necessarily directly linked to the function of the nuclear matrix. The primary phenotypic effect of these mutations is an inability of cells with contractile behavior to survive the stress associated with cellular function. The result is that the nuclei are damaged and thus destroyed so that the muscle fibers harbor reduced numbers of nuclei and cannot function. Other laminopathies induced through lamin A mutations including Hutchinson-Gilford progeria syndrome that also presents artherosclerosis (McClintock et al. 2006), and dilated cardiomyopathy (Taylor et al. 2003) may act by directly affecting nuclear scaffold/matrix attachment to destabilize the gene expression program. The role of MARs in cancer is well established. For example, sites of chromosomal fragmentation preferentially localize to MARs (Schoenlein et al. 1999; Bode et al. 2000a; Bode et al. 2000b). In addition, progression to a malignant phenotype may be promoted by the binding of mutant p53 to the nuclear matrix thereby dysregulating the cell-cycle (Deppert 1996). Similarly, aberrant binding to the nuclear matrix may destabilize the expression of a host of genes that maintain cells in a non- cancerous state (Linnemann and Krawetz 2009). The most direct evidence for cancer by perturbed nuclear scaffold/matrix attachment is that induced by SATB1. As a genomic organizer, SATB1 regulates transcription during T cell development (Dickinson et al. 1992; de Belle et al. 1998; Alvarez et al. 2000; Cai et al. 2006). SATB1 is not dominant in other cell types but its expression in breast cancer cells is indicative of an aggressive phenotype (Han et al. 2008). Interestingly, ectopic expression of SATB1 in non-invasive cancer cells induces an invasive phenotype whereas removal of SATB1 from metastatic cells reverses the invasive phenotype and inhibits tumor growth. S/MARs continue to reveal a multitude of varied roles in development and disease. Continued analyses should provide a window to their underlying mechanism(s) of action reflective of their complex nature. This is essential as we begin to take these elements from the bench to the bedside for use as effective gene therapeutics.

References Adachi, Y., Kas, E., and Laemmli, U.K. 1989. Preferential, cooperative binding of DNA topoisomerase II to scaffoldassociated regions. Embo J 8(13): 3997-4006. Adolphs, K.W., Cheng, S.M., Paulson, J.R., and Laemmli, U.K. 1977. Isolation of a protein scaffold from mitotic HeLa cell chromosomes. Proc Natl Acad Sci U S A 74(11): 4937-4941. Albiez, H., Cremer, M., Tiberi, C., Vecchio, L., Schermelleh, L., Dittrich, S., Kupper, K., Joffe, B., Thormeyer, T., von Hase, J. et al. 2006. Chromatin domains and the interchromatin compartment form structurally defined and functionally interacting nuclear networks. Chromosome Res 14(7): 707-733. Alvarez, J.D., Yasui, D.H., Niida, H., Joh, T., Loh, D.Y., and Kohwi-Shigematsu, T. 2000. The MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes during T-cell development. Genes Dev 14(5): 521-535. Antes, T.J., Namciu, S.J., Fournier, R.E., and Levy-Wilson, B. 2001. The 5' boundary of the human apolipoprotein B chromatin domain in intestinal cells. Biochemistry 40(23): 6731-6742. Belmont, A.S. and Bruce, K. 1994. Visualization of G1 chromosomes: a folded, twisted, supercoiled chromonema model of interphase chromatid structure. J Cell Biol 127(2): 287-302. Benyajati, C. and Worcel, A. 1976. Isolation, characterization, and structure of the folded interphase genome of Drosophila melanogaster. Cell 9(3): 393-407. Berezney, R. and Coffey, D.S. 1974. Identification of a nuclear protein matrix. Biochem Biophys Res Commun 60(4): 14101417. Bernstein, B.E., Meissner, A., and Lander, E.S. 2007. The mammalian epigenome. Cell 128(4): 669-681. Berrios, M., Osheroff, N., and Fisher, P.A. 1985. In situ localization of DNA topoisomerase II, a major polypeptide component of the Drosophila nuclear matrix fraction. Proc Natl Acad Sci U S A 82(12): 4142-4146. Berrios, S. and Fisher, P.A. 1988. Thermal stabilization of putative karyoskeletal protein-enriched fractions from Saccharomyces cerevisiae. Mol Cell Biol 8(10): 4573-4575. Bidwell, J.P., Van Wijnen, A.J., Fey, E.G., Dworetzky, S., Penman, S., Stein, J.L., Lian, J.B., and Stein, G.S. 1993. Osteocalcin gene promoter-binding factors are tissue-specific nuclear matrix components. Proc Natl Acad Sci U S A 90(8): 3162-3166. Bode, J., Benham, C., Ernst, E., Knopp, A., Marschalek, R., Strick, R., and Strissel, P. 2000a. Fatal connections: when DNA ends meet on the nuclear matrix. J Cell Biochem Suppl Suppl 35: 322. Bode, J., Benham, C., Knopp, A., and Mielke, C. 2000b. Transcriptional augmentation: modulation of gene expression by scaffold/matrix-attached regions (S/MAR elements). Crit Rev Eukaryot Gene Expr 10(1): 73-90. Bode, J., Winkelmann, S., Gotze, S., Spiker, S., Tsutsui, K., Bi, C., A, K.P., and Benham, C. 2006. Correlations between scaffold/matrix attachment region (S/MAR) binding activity and DNA duplex destabilization energy. J Mol Biol 358(2): 597613. Boeger, H., Griesenbeck, J., Strattan, J.S., and Kornberg, R.D. 2003. Nucleosomes unfold completely at a transcriptionally active promoter. Mol Cell 11(6): 1587-1598. Boeger H, Griesenbeck J, Strattan JS, Kornberg RD. (2004) Removal of promoter nucleosomes by disassembly rather than sliding in vivo. Mol Cell 14(5): 667-673. Bonifer, C., Yannoutsos, N., Kruger, G., Grosveld, F., and Sippel, A.E. 1994. Dissection of the locus control function located on

Acknowledgements This work was supported in part by National Institutes of Health grant HD36512, the Wayne State University Research Enhancement Program in Computational Biology and the Charlotte B. Failing Professorship if Fetal Therapy and Diagnosis to SAK.

239!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure the chicken lysozyme gene domain in transgenic mice. Nucleic Acids Res 22(20): 4202-4210. Boulikas, T. 1992. Homeotic protein binding sites, origins of replication, and nuclear matrix anchorage sites share the ATTA and ATTTA motifs. J Cell Biochem 50(2): 111-123. Brewer, L.R., Corzett, M., and Balhorn, R. 1999. Protamineinduced condensation and decondensation of the same DNA molecule. Science 286(5437): 120-123. Bridger, J.M., Boyle, S., Kill, I.R., and Bickmore, W.A. 2000. Remodelling of nuclear architecture in quiescent and senescent human fibroblasts. Curr Biol 10(3): 149-152. Britanova, O., Akopov, S., Lukyanov, S., Gruss, P., and Tarabykin, V. 2005. Novel transcription factor Satb2 interacts with matrix attachment region DNA elements in a tissue-specific manner and demonstrates cell-type-dependent expression in the developing mouse CNS. Eur J Neurosci 21(3): 658-668. Brown, K.E., Guest, S.S., Smale, S.T., Hahm, K., Merkenschlager, M., and Fisher, A.G. 1997. Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell 91(6): 845-854. Bruno, M., Flaus, A., Stockdale, C., Rencurel, C., Ferreira, H., and Owen-Hughes, T. 2003. Histone H2A/H2B dimer exchange by ATP-dependent chromatin remodeling activities. Mol Cell 12(6): 1599-1606. Cai, S., Lee, C.C., and Kohwi-Shigematsu, T. 2006. SATB1 packages densely looped, transcriptionally active chromatin for coordinated expression of cytokine genes. Nat Genet 38(11): 1278-1288. Capco, D.G., Wan, K.M., and Penman, S. 1982. The nuclear matrix: three-dimensional architecture and protein composition. Cell 29(3): 847-858. Chambeyron, S. and Bickmore, W.A. 2004. Chromatin decondensation and nuclear reorganization of the HoxB locus upon induction of transcription. Genes Dev 18(10): 1119-1130. Chernov, I.P., Akopov, S.B., Nikolaev, L.G., and Sverdlov, E.D. 2002. Identification and mapping of nuclear matrix-attachment regions in a one megabase locus of human chromosome 19q13.12: long-range correlation of S/MARs and gene positions. J Cell Biochem 84(3): 590-600. Choi, J.Y., Pratap, J., Javed, A., Zaidi, S.K., Xing, L., Balint, E., Dalamangas, S., Boyce, B., van Wijnen, A.J., Lian, J.B. et al. 2001. Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc Natl Acad Sci U S A 98(15): 8650-8655. Cockerill, P.N. and Garrard, W.T. 1986. Chromosomal loop anchorage of the kappa immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell 44(2): 273-282. Cook, P.R. and Brazell, I.A. 1976. Conformational constraints in nuclear DNA. J Cell Sci 22(2): 287-302. Cremer, T. and Cremer, C. 2001. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nat Rev Genet 2(4): 292-301. Das, A.T., Luderus, M.E., and Lamers, W.H. 1993. Identification and analysis of a matrix-attachment region 5' of the rat glutamate-dehydrogenase-encoding gene. Eur J Biochem 215(3): 777-785. de Belle, I., Cai, S., and Kohwi-Shigematsu, T. 1998. The genomic sequences bound to special AT-rich sequence-binding protein 1 (SATB1) in vivo in Jurkat T cells are tightly associated with the nuclear matrix at the bases of the chromatin loops. J Cell Biol 141(2): 335-348.

de Laat, W. and Grosveld, F. 2003. Spatial organization of gene expression: the active chromatin hub. Chromosome Res 11(5): 447-459. Deppert, W. 1996. Binding of MAR-DNA elements by mutant p53: possible implications for its oncogenic functions. J Cell Biochem 62(2): 172-180. Dickinson, L.A., Joh, T., Kohwi, Y., and Kohwi-Shigematsu, T. 1992. A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70(4): 631-645. Donev, R.M. 2000. The type of DNA attachment sites recovered from nuclear matrix depends on isolation procedure used. Mol Cell Biochem 214(1-2): 103-110. Drew, H.R. and Travers, A.A. 1985. DNA bending and its relation to nucleosome positioning. J Mol Biol 186(4): 773-790. Earnshaw, W.C., Halligan, B., Cooke, C.A., Heck, M.M., and Liu, L.F. 1985. Topoisomerase II is a structural component of mitotic chromosome scaffolds. J Cell Biol 100(5): 1706-1715. Fackelmayer, F.O. and Richter, A. 1994. Purification of two isoforms of hnRNP-U and characterization of their nucleic acid binding activity. Biochemistry 33(34): 10416-10422. Fey, E.G., Krochmalnic, G., and Penman, S. 1986. The nonchromatin substructures of the nucleus: the ribonucleoprotein (RNP)-containing and RNP-depleted matrices analyzed by sequential fractionation and resinless section electron microscopy. J Cell Biol 102(5): 1654-1665. Finch, J.T. and Klug, A. 1976. Solenoidal model for superstructure in chromatin. Proc Natl Acad Sci U S A 73(6): 1897-1901. Finlan, L.E., Sproul, D., Thomson, I., Boyle, S., Kerr, E., Perry, P., Ylstra, B., Chubb, J.R., and Bickmore, W.A. 2008. Recruitment to the nuclear periphery can alter expression of genes in human cells. PLoS Genet 4(3): e1000039. Fukuda, Y. 2000. Interaction of nuclear proteins with intrinsically curved DNA in a matrix attachment region of a tobacco gene. Plant Mol Biol 44(1): 91-98. Gasser, S.M. and Laemmli, U.K. 1986. Cohabitation of scaffold binding regions with upstream/enhancer elements of three developmentally regulated genes of D. melanogaster. Cell 46(4): 521-530. Gasser, S.M., Laroche, T., Falquet, J., Boy de la Tour, E., and Laemmli, U.K. 1986. Metaphase chromosome structure. Involvement of topoisomerase II. J Mol Biol 188(4): 613-629. Giaever, G.N., Snyder, L., and Wang, J.C. 1988. DNA supercoiling in vivo. Biophys Chem 29(1-2): 7-15. Girod, P.A., Nguyen, D.Q., Calabrese, D., Puttini, S., Grandjean, M., Martinet, D., Regamey, A., Saugy, D., Beckmann, J.S., Bucher, P. et al. 2007. Genome-wide prediction of matrix attachment regions that increase gene expression in mammalian cells. Nat Methods 4(9): 747-753. Goetze, S., Baer, A., Winkelmann, S., Nehlsen, K., Seibler, J., Maass, K., and Bode, J. 2005. Performance of genomic bordering elements at predefined genomic loci. Mol Cell Biol 25(6): 2260-2272. Goldman, R.D., Gruenbaum, Y., Moir, R.D., Shumaker, D.K., and Spann, T.P. 2002. Nuclear lamins: building blocks of nuclear architecture. Genes Dev 16(5): 533-547. Guelen, L., Pagie, L., Brasset, E., Meuleman, W., Faza, M.B., Talhout, W., Eussen, B.H., de Klein, A., Wessels, L., de Laat, W. et al. 2008. Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature 453(7197): 948-951. Hamiche, A., Sandaltzopoulos, R., Gdula, D.A., and Wu, C. 1999. ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF. Cell 97(7): 833-842.

240!

Gene Therapy and Molecular Biology Vol 13, page 241 Han, H.J., Russo, J., Kohwi, Y., and Kohwi-Shigematsu, T. 2008. SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis. Nature 452(7184): 187-193. Han, M. and Grunstein, M. 1988. Nucleosome loss activates yeast downstream promoters in vivo. Cell 55(6): 1137-1145. He, D.C., Nickerson, J.A., and Penman, S. 1990. Core filaments of the nuclear matrix. J Cell Biol 110(3): 569-580. Hendzel, M.J., Kruhlak, M.J., MacLean, N.A., Boisvert, F., Lever, M.A., and Bazett-Jones, D.P. 2001. Compartmentalization of regulatory proteins in the cell nucleus. J Steroid Biochem Mol Biol 76(1-5): 9-21. Heng, H.H., Goetze, S., Ye, C.J., Liu, G., Stevens, J.B., Bremer, S.W., Wykes, S.M., Bode, J., and Krawetz, S.A. 2004. Chromatin loops are selectively anchored using scaffold/matrixattachment regions. J Cell Sci 117(Pt 7): 999-1008. Imai, S., Nishibayashi, S., Takao, K., Tomifuji, M., Fujino, T., Hasegawa, M., and Takano, T. 1997. Dissociation of Oct-1 from the nuclear peripheral structure induces the cellular agingassociated collagenase gene expression. Mol Biol Cell 8(12): 2407-2419. Ishii, K., Hirano, Y., Araki, N., Oda, T., Kumeta, M., Takeyasu, K., Furukawa, K., and Horigome, T. 2008. Nuclear matrix contains novel WD-repeat and disordered-region-rich proteins. FEBS Lett. Jackson, D.A. 2005. The amazing complexity of transcription factories. Brief Funct Genomic Proteomic 4(2): 143-157. Jackson, D.A. and Cook, P.R. 1988. Visualization of a filamentous nucleoskeleton with a 23 nm axial repeat. Embo J 7(12): 36673677. Jackson, D.A., Dickinson, P., and Cook, P.R. 1990. The size of chromatin loops in HeLa cells. Embo J 9(2): 567-571. Jackson, D.A., McCready, S.J., and Cook, P.R. 1981. RNA is synthesized at the nuclear cage. Nature 292(5823): 552-555. Jackson, D.A., Yuan, J., and Cook, P.R. 1988. A gentle method for preparing cyto- and nucleo-skeletons and associated chromatin. J Cell Sci 90 ( Pt 3): 365-378. Javaherian, K., Liu, J.F., and Wang, J.C. 1978. Nonhistone proteins HMG1 and HMG2 change the DNA helical structure. Science 199(4335): 1345-1346. Jenuwein, T. and Allis, C.D. 2001. Translating the histone code. Science 293(5532): 1074-1080. Kalebic, T. 2003. Epigenetic changes: potential therapeutic targets. Ann N Y Acad Sci 983: 278-285. Kas, E. and Laemmli, U.K. 1992. In vivo topoisomerase II cleavage of the Drosophila histone and satellite III repeats: DNA sequence and structural characteristics. Embo J 11(2): 705-716. Kleinjan, D.A. and van Heyningen, V. 2005. Long-range control of gene expression: emerging mechanisms and disruption in disease. Am J Hum Genet 76(1): 8-32. Koina, E. and Piper, A. 2005. An inactive X specific replication origin associated with a matrix attachment region in the human X linked HPRT gene. J Cell Biochem 95(2): 391-402. Kornberg, R.D. 1974. Chromatin structure: a repeating unit of histones and DNA. Science 184(139): 868-871. Kramer, J.A., Zhang, S., Yaron, Y., Zhao, Y., and Krawetz, S.A. 1997. Genetic testing for male infertility: a postulated role for mutations in sperm nuclear matrix attachment regions. Genet Test 1(2): 125-129. Lalancette, C., Miller, D., Li, Y., and Krawetz, S.A. 2008. Paternal contributions: new functional insights for spermatozoal RNA. J Cell Biochem 104(5): 1570-1579. Langst, G., Bonte, E.J., Corona, D.F., and Becker, P.B. 1999. Nucleosome movement by CHRAC and ISWI without

disruption or trans-displacement of the histone octamer. Cell 97(7): 843-852. Lebkowski, J.S. and Laemmli, U.K. 1982a. Evidence for two levels of DNA folding in histone-depleted HeLa interphase nuclei. J Mol Biol 156(2): 309-324. -. 1982b. Non-histone proteins and long-range organization of HeLa interphase DNA. J Mol Biol 156(2): 325-344. Lee, D.C., Welton, K.L., Smith, E.D., and Kennedy, B.K. 2009. Atype nuclear lamins act as transcriptional repressors when targeted to promoters. Exp Cell Res 315(6): 996-1007. Lenartowski, R., Grzybowski, T., Miscicka-Sliwka, D., Wojciechowski, W., and Goc, A. 2003. The bovine tyrosine hydroxylase gene associates in vitro with the nuclear matrix by its first intron sequence. Acta Biochim Pol 50(3): 865-873. Lewis, C.D. and Laemmli, U.K. 1982. Higher order metaphase chromosome structure: evidence for metalloprotein interactions. Cell 29(1): 171-181. Linnemann, A.K. and Krawetz, S.A. 2009. Silencing by Nuclear Matrix Attachment Distinguishes Cell-type Specificity: Association with Increased Proliferation Capacity. Nucleic Acids Research 37(9): 2779-88. Linnemann, A.K., Platts, A.E., and Krawetz, S.A. 2009. Differential nuclear scaffold/matrix attachment marks expressed genes. Hum Mol Genet 18(4): 645-654. Lorch, Y., LaPointe, J.W., and Kornberg, R.D. 1987. Nucleosomes inhibit the initiation of transcription but allow chain elongation with the displacement of histones. Cell 49(2): 203-210. Lorch, Y., Zhang, M., and Kornberg, R.D. 1999. Histone octamer transfer by a chromatin-remodeling complex. Cell 96(3): 389392. Luderus, M.E., de Graaf, A., Mattia, E., den Blaauwen, J.L., Grande, M.A., de Jong, L., and van Driel, R. 1992. Binding of matrix attachment regions to lamin B1. Cell 70(6): 949-959. Luderus, M.E., van Steensel, B., Chong, L., Sibon, O.C., Cremers, F.F., and de Lange, T. 1996. Structure, subnuclear distribution, and nuclear matrix association of the mammalian telomeric complex. J Cell Biol 135(4): 867-881. Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389(6648): 251-260. Magdinier, F., Yusufzai, T.M., and Felsenfeld, G. 2004. Both CTCF-dependent and -independent insulators are found between the mouse T cell receptor alpha and Dad1 genes. J Biol Chem 279(24): 25381-25389. Mahy, N.L., Perry, P.E., and Bickmore, W.A. 2002. Gene density and transcription influence the localization of chromatin outside of chromosome territories detectable by FISH. J Cell Biol 159(5): 753-763. Marenduzzo, D., Faro-Trindade, I., and Cook, P.R. 2007. What are the molecular ties that maintain genomic loops? Trends Genet 23(3): 126-133. Marsden, M.P. and Laemmli, U.K. 1979. Metaphase chromosome structure: evidence for a radial loop model. Cell 17(4): 849-858. Martins, R.P. and Krawetz, S.A. 2007. Decondensing the protamine domain for transcription. Proc Natl Acad Sci U S A 104(20): 8340-8345. Mayer, R., Brero, A., von Hase, J., Schroeder, T., Cremer, T., and Dietzel, S. 2005. Common themes and cell type specific variations of higher order chromatin arrangements in the mouse. BMC Cell Biol 6: 44. McClintock, D., Gordon, L.B., and Djabali, K. 2006. HutchinsonGilford progeria mutant lamin A primarily targets human

241!

Linnemann and Krawetz: Nuclear matrix in normal and disease states and higher order to chromatin structure vascular cells as detected by an anti-Lamin A G608G antibody. Proc Natl Acad Sci U S A 103(7): 2154-2159. McCready, S.J., Akrigg, A., and Cook, P.R. 1979. Electronmicroscopy of intact nuclear DNA from human cells. J Cell Sci 39: 53-62. Mirkovitch, J., Gasser, S.M., and Laemmli, U.K. 1988. Scaffold attachment of DNA loops in metaphase chromosomes. J Mol Biol 200(1): 101-109. Mirkovitch, J., Mirault, M.E., and Laemmli, U.K. 1984. Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold. Cell 39(1): 223-232. Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. 2004. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303(5656): 343-348. Munkel, C., Eils, R., Dietzel, S., Zink, D., Mehring, C., Wedemann, G., Cremer, T., and Langowski, J. 1999. Compartmentalization of interphase chromosomes observed in simulation and experiment. J Mol Biol 285(3): 1053-1065. Ong, M.S., Richmond, T.J., and Davey, C.A. 2007. DNA stretching and extreme kinking in the nucleosome core. J Mol Biol 368(4): 1067-1074. Osborne, C.S., Chakalova, L., Mitchell, J.A., Horton, A., Wood, A.L., Bolland, D.J., Corcoran, A.E., and Fraser, P. 2007. Myc dynamically and preferentially relocates to a transcription factory occupied by Igh. PLoS Biol 5(8): e192. Ostermeier, G.C., Liu, Z., Martins, R.P., Bharadwaj, R.R., Ellis, J., Draghici, S., and Krawetz, S.A. 2003. Nuclear matrix association of the human beta-globin locus utilizing a novel approach to quantitative real-time PCR. Nucleic Acids Res 31(12): 3257-3266. Paulson, J.R. and Laemmli, U.K. 1977. The structure of histonedepleted metaphase chromosomes. Cell 12(3): 817-828. Pederson, T. 2000. Half a century of "the nuclear matrix". Mol Biol Cell 11(3): 799-805. Petrov, A., Pirozhkova, I., Carnac, G., Laoudj, D., Lipinski, M., and Vassetzky, Y.S. 2006. Chromatin loop domain organization within the 4q35 locus in facioscapulohumeral dystrophy patients versus normal human myoblasts. Proc Natl Acad Sci U S A 103(18): 6982-6987. Pienta, K.J. and Coffey, D.S. 1984. A structural analysis of the role of the nuclear matrix and DNA loops in the organization of the nucleus and chromosome. J Cell Sci Suppl 1: 123-135. Platts, A.E., Quayle, A.K., and Krawetz, S.A. 2006. In-silico prediction and observations of nuclear matrix attachment. Cell Mol Biol Lett 11(2): 191-213. Purbowasito, W., Suda, C., Yokomine, T., Zubair, M., Sado, T., Tsutsui, K., and Sasaki, H. 2004. Large-scale identification and mapping of nuclear matrix-attachment regions in the distal imprinted domain of mouse chromosome 7. DNA Res 11(6): 391-407. Razin, S.V., Vassetzky, Y.S., and Hancock, R. 1991. Nuclear matrix attachment regions and topoisomerase II binding and reaction sites in the vicinity of a chicken DNA replication origin. Biochem Biophys Res Commun 177(1): 265-270. Reddy, K.L., Zullo, J.M., Bertolino, E., and Singh, H. 2008. Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature 452(7184): 243-247. Reinke, H. and Horz, W. 2003. Histones are first hyperacetylated and then lose contact with the activated PHO5 promoter. Mol Cell 11(6): 1599-1607. Renz, A. and Fackelmayer, F.O. 1996. Purification and molecular cloning of the scaffold attachment factor B (SAF-B), a novel

human nuclear protein that specifically binds to S/MAR-DNA. Nucleic Acids Res 24(5): 843-849. Richmond, T.J. and Davey, C.A. 2003. The structure of DNA in the nucleosome core. Nature 423(6936): 145-150. Robinson, P.J., Fairall, L., Huynh, V.A., and Rhodes, D. 2006. EM measurements define the dimensions of the "30-nm" chromatin fiber: evidence for a compact, interdigitated structure. Proc Natl Acad Sci U S A 103(17): 6506-6511. Romig, H., Fackelmayer, F.O., Renz, A., Ramsperger, U., and Richter, A. 1992. Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements. Embo J 11(9): 3431-3440. Sachs, R.K., van den Engh, G., Trask, B., Yokota, H., and Hearst, J.E. 1995. A random-walk/giant-loop model for interphase chromosomes. Proc Natl Acad Sci U S A 92(7): 2710-2714. Schoenlein, P.V., Barrett, J.T., and Welter, D. 1999. The degradation profile of extrachromosomal circular DNA during cisplatin-induced apoptosis is consistent with preferential cleavage at matrix attachment regions. Chromosoma 108(2): 121-131. Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang, J.P., and Widom, J. 2006. A genomic code for nucleosome positioning. Nature 442(7104): 772-778. Shaman, J.A., Yamauchi, Y., and Ward, W.S. 2007. The sperm nuclear matrix is required for paternal DNA replication. J Cell Biochem 102(3): 680-688. Shen, X., Yu, L., Weir, J.W., and Gorovsky, M.A. 1995. Linker histones are not essential and affect chromatin condensation in vivo. Cell 82(1): 47-56. Sjakste, N. and Sjakste, T. 2005. Nuclear matrix proteins and hereditary diseases. Genetika 41(3): 293-298. Smith, M.F., Athey, B.D., Williams, S.P., and Langmore, J.P. 1990. Radial density distribution of chromatin: evidence that chromatin fibers have solid centers. J Cell Biol 110(2): 245-254. Tanabe, H., Muller, S., Neusser, M., von Hase, J., Calcagno, E., Cremer, M., Solovei, I., Cremer, C., and Cremer, T. 2002. Evolutionary conservation of chromosome territory arrangements in cell nuclei from higher primates. Proc Natl Acad Sci U S A 99(7): 4424-4429. Tang, C.W., Maya-Mendoza, A., Martin, C., Zeng, K., Chen, S., Feret, D., Wilson, S.A., and Jackson, D.A. 2008. The integrity of a lamin-B1-dependent nucleoskeleton is a fundamental determinant of RNA synthesis in human cells. J Cell Sci 121(Pt 7): 1014-1024. Taylor, M.R., Fain, P.R., Sinagra, G., Robinson, M.L., Robertson, A.D., Carniel, E., Di Lenarda, A., Bohlmeyer, T.J., Ferguson, D.A., Brodsky, G.L. et al. 2003. Natural history of dilated cardiomyopathy due to lamin A/C gene mutations. J Am Coll Cardiol 41(5): 771-780. Tolhuis, B., Palstra, R.J., Splinter, E., Grosveld, F., and de Laat, W. 2002. Looping and interaction between hypersensitive sites in the active beta-globin locus. Mol Cell 10(6): 1453-1465. Tolstonog, G.V., Sabasch, M., and Traub, P. 2002. Cytoplasmic intermediate filaments are stably associated with nuclear matrices and potentially modulate their DNA-binding function. DNA Cell Biol 21(3): 213-239. Tremethick, D.J. 2007. Higher-order structures of chromatin: the elusive 30 nm fiber. Cell 128(4): 651-654. Tsai, C.L., Rowntree, R.K., Cohen, D.E., and Lee, J.T. 2008. Higher order chromatin structure at the X-inactivation center via looping DNA. Dev Biol 319(2): 416-425.

242!

Gene Therapy and Molecular Biology Vol 13, page 243 Valouev, A., Ichikawa, J., Tonthat, T., Stuart, J., Ranade, S., Peckham, H., Zeng, K., Malek, J.A., Costa, G., McKernan, K. et al. 2008. A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning. Genome Res. Vogelstein, B., Pardoll, D.M., Coffey, D.S. 1980. Supercoiled loops and eukaryotic DNA replication. Cell 22(1): 79-85. Volpi, E.V., Chevret, E., Jones, T., Vatcheva, R., Williamson, J., Beck, S., Campbell, R.D., Goldsworthy, M., Powis, S.H., Ragoussis, J. et al. 2000. Large-scale chromatin organization of the major histocompatibility complex and other regions of human chromosome 6 and its response to interferon in interphase nuclei. J Cell Sci 113 ( Pt 9): 1565-1576. Wan, K.M., Nickerson, J.A., Krockmalnic, G., and Penman, S. 1999. The nuclear matrix prepared by amine modification. Proc Natl Acad Sci U S A 96(3): 933-938. Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Peng, W., Zhang, M.Q. et al. 2008. Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40(7): 897-903. Wasylyk, B., Thevenin, G., Oudet, P., and Chambon, P. 1979. Transcription of in vitro assembled chromatin by Escherichia coli RNA polymerase. J Mol Biol 128(3): 411-440. Whitehouse, I., Flaus, A., Cairns, B.R., White, M.F., Workman, J.L., and Owen-Hughes, T. 1999. Nucleosome mobilization catalysed by the yeast SWI/SNF complex. Nature 400(6746): 784-787. Williams, S.P., Athey, B.D., Muglia, L.J., Schappe, R.S., Gough, A.H., and Langmore, J.P. 1986. Chromatin fibers are lefthanded double helices with diameter and mass per unit length that depend on linker length. Biophys J 49(1): 233-248. Wong, A.H., Gottesman, II, and Petronis, A. 2005. Phenotypic differences in genetically identical organisms: the epigenetic perspective. Hum Mol Genet 14 Spec No 1: R11-18.

Wong, B., Chen, S., Kwon, J.A., and Rich, A. 2007. Characterization of Z-DNA as a nucleosome-boundary element in yeast Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 104(7): 2229-2234. Woodcock, C.L., Frado, L.L., and Rattner, J.B. 1984. The higherorder structure of chromatin: evidence for a helical ribbon arrangement. J Cell Biol 99(1 Pt 1): 42-52. Worcel, A., Strogatz, S., and Riley, D. 1981. Structure of chromatin and the linking number of DNA. Proc Natl Acad Sci U S A 78(3): 1461-1465. Wu, C., Bassett, A., and Travers, A. 2007. A variable topology for the 30-nm chromatin fibre. EMBO Rep 8(12): 1129-1134. Yamamura, J. and Nomura, K. 2001. Analysis of sequencedependent curvature in matrix attachment regions. FEBS Lett 489(2-3): 166-170. Yan, Z.J. and Qian, R.L. 1998. The 5'-flanking cis-acting elements of the human epsilon-globin gene associates with the nuclear matrix and binds to the nuclear matrix proteins. Cell Res 8(3): 209-218. Yaneva, J., Schroth, G.P., van Holde, K.E., and Zlatanova, J. 1995. High-affinity binding sites for histone H1 in plasmid DNA. Proc Natl Acad Sci U S A 92(15): 7060-7064. Yang, X., Zaurin, R., Beato, M., and Peterson, C.L. 2007. Swi3p controls SWI/SNF assembly and ATP-dependent H2A-H2B displacement. Nat Struct Mol Biol 14(6): 540-547. Yusufzai, T.M. and Felsenfeld, G. 2004. The 5'-HS4 chicken betaglobin insulator is a CTCF-dependent nuclear matrix-associated element. Proc Natl Acad Sci U S A 101(23): 8620-8624. Zaidi, S.K., Sullivan, A.J., van Wijnen, A.J., Stein, J.L., Stein, G.S., and Lian, J.B. 2002. Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites. Proc Natl Acad Sci U S A 99(12): 8048-8053. Zbarskii, I.B. and Debov, S.S. 1951. [Protein fractions in the cell nuclei.]. Biokhimiia 16(5): 390-395.

The Krawetz Laboratory: Front row from left to right, Amelia Linnemann, Kathryn Drennan, Claudia Lalancette, Back row from left to right, Robert Goodrich, Adrian Platts, Stephen A. Krawetz, Seema Mahadev, Graham Johnson !

243!

Lu et al: Study of immune response against, and TGFß1 effect on secondary adenoviral vector administration Gene Ther Mol Biol Vol 13, 244-253, 2009

Suppression of adenoviral-induced host immune response by TGFß1 expression Research Article

Yi Lu1,2,*, Ying Wang2, Guimin Chang2 1

Department of Pathology and Laboratory Medicine Department of Urology, University of Tennessee Health Science Center, Memphis, TN _________________________________________________________________________________________________ 2

*Correspondence: Yi Lu, Ph.D. Department of Pathology and Laboratory Medicine, University of Tennessee Health Science Center, Cancer Research Building, Room 218, 19 South Manassas Street, Memphis, TN 38163, USA; Telephone: (901) 448-5436; Fax: (901) 448-5496; e-mail: ylu@utmem.edu Key words: TGFß1, immune response, adenovirus, intratumoral injection, intravenous injection, neutralizing anti-Ad antibody Abbreviations: Ad, adenovirus; ELISA, standard enzyme-linked immunosorbent assay; i.t., intratumoral; i.v., intravenous; lacZ, ßgalactosidase; moi, multiplicity of infection; pfu, plaque forming units; s.c., subcutaneously; TGFß1, transforming growth factor ! 1; Xgal, ß-galactosidase substrate:5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside Received: 1 June 2009; Revised 26 June 2009 Accepted 29 June 2009; Electronically published July 2009

Summary Adenoviral vector (Ad) is the most commonly used viral vector in gene therapy because of its high transduction efficiency. However, Ad has its limitation due to its transient gene expression and reduced efficacy of repeated vector administration, thanks to host cellular and humoral immune responses. Although it is well known that Ad causes immune response to secondary Ad administration and thus hampers the repeated Ad-mediated gene transfer, the systemic comparison between different viral delivery routes and the optimal elapsed time between repetitive viral deliveries has yet to be extensively studied. In this study, in order to determine (i) to what extent the host immune system attenuates the function of the secondary-administrated Ad; and (ii) whether transforming growth factor-! 1 (TGFß1), an immune suppressor, would reduce this immune response, immune-competent C57BL/6 mice carrying subcutaneous prostate tumors were administrated by either intratumoral (i.t.) or intravenous (i.v.) injection of primary Ad (namely, the 1st viral administration: with either Ad expressing tumor suppressor gene p16, AdRSVp16, or Ad expressing reporter gene ß-galactosidase, AdRSVlacZ), then followed by i.t. injection of secondary Ad (AdRSVlacZ) in the presence or absence of co-delivery of Ad expressing TGFß1 (AdRSVTGFß1). Sera were purified from blood samples collected at various time points. Anti-adenoviral (anti-Ad) antibody in serum and its neutralizing ability to secondary Ad infection were evaluated. No immune response was observed in mice within 3 days after fisrt viral injection regardless of i.t. or i.v. injection. After 7 days, mice by i.v. viral injection developed a strong immune response and this immune potency was increased over the time up to 8 weeks. In contrast, mice by i.t. viral injection had only a minor immune response at day 7, and this response waned in 14 days after viral injection. The immune response was mainly caused by native Ad proteins rather than by transgenes. Moreover, expression of TGFß1 by co-delivery of AdRSVTGFß1 with secondary AdRSVlacZ reduced anti-Ad antibody in sera and prolonged transgene lacZ expression. These results suggest that repeated administration of therapeutic Ad for solid-tumor (such as gene therapy for prostate cancer) by directly i.t. injection with reasonable intervals may provide a rational approach in a clinical setting. The addition of immune suppressor like TGFß1 may be useful to minimize the immune response to the secondary Ad challenge. These results suggest that with reasonable and justified intervals between repeated viral administration, plus the aid of immune response suppressor, local delivery of Ad vector for solid tumor gene therapy should be efficacious with no or minimal immune response.

widely used gene transfer vehicle in gene therapy clinical trials so far because of the following reasons: (1) Ad can be easily rendered replication deficient by deletion of critical viral replication gene such as E1 (Haj-Ahmad and Graham, 1986). (2) Ad can transfer and express therapeutic genes efficiently into a wide variety of

I. Introduction Human adenoviruses (Ad) are nonenveloped DNA viruses. There are close to 50 serotypes of Ad that have been identified, but only Ad serotypes 5 and 2 have been tested extensively in strategies for gene therapy (Berkner 1988; Graham and Prevec, 1991). Ad represents the most 244

Gene Therapy and Molecular Biology Vol 13, page 245 dividing and non-dividing cells in vivo (Bett et al, 1994; Bett et al, 1993; Graham, 1990). (3) Ad has a relatively large carrying capacity for one or more therapeutic transgenes (Bett et al., 1993). (4) Ad can be grown to high titers and purified with relative ease (Graham and Prevec, 1991). However, Ad does not integrate its genome into the chromosomes of the host cells (Graham and Prevec, 1992), thus, Ad-mediated gene expression is transient and repetitive administration of the Ad may be required for effective expression of the therapeutic gene and treatment of diseases (Korst et al, 1995; Rosenfeld et al, 1992; Walter and High, 1997; Lu 2001). The consequence of this approach is that the secondary (and the thereafter repeated viral administration) Ad-mediated gene transfer is significantly hampered. Because Ad is highly immunogenic (Yang et al, 1994), the development of Adspecific neutralizing antibodies (i.e., anti-Ad antibody or neutralizing anti-Ad antibody) following primary administration by host immune system has a big immunological limitation for the repeated administration of the Ad (Yang et al, 1996a). Studies showed that delivery of Ad to immune-competent mice by intravenous (i.v.) (Barr et al, 1995), interperitoneal (Yang et al, 1996b), intratrachael (Bout et al, 1994), or via direct injection into the pancreas (McClane et al, 1997) resulted in the production of neutralizing antibodies and a block to repeated Ad administration. Several strategies have been developed in attempt to overcome this problem, including modification of Ad to decrease its immunogenicity and modulating host immune responses. Modification of the Ad capsid or genome is an alternative approach that may enable circumvention of the humoral immune response against the vector (Krasnykh et al, 1996). Expression of the Ad E3 region in the Gunn rats reduced their anti-Ad humoral immune response and enabled successful repeated administration of the Ad vector (Ilan et al, 1997). Efforts have also been made to suppress host immune system when repeated Ad administration is desired. For example, partial immune ablation using cytokines or CTLA4Ig leads to persistent Ad-mediated gene expression in mouse lung and liver (Kay et al, 1995; Kay et al, 1997). Certain chemotherapy agents commonly used to treat cancer patients can suppress the host immune responses to Ad and enable repeated Ad-mediated cancer gene therapy. For example, etoposide (Bouvet et al, 1998) and cyclophosphamide (Jooss et al, 1996) have the abilities to suppress the host humoral and cellular immune responses to Ad in immune competent mice. TGFß1 is a most important immunoregulatory cytokine (Rubtsov and Rudensky, 2007). It has an immune suppressive effect in general (Li et al, 2006) and dampens the susceptibility of dendritic cells to environmental stimulation (Ohtani et al, 2009); but its role in the regulation of T or B cell responses remains perplexing, probably due to its dependence on the type of T or B cells being regulated and their cytokine microenvironment (Banu and Meyers, 1999; Prud’homme and Piccirillo, 2000). Although TGFß1 was reported to be able to suppress the immune response induced by virus (Lu et al, 1999a; Reinhold et al, 1999), no study has been done by systemic comparison for TGFß1 suppression of

the immune response specifically induced by Ad via i.t. and i.v. administration in a time-course manner. In this study, the immune response to Ad in immunecompetent mice by different administrations (i.t or i.v.), repeated viral administration, and the effect of TGFß1 on attenuation of this immune response were systemically evaluated. More specifically, this study has compared immune responses against secondary Ad challenge from both i.t. and i.v. administration of primary Ad, respectively. The best administration route and optimal elapsed time to achieve the repeated Ad administration with the minimal immune response was provided. In addition, the effect of TGFß1 on suppression of anti-Ad antibody and sustaining of transgene in secondary Ad challenge was also evaluated.

II. Materials and methods A. Cell culture and medium Human prostate cancer cell line PPC-1 (ATCC, Rockville, MD) were grown in PRMI 1640 medium (Cellgro, Herndon, VA) with 10% Fetal bovine serum (FBS) (Hyclone Laboratories, Logan, UT). Mouse prostate tumor cell line TRAMP-C2, which was derived from a primary tumor in the prostate of the transgenic adenocarcinoma mouse prostate (TRAMP) model (Greenberg et al., 1995), was a generous gift from Dr. N. Greenberg (Baylor College of Medicine, Houston, TX). TRAMP-C2 cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco BRL, Gaithersburg, MD) with 10% FBS. Human embryonic kidney 293 cells was grown in DMEM with 10% heat inactivated FBS. All cultures were grown in medium with 100 units/ml penicillin, 100 µg/ml streptomycin (Gibco BRL) at 37 0C in 5% CO2.

B. Construction of recombinant adenoviral vectors Constructions of AdRSVlacZ (Lu et al., 1999b) and AdRSVp16 (Steiner et al, 2000) were described before. By the similar way, AdRSVTGFß1 has been generated in which TGFß1 cDNA gene is under the control of a Rous sarcoma virus (RSV) promoter and the inserted TGFß1 gene has been modified so the resultant TGFß1 protein product is an active form (Pierce et al, 1993). In addition, a control Ad carrying an unrelated gene coding for a cytochrome p450-2C9 enzyme (AdRSV2C9) was also generated. Each recombinant Ad was propagated in 293 cells and purified by twice CsCl2 gradient ultracentrifugation. The viral titration was performed as described before (Graham and Prevec, 1991). Viral transduction was performed at various moi in a volume of 1ml culture medium and incubated at 37 °C with gentle mixing every 15 min. After 90 min incubation, the infectious supernatant was then replaced with fresh medium.

C. Viral delivery routes and repeated Ad administration TRAMP-C2 prostate cancer cells (5x106) were subcutaneously (s.c.) injected into the flank of the syngeneic C57BL/6 mice (Harlan Sprague-Dawley, Indianapolis, ID). When the tumors reached the volume of about 50 mm3, the mice were injected with 1x109 plaque forming units (pfu) indicated recombinant Ad (AdRSVp16 or AdRSVlacZ) by either i.v. or i.t injection. In the Ad re-dosing (repeated viral administration) experiment, 7 days after the 1st i.t. viral administration (or 14 days after the 1st i.v. viral administration), the mice were injected with 2nd dose of indicated Ad (1x109 pfu AdRSVp16 or AdRSVlacZ) either by i.v. or i.t. route. In some experiments, the

245

Lu et al: Study of immune response against, and TGFß1 effect on secondary adenoviral vector administration allograft tumors. When tumors developed to about 50 mm3 size, the mice were injected (day 0) by either i.v. or i.t. with 1x109 plaque forming units (pfu) AdRSVp16, respectively. At day 3, 7, 10, 14 and 17, the blood was collected and the purified serum was used for the anti-Ad antibody ELISA assay for measuring the anti-Ad antibody titer. As shown in Figure 1, there was a minimal immune response observed within 72 hours after the first viral injection regardless of i.v. or i.t. injection. The difference between the two delivery route started to appear after one week, when i.v. injection induced a stronger immune response as reflected by the increased anti-Ad antibody in the serum (the higher OD450 value) than i.t. injection. The Ad-induced immune response by i.v. injection kept increasing over time; in contrast, the immune response induced by i.t. injection was lagging and it reached the plateau at around day 10 before starting to wane at two week after viral injection (Figure 1). These results indicated that Ad induced a lasting and significantly higher immune response by i.v. injection than by i.t. injection; the latter only caused a mild, flat and transient immune response.

2nd dose of Ad also contained 1x109 pfu AdRSVTGFß1. At indicated days prior or after Ad administration, the blood was collected from mice and the serum was purified as described below.

D. Mouse blood collection and serum purification The blood samples were collected from mice by retroorbital bleeding puncture at indicated days either prior to or after Ad administration. A sufficient large number of mice were used so no single mouse would be subjected to draw blood more than once in every two-week period. The serum was purified from blood by placing blood samples at room temperature for 3 hr and followed by centrifuging at 5,000 rpm for 4 min. The serum was carefully transferred to a clean tube from the blood clot and kept frozen at –700C until use.

E. ELISA assay for measuring anti-Ad antibody The anti-Ad antibody in mouse serum was measured by standard enzyme-linked immunosorbent assay (ELISA). AdRSVlacZ (1x106 pfu per well in 50 µl of 0.05 M sodium carbonate buffer, pH 9.6) was coated onto 96-well plates overnight at 40C. After washing, the wells were blocked in 1%BSA in PBS overnight at 40C. The following day a serial of diluted serum samples (100 µl/well) were added to the wells and incubated for 4 hr at 370C. After washing, goat anti-mouse IgG conjugated with horseradish peroxidase (Promega, Madison, WI) was added and incubated for 2 hr at 370C. Substrate, 3, 3’, 5, 5’– tetramethylbenzidine (Promega) was added and incubated for 10 min at room temperature. The reaction was stopped by 1M H2SO4 and absorbance at 450 nm (OD450) was measured.

B. The Ad-induced immune response is mainly caused by adenoviral proteins rather than by therapeutic genes To analyze whether the recombinant AdRSVp16induced immune response was mainly caused by Ad genomic proteins or by the transgene p16, we replaced AdRSVp16 with another Ad, AdRSVlacZ, for the same i.t. experiment. AdRSVlacZ shares the exactly same Ad genome framework as AdRSVp16 except that it carries a different transgene. With the same dose of either AdRSVp16 or AdRSVlacZ by i.t. injection, a similar level and time-course pattern of immune response were observed between these two Ads: As representatively shown in Figure 2, at both day 3 and 7 after the viral administration, AdRSVp16 and AdRSVlacZ caused similar levels of anti-Ad antibody in sera. This result indicates that the Ad-induced immune response is mainly caused by the native Ad proteins.

F. Assay for measuring effect of neutralizing anti-Ad antibody on block of the secondary Ad infection To detect neutralizing anti-Ad antibody in the serum and its blocking effect on the secondary Ad infection, PPC-1 cells (2x104/per well) were plated in 96-well plate and incubated overnight. The mouse serum purified as described above was diluted in a series of concentration from 1/4 to 1/2048 in culture medium. The dilutions were incubated with AdRSVlacZ at 370C for 1 hr. The mixture was used to infect PPC-1 cells in 96-well for 90 min at 370C at multiplicity of infection (moi) of 5. After replacing with the fresh medium, the cells were incubated at 370C for 48 hr. The cells were fixed for 5 min at 40C in 2% (v/v) formaldehyde and 0.2% (v/v) glutaraldehyde in PBS and rinsed three times with PBS. The staining reaction was performed on cells by incubating overnight at 370C in 1mg/ml X-gal (Gibco BRL), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, and 2 mM MgCl2 in PBS. The concentrations of serum dilution were recorded that gave 50% blue cells as compared to control cells that used pure AdRSVlacZ.

C. Blocking effect of neutralizing anti-Ad antibody on 2nd Ad infection To correlate the anti-Ad antibody titer (Ad-induced immune response) with the actual inhibition of the repeated Ad administration, we performed neutralizing anti-Ad antibody assay that measured the blocking effect of anti-Ad antibody in serum on the secondary Ad infection. Immune competent mice were first inoculated with TRAMP-C2 cells to establish s.c. allograft prostate tumor. When the tumors reached the volume of about 50 mm3, the first two groups of mice were i.t. injected with 1x109 pfu AdRSVlacZ and AdRSVp16 per tumor, respectively; the third group of mice were i.v. injected into the tail vein with 1x109 pfu AdRSVp16. At the day prior to Ad administration and at day 3, 7, 14, 28, and 56 after Ad administration, respectively, the blood samples were collected from mice and the sera were purified as described above. This assay (Table 1) showed that i.v.

III. Results A. Ad-induced immune response varies with route of viral administration To examine and compare the immune response induced by Ad of different delivery routes and the immunological tolerance by tumor itself, the kinetics (i.e., the process of the production) of anti-Ad antibody produced in mouse serum was analyzed. The immunecompetent mice were inoculated subcutaneously (s.c.) with prostate cancer TRAMP-C2 cells first to establish

246

Gene Therapy and Molecular Biology Vol 13, page 247 was between 1:4-1:8 and 1:8-1:16 dilution (3rd row, 1 week, Table 1). This inhibitory ability waned in two weeks after viral administration and thereafter. These results indicated, by comparing to those from i.v. injection, that i.t. injection gave much lower titer of neutralizing anti-Ad antibody and mild immune response to interfere with the function of the 2nd (repeated) administrated Ad. Also noticeably, the titer of neutralizing anti-Ad antibody is not associated with which kind of transgene (i.e., p16 or LacZ) it is, as both AdRSVp16 and AdRSVlacZ gave similar range of titer (Table 1); therefore, these results again demonstrated that Adinduced immune response is mainly caused by Ad proteins rather than by transgenes. Together with data from Figure 1 and Table 1 which also suggests that tumor tissue itself may develop immunological tolerance, these combined results suggest that directly intratumoral injection (i.e., intraprostatic injection in a clinical setting) of Ad at a reasonable interval (i.e. after every 10-14 days) should be considered as a rational approach of local delivery of viral vectors for cancer gene therapy.

injection caused significantly stronger immune response compared with that of i.t. injection. For example, the levels of neutralizing anti-Ad antibody that was able to inhibit the function of the 2nd Ad (as presented by 2nd AdRSVlacZ infection on PPC-1 cells --- the intensity of blue cells after X-gal staining) from serum on day 14 after i.v. injection is more than 16-fold higher (1/64 dilution vs 1/4 dilution, the row of 2 weeks, Table 1) than its counterpart of i.t. injection, demonstrating the presence of a much higher titer of neutralizing anti-Ad antibody in the serum of mice administrated by i.v. viral injection. Also as shown in Table 1, the titer of neutralizing anti-Ad antibody by i.v. injection that gave 50% inhibition on the 2nd Ad infection was about 1:32-1:64 dilution at one week after administration. Then, it kept increasing over time up to 8 weeks after viral administration, reaching 1:516 dilution (the more diluted serum, the higher potency of its anti-Ad neutralizing ability). In contrast, for all the groups administrated by i.t. route, all the counterpart titers were low, even the most concentrated dilution (1:4 dilution) gave no or much less inhibition on 2nd AdRSVlacZ infection on PPC-1 cells. The only detectable “peak” that was able to inhibit 50% of the 2nd Ad infection

Table 1: Fold of dilutions of Ad neutralized antibody from the first adenoviral infection that gave 50% inhibition of the secondary AdRSVlacZ infection Route of first adenoviral administration Time of serum collection intravenous (i.v.) injection intratumoral (i.t.) injection intratumoral (i.t.) injection before and after the 1st viral of AdRSVp16 of AdRSVlacZ of AdRSVp16 infection Pre-immune none* none none 72 hours >1/4*** >1/4 >1/4 1 weeks 1/32 – 1/64** 1/4 – 1/8 1/8 – 1/16 2 weeks 1/64 >1/4 1/4 4 weeks 1/64 – 1/128 >1/4 >1/4 8 weeks 1/516 >1/4 >1/4 Immuno-competent BL57/c mice were inoculated with mouse prostate cancer cell line Tramp C2 (5!106 cells/per mouse) to establish the subcutaneous tumors. When tumor became 50 mm3 in size, 1!109 pfu adenovirus (AdRSVp16 or AdRSVlacZ, the first viral infection) was injected either intravenously (i.v.) or intratumorally (i.t.) to each mouse. The blood samples were collected before (pre-immune) and after (at 72 h, 1, 2, 4, 8 weeks) adenovirus administration. Serial dilutions of the serum purified from blood were preincubated with AdRSVlacZ at 370C for 1 h, then the treated adenoviral vectors (AdRSVlacZ) were used to transduce human prostate cancer cell line PPC-1 (at moi=5) in 96-well plate. The PPC1 cells were fixed and stained with X-gal 48 h post AdRSVlacZ transduction (i.e., secondary infection) and the blue cells were counted under light microscope. [The lower dilution (i.e., 1/516), the higher potency of the neutralized antibody to inhibit the 2nd Ad infection]. *All pre-immune sera had no inhibition for the secondary AdRSVlacZ infection (shown as none), that is, serum without any dilution still gave no inhibition of the secondary AdRSVlacZ’s infection on PPC-1 cells. **The fold dilution of mouse serum (Ad neutralized antibody) that gave 50% inhibition to the secondary Ad infection (AdRSVlacZ on PPC-1 cells) is indicated. For example, 1/32 means a serum dilution of 1:32. The 50% inhibition was determined by comparing each well for the positively stained blue cells to the control PPC-1 cell wells that were transduced with untreated AdRSVlacZ (i.e., the AdRSVlacZ without serum). ***Any dilution more concentrated than 1:4 fold dilution (i.e., >1/4) is considered to contain no or minimal anti-Ad neutralized antibody.

247

Lu et al: Study of immune response against, and TGFß1 effect on secondary adenoviral vector administration

D. Anti-Ad antibody titer and TGFß1 effect on anti-Ad antibody production in the repeated Ad administration Because it was reported that 2nd administrated Ad is eliminated by the host mainly because of the existing neutralizing anti-Ad antibody (47), it was important for us to examine the existence and extent of anti-Ad antibodies after viral re-dosing, which directly correlates to the immune response induced by the 2nd Ad administration. We were also interested in examining whether TGFß1 has a suppression effect on host immune response towards the 2nd administrated Ad. To accomplish these goals, immune competent mice were administrated with the 1st Ad and then re-dosed with 2nd Ad (AdRSVlacZ) with and without AdRSVTGFß1, a recombinant Ad expressing an active form of TGFß1 protein. To determine the kinetic immunological responses after repeated Ad administration, we first examined the time-course immune response from mice that had been injected with Ad by i.t. route on both 1st and 2nd viral administration. C57BL/6 mice were immunized by i.t. injection of 1x109 pfu AdRSVp16 first, one week later, a 2nd dose of (repeated administration or re-dosing) i.t. Ad administration was performed (day 0) by either using 1x109 pfu AdRSVlacZ alone, or 1x109 pfu each of AdRSVlacZ and AdTGFß1, or 1x109 pfu each of AdRSVlacZ and AdRSV2C9 (a control Ad carrying an unrelated cDNA transgene). On day 3, 7, 10, 17 and 24 after the 2nd viral administration, sera were purified from blood and the levels of anti-Ad antibody were evaluated by ELISA assay. As shown in Figure 3, even with AdRSVlacZ alone as a 2nd viral administration by i.t. route, the levels of anti-Ad antibody after the 2nd Ad administration were significantly higher and more persistent than that induced by the 1st Ad administration by i.t. route [compare the OD450 values of the solid line (AdRSVlacZ alone) in Figure 3 with i.t. route in Figure 1, demonstrating that the repeated Ad administration, even by i.t. route, caused a high level of anti-Ad antibody; and consequently, this resulted in a higher immunologic response. Moreover, although all three groups showed elevated levels of anti-Ad antibody in serum over the time after the 2nd Ad administration, the group containing AdRSVTGFß1 had a significantly lower level of anti-Ad antibody compared to the other two groups without AdRSVTGFß1. For example, on day 17 after Ad redosing, the level of anti-Ad antibody (OD450 value) in the group with co-administration of AdRSVlacZ and AdTGFß1 is only 50% of the group with co-administration of AdRSVlacZ and AdRSV2C9, and about 56% of the group with AdRSVlacZ alone (Figure 3), suggesting that TGFß1 is able to suppress the production of anti-Ad antibody. To demonstrate that the TGFß1-mediated reduction of anti-Ad antibody production is a general phenomenon rather than specific to certain dilution of sera for the ELISA assay (such as 1:32 dilution we used in the assay of Figure 3), we randomly selected a time point (day 10), made a series of sera dilution on day 10’s sample, and then performed anti-Ad antibody ELISA assay for each dilution. As shown in Figure 4, all sera dilutions consistently demonstrated that TGFß1 expression

Figure 1: Kinetics of anti-Ad antibodies in serum. Immunecompetent mice C57BL/6 were s.c. inoculated with prostate cancer cell line TRAMP-C2 (5!106 cells/per mouse) to establish the allograft tumors. When tumors became 50 mm3 in size, 1!109 pfu AdRSVp16 were injected by either i.v. or i.t. route into each mouse (n=5 in each group), respectively. At the indicated times after viral administration, blood was collected and the serum was purified. The levels of anti-Ad antibody in serum were measured using anti-Ad antibody ELISA assay as described in M&M section. The OD450 values shown here are from serum dilution 1:32.

Figure 2: Comparison of anti-adenovirus antibodies in serum induced by different transgenes. Immune-competent mice C57BL/6 were inoculated with TRAMP-C2 cells (5!106 cells/per mouse) to establish the subcutaneous tumors. When tumors became 50 mm3 in size, 1!109 pfu of AdRSVlacZ or AdRSVp16 was i.t. injected to each mouse (n=5 in each group), respectively. At the indicated times after viral administration, blood was collected and the serum was purified. The levels of antiadenovirus antibodies in serum were measured using anti-Ad ELISA assay. The OD450 values shown here are from serum dilution 1:32. The differences between AdRSVlacZ and AdRSVp16 groups at both day 3 and 7, respectively, are statistically insignificant (P>0.05).

248

Gene Therapy and Molecular Biology Vol 13, page 249 1x109 pfu each of AdRSVlacZ and AdTGFß1, or 1x109 pfu each of AdRSVlacZ and AdRSV2C9, respectively. All immunized mice in the latter group died 3 days after 2nd i.v. Ad administration, indicating a stronger immune response that caused the death of the mice. In contrast, all mice i.v. injected with 2nd dose of Ad in the presence of AdRSVTGFß1 (i.e., AdRSVlacZ plus AdRSVTGFß1) survived for the entire experimental process. On day 3, 7, 10, 17 and 24 after the 2nd viral administration, blood samples were collected from this survived mouse group and sera were purified, and the levels of anti-Ad antibody were evaluated by ELISA assay. As expected, the level of neutralizing anti-Ad antibody was high after the 2nd i.v. viral administration (Figure 5). These results demonstrate that TGFß1 can partially suppress the production of neutralizing anti-Ad antibody primed by i.v. Ad re-dosing, while preventing the severe immunological-response consequences. While it is difficulty to tell whether TGFß1 has more suppressive effect on immune response by i.t. route versus i.v. route after repeated Ad administration (as all mice in two consecutive i.v. Ad administration in the absence of TGFß1 died so comparison cannot be made between groups with and without TGFß1 presence), it appears practical to apply repeated Ad administration by i.t. route, as even both in the presence of TGFß1, the immune response elicited by i.t. route was significantly lower that that by i.v. route (Figure 5). These results suggest that TGFß1 may be useful as an immune suppressive agent in repeated administration of Ad by i.t. route.

reduced levels of neutralizing anti-Ad antibody after the 2nd i.t. Ad administration. Therefore, it is appropriate and representative to show ELISA assay results at 1:32 sera dilution. In addition, the level of lacZ transgene expression, as examined by X-gal staining of the tumor sections on day 7 after the 2nd viral administration, was stronger in mice with co-administrtaion of AdRSVlacZ and AdTGFß1 than that with co-administration of AdRSVlacZ and AdRSV2C9 (not shown). Thus, expression of TGFß1 is useful for attenuating neutralizing anti-Ad antibody and enhancing the effect of the 2nd therapeutic Ad for repeated viral administration.

Figure 3: Immune response of mice to repeated i.t. viral administration in the presence and absence of TGFß1. Immune-competent mice C57BL/6 were inoculated with TRAMP-C2 cells (5!106 cells/per mouse) to establish the subcutaneous tumors. When tumors became 50 mm3 in size, all the mice were i.t. injected with 1!109 pfu AdRSVp16. Seven days after the 1st viral administration, the mice were divided into three groups (n=5 for each group): group 1 mice were i.t. injected with 1!109 pfu AdRSVlacZ alone to each mouse; group 2 mice were i.t. injected with 1!109 pfu each of AdRSVlacZ and AdRSVTGFß1; group 3 mice were i.t. injected with 1!109 pfu each of AdRSVlacZ and AdRSV2C9, an adenovirus expressing an unrelated gene product cytochrome P450-2C9 (as a control in the absence of AdRSVTGFß1). At the indicated times after the 2nd viral administration, serum were collected. The levels of anti-Ad antibody in serum of these mouse groups were measured using anti-Ad antibody ELISA assay. The OD450 values shown here are from serum dilution 1:32 from each day. *The differences between the group with co-administration of AdRSVlacZ plus AdRSVTGFß1, and the other two groups, respectively, are statistically significant (P<0.05).

Figure 4: Effect of TGFß1 on suppression of anti-Ad antibody production in i.t. Ad delivery route. Blood samples were collected and sera were purified from the three mouse groups as described above in Figure 3 legend. The levels of antiAd antibody in serum collected were measured using anti-Ad antibody ELISA assay. The representative anti-Ad antibody titer (serum dilution) is shown for the day 10 after the 2nd i.t. viral administration. In brief, the sera were diluted in D-MEM medium in two-fold steps starting from 1:8 dilutions, these dilutions were then applied to AdRSVlacZ-coated 96-well plates, and the plates were incubated at 40C overnight. The OD450 values for each serum dilution were measured following standard antiAd antibody ELISA assay.

E. Suppression of Ad-induced immune response by TGFß1 in repeated Ad administration To determine the immunological responses after repeated Ad administration by both i.v. route, C57BL/6 mice were immunized by i.v. injection of 1x109 pfu AdRSVp16 first, two weeks later, a 2nd dose i.v. administration was performed (day 0) by either using

249

Lu et al: Study of immune response against, and TGFß1 effect on secondary adenoviral vector administration decrease their immunogenicity. Third, to tame the host immune response to viral antigens. In an attempt for the first strategy, aspects of different vectors are combined to achieve stable genetic transduction and efficient delivery in vivo. An adenoviral-retroviral chimeric vector system has been developed that takes the advantages of both adenoviral and retroviral vectors, that is, the high in vivo transduction efficiency rendered by adenovirus and stable integration of transgene into the host genome rendered by retrovirus (Feng et al, 1997). In an attempt for the second strategy, antigenic viral proteins are eliminated by deleting viral genes. For example, a helper-virus independent adenoviral vector with multiply deletion of E1, polymerase, and preterminal protein, has been developed and it exhibited a capability of long-term gene transfer in vivo together with a significantly reduced hepatic toxicity (Hodges et al, 2000). The third strategy includes suppression of host immune system by co-administration of an immune-suppressing agent or viral cytokines to induce tolerance to viral antigens, or abrogation of the T cell function with antibodies. Ad-mediated expression of CTLA4IgG, which blocks the CD28-B7-mediated costimulatory signal and consequently inhibits T cells activation and prevents T cells-mediated immune responses (Nakagawa et al., 1998), or direct CTLA4IgG administration (Kay et al, 1995; Kay et al, 1997) effectively suppressed anti-Ad immunogenecity and prolonged Ad-mediated gene expression. Although it is well known that Ad causes immune response to secondary Ad administration and thus hampers the repeated Ad-mediated gene transfer, the systemic comparison among different viral delivery routes and the optimal elapsed time between repeated viral deliveries have not been extensively studied before. This study has compared immune responses against secondary Ad challenge from i.t. or i.v. administration of primary Ad. The best delivery route and optimal elapsed time between viral injections, which sustain the transgene expression and elicit the minimal immune response was provided. In addition, the effect of TGFß1 on suppression of anti-Ad antibody and sustaining of transgene in secondary Ad challenge was also explored. The previous studies by other groups indicated that development of the humoral response to Ad injection is dependent on the route and dose of administration (Gahery-Segard et al, 1997; Chen et al, 2000). Chen et al (Chen et al, 2000) have determined the minimal dose of Ad vector required to elicit the detectable production of neutralizing antibodies when delivering the Ad expressing luciferase (AdRSV.L) by the intramuscular route. By using Ad doses ranged from 102 to 1010 pfu, neutralizing antibodies were not detectable in mice immunized with less than 1x107 pfu Ad. The first evidence of neutralizing antibody production was at a dose of 1x107 pfu of AdRSV.L; this was also the minimum dose where detectable luciferase expression was observed in muscle tissue. An immunizing dose of 109 pfu AdRSV.L resulted in an increase in both luciferase expression and production of neutralizing anti-Ad antibody (Chen et al, 2000). Based on their results, we have selected 1x109 pfu as dose of Ad administration in our study.

Figure 5: Suppression of Ad-induced immune response by TGFß1 in repeated Ad administration (i.t. route versus i.v. route). For i.t. route, immune-competent mice C57BL/6 (n=5) were inoculated with TRAMP-C2 cells (5!106 cells/per mouse) to establish the subcutaneous tumors. When tumors became 50 mm3 in size, 1!109 pfu AdRSVp16 was i.t. injected first to the mouse. Seven days after the 1st viral administration, mice were i.t. injected with 1!109 pfu each of AdRSVlacZ and AdTGFß1. For i.v. route, immune-competent mice BL57C (n=5) were i.v. injected with 1!109 pfu of AdRSVp16 first, 14 days post 1st viral administration, the mice were i.v. injected again with 1!109 pfu each of AdRSVlacZ and AdTGFß1. At the indicated times after the 1st viral administration, serum were collected, and the levels of anti-Ad antibody in serum were measured using anti-Ad antibody ELISA assay. The OD450 values shown here are from serum dilution 1:32.

IV. Discussion An important and yet not solved issue in gene therapy is the host immune response against the viralmediated gene transfer, especially when an Ad vector is used (Yang et al, 1994). Ad does not integrate into the host cell chromosome and therefore the therapeutic transgene expression is transient (Dong et al, 1996). Even in an immune-incompetent nude mice model, Admediated expression of lacZ reporter gene in a human prostate xenograft tumor waned significantly within two weeks after i.t. viral injection (Lu, 2001). Together with the fact that not 100% of prostate cancer cells comprising the tumor are transduced at one time and a high-dose associated toxicity of Ad, the repetitive administration of Ad is therefore required to achieve a sustained and effective gene therapy of cancer. However, repeated exposure to viral antigen could provoke immune reaction of host that may prevent subsequent transductions by Ad vectors. In order to overcome these problems and reduce host immune response that rejects the repeated administration of therapeutic Ad, three main strategies are used. First, to modify the vectors in a way to sustain the transgene expression so that there is no need for repeated administration. Second, to modify the vectors in order to

250

Gene Therapy and Molecular Biology Vol 13, page 251 Our anti-Ad antibody ELISA assay (Figure 1) and anti-Ad neutralized antibody assay (Table 1) consistently showed that i.v. route of viral administration caused a much higher host immune response than i.t. route, although this difference is marginal within 72 h after the first viral injection. However, the immune potency caused by i.v. injection kept increasing over time, whereas the level of neutralizing anti-Ad antibody elicited from i.t. injection reached plateau at around at day 10 and maintained an overall much weaker immune response. This observation was consistently reflected in the ability of anti-Ad neutralized antibody in the sera to inhibit 2nd Ad infection (Table 1): Transgene (LacZ) expression by AdRSVlacZ in the presence of anti-Ad neutralizing antibody decreased remarkably with the increase of neutralizing antibody (Table 1), demonstrating that the immune response (level of neutralizing anti-Ad antibody) caused by i.t. Ad administration was weaker than that by i.v. route (Table 1). Several studies suggest that tumor tissue itself may develop immunological tolerance (Hay N, 2005; Ermolaeva et al, 2008; Essers et al, 2009). Taken together, these results suggest that directly intratumral (or intraprostatic situation in the clinical setting) injection of Ad at a reasonable interval (i.e., after every 10-14 days) should be considered as a rational approach for solid tumor (such as prostate cancer) gene therapy. The importance of TGFß1 in immune regulation and tolerance has been increasingly recognized (Li et al, 2006). TGFß1 is a potent regulatory cytokine with diverse effects (Rubtsov and Rudensky, 2007). The pivotal function of TGFß1 in the immune system is to maintain tolerance via the regulation of lymphocyte proliferation, differentiation, and survival (Li et al, 2006). Although TGFß1 is known to have multiple suppressive actions on T cells, B cells, dendritic cells, and macrophages (Gorelik and Flavell, 2002; Ahmadzadeh and Rosenberg, 2005; Marie et al, 2005; Thomas and Massague, 2005; Li et al, 2006; Marie et al, 2006; Otani et al, 2009), the exact mechanism of TGFß1’s suppression of Ad-induced immune responses remains to be defined. Several previous studies showed that exogenous expression of TGFß1, either by naked DNA or in Ad-mediated gene transfer, results in tolerance of host immune system by decreasing production of immunological cytokines and increasing production of endogenous regulatory cytokines (D’Ovidio et al, 1999; Chan et al, 2000). It is likely that TGFß1 suppresses Ad-induced immune response by blocking B cell activation and regulating other immune response components such as T cells, macrophages, Dentritic cells and natural killer cells (Li et al, 2006; Marie et al, 2006; Otani et al, 2009). Based on the reports that TGFß1 can suppress the immune response induced by virus (Lu et al, 1999a; Reinhold et al, 1999), we have analyzed whether TGFß1 can suppress the immune response specifically to the repeated administrated Ad. Our results have shown that administration of AdRSVTGFß1, which expresses an active form of TGFß1, can lower the level of anti-Ad neutralizing antibody after 2nd Ad administration and prolongs the expression of transgene carried by Ad. Remarkably, the prevention of death by co-delivery of

AdRSVTGFß1 in mouse group challenged with two consecutive i.v. injection of Ad demonstrates that TGFß1 has a suppressive effect on the Ad-induced immunological response: The immune response by two consecutive i.v. injection of Ad was so strong that all mice died in that group; however, in the presence of TGFß1 the mice survived the two consecutive i.v. injection of Ad. Moreover, the effect of TGFß1-mediated suppression on the production of neutralizing anti-Ad antibody in our study was probably underestimated---due to the fact that we used AdRSVTGFß1 to express TGFß1 protein. AdRSVTGFß1, as an Ad itself, would also elicit immune response. While the ideal delivery of TGFß1 should be in a less immune-prone manner such as co-delivery of TGFß1 protein form (rather than as AdRSVTGFß1) to the mice, this study has served as a “proof of concept” to demonstrate that immune response suppressor, such as TGFß1, can be a great adjuvant for gene therapy involving repeated Ad administration in order to attenuate the viralinduced host immune response and thus boost the therapeutic effects.

Acknowledgments We thank Andrew Lu for carefully reviewing this manuscript.

References Ahmadzadeh M, Rosenberg SA (2005) TGF-ß 1 attenuates the acquisition and expression of effector function by tumor antigen-specific human memory CD8 T cells. J Immunol 174, 5215-5223. Banu N, Meyers CM (1999) TGF-ß1 down-regulates induced expression of both class II MHC and B7-1 on primary murine renal tubular epithelial cells. Kidney Int 56, 985-994. Barr D, Tubb J, Ferguson D, Scaria A, Lieber A, Wilson C, Perkins J, Kay MA (1995) Strain related variations in adenovirally mediated transgene expression from mouse hepatocytes in vivo: comparisons between immunocompetent and immunodeficient inbred strains. Gene Ther 2, 151-155. Berkner KL (1998) Development of adenovirus vectors for the expression of heterologous genes. Biotechniques 6, 616-629. Bett AJ, Prevec L, Graham FL (1993) Packaging capacity and stability of human adenovirus type 5 vectors. J Virol 67, 5911-5921. Bett AJ, Haddara W, Prevec L, Graham FL (1994) An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc Natl Acad Sci USA 91, 8802-8806. Bout A, Imler JL, Schultz H, Perricaudet M, Zurcher C, Herbrink P, Valerio D, Pavirani A (1994) In vivo adenovirus-mediated transfer of human CFTR cDNA to rhesus monkey airway epithelium: efficacy, toxicity and safety. Gene Ther 1, 385394. Bouvet M, Fang B, Ekmekcioglu S, Ji L, Bucana CD, Hamada K, Grimm EA, Roth JA (1998) Suppression of the immune response to an adenovirus vector and enhancement of intratumoral transgene expression by low-dose etoposide. Gene Ther 1998 Feb; 5, 189-195. Chan SY, Goodman RE, Szmuszkovicz JR, Roessler B, Eichwald EJ, Bishop DK (2000) DNA-liposome versus adenoviral mediated gene transfer of transforming growth factor ß1 in vascularized cardiac allografts: differential sensitivity of CD4+ and CD8+ T cells to transforming growth factor ß1. Transplantation 70, 1292-1301.

251

Lu et al: Study of immune response against, and TGFß1 effect on secondary adenoviral vector administration Chen P, Kovesdi I, Bruder JT (2000) Effective repeat administration with adenovirus vectors to the muscle. Gene Ther 7, 587-595. Dong JY, Wang D, Van Ginkel FW, Pascual DW, Frizzell RA (1996) Systematic analysis of repeated gene delivery into animal lungs with a recombinant adenovirus vector. Hum Gene Ther 7, 319-331. D'Ovidio F, Yano M, Ritter JH, Mohanakumar T, Patterson GA (1999) Endobronchial transfection of naked TGF-ß1 cDNA attenuates acute lung rejection. Ann Thorac Surg 68, 10081013. Ermolaeva MA, Michallet MC, Papadopoulou N, Utermöhlen O, Kranidioti K, Kollias G, Tschopp J, Pasparakis M£®2008£©Function of TRADD in tumor necrosis factor receptor 1 signaling and in TRIF-dependent inflammatory responses.Nat Immunol 9:1037-1046 Essers MA, Offner S, Blanco-Bose WE, Waibler Z, Kalinke U, Duchosal MA, Trumpp A £®2009£©IFNalpha activates dormant haematopoietic stem cells in vivo.Nature 458£¨ 904908. Feng M, Jackson WH Jr, Goldman CK, Rancourt C, Wang M, Dusing SK, Siegal G, Curiel DT (1997) Stable in vivo gene transduction via a novel adenoviral/retroviral chimeric vector. Nat Biotech 15, 866-870. Gahery-Segard H, Juillard V, Gaston J, Lengagne R, Pavirani A, Boulanger P, Guillet JG (1997) Humoral immune response to the capsid components of recombinant adenoviruses: routes of immunization modulate virus-induced Ig subclass shifts. Eur J Immunol 27, 653-659. Gorelik L, Flavell RA (2002) Transforming growth factor-ß in Tcell biology. Nat Rev Immunol 2, 46-53. Graham FL (1990) Adenoviruses as expression vectors and recombinant vaccines. Trends Biotechnol 8, 85-87. Graham FL, Prevec L (1991) 'Methods in Molecular Biology' Murray EJ (ed); Human Press Inc, Chapter 11, pp. 109-128. Graham FL, Prevec L (1992) Adenovirus-based expression vectors and recombinant vaccines. Biotechnology 20, 363390. Greenberg NM, DeMayo F, Finegold MJ, Medina D, Tilley WD, Aspinall JO, Cunha GR, Donjacour AA, Matusik RJ, Rosen JM (1995) Prostate cancer in a transgenic mouse, Proc Natl Acad Sci USA 92, 3439-3443. Haj-Ahmad Y, Graham FL (1986) Development of a helperindependent human adenovirus vector and its use in the transfer of the herpes simplex virus thymidine kinase gene. J Virol 57, 267-274. Hay N (2005) The Akt-mTOR tango and its relevance to cancer.Cancer Cell 8:179-183. Hodges BL, Serra D, Hu H, Begy CA, Chamberlain, J.S., and Amalfitano, A (2000) Multiply deleted [E1, polymerase-, and pTP-] adenovirus vector persists despite deletion of the preterminal protein. J Gene Med 2, 250-259. Ilan Y, Droguett G, Chowdhury NR, Li Y, Sengupta K, Thummala NR, Chowdhury JR, Horwitz MS (1997) Insertion of the adenoviral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression. Proc Natl Acad Sci USA 94, 2587-2592. Jooss K, Yang Y, Wilson JM (1996) Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum Gene Ther 7, 1555-1566. Kay MA, Holterman AX, Meuse L, Gown A, Ochs HD, Linsley PS, Wilson CB (1995) Long-term hepatic adenovirusmediated gene expression in mice following CTLA4Ig administration. Nat Genet 11, 191-197. Kay MA, Meuse L, Gown AM, Linsley P, Hollenbaugh D, Aruffo A, Ochs HD, Wilson CB (1997) Transient

immunomodulation with anti-CD40 ligand antibody and CTLA4Ig enhances persistence and secondary adenovirusmediated gene transfer into mouse liver. Proc Natl Acad Sci USA 94, 4686-4691. Korst RJ, McElvaney NG, Chu CS, Rosenfeld MA, Mastrangeli A, Hay J, Brody SL, Eissa NT, Danel C, Jaffe HA, et al (1995) Gene therapy for the respiratory manifestations of cystic fibrosis. Am J Respir Crit Care Med 151, S75-87. Krasnykh VN, Mikheeva GV, Douglas JT, Curiel DT (1996) Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. J Virol 70, 6839-6846. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA (2006) Transforming growth factor-ß regulation of immune responses. Annu Rev Immunol 24, 99-146. Lu L, Lee WC, Takayama T, Qian S, Gambotto A, Robbins PD, Thomson AW (1999a) Genetic engineering of dendritic cells to express immunosuppressive molecules (viral IL-10, TGF-ß, and CTLA4Ig). J Leukoc Biol 66, 293-296. Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Roger W, Steiner MS (1999b). Delivery of adenoviral vectors to the prostate for gene therapy. Cancer Gene Ther 6, 64-72. Lu Y (2001) Viral-based gene therapy for prostate cancer. Current Gene Ther 1, 183-200. Marie JC, Letterio JJ, Gavin M, Rudensky AY (2005) TGFß1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J Exp Med 201, 1061-1067. Marie JC, Liggitt D, Rudensky AY (2006) Cellular mechanisms of fatal early onset autoimmunity in mice with the T cellspecific targeting of transforming growth factor-ß receptor. Immunity 25, 441-454. McClane SJ, Chirmule N, Burke CV, Raper SE (1997) Characterization of the immune response after local delivery of recombinant adenovirus in murine pancreas and successful strategies for readministration. Hum Gene Ther 8, 22072216. Nakagawa I, Murakami M, Ijima K, Chikuma S, Saito I, Kanegae Y, Ishikura H, Yoshiki T, Okamoto H, Kitabatake A, Uede T (1998) Persistent and secondary adenovirus-mediated hepatic gene expression using adenovirus vector containing CTLA4IgG. Hum Gene Ther 9, 1739-1745. Ohtani T, Mizuashi M, Nakagawa S, Sasaki Y, Fujimura T, Okuyama R, Aiba S (2009) TGF-beta1 dampens the susceptibility of dendritic cells to environmental stimulation, leading to the requirement for danger signals for activation. Immunology 126, 485-99. Pierce DF, Johnson MD, Matsui Y, Robinson SD, Gold LI, Purchio AF, Daniel CW, Hogan BL, Moses HL (1993) Inhibition of mammary duct development but not alveolar outgrowth during pregnancy in transgenic mice expressing active TGF-ß1. Genes Dev 7, 2308-2317. Prud'homme GJ, Piccirillo CA (2000) The inhibitory effects of transforming growth factor-beta-1 (TGF-ß1) in autoimmune diseases. J Autoimmun 14, 23-42. Reinhold D, Wrenger S, Kahne T, Ansorge S (1999) HIV-1 Tat: immunosuppression via TGF-ß1 induction. Immunol Today Aug; 20, 384-385. Rosenfeld MA, Yoshimura K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Fukayama M, Bargon J, Stier LE, Stratford-Perricaudet L, et al (1992) In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium. Cell 68, 143-155. Rubtsov YP, Rudensky AY (2007) TGFß signalling in control of T-cell-mediated self-reactivity. Nat Rev Immunol 7, 443453. Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, Lu Y (2000) Adenoviral vector containing wild-type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-372.

252

Gene Therapy and Molecular Biology Vol 13, page 253 Thomas DA, Massague J (2005) TGF-Ă&#x; directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell 8, 369-380. Walter J, High KA (1997) Gene therapy for the hemophilias. Adv Vet Med 40, 119-134. Yang Y, Greenough K, Wilson JM (1996a) Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Ther 3, 412-420.

Yang Y, Jooss KU, Su Q, Ertl HC, Wilson JM. (1996b) Immune responses to viral antigens versus transgene product in the elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther 3, 137-144. Yang Y, Nunes FA, Berencsi K, Furth EE, Gonczol E, Wilson J (1994) Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy. Proc Natl Acad Sci USA 91, 4407-4411.

Yi Lu, Ph.D.

253