Volume 15 路 Number 4 路 December 2012 路 ISSN 1139-6709 路 e-ISSN 1618-1905
INTERNATIONAL MICROBIOLOGY www.im.microbios.org
15(4) 2012
Official journal of the Spanish Society for Microbiology
INTERNATIONAL MICROBIOLOGY Publication Board
Editorial Board
Editor-in-chief Carles Pedrós-Alió, Institute of Marine Sciences-CSIC
Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Albert Bordons, Rovira i Virgili University, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Enrico Cabib, National Institutes of Health, Bethesda, MD, USA Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Seville, Sevilla, Spain Yehuda Cohen, The Hebrew University of Jerusalem, Jerusalem, Israel Rita R. Colwell, Univ. of Maryland & Johns Hopkins University, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Madrid, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain M. Luisa García López, University of León, León, Spain Steven D. Goodwin, University of Massachusetts-Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California-Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Paloma Liras, University of León, León, Spain Ruben López, Center for Biological Research, CSIC, Madrid, Spain Juan M. López Pila, Federal Environ. Agency, Dessau-Roßlau, Germany Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA M. Benjamín Manzanal, University of Oviedo, Oviedo, Spain Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain José Olivares, Experimental Station of Zaidín, CSIC, Granada, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain Eduardo Orías, University of California-Santa Barbara, CA, USA José M. Peinado, Complutense University of Madrid, Madrid, Spain J. Claudio Pérez Díaz, Ramón y Cajal Institute Hospital, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Tomás A. Ruiz Argüeso, Technical University of Madrid, Spain Hans G. Schlegel, University of Göttingen, Germany James A. Shapiro, University of Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Jean Swings, Ghent University, Ghent, Belgium Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Seville, Sevilla, Spain Josep M. Torres-Rodríguez, Municipal Inst. Medical Research, Barcelona José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Seville, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain
Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, Catalan Association for Science Communication Wendy Ran, International Microbiology Secretary General Ricard Guerrero, University of Barcelona, IEC Adjunct Secretary and Webmaster Nicole Skinner, Institute for Catalan Studies Managing Coordinator Carmen Chica, International Microbiology Members Teresa Aymerich, University of Girona Susana Campoy, Autonomous University of Barcelona Ramón Díaz, CIB-CSIC, Madrid Josep Guarro, Rovira i Virgili University Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, Institute of Mountain Livestock-CSIC Jordi Vila, University of Barcelona Jordi Urmeneta, University of Barcelona Addresses Editorial Office International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology Vitruvio, 8 28006 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: sem@microbiologia.org www.semicrobiologia.org Publisher (electronic version) Institute for Catalan Studies Carme, 47 08001 Barcelona, Spain Tel. +34-932701620. Fax +34-932701180 E-mail: int.microbiol@microbios.org © 2012 Spanish Society for Microbiology Printed in Spain ISSN (Print): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004
p2
CONTENTS International Microbiology (2012) 15:153-222 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Volume 15, Number 4, December 2012 EDITORIAL
Skinner N Year’s comments for 2012
153
RESEARCH REVIEWS
Garmendia J, Martí-Lliteras P, Moleres J, Puig C, Bengoechea JA Genotypic and phenotypic diversity of the noncapsulated Haemophilus influenzae: adaptation and pathogenesis in the human airways
159
Wierzchos J, de los Ríos A, Ascaso C Microorganisms in desert rocks: the edge of life on Earth
173
RESEARCH ARTICLES
Sheffield CL, Crippen TL, Poole TL, Beier RC Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme
185
Berlanga M, Miñana-Galbis D, Domènech O, Guerrero R Enhanced polyhydroxyalkanoates accumulation by Halomonas spp. in artificial biofilms of alginate beads
191
Luo P, Jiang H, Wang Y, Su T, Hu C, Ren C, Jiang X Prevalence of mobile genetic elements and transposase genes in Vibrio alginolyticus from the southern coastal region of China and their role in horizontal gene transfer
201
Mendoza G, Portillo A, Arías E, Ribas RM, Olmos J New combinations of cry genes from Bacillus thuringiensis strains isolated from northwestern Mexico
211
ANNUAL INDEXES
219
A1
INTERNATIONAL MICROBIOLOGY Spanish Society for Microbiology The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with about 1800 members working in different fields of microbiology.
International Microbiology Aims and scope International Microbiology, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles and complements (short papers dealing with microbiological subjects of broad interest such as editorials, perspectives, book reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology.
International Microbiology offers high-quality, internationally-based information, short publication times (< 3 months), complete copy-editing service, and online open access publication available to any reader prior to distribution of the printed journal. The journal encourages submissions in the following areas: • Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) • Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) • Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) • Critical reviews of new books on microbiology and related sciences are also welcome. The journal is covered in several leading abstracting and indexing databases, including the following ones: AFSA Marine Biotechnology Abstracts; Biological Abstracts; Biotechnology Research Abstracts; BIOSIS Previews; CAB Abstracts; Chemical Abstracts; Current Contents – Agriculture, Biology & Environmental Sciences; EBSCO; Embase; Food Science and Technology Abstracts; Google Scholar; IEDCYT; IBECS; Latíndex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; Scopus.
Cover legends Front cover Center. Star tracks above Timna Park in the Negev Desert. Several areas of the desert are covered by sandstone formations colonized by cryptoendolithic microorganisms, discovered by Prof. Imre E. Friedmann (1921– 2007). This photograph was taken by Jacek Wierzchos during a field expedition in 2006, the last one in which I.E. Friedmann took part. With this cover we commemorate the work of this eminent microbiologist of extreme and hyper-arid environments. [See article by Wierzchos et al., pp. 171-181, this issue.] Upper left. Particles of human immunodefficiency virus type 1 (HIV-1) budding from a lymphoid infected cell. The structural protein Gag oligomerizes in the inner leaflet of the plasma membrane to generate new HIV particles. Immature particles are characterized by their circular outlines, and mature HIV-1 virions by inner dense areas. Micrograph by M. Teresa Fernández-Figueras, and Julià Blanco, Hospital Trias i Pujol, Badalona, Spain. (Magnification, ca. 60,000×) Upper right. Typical position of filaments in a mature colony of Nostoc punctiforme Kützing (Hariot), isolated from a temporarily inundated soil. The thallus is microscopic, gelatinous, and changes during development. N. punctiforme is able to fix nitrogen in heterocysts, distinguished from vegetative barrel-shaped cells by their thick-walls and pale aspect. Isolation and micrograph by Mariona Hernández Mariné, University of Barcelona, Spain. (Magnification, ca. 1000×) Lower left. Giemsa-stained promastigotes of Leishmania infantum. This flagellated form of the protist occurs in the insect vector. Following inoculation into their human hosts, promastigotes enter macrophages, where they develop into amastigotes (the non-flagellated form) before multiplying. Micrograph by Roser Fisa and Cristina Riera, University of Barcelona, Spain. (Magnification, ca. 2000×) Lower right. Low-temperature scanning electron micrograph of mycobiont hyphae from the lichen Xanthoria elegans exposed to space conditions in the BIOPAN-5 facility of the European Space Agency. Lichenized fungal and algal cells survived in space after full exposure to massive UV, cosmic radiation and high vacuum. Image by Carmen Ascaso and Asunción de los Ríos (MNCN, CSIC, Madrid). (Magnification, ca. 1900×)
A2
Back cover Portrait and signature of Tomás Romay Chacón (1764–1849), Cuban physician, pioneer of Cuban medicine and public health, early advocate of vaccination, and author of Dissertation on the malignant fever, commonly known as black vomit, an epidemic disease of Eastern Indies, a monograph considered to have marked the beginning of scientific literature in Cuba. Born in Havana in 1764, Romay first received a degree in philosophy and afterwards started to study law. However, he was more interested in medicine and eventually abandoned his law studies for medicine, even though physicians were considered to be low-class professionals. After his graduation, in 1789, he completed two compulsory years of training courses and in 1791 obtained his title to work as a physician. In December of that same year, he was named chair of Pathology at the Royal and Pontifical University of Saint Jerome of Havana. By then, he was already Professor of Philosophy, and had founded, along with Governor Luis de Las Casas, the Papel Periódico de la Havana, the first serial publication in Cuba. After the arrival in Havana of a Spanish army whose members were suffering from yellow fever, Romay presented the above mentioned Dissertation, which based on its merits resulted in his election as corresponding member of the Royal Academy of Medicine in Madrid. However, he was to be remembered mostly because he introduced vaccination to Cuba and directed its dissemination. This was in February 1804, a few months before the Spanish expedition led by Francisco Xavier Balmis reached the country [see International Microbiology backcover and page A2 of issues 10(1) and 10(2), of 2007]. In 1833 there was a major outbreak of cholera in Cuba, with more than 400 people dying in Havana in a single day, among them one of Romay’s daughters. Although he was already 69 years old, Romay was at the forefront in the fight against the disease. He died from cancer in 1849. Throughout his professional life he received many awards and honors, not only in his country, but also abroad. He introduced a scientific approach to the problems of medicine and believed that humans had unlimited cognitive potential that allowed them to unravel the hidden secrets of nature.
Front cover and back cover design by MBerlanda & RGuerrero
EDITORIAL International Microbiology (2012) 15:153-158 DOI: 10.2436/20.1501.01.168 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Year’s comments for 2012 Nicole Skinner International Microbiology nskinner@microbios.org Higgs boson. The excitement was well-justified, as this was the last missing cornerstone of the Standard Model, the best theory we have so far to describe the building blocks that make up the Universe and how they interact with each other. But aside from being an important year for particle physics, from the Encyclopedia of DNA Elements (ENCODE)
Int Microbiol
As the end of the year approaches, it is always exciting to look back at the main scientific events and discoveries of the past twelve months. In 2012, in addition to the wealth of knowledge published in the academic journals, microbiology also occupied the media spotlight on many occasions, a sure sign of the growing interest in the applica-
Fig. 1. Interactions between microorganisms and the human body. Left: Adam and Eve, by Albrecht Dürer (1471–1528; Prado Museum). Right: Three plates with nutrient medium showing the growth of microorganisms normally present on the armpit, palm and leg of a healthy person (plates and photographs by M. Berlanga).
tions, implications, and challenges of our discipline. Nonetheless, as science breakthroughs go, 2012 will certainly be remembered as the year in which scientists at the European Organization for Nuclear Research (CERN), in Geneva, Switzerland, finally caught a glimpse of the long-sought
Project to NASA’s Curiosity rover landing on Mars, there were fascinating developments in all scientific disciplines. A hot topic in microbiology was that the full microbial make-up of healthy individuals, the microbiome, was mapped for the first time. It was published as a series of coordi-
Int. Microbiol. Vol. 15, 2012
skinner
Int Microbiol
154
munities of microorganisms that flourish (interestingly, microbiota was first known as ‘microflora’) in our bodies. Researchers also found that almost everyone carries pathogens, but in the healthy host these disease-causing microbes simply coexist with the rest of the microbiota. Another discovery was that the distribution of metabolic activities carried out by microbes matters more than what species are actually providing them. In the gut, for example, there will always be a population of bacteria digesting fats, but it may not always be made up of the same species. This implies that the microbiome can and does change over time. It is modifiable in a way that the human genome is not—an observation that has many clinical applications. By better understanding what is normal in healthy populations, scientists can now start to learn how changes in the microbiome correlate with our physiology, in order to look for associations of the microbiome with health and disease [1]. ***
Fig. 2. Logo of the Human Microbiome Project. nated scientific reports—the results of five years of work— by the Human Microbiome Project (HMP), a consortium of 200 researchers from nearly 80 scientific institutions and universities, in an effort to characterize the role of microbes in the human body [4]. Now we know that we harbor ten times more microbial cells than human cells, about 1–3 % of the body’s mass (or 10 % of our dry weight). Until very recently, though, very little was known about the contribution of this gargantuan number of microorganisms to human health. By sequencing and analyzing the bacterial DNA of over 5000 samples from up to 18 body sites in 242 healthy volunteers, researchers from the HMP were able to calculate that over 10,000 microbial species, with as many as 1000 different strains per person, colonize the vast range of habitats that make up the human ecosystem. These microbes carry approximately eight million genes, a contribution that is crucial for our survival. If it were not for the bacteria in our gastrointestinal tract, for example, we would not be able to digest food and absorb nutrients nor to synthesize certain vitamins and anti-inflammatory compounds [5]. The human microbiome is ‘acquired.’ As a baby passes through the birth canal it picks up bacteria from the mother’s vaginal microbiota, and shortly afterwards from the immediate environment. This person’s microbiome will then continue to be shaped throughout their life. Our diet, our health, and our lifestyle choices will determine the com-
In last year’s editorial [2] we remembered Lynn Margulis (1938–2011), one of the most outstanding biologists of the 20th century, and cofounder of this journal. Just over a year later, on 30 December 2012, the American microbiologist and biophysicist Carl Woese passed away, at the age of 84. Woese, together with Margulis, is considered one of the most important bacterial evolutionary scientists of the 20th century. In 1977, Woese and his collaborators introduced the 16S rRNA–18S rRNA phylogenetic taxonomy, whereby comparisons between these RNA molecules, rather than phenotypic similarities, were used to elucidate the evolutionary relationships between organisms. This method led him to split living beings into three lineages or ‘Domains’: Eubacteria, Archaeobacteria, and Eukaryotes, from 1991 onwards, Bacteria, Archaea, and Eukarya. Originally thought to be the ‘more obscure’ relatives of bacteria, living only in extreme environments, today we know that Archaea have a unique evolutionary history, with several molecular characteristics more closely related to Eukarya than to Bacteria. Despite the fact that Woese and Margulis for the most part did not agree about his taxonomy based on three Domains as opposed to Margulis’ five Kingdoms (Monera, Protoctists, Plants, Fungi, and Animals), Woese’s methods and tools for comparing genes from different species were essential for demonstrating the endosymbiotic origin of organelles, that Margulis proposed (in 1967, when she was 29 years old! [8]) and staunchly defended. The DNA sequences of chloroplasts in a species of Euglena that Woese
year’s comments
Int. Microbiol. Vol. 15, 2012
was studying [9] differed from those comprising the nuclear DNA of the protist itself and were shown to actually have originated from a prokaryote. The implications of his work were, and continue to be, far-reaching. Indeed, his 16S rRNA–18S rRNA-based molecular methods are actively used today, more than 30 years after their introduction, to study the aforementioned human microbiome. Surely, we will continue to discover practical applications for his work in the years to come. ***
As we approach the end of 2012, the debate about whether the results of research that has been publicly funded should be freely accessible has largely been put to rest. Research is not complete until results have been fully communicated and are openly available for others to build upon; thus, OA plays a central role in the research infrastructure as a whole. Freely available research supports a greater global exchange of knowledge; it directly benefits not only researchers, through the greater distribution, exposure, and recognition of their work, but also funding agencies and research institutions, through the acceleration of discoveries and increased returns on their investments. But OA ultimately benefits society, as research becomes more efficient and delivers better outcomes, creates new business opportunities, and contributes to our overall welfare. In July, the European Commission outlined measures to improve access to scientific information and made OA to peer-reviewed publications the default setting for Horizon 2020 (the EU’s Framework Program for Research and Innovation), as a means to boost Europe’s capacity for innovation and to provide citizens with quicker access to the benefits
Int Microbiol
International Microbiology strongly promotes open access (OA) [3]. According to the collective declarations of the Budapest Open Access Initiative (2002), the Bethesda Statement on Open Access Publishing (2003), and the Berlin Declaration on Open Access to Knowledge in the Sciences and Humanities (2003), OA must (i) provide free, immediate access and unrestricted reuse of scientific literature, while (ii) giving authors control over the integrity of their work and the right to be properly acknowledged and cited.
Fig. 3. Word cloud of topics related to Open Access.
155
156
Int. Microbiol. Vol. 15, 2012
of scientific discovery. The goal is for 60 % of European publicly funded research articles to be made available under OA, either by the publisher (gold OA) or through an OA repository (green OA), by 2016. The United Kingdom has been a pioneer in this effort. In 2012, it was announced that beginning in April 2013, free access would have to be granted to all papers funded by the Research Councils UK or the Wellcome Trust. To implement this policy, the two institutions will provide the necessary resources by introducing a new funding mechanism: a block grant to eligible research organizations and universities to cover the cost of article processing charges. As for commercial publishers, many—and not without reason—are skeptical regarding the feasibility of this model, as the publication landscape has been clearly disrupted by OA. Academic institutions whose main income is based on their journals’ revenues are also understandably concerned. In these cases, a solution remains to be worked out. Nonetheless, new journals are being launched and others are being published based on OA business models, which now represent the fastest growing segment of the scholarly journal market [6]. The financial viability of OA is evidenced by the fact that, as of 2012, the three largest OA publishers, BioMedCentral, PLoS, and Hindawi, have been profitable, albeit with much lower margins than ‘subscription’ journals. Many of the concerned parties agree that the challenge is in the transition—the coming period of relative uncertainty in which traditional publishing and OA coexist—as it will result in short-term increases in the cost of access for university libraries and in publication expenses for scientists, to cite a couple of examples. Despite these and other concerns, gold OA is expected to account for 50 % of scholarly journal articles by 2017, and 90 % of the articles as soon as 2020 [7]. These predictions reflect the recognition that this model will eventually become sustainable for all parties (researchers, funders, publishers, and society) and that initial transition costs will translate into social and financial benefits in the not too distant future. Finally, for OA to reach its full potential and maximize the return on the public’s investment, it must be possible for scientists, engineers, programmers, etc., to be able to build on that research. By granting more flexible and permissive copyright licenses, Creative Commons (CC) enables scientists and organizations to offer access to and reuse of their research and data, while being properly attributed. Only when reuse without restrictions is granted will the goals of OA be fulfilled. ***
skinner
From A Coruña to Cadiz, from Palma de Mallorca to Badajoz, in 2012 most of the specialized groups of the Spanish Society for Microbiology (SEM) held their biennial meetings. Across the Atlantic, on 28 October–1 November 2012, the 21st Congress of the Latin American Association for Microbiology (ALAM) took place in the city of Santos, Brazil. The event’s main objective was to connect colleagues from Latin America and the Iberian Peninsula in order to encourage and support microbiological research. The Congress in Santos was a great success, with participants from the 13 member societies—and the largest representation hailing from Brazil, Chile, Uruguay, and Argentina—coming together to take part in lectures, workshops, symposia, parallel sessions, and social events, the topics of which were as varied as the field of microbiology itself. Unfortunately, due to a lack of financial resources, only two of the ALAM’s societies have an international journal of their own. These are the Brazilian Journal of Microbiology and our own International Microbiology. During the round table discussion attended by the presidents and vicepresidents of the member societies, special mention was given to the SEM, congratulating it on its well-indexed journal and acknowledging the efforts of International Microbiology to publish articles authored by Latin American researchers. As previously agreed upon, the SEM and the Portuguese Society for Microbiology (SPM) held a joint PortugueseSpanish Symposium during the ALAM Congress, featuring two Portuguese and two Spanish speakers. It is the wish of both societies that future editions of the ALAM will include a joint symposium. Also, given the continued involvement of these two societies with ALAM activities, it was proposed that the Association’s name be changed to the ‘Ibero-American Association for Microbiology,’ a proposal that will be raised in a timely manner and voted on during the next Congress, to be held in Cartagena de Indias (Colombia) in 2014. July 2013 will be a very active month for Spanish and European microbiologists respectively, with the 24th SEM National Congress, which will take place in L’Hospitalet (Barcelona) on 11–13 July, and the 5th Congress of European Microbiologists, organized by the Federation of European Microbiology Societies (FEMS), to be held in Leipzig on 21–25 July. Both forums will cover key microbiologyrelated disciplines, such as clinical microbiology, pathogenesis, biodiversity, bioremediation, food microbiology, molecular microbiology, and genomics, to provide a comprehensive overview of the current state of the field. They will also include discussions of the many current challenges in
year’s comments
our world in which microbiology can contribute to finding a solution and those that can be anticipated in the future. *** In 2012, International Microbiology was one of the 31 Spanish journals recognized with a prestigious award from the Spanish Foundation for Science and Technology (FECYT), the Excellence in Scientific and Editorial Quality Diploma. This is a seal of quality that certifies excellence, over a three-year period, after journals have undergone a strict evaluation process (ISO 9001). Spain is currently 12th in journal rankings and 9th in scientific production worldwide. The goal of the FECYT is to recognize the best scientific journals published in Spain, to actively promote the inclusion of Spanish journals in accredited databases such as the Web of Knowledge and Scopus, and to ensure that evaluation agencies include, among the specific criteria for researcher evaluations, articles published in these certified journals. As recognized by this award, International Microbiology has worked hard to comply with the international standards of quality for scientific journals. In addition to our staunch support of OA beginning in 2004 [3], we introduced digital object identifiers (DOI) for all articles in 2007, have provided CC licenses for all the research we have published since 2008, and, more recently, have placed online as-soonas-publishable versions of the articles, i.e., before the print issue becomes available, with page-flip displays of each issue. These innovations, together with other indexing measures to increase the journal’s online presence, would not have been possible without the collaboration, during the past three years, of the Institute for Catalan Studies (IEC), the Catalan Academy for Sciences and Humanities. Moreover, they resulted in 101,783 article PDFs having been downloaded during 2012 (almost twice as much as the previous year), a figure that encouraged us to take these efforts one step further, by offering our authors, readers, and reviewers easier and more effective ways to access and share contents. It is for this reason that two significant changes in the journal will see the light in 2013. First, we will begin using ScholarOne ManuscriptsTM to manage article submission and peer review. Many of the journal’s authors and reviewers are already familiar with this system, but even for those who are not the online workflow is straightforward, with users led step by step through either process. Second is a completely renovated website, in which its overall navigation is improved and recent developments in web technologies are implemented to expand the user’s experi-
Int. Microbiol. Vol. 15, 2012
157
ence. Among some of the most important novelties, we will introduce HTML and ePUB versions of articles, which facilitate sharing and visualization via mobile devices. We will also provide statistics on the most visited, cited, and shared articles. This is just the beginning. Our goal, in the near future, is to join some of the biggest and most important publishers in the world to provide article-level metrics. Until recently, an article’s impact was gauged by the impact of the journal it was published in. Alternative metrics (altmetrics) are a more comprehensive set of indicators in which scholarship is measured and analyzed through the social web instead of by traditional citation. Altmetrics thus include usage such as HTML views and PDF downloads; citations in CrossRef, PubMed, Scopus, or the Web of Science; mentions or shares on social networks such as Facebook and Twitter, in blogs, and in the media; and captures and saves in online reference managers such as Mendeley. By considering all these possible sources, altmetrics provide a more broadly based set of tools to measure the varied forms of scholarly communication in our diverse academic ecosystem. *** During 2012, International Microbiology received 190 manuscripts (from 30 countries), twenty-two of which were published in the 222 pages of our four issues. These articles were authored by teams working in Argentina, Brazil, Bulgaria, China, Germany, France, Japan, Mexico, Poland, Spain, Sweden and the United States, and they covered a variety of subjects, ranging from bacterial regulation, survival, and phylogenetic diversity to antimicrobial and antibiotic resistance; from starvation stress to lignocellulose digestion and lithobiontic microorganisms. They also discussed topics such as bioremediation, food safety, and proactive (P4) medicine. The four micrographs (representing viruses, bacteria, protists, and fungi) that regularly appear as the background of the front cover of International Microbiology were provided by microbiologists working in Spain. In 2012, four landscapes were featured as the central cover image: an evaporitic flat in Laguna San Ignacio, Baja California Sur, Mexico; the Ter Vell lagoon in the Empordà region of Girona, Catalonia, Spain; the Araruama Lagoon, close to Rio de Janeiro, Brazil; and Timna Park in the Negev desert, Israel. Latin American countries have had a plethora of researchers in public health and infectious diseases since the early
158
Int. Microbiol. Vol. 15, 2012
18th century until now. Continuing our tradition for the promotion of microbiology in the region—those pioneers from the ‘South’—, our back covers featured the portrait and signature of the Colombian pioneer of medicine and public health, Antonio Vargas Reyes (1816–1873), in March and June, and the Cuban physician and early advocate of vaccination, Tomás Romay Chacón (1764–1849), in September and December. As in previous years, on behalf of the publication and editorial board, I would like to thank and recognize the efforts carried out by the many researchers who voluntarily devoted part of their time and expertise to reviewing the manuscripts received by our journal. Their work is of utmost importance in sustaining the quality and validity of International Microbiology. A list of their names and affiliations can be found on page 200 of this issue. As of December 2012, we leave our publisher since 2004, Viguera Editores, who provided the journal with technical support for the past nine years. We would also like to acknowledge our new publisher, the IEC. The IEC currently publishes more than 40 academic journals covering all branches of knowledge and it has vast experience in the digital management, editing, and promotion of publications. We look forward to a long and fruitful collaboration with this institution. Finally, 2012 also marked the 15th anniversary of I nternational M icrobiology . The journal has defini-
skinner
tively come a long way and has consolidated itself as a respected international publication in its field. This has only been possible thanks to the countless efforts of a small team of people that put all their goodwill, effort, love—and many of their free hours—into the journal. To them, thank you and may I nternational M icrobiol ogy continue for many years to come!
References 1. Abubucker S, Segata N, Goll J, et al. (2012) Metabolic reconstruction for metagenomic data and its application to the human microbiome. PLoS Comput Biol 8(6):e1002358 2. Guerrero R (2011) Lynn Margulis (1938–2011), in search of the truth. Int Microbiol 14:183-186 3. Guerrero R, Piqueras M (2004) Open Access. A turning point in scientific publications. Int Microbiol 7:157-161 4. Human Microbiome Project (HMP) published papers [http://www. genome.gov/27549115] 5. Human Microbiome Project Consortium (2012) A framework for human microbiome research. Nature 486:215-221 6. Joseph H (2012) The impact of open access on research and scholarship. Coll Res Lib News 73:83-87 7. Lewis DW (2012) The inevitability of open access. Coll Res Lib News 73:493-506 8. Sagan L (1967) On the origin of mitosing cells. J Theor Biol 14:225-274 9. Zablen LB, Kissil MS, Woese CR, Buetow DE (1975) Phylogenetic origin of the chloroplast and prokaryote nature of its ribosomal RNA Proc Natl Acad Sci USA 72:2418-2422
RESEARCH REVIEW International Microbiology (2012) 15:159-172 DOI: 10.2436/20.1501.01.169 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Genotypic and phenotypic diversity of the noncapsulated Haemophilus influenzae: adaptation and pathogenesis in the human airways Junkal Garmendia,1,2* Pau Martí-Lliteras,2,3 Javier Moleres,1 Carmen Puig,2,4 José A. Bengoechea2,3,5 1 Institute for Agrobiotechnology, CSIC-Public University of Navarra-Government of Navarra, Mutilva, Spain. 2Biomedical Research Network for Respiratory Diseases (CIBERES), Bunyola, Spain. 3Laboratory of Microbial Pathogenesis, Foundation Health Balearic Islands, Bunyola, Spain. 4Microbiology Department, University Hospital Bellvitge, IDIBELL, University of Barcelona, Barcelona, Spain. 5Spanish National Research Council (CSIC)
Received 30 October 2012 · Accepted 15 November 2012 Summary. The human respiratory tract contains a highly adapted microbiota including commensal and opportunistic pathogens. Noncapsulated or nontypable Haemophilus influenzae (NTHi) is a human-restricted member of the normal airway microbiota in healthy carriers and an opportunistic pathogen in immunocompromised individuals. The duality of NTHi as a colonizer and as a symptomatic infectious agent is closely related to its adaptation to the host, which in turn greatly relies on the genetic plasticity of the bacterium and is facilitated by its condition as a natural competent. The variable genotype of NTHi accounts for its heterogeneous gene expression and variable phenotype, leading to differential host-pathogen interplay among isolates. Here we review our current knowledge of NTHi diversity in terms of genotype, gene expression, antigenic variation, and the phenotypes associated with colonization and pathogenesis. The potential benefits of NTHi diversity studies discussed herein include the unraveling of pathogenicity clues, the generation of tools to predict virulence from genomic data, and the exploitation of a unique natural system for the continuous monitoring of long-term bacterial evolution in human airways exposed to noxious agents. Finally, we highlight the challenge of monitoring both the pathogen and the host in longitudinal studies, and of applying comparative genomics to clarify the meaning of the vast NTHi genetic diversity and its translation to virulence phenotypes. [Int Microbiol 2012; 15(4):159-172] Keywords: Haemophilus influenzae · noncapsulated/nontypable Haemophilus influenzae (NTHi) · pathogen-host interplay · genetic diversity · virulence phenotype
Introduction The human upper respiratory tract contains a characteristic and highly adapted microbiota encompassing commensal *Corresponding author: J. Garmendia Instituto de Agrobiotecnología CSIC-Universidad Pública de Navarra-Gobierno de Navarra 31192 Mutilva, Navarra, Spain Tel. +34-948168484. Fax +34-948232191 E-mail: juncal.garmendia@unavarra.es
microorganisms and opportunistic pathogens. The finetuned balance of the microbial-airway interplay underlies normal lung function, but it can be altered by host genetic factors or immunological status, by host exposure to external factors such as radiation, infectious agents, chemical contaminants, and environmental pollutants, as well as by diet, lifestyle (e.g., tobacco or alcohol use), occupation, and medical interventions [70]. Regardless of their origin, the changing conditions often allow existing or newly acquired
160
Int. Microbiol. Vol. 15, 2012
opportunistic pathogens to modify their status as colonizers, becoming the cause of a symptomatic infection. Moreover, opportunistic pathogens often display high genetic plasticity as a strategy to drive continuous evolution, thereby facilitating the evasion of host immunity, carrier state colonization, or symptomatic infection. In this review, we focus on a member of the human airway microbiota, the opportunist pathogen nontypable Haemophilus influenzae (NTHi). We review the most recent knowledge on its genetic diversity and highlight questions and challenges for its future study with respect to heterogeneity, evolution, and host interplay. Although tailored to H. influenzae, our discussion is applicable to almost any other opportunistic pathogen.
General features of the bacterial respiratory pathogen Haemophilus influenzae Haemophilus influenzae is a gram-negative coccobacillus whose environmental niche is primarily restricted to the human respiratory tract. It is classified on the basis of its production of a polysaccharide capsule; strain types a–f produce antigenically distinct capsules while nontypable strains do not. The use of H. influenzae type b (Hib) conjugate vaccines has nearly eliminated invasive strains in places where the vaccines have been administered, but they have also promoted the emergence of NTHi strains as the most predominant of this pathogen species [1]. NTHi is a member of the human respiratory microbiota in most healthy individuals beginning in early life. Colonization by several different NTHi strains is often simultaneous [18], continuously renovated, and actively modulates colonization by other opportunistic pathogens such as Streptococcus pneumoniae [41,66]. In addition to colonizing the nasopharynx of healthy individuals, NTHi is an opportunistic pathogen. Colonization of the upper airways is also the first step in the pathogenesis of NTHi infection, facilitated by contiguous spread of the bacteria and its migration from the nasopharynx to adjacent structures, including the sinuses, middle ear, trachea, and lower airways. Clinical manifestations of NTHi infection are: (i) upper respiratory tract involvement such as otitis media (OM) in children, as well as sinusitis, and conjunctivitis; (ii) exacerbations of conditions involving the lower respiratory tract (LRT) in adults suffering chronic obstructive pulmonary disease (COPD), as well as pneumonia and infections in cystic fibrosis (CF); and (iii) invasive disease, with bacteremia and meningitis as the most common presentations [1].
garmendia et al.
The notion that NTHi is highly adapted to the host is supported by the fact that this bacterium is: (i) human hostrestricted; (ii) successful at establishing a niche in the human airway as a colonizer; and (iii) provided with virulence factors facilitating the pathogen’s ability to take advantage of the host condition and cause a symptomatic infection. The adaptation of NTHi is manifested by wide variations in the DNA material among isolates. While encapsulated serotype type b invasive strains form a clonal group, there is enormous genetic heterogeneity among NTHi strains [25]. In general, existing evidence indicates that bacterial strains belonging to the same species vary considerably in gene content, and that the genetic repertoire of a given species is much larger than the gene content of individual strains. This has important consequences for our understanding of bacterial evolution, adaptation, and population structure, as well as for the identification of virulence genes, vaccine design, etc. Bacterial species are currently described by their gene pools (pan-genomes or supra-genomes), which include a core genome containing genes present in all strains and an accessory or adaptive genome consisting of partially shared and strain-specific genes [47]. Available information on genotyping systems and genome sequencing of NTHi strains indicates that the pan-genome of this bacterial species is large [25,35]. The sources of selective pressure driving genetic diversity among populations of H. influenzae are likely related to the bacterial necessity to attach to host cells or surfaces for colonization, to evade host innate and adaptive immunity and persist in the host, to obtain iron and other nutrients essential for replication, and to disseminate or spread. Genetic mechanisms that modify H. influenzae gene content are: (i) the lateral transfer of DNA sequences between different bacterial cells, facilitated by the fact that NTHi is a naturally competent DNA acceptor [56]; (ii) genetic polymorphisms, encompassing gene point mutations, insertions, deletions, or duplications [25]; (iii) phase variation, a slipped-strand mispairing mediated by short DNA repeats (SSR, simple sequence repeats) in the coding or the upstream promoter regions of certain genes such that a spontaneous gain or loss of repeat units in these unstable regions either results in a translational frameshift or alters the distance spanned by the promoter, thus modifying gene expression [48]; and (iv) hypermutation [54]. Genetic variability is likely to have fundamental consequences in NTHi infection, favoring heterogeneous gene expression as well as phenotypic and antigenic diversity while providing this pathogen with strategies to evade host immunity and overcome antimicrobial treatment (Fig. 1).
Int. Microbiol. Vol. 15, 2012
161
Int Microbiol
Diversity of noncapsulated H. influenzae
Fig. 1. Diagram of three different domains conferring diversity in Haemophilus influenzae: genetic variability, heterogeneous gene expression and phenotypic variability. The three diversity domains are intimately cross-related and lead to the generation of antigenic variation. Non-exhaustive examples of the available experimental evidence for each of these domains are provided.
NTHi genetic diversity: gene distribution/sequence conservation and genome-sequencing-based approaches Haemophilus influenzae strain Rd KW20 was the first freeliving organism from which a complete genome sequence was obtained, and the resulting information provided an excellent scaffold to assess H. influenzae diversity [19]. Nontypable strains of H. influenzae were long considered as colonizing bacteria whose virulence potential largely reflected alterations in host defenses. However, growing evidence based on NTHi recovered from disease states suggests that these bacteria are genotypically different, both in terms of disease state and compared to strains harvested from healthy carriers [25,52,55,73]. These observations raise several questions: Can we identify genes/genomic regions important for NTHi
virulence by comparing the genetic makeup of strains recovered from disease with strains isolated from healthy carriers? Would this virulence-associated genetic material allow strain stratification or the development of tools to predict NTHi virulence? The answers have been sought mainly by analyzing the differential distribution of limited numbers of genes or genetic traits among NTHi isolates, and more recently, by comparative genomics of sequenced strains. Gene distribution/sequence conservation among NTHi isolates. Explorations of NTHi genetic diversity have mainly been carried out using a reductionist approach, based on the survey of selected genes or genetic islands on isolate panels. The aim of these studies has been the identification of virulence factors, genetic markers for NTHi differentiation from other bacteria, and useful epitopes as vaccine candidates. Gene distribution assessment has focused on
162
Int. Microbiol. Vol. 15, 2012
garmendia et al.
Table 1. Sources of genetic variability among noncapsulated Haemophilus influenzae strains Gene
Variable distribution
Phase variation
Allelic polymorphisms
lic2C
Yes
No
ND*
lic2B
Yes
No
ND
losAB
Yes
Yes, 5´-CGAGCATA in losA
ND
lic3A
No
Yes, 5´-CAAT
ND
lic3B
Yes
Yes, 5´-CAAT
ND
lic1A
Yes
Yes, 5´-CAAT
ND
lic1D
Yes
No
Yes
lic2A
No
Yes, 5´-CAAT
ND
lgtC
No
Yes, 5´-GACA
ND
oafA
No
Yes, 5´-GCAA
ND
lex2A
Yes
Yes, 5´-GCAA
ND
lex2B
Yes
No
Yes
hmw1A
Yes
Yes, 5´-ATCTTTC
Yes
hmw2A
Yes
Yes, 5´-ATCTTTC
Yes
hia
Yes
No
Yes
hifABCDE
Yes
Yes, 5´-TA
Yes
hap
No
No
Yes
ompP5
No
No
Yes
oapA
No
No
Yes
igaB
Yes
Predicted in strain 2019, 5´-AAATTCA
Yes
*ND, not determined.
genes encoding NTHi surface molecules, including lipooligosaccharid (LOS) as well as adhesive and immunomodulatory molecules. Table 1 provides a list of genes that are variable on NTHi strains, and their sources of variability. The NTHi LOS is a glycolipid comprising a membraneanchoring lipid A linked by a single 2-keto-3-deoxyoctulosonic acid (Kdo) to a heterogeneous oligosaccharide (OS) composed of neutral heptose (Hep) and hexose (Hex) sugars, lacking an O antigen [60]. Each Hep of a conserved trisaccharide (HepI to HepIII) inner core can serve as a point for Hex addition and further chain extensions, the degree and pattern of which vary among strains [60]; a fourth heptose (HepIV) may be
present on the OS extension from HepI [37] (Fig. 2). Several genes involved in LOS biosynthesis are variably present among H. influenzae strains. This is the case for li2BC and losAB [16,17,36]. The lic2C and lic2B genes encode glycosyltransferases responsible for initiating sugar extension from HepII [36] and for adding the second sugar (Glc or Gal) to the Glc on HepII, respectively [65]. The losB gene encodes a heptosyltransferase responsible for adding HepIV to the OS on HepI, and losA encodes another glycosyltransferase [37]. When present, lic2C is located in a genetic island flanked by infA and ksgA. The infA-ksgA island can be absent, with the infA and ksgA adjacent to each other, or present, containing
Int. Microbiol. Vol. 15, 2012
163
Int Microbiol
Diversity of noncapsulated H. influenzae
Fig. 2. Model structure of NTHi lipooligosaccharide (LOS). A repertoire of modifications, whose presence and location are variable among strains, is shown. GlcN, glucosamine; Kdo, 2-keto-3-deoxyoctulosonic; PEtn, phosphoethanolamine; Hep, heptose; Glc, glucose; Gal, galactose; Neu5Ac, sialic acid; PCho, phosphorylcholine; OAc, O-acetyl group. Genes encoding enzymes responsible for the biosynthesis of the LOS molecule are indicated. Phase-variable genes are shown in white; non-phase-variable genes are shown in gray.
(i) lic2C, (ii) lic2B and lic2C, or (iii) losA and losB [17]. A comparison between invasive NTHi isolates obtained from the host middle ear and nasopharynx/throat revealed that this island is present in most nasopharyngeal and OM isolates but absent from 40 % of invasive isolates [17]. A survey of lic2C from a collection of NTHi inner ear-OM isolates showed the presence of the gene in approximately half of the analyzed strains [36]. A later study from our laboratory on a panel of non-isogenic NTHi isolates of different pathological origin showed a 95 % prevalence of lic2C, suggesting that it encodes a molecular feature conferring bacterial fitness during infectious processes [44]. Support for this observation comes from an analysis of lic2C distribution in a strain panel encompassing 54 NTHi strains collected
from 20 adults suffering an underlying chronic respiratory disease. The patients were seen at a tertiary reference center (University Hospital Bellvitge, Spain) between two and five times from 1996 to 2007. Strain molecular typing by pulsefield gel electrophoresis (PFGE) indicated a high diversity (45 PFGE different profiles). Patients were classified as follows: Group A, consisting of 14 patients in whom each of the collected strains differed from the others with respect to the PFGE profile; and Group B, consisting of six patients, among whom at least two of the strains collected per patient displayed the same PFGE profile. Collectively, lic2C was detected in 63 % of the isolates. Additional data from our laboratory suggested that lic2C is not necessarily linked to virulence, but, more generally,
164
Int. Microbiol. Vol. 15, 2012
to bacterial host adaptation. Evidence for this notion was obtained in an analysis of lic2C in a panel of 42 isolates encompassing 25 NTHi strains collected from 25 pediatric patients with OM (University Hospital Germans Trias i Pujol, Spain) and 17 NTHi nasopharyngeal isolates from 17 healthy children (University Hospital Bellvitge), in which the gene had a prevalence of 76 % and 94 %, respectively. The linkage of lic2B with lic2C has been reported [17], with several studies addressing lic2B distribution and the gene’s prevailing presence in middle ear-OM isolates [55,71,73]. Our data on lic2B distribution within the panel of 42 NTHi pediatric strains described above confirms an association between lic2B and lic2C, given that lic2B was only detected in lic2C-positive strains. Among OM patients and healthy carriers, the prevalence of lic2B was 56 % and 47 % , respectively; among the lic2C-positive isolates, the prevalence of lic2B was 73 % and 50 %, respectively. These data slightly differ from those previously reported, as the prevalence of lic2B among healthy carrier isolates was somewhat higher, which could be due to the origin, size, or nature of the strain panels. Nonetheless, they suggest the general involvement of lic2BC in NTHi-host interplay, rather than its exclusive role in virulence. Unlike lic2BC, the presence of losAB seems to be scattered, based on the gene’s detection in only three lic2BCnegative strains in the same panel of 42 pediatric isolates. Similarly, a previous evaluation of losAB in two collections of NTHi clinical isolates yielded a prevalence of 16 % and 18 %, respectively [16,17]. The phase variation of losA is an additional source of variability [16]. Sialylation, catalyzed by the sialyltransferases Lic3A, Lic3B, SiaA, and LsgB, is another variable modification of NTHi LOS. Although the lic3A gene seems to be universally present, a survey of lic3B on a collection of NTHi inner-ear isolates identified lic3B in 60 % of the strains [20]. However, a later study from our laboratory on a panel of non-isogenic NTHi isolates of different pathological origin showed the 100 % prevalence of lic3B [44], and an assessment of the gene on the above-discussed panel of 42 pediatric isolates found a 72 % and 100 % prevalence of lic3B among OM and healthy carriers, respectively. An additional source of variation in LOS sialylation is lic3A and lic3B phase variation [20]. The lic1 locus, encompassing the lic1ABCD operon, is responsible for the addition of phosphorylcholine (PCho) to LOS [68]. A survey of a collection of NTHi isolates detected lic1A in 96 % of the strains [45]; a later study from our laboratory on a panel of non-isogenic NTHi isolates of different pathological origin found a 100 % prevalence for lic1D [44]. PCho substitutions may occur on OSs extending
garmendia et al.
from any Hep, depending on the lic1D allele (lic1DI, lic1DIII, lic1DIV), which encodes a diphosphonucleoside choline transferase [43,45]. Moreover, although most strains have a single lic1D gene, a survey of NTHi strains collected from the middle ear found that 16 % of them had two lic1D alleles, each in a separate, phase-variable lic1 locus, which together could result in two PCho substitutions in the LOS of the respective strain [21]. Available information on the heterogeneous distribution of additional genes involved in NTHi OS extensions, such as lpsA, lic2A, lgtC, and oafA, suggests that, although extensively present in NTHi strains [15,22,36,44], these genes are not necessarily conserved; for example, lic2A, lgtC and oafA are phase variable [15,22,32]. Moreover, allelic polymorphisms have been found in lpsA. This gene encodes a glycosyltransferase responsible for the addition of a Hex to HepIII; the added Hex can be either Glc or Gal, and Hep linkage can be either b 1-2 or b 1-3. Each H. influenzae strain produces only one of the four possible combinations of linked sugars in its LOS, due to a specific allelic variant of lpsA directing both linkage and the added Hex, Glc, or Gal [10]. Variable distribution, allelic polymorphisms, and phase-variable expression also characterize the lex2 locus. The lex2A gene contains a variable number of 5´-GCAA repeats; lex2B encodes the glucosyltransferase that adds the second Hex during the extension of LOS by HepI [28]. Allelic polymorphisms are assumed for lex2B, based on the alteration of a single amino acid in Lex2B, which correlates with the addition of Glc or Gal to the OS extension from HepI [9]. Variable distribution has also been evaluated on genes encoding adhesive molecules. Thus, the distribution of the adhesin-encoding genes hmw and hia in a panel of 59 noncapsulated strains showed that 47 strains contained hmw1 and hmw2 while nine strains contained hia, but no strain harbored both hmw and hia [63]. Based on the available evidence: (i) all strains having hmw genes contain two hmw loci in conserved unlinked physical locations on the chromosome [5]; (ii) hmw genes occur in different allelic versions among strains [5,13]; and (iii) hmw genes are more prevalent in isolates associated with acute OM than in the throat isolates of healthy children [14,39,73]. An additional source of diversity is the phase variation of both hmw1A and hmw2A [8]. Although it has not been formally analyzed, hia may present polymorphisms, since its PCR amplification in two panels of clinical strains rendered variable size products [17,59]. The prevalence of the phase-variable hifABCDE gene cluster, responsible for the biosynthesis of the hemagglutinating pili, seems to be generally low [3,24], with a higher
Diversity of noncapsulated H. influenzae
prevalence among Hib than among NTHi isolates [14]. Discrepancies among independent studies do not allow a clear association between anatomic isolation site (throat or middle ear) and hifABCDE distribution [14,64]. According to current information, the adhesin-encoding genes hap, ompP5, and oapA are universally distributed among noncapsulated isolates, but they display variation. Thus hap, encoding a self-associating autotransporter involved in intercellular aggregation [62], has a stop codon in strain Rd KW20, and its PCR amplification results in products of different sizes among clinical isolates (B. Euba, personal communication). The ompP5 gene, encoding an outer membrane protein involved in bacterial adhesion to host cell surfaces [34], is highly variable among strains [12,49]. Although its amplification product was size-invariable among non-isogenic strains of different pathological origin, variability was detected in the five extracellular loop domains predicted for P5 by PREDTMBB analysis [44]. Despite the heterogeneity of ompP5, a P5 sequence comparison in two separate isolate panels containing sets of identical strains recovered from patients with a chronic respiratory disease who were seen in independent medical visits showed no differences among identical strains ([49], A. L贸pez-G贸mez, personal communication), pointing to the relative stability of P5 during NTHi persistence in the host. Conversely, the oapA amplification product is size variable, due to insertions/deletions in the gene region encoding the protein segment starting at amino acid 195 [44]. The iga gene, encoding an antigenically variable IgA1 protease, is extensively distributed among strains [42]. However, compared to strains from other clinical sources, genomes of isolates from adults with COPD have a higher likelihood of also having igaB, encoding a second IgA1 protease [52]. A sequence analysis of igaB showed minor sequence changes among isolates [52]. Collectively, variability studies based on a limited number of genes may facilitate associations between genes/ gene groups and disease manifestation or bacterial anatomic location, which in turn could reveal virulence factors and provide tools to predict virulence. However, gene selection, the number of selected genes, and the nature and size of the strain collections, are critical limiting factors that must be considered to obtain useful information. Comparative analysis of panels of whole-genome sequenced strains is a powerful approach that may contribute significantly to overcome these limitations. Whole-genome multiple-strain sequencing. Sequenced strain Rd KW20 was useful in understanding the
Int. Microbiol. Vol. 15, 2012
165
basic biology of H. influenzae, but it did not provide significant insight into disease because is a rough derivative of H. influenzae serotype d, which is rarely disease-associated [31]. Nonetheless, the elucidation of differences between the genomes of strains isolated from disease states and the genome of strain Rd KW20 may yield insight into NTHi pathogenicity. Thus, an analysis of NTHi strain 86-028NP, isolated from a patient with chronic OM, revealed large rearrangements in its genome architecture compared to strain Rd KW20, in addition to the presence of 280 ORFs not present in the latter strain [30]. Since then, further studies have provided increasing information on the H. influenzae core- and pan-genome. A comparative genomic study of strain Rd KW20 and 12 NTHi clinical isolates identified 2786 genes, of which 1461 were common to all strains. That study allowed the development of a finite supra-genome model in which a NTHi supra-genome containing between 4425 and 6052 genes was predicted [35]. A recent study sought to identify bacterial genetic elements with increased prevalence among strains isolated from COPD patients, compared to those from healthy carriers. Two NTHi strains recovered from the airways of two COPD patients and two strains from a healthy individual were sequenced. Seven genetic islands were defined, with their distribution among a panel of 421 strains of both disease and commensal origins revealing that four of these islands were more prevalent in COPD than in colonizing strains [73]. Whole-genome sequencing on H. influenzae has also been applied to study the impact of transformation-mediated homologous recombination in interstrain exchange of DNA [46,57]. Indeed, H. influenzae rendered the first genome-wide analysis of chromosomes directly transformed with DNA from a divergent genotype [46].
Heterogeneity in gene expression and its contribution to NTHi strain stratification The presence or absence of a gene is not necessarily indicative of the infection outcome, as the same gene may be found in asymptomatically carried strains but with slight genetic changes or differences in expression. NTHi differential gene expression has been mainly explored in phase-variable genes. The lic1ABCD operon is phase variably expressed due to a 5麓CAAT repeat within the lic1A reading frame [68]. Differential PCho expression has been reported among NTHi isolates [44] and may vary depending on the anatomic location in the host. In fact, H. influenzae variable PCho expression may correlate with the ability of the bacterium to persist on the mucosal
166
Int. Microbiol. Vol. 15, 2012
surface (PCho+ phenotype), and to cause invasive infection by evading innate immunity mediated by acute-phase C-reactive protein (PCho– phenotype) [67]. The losA gene is phase variably expressed due to a 5´-CGAGCATA repeat within the reading frame. Of 30 NTHi strains containing losA, 24 had two tandem copies of the SSR, allowing full-length translation of losA (on), and six had 3, 4, 6, or 10 tandem copies (losA off). The expression of losA, which is determined by the variations in its repeats, has been shown to affect NTHi resistance to serum-mediated killing [16]. Similarly, lic3A and lic3B, encoding two sialyltransferases, are phase variably expressed due to a 5´-CAAT repeat within their reading frames. The number of repeated motifs in 25 NTHi isolates was found to vary from 14 to 41 in lic3A and from 12 to 28 in lic3B; for both genes, two of the three possible reading frames were predicted to allow translation of full-length gene products from alternative initiation codons upstream of the repeats [20]. The lic2A galactosyltransferaseencoding gene is variably expressed due to a 5´-CAAT repeat within its reading frame [32]. The number of repeated motifs within lic2A varied between 7 and 33 in a group of 19 NTHi isolates [44]. The repeated tract of lic2A is preceded by four putative initiation codons in two reading frames [11]. Fifteen of those 19 isolates contained an in-frame lic2A gene [44]. Independently, in an SSR analysis of lic2A using the abovedescribed panel of H. influenzae isolates collected from adult patients suffering an underlying chronic respiratory disease, the number of repeated motifs within lic2A in 28 of those isolates varied between 7 and 28. Sequence comparison from sets of identical strains recovered from the above-described group B patients demonstrated diversity in the number of lic2A repeats among identical strains over time. Digalactose has been linked to NTHi resistance to serum-mediated killing [15] and to virulence [27]. Evaluation of hmw1A and hmw2A gene expression in three NTHi invasive isolates and in the prototype strain 12 showed that increased numbers of 5´-ATCTTTC repeats within the hmwA promoters correlate with decreased amounts of transcript [26]. In agreement with this finding, an analysis of HMW1 and HMW2 adhesins in isolates collected serially from COPD patients revealed that the expression of both proteins by a given strain decreased over time in the majority of patients, reflecting a progressive increase in the numbers of 7-bp repeats [7]. Microarray studies comparing gene expression among isolates have provided evidence for a conserved core of genes preferentially expressed during H. influenzae growth in iron/ heme-restricted condition [69]. Differential expression of surface molecules between bacteria grown planktonically or
garmendia et al.
forming biofilms demonstrated a greater abundance of peroxi– redoxin-glutaredoxin in H. influenzae biofilms than in planktonically grown bacteria. This molecule is involved in biofilm formation by H. influenzae and the degree of its involvement varies among strains; note that peroxiredoxin-glutaredoxin is recognized by the human immune system in vivo, which suggests its expression by H. influenzae during human respiratory tract infection [51]. LRT isolates associated with COPD exacerbation are more resistant to the bactericidal effect of serum than colonizing isolates from the upper airway, with the expression of vacJ and yrb positively correlating with serum resistance. The vacJ gene functions with an ABC transporter encoded by yrb in the retrograde trafficking of phospholipids from the outer to the inner leaflet of the cell envelope, suggesting that NTHi adapts to inflammation encountered during LRT infection by modulating its outer leaflet through the increased expression of vacJ and yrb, thereby minimizing recognition by bactericidal anti-OS antibodies [53]. Collectively, existing data reinforce the notion that the heterogeneous expression of genes involved in NTHi virulence should be considered and integrated in studies of bacterial diversity, as this may be a useful basis for stratifying the virulence potential of clinical isolates and/or identifying potential therapeutic targets.
Variable phenotypes among NTHi isolates and differential bacterial interplay with host immunity Genetic traits may be ultimately of little interest unless they can be associated with virulence. However, a clear-cut relationship between virulence-linked genotype and phenotype remains elusive for NTHi. This gap could be due to: (i) the absence of clearly defined phenotypes that can differentiate among NTHi strains with and without virulence potential; (ii) the absence of systematic comparative phenotypic studies using a significant number of isolates recovered from different disease states and from healthy carriers; and (iii) the lack of studies in which both genotypic and phenotypic traits are simultaneously analyzed in wide strain panels. An assessment of the phenotypic diversity of NTHi pointed out the differential interplay of host immunity elements and the various isolates. Variable resistance to serum-mediated killing among panels of NTHi isolates recovered from the pediatric inner ear and of non-isogenic NTHi isolates from different pathological origin suggested an association between LOS sialylation and NTHi resistance to
Int. Microbiol. Vol. 15, 2012
167
Int Microbiol
Diversity of noncapsulated H. influenzae
Fig. 3. Model presenting key features of epithelial cell infection by Haemophilus influenzae. Bacteria adhere to the cell surface. Once bacteria have adhered, interbacterial interactions lead to microcolony formation. Microcolony formation facilitates bacterial invasion into epithelial cells, potentially providing a protected niche and allowing bacterial evasion of host immunity. Rigth: a scanning electron micrograph shows NTHi infection of A549 immortalized human type II pneumocytes; the white arrows point at the attachment of bacteria to the host cell surface. Image courtesy of Dr. JosĂŠ Ramos Vivas, FundaciĂłn MarquĂŠs de Valdecilla, Santander, Spain.
complement. This finding was supported by the high serumsusceptibility displayed by a mutant strain lacking the CMPsynthetase siaB gene [38,44]. In addition, serum resistance of losAB-containing strains has been correlated with an on-vs. off-state of losA [16]. However, an attempt to establish serum resistance as a virulence trait potentially shared by invasive noncapsulated H. influenzae strains did not render conclusive results [17]. Similarly, there was no clear difference in serum resistance or binding to complement inhibitors between invasive NTHi isolates obtained from patients with sepsis and nasopharyngeal strains obtained from patients with upper respiratory tract infection [29], although a significant correlation between disease severity and serum resistance was identified in cases of NTHi invasive disease [29]. Evidence points out that H. influenzae interplay with the respiratory epithelium involves bacterial adherence to epithelial cells and inter-bacterial interactions leading to microcolony formation. Microcolony formation may lead to the establishment of a biofilm resistant to host immune factors. Attachment promotes bacterial invasion into epithelial cells, potentially providing a protected niche that may allow
bacterial evasion from local immune mechanisms (Fig. 3). Adhesion to epithelial host cell surfaces [7,44] and biofilm formation [50] are also heterogeneous features of NTHi. Of note, significant phenotypic differences between NTHi strains from COPD exacerbation and colonizers have been reported, with the former strains having greater adherence to airway epithelial cells and inducing more severe airway inflammation [6]. Another variable phenotypic trait is the antigenic variability of surface-exposed epitopes, evidenced by the development of new highly strain-specific bactericidal antibodies after exacerbation; these antibodies show low bactericidal activity for heterologous strains [61]. While a significant correlation between disease phenotype and global comparative genomic data would facilitate the stratification of isolates and our ability to predict disease manifestations, this goal remains elusive. In an in vivo chinchilla model of OM aimed at characterizing the local and systemic virulence patterns of ten genomically analyzed NTHi isolates from children with chronic OM with effusion or with otorrhea, strain stratification was indeed possible, but global comparative genomics of the same strains did not cluster them
168
Int. Microbiol. Vol. 15, 2012
by clinical phenotype [4]. Although several reasons could explain this inaccuracy, the wide genetic diversity among strains is particularly probable, given that genome sequence comparison has shown that the mean number of gene differences among each of the possible strain pairs are >350, but the number of genes associated with each parameter of clinical virulence may be a small fraction thereof [4]. In summary, the wide genetic and phenotypic variability among NTHi strains highlights the need to explore alternative approaches to facilitate the association of genotype with phenotype.
Current questions and challenges for future studies on the diversity of noncapsulated Haemophilus influenzae Pathogenicity is the result of the relationship between a bacterium and its host, specifically, between bacterial virulence factors, including how and when they are expressed, and the host immune status. The latter is determined by genetic factors, age, lifestyle, co-infections, and exposure to external agents, all of which can modulate host physiology and the ability to fight infection. Host factors in the dynamics of NTHi infection. Defining the role of host immunity in disease outcome is crucial; indeed, pathogen diversity studies should ideally be conducted in parallel with immunological studies on the respective host. This aspect may be particularly crucial for highly adapted and very flexible opportunistic pathogens such as H. influenzae, for which host immunological status is a strong determinant in the ability of a pathogen to cause symptomatic disease in a previously asymptomatic healthy carrier. An example of this notion is the association between NTHi infection and the progression of COPD. Patients with COPD sufffer from chronic bronchitis, emphysema, or both. In these diseases, the airways become narrowed, which leads to an irreversible limitation of airflow to and from the lungs, causing shortness of breath [2]. COPD is caused by airway exposure to noxious particles or gas, most commonly from tobacco smoking, which triggers an abnormal inflammatory response in the lung. These deleterious agents impair normal respiratory function and alter the host’s response to infection by opportunistic pathogens such as NTHi, which colonizes the upper airways, causes chronic LRT infection, and is frequently isolated in disease exacerbation [23]. Prospective comparative genotype and phenotype analyses of multiple NTHi isolates
garmendia et al.
serially recovered from the upper and lower airways of COPD patients in stable and acute condition, together with detailed clinical, inflammatory, and patho-physiological information obtained from those patients at the time of each microbial isolation, would provide invaluable biological material and information with which to assess microbial evolution. It would also faciliate the design of tools to predict disease severity, the virulence potential of a bacterial strain, and the outcome of the host-pathogen encounter. Virulence vs. niche factors and NTHi adaptation vs. infection. Given that NTHi is highly adapted to the human respiratory microbiota, it is likely to be equipped with evasion strategies allowing the bacterium to endlessly colonize the host. Evidence demonstrating differential gene distribution between strains isolated from different body locations and/or disease states supports the existence of genetic traits associated with disease [73]. However, an increase in the number, size, and clinical and geographical diversity of the strain panels screened may dilute the relevance of those proposed genetic virulence traits due to their extensive presence in healthy carrier isolates. Instead, they may prompt us to consider the fine line between virulence, adaptation, and genetic fitness for NTHi. This consideration should not limit the potential of currently identified genetic virulence traits, which could well be involved in both the colonization of healthy hosts and the symptomatic infection of immunocompromised individuals. In fact, many structures and strategies playing important roles in establishing and maintaining infection have been discovered and characterized in pathogens. However, these virulence factors can also be shared by commensals because they are required for their existence in the host, thus suggesting their re-consideration as niche factors [33]. Our current understanding of the role of NTHi virulence factors is in part based on lack-of-function mutant strains generated in the laboratory, when assayed for phenotypes linked to virulence. This approach, essential for gene– function associations, nonetheless has certain risks that must be taken into account in any discussion of the resulting data, given that: (i) there is often a reliance on reference strains that can be mutated under laboratory conditions, which can generate strain-dependent bias; (ii) functional redundancy is frequently not considered, although it could be a source of bias in the form of single-mutant strain-dependent data. Moreover, the relevance of so-called virulence phenotypes in the refined adaptation and colonization of the human host by NTHi cannot be excluded. Indeed, for NTHi, the precise
Diversity of noncapsulated H. influenzae
definition of phenotypes that clearly differentiate virulent and colonizing strains may be risky, as the difference may actually depend on host status. Further experimental evidence is required to address these issues. The widest possible repertoire of virulence phenotypes should be systematically assayed on vast collections of genotypically characterized NTHi strains, recovered from healthy carriers and from different disease states, in order to cluster phenotypes into categories and to define virulence and/or adaptation indexes. The challenges of genomic information in the study of NTHi diversity. In general, comparative genomics of microbial pathogens aims to predict the virulence potential of a bacterial strain from its genome sequence [58]. Sequencing can identify which virulence factor-encoding genes are present in a genome. However, the presence of these genes in itself is not indicative of disease outcome, as the same gene might well be found in asymptomatically carried strains. Therefore, without an understanding of the regulatory and epistatic processes controlling gene expression, the contribution of a list of genes to virulence cannot be quantified. A systems biology approach based on a comprehensive understanding of the combinations of genetic backgrounds, regulatory networks, and virulence factors that produce virulent strains has been proposed to help researchers determine the propensity of a particular strain to cause disease. The goals of the proposed framework are: (i) to define phenotypes that differentiate virulent and avirulent strains; (ii) to characterize how the relevant phenotypes are encoded, using expression arrays to construct models of the generegulatory networks as well as process diagrams informed by the underlying genetics; (iii) to develop models that predict the gene combinations leading to specific virulence phenotypes; and (iv) to test and refine the models with sets of strains independent from those used to build the model [58]. Although tailored to Staphylococcus aureus, mounting information on H. influenzae diversity may provide the necessary conditions to apply this type of framework to the prediction of virulence phenotypes using H. influenzae genome sequences. Laboratory experiments have led to important findings relating organism adaptation to genomic evolution. Continuous monitoring of long-term evolution in natural systems is expanding our knowledge of these processes in situ. We highlight here two exemples. Thus, the evolutionary dynamics of a lineage of Pseudomonas aeruginosa as it adapted to the airways of several individual CF patients over 200,000 bacterial generations has been reported. In contrast to predictions based on in vitro evolution experiments, the
Int. Microbiol. Vol. 15, 2012
169
evolving lineage showed limited diversification, in which an initial period of rapid adaptation caused by a small number of mutations with pleiotropic effects was followed by a period of genetic drift with limited phenotypic change and a genomic signature of negative selection. This pattern suggests that the evolving lineage reached a major adaptive peak in the fitness landscape [72]. Independently, in a retrospective study of a Burkholderia dolosa outbreak among CF patients, the genomes of 112 isolates collected from 14 individuals over 16 years were sequenced. Seventeen of the bacterial genes had acquired non-synonymous mutations that were detected in multiple individuals, indicating parallel adaptive evolution. Importantly, these mutations shed light on the genetic basis of pathogenic phenotypes [40]. NTHi acute and chronic infection has been associated with the progression of cigarette-smokerelated diseases such as COPD, which suggests the ability of this pathogen to adapt to a human niche rich in free radicals and other aromatic compounds present in smoke. This type of disease state offers a unique natural system for continuous monitoring of the long-term evolution of H. influenzae in the upper and lower airways of humans.
Final remarks Its relatively small genome size and wide genetic plasticity, together with its asymptomatic colonizer–virulence duality and prominent association with chronic respiratory diseases make noncapsulated H. influenzae a unique bacterial system for studies of microbial adaptation, pathogenesis, and long-term microbial evolution in human hosts exposed to external deleterious agents. Access to comprehensive strain panels and detailed clinical data from the respective hosts, when combined with extensive whole-genome sequencing and systematic phenotypic analysis in large number of isolates, will provide extensive insights into NTHi pathogenesis as well as both the tools to predict virulence and information on bacterial evolution and adaptation. Now that microbial whole-genome sequencing is becoming routine in diagnostic and public-health microbiology, this may be the right time to tackle detailed studies of the opportunistic pathogen nontypable H. influenzae. Acknowledgements. We thank Drs. Cristina Prat (Germans Trias i Pujol Hospital) and Josefina Liùares (University Hospital Bellvitge) for providing strains, Dr. Laura Calatayud for helping with PFGE and clinical data, and Dr. Pau Morey for helpful reading of the manuscript. This work has been funded by grants from the Health Institute Carlos III (ISCIII), grant PI09/00130, and from the Health Department of the Government of Navarra, Spain (Call 2011) to J.G., and by grant PI09/01904 (ISCIII) to J. Liùares. CIBERES is an initiative from ISCIII, Spain.
170
Int. Microbiol. Vol. 15, 2012
Competing interest. None declared.
References 1. Agrawal A, Murphy TF (2011) Haemophilus influenzae infections in the H. influenzae type b conjugate vaccine era. J Clin Microbiol 49:3728-3732 2. Barnes PJ (2004) Mediators of chronic obstructive pulmonary disease. Pharmacol Rev 56:515-548 3. Bayliss CD, Sweetman WA, Moxon ER (2004) Mutations in Haemophilus influenzae mismatch repair genes increase mutation rates of dinucleotide repeat tracts but not dinucleotide repeat-driven pilin phase variation rates. J Bacteriol 186:2928-2935 4. Buchinsky FJ, Forbes ML, Hayes JD, Shen K, Ezzo S, Compliment J, Hogg J, Hiller NL, Hu FZ, Post JC, Ehrlich GD (2007) Virulence phenotypes of low-passage clinical isolates of nontypeable Haemophilus influenzae assessed using the chinchilla laniger model of otitis media. BMC Microbiol 7:56 5. Buscher AZ, Burmeister K, Barenkamp SJ, St Geme JW 3rd (2004) Evolutionary and functional relationships among the nontypeable Haemophilus influenzae HMW family of adhesins. J Bacteriol 186:4209-4217 6. Chin CL, Manzel LJ, Lehman EE, Humlicek AL, Shi L, Starner TD, Denning GM, Murphy TF, Sethi S, Look DC (2005) Haemophilus influenzae from patients with chronic obstructive pulmonary disease exacerbation induce more inflammation than colonizers. Am J Respir Crit Care Med 172:85-91 7. Cholon DM, Cutter D, Richardson SK, Sethi S, Murphy TF, Look DC, St Geme JW 3rd (2008) Serial isolates of persistent Haemophilus influenzae in patients with chronic obstructive pulmonary disease express diminishing quantities of the HMW1 and HMW2 adhesins. Infect Immun 76:4463-4468 8. Dawid S, Barenkamp SJ, St Geme JW 3rd (1999) Variation in expression of the Haemophilus influenzae HMW adhesins: a prokaryotic system reminiscent of eukaryotes. Proc Natl Acad Sci USA 96:1077-1082 9. Deadman ME, Hermant P, Engskog M, Makepeace K, Moxon ER, Schweda EK, Hood DW (2009) Lex2B, a phase-variable glycosyltransferase, adds either a glucose or a galactose to Haemophilus influenzae lipopolysaccharide. Infect Immun 77:2376-2384 10. Deadman ME, Lundstrom SL, Schweda EK, Moxon ER, Hood DW (2006) Specific amino acids of the glycosyltransferase LpsA direct the addition of glucose or galactose to the terminal inner core heptose of Haemophilus influenzae lipopolysaccharide via alternative linkages. J Biol Chem 281:29455-29467 11. Dixon K, Bayliss CD, Makepeace K, Moxon ER, Hood DW (2007) Identification of the functional initiation codons of a phase-variable gene of Haemophilus influenzae, lic2A, with the potential for differential expression. J Bacteriol 189:511-521 12. Duim B, Bowler LD, Eijk PP, Jansen HM, Dankert J, van Alphen L (1997) Molecular variation in the major outer membrane protein P5 gene of nonencapsulated Haemophilus influenzae during chronic infections. Infect Immun 65:1351-1356 13. Ecevit IZ, McCrea KW, Marrs CF, Gilsdorf JR (2005) Identification of new hmwA alleles from nontypeable Haemophilus influenzae. Infect Immun 73:1221-1225 14. Ecevit IZ, McCrea KW, Pettigrew MM, Sen A, Marrs CF, Gilsdorf JR (2004) Prevalence of the hifBC, hmw1A, hmw2A, hmwC, and hia genes in Haemophilus influenzae isolates. J Clin Microbiol 42:3065-3072
garmendia et al.
15. Erwin AL, Allen S, Ho DK, Bonthuis PJ, Jarisch J, Nelson KL, Tsao DL, Unrath WC, Watson ME Jr., Gibson BW, Apicella MA, Smith AL (2006) Role of lgtC in resistance of nontypeable Haemophilus influenzae strain R2866 to human serum. Infect Immun 74:6226-6235 16. Erwin AL, Bonthuis PJ, Geelhood JL, Nelson KL, McCrea KW, Gilsdorf JR, Smith AL (2006) Heterogeneity in tandem octanucleotides within Haemophilus influenzae lipopolysaccharide biosynthetic gene losA affects serum resistance. Infect Immun 74:3408-3414 17. Erwin AL, Nelson KL, Mhlanga-Mutangadura T, et al. (2005) Characterization of genetic and phenotypic diversity of invasive nontypeable Haemophilus influenzae. Infect Immun 73:5853-5863 18. Farjo RS, Foxman B, Patel MJ, Zhang L, Pettigrew MM, McCoy SI, Marrs CF, Gilsdorf JR (2004) Diversity and sharing of Haemophilus influenzae strains colonizing healthy children attending day-care centers. Pediatr Infect Dis J 23:41-46 19. Fleischmann RD, Adams MD, White O, et al. (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269:496-512 20. Fox KL, Cox AD, Gilbert M, Wakarchuk WW, Li J, Makepeace K, Richards JC, Moxon ER, Hood DW (2006) Identification of a bifunctional lipopolysaccharide sialyltransferase in Haemophilus influenzae: incorporation of disialic acid. J Biol Chem 281:40024-40032 21. Fox KL, Li J, Schweda EK, Vitiazeva V, Makepeace K, Jennings MP, Moxon ER, Hood DW (2008) Duplicate copies of lic1 direct the addition of multiple phosphocholine residues in the lipopolysaccharide of Haemophilus influenzae. Infect Immun 76:588-600 22. Fox KL, Yildirim HH, Deadman ME, Schweda EK, Moxon ER, Hood DW (2005) Novel lipopolysaccharide biosynthetic genes containing tetranucleotide repeats in Haemophilus influenzae, identification of a gene for adding O-acetyl groups. Mol Microbiol 58:207-216 23. Garmendia J, Morey P, Bengoechea JA (2012) Impact of cigarette smoke exposure on host-bacterial pathogen interactions. Eur Respir J 39:467-477 24. Geluk F, Eijk PP, van Ham SM, Jansen HM, van Alphen L (1998) The fimbria gene cluster of nonencapsulated Haemophilus influenzae. Infect Immun 66:406-417 25. Gilsdorf JR, Marrs CF, Foxman B (2004) Haemophilus influenzae: genetic variability and natural selection to identify virulence factors. Infect Immun 72:2457-2461 26. Giufre M, Carattoli A, Cardines R, Mastrantonio P, Cerquetti M (2008) Variation in expression of HMW1 and HMW2 adhesins in invasive nontypeable Haemophilus influenzae isolates. BMC Microbiol 8:83 27. Griffin R, Bayliss CD, Herbert MA, Cox AD, Makepeace K, Richards JC, Hood DW, Moxon ER (2005) Digalactoside expression in the lipopolysaccharide of Haemophilus influenzae and its role in intravascular survival. Infect Immun 73:7022-7026 28. Griffin R, Cox AD, Makepeace K, Richards JC, Moxon ER, Hood DW (2003) The role of lex2 in lipopolysaccharide biosynthesis in Haemophilus influenzae strains RM7004 and RM153. Microbiology 149:3165-3175 29. Hallstrom T, Resman F, Ristovski M, Riesbeck K (2010) Binding of complement regulators to invasive nontypeable Haemophilus influenzae isolates is not increased compared to nasopharyngeal isolates, but serum resistance is linked to disease severity. J Clin Microbiol 48:921-927 30. Harrison A, Dyer DW, Gillaspy A, Ray WC, Mungur R, Carson MB, Zhong H, Gipson J, Gipson M, Johnson LS, Lewis L, Bakaletz LO, Munson RS, Jr. (2005) Genomic sequence of an otitis media isolate of nontypeable Haemophilus influenzae: comparative study with H. influenzae serotype d, strain KW20. J Bacteriol 187:4627-4636 31. Heath PT, Booy R, Azzopardi HJ, Slack MP, Fogarty J, Moloney AC, Ramsay ME, Moxon ER (2001) Non-type b Haemophilus influenzae disease: clinical and epidemiologic characteristics in the Haemophilus influenzae type b vaccine era. Pediatr Infect Dis J 20:300-305
Diversity of noncapsulated H. influenzae
32. High NJ, Jennings MP, Moxon ER (1996) Tandem repeats of the tetramer 5′-CAAT-3′ present in lic2A are required for phase variation but not lipopolysaccharide biosynthesis in Haemophilus influenzae. Mol Microbiol 20:165-174 33. Hill C (2012) Virulence or niche factors: what’s in a name? J Bacteriol 194:5725-5727 34. Hill DJ, Toleman MA, Evans DJ, Villullas S, Van Alphen L, Virji M (2001) The variable P5 proteins of typeable and non-typeable Haemophilus influenzae target human CEACAM1. Mol Microbiol 39:850-862 35. Hogg JS, Hu FZ, Janto B, Boissy R, Hayes J, Keefe R, Post JC, Ehrlich GD (2007) Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strains. Genome Biol 8:R103 36. Hood DW, Deadman ME, Cox AD, Makepeace K, Martin A, Richards JC, Moxon ER (2004) Three genes, lgtF, lic2C and lpsA, have a primary role in determining the pattern of oligosaccharide extension from the inner core of Haemophilus influenzae LPS. Microbiology 150:2089-2097 37. Hood DW, Deadman ME, Engskog MK, Vitiazeva V, Makepeace K, Schweda EK, Moxon R (2010) Genes required for the synthesis of heptose-containing oligosaccharide outer core extensions in Haemophilus influenzae lipopolysaccharide. Microbiology 156:3421-3431 38. Hood DW, Makepeace K, Deadman ME, Rest RF, Thibault P, Martin A, Richards JC, Moxon ER (1999) Sialic acid in the lipopolysaccharide of Haemophilus influenzae: strain distribution, influence on serum resistance and structural characterization. Mol Microbiol 33:679-692 39. Krasan GP, Cutter D, Block SL, St Geme JW 3rd (1999) Adhesin expression in matched nasopharyngeal and middle ear isolates of nontypeable Haemophilus influenzae from children with acute otitis media. Infect Immun 67:449-454 40. Lieberman TD, Michel JB, Aingaran M, Potter-Bynoe G, Roux D, Davis MR, Jr., Skurnik D, Leiby N, LiPuma JJ, Goldberg JB, McAdam AJ, Priebe GP, Kishony R (2011) Parallel bacterial evolution within multiple patients identifies candidate pathogenicity genes. Nat Genet 43:1275-1280 41. Lijek RS, Weiser JN (2012) Co-infection subverts mucosal immunity in the upper respiratory tract. Curr Opin Immunol 24:417-423 42. Lomholt H, van Alphen L, Kilian M (1993) Antigenic variation of immunoglobulin A1 proteases among sequential isolates of Haemophilus influenzae from healthy children and patients with chronic obstructive pulmonary disease. Infect Immun 61:4575-4581 43. Lysenko E, Richards JC, Cox AD, Stewart A, Martin A, Kapoor M, Weiser JN (2000) The position of phosphorylcholine on the lipopolysaccharide of Haemophilus influenzae affects binding and sensitivity to C-reactive protein-mediated killing. Mol Microbiol 35:234-245 44. Martí-Lliteras P, López-Gómez A, Mauro S, Hood DW, Viadas C, Calatayud L, Morey P, Servin A, Linares J, Oliver A, Bengoechea JA, Garmendia J (2011) Nontypable Haemophilus influenzae displays a prevalent surface structure molecular pattern in clinical isolates. PLoS One 6:e21133 45. McCrea KW, Xie J, LaCross N, Patel M, Mukundan D, Murphy TF, Marrs CF, Gilsdorf JR (2008) Relationships of nontypeable Haemophilus influenzae strains to hemolytic and nonhemolytic Haemophilus haemolyticus strains. J Clin Microbiol 46:406-416 46. Mell JC, Shumilina S, Hall IM, Redfield RJ (2011) Transformation of natural genetic variation into Haemophilus influenzae genomes. PLoS Pathog 7:e1002151 47. Mira A, Martin-Cuadrado AB, D’Auria G, Rodriguez-Valera F (2010) The bacterial pan-genome: a new paradigm in microbiology. Int Microbiol 13:45-57 48. Moxon R, Bayliss C, Hood D (2006) Bacterial contingency loci: the role of simple sequence DNA repeats in bacterial adaptation. Annu Rev Genet 40:307-333
Int. Microbiol. Vol. 15, 2012
171
49. Murphy TF, Brauer AL, Schiffmacher AT, Sethi S (2004) Persistent colonization by Haemophilus influenzae in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 170:266-272 50. Murphy TF, Kirkham C (2002) Biofilm formation by nontypeable Haemophilus influenzae: strain variability, outer membrane antigen expression and role of pili. BMC Microbiol 2:7 51. Murphy TF, Kirkham C, Sethi S, Lesse AJ (2005) Expression of a peroxiredoxin-glutaredoxin by Haemophilus influenzae in biofilms and during human respiratory tract infection. FEMS Immunol Med Microbiol 44:81-89 52. Murphy TF, Lesse AJ, Kirkham C, Zhong H, Sethi S, Munson RS Jr. (2011) A clonal group of nontypeable Haemophilus influenzae with two IgA proteases is adapted to infection in chronic obstructive pulmonary disease. PLoS One 6:e25923 53. Nakamura S, Shchepetov M, Dalia AB, Clark SE, Murphy TF, Sethi S, Gilsdorf JR, Smith AL, Weiser JN (2011) Molecular basis of increased serum resistance among pulmonary isolates of non-typeable Haemophilus influenzae. PLoS Pathog 7:e1001247 54. Oliver A, Mena A (2010) Bacterial hypermutation in cystic fibrosis, not only for antibiotic resistance. Clin Microbiol Infect 16:798-808 55. Pettigrew MM, Foxman B, Marrs CF, Gilsdorf JR (2002) Identification of the lipooligosaccharide biosynthesis gene lic2B as a putative virulence factor in strains of nontypeable Haemophilus influenzae that cause otitis media. Infect Immun 70:3551-3556 56. Poje G, Redfield RJ (2003) Transformation of Haemophilus influenzae. Methods Mol Med 71:57-70 57. Power PM, Bentley SD, Parkhill J, Moxon ER, Hood DW (2012) Investigations into genome diversity of Haemophilus influenzae using whole genome sequencing of clinical isolates and laboratory transformants. BMC Microbiol 12:273 58. Priest NK, Rudkin JK, Feil EJ, van den Elsen JM, Cheung A, Peacock SJ, Laabei M, Lucks DA, Recker M, Massey RC (2012) From genotype to phenotype: can systems biology be used to predict Staphylococcus aureus virulence? Nat Rev Microbiol 10:791-797 59. Rodriguez CA, Avadhanula V, Buscher A, Smith AL, St Geme JW 3rd, Adderson EE (2003) Prevalence and distribution of adhesins in invasive non-type b encapsulated Haemophilus influenzae. Infect Immun 71:1635-1642 60. Schweda EK, Richards JC, Hood DW, Moxon ER (2007) Expression and structural diversity of the lipopolysaccharide of Haemophilus influenzae: implication in virulence. Int J Med Microbiol 297:297-306 61. Sethi S, Wrona C, Grant BJ, Murphy TF (2004) Strain-specific immune response to Haemophilus influenzae in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 169:448-453 62. Spahich NA, St Geme JW 3rd (2011) Structure and function of the Haemophilus influenzae autotransporters. Front Cell Infect Microbiol 1:5 63. St Geme JW 3rd, Kumar VV, Cutter D, Barenkamp SJ (1998) Prevalence and distribution of the hmw and hia genes and the HMW and Hia adhesins among genetically diverse strains of nontypeable Haemophilus influenzae. Infect Immun 66:364-368 64. Syed SS, Gilsdorf JR (2007) Prevalence of hicAB, lav, traA, and hifBC among Haemophilus influenzae middle ear and throat strains. FEMS Microbiol Lett 274:180-183 65. Twelkmeyer B, Deadman ME, Haque E, Li J, Hood DW, Schweda EK (2011) The role of lic2B in lipopolysaccharide biosynthesis in Haemophilus influenzae strain Eagan. Carbohydr Res 346:12621266 66. Weimer KE, Armbruster CE, Juneau RA, Hong W, Pang B, Swords WE (2010) Coinfection with Haemophilus influenzae promotes pneumococcal biofilm formation during experimental otitis media and impedes the progression of pneumococcal disease. J Infect Dis 202:1068-1075
172
Int. Microbiol. Vol. 15, 2012
67 Weiser JN, Pan N, McGowan KL, Musher D, Martin A, Richards J (1998) Phosphorylcholine on the lipopolysaccharide of Haemophilus influenzae contributes to persistence in the respiratory tract and sensitivity to serum killing mediated by C-reactive protein. J Exp Med 187:631-640 68. Weiser JN, Shchepetov M, Chong ST (1997) Decoration of lipopolysaccharide with phosphorylcholine: a phase-variable characteristic of Haemophilus influenzae. Infect Immun 65:943-950 69. Whitby PW, Seale TW, VanWagoner TM, Morton DJ, Stull TL (2009) The iron/heme regulated genes of Haemophilus influenzae: comparative transcriptional profiling as a tool to define the species core modulon. BMC Genomics 10:6 70. Wild CP (2012) The exposome: from concept to utility. Int J Epidemiol 41:24-32
garmendia et al.
71. Xie J, Juliao PC, Gilsdorf JR, Ghosh D, Patel M, Marrs CF (2006) Identification of new genetic regions more prevalent in nontypeable Haemophilus influenzae otitis media strains than in throat strains. J Clin Microbiol 44:4316-4325 72. Yang L, Jelsbak L, Marvig RL, Damkiaer S, Workman CT, Rau MH, Hansen SK, Folkesson A, Johansen HK, Ciofu O, Hoiby N, Sommer MO, Molin S (2011) Evolutionary dynamics of bacteria in a human host environment. Proc Natl Acad Sci USA 108:7481-7486 73. Zhang L, Xie J, Patel M, Bakhtyar A, Ehrlich GD, Ahmed A, Earl J, Marrs CF, Clemans D, Murphy TF, Gilsdorf JR (2012) Nontypeable Haemophilus influenzae genetic islands associated with chronic pulmonary infection. PLoS One 7:e44730
RESEARCH REVIEW International Microbiology (2012) 15:173-183 DOI: 10.2436/20.1501.01.170 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Microorganisms in desert rocks: the edge of life on Earth Jacek Wierzchos,* Asunción de los Ríos, Carmen Ascaso National Museum of Natural Sciences, Spanish National Research Council (CSIC), Madrid, Spain Received 18 October 2012 · Accepted 30 November 2012
Summary. This article reviews current knowledge on microbial communities inhabiting endolithic habitats in the arid and hyper-arid regions of our planet. In these extremely dry environments, the most common survival strategy is to colonize the interiors of rocks. This habitat provides thermal buffering, physical stability, and protection against incident UV radiation, excessive photosynthetically active radiation, and freeze–thaw events. Above all, through water retention in the rocks’ network of pores and fissures, moisture is made available. Some authors have argued that dry environments pose the most extreme set of conditions faced by microorganisms. Microbial cells need to withstand the biochemical stresses created by the lack of water, along with temperature fluctuations and/or high salinity. In this review, we also address the variety of ways in which microorganisms deal with the lack of moisture in hyper-arid environments and point out the diversity of microorganisms that are able to cope with only the scarcest presence of water. Finally, we discuss the important clues to the history of life on Earth, and perhaps other places in our solar system, that have emerged from the study of extreme microbial ecosystems. [Int Microbiol (2012); 15(4):173-183]
Keywords: arid environments · endoliths · hyper-arid deserts · lithobiontic microorganisms · desert rocks
Introduction Although water is essential for life, even the tiniest amount may be sufficient for the survival of some microorganisms, as long as the accompanying environmental conditions are stable over long periods. Such conditions, which may eventually become extreme, are often found in the arid environments, or so-called deserts, of our planet. The main indicator of the dryness of a desert is its aridity index (AI), defined as the ratio
*Corresponding author: J. Wierzchos Museo Nacional de Ciencias Naturales Serrano, 115 28006 Madrid, Spain Tel. +34-917822084. Fax +34-915640800 E-mail: j.wierzchos@mncn.csic.es
between mean annual rainfall and mean annual evapotranspiration. Hyper-arid and arid regions with an AI of less than 0.20 occupy some 36.2 million km2, making up 20 % of the Earth’s surface area (Fig. 1). However, extremely arid conditions may be found in hyper-arid areas of AI under 0.05, usually with an annual rainfall of less than 25 mm. These areas occupy around 10.0 million km2 and therefore represent 7.5 % of the Earth’s surface (Fig. 1). Northern and southern polar regions may also be arid or hyper-arid [46], but note that Figure 1 only shows the Dry Valleys of Antarctica as a hyper-arid zone. Mean annual temperatures are >18 °C in hot deserts and <18 °C in cold deserts, while polar deserts have cold temperatures all-yearround, with maximum temperatures below freezing (polar frost) or 0 to 10 °C (polar tundra) [45]. As examples of hyper-arid deserts, we should mention a large part of the Atacama Desert (northern Chile) and some zones of the Negev Desert (Israel).
Int. Microbiol. Vol. 15, 2012
Wierzchos et al.
Int Microbiol
174
Fig. 1. World deserts classified as arid (AI = 0.2–0.05) and hyper-arid (AI < 0.05) according to the United Nations Environment Program (UNEP). Arrows indicate the hyper-arid deserts noted in this review as the regions examined by the authors: Atacama Desert, Chile; Dry Valleys, Antarctica; Negev Desert, Israel. (AI: aridity index.)
While specialized organisms can exist in all but the most arid parts of the Earth, at some point water is too scarce to permit the full range of functions necessary to sustain viable populations of organisms, and biological adaptation to desiccation is no longer possible. We call this threshold the dry limit of life. Understanding the dry limit of life is critical to maintain the water activity envelope for life on Earth, and to consider the possibility of life elsewhere.
Lithobiontic microorganisms in arid environments The lack of moisture that defines a desert determines the regulation of biological activity by an ephemeral availability of water. However, the disappearance of water from a cell leads to severe, often lethal, stress. Even in only moderately dry air, cell dehydration may be instantly lethal for most species [4] with a water activity limit (aw) of 0.61. In air conditions, this corresponds to a relative humidity (RH) of 61 %. Moreover, crucial for the survival of organisms in arid environments is their ability to reversibly activate metabolism, allowing growth during the short periods when water is available and
the delay of metabolic activity during dehydration [27]. Desiccation-tolerant cells implement structural, physiological, and molecular mechanisms to survive a severe water deficit. While these mechanisms are still poorly understood, it is clear that the dryness, or aridity, of a desert is not the only condition unfavorable for life. In desert zones, besides the scarcity of water, microorganisms also need to withstand solar fluxes, including lethal UV light, high and low temperatures and their rapid fluctuations, high rates of water evaporation, prolonged periods of desiccation, oligotrophic conditions, and frequently high salinity levels such as those in evaporitic rock habitats. Even brief exposure to solar radiation can cause cell death within a few hours [9]. Despite these numerous hurdles for life, researchers have been able to detect the presence of microorganisms in all of Earth’s deserts. It has thus become apparent that through a long process of evolution microbes have developed colonization strategies, with their survival in the extreme desert habitat dependent upon a delicate balance between favorable and less favorable conditions. Since any disturbance in this balance could have lethal consequences, these microhabitats generally sustain low levels of biomass [36,51]. The inhospitable conditions of extreme deserts have induced or obliged microbial life to search out the microhabitats
Microorganisms in desert rocks
Int. Microbiol. Vol. 15, 2012
most suitable for life. One of these microhabitats consists of the pores and fissures inside rocks. Thus, in hyper-arid deserts, life is essentially present in the form of microorganisms that take refuge in such endolithic habitats. Beginning with the pioneering studies of Imre E. Friedmann and Rosali Ocampo [e.g., 22] on the endolithic microorganisms of the Antarctic Dry Valleys, it has been established that endolithic habitats normally offer microorganisms better moisture conditions than the outside environment, and that these habitats protect them from high UV radiation and wind and temperature fluctuations, while still allowing the passage of light needed for photosynthesis. In addition, the mineral deposits found in association with endolithic microorganisms create a relatively isolated, closed environment that efficiently recycles nutrients. The bioreceptivity, or susceptibility, of rocks to endolithic colonization is thought to mainly depend on the physical and chemical properties of the rock substrate [25], including the rock’s mineral composition, its permeability, the presence of chemical compounds, the structure and distribution of pores, and other factors such as water retention capacity, pH, and exposure to climate and nutrient sources [10,11,28,32,41]. Lithobiontic microorganisms can grow on the rock surface (epilithic growth), rock underside (hypolithic growth), or inside the rock (endolithic growth) (Fig. 2). According to
Int Microbiol
Fig. 2. The diagram indicates the possible lithobiontic habitats of microorganisms. epilithic (rock surface); hypolithic (rock underside in contact with the soil); endolithic (the main habitats of hyper-arid deserts, and further divided into cryptoendolithic, chasmoendolithic and hypoendolithic).
175
Golubic and Nienow [24,40], the endolithic habitat can be subdivided into: (i) cryptoendolithic, consisting of natural pore spaces within the rock that are usually indirectly connected to the rock surface; (ii) chasmoendolithic, consisting of fissures and cracks also connected to the rock surface, and (iii) the recently defined hypoendolithic habitat [58], in which pore spaces are not in contact with the soil but occur on the underside of the rock and make contact with the underlying soil.
Hypolithic colonization When desert conditions become drier, epilithic microbial life decays and “transfers” to the hypolithic habitat. Hypolithic colonization can be viewed as a stress avoidance strategy whereby the overlying mineral substrate provides protection from incident UV radiation, freeze–thaw events, and excessive photosynthetically active radiation (PAR), as well as thermal buffering and physical stability, while enhancing moisture availability from the surrounding soil [7]. For example, for Mojave Desert hypolithic cyanobacteria maximum photosynthesis rates at low light levels are 200–400 mmol m–2 s–1, with lower rates measured at higher light intensities [50].
Int. Microbiol. Vol. 15, 2012
Wierzchos et al.
Int Microbiol
176
Fig. 3. Endolithic communities found within the sandstones of the University Valle (Dry Valleys, Antarctica). (A) Sandstone showing disaggregation of the rock surface due to the physical actions of endolithic microorganisms (the arrow points to a zone of cryptoendolithic colonization). (B) Closer view of an endolithic microbial community (open arrow) appearing at a depth of 2 mm from the rock surface (long arrow indicates the rock surface); (q) quartz grains. (C) Same area as in image (A), visualized by epifluorescence microscopy and showing autofluorescence emitted by phototrophic microorganisms (red signal). (D) In situ 3-D reconstruction of the microbial community appearing in (B), visualized by epifluorescence microscopy operated in structural illumination microscopy (SIM) mode, where: (a) algae (red signal); (h) hyphae (blue signal); (b) heterotrophic bacteria (green signal due to SYBR Green staining); the arrow heads point to decayed algal remains. (E,F) In situ scanning electron microscopy in backscattered electron mode (SEM-BSE) images of: (b) cryptoendolithic, and (c) chasmoendolithic associations of algae and hyphae in pores and fissures between quartz grains (q).
In the McMurdo Dry Valleys of Antarctica and the Atacama Desert of Chile, unicellular cyanobacteria (frequently species of the genus Chroococcidiopsis sp.) take refuge along with filamentous forms, fungi, green algae, and sometimes even diatom algae [12,37,53]. The rock substrate of these hot and cold deserts frequently comprises semitransparent quartz rocks [3,7,33,50,53]. However, hypolithic colonization on the
underside of opaque rocks has been also reported, including in the Arctic and Antarctic polar deserts [8]. Indeed, hypolithic microbial colonization is widely present in almost all arid environments. In the Mojave Desert of the southwestern USA, hypolithic colonization covers almost 100 % of the quartz rocks [40]. Despite the importance of hypolithic habitats in arid environments, these are not a main focus of this review.
Microorganisms in desert rocks
Endolithic colonization In some zones of the hyper-arid desert, epilithic and hypolithic habitats are insufficiently “secure” and life takes refuge in the rock interior (Fig. 2). The endolithic environment is extreme and most likely arises from seeding by a relatively small reservoir (metacommunity) of microorganisms highly adapted to this environment [52]. In such endolithic habitats, chasmo- and cryptoendolithic colonization are the predominant modes. Fissures and cracks connected to the surface of rocks form chasmoendolithic habitats. Symbiotic associations of chasmoendolithic lichen have been observed in the fissures and cracks of granites (Fig. 3c) [16], as have chasmoendolithic colonies of cyanobacteria in granites in different zones of the Antarctic Dry Valleys [17]. Cryptoendolithic microorganisms live in the spaces created by pores in rocks. Since microorganisms occupy spaces beneath the rock surface, rocks composed only of translucent grains become colonized by cryptoendolithic phototrophs accompanied by heterotrophs. Cryptoendolithic communities are macroscopically recognizable as a tinted band in the rock interior at a depth of a few millimeters below the surface. Cryptoendoliths have been found in sandstone rocks, granites and meteorized basalts, gneisses, limestones, marbles, porous volcanic rocks, gypsum crusts, and halite. Figure 3 provides examples from the Dry Valleys of the cryptoendolithic colonization of porous sandstones composed of quartz grains (Fig. 3A–F). Cryptoendolithic communities are perhaps the clearest example of how a biotype is able to avoid climate extremes. These communities were described for the first time in 1976, within porous sandstones of the Dry Valleys region [22], The Dry Valleys, one of Antarctica’s largest ice-free areas, are characterized by their extremely cold temperatures and extreme aridity. Their surface mineral soils are extremely dry, with a mass water content typically below 2 %, which is equivalent to the water contents of many of the world’s hottest deserts [6]. Precipitation is low, generally <100 mm/yr water equivalents, and always in the form of snow, much of which sublimes before reaching the soils. One of the most outstanding features of cryptoendolithic associations is their complexity and diversity. The most abundant is the community dominated by cryptoendolithic lichens [20], sometimes accompanied by colonies of melanized fungi and heterotrophic bacteria [14]. Black fungi also have been isolated as members of lichendominated cryptoendolithic communities [49]. Also present in the cryptoendolithic sandstone habitat are colonies of
Int. Microbiol. Vol. 15, 2012
177
cyanobacteria of different genera, such as Chroococcidiopsis and Gloeocapsa, along with free-living algae [23,47]. The connected pore network and translucent properties of the lithic substrate are sufficient for endolithic colonization of an extremely dry environment. Thus, small mixed communities of phototrophic cyanobacteria, heterotrophic bacteria, and fungi have been described in the Antarctic Peninsula, within translucent gypsum crusts [29]. The cryptoendolithic colonization of gypsum crusts by cyanobacteria and nonphotosynthetic bacteria has been also described in arid desert areas in Jordan, Tunisia, and the Mojave and Atacama Deserts [19]. An abundance of diverse cryptoendolithic colonizations was recently found within crusts composed of gypsum and anhydrite in the hyper-arid core of the Atacama Desert [58]. This ecosystem contains associations of algae and fungi as well as non-lichenized algae, melanized fungi, cyanobacteria, and non-photosynthetic bacteria. In some of these crusts, novel observations have been made of the colonization of hypoendolithic habitats by associations of algae and fungi (Fig. 4A,B). However, in the same desert, there are areas of extreme aridity where gypsum crusts lack apparent signs of any colonization, nor is there any evidence of hypolithic colonization [53]. While after several years of research, this zone of the Atacama Desert, called Yungay, was considered an absolute limit for photosynthetic life [39,53], later studies conducted in this area generated surprising results regarding the microbial ecology of extreme and hyper-arid environments. In the study by Wierzchos et al. [57], the presence of photosynthetic microbial life was detected in an environment as harsh as the interior of evaporite rocks composed of sodium chloride (halite), at a site that is possibly the driest in the world (Fig. 4C–E). Molecular biology analyses of these endolithic communities revealed that cyanobacteria are the dominant microorganisms and that they are accompanied by heterotrophic bacteria and archaea [18]. The ribosomal RNA gene sequence of these microorganisms indicates that in most cases they are as yet undescribed but are closely related to microbial forms inhabiting other hypersaline environments. These endolithic communities have been detected 3–7 mm below the surface of the halites of Yungay, distributed in the pores and inner fractures of the rocks. The halites of other hyper-arid sites of the Atacama Desert (Salar Llamara and Salar Grande) are colonized as well [18], but in a more dispersed manner and even in deep subsurface zones [26,44]. Hence, not only evaporite rocks in the hyper-arid environment of the Atacama Desert serve as a refuge for endolithic microbial life. Besides halites, it has recently
Int. Microbiol. Vol. 15, 2012
Wierzchos et al.
Int Microbiol
178
Fig. 4. Endolithic communities found within lithic habitats in the Atacama Desert (Chile); (A,B) Hypoendolithic communities within gypsum crusts (the arrow indicates the fractured gypsum crust showing a green colonization zone) and in situ SEM-BSE (scanning electron microscopy in backscattered electron mode) image of an association of algae (a) and fungal hyphae (h), among gypsum crystals (gy). (C–E) Cryptoendolithic communities within halite (NaCl) rocks: (C) landscape of the Yungay zone showing halite deposits and a fractured piece of halite (hl) bearing a greyish colonization zone indicated by the arrow; (D) in situ LT-SEM (low temperature SEM) micrograph showing cyanobacteria (cy) living among halite crystals; (E) TEM image showing cyanobacterial cells embedded in a thick extracellular polymeric substances (EPS) layer (open arrow). (F–H) Cryptoendolithic communities within volcanic (ignimbrite) rock: (F) stereoscopic microscopy view of ignimbrite revealing a green layer of endolithic microorganisms beneath the rock surface (arrow); (G) LT-SEM image of a bottle-shaped pore close to the ignimbrite surface totally filled with microorganisms; (H) bright-field image of cyanobacterial cells extracted from the cryptoendolithic community; (H’) fluorescence microscopy image of the same aggregate revealing cyanobacterial aggregates (red autofluorescence) and associated heterotrophic bacteria (SYBR Green stained DNA structures).
been discovered that volcanic rocks, specifically, the weakly-welded rhyolitic ignimbrites, harbor within large viable cryptoendolithic communities of cyanobacteria and heterotrophic bacteria [59] (Fig. 4F–H). In these rocks, endolithic aggregates colonize vesicle pores and spaces
between glass shards to an average depth of 1–2 mm beneath the ignimbrite surface. As with other porous rock substrates, the ignimbrite habitat helps to retain moisture after a wetting event, in addition to absorbing harmful UV radiation and attenuating the PAR fraction of light. Maximum penetration
Microorganisms in desert rocks
of cryptoendolithic microorganisms in the ignimbrite fabric is likely a compromise between these factors and the maximum penetration of photosynthetic light. In colonized ignimbrite the main source of liquid water is sporadic rainfall events such that <100 h of photosynthetic activity is possible over a year [59]. Hence, ignimbrite endoliths in this region rank amongst the microorganisms best adapted to withstand long periods of desiccation, and they are able to resume metabolic activity shortly after a wetting event. The dominance in the community structure of Chroococcidiopsis sp., a cyanobacterium well known for its desiccation tolerance, supports this claim. This is the first known example of an endolithic microbial community colonizing rocks of volcanic origin in an extremely dry environment. A similar simple endolithic ecosystem within sandstone rocks was described several decades ago in the southern Negev Desert of Israel [21]. In his pioneering work, E.I. Friedmann examined the microbiota of Nubian sandstone cliffs close to Timna Park (Negev). Understanding the important role played by cyanobacteria in this habitat, Friedmann hypothesized that, owing to the crust formed, the microclimate in the rock interior could differ from the outside climate. Friedmann was the author of papers revealing the existence of microbial ecosystems inside rocks, i.e., endolithic colonization. He discovered cryptoendolithic cyanobacteria, primarily Chroococcidiopsis sp., and heterotrophic bacteria forming a green layer up to 2 mm thick, located less than 1 mm below the sandstone rock surface [21]. Endolithic prokaryotes seem best adapted to survive the temperature fluctuations and nearly continuous drought that characterize this extreme, hot desert habitat. They are capable of ‘switching’ their metabolic activities on and off in response to rapid changes in environmental conditions. According to long-term measurements in the Negev Desert, average rainfall is less than 20 mm/yr [31]; instead, fog and dew seem to be frequent and relatively abundant sources of liquid water for microbial lithobiontic colonization in this desert [34].
Main microbial colonizers of endolithic habitats Endolithic communities from hyper-arid environments comprise microorganisms in different physiological states. Living and dead photosynthetic and non-photosynthetic microorganisms are found in the communities [15,55]. Microbial death, extinction, and fossilization are common phenomena in endolithic Antarctic communities [2,56]. Unexpectedly,
Int. Microbiol. Vol. 15, 2012
179
microhabitats with very different microclimate conditions and substrates host a variety of similar eukaryotic microorganisms with similar spatial relations. For example, algal and fungal associations have been observed in endolithic microhabitats in the granite rocks of maritime Antarctica [1] and the Ross Sea Coast [2]. This same association has also been detected in gypsum crusts of the hyper-arid core of the Atacama Desert [58] and in limestone at a high-altitude arid site in Tibet [62]. The authors of the latter study reported that endoliths were dominated by eukaryotic phylotypes suggestive of lichenized associations. In contrast, several studies have indicated that the endolithic communities of arid and hyperarid deserts comprise relatively simple communities dominated by cyanobacteria, with some heterotrophic components [5,15,18,19,29,57]. According to these works, Archaea and Eukaryotes may be absent or present in low abundance when endolithic communities are dominated by cyanobacteria. Although the natural habitat of the Negev Desert is nearly always dry, experiments on Chroococcidiopsis sp. isolated from this hyper-arid region have shown that this cyanobacterium incorporates CO2 only when matric water potentials are above 10 MPa (equivalent to RH > 93 %) [48]. In contrast to the simple endolithic ecosystems found in hot deserts (Atacama and Negev), a much more complex community exists within sandstone and granite rocks from the Dry Valleys (Antarctica). These ecosystems in cold deserts are frequently composed of different types of microorganisms, including endolithic lichens with eukaryotic photobionts (family Chlorophyceae), although with disorganized thalli, but they host few cyanobacteria [1,2]. Ecosystems in the Negev and Atacama are, nevertheless, simpler, with a predominance of cyanobacteria [42] and sometimes even the presence of epilithic cyanolichens (C. Ascaso, personal communication). This is because hot deserts are more hostile for endolithic microbial life. Our molecular biology and microscopy approaches (SEM-BSE, TEM, FM and CLSM) to the study of endolithic ecosystems colonizing sandstone in the Negev Desert (Timna Park) have confirmed previous results in addition to revealing the presence of primary producers (Chroococcidiopsis sp.) living within sandstone rocks (Fig. 5).
Moisture as the key abiotic driver The irregular system of pores and natural fissures of a rock provides an efficient protective network for microorganisms and creates a place for the absorption, condensation, and retention of water [52]. Studies conducted in both cold and hot
Int. Microbiol. Vol. 15, 2012
Wierzchos et al.
Int Microbiol
180
Fig. 5. Cryptoendolithic communities within sandstone from the Negev Desert (Israel). (A) Fractured sandstone from Timna Park, with a greenish colonization zone running parallel to the surface indicated by the arrow. (B) In situ confocal laser scanning microscopy (CLSM) image of cyanobacterial colonies forming aggregates. (C) In situ low temperature SEM (LT-SEM) showing cryofractured cyanobacteria. (D) Transmission electron microscopy (TEM) image of a cyanobacterial (Chroococcidiopsis) cell, in which thylakoids can be seen.
deserts have shown that their microbial communities are welladapted to withstand long periods of desiccation followed by brief episodes of rehydration, and that they can resume their metabolic activity within minutes of rehydration. A study on the microbial communities of the Negev Desert showed that night-time hydration by dew activates respiration ,which continues after daybreak until metabolic inactivation caused by desiccation occurs [38]. However, those authors observed that with cyanobacteria serving as the photobiont, and some free-living cyanobacteria, some dehydrated lichens were
unable to reactivate their photosynthetic metabolism simply by their hydration under conditions of high air humidity. This was indeed the case for Microcoleous sociatus inhabiting the soil crust of the Negev Desert. Notwithstanding, it was noted that desiccated populations of cultures of the same organism achieve turgor and are capable of photosynthesis at a RH of 96 % [38]. To date, little is known about the photosynthetic properties of endolithic lichens. Wessels and Kappen [54] measured the photosynthetic properties of endo- and epilithic lichens on sandstone (South Africa) and correlated them with
Microorganisms in desert rocks
local microclimate conditions. Lichens were found to be particularly well-adapted to the extremely varying conditions in which they occurred. In arid and semi-arid regions, water is the key environmental factor limiting photosynthesis [54,61]. In contrast, the photosynthetic properties of endolithic sandstone lichens in the cold desert of Antarctica are mainly limited by low temperatures [30]. Liquid water, with its corresponding water activity index aw = 1, is essential for cell rehydration processes. However, for several decades the possibility has been considered that microorganisms are able to survive under conditions in which aw indices are below 1 (down to 0.61), corresponding to an air RH of 61–100 %. The mechanisms used by microorganisms to survive such as low levels of aw (or RH) are still not fully understood. Thus, RH values much below 100 % (at which there is no water condensation) may also trigger the metabolic activity of phototrophic microorganisms. For example, the cryptoendolithic lichens that inhabit sandstones of the Dry Valleys start photosynthesis at RH levels ≥70 % [42], and cultured algae (Trebouxia sp.) are capable of photosynthesis at a RH of 80 % [43]. However, like other prokaryotes, to carry out photosynthesis, endolithic cyanobacteria inhabiting the sandstones of the Negev Desert require a relatively high RH, in excess of 90 % [42]. It has been recently shown that a high air RH in a hyper-arid zone of the Atacama Desert induces the abundant endolithic (but also epilithic) colonization of crusts of calcium sulfate (gypsum) [58]. In contrast, a low yearly RH in another area of the Atacama results in the virtual absence of colonization of the same substrate. Thus, there is now mounting evidence that some microbial communities in arid zones absorb and retain water vapor, and not only liquid water. Nienow [40] has described an “imbibition” process whereby endolithic microorganisms in the Negev Desert are able to absorb water, causing them to swell. According to that study, 300–450 h yr–1 of such imbibing supports colonization by endolithic lichens, whereas below this value endolithic habits are only colonized by the fungus Lichenothelia sp., associated with cyanobacteria and eukaryotic algae. In some of the hyper-arid zones of the Atacama Desert, one rainfall event can be separated from the next by several years such that scarce liquid water in the form of precipitations cannot be a source of water for microorganisms. However, high night- time RH levels along with low temperatures could give rise to dew/water vapor condensation on rock surfaces. Kidron [35] has speculated on the role played by dew in desert zones, while Büdel et al. [5] have been able to simulate the amount of water condensed on endolithically colonized granite rock surfaces in the Dry Valleys. These authors have found that the
Int. Microbiol. Vol. 15, 2012
181
intensity of dew and therefore the quantity of condensed water depends on the dew point, not of the air, but of the material on which the water condenses, which in turn is determined by its heat conductivity properties. As the consequence of dew/ condensation and also sometimes of fog, in some hyper-arid desert zones with occasionally high RHs, it is possible to find epilithic colonizations composed mainly of lichens. In fact, epilithic lichens have been found in the more humid areas of the Negev Desert and recently in some zones of the Atacama Desert, where they colonize gypsum crusts [58]. Lichens are symbiotic associations comprising a photobiont (phototrophic microorganism) and a fungus (mycobiont) that sometimes take the form of a lichen thallus. Lichen thalli designated as heteromeric generally have a superior cortex, and their structure is conducive to maintaining a humid environment within the thallus. Consequently, the photobiont’s cells may be hydrated for a sufficiently long period of time to trigger the metabolic activity of the symbionts as a water-retaining strategy. In the case of hygroscopic minerals such as halite, a nighttime rise in RH to above 75 % might lead to deliquescence, which would provide liquid water for an endolithic microbial community [13]. When the deliquescence RH is reached, water vapor condenses as a saturated aqueous solution on the surfaces of the crystals and/or the pores among the crystals. It is this water per se or its evaporation within the rock that promotes the hydration of endolithic colonies. Condensation and the build up of water inside the halites normally occur at sunrise, such that the water and light necessary for photosynthesis are simultaneously provided. However, the sporadic nature of deliquescence events makes this environment one of the most surprising and extreme for life on Earth. Interesting data on novel water sources for endolithic life in the hyper-arid zone of the Atacama Desert have been recently reported by Wierzchos et al. [60], who have shown that halite endoliths can obtain liquid water through spontaneous capillary condensation at RHs much lower than the deliquescence RH of NaCl. This condensation could occur inside nano-pores smaller than 100 nm in a newly characterized halite phase that is intimately associated with the endolithic aggregates. This nano-porous phase helps to retain liquid water for longer periods of time by preventing its evaporation even in extremely dry air conditions. While conditions outside the halite pinnacles were shown to always be extremely dry, the pinnacle interior was found to remain wet for 5362 h yr–1, with pore water brine available to endolithic microorganisms during 61 % of the year.
182
Int. Microbiol. Vol. 15, 2012
Endoliths as targets for the search for life outside our planet Life has developed strategies that have allowed organisms to survive in physically and chemically hostile environments. Extremely dry deserts are a good place to investigate the limits of life on our planet and therefore the strategies used by microorganisms to adapt to such conditions. The study of extreme microbial ecosystems can provide us with important clues to the history of life on Earth and perhaps in other places in our solar system. Deserts are important reservoirs of diversity. The strategies developed by living organisms to adapt to conditions of scarce water availability and climate change over time enrich the biota in endemic taxa that do not exist in other terrestrial ecosystems. The life and death of microorganisms and their biosignatures may bear excellent witness to past and present climate changes [2]. Scientists have long acknowledged the need to better understand the limits of life on Earth before undertaking searches for life beyond our planet: we cannot identify what we do not recognize. The existence of habitats capable of supporting abundant phototrophic and heterotrophic communities in an environment that precludes most life forms suggests that, if similar habitats were to be found on Mars, these should be considered important targets for the search for life. Indeed, chloride- and sulfate-bearing deposits have been recently discovered in many areas of Mars. In fact, the ignimbrite rocks tentatively identified in Gale Crater, the landing site of the Mars Science Laboratory (MSL) mission, might be an interesting target for its rover, Curiosity. Acknowledgements. This work was funded by grants CGL201016004 and CTM 2009-12838 -C04-03 from the Spanish Ministry of Science and Innovation. J.W. was supported by grant NNX12AD61G of the NASA Exobiology program. Competing interests. None declared.
References 1. Ascaso C, Wierzchos J (2002) New approaches to the study of Antarctic lithobiontic microorganisms and their inorganic traces, and their application in the detection of life in Martian rocks. Int Microbiol 5:215-222 2. Ascaso C, Wierzchos J (2003) The search for biomarkers and microbial fossils in Antarctic rock microhabitats. Geomicrobiol J 20:439-450 3. Azúa-Bustos A, González-Silva C, Mancilla RA, Salas L, Gómez-Silva B, McKay CP, Vicuña R (2011) Hypolithic cyanobacteria supported mainly by fog in the Coastal Range of the Atacama Desert. Microb Ecol 61:568-581
Wierzchos et al.
4. Billi D, Potts M (2002) Life and death of dried prokaryotes. Res Microbiol 153:7-12 5. Büdel B, Bendix J, Bicker FR, Allan TG (2008) Dewfall as a water source frequently activates the endolithic cyanobacterial communities in the granites of Taylor Valley, Antarctica. J Phycol 44:1415-1424 6. Cary SC, McDonald IR, Barrett JE, Cowan DA (2010) On the rocks: The microbiology of Antarctic Dry Valley soils. Nat Rev Microbiol 8:129-138 7. Chan Y, Lacap DC, Lau MCY, Ha KY, Warren-Rhodes KA, Cockell CS, Cowan DA, McKay CP, Pointing SB (2012) Hypolithic microbial communities: Between a rock and a hard place. Environ Microbiol 14:2272-2282 8. Cockell CS, Stokes MD (2006) Hypolithic colonization of opaque rocks in the Arctic and Antarctic polar desert. Arctic Antarctic Alpine Res 38:335-342 9. Cockell CS, McKay CP, Warren-Rhodes K, Horneck G (2008) Ultraviolet radiation-induced limitation to epilithic microbial growth in arid deserts—Dosimetric experiments in the hyperarid core of the Atacama Desert. J Photochem Photobiol B: Biology 90:79-87 10. Cockell CS, Olsson-Francis K, Herrera A, Meunier A (2009a) Alteration textures in terrestrial volcanic glass and the associated bacterial community. Geobiology 7:50-65 11. Cockell CS, Olsson K, Knowles F, Kelly L, Herrera A, Thorsteinsson T, Marteinsson V (2009b) Bacteria in weathered basaltic glass, Iceland. Geomicrobiol J 26:491-507 12. Cowan DA, Khan N, Pointing SB, Cary C (2010) Diverse hypolithic refuge communities in the McMurdo Dry Valleys. Antarctic Sci 22:714-720 13. Davila AF, Gomez-Silva B, de los Ríos A, Ascaso C, Olivares H, McKay CP, Wierzchos J (2008) Facilitation of endolithic microbial survival in the hyperarid core of the Atacama Desert by mineral deliquescence. J Geophys Res Biogeosci 113 G01028. DOI: 10.1029/2007JG000561 14. de la Torre JR, Goebel BM, Friedmann EI, Pace NR (2003) Microbial diversity of cryptoendolithic communities from the McMurdo Dry Valleys, Antarctica. Appl Environ Microbiol 69:3858-3867 15. de los Ríos A, Wierzchos J, Sancho LG, Ascaso C (2004) Exploring the physiological state of continental Antarctic endolithic microorganisms by microscopy. FEMS Microbiol Ecol 50:143-152 16. de los Ríos A, Wierzchos J, Sancho LG, Green TGA, Ascaso C (2005) Ecology of endolithic lichens colonizing granite in continental Antarctica. Lichenology 37:383-395 17. de los Ríos A, Grube M, Sancho LG, Ascaso C (2007) Ultrastructural and genetic characteristics of endolithic cyanobacterial biofilms colonizing Antarctic granite rocks. FEMS Microbiol Ecol 59:386-395 18. de los Ríos A, Valea S, Ascaso C, Davila A, Kastovsky J, McKay CP, Gómez-Silva B, Wierzchos J (2010) Comparative analysis of the microbial communities inhabiting halite evaporites of the Atacama Desert. Int Microbiol 13:79-89 19. Dong H, Rech JA, Jiang H, Sun H, Buck BJ (2007) Endolithnic cyanobacteria in soil gypsum: occurences in Atacama (Chile), Mojave (United States), and Al-Jafr Basin (Jordan) Deserts. J Geophys Research G: Biogeosci 112 G02030. DOI: 101029/2006JG000385 20. Friedmann EI (1981) Endolithic microorganisms in the Dry Valleys of Antarctica. Antarctic J USA 16:174-175 21. Friedmann EI, Lipkin Y, Ocampo R (1967) Desert algae of the Negev (Israel). Phycologia 6:185-196 22. Friedmann EI, Ocampo R (1976) Endolithic blue green algae in the Dry Valleys: primary producers in the Antarctic desert ecosystem. Science 193:1247-1249 23. Friedmann EI, Hua M, Ocampo-Friedmann R (1988) Cryptoendolithic lichen and cyanobacterial communities of the Ross Desert, Antarctica. Polarforshung 58:251-259
Microorganisms in desert rocks
24. Golubic S, Friedmann EI, Schneider J (1981) The lithobiontic ecological niche, with special reference to microorganisms. J Sediment Petrol 51:475-478 25. Guillitte O (1995) Bioreceptivity: a new concept for building ecology studies. Sci Total Environ 167:215-220 26. Gramain A, Díaz GC, Demergasso C, Lowenstein TK, McGenity TJ (2011) Archaeal diversity along a subterranean salt core from the Salar Grande (Chile). Environ Microbiol 13:2105-2121 27. Harel Y, Ohad I, Kaplan A (2004) Activation of photosynthesis and resistance to photoinhibition in cyanobacteria within biological desert crust. Plant Physiol 136:3070-3079 28. Herrera A, Cockell CS, Self S, Blaxter M, Reitner J, Thorsteinsson T, Arp G, Dröse W, Tindle AG (2009) A cryptoendolithic community in volcanic glass. Astrobiology 9:369-381 29. Hughes KA, Lawley B (2003) A novel Antarctic microbial endolithic community within gypsum crusts. Environ Microbiol 5:555-565 30. Kappen L, Friedmann EI (1983) Ecophysiology of lichens in the Dry Valleys of Southern Victoria Land, Antarctica. II. CO2 gas exchange in cryptoendolithic lichens. Polar Biol 1:227-232 31. Katznelson I (1958) Rainfall in Palestine. Meterol Papers 8:37-70 (in Hebrew) 32. Kelly LC, Cockell CS, Herrera-Belaroussi A, Piceno Y, Andersen G, DeSantis T, Brodie E, Thorsteinsson T, Marteinsson V, Poly F, LeRoux X (2011) Bacterial diversity of terrestrial crystalline volcanic rocks, Iceland. Microb Ecol 62:69-79 33. Khan N, Tuffin M, Stafford W, Cary C, Lacap DC, Pointing SB, Cowan D (2011) Hypolithic microbial communities of quartz rocks from Miers Valley, McMurdo Dry Valleys, Antarctica. Polar Biol 34:1657-1668 34. Kidron GJ (1999) Altitude dependent dew and fog in the Negev Desert, Israel. Agricul Forest Meteorol 96:1-8 35. Kidron G (2000) Microclimate control upon sand microbiotic crusts, western Negev Desert, Israel. Geomorphology 36:1-18 36. Kuhlman KR, Venkat P, La Duc MT, Kuhlman GM, McKay CP (2008) Evidence of a microbial community associated with rock varnish at Yungay, Atacama Desert, Chile. J Geophys Res Biogeosci 113, G04022. DOI: 10.1029/2007JG000677 37. Lacap DC, Warren-Rhodes KA, McKay CP, Pointing SB (2011) Cyanobacteria and chloroflexi-dominated hypolithic colonization of quartz at the hyper-arid core of the Atacama Desert, Chile. Extremophiles 15:31–38 38. Lange OL, Meyer A, Büdel B (1994) Net photosynthesis activation of a desiccated cyano-bacterium without liquid water in high air humidity alone. Experiments with Microcoleus sociatus isolated from a desert soil crust. Functional Ecol 8:52-57 39. Navarro-González R, Rainey FA, Molina P, Bagaley DR, Hollen BJ, De La Rosa J, Small AM, Quinn RC, Grunthaner FJ, Cáceres L, GomezSilva B, McKay CP (2003) Mars-like soils in the Atacama Desert, Chile, and the dry limit of microbial life. Science 302:1018-1021 40. Nienow JA (2009) Extremophiles: dry environments (including cryptoendoliths). In: Encyclopedia of Microbiology. Elsevier, Oxford, pp 159-173 41. Omelon CR, Pollard WH, Grant Ferris F (2007) Inorganicb species distribution and microbial diversity within high Arctic cryptoendolithic habitats. Microb Ecol 54:740-752 42. Palmer RJ, Friedmann EI (1990) Water relations and photosynthesis in the cryptoendolithic microbial habitat of hot and cold deserts. Microb Ecol 19: 111-118 43. Palmer RJ, Friedmann EI (1990) Water relations, thallus structure and photosynthesis in Negev Desert lichens. New Phytol 116:597-603 44. Parro V, De Diego-Castilla G, Moreno-Paz M, et al. (2011) A microbial oasis in the hypersaline Atacama subsurface discovered by a life
Int. Microbiol. Vol. 15, 2012
183
detector chip: Implications for the search for life on Mars. Astrobiology 11:969-996 45. Peel MC, Finlayson BL, McMahon TA (2007) Updated world map of the Köppen-Geiger climate classification. Hydrol Earth System Sci 11:1633-1644 46. Pointing SB, Belnap J (2012) Microbial colonization and controls in dryland systems. Nat Rev Microbiol 10:551-562 47. Pointing SB, Chan Y, Lacap DC, Lau MCY, Jurgens JA, Farrell RL (2009) Highly specialized microbial diversity in hyper-arid polar desert. Proc Natl Acad Sci USA 106:19964-19969 48. Potts M, Friedmann EI (1981) Effects of water stress on cryptoendolithic cyanobacteria from hot desert rocks. Arch Microbiol 130:267-271 49. Ruisi S, Barreca D, Selbmann L, Zucconi L, Onofri S (2007) Fungi in Antarctica. Rev Environ Sci Biotech 6:127-141 50. Schlesinger WH, Pippen JS, Wallenstein MD, Hofmockel KS, Klepeis DM, Mahall BE (2003) Community composition and photosynthesis by photoautotrophs under quartz pebbles, southern Mojave Desert. Ecology 84:3222-3231 51. Vestal JR (1988) Biomass of the cryptoendolithic microbiota from the Antarctic desert. Appl Environ Microbiol 54:957-959 52. Walker JJ, Pace NR (2007) Endolithic microbial ecosystems. Annu Rev Microbiol 61:331-347 53. Warren-Rhodes KA, Rhodes KL, Pointing SB, Ewing SA, Lacap DC, Gómez-Silva B, Amundson R, Friedmann EI, McKay CP (2006) Hypolithic cyanobacteria, dry limit of photosynthesis, and microbial ecology in the hyperarid Atacama Desert. Microbial Ecol 52:389-398 54. Wessels D, Kappen L (1994) Aspect, microclimate and photosynthetic activity of lichens in the northern Transvaal and Karoo, South Africa. Cryptogamic Bot 4:242-253 55. Wierzchos J, de los Ríos A, Sancho LG, Ascaso C (2004) Viability of endolithic micro-organisms in rocks from the McMurdo Dry Valleys of Antarctica established by confocal and fluorescence microscopy. J Microsc 216:57-61 56. Wierzchos J, Sancho LG, Ascaso C (2005) Biomineralization of endolithic microbes in rocks from the McMurdo Dry Valleys of Antarctica: implications for microbial fossil formation and their detection. Environ Microbiol 7:566-575 57. Wierzchos J, Ascaso C, McKay CP (2006) Endolithic cyanobacteria in halite rocks from the hyperarid core of the Atacama Desert. Astrobiology 6:415-422 58. Wierzchos J, Cámara B, de los Ríos A, Dávila AF, Sánchez Almazo IM, Artieda O, Wierzchos K, Gómez-Silva B, McKay CP, Ascaso C (2011) Microbial colonization of Ca-sulfate crusts in the hyperarid core of the Atacama Desert: implications for the search for life on Mars. Geobiology 9:44-60 59. Wierzchos J, Davila AF, Artieda O, Cámara-Gallego B, de los Ríos A, Nealson KH, Valea S, Teresa García-González M, Ascaso C (2012) Ignimbrite as a substrate for endolithic life in the hyper-arid Atacama Desert: Implications for the search for life on Mars. Icarus. DOI: 10.1016/ j.icarus.2012.06.009 60. Wierzchos J, Sanchez-Almazo IM, Hajnos M, Swieboda R, Ascaso C (2012) Novel water source for endolithic life in the hyperarid core of the Atacama Desert. Biogeosciences 9:2275-2286 61. Winkler JB, Kappen L (1997) Photosynthetic capacity of endolithic lichens from South-Africa. In: Kappen L (ed) New species and novel aspects in ecology and physiology of lichens. In Honour of O. L. Lange. Bibliotheca Lichenologica Cramer J. Berlin, Stuttgart, pp 165-181 62. Wong F, Lau M, Lacap D, Aitchison J, Cowan D, Pointing S (2010) Endolithic microbial colonization of limestone in a high-altitude arid environment. Microb Ecol 59:689-699
RESEARCH ARTICLE International Microbiology (2012) 15:185-189 DOI: 10.2436/20.1501.01.172 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme Cynthia L. Sheffield,* Tawni L. Crippen, Toni L. Poole, Ross C. Beier Food and Feed Safety Unit, Southern Plains Agricultural Research Center, Agricultural Research Service, U.S. Department of Agriculture, College Station, Texas, USA Received: 28 August 2012 · Accepted 30 October 2012 Summary.The aim of this work was to determine the destructive activity of dextranase, lactoferrin, and lysozyme, against single species biofilms composed of either Klebsiella pneumoniae subsp. pneumoniae or Escherichia coli using the MBEC Assay. Luminescence measurements based on quantitation of the ATP present were used to determine the amount of biofilm elimination and correlated with quantity of live bacteria present in the sample. The data were analyzed employing a two-way ANOVA and Bonferroni post-test. Treatments resulted in percentage reductions of E. coli biofilms ranging from 73 to 98 %. Lactoferrin (40 mg/ml) produced a significantly higher-percentage reduction than lysozyme (10 mg/ml) (P < 0.05), no other significant differences occurred. Similar treatments resulted in percentage reductions of K. pneumoniae subsp. pneumoniae biofilms ranging from 51 to 100 %. Dextranase treatments produced a significantly lower percentage reduction than all other materials (P < 0.05), no other significant differences occurred. No material was capable of complete destruction of both single species biofilms; however, low concentrations of lactoferrin and lysozyme each removed 100 % of the K. pneumoniae subsp. pneumoniae biofilm. Low concentrations of lactoferrin or lysozyme might be beneficial to prevent biofilm formation by K. pneumoniae subsp. pneumoniae. [Int Microbiol 2012; 15(4):185-189] Keywords: Escherichia coli · Klebsiella pneumoniae subsp. pneumoniae · dextranase · lactoferrin · lysozyme · biofilms · food safety
Introduction Approximately 99 % of the microorganisms on Earth exist as microbial communities known as biofilms [5]. Bacterial biofilms occur in a wide variety of natural and human-made environments and have been implicated as a constant source of *Corresponding author: C.L. Sheffield USDA-ARS-SPARC 2881 F & B Rd College Station, TX 77845, USA Tel. +1-9792609221. Fax +1-9792609332 E-mail: cindy.sheffield@ars.usda.gov
pathogens that cause infection and contamination in medical and food processing devices [12]. This has led to an increased interest in probing the molecular mechanisms fundamental to the formation and maintenance of these communities [10]. These factors result in serious economic and environmental impacts and consequently, a growing need exists for effective treatments focusing on biofilm reduction. Ölmez and Temur [15] have examined the effect of ozone, chlorine and organic acid treatments on the removal of Escherichia coli and Listeria monocytogenes embedded inside biofilms on the surface of lettuce leaves. Unfortunately, none of these sanitizing treatments are effective in eradi-
186
Int. Microbiol. Vol. 15, 2012
cating the bacteria. Furukawa et al. [6] have reported that some strong alkaline or acidic decontamination agents are markedly effective for disinfecting Staphylococcus aureus biofilm, as well as E. coli biofilm. Starek et al. [18] have found that toluene reduces average biofilm biomass and thickness, and diminishes the diversity of amplifiable 16S rRNA sequences. Regardless of their respective effectiveness, these materials are either highly corrosive or not suited to numerous environmental decontamination situations. Furukawa et al. [6] have also tested the relatively mild agents EDTA (ethylenediaminetetraacetic acid), SDS (sodium dodecyl sulfate) and Tween 20. These safer compounds, however, are ineffective against S. aureus biofilms and remove only partiallly E. coli biofilms. No ideal biofilm decontamination protocol presently exists and more innovation is needed to develop an effective, relatively robust, and non-corrosive material or cocktail of materials. These treatments must be novel, and for successful treatment, the materials must both kill the bacteria and detach the dead biofilm by removing the extracellular polymeric substances (EPS). Simple disruption of the biofilm without significant cell death permits relocation of viable remnants and eventual formation of a new biofilm [17]. To that end, our research examined three milder decontamination substances (dextranase, lactoferrin, and lysozyme) for their efficacy in the destruction of single species biofilms composed of either Klebsiella pneumoniae subsp. pneumoniae or E. coli.
Materials and methods Bacterial biofilm. Escherichia coli (ATCC 4157) and Klebsiella pneumoniae subsp. pneumoniae (ATCC 4352) were cultured on nutrient agar (NA) plates overnight at 37 °C. Using a sterile cotton swab, a sample of each bacterium was removed from the surface of the overnight culture. The bacteria were resuspended at approximately 107 colony forming units (CFU)/ml in sterile phosphate-buffered saline (PBS) for use as inoculum in the MBEC (minimum biofilm eliminating concentration) Assay (Innovotech, Edmonton, Canada) as per the manufacturer’s directions. Actual inoculum range as determined by serial dilution was 3.15 to 6.00 × 107 CFU/ml for E. coli and 2.35 to 3.40 × 107 CFU/ml for K. pneumoniae subsp. pneumoniae. Each bacterium was run on two-columns of every MBEC plate without any treatments applied as controls. One-column was quantified by serial dilution plating of the biofilm after dislodging via sonication from the growth peg to determine biofilm growth rate, and the second-column was quantified in the same manner as the treated biofilms after dislodging via sonication of biofilm from the growth peg. Treatment material. Treatment concentrations of dextranase (1, 2, 3, and 4 U/ml; A, B, C, D, respectively); lactoferrin (20, 40, 60, and 80 mg/ml; A, B, C, D, respectively) and lysozyme (5, 10, 25, and 50 mg/ml; A, B, C, D,
Sheffield et al.
respectively) dissolved in PBS were evaluated. PBS was run independent of the test material to determine its effect if any on the growth of E. coli and K. pneumoniae subsp. pneumoniae, and quantified in the same manner as the treated biofilms after dislodging via sonication of biofilm from the growth peg. Experimental setup. The experimental design is based on the manufacturer’s suggested protocol; the MBEC assay has also been described in detail elsewhere [4,20]. Briefly, an aliquot of 135 ml of bacterial inoculum was added per well to the MBEC plate and incubated at 37 °C while shaking at 150 rpm overnight. Biofilm formation was viewed as complete after 24 h. At that point, a biofilm colony concentration of ≥107 CFU/ml was achieved as determined by serial dilution plating of the biofilm removed from the growth peg by sonication. After incubation, the peg lids containing the biofilm were transferred into a rinse plate containing 200 ml/well (PBS) at pH 7.2, and incubated for 2 min without agitation at room temperature. The peg lids were then transferred into another plate containing 135 ml/well of each treatment. Each test material concentration was run in quadruplicate wells. The peg lids were then incubated at 37 °C for 1 h. After treatment, the peg lids were transferred into a rinse as described above, and incubated for 2 min without agitation at room temperature before being placed into the recovery wells containing 135 ml/well PBS. The recovery wells and MBEC peg lids were then subjected to 5 min of sonication to dislodge the biofilm from the peg lids. BacTiter-Glo reagent (100 ml/well; Promega, Madison, WI, USA) was added to the suspension, and the samples were mixed for 30 s at 150 rpm and then incubated for 5 min at room temperature. The luminescence was quantified using a VICTOR3 V plate reader (PerkinElmer, Waltham, MA, USA). The resulting live bacterial counts were correlated with a standard curve calculated from known bacterial quantities. Each experiment was replicated three times. Statistical analysis. Data were analyzed using commercially available statistical software (Prism ver. 5.01, GraphPad Software, La Jolla, CA, USA). Within each treatment and bacterial type, a means comparison of concentration was performed using a two-way ANOVA followed by Bonferroni post tests to determine least square means (P < 0.05).
Results Figure 1 shows the percentage of reduction in a 24 h old E. coli biofilm achieved after a 1-h exposure to three individual substances at increasing concentrations. Lactoferrin treatments produced the highest-reduction in biofilm of the three test substances, with a range in reduction of 95 to 98 %. Dextranase treatments were the second most effective, reducing biofilm from 81 to 84 %. Lysozyme treatments showed no significant difference when compared to the dextranase treatment, reducing the biofilm from 73 to 84 %. Figure 2 shows the percentage of reduction in a 24-h-old K. pneumoniae subsp. pneumoniae biofilm achieved after a 1-h exposure to the three substances at increasing concentrations. Lactoferrin and lysozyme treatments each produced a 100 % reduction in biofilms. Dextranase treatments resulted in biofilm reductions ranging from 51 to 65 %.
Int. Microbiol. Vol. 15, 2012
187
Int Microbiol
biofilms Destruction in E. coli and K. pneumoniae
Fig. 1. Percent reduction of the 24-h-old Escherichia coli biofilm resulting from dextranase, lactoferrin and lysozyme treatments at four dosage levels with one 1 h treatment exposure.
Escherichia coli and K. pneumoniae subsp. pneumoniae biofilms were compared; K. pneumoniae subsp. pneumoniae was significantly more resistant to removal by dextranase than was E. coli. Conversely, E. coli was significantly more resistant to removal by lysozyme than was K. pneumoniae subsp. pneumoniae. Unfortunately, none of the materials tested were able to completely eradicate individual biofilms of both E. coli and K. pneumoniae subsp. pneumoniae. PBS had no effect on the growth of either of the two bacteria (data not shown).
Discussion Dextranase, lactoferrin, and lysozyme were selected because they are capable of destroying the physical integrity of the matrix, interfere with bacterial adhesion or initiate cell detachment from surfaces in addition to destroying the individual bacterial cells. As such, they are good alternatives to biocides and/or disinfectants which can contribute to the propagation and spread of resistant strains and may have restricted use because of environmental regulations.
Dextranase is an enzyme produced by several bacteria and molds which catalyzes the endohydrolysis of 1,6-a-glucosidic linkages in dextran resulting in damage to the biofilm where dextran is employed as a key component [7,9]. Lactoferrin is a globular glycoprotein widely found in secretory fluids, whose antimicrobial activity results from its iron-binding properties which oxidize the bacteria via the formation of peroxides— which in turn deprives the bacteria of this essential element for growth; disruption of the cell membrane; and targeting of H+-ATPase [2,16]. Lysozyme is a glycoside hydrolase enzyme found in a number of secretions that disrupts bacterial cell walls by catalyzing hydrolysis of 1,4-b-linkages between N-acetylmuramic acid and N-acetyl-d-glucosamine residues in peptidoglycan and between N-acetyl-d-glucosamine residues in chitodextrins [11]. Dextranase, lactoferrin, and lysozyme were used at different concentrations to determine their effectiveness at eliminating mature single species biofilms of E. coli or K. pneumoniae subsp. pneumoniae. To our knowledge, this is the first report of these substances being utilized against K. pneumoniae subsp. pneumoniae biofilms. Yano et al. [21] have found that dextranase at 0.25 % (v/v) produces no significant reduction of Streptococcus mutans or
Int. Microbiol. Vol. 15, 2012
Sheffield et al.
Int Microbiol
188
Fig. 2. Percent reduction of the 24-h-old Klebsiella pneumoniae subsp. pneumoniae biofilm resulting from dextranase, lactoferrin and lysozyme treatments at four dosage levels with 1 h treatment exposure.
S. sobrinus biofilms. Our results demonstrated that dextranase was the least effective overall of the three substances tested; however, against E. coli and K. pneumoniae, it did achieve some biofilm destruction. This difference in findings can be explained by the content of dextran and glucans within the biofilm matrix, which is linked to the bacterial species, present [1,13,19]. Earlier work with E. coli O157:H7 biofilms has determined that lactoferrin alone is not bacteriostatic, and that, at concentrations between 20 and 40 mg/ml, it does not prevent the growth of E. coli O157:H7 in tryptic soy broth [3,14]. In contrast, we found that lactoferrin was very effective to destroy both single species K. pneumoniae subsp. pneumoniae and E. coli biofilms. The difference in outcome could partially be explained by the observations of Jenssen and Hancock [8], who have reported lactoferrin acting on E. coli by damaging the bacterial membrane and disrupting the bacterial type III secretion system. These actions would be expected to affect the hardiness of a biofilm formed by this bacterial species and thus have a more detrimental effect on biofilms than on planktonic cells.
Previous work has demonstrated the differential effect of lysozyme against various bacterial species. Branen and Davidson [3] have found that lysozyme has a mean inhibitory concentration <500 Âľg/ml on the growth of E. coli O157:H7. In our work, lysozyme at levels as low as 5 Âľg/ml was completely effective (100 %) against K. pneumoniae subsp. pneumoniae biofilms and partially effective (73 %) against E. coli biofilms. The differences between our results and those of Branen and Davidson [3] could be caused by the difference in species or variant and testing in a planktonic vs. biofilm format. The results of our study demonstrate the potential of lactoferrin as an agent to eradicate mature biofilms of K. pneumoniae subsp. pneumoniae. Further, low concentrations of lysozyme or lactoferrin might be beneficial to prevent biofilm formation by gram-negative bacteria, such as E. coli and K. pneumoniae subsp. pneumoniae, thus providing better hygiene in both agricultural and medical arenas. While dextranase achieved biofilm reduction, it was only partial, which minimizes its potential as a control product since biofilms are structured to resist and overcome incomplete degradation. In
biofilms Destruction in E. coli and K. pneumoniae
future work we will examine the effectiveness of these compounds against mature gram-positive biofilms and mixedspecies biofilms. Acknowledgements. The authors wish to thank Andrew Herndon and John Sorkness for their technical assistance. Mention of trade names, proprietary products, or specific equipment is solely for the purpose of providing specific information and does not constitute a guarantee, warranty or endorsement by the U.S. Department of Agriculture and does not imply its approval to the exclusion of other products that may be suitable. Competing interests. None declared.
References 1. Badel S, Laroche C, Gardarin C, Bernardi T, Michaud P (2008) New method showing the influence of matrix components in Leuconostoc mesenteroides biofilm formation. Appl Biochem Biotech 151:364-370 2. Baker EN, Baker HM (2005) Molecular structure, binding properties and dynamics of lactoferrin. Cell Mol Life Sci 62:2531-2539 3. Branen, JK, Davidson, PM (2004) Enhancement of nisin, lysozyme, and monolaurin antimicrobial activities by ethylenediaminetetraacetic acid and lactoferrin. Int J Food Microbiol 90:63-74 4. Ceri H, Olson M, Morck D Storey D Read R, Buret A, Olson B (2001) The MBEC assay system: Multiple equivalent biofilms for antibiotic and biocide susceptibility testing. Methods Enzymol 337:377-385 5. de Carvalho CCCR (2007) Biofilms: Recent developments on an old battle. Recent Pat Biotechnol 1:49-57 6. Furukawa S, Akiyoshi Y, Komoriya M, Ogihara H, Morinaga Y (2010) Removing Staphylococcus aureus and Escherichia coli biofilms on stainless steel by cleaning-in-place (CIP) cleaning agents. Food Control 21:669-672 7. Hayacibara MF, Koo H, Vacca-Smith AM, Kopec LK, Scott-Anne K, Cury JA, Bowen WH (2004) The influence of mutanase and dextranase on the production and structure of glucans synthesized by streptococcal glucosyltransferases. Carbohydr Res 339:2127-2137 8. Jenssen H, Hancock REW (2009) Antimicrobial properties of lactoferrin. Biochimie 91:19-29
Int. Microbiol. Vol. 15, 2012
189
9. Khalikova E, Susi P, Korpela T (2005) Microbial dextran-hydrolyzing enzymes: Fundamentals and applications. Microbiol Mol Biol Rev 69:306-325 10. Kolter R (2010) Biofilms in lab and nature: a molecular geneticist’s voyage to microbial ecology. Int Microbiol 13:1-7 11. Lönnerdal B (2003) Nutritional and physiologic significance of human milk proteins. Am J Clin Nutr 77:1537S-1543S 12. Lu TK, Collins JJ (2007) Dispersing biofilms with engineered enzymatic bacteriophage. Proc Natl Acad Sci USA 104:11197-11202 13. Marotta M, Martino A, De Rosa A, Farina AE, Carteni M, De Rosa M (2002) Degradation of dental plaque glucans and prevention of glucan formation using commercial enzymes. Process Biochem 38:101-108 14. Min S, Harris LJ, Krochta JM (2005) Antimicrobial effects of lactoferrin, lysozyme, and the lactoperoxidase system and edible whey protein films incorporating the lactoperoxidase system against Salmonella enterica and Escherichia coli O157:H7. Food Microbiol Safety 70:M332-M338 15. Ölmez H, Temur SD (2010) Effects of different sanitizing treatments on biofilms and attachment of Escherichia coli and Listeria monocytogenes on green leaf lettuce. LWT - Food Sci Technol 43:964-970 16. Sánchez L, Calvo M, Brock JH (1992) Biological role of lactoferrin. Arch Dis Child 67:657-661 17. Shakeri S, Kermanshahi RK, Moghaddam MM, Emtiazi G (2007) Assessment of biofilm cell removal and killing and biocide efficacy using the microtiter plate test. Biofouling 23:79-86 18. Starek M, Kolev KI, Berthiaume L, Yeung CW, Sleep BE, Wolfaardt GM, Hausner M (2011) A flow cell simulating a subsurface rock fracture for investigations of groundwater-derived biofilms. Int Microbiol 14:163-171 19. Sugiura M, Ito A, Ogiso T, Kato K, Asano H (1973) Studies on dextranase: Purification of dextranase from Penicillium funiculosum and its enzymatic properties. Biochim Biophys Acta-Enzymology 309:357-362 20. Wong HS, Townsend KM, Fenwick SG, Trengove RD, O’Handley RM (2009) Comparative susceptibility of planktonic and 3-day-old Salmonella Typhimurium biofilms to disinfectants. J Appl Microbiol 108:2222-2228 21. Yano A, Kikuchi S, Yamashita Y, Sakamoto Y, Nakagawa Y, Yoshida Y (2010) The inhibitory effects of mushroom extracts on sucrose-dependent oral biofilm formation. Appl Microbiol Biotechnol 86:615-623
INTERNATIONAL MICROBIOLOGY Acknowledgement of Institutional Subscriptions International Microbiology staunchly supports the policy of open access (Open Access Initiative, see Int. Microbiol. 7:157161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of International Microbiology, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Departament de Microbiologia i Parasitologia Sanitàries. Facultat de Farmàcia. Universitat de Barcelona / Societat Catalana de Biologia Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU. Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAMCentro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. Coruña / Biblioteca.
190
Volume 15(4) DECEMBER 2012
Divisió Alimentària del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Laboratorio de Patógenos Bacterianos Intracelulares. Centro Nacional de BiotecnologíaCSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIO-MAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Merck Sharp & Dohme de España, Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Depto. de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of Massachusetts-Amherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / Tecnología de los Alimentos. Facultad de Ciencias. Universidad de Vigo / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.
RESEARCH ARTICLE International Microbiology (2012) 15:191-199 DOI: 10.2436/20.1501.01.172 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Enhanced polyhydroxyalkanoates accumulation by Halomonas spp. in artificial biofilms of alginate beads Mercedes Berlanga,1* David Miñana-Galbis,1 Òscar Domènech,2 Ricardo Guerrero3 Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Barcelona, Spain. 2Physical Chemistry Laboratory V, Faculty of Pharmacy, University of Barcelona, Spain. 3Department of Microbiology, Faculty of Biology, University of Barcelona, Spain
1
Received 15 September 2012 · Accepted 20 October 2012 Summary. Microbial mats are complex but stable, multi-layered and multi-functional biofilms, which are the most frequent bacterial formations in nature. The functional strategies and physiological versatility of the bacterial populations growing in microbial mats allow bacteria to resist changing conditions within their environment. One of these strategies is the accumulation of carbon- and energy-rich polymers that permit the recovery of metabolic activities when favorable conditions are restored. In the present study, we systematically screened microbial mats for bacteria able to accumulate large amounts of the ester carbon polymers polyhydroxyalkanoates (PHA). Several of these strains were isolated from Ebro Delta microbial mats and their ability to accumulate PHA up to 40–60 % of their dry weight was confirmed. According to two identification approaches (16S rRNA and rpoD genes), these strains were identified as Halomonas alkaliphila (MAT-7, -13, -16), H. neptunia (MAT-17), and H. venusta (MAT-28). To determine the mode of growth yielding maximum PHA accumulation, these three different species were cultured in an artificial biofilm in which the cells were immobilized on alginate beads. PHA accumulation by cells that had detached from the biofilm was compared with that of their planktonic counterparts. Experiments in different culture media showed that PHA accumulation, measured as the relative fluorescence intensity after 48 h of incubation at 30 ºC, was higher in immobilized than in planktonic cells, with the exception of cells growing in 5 % NaCl, in which PHA accumulation was drastically lower in both. Therefore, for obtaining high PHA concentrations, the use of immobilized cells may be a good alternative to the PHA accumulation by bacteria growing in the classical, planktonic mode. From the ecological point of view, increased PHA accumulation in detached cells from biofilms would be a natural strategy to improve bacterial dispersion capacity and, consequently, to increase survival in stressed environments. [Int Microbiol 2012; 15(4):191-199] Keywords: Halomonas spp. · polyhydroxyalkanoates (PHA) · immobilized cells · alginate beads · artificial biofilms
Introduction In natural, clinical, and industrial environments, most bacterial populations develop communities that adhere to various *Corresponding author: M. Berlanga Department of Microbiology and Parasitology Faculty of Pharmacy, University of Barcelona Av. Joan XXIII, s/n 08028 Barcelona, Spain Tel. +34-934024497. Fax +34-934024498 E-mail: mberlanga@ub.edu
surfaces to form biofilms, while planktonic, free-swimming cells seem to be only a transitory growth mode [21]. Among the various types of biofilms, microbial mats are highly structured, comprising different functional groups in microspatial proximity and enclosed within a matrix of extracellular polymeric substances. Microbial mat environments are characterized by seasonal fluctuations of flooding and desiccation, and by diel fluctuations of temperature, light, pH, oxygen, sulfide, and nutrients.
192
Int. Microbiol. Vol. 15, 2012
The intracellular storage of polymers such as the ester carbon polymers poly-hydroxyalkanoates (PHA) is a strategy that increases cell survival in changing environments [3,35,37,41]. These polymers are carbon- and energy-rich reserves but they also act as electron sinks involved in maintaining the redox balance [11]. PHA accumulation contributes to the establishment of an environment suitable for bacteria, one that contains high concentrations of organic carbon sources [40]. Microbial mats, as highly diverse and productive systems, accumulate high quantities of PHA under natural conditions [23,30]. PHA accumulation in marine microbial mats has been studied in the community as a whole [30,39] and in isolated strains under laboratory cultivation [2,23,40]. In previous works on Ebro Delta microbial mats, most of the PHA-producing strains isolated belonged to the genus Halomonas [2,40]. According to 16S rRNA gene sequence analysis, the family Halomonadaceae forms a separate phylogenetic lineage within the gamma-proteobacteria. Of its nine genera, the most common is Halomonas, which contains 55 species distributed into two groups, group 1 and group 2 [9]. Members of the Halomonadaceae are gram-negative, chemoorganotrophic, aerobic or facultative anaerobic, moderately halophilic, haloalkaliphilic, halotolerant or non-halophilic. Microbial cells in biofilms are naturally immobilized and display a variety of physiological changes compared to their planktonic counterparts [20,27] To study the production of polyhydroxybutyrate (PHB, one of the most common PHA), Zhang et al. [44] compared the growth of Alcaligenes eutrophus in batch cultures (with different salts concentrations) and in biofilms formed in packed-bed reactors (using different microcarriers and ionic strengths). They observed that although biofilm formation in the packed-bed reactor was limited, the volumetric PHB yield of cells in the void volume was comparable to that of the batch culture. In this work, we studied PHA accumulation in several Halomonas strains isolated from microbial mats grown in artificial biofilms in which the cells were immobilized on alginate beads. In contrast to natural or laboratory biofilms (obtained by adhesion to microcarrier sufaces), cells immobilized by encapsulation on alginate beads do not carry out an adhesion step such that the changes in gene expression that normally follow adhesion are absent [27,42]. Commercial alginates are produced mainly by the brown algae Laminaria hyperborea, Macrocystis pyrifera, and Ascophyllum nodosum. Alginate is a polymer of 1,4-linked β-d-mannuronic acid and α-l-guluronic acid residues in varying proportions, sequence, and molecular weight. Alginate forms a gel when multivalent cations (usually Ca 2+) inter-
berlanga et al.,
act ionically with the blocks of guluronic residues between two different chains, resulting in a 3-D network [24]. From this alginate mass, beads can be produced, as described in Materials and methods. Calcium ions are not uniformly distributed throughout the bead; rather, they are strongly bound in the surface and subsurface of the beads, but only weakly bound in the center [28]. The final strength of the gel depends on the overall fraction of guluronic acid residues, the molecular weight of the polymer, and the Ca 2+ concentration at the time of gelation. Optimal concentrations for the gellification of the Na-alginate complex range from 1 % to 2 % (w/v) [34]. Depending on the characteristics of the alginate beads, bacteria growing on their surfaces are able to form microcolony-like cellular aggregates that can be easily detached and released into the surrounding medium [15,17,19,22,28]. Cells immobilized on alginate beads have been used in the degradation or biotransformation of pollutants [1,10], the production of enzymes [45], and the preservation of cell viability [4]. The main objective of the present work was to investigate the influence of different culture media and growth modes (batch culture of planktonic cells and artificial biofilms made of alginate beads) on PHA accumulation by several strains of Halomonas isolated from microbial mats. Accordingly, PHA accumulation in cells detached from alginate beads was compared with that of their planktonic counterparts to determine whether bacterial immobilization enhanced PHA production. We also considered whether PHA accumulation in newly released cells coild be one of the strategies used by the microbial communities of natural biofilms to cope with stressful environmental conditions.
Materials and methods Phylogenetic analysis and strain identification. DNA extraction and PCR amplification of the 16S rRNA gene for five strains isolated from Ebro Delta microbial mats [2] were performed using previously described methods [25]. The rpoD gene of strains MAT-7, MAT-13, MAT-16, MAT-17, and MAT-28 was PCR-amplified as described by de la Haba et al. [9], except that the temperatures for annealing and extension were 43 ºC and 72 ºC, respectively. Gene rpoD of strain MAT-28 could not be amplified under these conditions. Two primers were designed in this study on the basis of the complete rpoD sequences derived from the whole-genome sequences of H. elongata DSM 2581T (GenBank number FN869568), H. boliviensis LC1T (JH393258), Halomonas sp. GFAJ-1 (AHBC01000043), Halomonas sp. HAL1 (AGIB01000009), and Halomonas sp. TD01 (AFQW01000002). The sequences were aligned using MegAlign (Lasergene, DNASTAR, Madison, WI, USA). The following primers were designed using Primer3 [31]: 119F (5′-CGGATCAGGTGGAAGACATC-3′) and 1357R (5′- ATCATRTGCACGGAATACG-3′). The PCR (50 μl) contained 15 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 0.25 mM of each dNTP, 1 μM of primers 119F
Int. Microbiol. Vol. 15, 2012
PHA in Halomonas immobilized cells
and 1357R (Isogen Life Science, De Meern, the Netherlands), 2.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems-Life Technologies, Carlsbad, CA, USA), and 250 ng of DNA template. The reaction was done in a 2720 thermal cycler (Applied Biosystems) as follows: initial denaturation at 95 ºC for 5 min, 35 cycles of 94 ºC for 60 s, 56 ºC for 60 s, 72 ºC for 90 s, and a final extension at 72 ºC for 10 min. PCR products were purified using the Purelink PCR purification kit (Invitrogen-Life Technologies, Carlsbad, CA, USA) and measured in a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) to assess their optimal concentrations and purity. The BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) was used for sequencing reactions. The nucleotide sequences were determined by the Scientific and Technological Center of the University of Barcelona (CCiTUB), using an ABI PRISM 3730 DNA analyzer (Applied Biosystems). Sequence alignment, pairwise distance and phylogenetic analyses (neighbor-joining method with the Jukes-Cantor model and the pairwise deletion option) were conducted using MEGA5 software [36]. The topological robustness of the phylogenetic trees was evaluated by a bootstrap analysis through 1000 replicates. Isolates were identified using the EzTaxon-e server (http://eztaxon-e.ezbiocloud.net/) [18] and pairwise distance values [26] on the basis of 16S rRNA and rpoD sequence data, respectively. Cell immobilization by alginate beads. Sodium salt alginic acid from Macrocystis pyrifera (61 % mannuronic acid and 39 % glucuronic acid) (Sigma-Aldrich, St. Louis, MO, USA) was prepared by dissolving the alginate powder in warm water to a concentration of 4 % (w/v) and then autoclaving the solution at 121 ºC for 20 min. Cells to be added to the alginate were grown overnight at 30 ºC in tryptic soy broth (TSB) containing 3 % NaCl. The cell suspension was mixed with the alginate (1:1, v/v) at room temperature and stirred to obtain a uniform mixture. Aliquots of 1 ml were withdrawn from this mixture and transferred dropwise into a sterile solution of CaCl2 (0.2 M), resulting in the formation of beads of ca. 2.0 mm diameter. The beads were allowed to further harden in the CaCl 2 solution for 30 min at room temperature and then washed with sterile distilled water to remove the excess Ca 2+. Electron microscopy. Halomonas venusta MAT-28 immobilized in alginate beads was grown for 48 h at 30 ºC in glucose minimal medium supplemented with 3 % NaCl. After a fixation step in 2 % (v/v) glutaraldehyde for 18 h, the beads were cut, stained with osmium tetroxide and uranyl acetate, and then examined in a Leica transmission electron microscope. For scanning electron microscopy (SEM), beads at times 0 and 48 h of incubation were fixed with 2 % (v/v) glutaraldehyde for 18 h and then dehydrated in an ethanol series (20–100 %). The samples were dried, sputter-coated with gold, and observed using a Hitachi S-3400N scanning electron microscope. Spectrofluorometric monitoring of PHA accumulation. Cellular PHA accumulation was measured as the relative fluorescence intensity of cells incubated for 48 h at 30 ºC in different culture media. Two modes of growth were examined: batch culture of planktonic cells and artificial biofilms growing on alginate beads. The culture medium consisted of minimal medium (MM) containing TSB (Scharlau, Barcelona, Spain) diluted 50-fold, plus glucose or glycerol at 5 g/l, 3 or 5 % NaCl, and 0.5 µg Nile red dye (dissolved in dimethylsulfoxide)/ml. The MM was phosphate-free because phosphates retain Ca 2+, which results in extensive disintegration of the alginate beads. For the planktonic assays, cells were grown overnight at 30 ºC in TSB containing 3 % NaCl. An aliquot (1/100) from the overnight culture was transferred to 100-ml flasks containing 25 ml MM and one of the following different combinations of carbon sources and salt: glucose + 3 % NaCl;
193
glucose + 5 % NaCl; glycerol + 3 % NaCl; and glycerol + 5 % NaCl. For the immobilized cells assay, alginate beads were prepared as explained above. Flasks containing 25 ml of the same media used in the planktonic assays were then inoculated with approximately 200 beads. All flask cultures were incubated in the dark at 30 ºC for 48 h with shaking (100 rpm). A 1-ml sample was then removed and centrifuged in a microcentrifuge at 10,000 rpm at room temperature. Pellets were washed and resuspended in 1 ml of phosphate-buffered saline (PBS), pH 7.0. Relative PHA accumulation was measured using an SLM Aminco 8100 spectrofluorometer. The fluorescence excitation- and emission wavelengths of the stained cells in PBS were 543 nm and 598 nm, respectively. Slits of excitation and emission were set to 10 nm at 900 V. PHA accumulation in the two growth modes, planktonic and immobilized cells, was compared. Four measurements using independent bacterial cultures were obtained for confirmation.
Results Phylogenetic analysis and strain identification. The 16S rRNA and rpoD gene sequences from strains MAT-7, MAT-13, MAT-16, MAT-17, and MAT-28 were aligned independently with the respective gene sequences of the type strains belonging to Halomonas group 1 and H. elongata ATCC 33173T, representative of Halomonas group 2 [9]. Phylogenetic tree based on the 16S rRNA sequences (Fig. 1A) showed that all five isolates clustered within Halomonas group 1, comprising two subgroups and clearly separated from H. elongata (group 2). Halomonas group 1 was also subdivided into two subgroups in the phylogenetic tree based on rpoD sequences, but H. elongata clustered in one of these subgroups (Fig. 1B). The 16S rRNA and rpoD gene sequences of strains MAT-7, MAT-13 and MAT-16 were identical. Consequently, these isolates were considered as a single strain, represented by MAT-16. The 16S rRNA genes of MAT-16, MAT-17, and MAT-28 showed sequence similarities higher than 98 % with those of four (H. andesensis, H. hydrothermalis, H. venusta and H. alkaliphila), six (H. sulfidaeris, H. titanicae, H. variabilis, H. boliviensis, H. neptunia and H. alkaliantarctica) and five (H. stevensii, H. andesensis, H. hydrothermalis, H. alkaliphila and H. venusta) type strains of the genus Halomonas, respectively. In the distance matrix obtained from the rpoD sequences, pairwise distance values <3 % were as follows: 2.4 % between MAT-16 and H. alkaliphila DSM 16354 T, 0.2 % between MAT-17 and H. neptunia CECT 5815 T, and 0.9 % and 1.4 % between MAT-28 and H. venusta DSM 4743 T and H. hydrothermalis CECT 5814 T, respectively. Distance values <3 % were also obtained in com-
194
Int. Microbiol. Vol. 15, 2012
berlanga et al.,
A
Int Microbiol
B
Fig. 1. (A) Neighbor-joining phylogenetic tree obtained from 16SrRNA and (B) rpoD gene sequences encompassing strains MAT-7, MAT-13, MAT-16, MAT-17, and MAT-28 and all type strains of Halomonas group 1, and with the type strain of Halomonas group 2, H. elongata. Bootstrap values (>50 %) based on 1000 replicates are shown. Bars indicate sequence distance. (Red: strains of H. alkaliphila; blue: strains of H. venusta; blue: strains of H. neptunia.)
Int. Microbiol. Vol. 15, 2012
195
Int Microbiol
PHA in Halomonas immobilized cells
Fig. 2. Transmission electron micrograph of Halomonas venusta MAT-28 immobilized-cells growing in MM-glucose with 3 % NaCl after 48 h at 30 ºC. (A) Individual cell near the center of an alginate bead. Note the electron-dense peripheral zone sorrounding the cytoplasm. (B) Group of cells forming a microcolony near the surface of the bead, indicating an active state of growth. (C) Scanning electron micrograph of immobilized cells of Halomonas strain MAT-28 at time 0, and (C′) after 48 h of incubation. (D) Microcolonies formed at the surface of a bead and about to detach. Note that several individual cells are protuding from the bumps produced by the presence of the microcolonies (arrows).
parison of H. alkaliphila–H. axialensis–H. meridiana and H. venusta–H. hydrothermalis. All remaining pairwise comparisons were >5 %. Influence of growth mode (planktonic or immobilized cells) on PHA accumulation In previous work we observed that PHA accumulation in MAT-16, MAT-17, and MAT-28 reached steady-state concentrations after 48 h of incubation [2]. Here, Halomonas strains were grown in two modes, planktonically (free swimming) or
as immobilized cells in alginate beads (artificial biofilm). The conditions used for bead preparation (see Materials and methods) favored leakage of entrapped bacteria while the integrity of the beads was maintained (Fig. 2). Cells inside the alginate beads were surrounded by a transparent area, apparently without alginate polymer. These cells did not seem to accumulate PHA, but electron-dense particles were observed near the cytoplasmic membrane (Fig. 2A). On the surface of the bead, however, microcolonies formed and they were surrounded by an unspecified structure, perhaps con-
196
Int. Microbiol. Vol. 15, 2012
berlanga et al.,
Table 1. Number of viable cells on plates of Halomonas strains MAT-16, MAT-17, and MAT-28 using different culture media and growth modes Halomonas alkaliphila MAT-16 Culture medium* (48 h at 30ºC)
Planktonic mode (CFU/ml)
Immobilized (biofilm) mode (CFU/ml)
Halomonas neptunia MAT-17 Planktonic mode (CFU/ml)
Immobilized (biofilm) mode (CFU/ml)
Halomonas venusta MAT-28 Planktonic mode (CFU/ml)
Immobilized (biofilm) mode (CFU/ml)
MM + glucose + 3 % NaCl
9.8 × 108
1.3 × 105
1.0 × 108
4.3 × 105
2.4 × 108
4 × 106
MM + glucose + 5 % NaCl
nd
nd
nd
nd
1.0 × 108
1.2 × 106
MM + glycerol + 3 % NaCl
3.0 × 108
1.5 × 106
1.5 × 107
1.3 × 105
3.2 × 108
2.1 × 106
MM + glycerol + 5 % NaCl
nd
nd
nd
nd
1.5 × 108
2.5 × 106
*MM: minimal medium (see text). nd: not determined.
sisting of minerals precipitated as a result of changes in the alginate polymer due to the cell metabolic activity. Outside this structure, alginate polymer strands were observed. The cells of the microcolonies in the surface lacked the electron dense particles clearly visible in the cells from the center of the beads (Fig. 2B). For Halomonas venusta (MAT-28), the scanning micrographs revealed the formation of bumps on the surface of the beads after 48 h of incubation at 30 °C, but not at time 0 h. Each bump was due to the presence of a growing microcolony (Fig. 2C,D). For all three strains, the number of cells (measured as colony-forming units, CFU, per ml) that had detached from the alginate beads after 48 h and were released into the surrounding medium was two orders of magnitude lower than the CFU/ml determined for parallel cultures in planktonic growth mode (Table 1). The lower growth rate (CFU/ml) of the detached cells might be explained by low nutrient/ oxygen concentration, osmotic pressure, or water activity [16]. Halomonas cells in alginate beads are surrounded by the gel matrix. Immediately after immobilization the cells are distributed homogeneously in the beads that entrap them. However, as substrates and waste products are carried to and from the cells by diffusion, gradients form such that the entrapped cells become heterogeneously distributed inside the bead. Consequently, cells grow and form microcolonies in the peripheral areas of the beads, while no growth occurs in cells situated in the inner parts [22]. Bacterial cells that have accumulated at the periphery were, as a consequence, easily detached from the beads and liberated into the medium.
In the three strains assayed in this work, PHA accumulation in medium containing glucose and 3 % NaCl was higher in detached cells from alginate beads than in planktonic cells. Among all the strains, PHA accumulation was highest in MAT-28 and significantly lower in MAT-17. This result was unexpected because MAT-17 (H. neptunia) is related phylogenetically (by 16S rRNA analysis) to H. boliviensis, in which PHA yields and volumetric productivities are close to the highest amounts reported thus far [26] (Fig. 3A). In the PHA accumulation assay using glycerol as carbon source and 3 % NaCl, only strains MAT-16 and MAT-28 were tested. Accumulation was slightly higher in cells cultured in glycerol rather than glucose. Again, PHA accumulation was higher in detached cells (Fig. 3B). In the presence of 5 % NaCl, PHA accumulation by strain MAT-28 was significantly lower than in culture medium containing 3 % NaCl; this was the case in both planktonic and immobilized cells (Fig. 3C).
Discussion Taxonomic identification and immobilized cells. Based on 16S rRNA gene sequence analysis, strains MAT-16, MAT-17, and MAT-28 were identified as belonging to the genus Halomonas, but they could not be identified at the species level because their similarities with several Halomonas species were higher than 98 % [43]. However, following rpoD sequence analysis, the three strains were identified as H. alkaliphila, H. neptunia and H. venusta,
Fig. 3. PHA accumulation in Halomonas spp. was measured spectrofluorometrically after 48 h of incubation at 30 ÂşC in different culture media (Glu, glucose; Gly, glycerol; and 3 % NaCl or 5Â % NaCl) and in two growth modes: planktonic or artificial biofilm (alginate beads). Data shown are the average of the results of four independent experiments.
respectively, based on pairwise distance values below 3 % [26]. For the same reason, rpoD sequence analysis suggested that H. alkaliphila and H. axialensis are later heterotypic synonyms of H. meridiana and that H. hydrothermalis is a later heterotypic synonym of H. venusta [12]. Influence of growth mode on PHA accumulation. The 4119-kb genome of Halomonas boliviensis contains 3863 genes, of which 160 are related to carbohydrate transport and metabolism [14]. Halomonas can adjust its metabolism
Int. Microbiol. Vol. 15, 2012
197
Int Microbiol
PHA in Halomonas immobilized cells
to optimize cell growth in response to the specific environmental conditions by engaging different combinations of metabolic pathways. Thus, carbon flow will be directed towards the synthesis of more reduced or more oxidized products according to intracellular redox conditions. PHB is synthesized from acetyl-CoA in the presence of excess NADH in the bacterial cytoplasm. Glycerol has a lower oxidation state than glucose and its catabolism renders more reduced products in order to maintain redox balance [11]. In studies on PHB production,
198
Int. Microbiol. Vol. 15, 2012
with glucose as the carbon source, high aeration conditions usually favored high polymer accumulation, whereas low aeration was shown to promote the synthesis of other metabolic products derived from fermentation pathways, such as acetate. However, with glycerol as the carbon source, the highest PHB contents are obtained under conditions of relatively low aeration [7]. This was also the case in our study, in which PHA accumulation by strains MAT-16 and MAT-28 cultured in 3 % NaCl was higher with glycerol than with glucose (Fig. 3) and even higher in cells detached from immobilized alginate beads than in planktonic cells. Alginate-immobilized cells may be subjected to higher stress than planktonic cells, e.g., due to oxygen deprivation, which could also favor polymer accumulation. In Shewanella oneidensis MR-1 detachment of cells from biofilms could be induced by a decrease in oxygen tension, suggesting a physiological link between oxygen sensing and detachment [38]. Other studies have shown that the yield of PHA in Halomonas boliviensis improves under conditions of oxygen limitation. Oxygen depletion is also known to obstruct the tricarboxylic acid cycle because the unconsumed NAD(P)H inhibits citrate synthase, which in several microorganisms results in the utilization of this cofactor for PHB synthesis [29]. In our study, 5 % NaCl, together with either glucose or glycerol resulted in significantly lower PHA accumulation by planktonic as well as immobilized cells than similarly obtained with 3 % NaCl (Fig. 3). This result may reflect the coproduction of PHA and an osmoprotector such as ectoine, in agreement with previous studies [13]. Under salt stress, there are significant variations in the expression of proteins involved in osmoregulation, stress response, energy generation, and transport [5,6,13]. At high salinity, total flux through energy-generating pathways is significantly lower and carbon sources enter in the system as citrate and are mainly diverted to osmolyte synthesis [6]. Acetyl-CoA is a common precursor for the synthesis of PHB, as noted above, and for ectoine; hence, metabolic flux to either of these products could alter production of the other. This sequence of events was proposed to explain the lower PHB production rates and yields when ectoine synthesis was promoted by increasing the salt concentration of the medium [13]. We conclude that, in artificial biofilms made by alginate beads, detached cells of Halomonas spp. accumulate more PHA than their counterparts growing planktonically in the same stressing culture media. In natural biofilms, it has been observed that cell detachment is favored by starvation for nutrients and/or depletion of oxygen [33,38]. As
berlanga et al.,
PHA serve as an endogenous source of carbon and energy during starvation [41], under stress conditions, bacterial cells with higher contents of PHA survive longer than those with lower contents [8,32,35,37]. Detachment is a biologically controlled process [38]. Similar mechanisms might also operate in Halomonas spp. Thus, detached cells from immobilized alginate-beads that accumulate more PHA than planktonic cells could constitute an adaptative advantage for the dispersion in stressful environments by increasing survival in the new planktonic mode of growth. Acknowledgements. This work was supported by grant CGL200908922 (Spanish Ministry of Science and Technology) to RG. We thank the Scientific-Technological Services of the University of Barcelona for SEM samples preparation. RG and MB are members of a CYTED network, the Ibero-American Programme for Science, Technology, and Development. We thank M. Palau for her participation in the taxonomic determinations. Competing interests. None declared.
References 1. Ahamad PYA, Kunhi AAM (2011) Enhanced degradation of phenol by Pseudomonas sp. CP4 entrapped in agar and calcium alginate beads in batch and continuous processes. Biodegradation 22:253-265 2. Berlanga M, Montero MT, Hernández-Borrell J, Guerrero R (2006) Rapid spectrofluorometric screening of poly-hydroxyalkanoate-producing bacteria from microbial mats. Int Microbiol 9:95-102 3. Berlanga M, Paster BJ, Grandcolas P, Guerrero R (2010) Comparison of the gut microbiota from soldier and worker castes of the termite Reticulitermes grassei. Int Microbiol 14:83-93 4. Brachkova MI, Duarte MA, Pinto JF (2010) Preservation of viability and antibacterial activity of Lactobacillus spp. in calcium alginate beads. Eur J Pharma Sci 41:589-596 5. Cai L, Tan D, Aibaidula G, Dong X-D, Chen J-C, Tian W-D, Chen G-Q (2011) Comparative genomics study of polyhydroxyalkanoates (PHA) and ectoine relevant genes from Halomonas sp. TD01 revealed extensive horizontal gene transfer events and co-evolutionary relationships. Microb Cell Factor 10:88 6. Ceylan S, Yilan G, Akbulut BS, Poli A, Kazan D (2012) Interplay of adaptative capabilities of Halomonas sp. AAD12 under salt stress. J Bioscien Bioeng 114:45-52 7. De Almeida A, Giordano AM, Nikel PI, Pettinari MJ (2010) Effects of aeration on the synthesis of poly(3-hydroxybutyrate) from glycerol and glucose in recombinant Escherichia coli. Appl Environ Microbiol 76:2036-2040 8. De Eugenio LI, Escapa IF, Morales V, Dinjaski N, Galán B, García JL, Prieto MA (2010) The turnover of medium-chain-length polyhydroxyalkanoates in Pseudomonas putida KT2442 and the fundamental role of PhaZ depolymerase for metabolic balance. Environ Microbiol 12:207-221 9. De la Haba RR, Márquez MC, Papke RT, Ventosa A (2012) Multilocus sequence analysis of the family Halomonadaceae. Int J Syst Evol Microbiol 62:520-538 10. Dey K, Roy P (2011) Degradation of chloroform by immobilized cells of Bacillus sp. in calcium alginate beads. Biotechnol Lett 33:1101-1105 11. Escapa IF, García JL, Bühler B, Blank LM, Prieto MA (2012) The
PHA in Halomonas immobilized cells
polyhydroxyalkanoate metabolism controls carbon and energy spillage in Pseudomonas putida. Environ Microbiol 14:1049-1063 12. Euzéby JP (2012) List of prokaryotic names with standing in nomenclature [http://www.bacterio.net] 13. Guzmán H, van-Thuoc D, Martín J, Hatti-Kaul R, Quikkaguamán J (2009) A process for the production of ectoine and poly(3-hydroxybutyrate) by Halomonas boliviensis. Appl Microbiol Biotechnol 84:1069-1077 14. Guzmán D, Balderrama-Subieta A, Cardona-Ortuño C, Guevara-Martínez M, Callisaya-Quispe N, Quillaguamán J (2012) Evolutionary patterns of carbohydrate transport and metabolism in Halomonas boliviensis as derived from its genome sequence: influences on polyester production. Aquatic Biosyst 8:9 15. Hüsken LE, Tramper J, Wijffels RH (1996) Growth and eruption of gel-entrapped microcolonies. In: Wijffels RH et al. (eds) Immobilized cells: Basics and applications. Elsevier Science, Amsterdam, the Netherlands, pp 336-340 16. Inanç E, Miller JE, DiBiasio D (1996) Effect of oxygen supply on metabolism of immobilized and suspended Escherichia coli. Biotechnol Bioeng 51:697-702 17. Junter G-A, Coquet L, Vilain S, Jouenne T (2002) Immobilized-cell physiology: current data and potentialities of proteomics. Enzyme Microb Technol 31:201-212 18. Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, Park SC, Jeon YS, Lee JH, Yi H, Won S, Chun J (2012) Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol 62:716-721 19. Klinkenberg G, Lystad KQ, Levine DW, Dyrset N (2001) pH-controlled cell release and biomass distribution of alginate-immobilized Lactococcus lactis subsp. lactis. J Appl Microbiol 91:705-714 20. Knudsen GM, Nielsen M-B, Grassby T, Danino-Appleton V, Thomsen LE, Colquhoun IJ, Brocklehurst TF, Olsen JE, Hinton JCD (2012) A third mode of surface-associated growth: immobilization of Salmonella enterica serovar Thyphimurium modulates the RpoS-directed transcriptional programme. Environ Microbiol 14:1855-1875 21. Kolter R (2010) Biofilms in lab and nature: a molecular geneticist’s voyage to microbial ecology. Int Microbiol 13:1-8 22. Lefebvre J, Vincent J-C (1997) Control of the biomass heterogeneity in immobilized cell systems. Influence of initial cell and substrate concentrations, structure thickness, and type of bioreactors. Enzyme Microb Technol 20:536-543 23. López-Cortés A, Lanz-Landázuri A, García-Maldonado JQ (2008) Screening and isolation of PHB-producing bacteria in a polluted marine microbial mat. Microb Ecol 56:112-120 24. Martinsen A, Skjak-Braek G, Smidsrod O (1989) Alginate as immobilization material. I. Correlation between chemical and physical properties of alginate gel beads. Biotechnol Bioeng 33:79-89 25. Miñana-Galbis D, Farfán M, Fusté MC, Lorén JG (2007) Aeromonas bivalvium sp. nov., isolated from bivalve molluscs. Int J Syst Evol Microbiol 57:582-587 26. Miñana-Galbis D, Farfán M, Lorén JG, Fusté MC (2010) The reference strain Aeromonas hydrophila CIP 57.50 should be reclassified as Aeromonas salmonicida CIP 57.50. Int J Syst Evol Microbiol 60:715-717 27. Monds RD, O’Toole GA (2009) The development model of microbial biofilms: ten years of a paradigm up for review. Trends Microbiol 17:73-87 28. Nava-Saucedo JE, Roisin C, Barbotin J-N (1996) Complexity and heterogeneity of microenvironments in immobilized systems. In: Wijffels RH et al. (eds) Immobilized cells: Basics and applications. Elsevier Science, Amsterdam, the Netherlands, pp 39-46
Int. Microbiol. Vol. 15, 2012
199
29. Quillaguamán J, Delgado O, Mattiasson B, Hatti-Kaul R (2006) Poly(βhydrohybutyrate) production by a moderate halophile, Halomonas boliviensis LC1. Enzyme Microb Technol 38:148-154 30. Rothermich MM, Guerrero R, Lenz RW, Goodwin S (2000) Characterization, seasonal occurrence, and diel fluctuations of poly (hydroxyalkanoate) in photosynthetic microbial mats. Appl Environ Microbiol 66:4279-4291 31. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols. Methods in molecular biology. Humana Press, Totowa, NJ, USA, pp 365-386 32. Ruiz JA, López NI, Fernández RO, Méndez BS (2001) Polyhydroxyalkanoate degradation is associated with nucleotide accumulation and enhances stress resistance and survival of Pseudomonas oleovorans in natural water microcosms. Appl Environ Microbiol 67:225-230 33. Sauer K, Cullen MC, Rickard AH, Zeef LAH, Davies DG, Gilbert P (2004) Characterization of nutrient-induced dispersion in Pseudomonas aeruginosa PAO1 biofilm. J Bacteriol 186:7312-7326 34. Selimoglu SM, Elibol M (2010) Alginate as an immobilization material for MAb production via encapsulated hybridoma cells. Crit Rev Biotechnol 30:145-159 35. Soto G, Setten L, Lisi C, Maurelis C, Mozzicafreddo M, Cuccioloni M, Angeletti M, Ayub ND (2012) Hydroxybutyrate prevents protein aggregation in the halotolerant bacterium Pseudomonas sp. CT13 under abiotic stress. Extremophiles 16:455-462 36. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-2739 37. Tiribelli PM, López N (2011) Poly(3-hydroxybutyrate) influences biofilm formation and motility in the novel Antarctic species Pseudomonas extremaustralis under cold conditions. Extremophiles 15:541-547 38. Thormann KM, Saville RM, Shukla S, Spormann AM (2005) Induction of rapid detachment in Shewanella oneidensis MR-1 biofilms. J Bacteriol 187:1014-1021 39. Villanueva L, Navarrete A, Urmeneta J, Geyer R, Guerrero R, White DC (2007) Monitoring diel variations of physiological status and bacterial diversity in an estuarine microbial mat: an integrated biomarker analysis. Microb Ecol 54:523-531 40. Villanueva L, del Campo J, Guerrero R (2010) Diversity and physiology of polyhydroxyalkanoate-producing and -degrading strains in microbial mats. FEMS Microb Ecol 74:42-54 41. Wang Q, Yu H, Xia Y, Kang Z, Qi Q (2009) Complete PHB mobilization in Escherichia coli enhances the stress tolerance: a potential biotechnological application. Microb Cell Fact. DOI:10.1186/14752859-8-47 42. Wang Y, Yi L, Wu Z, Shao J, Liu G, Fan H, Zhang W, Lu C (2012) Comparative proteomic analysis of Streptococcus suis biofilms and planktonic cells that identified biofilm infection-related immunogenic proteins. PLoS One 7:e33371 43. Yarza P, Ludwig W, Euzéby J, Amann R, Schleifer KH, Glöckner FO, Rosselló-Móra R (2010) Update of the All-Species Living Tree Project based on 16S and 23S rRNA sequence analyses. Syst Appl Microbiol 33:291-299 44. Zhang S, Norrlöw O, Wawrzynczyk J, Dey ES (2004) Poly (3-hydroxybutyrate) biosynthesis in the biofilm of Alcaligenes eutrophus, using glucose enzymatically released from pulp fiber sludge. Appl Environ Microbiol 70:6776-6782 45. Zhang Y-W, Prabhu P (2010) Alginate immobilization of recombinant Escherichia coli whole cells harboring l-arabinose isomerase for lribulose production. Bioprocess Biosyst Eng 33:741-748
List of reviewers · 2012 The editorial staff of International Microbiology thanks the following persons for their invaluable assistance in reviewing manuscripts from January 2012 through December 2012. The names of several reviewers have been omitted at their request.
Alonso, Amanda. Autonomous Univ. of Barcelona, Bellaterra, Spain Amils, Ricardo. Autonomous Univ. of Madrid, Cantoblanco, Spain Antón, Josefa. University Miguel Hernández, Alicante, Spain Ayala, Juan Alfonso. CBM-AUM, Cantoblanco, Spain Aymerich, Teresa. IRTA, Monells, Girona, Spain Badosa, Esther. University of Girona, Girona, Spain Bañeras, Lluís. University of Girona, Girona, Spain Barja, Juan Luis. Univ. of Santiago de Compostela, Santiago de C., Spain Bécares, Eloy. University of Leon, Leon, Spain Berenguer, José. CBM, CSIC-UAM, Cantoblanco, Spain Berlanga, Mercedes. University of Barcelona, Barcelona, Spain Bonaterra, Anna. University of Girona, Girona, Spain Borrego, Carlos. University of Girona, Girona, Spain Bosch, Rafael. Univ. of the Balearic Islands, Palma de Mallorca, Spain Cabanes, Didier. Institute for Molecular & Cell Biology, Porto, Portugal Campoy, Susana. Autonomous Univ of Barcelona, Bellaterra, Spain Cardona, Pere-Joan. Germans Trias Pujol Hospital, Badalona, Spain Casadesús, Josep. University of Sevilla, Sevilla, Spain Coci, Manuela. Institute for Ecosystem Study, CNR, Verbania, Italy Collado, M. Carmen. IATA-CSIC, Valencia, Spain de Vicente, Antonio. University of Malaga, Malaga, Spain del Valle, Jaione. Public University of Navarra, Pamplona, Spain Díaz-Orejas, Ramón. CBM, CSIC-UAM, Cantoblanco, Spain Domínguez, Ángel. University of Salamanca, Salamanca, Spain Estévez-Toranzo, Alicia. Univ. of Santiago de C., Santiago de C., Spain Ferré, Juan. University of Valencia, Valencia, Spain Gálvez, Antonio. University of Jaen, Jaen, Spain García del Portillo, Francisco. CNB, CSIC-UAM, Cantoblanco, Spain García-Gil, Jesús. University of Girona, Girona, Spain Gil, José Antonio. University of Leon, Leon, Spain Gram, Lone. Technical Univ. of Denmark, Lyngby, Denmark Guarro, Josep. University Rovira Virgili, Reus, Spain Gueimonde, Miguel. Inst. for Dairy Products, CSIC, Villaviciosa, Spain Hernández, Pablo. Complutense University of Madrid, Madrid, Spain Herrero, Enric. University of Lleida, Lleida, Spain Hjarvard de Fine Licht, Henrik. Lund University, Lund, Sweden Hood, Derek W. University of Oxford, Oxford, UK Hugas, Marta. European Food Safety Authority, Parma, Italy Imhoff, Johannes. University of Kiel, Kiel, Germany Janssen, Paul JD. Belgian Nuclear Research Center, Boeretang, Belgium Jiang, Xiaoxu. University of California, Los Angeles, CA, USA Kelley, Cheryl A. University of Missouri, Columbia, MO, USA Kolter, Roberto. Harvard University, Boston, MA, USA Lalucat, Jordi. Univ. of the Balearic Islands, Palma de Mallorca, Spain Lasa, Iñigo. Public University of Navarra, Pamplona, Spain Latorre, Amparo. University of Valencia, Valencia, Spain Llorca, Jordi. Technical University of Catalonia, Barcelona, Spain 200
Margolles, Abelardo. Inst. for Dairy Products, CSIC, Villaviciosa, Spain Martínez, Beatriz. Inst. for Dairy Products, CSIC, Villaviciosa, Spain Mas, Jordi. International Microbiology, Barcelona, Spain Mateos, Luis M. University of Leon, Leon, Spain Mayo, Baltasar. Inst. for Dairy Products, CSIC, Villaviciosa, Spain McKay, Chris. NASA Ames, Moffet Field, CA, USA Méndez, Beatriz. University of Buenos Aires, Buenos Aires, Argentina Monte, Enrique. University of Salamanca, Salamanca, Spain Montesinos, Emili. University of Girona, Girona, Spain Moreno, Conrado. University of Cordoba, Cordoba, Spain Nogales, Balbina. Univ. of the Balearic Islands, Palma de Mallorca, Spain Penadés, José R. Valencian Inst. of Agriculture Research, Segorbe, Spain Peleg, Anton. Alfred Hospital, Melbourne, Australia Pérez Diaz, José Claudio. Ramón y Cajal Hospital, Madrid, Spain Pérez-Moreno, Mar Olga. Hospital of Tortosa, IISPV, Tortosa, Spain Pilloni, Giovanni. Institute of Groundwater Ecology, Munich, Germany Piqueras, Mercè. International Microbiology, Barcelona, Spain Pisabarro, Gerardo. Public University of Navarra, Pamplona, Spain Requena, Teresa. Inst. of Food Science, CSIC-UAM, Cantoblanco, Spain Sanz, José Luis. Autonomous Univ of Madrid, Cantoblanco, Spain Segura, Ana. Zaidin Experimental Station, Granada, Spain Slifko, Terri. Sanitation District LA County, Los Angeles, CA, USA Suárez, Evaristo. University of Oviedo, Oviedo, Spain Toranzos, Gary. University of Puerto Rico, Rio Piedras, Puerto Rico Tudó, Griselda. University of Barcelona, Barcelona, Spain Uriz, Iosune. Center for Advanced Studies, CSIC, Blanes, Spain Urmeneta, Jordi. University of Barcelona, Barcelona, Spain Valle, Jaione. Public University of Navarra, Mutilva (Pamplona), Spain Ventosa, Antonio. University of Sevilla, Sevilla, Spain Vila, Jordi. University of Barcelona, Barcelona, Spain Villa, Tomás G. Univ. of Santiago de Compostela, Santiago de C., Spain
RESEARCH ARTICLE International Microbiology (2012) 15:201-210 DOI: 10.2436/20.1501.01.173 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
Prevalence of mobile genetic elements and transposase genes in Vibrio alginolyticus from the southern coastal region of China and their role in horizontal gene transfer Peng Luo, Haiying Jiang, Yanhong Wang, Ting Su, Chaoqun Hu,* Chunhua Ren, Xiao Jiang Key Laboratory of Marine Bio-resources Sustainable Utilization, Chinese Academy of Sciences, South China Sea Institute of Oceanology, Guangzhou, China Received 20 September 2012 · Accepted 14 November 2012 Summary. Vibrio alginolyticus has high genetic diversity, but little is known about the means by which it has been acquired. In this study, the distributions of mobile genetic elements (MGEs), including integrating conjugative elements (ICEs), superintegron-like cassettes (SICs), insertion sequences (ISs), and two types of transposase genes (valT1 and valT2), in 192 strains of V. alginolyticus were investigated. ICE, SIC, and IS elements, valT1, and valT2 were detected in 8.9 %, 13.0 %, 4.7 %, 9.4 %, and 2.6 % of the strains, respectively. Blast searches and phylogenetic analysis of the acquired sequences of the ICE, SIC, IS elements and transposase genes showed that the corresponding homologues were bacterial and derived from extensive sources. The high prevalences of these MGEs in V. alginolyticus implied the extensive and frequent exchange of genes with environmental bacteria and that these elements strongly contribute to the genetic and phenotypic diversity of the bacterium. To our knowledge, this is the first report of V. alginolyticus harboring ICE and SIC elements. [Int Microbiol 2012; 15(4):201-210] Keywords: Vibrio alginolyticus · integrating conjugative elements · insertion sequences · superintegrons · transposases · horizontal gene transfer
Introduction Vibrio spp. are members of the family Vibrionaceae and they are ubiquitous in marine and estuary environments [1,2,17]. Vibrio alginolyticus has acquired increasing importance as some strains are pathogenic to aquatic animals, resulting in huge economic losses, as well as to humans [2,8,16,36]. Several studies have sought to identify the virulence genes of V. alginolyticus and the molecualr basis of its pathogenic be*Corresponding author: C.Q. Hu Key Laboratory of Marine Bio-resources Sustainable Utilization, CAS South China Sea Institute of Oceanology Guangzhou 510301, China Tel.+86-2089023216. Fax +86-2089023218 E-mail: hucq@scsio.ac.cn
havior. Others have been aimed at determining the dissemination among environmental Vibrio species of the virulence genes found in medically significant V. cholerae and V. parahaemolyticus. Together, these efforts have revealed that some V. alginolyticus strains carry virulence genes derived from pathogenetic V. cholerae and V. parahaemolyticus strains, such as ace [32], zot [24,30,32], tdh [6], and trh [12]. In addition to virulence genes acquired through horizontal gene transfer (HGT), there are putative genes, contained in a reported complete plasmid sequence of V. alginolyticus, that are apparently mosaics. These genes, largely of unknown function, appear to be spliced with multiple fragments of genes derived from different vibrios [34] and their presence suggests gene exchange and recombination between V. alginolyticus and other Vibrio species [34]. However, the vectors
202
Int. Microbiol. Vol. 15, 2012
luo et al.,
or mobile elements containing these genes in V. alginolyticus are as yet unknown. In the process of searching for virulence genes of V. alginolyticus, we detected several mobile genetic elements (MGEs), including integrating conjugative elements (ICEs), insertion sequences (ISs), superintegron-like cassettes (SICs), and heterogenous transposase genes. As reported herein, further investigation of their distribution in environmental V. alginolyticus strains showed that they were highly prevalent in this species.
Materials and methods Vibrio alginolyticus strains and DNA extraction. In this study of the distribution of ICEs, ISs, SICs, and heterogenous transposase genes, 192 V. alginolyticus strains, isolated from seawater and from marine animals (healthy or sick) in the southern coastal region of China in 2006–2009 were investigated. All of the strains were isolated with thiosulfate-citrate-bile salt-sucrose (TCBS) agar, cultured in Broth 2216E (2 % NaCl; Oxoid), and identified by PCR [17] as well as by the standard biochemical tests listed in Bergey’s Manual of Systematic Bacteriology [5]. Genomic DNA for PCR assays was extracted from the strains using a bacterial DNA extraction kit (Tiangen, China) according to the manufacturer’s instructions.
PCR assays of the distribution of ICEs, ISs, SICs, and transposase genes in Vibrio alginolyticus. The sequences of ICEs, ISs, and the transposase gene ValT1 from multiple bacterial species were downloaded from the GenBank database and aligned with Clustal-W in BioEdit software. Repeat sequences in Vibrio cholerae (VCRs) strains were also adopted for primer design aimed at SIC amplification in V. alginolyticus. A correlation between SIC and integrase genes (int) was tested by collecting int genes derived from the integrons or superintegrons of Vibrio species (Table 1) for use in primer design. The respective consensus sequences were established and used to design primers pairs, which were theoretically tested by BLAST searches against sequences in the GenBank database. All PCRs were performed in a 25-μl reaction containing 1 μl of genomic DNA, 0.4 μM of each primer, 2.5 μl of 10 × PCR buffer , 0.2 mM dNTP, and 1 U of Taq DNA polymerase (Takara, China). The amplification program consisted of an initial denaturation at 94 °C for 4 min, 32 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 8 min. In addition, a PCR assay for the transposase gene valT2, which is highly similar to the gene vpiT harbored in the V. cholerae pathogenecity island (VPI), was carried out using a previously reported method [30], in order to test the gene’s distribution in V. alginolyticus. After amplification, 4 μl of each product was electrophoresed in a 1.0 % agarose gel. The resulting bands were visualized under UV light. The predicted lengths of the amplification products are listed in Table 1, as are the primers used in the PCR detection in V. alginolyticus of ICE, IS, and SIC elements, and the two transposase genes. Sequence determination and phylogenetic analysis. To confirm that the PCR products were indeed derived from the ICE, IS, and SIC
Table 1. Primers used in this study and the PCR results for the different genetic elements Genetic elements
Primers and their sequences (5′–3′)
Product size (bp)
No. of positive strains§
ICE
Ice-F: TGCGGCTCATTTCGACGATCT Ice-R: ACTCGGCCAATATGTACCTGCT
1285
17
Vibrio fluvialis Ind1 (GQ463144) Vibrio cholerae MJ-1236 (CP001485) Providencia alcalifaciens (GQ463139)
SIC
SIC-F: ACTGTCAACGCGCGGCGTTT SIC-R: CAGTCCCTCTTGAGGCGTTTG
N¶
25
Vibrio cholerae LMA3894-4 (CP002556) Vibrio cholerae O395 ( CP001236) Vibrio cholerae MJ-1236( CP001486)
int
int-F1: WRGYGTHMAAGAKCAYATG int-R1: GATGGRAABARAWAGTGCCA
655
25
Vibrio vulnificus YJ016 (BA000037.2) Vibrio natriegens CIP 103193 (AY181034.1) Vibrio harveyi ATCC BAA-1116 (CP000789.1) Vibrio parahaemolyticus RIMD 2210633 (BA000031.2
IS
Is-F: TCAACCCGGTACGCACCAGAAA Is-R: AGCGGCCAGCCATCCGTCAT
365
9
Enterobacter cloacae (AJ539161) Escherichia coli BL21 (CP001509) Escherichia coli ED1a (CU928162)
valT1
valT-F1: CTCGGCGCACAGCAGCAAATACAG valT-R1: CGCTGAATCGGCGAGGTCTACCAC
414
18
Shewanella baltica OS195 (NC_009997) Vibrio furnissii CIP 102972 (NZ_ACZP01000023) Vibrio cholerae PL107b (AY961483)
valT2
vpiT-F: GCAATTTAGGGGCGCGACGT vpiT-R: CCGCTCTTTCTTGATCTGGTAG
680
5
Sechi et al. [Ref. 30]
In total, 192 Vibrio alginolyticus strains were tested. The length of the amplicons depends on the number and size of the cassettes.
§ ¶
Reference strains for primer design or primer origin
Int. Microbiol. Vol. 15, 2012
203
Int Microbiol
Mobile elements in V. alginolyticus
Fig. 1. ICE sequence-based phylogenetic tree constructed using the neighbor-joining method. Bootstrap values were obtained after 1000 repetitions. Scale bar indicates 0.5 % sequence dissimilarity. Underlined strains are those sequenced for this work.
elements, the transposase genes, and the integrase gene and to determine the phylogenetic relationship of these elements with related genetic elements, randomly selected positive PCR products were purified and then directly sequenced using an Applied Biosystems 3730 Automatic Sequencer. The retrieved sequences and related sequences obtained by Blast searches or the IS Finder database [http://www-is.biotoul.fr/is.html] were aligned and then used for similarity comparisons as well as the construction of a phylogenetic tree using Mega 4.0. All of the sequences retrieved were deposited in GenBank (accession numbers: JQ612656–JQ612700, JQ928706–JQ928709, and EU787499).
Results Distribution and features of ICE elements in Vibrio alginolyticus. PCR assays of the ICE elements were positive for 17 of the 192 V. alginolyticus strains (8.9 %).
Among them, 13 ICE-positive PCR products were randomly selected for direct sequencing and phylogenetic analysis. The results showed that all of the sequences included three genes, TraC (encoding a type-IV secretion system protein), hpoA (encoding a hypothetical protein), and pcs (encoding a plasmid conjugation signal peptidase). The 12 similar sequences acquired by Blast searches, together with our query sequences, were used in the construction of a phylogenetic tree (Fig. 1). The ICE sequences of V. alginolyticus did not form a single clade, and closely related homologues were widely attributed, including seven species from five genera, Vibrio, Providencia, Proteus, Photobacterium, and Shewanella (Fig. 1). Despite the relatively low identity between the ICE of V. alginolyticus HN492 (95.6 %) and that of Proteus mirabilis HI4320, the percentage was still high enough to suggest the rather high
216 180
2
3
156
252
2
1
1
1
1
HN266b
HN401
E06333
E06381
JQ612680
JQ612679
JQ612678
JQ612677
JQ612675
JQ612676
JQ612674
GenBank no.
b
a
Closely related encoding gene
Hypothetical protein
Hypothetical protein
NADPH-P-450 reductase
Ethylenetetrahydrofolate dehydrogenase
Hypothetical protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
ORF1, ORF2, and ORF3 in HN261 have overlapping reading frames. ORF1 in HN266 was not intact. c Core sites are an imperfect repeat.
255
405
372
174
1
HN076
201
1
HN261a
636
1
HN045
Length (bp)
ORF
Strains
49.5
92.5
68.8 51.8
80.7
88.4
78.5
98.4
99.7
91.8
Vibrio parahaemolyticus 10329 (AFBW01000029) Vibrio sp. DAT722 (DQ139261) Vibrio vulnificus CMCP6 (AE016795) Vibrio cholerae MZO-3 (AAUU01000163) Vibrio vulnificus YJ016 (BA000037) Vibrio cholerae TMA 21 (NZ_ ACHY01000017)
Vibrio sp. Ex25 (NC_013456)
Vibrio alginolyticus 12G01 (NZ_AAPS01000005) Vibrio vulnificus CMCP6 (NC_004459)
% Identity
Geobacter metallireducens GS15 (NC_007517)
Closely related species (accession number)
Table 2. The features of Vibrio alginolyticus repeats (VARs) and predicted genes (ORFs) in cassettes of Vibrio alginolyticus
Y
N
Y
N
Y
Y
Y
Y
N
Y
Related to integron or SI
<1–27 514–594>
<1–65 492–519>
<1–70 460–486>
415–533
430–555
<1–28 515–605>
<1–111 758–787>
VARs Position
GTTAGTT AACTAAC
GTTAGCT AGCTAAC
GTTATGC GCATAAC
TTCTAAC GTTACCAc
GCATAAC GTTAACTc
GTTAGTT AACTAAC
GTTAGCC GGCTAAC
Complementary core sites in VARs
204 Int. Microbiol. Vol. 15, 2012 luo et al.,
Int. Microbiol. Vol. 15, 2012
205
Int Microbiol
Mobile elements in V. alginolyticus
Fig. 2. Typical amplification results of Vibrio alginolyticus repeats (VARs) in 25 strains. M: DNA Marker DL2000. 1: A056. 2: HN017. 3: HN029. 4: HN034. 5: HN045. 6: HN063. 7: HN 066. 8: HN072. 9: HN076. 10: HN179. 11: HN261. 12: HN 269.13:HN 271. 14: HN275. 15: HN 283. 16: HN296. 17: HN 318. 18: HN 332. 19: HN401. 20: HN 441. 21: HN 445. 22: E06333. 23: E06346. 24: E06381.
identity between ICEs of V. alginolyticus and these elements of other bacterial species. However, Blast searches showed that counterparts to the ICE elements are not contained in any reported V. alginolyticus sequences. Distribution and features of SIC elements in Vibrio alginolyticus. Primers used in the amplification of the SIC elements were designed to match the V. alginolyticus repeats (VARs) corresponding to the repeated sequences (VCR) in the superintegron of V. cholerae. Thus, the amplified region should theoretically contain gene cassettes and partly repeated sequences. PCR assays showed that 25 strains (13.0 %) were clearly positive for VAR and that they gave rise to multiple bands (Fig. 2). Among the bands excised for direct sequencing, each of the seven acquired sequences contained one gene cassette and complete or partial VAR sequence. Genes closely related to those in the cassettes were from a wide range of sources, i.e., four Vibrio species (V. cholerae, V. vulnificus, V. parahaemolyticus, and V. alginolyticus), two unnamed Vibrio species (Vibrio sp. DAT722 and Vibrio sp. Ex25), and one Geobacter species (G. metallireducens). Of the ten predicted genes (ORFs), eight encoded hypothetical proteins with unknown function, while the other two genes encoded ethylenetetrahydrofolate dehydrogenase and NADPH-P-450 reductase, respectively. Further analysis of the flanking regions of these related genes in GenBank showed that seven of the ten genes were derived from superintegrons (4 genes) or integrons (3 genes) (Table 2). Through Blast searches and Clustal alignments, complete or partial VAR sequences of these cassettes were
identified that had perfect or imperfect complementary core sequences featuring conservative inverse core sites (RYYTAAC) and conservative core sites (GTTARRY) (Table 2). The subsequent PCR of the int gene indicated that all 25 SIC-positive strains were positively amplified while the SIC-negative strains were not. Four positive PCR products were randomly selected for direct sequencing, and the acquired sequences (JQ928706–JQ928709) confirmed that they derived from int genes. Distribution and features of IS elements in Vibrio alginolyticus. The primers used in the IS amplification were designed to match similar transposase genes (traIS) in terms of the IS1 elements of Escherichia coli and Shigella sonnei. Nine of the 192 V. alginolyticus strains were positive (4.7 %) for the amplification, and five sequences were acquired by direct sequencing. A comparison and phylogeny determination of those sequences with similar sequences acquired using the IS Finder database revealed the 100 % identity of sequences from V. alginolyticus strains E06235, E06236, E06242, and HN381 with the traIS sequences of IS elements belonging to the IS1 family in E. coli strains ED1a and BL21(DE3), Salmonella enterica AKU 12601, and Enterobacter cloacae Z-2376 (Fig. 3). IS elements from V. alginolyticus strains E0601 had 100 % sequence identity with the IS element belonging to the IS1 family in E. coli MS2027. The lowest identity (97.7 %) was between E. coli MS2027 and Klebsiella pneumoniae NTUH-K2044, but the value was still high enough to show a close phylogenetic relationship. IS sequences of V. alginolyticus strains were clustered into two
Int. Microbiol. Vol. 15, 2012
luo et al.,
Int Microbiol
206
Fig. 3. IS-based phylogenetic tree constructed using the neighbor-joining method. Bootstrap values were obtained after 1000 repetitions. Scale bar indicates 20 % sequence dissimilarity. Underlined strains are those sequenced for this work.
clades. All related bacteria in both were from Enterobacteriaceae and they formed a large branch that was clearly distinct from the stand-alone branch of another IS1 sequence of V. vulnificus YJ106, although both species are members of Vibrio. Blast searches and IS searches failed to detect highly similar IS sequences in any other Vibrionaceae species. Distribution and features of transposase genes in Vibrio alginolyticus. PCR results indicated that 18 of the 192 V. alginolyticus strains (9.4 %) were positive for the transposase gene valT1. Sixteen sequences were retrieved by direct sequencing. The acquired and the related sequences were used in a phylogenetic analysis and to construct a phylogenetic tree (Fig. 4). The results showed that valT1 from V. alginolyticus strains A056, HN318, and HN303 had 100Â % sequence identity with the transposase gene from V. parahaemolyticus K5030, and the valT1 sequence from V. alginolyticus HN145 had 100 % identity with that from V. furnissii CIP 102972. The valT1 sequences from V. alginolyticus clustered in different clades with bacteria belonging to distinct genera. Blast searches (Blastn and Blastx) did not identify any similar sequences from V. alginolyticus that had been deposited in GenBank.
A PCR assay for valT2 was also carried out, with five of the 192 V. alginolyticus strains found to be positive (2.6 %). The PCR products were subsequently purified for direct sequencing. Blast searches and a phylogenetic analysis (Fig. 5) showed that all valT2 genes had ≼ 92 % sequence identity with transposase genes from multiple Vibrio species (V. cholerae, V. vulnificus, V. alginolyticus, and V. parahaemolyticus). The most similar sequences, obtained from five valT2 genes, were all from V. vulnificus or V. cholerae strains, including the transposase gene (vpiT) of pathogenecity island (VPI) of V. cholerae N16961. Except for the vpiT-like transposase gene sequence (AY825359) of V. alginolyticus (highly similar to the above-mentioned vpiT of V. cholerae), previously submitted by our laboratory, none of the other similar sequences in V. alginolyticus have been reported.
Discussion Previous work showed that V. alginolyticus is ubiquitous in marine and estuary environments [2,17] and that it exhibits high genetic and phenotypic diversity [23,25,32]. To our knowledge, for V. alginolyticus neither the distribution of mo-
Int. Microbiol. Vol. 15, 2012
207
Int Microbiol
Mobile elements in V. alginolyticus
Fig. 4. Phylogenetic tree constructed from the valT1 sequences of Vibrio alginolyticus and from closely related sequences using the neighborjoining method. Bootstrap values were obtained after 1000 repetitions. Scale bar indicates 2 % sequence dissimilarity. Underlined strains are those sequenced for this work.
bile genetic elements (especially those mainly found in other bacteria) nor the relationship between the genetic diversity of this species and the various MGEs has been studied. Furthermore, few articles have focused on the contribution of MGEs from V. alginolyticus to the transmission of genes involved in virulence, antibiotic resistance, or host adaptation in marine environments. Our results confirmed the wide distribution of ICEs, ISs, SICs, and transposase genes in the environmental V. alginolyticus isolates analyzed herein. ICEs can be transferred from a donor to a recipient cell, integrating into the host’s chromosome [15]. These elements contain conserved as well as variable regions, with the latter allowing the capture of foreign genes, such as those encoding
antibiotic or heavy metal resistance [18,38]. Since the ICEs SXT and R391 were first reported, in isolates of V. cholerae and Providencia rettgeri, more than 30 elements belonging to the SXT/R391-like family have been described [18]. In the V. alginolyticus strains analyzed in this study, ICEs were determined with 8.9 % of the occurence rate, indicating their wide distribution in this bacterium. The fact that the ICEs in V. alginolyticus did not not form a single clade in the phylogenetic tree and their homologues had distinct sources, including seven species from five genera, strongly suggests that these elements do not derive from a single lineage and that their acquisition by V. alginolyticus strains was from different sources. Moreover, these strains may further act as ICE do-
Int. Microbiol. Vol. 15, 2012
luo et al.,
Int Microbiol
208
Fig. 5. Phylogenetic tree constructed from the valT2 sequences of Vibrio alginolyticus and closely related sequences using the neighbor-joining method. Bootstrap values were obtained after 1000 repetitions. Scale bar indicates 5 % sequence dissimilarity. Underlined strains are those sequenced for this work.
nors, since transmission of these elements is not solely unidirectional. To our knowledge, this is the first report of ICE elements in V. alginolyticus. Previously they have been described only in V. cholerae [18] and V. fluvialis [38] but not in other Vibrio species. The simplest forms of transposable elements in bacteria are ISs [11]. In fact, most of them encode only a single gene, for transposase (Tnp), bordered by inverted repeats (IRs), the sites for Tnp binding and action [7]. While ISs are known to alter the expression of adjacent genes, through insertion or deletion, there is also evidence that they can efficiently enrich the pool of mobile DNA, which could strongly impact lateral gene transfer and the evolution of bacterial genomes [3,21]. Thus, ISs may well have importantly contributed to genetic diversity within a single species. Although we could not obtain more recent data on the number of discovered ISs, by 2006 over 1500 IS sequences had been identified [31]. IS searches using the IS Finder database showed that no more than 60 ISs have been reported from Vibrio species. All of the IS highly similar to those of V. alginolyticus were from the IS1 family. Likewise, we inferred that the ISs detected in the V. alginolyticus strains analyzed in this study belonged to the IS1 family. The IS1 of V. vulnificus YJ106 formed a
stand-alone clade, distinct from clades containing all V. alginolyticus strains and Enterobacteriaceae strains. No highly similar ISs were found in any Vibrionaceae species by either Blast or IS Finder searches when using the above-mentioned Vibrio ISs as queries, consistent with the infrequency of this type of IS1 element in V. alginolyticus. By contrast, all 100 % identical IS elements were from Enterobacteriaceae strains, which strongly supported the hypothesis that they were obtained through HGT from distantly related sources. We recently reported the detection of ISs, belonging to the IS5 family, which were highly similar to those from V. parahaemolyticus and detected in V. alginolyticus strains [26]. In this study, ISs in several V. alginolyticus strains were determined to be highly similar to those from Enterobacteriaceae. Previous reports have shown the IS-mediated spread of the thermostable direct hemolysin gene among Vibrio species, including V. alginolyticus [12,35]. This finding supports the idea that V. alginolyticus extensively exchanges genes with other bacteria in the environment. To our knowledge, ours is the first report showing that Vibrio species have IS1 sequences sharing high identity with those of Enterobacteriaceae. Our attempts to amplify the regions between VARs yielded sequences showing that these regions include the gene cas-
Int. Microbiol. Vol. 15, 2012
Mobile elements in V. alginolyticus
settes and complete or partial VARs. Most of the acquired genes in the cassettes were superintegron- or integron-related and the VARs contained perfect or imperfect inverted core sites and core sites identical to those in the VXRs of the Vibrio superintegron [27]. Electrophoretic analysis of the PCR products revealed multiple bands with different lengths in these VAR-positive strains, which could be explained by the fact that VAR primers can, at least theoretically, anchor repeat regions located at both sides of every cassette. Similar PCR profiles evidencing superintegron detection were reported in other Vibrio species [20], providing indirect support for the presence of a superintegron in the V. alginolyticus strains analyzed. In order to obtain additional evidence for the presence of a superintegron in V. alginolyticus, in addition to multiple gene cassettes, we specifically amplified and then sequenced the integrase gene (int) of this superintegron. The results showed that all VAR-positive strains simultaneously had an int gene highly similar to the integrase gene from the superintegron of V. cholerae or other Vibrio species. Further sequence analysis was performed through PCR walking and other methods using the VAR- and int-positive strain E06333. The acquired sequence contained more than 18 cassettes (data not shown). Moreover, the results strongly suggested that V. alginolyticus had a complete superintegron. Since the initial discovery of a superintegron in V. cholerae [20], these elements have been found in the genomes of at least 45 bacteria, including V. parahaemolyticus, V. metschnikovii, V. mimicus, and V. vulnificus [19]. Among them, the superintegron of V. cholerae has been explored in the greatest detail; however, the potential functions of its gene cassettes are not yet known. There is much speculation about superintegrons as ancestors or reservoirs of various integrons, based on the fact that, in some bacteria, gene cassettes recruited from superintegrons form multiple resistance integrons [26]. V. alginolyticus is more common than V. cholerae and other Vibrio species, and it is more widely distributed. The genes in the cassettes are closely related to those found in other bacteria from extensive sources. Therefore, potential superintegrons in V. alginolyticus might carry out extensive gene exchange with environmental bacteria and serve as the reservoirs of gene cassettes. To our knowledge, this is the first report of SICs in V. alginolyticus. The two V. alginolyticus transposase genes investigated in this study occurred with a frequency of <10 %. They were highly similar to those found in other Vibrio species but not in any reported sequences from V. alginolyticus (except one previously reported by our laboratory). The fact that valT1 sequences from V. alginolyticus did not form a clade suggests
209
their different origins. Further sequence analysis showed that some transposase genes were parts of a transposon. Thus, either transposase genes carry other transferable genes for transfer or the latter were acquired from other bacteria through HGT. A transposon is one type of bacterial MGE [13] and it plays a major role in bacterial adaptation and genomic evolution, together with other MGTs, through HGT [4,20,33]. Further work is needed to verify the presence of complete transposons in V. alginolyticus and to analyze their structure and function. Nowadays, it is well recognized that MGEs are of great importance in the evolution of bacterial pathogenesis, antibiotic resistance, and host adaptation [9,10,29,33]. The prevalence of MGEs and the wide distribution of V. alginolyticus not only suggest that these elements account for the high genetic diversity and phenotypic differences of this bacterium (including pathogenic and nonpathogenic strains) but also that the bacterium is an important donor of MGEs to other environmental bacteria. The abundance of V. alginolyticus MGEs provides a precondition for the HGT of virulence genes and the development of new pathogenetic strains. Other authors have already pointed out that V. alginolyticus is a major reservoir for virulence factors in marine environments [14,40]. Our report of the strong prevalence of MGEs in V. alginolyticus provides a mechanism explaining this observation. Acknowledgements. This work was supported by the Natural Science Fund of China (No. 31070106), Important Direction Program of Knowledge Innovation Project in the China Academy of Sciences (CAS) (KZCXZ-EWQ212), and the Frontier Key Program for Youngsters in SCSIO (SQ200801). Competing interests. None declared.
References 1. Arias CR, Olivares-Fuster O, Goris J (2010) High intragenomic heterogeneity of 16S rRNA genes in a subset of Vibrio vulnificus strains from the western Mediterranean coast. Int Microbiol 13:179-188 2. Balebona MC, Andreu MJ, Bordas A, Zorrilla I, Moriùigo MA, Borrego JJ (1998) Pathogenicity of Vibrio alginolyticus for cultured gilt-head sea bream (Sparus aurata L.). Appl Environ Microbiol 64:4269-4275 3. Bartosik D, Putyrski M, Dziewit L, Malewska E, Szymanik M, Jagiello E, Lukasik J, Baj J (2008) Transposable modules generated by a single copy of insertion sequence ISPme1 and their inuence on structure and evolution of natural plasmids of Paracoccus methylutens DM12. J Bacteriol 190:3306-3313 4. Berg DE, Berg CM, Sasakawa C (1984) Bacterial transposon Tn5: evolutionary inferences. Mol Biol Evol 1:41l-422 5. Brenner DJ, Krieg NR, Staley JT (2005) Bergey’s Manual of Systematic Bacteriology (Vol. 2: Part B), 2nd ed, Springer, New York, USA
210
Int. Microbiol. Vol. 15, 2012
6. Cai SH, Wu ZH, Jian JC, Lu YS (2007) Cloning and expression of gene encoding the thermostable direct hemolysin from Vibrio alginolyticus strain HY9901, the causative agent of vibriosis of crimson snapper (Lutjanus erythopterus). J Appl Microbiol 103:289-296 7. Chandler M, Mahillon J (2002) Insertion sequences revisited. In: Craig NL, Craigie M, Gellert M, Lambowitz AM (eds) Mobile DNA II. ASM Press, Washington, DC, USA, pp 305-366 8. Daniels NA, Shafaie A (2000) A review of pathogenic Vibrio infections for clinicians. Infect Med 17:665-685 9. Dutta C, Pan A (2002) Horizontal gene transfer and bacterial diversity. J Biosci 27:27-33 10. Frost LS, Leplae R, Summers AO, Toussaint A (2005) Mobile genetic elements: the agents of open source evolution. Nat Rev Microbiol 3:722-732 11. Galas DJ, Chandler M (1989) Bacterial insertion sequences. In: Berg DE, Howe MM (eds) Mobile DNA. Amer Soc Microbiol, Washington DC, USA, pp 109-162 12. González-Escalona N, Blackstone GM, DePaola A (2006) Characterization of a Vibrio alginolyticus strain, isolated from Alaskan oysters, carrying a hemolysin gene similar to the thermostable direct hemolysinrelated hemolysin gene (trh) of Vibrio parahaemolyticus. Appl Environ Microbiol 72:7925-7929 13. Hacker J, Carniel E (2001) Ecological fitness, genomic islands and bacterial pathogenicity. EMBO Reports 2:376-381 14. Harriague AC, Di Brino M, Zampini M, Albertelli G, Pruzzo C, Missic C (2008) Vibrios in association with sedimentary crustaceans in three beaches of the northern Adriatic Sea (Italy). Marine Poll Bull 56:574-579 15. Hochhut B, Waldor MK (1999) Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC. Mol Microbiol 32:99-110 16. Liu CH, Cheng W, Hsu JP, Chen JC (2004) Vibrio alginolyticus infection in the white shrimp Litopenaeus vannamei confirmed by polymerase chain reaction and 16S rDNA sequencing. Dis Aqua Organ 61:169-174 17. Luo P, Hu CQ (2008) Vibrio alginolyticus gyrB sequence analysis and gyrB-targeted PCR identification in environmental isolates. Dis Aquat Org 82:209-216 18. Mata C, Navarro F, Miró E, Walsh TR, Mirelis B, Toleman M (2011) Prevalence of SXT/R391-like integrative and conjugative elements carrying blaCMY-2 in Proteus mirabilis. J Antimicrob Chemother 60:2266-2270 19. Mazel D (2006) Integrons: agents of bacterial evolution. Nat Rev Microbiol 4:608-620 20. Mazel D, Dychinco B, Webb VA, Davies J (1998) A distinctive class of integron in the Vibrio cholerae genome. Science 280:605-608 21. Mira A, Martín-Cuadrado AB, D’Auria G, Rodríguez-Valera F (2010) The bacterial pan-genome: a new paradigma in microbiology. Int Microbiol 13:45-57 22. Nagy Z, Chandler M (2004) Regulation of transposition in bacteria. Res Microbiol 155:387-398 23. Özer S, Aslan G, Tezcan S, Bulduklu PS, Serin MS, Emekdas G (2008) Genetic heterogeneity and antibiotic susceptibility of Vibrio alginolyticus strains isolated from horse-mackerel (Trachurus trachurus L, 1758). Turk J Vet Anim Sci 32:107-120 24. Raja N, Shamsudin MN, Somarny W, Rosli R, Rahim RA, Radu S (2001) Detection and molecular characterization of the zot gene in Vibrio cho– lerae and V. alginolyticus isolates. Southeast Asian J Trop Med Public Health 32:100-104
luo et al.,
25. Ren CH, Hu C, Luo P, Chen C, Jiang X, Wang Q (2008) Genotyping of Vibrio alginolyticus isolates from Daya Bay by infrequent-restriction-site PCR and pulsed-field gel electrophoresis. Mol Cell Probe 22:267-271 26. Ren CH, Jiang X, Sun HY, Luo P, Chen C, Zhao Z, Hu C (2012) Detection and characterization of two insertion sequences in Vibrio alginolyticus. Ann Microbiol 62:69-75. 27. Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P, Mazel D (2003) Comparative analysis of superintegrons: engineering extensive genetic diversity in the Vibrioaceae. Genome Research 13:428-442 28. Rowe-Magnus DA, Guerout AM, Mazel D (2002) Bacterial resistance evolution by recruitment of super-integron gene cassettes. Mol Microbiol 43:1657-1669 29. Schmidt H, Hensel M (2004) Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev 17:14-56 30. Sechi LA, Duprè I, Deriu A, Fadda G, Zanetti S (2008) Distribution of Vibrio cholerae virulence genes among different Vibrio species isolated in Sardinia, Italy. Appl Microbiol 88:475-481 31. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M (2006) IS finder: the reference centre for bacterial insertion sequences. Nucleic Acids Res 34:32-36 32. Snoussi M, Noumi E, Usai D, Sechi LA, Zanetti S, Bakhrou A (2008) Distribution of some virulence related-properties of Vibrio alginolyticus strains isolated from Mediterranean seawater (Bay of Khenis, Tunisia): investigation of eight Vibrio cholerae virulence genes. World J Microbiol Biotechnol 24:2133-2141 33. Sobecky PA, Hazen TH (2009) Horizontal gene transfer and mobile genetic elements in marine systems. In: Gogarten MB, et al. (eds) Horizontal gene transfer: genomes in flux. Humana Press, Totowa, NJ, USA, pp 435-453 34. Su T, Luo P, Ren C, Hu C (2010) Complete nucleotide sequence of a plasmid pVAE259 from Vibrio alginolyticus and analysis of molecular biological characteristic of the plasmid. Acta Microbiologica Sinica 50:162-168 35. Terai A, Baba K, Shirai H, Yoshida O, Takeda Y, Nishibuchi M (1991) Evidence for insertion sequence-mediated spread of the thermostable direct hemolysin gene among Vibrio species. J Bacteriol 173:5036-5046 36. Top EM, Springae D (2003) The role of mobile genetic elements in bacterial adaptation to xenobiotic organic compounds. Curr Opin Biotechnol 14:262-269 37. Villamil L, Figueras A, Planas M, Novoa B (2003) Control of Vibrio alginolyticus in Artemia culture by treatment with bacterial probiotics. Aquaculture 219:43-56 38. Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet 5(12):e1000786 39. Wozniak RA, Waldor MK (2010) Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol 8:552-563 40. Xie ZY, Hu CQ, Cheng C, Zhang LP, Ren CH (2005) Investigation of seven Vibrio virulence genes among Vibrio alginolyticus and Vibrio parahaemolyticus strains from the coastal mariculture systems in Guangdong, China. Lett Appl Microbiol 42: 202-207
RESEARCH ARTICLE International Microbiology (2012) 15:211-218 DOI: 10.2436/20.1501.01.174 ISSN 1139-6709 www.im.microbios.org
INTERNATIONAL MICROBIOLOGY
New combinations of cry genes from Bacillus thuringiensis strains isolated from northwestern Mexico Gretel Mendoza,1 Amelia Portillo,2 Efraín Arias,1 Rosa M. Ribas,3 Jorge Olmos1* 1
Department of Marine Biotechnology, Center for Scientific Research and Education (CICESE), Ensenada, B.C., Mexico. Faculty of Sciences, Autonomous University of Baja California, Ensenada, B.C., Mexico. 3Department of Microbiology, School of Biological Sciences, National Technical Institute, Mexico, D.F., Mexico
2
Received 8 October 2012 · Accepted 7 November 2012 Summary. Twenty eight Bacillus thuringiensis strains isolated from the Tijuana-Ensenada region of northwestern Mexico were analyzed to determine the distribution of cry and cyt genes. Crystal production by the strains was examined by scanning electron microscopy, which showed the predominance of cubic crystals. Alkaline-dissolved and trypsin activated crystals were also analyzed by SDS-PAGE, yielding bands of 40–200 kDa. The cry1 and cry2 genes were molecularly characterized using general and newly designed specific primers in addition to other oligonucleotides (cry3, cry4, cry8, cry9, cry11, Nem, cry25, cry29 and cyt), resulting in the identification of novel gene combinations. The use of specific primers for cry1A, cry1B, cry1C, cry1D, cry1E, cry1F and cry2Aa, cry2Ab, cry2Ac, cry2Ad showed differences in the distribution of cry1 (36 %), cry2 (71 %), and cyt (40 %) in strains from Tijuana-Ensenada compared to other previously studied regions. Bioassays were conducted on Manduca sexta larvae to analyze the Cry insecticidal capacity of the isolated strains. The hemolytic activity of the Cyt toxin from the same strains was assessed in human erythrocytes. [Int Microbiol 2012; 15(4):211-218] Keywords: Bacillus thuringiensis · Cry proteins · Cyt proteins · insecticidal activity
Introduction According to the Mexican Commission for the Knowledge and Use of Biodiversity [http://www.conabio.gob.mx/conocimiento/manglares/doctos/manglaresMexico.pdf], Mexico is a megadiverse country, the fourth richest nation in biodiversity after Colombia, Brazil, and Indonesia. The diversity of insects in Mexico is estimated at about 110,000 species, of which 10,000 belong to Hemiptera, 20,000 to Diptera, 21,000 to Hymenoptera, and more than 35,000 to Coleoptera [Morón and Valenzuela, 1993, Revista de la Sociedad Mexicana de Historia Natural]. *Corresponding author: J. Olmos Department of Marine Biotechnology PO Box 430222 San Diego, CA 92143-0222, USA Tel + 52-6461750500. Fax 52-6461750534 E-mail: jolmos@cicese.mx
Bacillus thuringiensis (Bt) is a ubiquitous gram-positive, spore-forming bacterium that has been isolated all over the world from many different habitats, including soil, water, plant leaves, dead insects, and cobwebs [1,4,10]. During spore synthesis, Bt also produces a mixture of δ-endotoxins, known as Cry and Cyt toxins [5,12]. These proteins form crystalline parasporal inclusions bodies in the mother-cell compartment [2]. Genes encoding the Bt Cry and Cyt toxins are frequently located on plasmids [6,14], implying a high degree of genetic plasticity that results in a wide variety of Bt strains and crystal protein diversity [3,14]. Cry proteins show toxic activity against Lepidoptera, Coleoptera, Diptera, Hymenoptera, mites, and other invertebrates as well as against nematodes, flatworms, and protozoa [1,2,11]. In contrast, Cyt proteins specifically target dipteran insects. Importantly, Cry and Cyt proteins, including their solubilized and trypsin-activated forms, are not in any way toxic for mammals, birds, amphibians, and reptiles [7,13].
212
Int. Microbiol. Vol. 15, 2012
mendoza et al.,
The variation in the frequency distribution of the cry and cyt genes in Bt isolates, even those from the same country, is well recognized and likely reflects differences in biological, geographical, and ecological conditions, but it may also be directly related to the diversity of insects from region to region [15]. Based on these observations, the co-evolution of cry genes and insects has been proposed [1,14,15]. In this study, 28 Bt isolates were analyzed with newly developed primers to determine the frequency of cry1, cry2, and cyt genes in strains from northwestern Mexico. Our results differ from those of a previously reported study but contribute to the pool of knowledge on the distribution of cry and cyt genes.
Materials and methods Isolation of Bacillus thuringiensis strains. Bt strains used to produce the commercial agricultural insecticides DiPe1, containing spores and crystals of Bt var. kurstaki, and Xentari DF, containing spores and crystals of Bt var. aizawai, were used as controls. Samples were obtained from different geographical locations of Tijuana-Ensenada, in western Mexico. Each of the 50 isolates was grown in 50 ml of SP liquid medium [9]
for 30 °C at 96 h with constant agitation at 275 rpm. The production of Bt spores and crystals was screened every 24 h by phase-contrast microscopy and malachite green staining (malachite green oxalate salt, Sigma). Spores and crystal inclusions were harvested after sporulation from 28 positive Bt isolates by centrifugation for 10 min at 10,000 rpm, in 50-ml conical tubes. The pellets were washed with a buffer consisting of 0.5 M NaCl, 0.01 M EDTA, pH 8.0, and centrifuged for 10 min at 10,000 rpm. The procedure was repeated twice. The pellets were then washed with 20 ml of 0.1 M phenylmethylsulfonil fluoride (PMSF) per 50-ml culture, twice repeating the procedure, and maintained at –20°C until the activation of Cry proteins. Identification of crystal morphology by scanning electron microscopy. Crystal-spore pellets were thawed, washed twice with 5 ml of deionized water, and centrifuged at 10,000 rpm for 10 min. The crystals were suspended in 0.5 ml of deionized water and 10-μl aliquots were placed on glass slides, which were allowed to air dry. The samples were processed in the Nanoscience and Nanotechnology Center-UNAM, by coating with a gold layer using a vacuum evaporator (JEOL: JEE-400). They were then observed in a JSM-5300 scanning electron microscope. DNA purification. Bt strains were grown in LB medium for 12 h [1]. Total DNA was then extracted according to a previously reported protocol [15] in cells harvested by centrifugation at 9000 ×g for 10 min. Molecular characterization by PCR of cry and cyt genes. The cry and cyt genes from Bt strains were identified using the following specific and conserved previously reported primers [1,5,15]: cry1A, cry1D, cry3,
Table 1. Characteristics of the general and specific primers used in the identification of cry genes Primer pair
Sequence
Gene recognized
Annealing temp. (°C)
Product size (bp)
Gral-cry1
5´-GCGGTGAATGCTCTGTTT (f) 5´-TTTATCTGCCGCATGAATC (r)
Gral-cry2
Accession no.
cry1A, cry1B, cry1C, cry1D cry1E, cry1F
50
990
EF102874.1
5´-ACCTTTATTTGCACAGGCA (f) 5´-AATATCTGAAAAACGAGCTC (r)
cry2Aa,cry2Ab cry2Ac, cry2Ad
50
1249
AF273218.1
spe-cry1B
5′-CTTCATCACGATGGAGTAA (f) 5′ -CATAATTTGGTCGTTCTGTT (r)
cry1B
50
369
EF102874.1
spe-cry1C
5′-CAAAGATCTGGAACACCTT (f) 5′-CAAACTCTAAATCCTTTCAC (r)
cry1C
50
131
AY955268.1
spe-cry1E
5′-GAACCAAGACGAACTATTG (f) 5′- TGAATGAACCCTACTCCC (r)
cry1E
50
144
173252.1
spe-cry1F
5′-GCAGGAAGTGATTCATGG (f) 5′-CAATGTGAATGTACTTTGCG (r)
cry1F
50
432
EU679501.1
spe-cry2Aa
5′-CAAGCGAATATAAGGGAGT (f) 5′ TAGCGCCAGAAGATACCA (r)
cry2Aa
50
460
AF273218.1
spe-cry2Ab
5′-CACCTGGTGGAGCACGAG (f) 5′-GTCTACGATGAATGTCCC (r)
cry2Ab
50
771
AF336115.1
spe-cry2Ac
5′-GCAGACACCCTTGGTCGT(f) 5′-TGGCAACGCCCTCCCGAT(r)
cry2Ac
50
841
EU360896.1
spe-cry2Ad
5′-TCAAAATCACCTGAGAAA(f) 5′-ATTAGGACCCCCTATAC (r)
cry2Ad
50
442
DQ358053.1
cry genes in B. thuringiensis
cry4, nem (cry5, cry12, cry14, cry21), cry8, cry9, cry10, cry11, cry25, cry29 and cyt. In addition, new cry1 and cry2 primers were designed from specific and conserved sequences. The cry and cyt genes were amplified according to previously reported conditions [1,5,15] and annealing temperatures (Table 1). Protein electrophoresis. Denaturing SDS-PAGE [8] was performed using a 10 % separating gel (wt/vol). Samples were run at 25 mA for approximately 40 min and at 30 mA for approximately 1.5 h. The gel was stained with 0.4 % Coomassie brilliant blue R250 (Sigma, St. Louis, MO, USA). The molecular masses of the proteins of interest were determined using a commercial molecular mass marker as reference (Precision Plus Protein All Blue Standard from BioRad).
213
by the addition of 1 mM PMSF (final concentration). Activated toxins were recovered from the supernatant after centrifugation at 10,000 rpm for 10 min and stored at –70ºC until used in the toxin assays. The presence of activated Cry proteins was confirmed by SDS-PAGE (data not shown). The amount of protein was quantified according to the Lowry method, using bovine serum albumin as reference. Insecticidal activity. The toxicity of the activated Cry proteins was tested in Manduca sexta larvae. Toxin concentrations of 2000, 1000, and 100 ng/cm2 were placed in each well of a 24-well plate containing artificial food for Manduca sexta larvae and maintained under sterile conditions. The plates were allowed to dry, sealed with plastic wrap, and incubated for 7 days under a photoperiod of 12 h light/12 h darkness at 26 ºC and a relative humidity of 60 %. The number of dead larvae per plate was counted. Three repetitions, involving 24 larvae per concentration, were prepared and analyzed. Hemolytic activity. Hemolytic activity was assayed as previously described [16]. One hundred µl of a 0.1 % erythrocyte suspension was added to each well of a U-bottomed 96-well plates, followed by the addition of 100 µl of activated toxin at concentrations of 5, 2.5, and 1.25 µg/ml. The negative control was not inoculated with toxins. The positive control for hemolysis was prepared by mixing 100 µl of the erythrocyte suspension with a final concentration of 1 % Triton X-100. Hemolytic activity in each well was quantified using an automatic blood cell counter after incubation of the samples for 24 h at 37 °C. The test was performed in triplicate.
Int Microbiol
Solubilization and trypsin activation of crystal inclusions. The crystal-spore pellets were thawed, washed twice with 5 ml of deionized water, and centrifuged at 10,000 rpm for 10 min. The pellets were suspended in TNT buffer (20 mM Tris, 300 mM NaCl, Triton X-100 at 0.1 %, pH 7.2), incubated at 37 °C for 30 min, and sonicated for 6 min at 20 Watts. The proteins were solubilized at an alkaline pH of 10.5 either with 0.5 M sodium carbonate-sodium bicarbonate or with 0.1 M sodium hydroxide and reducing conditions obtained with 0.2 % β-mercaptoethanol. Solubilized proteins were recovered from the supernatant after centrifugation of the samples at 10,000 rpm for 10 min and then analyzed by SDS-PAGE. They were then activated by incubation with different trypsin concentrations (5–50 µg/ml, final concentrations) for 30 min to 2.5 h at 37 °C. The reaction was stopped
Int. Microbiol. Vol. 15, 2012
Fig. 1. (A) Phase-contrast microscopy. Vegetative cells, spores, and crystals (dark and white dots) of different sizes and shapes are shown outside strain 18-5 cells. (B) Electron microscopy of the isolated crystals: (B1) Scanning electron microscopy (SEM) images from strain 10-2; SC-IC, spherical, irregular crystals, and S, spores. (B2) SEM images from strain M1#8; BC, bipyramidal crystals, and S, spores. (B3) SEM images from strain 8-3; CC, cubic crystals, S, spores, and VC, vegetative cells.
214
Int. Microbiol. Vol. 15, 2012
Results Isolation of Bacillus thuringiensis strains and crystal characterization. Forty nine positive Bacillus strains were isolated by applying the temperature spore resistance methodology to 73 samples. Crystals produced by the cultured strains were analyzed by phase-contrast (Fig. 1A) and scanning electron (Fig. 1B) microscopy. The former showed vegetative cells as well as spores and crystals (dark and white dots) of different sizes and shapes. Figure 2 shows the frequency of the diverse crystal morphology encountered in some of the 28 isolated strains.
40 % in the 28 Bt isolated strains. Interestingly, the diversity and frequency distribution of cry and cyt genes differed from others regions of Mexico and from other countries, most likely reflecting differences in the geographical and climate conditions. The predominance of cubic crystals in the 28 Bt isolates matched well with that of cry2 (Figs. 2 and 3). Analysis of cry gene profiles in the isolated strains. The study of cry gene profiles from Bt isolates showed the presence of two or more cry gene combinations (Table 3). cry2Aa, the most abundant gene identified, was detected in 20 of the 28 strains, while cry2Ab occurred in 18 of the 28 strains (Table 2). cry2Ac was detected in 4 of the Bt strains. Ten of the 28 isolates were positive for cry1 genes, with cry1A determined in 10 of the 28 strains, followed by cry1B, cry1C, and cry1D genes, each of which were detected in 3, 1, and 3 of the 28 isolates (Table 2). Sixteen different cry and cyt gene profiles, including cry1, cry2, cry3, cry8, cry11, and cyt, were present in our collection. The most abundant profile were the combination cry2Aa/cry2Ab and combination cry2Aa/cry2Ab/cry2Ac (Table 3). Characterization of Cry protein profiles. To characterize the Cry protein profiles from each of the 28 Bt isolated strains, SDS-PAGE was performed after alkaline pH solubilization and trypsin digestion of the protoxins (see Materials and methods). Bands between 40 and 200 kDa were obtained and are described together with the protein profiles in Table 2.
Int Microbiol
Identification of cry and cyt in the isolated strains. Figure 3 summarizes the cry and cyt genes determined in the 28 Bt isolates using both sets of primers in Table 1. As seen in the figure, the analyzed Bt strains showed little diversity in their cry genes. The most frequently occurring gene was cry2, detected in 20 of the 28 isolates and accounting for almost 71 % of all cry genes, followed by cry1, contained in 10 of the 28 Bt isolates and representing 36 % of the total cry genes. Three other cry genes, cry11, cry8, and cry3, were also identified in isolates from this region of Mexico, in 20Â %, 11 % and 11 % of the strains, respectively. Four of the 28 Bt isolated strains did not amplify with any of the tested cry oligonucleotides, indicating the presence of new genes (Table 2). Amplification of cyt genes yielded a frequency of
mendoza et al.,
Fig. 2. The crystals composition (% abundance) of Bt strains isolated from Tijuana-Ensenada, in western Mexico. CC: cubic crystals (68 %). IC: irregular crystals (43 %). BC: bipyramidal crystals (36 %). SC: spherical crystals (28 %). SqC: square crystals (14 %).
cry genes in B. thuringiensis
Int. Microbiol. Vol. 15, 2012
215
Table 2. Protein size, gene profiles, and insecticidal and hemolytic activity of the isolated strains Strain
Protein profile
cry and cyt genes identification
Crystal shape*
Insecticidal activity (ng/cm2) 2000, 1000, 100
M1#4
200, 130, 88, 75, 65, 44
cry2Aa, cry2Ab, cry2Ac, cyt
CC, IC
M1#7
200, 160, 140, 88, 75
cry1A, cry1B, cry2Aa, cry2Ab
BC, CC
+ +
nt +
–
+
–
Hemolytic activity (µg/ml) 5, 2.5, 1.25 +
–
–
–
–
–
M1#8
160, 140, 88
cry1A, cry2Aa, cry2Ab
BC
–
–
–
M2#2
180, 150, 120, 100, 88, 65
cry2Aa, cry2Ab, cry8
CC, SC
nt
–
–
–
M2#7
88, 70, 65, 50
cry2Aa, cry2Ab, cyt
CC, IC
nt
–
–
–
1-2
200, 130, 100, 88, 75, 65
cry1A, cry1D, cry2Aa, cry2Ab, cry8
BC, CC
–
–
–
+
+
+
2-2
200, 88, 75
cry2Aa, cry2Ab
CC, IC
nt
–
–
–
4-2
200, 88, 75, 68, 65, 62, 50
cry2Aa, cry2Ab, cry2Ac, cyt
CC, SC
nt
–
–
–
4-5
200, 88, 75, 68, 65, 62
cry2Aa, cry2Ab
CC
nt
–
–
–
5-4
150, 120, 75, 65, 55, 48
cry2Aa, cry2Ab, cry2Ac, cyt
CC, IC
nt
+
–
–
6-1
250, 130, 88, 75, 65
cry1A, cry2Aa, cry2Ab
BC, CC, SC
–
–
–
6-3
88, 75, 65, 55, 48
–
–
–
+
SC, IC
–
–
nt
6-4
200, 88, 75, 70, 44
7-2
200, 88, 70
cry1A, cry1B, cry2Aa, cry2Ab
BC, CC
–
–
–
–
–
–
7-3
210, 40
cry11, cyt
SC, IC
+
+
+
8-3
130, 88, 75, 65, 50
cry1A, cry2Aa, cry2Ab, cyt
BC, CC
+
+
–
+
+
–
8-4
200, 130, 120, 100, 88, 70, 65, 50
cry1A, cry1D, cry8, cry11, cyt
BC, IC, SC
+
+
+
+
–
–
9-2
140, 110, 75
cry2Aa, cry2Ab, cry11
CC, SqC, SC
nt
–
–
–
10-2
150, 88, 70, 55
IC, SC
nt
–
–
–
11-4
200, 88, 70, 67
cry2Aa, cry2Ab
CC
nt
–
–
–
12-2
200, 88, 70, 67, 66, 44
cry1Aa, cry1C, cry2Aa, cry3, cyt
BC, IC
–
–
–
cry3, cry11
12-6
200, 88, 75
13-4
80
14-1
200, 55, 47, 40
17-3
CC
nt +
+
–
nt
+
+
–
SqC
nt
–
–
–
CC
nt
–
–
–
cry3, cry11, cyt
IC, SqC
nt
+
+
–
160, 88, 72, 44
cry1A, cry1B, cry2Aa, cyt
BC, IC, CC
+
+
–
18-2
130, 88, 70
cry2Aa, cry2Ab, cry2Ac
CC
–
–
–
18-5
100, 75, 50
cry1A, cry1D, cry2Aa, cry2Ab
BC, SqC
–
–
–
19-1
88, 75, 50
cry2Aa, cry2Ab, cry2Ac, cyt
CC, IC
+
+
+
+
+
–
nt +
+ nt
–: No amplification and no activity; +: positive activity; nt: not tested. *BC: bipyramidal crystal. CC: cubic crystal. IC: irregular crystal. SC: spherical crystal. SqC: square crystal.
+
Int. Microbiol. Vol. 15, 2012
mendoza et al.,
Int Microbiol
216
Fig. 3. The cry and cyt genes detected in the 28 Bt isolates.
Insecticidal activity on Manduca sexta larvae. Bioassays were carried out with Cry proteins produced from the isolated strains (Table 2). The toxic effects on Manduca sexta larvae were measured by including pre-defined concentrations of the proteins in the larval diet, with feeding carried out for a period of 7 days. The results were considered positive when 50 % of the larvae in the test well had died at the end of the experiment. Based on this criterion, strains 1-2, 8-4, and 18-5, containing the cry gene profile cry1A/cry1D, were the most toxic against Manduca sexta, as their toxins were effective even at the lowest concentration (Table 2). Hemolytic activity on human erythrocytes. Hemolytic activity on human erythrocytes was determined in 11 of the 28 Bt isolates, in agreement with the number of Bt strains harboring cyt genes (Table 2). Strains 7-3 and 19-1 had hemolytic activity at toxin concentrations of 5, 2.5, and 1.25 µg/ml, and strains 8-3, 14-1, and 17-3 at 5 and 2.25 µg/ml. Strains M1#4, M2#7, 4-2, 5-4, 8-4 and 12-2, while also positive, showed hemolytic activity only at the highest toxin concentration (Table 2).
Discussion The co-evolution of toxins and insects has been postulated to account for the high degree of variability of Bt strains, which produce a broad range of Cry and Cyt proteins active against most insect pests. In 1998, a collection of Bt strains isolated from soil samples taken throughout Mexico, with the exception of the Baja California peninsula, was described [1]. In that
study, the cry1 gene was determined to be the most abundant (49.5 %) in the isolated strains, followed by cry3 (20 %) and cry4 (10 %). However, the presence of cry2 was not analyzed and Bt strain selection was largely based on phase-contrast microscopy. This approach favors isolates producing bipyramidal crystals (Cry1 toxin), which are more readily distinguished than cubic (Cry2 toxin), rhomboid, oval, or irregular crystals. In the present work, strain selection based on Bt crystal production was carried out by phase-contrast and scanning electron microscopy. Surprisingly, among the 28 Bt isolates cubic crystals, indicative of Cry2 toxins, were the most abundant (68 %) whereas bipyramidal crystals, formed by Cry1 toxins, were produced by 38 % of the strains and were thus the third most abundant type. Accordingly, the strains isolated in this study differed from those obtained from other areas in Mexico, where bipyramidal was the most abundant crystal type [1]. To corroborate our scanning electron microscopy results of crystal characterization, the cry genes of the isolates were identified using general primers as well as primers specifically designed for this study (Table 1). The latter principally targeted the cry1, cry2, and cyt gene combinations typical of this geographical area. As shown in Fig. 3, the results confirmed cry2 as the most abundant gene in the 28 Bt isolates. Additionally, the predicted size of the Cry2 protein (50–75 kDa) was almost always confirmed by the protein profiles determined by SDS-PAGE, thus supporting cry2 gene identification. On the other hand, the detection of cry1 in 36 % of the isolates is in agreement with previously reported results [1], suggesting a similar distribution of this gene throughout Mexico. Other cry genes highly distributed in this region were
cry genes in B. thuringiensis
Int. Microbiol. Vol. 15, 2012
Table 3. The cry and cyt gene combination profiles in the isolated strains cry and cyt gene profiles
No. of strains
cry1A, cry1B, cry2Aa, cry2Ab
2
cry1A, cry1B, cry2Aa, cyt
1
cry1A, cry1C, cry2Aa, cry3, cyt
1
cry1A, cry1D, cry2Aa, cry2Ab
1
cry1A, cry1D, cry2Aa, cry2Ab, cry8
1
cry1A, cry1D, cry8, cry11, cyt
1
cry1A, cry2Aa, cry2Ab
2
cry2Aa, cry2Ab
3
cry2Aa, cry2Ab, cry8
1
cry2Aa, cry2Ab, cry11
1
cry2Aa, cry2Ab, cyt
1
cry2Aa, cry2Ab, cry2Ac
1
cry2Aa, cry2Ab, cry2Ac, cyt
3
cry3, cry11
1
cry3, cry11, cyt
1
cry11, cyt
1
cry11 (20 %), cry8 (11 %), and cry3 (11 %) (Fig. 3). While the predominance of cry1 has been reported in other countries, a large proportion of those samples were also positive for cry2. For example, in a 2003 report from China [17], cry1, cry2, and cry9 were detected, respectively, in 76.5 %, 70 %, and 15.5 % of the Bt strains. In Thailand, a 2008 report [15] found that these same genes were present in 81.3 %, 80.6 % and 37.3 % of the isolates. Our findings in 28 Bt strains isolated from the Tijuana-Ensenada region of northwestern Mexico complement current knowledge on cry gene distribution. Also of interest is the relatively high abundance (40 %) of the cyt gene in the 28 Bt isolates, as this was not the case in other studies [1,18]. As shown in Table 2 and Fig. 3, cyt was the second most frequently amplified gene in this study. This predominance of Cyt is surprising since these proteins are toxic to mosquitoes, which inhabit regions characterized by high levels of rain and/or humidity. However, in TijuanaEnsenada rain is scarce, there are no tropical forests or large
217
lagoons, and mosquitoes are uncommon. Nevertheless, this region is the only zone in Mexico that is influenced by cold sea water, which results in humidity levels of 50–75 % at least 15 h a day throughout the year, with temperatures fluctuating from 15 to 22 oC. Therefore, the high percentage of Cyt proteins in Bt isolates from this area seems to be related to the high humidity rather than to an abundance of mosquitoes. In addition, the percentage of Bt isolates expressing the cyt gene is one of the highest reported thus far. The distribution of cry2 and cyt in the 28 Bt isolates obtained in this study versus isolates from other areas [1,5] is a topic that deserves careful study in relation to insect distribution and the respective environmental conditions. Analyses of the insecticidal capacity of isolated strains will no doubt yield new and more potent Cry and Cyt toxin combinations. To the best of our knowledge, protein combinations such as Cry2Aa/Cyt, which kill Lepidoptera and Diptera, have not been reported (Table 2). Thus, Bt isolates of this type are good candidates as a multifunctional insecticide, with the advantages of diminishing the need for strain combination and avoiding growth competence issues as well as the need for DNA recombinant technology. Additionally, our results highlight the benefits to be gained by searching for Bt strains in new and extreme geographical areas. Finally, although some of the 28 Bt isolates did not amplify with any of the oligonucleotides tested, they were nonetheless classified as Bt based on their protein profiles and crystal production (Table 2). These strains are likely to be sources of new Cry proteins. Acknowledgements. This work was supported by the Consejo Nacional de Ciencia y Tecnología, CONACYT-202918. We thank Israel Gradilla for technical assistance and Christian Hernández for editing of the figures. Competing interest. None declared.
References 1. Bravo A, Sarabia S, López L, Ontiveros H, Abarca C, Ortiz A, Ortiz M, Lina L, Villalobos FJ, Peña G, Núñez-Valdez ME, Soberón M, Quintero R (1998) Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl Environ Microbiol 64:4965-4972 2. Bravo A, Gill SS, Soberón M (2007) Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 49:423-435 3. Broderick N, Raffa KF, Handelsman J ( 2006) Midgut bacteria required for Bacillus thuringiensis insecticidal activity. Proc Natl Acad Sci USA 103:15196-15199 4. Gao M, Li R, Dai S, Wu Y, Yi D (2008) Diversity of Bacillus thuringiensis strains from soil in China and their pesticidal activities. Biol Control 44:380-388
218
Int. Microbiol. Vol. 15, 2012
5. Ibarra JE, del Rincón MC, Ordúz S, Noriega D, Benintende G, Monnerat R, Regis L, de Oliveira CMF, Lanz H, Rodriguez MH, Sánchez J, Peña G, Bravo A (2003) Diversity of Bacillus thuringiensis strains from Latin America with insecticidal activity against different mosquito species. Appl Environ Microbiol 69:5269-5274 6. Ito A, Sasaguri Y, Kitada S, Kusaka Y, Kuwano K, Masutomi K, Mizuki E, Akao T, Ohba M (2004) A Bacillus thuringiensis crystal protein with selective cytocidal action to human cells. J Biol Chem 279:21282-21286 7. Jiménez-Juárez N, Muñoz-Garay C, Gómez I, Gill SS, Soberón M, Bravo A (2008) The pre-pore from Bacillus thuringiensis Cry1Ab toxin is necessary to induce insect death in Manduca sexta. Peptides 29:318-323 8. Laemmli U (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685 9. Lereclus D, Agaisse H, Gominet M, Chaufaux J (1995) Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spo0A mutant. Nature Biotechnol 13:67-71 10. Martínez-Alonso M, Escolano J, Montesinos E, Gaju N (2010) Diversity of the bacterial community in the surface soil of a pear orchard based on 16S rRNA gene analysis. Int Microbiol 13:123-134 11. Mora I, Cabrefiga J, Montesinos E (2011) Antimicrobial peptide genes in Bacillus strains from plant environments. Int Microbiol 14:213-223 12. Palma L, Hernández-Rodríguez CS, Maeztu M, Hernández-Martínez P, de Escudero IR, Escriche B, Muñoz D, Van Rie J, Ferré J, Caballero P (2012) Vip3C, a novel class of vegetative insecticidal proteins from Bacillus thuringiensis. Appl Environ Microbiol 78:7163-7165
mendoza et al.,
13. Pérez C, Fernández LE, Sun J, Folch JL, Gill SS, Soberón M, Bravo A (2005) Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. Proc Natl Acad Sci USA 102:18303-18308 14. Sarrafzadeh MH, Bigey F, Capariccio B, Mehrnia MR, Guiraud JP, Navarro JM (2007) Simple indicators of plasmid loss during fermentation of Bacillus thuringiensis. Enzyme Microb Tech 40:1052-1058 15. Thammasittirong A, Attathom T (2008) PCR-based method for the detection of cry genes in local isolates of Bacillus thuringiensis from Thailand. J Invertebr Pathol 98:121-126 16. Thomas WE, Ellar DJ (1983) Bacillus thuringiensis var israelensis crystal d-endotoxin: effects on insect and mammalian cells in vitro and in vivo. J Cell Sci 60:181-197 17. Wang J, Boets A, Van Rie J, Ren G (2003) Characterization of cry1, cry2, and cry9 genes in Bacillus thuringiensis isolates from China. J Invertebr Pathol 82:63-71 18. Wu Y, Gao M, Dai S, Yi D, Fan H (2008) Investigation of the cyt gene in Bacillus thuringiensis and the biological activities of Bt isolates from the soil of China. Biol Control 47:335-339
INDEX VOLUME 15 International Microbiology (2012) www.im.microbios.org
Contents Volume 15 · 2012 Abreu F àMartins JL Arias E à Mendoza G Ascaso C à Wierzchos J Bañeras L à The role of plant type and salinity in the selection for the denitrifying community structure in the rhizosphere of wetland vegetation, 89 DOI: 10.2436/20.1501.01.162 Bebout BM à García-Maldonado JQ Beier RC à Sheffield CL Berlanga M à Enhanced polyhydroxyalkanoates accumulation by Halomonas spp. in artificial biofilms of alginate beads, 191 DOI: 10.2436/20.1501.01.172 Bengoechea JA à Infection systems biology: from reactive to proactive (P4) medicine, 55 DOI: 10.2436/20.1501.01.158 Bengoechea JA à Garmendia J Bitrian M à Identification of virulence markers in clinically relevant strains of Acinetobacter genospecies, 79 DOI: 10.2436/20.1501.01.161 Bonete MJ à Nájera-Fernández C Celis LB à García-Maldonado JQ Chen P à Surface alteration of realgar (As 4S4) by Acidithiobacillus ferrooxidans, 9 DOI: 10.2436/20.1501.01.154 Crippen TL à Sheffield CL de Almeida FP à Martins JL de los Ríos à Wierzchos J de Oliveira MVV à Intorne AC de Souza Filho GA à Intorne AC Domènech O à Berlanga M Escudero JA à González-Zorn B Fari K à Moskot M Fujii K à Isolation and characterization of aerobic microorganisms with cellulolytic activity in the gut of endogeic earthworms, 121 DOI: 10.2436/20.1501.01.165 Gabig-Cimińska M à Moskot M García-Maldonado JQ à Phylogenetic diversity of methyl-coenzyme M reductase (mcrA) gene and methanogenesis from trymethyl-amine in hypersaline environments, 33 DOI: 10.2436/20.1501.01.155 Garmendia J à Genotypic and phenotypic diversity of the noncapsulated Haemophilus influenzae: adaptation and pathogenesis in the human airways, 159 DOI: 10.2436/20.1501.01.170 Germani JC à Schinke C González RH à Bitrian M
INTERNATIONAL MICROBIOLOGY
González-Zorn B à Ecology of antimicrobial resistance: humans, animals, food and environment, 101 DOI: 10.2436/20.1501.01.163 Guerrero R à Berlanga M
Miñana-Galbis D à Berlanga M Moleres J à Garmendia J Moskot M à Metal and antibiotic resistance of bacteria isolated from the Baltic Sea, 131 DOI: 10.2436/20.1501.01.166
Hallin S à Bañeras L Heindl H à Bacterial isolates from the bryozoan Membraniphora membranacea: influence of culture media on isolation and antimicrobial activity, 17 DOI: 10.2436/20.1501.01.155 Hu C à Luo P
Nájera-Fernández C à Role of the denitrifying Haloarchaea in the treatment of nitrite-brines, 111 DOI: 10.2436/20.1501.01.164 Nudel CB à Bitrian M
Ikeda K à Fujii K Imhoff JF à Heindl H Intorne AC à Essential role of the czc determinant for cadmium, cobalt and zinc resistance in Gluconacetobacter diazotrophicus PAI 5, 69 DOI: 10.2436/20.1501.01.160 Jakóbkiewicz-Banecka J à Moskot M Jiang H à Luo P Jiang X à Luo P Kotlarska E à Moskot M Li H à Chen P Li Y à Chen P Lins U à Martins JL López-Cortés A à García-Maldonado JQ López-Flores R à Bañeras L Luo P à Prevalence of mobile genetic elements and transposase genes in Vibrio alginolyticus from the southern coastal region of China and their role in horizontal gene transfer, 201 DOI: 10.2436/20.1501.01.173 Mariscotti JF à Contribution of sortase A to the regulation of Listeria monocytogenes LPXTG surface proteins, 43 DOI: 10.2436/20.1501.01.157 Markova N à Unique biological properties of Mycobacterium tuberculosis l-form variants: impact for survival under stress, 61. DOI: 10.2436/20.1501.01.159 Martí-Lliteras P à Garmendia J Martínez-Espinosa RM à Nájera-Fernández C Martins JL à Spatiotemporal distribution of the magnetotactic multicellular prokaryote Candidatus Magnetoglobus multicellularis in a Brazilian hypersaline lagoon and in microcosms, 141 DOI: 10.2436/20.1501.01.167 Mendoza G à New combinations of cry genes from Bacillus thuringiensis strains isolated from northwestern Mexico, 211 DOI: 10.2436/20.1501.01.174 Michailova L à Markova N
Olmos J à Mendoza G Pereira LM à Intorne AC Poole TL à Sheffield CL Portillo A à Mendoza G Pucciarelli MG à Mariscotti JF Puig C à Garmendia J Quereda JJ à Mariscotti JF Quintana XD à Bañeras L Ren C à Luo P Ribas RM à Mendoza G Rosado AS à Martins JL Ruiz-Rueda O à Bañeras L Schinke C à Screening Brazilian Macro-phomina phaesolina isolates for alkaline and other extracellular hydrolases, 1 DOI: 10.2436/20.1501.01.153 Sheffield CL à Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozime, 185 DOI: 10.2436/20.1501.01.171 Silveira TS à Martins JL Skinner N à Year’s comments for 2012, 153 DOI: 10.2436/20.1501.01.168 Slavchev G à Markova N Solari CM à Bitrian M Su T à Luo P Thiel V à Heindl H Wang Q à Chen P Wang Y à Luo P Węgrzyn G à Moskot M Wierzchos J à Microorganisms in desert rocks: the edge of life on Earth, 173 DOI: 10.2436/20.1501.01.160 Wiese J à Heindl H Wróbel B à Moskot M Yan L à Chen P Yoshida S à Fujii K Zafrilla B à Nájera-Fernández C
219
INTERNATIONAL MICROBIOLOGY Authors Index · 2012 Abreu F à 141 Arias E à 211 Ascaso Cà 173
Ikeda K à 121 Imhoff JF à 17 Intorne AC à 69
Bañeras L à 89 Bebout BM à 33 Beier RC à 185 Berlanga M à 189 Bengoechea JA à 55, 159 Bitrian M à 79 Bonete MJ à 111
Jakóbkiewicz-Banecka J à 131 Jiang H à 201 Jiang X à 201
Celis LB à 33 Chen P à 9 Crippen TL à 185 de Almeida FP à 141 de los Ríos à 173 de Oliveira MVV à 69 de Souza Filho GA à 69 Domènech O à 191 Escudero JA à 101 Fari K à 131 Fujii K à 121 Gabig-Cimińska M à 131 García-Maldonado JQ à 33 Garmendia J à 159 Germani JC à 1 González RH à 79 González-Zorn B à 101 Guerrero R à 191 Hallin S à 89 Heindl H à 17 Hu C à 201
220
Kotlarska E à 131 Li H à 9 Li Y à 9 Lins U à 141 López-Cortés A à 33 López-Flores R à 89 Luo P à 199 Mariscotti JF à 43 Markova N à 61 Martí-Lliteras P à 159 Martínez-Espinosa RM à 111 Martins JL à 141 Mendoza G à 209 Michailova L à 61 Miñana-Galbis D à 191 Moleres J à 159 Moskot M à 131 Nájera-Fernández C à 111 Nudel CB à 79 Olmos J à 211 Pereira LM à 69 Poole TL à 185 Portillo A à 211 Pucciarelli MG à 43 Puig Cà 159
Quereda JJ à 43 Quintana XD à 89 Ren C à 201 Ribas RM à 211 Rosado AS à 141 Ruiz-Rueda O à 89 Schinke C à 1 Sheffield CL à 183 Silveira TS à 141 Skinner N à 153 Slavchev G à 61 Solari CM à 79 Su T à 201 Thiel V 17 Wang Q à 9 Wang Y à 201 Węgrzyn G à 131 Wierzchos J à 171 Wiese J à 17 Wróbel B à 131 Yan L à 9 Yoshida S à 121 Zafrilla B à 111
INTERNATIONAL MICROBIOLOGY Keywords Index 路 2012 Acidithiobacillus ferrooxidans 9 Acinetobacter 79 Alginate beads 189 Amylases 1 Antibiotic resistance 131 Antibiotics 101 Antimicrobial activity 17 Araruama Lagoon 141 Arid environments 173 Artificial biofilm 191 Assimilatory nitrite pathway 111 Bacillus thuringiensis 211 Bacterial communities 89 Bacterial regulation 43 Bacterial survival 61 Baltic Sea 17, 131 Biofilm 185 Bioleaching 9 Bioremediation 111 Brines 111 Burkholderia 121 Cadmium 69 Candidatus Magnetoglobus multicellularis 141 Cellulases 121 Chaetomium earthworms 121 Coastal lagoons 89 Cobalt 69 Covalent anchoring 43 Cry proteins 211 Cultivation media 17 Cyt proteins 211 czc determinant 69 Denitrification 89, 111 Desert rocks 173 Dextranase 185 Eco-evo drugs 101 Ecology of antimicrobial resistance 101 Endoliths 173 Escherichia coli 185 EU antimicrobial policy 101 Eutrophication gradient 89
Food safety 185
OMICs 55
Gene analysis 17 Gene mcrA 33 Genetic diversity 159 Gluconacetobacter diazotrophicus PAI 5 69 Gradial growth rate 1
P4 medicine 55 Pathogen-host interplay 159 Pectinases 1 Peptidoglycan 43 Polyhydroxyalkanoates (PHA) 191 Phylogeny 79 Pigmentation 131 Plasmids 131 Proteases 1 Public health 101
Haemophilus influenzae 159 Haloarchaea 111 Haloferax mediterranei 111 Halomonas spp. 191 Horizontal gene transfer 201 Hyper-arid deserts 173 Hypersaline environments 33 Immobilized cells 191 Infection biology 55 Insecticidal activity 211 Insertion sequences 201 Integrating conjugative elements (ICE) 201 Klebsiella pneumoniae subsp. pneumoniae 185 Lactoferrin 185 L-form conversion 61 Light 79 Lignocellulose digestion 121 Listeria monocytogenes 43 Lithobiontic microorganisms 173 Lypolytic activity 1 Lysozyme 185 Macrophomina phaseolina 1 Magnetotactic prokaryotes 141 Marine bacteria 131 Membranipora membranacea 17 Metal resistance 69, 131 Methanosarcinaceae 33 Microbial mats 33 Microbial systems biology 55 Mycobacterium tuberculosis 61
Quorum sensing 79 Raman spectroscopy 9 Realgar (arsenic sulfide) 9 Resistance units 101 Respiratory nitrite pathway 111 Rhizosphere ecology 89 Salinity gradient 89 Sortases 43 Spatiotemporal bacterial distribution 141 Starvation stress 61 Superintegrons 201 Surface proteins 43 Transposases 201 Trimethylamine 33 Vibrio alginolyticus 201 Virulence markers 79 Virulence phenotype 159 Wetlands 89 X-ray diffraction 9 Xylanases 121 Zinc 69
Noncapsulated/nontypable Haemophilus influenzae (NTHi) 159
221
INTERNATIONAL MICROBIOLOGY Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz
222
S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.
INTERNATIONAL MICROBIOLOGY General Information International Microbiology is a quarterly, open-access, peer-reviewed
journal in the fields of basic and applied microbiology. It publishes two kinds of papers: research articles and complements (editorials, perspectives, books reviews, etc.). Submission Manuscripts must be submitted by one of the authors of the manuscript by e-mail to int.microbiol@microbios.org. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 2. The submission file is in Microsoft Word, RTF, or OpenOffice document file format. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in “Preparation of manuscripts.” 4. Illustrations and figures are placed separately in another document. Large files should be compressed. Copyright and license If an article is accepted for publication in International Microbiology, the authors (or other copyright holders) must transfer the copyright to the journal, which covers the right—not exclusive—to reproduce and distribute the article including reprints, translations, photographic reproductions, microforms, electronic form (offline, online) or any other reproduction of similar nature. Creative Commons The journal is published under a Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License. http://creativecommons.org/licenses/by-nc-sa/3.0/
Open access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. International Microbiology’s open access policy enables a far greater distribution and impact of an author’s work and is in the interest of the scientific community worldwide. The journal’s expenses for providing immediate, permanent, free online access to the full text of research articles are recovered partly from article-processing charges. Currently many research funding agencies not only allow these expenses to be paid from their grants, but also encourage open access publication. The journal’s standard processing fee is 800.00 €. If a manuscript requires extensive editorial work, an extra charge may be requested. The acceptance of a paper, however, will not depend on the authors’ ability to pay these charges. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers International Microbiology is published quarterly. Volume 14 will consist of 4 issues—March, June, September and December—and will be published during 2012. Recommended annual subscription is 300.00 € plus shipping and handling. Single-issue prices are available upon request. SAL (Surface Air Lifted) delivery is mandatory for Japan, Northeast and Southeast Asia, India, Australia and New Zealand. Airmail delivery to all other countries is available upon request. Orders or claims can be sent directly to: International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact int.microbiol@ microbios.org if you have any questions regarding your subscription. Information for advertisers For advertising inquiries, please contact us at int.microbiol@microbios. org. All advertisements are subject to the publisher’s approval.
All articles in International Microbiology will be available on the Internet to any reader at no cost. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited and it is not used for commercial purposes. We recommend authors read about the Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License before submitting their paper. Open access and article processing charges
Disclaimer While the contents of this journal are believe to be true and accurate at the date of its publication, neither the authors and editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein. p3
INTERNATIONAL MICROBIOLOGY Official journal of the Spanish Society for Microbiology Volume 15 · Number 4 · December 2012
EDITORIAL
Skinner N Year’s comments for 2012
153
RESEARCH REVIEWS
Garmendia J, Martí-Lliteras P, Moleres J, Puig C, Bengoechea JA Genotypic and phenotypic diversity of the noncapsulated Haemophilus influenzae: adaptation and pathogenesis in the human airways
159
Wierzchos J, de los Ríos A, Ascaso C Microorganisms in desert rocks: the edge of life on Earth
173
RESEARCH ARTICLES
Sheffield CL, Crippen TL, Poole TL, Beier RC Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme
Berlanga M, Miñana-Galbis D, Domènech O, Guerrero R Enhanced polyhydroxyalkanoates accumulation by Halomonas spp. in artificial biofilms of alginate beads
191
Luo P, Jiang H, Wang Y, Su T, Hu C, Ren C, Jiang X Prevalence of mobile genetic elements and transposase genes in Vibrio alginolyticus from the southern coastal region of China and their role in horizontal gene transfer
201
Mendoza G, Portillo A, Arías E, Ribas RM, Olmos J New combinations of cry genes from Bacillus thuringiensis strains isolated from northwestern Mexico
211
ANNUAL INDEXES
185
INDEXED IN
Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elservier Bibliographic Databases; Food Science and Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®; Latíndex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®
219