Issuu on Google+


a Ariane

[CPyM]

a Pato, Paty, Richard y Nathy

[ALC]


GLIFOSATO  Genética, Salud y Ambiente                       

Autores / Editores 

    César Paz‐y‐Miño  Instituto de Investigaciones Biomédicas  Escuela de Medicina  Facultad de Ciencias de la Salud  Universidad de las Américas 

    Andrés López Cortés  Instituto de Investigaciones Biomédicas  Escuela de Medicina  Facultad de Ciencias de la Salud  Universidad de las Américas 

 

 


© GLIFOSATO Genética, Salud y Ambiente  UDLA Universidad de las Américas  SENESCYT Secretaría Nacional de Educación Superior, Ciencia, Tecnología e Innovación    Derechos reservados. Citar mencionando sus autores y fuente de origen.    Esta publicación puede ser obtenida bajo pedido al:  Instituto de Investigaciones Biomédicas (IIB). Universidad de las Américas (UDLA).  Av. de los Granados E12‐41 y Colimes. Primer nivel.  E‐mail: iib@udla.edu.ec  www.udla.edu.ec    Autores / Editores:  César Paz‐y‐Miño [UNIVERSIDAD DE LAS AMÉRICAS]     Andrés López Cortés [UNIVERSIDAD DE LAS AMÉRICAS]       Autores:  María José Muñoz [UNIVERSIDAD DE LAS AMÉRICAS]     María Eugenia Sánchez [UNIVERSIDAD DE LAS AMÉRICAS]   Catalina Herrera [UNIVERSIDAD CENTRAL DEL ECUADOR]  Adolfo Maldonado [CORPORACIÓN ACCIÓN ECOLÓGICA]  Carolina Valladares [CORPORACIÓN ACCIÓN ECOLÓGICA]    Fotografía:  Andrés López Cortés   Catalina Herrera     Fotos de portada:  ∙ Figura modificada de la estructura tridimensional de la proteína GSTP1 (EMBL‐EBI, 2010).   ∙ Figura modificada del empaquetamiento del ADN (The Royal Swedish Academy of Sciences, 2009).    Fotos de contraportada:  ∙ Figura modificada de la estructura tridimensional de la proteína GPX‐1 (EMBL‐EBI, 2010).     Derechos de autor No. 034672  ISBN: 978‐9942‐03‐394‐9  Imprenta: Hojas y Signos    El Municipio Metropolitano de Quito otorgó el premio “Enrique Garcés” a la mejor obra en Ciencias de  la Vida a través de la estatuilla “Rumiñahui de Oro”.    2011 


Índice de contenido  COLABORADORES 

VIII 

AGRADECIMIENTOS 

IX 

PRESENTACIÓN 

XI 

RESUMEN 

XIII 

SUMMARY 

XIV 

ABREVIATURAS 

XV 

 

PARTE I    ADN Y CROMOSOMAS                                                                                                   1. 

BASES MOLECULARES DE LA GENÉTICA  1.1.  MUTACIONES DEL ADN  1.2.  POLIMORFISMOS DEL ADN  1.2.1.  Biomarcadores genéticos: SNPs, RFLPs y SSLPs 

2. 

CROMOSOMAS  2.1. 

3. 

ABERRACIONES CROMOSÓMICAS 

NUESTRA EXPERIENCIA EN ESTUDIOS CON GENOTÓXICOS  3.1.  3.2. 

GENES, POLIMORFISMOS Y SU ASOCIACIÓN CON ENFERMEDADES  GENOTÓXICOS: HIDROCARBUROS, RAYOS X Y PESTICIDAS 

1  1  1  1  2  3  4  4  5 

  FOTOGRAFÍA Región Amazónica   

PARTE II   COCTEL HERBICIDA  4. 

EL GLIFOSATO  4.1. 

5. 

ROUNDUP: SURFACTANTES, COADYUVANTES Y CONTAMINANTES  5.1.  5.2.  5.3. 

6. 

MECANISMO DE ACCIÓN 

POLIOXIETILENO AMINA (POEA)  COSMO‐FLUX 411F  N‐NITROSO GLIFOSATO 

RESISTENCIA GENÉTICA DE PLANTAS AL GLIFOSATO  6.1.  6.2. 

RESISTENCIA ADQUIRIDA NATURALMENTE CONTRA HERBICIDAS  PLANTAS TRANSGÉNICAS TOLERANTES AL GLIFOSATO Y SUS EFECTOS EN LA SALUD 

16  16  18  19  20  20  21  21  21 

 

FOTOGRAFÍA Flora   

PARTE III  TOXICOLOGÍA   7. 

TOXICOLOGÍA GENÉTICA Y SUS EFECTOS EN LA SALUD 

30 

8. 

ESTUDIOS TOXICOLÓGICOS DE PESTICIDAS EN HUMANOS 

30 

9. 

ESTUDIOS TOXICOLÓGICOS DE PESTICIDAS EN OTROS ORGANISMOS 

36 


FOTOGRAFÍA Anfibios y reptiles   

PARTE IV   ASPERSIONES AÉREAS  10.  BIODIVERSIDAD AMAZÓNICA ECUATORIANA: RECURSOS Y AMENAZAS 

40 

11.  ORIGEN DE LAS ASPERSIONES AÉREAS 

41 

12.  ANTECEDENTES DE IMPACTOS POR LAS ASPERSIONES AÉREAS 

43 

12.1.  CARACTERÍSTICAS DE LAS ASPERSIONES  12.2.  PERCEPCIÓN SOBRE LAS ASPERSIONES  12.3.  COMPORTAMIENTO ANTE LAS ASPERSIONES  13.  EFECTOS DE LAS ASPERSIONES A LA COMUNIDAD  13.1.  DESARROLLO COMUNITARIO  13.2.  COHESIÓN Y DESPLAZAMIENTO 

43  45  46  48  48  49 

14.  EFECTOS DE LAS ASPERSIONES A LOS CULTIVOS 

50 

15.  EFECTOS DE LAS ASPERSIONES A LOS ANIMALES 

51 

16.  EFECTOS DE LAS ASPERSIONES AL AGUA 

51 

  FOTOGRAFÍA Insectos   

PARTE V    BIOMONITOREO EN LA PROVINCIA DE SUCUMBÍOS  17.  ÁREA DE ESTUDIO 

56 

17.1.  COMUNIDADES 

56 

18.  ORIGEN Y DATOS DE LA POBLACIÓN  18.1.  18.2.  18.3.  18.4.  18.5.  18.6. 

INDICADORES SOCIO‐ECONÓMICOS Y DE SALUD  PROCEDENCIA  ORIGEN ÉTNICO  TIEMPO DE RESIDENCIA  SEXO Y EDAD  NIVEL EDUCATIVO 

19.  CONDICIONES DE VIDA  19.1.  19.2.  19.3.  19.4.  19.5.  19.6.  19.7.  19.8. 

DISTANCIA A LA FRONTERA  MATERIALES DE LAS CASAS Y TESTIMONIOS DE CONDICIONES DE VIDA  DORMITORIOS POR VIVIENDA  VENTANAS Y TOLDILLOS  MANEJO DE BASURA  FUENTES DE AGUA PARA EL CONSUMO  MANEJO DE HECES  POSESIÓN Y USO DE LA TIERRA 

57  58  59  59  60  60  60  61  61  61  62  62  62  63  63  63 

 

FOTOGRAFÍA Comunidades fronterizas I   

PARTE VI   DIAGNÓSTICO GENÉTICO   20.  MUESTRAS BIOLÓGICAS 

70 

21.  TÉCNICAS DE BIOLOGÍA MOLECULAR 

70 


21.1.  EXTRACCIÓN DEL ADN  21.2.  REACCIÓN EN CADENA DE LA POLIMERASA  21.3.  FRAGMENTOS DE RESTRICCIÓN DE LONGITUD POLIMÓRFICA  22.  GEN GPX‐1  22.1.  AMPLIFICACIÓN Y GENOTIPAJE  22.2.  POLIMORFISMO PRO198LEU  23.  GEN GSTP1  23.1.  AMPLIFICACIÓN Y GENOTIPAJE  23.2.  POLIMORFISMO ILE105VAL  24.  GEN XRCC1  24.1.  AMPLIFICACIÓN Y GENOTIPAJE  24.2.  POLIMORFISMO ARG399GLN  25.  CITOGENÉTICA  25.1.  25.2.  25.3.  25.4.  25.5.  25.6. 

CULTIVO DE SANGRE PERIFÉRICA  COSECHA DE SANGRE PERIFÉRICA  EXTENSIÓN DE PLACAS  TINCIÓN SIMPLE DE PLACAS  BANDEO GTG  ANÁLISIS DE CARIOTIPOS 

70  71  71  71  73  74  75  76  77  77  78  79  79  79  80  80  81  81  81 

 

FOTOGRAFÍA Genética   

PARTE VII  DIAGNÓSTICO EN SALUD  26.  VALORACIÓN DEL ESTADO NUTRICIONAL  26.1.  26.2.  26.3.  26.4. 

ESTADO NUTRICIONAL GLOBAL  ESTADO NUTRICIONAL CRÓNICO (RETRASO DEL CRECIMIENTO)  ESTADO NUTRICIONAL AGUDO (EMACIACIÓN)  ÍNDICE DE MASA CORPORAL 

27.  VALORACIÓN DE LA SALUD 

86  86  88  91  93  94 

27.1.  PERCEPCIÓN DE LA SALUD  27.2.  MORTALIDAD FAMILIAR 

94  95 

28.  SALUD MATERNO‐INFANTIL 

96 

28.1.  28.2.  28.3.  28.4. 

ABORTOS  MALFORMACIONES  MORTALIDAD INFANTIL Y JUVENIL  PLANIFICACIÓN FAMILIAR 

96  97  98  98 

29.  ANTECEDENTES PERSONALES 

99 

29.1.  MORDEDURAS DE ANIMALES  29.2.  INTOXICACIONES AGUDAS  29.3.  ENFERMEDADES INFECCIOSAS  29.4.  HÁBITOS  29.4.1.  Tabaco  29.4.2.  Alcohol  29.4.3.  Droga 

99  99  100  100  100  100  101 

30.  IMPACTO DE LAS ASPERSIONES AÉREAS A LA SALUD 

101 


30.1.  EFECTOS DE LAS ASPERSIONES A LA SALUD DE LOS POBLADORES  30.2.  TIPOS DE PATOLOGÍAS  31.  CHEQUEOS MÉDICOS  31.1.  31.2.  31.3.  31.4.  31.5.  31.6.  31.7.  31.8.  31.9.  31.10.  31.11.  31.12.  31.13.  31.14.  31.15. 

ALERGIAS  OJOS  SISTEMA DIGESTIVO  PIEL  ODONTOLOGÍA  OÍDOS  NARIZ Y GARGANTA  SISTEMA RESPIRATORIO  CORAZÓN Y VASOS SANGUÍNEOS  RIÑÓN  SISTEMA LOCOMOTOR  SANGRE  SISTEMA ENDÓCRINO  GENITALES  SISTEMA NERVIOSO CENTRAL Y AFECCIONES PSICOLÓGICAS 

101  106  108  109  109  110  110  111  111  112  112  112  113  113  114  114  115  115 

  FOTOGRAFÍA Salud   

PARTE VIII DIAGNÓSTICO PSICOLÓGICO  32.  ESTUDIO PSICOLÓGICO  32.1.  32.2.  32.3.  32.4.  32.5.  32.6.  32.7.  32.8. 

COMUNIDAD YANAMARUM  COMUNIDAD CHONE 2  COMUNIDAD SAN FRANCISCO  COMUNIDAD FUERZAS UNIDAS  COMUNIDAD PLAYERA ORIENTAL  COMUNIDAD CORAZÓN ORENSE  COMUNIDAD LAS SALINAS  COMUNIDAD PUERTO ESCONDIDO 

124  124  125  125  125  125  125  126  126 

 

FOTOGRAFÍA Dibujos de niños   

PARTE IX   DIAGNÓSTICO AMBIENTAL  33.  DESTINO AMBIENTAL Y MOVILIDAD DEL GLIFOSATO 

130 

34.  MOVILIDAD EN SUELOS 

130 

35.  PERSISTENCIA DEL GLIFOSATO 

131 

36.  DESCRIPCIÓN DE LA ZONA 

131 

37.  MUESTREO DE SUELOS 

131 

37.1.  DETERMINACIÓN DEL GLIFOSATO  37.2.  DETERMINACIÓN DE HIERRO Y ALUMINIO  38.  CALIDAD DEL SUELO AGRÍCOLA  38.1.  EVALUACIÓN DE LA CALIDAD DEL SUELO  38.2.  INDICADORES DE LA CALIDAD DEL SUELO  38.2.1.  Indicadores físicos  38.2.2.  Indicadores químicos 

132  133  134  134  134  135  135 


38.2.3. 

Indicadores biológicos 

39.  INDICADORES PARA EVALUAR LA CALIDAD DEL SUELO  39.1.  METODOLOGÍA ANALÍTICA Y RESULTADOS  39.1.1.  Nitrógeno  39.1.2.  Fósforo  39.1.3.  Hierro, manganeso y potasio  39.1.4.  Materia orgánica  39.2.  DETERMINACIÓN DE MACRO Y MICRONUTRIENTES EN SUELOS CULTIVADOS 

136  137  137  137  138  138  139  140 

40.  CALIDAD DEL AGUA 

140 

41.  ANÁLISIS MICROBIOLÓGICO Y PARASITOLÓGICO 

140 

41.1.  ANÁLISIS MICROBIOLÓGICO  41.2.  ANÁLISIS PARASITOLÓGICO 

141  141 

42.  DETERMINACIÓN DE LA CALIDAD DEL AGUA 

141 

42.1.  RESULTADOS DE MICROBIOLOGÍA  42.1.1.  Recuento de enterobacterias  42.1.2.  Recuento de hongos  42.1.3.   Recuento de Escherichia coli  42.1.4.  Recuento de coliformes totales  42.2.  RESULTADOS DE PARASITOLOGÍA 

141  141  141  142  142  143 

 

FOTOGRAFÍA Ambiente   

PARTE X    MECANISMOS DE ATENUACIÓN Y REMEDIACIÓN  43.  LAS PLANTAS COMO FUENTE DE AGENTES ANTIMUTAGÉNICOS 

151 

44.  MECANISMOS FISICOQUÍMICOS Y BIOLÓGICOS CONVENCIONALES 

152 

45.  MECANISMOS ENZIMÁTICOS 

153 

46.  MECANISMOS DE OXIDACIÓN 

153 

 

FOTOGRAFÍA Comunidades fronterizas II   

PARTE XI   CONCLUSIONES Y SUGERENCIAS  47.  CONCLUSIONES  47.1.  47.2.  47.3.  47.4. 

CONDICIONES GENÉTICAS  CONDICIONES SOCIALES Y DE SALUD  CONDICIONES PSICOLÓGICAS  CONDICIONES AMBIENTALES 

48.  SUGERENCIAS  48.1.  SUGERENCIAS DE LAS COMUNIDADES 

161  161  162  165  166  166  166 

REFERENCIAS BIBLIOGRÁFICAS 

168 

ANEXOS 

180 

GLOSARIO 

191 

ÍNDICE ANALÍTICO 

198 


Colaboradores 

VIII 

  Se les agradece a las personas que colaboraron en la realización del proyecto de investigación  PIC‐08‐113 titulado: “Cuantificación del daño causado por aspersiones aéreas con glifosato en  microorganismos, plantas, animales, humanos y en calidad de suelo del territorio ecuatoriano  limítrofe a la frontera con Colombia”, y en la publicación del libro titulado “Glifosato: Genética,  Salud y Ambiente”.       Instituto de Investigaciones Biomédicas (IIB‐UDLA)  Tatiana Bermeo [BIOTECNOLOGÍA]  Alejandro Cabrera [GENÉTICA]  Bernardo Castro [GENÉTICA]  Carlos Chávez [BIOTECNOLOGÍA]  María José Corral [FINANZAS]  Nadia Cumbal [CITOGENÉTICA]  José Domínguez [BIOTECNOLOGÍA]  Jorge Navarrete [VETERINARIA]  Patricio Orozco [BIOTECNOLOGÍA]  Paulo Robles [CITOGENÉTICA]  Carla Rodríguez [BIOTECNOLOGÍA]  Mayra Rojas [COORDINACIÓN DE LABORATORIOS]  Lucía Romero [VÍDEO Y COMUNICACIÓN]  Carmen Salvador [BIOTECNOLOGÍA]  Karla Sandoval [BIOTECNOLOGÍA]  Daniela Santander [BIOTECNOLOGÍA]  Janeth Terraza [ASISTENTE DE LABORATORIOS]    Emilia Vázquez [BIOTECNOLOGÍA]  Alexandra Villalba [BIOLOGÍA]  Patricio Viteri [CORRECTOR DE ESTILO]    Acción Ecológica    Germán Luebert [GEOGRAFÍA]    Fundación De Waal    Xavier Caicedo [DIRECTOR]    Rocío Mariño [CIENCIAS DE LA EDUCACIÓN]   

Pontificia Universidad Católica del Ecuador (PUCE)    Javier Irazábal [BIOLOGÍA]                       


Agradecimientos    Secretaría Nacional de Educación Superior, Ciencia, Tecnología e Innovación (SENESCYT)  Manuel Baldeón [SECRETARIO SENESCYT]  Pedro Montalvo [EX SECRETARIO SENACYT]    Universidad de las Américas (UDLA)    Carlos Larreátegui [RECTOR]    Simón Cueva [VICERRECTOR]    Dirección de Finanzas – Departamento de Reportes (UDLA)    Francisco Corral [FINANZAS]    Pablo Moreno [FINANZAS]    Asociación de Comités Populares de Salud de Sucumbíos (ACOPSAS)    Mario Shingre [LABORATORISTA]    Jesús Plasencia [PROMOTOR DE SALUD]    Celia Erique [CHONE 2]    María Jiménez [CHONE 2]    Luis Méndez [YANAMARUM]    Dionisio Encarnación [PLAYERA ORIENTAL]    Víctor Pineda [PLAYERA ORIENTAL]    Cecilia Triana [FUERZAS UNIDAS]    Flor Trujillo [FUERZAS UNIDAS]  Juan Escobar [PUERTO NUEVO]  Jairo Mutumbajoi [PUERTO ESCONDIDO]  Luz Abad [PUERTO ESCONDIDO]  Mónica Muepaz [CORAZÓN ORENSE]  Yuli Cabrera [CORAZÓN ORENSE]  Hugo Gavilanes [5 DE AGOSTO]  Nora Yela [SANTA MARIANITA]  Kelly Moreno [SANTA MARIANITA]  Rocío Grefa [SAN FRANCISCO 1]  Laura Saritama [SAN FRANCISCO 2]  Franco Ortega [LAS SALINAS]  Jacqueline Elizalde [LAS SALINAS]    CEPI Fundación ponte en mi piel    Santiago Palacios [DERMATOLOGÍA]    Genevieve Boily [ENFERMERÍA]    Alejandro Arias [MEDICINA]  María Augusta Veintimilla [MÉDICO]      David Revelo [MEDICINA]  Virgilio Narváez [PSICOLOGÍA]    Clínica ambiental    Wilson Suárez [PROMOTOR AMBIENTAL]    Balia Vaca [PROMOTORA AMBIENTAL]    Luis Congacha [PROMOTOR AMBIENTAL]    Ángel Encarnación [PROMOTOR AMBIENTAL]   

IX 


Federación de Organizaciones Campesinas del Cordón Fronterizo Ecuatoriano de Sucumbíos  (FORCCOFES)    Calixto Párraga [PRESIDENTE]    Frenda Vite [SECRETARIO]    Iglesia de San Miguel de Sucumbíos (ISAMIS)    Pedro Perpiñán [MEDICINA]    Vaneska Zamora [MATRONA]    Movimiento de los Sin Tierra – Brasil    Francisco Martínez [MEDICINA]    Radialistas    Carlos Romero [CUENTACUENTOS]    Patronato Provincial de Salud del Gobierno Provincial de Sucumbíos    Luis Silva [LABORATORISTA]    Joffre Robalino [ODONTOLOGÍA]    Apoyo logístico    Ángel Lemache [COOPERATIVA TAXIS LAGO AGRIO]    Daniel Vargas [COOPERATIVA TAXIS LAGO AGRIO]    Roberto Jaramillo [CHOFER]    Edy Vera [CHOFER]    Julio Muñoz [CHOFER]   

Provincia de Sucumbíos  Se  les  agradece  a  todas  las  personas  que,  bajo  su  consentimiento,  se  les  extrajo  muestras de sangre periférica, se les tomó fotografías, se les realizó chequeos médicos  y  se  les  realizó  entrevistas.  De  la  misma  forma,  se  les  agradece  a  las  personas  de  las  comunidades  de  la  Provincia  de  Sucumbíos,  quienes  apoyaron  y  colaboraron  con  los  investigadores en sus labores diarias.                                           


Presentación  El  glifosato  es  uno  de  los  herbicidas  más  ampliamente  utilizados  alrededor  del  mundo;  y  ha  sido  señalado  por  su  fabricante  como  el  herbicida  más  seguro  para  la  salud  humana  bajo  las  condiciones  técnicas estipuladas: fumigación directa sobre la maleza, concentración de uso entre el��1 al 3%, y baja  dosis y tiempo de exposición de quien lo manipule.      Para el Ecuador, las aspersiones aéreas que el Gobierno de Colombia realizó entre los años 2000 al 2007,  dentro del plan colombiano para combatir las plantaciones de coca, amapola y marihuana, afectaron a  las  poblaciones  de  la  zona  fronteriza  colombo‐ecuatoriana;  esto  llevó  a  los  dos  países  a  un  posicionamiento  diplomático,  científico‐técnico,  ético  y gubernamental diverso,  llegando  a  convertirse  en un problema de Estados.    Ambos  países,  a  través  de  sus  gobiernos,  nombraron  sendas  comisiones  científicas,  las  cuales  en  las  discusiones bilaterales no llegaron a ponerse de acuerdo. Para el Ecuador, el problema radica en que el  uso del glifosato es antitécnico: las aspersiones aéreas se realizaron a gran altura, de forma repetitiva, y  con el uso de un coctel herbicida que además de presentar glifosato como ingrediente activo, contenía  Cosmo‐Flux  como  coadyuvante  y  polioxietileno  amina  (POEA)  como  surfactante.  Por  lo  tanto,  la  exposición crónica al ambiente (agua, vegetación, tierras), a los  animales y a las personas, determinaron  importantes  cambios  y  problemáticas  por  el  efecto  indirecto  que  recibió  el  lado  ecuatoriano  de  la  frontera.  El  efecto  se  lo  observó  y  determinó  por  los  testimonios  de  los  pobladores  de  las  zonas  afectadas, quienes refirieron la muerte de sus animales, plantaciones y contaminación de sus aguas, e  incluso  por  las  denuncias  recogidas  por  la  Defensoría  del  Pueblo.  El  efecto  fue  verificado  por  varias  comisiones nacionales e internacionales, incluida las Naciones Unidas. Concomitantemente, los médicos  ecuatorianos informaron un cambio en el patrón de salud de las personas expuestas a las aspersiones  con el coctel herbicida. Aumentaron los problemas gastrointestinales, de piel, respiratorios, oculares y  trastornos psicológicos, según lo verificó la Comisión Científica Ecuatoriana, nombrada por el Presidente  del  Ecuador  Rafael  Correa  y  su  Ministra  de  Relaciones  Exteriores,  Comercio  e  Integración,  María  Fernanda Espinosa.    El  trabajo  investigativo  de  la  Comisión  Científica  Ecuatoriana  se  plasmó  en  el  libro  “El  sistema  de  aspersiones  aéreas  del  Plan  Colombia  y  sus  impactos  sobre  el  ecosistema  y  la  salud  en  la  frontera  ecuatoriana” (2007), que recoge las diversas evidencias y perjuicios que el Ecuador considera ser objeto.  Producto  de  la  documentación  recopilada  por  el  Ecuador,  el  país  resolvió  poner  una  demanda  internacional  ante  La  Haya  por  considerar  que  las  aspersiones  producen  severos  daños  en  la  salud  y  ambiente ecuatorianos.    En  la  actualidad  existe  abundante  información  científica,  que  pone  en  duda  la  inocuidad  del  glifosato  solo  o  en  combinaciones  comerciales,  más  aún  dentro de  un coctel  herbicida  altamente  concentrado,  cuyo  método de  aplicación  no  tiene  comparación  alguna  en  el  planeta.  Estudios  sobre  el  daño  que  el  glifosato produce al material genético evidencian la degradación del ADN mediante la prueba cometa y  las  roturas  de  los  cromosomas,  convirtiéndolo  en  un  agente  genotóxico.  Los  genotóxicos  están  implicados  en  al  menos  tres  fenómenos  biológicos  importantes:  desarrollo  de  cáncer,  pérdidas  de  embarazos e infertilidad en los individuos expuestos.     Las aspersiones aéreas, con el coctel herbicida que contiene glifosato, cesaron en enero del 2007, y la  experiencia que los ecuatorianos adquirimos con este extraño y nuevo factor que alteró la biología de la  frontera,  ha  enriquecido  el  conocimiento  académico,  pero  también  el  saber  comunitario  de  las  zonas  afectadas.    El glifosato tiene un período corto de vida, el fabricante habla de tres meses, pero los estudios sobre el  destino ambiental de este herbicida llegan a detectarlo hasta luego de dos años, sobre todo en suelos  ricos  en  hierro.  Sea  como  fuere,  es  evidente  que  las  aspersiones  aéreas  causaron  problemas  en  la  frontera,  estudiados  por  varias  organizaciones  en  su  momento.  Conscientes  de  esta  problemática,  el  Instituto de Investigaciones Biomédicas de la Universidad de las Américas formuló un proyecto que fue  aprobado por la Secretaría Nacional de Ciencia y Tecnología (SENACYT), actualmente llamada Secretaría 

XI 


XII 

Nacional de Educación Superior, Ciencia, Tecnología e Innovación (SENESCYT), para evaluar el impacto  de  las  aspersiones  aéreas  con  glifosato  en  la  frontera norte,  y durante  dos  años  analizar  una  serie  de  determinantes  genéticos,  de  salud  física  y  psíquica,  y  ambientales,  que  conforman  los  resultados  que  este libro recoge.       Con este nuevo libro, que involucra muchos actores e investigadores, pretendemos brindar información  científica relacionada con los mecanismos de contaminación, precaución, protección y remediación, y de  los  potenciales  efectos  de  las  aspersiones  aéreas  indirectas  y  directas  sobre  las  comunidades  ecuatorianas fronterizas con Colombia. Para un mejor entendimiento del impacto del coctel herbicida, la  SENACYT  creó  la  Red  de  Ecotoxicología,  integrada  por  la  Universidad  de  las  Américas,  el  Museo  Ecuatoriano  de  Ciencias  Naturales,  la  Universidad  Técnica  del  Norte  y  la  Escuela  Politécnica  Nacional;  cuyo  propósito  es  el  intercambiar  la  información  que  estas  cuatro  instituciones  obtendrán  sobre  una  misma temática: aspersiones aéreas con paquete herbicida y sus efectos en territorio ecuatoriano.      De forma preliminar, los resultados del proyecto, conjuntamente con un video, los presentamos en la  13ra Reunión de Pacific Basin Consortium denominada “Environmental Exposures in the Era of Climate  Change”, y realizada el mes de noviembre del 2009 en el Telethon Institute for Child Health Research en  Perth, Australia, bajo el título “Social, health and genetic diagnoses of the zone of influence affected by  glyphosate aerial spraying in the north Ecuadorian border”; y el trabajo científico formal está disponible  en  la  revista  Reviews  on  Environmental  Health,  Vol.  26, No.  1,  Enero  del  2011,  con  el  título  “Baseline  determination in social, health, and genetic areas in communities affected by glyphosate aerial spraying  in the Northeastern Ecuadorian border”.     Terminado  el  proyecto  bajo  mi  dirección,  y  cuyos  resultados  ahora  los  presentamos  ampliados  y  analizados  en  este  libro,  podría  calificárselo  como  un  estudio  de  “línea  base”  sobre  las  condiciones  genéticas,  citogenéticas,  sociales,  de  salud  y  ambientales,  de  las  comunidades  de  la  Provincia  de  Sucumbíos fronterizas con Colombia.    Esta obra científica brinda información sobre los efectos de este genotóxico sobre la estructura del ADN  y de los cromosomas; el mecanismo de acción del glifosato y su incremento de acción mediante el uso  de  surfactantes,  coadyuvantes  y  otros  contaminantes.  Los  estudios  toxicológicos  internacionales  de  pesticidas en humanos y en otros organismos. La biodiversidad amazónica ecuatoriana amenazada por  las  aspersiones  aéreas,  así  como  efectos  en  los  cultivos,  animales  y  el  agua;  la  procedencia  y  las  condiciones de vida de las comunidades; el estudio de alteraciones cromosómicas y de polimorfismos  genéticos del ADN, relacionados a mayor o menor susceptibilidad frente al glifosato. La valoración del  estado  nutricional,  la  salud  materno‐infantil  y  el  impacto  de  las  aspersiones  aéreas  en  el  estado  psicológico de las comunidades. El diagnóstico ambiental, mediante el análisis de glifosato y AMPA en  muestras  de  suelo,  y  el  análisis  parasitológico  y  microbiológico  de  muestras  de  agua. Por  último,  esta  obra  brinda  información  bibliográfica  sobre  agentes  antimutagénicos  y  mecanismos  fisicoquímicos,  enzimáticos y de oxidación, utilizados en otros países, con el objetivo de atenuar y remediar la presencia  del glifosato en el ambiente, y que pueden ser de ayuda en el Ecuador si en el futuro continua el uso  indiscriminado de este pesticida.      La importancia de desarrollar un estudio estrictamente científico de alta envergadura, para determinar  una línea base en las áreas de genética, salud y ambiente, y plantear la importancia de continuar con  estudios prospectivos a corto y largo plazo, permitirán a las instituciones públicas y privadas, evaluar de  forma  más  verás  el  estado  de  las  comunidades  ecuatorianas,  y  desarrollar  proyectos  de  ayuda  social,  psicológica,  nutricional  y  ambiental,  con  el  fin  de  mejorar  el  nivel  socio‐económico,  de  nutrición,  de  salud, psicológico y ambiental, de las comunidades ecuatorianas fronterizas con Colombia.      César Paz‐y‐Miño  Quito, Enero 2011  

    


Resumen    Durante  los  años  2000  al  2007,  las  comunidades  ecuatorianas  localizadas  en  la  frontera norte han sido afectadas por el Plan  Colombia debido a las aspersiones aéreas con  glifosato, un herbicida selectivo que contiene  pesticidas,  surfactantes  y  adyuvantes,  aplicados  en  la  erradicación  del  cultivo  de  coca,  fuente  de  producción  mundial  de  la  cocaína.     El  propósito  de  esta  investigación  fue  cuantificar el daño a nivel genético, de salud,  social  y  ambiental,  de  las  comunidades  ecuatorianas  localizadas  en  el  cordón  fronterizo,  afectadas  por  las  fumigaciones,  mediante  la  aplicación  de  biomarcadores  de  exposición,  efecto  y  susceptibilidad  individual,  que  facilitará  una  valoración  temprana del desarrollo de carcinogénesis en  poblaciones  vulnerables  expuestas  a  genotóxicos.     La  ejecución  del  estudio  se  realizó  en  dos  etapas  considerando  el  avance  de  los  resultados por cada componente. La primera  etapa  consistió  en  obtener  la  información  toxicológica  de  144  familias  mediante  un  chequeo médico, evaluando a 521 individuos  pertenecientes  a  las  comunidades  afectadas  de  la  Provincia  de  Sucumbíos.  En  cuanto  a  salud,  se  determinó  que  la  malnutrición  fue  de  3%.  El  7,7%  de  las  personas  presentaron  niños  con  malformaciones,  mientras  que  el  porcentaje  de  abortos  fue  12,7%.  En  conclusión,  la  población  no  presentó  daño  significativo  a  nivel  genético  pero  presenta  problemas  en  relación  con  el  desarrollo  psicológico, social y sanitario.    Para determinar  los efectos a nivel genético,  se  emplearon  dos  biomarcadores.  El  biomarcador  de  efecto  fue  evaluado  en  linfocitos  de  sangre  periférica  en  182  individuos  de  la  población  expuesta,  aplicando  la  técnica  de  Alteraciones  Cromosómicas  (AC).  Los  resultados  de  AC  presentaron  un  cariotipo  normal  (46  cromosomas) en 182 individuos estudiados.   

Para  el  biomarcador  de  susceptibilidad  individual,  se  realizó  la  respectiva  extracción  de  ADN.  Para  el  genotipaje  de  los  polimorfismos  GSTP1  Ile105Val,  GPX‐1  Pro198Leu  y  XRCC1  Arg399Gln  se  utilizó  la  técnica  de  Reacción  en  Cadena  de  la  Polimerasa‐Fragmentos  de  Restricción  de  Longitud  Polimórfica  (PCR‐RFLP).  Con  respecto  al  análisis  genético,  los  individuos  con la variante GSTP1 Val/Val presentaron un  odds ratio (OR) de 4.88 (P < 0.001), mientras  que  la  combinación  de  los  genotipos  Ile/Val  junto  con  Val/Val  arrojó  un  OR  de  2.6  (P  <  0.05).  Los  individuos  con  genotipo  GPX‐1  Leu/Leu presentaron un OR de 8.5 (P < 0.05).  Los  resultados  obtenidos  sugieren  a  las  autoridades  locales  y  a  los  pobladores,  emprender  proyectos  relacionados  con  la  importancia  de  una  correcta  nutrición  e  higiene, con el objetivo de evitar el desarrollo  de  enfermedades  como  el  cáncer  o  malformaciones genéticas.      El desarrollo de la segunda fase del proyecto  consistió  en  el  análisis  del  biomarcador  de  exposición  mediante  la  cuantificación  de  residuos  de  glifosato  y  ácido  aminometilfosfónico  (AMPA)  en  muestras  de  suelo,  la  evaluación  de  calidad  de  macro  y  micronutrientes  del  terreno,  y  la  determinación  de  la  calidad  microbiológica  del agua de los Ríos San Miguel y Putumayo.  De  acuerdo  a  la  metodología  analítica  en  las  muestras  de  suelos  se  encontró  la  presencia  de  hierro  en  un  rango  mínimo  de  1,0  %    y  máximo 5,1 %, y la presencia de aluminio  en  un  rango  mínimo  de  1,5%    y  un  máximo  de  9,8  %  en  las  comunidades  de  la  zona  de  estudio.  Con  respecto  a  los  micro  y  macronutrientes, en las muestras de suelo se  encontraron  niveles  altos  de  nitrógeno,  fósforo, hierro, potasio y materia orgánica; y  niveles  medios  de  manganeso.    En  cuanto  al  análisis  de  las  muestras  de  agua  de  los  Ríos  San  Miguel  y  Putumayo,  se  cuantificó  la  presencia  de  enterobacterias,  hongos,  Escherichia  coli  y  coliformes  totales.  No  se  observó  la  presencia  de  parásitos  ni  de  rotíferos. 

XIII


Summary 

XIV 

  During  the  years  2000  to  2007,  the  Ecuadorian  communities  located  in  the  Northern  border  have  been  affected  by  the  Plan  Colombia  due  to  glyphosate  aerial  spraying.  Glyphosate  is  a  selective  herbicide  containing  pesticides,  surfactants,  and  adjuvants, which is applied to eradicate coca  crops, source of global cocaine production.         The  purpose  of  this  research  was  to  assess  the damage at the genetic, health, social, and  environmental  level  in  the  Ecuadorian  communities  located  along  the  border  that  has  been  affected  by  this  spraying.  This  assessment  is  carried  out  through  the  application of biomarkers of exposure, effect,  and individual susceptibility. Such biomarkers  will  provide  an  early  assessment  of  carcinogenesis  development  in  vulnerable  populations  that  have  been  exposed  to  genotoxics.        This  study  was  executed  in  two  stages,  considering  the  progress  of  the  results  for  each component.  The first stage consisted in  obtaining the toxicological information of 144  families  by  means  of  a  medical  checkup,  assessing  521  individuals  belonging  to  the  affected  communities  in  the  Province  of  Sucumbios,  Ecuador.  Regarding  health,  undernourishment was determined to be 3%.  7.7%  of  the  people  had  children  with  malformations, as the percentage of abortion  is 12.7%. In conclusion, the population had no  significant damage at the genetic level, but it  does  have  psychological,  social,  and  sanitary  problems.     In  order  to  determine  the  effects  at  the  genetic level, two biomarkers were used. The  biomarker  of  effect  was  assessed  in  peripheral  blood  lymphocytes  of  182  individuals  from  the  exposed  community,  by  applying  the  technique  of  Chromosomal  Alterations  (CA).  The  CA  results  demonstrated  a  normal  karyotype  (46  chromosomes) in 182 studied individuals.    

For the biomarker of individual susceptibility,  the  respective  DNA  extraction  was  carried  out.     For  the  genotype  of  the  GSTP1  Ile105Val,  GPX‐1  Pro198Leu,  and  XRCC1  Arg399Gln  polymorphisms,  the  technique  called  Polymerase  Chain  Reaction  –  Restriction  Fragments  Length  Polymorphism  (PCR‐RFLP)  was  used.  Considering  the  genetic  analysis,  the individuals with the GSTP1 Val/Val variant  had an odds ratio (OR) of 4.88 (P < 0.001), as  the  combination  of  the  Ile/Val  genotype,  together  with  the  Val/Val  genotype  had  an  OR  of  2.6  (P  <  0.05).  The  odds  ratio  of  the  individuals with the  GPX‐1 Leu/Leu genotype  was  8.5  (P  <  0.05).  These  results  give  local  authorities  and  dwellers  the  idea  of  undertaking  projects  related  to  the  importance  of  a  correct  nutrition  and  hygiene,  in  order  to  avoid  the  outbreak  of  diseases  such  as  cancer  or  genetic  malformations.           The  development  of  the  second  stage  of  the  research consisted in analyzing the biomarker  of  exposure  through  the  assessment  of  glyphosate and aminomethylphosphonic acid  (AMPA)  residues  from  soil  samples,  the  assessment  of  quality  of  soil  macronutrients  and micronutrients, and the determination of  microbiological  quality  of  the  water  of  San  Miguel  and  Putumayo  Rivers.  In  accordance  with  the  analytical  methodology  in  the  soil  samples, iron was found at a minimum range  of  1.0  %  and  a  maximum  of  5.1%  and  aluminum was found at a minimum range of  1.5%  and  a  maximum  of  9.8%  in  the  communities  located  in  the  study  area.  Regarding  micro  and  macronutrients,  high  levels  of  nitrogen,  phosphorus,  iron,  potassium, and organic material and medium  levels  of  manganese  were  found  in  the  soil  samples. Concerning the analysis of the water  samples  taken  from  San  Miguel  and  Putumayo  Rivers,  the  presence  of  enterobacteria,  fungus,  Escherichia  coli,  and  total  coliforms  was  assessed.  Neither  parasites nor rotifers were observed. 


Abreviaturas    45, X    47, XXY     χ2  A    aa    AAS    ACAasa   ADN    Al     ALS    AMPA    Arg    ARN    ASTM    ATSDR    B    CAT     CCE    Cd    CE    CNE    CHCl3    C3H8NO5P  COOH    CONICET  CS    Cu    Da    DE    DG    DL    DL50     DM    DNA    dNTP     EDTA    EOR    EPA    EPSPS    ETS    Fe    Fe+3/C2O4‐2  FMOC    FORCCOFES  GPX‐1    GSTP1    Gln    g/L    g/m3   

Cariotipo del síndrome de Turner  Cariotipo del síndrome de Klinefelter  Chi‐cuadrado   Talla alta  Aminoácido  Espectrometría de absorción atómica  Enzima acetil CoA carboxilasa  Ácido desoxirribonucleico  Aluminio  Enzima acetolactato sintetasa  Ácido aminometilfosfónico  Arginina  Ácido ribonucleico   The American Society for Testing and Materials  Agencia para Sustancias Tóxicas y Registro de Enfermedades  Talla baja  Catalasa  Comisión Científica Ecuatoriana  Cadmio  Conductividad eléctrica  Concejo Nacional de Estupefacientes  Cloroformo  N‐fosfonometil glicina  Ácido carboxilo  Consejo Nacional de Investigaciones Científicas y Técnicas  Calidad del suelo  Cobre  Dalton  Desviación estándar   Desnutrición grave  Desnutrición leve  Dosis letal 50  Desnutrición moderada  Ácido desoxirribonucleico  Dideoxinucleótido trifosfato  Ácido etilendiamintetracético  Especies oxígeno reactivas  Agencia de Protección Ambiental de Estados Unidos  Enzima 5‐enolpiruvilshikimato‐3‐fosfato sintetasa  Enfermedades de transmisión sexual  Hierro  Sistema ferrioxalato  9‐fluorenilmetilcloroformato  Federación de Organizaciones Campesinas del Cordón Fronterizo  Glutatión peroxidasa 1  Glutatión S‐transferasa pi 1  Glutamato  Gramos por litro   Gramos por metro cúbico 

XV 


XVI 

ha    HA    H2O2    H3PO4    Hg    HPLC    HTA    Ile    IMC    INEC    INFA    INH    ISS    IVU    K    Kb    KH2PO4   Km    Kd    Koc    LA    LB    Leu    LLA    LMC    L/Kg    m    MgCl2    min    mPa    Mn    MO    MS    NH4+    N    nm    NaCl    NNG    NRCS    OB    ∙OH    OMS    OR    P    p    PAH    PAO    Pb    PCB    pb    PCR    PENMPF 

Hectárea  Aminas heterocíclicas  Peróxido de hidrógeno  Ácido fosfórico  Mercurio  Cromatografía líquida de alta performance  Hipertensión arterial  Isoleucina  Índice de masa corporal  Instituto Nacional de Estadísticas y Censos  Instituto Nacional de la Niñez y la Familia  Instituto Nacional de Higiene  Instituto de Ciencias en la Sociedad  Infección a vías urinarias  Potasio  Kilo base de ADN  Fosfato monopotásico  Kilómetro  Coeficiente de partición   Coeficiente de absorción  Talla ligeramente alta  Talla ligeramente baja  Leucina  Leucemia linfoide aguda  Leucemia mieloide aguda  Litros por kilogramo   Metros  Cloruro de magnesio  Minutos  Mega Pascal  Manganeso  Materia orgánica  Espectrometría de masas  Nitrógeno que se encuentra en forma de amonio  Talla normal  Nanómetro  Cloruro de sodio  N‐nitroso glifosato  National Resourse Conservation Soil   Obesidad  Hidroxilo  Organización Mundial de la Salud  Odds ratio  Fósforo  Brazo corto del cromosoma  Hidrocarburos policíclicos aromáticos  Procesos avanzados de oxidación  Plomo  Bifenilos policlorinados  Pares de bases nucleotídicas  Reacción en cadena de la polimerasa  Primer Encuentro Nacional de Médicos de Pueblos Fumigados 


pKa    PN    POEA    ppm    Pro     q    QA/QC   qCO2    RFLPs    Seg    SNC    SNPs    SOD    SP    SSLPs    SSSA    STRs    TA    TAO    TBC    TiO2    TNI    TNF‐α    UNC    USDA    US EPA  US OPP  UV  Val  VNTRs    WHO    XRCC1    YM    Zn     

     

Fuerza de disociación   Peso normal  Polioxietileno amina  Partes por millón  Prolina  Brazo largo del cromosoma  Aseguramiento y control de calidad  Cociente respiratorio  Fragmentos de restricción de longitud polimórfica  Segundos  Sistema nervioso central  Polimorfismos de nucleótido simple  Superóxido dismutasa  Sobrepeso  Longitud polimórfica de cadena simple  Soil Science Society of America  Repeticiones en tándem cortos  Temperatura ambiente  Tecnologías avanzadas de oxidación  Tuberculosis  Dióxido de titanio  Instituto Transnacional  Factor de necrosis tumoral  Universidad Nacional de Córdoba  Departamento de Agricultura de Estados Unidos  Agencia de Protección Ambiental de Estados Unidos  Oficina de Programas de Pesticidas de Estados Unidos  Ultravioleta  Valina  Repeticiones en tándem de número variable  Organización Mundial de la Salud   Gen reparador del ADN   Yeast and mold  Zinc 

XVII


PARTE I    ADN Y CROMOSOMAS   

1. Bases moleculares de la genética    La  información  para  el  desarrollo  y  las  funciones  específicas  de  las  células  y  los  tejidos  se  almacena  en  los  genes.  Un  gen  es  una  secuencia  nucleotídica  que  codifica  información  genética,  presenta  una  estructura  y  cumple  una  función  específica.  Los cromosomas se encuentran conformados  por la agrupación de genes y se ubican en el  núcleo celular.     Los  genes  se  encuentran  conformados  por  exones,  en  los  cuales  está  la  información  necesaria para los procesos de transcripción y  posterior síntesis de proteínas estructurales o  enzimáticas.    El  ácido  desoxirribonucleico  (ADN)  es  una  macromolécula  conformada  por  una  doble  cadena  larga.  Fue  descubierto  por  Johann  Friedrich  Miescher  en  el  año  1869.  Sus  componentes  químicos  son  bases  nitrogenadas  (purinas:  adenina  y  guanina;  pirimidinas:  citosina  y  timina),  azúcar  (desoxirribosa)  y  grupos  fosfato  (Passarge,  2004).    En  el  ácido  ribonucleico  (ARN)  el  azúcar  desoxirribosa del ADN es reemplazado por la  ribosa y la base timina  por el uracilo. El ARN  mensajero  realiza  la  traducción  del  mensaje  al  ribosoma  ubicado  como  organela  dentro  del  citoplasma  celular  y  allí  se  sintetiza  la  proteína  que  cumplirá  funciones  específicas  dentro y fuera de la célula (Celeda, 1991).    1.1. Mutaciones del ADN    El ADN codificante y su respectivo polipéptido  son colineales. Una mutación de la secuencia  de bases del ADN puede dar lugar a un codón  diferente.  La  posición  del  cambio  resultante  en  la  secuencia  de  aminoácidos  corresponde  a  la  posición  de  la  mutación  (Alberts,  et  al.,  1994).    Existen  tres  tipos  de  mutaciones  diferentes  que  involucran  un  solo  nucleótido  (mutación 

puntual): sustitución, deleción e inserción. Se  distinguen  dos  tipos  de  sustituciones:  transición,  que  es  el  cambio  de  una  purina  por  otra  o  de  una  pirimidina  por  otra;  y  la  transversión,  que  es  el  intercambio  de  una  purina por una pirimidina o viceversa (Lodish,  et al., 2004). Una sustitución puede alterar un  codón  de  modo  que  se  presente  un  aminoácido  incorrecto  en  este  sitio  pero  sin  que  se  produzcan  cambios  en  el  marco  de  lectura,  mientras  que  una  deleción  o  una  inserción  causa  un  corrimiento  en  el  marco  de lectura. Luego, las secuencias que siguen a  continuación  ya  no  codifican  para  un  producto  genético  funcional  o  causan  una  sobre  expresión  en  la  codificación  de  un  determinado gen (Passarge, 2004).     1.2. Polimorfismos del ADN    El  polimorfismo  genético  se  refiere  a  la  existencia  de  variantes  con  relación  a  un  locus génico, una estructura cromosómica, un  producto  génico  o  un  fenotipo.  El  polimorfismo del ADN se refiere a una amplia  gama  de  variaciones  en  la  composición  de  bases  nitrogenadas,  la  longitud  de  repeticiones de nucleótidos o las variantes en  un solo nucleótido (Passarge, 2004).     Los  polimorfismos  genéticos  pueden  ser  utilizados  como  biomarcadores  genéticos  para  el  análisis  de  enfermedades  o  estudios  parentales.  Entre  los  biomarcadores  más  destacados  para  su  estudio  se  encuentran:  polimorfismos  de  nucleótido  simple  (SNPs),  polimorfismos  de  longitud  de  secuencias  discretas  (SSLPs)  y  fragmentos  de  restricción  de  longitud  polimórfica  (RFLPs).  Debido  a  la  gran  importancia  que  tiene  el  estudio  de  marcadores  de  ADN,  han  sido  rápidamente  desarrolladas  técnicas  que  permiten  su  análisis.     1.2.1. Biomarcadores genéticos: SNPs, RFLPs  y SSLPs    Los SNPs son variaciones del ADN que afectan  a  una  sola  base  nitrogenada  de  la  secuencia 


del  genoma.  Para  ser  considerado  polimorfismo,  la  variación  debe  darse  al  menos en el 1% de la población. Los SNPs se  originan cuando una mutación puntual ocurre  en el genoma, convirtiendo un nucleótido en  otro.  Si  la  mutación  ocurre  en  células  reproductivas  de  un  individuo,  uno  o  más  descendientes  pueden  nacer  con  dicha  mutación,  y  a  lo  largo  de  generaciones  la  mutación  se  puede  establecer  en  la  población.  En  la  mayoría  de  organismos  eucariotes,  hay  al  menos  una  mutación  por  cada 10 Kb de ADN (Brown, 2007).     Los RFLPs fueron los primeros marcadores de  ADN  en  ser  estudiados.  Consiste  en  que  enzimas de restricción cortan el ADN en sitios  específicos,  esto  quiere  decir  que  moléculas  de  ADN  tratadas  con  la  misma  enzima  de  restricción  producirán  el  mismo  set  de  fragmentos.  Estos  biomarcadores  se  los  utiliza  generalmente  para  obtener  el  genotipo  de  cualquier  organismo  en  las  secuencias genéticas de interés.    Los SSLPs reportan variaciones a lo largo de la  cadena  de  ADN.  Estas  variaciones  son  secuencias  repetitivas,  en  donde  diferentes  alelos  contienen  diferentes  números  de  unidades  repetidas.  Existen  dos  tipos  de  SSLPs:  los  minisatélites,  también  conocidos  como  repeticiones  en  tándem  de  número  variable  (VNTRs),  en  los  cuales  las  unidades  de repetición tienen una longitud aproximada  de 25 pares de bases (pb), y los microsatélites  o  repeticiones  en  tándem  cortos  (STRs)  que  presentan  unidades  cortas  de  repetición  de  13 pb (Brown, 2007).      2. Cromosomas    El  descubrimiento  del  número  cromosómico  humano (46 cromosomas) en el año 1956 por  Tjio  y  Levan,  marcó  el  comienzo  de  la  citogenética humana moderna.    El  ADN  se  encuentra  en  el  núcleo  celular  en  forma  dispersa  y  junto  con  ciertas  proteínas  constituye la cromatina (2,37 nm).    

Durante la división celular el ADN se organiza  en  estructuras  más  complejas  hasta  formar  los  cromosomas.  El  primer  nivel  de  organización  del  ADN  consiste  en  subunidades  denominadas  nucleosomas,  en  las  cuales  la  fibra  de  cromatina  dará  dos  vueltas  alrededor  de  un  núcleo  formado  por  un  octámero  de  histonas  empaquetando  al  ADN  en  una  proporción  de  siete  veces,  constituyéndose  una  fibra  de  10  nm  de  diámetro.  Un  segundo  nivel  de  organización  es el solenoide en el que los nucleosomas se  reenrollan  sobre  sí  mismos,  condensando  la  longitud del ADN en 40 veces más. El arreglo  interno  del  solenoide  está�� formado  por  una  fibra  de  cromatina  enrollada  en  forma  de  hélice  conteniendo  seis  nucleosomas  por  vuelta  y  tiene  30  nm  de  diámetro.  Esta  fibra  parece ser la unidad fundamental para que la  cromatina  se  organice  en  cromosomas.  La  fibra  de  30  nm  durante  la  condensación  de  los  cromosomas  forma  empaquetamientos  en forma de lazos unidos a un eje central, que  constituye  una  matriz  de  proteínas  no  histónicas; el ADN en este nivel se compacta  mil  veces  al  final  de  la  interfase  (700  nm)  y  diez  mil  veces  en  el  cromosoma  metafásico  (2000  nm).  Los  lazos  contienen  de  60  a  100  Kb  cada  uno  y  están  empacados  a  modo  de  hélices  superpuestas  sujetas  a  un  eje  central  o andamio (Strachan & Read, 2004).    Entre las proteínas no histónicas del andamio  se  destaca  la  Sci  (Topoisomerasa  II).  La  Topoisomerasa  II  constituye  el  70%  del  eje  central formando los complejos de anclaje de  los lazos de ADN.  Su función es la de enrollar  y  desenrollar  las  cadenas  de  ADN  para  permitir  la  separación  de  las  cromátides  hermanas  durante  la  anafase.  Su  ubicación  estratégica  en  la  base  de  los  dominios  permite  que  desde  aquí  actúe  en  la  segregación  y  condensación  cromosómica  (Strachan & Read, 2004).    Los  cromosomas  están  formados  por  dos  cromátides  unidas  en  el  centrómero  (constricción primaria), regiones terminales o  telómeros  y  en  ocasiones  pueden  presentar  satélites,  separados  del  cromosoma  por  una  constricción secundaria. El centrómero divide 


al cromosoma en dos brazos: uno corto (p) y  uno largo (q).    El complemento cromosómico de cada célula  se denomina cariotipo. Este término se utiliza  para describir la constitución cromosómica de  una especie. La identificación morfológica de  los  cromosomas  está  basada  en  los  tamaños  relativos  de  los  mismos  y  de  sus  brazos.  Un  idiograma  es  la  representación  esquemática  de  la  morfología  cromosómica  que  se  usa  como diagnóstico para la comparación de los  cariotipos  de  diferentes  especies  y  variedades.  El  idiograma  está  basado  en  las  medidas de los cromosomas en varias células.    Los  cromosomas  humanos  de  acuerdo  a  la  posición  del  centrómero  se  clasifican  en:  metacéntricos  cuando  sus  brazos  son  equidistantes  con  respecto  al  centrómero  y  por lo tanto  sus cromátides son de la  misma  longitud; acrocéntricos cuando el centrómero  se localiza en la región subterminal formando  brazos  muy  pequeños  generalmente  con  satélites;  submetacéntricos  cuando  la  localización del centrómero tiende hacia uno  de los extremos, por lo que los brazos de las  cromátides  son  desiguales,  y  telocéntricos  cuando  el  centrómero  se  ubica  en  la  región  terminal  del  cromosoma,  por  lo  tanto  no  existen brazos p, este tipo de cromosoma no  está  presente  en  el  cariotipo  humano  (ISCN,  1985).    En  1960,  en  la  convención  de  Denver,  se  unificó  la  nomenclatura  de  los  cromosomas  reconociéndose  dos  grupos:  autosomas  (cromosomas  somáticos)  y  gonosomas  (cromosomas  sexuales).  Los  autosomas  se  numeran del 1 al 22 ordenados por tamaños  decrecientes  y,  dentro  del  mismo  tamaño,  por  la  posición  del  centrómero.  Los  cromosomas de tamaño semejante se reúnen  en grupos que se designan por letras (A ‐ G).  A  los  cromosomas  sexuales  X  y  Y  se  les  incluye en los grupos C y G respectivamente.    Desde  1970  se  han  desarrollado  nuevas  técnicas  que  permiten  identificar  a  cada  par  de  cromosomas  por  su  patrón  característico  de  bandas  transversales,  que  se  ponen  de  manifiesto  con  métodos  de  tinción 

especiales.  Las  técnicas  de  bandeo  cromosómico  consisten  en  exponer  a  los  cromosomas  a  diferentes  substancias  y  colorantes  para  desnaturalizar  porciones  de  proteínas  del  esqueleto  cromosómico  (histonas  y  no  histonas)  o  evidenciar  secuencias  de  ADN  con  mayor  o  menor  cantidad de enlaces bi o trivalentes entre las  bases nitrogenadas constitutivas del ADN.    2.1. Aberraciones cromosómicas      La  exposición  de  células  eucariotes  a  varios  agentes  químicos  y  físicos  puede  inducir  daños  cromosómicos,  ya  sea  en  número  o  estructura.  Estos  daños  pueden  ser  producidos en células somáticas o germinales  (Au, 1991; Leonard, et al., 1985).     Las  anomalías  numéricas  o  mutaciones  genómicas  se  presentan  en  individuos  cuyo  número  de  cromosomas  varía  de  su  número  diploide.  Pueden  afectar  tanto  a  autosomas  como a cromosomas sexuales. Las anomalías  numéricas  se  clasifican  en  aneuploidía,  en  donde  un  individuo  presenta  accidentalmente  un  cromosoma  más  o  uno  menos  con  respecto  a  su  condición  diploide;  la  monosomía,  en  donde  un  individuo  presenta  solo  un  cromosoma  del  par  homólogo.     Casi  todas  las  monosomías  autosómicas  llevan  a  la  muerte  poco  después  de  la  concepción.  La  trisomía  es  cuando  hay  la  presencia de tres cromosomas homólogos en  un  mismo  individuo.  Además,  existe  una  condición  llamada  triploidía,  en  la  cual  hay  una copia extra de todos los cromosomas. Los  individuos  con  esta  condición  pueden  ocasionalmente  sobrevivir  hasta  el  nacimiento,  aunque  normalmente  mueren  durante el período neonatal.    Las  anomalías  de  cromosomas  sexuales  más  comunes son la monosomía del cromosoma X  (45,X) o síndrome de Turner y el síndrome de  Klinefelter (47,XXY).    Las anomalías estructurales implican cambios  en la estructura de uno o varios cromosomas.  Existen  varios  tipos  de  anomalías 


estructurales,  como  son  las  deleciones,  que  que implican el cambio de material entre dos  implican  la  pérdida  de  material  de  un  solo  o más cromosomas. Las anomalías numéricas  cromosoma; las inversiones, que tienen lugar  y  estructurales  se  pueden  dividir  a  su  vez  en  cuando  se  dan  dos  cortes  dentro  de  un  dos  categorías  principales:  las  constitutivas,  mismo cromosoma y el segmento intermedio  aquéllas con las que se nace, y las adquiridas,  se  invierte  y  se  vuelve  a  unir  formando  un  las  que  surgen  como  cambios  secundarios  a  cromosoma  que  estructuralmente  tiene  la  otras  enfermedades,  tales  como  el  cáncer  secuencia  cambiada;  y  las  translocaciones,  (Figura I.1).    Figura I.1. Aberraciones cromosómicas                                                    3. Nuestra  experiencia  en  estudios  con  3.1. Genes,  polimorfismos  y  su  asociación  genotóxicos  con enfermedades       Desde 1987, nuestro grupo de investigadores  El estudio de polimorfismos en pacientes con  integrados por médicos, genetistas y biólogos  diferentes  enfermedades,  como  cáncer,  es  moleculares  hemos  venido  desarrollado  una  línea  de  investigación  que  se  ha  venido  proyectos  e  investigaciones  relacionadas  con  desarrollando en el Ecuador debido a que es  el  estudio  genético  y  citogenético  de  de  mucho  interés  científico  conocer  las  síndromes  y  enfermedades.  De  la  misma  frecuencias  polimórficas  de  los  genes  para  forma,  se  han  realizado  biomonitoreos  determinar  si  pueden  ser  considerados  genéticos para evaluar el daño en el ADN y el  biomarcadores  moleculares  específicos  para  porcentaje de aberraciones cromosómicas en  las diferentes enfermedades.   poblaciones  ecuatorianas  afectadas  por  la    exposición  a  genotóxicos  como  los  Una  de  las  causas  de  mayor  índice  de  hidrocarburos, pesticidas y rayos X.  mortalidad  en  el  Ecuador  es  el  cáncer;  esta    enfermedad  puede  desarrollarse  debido  a  factores  externos  como  la  exposición  a 


genotóxicos,  los  cuales  rompen  las  cadenas  del  ADN,  alteran  la  información  genética  y  por ende la síntesis proteica de los diferentes  genes  relacionados  al  cáncer,  como  son  los  genes  supresores  de  tumores,  los  reparadores  del  ADN,  los  oncogenes  y  los  genes de apoptosis.     Entre los proyectos de investigación genética  más  relevantes  que  se  realizaron  están:  encontrar  nuevas  mutaciones  y  polimorfismos  del  gen  RB1  en  personas  con  retinoblastoma  (Leone,  et  al.,  2003);  el  estudio  de  la  mutación  ΔF508  del  gen  CFTR  en  pacientes  con  fibrosis  quística  (Paz‐y‐ Miño,  et  al.,  1999);  el  estudio  de  los  genes  BRC‐ABL y hRAD5 en individuos con leucemia  mieloide  crónica  (LMC)  y  leucemia  linfoblástica  aguda  (LLA)  (Paz‐y‐Miño,  et  al.,  2002,  2010);  el  análisis  de  polimorfismos  del  gen  hMSH2  asociado  con  el  linfoma  no‐ Hogkin  (Paz‐y‐Miño,  et  al.,  2002);  el  estudio  del  gen  CYP1A1  en  personas  expuestas  a  pesticidas  (Paz‐y‐Miño,  et  al.,  2004);  la  asociación  entre  el  cáncer  de  próstata  y  el  gen  SRD5A2  (Paz‐y‐Miño,  et  al.,  2009);  la  relación  entre  cáncer  de  pulmón  y  las  mutaciones L858R y G719S del oncogén EGFR  (Paz‐y‐Miño, et al., 2010); la asociación entre  los  genes  GPX‐1  (Pro198Leu)  y  MnSOD  (Ile58Thr)  con  cáncer  de  vejiga  (Paz‐y‐Miño,  et  al.,  2010);  la  asociación  entre  los  genes  detoxificadores  GPX‐1,  GSTP1  y  el  gen  reparador  XRCC1  en  individuos  expuestos  a  aspersiones  aéreas  con  glifosato  en  la  frontera  norte  del  Ecuador  (Paz‐y‐Miño,  et  al.,  2011);  y  la  correlación  entre  los  genes  MTHFR, MTR y MTRR, la metilación del ADN y  el  cáncer  de  próstata  (López‐Cortés,  et  al.,  2011).     3.2. Genotóxicos:  hidrocarburos,  rayos  X  y  pesticidas    El  análisis  citogenético  para  determinar  el  porcentaje  de  aberraciones  estructurales  y  numéricas  en  individuos  es  una  herramienta  muy  útil  que  permite  ver  el  daño  a  nivel  cromosómico  de  personas  enfermas  o  bajo  exposición  de  agentes  genotóxicos  como  hidrocarburos,  rayos  X  o  pesticidas  como  el  glifosato.  De  la  misma  forma,  la  prueba 

ensayo  cometa  es  útil  para  determinar  el  nivel  de  fragmentación  del  ADN  debido  a  la  exposición  a  agentes  tóxicos  que  rompen  las  cadenas del ácido nucleico.    En  el  año  2008,  se  publicó  un  artículo  científico  en  la  revista  Annuals  of  the  New  York  Academy  of  Sciences,  en  el  cual  se  realizó  un  monitoreo  del  daño  del  ADN  en  individuos  expuestos  a  hidrocarburos  en  San  Carlos,  Provincia  de  Orellana.  Las  evidencias  científicas  obtenidas  en  esta  investigación  demostraron  que  los  individuos  expuestos  a  hidrocarburos  presentaron  alto  riesgo  carcinogénico  y  mutagénico.  Las  personas  expuestas  a  agentes  tóxicos  propios  de  las  industrias  petroleras  sufrieron  síntomas  como  fatiga,  dolor  de  cabeza,  micosis  cutánea,  dermatitis,  irritación  nasal  y  ocular,  gastritis,  náusea  y  diarrea.  El  análisis,  desarrollado  mediante  la  prueba  ensayo  cometa,  permitió  determinar  que  los  individuos  expuestos  a  los  hidrocarburos  presentaron  alto  porcentaje  de  daño  en  el  ADN  comparado  con  individuos  sanos  considerados  como  control.  El  análisis  citogenético  determinó  que  las  personas  expuestas  presentaron  rupturas  cromosómicas  y  gaps.  Mientras  que  en  los  estudios  genéticos  se  encontró  asociación  significativa del gen hMSH2 con los individuos  expuestos  a  hidrocarburos  y  derivados  del  petróleo (Paz‐y‐Miño, et al., 2008).     En  los  años  2002  y  2010,  se  publicaron  dos  artículos  científicos  en  las  revistas  Mutation  Research  y  Oncología,  respectivamente.  Ambos artículos trataron sobre el estudio de  aberraciones  cromosómicas  y  daño  del  ADN  en  trabajadores  hospitalarios  de  los  departamentos  de  radiología  expuestos  a  radiación ionizante. En ambos estudios se ha  podido  concluir  que  existe  un  efecto  nocivo  de  la  radiación  ionizante  a  nivel  genético  en  las  personas  expuestas  ocupacionalmente  a  bajas  dosis  de  rayos  X.  En  el  estudio  de  aberraciones  cromosómicas  no  se  encontró  diferencia  significativa  entre  grupos  expuestos y control, a pesar que presentaron  mayor  número  de  alteraciones  estructurales  los  individuos  expuestos  a  radiación  ionizante.  El  ensayo  cometa  demostró  que 


existe diferencia significativa entre los niveles  de  fragmentación  del  ADN  entre  sanos  y  expuestos  a  rayos  X.  Es  por  ello  que  las  personas  expuestas  a  dosis  de  radiación  ionizante  permisible  presentan  fragmentación leve en su ADN y alteraciones  cromosómicas  estructurales  dentro  de  los  rangos  normales  (Paz‐y‐Miño,  et  al.,  2002;  Muñoz, et al., 2010).      En  los  años  2002  y  2004,  se  publicaron  dos  artículos  científicos  relacionados  con  el  estudio  genético  y  citogenético  de  personas  trabajadoras  en  florícolas  de  Quito  y  Cayambe,  las  cuales  estaban  expuestas  a  pesticidas.  Estas  investigaciones  fueron  publicadas  en  las  revistas  Environmental  Health  Perspectives  y  Mutation  Research,  respectivamente.  Según  las  evidencias  encontradas  se  concluyó  que  los  individuos  expuestos  a  pesticidas  en  las  florícolas  presentaron  un  alto  riesgo  carcinogénico    Links web  www.ncbi.nlm.nih.gov/snp   www.humanvariomeproject.com                                

debido a los agentes genotóxicos. Tanto en el  estudio  citogenético  como  en  la  prueba  ensayo  cometa  hubo  diferencia  significativa  entre  los  trabajadores  expuestos  a  los  pesticidas  con  los  individuos  controles  no  expuestos a agentes tóxicos. Estos resultados  no se asociaron con los estudios polimórficos  del gen CYP1A1 (Paz‐y‐Miño, et al., 2002; Paz‐ y‐Miño, et al., 2004).     En  los  años  2007  y  2011,  se  publicaron  dos  artículos  científicos  en  las  revistas  Genetics  and  Molecular  Biology  y  Reviews  on  Environmental  Health,  respectivamente.  Los  dos estudios tuvieron el objetivo de evaluar y  realizar diagnósticos genéticos, ambientales y  de  salud  en  población  expuesta  a  las  aspersiones  aéreas  con  glifosato  en  la  frontera  norte  del  Ecuador.  Ambos  estudios  se  analizan  detalladamente  en  los  siguientes  capítulos  (Paz‐y‐Miño,  et  al.,  2007;  Paz‐y‐ Miño, et al., 2011). 


FOTOGRAFÍA Región Amazónica

7

Río Tiputini Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Parque Nacional Yasuní Refugio de vida del Pleistoceno Provincias de Napo, Pastaza y Orellana


8

Espacio aéreo ecuatoriano Provincia de Sucumbíos

Reserva Faunística Cuyabeno Provincia de Sucumbíos


9

Bosque de dosel Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Bosque húmedo tropical Reserva Faunística Cuyabeno Provincias de Sucumbíos y Orellana


10

Árboles característicos de la región fronteriza con Colombia

Fuente natural de agua susceptible a ser contaminada


11

La Ceiba Provincia de Sucumbíos

Luis Bermeo Provincia de Sucumbíos


12

La Ceiba Plantaciones con hojas secas Provincia de SucumbĂ­os

Luis Bermeo Plantaciones Provincia de SucumbĂ­os


13

R铆o Putumayo Regi贸n Amaz贸nica

R铆o San Miguel Frontera natural entre Ecuador y Colombia


14

Río Putumayo

Río San Miguel


15

Luis Bermeo Tarde nublada

La Ceiba Bosque de dosel


PARTE II   COCTEL HERBICIDA    4. El glifosato    La  N‐fosfonometil  glicina  (C3H8NO5P)  fue  reportada  como  herbicida  en  el  año  1971.  Esta  sustancia  conocida  comúnmente  como  glifosato  es  un  herbicida  organofosforado,  sistémico, no selectivo y de amplio espectro,  efectivo  para  controlar  y  matar  todo  tipo  de  plantas  anuales,  bienales  y  perennes,  incluyendo  especies  leñosas.  Además,  es  el  ingrediente  activo  de  varias  formulaciones  comerciales  de  pesticidas  y  herbicidas  fabricadas  y  distribuidas  a  nivel  mundial  (Smith, et al., 1992; Duke & Powles, 2008).     A  temperatura  ambiente,  el  glifosato  es  una  sustancia  cristalina  de  color  blanco.  En  su  forma cristalina, este herbicida está formado  por  cargas  positivas  y  negativas.  En  solución  acuosa,  los  átomos  de  hidrógeno  del  ácido  carboxílico  (COOH)  y  del  grupo  fosfato  (PO2H2)  tienen  la  capacidad  de  asociarse  (‐ COOH) o disociarse (‐COO‐ + H+) dependiendo  del nivel de pH de la solución, que varía de 5  a  9  (USDA,  2003).  El  glifosato  en  su  grado  técnico  contiene  un  microcontaminante  denominado  N‐nitroso  glifosato  (NNG).  Las  propiedades  físicas,  químicas  y  bioquímicas  del glifosato se las detalla en la tabla II.1.     Actualmente  existe  en  el  mercado  35  formulaciones  comerciales  de  glifosato  registradas  para  el  uso  como  herbicida  en  la  agricultura.  Todas  estas  formulaciones  usan  al  glifosato  comúnmente  como  sal,  siendo  la  forma  más  utilizada  la  sal  isopropilamina  de  N‐fosfonometil  glicina.  El  glifosato  tiene  una  solubilidad relativamente alta en el agua y la  naturaleza iónica de este herbicida retarda la  penetración  en  las  plantas  con  cutículas  hidrofóbicas,  es  por  esta  razón  que  el  glifosato  es  comúnmente  formulado  con  surfactantes  que  decrecen  la  tensión  superficial  de  la  solución  y  por  ende  se  incrementa  la  capacidad  de  penetración  en  los tejidos (WHO, 1994; Giesy, et al., 2000).    El  glifosato  es  uno  de  los  herbicidas  más  utilizados en la agricultura a nivel mundial. Se 

encuentra  conformando  decenas  de  productos  de  varias  compañías  elaboradoras  de  pesticidas.  La  venta  de  los  productos  con  glifosato  han  generado  ganancias  aproximadamente  de  US$1200  millones  anuales  y  abarca  el  60%  de  ventas  relacionadas  a  herbicidas  no  selectivos  (Zeneca,  1995).  Este  herbicida  es  mayormente utilizado en Estados Unidos con  cerca  de  51000  toneladas  y  en  Europa  con  20000  toneladas  (Acquavella,  et  al.,  2004;  Kiely, et al., 2004).     4.1. Mecanismo de acción    El mecanismo de acción del glifosato consiste  principalmente en la inhibición  de la enzima  5‐enolpiruvilshikimato‐3‐fosfato  sintetasa  (EPSPS),  generando  retraso  o  colapso  de  la  ruta  metabólica  shikimato,  la  cual  se  encuentra  envuelta  en  la  síntesis  de  aminoácidos aromáticos esenciales como son  la fenilalanina, la tirosina y el triptófano, y de  esta  manera  se  impide  el  crecimiento  y  supervivencia  de  plantas  y  microorganismos  (USDA,  2003;  Mladinic,  et  al.,  2009).  A  partir  del  ácido  shikímico  se  producen  otros  productos  aromáticos  como  ligninas,  alcaloides,  flavonoides,  ácidos  benzoicos  y  fitohormonas  propias  del  metabolismo  secundario  como  los  aleloquímicos.  De  hecho,  un  20%  del  carbono  que  es  fijado  es  utilizado en esta ruta metabólica (CCE, 2007).     Debido  a  que  la  ruta  metabólica  del  ácido  shikímico  no  existe  en  animales,  la  toxicidad  aguda  del  glifosato  es  baja.  Este  herbicida  puede  interferir  en  mecanismos  bioquímicos  como son el desacoplamiento de los procesos  celulares  de  fosforilación  oxidativa  y  la  inhibición  de  oxidasas  hepáticas  de  función  mixta.  La  fosforilación  oxidativa  es  un  proceso metabólico fundamental en el cual la  energía  metabólica  derivada  de  la  oxidación  de nutrientes es transferida y almacenada en  enlaces  fosfato  de  alta  energía;  el  desacoplamiento  de  este  proceso  resulta  en  pérdida  de  energía  en  los  organismos  y  por  ende  su  muerte.  Los  síntomas  de  disfunción 

16 


17 

en  los  procesos  de  fosforilación  oxidativa  embargo,  los  productos  que  contienen  también  contienen  otros  incluyen  incremento  del  ritmo  cardiaco,  glifosato  problemas  respiratorios,  fiebre,  acidosis  compuestos tóxicos.  metabólica y pérdida de peso (ATSDR, 2001).    La inhibición de oxidasas hepáticas de función  El  principal  metabolito  en  la  degradación  del  mixta  impide  que  las  enzimas  oxidantes  glifosato  en  ambientes  terrestres  es  el  ácido  actúen  en  el  metabolismo  de  compuestos  aminometilfosfónico  (AMPA),  el  cual  es  extraños  y  tóxicos.  Los  síntomas  de  también tóxico. Del AMPA pasa a metilamina  intoxicación  dependen  de  altas  dosis  y  y  de  ahí  a  formaldehído,  un  carcinógeno  tiempo  prolongado  de  exposición.  Sin  conocido (Cox, 1991 y 1995; Dinham, 1999).     Tabla II.1. Propiedades fisicoquímicas y bioquímicas del glifosato 

  CAS #:  Nombre químico:  Clase/uso químico:  Solubilidad en agua:  Solubilidad en otros solventes:  Peso molecular:  Punto de fusión:   Presión de vapor (mm Hg):  Valor de disociación:

Log Kow: 

Coeficiente de partición Kd en agua‐suelo: 

Absorción en suelo Koc (L/kg): 

Vida‐media en hojas (días): 

Vida‐media en suelo (días):  

Vida‐media en agua (días): 

   

1071‐83‐6  N‐fosfonometil glicina Herbicida fosfanoglicina 12 g/L (25°C)  900 g/L, sal amina (Knisel, et al., 1992)  11,6 g/L (Schuette, 1998) Insoluble en compuestos orgánicos  169,07 (Budavari, 1989) 185° C (descompone a 199° C)   < 7 x 10‐9 mm Hg (25°C) (Weber, 1991)  2,27 (pKa) ‐3,39 (pH 1,77) (Chamberlain, et al., 1996)  ‐4,38 (pH 4,61) (Chamberlain, et al., 1996)  ‐4,85 (pH 6,86) (Chamberlain, et al., 1996)  ‐4,14 (pH 9,00) (Chamberlain, et al., 1996)  ‐3,5 (Schuette, 1998) 61 g/m3 (Schuette, 1998) 2100 (500‐2600)  554‐34000 (Piccolo, et al., 1994)  2,600‐4,900 (Glass, 1987) 8 a >500000 (Gerritse, et al., 1996)  54 (Knisel, et al., 1992) 1,6 (Thompson, et al., 1994)  8‐10 (Feng & Thompson, 1990)  10,6‐26,6 (Newton, et al., 1984)  2,5 (Knisel, et al., 1992) 46 (Siltanen, et al., 1981) 20‐40 (Weber, 1991) < 60  45‐60 (Feng & Thompson, 1990)  29‐40 (Newton, et al., 1984)  30‐40 (Smith and Aubin, 1993)  47 (Knisel, et al., 1992) 22,1 aerobio; 96,4 anaerobio (Schuette,1998) 50‐70 (US EPA/ODW, 1992)    42‐70 (Reinert & Rodgers, 1987)   > 35 (Schuette, 1998) 


5. Roundup:  surfactantes,  coadyuvantes  y  Protección  Ambiental  de  los  EEUU  de  contaminantes  Norteamérica  (US  EPA,  1992),  lo  ubica  como    compuesto  Clase  III:  “Irritante  leve”  (WHO,  La  Organización  Mundial  de  la  Salud  2004).  Las  características  que  se  toman  en  recomienda  la  clasificación  del  glifosato  de  cuenta en las cuatro  categorías se las detalla  acuerdo  con  su  peligrosidad  como  de  Clase  en la tabla II.2.  IV:  “Poco  probable  que  presente  peligro  en  condiciones  de  uso  normal”.  La  Agencia  de    Tabla II.2. Lista de productos inertes en base a sus propiedades nocivas 

  Lista 1 

Lista 2 

Lista 3 

Lista 4 

Propiedades nocivas Productos  inertes  que  han  demostrado  potencial  cancerígeno,  efecto  sobre  el  desarrollo,  efectos neurotóxicos  o  que presentan  riesgos  ecológicos y  que  son  prioritarios  en  materia  de acción reglamentaria.  Productos altamente prioritarios debido a que los datos de toxicidad son subjetivos pero no  concluyentes, los efectos crónicos sobre la salud son posibles o tienen una estructura similar  a los productos de la lista 1.  Productos  juzgados  no  prioritarios  en  términos  de  acción  reglamentaria  puesto  que  los  datos de toxicidad o la evaluación de sus estructuras químicas no presentan inquietudes en  cuanto a la toxicidad o los riesgos de utilización de los productos.  Ingredientes inertes generalmente reconocidos como seguros.

  Todo producto pesticida contiene, además de  productos  comerciales  son  diferentes  a  su  ingrediente  activo,  otras  sustancias  cuya  aquellas presentadas solo por el glifosato.    función  es facilitar su  manejo o aumentar su    eficiencia.  En  general,  estos  ingredientes  Las  compañías  fabricantes  de  pesticidas  denominados  “inertes”  no  son  especificados  utilizan  una  amplia  lista  de  ingredientes  en  las  etiquetas  de  los  productos.  En  el  caso  inertes  que  se  encuentran  conformando  de  los  herbicidas  como  el  glifosato,  se  han  diferentes  fórmulas  comerciales  en  base  al  identificado  muchos  ingredientes  inertes.  glifosato.  Cada  uno  de  estos  compuestos  Para ayudar al glifosato a penetrar los tejidos  inertes  desarrolla  síntomas  de  toxicidad  de  las  plantas,  la  mayoría  de  las  aguda  en  humanos  en  altas  dosis  y  tiempo  formulaciones  comerciales  incluyen  una  prolongado  de  exposición.  La  sintomatología  sustancia  química  surfactante.  Por  lo  tanto,  de  los  ingredientes  inertes  se  detalla  en  la  las  características  toxicológicas  de  los  siguiente tabla:     Tabla II.3. Ingredientes inertes y sintomatología 

  Sulfato de amonio  Benzisotiazolona  3‐yodo‐2‐ propinilbutilcarbamato  Isobutano  Metil pirrolidinona  Ácido pelargónico  Hidróxido de potasio Sulfito sódico 

Sintomatología Irritación ocular, náusea, diarrea, reacciones alérgicas respiratorias y daño  ocular irreversible en exposición prolongada.  Eccema, irritación dérmica, fotoreacción alérgica en individuos sensibles. Irritación ocular severa, mayor frecuencia de abortos, alergia cutánea.  Náusea, depresión del sistema nervioso, disnea. Irritación ocular severa, aborto y bajo peso al nacer en animales.  Irritación ocular, dérmica y del tracto respiratorio. Lesiones  oculares  irreversibles,  ulceraciones  cutáneas  profundas,  ulceraciones severas del tracto digestivo, irritación pulmonar.  Irritación  ocular  y  dérmica  concomitante  con  vómito  y  diarrea,  alergia  cutánea, reacciones alérgicas severas. 

18 


19 

Existen  varias  formulaciones  líquidas  que  como microcontaminante (Doliner, 1991; Tsui  están  compuestas  por  glifosato  y  agua  como  & Chu, 2003).    son  Aquamaster,  Glyfos  Aquatic,  Roundup    Custom,  Rodeo.  Otras  formulaciones  5.1. Polioxietileno amina (POEA)  comerciales  compuestas  por  glifosato  y    surfactantes  son  Credit,  Glyfos,  Glyfos  Pro,  De  acuerdo  con  la  información  dada  por  Glyfos  X‐TRA,  Honcho,  Mirage,  Razor,  Martin  Jelsma,  especialista  en  políticas  Roundup,  Roundup  PRO.  La  formulación  internacionales  sobre  drogas  e  investigador  herbicida  más  utilizada  se  denomina  asociado  de  Transnational  Institute  (TNI),  la  Roundup,  cuya  formulación  química  se  compañía  Monsanto  ha  confirmado  que  el  encuentra  patentada  por  la  compañía  ingrediente  activo  del  Roundup  Ultra  es  el  mismo  glifosato  del  Roundup  comercial  Monsanto.   común.  Según  Farm  Chemicals  Handbook    El  Roundup  es  una  solución  acuosa  2000,  el  glifosato  se  identifica  químicamente  compuesta  por  glifosato  como  ingrediente  como  una  sal  isopropilamina  de  N‐ activo,  polioxietileno  amina  (POEA)  como  fosfonometil glicina. La formulación Roundup  surfactante,  Cosmo‐Flux  411F  como  Ultra contiene:  coadyuvante  y  N‐nitroso  glifosato  (NNG)    Tabla II.4. Formulación química de Roundup Ultra 

  41%  44,5%  14,5% 

Roundup Ultra Sal isopropilamina de glifosato (ingrediente activo) Agua  “A phosphate ester neutralized polyethoxylated tallowamine mixture”  Surfactante que incrementa el poder de penetración del ingrediente activo 

  La  parte  polietoxilada  significa  que  tiene  múltiples unidades (CH2CH2O), donde C, H y O  son  carbono,  hidrógeno  y  oxígeno.  Un  “tallowamine”  es  derivado  de  grasa  animal  (tallow) y tiene un grupo funcional amina. Las  aminas  son  bases  débiles  y  sus  sales  de  amonio  son  ácidos  débiles,  pero  pueden  ser  corrosivos  a  la  piel  a  causa  de  sus  propiedades ácido/base (Nivia, 2001).    El  POEA  es  un  agente  tensoactivo  aniónico  utilizado  en  la  formulación  comercial  Roundup  en  una  proporción  aproximada  de  15% (150 g/L). Es un derivado de grasa animal  conocido  químicamente  como  un  aminado  graso  polioxietileno.  Los  surfactantes  aniónicos  son  frecuentemente  utilizados  en  detergentes y jabones aniónicos (Onil, 2001).     Este  surfactante  contiene  una  variedad  de  ácidos  grasos  incluyendo  los  ácidos:  oleico  (37‐43%),  palmítico  (24‐32%),  esteárico  (20‐ 25%),  mirístico  (3‐6%)  y  linoleico  (2‐3%),  así 

como  pequeñas  cantidades  de  colesterol  (Budaveri, 1989).     Existen varias formulaciones de glifosato que  contienen  POEA  a  niveles  mayores  del  20%  (200  g/L).  El  POEA  es  un  surfactante  que  se  usa  para  que  el  glifosato  pase  a  través  de  la  cutícula  de  las  plantas,  ya  que  esta  tiene  características  no  polares  (hidrofóbicas),  lo  que  dificulta  la  absorción  del  químico.  Los  llamados “ingredientes inertes” actúan como  solventes  y  humectantes  capaces  de  aumentar  la  permeabilidad  y  atravesar  la  barrera cuticular vegetal (CCE, 2007).    Varias  investigaciones  sobre  el  glifosato  indican  que la adición de  surfactantes  puede  incrementar  los  efectos  del  herbicida  y  producir fitotoxicidad (O’Sullivan, et al., 1981;  Sundaram,  1990;  Laerke,  1995;  Riechers,  et  al.,  1995;  De  Ruiter  &  Meinen,  1996;  Sundaram, et al., 1996; Denis & Delrot, 1997;  Miller,  et  al.,  1998).  Además,  varios  estudios  concluyen que los efectos de los surfactantes 


pueden llegar a ser más perjudiciales para las  plantas  y  animales  que  el  herbicida  solo  (Chang, et al., 1999; Garry, et al., 1999; Lin &  Garry, 2000).    El  POEA  tiene  una  toxicidad  aguda  mucho  mayor  que  la  del  glifosato,  causa  daño  gastrointestinal,  alteraciones  del  sistema  nervioso  central,  problemas  respiratorios,  destrucción  de  los  glóbulos  rojos,  daños  al  hígado y riñones, lesiones cutáneas (eritema,  inflamación,  exudación,  ulceración),  náuseas  y  diarrea.  Además,  el  polioxietileno  amina  está contaminado con 1‐4 dioxano, el cual se  lo ha relacionado con el desarrollo de cáncer  en  animales  y  daño  hepático  y  renal  en  humanos (Nivia, 2001).     La  toxicidad  aguda  del  surfactante  POEA  es  entre 4 y 5 veces mayor que la del glifosato y  Roundup. La dosis letal (DL50) oral en ratas es  > 1.200 mg/Kg y la DL50 dermal en conejos es  > 1.260 mg/Kg (CCE, 2007).    5.2. Cosmo‐Flux 411F    Existe  escasa  información  relacionada  con  la  composición  y  los  efectos  nocivos  de  este  producto  químico.  Ha  sido  utilizado  en  las  aspersiones  aéreas  en  la  frontera  norte  del  Ecuador como coadyuvante no iónico que se  lo  añade  a  herbicidas  como  Roundup  para  mejorar  la  adherencia  y  uniformidad  de  las  preparaciones  de  agroquímicos.  Este  compuesto  conforma  la  lista  3  de  productos  moderadamente  tóxicos,  y  su  vida  media  fluctúa entre 3 y 60 años (Cox, 1991 y 1995).      Su  efectividad  se  considera  4  veces  mayor  que  los  aceites  de  aspersión  convencionales,  por el sinergismo entre el aceite parafínico y  el tensoactivo especializado.    Según  la  ficha  técnica  313,03  de  la  empresa  colombiana  Cosmagro,  comercializadora  de  este  producto,  se  describe  químicamente  a  Cosmo‐Flux 411F como una mezcla de aceite  mineral  y  surfactantes  especializados  no  iónicos con agentes de acoplamiento.   El  ingrediente  activo  es  descrito  como  una  mezcla  de  ésteres  de  Hexitan:  alcoholes  lineales  más  aryl  etoxilado.  Es  decir,  mezclas 

de tensoactivos estereoespecíficos no iónicos  basados  en  alcoholes  lineales  etoxilados  propoxilados  con  pequeñas  cantidades  de  compuesto aryl etoxilado (Cosmagro, 2004).   El  ingrediente  aditivo  lo  conforman  isoparafinas  líquidas,  que  son  aceites  isoparafínicos  de  alta  pureza,  de  muy  baja  fitotoxicidad,  de  muy  bajo  contenido  de  aromáticos  y  baja  tensión  superficial  que  mejora la humectabilidad, promoviendo así la  eficiencia  de  los  ingredientes  activos  (Cosmagro, 2004).    El Cosmo‐Flux 411F es un líquido amarillento  a 25°C; punto de llama (flash point) mayor de  149°C;  gravedad  específica  0,89;  viscosidad  60 mPa a 25°C; pH en solución al 1% en agua  destilada  entre  6,3  y  6,8  y  concentración  de  aceite  80‐85  (%  w/w).  Soluble  en  aceites  minerales,  aceites  vegetales  y  solventes  orgánicos  usados  en  la  formulación  de  agroquímicos. Dispensable en agua formando  una  rápida  emulsión  e  insoluble  en  etanol  (Nivia, 2001).     Este  coadyuvante  estereoespecífico  de  carácter  no  iónico,  constituido  por  la  combinación  de  aceite  parafinado  más  un  tensoactivo  adyuvante  estereoespecífico,  controla la evaporación e hidrólisis del activo  con  cubrimiento  total,  garantizando  concentración  homogénea  del  activo  por  unidad  de  área  y extendiendo  el  espectro  de  los agroquímicos (Nivia, 2001).    5.3. N‐nitroso glifosato    El  N‐nitroso  glifosato  (NNG)  ha  sido  reconocido  como  un  microcontaminante  de  la  materia  activa  técnica  y  las  concentraciones  halladas  han  sido  del  orden  de  0,1  a  0,4  ppm  (el  límite  de  detección  ha  sido de 0,1 a 0,2 ppm)  (Onil, 2001).    Al combinarse con nitrato (presente en saliva  humana  o  fertilizantes)  el  glifosato  puede  generar  trazas  de  N‐nitroso  glifosato.  La  mayoría  de  compuestos  de  N‐nitroso  son  cancerígenos  y  no  existe  nivel  seguro  de  exposición a ellos (Cox, 1995; Dinham, 1999).   

20 


21 

6. Resistencia genética de plantas al  glifosato    6.1. Resistencia adquirida naturalmente  contra herbicidas    La  resistencia  es  la  capacidad  hereditaria  natural  de  una  planta,  dentro  de  una  población,  que  le  permite  sobrevivir  y  reproducirse después del tratamiento con un  herbicida como el glifosato. La especie como  tal es afectada por la aplicación del herbicida,  pero  la  planta  genéticamente  resistente  sobrevive  y  completa  su  ciclo  reproductivo.  La resistencia a uno o varios herbicidas es una  característica  hereditaria  cuya  transmisión  a  las  generaciones  siguientes  dependerá  de  la  naturaleza  del  gen  o  genes  involucrados  y  también  de  la  presión  de  selección  impuesta  por el uso del herbicida.    El  biotipo  resistente  se  desarrolla  a  partir  de  una  mutación  natural  y  espontánea,  que  puede  ser  única  y  que  da  origen  a  un  individuo especial entre los de su especie. Esa  mutación  no  tiene  ninguna  relación  con  el  herbicida que se aplica. Esto quiere decir que  los  herbicidas  no  inducen  el  cambio  (mutación)  que  genera  el  biotipo  resistente.  Sin  embargo,  al  tener  ahora  una  ventaja  adaptativa  en  presencia  del  herbicida,  este  biotipo  es  capaz  de  difundirse  ampliamente  en  la  población,  es  decir  es  seleccionado  favorablemente  en  detrimento  de  los  individuos sensibles.    La  evolución  de  plantas  naturalmente  resistentes  a  herbicidas  como  el  glifosato  conlleva  a  lo  largo  del  tiempo  a  graves  problemas ecológicos y ambientales debido a  la  capacidad  adaptativa  de  las  malezas  resistentes  y  a  la  probable  extinción  de  malezas  susceptibles  al  glifosato.  Debido  a  que  la  naturaleza  conforma  nichos  de  las  diferentes  especies  animales  y  vegetales,  la  introducción  de  sustancias  químicas  como  herbicidas  o  pesticidas  altera  esta  cadena  natural  equilibrada,  lo  que  desencadena  no  solo la muerte de las plantas, sino también de  las miles de especies de insectos que viven y  se alimentan de ellas.   

La  resistencia  de  una  planta  a  un  determinado herbicida se debe a la aparición  de una o un grupo de plantas que presentan  información  genética  modificada  naturalmente  en  determinado  gen,  y  por  ende,  la  especificidad  de  un  herbicida  en  inhibir  determinada  enzima  codificada  por  ese gen no se da y por ello la planta es capaz  de  ser  seleccionada  naturalmente  para  sobrevivir y reproducirse en ese medio.    Hasta finales del año 2005 se registraron 296  biotipos  de  malezas  resistentes  a  herbicidas.  Esos  biotipos  pertenecen  a  178  especies  de  malezas  distintas:  107  dicotiledóneas  y  71  monocotiledóneas.  Existen  90  especies  de  plantas  resistentes  a  herbicidas  inhibidores  de  la  enzima  acetolactato  sintetasa  (ALS),  34  especies  de  plantas  resistentes  a  herbicidas  inhibidores  de  la  enzima  acetil  CoA  carboxilasa  (ACCasa)  y  se  ha  confirmado  un  mínimo  de  7  especies  de  plantas  resistentes  al  glifosato,  inhibidor  de  la  enzima  5‐ enolpiruvilshikimato‐3‐fosfato  sintetasa  (EPSPS).     Según la compañía Monsanto en Argentina, la  prevención  de  la  resistencia  de  malezas  al  glifosato  consiste  en  aplicar  la  dosis  adecuada, en el momento adecuado y con la  formulación  adecuada  de  herbicida.  A  pesar  de  las  recomendaciones  de  la  propia  compañía,  las  aspersiones  aéreas  en  la  frontera  ecuatoriana  se  las  realizó  aplicando  un  porcentaje  de  ingrediente  activo  y  surfactante  mayor  al  permitido  sin  tomar  en  consideración  otro  tipo  de  aspectos  importantes  como  la  resistencia  genética,  la  fauna y la salud humana.     6.2. Plantas  transgénicas  tolerantes  al  glifosato y sus efectos en la salud    La  planta  de  soja  argentina,  genéticamente  modificada  (transgénica)  para  adquirir  resistencia  al  herbicida  glifosato,  ha  sido  desde 1996 ampliamente comercializada para  la  agricultura  de  ese  país  (National  Agriculture  Statistics  Service,  2005).  Al  igual  que  la  soja  argentina,  el  principio  de  transgénesis  está  siendo  aplicado  con  varios  productos agrícolas a nivel mundial. 


Los  herbicidas  que  tienen  como  ingrediente  activo  al  glifosato,  como  el  Roundup,  cumplen la función de inhibir la enzima EPSPS  en la vía shikimato; esta vía es indispensable  para  la  vida  de  las  plantas.  Las  plantas  transgénicas  presentan  una  versión  de  la  enzima  EPSPS  tolerante  al  glifosato.  El  proceso  de  transgénesis  consiste  en  aislar  el  gen  CP4  EPSPS  de  Agrobacterium  sp.  cepa  CP4  resistente  al  glifosato;  este  gen  se  lo  clona  y  una  vez  transfectado  a  la  soja,  esta  adquiere  la  capacidad  de  tolerar  las  aspersiones  con  glifosato  debido  a  la  codificación  de  la  enzima  CP4  5‐ enolpiruvilshikimato‐3‐fosfato  sintetasa  tolerante  al  glifosato  (Heck,  et  al.,  2005;  Funke, et al., 2006).     Desde  1996  comenzó  la  comercialización  de  la  soja  transgénica  (National  Agriculture  Statistics Service, 2005).     En  un  informe  publicado  el  año  2002  por  el  Institute  of  Science  in  Society  (ISS)  de  Inglaterra, el Profesor Joe Cummis revela que  la alerta sanitaria con respecto a la presencia    Links web  www.epa.gov  www.i‐sis.org.uk  www.nass.usda.gov                                         

de  acrilamida  tóxica  en  alimentos  cocidos  está relacionada con el glifosato, el herbicida  que  es  tolerado  por  los  cultivos  transgénicos  más  difundidos,  tales  como  la  soja  Roundup  Ready.  La  acrilamida  es  un  potente  neurotóxico,  afecta  la  función  reproductiva  masculina,  causa  malformaciones  congénitas  y cáncer en animales (ISIS, 2002).    Las  evidencias  y  estudios  realizados  indican  que  la  acrilamida  es  liberada  por  la  poliacrilamida  ambiental,  cuya  fuente  principal  se  halla  en  las  fórmulas  herbicidas  en  base  a  glifosato.  La  cocción  de  vegetales  que  han  estado  expuestos  al  glifosato  utilizado en cultivos transgénicos tolerantes a  herbicidas  o  usados  en  la  preparación  del  suelo en cultivos convencionales resultaría en  una  adicional  liberación  de  acrilamida.  La  situación  es  más  compleja  cuando  en  países  como  Estados  Unidos,  los  aditivos  tipo  poliacrilamida  se  consideran  “secreto  comercial”  y  la  información  sobre  la  composición  de  las  fórmulas  herbicidas  no  está  al  alcance  del  público  (Smith,  et  al.,  1997; Weiss, 2002). 

22 


FOTOGRAFÍA Flora

23

Ceiba pentandra Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Flora característica del Yasuní Bosque húmedo tropical Provincias de Napo, Pastaza y Orellana


24

Árbol característico del Yasuní Provincias de Pastaza y Orellana

Árbol característico de la región fronteriza Provincia de Sucumbíos


25

Theobroma cacao Producción de polvo y grasa de cacao Provincia de Sucumbíos

Artocarpus heterophyllus Fruta de Jack Provincia de Sucumbíos


26

Theobroma cacao Afectado por herbicidas t贸xicos Provincia de Sucumb铆os

Hojas quemadas por herbicidas t贸xicos Comunidad 5 de Agosto Provincia de Sucumb铆os


27

Arrozales Provincia de SucumbĂ­os

Cultivos Provincia de SucumbĂ­os


28

Malanga Provincia de SucumbĂ­os

Montepa Provincia de SucumbĂ­os


29

Carica papaya รrbol de papaya

Eugenia stipitata Arazรก


PARTE III  TOXICOLOGÍA     7. Toxicología  genética  y  sus  efectos  en  la  salud    Con  la  revolución  industrial  y  agrícola  del  siglo XX y la aplicación de nuevas tecnologías  para diversos fines como producción vegetal,  industria química y producción de energía, ha  ido  aumentando  enormemente  la  presencia  de agentes físicos y químicos.     A  partir  de  1940  se  ha  venido  demostrando  que  el  uso  de  estos  agentes  químicos  como  los pesticidas son capaces de producir efectos  perjudiciales  sobre  los  seres  vivos,  desde  las  bacterias  hasta  los  mamíferos  más  evolucionados, incluyendo al hombre.    La  toxicología  genética  se  ocupa  fundamentalmente  de  la  identificación  y  el  análisis  de  la  acción  de  cualquier  agente  físico,  químico  o  biológico  que  sea  capaz  de  ejercer  efectos  tóxicos  sobre  el  material  genético de los seres vivos.    Actualmente se sabe que un gran número de  productos  químicos,  tanto  naturales  como  sintéticos,  así  como  las  radiaciones  ionizantes, la luz ultravioleta, algunas fibras y  distintos  virus  y  bacterias  pueden  provocar  alteraciones  genéticas  en  las  células  y  en  los  organismos.  Si  las  células  afectadas  pertenecen  a  la  línea  germinal  o  reproductora,  pueden  aparecer  distintas  taras  genéticas  hereditarias.  Si  las  células  afectadas  son  células  somáticas,  las  mutaciones  pueden  conducir  al  cáncer,  envejecimiento  y  aterosclerosis.  Así  mismo,  también  es  conocido  que  estos  agentes  potencialmente  mutagénicos  pueden  ejercer  su  acción  nociva  durante  el  desarrollo  embrionario, produciendo alteraciones más o  menos  graves  durante  el  desarrollo  normal.  Por lo tanto, no debemos olvidar que, aunque  en  la  mayoría  de  los  casos,  la  teratogénesis  no  tiene  una  base  genética,  existen  agentes  genéticos con acción teratogénica.      Las  exposiciones  teratogénicas  suelen  producir  anomalías  múltiples,  siendo 

responsables  de  alrededor  del  10%  de  todas  las  anomalías  congénitas  en  humanos.  Por  ejemplo,  se  sabe  que  la  radiación  ionizante  puede  producir  microcefalia;  la  iodina  radiactiva  puede  originar  cretinismo;  los  bifenilos  policlorinados  (PCBs)  pueden  producir  retraso  en  el  crecimiento  fetal,  hiperpigmentación  difusa  y  aparición  de  dientes  en  el  neonato;  el  alcohol  origina  un  síndrome  característico  que  incluye  deficiencia en el crecimiento, retraso mental,  anomalías  del  comportamiento  y  un  aspecto  facial típico; la cocaína se ha relacionado con  roturas  de  placenta  y  rompimientos  vasculares  tales  como  lesiones  encefaloclásticas  en  el  feto;  la  talidomida  en  el  primer  trimestre  de  gestación  puede  producir  distintos  efectos,  especialmente  graves  anomalías  en  el  desarrollo  de  las  extremidades;  la  aminopterina  y  otros  compuestos  citotóxicos  destruyen  rápidamente  las  células  en  crecimiento  en  el  feto  y  causan  deficiencias  en  el  desarrollo  y  una variedad de anomalías.    Dada  la  importancia  de  las  consecuencias  adversas que los agentes genotóxicos ejercen  sobre  los  seres  vivos  y  la  relación  entre  toxicidad  genética,  mutación,  cáncer  y  otras  enfermedades,  la  toxicología  genética  desempeña  un  papel  relevante  con  fines  de  mejorar la salud pública. Sin lugar a dudas, la  toxicología  genética  ha  contribuido  a  que  se  tome  conciencia  de  la  importancia  de  preservar  nuestro  patrimonio  genético  y  reducir al máximo el riesgo que supone, para  cualquier ser vivo en general, la exposición a  agentes  mutagénicos  y/o  carcinogénicos  (Johansen & Mange, 1999; Paz‐y‐Miño, et al.,  2002).      8. Estudios  toxicológicos  de  pesticidas  en  humanos    El  glifosato  es  uno  de  los  herbicidas  más  ampliamente  utilizado  a  nivel  mundial,  con  20000  toneladas  en  Europa  y  51000  toneladas  en  Estados  Unidos  (Acquavella,  et 

30 


31 

al., 2004; Kiely, et al., 2004). La actividad del  glifosato  se  debe  principalmente  a  la  inhibición  de  la  enzima  5‐ enolpiruvilshikimato‐3‐fosfato  sintetasa,  la  cual genera el retraso de la vía shikimato que  se  encuentra  envuelta  en  la  síntesis  de  aminoácidos  aromáticos  en  plantas  y  microorganismos  (USDA,  2003;  Mladinic,  et  al.,  2009).  Se  encuentra  comúnmente  formulado  con  surfactantes  que  decrecen  la  tensión  superficial  de  la  solución  e  incrementan  la  penetración  en  los  tejidos  (OMS,  1994).  Round  up  es  una  solución  acuosa de sal isopropilamina de glifosato con  POEA  como  surfactante  y  Cosmoflux  411F  como adyuvante (Bolognesi, et al., 2009; Tsui  & Chu, 2003).    Existen varias investigaciones a nivel mundial  que demuestran que el uso de la formulación  del  glifosato  desarrolla  niveles  de  toxicidad,  tanto  altos  como  bajos,  en  diferentes  organismos.  Este  herbicida  puede  interferir  con  algunas  funciones  enzimáticas  en  animales,  pero  los  síntomas  de  envenenamiento  dependen  de  la  dosis  y  el  tiempo de exposición.     En  humanos,  se  ha  demostrado  que  el  glifosato  es  tóxico  en  células  placentarias  y  embrionarias y en la biosíntesis de esteroides  sexuales  (Benachour  &  Séralini,  2009).  Este  pesticida  mezclado  con  adyuvantes  ha  resultado  ser  citotóxico  a  través  de  alteraciones  de  la  enzima  succinato  deshidrogenasa y también se ha demostrado  que es tóxico para las células mononucleares  de  la  sangre  periférica  (Martínez,  et  al.,  2007).  Cuatro  estudios  caso‐control  sugieren  una asociación entre el glifosato y el riesgo a  desarrollar  linfoma  no‐Hodgkin  (DeRoos,  et  al., 2003; Eriksson, et al., 2008; Hardell, et al.,  2002; McDuffie, et al., 2001).    En  el  año  2007,  se  publicó  en  la  revista   Genetics  and  Molecular  Biology  un  estudio  relacionado  con  la  evaluación  del  daño  del  ADN en la población ecuatoriana expuesta al  glifosato (Paz‐y‐Miño, et al., 2007).    El  estudio  de  la  fragmentación  del  ADN  se  realizó  a  través  de  la  técnica  ensayo  cometa 

(ensayo de electroforesis de una sola célula),  que es una herramienta de gran utilidad para  investigar  daño  del  ADN  y  su  posible  correlación con mecanismos de reparación. El  ensayo cometa tiene excelente sensibilidad y  especificidad  para  daño  del  material  genético;  cuando  el  núcleo  celular  es  sometido  a  electroforesis  los  fragmentos  rotos  migran  fuera  del  mismo,  dando  la  imagen  de  una  cometa,  dependiendo  del  tamaño  de  los  fragmentos  de  ADN,  como  de  la  cantidad  del  material  genético  destruido.  La  célula  dañada  tiene  dos  opciones:  1)  que  sea reparado el ADN por sistemas propios, 2)  que  no  sea  reparado  por  fallas  circunstanciales  o  constitucionales:  si  afecta  las  células  germinales  se  desencadenará  dificultades  reproductivas  o  efectos  teratogénicos  en  la  descendencia;  si  afecta  las  células  somáticas  se  desencadenará  apoptosis  celular  o,  si  la  mutación  no  puede  ser  eliminada,  se  generaría  la  línea  celular  que ocasionará un cáncer.      El  objetivo  del  estudio  fue  determinar  la  posible  influencia  de  la  formulación  del  glifosato,  usado  durante  las  aspersiones  aéreas  del  año  2006,  en el  material  genético  de  los  individuos  expuestos.  El  grupo  expuesto  consistió  de  24  individuos  quienes  vivieron a 3 Kms o menos de la frontera entre  Ecuador  y  Colombia.  El  grupo  de  individuos  expuestos  manifestó  síntomas  de  toxicidad  después  de  varias  exposiciones  a  las  aspersiones  aéreas,  entre  ellos:  dolor  intestinal y vómito, diarrea, fiebre, dolores de  cabeza,  insomnio,  cansancio,  quemadura  de  ojos  y  piel  y  dificultad  al  respirar    (Paz‐y‐ Miño, et al., 2007).    Luego  de  los  análisis  se  encontró  que  los  individuos  expuestos  a  las  aspersiones  con  glifosato  presentaron  altos  niveles  de  migración  del  ADN  a  diferencia  de  los  individuos  control  (p  <  0,001).  Los  individuos  expuestos  presentaron  una  migración  media  de  35,50  µm  mientras  que  los  individuos  control  presentaron  una  migración  media  de  25,94  µm.  Los  tipos  de  cometas  D  y  E  no  fueron observados en el grupo control (Figura  III.1)  (Tabla  III.1  y  III.2)  (Paz‐y‐Miño,  et  al.,  2007).


Figura III.1. Tipos de cometas según el nivel de degradación del ADN 

32 

  Tabla III.1. Mediciones del daño del ADN en individuos expuestos a las aspersiones    Individuos expuestos al glifosato  Individuos  Número de células analizadas en cada grupo  Migración del ADN (µm)  (género, año)a  A  B  C  D  E  Media  Mediana  1E (F, 53)  2  120  76  5  3  39,5  32,5  2E (F, 37)  13  92  82  14  0  44,1  32,5  3E (F, 40)  2  64  62  77  4  56,6  52,5  4E (M, 27)  8  75  64  47  8  49,2  37,5  5E (F, 44)  9  138  63  3  0  34,6  30,0  6E (F, 50)   51  113  30  3  0  30,8  27,5  7E (F, 38)  21  139  48  3  0  33,2  30,0  8E (F, 46)  21  116  72  4  0  35,2  30,0  9E (F, 55)  26  100  84  1  0  32,8  30,0  10E (F, 50)  26  100  84  1  0  34,2  30,0  11E (F, 22)  28  123  60  0  0  32,0  27,5  12E (F, 27)  11  130  63  6  0  33,7  30,0  13E (F, 28)  40  132  40  2  0  31,0  30,0  14E (F, 59)  10  96  99  1  0  36,4  32,5  15E (F, 55)  35  110  62  1  0  32,7  30,0  16E (F, 17)  60  101  44  1  0  31,3  37,5  17E (F, 34)  7  114  57  2  0  33,4  30,0  18E (F, 45)  10  150  50  4  0  33,0  30,0  19E (F, 28)  13  160  44  0  0  31,3  27,5  20E (F, 21)  1  153  47  3  0  33,2  30,0  21E (F, 34)  2  130  25  1  0  31,8  30,0  22E (F, 23)  0  29  173  2  0  39,3  37,5  23E (F, 34)  2  88  115  1  0  35,5  37,5  24E (F, 42)  93  103  9  0  0  27,6  27,5  Edad media = 38 ± 12,2b  35,5 ± 6,4c  30 ± 5,4d  a F = femenino, M = masculino; b,cMedia ± desviación estándar; dValor de la mediana ± desviación estándar 

 


Tabla III.2. Mediciones del daño del ADN en individuos no expuestos a las aspersiones   

33 

Individuos no expuestos al glifosato  Individuos  Número de células analizadas en cada grupo  Migración del ADN (µm)  (género, año)a  A  B  C  D  E  Media  Mediana  1U (F, 17)  150  59  3  0  0  26,2  25,0  2U (F, 40)  164  43  4  0  0  25,4  25,0  3U (F, 26)  165  40  2  0  0  25,7  25,0  4U (M, 14)  111  96  6  0  0  27,3  26,5  5U (M, 32)  165  38  3  0  0  25,9  25,0  6U (M, 21)   171  35  1  0  0  25,7  25,0  7U (M, 16)  177  25  6  0  0  25,8  25,0  8U (F, 47)  176  25  3  0  0  25,7  25,0  9U (F, 15)  190  14  1  0  0  25,2  25,0  10U (F, 36)  179  25  1  0  0  25,4  25,0  11U (F, 21)  150  46  9  0  0  26,3  25,0  12U (F, 43)  148  49  15  0  0  26,8  25,0  13U (F, 53)  161  27  10  0  0  26,1  25,0  14U (F, 35)  164  23  21  0  0  27,0  25,0  15U (F, 38)  169  28  11  0  0  26,4  25,0  16U (F, 22)  183  15  8  0  0  25,1  25,0  17U (F, 71)  191  8  5  0  0  25,0  25,0  18U (F, 39)  195  13  6  0  0  25,5  25,0  19U (F, 21)  179  20  8  0  0  25,9  25,0  20U (F, 50)  190  14  2  0  0  25,3  25,0  21U (F, 43)  150  56  9  0  0  26,4  25,0  Edad media = 33 ± 15b   25,94 ± 0,6c  25 ± 0,3d  a b,c d F = femenino, M = masculino;  Media ± desviación estándar;  Valor de la mediana ± desviación estándar 

  Los  compuestos  formulados  a  partir  de  mezclas  de  herbicidas  con  glifosato  son  mutágenos  más  potentes  para  microorganismos,  plantas,  animales  y  humanos,  a  diferencia  del  mecanismo  de  acción  del  glifosato  solo.  Es  por  ello  que  los  individuos expuestos al glifosato presentaron  altos  niveles  de  daño  en  el  ADN  en  comparación con los individuos no expuestos  a las aspersiones aéreas.    Con el fin de generar un espacio de análisis y  reflexión  académica  y  científica  sobre  el  estado  sanitario  de  los  pueblos  fumigados,  y  de escuchar y contener a los miembros de los  equipos  de  salud  que  vienen  denunciando  y  enfrentando  este  problema,  la  Facultad  de  Ciencias  Médicas  de  la  Universidad  Nacional  de  Córdoba  (UNC)  de  Argentina  convocó  al  Primer  Encuentro  Nacional  de  Médicos  de  Pueblos Fumigados los días 27 y 28 de agosto  del 2010.    Las exposiciones y relatos de los participantes  fueron  coincidentes  con  respecto  a  la 

observación  clínica  de  una  gama  de  enfermedades  y  afecciones  de  la  salud  en  la  población sujeta a fumigaciones. Lo que más  alarma  a  los  médicos  de  los  pueblos  fumigados son dos observaciones principales:  1) una mayor cantidad de recién nacidos que  presentaron  malformaciones  congénitas  y  muchos  más  abortos  espontáneos  que  los  que  habitualmente  se  producían  en  sus  poblaciones  de  pacientes,  y  2)  una  mayor  detección  de  cánceres  en  niños  y  adultos,  y  enfermedades  severas  como  púrpuras,  hepatopatías  tóxicas  y  trastornos  neurológicos.  Los  médicos  destacaron  que  ellos  atienden,  en  general,  desde  hace  más  de 25 años a las mismas poblaciones, pero lo  que  encuentran  en  los  últimos  años  es  absolutamente  inusual  y  lo  vinculan  directamente a las fumigaciones sistemáticas  con plaguicidas.     El  Dr.  Rodolfo  Páramo,  médico  pediatra  y  neonatólogo  del  hospital  público  de  Malabrigo, Argentina, resaltó la alarma que le  produjo encontrar 12 casos de neonatos con 


malformaciones  sobre  200  nacimientos  embarazadas,  problemas  respiratorios  y  anuales  en  el  año  2006.  Al  igual  que  los  4  alérgicos  agudos.  Todos  ellos  vinculados,  por  casos  de  niños  muertos  a  causa  de  los  equipos  de  salud,  a  un  mayor  nivel  de  malformaciones  congénitas  nacidos  en  el  contaminación  química  del  ambiente,  pequeño pueblo de Rosario del Tala, zona de  generado  por  la  práctica  agroindustrial  masiva fumigación con agrotóxicos (PENMPF,  impuesta  en  la  zona,  que  desplazó  a  los  2010).  pequeños  y  numerosos  predios  de  algodón    preexistentes  y  exterminó  al  bosque  nativo  La  Dra.  María  del  Carmen  Seveso,  jefa  de  (PENMPF, 2010).  terapia  intensiva  del  hospital  4  de  junio  de    Presidencia  Roque  Saenz  Peña‐Chaco,  La Dra. Ana Lía Otaño, delegada nacional del  presentó  un  panorama  desolador  en  los  Ministerio de Salud en el Chaco, presentó los  pueblos  del  centro  de  la  Provincia  del  Chaco  resultados  de  una  investigación  donde  se  como  Napenay,  Gancedo,  Santa  Silvina,  Tres  destaca  claramente  un  aumento  a  nivel  Isletas,  Colonia  Elisa  y  Avia  Terai,  en  los  que  provincial de la incidencia de malformaciones  hubo  muchos  casos  de  enfermos  con  congénitas en recién nacidos, según los datos  insuficiencia  renal,  malformaciones  del Servicio de Neonatología del Hospital J.C.  congénitas  en  hijos  de  madres  jóvenes,  Perrando  de  Resistencia  Chaco  (Tabla  III.3)  cáncer  en  personas  muy  jóvenes,  abortos  (PENMPF, 2010).  espontáneos  y  dificultades  para  quedar    Tabla III.3. Aumento de malformaciones congénitas    Año  1997  2001  2008 

Casos registrados de  malformaciones  46  60  186 

Nacidos vivos  24030  21339  21808 

Incidencia   (malformados / 10000 nacidos vivos)  19,1 / 10000  28,1 / 10000  85,3 / 10000 

 

En  la  Provincia  del  Chaco  ahora  se  reconoce  Regional  de  la  Universidad  Nacional  del  que la actividad laboral con agroquímicos o la  Nordeste,  quien  los  viene  registrando  y  exposición  habitacional  está  relacionada  con  estudiando  desde  hace  más  de  10  años;  sus  problemas  reproductivos,  abortos  observaciones  han  sido  totalmente  espontáneos  repetidos  y  graves  confirmadas (PENMPF, 2010).  malformaciones congénitas, como la serie de    casos  de  malformaciones  congénitas  cuyas  Con respecto al cáncer infantil, la Dra. Otaño  madres  presentan  antecedentes  directos  de  señaló que las tasas de incidencia del  cáncer  exposición  con  plaguicidas,  recogida  por  el  han  aumentado  marcadamente  sobre  los  Dr.  Horacio  Lucero  jefe  del  laboratorio  de  niveles  previamente  existentes  en  sus  biología  molecular  del  Instituto  de  Medicina  registros (Tabla III.4).    Tabla III.4. Aumento de casos de cáncer infantil    Año  1985  1991  2001  2007 

Casos registrados de cáncer infantil  29  26  40  59 

  Se  analizó  la  incidencia  de  cánceres  en  el  pueblo  más  agredido  con  agrotóxicos  (La  Leonesa), y se comparó con pueblos cercanos  medianamente  fumigados  (Las  Palmas),  y 

Población menor a 15 años  275858  323788  354991  376833 

Incidencia  10,5 / 100000  8,03 / 100000  11,3 / 100000  15,7 / 100000 

poco fumigados (Puerto Bermejo) (Tabla III.5)  (PENMPF, 2010).     

34 


Tabla III.5. Incidencia de cánceres infantiles    Municipio 

La  Leonesa 

35 

Población  (2001) 

10067 

Menores de 15  años (2001) 

2960 

Casos  esperados 

Casos registrados 

0,41 casos /  año 

1996: 1 caso 1997: 1 caso  2000: 1 caso  2003: 2 casos  2004: 1 caso  2008: 1 caso  2009: 1 caso 

Las  Palmas 

6593 

2146 

0,3 casos /  año 

1993: 1 caso  1995: 1 caso  2006: 1 caso 

Puerto  Bermejo 

1832 

652 

0,09 casos /  año 

1995: 1 caso  2008: 1 caso 

Incidencia  anual  1990 – 1999  0,2 casos/año    2000 – 2009  0,6 casos /año  1990 – 1999 0,2 casos / año    2000 – 2009  0,1 casos / año  1990 – 1999 0,1 casos / año    2000 – 2009   0,1 casos / año 

  El  Centro  Latinoamericano  de  Registro  de  personas  expuestas  a  plaguicidas  en  forma  Malformaciones Congénitas (ECLAM) informó  directa (fumigadores del cordón frutihortícola  que  la  Provincia  de  Misiones  tiene  una  tasa  de  Santa  Fe)  e  indirecta  (no  fumigadores),  de  0,1  /  1000  nacidos  vivos  con  defecto  de  quienes  han  sido  evaluados  mediante  el  cierre del tubo neural; por el contrario, el Dr.  ensayo  cometa  para  determinar  daño  y  Demaio, cirujano pediátrico y jefe del servicio  fragmentación  del  ADN.  Este  grupo  de  de  pediatría  del  hospital  de  Posadas  en  trabajo  presenta  varias  publicaciones  Misiones, registra en su hospital una tasa de  nacionales  e  internacionales  (Simoniello,  et  7,2  /  1000  nacidos  vivos  (70  veces  más).  Su  al., 2007, 2008, 2010).  equipo georeferenció el origen de las familias    con  estos  graves  e  invalidantes  déficits  y  Los  resultados  mostraron  que  ambos  grupos  todos  provienen  de  zonas  fuertemente  de expuestos a los plaguicidas (ocupacional y  habitacional)  tenían  un  índice  de  daño  fumigadas (PENMPF, 2010).  genético  estadísticamente  muy  superior  al    La  Dra.  María  Fernanda  Samoniello,  junto  al  grupo  control  (no  expuestos  a  plaguicidas),  que  equipo  de  toxicología,  farmacología  y  diferencia  es  estadísticamente  bioquímica  legal  de  la  Universidad  Nacional  significativa  y  que  se  mantuvo  en  el  análisis  del  Litoral,  se  ha  dedicado  al  estudio  de  de reparación de daño genético (Tabla III.6).  biomarcadores  de  reacción  celular  en    Tabla III.6. Índice de daño del ADN mediante el ensayo cometa    Ensayo cometa  Índice de daño  (media ± SDa)  a SD = desviación estándar  

Control (n = 30) 113,36 ± 13,48

  Por  el  contrario,  existen  investigaciones  que  han  demostrado  un  nivel  de  toxicidad  bajo  del  glifosato,  entre  ellos  se  destacan:  un  estudio  realizado  por  Bolognesi,  et  al.,  en  el 

Expuestos directos 214,92 ± 15,44

Expuestos indirectos 221,06 ± 18,32 

cual  efectúan  un  análisis  citogenético  a  agricultores  de  cinco  regiones  de  Colombia  (Bolognesi, et al., 2009); un estudio realizado  por Sanin, et al., en el cual demuestran la no 


asociación entre el glifosato y la prolongación  II y III permitiendo la formación de aductos de  en  el  tiempo  de  embarazo  de  las  mujeres  ADN  tanto  en  el  hígado  como  en  el  riñón  (Sanin,  et  al.,  2009);  y  un  estudio  en  el  que  (Peixoto, et al., 2005).   demuestran  el  bajo  riesgo  genotóxico  del    glifosato en el ambiente en comparación con  El  laboratorio  de  embriología  molecular  del  productos  utilizados  en  la  producción  de  Consejo  Nacional  de  Investigaciones  cocaína en Colombia (Solomon, et al., 2009).   Científicas y Técnicas (CONICET‐UBA), dirigido  por  el  Dr.  Andrés  Carrasco,  ha  venido    estudiando  el  glifosato  como  noxa  del    9. Estudios  toxicológicos  de  pesticidas  en  desarrollo  embrionario  en  modelos  de  vertebrados  con  reconocida  compatibilidad  otros organismos  con  el  desarrollo  embrionario  humano.    No  solamente  existen  estudios  para  evaluar  Carrasco,  et  al.,  verificaron  los  efectos  la  toxicidad  de  una  amplia  gama  de  teratogénicos  del  glifosato,  incubando  e  pesticidas,  como  el  glifosato,  en  humanos,  inoculando  embriones  anfibios  y  de  pollos  sino  que  también  se  han  realizado  con  dosis  muy  diluidas  del  herbicida.  Los  investigaciones en diversas especies animales  resultados  encontrados  fueron  disminución  como  anfibios,  ratones,  conejos,  erizos  de  del  largo  del  embrión,  alteraciones  en  la  mar, entre otros.   formación  del  eje  embrionario,  modificación    del  tamaño  de  la  zona  cefálica  con  En  anfibios,  renacuajos  de  Rana  pipiens  compromiso  en  la  formación  del  cerebro  y  Schreber  demostraron  decrecimiento  en  la  reducción  de  ojos,  alteraciones  de  los  arcos  longitud  boca‐cloaca  e  incremento  de  la  branquiales  y  placoda  auditiva  y  cambios  etapa  de  metamorfosis,  también  se  observó  anormales  en  los  mecanismos  de  formación  daño  en  la  cola  y  anomalías  a  nivel  gonadal.  de  la  placa  neural  que  podrían  afectar  el  La toxicidad de los pesticidas es un factor que  normal  desarrollo  del  cerebro,  del  cierre  del  ha  contribuido  en  el  declinamiento  de  los  tubo  neural  u  otras  deficiencias  del  sistema  anfibios  a  nivel  mundial  (Howe,  et  al.,  2004;  nervioso (Paganelli, et al., 2010).    Dinehart, et al., 2009).   Al  medir  la  actividad  de  algunos  sistemas    En cuanto al desarrollo de los huevos de erizo  enzimáticos,  se  descubrió  que  el  glifosato  de  mar,  el  glifosato  previene  la  síntesis  de  aumenta  la  actividad  endógena  del  ácido  enzimas y al  haber daño en el ADN se  activa  retinoico;  la  manifestación  de  los  daños  el punto de control CDK1/ciclina B en el ciclo  estructurales  en  los  embriones  fue  revertida  celular  desencadenando  la  muerte  celular  cuando  se  utilizó  simultáneamente  al  programada mediante apoptosis (Marc, et al.,  herbicida,  un  antagonista  del  ácido  retinoico  2002;  Bellé,  et  al.,  2007;  Benachour,  et  al.,  (Paganelli, et al., 2010).    2009).   Los  autores  concluyen  afirmando  que  el    En  conejos,  el  tratamiento  con  glifosato  ha  efecto  directo  del  glifosato  sobre  los  resultado en la pérdida de peso corporal, baja  mecanismos  iniciales  de  la  morfogénesis  en  de  vertebrados,  genera  concentración  de  esperma  y  alteración  en  la  embriones  osmolalidad del semen (Yousef, et al., 1995).  preocupación  por  los  resultados  clínicos  que  Mientras que en muestras mitocondriales de  se  observan  en  la  descendencia  de  las  hígado  de  ratón  se  ha  observado  que  poblaciones  expuestas  a  glifosato  en  los  Roundup altera los complejos mitocondriales  campos  agrícolas  (Paganelli,  et  al.,  2010).   Links web  www.scielo.br/pdf/gmb/v30n2/a26v30n2.pdf  www.fs.fed.us/r5/hfqlg/publications/herbicide_info/1996_glyphosate.pdf   

36 


FOTOGRAFÍA Anfibios y reptiles

37

Bufo sp. Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Renacuajos Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana


38

Diversidad de anfibios Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Diversidad de anfibios Reserva Faunística Cuyabeno Provincias de Sucumbíos y Orellana


39

Caiman niger Reserva FaunĂ­stica Cuyabeno Provincias de SucumbĂ­os y Orellana


PARTE IV   ASPERSIONES AÉREAS    10. Biodiversidad  amazónica  ecuatoriana:  recursos y amenazas    La  región  amazónica  es  uno  de  los  ecosistemas  o  biorregiones  geográficas  más  importantes  del  planeta,  y  desempeña  un  papel ecológico fundamental a nivel mundial.  Esta  región  equivale  a  un  tercio  del  total  de  los  bosques  tropicales  del  planeta,  y  sus  ríos  constituyen  la  quinta  parte  del  agua  dulce  que  circula  por  la  corteza  terrestre.  La  Amazonia  posee  la  mayor  diversidad  ecológica  en  su  fauna  y  flora.  Asimismo,  permite  la  regulación  de  oxígeno  y  gas  carbónico  para  Sudamérica  y  el  mundo  (Veyrunes, 2008).    El Ecuador es un país privilegiado por poseer  una  porción  de  este  gran  ecosistema  y  albergar    la  gran  biodiversidad  presente  en  este y otros ecosistemas propios de la región  andina,  siendo  el  Ecuador  uno  de  los  países  con mayor biodiversidad a nivel mundial, con  solo  270,600  km2  de  territorio  nacional,  esto  debido  a  su  alta  variedad  de  factores  climáticos  y  geográficos  (Izquierdo,  et  al.,  2000).     Dentro  de  los  ecosistemas  presentes  en  el  Ecuador, que van desde el páramo en zona de  altitud (hasta los 4700msnm)  pasando  por el  bosque  nublado  a  altitudes  intermedias,  el   bosque  húmedo  tropical,  en  tierras  bajas,  ocupa  una  gran  porción  del  territorio  ecuatoriano,  principalmente  en  la  región  amazónica.  Estos  bosques  son  de  gran  importancia  debido  a  la  extensión  que  ocupan y sus riquezas ecológicas, además de  su  alta  diversidad  y  heterogeneidad,  lo  cual  se  encuentra  mayormente  reflejado  en  la  región  oriental  del  país  correspondiente  a  la  Amazonia  ecuatoriana  (Palacios  &  Jaramillo,   2001).    El  levantamiento  sucesivo  y  final  de  los  Andes,  causó  la  separación  progresiva  de  zonas de vegetación tropical en el oeste, de la  gran  zona  que  actualmente  llamamos  Amazonia; el clima se volvió más húmedo por 

el  levantamiento  de  la  cordillera,  y  se  desarrolló una flora de extraordinaria riqueza  con  abundantes  elementos  endémicos  (Van  der  Hammen,  2000).  Aproximadamente  un  80%  de  endemismo,  y  su  diversidad  puede  explicarse  por  el  predominio  de  una  especiación  alopátrica  y  por  el  equilibrio  ecológico  y  evolutivo  de  la  región  como  consecuencia del levantamiento de los Andes  (Palacios & Jaramillo,  2001).    A  menudo  a  la  región  amazónica  se  la  ha  descrito  como  una  extensión  monótona  de  bosque  de  dosel  alto  que  cubre  más  de  la  mitad  del  continente  sudamericano,  sin  embargo  existe  una  alta  heterogeneidad  de  especies  dentro  de  este  ecosistema,  la  variabilidad de la composición de especies se  manifiesta  a  escala  de  cuenca,  regional  y  local.  Tras  varia  investigaciones  se    ha  demostrado  esta  heterogeneidad  mostrando  floras con una marcada diferencia regional, y  una  distribución  de  vertebrados  limitada  por  ríos,  lo  cual  conlleva  a  la  presencia  de  varias  especies  y  subespecies  endémicas  (Killeen,  2007).  En  el  Ecuador,  a  pesar  de  su  corta  extensión  en  relación  al  territorio  total  que  ocupa  la  Amazonia,  la  heterogeneidad  de  este ecosistema se encuentra reflejada en los  cambios  de  dominancia  de  especies  en  las  distintas provincias presentes en la Amazonia  ecuatoriana (Palacios & Jaramillo,  2001).    En  cuanto  a  su  biodiversidad,  la  Amazonia  ecuatoriana  alberga    una  gran  riqueza  biológica,  y  contiene  el  27%  de  las  especies  de los trópicos y al menos el 13% de especies  vegetales  del  planeta,  por  este  motivo  el  bosque  húmedo  tropical  amazónico  del  Ecuador  consta  como  uno  de  los  diez  hostpots  de  biodiversidad  de  los  trópicos.  Además,  el  Ecuador  ocupa  un  lugar  importante en la riqueza de anfibios (el tercer  lugar  a  nivel  mundial  con  402  especies)  (Izquierdo,  et  al.,  2000).  Y  es  el  bosque  húmedo  tropical,  principalmente  el  de  la  región  amazónica,  el  que  contiene  los 

40 


41 

mayores  porcentajes  de  especies  de  anfibios  y reptiles registrados en el país (Izquierdo, et  al., 2000).     Debido  a  la  alta  diversidad  de  los  bosques  amazónicos,  esta  presenta  un  gran  potencial  económico  para  los  países  en  vías  de  desarrollo  como  es  el  Ecuador,  y  existen  actividades  de  extracción  de  recursos  naturales  de  forma  sustentable  así  como  destruyendo el equilibrio de este ecosistema,  como  es  el  caso  de  la  extracción  petrolera,  minera y maderera, además de la ganadería y  el  uso  de  pesticidas  en  la  agricultura,  las  cuales se manejan de manera responsable en  algunos casos o irresponsablemente en otros;  sin  embargo,  estas  actividades  siempre  tienen un nivel de impacto en el ecosistema.  Además  del  impacto  directo  que  estas  actividades  tienen  sobre  el  ecosistema,  generan  efectos  secundarios  como  la  construcción de caminos en áreas remotas, lo  cual    estimula  la  migración  humana,  que  conlleva  a  un  cambio  acelerado  del  uso  del  suelo y a un aumento de la fragmentación del  hábitat.  Puesto  que  las  tierras  situadas  en  el  pie  de  monte  y  las  llanuras  adyacentes  son  esencialmente  planas,  proliferarán    los  caminos  secundarios,  causando  una  gran  deforestación,  fragmentación  y  degradación  de los bosques (Killeen, 2007).    En  el  Ecuador,  las  tasas  anuales  de  deforestación  varían  entre  0,5%  y  2,4%,  por  tanto,  en  la  Amazonía  ecuatoriana  se  perderían  anualmente  entre  46,000  y  220,800  hectáreas  de  bosques  (Brito,  2006),  lo  cual  conlleva  a  una  disminución  en  la  biodiversidad  y  la  alteración  del  equilibrio  ecológico  de  este  gran  ecosistema.  Además  que afecta a la calidad de vida y la cultura de    11. Origen de las aspersiones aéreas    Colombia  es  el  país  que  más  cultiva  coca  (Erythrozyllum coca) a nivel mundial. De igual  forma, es uno de los países más productores  de la amapola del opio (Papaver somniferum)  y  de  la  marihuana    (Cannabis  sativa)  (TAC,  2003).  Con  el  propósito  de  erradicar  los  cultivos ilícitos, el Gobierno de Colombia ha  

los pueblos ancestrales pertenecientes a esta  región.     En  los  países  en  vías  de  desarrollo,  la  biodiversidad  vegetal  de  los  bosques  húmedos  tropicales  tiene  una  gran  importancia en sus habitantes ya que el 80%  de  estos  emplean  las  especies  vegetales  como  medicina  tradicional,  pues  son  una  alternativa  efectiva  en  el  tratamiento  de  muchas  enfermedades.  En  el  Ecuador,  el  conocimiento  tradicional  acumulado  y  transmitido  durante  generaciones,  relacionado  con  el  uso  de  las  plantas,  ha  evolucionado desde el establecimiento de los  primeros humanos hasta el presente (Ríos, et  al., 2007).    El  gran  potencial  económico  que  presenta  la  Amazonia  para  el  país  ha  puesto  por  encima  el  desarrollo  económico  sobre  el  cuidado  de  la  biodiversidad  de  este  ecosistema,  sin  embargo  existen  alternativas  más  sustentables  para  explotar  la  riqueza  de  su  biodiversidad.  A  nivel  mundial  se  puede  considerar  que,  a  partir  de  la  diversidad  vegetal  de  los  bosques  húmedos  tropicales,  se estaría en capacidad de sintetizar 750,000  extractos  potenciales  y  producir  fármacos  con  un  valor  económico  entre  420  y  900  billones de dólares (Ríos, et al, 2007).    El desarrollo en el campo investigativo acerca  del  potencial  farmacéutico  de  la  biodiversidad de las especies del país apenas  está empezando (Velasco, 2001),  y puede ser  una gran alternativa para generar ingresos al  Estado,  y  de  esta  manera  remplazar  las  actividades  de  extracción  de  diversos  recursos,  lo  cual  puede  mitigar  el  deterioro  ambiental y la pérdida de la biodiversidad.      fomentado la estrategia de fumigar en forma  aérea,  mediante  avionetas  y  helicópteros,  diversos  herbicidas  químicos  de  alta  concentración (Crespo, 2009).    Entre  los  años  1978  y  1991,  se  iniciaron  las  aspersiones  discontinuas  mediante  el  uso  de  Paraquat, 2,4‐D y glifosato, en Sierra Nevada  de Santa Marta (Puyana, 2007). 


Entre  los  años  1992  y  1999,  se  realizaron  aspersiones sistemáticas. El Concejo Nacional  de  Estupefacientes  (CNE)  reglamentó  el  procedimiento  y  se  le  otorgó  el  rango  de  política pública sistemática de Estado. En ese  período  se  asperjaron  187858  hectáreas,  pero  la  producción  se  incrementó  en  243%.  Durante  este  período  la  Defensoría  del  Pueblo  de  Colombia  denunció  el  uso  de  Tebuthiuron, Velpar (hexazinona) e Imazapyr  (Castro, 2000; CCE, 2007; Puyana, 2007).     Desde el inicio, las aspersiones aéreas fueron  rechazadas por las poblaciones afectadas, por  los  diseñadores  de  políticas  y  por  la  comunidad  científica.  En  1984,  el  Gobierno  de Colombia, a través de su Instituto Nacional  de  Higiene  (INH),  reunió  a  un  grupo  de  expertos  en  herbicidas  para  que  analizaran  los  daños  potenciales  de  las  aspersiones  aéreas.  Los  expertos  se  opusieron  a  la  fumigación  aérea  con  cualquier  herbicida,  incluyendo el glifosato: “No se recomienda su  uso  por  vía  aérea  para  la  erradicación  de  los  cultivos  de  marihuana  y  coca”.  Los  datos  obtenidos  en  experimentos  con  animales  muestran  una  baja  toxicidad  aguda;  se  conoce  muy  poco  sobre  su  toxicidad  aguda  en los seres humanos (TAC, 2003). 

A  pesar  del  análisis  y  las  recomendaciones  dadas  por  los  expertos,  Colombia  continuó  con  las  aspersiones  aéreas  con  una  mezcla  concentrada  de  herbicidas  con  el  propósito  de  controlar  los  cultivos  ilícitos  antes  mencionados.     Colombia depende considerablemente de las  aspersiones aéreas desde 1999, año en el que  se  efectivizó  el  programa  “Plan  Colombia”  entre  Estados  Unidos  y  Colombia,  con  el  propósito de eliminar las plantaciones ilícitas  mediante  la  aspersión  aérea  de  diversos  herbicidas  en  el  territorio  colombiano,  incluyendo  las  zonas  que  limitan  con  las  Provincias  ecuatorianas  de  Sucumbíos  (Oriente), Carchi (Sierra) y Esmeraldas (Costa)  (Crespo, 2009).    Las  primeras  aspersiones  ejecutadas  por  el  Gobierno  de  Colombia  se  realizaron  en  las  Provincias de Putumayo y Nariño, cerca de las  provincias  del  norte  del  Ecuador.  Dentro  de  todas  las  aspersiones  aéreas  realizadas  por  Colombia,  se  ha  constatado  que  varias  de  ellas  han  afectado  a  las  comunidades  ecuatorianas  fronterizas  de  forma  negativa.  En  la  siguiente  tabla  se  observan  las  diferentes  comunidades  afectadas  desde  el  2000 hasta el 2007. 

  Tabla IV.1. Comunidades ecuatorianas afectadas por aspersiones aéreas colombianas    Provincia  Esmeraldas  Carchi  Sucumbíos  Carchi  Sucumbíos 

Sucumbíos  Carchi  Sucumbíos   Esmeraldas  Carchi  Sucumbíos  Sucumbíos 

   

Comunidad  Mataje  San Marcos  San  Francisco  1  y  2,  Nuevo  Mundo  y  San  Pedro  del  Cóndor  San Marcos  Chone  II,  Playera  Oriental,  Palma  Seca,  Puerto  Nuevo,  Santa  Marianita,  5  de  Agosto  y  Puerto  Mestanza  Santa  Marianita,  Corazón  Orense,  5  de  Agosto  y  Puerto Mestanza  Chical  Frente al Azul  Limones  San Marcos  Comunidades de Salinas a Puerto Escondido Comunidades de Puerto El Carmen a Río Abajo

Fecha Octubre, 2000  Octubre, 2000  Diciembre – Febrero, 2001 Octubre – Noviembre, 2001 Agosto – Octubre, 2002 

Julio, 2003  Diciembre, 2004  Diciembre, 2004  Abril, 2005  Mayo, 2005  Diciembre, 2006  Enero, 2007 

42 


43 

12. Antecedentes  de  impactos  por  las  en  el  57,64%  de  los  casos  como  las  últimas  aspersiones  que  sufrieron,  y  que  aspersiones aéreas  reconocieron  la  mayoría  de  las  veces    coincidían  con  el  periodo  de  navidades.  12.1. Características de las aspersiones  Siendo  las  más  recordadas  las  de  los  años    Tras  las  aspersiones  aéreas  del  Plan  2002,  2003  y  2004,  pues  la  población  sufrió  Colombia,  el  32,37%  de  las  familias  los  impactos  de  estas  aspersiones  en  varias  manifestaron que alguno de los miembros se  ocasiones.  Las  aspersiones  según  las  enfermó  de  manera  grave  a  la  par  que  se  encuestas familiares tenían una duración de 1  produjeron  impactos  en  los  cultivos  y  en  los  a 20 días, con un término medio de 4 días.  animales.    El número de aviones fumigadores era de 1 a    Las  aspersiones  que  afectaron  el  cordón  3 acompañados de 1 a 4 helicópteros, a veces  fronterizo de Ecuador se notaron por primera  más,  para  la  defensa  y  que  en  algunas  vez  en  octubre  del  año  2000  en  Esmeraldas,  ocasiones  disparaban.  El  horario  de  donde  la  población  de  Mataje  denunció  aspersiones fue descrito por los encuestados  graves  afectaciones  a  la  salud.  En  la  zona  de  desde la mañana a la tarde en el 74,58% con  Sucumbíos,  la  última  fumigación  fue  entre  un  promedio  aproximado  de  6  horas  al  día  diciembre  del  2006  y  marzo  del  2007.  Esas  (Figura IV.1).  aspersiones son reconocidas por la población    Figura IV.1. Horario de aspersiones    mañana   tarde 0.85%   noche 17.8%   mañanatarde   3.39% madrugada   mañananoche   74.58%             Si  bien  para  la  mitad  de  las  familias  familias manifestó que éstas sí lo eran (Figura  encuestadas  las  aspersiones  no  eran  IV.2).  diferentes  unas  de  otras,  un  35,7%  de  las    Figura IV.2. Percepción sobre las aspersiones    iguales   diferentes 4.38%   5.11% No sabe   5.84% no vivía   única vez   48.91%   35.77%          


De  hecho  manifestaron  que  la  cantidad  de  En  otras  ocasiones  la  diferencia  de  la  químico  aplicado  era  diferente  (18,92%)  en  composición química era visible (18,92%) por  una o en otra ocasión por la composición del  colores diferentes (Figura IV.3).  químico o por la intensidad de sus impactos.    Testimonios de la comunidad  “Unas veces botaban más líquido que otras”.  “A veces el líquido era más fuerte, en el 2002 fueron muy fuertes, murió todo, nos quedamos  sin nada y hubo más enfermedades”.  “A veces se iban temprano, a veces tarde dependiendo del clima. Se quedaban más cuando  había sol”.    Figura IV.3. Diferentes características en las aspersiones    cantidad químico   clima   8.11% color 18.92%   8.11% composición químico   cruzaron río   5.41% distancia 16.22%   horario 8.11%   intensidad Other otro   10.81% 10.81%   13.51%           Testimonios de la comunidad  “A veces era químico diluido en líquido y a veces parecía polvo seco”.  “A  veces  fumigaban  y  les  caían  hongos  a  los  árboles,  como  una  langosta,  y  se  quedaron  pelados los árboles. Otras veces quemaba las hojas” (SM‐06, Santa Marianita).  “Cuando llovía parece que echaban químicos más fuertes”.  “Parece que dependía del clima, a veces eran de color blanco y otras veces de color negro,  como aceite y eran más fuertes”.  “Hace 2 años vivía en la orilla del río y veía la TV colombiana, en el 2002 vi un reportaje que  decía  que  en  la  primera  fumigación  no  pudieron  terminar  con  las  plantas  y  que  en  la  segunda iban a reforzar con venenos más fuertes”.      Testimonios de la comunidad  “En  los  años  2002,  2003  y  2006  las  avionetas  cruzaron  el  río  San  Miguel  y  entraron  al  territorio ecuatoriano”.  “Las últimas aspersiones daban la vuelta en Puerto Escondido”.  “Una vez sobrevolaron a Puerto Escondido (2002), las otras eran más lejos”.  “En  el  2002  fue  a  200m  de  la  línea  de  frontera,  en  el  2006  fueron  más  retiradas  las  aspersiones”.  “Vi la aspersión en Puerto Nuevo, todos se asustaron, pasaron las avionetas por encima de  Puerto Nuevo y daban la vuelta sobre suelo ecuatoriano”.   

44 


45 

“químico”  o  “glifosato”,  mientras  que  el  12.2. Percepción sobre las aspersiones  29,8%  dijo  “no  saber”,  “picante”,  “caucho    El  olor  de  las  aspersiones  fue  definido  de  quemado”,  “pólvora”,  “ácido”,  “gasolina”  forma  amplia,  el  46%  de  los  individuos  (Figura IV.4).  encuestados  definió  el  olor  como  “veneno”,    Figura IV.4. Olor de las aspersiones    feo   fuerte   Glifosato glifosato 2.19%   inoloro 11.68%   no sabe  No sabe   picante   11.68% quemado   22.63% químico 6.57%   tóxico 2.92%   3.65% veneno     Other otro      El  aspecto  de  las  aspersiones  también  fue  Con  respecto  al  color,  el  69,29%  manifestó  intensamente variable en su descripción. Para  que era “blanco” o “gris”, el 7,14% manifestó  el 39% el aspecto era similar al de la neblina,  que  era  “negro”,  el  2,8%  observó  tonalidad  para  el  13,48%  el  aspecto  era  similar  a  la  “transparente”  o  “azul”,  mientras  que  el  “llovizna”  o  “rocío”,    el  19,15%  lo  percibió  restante 20,7% dijo “no saber”, “no ver”, “no  como  “humo”  o  “ceniza”  y  el  5,65%  lo  vivir  ahí”  o  “el  agua  se  veía  blanca  y  el  gas  percibió  como  “brisa”  o  “gas”,  por  último  el  negro” (Figura IV.5).  21,7% no vio las aspersiones o no supo definir  sus características.    Figura IV.5. Color de las aspersiones    azul   blanca   blanco 1.5% 14.29% blanco y gris   gris 1.5%   6.02% negro   No sabe 6.77%   transparente 51.88% Other otro   13.53%     3.01%         Con  respecto  a  la  constitución  de  las  preocupación  de  que  las  aspersiones  aéreas  aspersiones,  el  45,4%  dijo  que  era  de  tipo  no se hicieron con un solo producto, sino que  aceitoso  y  el  33,3%  de  tipo  líquido.  Todas  se utilizaron diversos químicos en algunas de  estas  variaciones  han  fundamentado  la  las aspersiones (Figura IV.6).      


Figura IV.6. Constitución de las aspersiones    50   %    40   30     45.45% 20

  33.33%   21.21% 10   0   líquido aceitoso No sabe no sabe     Entre las familias que usan pesticidas, el 78%  normalmente  de  los  químicos  en  la  manifestó  que  el  efecto  de  las  aspersiones  agricultura. aéreas  era  muy  diferente  al  uso  que  se  hace    Testimonios de la comunidad  “La diferencia entre uso de pesticidas y fumigaciones es que el ambiente ya quedó de otra  forma, con olor feo y la psicosis”.  “No  uso  agrotóxicos  hace  4  años,  los  doctores  me  prohibieron  cuando  me  enfermé  de  los  pulmones después de las fumigaciones”.    12.3. Comportamiento ante las aspersiones  condiciones  de  la  climatología  las  casas  tienen muchos espacios abiertos. De hecho el    La  falta  de  información  por  parte  de  las  46,88%  de  los  encuestados  dijeron  que  los  autoridades  responsables  de  las  aspersiones  químicos  habían  entrado  en  sus  casas,  aéreas  acerca  de  los  posibles  riesgos  que  la  mientras que un 44,53% dijeron no creer que  mezcla  de  pesticidas  pudiera  ocasionar,  hubieran entrado.  generó  una  actitud  de  inseguridad  en  la    Un  47,7%  manifestó  no  protegerse  de  población.     ninguna  manera  y  seguir  con  sus  actividades  El  84,33%  de  la  población  manifestó  haber  laborales  y  apenas  un  4,6%  sí  adoptó  estado realizando sus labores normales como  reacciones  como  bañarse  enseguida  o  trabajar en la casa, en la finca o lavar la ropa  cubrirse  bajo  un  árbol,  medidas  que  reflejan  en  el  río,  en  el  momento  que  ocurrieron  las  la indefensión de la población ante un evento  del  que  no  fueron  informados  que  se  iba  a  diversas aspersiones aéreas.  presentar (Figura IV.7).    El  ver  las  aspersiones  directamente  generó    que un 37,7% de las familias se encerraran en  En las figuras IV.8 Y IV.9 se puede observar las  sus  casas,  lo  cual  no  es  garantía  de  diversas  reacciones  de  los  encuestados  y  sus  protección,  pues  las  casas  no  están  familias ante las aspersiones.  perfectamente  aisladas  ya  que  por    Testimonios de la comunidad  “Para  protegerse  de  las  fumigaciones  mis  hijos  hicieron  caretas  de  cartón  dejando  huecos  para la nariz y ojos. Para curarles los granos de la piel dejaba a mis hijos enjabonados”.         

46 


Figura IV.7. Protección durante las aspersiones 

47 

                           

dentro de casa no se protegió se bañó enseguida se cubrió bajo un árbol

9.23% 2.31% 37.69%

Other otro 

47.69%

    Figura IV.8. Reacción de los encuestados ante las aspersiones                    otro             Figura IV.9. Reacción de las familias ante las aspersiones                              Las  figuras  IV.7,  IV.8  y  IV.9  muestran  las  reacciones  de  la  población  ante  las  aspersiones  aéreas.  Una  mezcla  entre  el  miedo y la curiosidad hubo en la población y 

otro 

algunos  al  ver  el  despliegue  militar  se  encerraban  en  sus  casas,  mientras  otras  familias  veían  desde  sus  escondites  lo  que  pasaba.


Testimonios de la comunidad  “Durante las fumigaciones nos quedamos en la casa, pero los niños salían a ver y les caía las  aspersiones”. “Los niños se trepaban a los árboles para ver”.    Las  reacciones  al  principio  fueron  de  aspersiones,  incluso  de  creer  que  se  podían  curiosidad  y  de  quitarle  importancia  a  las  beneficiar.   Testimonios de la comunidad  “No nos protegimos porque pensábamos que con el viento se expandiría, además pensamos  que ayudaría a matar monte”.    Pero después las reacciones cambiaron.    Testimonios de la comunidad  ”Al  ver  las  fumigaciones  salimos  corriendo  con  toda  la  comunidad.  La  gente  se  alborotó.  Decían  que  no  podían  pasarse  al  otro  lado  (Colombia).  Se  reunieron  todos  en  la  escuela  y  luego  cada  uno  se  metió  a  su  casa.  Ardía,  quemaba,  teníamos  que  ponernos  trapos  mojados, los niños lloraban y gritaban y los perros aullaban de ardor”. “Las primeras veces  de ver las aspersiones era curiosidad después procedían a taparse y cerrar las ventanas”.  “Al  preguntar  por  las  aspersiones  los  niños  confunden  con  bombardeo.  En  diciembre  del  2002  a  la  noche:  Corrimos  aterrorizados  a  meternos  bajo  la  casa  semidesnudos  porque  estábamos  ya  durmiendo,  pensábamos  que  nos  iban  a  bombardear  y  moriríamos.  Esto  le  traumó a mi hijo”.    Quienes  manifestaron  tener  miedo  dijeron  morir”, pues “había disparos desde el monte,  estar  preocupados  por  un  lado  de  que  en  Colombia,  a  las  avionetas”,  pero  por  otro  “hubiera  guerra”,  “pensando  que  era  lado daba miedo “el veneno” y su acción.  enfrentamiento  armado”  y  que  “iban  a    Testimonios de la comunidad  “Cuando pasaban las avionetas y lanzaban bomba se movía el suelo, se veía candela en el  aire y el ruido era duro”.  “Vimos  las  aspersiones  cuando  estábamos  de  visita  en  Colombia,  desde  los  helicópteros  echaban ráfagas cuando veían alguien que corría”.      13. Efectos  de  las  aspersiones  a  la  afectada de tal manera que ha sido imposible  comunidad  hacerla  producir  como  antes.  Por  lo  que    todavía  están  sufriendo  los  impactos  de  las  13.1. Desarrollo comunitario  mismas.  En  algunas  de  las  comunidades  se    comentó especialmente la agresión contra el  En  todas  las  asambleas  comunitarias  dijeron  agua y cómo hasta la educación fue afectada  que  las  aspersiones  tuvieron  un  efecto  por la falta de maestros, pues no querían ir a  negativo  sobre  el  desarrollo  comunitario  y  la  frontera.  Se  mencionaron  las  pérdidas  de  para  ello  argumentaron  los  impactos  en  la  cosechas del café y de cualquier producto, lo  salud, en la alimentación y las enfermedades  que  impidió  la  comercialización  y  bajó  los  de los niños; todos aquellos casos en los que  ingresos  familiares,  pero  también  la  de  se  necesitaba  gastar  recursos  económicos.  aquellos  cultivos  que  permitían  la  Pero  a  esto  se  añadía  que  los  ingresos  sobrevivencia  familiar,  por  lo  que  ésta  fue  decayeron  porque  las  cosechas  mermaron  gravemente  comprometida.  En  una  de  las  hasta casi acabarse, y después la tierra quedó 

48 


49 

comunidades se mencionó además la pérdida  sufriendo  y  los  impactos  a  sus  cultivos.  Aunque  en  una  de  ellas  se  reconoció  que  lo  de los animales.    que provocaron fue una mayor dispersión de  13.2. Cohesión y desplazamiento  las  familias,  pues  muchas  migraron  aunque    ahora algunas están regresando. De hecho en  En  las  asambleas  comunitarias  la  mayoría  de  nueve  de  las  diez  comunidades  se  habló  de  las comunidades por consenso dijeron que las  un total de cuarenta y nueve familias que se  aspersiones les obligaron a juntarse más para  fueron,  lo  que  equivale  a  un  15,96%  de  denunciar  mejor  los  atropellos  que  estaban  familias desplazadas.    Testimonios de la comunidad  “Sin producción era muy complicada la vida”; “la sobrevivencia estaba comprometida”; “el  Plan Colombia les dejó sin trabajo en sus propias fincas y se fueron decepcionados”.  “Los  cultivos  los  perdimos  totalmente,  no  había  cosecha,  tuvimos  que  salir  al  recinto  Nazareno; luego, a los 5 años, regresamos, seguimos cultivando pero ya no es como antes”.    La dinámica de estas familias que sufrieron el  más grande porque la gente no tenía a donde  desplazamiento  interno  fue  dejar  remontar  ir  y  que  la  falta  de  apoyo  oficial  fue  sus  fincas  con  la  esperanza  de  regresar.  La  desoladora. población manifestó que  la migración  no fue    Testimonios de la comunidad  “Nos hemos sentido desanimados de trabajar por las pérdidas y no se ha tenido donde ir y  no tener apoyos de las autoridades”.  “La  preocupación  fue  porque  perdimos  nuestros  cultivos,  nos  quedamos  sin  trabajo  y  no  teníamos  el  apoyo  del  gobierno  porque  permitía  que  fumiguen  el  Cordón  Fronterizo.  Queremos que el gobierno haga respetar los 10 km de frontera”.    A  la  par  que  un  sector  de  la  población  familias que residen en la actualidad; algunas  ecuatoriana  se  desplazaba  fuera  de  la  zona,  de  estas  familias  fueron  indígenas  paeces  45 familias colombianas se asentaron en este  (Nasa). tiempo,  lo  que  equivale  a  un  14,65%  de  las    Testimonios de la comunidad  “Hace  7  años  vivíamos  a  orillas  del  río,  teníamos  2  hectáreas,  vendimos  después  de  las  fumigaciones porque ya no producía. Donde vivimos ahora ya no cultivan”.  “Hace  1  año  que  vamos  y  venimos  del  Oro.  Aquí  vivimos  22  años  y  aunque  seguimos  pasando  bastante  tiempo  aquí,  decidimos  salir  por  enfermedades  y  pérdida  de  cultivos  y  animales”.    Las respuestas a las muertes de los animales,  para enfrentar el problema. La  única medida  a  las  pérdidas  de  cultivos  y  a  las  colectiva  fue  asociarse  a  la  Federación  de  enfermedades  familiares  fueron  siempre  Organizaciones  Campesinas  del  Cordón  individuales.  Se  buscaron  remedios  con  Fronterizo  (FORCCOFES)  y  poner  una  veterinarios,  se  desmontó  más  finca  o  se  demanda a nivel internacional.  acudieron a los médicos o remedios caseros,    Testimonios de la comunidad  “Estábamos preocupados y sufríamos sin animales ni cultivos y con enfermedades, sin tener  qué comer ni vender. Era un sufrimiento amargo, por eso mucha gente vendió sus fincas”.   


comunidades  la  producción  bajó  de  30  14. Efectos de las aspersiones a los cultivos  quintales  a  menos  de  10  quintales  por    En  las  asambleas  comunitarias  la  población  hectárea. En el cacao se describió que morían  comentó  que  las  aspersiones  sobre  los  las  copas  de  los  árboles,  conduciendo  a  que  cultivos  de  ciclo  corto  ocasionaban  que  la  las  hojas  se  sequen,  se  amarillenten  y  se  planta se secara, marchitara y que los granos  marchiten  hasta  llegar  a  un  aspecto  se  pudrieran  sin  poder  cargar.  Tal  como  ennegrecido.    Del  banano  comentaron  cómo  ocurrió  con  el  arroz  y  el  maíz.  En  el  café  se  la  planta  se  hacía  amarilla  en  sus  hojas  y  morían  los  cogollos  del  árbol  y  amarilleaba  cómo  el  racimo  no  desarrollaba  y  se  hasta que poco a poco caía la pepa, las hojas  ennegrecía por dentro al cortarlo.  y  dejaba  de  dar  fruto.  En  algunas    Testimonios de la comunidad   “Los  plátanos  se  secaron,  las  frutas  se  secaron  y  por  encima  coge  una  cosa  blanca  como  ceniza  y  se  pudren.  Al  tronco  también  le  pega  esa  ceniza  blanca.  Cuando  se  cortan  esos  frutos brinca la ceniza a otra planta y le contagia”.    De las yucas se mencionó que se pudrían, que  frutales  se  mencionó  que  éstos  dejaron  de  por  dentro  ennegrecían  y  mientras  las  hojas  cargar  la  misma  producción  y  que  las  hojas  se  caían  las  raíces  no  desarrollaban  y  caían así como los frutos.  quedaban  como  ‘bejucos’.  De  los  árboles    Testimonios de la comunidad  “Los árboles se marchitaban, se les caían las hojas, en la yuca y en otras plantas quedaban  manchas negras. Después se pudrían, también les daba hongos”.  “Entre  el  2003  y  2004  el  banco  nos  embargó  la  finca  de  50  hectáreas  porque  perdimos  la  producción por fumigaciones y no pagamos el crédito”.    En las encuestas familiares se describió como  familias  manifestaron  que  presentaban  mal  las plantas en el momento de las aspersiones  olor  (2,4%),  se  manchaban  (2,4%)  o  se  percibían  como:  aceitosas  o  pegajosas  negreaban  y  pudrían  (2,4%)  hasta  morir  (22,35%),  amarillentas  (22,35%),  marchitas  y  (7,1%). Un 3,5% manifestó notarlas mojadas y  secas (23,6%), quemadas (8,2%), a las que se  en  un  2,4%  manifestó  no  haber  encontrado  les caían las hojas y los frutos (3,6%). Algunas  nada anormal.    Testimonios de la comunidad   “Las  plantas  se  marchitaron  y  se  amarillaron  en  5  minutos.  Salimos  de  Puerto  Mestanza  porque la tierra quedó estéril”.    Estas plantas días después de las aspersiones:  hojas,  les  salían  manchas,  se  dañaban  o  se  amarilleaban  (11,5%),  caían  las  flores,  los  enduraban (2,1%). En definitiva el 96,32% de  frutos  y  las  hojas  (8,3%),  marchitaban  hasta  las  familias  manifestaron  encontrar  tras  las  secarse  (28,1%)  y  morían  (19,4%).  Algunas  aspersiones cambios en el color, apariencia o  familias  dijeron  que  más  que  secarse,  se  sabor de las plantas.  pudrían  (10,6%)  y  negreaban  (4%)  como    quemadas (5,7%), otras mencionaban que las  En  un  rango  entre  un  lote  y  casi  cincuenta  plantas como que se debilitaban y se llenaban  hectáreas,  los  encuestados  manifestaron  de  pestes  u  hongos  (2,6%),  que  dejaban  de  haber visto como se dañaron 1141 hectáreas  crecer  (1,7%),  se  volvían  estériles  y  dejaban  de  las  2500  que  poseían,  lo  que  significa  un  de  tener  granos  (5,7%)  o  que  se  rompían  las  45,6% de sus fincas.   

50 


Testimonios de la comunidad  “Tuvimos  que  pedir  semillas  regaladas  a  otros  recintos  por  la  muerte  de  plantas  con  las  fumigaciones”. 

51 

    15. Efectos de las aspersiones a los animales  mientras    que  los  adultos  morían  a  los  7‐10  días  de  las  aspersiones.  En  una  de  las    El  37,98%  de  las  familias  encuestadas  comunidades  3  familias  refirieron  haber  manifestaron  haber  encontrado  peces  perdido  270  gallinas,  al  parecer  por  el  agua  muertos  en  los  ríos  y  esteros,  el  59,69%  no  contaminada  que  tomaron.  A  los  perros  y  observó  peces  muertos  y  el  2,33%  no  supo  gatos  se  les  caía  el  pelaje  y  presentaban  responder.  De  la  población  encuestada,  el  heridas en la piel.  Este síntoma sucedió en 6  19,6%  manifestó  tener  piscinas  de  peces  en  de las 10 comunidades estudiadas.  donde llegaron a perder un promedio de 467    Los  productos  de  los  animales  peces por familia.  presumiblemente  afectados  por  las    Con respecto a las vacas, se manifestó en las  aspersiones  aéreas  fueron  ingeridos  por  la  asambleas  comunitarias  que  después  de  las  misma  comunidad  debido  a  que  asumieron  aspersiones  aéreas  ellas  abortaron  en  5  que nadie iba a reponer los daños.  comunidades;  las  vacas  tiernas  dejaron  de    lactar,  enflaquecieron  y  murieron,  mientras  Lo que las encuestas permitieron descubrir es  que  las  vacas  adultas  se  hincharon,  tuvieron  que  el  30,88%  de  las  vacas,  el  35%  de  los  diarreas,  temblaban  y  algunas  morían.  En  la  caballos, el 33,3% de las gallinas y el 33,8% de  comunidad  Corazón  Orense  se  habló  de  la  los  chanchos  murieron  en  el  año  2002.  Le  muerte de más de 13 vacas.  siguen  en  importancia  por  pérdidas  los  años    2003 y 2001 (Figura IV.10).  Sobre  los  chanchos  se  mencionó  que  los  tiernos morían a los 2 días de las aspersiones,    Figura IV.10. Porcentaje de pérdida de vacas por año                 

2000 2001

2.94%

2002 2003

8.82%

2004

10.29%

    16.18%             16. Efectos de las aspersiones al agua    El 68,9% de las familias encuestadas observó  como  el  agua  se  alteró  después  de  las  aspersiones aéreas, mientras que el 31,1% no 

2005 30.88%

2006 2007 2008

encontró  cambio.  Entre  los  individuos  que  vieron  algún  tipo  de  alteración  del  agua,  el  58,5%  vio  al  agua  aceitosa  o  con  nata,  el  29,25% vio que el agua cambió de tonalidad y  el 13,2% notó mal olor o sabor (Figura IV.11).


Figura IV.11. Aspectos del agua dañada     

amarillenta

9.43%

             

aceitosa mal olor

1.89% 36.79% 16.98%

mal sabor murieron animales natosa

6.6% 8.49%

6.6%

no sabe  No sabe oscura sucia verde otro  Other

Links web  www.utpl.edu.ec/eva/descargas/material/192/G3410093.pdf  www.mamacoca.org/.../InformeComisionEcuatorianaaspersionaerea_julio_2007.pdf                                      

52 


FOTOGRAFÍA Insectos

53

Mantis religiosa Parque Nacional Yasuní Provincias de Napo, Pastaza y Orellana

Familia Gryllidae Reserva Faunística Cuyabeno Provincias de Sucumbíos y Orellana


54

Paraponera clavata Hormiga conga siendo atacada por hormigas de cola roja Parque Nacional YasunĂ­

Hormiga cortadora del gĂŠnero Atta Lleva flores y hojas


55

Tela de araña en forma de red Parque Nacional Yasuní

Tela de araña elaborada por arañas sociables Parque Nacional Yasuní


56

Mantis religiosa Vista frontal Parque Nacional YasunĂ­


PARTE V    BIOMONITOREO EN LA PROVINCIA DE SUCUMBÍOS    17. Área de estudio    La Provincia de Sucumbíos se encuentra en la  Región  Amazónica,  al  noroeste  del  Ecuador.  Esta provincia fue creada el 13 de febrero de  1989 debido a la necesidad del Gobierno del  Ecuador de mejorar el sistema administrativo  y  económico  tanto  de  la  provincia  como  del  país.  Dentro  de  los  objetivos  más  relevantes  planteados  para  la  creación  de  Sucumbíos  estuvieron: a) aprovechar la inmensa riqueza  petrolera  y  minera;  b)  controlar  con  mayor  eficacia  la  presión  poblacional  y    c)  las  imperiosas  necesidades  básicas  de  la  población.     El  reordenamiento  jurisdiccional  de  la  Provincia  de  Sucumbíos  permitió  la  conformación  de  siete  cantones:  Lago  Agrio,  Cuyabeno,  Shushufindi,  Sucumbíos,  Putumayo, Gonzalo Pizarro y Cascales.    17.1. Comunidades    El  análisis  socio‐económico,  genético  y  de  salud  se  realizó  en  diez  comunidades  ubicadas  en  el  límite  fronterizo  de  Ecuador  con  Colombia,  en  la  Provincia  de  Sucumbíos.  Las comunidades estudiadas fueron Chone 2,  Yanamarum,  Playera  Oriental,  Fuerzas  Unidas,  Puerto  Escondido,  Corazón  Orense,  Santa Marianita, San Francisco, Las Salinas y 5  de Agosto (Figura V.1).     Estas  comunidades  se  encuentran  a  menos  de 2 Kms del río San Miguel. Según los datos  poblacionales,  existen  307  familias  censadas,  1450  habitantes  y  fueron  seleccionadas  en  función  de  haber  denunciado  previamente  sufrir de impactos por las aspersiones aéreas  del  Plan  Colombia,  de  estar  lo  más  cerca  posible de la frontera y de haberse realizado  estudios previos en ellas.      Dentro  de  las  diez  comunidades  seleccionadas  por  su  cercanía  a  la  frontera  con Colombia y por haber sido afectadas con       

las  aspersiones  aéreas  con  glifosato  desde  el  inicio  del  Plan  Colombia,  se  seleccionaron  zonas específicas dentro de escuelas, centros  de  salud  y  áreas  de  reunión  para  realizar  las  respectivas  entrevistas,  chequeos  médicos  y  tomas de muestra de sangre periférica.     Uno  de  los  factores  de  interés  es  que  estas  comunidades  han  sido  previamente  evaluadas  de  tal  forma  que  los  resultados  médicos  y  genéticos  han  podido  ser  comparados  con  el  fin  de  conocer  las  condiciones  generales  de  salud  de  las  personas.  En  cada  uno  de  los  puntos  de  muestreo  se  recopilaron  datos  como  coordenadas UTM y altitud (Tabla V.1).    El análisis ambiental se realizó en diez y ocho  localidades  ubicadas  en  el  Río  San  Miguel  y  Putumayo  del  cordón  fronterizo  con  Colombia,  pertenecientes  a  los  cantones  Cascales,  Lago  Agrio  y  Putumayo  de  la  Provincia  de  Sucumbíos,  con  una  extensión  recorrida de 764 Km2. Las trayectorias del Río  San Miguel comprenden las coordenadas 00°  23´ 17´´ N 77° 10´ 60´´ O y 00° 07´ 54´´ N 76°  04´  05´´  O,  y  del  Río  Putumayo  ubicadas  en  00° 02´ 56´´ N 76° 24´ 00´´ O y 00° 07´ 27´´ N  75° 51´ 98´´ O.     La  selección  de  la  zona  de  intervención  se  realizó  aplicando  un  análisis  estadístico  por  estratificación,  considerando  a  comunidades  afectadas  por  exposición  aérea  al  glifosato,  durante  el  período  del  2000  al  2007,  en  un  rango mínimo de 150 m y máximo de 24 Kms  desde la frontera.     La planificación de la fase de campo consistió  en  cuatro  zonas  de  estudio,  en  las  cuales  se  consideraron  aspectos  físicos,  climatografía,  fisiología,  geología,  demografía,  ubicación  geográfica,  condiciones  sanitarias‐ ambientales,  interés  de  la  comunidad  y  participación  de  promotores  de  salud  comunitarios.

56 


Tabla V.1. Coordenadas UTM y altitud de comunidades fronterizas visitadas 

  Provincia  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos  Sucumbíos 

57 

Comunidades Chone 2  Yanamarum  Playera Oriental Fuerzas Unidas Puerto Escondido Corazón Orense Santa Marianita San Francisco Las Salinas  5 de Agosto 

Símbolo CH2 YAN PLO FUN PTE COR SMA SF2 SAL 5AG

Coordenadas UTM  18 N 331387 25220 18 N 342418 26190 18 N 342418 26190 18 N 319301 28533 18 N 304907 27303 18 N 305456 25473 18 N 298861 25797 18 N 286061 25056 18 N 281286 29627 18 N 301318 25497

Altura (msnm*) 295  253  252  254  305  275  284  293  307  478 

*msnm = metros sobre el nivel del mar                                                                      

Figura V.1. Comunidades sometidas a análisis sociales, genéticos y de salud en Sucumbíos 

  18. Origen y datos de la población     De  un  total  de  307  familias  censadas,  se  hicieron encuestas a 144 familias (46.9%) que  engloban  a  un  conjunto  de  771  personas  (53.17%).  De  estas  familias,  los  chequeos   

  médicos se realizaron a 521 personas (lo que  equivale al 35.93% de las personas que viven  en  las  comunidades  y  al  67.6%  de  las  771  personas que componen esas familias) (Tabla  V.2).


Tabla V.2. Datos de familias estudiadas por comunidad    Comunidades  (Com.)  Chone 2  Yanamarum  Playera Oriental  Fuerzas Unidas  Puerto Escondido  Corazón Orense  5 de Agosto  Santa Marianita  San Francisco  Las Salinas  Total 

Familias  censadas  26 13 17 30 18 40 28 60 22 53 307

Familias  estudiadas  15  9  9  16  14  18  12  20  13  16  144 

%  Familias  57,7 69,2 64,7 53,3 77,8 45 42,8 33,3 59,1 30,18 46,9

% Total

Habitantes

Chequeos 

10,4 6,3 7,6 11,1 9,7 12,5 8,3 13,9 9,0 11,1 100

130 65 86 119 120 200 140 300 110 180 1450

41 48 46 73 44 46 43 62 67 51 521

%   Com.  31,53  73,84  53,49  61,34  36,67  23  30,71  20,67  60,9  28,33  35,93 

%  Total  7,87 9,21 8,83 14 8,44 8,83 8,25 11,9 12,8 9,79 100

  18.1. Indicadores  socio‐económicos  y  de  salud    Se  realizaron  entrevistas  familiares  a  uno  o  dos  jefes  de  familia.  Esta  información  sirvió  como  indicador  socio‐económico  y  de  salud  de  las  comunidades  estudiadas.  Se  aplicaron  cuatro  tipos  de  historias:  1)  historia  comunitaria,  2)  historia  familiar,  3)  historia  clínica  personal  y  4)  historia  clínica  dermatológica.    La  historia  comunitaria  consistió  en  obtener  información  sobre  la  ubicación  de  la  comunidad;  las  características  de  la  comunidad como: el grupo étnico, su tiempo  de creación, la procedencia de la población y  la  presencia  de  actividad  petrolera;  la  cohesión comunitaria; la información sobre el  desplazamiento,  pérdida  de  territorio  y  sus  consecuencias;  la  salud  como:  los  tipos  de  enfermedades  adquiridas  por  personas,  animales y plantas; los niveles de violencia o  protección  por  parte  de  los  grupos  militares;  el  apoyo  del  gobierno  como:  atención  de  centros  de  salud,  servicio  eléctrico,  escuelas  fiscales y lavandería comunitaria (Anexo 1).     En  la  historia  familiar  se  obtuvieron  datos  como  la  identificación  familiar;  las  condiciones  de  la  vivienda  como:  el  material  de  construcción  de  las  casas,  el  número  de  dormitorios,  camas,  tomas  de  corriente  de  cada  vivienda,  el  tratamiento  que  se  realizó  con  las  heces  y  la  basura;  en  cuanto  a  la  ocupación y exposición se conoció el número  de hectáreas por finca, el tipo de cultivo y el  uso de agrotóxicos; en cuanto a situación de 

salud  se  conoció  el  número  y  la  causa  de  familiares  fallecidos,  el  número  de  abortos  e  hijos  nacidos  con  malformaciones  y  el  número  de  niños  fallecidos  tras  las  aspersiones  con  glifosato;  en  cuanto  a  los  antecedentes  de  aspersiones  aéreas  se  recopilaron  evidencias  sobre  el  tiempo  de  duración,  la  distancia  a  la  que  pasaron  las  avionetas de las viviendas, los estragos físicos  y  psicológicos  durante  y  después  de  las  aspersiones,  los  daños  producidos  en  la  tierra,  en  la  vegetación,  en  el  agua  de  consumo, en el aire y el número de animales  de granja perdidos producto del contacto con  el glifosato (Anexo 2).     En la historia clínica personal se evaluaron los  problemas  a  nivel  de  órganos  y  aparatos.  Se  obtuvo  información  sobre  problemas  digestivos,  de  ojos,  oídos,  piel,  pelo,  riñon  y  vías  urinarias,  nariz  o  garganta,  uñas  y  ganglios,    dientes,  problemas  respiratorios,  cardiacos,  de  huesos  y  articulaciones,  de  la  sangre,  del  sistema  endócrino,  de  genitales  y/o  mamarios  y  problemas  del  sistema  nervioso  central.  En  cuanto  a  los  antecedentes  de  interés,  se  consultó  sobre  intoxicaciones,  infecciones,  medicamentos  ingeridos y hábitos de fumar o beber alcohol  (Anexo 3).       La  historia  clínica  dermatológica  permitió  evaluar las alteraciones y problemas de la piel  de  la  población.  En  esta  encuesta  se  obtuvo  información  sobre  presencia  de  inflamación  dérmica,  epidérmica,  presencia  de  necrosis,  color  de  piel,  presencia  de  tumores,  alteración de pelo y uñas (Anexo 4).  

58 


Ecuador.  La  población  estudiada  provino  de  18.2. Procedencia  17  provincias  ecuatorianas  con  excepción  de    El  53,4%  de  la  población  nació  en  las  Morona Santiago, Azuay, Cañar, Tungurahua,  provincias  orientales,  el  19,8%  procede  de  la  Cotopaxi,  Santa  Elena  y  Galápagos.  La  sierra, el 16,1% es de origen colombiano y el  distribución de las provincias se la detalla en  10,7%  procede  de  las  regiones  costeras  del  la siguiente tabla:    Tabla V.3. Origen por provincia de la población estudiada    Oriente 

59 

Sierra  Costa 

Sucumbíos  48,74%  Loja  10,7%  Sto. Domingo 3,69% 

Napo  1,94%  Bolívar  4,08%  Manabí  2,91% 

Orígenes por provincia Orellana Pastaza 1,36% 0,77% Carchi Chimborazo 3,49% 0,97% Esmeraldas El Oro 1,94% 1,16%

Zamora 0,58% Imbabura 0,38% Los Ríos 0,58%

‐  ‐  Pichincha  0,2%  Guayas  0,38 

TOTAL 53,4% 19,8% 10,7%

                 

Porcentaje

  El 54% de las personas nacidas en Sucumbíos  intradomiciliarios. De las familias encuestadas  lo  había  hecho  en  las  mismas  comunidades  cuyo  lugar  de  procedencia  es  Sucumbíos,  el  estudiadas,  con  diferencias  importantes  25%  ha  vivido  siempre  en  la  comunidad  como se puede observar en la figura V.2.  visitada.  El  29,6%  de  quienes  llegaron  desde  Estos datos muestran las comunidades donde  Sucumbíos  a  las  zonas  fronterizas  viven  más  hay  una  mayor  atención  a  partos  de 20 años.     Figura V.2. Porcentaje de nacimientos en las comunidades estudiadas  70 60 50 40 30 20 10 0

59.7 50.0 35.3 25.0

20.8 2.4

13.0

11.0

18.6 16.1

CH2 YAN PLO FUN PTE COR 5AG SMA SF2 SAL

es  población  negra.  Además  en  estas  18.3. Origen étnico  comunidades  se  destaca  la  presencia  en  un    Con respecto al origen étnico de la población  14,1%  de  población  de  origen  Nasa  se  encontró  que  el  83%  de  la  población  es  (procedencia colombiana), frente al 85,9% de  mestiza, el 15% es de origen indígena y un 2%  origen Kichwa (Figura V.3).     Figura V.3. Porcentaje del origen étnico de la población de estudio 

                   

2% 15% 83%

Mestizo

Indígena

Afro


Edad

18.4. Tiempo de residencia    Con  respecto  a  las  comunidades  estudiadas,  el  13%  refirió  residencias  superiores  a  los  20  años,  el  27%  manifestó  residir  entre  11  a  20  años, siendo el grupo más numeroso (60%) el  que  tiene  un  tiempo  de  residencia  inferior  a  los  10  años  en  las  comunidades  de  Sucumbíos.  La  movilidad  de  este  último  grupo  es  de  destacar  debido  a  que  coincide  con las aspersiones aéreas y si se toma el 60%  como universo se encuentra que cerca de las  tres  cuartas  partes  (74,2%)  de  la  población  que  vive  en  la  frontera  hace  menos  de  una  década  proviene  de  Colombia,  lo  que  hace  pensar  que  el  motivo  ha  sido  la  política  de  fumigaciones en la frontera, que inició con el  Plan Colombia en el año 2000. Con relación a 

     

75y+ 70a74 65a69 60a64 55a59 50a54 45a49 40a44 35a39 30a34 25a29 20a24 15a19 10a14 5a9 0-4 -60

los  últimos  5  años  el  51,6%  de  las  familias  asentadas  son  de  origen  colombiano,  y  el  12,5%  de  las  familias  llegaron  a  la  zona  fronteriza ecuatoriana después de las últimas  aspersiones aéreas, es decir hace 2 años.    

  18.5. Sexo y edad    En cuanto al género, el 47,8% de las personas  chequeadas  fueron  hombres  frente  al  52,2%  que fueron mujeres.    Según la figura V.4, el corte de la pirámide se  corresponde con una “pirámide de población  joven”  caracterizada  según  el  INEC  por  una  alta  fecundidad  e  incluso  alta  mortalidad  (INEC, 2001). 

Figura V.4. Pirámide poblacional  PIRÁMIDE POBLACIONAL   2   32 0 1 7   7 11 9   7 8 10 13 14   6 10   21 15 21 8  14 12 22  5 20 11   38 46   50 34 -40

-20 Hombres

  Más del 40% de la población es menor de 15  años y menos del 4% es mayor a los 65 años.  En  este  estudio  el  49,13%  de  la  población  encuestada  es  menor  de  15  años  y  el  1,34%  es  mayor  a  los  65  años.  En  figura  V.4  se  destaca una brecha muy importante entre el  grupo poblacional de 10 a 14 años y el de 15  a 19 años, justo el período en que se termina  la escuela. Una explicación importante podría  ser  que  los  jóvenes  acuden  a  colegios  presenciales  en  otras  comunidades  o  que  precisamente  los  estudios  se  realizaron  en  fines  de  semana,  donde  los  jóvenes  participan  en  clases  presenciales.  Sin  embargo  la  continuidad  de  las  ausencias,  especialmente  en  los  jóvenes  varones,  hace 

0 Mujeres

20

40

42 46 60

pensar  que  puede  tratarse  de  procesos  migratorios.    18.6. Nivel educativo    En  las  comunidades  estudiadas  se  encontró  un  nivel  de  analfabetismo  de  un  10,2%,  siendo  este  más  importante  en  los  hombres  (13,2%)  que  en  las  mujeres  (7,7%).  Estos  datos coinciden con otros estudios en donde  se  reportan  datos  de  analfabetismo  en  individuos  mayores  de  18  años  de  un  10,2%  (Maldonado, et al., 2008). Son las mujeres las  que  tienen  además  un  mayor  porcentaje  de  educación  secundaria  completa  (7,7%)  a  diferencia de los hombres (4,7%) (Figura V.5). 

60 


Figura V.5. Nivel educativo de hombres y mujeres 

61 

Porcentaje

                       

g

45 40 35 30 25 20 15 10 5 0

39.6 38.1 36.9

33.8 33.1 32.1 13.2

13.6

14.2

10.2

7.7

13.1

7.7

0.9

Sin

PI PC Hombres

  19. Condiciones de vida 

SI Mujeres

4.7

SC TOT

0.4

0.8 0.0 Sup

de  la  finca  es  1  Km  y  150  metros.  El  grupo  entrevistado  por  familias  está  distribuido  en  un  rango  de  distancia  desde  menos  de  100  metros  hasta  más  de  4  Km.  Existe  un  grupo  de  encuestados  que  tienen  sus  propiedades  entre 100 y 400 m de la frontera y otros entre  1  y  4  Km.  Los  resultados  del  estudio  promedian  las  situaciones  e  impactos  que  sucedieron  en  primera  línea  desde  el  río  hasta  lugares  más  retirados  (Figura  V.6).

  Es importante conocer las condiciones de  vida de las comunidades para evaluar los  niveles socioeconómicos.    19.1. Distancia a la frontera     La  distancia  promedio  que  hay  entre  la  frontera y las casas es de 1 Km y 250 metros  de largo, mientras que la distancia promedio 

Figura V.6. Distancia de fincas (izq) y de casas (der) a la frontera   

             

 

menos de 100 Km. 5.15%

16.18%

100-399 Km. 400-699 Km.

400-699 Km.

23.53%

10.29%

menos de 100 Km.

100-399 Km.

25.74%

17.65%

 

700-999 Km.

5.52%

24.83%

26.9%

10001999 Km. 20003999 Km. más de 4000

    19.2.  Materiales de las casas y testimonios  de condiciones de vida    La mayoría de las viviendas construidas en las  comunidades  estudiadas  se  encuentran  hechas  con  techo  de  zinc,  paredes  y  piso  de  madera  y  elevadas  en  su  mayoría  sobre  pilares. 

1000-1999 Km.

10.34%

2000-3999 Km. más de 4000 Other

   

16.55%

11.03%

  En  algunas  de  las  encuestas  familiares  se  evidenciaron  condiciones  de  la  vivienda  muy  difíciles  con  testimonios  de  familias  colombianas  que  evidenciaron  las  duras  condiciones  de  vida  que  han  tenido  que  soportar  desde  que  llegaron  a  territorio  ecuatoriano.  


Según  sus  propias  versiones,  estas  personas  están  dispuestas  a  pasar  malas  condiciones 

de  vida  antes  de  regresar  a  la  situación  que  viven en Colombia: 

  Testimonios de la comunidad “Uno en los campos no espera nada bueno, mucha violencia nos tiene aterrados. Nos acabamos de  pasar a Ecuador hace tres días; estamos viviendo todos en una carpa. Vinimos por la violencia y falta  de trabajo en nuestro país (Colombia)”.   “Somos  colombianos  y  vivimos  hace  8  años  en  Ecuador.  Vivimos  6  meses  en  una  casa  de  plástico  hasta que se dañó y pedimos posada a un señor que se fue a Santo Domingo”.   “Llegamos a Ecuador hace 2 meses y desde allí estamos viviendo en la casa comunitaria”. 

  19.3. Dormitorios por vivienda    Las  encuestas  realizadas  destacan  que  el  promedio  de  personas  viviendo  bajo  un  mismo  techo  es  de  5,3,  con  una  media  de  dormitorios  por  hogar  de  2,6.  El  índice  de  hacinamiento  calculado  corresponde  a  2,04  personas  por  dormitorio,  lo  que  se  clasifica  como “sin hacinamiento”.  

19.4.  Ventanas y toldillos    El  74%  de  las  familias  carece  de  una  ventilación adecuada en casa al no contar con  ventanas  amplias.  Además,  la  exposición  a  vectores  de  enfermedades  tropicales  aumenta para el 43% de la población que no  utiliza toldo en sus camas (Figura V.7). 

Figura V.7. Porcentaje de ventanas (izq) y toldillos en las viviendas (der)                   

Si

Si

No

No

26.06% 43.26% 56.74%

73.94%

  restos de comida a los animales. En el caso de  19.5. Manejo de basura  la  basura  enterrada  los  depósitos  se    En cuanto a la basura no orgánica, el 40% de  encuentran  a  una  distancia  media  de  37  la población la quema, el 36,7% la entierra y  metros  de  las  casas,  aunque  el  rango  oscila  el  23%  la  bota.  El  98%  de  las  familias  da  los  entre  1  y  300  metros  (Figura  V.8).    Figura V.8. Manejo de restos de comida (izq) y basura no orgánica (der)  da a los animales

 

2.11%

             

   

entierra

50 40

% 97.89%

30 20

36.75%

40.36% 22.89%

10 0

   

entierra

quema

bota

62 


19.6. Fuentes de agua para el consumo    Las  principales  fuentes  de  agua  para  el  consumo humano son pozos en un 25%, y la  lluvia  en  el  21,5%.  El  río  sigue  siendo  una  importante  fuente  para  la  población.  Todas  estas  fuentes  de  agua  de  consumo,  excepto  pozos  tapados,  agua  entubada  (10%)  o  potable  (4,2%),  están  expuestas  a  cualquier 

agente contaminante del ambiente, razón por  la  cual  las  aspersiones  aéreas  tuvieron  impacto directo en la salud de los pobladores  (Figura V.9).    Las  personas  que  ingirieron  agua  contaminada  con  glifosato  declararon  que  sintieron  efectos  nocivos  inmediatos  en  su  salud:

  Testimonios de la comunidad “Estaba  aserrando  y  como  me  dio  sed  entonces  tomé  agua  de  un  estero  y  no  pensé  que  estaba  contaminado y enseguida se me durmió el cuerpo y sentí desmayo y mareo y no veía bien. Al mes me  empecé a hinchar”.  

63 

  Figura V.9. Fuentes para recolección de agua  entubada   pozo   vertiente   10.07% estero 10.79%   lluvia   río 25.18%   potable 21.58%       12.95% 15.11%       19.7. Manejo de heces  quien  posee  250  hectáreas.  Las  familias    ocupan  por  término  medio  la  mitad  de  sus  El  38,4%  de  la  población  cuenta  con  terrenos  para  cultivar.  El  4,4  %  de  los  instalaciones  de  servicio  higiénico  o  letrinas  encuestados no cultiva, mientras que el 2,5%  para  el  depósito  de  heces,  mientras  que  el  no  tiene  finca.  Para  el  análisis  de  los  61,4%  de  la  población  lo  hace  en  campo  productos que más se cultivan en la zona, se  abierto.  La  distancia  de  la  casa  hasta  el  excluyó  a  este  6,9%.  Cacao,  potrero,  café  y  depósito  de  heces  es  de  50  metros  en  cultivos  de  ciclo  corto  son  los  principales  productos  cultivados  en  la  zona.  A  estos  promedio.   cultivos  principales  se  les  destina  un    promedio de 4 Ha, es decir el 37% de las Ha  19.8. Posesión y uso de la tierra    cultivadas.  Como  cultivos  secundarios  se  Apenas  un  30,29%  de  las  familias  de  los  mencionaron  entre  los  principales  al  cacao,  sectores  estudiados  tienen  título  de  café y plátano. El café es el producto que más  propiedad  de  las  tierras.  La  mayoría  (69,7%)  familias  cultivan  después  del  cacao,  aunque  son  posesionarios.  Las  familias  tienen  una  en extensión ha sido desplazado por  cacao y  media  de  21,3  hectáreas  (Ha)  de  finca,  pasto. Entre los cultivos de ciclo corto el más  aunque el rango de  distribución de la  misma  referido fue el maíz.  pasa por entre el que ocupa apenas un solar y    Links web  www.sucumbios.gov.ec 

 


FOTOGRAFÍA Comunidades fronterizas I

65

Proceso de extracción del jugo de caña de azúcar

Estructura artesanal para la elaboración y concentración Aceite de caña


66

Cocina de le単a para el procesamiento de la ca単a

Punteo y batida manual del producto de la ca単a


67

Panela Proceso de moldeo y enfriamiento

Jugo de caĂąa de azĂşcar


68

Estructura para cocinar con le帽a Exposici贸n directa al ambiente

Tanques para almacenamiento de agua lluvia Agua utilizada para cocinar y beber


69

Comunidad La Ceiba Provincia de Sucumbíos

Taller de capacitación La Ceiba Provincia de Sucumbíos


70

Río San Miguel Frontera Ecuador – Colombia

Sansahuari Provincia de Sucumbíos


PARTE VI   DIAGNÓSTICO GENÉTICO     20. Muestras biológicas    Para  realizar  el  análisis  de  aberraciones  cromosómicas  y  el  cálculo  de  frecuencias  de  los  genes  de  detoxificación  GPX‐1,  GSTP1  y  del  gen  de  reparación  XRCC1,  se  procedió  a  extraer sangre periférica a través de punción  venosa, utilizando vacutainers con heparina y  EDTA  (ácido  etilendiamintetracético)  como  anticoagulantes, de 92 individuos expuestos a  las  aspersiones  aéreas  con  glifosato.  Como  individuos  control  se  analizaron  90  muestras  del  banco  de  ADN  del  Instituto  de  Investigaciones  Biomédicas;  estos  individuos  no presentaron antecedentes de tabaquismo,  alcoholismo,  enfermedades  como  cáncer  ni  exposición  a  agentes  carcinogénicos  como  pesticidas.  Cada  uno  de  los  individuos  analizados  llenó  una  encuesta  biomédica  y  firmó  el  respectivo  consentimiento  informado.       21. Técnicas de Biología Molecular    21.1. Extracción del ADN    Se realizó la extracción del ADN a partir de las  muestras  de  sangre  periférica  de  los  individuos  en  estudio.  El  proceso  de  extracción  del  ADN  se  lo  realizó  mediante  el  kit  PurelinkTM  Genomic  DNA  InvitrogenTM,  y  varios  pasos  se  los  estandarizó  en  el  laboratorio  para  obtener  un  ADN  bien  concentrado y libre de contaminantes.    Los pasos para la extracción del ADN son los  siguientes:     ∙ Se prepara un baño María a 55° C.  ∙ En un tubo eppendorf estéril de 1,5 mL se  añade  200  µL  de  muestra  de  sangre  periférica  y  400  µL  de  suero  fisiológico  para lavar la muestra y eliminar la mayor  cantidad  de  proteínas  y  enzimas  que  puedan inhibir la PCR.  ∙ La  muestra  se  mezcla  en  un  vortex  y  se  centrifuga  durante  1  minuto  a  5,000  gravedades (g). 

∙ ∙

∙ ∙

∙ ∙

∙ ∙ ∙

 

Se descarta el sobrenadante y se procede  a  realizar  el  lavado  hasta  que  el  sobrenadante quede transparente.  A la muestra de sangre lavada se le añade  20  µL  de  proteinasa  K  para  degradar  las  proteínas, 20 µL de RNasa para degradar  las  cadenas  de  ARN.  Se  mezcla  en  el  vortex  y  se  incuba  durante  2  minutos  a  temperatura ambiente (TA).        Se  añade  200  µL  de  Genomic  Lysis/Binding Buffer (buffer de ligación) y  se mezcla bien para obtener una solución  homogénea.   Se  incuba  la  muestra  a  55°  C  por  10  minutos  para  promover  la  digestión  de  proteínas.   Se añade 200 µL de etanol absoluto 95%  al  lisado.  Se  mezcla  bien  con  vortex  durante  5  segundos  para  obtener  una  muestra homogénea.   Se  prepara  las  columnas  sobre  tubos  colectores.  Se  añade  los  640  µL  de  lisado  a  la  columna con membrana. Se centrifuga la  columna  a  10,000  g  durante  1  minuto  a  TA.  Se descarta el tubo colector y se coloca la  columna en un tubo colector nuevo.  Se añade en la columna 500 µL de Wash  Buffer  1  (buffer  de  lavado)  preparado  previamente  con  etanol.  Se  centrifuga  la  columna a 10,000 g durante 1 minuto.  Se descarta el tubo colector y se coloca la  columna en un tubo colector nuevo.  Se añade en la columna 500 µL de Wash  Buffer  2.  Se  centrifuga  la  columna  a  máxima  velocidad,  durante  3  minutos,  a  TA. Se descarta el tubo colector.  Se  coloca  la  columna  en  un  tubo  eppendorf estéril de 1,5 mL.  Se añade 50 µL de Genomic Elution Buffer  (buffer de elusión) en la columna.   Se  incuba  la  muestra  a  TA  durante  1  minuto.  Se  centrifuga  la  columna  a  máxima velocidad durante 1 minuto a TA.  Se  hacen  alícuotas  de  trabajo  del  ADN  y  se procede a guardar a ‐20° C.      

70 


71 

21.2. Reacción en cadena de la polimerasa    La  reacción  en  cadena  de  la  polimerasa,  también conocida como PCR por sus siglas en  inglés  (Polymerase  Chain  Reaction),  es  una  técnica  de  Biología  Molecular  descrita  en  1986 por Kary Mullis (Bartlet & Stirling, 2003).  Está  técnica  es  ampliamente  utilizada  por  investigadores alrededor del mundo debido a  su alta fiabilidad.     La reacción PCR es una forma de clonación in  vitro  que  es  utilizada  en  la  amplificación  de  pequeñas cantidades de ADN. Depende de la  enzima  ADN  polimerasa  de  una  bacteria  termófila (Termophilus acuaticus) que resiste  temperaturas  de  95°  C  y  tiene  una  temperatura  óptima  de  crecimiento  a  72°  C.  Las  ADN  polimerasas  solo  pueden  sintetizar  nuevo ADN por extensión del extremo 3´ libre  de  un  preexistente  primer  o  cebador.  Se  aprovecha  esta  característica  para  amplificar  de  modo  específico  una  región  entre  dos  sitios  determinados  por  los  primers.  En  cada  ciclo  el  ADN  molde  se  desnaturaliza  por  calentamiento  a  95°  C,  fijando  los  cebadores  a  una  temperatura  óptima  estandarizada  en  el laboratorio e incubando a 72° C para que la  polimerasa alargue la cadena de ADN. Al cabo  de  varios  ciclos  se  obtienen  varias  copias  de  ADN molde. La reacción se lleva a cabo en un  termociclador (Sudbery, 2004).      El  ADN  genómico  obtenido  a  partir  de  las  muestras  de  sangre  periférica  de  individuos  expuestos  a  glifosato  sirve  como  templado  para realizar la amplificación de los genes de  detoxificación  GPX‐1,  GSTP1  y  el  gen  de  reparación  XRCC1,  y  así  poder  determinar  el  genotipo  y  presencia  de  los  polimorfismos  Pro198Leu,  Ile105Val  y  Arg399Gln,  respectivamente.     21.3. Fragmentos  de restricción de longitud  polimórfica     La  primera  generación  de  marcadores  moleculares  de  ADN  fueron  los  fragmentos  de restricción de longitud polimórfica (RFLPs).  La técnica PCR‐RFLP es un marcador genético  bi‐alélico  que  se  basa  en  la  presencia  o  ausencia  de  una  secuencia;  generalmente 

estos  marcadores  moleculares  son  utilizados  a partir de la amplificación de las muestras de  ADN mediante PCR.     El producto de PCR es incubado con la enzima  de  restricción  específica  y  luego  es  analizada  para observar si el fragmento de ADN ha sido  cortado (Strchan & Read, 1999). Dentro de la  semejanza entre los individuos de una misma  especie, existen variaciones individuales en la  secuencia  de  la  información  genética.  Los  polimorfismos  consisten  en  variaciones  en  la  secuencia del ADN.    Las  enzimas  de  restricción  ponen  de  manifiesto  la  presencia  o  ausencia  de  los  polimorfismos  de  nucleótido  simple  (SNPs),  ya  que  un  cambio  en  la  secuencia  del  ADN  puede  crear  o  destruir  un  lugar  de  corte,  dando  lugar  a  un  fragmento  (ausencia  del  lugar de corte) o a dos fragmentos (presencia  del lugar de corte). A los RFLPs se los analiza  sobre  el  amplicón  obtenido  a  través  de  la  PCR, de ahí el nombre de la técnica PCR‐RFLP  (Pan, 2005; Riely, 2006).      22. Gen GPX‐1    La experiencia en el estudio de polimorfismos  en  población  ecuatoriana  nos  ha  permitido  entender  la  importancia  de  realizar  investigaciones genéticas en personas afectas  con  enfermedades  o  expuestas  a  agentes  carcinogénicos.  El  estudio  de  determinado  gen  depende  básicamente  de  la  función  que  cumpla  dicho  gen  y  la  relación  de  la  función  con  la  enfermedad  o  el  agente  externo  en  estudio.  Para  el  análisis  genético  de  las  personas  que  viven  en  las  comunidades  aledañas  a  la  frontera  con  Colombia  se  determinó  el  estudio  de  genes  detoxificadores  (GPX‐1,  GSTP1),  y  el  gen  reparador del ADN (XRCC1).     Los  genes  de  detoxificación  tienen  mucho  interés  cuando  se  trata  sobre  la  eliminación  de radicales libres en el organismo, los cuales,  al  acumularse  crean  alto  riesgo  en  el  desarrollo  de  enfermedades  como  el  cáncer.  Los  genes  reparadores  son  vitales  en  los  procesos  moleculares  del  organismo,  y  su, 


finalidad  es  corregir  las  bases  que  se  han  acoplado  erróneamente  en  la  secuencia  del  ADN,  y  el  mal  funcionamiento  de  esta  maquinaria  puede  incidir  en  problemas  celulares.     La  familia  glutatión  peroxidasa  (GPX)  se  encuentra  conformada  por  seis  isoenzimas  (GPX‐1,  GPX‐2,  GPX‐3,  GPX‐4,  GPX‐5,  GPX‐6).  Las  enzimas  glutatión  peroxidasas  se  denominan  así  por  la  capacidad  de  usar  glutatión  como  un  reductor  de  sustratos.  La  enzima  antioxidante  GPX‐1  es  parte  de  la  defensa  enzimática  antioxidante  la  cual  previene el daño oxidativo del ADN, proteínas  y  lípidos  (Ravn‐Haren,  et  al.,  2006).  Las  características  del  gen  GPX‐1  se  encuentran  detalladas en la tabla VI.1.     El  estrés  oxidativo  está  caracterizado  por  el  incremento  de  especies  oxígeno  reactivas  (EOR)  y  por  reducir  la  actividad  de  enzimas  antioxidantes  las  cuales  causan  disfunciones  metabólicas  y  daño  en  las  macromoléculas  biológicas.  La  acumulación  de  EOR  presenta  un  papel  importante  en  la  patogenicidad  de  enfermedades  cardiovasculares,  desórdenes  neurodegenerativos,  daño  crónico  de  hígado  y  riñón,  así  como  diferentes  tipos  de  cáncer  (Atanasova, et al., 2006).    Las  enzimas  que  cumplen  la  función  de  detoxificación,  inactivan  compuestos  y 

aniones  altamente  peligrosos  para  la  célula.  Las  defensas  contra  especies  oxígeno  reactivas  están  conformadas  por  glutatión  peroxidasa (GPX), catalasa (CAT) y superóxido  dismutasa  (SOD).  GPX‐1  es  una  enzima  detoxificadora  dependiente  del  selenio,  protege  a  la  célula  de  daño  oxidativo  reduciendo  el  peróxido  de  hidrógeno  y  un  amplio  rango  de  peróxidos  orgánicos  (Ichimura,  et  al.,  2004).  El  gen  GPX‐1  se  localiza  en  la  región  cromosómica  3p21  (Figura VI.1).     Esta  enzima  es  la  reguladora  final  de  la  vía  metabólica  que  degrada  especies  oxígeno  reactivas (De Hann, et al., 1998; Ichimura, et  al., 2004).     La  proteína  GPX‐1  pesa  21946  Da  y  se  encuentra  conformada  por  201  aminoácidos  que son codificados mediante los procesos de  transcripción  y  traducción  de  la  información  presente  en  el  ADN  (Figura  VI.2).  Se  ha  reportado que la sustitución de un nucleótido  en  el  codón  198  del  gen  GPX‐1  resulta  en  la  transversión  de  una  timina  por  una  citosina,  resultando a nivel aminoacídico la sustitución  de una leucina (L) por una prolina (P), y este  cambio  está  asociado  con  un  incremento  en  el  riesgo  de  adquirir  cáncer  de  vejiga  y  pulmonar en población caucásica debido a la  reducción  en  la  producción  de  la  actividad  enzimática (Ichimura, et al., 2004). 

  Tabla VI.1. Características del gen GPX‐1    GPX‐1 Símbolo oficial  Nombre  Otros alias  Cromosoma  Localización  # Acceso NCBI  Gen ID  Tamaño secuencia  Tamaño proteína  Subunidad  Localización subcelular 

       

GPX‐1 Glutathione peroxidase 1 GSHPX1, MGC14399, MGC88245  3 (Figura VI.1) 3p21.3 (Figura VI.1) NC_000003.11 2878 1186 pb 201 aa; 21946 Da (Figura VI.2)  Homotetrámero Citoplasma

72 


Figura VI.1. Cromosoma 3. Ubicación del gen GPX‐1   

             

GeneCards, 2010  Figura VI.2. Glutatión peroxidasa 1 

  73 

                            22.1. Amplificación y genotipaje    Para la amplificación del fragmento de 191 pb  del gen GPX‐1, se obtuvo un volumen final de  PCR  de  25  µL.  Cada  muestra  estuvo  conformada por 10,85 µL de H2O Milli‐Q, 2,5  µL  de  buffer  10x  (200  mM  Tris  HCl  (pH  8,4),  500  mM    KCl),  0,8  µL  de  MgCl2  25  mM,  2  µL  de  dNTPs  (dideoxinucleótidos  trifosfato)  a  200  mM,  2,5  µL  de  los  primers  FW  5´‐ AAGGTGTTCCTCCCTCGTAGGT‐3´  y  RV  5´‐ CTACGCAGGTACAGCCGCCGCT‐3´  a  0,5  µM   (BioSynthesis  Inc),  2,5  unidades  (U)  de  Taq  polimerasa (Invitrogen) y 4 µL de muestra de  ADN  a  una  concentración  de  100  ng/µL.  Luego  de  obtener  la  reacción  de  PCR  se  procedió  a  colocar  las  muestras  en  el  termociclador  MJ  Research  PTC  200®  (MJ‐ Research  Inc.,  Watertown,  Mass.,  USA)  para  su  amplificación.  El  primer  paso  de  denaturación  inicial  duró  8  min  a  94°  C,  seguido de 36 ciclos de 1 min a 94° C, 1 min a  60° C, 1 min a 72° C y una elongación final de  9  min  a  72°  C.  Se  evidenció  la  amplificación 

(EMBL‐EBI,  2010)

del fragmento mediante electroforesis en gel  de  agarosa  al  2%  con  bromuro  de  etidio,  las  bandas  de  ADN  se  las  observó  mediante  el  transiluminador UV.    Se  determinó  el  genotipo  de  los  individuos  expuestos  a  las  aspersiones  aéreas  con  glifosato  mediante  la  técnica  PCR‐RFLP.  La  enzima  de  restricción  ApaI  (New  England  Biolabs,  Beverly,  Massachusetts)  se  utilizó  para  identificar  la  variante  Pro198Leu.  Cuando la enzima de restricción no reconoce  el  sitio  de  corte  se  trata  de  un  ADN  no  mutado,  observándose  en  el  gel  de  agarosa  una banda de 191 pb y se demuestra que se  trata  de  un  individuo  homocigoto  (P/P),  cuando  se  observan  tres  bandas  (191,  117  y  74  pb),  se  trata  de  un  heterocigoto  (P/L),  y  cuando  se  observan  dos  bandas  (117  y  74  pb), se trata de un homocigoto (L/L).    Para que las enzimas de restricción corten los  sitios  de  restricción,  el  producto  de  PCR  fue  digerido  durante  2  horas  a  37°C  con  5  U  de 


enzima  ApaI.  Después  de  la  digestión  con  prueba  de  χ2  se  aplicó  para  determinar  enzimas se procedió a analizar el genotipo de  diferencias  significativas  entre  la  presencia  cada  uno  de  los  individuos  mediante  del  polimorfismo  y  la  exposición  al  glifosato.  electroforesis  en  gel  de  agarosa  al  5%  con  Se realizó a un nivel de significación de 0,001  bromuro  de  etidio,  bajo  el  transiluminador  y 2 grados de libertad. La prueba OR permitió  determinar  la  asociación  que  existe  entre  la  UV.  presencia  del  polimorfismo,  la  exposición  al    glifosato  y  el  riesgo  a  desarrollar  22.2. Polimorfismo Pro198Leu     enfermedades.  El  análisis  OR  se  realizó  Entre  los  individuos  expuestos  a  las  mediante una tabla de contingencia 2 x 2.  aspersiones  con  glifosato  se  observó  que  el    35%  fue  homocigoto  normal  con  el  genotipo  Con  relación  al  polimorfismo  Pro198Leu  del  (P/P),  el  48%  fue  heterocigoto  con  el  gen  GPX‐1,  se  obtuvo  un  OR  de  0,87  para  el  genotipo  (P/L)  y  el  17%  fue  homocigoto  genotipo  P/L  (OR  =  0,87;  95%  IC  0,5‐1,6;  p  =  mutante  con  el  genotipo  (L/L).  La  frecuencia  0,77NS), un OR de 8,5 para el genotipo L/L (OR  del  alelo  normal  (P)  fue  0,59  y  la  frecuencia  = 8,5; 95% IC 1,8‐39,9; p < 0,05*), y un OR de  del alelo mutante (L) fue 0,41. Con respecto a  1,14 para la combinación de los genotipos P/L  los individuos control, se observó que el 38%  +  L/L  (OR  =  1,14;  95%  IC  0,6‐2,1;  p  =  0,79NS)  fue  homocigoto  normal  (P/P),  el  60%  fue  (Tabla  VI.3).  Los  resultados  permiten  heterocigoto  (P/L)  y  el  2%  fue  homocigoto  determinar  que  los  individuos  con  la  mutante (P/L). La frecuencia del alelo normal  presencia  del  genotipo  L/L  presentan  fue 0,68, y 0,32 para el alelo mutante  (Tabla  asociación significativa entre la presencia del  VI.2).  polimorfismo  Pro198Leu,  la  alteración  de  los    niveles de la enzima glutatión peroxidasa y la  Con  respecto  al  análisis  estadístico  se  posible  adquisición  de  problemas  en  los  analizaron los resultados con dos pruebas: el  procesos  de  detoxificación  de  peróxidos  a  chi‐cuadrado  (χ2)  y  el  odds  ratio  (OR).  La  nivel celular.    Tabla VI.2. Distribución genotípica y frecuencia alélica de Pro198Leu    Grupo 

Frecuencia 

Individuos

%

Frecuencia genotípica

Frecuencia alélica

Expuestos  (n = 92) 

P/P  P/L  L/L  P/P  P/L  L/L 

32  44 16 34  54  2 

35 48 17 38 60 2

0,35 0,48 0,17 0,38 0,6 0,02

0,59    0,41  0,68    0,32 

Controles  (n = 90) 

  Tabla VI.3. Análisis estadístico del odds ratio en los genes GPX‐1, GSTP1 y XRCC1    Genes  GPX‐1 Pro198Leu 

GSTP1  Ile105Val  XRCC1  Arg399Gln 

   

Genotipo 

OR

P/P  P/L  L/L  P/L + L/L  I/I  I/V  V/V  I/V + V/V  R/R  R/Q  Q/Q  R/Q + Q/Q 

1,0 (Referencia) 0,87 8,5 1,14 1,0 (Referencia) 1,95 4,88 2,6 1,0 (Referencia) 12,2 0,03 0,2

95% IC 0,5 – 1,6 1,8 – 39,9 0,6 – 2,1 1,0 – 3,8 2,0 – 11,8 1,4 – 4,8 0,7 – 219,8 0,003 – 0,2 0,02 – 1,4

p    NS 0,77   < 0,05*  NS 0,79     NS 0,07   < 0,001*  < 0,05*    NS 0,4   < 0,001*  NS 0,1   

74 


La enzima glutatión S‐transferasa pi 1 no solo  funciona  como  un  metabolizador  de  drogas  de  fase  dos,  también  actúa  como  un  regulador  de  la  apoptosis  (Moyer,  et  al.,  2008),  regulador  de  la  vía  quinasa  MAPKs  como resultado de la actividad enzimática no  ligada  (Wu,  et  al.,  2006;  Zhao,  et  al.,  2006),  regulador  de  señales  celulares  a  través  del  enlace a proteínas como c‐Jun NH2‐ terminal  quinasa,  ASK1  y  TRAF2,  regulando  la  señal  downstream  de  los  genes  (Wu,  et  al.,  2006).  Cuando  la  actividad  de  GSTP1  decrece,  las  células  se  tornan  más  susceptibles  a  mutaciones  como  resultado  del  estrés  oxidativo (Meiers, et al., 2007).      Se ha reportado una mutación transición de A  a G en el nucleótido 313, en el exón 5 del gen  GSTP1.  Esta  mutación  del  ADN  resulta  en  la  traducción  del  aminoácido  valina  (V)  en  vez  de  isoleucina  (I),  en  el  codón  105  del  sitio  activo  de  la  enzima  (Figura  VI.4).  Esta  mutación  se  asocia  con  la  reducción  de  la  actividad  enzimática  alterando  su  termoestabilidad. La presencia del alelo V ha  sido relacionada con el incremento del riesgo  de  adquirir    cáncer  de  vejiga,  testículo  y  próstata (Zendehdel, et al., 2009). 

23. Gen GSTP1    El gen glutatión S‐transferasa pi 1 (GSTP1) es  miembro  de  la  superfamilia  citosólica  GST  (Cowell, et al., 1988). Este gen se ubica en el  cromosoma  11  en  la  región  11q2  y  se  encuentra conformado por una secuencia de  ADN de 3066 pb (Tabla VI.4) (Figura VI.3).  

  75 

GSTP1  codifica  para  una  enzima  de  210  aminoácidos,  de  fase  dos,  la  cual  cataliza  la  conjugación  del  tripéptido  glutatión  con  una  amplia variedad de compuestos electrofílicos,  incluyendo  genotóxicos,  carcinógenos  y  agentes  quimioterapéuticos  (Lo,  et  al.,  2008)  (Figura VI.4). Esta enzima detoxifica radicales  libres, especialmente los sustratos del tabaco,  e  interactúa  con  una  variedad  de  xenobióticos  electrofílicos,  incluyendo  sustratos que van desde toxinas ambientales,  carcinógenos  hasta  drogas  usadas  en  tratamientos  de  cáncer  (Ketterer,  2001;  Hayes,  et  al.,  2005;  Zendehdel,  et  al.,  2009).  GSTP1  también  es  responsable  de  la  detoxificación  de  metabolitos  reactivos  acelerando el rango de excreción (Rybicki, et  al., 2006).       Tabla VI.4. Características del gen GSTP1 

  GSTP1 Símbolo oficial  Nombre  Otros alias  Cromosoma  Localización  # Acceso NCBI  Gen ID  Tamaño secuencia  Tamaño proteína 

GSTP1 Glutathione S‐transferase pi 1  DFN7, FAEES3, GST3, GSTP, PI  11 (Figura VI.3) 11q2 (Figura VI.3) NC_000011.9 2950 3066 pb 210 aa (Figura VI.4)

    Figura VI.3. Cromosoma 11. Ubicación del gen GSTP1                

GeneCards, 2010 


23.1. Amplificación y genotipaje    Para la amplificación del fragmento de 177 pb  del gen GSTP1, se obtuvo un volumen final de  PCR  de  50  µL.  Cada  muestra  estuvo  conformada por 37 µL de H2O Milli‐Q, 5 µL de  buffer  10x,  1,5  µL  de  MgCl2  25  mM,  1  µL  de  dNTPs  a  200  mM,  2,5  µL  de  los  primers  FW  5´‐ACCCCAGGGCTCTATGGGAA‐3´  y  RV  5´‐ TGAGGGCACAAGAAGCCCCT‐3´  a  0,5  µM,  2,5  U  de  Taq  polimerasa  y  4  µL  de  ADN.  Las  condiciones  de  la  amplificación  consistieron  en una denaturación inicial de 5 min a 95° C,  seguida de 35 ciclos de 45 seg a 94° C, 1 min a  62° C, 45 seg a 72° C y una elongación final de  5 min a 72° C. El amplicón migró en un gel de  agarosa al 2% con bromuro de etidio, en una  cámara de electroforesis y las bandas fueron 

observadas  en  un  transiluminador  bajo  luz  ultravioleta (UV).    Se utilizó la enzima de restricción HaeIII para  determinar  el  polimorfismo  Ile105Val  de  los  individuos  en  estudio.  Cuando  la  enzima  no  reconoce  el  sitio  de  corte  se  observa  una  banda de 177 pb y se demuestra que se trata  de  un  individuo  homocigoto  (I/I),  cuando  se  observan  tres  bandas  de  177,  92  y  85  pb  se  trata  de  un  heterocigoto  (I/V),  y  cuando  se  observan  dos  bandas  de  92  y  85  pb  se  trata  de  un  homocigoto  mutante  (V/V).  La  enzima  de  restricción  HaeIII  digirió  el  producto  de  PCR  durante  2  horas  a  37°C  con  5  U.  Y  las  bandas  fueron  observadas  en  gel  de  agarosa  al  5%  con  bromuro  de  etidio  bajo  la  luz  UV.

 

Figura VI.4. Glutatión S‐transferasa pi 1 

                                           

               

(EMBL‐EBI, 2010) 

76 


77 

En  cuanto  al  análisis  estadístico  del  23.2. Polimorfismo Ile105Val     polimorfismo  Ile105Val  del  gen  GSTP1,  se  Con respecto a los individuos expuestos a las  obtuvo  un  OR  de  1,95  para  el  genotipo  I/V  aspersiones  con  glifosato  se  observó  que  el  (OR=1,95;  95%  IC  1,0‐3,8;  p  =  0,07NS),  un  OR  32%  fue  homocigoto  normal  (I/I),  el  40%  fue  de  4,88  para  el  genotipo  V/V  (OR=4,88;  95%  heterocigoto  (I/V)  y  el  28%  fue  homocigoto  IC 2,0‐11,8; p < 0,001*) y un OR de 2,6 para la  mutante (V/V). La frecuencia del alelo normal  combinación de genotipos I/V + V/V (OR=2,6;  (I)  fue  0,52  y  la  frecuencia  del  alelo  mutante  95%  IC  1,4‐4,8;  p  <  0,05*)  (Tabla  VI.3).  Estos  (V)  fue  0,48.  En  cuanto  a  los  individuos  resultados nos indican que los individuos con  control,  se  observó  que  el  54%  fue  genotipo  V/V  presentan  mayor  riesgo  en  homocigoto  normal  (I/I),  el  36%  fue  adquirir  problemas  en  los  procesos  de  heterocigoto  (I/V)  y  el  10%  fue  homocigoto  detoxificación de metabolitos, al igual que en  mutante (V/V). La frecuencia del alelo normal  los  procesos  de  señalización  celular  para  fue  0,72  y  del  alelo  mutante  fue  0,28  (Tabla  apoptosis y activación de genes quinasa.   VI.5).    Tabla VI.5. Distribución genotípica y frecuencia alélica de Ile105Val 

  Grupo  Expuestos  (n = 92)  Controles  (n = 90) 

Frecuencia  I/I  I/V  V/V  I/I  I/V  V/V 

Individuos 29 37 26 49 32 9

    24. Gen XRCC1    El  gen  XRCC1  es  uno  de  los  más  de  veinte  genes  que  participan  en  las  vías  de  reparación por escisión de bases; se ubica en  el  cromosoma  19  en  la  región  19q13.2  y  codifica  una  proteína  de  andamiaje  de  633  aminoácidos  y  69526  Da,  que  funciona  en  la  reparación  de  rupturas  del  ADN,  una  de  las  lesiones  más  comunes  del  material  genético  (Tabla  VI.6)  (Figura  VI.5  y  VI.6)  (Caldecott,  et  al., 1995). 

  El  cáncer  humano  puede  desarrollarse  por  daño  en  el  ADN  causado  por  exposición  a  rayos  UV,  radiación  ionizante  y  agentes  químicos  ambientales.  Para  salvaguardar  la  integridad  del  genoma,  los  humanos  han  desarrollado  un  complejo  sistema  de  reparación  del  ADN.  Entre  las  funciones  ejercidas  por  el  ADN,  la  reparación  por  escisión es el principal mecanismo de defensa  contra  el  daño  que  resulta  del  metabolismo  celular,  incluyendo  especies  oxígeno  reactivas,  metilación,  deaminación  e 

% 32 40 28 54 36 10

Frecuencia genotípica 0,32 0,40 0,28 0,54 0,36 0,10

Frecuencia alélica 0,52    0,48  0,72    0,28 

hidroxilación.  Por  lo  tanto,  la  reparación  por  escisión  de  bases  es  un  evento  universal  en  las células y es relevante en la prevención de  la  mutagénesis  (Zhibin,  et  al.,  2005).  XRCC1  interactúa  con  un  complejo  de  proteínas  reparadoras  del  ADN,  incluyendo  poli(ADP‐ ribosa)  polimerasa,  ADN  ligasa  3  y  ADN  polimerasa‐h (Caldecott, et al., 1995; Dianov,  et al., 1999; Thompson, et al., 2000).    Debido  a  que  el  polimorfismo  Arg399Gln  se  encuentra localizado en el dominio BRCT‐1 de  XRCC1  dentro  de  la  región  poli(ADP‐ribosa),  ha sido ampliamente investigado tanto en su  función  como  en  la  asociación  con  riesgo  al  cáncer.  Es  por  ello  que  resulta  de  gran  importancia  el  estudio  de  frecuencias  del  polimorfismo Arg399Gln del gen XRCC1 en la  población  expuesta  a  las  aspersiones  aéreas  con glifosato. 

  El  polimorfismo  Arg399Gln  consiste  en  la  sustitución de la base nitrogenada G por A en  el codón 399, exón 10 del gen XRCC1; siendo  a nivel aminoacídico el cambio de arginina (R) 


por  glutamato  (Q).  La  presencia  de  esta  por la presencia de aductos de ADN (Lunn, et  variante ha sido asociada con la reducción de  al., 1999; Matullo, et al., 2001).  la  capacidad  del  ADN  de  reparar  mutaciones     Tabla VI.6. Características del gen XRCC1    Símbolo oficial  Nombre  Otros alias  Cromosoma  Localización  # Acceso NCBI  Gen ID  Tamaño proteína  Subunidad  Localización subcelular 

XRCC1 XRCC1 X‐ray repair cross complementing protein  RCC 19 (Figura VI.5) 19q13.2 (Figura VI.5) NC_000019.9 7515 633 aa; 69526 Da (Figura VI.6) Homodímero Núcleo

78 

  Figura VI.5. Cromosoma 19. Ubicación del gen XRCC1. Genecards.org   

GeneCards, 2010 

   

Figura VI.6. Proteína reparadora de ADN XRCC1 

                        24.1. Amplificación y genotipaje    La amplificación del fragmento de 242 pb del  gen XRCC1 se realizó a partir de  un volumen  final  de  PCR  de  50  µL.  Cada  muestra  estuvo  conformada  por  34  µL  de    H2O  Milli‐Q,  5  µL  de  buffer  10x,  1,5  µL  de  MgCl2  25  mM,  1  µL  de dNTPs a 200 mM, 2 µL de los primers FW  5´‐CCCCAAGTACAGCCAGGTC‐3´  y  RV  5´‐ TGCCCCGCTCCTCTCAGTAG‐3´ a 0,4 µM,  2,5 U  de  Taq  polimerasa  y  4  µL  de  ADN.  Las  condiciones  para  la  amplificación  del  gen 

(EMBL‐EBI, 2010)  XRCC1  fueron  95°  C  durante  5  min,  35  ciclos  de  94°  C  por  15  seg,  59°  C  por  1  min,  72°  C  por  30  seg  y  72°  C  por  5  min.  Las  bandas  amplificadas se observaron bajo luz UV.      Para  determinar  la  presencia  del  polimorfismo  Arg399Gln  se  utilizó  la  enzima  de  restricción  MspI.  Cuando  la  enzima  no  reconoce  el  sitio  de  corte  se  observa  un  fragmento  de  242  pb  es  un  individuo  homocigoto  (R/R),  cuando  se  observan  fragmentos  de  242,  148  y  94  pb  se  trata  de 


79 

un  individuo  heterocigoto  (R/Q)  y  cuando  se  heterocigoto  (R/Q)  y  el  98%  fue  homocigoto  observan  dos  fragmentos  de  148  y  94  pb  se  mutante  (Q/Q).  La  frecuencia  del  alelo  trata  de  un  genotipo  homocigoto  mutante  normal fue 0,02 y del alelo mutante fue 0,98  (Q/Q).  De  igual  forma,  los  amplicones  se  (Tabla VI.7).       digieren con 5 U de la enzima MspI durante 2    horas a 37° C. Y las bandas se las observa bajo  Con  relación  al  polimorfismo  Arg399Gln  del  gen XRCC1, se obtuvo  un  OR  de 12,2  para el  luz UV.     genotipo R/Q (OR=12,2; 95% IC 0,7‐219,8; p =  24.2. Polimorfismo Arg399Gln   0,4NS),  un  OR  de  0,03  para  el  genotipo  Q/Q    (OR=0,03; 95% IC 0,003‐0,2; p < 0,001*) y un  Con  relación  a  los  individuos  expuestos  al  OR  de  0,2  para  la  combinación  de  genotipos  glifosato  se  observó  que  el  7%  fue  R/Q  +  Q/Q  (OR=0,2;  95%  IC  0,02‐1,4;  p  =  homocigoto  normal  (R/R),  el  79%  fue  0,1NS)  (Tabla  VI.7).  Los  datos  obtenidos  nos  heterocigoto  (R/Q)  y  el  14%  fue  homocigoto  demuestran  que  no  existe  asociación  ni  mutante  (Q/Q).  La  frecuencia  del  alelo  riesgo  entre  el  polimorfismo  Arg399Gln  y  normal  (R)  fue  0,46  y  la  frecuencia  del  alelo  daño en el ADN en los individuos estudiados,  mutante  (Q)  fue  0,54.  Con  respecto  a  los  demostrando  como  resultado  un  sistema  de  individuos  control,  se  observó  que  el  1%  fue  reparación del ADN estable.  homocigoto  normal  (R/R),  el  1%  fue    Tabla VI.7. Distribución genotípica y frecuencia alélica de Arg399Gln 

  Grupo  Expuestos  (n = 92)  Controles  (n = 90) 

Frecuencia  R/R  R/Q  Q/Q  R/R  R/Q  Q/Q 

Individuos 6 73 13 1 1 88

% 7 79 14 1 1 98

Frecuencia genotípica 0,07 0,79 0,14 0,01 0,01 0,98

Frecuencia alélica 0,46    0,54  0,02    0,98 

    25. Citogenética    La  exposición  de  las  células  eucariotes  a  varios  agentes  químicos  y  físicos  pueden  inducir  al  daño  o  alteración  a  nivel  cromosómico  (Au,  1991;  Leonard,  et  al.,  1985).  El  análisis  citogenético  permite  conocer  las  alteraciones  numéricas  y  estructurales  presentes  en  los  cromosomas  de los individuos expuestos a las aspersiones  con glifosato.     La obtención del cariotipo de cada uno de los  individuos  consiste  en  estimular  el  crecimiento  celular  en  medios  de  cultivo  específicos,  cultivar  las  células  y  detenerlas  en  metafase,  distribuir  las  metafases  en  placas,  teñir  y  bandear  los  cromosomas  para  posteriormente analizarlos en el microscopio  y con un programa informático especializado.     

25.1. Cultivo de sangre periférica    El  cultivo  de  sangre  periférica  consiste  en  colocar  a  las  células  en  un  medio  favorable  para estimular su división y así poder obtener  cromosomas  adecuados  para  su  posterior  análisis.     Los pasos realizados son los siguientes:    ∙ Se  limpia  la  cámara  de  flujo  laminar  con  cloro y alcohol.  ∙ Se  descongela  la  alícuota  del  medio  de  cultivo RPMI 1640 en el baño María a 37°  C.  ∙ Se  rotula  un  nuevo  tubo  cónico  con  el  código  del  paciente  y  la  fecha  de  procesamiento.   ∙ Se  coloca  el    tubo  cónico  y  el  frasco  de  medio  RPMI  1640  descongelado  en  la  cámara  de  flujo  laminar  encendida  y  se 


enciende  la  luz  ultravioleta  por  10  minutos antes del cultivo.  Se  utilizar  mandil,  mascarilla  y  guantes  desinfectados con alcohol para realizar el  cultivo.   Se  coloca  5  mL  del  medio  RPMI  1640  en  el  tubo  cónico  y  se  añade  10  gotas  de  la  muestra (aproximadamente 1mL).   Se  sella  el  tubo  cónico  con  el  cultivo  y  todos  los  reactivos  utilizados  con  parafilm.  Se incuba la muestra en la estufa de 37° C  por  48  horas  para  observar  genotoxicidad.   Se limpia la cámara y si sobra muestra se  guarda en la refrigeradora a 4° C.  

  25.2. Cosecha de sangre periférica    La  cosecha  de  las  células  previamente  cultivadas se divide en dos partes, la primera  parte  consiste  en  colocar  colchicina  a  la  muestra  con  el  fin  de  detener  la  división  celular  en  metafase  y  así  observar  de  mejor  forma  los  cromosomas.  Y  la  segunda  parte  consiste  en  romper  las  membranas  celulares  para liberar a los cromosomas en metafase y  así  continuar  con  la  tinción  y  posterior  análisis.     Los  pasos  para  cosechar  las  muestras  de  sangre son los siguientes:    ∙ Se  añade  200  µL  de  Colcemid®  y  se  deja  la muestra en la estufa a 37° C durante 1  hora.  ∙ Durante  ese  período  se  prepara  el  choque hipotónico y el fijador de Carnoy.   ∙ Se  calienta  la  cantidad  de  choque  hipotónico que se vaya a utilizar en baño  María a 37° C.  ∙ Transcurrido  el  tiempo  de  colchicina,  se  centrifuga  la  muestra  por  10  min  a  2500  rpm.  ∙ Se elimina el sobrenadante hasta la línea  del  tubo  cónico  (1  mL)  en  un  frasco  que  contenga cloro diluido y se resuspende el  botón.  ∙ Se absorbe toda la muestra en la pipeta y  se  coloca  7  mL  de  choque  hipotónico  a  37° C en el tubo vacío. 

∙ ∙

∙ ∙

∙ ∙

Se  suelta  el  contenido  de  la  pipeta  lentamente por las paredes del tubo y se  incuba a baño María a 37°C por 25 min en  sangre.  Pasado  el  tiempo  de  baño  María  se  centrifuga  la  muestra  por  10  min  a  2500  rpm.  Se elimina el sobrenadante hasta la línea  del tubo cónico y se resuspende el botón.  Se absorbe toda la muestra en la pipeta y  se  coloca    4  mL  de  fijador  en  el  tubo  vacío.  Se  suelta  el  contenido  de  la  pipeta  rápidamente,  se  resuspende  2  ó  3  veces  con la pipeta.  Se  deja  la  muestra  por  15  min  al  medio  ambiente.   Transcurrido  el  tiempo,  se  centrifuga  la  muestra  por  10  min  a  2500  rpm  y  se  elimina el sobrenadante hasta la línea del  tubo cónico y se resuspende el botón.   Se  absorbe  la  muestra  en  la  pipeta  y  se  coloca 4 mL de fijador en el tubo vacío, se  suelta  el  contenido  de  la  pipeta  rápidamente,  se  resuspende  2  ó  3  veces  con la pipeta.  Se  centrifuga  la  muestra  por  10  min  a  2500  rpm,  se  elimina  el  sobrenadante  hasta  la  línea  del  tubo  cónico  y  se  resuspende el botón.  Se  repite  el  lavado  con  fijador  hasta  obtener un pellet limpio.  Se  deja  reposar  la  muestra  1  hora  en  el  refrigerador antes de extender las placas. 

  25.3. Extensión de placas    El proceso de extensión de placas consiste en  permitir  una  buena  distribución  de  las  metafases por toda la placa.    Los pasos para la extensión de las placas es el  siguiente:     ∙ Se  saca  la  muestra  del  refrigerador  y  se  centrifuga��por 10 min a 2500 rpm.  ∙ Se  rotula  la  placa  (previamente  sumergida  en  solución  al  60%  de  ácido  acético)  cerciorándose  del  número  de  la  última  placa  extendida  según  el  registro  pertinente. 

80 


81  ∙

cortos  y  largos  para  facilitar  la  identificación  del  par  homólogo  y  de  este  modo  realizar  el  cariotipo de los individuos sanos y expuestos  a las aspersiones aéreas con glifosato.    El  proceso  de  bandeamiento  GTG  de  las  placas es el siguiente:    ∙ Se deja envejecer las placas por 48 horas  a 60° C.  ∙ Se descongela la tripsina y se pone a 37°  C en el baño María.  ∙ Se  calienta  45  mL  de  agua  en  un  vaso  Coplin  hasta  llegar  a  37°  C,  una  vez  alcanzada  la  temperatura  se  añade  5  mL  de tripsina.  ∙ Se  coloca  la  placa  en  la  solución  de  tripsina a 37° C durante 30 minutos.  ∙ Se  lava  la  placa  con  NaCl  al  0,95%  y  posteriormente con agua.  ∙ Se  tiñe  las  placas  según  el  protocolo  de  tinción simple con giemsa.  ∙ Se  deja  secar  las  placas  al  ambiente  y  se  observa al microscopio.    25.6. Análisis de cariotipos    Las  metafases  de  cada  uno  de  los  individuos  se  analizaron  bajo  un  lente  de  100x  en  un  microscopio Olympus BX51. El cariotipo de las  personas  expuestas  a  las  aspersiones  aéreas  se  armó  con  la  ayuda  del  software  CytoVision®  System  (Applied  Imaging)  (Figura  VI.7). Los resultados indican que el 0% de los  individuos  presentó  algún  tipo  de  alteraciones  cromosómicas  y  se  observaron  porcentajes  de  fragilidad  cromosómica  menor  al  3%,  es  decir  todos  se  encontraron  dentro  de  los  rangos  normales  establecidos.  Los  resultados  se  detallan  en  la  tabla  VI.8.

Pasado el tiempo de la centrifugación, se  elimina  el  sobrenadante  hasta  que  queden 3 mL de muestra y se resuspende  el botón. En el caso de obtener más de 1  mL  de  pellet,  se  resuspende  delicadamente  con  la  pipeta  Pasteur  elevando las células de la superficie.  Se  deja  caer  sobre  la  placa,  desde  una  altura  aproximada  de  30  cm,  4  gotas  de  muestra  resuspendida  (pellet  abundante),  6  gotas  (en  caso  de  pellet  normal)  y  8  gotas  (en  caso  de  pellet  escaso).  Para placas de tinción directa, se somete  a  la  llama  brevemente.  En  el  caso  de  las  placas  dirigidas  a  bandeo  GTG,  se  coloca  una  bandeja  y  se  lleva  a  la  estufa  por  2  días a 60° C.  Se procede a teñir las placas. 

∙   25.4. Tinción simple de placas    La tinción simple consiste en dar coloración a  los cromosomas con el tinte giemsa con el fin  de observar las metafases a ser analizadas.    Los pasos de tinción son los siguientes:    ∙ Se  prepara  la  solución  de  giemsa  en  un  vaso Coplin (5 mL de solución madre y 45  mL de agua).  ∙ Se  coloca  las  placas  ya  extendidas  en  el  vaso Coplin y se deja transcurrir de 8 a 10  minutos.  ∙ Se  pasa  la  placa  por  un  chorro  de  agua  para  retirar  el  exceso  de  colorante,  se  deja secar y se observa al microscopio.     25.5. Bandeo GTG    El  bandeo  GTG  de  los  cromosomas  permite  crear  un  patrón  de  bandas  en  los  brazos    Links web  www.genecards.org  www.embl.de  www.ncbi.nlm.nih.gov  www.ebi.ac.uk     


Figura VI.7. Cariotipo 

82 

  Tabla VI.8. Porcentaje de fragilidad y alteraciones cromosómicas    Comunidad 

Chone 2  (CH2) 

Yanamarum   (YA) 

Playera Oriental  (PO) 

 

Código  CH2‐A  CH2‐B  CH2‐C  CH2‐D  CH2‐E  CH2‐F  CH2‐G  CH2‐H  CH2‐I  CH2‐J  CH2‐K  YA‐A  YA‐B  YA‐C  YA‐D  YA‐E  YA‐F  YA‐G  YA‐H  YA‐I  YA‐J  YA‐K  PO‐A  PO‐B  PO‐C  PO‐D  PO‐E  PO‐F  FUN‐A 

Fragilidad cromosómica  (%)  0 1,2 0 0 0 0 1,9 0 1,4 0 0 2,4 0 0 0 0 1,2 0 2,5 0 0 2 0 0 1 0 2 0 2,8

Alteración cromosómica  (AC)  No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC

Cariotipo 46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX 


Fuerzas Unidad (FUN) 

83          Puerto Escondido  (PTE) 

Corazón Orense  (COR) 

5 de Agosto (5AG) 

Santa Marianita  (SM) 

Las Salinas (SAL) 

San Francisco (SF2) 

 

FUN‐B  FUN‐C  FUN‐D  FUN‐E  FUN‐F  FUN‐G  FUN‐H  FUN‐I  FUN‐J  FUN‐K  FUN‐L  FUN‐M  FUN‐N  PTE‐A  PTE‐B  PTE‐C  PTE‐D  PTE‐E  PTE‐F  PTE‐G  PTE‐H  PTE‐I  PTE‐J  PTE‐K  PTE‐L  PTE‐M  COR‐A  COR‐B  COR‐C  COR‐D  COR‐E  COR‐F  COR‐G  COR‐H  COR‐I  COR‐J  5AG‐A  5AG‐B  5AG‐C  5AG‐D  5AG‐E  5AG‐F  5AG‐G  SM‐A  SM‐B  SM‐C  SM‐D  SM‐E  SM‐F  SM‐G  SAL‐A  SAL‐B  SAL‐C  SAL‐D  SAL‐E  SAL‐F  SF2‐A  SF2‐B  SF2‐C  SF2‐D  SF2‐E  SF2‐F  SF2‐G 

0 1,2 2 0 0 0 0 0 2 0 0 1,2 0 0 1,2 0 1 0 1,2 2 0 1,5 0 0 0 0 0 0 1,2 0 0 1,2 0 0 1,2 0 2 1,2 0 0 1,5 0 1,2 0 0 0 0 0 0 0 0 0 1,2 1,2 2 0 0 0 0 0 0 1,2 0

No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC No AC

46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX  46,XX 


FOTOGRAFÍA Genética

85

Estudio de los genes GPX-1, GSTP1 y XRCC1 Reacción en cadena de la polimerasa (PCR)

Genotipaje de la población de estudio mediante PCR-RFLP Análisis de fragmentos mediante electroforesis


86

Análisis de cariotipo Aberraciones cromosómicas

Obtención de metafases Técnica de extensión de cultivo


PARTE VII  DIAGNÓSTICO EN SALUD    26. Valoración del estado nutricional    Para  hacer  una  valoración  del  estado  nutricional  de  la  población,  se  realizaron  grupos de 0 a 5, 6 a 11 y 12 a 17 años para los  menores  de  18  años  de  edad.  Para  la  población  adulta  los  cuatro  grupos  formados  fueron de 15 a 34 años, de 35 a 44, de 45 a 64  y  más  de  65  años.  La  formación  de  estos  grupos  permite  hacer  un  análisis  más  eficiente  con  respecto  a  los  valores  del  estado nutricional de la población de estudio.  

26.1. Estado nutricional global    El  grado  de  nutrición  global  se  lo  midió  mediante  el  índice  “peso  para  la  edad”,  que  es  un  buen  indicador  para  medir  la  insuficiencia  de  peso.  Tiene  un  importante  papel  en  los  niños  menores  de  un  año.  Este  indicador  es  utilizado  para  ver  el  aumento  normal  de  peso  de  los  niños/as  y  sirve  para  identificar los riesgos en las pérdidas de peso  (Tabla VII.1). 

  Tabla VII.1.  Categoría clínica de peso/edad    Categoría peso/edad  DG: Desnutrición grave  DM: Desnutrición moderada 

Relación con la mediana  Igual y menos de ‐3DEa  De ‐2DE a ‐2,99DE 

Significado  Desnutrición peligrosa  Junto  con  DG  define  la  desnutrición de la población  DL: Desnutrición leve  De ‐1DE a ‐1,99DE  Indica riesgo de desnutrición  PN: Peso normal  Más de ‐1DE a menos de +1DE  Peso normal para la edad  SP: Sobrepeso  De +1DE a +1,99 DE  Hay riesgo de obesidad  OB: Obesidad  Igual y más de +2DE  Obesidad  a DE:  Desviación  estándar  con  respecto  a  la  mediana.  Son  positivas  (+)  cuando  exceden  o  negativas  (‐)  cuando  no  llegan al valor de la mediana.  

  En  el  estudio  realizado  sobre  una  población  Estos datos son mejores que los encontrados  de  262  niños  y  jóvenes  (131  varones  y  131  en  un  estudio  de  la  frontera  (Maldonado,  et  mujeres)  encontramos  una  desnutrición  al.,  2006)  en  el  que  se  estudió  el  estado  (DG+DM)  de  7,2%,  con  un  riesgo  de  nutricional  de  la  población  escolar,  en  desnutrición  del  25,2%  y  un  sobrepeso  localizaciones  a  menos  de  3  Km  de  la  (SP+OB)  del  8,8%.  En  estos  porcentajes  frontera,  encontrándose  una  desnutrición  de  existen  muy  pocas  diferencias  entre  varones  10,3%, un riesgo de desnutrición del 36,3% y  y mujeres como puede apreciarse en la figura  un  sobrepeso  de  4,6%.  Pero  ese  estudio  no  VII.1.   incluía  población  menor  de  6  años  (Figura    VII.2).   Figura VII.1. Nutrición global peso/talla total       

60 50 Porcentaje

                 

58.8 58.8 58.8

40 30

22.9

27.5 25.2

20 10 2.3 0

5.3 5.3 5.3 1.5 1.9

DG

6.9

5.3 6.1 3.8 2.7 1.5

DM DL PN SP Hombres Mujeres Total

OB

86 


Figura VII.2. Desnutrición global (peso/edad) en escuelas a 3 Kms de la frontera 

         

36,31

40 30 20

8,94

10

1,36

2,44

2,17

SP

OB

0 DG

DM

DL

PN

un 3% de desnutrición, el riesgo de ésta (DL)  baja  a  un  23,2%,  mientras  que  el  estado  nutricional  normal  alcanza  al  67,1%  de  los  escolares, lo que hace tres años no llegaba ni  a la mitad de la población (Figura VII.3).    

Si  se  compara  solo  a  la  población  de  6‐17  años que fue revisada en el presente estudio,  se determina que en estos tres años, tras dos  de  ellos  sin  aspersiones  aéreas  del  plan  Colombia,  las  condiciones  nutricionales  han  mejorado  notablemente,  pues  solo  existiría 

  Figura VII.3. Nutrición global en niños de 6 a 17 años en el año 2009 

                   

Porcentaje

70 67.1

60 50 40 30 20 10 0

23.2 4.9

3.0

1.8

0.0 DG

DM

DL

PN

SP

OB

Si se analiza esta desnutrición desde el punto  40,9%. Llama la atención que mientras en los  de  vista  de  las  edades  y  teniendo  en  cuenta  varones  hay  una  tendencia  creciente  en  la  las  diferencias  de  sexos,  se  encuentra  que  desnutrición  leve  (riesgo  de  desnutrición)  existe  una  mayor  desnutrición  (DG+DM)  en  esta  tendencia  tiende  a  disminuir  en  las  niños  menores  de  6  años,  alcanzando  el  mujeres  conforme  se  aumenta  la  edad.  Los  14,9%  en  niños  y  el  13,6%  en  niñas.  En  datos  y  tendencias  correspondientes  a  la  ninguno de los sexos el peso normal alcanza a  nutrición  global  tanto  en  hombres  como  en  la  mitad  de  la  población  en  este  grupo  de  mujeres de 0 a 5 años, 6 a 11 años y 12 a 17  edad, quedando en los varones reducido a un  años se las puede observar en las figuras VII.4  48%,  mientras  que  en  las  niñas  queda  en  el  y VII.5.    Figura VII.4. Nutrición global (peso/edad) en varones  70 60 Porcentaje

87 

48,78

50 Porcentaje

     

50 40 30 20 10

 

0

9.3 5.6 0.0 0.0 DG

  66.7 65.4     48.1   30.8 24.1     7.4 9.8 3.8 17.6   2.0

DM 0A-5A

DL  

6A-11A

 

PN 12A-17A

0.0 SP

5.6 3.9 0.0 OB


Porcentaje

Figura VII.5. Nutrición global (peso/edad) en mujeres    70.0 66.7 70   60   50   40.9 34.1 40   24.6 30   23.3   20 9.1 6.7 9.1   5.3 10 4.5 2.3 1.8 1.8   0.0 0.0 0.0 0.0 0 DG DM DL PN SP OB   0A-5A 6A-11A 12A-17A       La  desnutrición  global  en  el  país  para  recogidas  para  las  comunidades  afectadas  menores de 5 años, que tiene una tendencia  (Tabla VII.2).  decreciente,  es un poco  mayor que las cifras    Tabla VII.2. Distribución de la desnutrición global por año, área, región y sexo 

  Área  Año  País  Urbana  Rural 1999a  17,2  13,5  21,8 2000a  16,4  13,3  20,7 2004a  14,6  12,4  18,4 a  Para niños menores de 5 años 

Región Costa  Amazonía 15,9 ‐ 15,1 17,4 15,0 14,1

Sierra  18,5 18,0 14,2

Sexo  Masculino  Femenino 16,0  18,3  15,2  17,6  16,2  13,0 

  26.2. Estado nutricional crónico (retraso del  mejor  indicador  para  medir  el  retraso  del  crecimiento.  Mide  la  dieta  adecuada  y  el  crecimiento)  estado  nutricional  de  largo  plazo.  Sus  datos    Se mide con el indicador “talla para la edad”.  son  irreversibles,  indican  cronicidad  (Tabla  Refleja  el  crecimiento  esquelético  y  es  el  VII.3).    Tabla VII.3. Categoría clínica de talla/edad 

  Categoría talla/edad  Relación con la mediana Significado  B: Talla baja  Igual y menor de ‐2 DEa Indica desnutrición crónica  LB: Ligeramente baja Entre ‐1 DE y ‐1,99 DE Indica riesgo de desnutrición crónica N: Talla normal  Entre ‐0,99 DE y +0,99 DE Talla normal LA: Ligeramente alta  Entre +1 DE y + 1,99 DE Ligeramente por encima  A: Talla alta  Igual y por encima de +2 DE Muy altas para la media  a DE:  Desviación  estándar  con  respecto  a  la  mediana.  Son  positivas  (+)  cuando  exceden  o  negativas  (‐)  cuando no llegan al valor de la mediana.    

Para  este  estudio  los  datos  de  referencia  fueron  tomados  de  la  lista  creada  por  la  Organización  Mundial  de  la  Salud  (OMS),  en  Ginebra  en  1979  (WHO,  1979).  Con  estos  datos,  se  buscaron  en  tablas  las  categorías  correspondientes  a  cada  una  de  las  242  personas  chequeadas  con  datos  menores  de  18  años  y  se  encontró  el  siguiente  nivel  de 

nutrición  crónica:  una  talla  baja  (B)  del  29%  indicadora de desnutrición crónica, un riesgo  de  desnutrición  (LB)  en  el  40%,  una  talla  normal  (N)  en  una  cuarta  parte  de  la  población  (24%)  y  tallas  altas  en  el  7%  de  la  población.   

88 


89 

En  el  estudio  realizado  en  el  2006  por  equiparamos  con  el  estudio  realizado  en  el  Maldonado  et  al.,  en  la  frontera  con  2006,  encontramos  que  no  existen  población  escolar  (sin  grupo  de  niños  variaciones significativas, lo que da crédito al  menores  a  6  años),  se  encontró  la  siguiente  carácter  crónico  del  indicador  de  no  variar  distribución  en  estado  nutricional:  una  considerablemente  después  de  dos  años  de  desnutrición  crónica  del  29%  y  un  riesgo  del  ausencia de aspersiones aéreas. Los datos de  35% en aquellas escuelas que se encontraban  este  estudio  recogen  una  desnutrición  a  menos  de  3  Kms  de  la  frontera.  Si  a  los  crónica para los escolares de 6 a 17 años del  datos  obtenidos  en  este  estudio  se  omite  el  28%  y  un  riesgo  de  desnutrición  del  40%  sector  de  población  menor  a  los  6  años  y  (Figura VII.6).      Figura VII.6. Nutrición crónica (talla/edad) en todas las edades 

                   

3% 4%

29%

24%

40%

B

LB

N

LA

A

A continuación se observa la comparación de  mismo  sector  de  población  fronteriza  a  las  mediciones  del  2006  y  el  2009  para  el  menos de 3 Kms de la frontera (Figura VII.7).    Figura VII.7. Nutrición crónica (talla/edad) en estudios del 2006 (izq) y 2009 (der)   

             

2%

2% 2%

3% 31%

28%

28%

B

29%

LB N LA

40%

A

35%

B

LB

N

LA

A

    Los datos oficiales de desnutrición crónica en  años, adoptan la siguiente distribución según  Ecuador  en  niños  preescolares,  menores  a  5  los años:    Tabla VII.4. Distribución de desnutrición crónica por año, área, región y sexo    Año 

País 

1999  2000  2004 

22,9  22,7  17,4 

Área  Urbana  Rural 14,5  33,6 15,6  32,8 12,0  26,6

Sierra  30,6 29,6 23,0

Región Costa  Amazonia 15,7 ‐ 17,1 27,2 12,3 21,3

Sexo  Masculino  Femenino 22,4  23,4  24,9  20,3  19,5  15,2 

  De  los  siguientes  gráficos  se  puede  resaltar  que  existe  una  mayor  desnutrición  en  el  grupo de niños de 0 a 5 años y en el grupo de 

adolecentes,  que  se  encuentran  desarrollando su cuerpo de forma definitiva y  acelerada. Mientras en el primer grupo existe 


una  desnutrición  y  riesgo  en  el  72%,  en  el  el  grupo  de  12  a  17  años  se  llega  al  77%,  grupo de 6 a 11 años se alcanza un 62% (diez  superando  los  tres  cuartos  de  población  puntos  menos  que  es  muy  significativo)  y  en  juvenil (Figuras VII.8, VII.9 y VII.10).     Figura VII.8. Nutrición crónica (talla/edad) de niños de 0 a 5 años de edad 

       30%  

8% 4% 16%

 

B LB N

       

42%

LA A

      Figura VII.9. Nutrición crónica (talla/edad) de niños de 6 a 11 años de edad 

3% 3%  

32%

      22%             40%

B LB N LA A

      Figura VII.10. Nutrición crónica (talla/edad) de niños de 12 a 17 años de edad      2%   0%

21%

          36%     Si  los  niveles  de  nutrición  crónica  se  comparan  por  sexos  se  puede  observar  que  hay  mayor  desnutrición  en  las  mujeres  que,  sumando  la  talla  baja  y  la  ligeramente  baja, 

      41%

B LB N LA A

presentan  una  deficiencia  del  66%  para  los  varones  y  72%  para  las  mujeres  (Figuras  VII.11 y VII.12). 

90 


Figura VII.11. Nutrición crónica (talla/edad) en individuos varones de 0 a 17 años    3%

91 

                 

1%

24% B

30%

LB N LA A

42%

  Figura VII.12. Nutrición crónica (talla/edad) en individuos mujeres de 0 a 17 años 

5% 4% 19%

        33%      

B LB N LA A

       

39%

26.3. Estado nutricional agudo (emaciación)  Chevassus‐Agnes  establece  que  siempre  y  cuando  no  haya  una  pérdida  de  alimentos    El  indicador  peso  para  la  talla  es  reconocido  importante,  se  consideran  normales  en  la  como  un  buen  indicador  para  las  pérdidas  o  población  cifras  de  hasta  un  5%  de  pérdidas  ganancias  recientes  de  peso  y  muestra  el  de peso (DG+DM) incluso en países pobres; si  reciente estado de nutrición de una persona.  excede  el  5%  estaríamos  hablando  de  un  Es  el  indicador  preferido  en  situaciones  de  estado de alarma, donde rangos entre el 10‐ emergencia  para  valorar  las  pérdidas  14%  nos  hablarían  de  un  estado  muy  serio  y  nutricionales  que  estos  estados  generan.  Los  cifras  superiores  al  15%  nos  mostrarían  un  indicadores  bajos  señalan  que  un  suceso  estado crítico (Chevassus‐Agnes, 1999) (Tabla  reciente  y  severo  de  pérdida  de  peso  se  ha  VII.5). dado  con  inanición  aguda  o  enfermedad  severa.     Tabla VII.5. Categoría clínica de peso/talla   

a

Categoría peso/edad  DG: Desnutrición grave  DM: Desnutrición  moderada  DL: Desnutrición leve  PN: Peso normal 

Relación con la mediana  Igual y menos de ‐3 DEa  De ‐2 DE a ‐2,99 DE 

SP: Sobrepeso  OB: Obesidad 

De +1 DE a + 1,99 DE  Igual y más de +2 DE 

De ‐1 DE a ‐1,99 DE  Más de ‐1 DE a menos de +1 DE 

Significado  Desnutrición peligrosa  Junto con DG define la desnutrición de la  población  Es el riesgo de desnutrición  Peso normal para la talla, aunque no  discrimina niños bajos  Hay un riesgo de obesidad  Obesidad 

DE:  Desviación  estándar  con  respecto  a  la  mediana.  Son  positivas  (+)  cuando  exceden  o  negativas  (‐)  cuando no llegan al valor de la mediana.  


El  estado  de  nutrición  aguda  de  la  totalidad  Para comparar estas cifras con las del estudio  de  la  población  infantil  y  juvenil  destaca  que  del  año  2006,  se  tiene  que  extraer  la  está  por  debajo  del  5%  mencionado  con  población  infantil  de  0  a  5  años,  pues  el  anterioridad, por lo que las cifras demuestran  estudio  al  que  se  hace  mención  fue  solo  una  falta  de  peligrosidad  en  el  momento  sobre población escolar que vivía a menos de  actual.   3 Kms de la frontera (Figura VII.13).      Figura VII.13. Nutrición aguda (peso/talla) en individuos de 0 a 17 años 

                   

12.5

OB

19.6

SP

55.4

PN 9.8

DL 0.5

DM

2.2

DG 0

10

20

30

40

50

60

La  comparación  muestra  un  patrón  desnutrición  aguda  del  1,87%  y  desnutrición  semejante  aunque  el  nivel  de  desnutrición  leve del 7,17% (Figura VII.14).  difiere en el grado. En el año 2006 había una      Figura VII.14. Desnutrición aguda (peso/talla) en escuelas a 3 Kms de la frontera 

             

5,92 20,25

SP

64,80

7,17 1,87 DG 0,00 DL

0

20

40

60

80 %

  Los datos en el 2009 son ligeramente mejores  muy  superiores  en  el  2009,  pasando  de  una  con respecto a la desnutrición, pues se pasa a  obesidad  del  5,92%  al  16%,  lo  que  no  una desnutrición aguda del 1% y desnutrición  necesariamente  está  hablando  de  una  mejor  leve  del  5,8%,  sin  embargo  las  cifras  de  nutrición  sino  de  un  desbalance  nutricional  sobrepeso  y  obesidad,  son  notablemente  importante (Figura VII.15).    Figura VII.15. Nutrición aguda (peso/talla) en varones y mujeres de 6 a 17 años  OB

             

   

16.3

y

25.0

SP

51.9

PN 5.8

DL

1.0

DM

DG 0.0 0

10

20

30

Esta tendencia hacia la obesidad también va a  quedar  de  manifiesto  en  la  población  adulta 

40

50

60

%

con  la  medición  del  Índice  de  Masa  Corporal  (IMC).  

92 


población.  La  OMS  plantea  unas  tablas  de  26.4. Índice de Masa Corporal  valores  que  sirven  para  clasificar  el  estado    La  OMS  ha  definido  que  el  IMC  es  un  buen  nutricional  de  una  población.  El  IMC  resulta  indicador  para  establecer  el  estado  de  de dividir el peso en Kg de una persona por el  nutrición  y  la  calidad  nutricional  de  una  cuadrado de su talla en metros (Tabla VII.6).    Tabla VII.6. Clasificación del índice de masa corporal    Clasificación < 16  16 a 16,99 17 a 17,99 18 a 24,99 25 a 29,99 30 a 34,99 35 a 39,99 40 a 49,99 > 45 

93 

Significado Criterio de ingreso (Desnutrición severa) Infrapeso (Desnutrición moderada) Bajo peso (Desnutrición leve) Peso normal (Saludable) Sobrepeso (Obesidad grado I) Sobrepeso crónico (Obesidad grado II) Obesidad premórbida (Obesidad grado III) Obesidad mórbida (Obesidad grado IV) Obesidad hipermórbida (Obesidad grado V)

  Los  resultados  de  los  cuadros  siguientes  clara  tendencia  a  la  obesidad.  Esa  tendencia  demuestran  que  en  las  comunidades  de  es mayor en las mujeres donde el 64,1% tiene  frontera, después de dos años de las últimas  algún  grado  de  obesidad  o  sobrepeso,  fumigaciones  no  hay  desnutrición  en  la  llegando la primera al 29,7% frente al 7,8% de  población  mayor  de  18  años,  existiendo  una  los varones (Figuras VII.16 y VII.17).     Figura VII.16. Índice de masa corporal en el año 2009  60

56.3

50 Porcentaje

                   

35.9 35.9 34.4

40 30

19.5

20

0

10.2

7.8

10 0.0 0.0 0.00.0 0.00.0 DS DM DL

PN

Hombres

SP

O-I

0.0 O-II

0.00.0 O-III

Mujeres

  Figura VII.17. Índice de masa corporal  de individuos mayores a 15 años  58

60

               

Porcentaje

50 40 30

      41.7  

y

36.7

25

21.7

20 10 0

1 0.0 DS

2

0.0 DM

4

3

0.0 DL TOT AFEC

PN

SP

O-I

TOT NO AFEC

     

7 0.0 00.0 O-II O-III


Porcentaje

Las  cifras  facilitadas  por  la  OMS  en  el  2005  de  las  comunidades  no  afectadas  por  la  detallan que la obesidad en las mujeres en el  comunidad  petrolera  (Maldonado,  et  al.,  Ecuador  fue  del  16,7%  y  en  los  hombres  del  2008) (Figuras VII.18 y VII.19). Con respecto a  6,7%.  En  nuestro  estudio  se  observa  que  edades  se  observa  como  la  obesidad  se  da  estas cifras están ampliamente superadas en  más  en  personas  adultas,  existiendo  una  las mujeres y ligeramente en los hombres. Se  tendencia  creciente  en  los  porcentajes  de  puede  destacar  además  que  si  se  compara  esta  categoría,  y  esta  tendencia  comienza,  nuestro  estudio  con  los  realizados  por  tanto  en  hombres  como  en  mujeres  a  partir  Maldonado et al., el IMC es muy semejante al  de los 35 años.      Figura VII.18. Índice de masa corporal por edades en hombres    80 76.9     58.5 54.2 60 50  

 

40 20 0

33.3

PN 18-34a

  41.5 15.4

   

25

25

12.5 7.7 0.0 0.00.00.00   SP O-I O-II 35-44a   45-64a > 65a

    Figura VII.19. Índice de masa corporal por edades en mujeres 

Porcentaje

j   50 49.2   40.7   40 33.3 36.137.0 33.3 33.3 32.4   30 29.7   18.9 18.9 20   11.5 11.1 11.1   10 3.3 0.0   0   PN SP O-I O-II   18-34a 35-44a 45-64a > 65a     27. Valoración de la salud  20,4% como mala o muy mala (Figuras VII.20    y VII.21).  27.1. Percepción de la salud      Si  se  comparan  estos  resultados  de  la  La  percepción  de  salud  en  las  encuestas  percepción  en  salud  de  los  encuestados  con  familiares  para  los  jefes  de  familia,  dos  años  otros  estudios  realizados  en  la  misma  zona  después  de  las  últimas  aspersiones  aéreas,  amazónica,  se  encuentra  que  la  percepción  indican  que  se  considera  un  7%  como  muy  de  salud  es  mejor  que  la  percibida  en  las  buena o  buena, un 57,2% como regular y un  zonas  petroleras  de  la  Texaco  (Beristain,  et  35,7% como mala o muy mala. La percepción  al., 2009), y que la encontrada en los campos  de  salud  para  el  resto  de  la  familia  es  petroleros  de  Perenco,  aunque  inferior  a  ligeramente  mejor  con  un  14,5%  como  muy  aquellas  comunidades  que  no  tienen  buena o  buena, un 64,9% como regular y un  actividad petrolera ni son parte de la frontera  (Maldonado, et al., 2008) (Figura VII.22).     

94 


Figura VII.20. Percepción de la salud personal           

95 

                  Figura VII.21. Percepción de la salud familiar                               

70 60 50 40 64.96%

30 20 10 0

13.87%

17.52% 2.92%

0.73%

Buena Mala no famil Muy buena Regular Muy mala

Percepción de la Salud Familiar

Figura VII.22. Percepción de la salud a nivel personal                          27.2. Mortalidad familiar    En las encuestas familiares se encontró que el  22,22%  de  las  familias  habían  sufrido  la  muerte  de  un  familiar  mientras  residían  en  las fincas que ocupan en la actualidad (Figura  VII.23).  De  ese  total,  al  revisar  las  causas  de  muerte  se  encontró  un  55,8%  de  causas 

desconocidas o no diagnosticadas frente a un  32,35%  de  causas  de  cáncer  y  un  11,76%  de  asesinatos.  Los  casos  de  cáncer  fueron  diagnosticados  en  centros  hospitalarios  de  Sucumbíos, Quito o Colombia (Figura VII.24).     El  70,6%  de  las  muertes  se  produce  en  el  período  de  las  aspersiones  aéreas  del  Plan 


Colombia,  del  año  2000  al  2007.  Destacando  aquellos  en  donde  se  da  una  mayor  especialmente  los  años  2003  y  2004  como  mortalidad (Figura VII.25).    Figura VII.23. Muerte de un familiar                             Figura VII.24. Causa de muerte familiar    asesinado No   cáncer Cáncer Si 11.76%   murió de 22.22% repente   Other otro      50.0% 32.35%   77.78%     5.88%         Figura VII.25. Porcentaje por año de muerte familiar    1003 1996   1997   1998   1999 3.03%   2000 9.09%   3.03% 2001 6.06%   2002   2003 9.09% 9.09%   2004 6.06% 6.06%   2005   2006   2007   12.12% 2008 15.15%   2009       28. Salud materno‐infantil  mujeres estaban embarazadas. Las revisiones    se  hicieron  y  presentaron  buen  estado  Del  total  de  personas  encuestadas  y  general,  pero  algunas  de  ellas  manifestaron  chequeadas, 130 fueron mujeres con historia  no  haberse  controlado  médicamente  en  reproductiva. Todas ellas sumaron un total de  ningún momento.  731 embarazos. De ellas, 44 mujeres (33,84%)    tuvieron  todos  sus  hijos  antes  del  2001  28.1. Abortos  cuando  comenzaron  las  fumigaciones,  39  de    ellas  (30%)  solo  tuvieron  hijos  después  del  Antes  del  2001  el  número  de  abortos  era  de  incrementándose  tras  las  2000  y  49  de  ellas  (37,69%)  tuvieron  hijos  8,43%,  antes y después de estas fechas. El 73% de los  fumigaciones  a  un  12,7%.  Paralelamente  el  niños  nacieron  antes  del  2001  mientras  que  porcentaje  de  hijos  muertos  disminuye  del  el  27%  de  los  nacimientos  fue  después  del  12% al 9,14%, manteniéndose una tendencia  2000. La media es entre 5 y 6 embarazos por  de pérdida de vitalidad del 80,15% al 77,66%  mujer,  con  un  rango  de  entre  1  y  21  (Tablas VII.7 Y VII.8).  embarazos.  Durante  el  estudio  seis  de  estas   

96 


Tabla VII.7. Historia reproductiva antes y después del 2001    2001  Abortos  Muertos  Vivos  Antes  45  64  428  Después  25  18  153  Total  70  82  581 

Embarazos  534  197  731 

  Tabla VII.8. Porcentaje de historia reproductiva antes y después del 2001    2001  Abortos (%)  Muertos (%)  Vivos (%)  Antes  8,43  11,99  80,15  Después  12,69  9,14  77,66  Total  9,58  11,22  79,48 

97 

  Las causas de estos abortos son en un 64,3%  abortos  eran  causa  de  las  aspersiones  del  desconocida,  en  un  17,14%  responde  a  Plan  Colombia,  siendo  este  un  porcentaje  causas  emocionales  (muerte  del  marido,  muy  semejante  al  incremento  detectado  en  sustos,  antojos,  disgustos  familiares),  en  un  las  encuestas.  Pero  este  porcentaje  del  total  8,57% a traumatismos (golpes, caídas), en un  significa  un  8%  de  las  causas  de  aborto  para  7,14%  a  enfermedades  (febriles,  ectopias),  y  el  periodo  posterior  al  2000  (Figura  VII.26). en  un  2,86%  las  mujeres  refirieron  que  los    Figura VII.26. Causas de abortos    3% 7% 9%       17%   64%       No sabe Emocional Trauma Enfermedad Fumigaciones     28.2. Malformaciones  las  aspersiones  aéreas,  precisamente  entre    los  años  2001  al  2004.  Solo  una  se  dio  antes  En  las  encuestas  familiares  se  describieron  de este periodo y fue en el año 1995 (Figura  cinco  casos  de  malformaciones  congénitas.  VII.27). De ellas, el 80% fueron después de comenzar 

  Figura VII.27. Clasificación de las malformaciones en hijos                       


de los cuales el 60% son menores de edad (3  28.3. Mortalidad infantil y juvenil  a  14  años),  el  14,3%  de  los  casos  de  muerte    Las  causas  de  fallecimiento  de  los  82  hijos  por  violencia  se  deben  a  suicidios  y  el  fueron  muy  variadas.  El  17%  de  las  mismas  restante 14,3% tiene su origen en la violencia  fueron  por  causa  desconocida.  La  primera  intradomiciliaria contra los niños. Destacando  causa  de  muerte  son  en  el  40%  las  que  el  número  de  suicidios  para  esta  enfermedades  (de  ellas  diarreicas  el  21,9%,  población  es  equivalente  a  191  por  cada  fiebre  de  origen  desconocido  el  18,7%,  100000 habitantes, lo que resulta en una cifra  enfermedades  prevenibles  el  15,6%  [tétanos  excesivamente  alta,  pues  la  OMS  ha  el 9,4% y tos ferina el 6,2%], abdomen agudo  establecido  como  norma  una  cifra  de  18  por  en 12,5% y neumonías en 12,5%, siguiéndoles  cada  100000  habitantes.  La  cuarta  causa  de  en  menor  cantidad  la  meningitis,  anemias,  muerte  fue  definida  por  los  encuestados  parásitos y parálisis cerebral). En una segunda  como  causados  por  brujería  en  un  6%;  agrupación,  con  un  13%,  aparecen  las  siguiéndole  en  quinto  lugar  con  un  5%  los  enfermedades  ligadas  al  parto  (podálico,  fallecimientos  secundarios  a  las  aspersiones  prematuros)  con  niños  que  mueren  al  poco  del  Plan  Colombia  y  en  un  sexto  lugar  las  tiempo  después  de  nacer.  El  tercer  lugar  lo  muertes  por  leucemias  o  cáncer  que  ocupan con un 9% las muertes secundarias a  ocasionaron  el  4%  de  las  muertes  (Figura  la  violencia,  de  ellas  el  71,4%  son  asesinatos  VII.28).   Figura VII.28. Causas de hijos fallecidos    2% 1%1% 17%   2% 6% 4%   5%       9%   40% 13%   No sabe Enfermedad Parto   Violencia Fumig.P.C. Leucemia/cáncer     Accidente Mal aire Malformación   Culebra Envenenado

    Testimonios de la comunidad “Tuvo 5 hijos que murieron dos de ellos no sabe por qué”. “Tuvo  8  abortos  que  considera  fueron  espontáneos.  Se  le  murieron  4  hijos  por  meningitis,  dolor  abdominal, leucemia y el último ahogado. Su marido murió hace 13 años”.  “Tuvo 6 abortos y 4 hijos fallecidos antes de las fumigaciones”. “Vivían en la Dorada y mientras trabajaba le fumigaron y abortó de dos meses. Una hija de dos años  murió también, pues comían las yucas fumigadas. Otra de las hijas, con 8 meses empezó con vómitos  pero como había paro armado no la pudieron sacar y se murió a los 15 días de las fumigaciones. Entre  uno y otro hijo muerto pasaron 3 años. El refugio en Ecuador se debe a no poder vivir en Colombia por  las fumigaciones. La hija mayor, tras las fumigaciones, no recuerda lo que le dicen”. 

  28.4. Planificación familiar    De las 130 mujeres con historia reproductiva,  el  19%  ya  no  podía  tener  más  hijos  (menopausia),  el  30%  realizaba  planificación 

familiar  y  solo  el  51%  estaba  con  posibilidades de procreación.     Entre las mujeres que realizaban planificación  familiar,  el  32,5%  optó  por  la  ligadura  de  trompas,  un  32,5%  se  inclinó  por  los 

98 


99 

anticonceptivos de depósito intramuscular, el  por  algún  animal  (se  descartaron  las  25%  lo  hizo  por  los  anticonceptivos  orales  y  picaduras  por  congas,  arácnidos  o  alacranes,  un  10%  por  otro  tipo  de  métodos  (ritmo  y  T  centrándonos  solo  en  mamíferos  y  ofidios),  destacando especialmente las mordeduras de  de cobre).     perros  (70,4%)  y  serpientes  (22,4%).  Del  El 21,9% de ellas lleva planificando menos de  suceso  en  el  tiempo  se  destacó  que  hay  un  1 año; el 46,9% planifica entre 1 y 3 años; un  aumento  considerable  en  el  porcentaje  de  15,6%  lo  hace  entre  4  y  10  años  y  un  12,5%  mordeduras  de  perros  en  los  últimos  años,  pues  el  62,9%  de  las  mismas  se  produjeron  planifica por más de 10 años.   hace  menos  de  10  años,  frente  a  un  20,6%    que  se  produjeron  entre  10  y  20  años  y  un    29. Antecedentes personales  16,5%  de  mordeduras  hace  más  de  20  años;    sin  embargo  la  frecuencia  de  las  mismas  no  29.1. Mordeduras de animales  tiene  variación  para  las  serpientes  que  se    mantienen en un 40% para los periodos de 0‐ Del  total  de  las  personas  chequeadas,  98  10  años  y  de  11‐20  años,  dejando  un  20%  (18,8%)  manifestaron  haber  sido  mordidas  para  el  periodo  posterior  (Figura  VII.29).   Figura VII.29. Mordeduras de animales      Mono 1.0   Conejo 1.0   Chancho 1.0   2.0 Caballo   2.0 Gato   Serpiente 22.4   70.4 Perro     0 20 40 60 80 %      29.2. Intoxicaciones agudas  produjeron  antes,  hace  10  a  20  años  y  un    semejante 10,4% se dio hace más de 20 años.   Luego  de  las  entrevistas  realizadas  a  los    individuos  se  observó  que  el  9,4%  respondió  Para hacerse una idea de la extensión del uso  afirmativamente  sobre  la  adquisición  de  de  agrotóxicos,  de  las  144  familias  algún  tipo  de  intoxicación  sufrida.  Dentro  de  encuestadas  y  chequeadas,  84  dijeron  ese  grupo  de  individuos,  el  57%  dijo  haber  haberlos  usado,  es  decir,  el  58,3%  sufrido  intoxicación  con  pesticidas,  manifestaron un uso más o menos frecuente,  especialmente  por  el  uso  de  Furadán,  un 48,55% manifestaron usarlos cada mes, un  Gramoxone  y  glifosato;  el  6%  presentó  33,62%  refirieron  hacerlo  en  los  últimos  6  alergias por consumo de alimentos, el 2% por  meses,  el  7,76%  refirieron  usarlos  entre    los  consumo  de  cocaína,  destacando  que  en  un  últimos seis meses y un año, mientras que el  29% los afectados manifestaron haber sufrido  6% manifestó haberlo usado hace tres años y  intoxicación severa por las aspersiones aéreas  un 6% más de tres años.   del Plan Colombia. Este tipo de intoxicaciones    se ha dado sobre todo en los últimos 10 años  La frecuencia de uso de agrotóxicos se detalla  (con  un  77,1%),  mientras  que  un  12,5%  se  en la tabla VII.9.         


Tabla VII.9. Distribución del uso de agrotóxicos por familia  Distribución del uso de agrotóxicos por familias Familias SÍ agrotóxicos Familias NO agrotóxicos  #  % # %  8  53,3% 7 46,7%  3  33,3% 6 66,6%  2  18,2% 9 81,8%  15  93,75% 1 6,25%  13  92,8% 1 7,2%  13  72,2% 5 27,8%  5  41,6% 7 58,3%  6  30% 14 70%  10  76,9% 3 23,1%  9  56,25% 7 43,75% 

Comunidades  Chone 2  Yanamarum  Playera Oriental  Fuerzas Unidas  Puerto Escondido  Corazón Orense  Santa Marianita  San Francisco  Las Salinas  5 de Agosto 

Total  15  9  11  16  14  18  12  20  13  16 

 

29.2

      29.4. Hábitos    29.4.1. Tabaco    El tabaco es fumado de manera ocasional por  un 8,8%  de la población  adulta en reuniones  sociales.  El  consumo  sistemático  o  diario  se  produce  solo  entre  el  7,9%  de  la  población  adulta.  De  este  porcentaje,  el  63%  consume  solo  de  uno  a  tres  cigarrillos  por  día  con  un  rango de 1 a 40 años y una media de 16 años. 

1.0

0.8

0.4

0.2

0.2

ED A Ne um TB on ía Cp ul m on Le ar ish m an ia To sF er in a

1.7

de a De ng ue He pa t it is

4.0

fo i

m

o

4.2

Ti

         

35 30 25 20 15 10 5 0 Pa lu di s

     

Porcentaje

Del  total  de  la  población  estudiada  (521  29.3. Enfermedades infecciosas  personas  chequeadas),  239  son  adultos    (45,9%),  de  ellos  118  personas  manifestaron  Se manifestó haber sufrido de paludismo casi  usar  agrotóxicos,  lo  que  equivale  a  que  el  en  un  tercio  de  la  población,  las  49,4%  de  la  población  adulta  los  usa,  pero  enfermedades  por  contaminación  de  agua  además  11  menores  de  edad  los  aplican  en  (tifoidea,  hepatitis,  EDA)  tuvieron  edades entre 11 y 17 años, lo que equivale al  antecedentes  en  un  6,7%,  muy  semejantes  a  9,3%  de  quienes  los  utilizan.  Un  dato  quienes  han  sufrido  de  dengue,  y  a  mayor  importante  es  que  poco  más  de  un  tercio  distancia  los  problemas  respiratorios  tipo  (36,44%)  son  mujeres  que  aplican  los  neumonía y tuberculosis (TBC) (Figura VII.30). químicos tanto en la casa como en la finca.      Figura VII.30. Antecedentes de enfermedades transmisibles 

El  31,5%  refiere  fumar  de  cuatro  a  diez  cigarrillos  diarios  en  un  rango  entre  8  y  40  años  lo  que  da  un  promedio  de  18  años.  Mientras  que  el  5%  restante  tiene  un  consumo  de  veinte  cigarrillos  durante  40  años.     29.4.2. Alcohol    El  35,15%  de  adultos  encuestados  refirieron  consumir  alcohol  en  eventos  sociales, 

100


101 

mientras  que  el  4,75%  de  los  consumidores  medicamentos que se estaban tomando en el  habituales eran menores de edad.  momento  de  los  chequeos  siguieron  la    siguiente  distribución:  el  17,7%  de  la  Aparte  de  ellos,  el  1,67%  de  los  adultos  población  estaba  tomando  medicinas.  Solo  manifestó  tomar  de  una  a  dos  veces  por  una  persona  (0.19%)  manifestó  estar  semana  y    haberlo  hecho  durante  32  a  40  tomando  hierbas  medicinales.  De  las  años. Una de las personas manifestó haberlo  personas  que  tomaban  medicinas  36,9%  dejado  hace  un  año  pues  fue  diagnosticada  tomaban  vitaminas,  el  27,2%  tomaban  antiparasitarios,  17,4%  tomaba  antibióticos,  de cirrosis.  13%  anticonceptivos,  6,5%  analgésicos,  5,4%    antihipertensivos, con 3% antiinflamatorios y  29.4.3. Droga    antigripales,  antiácidos  un  2%  y  1%  Nadie  manifestó  tomar  algún  tipo  de  tratamientos para el colesterol.  estupefacientes.  Solo  una  persona  indígena    manifestó  haber  tomado  en  varias  ocasiones    ayahuasca  con  carácter  médico,  y  una  30. Impacto  de  las  aspersiones  aéreas  a  la  persona  colombiana  manifestó  haber  salud  consumido base de cocaína hace 9 años.      30.1. Efectos  de  las  aspersiones  a  la  salud  29.5. Consumo de medicamentos  de los pobladores      En  varias  de  las  comunidades  visitadas  No  resulta  extraño,  teniendo  en  cuenta  que  refirieron  que  el  Ministerio  de  Salud  Pública  en  casi  la  mitad  de  las  casas  entraban  las  había  pasado  en  brigadas  la  semana  en  que  sustancias  asperjadas,  que  el  84,73%  de  las  se  realizaron  las  encuestas,  por  lo  que  los  familias  haya  dicho  que  algún  familiar  se  índices del uso de medicamentos no van a ser  enfermó  durante  las  aspersiones  aéreas  fieles  a  lo  que  pasa  realmente  en  las  (Figura VII.31).  comunidades,  con  esta  aclaración  el  tipo  de    Figura VII.31. Porcentaje de enfermos durante las aspersiones 

                        o  problemas  de  piel  (8,84%).  Después  de  las  aspersiones  los  problemas  de  piel  suben  al  primer  puesto  (27,4%),  se  mantienen  los  dolores  de  cabeza  (17,44%)  mientras  disminuye  el  malestar  general  (8,19%),  los  problemas  digestivos  (6,76%),  procesos  febriles  (6,41%)  y  los  problemas  a  los  ojos  (4,63%) (Tabla VII.10). 

Los  jefes  de  familia  reconocieron  que  el  81,6%  de  ellos  como  entrevistados  sufrieron  algún  tipo  de  patología  física  durante  las  aspersiones  aéreas,  destacando  que  las  más  frecuentes  fueron  manifestaciones  respiratorias 19%, manifestaciones digestivas  17,67%,  problemas  oftalmológicos  (14,88%),  del  sistema  nervioso  central  (SNC)  (14,88%),   


Tabla VII.10. Estragos durante y después de las aspersiones 

   

Entrevistado 

Estragos durante aspersiones Físico  Psicológico Estragos  %  Estragos % Problemas  19,07  Miedo 51,32 respiratorios  Nada  18,14  Nada 11,84 Mareo, desmayo,  17,67  Preocupación 7,89 náusea  Problemas  14,88  Nervioso 5,30 oftalmológicos  Cefalea  14,88  Triste 5,30 Problemas  8,84  Curiosidad 4,60 dermatológicos    Tranquilo 3,30   Otros 

Total 

6,51  100 

Otros

10,45 100

Estragos después aspersiones  Físico Psicológico  Estragos % Estrago  % Problemas  27,4 Miedo  25 dermatológicos  Cefalea 17,44  Preocupación  18,6 Malestar 8,19 Triste  16,7 Fiebre

6,41

Nada 

10,3

Náusea Fiebre

8,19 6,41

Tranquilo  Nervioso 

7,1 5,8

Diarrea Problemas  oftalmológicos  Otros

6,05 4,63

Desesperación  Necesidad 

5,8 2,6

16,71  100

Otros   

8,1 100

  Testimonios de la comunidad “El médico que nos atendió en el 2002 dijo que después de las aspersiones estaba recibiendo muchos  pacientes”.  “Me  hice  atender  con  el  doctor  porque  tenía  fuertes  dolores  de  cabeza  que  casi  perdía  el  conocimiento,  me  mandaron  hacerme  una  tomografía,  me  hice  el  examen  y  dijeron  que  no  salió  nada”.  “Tuve 1 aborto y 2 niños fallecidos”.  “Olga  estaba  embarazada  en  el  2006  cuando  fumigaron  en  2  ocasiones.  A  los  3  meses  de  una  fumigación estuvo hospitalizada 15 días con pulmonía. Luego, al mes de otra fumigación dio a luz y su  hija murió a los 8 días con hidrocefalia”.  “Aborté 2 meses pasadas las fumigaciones del 2001”.  

Las  manifestaciones  psicológicas  manifestaron  tenerlas  el  84,86%  de  la  población,  mientras  un  15,14%  de  los  encuestados  describieron  haber  sentido  tranquilidad o no haber sentido preocupación  alguna.  Entre  ellos  el  miedo  fue  la  reacción  más  frecuente  (51,3%),  seguido  de  preocupación  (7,9%),  nervios  (5,3%),  tristeza 

(5,3%)  o  curiosidad  (4,6%).  Destaca  que  tras  el  periodo  de  las  aspersiones,  cuando  las  avionetas desaparecen, disminuyó el miedo a  la  mitad  (25%),  pero  se  duplicó  la  preocupación  (18,6%)  de  qué  pasaría,  se  triplicó la tristeza (16,7%) al ver los impactos  de  las  aspersiones  y  se  mantuvo  el  nerviosismo (5,8%) (Tabla VII.10). 

  Testimonios de la comunidad “Durante las fumigaciones estábamos atemorizados de que vayan a lanzar una bomba. Después de  las  fumigaciones  sentimos  desesperación  porque  ya  no  teníamos  que  comer.  Los  hijos  estaban  molestos porque no teníamos para darles de comer”.  “Estaban tristes y con rabia porque no tenían con qué alimentar a sus hijos, por la pérdida de cultivos  después de las fumigaciones”.  “Después de las aspersiones uno se queda medio aprisionada, con tristeza y apuro por la pérdida de  tierras”.  “Durante  las  fumigaciones  sentíamos  que  era  el  fin  del  mundo,  le  vienen  a  fumigar  a  uno  como  cucarachas. Teníamos miedo y pesadillas, llegaron los paras y empezaron a matar”.  “Estábamos  preocupados  y  sufríamos  sin  animales,  ni  cultivos  y  con  enfermedades,  sin  tener  que  comer ni vender. Era un sufrimiento amargo, por eso mucha gente vendió sus fincas”. 

 

102


La  percepción  de  lo  que  les  pasó  a  otros  digestivos (12,1%), dolores de cabeza (11,5%)  miembros  de  la  familia  es  ligeramente  y  problemas  de  piel  (10,3%).  Después  de  las  diferente,  así  quienes  dieron  las  entrevistas  aspersiones  se  observó  como  los  problemas  familiares no identificaron en el momento de  de piel se incrementaron notablemente hasta  las  aspersiones  ningún  tipo  de  problemas  al  en  tres  veces  (30,9%),  se  mantuvo  el  27%  de  sus  parejas,  encontrando  porcentaje  de  dolores  de  cabeza  (14,3%)  y  nuevamente  que  los  principales  problemas  disminuyeron los problemas digestivos (8,5%)  en  ellos  fueron  los  respiratorios  (13,3%),  y oftalmológicos (5,8%) (Tabla VII.11).    Tabla VII.11. Estragos de las parejas durante y después de las aspersiones 

  103 

 

Estragos durante aspersiones Físico  Psicológico Estragos %  Estragos % Nada  27,3  Miedo 48,31

Entrevistado 

Total 

Problemas  respiratorios  Mareo,  desmayo,  náusea   Cefalea   Problemas  oftalmológicos  Problemas  dermatológicos    Otros   

13,3 

Nada

15,3

12,1 

Preocupación

9,32

11,5  11,5 

Desesperación Curiosidad

5,9 5,1

10,3 

Tristeza

5,1

  14  100 

  Otros  

10,17 100

Estragos después aspersiones  Físico Psicológico  Estragos % Estrago  % Problemas  30,9 Miedo  26,1 dermatológicos  Cefalea 14,3 Preocupación  21,01 Mareo,  desmayo,  náusea  Fiebre Problemas  oftalmológicos  Diarrea Problemas  respiratorios  Otros

8,5

Triste 

14,3

7,2 5,8

Nada  Desesperación 

12,6 5

5,4

Tranquilo  

4,2

5,4

 

22,5 100

Otros   

16,79 100

  En  el  aspecto  psicológico  se  reconoció  por  igual que en la mitad de las parejas (48,31%)  el miedo tuvo una importante presencia, que  después  de  las  aspersiones  se  reduce  a  la  mitad  (26,1%).  La  preocupación  que  durante  las  aspersiones  es  secundaria  al  miedo,  con 

un  9,32%,  se  eleva  después  a  un  21%,  así  como  la  tristeza  que  se  triplica  de  5,1%  a  14,3%,  mientras  la  desesperación  se  mantiene alrededor del 5% (Tabla VII.11). Sin  embargo  los  testimonios  sí  hablan  de  graves  afectaciones  después  de  las  aspersiones:

  Testimonios de la comunidad “A Asunción Cango de 50 años le cayó directo las brisas de las fumigaciones. Murió en el 2002 con  dolor de estómago, el doctor dijo que era intoxicación por fumigaciones lo que le afectó”.  “Estábamos preocupados porque le cayó químico a mi hermana. Podíamos ver los pilotos saludando  desde  las  avionetas  cuando  vivíamos  en  Puerto  Mestanza.  Mi  hermana  Juditn  murió  de  cáncer  hepático en el 2005, le detectaron en noviembre del 2004 en Bogotá luego de que en Lago Agrio no le  detectaron nada. En ese tiempo vivíamos en Puerto Mestanza, estaba lavando en el Río San Miguel  con  su  madre,  cuando  pasaron  las  avionetas  y  ella  se  quedó  bañada  en  los  químicos  que  lanzaron.  Aproximadamente 5 meses después le diagnosticaron cáncer”.  “A mi esposa le dio cáncer de útero en el 2004, le hicieron histerectomía”. “Mi nieta Martha Ordóñez era teniente de la Junta General Farfán y tuvo que hacer un recorrido por  la frontera por el tema de fumigaciones, poco tiempo después en el 2006 sufrió mareos y ahora tiene  una parálisis que la tiene en cama 3 años”.  “Mi  hermano  Luís  Cabrera  murió  en  el  2006,  tenía  dificultad  para  respirar,  cayó  inconsciente.  Le  atendieron  en  Quito  y  luego  en  Loja  donde  murió.  Mi  hermano  tomaba  agua  de  la  tierra  y  seguramente tomó agua que rociaron las avionetas. El tenía 80 años pero seguía trabajando la finca y  cargando costales pesados al hombro, él era de Vilcabamba”.  “Esperanza Silva estaba cosechando café y le cayó brisa de la avioneta, la finca era a la orilla del río.  Le salió fuegos en la boca y el doctor dijo que tenía fuegos por dentro. Murió bien flaquita”. 


Los  impactos  a  los  niños  también  fueron  (11,7%), dolores de cabeza en el 11,1% y 7,6%  registrados.  Durante  las  aspersiones,  un  en  problemas  de  los  ojos.  Mientras  que  tras  26,3%  no  sufrió  impactos  físicos,  siendo  sus  las  aspersiones  los  problemas  de  piel  se  principales  afectaciones  las  digestivas  (17%),  triplicaron  (35,8%)  y  se  mantuvieron  los  respiratorias  (12,3%),  dermatológicas  dolores de cabeza (9%) (Tabla VII.12).     Tabla VII.12. Estragos en los niños durante y después las aspersiones      Estragos Nada 

Entrevistado 

Total 

Estragos durante aspersiones Físico  Psicológico %  Estragos % 26,3 Miedo 49,6

Mareo,  desmayo,  náusea   Problemas  respiratorios  Problemas  oftalmológicos   Cefalea  Problemas  dermatológicos  Otros   

Nada

24,4

Estragos después aspersiones  Físico Psicológico  Estragos % Estrago  % Problemas  35,8  Miedo  28,2 dermatológicos  Fiebre 11,2  Nada   23,1

12,3

Lloraban

8,9

Diarrea 

11,2 

11,7

Curiosidad

7,3

Cefalea

11,1

Gritaban

2,4

Mareo, desmayo,  náusea   Problemas  estomacales  Otros

17 

7,6  13.9 100 

Otros

7,4 100

Triste 

8,5

9

Decaído 

8,5

7,8

Tranquilo 

6,8

6,3

Traumado 

5,1

18,7  100 

Otros   

19,8 100

  Testimonios de la comunidad “El doctor dijo que los niños tenían alergia por las fumigaciones porque una multitud de gente llegaba  por lo mismo”.  “En el 2003 Nina Pacari fue a visitar a mi  hijo en el Hospital Baca Ortiz, él murió de cáncer. Un día  después  de  que  las  avionetas  fumigaran  cerca  de  la  casa,  mi  hijo  perdió  el  equilibrio  y  se  cayó  con  dolor de cabeza. En el Hospital de Lago Agrio no le diagnosticaron, no querían darle cama, luego no le  atendían bien y [el papá] pidió un vuelo de urgencia a Quito. Mi hijo murió 3 meses y medio después  de las fumigaciones del 2003”.  “Mi hija murió una semana después de la fumigación, mi hijo enfermó a los pocos meses del corazón y  respiración. El doctor que les atendió nos dijo que salgamos de ahí porque los niños pequeños no iban  a resistir”.  “Mi  esposa  estuvo  muy  grave  8  días  después  de  las  aspersiones,  desmayada  tuve  que  llevarla  a  un  curandero.  Pensaba  que  se  iba  a  morir y me  recomendaba que  cuide  al  niño  si  se moría.  Yo  estaba  triste”. 

  Los  impactos  psicológicos  cuyos  padres  describieron  haber  afectado  al  49,6%  de  sus  hijos, después de las aspersiones se redujo a  un  28,2%,  así  también  presentaron  tristeza  un  8,5%  de  niños  y  solo  un  27,9%   

presentaron  manifestaciones  de  tranquilidad  o  como  si  nada  les  hubiese  pasado,  sin  embargo  en  ellos  las  agresiones  fueron  notables:

Testimonios de la comunidad “Los niños lloraban y temblaban, gritaban que les iban a matar. Ya no quisieron ir a estudiar más. Les  cogió cuando regresaban de la escuela y el niño se espantó. A todos los 4 les hice curar del espanto.  Volvieron a la escuela 1 mes después”.  “Mi hijo se retiró de la escuela 3 años. Los padres no les mandaban a clases hasta que se curen y los  maestros los regresaban porque tenían náuseas”.  “Después de las aspersiones, sufría por el temor de los niños, tenían miedo de que vuelvan”.  “Los niños hasta ahora se siguen asustando, preguntan cuando oyen, tienen tristeza y pesadillas”.  “Mi hijo mayor, casado, se puso muy nervioso, no dormía ni comía, se puso muy flaco. Al año fuimos 

104


al  psicólogo en  Quito,  al Eugenio  Espejo. Mi  otro  hijo  de  13 años  tiene  un  problema  psicológico,  se  queda aletargado y llora, está así desde que tenía 8 años. Al ver los aviones gritó y temblaba cuando  vio los helicópteros a la noche, en diciembre del 2002, creemos que fue eso lo que le traumó. Estaban  bombardeando a Colombia pero cruzaron a Ecuador, todos nos escondimos bajo las mesas del susto.  Por la enfermedad de mi hijo vendimos las vacas flacas perdiendo”.  “No sirvió el tratamiento médico, se curó y 5 meses después enfermó de nuevo hasta que le llevaron  al yerbatero”. 

 

105 

La mayoría de las familias reportó que el año  Tras  las  aspersiones  aéreas  las  familias  con  más  impactos  visibles  fue  el  2002,  denunciaron  la  aparición  de  casos  graves  de  correspondiendo  a  este  año  el  mayor  enfermedad  en  el  60,9%  de  las  familias  porcentaje de casos de enfermedades graves.  (Figura VII.32).    Figura VII.32. Porcentaje de enfermedades graves por año 

                     

2000 4.44%

2001

4.44% 15.56%

2002 2003

13.33%

2004 2005

15.56%

2006

24.44%

13.33%

2007

2008             El 60% de individuos que recibieron atención  como  los  subcentros,  hospitales  provinciales  médica dijo haberles servido mientras que un  o  nacionales.  La  dispersión  de  estas  40%  no.  La  mayoría  de  estas  enfermedades  patologías no fue recogida por los centros de  graves fueron atendidas en clínicas privadas o  salud  y  no  se  despertaron  las  alarmas  consultorios, seguidos de los centros públicos  epidemiológicas (Figura VII.33).    Figura VII.33. Lugares de diagnóstico de enfermedades graves                               

Centro Salud Clínica San José

13.95%

curandero

4.65%

doctor particular Eugenio Espejo

34.88%

H.Marco Vinicio Iza

6.98%

Médicina natural 9.3% 4.65%

4.65%

Nadie Solca Other otro 

4.65%

9.3%


manifestaciones  clínicas  que  hemos  30.2. Tipos de patologías    respetado  como  fueron  recogidas  por  los    Durante  los  diferentes  períodos  de  las  médicos  que  hicieron  los  chequeos  médicos.  aspersiones  aéreas  la  población  declaró  Dichas  manifestaciones  hacen  referencia  a  haber  padecido  las  siguientes  problemas en:    Ojos: Pérdida de vista, irritación con ojos rojos, lagrimeo y ardor.    Testimonio médico “Tras las fumigaciones refiere mareos y pérdida de vista”. “Refiere que desde que recibió las fumigaciones del Plan Colombia tiene irritación ocular y perdió la  vista”.  “Con las fumigaciones perdió parte de la vista, se mareó y tuvo vómitos”. “Cuando vinieron las fumigaciones del Plan Colombia él estaba trabajando junto al río y sintió dolor  de cabeza, ardor de vista y dolor en la cintura”. 

  Digestivo: Náuseas y mareos. Falta de apetito y cansancio. Diarreas y fiebre.      Testimonio médico “En la intoxicación sufrió de mareos, vómitos y cefaleas”. “En el 2002 tras las fumigaciones sufrió de falta de apetito y astenia”. “Con las primeras fumigaciones sufrió de vómitos y diarrea y la piel se le llenó de granos”.  “Afectada por las fumigaciones como toda la familia con náuseas, vómitos y fiebre”. 

  Respiratorio: Ahogos, dificultad respiratoria, falta de aire y secreción rinofaríngea. 

  Testimonio médico “Hace  6  años  cuando  fumigaron  sintió  dolores  de  cabeza,  se  ‘atajaba’  la  respiración  y  no  podía  respirar”.  “Después  de  las  aspersiones  tuvo  dificultad  respiratoria  sin  cianosis.  Sufre  de  desesperación  y  sensación de falta de aire, desolación tras las fumigaciones”. 

  Piel: Presencia de granos, comezón, vitíligo, lesiones descamativas máculo‐papulares.    Testimonio médico “En  las  fumigaciones  del  2003  tuvo  erupción  cutánea  en  tronco  y  extremidades  de  2‐3  meses  de  duración que reaparecía al bañarse, durándole como año y medio. Lo tenía toda la familia”.  “Sin  antecedentes  previos  comenzó  a  desarrollar  el  vitíligo  después  de  las  fumigaciones  con  glifosato”.  “El vitíligo refiere que le salió después de las aspersiones aéreas”. “Refiere que cuando fumigaron tuvo cuadro muy pruriginoso. “Durante  las  fumigaciones  de  hace  7  años  presentó  lesiones  descamativas  generalizadas  de  tipo  máculo‐papulares”.  “Con las fumigaciones del P.C. sufrieron de vómitos, diarrea y cefalea en los dos hijos mayores; en el  menor de 1 año tuvo pérdida de pelo y caída de uñas”.  “Después de las fumigaciones refiere prurito intenso además de cefaleas persistentes”.  “Refiere un cuadro de fiebre con dolor de cabeza, diarrea y erupción cutánea de 1 semana tanto en  niños como en padres después de las fumigaciones”.  “Fue  atendido  en  Colombia,  el  médico  dijo  que  era  por  las  fumigaciones,  le  pusieron  inyecciones  y  pastillas, dijo que era como intoxicación a la piel. Se fueron hasta que pasaran las fumigaciones”. 

  Embarazo:  Se  describieron  casos  de  aborto  y  mayor  número  de  malformaciones.

106


Testimonio médico “Embarazada  de  6  meses  sufrió  de  exposición  a  las  fumigaciones  del  lado  colombiano  con  cefalea,  fatiga y sangrado vaginal que casi le hace abortar”.  “Algunas mujeres abortaron estando de pocos meses”.

  Mortalidad infantil: Se incrementó el número de niños que fallecían tras las aspersiones.    Testimonio médico “Los  dos  hijos  que  perdió  fueron  tras  las  fumigaciones,  una  en  el  2001  por  gastroenteritis  aguda  y  fiebre, cuando tenía un año de edad, la segunda hija murió con una malformación en el cuello en el  2003 con 3 meses de vida”.  “Su hijo murió en el 2001 poco después de las fumigaciones, con un mes y medio de vida. Lo llevaron  al  Hospital  de  Lago  y  al  Dr.  Gonzabay.  Primero  dijeron  que  era  paludismo  (los  análisis  no  lo  confirmaron) y murió a pesar del tratamiento. Tenía la piel muy inflamada y los pies deformes”.  “En el 2001 muere una hija de 3 meses de edad y en el 2003 otro de 4 meses. Los dos mueren con  diarreas, vómitos y fiebre, que ella relaciona con fumigaciones. Las muertes se producen una semana  después de las aspersiones”. 

107 

  Odontología: Se describió un caso de abscesos peridentarios. 

  Testimonio médico “Hace 5 años, inmediatamente después de las fumigaciones, comenzó a tener abscesos peridentarios  que le hicieron caer todos los dientes”. 

  Locomotor: Se describieron dolores articulares y de huesos largos.    Testimonio médico “Desde las fumigaciones padece de artralgias, cefaleas e irritación ocular con ardor en plantas de los  pies”.  “Refiere  cefaleas  y  dolor  abdominal  tras  la  exposición  a  las  fumigaciones  además  de  "quemazón"  y  dolor en piernas así como ardor en los ojos que también relaciona con fumigaciones”. 

  Cansancio y debilidad: Cansancio y debilidad.    Testimonio médico  “Refiere astenia desde las fumigaciones del 2002”.  “Durante  las  fumigaciones  del  Plan  Colombia  sufrió  con  debilidad,  cefaleas,  vómitos  y  oscurecimiento de la vista con granazón del cuerpo”. 

  Sistema nervioso central: Dolores de cabeza, pérdida de conocimiento y desmayos.    Testimonio médico “Cuando fumigaron los aviones padeció cefaleas y náuseas”. “En el 2002 se intoxicó con las aspersiones aéreas. Tenía 8 meses y se puso morado, envenenado. Los  padres le vieron una tumoración a nivel de hígado.  Tiene retraso escolar. Los otros hermanos no”.  “Ha  sido  revisado  en  neurología  en  dos  ocasiones  por  cefaleas  intensas  de  6  años  de  evolución,  con  tratamiento de 3 años. Actualmente, sin tratamiento, mantiene ciertas molestias”.  “En  el  2002  se  le  diagnosticó  hidrocefalia  y  en  el  2006  se  operó  con  un drenaje.  No  asiste  a  control  neurológico por falta de recursos económicos. Tiene convulsiones frecuentes que han sido tratadas con  Tegretol de 200 mg, pero no sigue control ni medición de niveles”. 


Psicológico:  Insomnio,  desánimo,  tristeza,  preocupaciones  persistentes,  ansiedad,  miedo,  angustia, psicosis, pesadillas, pérdida del habla. Quizás este haya sido uno de los aspectos más  graves y ocultos de los que la población haya sufrido.    Testimonio médico “Refiere clínica depresiva desde hace años (insomnio, desánimo, preocupaciones persistentes) y desde  las fumigaciones decaimiento y fatiga. Refiere cuadro rino‐faríngeo cuando recibió las fumigaciones.  Desde hace 3 años dejó de fumigar”.  “Siente ansiedad y miedo por las fumigaciones cuando pasan aviones”. “Tiene miedo de que vuelvan las fumigaciones y los productos no vuelvan a cargar”.  “Durante  las  fumigaciones  tuvo  cefaleas,  vómitos,  y  lesiones  cutáneas  así  como  problemas  psicosomáticos, angustia, sensación de falta de aire”.  “Durante las fumigaciones el niño no podía dormir y lloraba intensamente hasta que lo sacaban fuera  de la casa”. 

  En  todas  las  asambleas  comunitarias  se  mencionó que las aspersiones se vivieron con  preocupación  y  con  miedo  tanto  de  adultos  como  de  los  niños.  El  miedo  es  a  las  enfermedades,  pero  también  a  la  violencia  y  a  que  se  repitan  las  aspersiones  y  sus 

impactos.  Los  niños  siguen  “espantados”  y  “se  esconden  cada  vez  que  escuchan  un  avión”,  pero  también  los  adultos  dejaron  de  sembrar  como  antes  y  mencionaron  “estar  mal psicológicamente”. 

  Testimonios de la comunidad “Desde ahí tengo a mi hijo Juan Giovanni de 10 años que no habla, es muy tímido. Yo digo que se me  espantó, le hablan duro y le agarra tembladera. No quería venir al chequeo, estaba escondido y dijo  que no quería venir porque van a mandar el avión. Se quedó espantadito”.  “Los niños sueñan con la muerte de la madre y las hijas con avionetas que les disparaban”.  “Yo soy muy nerviosa desde las fumigaciones, me desespero y salgo corriendo a donde los vecinos”. “Los  niños  tenían  temor  y  lloraban  durante  las  fumigaciones,  los primeros  días  se  pasaron  a  dormir  con los papás. Tenemos miedo de que los que andaban resguardando disparen al Ecuador”. 

    31. Chequeos médicos    Se  realizó  una  revisión  médica  a  un  total  de  521  individuos.  Los  resultados  que  se  describen a continuación son un indicador de  la  situación  en  la  salud  de  la  frontera  norte  después  de  dos  años  de  las  últimas  aspersiones  aéreas  del  Plan  Colombia.  Del 

total  de  las  personas  chequeadas,  312  (59,88%)  manifestaron  tener  algún  tipo  de  molestia  mientras  que  un  40,11%  dijo  no  tener  alguna  enfermedad  y  encontrarse  con  buena  salud.  Los  malestares  con  mayor  frecuencia  de  la  población  venían  del  SNC,  aparato  locomotor,  aparato  digestivo,  piel  y  aparato respiratorio (Figura VII.34). 

  Figura VII.34. Porcentaje de molestias por órgano 

                 

Molestias por aparatos 1% 1% 0% 3% 3% 3% 5%

SNC SNC Locomotor Digestivo Piel

20%

Respiratorio Ojos

6%

ORL Genitourin.

6%

Fiebre

7%

20%

CardioCirc. Inespecífico

8% 17%

Psicológico Endocrino Odontológico

108


alimentos  (sardina,  sábila)  o  por  causa  del  31.1. Alergias    polvo.  Ninguno  de  ellos  se  había  hecho  Este tipo de patología estuvo presente en 17  estudios  más  específicos  para  conocer  las  personas (3,26%) las cuales manifestaron que  causas  más  profundas  de  su  enfermedad.  en  la  mitad  de  los  casos  no  conocen  las  Habían sido diagnosticados por médicos en su  causas  de  las  mismas.  En  casi  un  tercio  momento  sin  haber  recibido  más  que  la  dijeron  ser  de  causa  medicamentosa  advertencia médica (Figura VII.35).  (penicilina,  albendazol  y  cloroquina),  por    Figura VII.35. Causas de alergias    50 45

47.06

40 35 Porcentajes

                   

30 25

29.41

20 15

17.65

10 5

5.88

0 No sabe

Medicamentos

Alimentos

Polvo

  menos en uno de los ojos, lo que supone una  31.2. Ojos  afectación del 10,84% de la población que se    A 148 individuos, que representa el 28,4% de  hizo  esta  prueba.  De  todos  ellos,  31  la  población  analizada,  se  le  encontraron  individuos  (7,31%)  presentaron  pérdida  de  problemas  oculares,  entre  los  que  destacan  más  del  60%  de  agudeza  visual  en  los  dos  especialmente  el  pterigium  (14,01%)  y  la  ojos,  sin  que  tuvieran  acceso  a  lentes.  Esto  presbicia  (13,24%),  el  2,3%  de  la  población  hace que sumando los casos de presbicia (69)  presentó  conjuntivitis  de  origen  viral  o  con  la  pérdida  de  agudeza  visual  (31)  y  bacteriano,  el  0,96%  presentó  cataratas,  el  restando las coincidencias de padecer las dos  0,77%  presentó  ardor  inespecífico,  el  0,58%  cosas  (17),  casi  una  de  cada  cinco  personas  tuvo traumatismos, el 0,58% tuvo estrabismo  (19,57%)  en  la  frontera  se  encuentran  necesitando  de  lentes  correctores,  y  éstos  y el 0,58% orzuelos (Figura VII.36).  sean  imprescindibles  para  el  4%  (17)  que    También  se  observó  que  46  personas  sufre de presbicia y pérdida de agudeza visual  presentaron  pérdida  de  agudeza  visual  de  (Figura VII.36).  más de un 60% de la vista a larga distancia al    Figura VII.36. Ojos    16 14.01 13.24   14   12            

Porcentaje

109 

10

8 6 4 2

2.30

0.96

0.77

0.58

0.58

0.58

0 o o s r m is ia ri giu res bic j untiv it atar ata Ardo matis m tr abis m O rz uelo Pte u P C Es Con Tra


hemorroides  en  el  0,77%  y  hepatitis  en  el  31.3. Sistema digestivo  0,19%  de  la  población.  Los  problemas    A 237 individuos, que corresponde al 45,48%  digestivos se relacionan directamente con los  de  la  población  analizada,  se  le  diagnosticó  problemas  en  el  desbalance  nutritivo,  mala  enfermedades  y  problemas  digestivos  alimentación,  escasos  procesos  de  higiene  distribuidos  de  la  siguiente  manera:  tanto del distribuidor de alimentos como del  parasitosis en el 31,29%, gastritis y úlceras en  manejo  y  preparación  de  los  mismos,  el  9,41%,  enfermedades  diarreicas  en  el  generando  el  desarrollo  de  parásitos  (Figura  3,65%, cálculos en la vesícula en el 1,54% así  VII.37).  como hernias (umbilical, inguinal y de hiato),    Figura VII.37. Digestivo       

35

31.29

30 25 20

 

15

 

10

7.49

3.65 1.92 5   1.54 1.54 0.77 0.19 0.19   0   s s is Ed a e ra ilia r ias   e s ro sis a titi ito strit c n l d s B i r . r Ú L it rá Ga   H e o rro C i H ep Pa m   He     31.4. Piel      Patologías  hiperpigmentarias  (4,03%):  Presentaron enfermedades o problemas en la  Cloasma (3,07%) y nevus (0,96%).  piel  283  personas  (54,31%)  repartidas  en  33    tipos diferentes de patologías (Figura VII.38).  Patologías  inespecíficas  (2,69%):  Sarpullido  Se  agruparon  las  patologías  de  la  siguiente  (0,58%),  prurigo  (1,73%),  granuloma  (0,19%),  manera:  ictericia (0,19%).      Enfermedades  por  hongos  (39,2%):  Tiña  Infecciones  virales  (2,1%):  Verrugas  (1,34%),  versicolor  (15,5%),  tiña  pedis  (9,98%),  herpes (0,38%), exantema viral (0,38%).  onicomicosis  (7,49%),  tiña  corporis  (4,41%),    candidiasis  (1,34%),  dermatitis  seborreica  Infecciones  parasitarias  (1,34%):  Escabiosis  (0,76%), leishmania (0,38%) y miasis (0,19%).  (0,38%).      Patologías  por  alteraciones  inmunológicas  Cicatrices  (1,15%):  Cicatrices  (0,96%)  y  (6,52%):  Dermatitis  de  contacto  (4,03%),  lesiones postfumigación (0,19%).  liquen  (1,73%),  vitíligo  (0,58%),  eccemas     Otros:  Heridas  (1,15%),  lipomas  (0,76%),  (0,19%).  angiomas (0,57%) y úlceras (0,19%).    Infecciones  bacterianas  (6,33%):  Piodermis  (4,99%),  acné  (0,77%),  tuberculosis  ganglionar (0,38%) y quiste pilonidal (0,19%).  

110


Figura VII.38. Piel  PIEL

40 39.2

 

35

 

 

Porcentaje

 

30

 

25 20 15

6.5

10 5

  0   . t   s is l óg na en as les i as l es as ma as as co uno teri a i gm n tom V ira si tar ric ia er id li po g iom lc er i Ú p M H í c   er S Inf. ara ic at nm a An P C . P.I Inf.B Hip f In     31.5. Odontología      31.6. Oídos  Del  total  de  la  población,  134  (25,71%)    personas  presentaron  una  dentadura  Un total de 98 personas, que corresponde al  perfecta,  sin  caries  ni  pérdidas  dentales.  Sin  18,8%  de  la  población  analizada,  presentó  embargo el 55,27% presentó caries o pérdida  alguno de los ocho problemas de oído que se  de  una  a  diez  piezas  dentarias,  el  10,17%  describen a continuación: otitis (6,33%), otitis  presentó  pérdidas  o  caries  de  once  a  veinte  fúngica  (6,33%),  hipoacusia  (3,45%),  otitis  piezas  dentarias,  mientras  que  2,49%  viral  (1,34%),  otitis  bacteriana  (1,15%),  presentó  más  de  veintiún  piezas  dentarias  perforación  timpánica  (0,77%),  pólipos  con caries o pérdidas y un 6,33% presentaron  (0,19%)  y  cuerpos  extraños  en  el  oído  pérdida  de  la  totalidad  de  las  piezas  (0,19%).  Los  problemas  de  oídos  se  dentarias.  Una  familia  tenía  los  hijos  con  identificaron  especialmente  en  las  todos  los  dientes  completamente  dañados  y  comunidades  que  estaban  directamente  argumentaron  que  era  por  causa  médica,  relacionadas con agua bastante contaminada  pues refirieron que la toma de hierro que les  (Figura VII.39).  indicó el médico les dañó completamente los  dientes.    Figura VII.39. Oídos    7

 

6

 

5

                 

Porcentaje

111 

6.3 4.0 2.7 2.1 1.3 1.2 1.2 0.8 0.6 0.2

4

6.33 6.33

3.45

3 2 1

1.34 1.15

0.77

0.19 0.19

0 l . t ia ca ac i ra ng ión ólipo rañ o cífi t isF u acus t it isV t it isB o rac P xt e sp Ot i H ip o oE O P e rf O e p r n I e O. Cu


vías  respiratorias  altas  (13,82%),  amigdalitis  31.7. Nariz y garganta  (1,15%),  desviación  del  tabique  (0,58%),    Fueron  91  personas  (17,33%)  las  que  faringitis  (0,38%),  gingivitis  (0,38%),  manifestaron  tener  algún  tipo  de  patología  herpangina (0,38%), lengua saburral (0,38%) y  destacando  ocho  entre  ellas:  el  catarro  de  aftas bucales (0,19%) (Figura VII.40).    Figura VII.40. Nariz y garganta    14 13.82   12     10  

112

8 6

  4   1.15   2 0.58 0.38 0.38 0.38 0.38 0.19 0.19   0   . s a e is ro il lo i tis gi n Sab es l iti qu ngi t v ar i a i   t al en n b d a i g r c a a r a g u n F i i u C rp .T G Fa ng a sB   Am es v He Le t f A D     31.8. Sistema respiratorio  presentaron casos de sinusitis (Figura VII.41).    De  los  casos  de  tuberculosis,  4  de  ellos  eran  Se encontraron 30 personas (5,75%) con seis  ya  atendidos  por  el  Ministerio  de  Salud  y  2  diferentes  tipos  de  problemas  respiratorios:  eran  casos  nuevos.  Uno  de  estos  casos  era  2,69%  sufrían  de  bronquitis,  1,15%  una  familia  donde  la  madre  tenía  esta  presentaron  casos  de  tuberculosis,  0,96%  enfermedad  y  había  tenido  dos  hijos  con  sufrían de asma, 0,58% presentaron casos de  parálisis cerebral, estaba siendo atendida por  infección  respiratoria  aguda,  0,98%  el  Instituto  Nacional  de  la  Niñez  y  la  Familia  presentaron  enfermedad  pulmonar  (INFA).  obstructiva  crónica  y  en  un  0,19%      Figura VII.41. Respiratorio    3

 

2.69

2.5 Porcentaje

2     1.5 1.15 0.96   1 0.58   0.38 0.19 0.5     0   a A C OC itis itis m IR TB us qu EP As   n n i o S Br     vasos  sanguíneos  encontrados,  la  causa  más  31.9. Corazón y vasos sanguíneos  frecuente  fue  la  hipertensión  arterial  (HTA)    De las 63 personas (12,09%) que presentaron  con  un  4,61%.  La  mayoría  de  ellos  alguno de los siete problemas cardiacos o de  manifestaron no estar en tratamiento o hace 


mucho tiempo que no fueron controlados por  estuvo presente en un 0,77% de los casos, las  los  médicos.  La  hipotensión  estuvo  presente  arritmias  en  el  0,77%,  la  preeclampsia  se  en  el  3,65%  de  las  personas  chequeadas,  las  encontró  en  un  0,38%  y  los  dolores  varices  en  un  2,11%  siendo  necesario  en  precordiales en un 0,19% de los casos (Figura  algunos  de  los  casos  la  operación.  El  soplo  VII.42).   Figura VII.42. Corazón y vasos sanguíneos     

 

3.65

3.5

Porcentaje

 

3 2.5

2.11

2

 

1.5 1

 

0.5 0

0.77

0.77 0.38

es i ón ns ri c e t Va o p i H

HT

 

A

ia sia p lo ritm So lam c Ar ee Pr

0.19

r go An

    31.10. Riñón  pielonefritis  y  atrofias  renales  unilaterales    ocurrieron en el 0,19% de los casos, cada una.  A  39  personas  (7,48%)  se  les  encontró  cinco  Los  estudios  de  IVU  fueron  realizados  con  problemas  renales.  Las  infecciones  de  vías  tiras  reactivas  que  permitieron  detectar  urinarias  (IVU)  ocuparon  el  primer  puesto  sobre  el  terreno  las  molestias  de  disuria  (7,76%);  las  prostatitis  ocurrieron  en  un  (Figura VII.43).  2,81%  de  los  varones,  las  litiasis  renales,    Figura VII.43. Riñón    6

 

5.76

5

     

Porcentaje

113 

4.61

5 4.5 4

4 3 2

1.34

  0.19 0.19 0.19 1     0 IVU Prostatitis Litiasis Pielonefritis AtrofiaUnilat.     (5,18%),  tendinitis  (0,76%),  traumatismos  31.11. Sistema locomotor  (0,57%),  neuropatías  (0,57%),  hernia  discal    Se  les  encontró  diez  problemas  osteo‐ (0,38%),  cifosis/escoliosis  (0,38%),  sindactilia  articulares a 128 personas que corresponden  (0,19%)  y  esternón  prominente  (0,19%)  al 24,56% de la población analizada: artralgias  (Figura VII.44).  (10,75%),  artritis/artrosis  (6.14%),  lumbalgias   


Figura VII.44. Locomotor    12 10.7     10   8   6.1   6 5.2     4   0.8 2   0.6 0.6 0.4 0.4 0.2 0.2   0   i a iti s mo tía al is il ia nte is as lgi i s/os b alg ndi n atis ropa Di sc o lio s dac t i ne   a r t a t m c Ar Artri Lum Te ra um Neu erni s/Es Si n Pro   n T H o si ó n ter Cif   Es     rostro céreo, palidez conjuntival, retraso en el  31.12. Sangre    regreso  vascular  a  la  presión  ungueal  y  Se  observó  problemas  sanguíneos  en  83  palidez de mucosas. Los casos diagnosticados  personas  analizadas  (15,93%).  El  mayor  de  hipercolesterolemia  (1,73%),  porcentaje  de  las  cinco  patologías  hiperuricemia  (0,58%),  problemas  de  encontradas  corresponde  a  personas  con  coagulación  (0,19%)  y  dislipemias  (0,19%)  se  anemia  (14,59%),  para  llegar  a  este  corresponden  a  resultados  de  recientes  diagnóstico  se  analizó  la  presencia  de  tres  analíticas  de  sangre  aportados  por  los  síntomas:  cansancio  con  poco  esfuerzo,  participantes en los chequeos (Figura VII.45).    Figura VII.45. Sangre   

16

14.59

14

 

12 Porcentaje

  10   8   6     4 1.73 0.58   0.19 2 0.19   0   Anemia ColesterolAlto AcUrico P.CoagulaciónDislipemia     dietas o tabletas, no han necesitado insulina,  31.13. Sistema endócrino  pero  los  controles  han  sido  muy  deficientes.    Se  encontraron  13  personas  (2,49%)  con  El  síndrome  metabólico  se  ha  presentado  en  cuatro  tipos  de  problemas  endocrinos.  La  el  0,96%,  las  alteraciones  menstruales  en  el  diabetes estuvo presente en un 0,96% de los  0,58% y el hipertiroidismo en el 0,19% (Figura  chequeados.  Estos  casos  son  tratados  con  VII.46).     

114


Figura VII.46. Endócrino   

1 0.9

 

0.96

0.96

0.8

 

0.6 0.5

0.58

0.4   0.3   0.2   0.19 0.1     0 Diabetes S.Metabólico Dismenorrea Hipertiroidismo       31.14. Genitales  presencia  de  quistes  de  ovario  (2,21%),    miomas  (1,47%),  mastitis  (0,74%),  historias  De  las  62  personas  (11,9%)  que  sufrieron  de  de  histerectomías  (0,37%),  prolapso  uterino  problemas genitales, el 92% fueron mujeres y  (0,37%). Mientras que en los 272 hombres se  el  8%  fueron  hombres.  Las  patologías  más  encontró  fimosis  (1,2%),  hidrocele  (0,4%)  y  frecuentes  en  las  mujeres  fueron  las  enfermedades de transmisión sexual (ETS) en  infecciones  vaginales  con  una  presencia  del  el 0,4% (Figura VII.47).  18,01%  de  las  249  mujeres,  seguida  de    sintomatología  que  hace  sospechar  la    Figura VII.47. Genitales    20 18.01   18   16   14   12   10   8   6   4 2.21 1.47 1.20 0.74   0.37 0.37 0.40 0.40 2   0   as s is titi s mía ri no ele ETS iti s ric o   gi n Ov á mi om Fimo Mas ecto Ute id roc a v e H ter pso   l vo uis t His r ol a Vu Q P     31.15. Sistema  nervioso  central  y  manifestaron  casos  de  pérdida  de  memoria  (0,96%),  epilepsia  (0,77%),  convulsiones  afecciones psicológicas  febriles  (0,58%),  dificultad  de  aprendizaje    Fueron  132  las  personas  (25,33%)  que  (0,58%),  parálisis  facial  (0,38%),  parálisis  manifestaron  tener  algún  problema  de  este  cerebral  (0,19%)  e  hidrocefalia  (0,19%)  tipo. El 10,36% manifestaron tener dolores de  (Figura VII.48).  cabeza  frecuentes;  a  mayor  distancia,  se   

Porcentaje

115 

Porcentaje

 

0.7


Figura VII.48. Sistema nervioso central   

Porcentaje

Porcentaje

12   10.36   10   8   6     4 0.58 0.96   0.38 0.19 2 0.77   0.58 0.19   0   b r s ia ia ial ri a r al l ea emo i lép s e sFe ende .Fac ereb c efal a f P o C   r i Ce i daM Ep ls ion f. Apr is Hid u rál Di rd nv Pa   Pé Co     Por  su  parte  los  problemas  psicológicos  el  lenguaje  (0,38%),  depresión  (0,19%)  y  detectados  se  centran  en  el  miedo  (7,68%),  estrés postraumático (0,19%) (Figura VII.49).  ansiedad (3,26%), enuresis (0,5%), retraso en    Figura VII.49. Psicológico    8   7   7.68 6   5     4   3 3.26   2 0.58 0.38   1 0.19 0.19   0   . o je d is ión ma ed ua da res res Mi   ng ra u s ie p t nu e n e s L E A t. D Po Re   es Str     El miedo fue reiteradamente manifestado en  con  muertes  y  asesinatos”,  “comenzar  con  aquellas  comunidades  que  vivían  más  a  la  enuresis nocturna al irse la hermana mayor”,  orilla  del  río  San  Miguel.  Un  miedo  que  para  padecer  de  verdadero  “terror  nocturno,  con  algunos  se  desencadena  con  la  presencia  de  sudores y gritos en la noche” volverse “tímido  los helicópteros y que se focaliza en los niños.  y  dejar  de  hablar”  con  apenas  dos  años  de  Es un miedo que tiene su razón en que alguna  edad.  Este  miedo  crece  en  la  noche,  vez  “ya  pasaron  disparando”  y  desde  volviéndose  “extremo”,  con  temor  de  que  entonces  quedaron  con  un  miedo  que  les  llegue “gente mala”.    “despierta pesadillas”.  El miedo hoy también lo tienen los adultos y    Este miedo tiene diferentes manifestaciones:  por  un  lado  es  debido  a  las  aspersiones  “perder  el  sueño  y  tener  pesadillas”,  “soñar  aéreas directamente.        Sobre  los  chequeos  médicos  se  puede  diferentes de patologías que se distribuyeron  concluir  que  se  encontraron  133  tipos  en una media de 2,82 por persona (sin contar 

116


las  afecciones  odontológicas  que  fueron  las  más  frecuentes,  caries  o  pérdidas  de  piezas  dentales y que presentaban tres cuartos de la  población).    Las  enfermedades  más  frecuentes  fueron  las  dermatológicas, presentes en más de la mitad  de  la  población,  seguido  de  problemas 

digestivos, oculares, de oído, nariz y garganta  y del aparato locomotor (Tabla VII.13).     Esta  distribución  permite  conocer  lo  que  podría  ser  una  situación  de  frecuencias  de  enfermedades  en  la  frontera  que  deberían  ser abordadas por las instancias oficiales para  poder  intervenir  de  alguna  manera  en  el  mejor  manejo  y  control  de  las  mismas.

Testimonios de la comunidad “Tiene  miedo  a  nuevas  fumigaciones,  dice  que  desde  ellas  tiene  el  cuerpo  dormido  y  no  se  siente  bien”.  “Su  hijo  fue  atendido  en  el  Hospital  de  Lago  Agrio  y  le  dijeron  que  era  intoxicación.  Se  enfermó  después  de  las  fumigaciones  del  2006  y  murió  en  el  2008  con  13  años  (Pedro  Rafael  Encarnación  Calero).  Su  marido  también  murió  de  causa  desconocida  hace  6  años,  en  el  2002,  después  de  las  aspersiones de ese año”.  “Quedamos espantados y con mucho miedo”. “Con  las  fumigaciones  murieron  los  sembríos  de  plátano,  yuca  y  murieron  los  animales  que  tenían  porque comían la hierba”.  “Por las fumigaciones perdieron la finca y por la violencia decidieron cruzar la frontera”. 

117 

  Tabla VII.13. Patologías encontradas en los chequeos médicos    Órganos y aparatos 

Afectados

Odontología  Piel  Digestivo  Ojos Oído, nariz y garganta  Locomotor  Sangre Psicológico  SNC  Corazón Genitales  Riñón y vías urinarias  Respiratorio  Sistema inmunológico  Endócrino  Total Sin problemas odontológicos 

387 283 237 194 189 128 83 68 64 63 62 39 30 17 13 1857 1470 = 2,82

  Links web  www.who.int/es  www.paho.org  www.accionecologica.org       

Porcentaje (Total = 521)  74,3% 54,31% 45,48% 37,23% 36,27% 24,56% 15,93% 13,05% 12,28% 12,09% 11,9% 7,48% 5,75% 3,26% 2,49% 356,24%

Enfermedades  presentes  2  33  9  9  17  10  5  6  8  7  9  5  6  3  4  133   


FOTOGRAFÍA Salud

119

Diagnóstico dermatológico no concluyente Los problemas en la piel fueron muy relevantes en los chequeos médicos

Diagnóstico dermatológico no concluyente El 54% de la población analizada presentó problemas dermatológicos


120

Diagnóstico dermatológico no concluyente La población presentó 33 tipos de patologías

Diagnóstico Diagnóstico dermatológico dermatológico no no concluyente concluyente El El 6,5% 6,5% de de la la población población presentó presentó patologías patologías por por alteraciones alteraciones inmunológicas inmunológicas


121

Diagnóstico dermatológico no concluyente El 2,1% de los individuos presentó infecciones virales como verrugas (1,34%), herpes (0,38%), y exantema viral (0,38%)

Diagnóstico dermatológico no concluyente El 2,34% de los individuos presentó patologías inespecíficas como sarpullido (0,58%), prúrigo (1,73%), granuloma (0,19%), e ictericia (0,19%)


122

Diagnóstico dermatológico no concluyente El 1,34% de los individuos presentó patologías parasitarias tales como escabiosis (7,76%), leishmania (0,38%), y miasis (0,19%)

Diagnóstico dermatológico no concluyente El 1,5% de los individuos presentó cicatrices, y el 0,19% presentó lesiones postfumigaciones


123

Diagnóstico dermatológico no concluyente El 1,15% de los individuos presentó heridas, tales como lipomas (0,76%), angiomas (0,57%) y úlceras (0,19%)

Diagnóstico dermatológico no concluyente El 4,03% de los individuos presentó patologías hiperpigmentarias, tales como claosma (3,07%), y nevus (0,96%)


124

Diagnóstico dermatológico no concluyente El 39,2% de los individuos presentó problemas en la piel por hongos

Diagnóstico dermatológico no concluyente El 6,33% de los individuos presentó infecciones bacterianas, el 4,99% presentó piodermis y el 0,77% acné


PARTE VIII  DIAGNÓSTICO PSICOLÓGICO    32. Estudio psicológico  habitantes. Los niños de las escuelas tuvieron    libertad  de  dibujar  y  pintar.  Los  parámetros  Se  realizaron  psicodiagnósticos  de  dibujos  analizados  fueron:  posición  de  la  hoja,  elaborados  por  niños  y  niñas  de  las  extensión,  emplazamiento,  transparencia,  comunidades  ecuatorianas  fronterizas  con  contraste,  proporcionalidad,  simetría,  base  Colombia:  Yanamarum,  Chone  2,  San  de  sustentación,  ocultamiento,  confusión,  Francisco,  Fuerzas  Unidas,  Playera  Oriental,  grotesidad,  movimiento,  rigidez,  trazo,  Corazón  Orense,  Las  Salinas  y  Puerto  presentación,  expresión  cromática,  contorno  Escondido, con el afán de conocer la situación  y  textura.  Estos  factores  permitieron  actual  y  el  contexto  general  donde  se  interpretar  y  sacar  conclusiones  a  nivel  desenvuelve  la  vida  de  cada  uno  de  sus  psicológico (Tabla VIII.1).    Tabla VIII.1. Parámetros analizados en las escuelas de Sucumbíos    Comunidades Parámetros 

Yanamarum 

Chone 2 

San  Francisco 

Fuerzas  Unidas 

Playera  Oriental 

Corazón  Orense 

Las Salinas 

Puerto  Escondido 

Posición de la  hoja  Extensión  Emplazamiento 

Vertical 

Vertical 

Transversal 

Vertical 

Vertical 

Vertical 

Vertical 

Vertical 

Espontánea  Adaptación  Autodirección 

Espontánea  Derrota  Arraigamiento  Serenidad 

Espontánea  Adaptación  Autodirección 

No  Desproporción  No  No 

Espontánea  Adaptación  Autodirección  Sobrevigilancia  Introversión  Sí  Proporcional  Sí  Equilibrio 

Ocultamiento  Confusión 

No  Dificultad de  contenido 

Tristeza  Dificultad de  contenido 

Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Grado  satisfactorio  con realidad  Fantasía  No  Permiten  identificar su  significado 

Espontánea  Adaptación  Autodirección  Sobrevigilancia  Introversión  Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Grado  satisfactorio  con realidad  Fantasía  No  Se determina  el mensaje de  los dibujos 

Espontánea  Adaptación  Autodirección  Sobrevigilancia  Introversión  Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Grado  satisfactorio  con realidad  Fantasía  No  Se determina  el mensaje de  los dibujos 

Espontánea  Adaptación  Autodirección 

Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Fantasía 

Espontánea  Inseguridad  Depresión  Sentimiento  de derrota  Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Grado  satisfactorio  con realidad  Fantasía  No  Permiten  identificar su  significado 

Grotesidad 

Rasgos  inarmónicos 

Rasgos  inarmónicos 

Rasgos  inarmónicos 

Rasgos  inarmónicos 

Rasgos  inarmónicos 

Rasgos  inarmónicos 

Movimiento 

Normal  Adaptación 

No 

Se evidencia  en escasos  dibujos  Normal  Adaptación 

Normal  Adaptación 

Normal  Adaptación 

Fragilidad  Rigidez  Energía  Desorden  Desaseo  Emoción  descontrolada  Expresión  espontánea 

Fragilidad  Rigidez  Agresividad  Desorden  Desaseo  Adaptabilidad  afectiva  Restricción  afectiva  Angustia 

Fragilidad  Rigidez  Energía  Desorden    Adaptabilidad  afectiva   

Serios  conflictos  Poca actividad  e iniciativa  Fragilidad  Rigidez  Energía  Orden 

Poca actividad  e iniciativa 

Rigidez 

Situaciones  de rigidez  Graves  conflictos  Fragilidad  Rigidez  Energía  Orden 

Fragilidad  Rigidez  Agresividad  Pulcritud 

Fragilidad  Rigidez  Energía  Pulcritud 

Fragilidad    Energía  Pulcritud 

Adaptabilidad  afectiva  Emoción  Expresión  espontánea 

Adaptabilidad  afectiva  Emoción   

Adaptabilidad  afectiva  Emoción  Expresión  espontánea 

Equilibrio en  las  manifestacion es afectivas 

Normalidad  Originalidad 

No  Rasgos  aislados 

Normalidad  Originalidad 

Adaptabilidad  afectiva  Emoción  descontrolada  Expresión  espontánea  Normalidad  Originalidad 

Normalidad  Originalidad 

Normalidad  Originalidad 

Normalidad  Originalidad 

Normalidad  Originalidad 

Transparencia  Contraste  Proporcionalidad  Simetría 

Base de  sustentación 

Trazo  Presentación  Expresión  cromática 

Contorno  Textura 

Fantasía 

  32.1. Comunidad Yanamarum    Interpretación:    En uno de los dibujos se observa la presencia  de un helicóptero sobrevolando el campo en 

Grado  satisfactorio  con realidad    No  Se determina  el mensaje de  los dibujos  Rasgos  borrosos  Rasgos  inarmónicos 

Sí  Proporcional  Sí  Capacidad  analítica y  equilibrada  Grado  satisfactorio  con realidad  Fantasía  No  Se determina  el mensaje de  los dibujos 

el  que  dos  personas  se  encuentran  a  la  intemperie,  en  posición  rígida  y  sin  movimiento.  La  vulnerabilidad  en  esta  comunidad  se  hace  evidente,  la  incertidumbre  de  no  saber  a  qué  atenerse,  teniendo  un  contacto  directo  con  la 

124


125 

naturaleza,  donde  las  posibilidades  de  llevar  una  vida  tranquila,  se  ve  amenazada  por  la  presencia de helicópteros.    32.2. Comunidad Chone 2    Interpretación:    En  los  dibujos  analizados  se  evidencia  agresión  reprimida  si  bien  se  aprecia  adaptabilidad para responder a las exigencias  del  medio,  existen  graves  y  profundos  conflictos mantenidos bajo un control rígido y  endeble.  La  presencia  de  sentimientos  de  derrota  y  arraigamiento,  así  como  un  alejamiento de la realidad, existiendo tristeza  y  fragilidad.  Se  encuentran  rasgos  de  agresividad,  restricción  afectiva  y  angustia.  Además de tendencias paranoides, hostilidad  y sospecha.    32.3. Comunidad San Francisco    Interpretación:    En  los  dibujos  analizados  se  evidencia  capacidad  adaptativa  al  medio,  sin  embargo  existen  rasgos  de  inseguridad,  sentimientos  de  indefensión,  dificultades  de  contacto,  así  como profunda represión.    Acompañados  con  sentimientos  de  derrota,  capacidad  analítica,  fantasía,  energía,  expresión  espontánea  y  originalidad.  Se  evidencia  además  agresividad  reprimida,  tendencias paranoides y sospechas.    Llama  especialmente  la  atención  en  muchos  de  los  dibujos  analizados,  la  presencia  de  helicópteros sobrevolando poblados, además  de  naves  aéreas  (aviones,  avionetas)  que  desde  el  aire  arrojan  algún  líquido  en  especial,  que  cae  sobre  animales,  plantas  y  personas.     32.4. Comunidad Fuerzas Unidas    Interpretación:    En los dibujos analizados se aprecia profunda  represión,  sentimientos  de  expansión  y  agresión, rigidez. 

Agresividad  mantenida  acompañada  de  defensas  paranoides,  aislamiento.  Se  evidencia  falta  de  seguridad,  deseo  de  protección  y  seguridad,  sentimientos  de  indefensión.  Así  también  graves  conflictos  mantenidos bajo un control rígido y endeble.  Identificación con los símbolos patrios.    En  los  dibujos  analizados  se  aprecian  helicópteros  sobrevolando  poblados,  donde  sus  habitantes,  se  encuentran  sin  movimiento,  en  una  posición  rígida,  con  características  de  indefensión  y  vulnerabilidad.    32.5. Comunidad Playera Oriental    Interpretación:    En  los  dibujos  analizados  se  evidencia  una  alta  represión,  acompañada  de  sentimientos  de  pequeñez  e  inadaptación,  acompañados  de  una  sensación  de  rechazo.  Se  evidencia  necesidad de protección. Existe rigidez y poco  control  sobre  su  mundo  externo.  La  falta  de  seguridad es notable.    Se  evidencian  helicópteros  y  aeronaves  sobrevolando  poblados,  en  el  caso  de  las  aeronaves,  dispersando  desde  el  aire  algún  elemento líquido, que se puede percibir en la  mayoría  de  los  dibujos.  Estos  hechos  nos  permiten  entonces  corroborar  la  interpretación  de  los  dibujos  en  los  que  se  determina  la  existencia  de  necesidad  de  protección,  poco  control  sobre  el  mundo  externo y falta de seguridad.    32.6. Comunidad Corazón Orense    Interpretación:    Existen  sentimientos  de  pequeñez  e  inadaptación, así como una gran sensación de  rechazo y rigidez.    Una  represión  marcada,  con  poco  control  sobre  el  mundo  externo  y  una  notable  falta  de  seguridad.  Se  evidencia  además  una  gran  necesidad de protección.   


En  los  dibujos  se  aprecian  helicópteros  y  aviones  sobrevolando  los  poblados  y  el  campo,  en  uno  en  particular  se  aprecia  una  aeronave  y  en  el  agua  una  lancha  con  bandera  tricolor.  Esto  permite  corroborar  y  aseverar  entonces  la  represión  marcada,  el  poco  control  sobre  el  mundo  exterior  y  la  falta  de  seguridad.  Evidente  entonces  la  necesidad de protección.    32.7. Comunidad Las Salinas    Interpretación:    En  los  dibujos  se  evidencia  fantasía,  represión,  inadaptación,  rechazo  y  rigidez.  Existe  poco  control  sobre  el  mundo  externo,  además  de  tendencias  paranoides  y  vigilancia.  Se  aprecia  falta  de  seguridad,  necesidad de afecto y protección.    En  los  dibujos  existen  aeronaves  sobrevolando  los  poblados  y  dispersando  algún  líquido  en  particular,  pudiendo  ser  percibidos  como  amenazantes,  lo  que  permite  corroborar  los  sentimientos  de  indefensión  e  inseguridad.  La  necesidad  de  afecto y protección se hace evidente.    32.8. Comunidad Puerto Escondido    Interpretación:    Se  evidencia  fantasía,  una  fuerte  represión,  rigidez, poco control sobre el mundo externo,  acompañado  de  falta  de  seguridad.  Se  aprecian  rasgos  de  vigilancia  y  tendencias  paranoides,  así  como  sentimientos  de  pequeñez e inadaptación. Existe una falta de  seguridad  marcada,  así  como  necesidad  de  afecto  y  protección,  sumado  a  sentimientos  de  indefensión  e  inseguridad,  lo  que  denota  una marcada sensibilidad.    En los dibujos se evidencia una aeronave que  ataca  un  poblado  y  que  aniquila  a  un  ser  humano.    Se  determinan  rasgos  compatibles  con  espontaneidad, adaptabilidad para responder  a  las  exigencias  del  medio,  capacidad  de 

expresión,  originalidad,  energía,  expresión,  alegría, fortaleza, sensibilidad y creatividad.    A la vez que se evidencian rasgos compatibles  con  fragilidad,  restricción  afectiva,  angustia,  represión,  inadaptación,  tendencias  paranoides,  vigilancia,  dificultades  de  contacto,  sentimientos  de  expansión  y  agresión,  profundos  conflictos  mantenidos  bajo un control endeble y cautela.    Teniendo  en  cuenta  lo  anteriormente  expuesto,  los  niños  manifiestan  una  sensación  de  inseguridad,  sentimientos  de  indefensión,  sentimientos  de  inferioridad  así  como  un  notable  deseo  y  necesidad  de  protección y seguridad.    Recomendaciones:    ∙ A  la  vez  que  se  dispone  de  un  psicodiagnóstico,  es  importante  hacer  el  seguimiento  respectivo  de  la  persona  para  conocer  las  conductas  y  comportamientos  que  van  desarrollando  los  niños  en  su  desenvolvimiento  social  con  el  afán  de  determinar  su  adaptación  al medio social y ambiental.    ∙ Realizar  un  apoyo  psicológico  debido  a  que  en  la  evaluación  realizada  se  aprecian  rasgos  en  que  la  presencia  de  aviones  y  helicópteros  influyen  de  una  manera  negativa  en  la  psique  de  los  niños,  puesto  que  en  muchos  dibujos  se  observa  cruce  de  fuego  entre  esos  artefactos  y  otros,  aeronaves  arrojan  líquidos  no  determinados  desde  el  aire,  los  cuales  caen  a  tierra  sobre  humanos,  animales y vegetación.    ∙ Los  resultados  obtenidos  del  psicodiagnóstico  actual,  deben  ser  contrastados  con  los  resultados  de  otras  investigaciones realizadas anteriormente,  con  el  afán  de  determinar  si  los  diagnósticos  son  comunes,  luego  si  los  diagnósticos  evidencian  un  aumento  progresivo  de  miedo,  inseguridad,  necesidad de protección y seguridad, o si  las  condiciones  han  permitido  disminuir  la preocupación, el miedo y la ansiedad. 

126


     

127 

                                         

Con  los  resultados  obtenidos,  es  importante  desarrollar  un  programa,  a  través  de  jornadas  de  intervenciones  multidisciplinarias,  en  este  caso  con  el  afán  de  promover  la  salud  mental  individual,  social,  comunitaria,  para 

mitigar  las  reacciones  de  aquellas  emociones  que  en  determinado  momento  y  bajo  ciertas  circunstancias  pueden  tornarse  atentatorias  para  el  desarrollo  psicosocial  de  los  niños.


FOTOGRAFÍA Dibujos de niños

128

Pintura que refleja las aspersiones aéreas en las comunidades fronterizas con Colombia Región Amazónica

Prueba psicología Dibujo de niño escolar que refleja las aspersiones aéreas Provincia de Sucumbíos


129

Niña evaluada psicológicamente Provincia de Sucumbíos

Prueba psicológica Dibujo que refleja el impacto negativo de las aspersiones aéreas en el ambiente Provincia de Sucumbíos


PARTE IX   DIAGNÓSTICO AMBIENTAL  33. Destino  ambiental  y  movilidad  del  glifosato    La  química  del  glifosato  es  importante  para  determinar  su  destino  en  el  ambiente.  Química y físicamente, el glifosato se asemeja  mucho  a  sustancias  que  se  encuentran  en  la  naturaleza y no es especialmente reactivo. Se  ha afirmado que es poco móvil en los suelos,  no  tiene  una  gran    persistencia  biológica,  no  es bioacumulable ni se biomagnifica a lo largo  de la cadena alimenticia (Giespy, et al., 2000;  WHO, 1994; Williams, et al., 2000).         34. Movilidad en suelos    El  glifosato  ha  sido  fabricado  para  ser  aplicado  directamente  a  las  hojas  de  las  plantas;  aunque  el  glifosato  no  se  aplica  directamente a los suelos, una concentración  significativa  del  compuesto  puede  llegar  al  suelo (Haney, et al., 1999).    Una  vez  en  el  suelo,  hay diferentes  procesos  que determinan el destino final del glifosato:    ∙ La  formación  de  complejos  con  iones  de  Ca2+ y Mg2+ presentes en el agua.  ∙ La  adsorción  en  sedimentos  o  partículas  suspendidas en el agua y el suelo.   ∙ El  ingreso  en  el  metabolismo  de  las  plantas.  ∙ Su biodegradación por micro‐organismos.    La  retención  del  herbicida  en  el  suelo  es  el  principal  proceso  regulador  de  movilidad.  Posee una alta afinidad al ser retenido por las  partículas  del  suelo,  aunque,  existen  antecedentes  que  muestran  pérdidas  por  lixiviación  a  través  de  vías  de  flujo  preferencial    cuando    las    precipitaciones   ocurren  después    de  la  pulverización  sobre  suelos húmedos (AEGA1664, 2009).    El  herbicida  es  degradado  en  el  suelo  por  acción  principalmente  bacteriana  a  su  metabolito, el AMPA y el dióxido de carbono 

(Rueppel,  et  al.,  1977;  Sprankle,  et  al.,  1975;  Mueller, et al., 2003).    Por  otra  parte,  se  ha  encontrado  que  la  adsorción del glifosato varía de acuerdo a los  tipos de suelos. Hay una menor adsorción en  suelos  con  bajos  contenidos  de  óxido  de  hierro  (Piccolo,  et  al.,  1994).  Estos  autores  encontraron  que  en  algunos  tipos  de  suelos  se  libera  el  80%  del  herbicida  adsorbido,  mientras  que  otros  liberan  entre  el  15  y  el  35%.      También  el  contenido  de  minerales  en  la  arcilla  puede  jugar  un  papel  importante.  Un  estudio  hecho  por  Morillo,  et  al.,  revela  que  la  adsorción  del  glifosato  disminuye  con  la  presencia de cobre, debido a la formación de  complejos  glifosato‐cobre.  Este  estudio  concluye que para entender la relación entre  el  glifosato  liberado  y  su  movilidad  en  el  suelo, es necesario tener en cuenta el tipo de  suelos  y  los  elementos  presentes  en  él,  capaces de formar complejos con el glifosato  (Morillo, et al., 1997).     El  glifosato  también  puede  unirse  a  substancias  hidrosolubles  del  humus.  Las  substancias  húmicas  son  las  principales  responsables de la movilidad de los pesticidas  en  el  suelo.  El  glifosato  transportado  por  las  substancias  húmicas,  puede  también  entrar  en  los  niveles  más  profundos  del    suelo  (Piccolo, et al., 1994). Welten, determinó que  el  glifosato  puede  adherirse  a  partículas  del  suelo  y  puede  todavía  ser  tóxico  y  biodisponible  a  organismos  que  ingieren  cantidades  significativas  de  suelo  durante  su  alimentación normal (Welten, 2000).     Se  ha  encontrado  también  que  la  materia  orgánica  del  suelo,  compite  con  el  glifosato  por  los  sitios  de    adsorción  (Gerritse,  et  al.,  1996).  Un  estudio  brasilero  conducido  por  Prata, et al., muestra que el glifosato compite  con  el  fósforo  por  sitios  específicos  de  adsorción,  especialmente  en  suelos  con  niveles  elevados  de  fósforo  (Prata,  et  al.,  2003).  

130


131 

35. Persistencia del glifosato    Otra  afirmación  que  se  hace  con  relación  al  glifosato  es  que  este  herbicida  se inactiva y  degrada  rápidamente  en  el  suelo.  La  Agencia  de  Protección  Ambiental  de  Estados  Unidos  ha    reportado  que  la  vida  media  del  glifosato  en  el  suelo  puede  ser  de hasta 60 días (US EPA, 1999). En estudios  de  campo  los  residuos  se  encuentran  a  menudo al año siguiente.    A  continuación  se  presentan  algunos  datos  sobre  la  persistencia  del  glifosato  en  distintos ambientes (Cox, 1995):    ∙ 249 días en suelos agrícolas de Finlandia.  ∙ Entre 259 y 296 días en 8 sitios forestales  en Finlandia.  ∙ Entre 1 y 3 días en 11 sitios forestales en  Suecia.  ∙ 335 días en un sitio forestal en Canadá.  ∙ 360 días en 3 sitios forestales de Canadá.    Dos  estudios  canadienses  encontraron  que  el  glifosato  puede  persistir  entre  12  y  60  días  en  un  cuerpo  de  agua  luego  de  una  aplicación  directa.  Se  encontraron  residuos  de  glifosato  en  los  sedimentos  de  una  laguna  un  año  después  de  su  aplicación  directa,  en Estados  Unidos.      Estudios  hechos  en  bosques  de  Canadá  sobre  la  persistencia  del  glifosato  en  el  suelo,  encontraron  que  en  suelos  de  bosques  canadienses,  éstos  pueden persistir  entre  45  y  60  días.  Luego  de  360  días  se  encontró  una  presencia  del  6  al  18%  de  los  niveles  iniciales,  tanto  en el   suelo como en  los  residuos  vegetales  (Bell, et al., 1997).    Se  ha  encontrado  que  el  AMPA  es  más  persistente  que  el  glifosato.  La  vida  media  para  este  compuesto  varía  entre  199  y  958  días (WHO, 1994).      A  pesar  que  el  efecto  del  glifosato,  como  químico,  ha  sido  investigado  en  algunos  tipos  de    suelos,  los  efectos  de  los  surfactantes  y  otros  aditivos  utilizados  en  las  formulaciones  de  aspersión  no  han  sido  investigados en los suelos. 

Se  destaca  que  las  condiciones  de  degradación  del  glifosato,  dependen  de  las  características  climatológicas  a  distintas  latitudes,  siendo  su  mayor  persistencia  en  climas  fríos  o  templados  fríos,  y  menor  en  climas cálidos o tropicales.      36. Descripción de la zona    La  zona  de  estudio  se  ubica  dentro  del  bioclima  denominado  Bosque  Húmedo  Tropical,  en  la  formación  vegetal  Bosque  Siempreverde  de  Tierras  Bajas  y  en  el  piso  zoogeográfico Tropical Oriental; identificados  como sistemas ecológicos representativos de  la Amazonia (Holdridge, et al., 1971).    Los suelos presentan texturas finas arcillosas,  arcillo‐limosas,  limo‐arcillosas,  con  predominio de la fracción arcilla, asociados a  un  bajo  grado  de  desarrollo  pedogenético  o  carencia de agentes cementantes (materiales  orgánicos) entre sus partículas. Debido a que  el  volumen  de  los  microporos  y  poros  capilares  es  mayor,  tienen  una  gran  capacidad de retención de agua. Cabe indicar  que  el  predominio  de  la  arcilla  contribuye  a  una  mayor  retención  de  los  iones  en  forma  intercambiable;  por  lo  tanto,  se  presentan  más resistentes a los procesos de lixiviación o  percolación (Mejía, 1997).    Los suelos con fijación de hierro (Fe) y fósforo  (P),  incluyen  principalmente  los  suelos  rojos,  arcillosos y caoliníticos, en donde el hierro es  el  elemento  que  mayor  influencia  ejerce  sobre  el  color  y  está  presente  en  forma  de  óxido o hidróxido (Mejía, 1997).      37. Muestreo de suelos    El muestreo de suelos se realizó de acuerdo a  las  normas  de  The  American  Society  for  Testing  and  Materials  (ASTM),  para  establecer  el  “Plan  de  Muestreo”  de  investigación  de  suelos  mediante  barrenos,  para  muestreo  de  suelos  referente  al  transporte y preservación de muestras.   


Los  barrenos  para  el  muestreo  cumplieron  con  la  calificación  técnica  mediante  la  aplicación  detergente  no  fosforado  y  agua  desionizada,  previo  a  cada  extracción.  En  cada  comunidad  se    estableció  la  unidad  de  muestreo de 1 ha (100 x 100 m2), se procedió  a  recolectar  las  submuestras  a  cierta   distancia  recorriendo  el  terreno  en  zigzag  de  forma  sistemática.  Se  colectó  un  1  Kg  de  suelo con duplicados para el Aseguramiento y  Control de la Calidad (QA/QC).    Para  garantizar  la  representatividad  y  menor  inalterabilidad  posible  de  la  muestra  a  ser  obtenida,  cuando  la  litología  local  lo  permita  se practicarán los muestreos de suelos, de la  zona no saturada. Considerando los objetivos  del  estudio,  se  utilizó  un  equipamiento  de  empuje directo, con la potencial asistencia de  barrenos  helicoidales  de  vástago  hueco  (Hollow Steam Auger).     El muestreo correspondió a perfil A del suelo,  de acuerdo con los objetivos del estudio para  la  determinación  de  residuos  de  glifosato  y  AMPA; se muestreó en bosques nativos a una  profundidad de 0 a 10 cm, y con respecto a la  determinación  de  la  calidad  de  suelos  por  análisis de micro y macronutrientes en suelos  cultivados, se muestreó a una profundidad de  5 a  20 cm.    Las  muestras  se  colectaron  en  fundas  de  papel  auto  clavadas  y  guardadas  en  fundas  ziploc,  codificadas,  transportadas  y  mantenidas  a  una  temperatura  de  4°  C  para  su análisis. Se identificó, lugar, fecha, tipo de  muestra,  profundidad  y  temperatura  ambiental.     37.1. Determinación del glifosato    Los  métodos  analíticos  para  monitorear  el  glifosato  están  basados  en  técnicas  cromatografías  clásicas,  cromatografía  de  gases  y  liquida  con  derivatización  pre  o  post  columna,  también  se  emplean  estas  técnicas  acopladas  a  espectrometría  de  masas  (MS);  todas  estas  metodologías  son  costosas,  usan  solventes  tóxicos  y  son  altamente  especializadas  (Sancho,  et  al.,  1996;  Seiber,  2002). 

El  análisis  de  residuos  de  glifosato  y  AMPA,  en  las  muestras  de  suelo,  fueron  determinadas por derivatización pre‐columna  con FMOC a pH controlado, este derivado se  inyecta  en  HPLC  (High  performance  liquid  chromatography)  con  detección  por  fluorescencia. Antes de la extracción, se pesó  15  g  de  la  muestra  para  un  pre‐tratamiento  alcalino con KH2PO4 (fosfato monopotásico) a  0,1  M,  agitación  de  la  solución  por  15  minutos,  centrifugación  a  3500  rpm  durante  10  minutos  y  filtración  en  papel  filtro  Whatman  No.  1,  la  extracción  fue  repetida  dos  veces  obteniendo  un  extracto  de  25  mL  por  cada  muestra.  Los  extractos  fueron  filtrados en membrana de acetato de celulosa  No.  0,45  µm.  La  derivatización  consistió  en  añadir a 1 mL de la muestra de suelo, 0,25 mL  de  buffer  borato  al  5%  y  0,30  mL  de  9‐ fluorenilmetilcloroformato (FMOC) a 2 nM en  una  solución  de  CHCl3  (Cloroformo).  Las  muestras  fueron  colocadas  a  40°  C  en  obscuridad  durante  24  horas,  después  se  añadió  0,30  mL  de  H3PO4  (ácido  fosfórico)  al  2% para detener la reacción, y se conservó en  el  refrigerador  para  su  respectivo  análisis.  El  producto  de  derivatización  (Gly‐FMOC)  fue  analizado  por  HPLC  (Beckman,  System  Gold  126,  detector  166  UV).  Las  condiciones  de  cromatografía: Supelco RP de 18 columnas (5  µm de tamaño de la partícula, longitud X I.D:  25 cm x 10 nm); fase móvil 0,05 M de buffer  de  fosfato  (pH  5,5);  acetonitrile  (65:35);  corriente: 0,8 mL/ min; y la detección con UV  a  206  nm.  La  metodología  fue  adaptada  y  aprobada  de  literatura  especializada  en  análisis  técnico‐científico  valorando  los  resultados  del  estudio  (APHA,  1998;  Sancho,  et al., 1996; Stalikas, et al., 2001; Veiga, et al.,  2001).    Según  los  resultados  obtenidos  en  el  análisis  de  glifosato  y  AMPA,  a  estos  compuestos  se  los encontró en valores menores al límite de  detección  (0,05mg/Kg),  en  las  muestras  analizadas de suelo de bosques ubicados a no  más  de  250  metros  del  límite  fronterizo  con  Colombia. Lo cual nos indica que gracias a las  características arcillosas de los suelos, se han  absorbido  residuos  mínimos  del  glifosato  procedente de las aspersiones aéreas.   

132


133 

37.2. Determinación de hierro y aluminio  extractos  resultantes  de  disoluciones  más    selectivas  (citrato,  ditionito  u  oxalato  Las  normativas  y  métodos  de  referencia  de  amónico), para conocer el impacto ambiental  carácter nacional para el análisis de aluminio  potencial  de  los  suelos  contaminados  (Al)  y  hierro  (Fe),  no  son  frecuentes,  sólo  (Holmgren, et al., 1990).   existen  algunas  metodologías  establecidas    internacionalmente  para  caracterizar  la  De acuerdo a la metodología analítica, en las  presencia  de  estos  átomos  en  suelos  y  dieciocho  muestras  de  suelos  se  encontró  muestras  sólidas  de  zonas  contaminadas  (US  presencia de Fe en un rango mínimo de 1,0 %   EPA,  1991).  Los  métodos  analíticos  se  deben  y  máximo  de  5,1  %.  Con  respecto  al  Al,  se  basar  en  los  procedimientos  recomendados  registró entre un rango mínimo de 1,5 %  y un  para  aguas,  aguas  residuales,  lodos  máximo  de  9,8  %,  en  las  comunidades   estudiadas.  residuales, sedimentos y suelos agrícolas.       La  técnica  analítica  de  espectrometría  de  Los  resultados  de  los  suelos  de  bosques  absorción  atómica  de  llama  (AAS)  se  aplicó  primarios,  demuestran  que  poseen  un  pH  para  el  análisis  del  porcentaje  de  Fe  y  Al  en  ácido  con  predominio  de  hierro  (1,0  %  ‐  5,1  las  muestras  de  suelo.  Aplicando  el  método  %)  y  aluminio  (1,5%  ‐  9,8  %),  entre  las  de  referencia  (Diaz‐Romeu  &  Hunter,  1978),  comunidades  de  la  zona  de  estudio.  En  el  se  obtuvo  los  compuestos  en  diferentes  Texto  Unificado  de  Legislación  Ambiental  extractos,  según  requerimientos;  y  su  (TULAS,  2003),  el  hierro  y  el  aluminio  no  totalidad,  por  digestión  ácida  con  métodos  están  incluidos  como  parámetros  de  calidad  clásicos.   ambiental  (LPCCA,  1976),  a  pesar  que  son    metales  pesados  con  potencial  riesgo  Numerosos  estudios  medioambientales  genotóxico  y  carcinogénico  para  poblaciones  utilizan  datos  sobre  la  presencia  total  de  humanas,  vegetales  y  animales.  Esto  implica  elementos  en  suelos  o  sedimentos,  aunque  un  limitante  condicional  para  cuantificar  la  es  frecuente  utilizar  esta  información  en  persistencia de glifosato.  conjunción con otros análisis realizados sobre    Tabla IX.1. Análisis de glifosato y AMPA en muestras de suelo de bosque    Muestra  Analito  Valor medido (mg/Kg)  1 Bosque  Glifosato  < L.D.  22.06.2010  AMPA  D.N.C.  2 Bosque  Glifosato  < L.D.  24.06.2010  AMPA  < L.D.  3 Bosque  Glifosato  < L.D.  26.06.2010  AMPA  D.N.C.  4 Bosque  Glifosato  < L.D.  28.06.2010  AMPA  D.N.C.  6 Bosque  Glifosato  < L.D.  27.07.2010  AMPA  < L.D.  8 Bosque  Glifosato  < L.D.  27.07.2010  AMPA  < L.D.  9 Bosque  Glifosato  < L.D.  22.06.2010  AMPA  < L.D.  L.D. = Límite de detección (0,05 mg/Kg); D.N.C. = Detectable no cuantificable.     


38. Calidad del suelo agrícola    La  Soil  Science  Society  of  America  (SSSA),  define la calidad del suelo como “la capacidad  funcional de un tipo específico de suelo, para  sustentar  la  productividad  animal  o  vegetal,  mantener  o  mejorar  la  calidad  del  agua  y  el  aire,  y  sostener  el  asentamiento  y  salud  humanos, con límites ecosistémicos naturales  o determinados por el manejo” (Karlen, et al.,  1997).     La calidad del suelo incluye los conceptos de  capacidad  productiva  del  suelo  y  la  protección  ambiental.  Las  funciones  específicas  representadas  por  la  calidad  del  suelo incluyen (Brejeda & Moorman, 2001):    ∙ Captar,  mantener  y  liberar  nutrientes  y  otros compuestos químicos.  ∙ Captar,  mantener  y  liberar  agua  a  las  plantas y recargar las napas subterráneas.  ∙ Mantener  un  hábitat  edáfico  adecuado  para la actividad biológica del suelo.    La  calidad  del  suelo  es  dinámica  y  puede  cambiar en el corto plazo de acuerdo al uso y  a las prácticas de manejo; para conservarla es  necesario implementar prácticas sustentables  en  el  tiempo  (NRCS,  2004).  La  mantención  o  mejora puede generar beneficios económicos  en  forma  de  aumentos  de  la  productividad,  mayor  eficiencia  en  el  uso  de  nutrientes  y  pesticidas, mejor calidad del aire y del agua, y  reducción de los gases de efecto invernadero  (Brejeda, 2001). De lo anterior, se determina  que  la  calidad  del  suelo  es  una  propiedad  dinámica  asociada  al  uso  del  suelo  y  su  función,  comúnmente  la  protección  ambiental y la producción silvoagropecuaria.    38.1. Evaluación de la calidad del suelo    La  evaluación  de  la  calidad  del  suelo  (CS)  permite mejorar la respuesta de los recursos,  como  son:  pérdida  de  suelo  por  erosión,  depósitos  de  sedimento  por  viento  o  inundación,  reducción  de  la  infiltración  e  incrementos  de  lluvia,  endurecimiento  de  la  capa  superficial,  perdida  de  nutrientes,  transporte  de  pesticidas,  cambios  en  el  pH,  aumento  de  la  disponibilidad  de  metales 

pesados,  pérdida  de  materia  orgánica,  infestación  de  organismos  patógenos  y  reducción  de  la  calidad  del  agua  (NRCS,  2004).    Debido  al  carácter  dinámico  de  la  CS,  ésta  puede  cambiar  en  el  corto  o  largo  plazo  de  acuerdo  al  uso  y  a  las  prácticas  de  manejo,  por  lo  tanto,  es  necesario  monitorear  los  cambios del suelo y determinar qué prácticas  son  sustentables  (NRCS,  2004).  La  selección  de  un  conjunto  de  indicadores  de  calidad  de  suelo  y  el  desarrollo  de  su  aplicación  dentro  de  un  sistema  de  monitoreo  son  claves  para  la evaluación de la calidad del suelo.     El  mejoramiento  de  la  CS  se  percibe,  en  general,  por  el  aumento  o  disminución  en  el  valor de algunas características. Por ejemplo,  puede incrementarse la tasa de infiltración o  de  aireación,  debido  a  un  aumento  de  la  cantidad de macroporos, a un mayor tamaño  y  estabilidad  de  los  agregados,  y  una  mayor  cantidad  de  materia  orgánica.  Pero  pudiese  reducirse la densidad aparente, la resistencia  a la labranza, el crecimiento radical, la tasa de  erosión  y  la  pérdida  de  nutrimentos.  Una  mejor  evaluación  se  logra  si,  además  de  los  cambios  señalados,  se  incluyesen  otros  indicadores  potenciales  de  índole  ecológico‐ biológico; por ejemplo, el grado de diversidad  genética  (tanto  del  cultivo  como  de  las  especies  de  microorganismos,  insectos  y  animales  benéficos),  el  rendimiento  de  los  cultivos  (en  grano  o  biomasa  total),  el  vigor  de  las  plantas  y  su  desarrollo  radical,  y  la  calidad del agua que drena superficialmente,  así  como  la  que  se  pierde  por  lixiviación  subterránea (Parr, et al., 1992).    La  manutención  o  mejora  de  la  CS  puede  generar  beneficios  económicos  en  forma  de  incrementos  de  la  productividad,  mayor  eficiencia en el uso de nutrientes y pesticidas,  mejor calidad del aire y del agua, y reducción  de los gases de efecto invernadero (Brejeda &  Moorman, 2001).    38.2. Indicadores de la calidad del suelo    El  suelo  no  tiene  estándares  de  calidad  definidos debido a su variabilidad, por lo que 

134


135 

es  casi  imposible  establecer  una  simple  medida  física,  química  o  biológica  que  la  refleje adecuadamente. Se deben considerar,  además,  otros  factores  que  afectan  su  funcionamiento,  lo  que  dificulta  definir,  medir  y  regular  la  calidad  de  este  recurso  (Bandinck & Dick, 1999).     La  calidad  del  suelo  se  evalúa  empleando  indicadores  que  reflejen  los  cambios  en  la  capacidad del suelo y en su función (Dalurzo,  et  al.,  2002).  Los  indicadores  dependen  del  ecosistema,  debiendo  determinarse  características  que  sirvan  como  indicadores  de su sustentabilidad.    Los  indicadores  directos  comúnmente  utilizados  corresponden  a  las  propiedades  físicas,  químicas  y  biológicas  del  suelo.  La  capacidad  productiva  del  suelo  puede  ser  evaluada  indirectamente  con  el  rendimiento  de  los  sistemas  (agrícolas,  forestales  y  ganaderos).    Según la National Resource Conservation Soil  (NRCS),  los  indicadores  de  CS  deben  cumplir  con las siguientes condiciones:    ∙ Ser fáciles de medir.  ∙ Medir  los  cambios  en  las  funciones  del  suelo.  ∙ Abarcar  las  propiedades  físicas,  químicas  y biológicas del suelo.  ∙ Ser  accesibles  a  los  evaluadores  y  aplicables en condiciones de campo.  ∙ Ser sensibles a las variaciones climáticas y  de manejo.    Los  indicadores  de  CS  permiten  analizar  la  situación  actual  e  identificar  puntos  críticos  con  respecto  a  la  sustentabilidad  del  suelo  como medio productivo o bien como recurso  natural importante para la calidad de la vida y  mantención  de  la  biodiversidad;  permiten  analizar  los  posibles  impactos  antes  de  una    38.2.2. Indicadores químicos     Los  indicadores  químicos  de  la  calidad  de  suelo  incluyen  propiedades  que  afectan  las  relaciones suelo‐planta, la calidad del agua, la  capacidad  amortiguadora  del  suelo  y  la 

intervención;  monitorear  el  impacto  de  la  intervención  y  ayudar  a  determinar  si  el  uso  del  recurso  es  sustentable  (Hünnemeyer,  et  al., 1997).     Los  indicadores  pueden  ser  variables  cualitativas  (afloramiento  del  subsuelo,  aparición de canalículos de erosión, aparición  de  encharcamiento,  etc.),  variables  cuantitativas  (tasa  de  infiltración,  capacidad  de  intercambio  catiónico,  pH,  cantidad  de  nemátodos  u  otros)  o  bien  índices  compuestos  por  la  relación  entre  diferentes  variables (Astier‐Calderón, et al., 2002).     La  evolución  de  la  calidad  del  suelo  puede  determinarse  de  manera  comparativa  o  relativa.  Para  esto  puede  compararse  la  evolución  de  un  sistema  a  través  del  tiempo  (comparación  longitudinal),  u  observar  simultáneamente  uno  o  más  sistemas  de  manejo  alternativo  con  una  referencia  (comparación  transversal)  (Masera,  et  al.,  1992).    38.2.1. Indicadores físicos    Existe  una  variedad  de  indicadores  físicos  de  la  calidad  de  suelo  (Tabla  IX.2),  éstos  varían  de  acuerdo  a  las  características  predominantes del lugar en estudio. Doran y  Parkin  seleccionaron  como  indicadores:  la  textura,  profundidad,  tasa  de  infiltración  de  agua  del  suelo,  densidad  aparente,  y  capacidad  de  retención  del  agua  (Doran  &  Parkin, 1994).    Chen,  et  al.,  sugirieron  la  textura  del  suelo,  que se relaciona con la porosidad, infiltración  y  disponibilidad  del  agua;  la  densidad  aparente,  relacionada  con  la  tasa  de  infiltración  y  conductividad  hidráulica;  y  la  estabilidad  de  agregados,  que  se  relaciona  con la resistencia a la erosión y contenido de  materia orgánica.  disponibilidad  de  agua  y  nutrientes  para  las  plantas y microorganismos (Tabla IX.2).     Doran y Parkin propusieron como indicadores  el  contenido  de  materia  orgánica  (MO),  o  carbono  y  nitrógeno  orgánico,  el  pH,  la  conductividad eléctrica (CE), el nitrógeno que 


se  encuentra  en  forma  de  amonio  (NH4+),  fósforo  (P)  y  potasio  (K)  disponible.  Los  indicadores  que  reflejan  estándares  de  fertilidad  (pH,  MO,  N,  P  y  K),  son  factores  importantes  en  términos  de  producción  de  cultivos. Cuando se evalúa la calidad del suelo 

en sistemas polucionados, sin embargo, otros  indicadores toman mayor importancia, como  es  el  caso  de  los  elementos  trazas  disponibles, cobre (Cu), zinc (Zn), cadmio (Cd)  y plomo (Pb), seleccionados en Taiwán como  indicadores químicos (Chen, et al., 2000). 

  Tabla IX.2. Indicadores físicos, químicos y biológicos de la calidad del suelo    Indicador 

Relación con las funciones y condiciones del suelo  Indicadores físicos Textura del suelo  Retención y transporte de agua y minerales; erosión del suelo.  Profundidad del suelo Estimación del potencial productivo y de erosión.  Infiltración y densidad aparente  Potencial de lixiviación, productividad y erosión.  Capacidad de retención del agua  Relacionado al contenido de humedad, transporte y erosión.  Estabilidad de agregados  Erosión potencial de un suelo, infiltración de agua.  Indicadores químicos Materia orgánica   Fertilidad  del  suelo,  estabilidad  y  grado  de  erosión.  Potencial  (C y N orgánico)  productivo.  pH   Actividad  química  y  biológica,  límites  para  el  crecimiento  de  plantas y actividad microbiana.   Conductividad eléctrica  Actividad  microbiológica  y  de  las  plantas,  límites  para  el  crecimiento de las plantas y actividad microbiológica.  N, P y K extraíble  Disponibilidad de  nutrientes para  las  plantas  y  pérdida potencial  de N, indicadores de productividad y calidad ambiental.  Capacidad  de  intercambio  Fertilidad de suelo, potencial productivo. catiónico  Metales pesados disponibles  Niveles de toxicidad para el crecimiento de la planta y calidad del  cultivo.  Indicadores biológicos Biomasa microbiana (C y N)  Potencial catalizador microbiano y reposición de C y N.  N potencial mineralizable  Productividad del suelo y aporte potencial de N.  Respiración  edáfica,  contenido  Medición de la actividad microbiana. de agua, temperatura de suelo  Número de lombrices Relacionado con la actividad microbiana. Rendimiento del cultivo  Producción potencial del cultivo, disponibilidad de nutrientes. 

  38.2.3. Indicadores biológicos     Los  indicadores  biológicos  integran  los  diferentes factores que afectan la calidad del  suelo.  Generalmente  se  refieren  a  la  abundancia  y  subproductos  de  las  bacterias,  hongos,  nemátodos,  lombrices,  anélidos  y  artrópodos  (Chen,  et  al.,  2000;  Bautista,  et  al., 2004).     Las  propiedades  biológicas  del  suelo  son  dinámicas  por  sirven  de  señales  tempranas  de  degradación  o  de  mejoría  de  los  suelos.  Doran  y  Parkin  seleccionaron  como  indicadores biológicos el carbono y nitrógeno  de  la  biomasa  microbiana;  el  nitrógeno 

potencialmente mineralizable y la respiración  edáfica.     Las  propiedades  biológicas  y  bioquímicas  (respiración  edáfica,  biomasa  microbiana,  actividades  enzimáticas,  microorganismos,  y  otros)  son  valiosas  en  la  interpretación  de  la  dinámica  de  la  materia  orgánica;  dan  rápida  respuesta  a  los  cambios  en  el  manejo  del  suelo,  son  sensibles  al  estrés  ambiental  y  fáciles de medir (Bandinck & Dick, 1999).     La  tabla  IX.3  muestra  la  sensibilidad  y  respuesta  de  los  indicadores  biológicos  más  usados,  y  tipo  de  laboratorio  requerido  para  su medición. 

136


Tabla IX.3. Sensibilidad y respuesta de indicadores biológicos más usados, y tipo de laboratorio  requerido para su medición    Indicador  Carbono (%) Biomasa C  Biomasa N Biomasa P  Actividad respiratoria  Respiración específica  Actividad deshidrogenasa 

137 

Sensibilidad Muy sensible Muy sensible Muy sensible Muy sensible Muy sensible Muy sensible Muy sensible

    39. Indicadores  para  evaluar  la  calidad  del  suelo    La  biomasa  de  microorganismos  del  suelo  representa  menos  del  5%  de  su  materia  orgánica,  sin  embargo,  desempeña  por  lo  menos tres funciones críticas en el suelo y en  el  medio  ambiente:  es  una  fuente  lábil  de  carbono,  nitrógeno  y  fósforo;  constituye  una  reserva  de  estos  elementos;  y  es  un  agente  de  transformaciones  de  nutrientes  y  de  degradación de pesticidas (Dalal, 1998).    La  comparación  de  la  biomasa  microbiana  e  índices  derivados  de  ella  se  ha  usado  exitosamente  para  medir  cambios  inducidos  por  las  prácticas  de  manejo,  cero‐labranza,  rotación  de  cultivos,  ciclo  de  nutrientes,  disposición de lodo o aplicación de herbicidas  e insecticidas.    El  incremento  actual  de  la  demanda  para  monitorear  la  calidad  del  suelo  y  cuidar  el  medio ambiente ha hecho que se modernicen  técnicas  para  medir  biomasa  u  otros  índices  equivalentes.  La  biomasa  tiene  un  rápido  cambio,  lo  que  determina  que  experimente  modificaciones  muy  rápidas  frente  a 

Respuesta Lenta Rápida Rápida Rápida Rápida Rápida Rápida

variaciones del medio ambiente, aparición de  contaminantes,  pesticidas  u  otros,  modificando  sus  valores  antes  de  que  estos  cambios  se  manifiesten  en  propiedades  químicas o físicas del suelo.    Los parámetros medidos y que se encuentran  con  mayor  frecuencia  en  la  literatura  son:  biomasa,  actividades  enzimáticas  como  la  deshidrogenasa,  actividad  respiratoria  y  también  ciertos  índices  que  combinan  dos  o  más  parámetros  como  por  ejemplo  qCO2  (cociente respiratorio) que corresponde a mg  de CO2 respirado por hora y por kilogramo de  biomasa microbiana (Bautista, et al., 2004).    39.1. Metodología analítica y resultados    39.1.1. Nitrógeno    ∙ Se aplicó el procedimiento de Kjeldahl.    ∙ Se  encontró  un  nivel  alto  con  rango  de  66,00  a  101,00  ppm  en  6  comunidades,  nivel medio desde  46,00 a 51,00 ppm en  5  comunidades  y  nivel  bajo  con  10,00  a  29,00  ppm  en  7  comunidades  (Figura  IX.1).

  Figura IX.1. Nitrógeno                   

Determinación  Laboratorio de suelos Laboratorio especializado Laboratorio especializado Laboratorio especializado Laboratorio especializado Laboratorio especializado Laboratorio de suelos


39.1.2. Fósforo    ∙ Se  aplicó  la  metodología  de  extracción  2,5:25  Olsen  Mod.  (NaHCO3  0,5  N,  EDTA  disódica  0,01  M  y  Superfloc  127)  para  determinación  por  colorimétrica  azul  de  molibdeno  (NH4)2MoO4  ácido  y  tartrato  doble de Sb y K con unidad mg/L. 

Se encontró un nivel alto con un rango de  25,00  a  28,00  ppm  en  2  comunidades,  nivel medio  en un rango de 9,00 a 19,00  ppm  en  10  comunidades  y  nivel  bajo  en  un  rango  de  2,20  a  7,60  ppm  en  6  comunidades (Figura IX.2). 

  Figura IX.2. Fósforo             

              39.1.3. Hierro, manganeso y potasio      ∙ Se  aplicó  la  metodología  de  extracción  ppm  en  8  comunidades  y  nivel  bajo  de  2,5:25  Olsen  Mod.  (NaHCO3  0,5  N,  EDTA  2,8 a 4,6 ppm en 10 comunidades (Figura  IX.4).   disódica  0,01  M  y  Superfloc  127)  para  determinación  por  espectrometría  de    ∙ Sobre  el  potasio  (K),  se  encontró  en  un  absorción atómica con meq/L.   nivel alto con un rango de 0,52 meq/100    mL  en  1  comunidad,  nivel  medio  desde  ∙ Sobre  el  hierro  (Fe),  se  encontró  en  un  nivel  alto  con  un  rango  de  120,00  a  0,20  a  0,37  meq/100  mL  en  7  2.100,00  ppm  en  las  18  comunidades  comunidades  y  nivel  bajo  con  rango  de  (Figura IX.3).  0,13  a  0,19  meq/100  mL    en  10    comunidades (Figura IX.5).  ∙ Sobre el manganeso (Mn), se encontró en  un nivel medio en un rango de 5,9 a 14,6    Figura IX.3. Hierro                         

138


Figura IX.4. Manganeso     

139 

                        Figura IX.5. Potasio                            39.1.4. Materia orgánica    ∙ Se  aplicó  la  metodología  de  extracción  K2Cr2O7  1Nf  determinación  por  titulación  FeSO4 0,5 N en unidad porcentual.   

Se encontró un nivel alto con un rango de  4,20  a  6,00  %  en  6  comunidades,  nivel  medio  entre    3,10  a  4,60  %  en  8  comunidades  y  nivel  bajo  comprendido  desde  0,90  a  2,60  %  en  4  comunidades  (Figura IX.6). 

  Figura IX.6. Materia orgánica 

                           


39.2. Determinación  de  macro  y  micronutrientes en suelos cultivados    ∙ Los  resultados  obtenidos  del  análisis  de  suelos  para  la  determinación  de  nitrógeno  indican  que  el  33%  de  muestras  presentan  niveles  altos,  el  28%  de  muestras  presentan  niveles  medios  y  el  39%  de  muestras  presentan  niveles  bajos.  La  mayoría  de  las  comunidades  presentan  niveles  nutricionales  altos  y  bajos,  esto  interfiere  en  el  crecimiento  vegetativo,  coloración  de  las  hojas,  retraso y menor producción de frutos.    ∙ En  relación  con  la  cuantificación  de  fósforo,  se  observa  que  el  11%  de  muestras  presentan  niveles  altos,  el  56%  de  muestras  presentan  niveles  medios  y  el  33%  de  muestras  presentan  niveles  bajos.�� Significando  que  la  mitad  de  los  suelos cultivados están en rangos medios  mostrando    una  correcta  maduración  de  las  plantas,  facilidad  de  crecimiento,  división  y  alargamiento  celular  resistiendo a enfermedades.    ∙ El hierro es concluyente al demostrar que  todos  los  terrenos  de  la  zona  de  estudio  contienen  100%.  Confirmando  que  este  metal  está  interviniendo  en  reacciones  fundamentales  de  óxido‐reducción,  en  hemoproteínas y proteínas no‐hémicas.     ∙ El análisis de manganeso muestra que los  suelos  están  distribuidos  entre  un  nivel  medio 44% y bajo 56%. Esto significa que  los  procesos  enzimáticos  relacionados  con  el  metabolismo  del  nitrógeno  y  descomposición de los carbonatos de los  suelos contienen niveles medios y bajos.     ∙ El potasio registra un nivel alto 5%, medio  39%  y  bajo  56%.  Esto  indica  que  la  mayoría  de  los  suelos  analizados  presentan  un  nivel  bajo  para  este  macronutriente,  indicando  que  el  déficit  puede  afectar  en  el  proceso  de  la  fotosíntesis,  activación  de  enzimas  con  funciones  bioquímicas  y  la  resistencia  a  condiciones  adversas  como  sequías  o  presencia de enfermedades.  

La  materia  orgánica  de  los  suelos  investigados presenta un balance entre el  nivel  medio  44%  y  bajo  56%.  Esto  indica  que los suelos presentan un bajo y medio  porcentaje  de  disponibilidad  de  nutrientes  para  el  crecimiento  de  las  plantas,  la  fuente  de  energía  tanto  para  organismos de macro y microfauna.  

    40. Calidad del agua    El    perfil  epidemiológico,  en  la  zona  de  integración  fronteriza,  está  determinado  por  la poca disponibilidad de agua segura para el  consumo humano, y por la contaminación de  las  fuentes  de  agua,  incidiendo  en  el  alto  porcentaje  de  la  población  afectada  por  diarreas  y  enfermedades  gastrointestinales,  desde  el  período  de  las  fumigaciones.  Existe  un  mayor  riesgo  epidemiológico  por  la  contaminación de fuentes de agua cuando los  microorganismos  son  patógenos  (bacterias,  virus,  protozoarios  y  helmintos),  principalmente  por  deficientes  prácticas  de  saneamiento comunitario.    La  evaluación  microbiológica  y  parasitológica  permite  investigar  la  calidad  del  agua,  definiendo  la  aceptabilidad  de  ella  para  el  consumo  humano;  siendo  el  peligro  más  común  la  contaminación,  directa  o  indirectamente,  por  la  acción  de  aguas  residuales,  excretas  de  hombres  y  animales,  etc.      41. Análisis microbiológico y parasitológico    Para  el  análisis  microbiológico  y  parasitológico,  se  colectó  por  separado  100  mL  de  agua  de  río,  sumergiendo  los  envases  estériles de tapa rosca a una profundidad de  20 a 40 cm, se flameó y selló con parafilm, de  acuerdo  al  Standard  Methods  for  the  Examination  of  Water  and  Wastewater  (APHA,  1998).  Las  muestras  fueron  codificadas  en  cada  sitio,  guardas  en  fundas  ziploc,  transportadas  y  mantenidas  a  una  temperatura  de  4°  C  para  su  análisis.  Se  identificó,  lugar,  fecha,  tipo  de  muestra  y  temperatura ambiental. 

140


141 

41.1. Análisis microbiológico    Para  la  determinación  microbiológica  del  agua,  se  realizó  el  recuento  total  de  enterobacterias, hongos, coliformes totales y  coliformes  fecales.  La  metodología  consistió  en  la  inoculación  de  1  mL    de  agua  en  el  centro  de  la  placa  Petrifilm  MR,  evitando  atrapar  burbujas  de  aire  y  aplicando  el  dispensor para homogenizar la muestra.     Se  incubaron  200  placas  por  cada  familia  a  analizarse:  3M™  Petrifilm™  Enterobacteriaceae  Count  plates  a  35°  C  (+/‐  1°  C)  durante  24  horas  (+/‐  2  horas).  Medio  de  cultivo  VRBG  en  películas  laminadas.  Colonias  coloreadas  por  el  indicador  TTC.  Hongos  The  Petrifilm™  Yeast  and  Mold  (YM)  incubación  entre  20  a  25˚  C  durante  3  a  5  días.  Medio  de  cultivo  de  Sabouraud  en  películas laminadas, presencia de indicadores  químicos:  Indicador  para  fosfatasa.  Para  recuento de E. coli / coliformes, incubar para  coliformes a 35° C (+/‐ 1° C) durante 24 horas  (+/‐  2horas)  con  medio  de  cultivo  VRBL  modificado en películas laminadas, presencia  del indicador TTC  y para E. coli incubar a 35°  C (+/‐1° C) durante 48 horas (+/‐ 2 horas).    

41.2. Análisis parasitológico    Cada  una  de  las  muestras  de  agua  (100  mL),  se las centrifugó a 60 rpm durante 1 a 3 min;  se descartó el sobrenadante y los sedimentos  obtenidos  fueron  utilizados  como  muestra  para  el  análisis  parasitológico  (Rodríguez,  2000),  a  partir  del  cual  se  prepararon  los  frotis  o  extendidos.  Seguidamente,  se  realizaron  diversas  observaciones  utilizando  los métodos: directo (fresco), coloraciones de  hematoxilina  férrica  (heidenhain)  y  giemsa  modificada  (Maldonado,  et  al.,  2006).  También  se  hicieron  mediciones  micromorfométricas  de  las  estructuras  y  formas parasitarias detectadas.      42. Determinación de la calidad del agua    42.1. Resultados de microbiología    42.1.1. Recuento de enterobacterias    Los  resultados  de  las  aguas  del  Río  San  Miguel  presentaron  un  recuento  total  de  2428  enterobacterias,  este  valor  se  cuadruplica  con  respecto  al  registro  de  las  aguas del Río Putumayo (542) (Figura IX.7). 

  Figura IX.7. Recuento total de Enterobacteriaceae                        RÍO SAN MIGUEL       RÍO PUTUMAYO       hongos,  este  valor  se  triplica  con  respecto  al  42.1.2. Recuento de hongos  registro  de  las  aguas  del  Río  Putumayo  (18)    Los  resultados  de  las  aguas  del  Río  San  (Figura IX.8).  Miguel  presentan  un  recuento  total  de  70       


Figura IX.8. Recuento total de hongos                          RÍO SAN MIGUEL       RÍO PUTUMAYO     coli,  este  valor  se  duplica  con  respecto  al  42.1.3. Recuento de Escherichia coli  registro  de  las  aguas  del  Río  Putumayo  (51)    Los  resultados  de  las  aguas  del  Río  San  (Figura IX.9).  Miguel presentan un recuento total de 129 E.    Figura IX.9. Recuento total de Escherichia coli                          RÍO SAN MIGUEL       RÍO PUTUMAYO     coliformes  totales,  este  valor  tiene  similitud  42.1.4. Recuento de coliformes totales   con el registro de las aguas del Río Putumayo    Los  resultados  de  las  aguas  del  Río  San  (448) (Figura IX.10).  Miguel  presentan  un  recuento  de  643    Figura IX.10. Recuento total de coliformes fecales                      RÍO SAN MIGUEL       RÍO PUTUMAYO

142


42.2. Resultados de parasitología    No se registraron parásitos ni rotíferos en las  muestras de agua analizadas.    Se registró el 25% de diatomeas en el Río San  Miguel y Río Putumayo.   

En  el  Río  San  Miguel,  se  cuantificó  un  5%  de  hongos en relación al 25% del Río Putumayo,  indicando  que  la  cantidad  de  microorganismos se presenta en 5 veces más.     Las  bacterias  se  encontraron  presentes  en  el  35% de muestras de agua del Río San Miguel,  a diferencia del 65% encontrado en muestras  del Río Putumayo (Figura IX.11). 

  Figura IX.11. Parasitología de muestras de agua 

143 

                             

65 

      RÍO SAN MIGUEL                       RÍO PUTUMAYO

   PARÁSITOS  HUEVOS DE ASCARIS  ROTÍFEROS      DIATOMEAS          HONGOS            BACTERIAS  

Links web  www.soils.usda.gov  www.astm.org  www.soils.org  www.standardmethods.org                                         


FOTOGRAFรA Ambiente

143

Tala de รกrboles

Desechos presentes en riachuelos


144

Piscina expuesta a contaminaci贸n por aspersiones a茅reas

Contaminaci贸n en aguas del R铆o Putumayo


145

Análisis de suelo Toma de muestra Provincia de Sucumbíos

Análisis de suelo Toma de muestra Provincia de Sucumbíos


146

An谩lisis de suelos I Determinaci贸n de residuos de glifosato y AMPA Bosques

An谩lisis de suelos II Determinaci贸n de residuos de glifosato y AMPA Bosques


147

An谩lisis de suelos I Determinaci贸n de micro y macronutrientes Suelos cultivados

An谩lisis de suelos II Determinaci贸n de micro y macronutrientes Suelos cultivados


148

An谩lisis microbiol贸gico de muestras de agua Enterobacteriaceae

An谩lisis microbiol贸gico de muestras de agua Hongos y levaduras


149

An谩lisis microbiol贸gico de muestras de agua Escherichia coli

An谩lisis microbiol贸gico de muestras de agua Coliformes totales


PARTE X    MECANISMOS DE ATENUACIÓN Y REMEDIACIÓN 

151 

  43. Las  plantas  como  fuente  de  agentes  antimutagénicos    Las plantas vasculares contienen una enorme  potencialidad de productos que son útiles en  la  quimioprevención  de  enfermedades  relacionadas  con  las  mutaciones.  Las  plantas  han  sido  una  fuente  de  bioproductos  útiles  tanto  en  el  tratamiento  de  enfermedades  como  en  su  prevención.  Actualmente,  se  obtienen más de 120 bioproductos de plantas  vasculares  con  una  amplia  variedad  de  propiedades  terapéuticas  y  se  ha  estimado  que los productos derivados de estas plantas  representan  un  25%  del  total  de  las  prescripciones  de  fármacos  en  el  continente  asiático (Midorikawa, et al., 2001).     Los  antimutágenos  naturales  presentes  en  la  dieta  constituyen  una  opción  importante  como  agentes  quimiopreventivos  contra  el  cáncer  y  otros  padecimientos  de  riesgo,  ya  que  la  mayoría  de  los  inhibidores  de  la  mutagénesis  provenientes  de  otras  fuentes  pueden  causar  efectos  adversos  (Deguchi,  et  al.,  2000).  Los  productos  naturales  de  las  plantas  pueden  dividirse  en  terpenoides,  alcaloides,  compuestos  fenólicos  y  carbohidratos,  presentando  los  3  primeros  agentes  anticancerígenos  gracias  a  su  efecto  antimutagénico  (Ferrer,  et  al.,  2002).  Dentro  del  grupo  de  los  terpenoides,  se  encuentran  los fitosteroles, carotenoides, monoterpenos,  sesquiterpenos  y  saponinas.  Siendo  los  carotenoides  buenos  agentes  antioxidantes  que  eliminan  radicales  libres  y  especies  reactivas de oxígeno (Arencibia, et al., 2003).     Una  dieta  suplementada  con  β‐caroteno,  retinol,  α‐tocoferol  o  vitamina  C  resulta  de  gran beneficio para la reducción del cáncer y  el incremento de la longevidad. La capsantina  ha  sido  considerada  mejor  antioxidante  que  el  β‐caroteno  y  su  habilidad  para  eliminar  radicales  no  está  influenciada  por  la  esterificación (Maoka, et al., 2001).     El  D‐limonene  es  un  monoterpeno  cíclico  presente  en  los  aceites  esenciales  de 

numerosas  angiospermas,  y  se  conoce  que  puede  actuar  como  inhibidor  de  enzimas  de  fase  I  del  metabolismo  de  xenobióticos  y  como  inhibidor  de  las  modificaciones  post‐ transcripcionales de oncoproteínas (De Flora,  et al., 1998).     El efecto anticarcinogénico que se le atribuye  a  la  vitamina  E  (α‐tocoferol),  el  selenio  y  la  vitamina  C  (ácido  ascórbico)  es  resultado  de  las  propiedades  antioxidantes  de  estos  compuestos. El antioxidante más potente del  grupo  de  la  vitamina  E  es  el  α‐tocoferol,  el  cual puede actuar de manera sinérgica con el  β‐caroteno.  La  vitamina  E  es  capaz  de  funcionar a altas presiones de oxígeno y es un  potente  degradador  de  radicales  libres  de  oxígeno (Collins, 2001).     Los alcaloides pueden encontrarse en el 20%  de las angiospermas y presentan propiedades  analgésicas,  bactericidas,  antibióticas  y  psicotrópicas.  Entre  los  alcaloides  que  contienen pigmentos de monoterpenoides en  su  estructura  están  la  vinblastina  y  la  vincristina (aislados de Catharanthus roseus),  utilizadas  en  la  quimioterapia  frente  a  determinados  tipos  de  tumores  (Croteau,  et  al., 2000).     Entre  los  compuestos  más  estudiados  con  la  finalidad  de  buscar  agentes  quimiopreventivos  están  los  polifenoles,  que  agrupan  a  los  flavonoides  (tales  como  los  flavonoles,  las  flavononas  y  las  isoflavonas),  las  antocianinas,  los  taninos  y  los  lignanos,  muchos  de  los  cuales  se  encuentran  presentes en frutas, vegetales y bebidas muy  populares como el té y el vino. Los polifenoles  desempeñan  un  importante  papel  en  la  nutrición  y  se  ha  planteado  que  estos  compuestos  tienen  propiedades  antioxidantes,  antimutagénicas  y  anticarcinogénicas.  Se  conoce  que  inhiben  la  producción  de  bisulfitos  en  órganos  digestivos,  además  de  proteger  y  estabilizar  el  genoma.  Sin  embargo,  algunos  de  ellos  resultan  mutagénicos  y/o  pro‐oxidantes  ya  que  intervienen  en  vías  bioquímicas 


esenciales  que  involucran  topoisomerasas,  prostanoides  y  traducción  de  señales  (Ferguson,  1998,  2001).  Además,  polifenoles  como  el  cinnamaldehído,  la  coumarina  y  el  ácido  tánico,  modifican  la  replicación  y/o  la  reparación  del  ADN.  Ciertos  polifenoles  pueden  influir  directamente  modulando  la  expresión  génica  de  enzimas  que  participan  en  la  reparación  libre  de  error  del  ADN  (Abalea,  et  al.,  1999).  La  actividad  antioxidante  en  estos  compuestos  se  ha  asociado  a  su  habilidad  para  eliminar  los  radicales  libres  y  de  inhibir  los  citocromos  P450 o enzimas con actividad oxidante como  las  ciclooxigenasas  y  las  lipooxigenasas  (Abalea, et al., 1999).     Numerosos  estudios  experimentales  realizados  en  ensayos  de  mutación  múltiple  lo  identifican  al  té  como  anticlastogénico  y  antimutagénico,  atribuyendo  estas  propiedades  a  los  polifenoles  que  se  han  identificado  en  los  mismos.  El  té  contiene  polifenoles  tales  como  la  catequina,  epicatequina,  epigalocatequina,  galato  de  epigalocatequina  y  galato  de  epicatequina  entre otros. Es de resaltar que el té verde es  muy  usado  en  la  prevención  del  cáncer  ya  que  inhibe  la  expresión  de  genes  como  los  que  codifican  para  el  factor  de  necrosis  tumoral  (TNF‐α)  y  citoquinas,  inducidos  por  TNF‐α  (Suganuma,  et  al.,  2000).  Además  del  té,  existen  otras  plantas  que  poseen  acción  protectora y tal es el caso de la espinaca y la  remolacha,  de  las  cuales  se  conoce  que  el  jugo ofrece actividad antigenotóxica frente al  2‐acetilaminofluoreno  (Edenharder,  et  al.,  2002).  De  igual  forma,  el  ajo  ha  sido  considerado  un  compuesto  antioxidante  (Imai, et al., 1994). En un estudio en China se  indicó que existe una relación inversa entre la  mortalidad  por  cáncer  de  estómago  y  el  consumo  de  ajo,  lo  cual  muestra  la  primera  evidencia  de  su  potencial  anticarcinogénico,  corroborándose  luego  dichos  resultados  por  Buiatti  y  colaboradores  en  1989  (Buiatti,  et  al., 1989). El ajo y los componentes sulfurosos  asociados  a  este  son  reportados  como  supresores  de  la  incidencia  del  tumor  en  varias  partes  del  cuerpo  humano  incluyendo  el  cáncer  de  colon,  mamas,  útero,  esófago  y  pulmones  (Shukla,  et  al.,  1999;  Song  & 

Milner, 1999). Dicha protección es atribuida a  diferentes  mecanismos  como  pueden  ser  el  bloqueo  de  la  formación  de  compuestos  N‐ nitrosos,  la  supresión  en  la  bioactivación  de  severos  carcinógenos,  la  activación  de  la  reparación  del  ADN,  reducción  de  la  proliferación  celular  y  la  inducción  de  apoptosis (Arencibia, et al., 2003).     La  dieta  es  la  mayor  fuente  de  exposición  humana  a  los  carcinógenos  y  mutágenos  ambientales  así  como  a  los  anticarcinógenos  y antimutágenos. Estudios de laboratorio han  identificado  numerosos  mutágenos  y  carcinógenos  que  incluyen:  hidrocarburos  policíclicos  aromáticos  (PAHs),  aminas  heterocíclicas  (HAs),  nitrosaminas,  micotoxinas y carcinógenos de plantas. Existe  una  gran  evidencia  epidemiológica  de  que  una  dieta  rica  en  frutas  y  vegetales  puede  prevenir de alguna manera el cáncer humano  (DeMarini, 1998).     Los  compuestos  órgano‐sulfurados  solubles  en  agua  son  quimiopreventivos  en  la  etapa  de  iniciación  de  la  carcinogénesis.  Los  diallyl  sulfidos  inhiben  electivamente  ciertas  enzimas  P450,  así  como  el  desarrollo  de  carcinomas  de  colon,  esófago  y  adenomas  pulmonares  en  roedores  cuando  son  administrados  después  de  la  exposición  a  carcinógenos (Fukushima, et al., 2001).     El  ácido  fítico  (myo‐inositol  hexafosfórico)  se  encuentra presente en el polen y las esporas  así como en las plantas leguminosas, cereales  y  en  el  interior  de  las  células  de  mamíferos,  para lo cual se sugiere un rol protagónico de  los  grupos  fosfatos  del  ácido  fítico  y  los  inositoles  fosfatos  en  la  protección  ante  el  daño  oxidativo  al  ADN  (Midorikawa  &  Kawanishi, 2001).       44. Mecanismos  fisicoquímicos  y  biológicos  convencionales    Es  muy  importante  conocer  el  funcionamiento  de  los  diferentes  mecanismos  tanto  convencionales  como  avanzados  para  el  proceso  de  atenuación  y  remediación  del  herbicida  glifosato  en  las 

152


153 

diferentes  superficies  de  la  naturaleza  expuestas  a  las  aspersiones  tanto  terrestres  como  aéreas,  con  el  objetivo  de  frenar  de  alguna forma el grave impacto ambiental que  generan  las  mezclas  concentradas  de  herbicidas.    Existen  varios  estudios  que  han  permitido  establecer procesos de remoción del glifosato  en el agua.     En  los  estudios  desarrollados  por  Hallas,  et  al.,  se  plantea  el  uso  de  bacterias  inmovilizadas  para  la  remoción  del  glifosato  (≤  50  mg/L)  en  corrientes  acuosas  y  con  tiempos  de  retención  hidráulicos  bajos;  además desarrollaron el proceso de remoción  del  glifosato  utilizando  un  reactor  cuya  capacidad  fue  de  45  L/min,  logrando  una  degradación  de  más  del  90%  en  10  minutos  de  tiempo  de  retención  hidráulico  de  la  sustancia tóxica (Hallas, et al., 1992).     En  los  estudios  desarrollados  por  Speth,  se  plantea  el  uso  de  carbón  activado,  tratamientos  convencionales,  oxidación,  filtración y separación por membranas con el  fin  de  remover  el  glifosato  de  las  fuentes  de  agua  potable  de  las  poblaciones  afectadas.  Este  mecanismo  se  aplicó  con  concentraciones  bajas  del  glifosato  (0,796  mg/L) en agua destilada y en agua de río. Los  ensayos  de  oxidación  determinaron  que  el  glifosato  a  bajas  concentraciones  es  destruido  por  cloro  y  ozono;  los  oxidantes:  peróxido  de  hidrógeno,  permanganato  de  hidrógeno  y  dióxido  de  cloro  no  fueron  eficientes  para  la  remoción  del  glifosato.  El  uso del coagulante alumbre determinó que el  glifosato  se  elimina  solo  si  la  turbiedad  del  agua  es  menor  a  0,2  NTU.  Mientras  que  el  uso  de  carbón  activado  determinó  que  el  glifosato  es  fuertemente  absorbido  en  agua  destilada y menos fuerte en agua correntosa  de río (Speth, 1993).    En la investigación realizada por Ermakova, et  al., se determinó la eficiencia del proceso de  bioremediación  en  los  suelos  afectados  por  concentraciones  de  glifosato  10  veces  mayores  a  las  recomendadas.  La  biodegradación  aeróbica  del  glifosato  se 

realizó  a  partir  del  uso  de  las  cepas  bacterianas  Ochrobactrum  anthropi  GPK  3  y  Achromobacter  sp.  Kg  16,  cuyos  rangos  de  degradación  fueron  entre  2  y  3  veces  mayores que las bacterias nativas del suelo, y  cuya duración no tardó más de 2 semanas. Se  demuestra  que  el  uso  de  bacterias  bioremediadoras  es  una  importante  estrategia para atenuar el impacto ambiental  producido  por  aspersiones  o  derrame  del  herbicida (Ermakova, et al., 2010).       45. Mecanismos enzimáticos    La  investigación  realizada  por  Pizzul  et  al.,  consistió  en  estudiar  el  potencial  de  las  enzimas  lignolíticas  (peroxidasa  y  lactasa)  para  degradar  el  glifosato  (10  mg/L)  y  formulaciones  con  glifosato  como  es  el  Roundup Bio. A partir del uso de las enzimas  lignolíticas  se  logró  degradar  el  glifosato  en  24  horas,  mientras  que  la  formulación  tardó  en degradarse alrededor de 4 días. A pesar de  que se observó degradación del herbicida, no  se  observó  transformación  con  respecto  al  metabolito  AMPA  utilizando  la  enzima  manganeso peroxidasa (Pizzul, et al., 2009).        46. Mecanismos de oxidación     Los  procesos  avanzados  de  oxidación  (PAOs)  o  las  tecnologías  avanzadas  de  oxidación  (TAOs)  han  sido  útiles  en  la  degradación  del  glifosato  presente  en  el  agua.  Los  PAOs  utilizan  agentes  antioxidantes  (H2O2/Fe/UV,  TiO2/UV,  UVC/O3,  H2O2/UVC)  para  producir  especies altamente oxidantes como el radical  hidroxilo (∙OH) que reacciona con el herbicida  permitiendo  su  degradación.  Las  tecnologías  avanzadas  de  oxidación  presentan  varias  ventajas  debido  a  que  permiten  degradar  el  agente  contaminante  generando  su  mineralización  completa,  mejoran  las  propiedades organolépticas del agua tratada,  y  no  generan  efectos  secundarios  perjudiciales a la salud (Domènech, 2004).     Uno  de  los  procesos  avanzados  de  oxidación  para  la  degradación  inicial  de  42  mg/L  de  glifosato  en  agua,  consiste  en  el  uso  del 


catalizador  dióxido  de  titanio  (TiO2)  en  suspensión y radiación UV. En este estudio se  demuestra  que  el  glifosato  puede  ser  fácilmente degradado (Chen & Liu, 2007).    Huston  &  Pignatello  estudiaron  la  degradación  del  glifosato  en  agua  mediante  el  proceso  foto‐Fenton.  Se  investigó  la  degradación de ingredientes activos de varios  pesticidas.  Los  principios  activos  estudiados  fueron:  aldicarb,  azinfos‐metil,  carbofuran,  alaclor,  captan,  disulfotón,  glifosato,  dicamba,  metoxicloro,  malation,  picloram  y  simazina.  Los  resultados  permitieron  observar que en la mayoría de los casos hubo  una  completa  pérdida  de  los  principios  activos.  Además  se  observó  que  los  ingredientes  organofosforados  (glifosato)  mostraron  menor  conversión  del  carbono  orgánico  total  para  un  mismo  tiempo  de  reacción  (Huston  &  Pignatello,  1999).  Los  estudios realizados por Chen, et al., se basan  en la fotodegradación del glifosato en agua a  partir  del  sistema  ferrioxalato  (Fe+3/C2O4‐2)  bajo  irradiación  usando  una  lámpara  de  haluro metálico. La degradación del glifosato  (1  a  5  mg/L)  resultó  ser  eficaz.  Los  investigadores  también  proponen  un  mecanismo  de  degradación  donde  se  formarían  sarcosina  y  ácido  aminometilfosfónico (Chen, et al., 2007).     El  proceso  que  utiliza  UVC/H2O2  ha  sido  exitoso  en  la  remoción    de  numerosos  contaminantes  presentes  en  aguas  y 

efluentes  industriales  incluyendo  pesticidas  (Ikehata  &  Gama,  2006).  Los  estudios  realizados  por  Hügul,  et  al.,  han  demostrado  que  este  proceso  presenta  grandes  ventajas  debido  a  que  el  oxidante  es  comercialmente  accesible,  es  térmicamente  estable,  posee  solubilidad  infinita  en  agua,  se  requiere  una  mínima  inversión  y  el  proceso  operativo  es  sencillo  (Hügul,  et  al.,  2000).  El  proceso  que  se  realiza  a  partir  de  UVC/H2O2  ha  sido  aplicado  por  la  Universidad  Nacional  del  Litoral  con  el  objetivo  de  degradar  tanto  diluciones  acuosas  del  glifosato  ácido  como  de  formulaciones  comerciales.  En  un  trabajo  realizado por Manassero, et al., se estudiaron  todas  las  variables  que  afectan  la  eficacia  de  este proceso de degradación como son el pH,  las concentraciones de glifosato, el H2O2 y los  niveles de radiación (Manaserro, et al., 2010;  UNL, 2010).        El  grupo  de  investigación  de  Balci,  et  al.,  estudió  la  capacidad  del  proceso  electro‐ Fenton  modificado  para  la  degradación  de  soluciones  acuosas  de  glifosato,  en  el  cual,  reemplaza  el  átomo  de  Fe  por  Mn+2.  Este  proceso  se  lo  llevó  a  cabo  en  una  celda  electrolítica  con  cátodo  de  carbono  y  ánodo  de  platino  y  se  estudió  el  efecto  de  la  corriente  aplicada  y  de  diferentes  concentraciones  de  Mn+2  y  del  herbicida  glifosato que van de 17 a 68 mg/L. Una de las  observaciones  importantes  fue  la  degradación más lenta del AMPA (Balci, et al.,  2009).

   Links web  www.ncbi.nlm.nih.gov/pubmed/11334889  www.pubs.acs.org/doi/abs/10.1021/jf990944b  www.cancerletters.info/article/S0304‐3835(01)00635‐8/abstract  www.ncbi.nlm.nih.gov/pubmed/11295150  www.ncbi.nlm.nih.gov/pubmed/9685677  www.ncbi.nlm.nih.gov/pubmed/11295156  www.ncbi.nlm.nih.gov/pubmed/10401609  www.ncbi.nlm.nih.gov/pubmed/11237202  www.ncbi.nlm.nih.gov/pubmed/12438004  www.ncbi.nlm.nih.gov/pmc/articles/PMC195577/  www.cedb.asce.org/cgi/WWWdisplay.cgi?85599  www.ncbi.nlm.nih.gov/pubmed/20676632  www.ncbi.nlm.nih.gov/pubmed/19396551   

154


FOTOGRAFÍA Comunidades fronterizas II

154

Convivencia de viviendas con la naturaleza Provincia de Sucumbíos

Viviendas desprotegidas Provincia de Sucumbíos


155

Siembra de cultivos Provincia de Sucumbíos

Fuente natural de agua susceptible a contaminación Provincia de Sucumbíos


156

Forma inapropiada de agrupar el ganado bajo una vivienda Provincia de Sucumbíos

Ganado alimentándose Provincia de Sucumbíos


157

Animales en viviendas Provincia de SucumbĂ­os

Aves y cerdos Provincia de SucumbĂ­os


158

Reservorio de agua Susceptible a la contaminación

Títeres Provincia de Sucumbíos


159

Problemas de estructura en las viviendas Provincia de Sucumbíos

Forma en la que la población seca la ropa, susceptible a ser contaminada Provincia de Sucumbíos


PARTE XI    CONCLUSIONES Y SUGERENCIAS  

161 

  47. Conclusiones    ∙ Desde el año 2000 hasta el 2007, el territorio  ecuatoriano  fronterizo  con  Colombia,  en  especial  las  comunidades  fronterizas  de  las  Provincias  de  Esmeraldas,  Carchi  y  Sucumbíos  han  sido  afectadas  por  el  Plan  Colombia, cuyo objetivo ha sido erradicar la  producción  de  cultivos  ilícitos  como  la  coca  (Erythrozyllum  coca),  amapola  (Papaver  somniferum)  y  marihuana  (Cannabis  sativa),  mediante  las  aspersiones  aéreas  con  un  paquete  herbicida  de  amplio  espectro.  El  programa facilitado por el Departamento de  Antinarcóticos  de  la  policía  de  Colombia  (DIRAN‐CNP)  ha  causado  conflicto  político,  social y económico entre ambos países.    ∙ Debido  a  la  problemática  generada  a  causa  de  las  aspersiones  aéreas  con  paquetes  de  herbicidas  altamente  concentrados,  el  Instituto de Investigaciones Biomédicas de la  Universidad  de  las  Américas  desarrolló  un  proyecto  entre  los  años  2008  y  2010,  cuyo  objetivo  fue  el  establecer  una  línea  base  en  el área genética, citogenética, en la salud, en  el  área  psicológica  y  en  los  factores  ambientales de 10 de las comunidades, de la  Provincia  de  Sucumbíos,  afectadas  por  las  aspersiones aéreas.     ∙ El  estudio  recoge  declaraciones  de  174  adultos,  presentes  en  10  asambleas  comunitarias  de  10  comunidades  visitadas,  las  entrevistas  personales  a  144  padres  de  familia (46,9% de las 307 familias censadas),  los chequeos médicos a 521 personas (35,9%  de  los  1450  residentes)  y  los  análisis  genéticos  y  citogenéticos  a  partir  de  muestras  de  sangre  periférica  de  182  individuos  expuestos  y  no  expuestos  a  las  aspersiones aéreas.    ∙ La  población  es  eminentemente  ecuatoriana,  con  orígenes  de  17  provincias,  pero  el  16,1%  de  las  familias  son  de  origen  colombiano.  Presencia  que  se  ha  incrementado  especialmente  en  los  últimos 

10  años  que  comenzaron  en  Colombia  las  aspersiones aéreas contra cultivos ilícitos.     47.1. Condiciones genéticas   

  ∙

  ∙

  ∙

 

En el año 2006, se evaluó el daño del ADN a  24  individuos  ecuatorianos  expuestos  a  las  aspersiones  aéreas  a  través  de  la  técnica  ensayo  cometa,  utilizada  ampliamente  en  estudios  con  genotóxicos  como  hidrocarburos,  rayos  X  y  pesticidas;  los  resultados  demostraron  un  alto  grado  de  daño del ADN en el grupo expuesto (longitud  cometa = 35,5 µm) comparado con el grupo  control  (longitud  del  cometa  =  25,94  µm),  sugiriendo  que  los  individuos  expuestos  al  paquete  herbicida  de  amplio  espectro  presentaron efecto genotóxico.  Dos años después de las últimas aspersiones  aéreas  se  observó  que  el  total  de  la  población estudiada no presentó ningún tipo  de  alteraciones  cromosómicas,  siendo  su  cariotipo  normal  46,XX;  mientras  que  el  porcentaje  de  fragilidad  cromosómica  se  encontró dentro de los rangos normales.  Con  respecto  al  estudio  genético,  el  gen  GSTP1 codifica proteínas que intervienen en  el  metabolismo  de  xenobióticos  y  juega  un  rol  importante  en  la  regulación  de  la  apoptosis.  Se  observó  asociación  estadísticamente  significativa  del  alelo  correspondiente  a  valina  en  expuestos  (0,48),  a  diferencia  de  los  no  expuestos  (0,28).  La  glutatión  peroxidasa  es  una  de  las  enzimas  antioxidantes  más  importantes  en  humanos,  funciona  en  la  detoxificación  del  peróxido  de  hidrógeno  y  forma  parte  de  la  defensa  antioxidante  que  previene  el  daño  oxidativo  en  el  ADN.  El  polimorfismo  Pro198Leu se lo ha asociado con el cáncer de  pulmón,  de  vejiga  y  de  mama.  Se  observó  asociación  del  alelo  correspondiente  a  leucina  en  expuestos  (0,41),  a  diferencia  de  los individuos no expuestos (0,32). 


  ∙

La  proteína  codificada  por  el  gen  XRCC1  se  encuentra envuelta en el mantenimiento de  la integridad  estructural del ADN  cuyo  daño  es  inducido  por  factores  ambientales.  El  alelo  Arg  se  encontró  presente  en  mayor  frecuencia  en  la  población  expuesta  al  glifosato. La prueba de OR determina que no  hay  riesgo  significativo  en  la  población  que  presenta el polimorfismo Arg399Gln.  Los análisis genéticos realizados al momento  de las aspersiones aéreas con glifosato, en el  año  2006,  demostraron  que  la  población  ha  sufrido  fragmentación  en  su  ADN,  mientras  que  la  evaluación  citogenética  realizada  dos  años  después  de  las  últimas  aspersiones  aéreas  con  glifosato  nos  demuestra  que  la  población  estudiada  no  presenta  alteraciones cromosómicas. 

  47.2. Condiciones sociales y de salud    ∙ Las  comunidades  estudiadas  de  la  Provincia  de Sucumbíos no tienen buenas condiciones  de vida puesto que no cuentan con servicios  básicos.  Las  condiciones  de  salubridad  y  vivienda  no  son  las  más  adecuadas  para  el  ambiente  amazónico  debido  a  que  son  viviendas  poco  ventiladas  construidas  con  techos  de  zinc,  y  el  42,3%  de  ellas  no  usa  toldillos  de  protección  para  vectores.  Las  tres  cuartas  partes  de  las  familias  permiten  la  entrada  de  animales  como  perros  y  gallinas  a  las  casas.  El  77%    de  los  hogares  dan tratamiento a la basura mientras que el  23%  la  bota.  La  población  refugiada  inicialmente  vive  en  condiciones  extremas  siendo  ayudados  por  la  solidaridad  de  la  población ecuatoriana.    ∙ El  consumo  de  agua  depende  en  su  gran  mayoría de lo que aporta la naturaleza, pues  el  38,8%  procede  de  los  ríos,  esteros  o  vertientes mientras que el 25,2% procede de  la lluvia. En un 21,58% el suministro de agua  proviene de pozos abiertos por cada familia,  siendo el consumo potable o entubado solo  el 14,42%. Para la eliminación de heces solo  el  38,4%  de  las  familias  cuenta  con  algún  tipo de instalación, mientras que el 61,4% lo  hace  en  campo  abierto.  El  aseo  personal  es  importante  y  diario  en  el  90%  de  la 

población pero el 64,4% usa jabones que son  abrasivos para la piel.    ∙

  ∙

  ∙

El  30,3%  de  las  familias  tienen  tierras,  mientras que el 69,7% son posesionarios de  fincas  que  en  promedio  tienen  21,3  hectáreas,  aunque  el  rango  oscila  entre  el  solar y 250 hectáreas, de las cuales, la mitad  están  cultivadas.  Esta  falta  de  propiedad  (dificultad  de  trámites  y  costos)  da  mucha  vulnerabilidad a la población y le hace objeto  fácil  de  migraciones,  especialmente  cuando  sus  principales  productos  son  afectados.  La  principal  actividad  de  subsistencia  es  la  agricultura, cultivando principalmente cacao,  potrero y café.   Más  de  la  mitad  de  las  familias  (54,2%)  no  usa  agrotóxicos,  y  de  este  porcentaje  el  76,56%  no  usa  glifosato.  El  uso  de  glifosato  no  es  generalizado,  ni  en  cantidades  significativas.  El  88,2%  de  las  familias  encuestadas  no  usa  este  químico  para  sus  cultivos.  Además  la  frecuencia  de  uso  de  este  compuesto  es  más  común  semestralmente.  El  81,6%  de  la  población  manifestó  conocer  poco  o  nada  de  los  riesgos  del  uso  de  agrotóxicos  (sólo  el  18,7%  afirmó  saber  mucho al respecto). El 64,5% de las personas  que  usan  agroquímicos  no  se  protegen  con  ropa  adecuada  para  evitar  entrar  en  contacto  con  el  químico,  el  73,8%  no  usa  mascarillas,  el  87,8%  no  usa  guantes  y    el  8,2%  no  usa  botas,  pero  además,  a  la  hora  de lavar la ropa con la que se fumigó, se lava  en  un  48,3%  con  la  del  resto  de  la  familia.  Reconocen  que  el  53%  de  los  equipos  de  fumigación están en mal estado. El 40% bota  los  envases  al  medio  ambiente  y  el  4,5%  de  los  usuarios  de  agrotóxicos  reutiliza  los  envases  para  contener  y  tomar  agua.  Esto  causó  que  el  9,4%  de  los  chequeados  manifestaran intoxicación por pesticidas. 

 

Sobre la nutrición global, existe una notable  mejoría  del  estado  nutricional  actualmente  al  presentado  en  el  año  2006,  en  pleno  periodo  de  fumigaciones.  Han  bastado  dos  años  sin  fumigar  para  que  el  estado  desnutricional global en niños de 6 a 17 años 

162


baje  de  un  10,3%  a  un  3%  mientras  que  el  riesgo de desnutrición disminuyó también de  un  36,3%  a  un  23,2%.  Por  edades,  el  grupo  de  niños  y  niñas  menores  a  6  años  tiene  el  mayor  porcentaje  de  desnutrición  (14,9%  para  varones  y  13,6%  para  niñas);  el  porcentaje  de  desnutrición  disminuye  notablemente  en  el  grupo  de  6  a  11  años  (2%  para  varones  y  1,8%  para  niñas);  mientras que en el grupo de edad de 12 a 17  años asciende la desnutrición a un 3,8% para  varones y 6,7% para mujeres. 

163    ∙

  ∙

  ∙

Sobre  la  desnutrición  crónica,  se  encontraron  cifras  muy  similares  a  las  encontradas  en  el  año  2006  para  la  población  escolarizada  de  6  a  17  años.  Donde había una desnutrición del 29% ahora  es de 28% y frente a un riesgo del 35% ahora  hay  riesgo  del  40%.  Estas  cifras  avalan  el  carácter  crónico  del  indicador  y  posiblemente  se  requiera  de  más  tiempo  para  ver  variaciones.  Por  grupos  de  edad  destaca  que  el  que  tiene  una  peor  desnutrición  va  de  12  a  17  años  (41%),  posiblemente  porque  ya  es  población  que  realiza  labores  fuertes  en  la  producción  agrícola  (como  el  uso  de  pesticidas)  y  necesitaría  una  mejor  nutrición,  frente  al  30% del grupo menor de 6 años y el 22% de  entre 6 y 11 años. Destaca además que esta  desnutrición  es  peor  en  las  mujeres  (33%)  que en los varones (24%).  Sobre  la  desnutrición  aguda,  hay  ligeras  modificaciones  con  respecto  a  las  del  año  2006,  pasando  de  una  desnutrición  aguda  del 1,87% a una actual de 1% y un riesgo de  7,17%  a  un  5,8%,  sin  embargo  se  destaca  que  hay  una  mayor  obesidad  que  pasó  del  5,9% al 16,3%, lo que no habla de una mejor  nutrición,  sino  de  un  mayor  desbalance  nutricional.  El  IMC  en  los  adultos  demuestra  que  después  de  estos  dos  años  sin  aspersiones  no  hay  desnutrición  en  los  adultos  mayores  de  18  años,  existiendo  no  obstante  una  tendencia a la obesidad que implica al 29,7%  de las mujeres y al 7,8% de los varones y es  una  tendencia  que  aumenta  con  la  edad.  El  8% de las mujeres manifestaron que la causa 

de  sus  abortos  fueron  las  aspersiones  del  Plan Colombia.    ∙

  ∙

  ∙

  ∙

  ∙

  ∙

Sobre  la  salud  familiar,  se  destaca  que  durante el periodo de las aspersiones aéreas  del  Plan  Colombia,  aumentaron  los  abortos  de un 8,4% a un 12,7%, mientras que en ese  mismo  periodo  la  mortalidad  infantil  disminuyó del 12% al 9,1%.  El  80%  de  las  malformaciones  que  se  manifestaron  en  la  frontera  fueron  después  del comienzo del periodo de las aspersiones.  El restante 20% fue previo a las aspersiones.  Las principales causas de mortalidad son por  causa  de  enfermedades  (40%),  por  causas  desconocidas  (17%),  por  causas  ligadas  al  parto  (13%),  muertes  ligadas  a  la  violencia  (9%),  atribuidos  al  mal  aire  (6%),  las  causadas por las aspersiones aéreas del Plan  Colombia (5%), cánceres (4%), accidentes de  tránsito y malformaciones congénitas el 2%,  y  el  1%  por  uso  de  pesticidas  y  mordeduras  de serpiente.    La  falta  de  aviso  de  que  se  iba  a  fumigar  sumió a la gente en la indefensión. El 46,8%  dijeron que los químicos entraron a las casas  y  un  47,7%  manifestaron  continuar  con  sus  labores  durante  las  aspersiones.  Las  comunidades  estuvieron  expuestas  a  los  impactos  de  las  aspersiones  porque  no  se  tomaron  medidas  preventivas  ni  se  informó  a las comunidades de los riesgos.  El  35,7%  de  los  individuos  manifestó  que  la  sustancia  que  descendía  de  las  aspersiones  aéreas  no  siempre  tenía  la  misma  forma,  color  y  olor,  lo  que  hace  pensar  que  en  las  aspersiones  se  usó  un  paquete  de  herbicidas, mezclado con varios compuestos  tóxicos a elevadas concentraciones.  En  el  84,7%  de  las  familias,  uno  de  los  miembros se enfermó en el momento de las  aspersiones  aéreas  por  causa  del  efecto  de  los herbicidas utilizados. Las manifestaciones  fueron  problemas  respiratorios,  digestivos,  oftalmológicos,  cefaleas,  o  cutáneos,  mientras  que  poco  después  de  las  aspersiones,  los  problemas  de  piel  se 


través  de  promotores  de  salud,  parteras  y  hierbateros  que  con  dotación  de  botiquines  con  medicamentos,  plantas  y  acupuntura  pudieran  ofrecer  un  primer  recurso  a  los  habitantes, para que las enfermedades no se  tornen  crónicas  y  puedan  ser  atendidos  aquellos  casos  que  necesiten  de  una  pronta  identificación para instituciones que como el  Patronato  Provincial  o  el  mismo  Ministerio  de Salud puedan darle seguimiento. 

convierten  en  los  más  importantes.  Los  niños fueron los principales afectados por las  aspersiones  aéreas.  El  32,4%  de  las  familias  manifestaron  que  durante  las  aspersiones  aéreas  algún  miembro  se  enfermó  de  gravedad y este porcentaje sube al 60,9% de  las familias después de las aspersiones.    ∙

  ∙

  ∙

  ∙

La mayoría de las familias manifestaron que  los impactos más visibles y las enfermedades  más  graves  se  dieron  en  el  año  2002,  y  la  atención  se  dio  especialmente  en  consultorios  y  clínicas  privadas,  por  lo  que  no  se  despertaron  las  alarmas  epidemiológicas.  En  las  521  personas  chequeadas  se  encontraron  133  tipos  diferentes  de  enfermedades,  destacando  que  las  principales  afecciones  fueron  de  piel,  digestivas,  de  ojos,  garganta,  nariz,  oídos  y  músculo‐esqueléticas; todas ellas superaban  a  un  cuarto  de  la  población,  y  junto  con  los  problemas  detectados  en  la  sangre,  constituyen  el  76%  de  la  frecuencia  de  enfermedades.  Las manifestaciones clínicas que presentó la  población  durante  e  inmediatamente  después  de  las  aspersiones  fueron  pérdida  de vista, irritación de ojos, náuseas, vómitos  y  mareos,  dificultad  respiratoria,  secreción  rinofaríngea,  lesiones  descamativas  máculo‐ papulares, granos tipo piodermis, pérdida de  pelo,  prurito  intenso,  dolores  de  cabeza,  pérdida  de  conocimiento  y  desmayo,  insomnio,  desánimo,  tristeza,  preocupaciones  persistentes,  ansiedad,  miedo,  angustia,  psicosis,  pesadilla,  presencia de abscesos peridentarios, dolores  articulares, cansancio, debilidad, incremento  de  las  interrupciones  del  embarazo  y  de  las  malformaciones  e  incremento  de  la  mortalidad  infantil  en  el  momento  de  las  aspersiones.  La  situación  de  abandono  en  la  que  se  encuentran  las  comunidades  de  la  frontera  no  solo  necesita  de  una  mejor  y  más  frecuente atención médica, sino del impulso  de instituciones que desde las comunidades  puedan  rescatar  y  ofrecer  mejor  atención  a 

  ∙

  ∙

  ∙

  ∙

En  el  caso  de  enfermedades  crónicas,  se  ha  encontrado  una  falta  de  seguimiento  de  las  instituciones y un acceso voluntarista de los  pacientes.  Es  necesario  que  el  seguimiento  se pueda estructurar y en esto el apoyo de la  población local es muy importante.  Sobre  los  cultivos,  los  testimonios  comunitarios  y  las  entrevistas  familiares,  coinciden  en  manifestar  que  durante  las  aspersiones se perdieron las cosechas de los  productos de ciclo corto y que los cultivos de  cacao,  café  y  banano  disminuyeron  notablemente  su  producción  y  algunas  plantas  murieron,  afectándose  también  los  árboles frutales y el pasto.  Se  refirieron  pérdidas  en  alrededor  del  45,6%  de  las  fincas,  especialmente  la  casi  totalidad  de  las  tierras  cultivadas,  mientras  que  el  39,8%  manifestó  daños  también  en  los árboles de la montaña.  El  96,3%  de  las  familias  manifestaron  que  tras  las  aspersiones  cambió  el  color,  la  apariencia  o  el  sabor  de  las  plantas.  Las  familias tuvieron que enfrentar la pérdida de  sus  cultivos,  y  la  posterior  baja  de  producción  y  esterilidad  o  pérdida  de  fertilidad  en  sus  tierras.  Las  características  del  mal  que  afectó  a  sus  productos  fueron  variadas, pero siempre con el mismo efecto:  dejó  a  muchos  campesinos  sin  el  sustento  económico resultante de las ventas de estos  productos,��e incluso el 96,1% de las familias  manifestó  que  se  amenazó  el  autoabastecimiento  de  alimentos  por  pérdidas de sus chacras. Todo ello, junto con  el  rechazo  a  comprar  los  productos  procedentes  de  la  frontera,  llegó  a  generar  hambre. 

164


165 

  ∙

  ∙

  ∙

  ∙

  ∙

El  81,4%  de  las  familias  manifestó  que  se  produjeron daños en la fertilidad de la tierra  y  que  éstos  se  mantienen  hasta  el  día  de  hoy, lo que afecta el volumen de sus ventas  y  por  tanto  de  ingresos.  En  búsqueda  de  soluciones  para  esta  situación  se  ha  ampliado  la  frontera  agrícola  de  las  comunidades,  tumbando  montaña  y  solicitado  nuevos  créditos  a  bancos  e  instituciones.  El 68,9% de las familias manifestaron que el  agua  de  consumo  estaba  contaminada  y  algunos  tuvieron  que  consumirla  porque  no  tenían otra alternativa.  Con  respecto  la  perdida  de  animales,  el  37,9%  de  las  familias  dijeron  haber  visto  peces  muertos  en  los  ríos  tras  las  aspersiones,  pero  todos  quienes  tuvieron  piscinas de peces manifestaron haber tenido  pérdidas  importantes  durante  las  aspersiones. De igual manera se manifestó el  alto  número  de  abortos  y  muerte  de  vacas,  chanchos,  gallinas,  caballos,  perros  y  gatos.  También  animales  de  monte  aparecieron  muertos  durante  las  aspersiones  como  los  monos, guacamayos y loros. El 13,6% de las  familias  dijeron  haber  consumido  los  animales  muertos  ante  la  seguridad  de  que  nadie les iba a reponer esas pérdidas.  A  la  pérdida  de  animales  por  enfermedad  o  muerte se suma la venta,  y muy por debajo  del precio en el mercado, de otros animales  con  el  objetivo  de  cubrir  los  gastos  de  atención médica de algún familiar.  El  período  de  mayor  intensidad  de  las  aspersiones aéreas fue entre los años 2002 y  2004. La mayoría de casos de enfermedades  graves  y  muerte  de  animales  ocurrió  en  el  año  2002,  mientras  que  el  mayor  índice  de  mortalidad ocurrió en los años 2003 y 2004.  La  población  recuerda  más  los  episodios  de  estos años.  Sobre  las  afecciones  comunitarias,  las  aspersiones  aéreas  ocasionaron  un  grave  daño  al  modo  de  vida  de  los  pobladores  de  la  frontera,  quienes  vieron  comprometidos  la  producción  y  comercialización  de  sus 

productos,  la  salud  y  la  educación  de  sus  hijos, así como la calidad del agua y alimento  de  consumo  propio.  La  pérdida  de  productividad dura hasta hoy.    ∙

Las  aspersiones  aéreas  fueron  la  principal  causa  del  desplazamiento  del  15,9%  de  familias  ecuatorianas  de  la  frontera  que  migraron a otras partes del país para alejarse  de  los  efectos  tóxicos  de  los  herbicidas,  mientras  que  a  las  comunidades  fronterizas  llegaron  un  14,6%  de  familias  colombianas  que a su vez huyeron de la violencia y de las  aspersiones del territorio colombiano. 

  47.3. Condiciones psicológicas    ∙ El 84,86% de las familias manifestaron haber  tenido  algún  tipo  de  alteraciones  psicológicas  durante  las  aspersiones,  siendo  la  reacción  más  frecuente  el  miedo  que  presentó  el  51,3%.  Tras  el  paso  de  las  avionetas disminuyó el miedo y aumentaron  las  preocupaciones  sobre  el  futuro  de  los  cultivos (18,6%) y la tristeza (16,7%).     ∙ En  los  dibujos  evaluados  se  aprecian  rasgos  de  alegría,  espontaneidad,  adaptabilidad,  sensibilidad,  creatividad,  capacidad  de  expresión  y  adaptación  a  las  exigencias  del  medio, a su vez angustia, fragilidad, cautela,  tendencias paranoides y vigilancia. Donde la  necesidad  de  protección  y  seguridad  son  evidentes.    

En los niños las manifestaciones psicológicas  y  el  miedo  originado  desde  el  momento  de  las  aspersiones  se  mantiene  hasta  el  día  de  hoy. Algunos padres señalaron el cambio de  comportamiento,  después  de  las  aspersiones,  con  conductas  de  agresividad,  nerviosismo,  cohibición  o  del  impacto  negativo  en  su  asistencia  y  desempeño  escolar.  El  informe  psicológico  realizado  a  través  de  los  dibujos  infantiles  demuestra  que es evidente la necesidad de protección y  seguridad.  El  especialista  aconseja  realizar  un apoyo psicológico porque a la evaluación  realizada  se  aprecian  rasgos  en  que  la  presencia de aviones y helicópteros influyen  de  una  manera  negativa  en  la  psicología  de  los  niños  puesto  que  en  muchos  dibujos  se 


nivel  bajo.  Significando  que  la  mitad  de  los  suelos  cultivados  están  en  rangos  medios  mostrando    una  correcta  maduración  de  las  plantas,  facilidad  de  crecimiento,  división  y  alargamiento  celular  resistiendo  a  enfermedades. 

observa  cruce  de  fuego  entre  esos  artefactos,  y  en  otros,  aeronaves  arrojan  líquidos  no  determinados  desde  el  aire,  los  cuales  caen  a  tierra  sobre  humanos,  animales y vegetación.    47.4. Condiciones ambientales    ∙ El  glifosato  es  poco  móvil  en  suelos  aunque  esta  propiedad  debe  entenderse  en  función  de    la    composición  particular  de  los  mismos.  Sin  embargo, existe  escasa  información  y  producción  de  datos  al  respecto en nuestro país.     

La  persistencia  del  glifosato  relevada  en  suelos  varía  sensiblemente,  en  semanas  a  pocos  meses,  según  se  trate  de  climas  templados  o  cálidos,  dependiendo  de  las  características del suelo. 

  ∙

  ∙

 

  ∙

  ∙

Se  advierte  la  escasez  de  estudios  regionales  sobre  la persistencia y movilidad  en  suelos,  por  lo  cual  se  considera  importante    el  monitoreo  continuo  en  la  zona de frontera.  En  muestras  de  suelo  de  bosque  se  determinó la presencia de glifosato y AMPA  en  cantidades  menores  al  límite  de  detección. Debido a que las zonas donde se  tomaron las muestras pertenecen a bosques  y  no  a  zonas  para  la  agricultura,  resulta  concluyente  que  por  las  características  geológicas  de  los  suelos,  se  absorbieron  y  perduraron  residuos  mínimos  del  coctel  pesticida  proveniente  de  las  aspersiones  aéreas.  Los  resultados  obtenidos  del  análisis  de  suelos  para  determinación  de  nitrógeno  indican  que  el  33%  presentan  nivel  alto,  el  28%  de  suelos  nivel  medio  y  el  39%  de  muestras  de  suelo  nivel  bajo.  La  presencia  de  niveles  nutricionales  altos  y  bajos  interfieren  en  el  crecimiento  vegetativo,  coloración  de  las  hojas,  retraso  y  menor  producción de frutos.  En  relación  con  la  cuantificación  de  fosforo,  el  11%  de  muestras  presenta  nivel  alto,  el  56% presenta nivel medio y el 33% presenta 

  ∙

  ∙

El micronutriente de hierro es concluyente al  demostrar que todos los terrenos de la zona  de  estudio  contienen  100%.  Confirmando  que  este  metal  está  interviniendo  en  reacciones  fundamentales  de  óxido‐ reducción, en hemoproteínas y proteínas no‐ hémicas.   El  análisis  de  manganeso  muestra  que  los  suelos  del  área  están  distribuidos  entre  un  nivel  medio  44%  y  bajo  56%.  Esto  significa  que  los  procesos  enzimáticos  relacionados  con  el  metabolismo  del  nitrógeno  y  descomposición  de  los  carbonatos  de  los  suelos contienen niveles medios y bajos.   El  potasio  registra  un  nivel  alto  5%,  medio  39%  y  bajo  56%.  Esto  indica  que  la  mayoría  de  los  suelos  analizados  presentan  un  nivel  bajo  para  este  macronutriente,  indicando  que el déficit puede afectar en el proceso de  la  fotosíntesis,  activación  de  enzimas  con  funciones  bioquímicas  y  la  resistencia  a  condiciones  adversas  como  sequías  o  presencia de enfermedades.   La  materia  orgánica  de  los  suelos  investigados  presenta  un  balance  entre  el  nivel  medio  44%  y  bajo  56%.  Esto  implica  que  los  suelos  presentan  un  bajo  y  medio  porcentaje  de  disponibilidad  de  nutrientes  para el crecimiento de las plantas, la fuente  de energía  tanto para organismos de  macro  y microfauna.  

    48. Sugerencias     48.1. Sugerencias de las comunidades    ∙ Tener  una  verdadera  presencia  en  la  zona  que  permita  conocer  las  necesidades  reales  de la población, pues los funcionarios locales  se quedan en las ciudades y no se desplazan 

166


con  frecuencia  ni  conocen  a  la  gente  ni  sus  problemas.    ∙

Apoyar proyectos agrícolas que incentiven la  producción orgánica y la comercialización de  los productos a través de centros de acopio. 

  ∙

Impulsar  un  proyecto  de  coordinación  interministerial en la frontera con el objetivo  de  abordar  los  problemas  y  aportar  con  soluciones  no  solo  militares  sino  también  sociales, ambientales y de salud. 

167    ∙

Impulsar  obras  de  infraestructura:  vías,  electrificación,  salud,  agua,  baterías  sanitarias, educación primaria y secundaria.                                           

∙   ∙

  ∙

Impulsar  programas  de  recuperación  de  los  bosques y de la fauna nativa.  Mantener  con  firmeza  el  rechazo  a  las  aspersiones  aéreas  y  por  ende  que  la  población recupere la esperanza de trabajar  y vivir a futuro en los sectores afectados.  Mejorar  las  carreteras,  la  electrificación  y  que el suministro de agua potable sea lo más  saludable  para  el  consumo  de  las  poblaciones.  Realizar proyectos con el objetivo de reparar  los daños psicológicos de los niños en todo el  sector fronterizo. 


Referencias bibliográficas    Abalea V, Cillard J, Dubos MP, Sergent O, Cillard P, More l. 1999. Repair of iron‐induced DNA oxidation  by the flavonoid myricetin in primary rat hepatocyte cultures. Free Rad Biol Med. 26:1457‐1466.    Acquavella  J,  Bruce  H,  Alexander  B,  Mandel  J,  Gustin  C,  Baker  B,  Champan  P,  Blleeke  M.  2004.  Glyphosate biomonitoring for farmers and their families: Results from the farm family exposure study.  Environ Health Perspect. 112:321‐326.    AEGA1664. 2009. Estudio de la dinámica de los herbicidas Glifosato e Imazapir en   distintos suelos  de  Argentina. Monitoreo de herbicidas en aguas subterráneas y superficiales. INTA. 2009.    Agency for Toxic Substances and Disease Registry (ATSDR). 2001. ATSDR ToxProfiles 2002 on CD‐ROM,  Available from ATSDR, Division of Toxicology. [En línea] www.atsdr.gov.    Alberts B. 1994. Molecular Biology of the cell. 3rd edition. Garland Publishing Co., New York, USA.      American Public Health Association (APHA). 1998. Standard methods for the examination of water and  wastewater.  20th  ed.  American  Public  Health  Association  (APHA),  American  Water  Work  Association  (AWWA) and Water Environment Federation (WEF). Washington DC, USA.    An  International  System  for  Human  Cytogenetic  Nomenclature  (ISCN).  1985  Cytogenet  Cell  Genet.  S.  Karger Medical and Scientific Publisher. Basel, Switzerland.    Arencibia  D,  Rosario  L,  López  Y,  Díaz  D.  2003.  Las  plantas,  fuente  de  agentes  antimutagénicos  y  quimiopreventivos. Rev Toxicol. 37‐51.     Astier‐Calderón M, Maass‐Moreno M, Etchevers‐Barra J. 2002. Derivación de indicadores de calidad de  suelos en el contexto de la agricultura sustentable. Agrociencia. 36:605‐620.    Atanasova  S,  Von  Ahsen  N,  Schlumbohm  C,  Wieland  E,  Oellerich  M,  Armstrong  V.  2006.  Marmoset  glutathione  peroxidases:  cDNA  sequences,  molecular  evolution,  and  gene  expression.  J  Med  Primatol.  35:155‐164.    Au  W.  1991.  Monitoring  human  populations  for  effects  of  radiation  and  chemicals  exposures  using  cytogenetic techniques. Occ Med. 6(4).     Balci  B,  Oturan  ME,  Oturan  N,  Sirés  I.  2009.  Decontamination  of  aqueous  glyphosate  (aminomethyl)  phosphonic  acid,  and  glufosinate  solutions  by  Electro‐Fenon‐like  process  with  Mn+2  as  the  catalyst.  J  Agric Food  Chem. 57:4888‐4894.     Bandinck  AK  &  Dick  RP.  1999.  Field  management  effects  on  soil  enzimes  activities.  Soil  Biol  Biochem.  31(11):1471‐1479.    Bartlet J & Stirling D. 2003. A short history of the polymerase chain reaction. Meth Mol Biol. 226:3‐6.     Bautista CA, Etchevers B, del Castillo R, Gutiérrez C. 2004. Ecosistemas 2004/2. La calidad de suelo y sus  indicadores.    Bell  FW,  Lautenschlager  RA,  Wagner  RG,  Pitt  DG,  Hawkins  JW,  Ride  KR.  1997.    Motor‐manual,  mechanical,  and  herbicide  release  affect  early  succession  vegetation  in  northwestern  Ontario.  Forest  Chron. 73.    Benachour  N  &  Séralini  GE.  2009.  Glyphosate  formulations  induce  apoptosis  and  necrosis  in  human  umbilical, embryonic, and placental cells. Chem Res Toxicol. 22:97‐105.   

168


169 

Beristain CM, Páez D, Fernández I. 2009. Las palabras de la selva. Estudio psicosocial del impacto de las  explotaciones petroleras de Texaco en las comunidades amazónicas de Ecuador. Hegoa. Bilbao, España.     Bolognesi C, Carrasquilla G, Volpi S, Solomon KR, Marshall EJP. 2009. Biomonitoring of genotoxic risk in  agricultural workers from five Colombian regions: Association to occupational exposure to glyphosate. J  Toxicol Environ Health A. 72:986‐997.    Brejeda JJ & Moorman TB. 2001. Identification and interpretation of regional soil quality   factors for the  central high plains of the Midwestern USA. In: Stott DE, Mohtar RH, Steinhardt GC (eds). Sustaining the  Global Farm. 535‐540.    Brito  NF.  2006.  Representaciones  de  la  naturaleza  en  la  Amazonia  ecuatoriana:  ¿Subsistencia  local  o  conservación global?. Iconos. Rev Cie Soc. 25:57‐65.    Brown T. 2007. Genomes 3. Gerald Science Publishing. New York, USA.     Budavari S. 1989. The Merck Index: An encyclopedia of chemicals, drugs, and biologicals, 11th ed. Merck  & Co. Rahway, New Jersey.    Buiatti  E,  Palli  D,  Decarli  A,  Amadori  D,  Avellini  C,  Bianchi  S,  Biserni  R.  1989.  A  case‐control  study  of  gastric cancer and diet in Italy. Int J Cancer. 44:611‐616.    Caldecott KW, Tucker JD, Stanker LH, Thompson LH. 1995. Characterization of the XRCC1‐DNA ligase III  complex in vitro and its absence from mutant hamster cells. Nucleic Acids Res. 23:4836‐4843.    Castro JF. 2000. Los cultivos ilícitos, política mundial y realidad en Colombia. Defensoría del Pueblo de  Colombia. Bogotá, Colombia.     Celada A. 1991. Factores de transcripción y control de la expresión génica. Invest Cien. 179:42‐52.     Chamberlain  K,  Evans  A,  Bromilow  R.  1996.  1‐octanol/water  partition  coefficient  (Kow)  and  pka  for  ionisable pesticides measured by a ph‐metric method. Pest Sci. 47(3):265‐271.    Chang  C,  Peng  Y,  Hung  D,  Hu  W,  Yang  D,  Lin  T.  1999.  Clinical  impact  of  upper  gastrointestinal  tract  injuries in glyphosate‐surfactant oral intoxication. Hum Exp Toxicol. 18(8):475‐478.    Chen C, Stemberger R, Klaue B, Blum J, Pickhardt P, Folt C. 2000. Accumulation of heavy metals in food  web components across a gradient of lakes. Limnol Oceanogr. 45(7):1525‐1536.    Chen  S  &  Liu  Y.  2007.  Study  on  the  photocatalytic  degradation  of  Glyphosate  by  TiO2  Photocatalyst.  Chemosphere. 67:1010‐1017.     Chen  Y,  Wu  F,  Lin  Y,  Deng  N,  Bazhin  N,  Glebov  E.  2007.  Photodegradation  of  glyphosate  in  the  ferrioxalate system. J Hazard Mater. 148:360‐365.    Chevassus‐Agnès S. 1999. Población Pobreza y Ambiente: Indicadores Antropométricos de Salud. Food  and Agricultural Organization (FAO).     Collins AR. 2001. Carotenoids and genomic stability. Mut Res. 475:21‐28.    Comisión Científica Ecuatoriana. 2007. El sistema de aspersiones aéreas y su impacto en las condiciones  de vida, salud y en el ambiente: El sistema de aspersiones aéreas del plan Colombia y sus impactos sobre  el ecosistema y la salud en la frontera ecuatoriana. 19‐121.    Cosmoagro. 2004. Cosmo‐Flux 411F, Coadyuvante de la aplicación de Agroquímicos. Lic. ICA 05.4‐2186 –  Colombia. Hoja Técnica 313.03 Mayo 30/94. Palmira, Colombia. 3.   


Cowell  IG,  Dixon  KH,  Pemble  SE,  Ketter  B,  Taylor  JB.  1988.  The  structure  of  the  human  glutathione  S  transferase pi gene. Biochem J: 255:79‐83.    Cox, C. 1991. Glyphosate fact sheet. Journal of Pestic Reform. 11(2).    Cox, C. 1995. Glyphosate, part 2: Human exposure and ecological effects. J Pestic Reform 15(4):14‐20.      Crespo  R.  2009.  Demanda  de  la  República  del  Ecuador.  Instrumentos  Internacionales  de  Derecho  Ambiental. Editorial de la Universidad Técnica Particular de Loja. Universidad Técnica Particular de Loja  (UTPL). Loja, Ecuador.    Croteau  R,  Kutchan  HK,  Lewis  NG.  2000.  Natural  products  (secondary  metabolites)  chapter  24  from  biochemistry and molecular biology of plants. Buchanan B, Gruissen W, Jones R. (Eds) Amer Soc Plant  Physiol. 312‐948.    Cummis  J.  2002.  Acrylamide  in  cooked  foods:  The  glyphosate  connection.  The  Institute  of  Sciences  in  Society (ISIS). [En línea] http://www.i‐sis.org.uk/acrylamide.php.    Dalal RC. 1998. Soil microbial biomass‐ what the numbers really means?. Aust J Exp Agr. 38:649‐665.    Dalurzo HC, Serial RC, Vázquez S, Ratto S. 2002. Indicadores químicos y biológicos de calidad de suelos  en oxisoles de Misiones, Argentina. Facultad de Ciencias Agrarias‐UNNE. Misiones, Argentina.     De Roos A, Zahm S, Cantor K, Weisenburger D, Holmes F, Burmeister L. 2003. Integrative assessment of  multiple pesticides as risk factors for non‐Hodgkin lymphoma among men. Occup Environ Med. 60:1‐9.    De Ruiter H, Meinen E. 1998. Influence of water stress and surfactant on the efficacy, absorption, and  translocation of glyphosate. Weed Sci. 46(3):289‐296.    Deguchi  T,  Ohba  R,  Ueda  S.  2000.  Radical  scavenging  activity  of  a  purple  pigment,  hordeumin,  from  uncooked barley bran‐fermented broth. J Agric Food Chem. 48:3198‐3201.    DeMarini DM. 1998. Dietary interventions of human carcinogenesis. Mut Res. 400:457‐465.    Denis M & Delrot S. 1997. Effects of salts and surfactants on foliar uptake and long distance transport of  glyphosate. Plant Physiol Biochem (Paris). 35(4):291‐301.    Dianov GL, Prasad R, Wilson SH, Bohr VA. 1999. Role of DNA polymerase h in the excision step of long  patch mammalian base excision repair. J Biol Chem. 274:13741‐13743.    Diaz‐Romeu R & Hunter A. 1978. Metodología de suelos, análisis químicos de suelos y tejidos vegetal e  investigación en invernadero. Turrialba, Costa Rica. 68.    Dinham B. 1999. “Life sciences” take over. En: Pesticides News 44:7. The pesticides trust. PAN‐Europe.  London.UK.    Doliner  L.  1991.  Emploi  avant  récolte  du  glyphosate  (RoundupMD).  Document  de  Travail.  Agriculture  Canada, Direction des pesticides. 107.    Domènech X, Jardim W, Litter M. 2004. En: Eliminación de contaminantes por fotocatálisis heterogénea.  Segunda edición. Editorial CIEMAT. Madrid. 6:163‐183.     Doran JW & Parkin TB. 1994. Defining and assessing soil quality. In: Doran JW, Coleman DC, Bezdicek DC,  Stewart BA (eds). Defining and assessing soil quality for sustainable environment. Soil Science Society of  America. Special Publication 35. Madison, Wisconsin, USA. 3‐21.    Duke S & Powles S. 2008. Glyphosate: A once‐in‐a‐century herbicide. Pestic Manage Sci. 64:319‐325. 

170


171 

Eberhard  P.  2004.  Bases  Moleculares  de  la  Genética.  Genética  Texto  y  Atlas.  Editorial  Médica  Panamericana. 36.    Edenharder R, Sanin LH, Carrasquilla G, Solomon KR, Cole D, Marshal EJP. 2009. Regional differences in  time to pregnancy among fertile women from five Colombian regions with different use of glyphosate. J  Toxicol Environ Health A. 72:949‐960.     Environmental  Protection  Agency  (EPA).  1993.  Glyphosate  (CASRN  1071‐83‐6)  Integrated  Risk  Information System. URL: http://www.epa.gov/iris/subst/0057.htm.    Eriksson M, Hardell L, Carlberg M, Akerman M. 2008. Pesticide exposure as risk factor for non‐Hodgkin  lymphoma including histopathological subgroup analysis. Int J Cancer. 123:1657‐1663.    Ermakova IT, Kiseleva NI, Shushkova T, Zharikov M, Zharikov GA, Leontievky AA. 2010. Bioremediation of  glyphosate‐contaminated soils. Appl Microbiol Biotechnol. 88:585‐594.     European  Molecular  Biology  Laboratory  ‐  European  Bioinformatics  Institute.  2010.  Glutathione  peroxidasa 1 (GPX‐1). [En línea] www.ebi.ac.uk/embl/.     European  Molecular  Biology  Laboratory  ‐  European  Bioinformatics  Institute.  2010.  Glutathione  S‐ transferase P (GSTP1). [En línea] www.ebi.ac.uk/embl/.     Feng J, Thompson D. 1990. Fate of glyphosate in a Canadian forest watershed: 2. Persistence in foliage  and soils. J Agric Food Chem. 38(4):1118‐1125.    Ferguson LR. 1998. Inhibitors of topoisomerse II enzymes: a unique group of environmental mutagens  and carcinogens. Mut Res. 400:271‐278.    Ferguson LR. 2001. Role of plant polyphenols in genomic stability. Mut Res. 475:89‐111.    Ferrer  M.  2002.  Estudio  del  potencial  antimutagénico  de  Phyllanthus  orbicularis.  Departamento  de  Genética y Microbiología. Tesis de Doctorado. Facultad de Ciencias. Universidad Autónoma de Barcelona  (UAM). 1‐91.    Funke  T,  Han  H,  Healy‐Fried  M,  Fischer  M,  Schönbrunn  E.  2006.  Molecular  basis  for  the  herbicide  resistance of Roundup Ready crops. PNAS. 103(35):13010‐13015.    Garry  V,  Burroughs  B,  Tarone  R,  Kesner  J.  1999.  Herbicides  and  adjuvants:  An  evolving  view.  Toxicol  Indust Health. 15(1‐2):159‐167.    Gerritse R, Beltran J, Hernandez F. 1996. Adsorption of atrazine, simazine, and glyphosate in soils of the  Gnangara Mound, Western Australia. Aust J Soil Res. 34(4):599‐607.    Giesy  J,  Dobson  S,  Salomon  K.  2000.  Ecotoxicological  risk  assessment  for  Roundup®  herbicide.  Rev  Environ Contam Toxicol. 167:35‐120.     Glass R. 1987. Adsorption of glyphosate by soils and clay minerals. J Agric Food Chem. 35(4):497‐500.    Hallas  LE,  Adams  WJ,  Heitkamp  MA.  1992.  Glyphosate  degradation  by  immobilized  bacteria:  fields  studies with industrial wasterwater effluent. Applied Environ Microb. 58:1215‐1219.     Haney  RL. 1999. Effect of glyphosate on soil microbial activity. Proc S Weed Sci Soc. 52:215.    Hardell  L,  Eriksson  M,  Nordstorm  M.  2002.  Exposure  to  pesticides  as  risk  factor  for  non‐Hodgkin´s  lymphoma  and  hairy  cell  leukemia:  Pooled  analysis  of  two  Swedish  case‐control  studies.  Leuk  Lymphoma. 43:1043‐1049. 


Hayes JD, Flanagan JU, Jowsey IR. 2001. Glutathione transferases. Annu Rev Pharmacol Toxicol. 45:51‐ 88.    Heck  G,  Armstrong  C,  Astwood  J,  Behr  C,  Bookout  J,  Brown  S.  2005.  Genomics,  molecular  genetics  &  biotechnology. Crop Sci. 44:329‐339.     Holdridge  LR,  Grenke  W,  Hatheway  WH,  Liang  T,  Tosi  JA.  1971.  Forest  Environments  in  Tropical  Life  Zones: A Pilot Study. Pergamon Press, Oxford.    Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Ed. New York Botanical Garden. New  York, USA.    Hügul  M,  Apak  R,  Demirci  S.  2000.  Modeling  the  kinetics  of  UV/hydrogen  peroxide  oxidation  of  some  mono‐, di‐, and trichlorophenols. J Hazard Mater. B77:193‐208.     Hünnemeyer  JA,  De  Camino  R,  Muller  S.  1997.  Análisis  de  desarrollo  sostenible  en  Centroamérica:  Indicadores para la agricultura y los recursos naturales. IICCA/GTZ. San José, Costa Rica.    Huston PL & Pignatello JJ. 1999. Degradation of selected pesticides active ingredients and commercial  formulations in water by the photo‐assisted Fenton reactions. Wat Res. 33:1238‐1246.     Imai  J,  Ide  N,  Nagae  S,  Moriguchi  T,  Matsuura  H,  Itakura  Y.  1994.  Antioxidant  and  radical  scavenging  effects of aged garlic extract and its constituents. Planta Med. 60:417‐420.    INEC.  2001.  Censos  Nacionales  del  año  2000.  San  José,  Costa  Rica.  [En  línea]  www.inec.go.cr/INEC2/censo2000.pdf.     Izquierdo J, Nogales F, Yánez AP. 2000. Análisis herpetofaunístico de un bosque húmedo tropical en la  Amazonia ecuatoriana. Ecotrópicos. 13(1):29‐42.    Johansen  E  &  Mange  A.  1998.  Basic  Human  Genetics.  Sinauer  Associates,  Inc.  Publishers  Aunderland,  Massachusetts.    Karlen  DL,  Mausbach  MJ,  Doran  JW,  Cline  RG,  Harris  RF,  Schuman  GE.  1997.  Soil  quality:  A  concept,  definition, and framework for evaluation. Soil Sci Soc Am J. 61:4‐10.    Ketterer B. 2001. A bird's eye view of the glutathione transferase field. Chem Biol Interact. 138:27‐42.    Kiely  T,  Donaldson  D,  Grube  A.  2004.  Pesticides  industry  sales  and  usage  2000  and  2001  market  estimates. US Environmental Protection Agency, Office of Pesticide Programs (US EPA/OPP). Washington  DC, USA.    Killeen TJ. 2007. Una tormenta perfecta en la Amazonia: Desarrollo y conservación en el contexto de la  iniciativa para la integración de la infraestructura regional sudamericana (IIRSA). Conserv Int. 48‐49.    Knisel  W,  Davis  F,  Leonard  R.  1992.  GLEAMS  Version  2.0  User  Manual.  US  Department  of  Agriculture,  Agricultural Research Service, Southeast Watershed Research Laboratory. Tifton, GA. pp 202.    Laerke  P,  Streibig  J.  1995.  Foliar  absorption  of  some  glyphosate  formulations  and  their  efficacy  on  plants. Pest Sci. 44(2):107‐116.    Leonard,  A.  1985.  Population  Monitoring  for  Genetic  Damage  Induced  by  Environmental  Physical  and  Chemical Agents. Environ Monit Assess. 5:369‐284.     Leone  P,  Vega  ME,  Jervis  P,  Pestaña  A,  Alonso  J,  Paz‐y‐Miño  C.  2003.  Two  new  mutations  and  three  novel polymorphisms in the RB1 in Ecuadorian patients. J Hum Genet. 1‐5.    

172


173 

Ley de Prevención y Control de la Contaminación Ambiental (LPCCA). 1976. Decreto Supremo No. 374,  RO No. 97.    Lin N & Garry VF. 2000. In vitro studies of cellular and molecular developmental toxicity of adjuvants,  herbicides,  and  fungicides  commonly  used  in  Red  River  Valley,  Minnesota.  J  Toxicol  Environ  Health.  60(6):423‐439.    Lo  HW,  Stephenson  L,  Cao  X,  Milas  M,  Pollock  R,  Ali‐Osman  F.  2008.  Identification  and  functional  characterization of the human glutathione S transferase P1 gene as a novel transcriptional target of the  p53 tumor suppressor gene. Mol Cancer Res: 6(5):843‐850.    Lodish H, Berk A, Matsudaira P, Kaiser C, Kreiger M, Scott M, Zipursky S, Darnell J. 2005. Biología Celular  y Molecular. 5ta edición. Editorial Médica Panamericana. Buenos Aires, Argentina.    López‐Cortés  A,  Muñoz  MJ,  Robles  P,  Paz‐y‐Miño  C.  2011.  Genetic  polymorphisms  of  methylenetetrahydrofolate reductase (C677T, A1298C), methionine synthase (A2756G) and methionine  synthase  reductase  (A66G)  genes  associated  with  pathologic  characteristics  of  the  Ecuadorian  population affected with prostate cancer. Prost Cancer Prost Dis. Submitted.     Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA. 1999. XRCC1 polymorphisms: effects on aflatoxin  B1‐DNA adducts and glycophorin A variant frequency. Cancer Res. 59:2557‐2561.    Maldonado A, Piedra I, Maldonado P, Bonilla M, Chiriboga A, Herdoíza C, Rodríguez E, Suárez W, Herrera  R.  2006.  Estado  de  la  nutrición  en  escuelas  ecuatorianas  de  la  frontera  norte  afectadas  por  las  aspersiones aéreas del plan Colombia. Acción Ecológica.    Maldonado A, Saravia A, Valladares C, Álvarez S, Bonilla M, Maldonado P, Supliguicha V. 2008. Estudio  de  impacto  de  la  actividad  petrolera  de  Perenco  en  el  bloque  7  de  la  Región  Amazónica  Ecuatoriana.  Acción Ecológica.     Manassero  A,  Passalía  C,  Negro  AC,  Cassano  AE,  Zalazar  CS.  2010.  Glyphosate  degradation  in  water  employing the H2O2/UVC process. Water Res. 44:3875‐3882.     Maoka T, Mochida K, Kozuka M, Ito Y, Fujiwara Y, Hashimoto K, Enjo F, Ogata M, Nobukuni Y, Tokuda H,  Nishino H. 2001. Cancer chemopreventive activity of carotenoids in the fruits of red paprika Capsicum  annuum L. Cancer Lett. 172(2):103‐109.    Martínez A, Reyes I, Reyes N. 2007. Cytotoxicity of the herbicide glyphosate in human peripheral blood  mononuclear cells. Biomedica. 27:594‐604.    Masera O, Arshad MA, Coen GM. 1992. Characterization of soil quality: physical and chemical criteria.  Am J Alternative Agric. 7:25‐31.    Matullo G, Guarrera S, Carturan S. 2001. DNA repair gene polymorphisms, bulky DNA adducts in white  blood cells and bladder cancer in a case‐control study. Int J Cancer. 92:562‐567.    McDuffie H, Pahwa P, McLaughlin J, Spinelli J, Fincham S, Dosman J. 2001. Non‐Hodgkin´s lymphoma and  specific  pesticide  exposures  in  men:  Cross‐Canada  study  of  pesticides  and  health.  Cancer  Epidemiol  Biomarkers Prev. 10:1155‐1163.    Meiers  I,  Shanks  JH,  Bostwick  DG.  2007.  Glutathione  S‐transferase  pi  (GSTP1)  hypermethylation  in  prostate cancer: review. Pathology. 39:299‐304.    Meister Publishing Company. 2000. Farm Chemicals Handbook’2000. Willoughby, USA.    Mejía  L.  1997.  Suelos  del  Ecuador.  Reconocimiento  general  en  base  a  su  capacidad‐fertilidad.  Quito,  Ecuador.  


Midorikawa K, Kawanishi S. 2001. Superoxide dismutases enhance H2O2‐induced DNA damage and alter  its site specificity. FEBS Lett. 495:187‐190.    Miller  D,  Griffin  J,  Richard  E.  1998.  Johnsongrass  (Sorghum  halepense)  control  and  rainfastness  with  glyphosate and adjuvants. Weed Tech. 12(4):617‐622.    Mladinic M, Berend S, Vrodoljak A, Kopjar N, Radic B, Zeljezic D. 2009. Evaluation of genome damage  and  its  relation  to  oxidative stress  induced  by glyphosate  in human  lymphocytes  in  vitro.  Environ Mol  Mutag. 1‐8.    Morillo  E,  Undabeytia  T,  Maqueda  C.  1997.  Adsorption  of  glyphosate  on  the  clay  mineral  montmorillonite:  effect  of  Cu  (II)  in  solution  and  adsorbed  on  the  mineral.  Environ  Sci  Technol.  31(12):3588‐3592.    Moyer  AM,  Salavaggione  O,  Wu  TY,  Moon  I,  Eckloff  BW,  Hildebrandt  MA,  Schaid  DJ,  Wieben  ED,  Weinshilboum  RM.  2008.  Glutathione  S‐transferase  P1:  Gene  sequence  variation  and  functional  genomics studies. Cancer Res. 68(12):4791‐4801.    Mueller  TC,  Massey  JH,  Hayes  RM,  Main  CL,  Stewart  CN.  2003.  Shikimate  accumulates  in  both  glyphosate‐sensitive  and  glyphosate‐resistant  horseweed  (Conyza  canadensis  L.  Cronq.).  J  Agric  Food  Chem. 51:680‐684.    Muñoz  MJ,  López‐Cortés  A,  Sarmiento  I,  Herrera  C,  Sánchez  ME,  Paz‐y‐Miño  C.  2008.  Biomonitoreo  genético  de  individuos  expuestos  a  radiación  ionizante  y  su  relación  con  el  desarrollo  de  cáncer.  Rev  Oncol. (18):75‐82.     National  Agriculture  Statistics  Service.  2005.  In  Acreage  eds.  Johanns  M  &  Wiyatt  SD.  6‐30.  US  Department of Agriculture. Washington DC, USA.    National  Resource  Conservation  Soil  (NRCS).  2004.  What  is  soil  quality?.  Unites  States  Department  of  Agriculture. [En línea] www.soils.usda.gov/sqi/soil_quality/what_is.    Newton  M,  Howard  K,  Kelpsas  B,  Danhaus  R,  Lottman  C,  Dubelman  S.  1984.  Fate  of  glyphosate  in  an  Oregon (USA) forest ecosystem. J Agric Food Chem. 32(5):1144‐1151.    Nivia  E.  2001.  Efectos  sobre  la  salud  y  el  ambiente  de  herbicidas  que  contienen  glifosato.  Boletín  electrónico de la UITA. URL: http://www.rel‐uita.org/Agrotoxicos.    Nivia, E. 2001. Cosmo‐Flux 411F, coadyuvante adicionado al Roundup Ultra en la erradicación forzosa de  cultivos ilícitos en Colombia. Rapalmira, Colombia. [En línea] www.usfumigation.org.    Onil, S. 2001. Riesgos inherentes a la utilización del Roundup para el control de plantaciones de cocaína  en Colombia. Institut National de Santé Publique de Quebec.    O'Sullivan  P,  O'Donovan  J,  Hamman  W.  1981.  Influence  of  nonionic  surfactants,  ammonium  sulfate,  water quality and spray volume on the phytotoxicity of glyphosate. Can J Plant Sci. 61(2):391‐400.    Paganelli  A,  Gnazzo  V,  Acosta  H,  Lopez  SL,  Carrasco  AE.  2010.  Glyphosate‐Based  Herbicides  Produce  Teratogenic Effects on Vertebrates by Impairing Retinoic Acid Signaling. Chem Res Toxicol. [Epub ahead  of print].    Palacios  WA,  Jaramillo  N.  2001.  Riqueza  florística  y  forestal  de  los  bosques  tropicales  húmedos  del  Ecuador e implicaciones para su manejo. Rev Forest Centroamer. 36:46‐50.    Pan Q, Pao W, Ladanyi M. 2005. Rapid polymerase chain reaction‐based detection of epidermal growth  factor receptor gene mutations in lung adenocarcinomas. J Mol Diagn. 7(3):396‐403.    

174


175 

Parr  JF,  Papendick  RI,  Hornick  SB,  Meyer  RE.  1992.  Soil  quality:  Attributes  and  relationships  to  alternative and sustainable agriculture. Am J Alternative Agr. 7:5‐11.    Paz‐y‐Miño  C,  Arévalo  M,  Sánchez  ME,  Leone  PE.  2004.  Chromosome  and  DNA  damage  analysis  in  individuals occupationally exposed to pesticides with relation to genetic polymorphism for CYP 1A1 gene  in Ecuador. Mut Res. 562:77‐89.     Paz‐y‐Miño  C,  Burgos  R,  Morillo  S,  Santos  JC,  Fiallo  F,  Leone  P.  1998.  BCR‐ABL  rearrangement  frequencies in CML and ALL in Ecuador, South America. Cancer Genet Cytogenet. 132:65‐67.     Paz‐y‐Miño C, Creu A, Cabré O, Leone P. 2002. Genética Toxicológica y Carcinogénesis. Abya Yala. PUCE‐ FUNDACYT. Quito, Ecuador.     Paz‐y‐Miño  C,  López‐Cortés  A,  Arévalo  M,  Sánchez  ME.  2008.  Monitoring  of  DNA  damage  in  exposed  individuals to petroleum hydrocarbons in Ecuador. Ann N Y Acad Sci. 1140:121‐128.    Paz‐y‐Miño  C,  López‐Cortés  A,  Muñoz  MJ,  Cabrera  A,  Castro  B,  Sánchez  ME.  2010.  Incidence  of  the  L858R  and  G719S  mutations  of  the  epidermal  growth  factor  receptor  oncogene  in  an  Ecuadorian  population with lung cancer. Cancer Genet Cytogenet. 196:201‐203.    Paz‐y‐Miño C, López‐Cortés A, Muñoz MJ, Castro B, Cabrera A, Sánchez ME. Relationship of a hRAD54  gene  polymorphism  (2290  C/T)  in  the  altitude  Ecuadorian  population  with  chronic  myelogenous  leukemia. Genet Mol Biol. [Epub ahead of print].    Paz‐y‐Miño C, Muñoz MJ, López‐Cortés A, Cabrera A, Palacios A, Castro B, Paz‐y‐Miño N, Sánchez ME.  2010. Frequency of polymorphisms pro198leu in GPX‐1 gene and ile58thr in MnSOD gene in the altitude  Ecuadorian population with bladder cancer. Oncol Res. 18:395‐400(6).     Paz‐y‐Miño  C,  Muñoz  MJ,  Maldonado  A,  Valladares  C,  Cumbal  N,  Herrera  C,  Robles  P,  Sánchez  ME,  López‐Cortés  A.  2011.  Baseline  determination  in  social,  health  and  genetic  areas  in  communities  affected  by  glyphosate  aerial  sprying  in  the  northeastern  Ecuadorian  border.  Rev  Environ  Health.  26(1):65‐74.     Paz‐y‐Miño  C,  Pérez  JC,  Fiallo  BF,  Leone  PE.  2001.  A  polymorphism  in  the  hMSH2  gene  (gIVS12‐67>C)  associated with non‐Hodgkin lymphomas. Cancer Genet Cytogen. 133:29‐33.     Paz‐y‐Miño C, Sánchez ME, Arévalo M, Muñoz MJ, Witte T, Oleas G, Leone P. 2007. Evaluation of DNA  damage in an Ecuadorian population exposed to glyphosate. Genet Mol Biol. 30(2):456‐460.      Paz‐y‐Miño  C,  Witte  T,  Robles  P,  Llumipanta  W,  Díaz  M,  Arévalo  M.  2009.  Association  among  polymorphisms in the steroid 5α‐reductase type II (SRD5A2) gene, prostate cancer risk, and pathologic  characteristics of prostate tumors in an Ecuadorian population. Cancer Genet Cytogenet. 189:71‐6.     Piccolo  A,  Celano  G,  Arienzo  M,  Mirabella  A.  1994.  Adsorption  and  desorption  of  glyphosate  in  some  European soils. J Environ Sci Health Part B. 29(6):1105‐1115.    Pizzul  L,  Castillo  M,  Stenström  J.  2009.  Degradation  of  glyphosate  and  other  pesticides  by  ligninolytic  enzymes. Biodegradation. 20:751‐759.     Population  Reference  Bureau.  1995.  Nuevas  perspectivas  sobre  población:  Lecciones  aprendidas  en  El  Cairo. [En línea] www.ccp.ucr.ac.cr.    Prata F, Camponez V, Lavorenti A, Tornisielo VL, Borges J. 2003. Glyphosate sorption  and desorption in  soils with distinct phosphorus levels. Scient Agric. 60(1):175‐180.    Primer  Encuentro  Nacional  de  Médicos  de  Pueblos  Fumigados  (PENMPF).  2010.  Facultad  de  Ciencias  Médicas, Universidad Nacional de Córdoba (UNC). Córdoba, Argentina. 


Puyana AM. 2007. Fumigaciones químicas como estrategia antinarcóticos en Colombia: tres décadas de  perversidad e ineficacia. Ponencia de la autora en la preaudiencia sobre biodiversidad, fumigaciones y  militarización en Colombia. Medellin, Colombia.    Ravn‐Haren G, Olsen A, Tjonneland A, Dragsted LO, Nexo BA, Wallin H, Overvad K, Raaschou‐Nielsen O,  Vogel U. 2006. Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol  consumption and breast cancer risk in a prospective cohort study. Carcinogenesis. 27(4):820‐825.    Reinert  K,  Rodgers  J.  1987.  Fate  and  persistence  of  aquatic  herbicides.  Rev  Environ  Contam  Toxicol.  98:86‐98.    Riechers  D,  Wax  L,  Liebl  R,  Bullock  D.  1995.  Surfactant  effects  on  glyphosate  efficacy.  Weed  Tech.  9(2):281‐285.    Riely G, Pao W, Pham D, Li A, Rizvi N, Venkatraman E, Zakowski M, Kris M, Ladanyi M, Miller V. 2006.  Clinical course of patients with non‐small cell lung cancer and epidermal growth factor receptor exon 19  and exon 21 mutations treated with Gefitinib or Erlotinib. Clin Cancer Res. 12(3):839‐844.    Ríos M, Koziol M, Borgtoft PH, Granda G. Los etnobotánicos en el Ecuador: Escenario actual y desafíos.  Plantas útiles del Ecuador: Aplicaciones, retos y perspectivas. Ediciones Abya‐Yala. Quito, Ecuador. 652.     Rodríguez M. 2000. Parásitos intestinales. Métodos de diagnóstico. Venezuela: Escuela de Malariología y  Saneamiento Ambiental “Dr. Arnoldo Gabaldeon”, Maracay.    Rueppel ML, Brightwell BB, Schaefer J, Marvel JT. 1977. Metabolism and degradation of glyphosate in  soil and water. J Agric Food Chem. 25:517‐528.    Rybicki  BA,  Neslund‐Dudas  C,  Nock  NL,  Schultz  LR,  Eklund  L,  Rosbolt  J,  Bock  CH,  Monaghan  KG.  2006.  Prostate  cancer  risk  from  occupational  exposure  to  polycyclic  aromatic  hydrocarbons  interacting  with  the GSTP1 Ile105Val polymorphism. Cancer Detect Prev. 30(5):412‐422.    Sager JW, Glatt H, Muckel E, Platt KL. Protection by beverages, fruits, vegetables, herbs, and flavonoids  against genotoxicity of 2‐acetylaminofluorene and 2‐amino‐1‐ methyl‐6 phenylimidazo [4,5‐b] pyridine  (PhIP) in metabolically competent V79 cells. Mut Res. 521:57‐72.    Sancho JV, Fernández F, López FJ, Hognedoom EA, Dijkman E. 1996. Rapid determination of glufosinate,  glyphosate,  and  aminomethylphosphonic  acid  in  environmental  water  samples  using  precolumn  flurogenic labeling and coupled‐column liquid chromography. J Chromatogr. 737;75‐83.    Schuette J. 1998. Environmental fate of glyphosate. California EPA, Environmental Monitoring and Pest  Managment. 13.    Seiber JN. 2002. In Pesticides in Agriculture and the Environment. Wheeler BW, ed. Marcel Dekker Press:  New York, USA. 36.     Siltanen  H,  Rosenberg  C,  Raatikainen  M,  Raatikainen  T.  1981.  Triclopyr,  glyphosate  and  phenoxyherbicide residues in cowberries, bilberries and lichen. Bull Environ Contam Toxicol. 27(5):731‐ 737.    Simoniello MF, Kleinsorge EC, Scagnetti JA, Grigolato RA, Poletta GL, Carballo MA. 2008. DNA damage in  workers occupationally exposed to pesticide mixtures. J Appl Toxicol. 28(8):957‐65.    Simoniello  MF,  Kleinsorge  EC,  Scagnetti  JA,  Mastandrea  C,  Grigolato  RA,  Paonessa  AM,  Carballo  MA.  2010. Biomarkers of cellular reaction to pesticide exposure in a rural population. Biomarkers. 15(1):52‐ 60.    

176


177 

Simoniello  MF,  Scagnetti  JA,  Kleinsorge  EC.  2007.  Biomonitoreo  de  población  rural  expuesta  a  plaguicidas. Revista FACIBI. 11:73‐85.    Smith  A  &  Aubin  A.  1993.  Degradation  of  14C‐glyphosate  in  Saskatchewan  soils.  Bull  Environ  Contam  Toxicol. 50(4):499‐505.    Smith  E  &  Oehme  F.  1992.  The  biological  activity  of  glyphosate  to  plants  and  animals:  A  literature  review. Vet Hum Tox. 34:531‐543.    Smith E, Prues S, Ochme F. 1997. Environmental degradation of polyacrylamides: II Effects of outdoor  exposure. Ecotoxicol Environ Saf. 37:76‐91.    Solomon KR, Marshall EJP, Carrasquilla G. 2009. Human health and environmental risks from the use of  glyphosate  formulations  to  control  the  production  of  coca  in  Colombia:  Overview  and  conclusions.  J  Toxicol Environ Health A. 72:914‐920.     Speth TF. 1993. Glyphosate removal from drinking water. J Environ Eng. 119:1139‐1157.     Sprankle  P,  Meggitt  WF,  Penner  D.  1 9 7 5 .   Rapid  inactivation  of  glyphosate  in  soils.  Weed  Sci.  23:224‐228.    Stalikas  CD,  Konidari  CN.  2001.  Analytical  methods  to  determine  phosphoric  and  aminoacid  group‐ containing pesticides. J Chomatogr A. 907:1‐9.    Strachan T & Read A. 1999. Human Molecular Genetics 2. Second edition. BIOS Scientific Publishers Ltd.  Oxford, UK.    Strachan T & Read A. 2004. Human Molecular Genetics 3. Third edition. Gerland Science.     Sudbery P. 2004. Genética Molecular Humana. Segunda edición. Pearson Prentice Hall.     Suganuma  M,  Sueoka  E,  Sueoka  N,  Okabe  S,  Fujiki  H.  2000.  Mechanisms  of  cancer  prevention  by  tea  polyphenols based on inhibition of TNF expression. BioFactors. 12:1‐6.    Sundaram  A,  Leung  J,  Webster  G,  Nott  R,  Curry  J,  Sloane  L.  1996.  Effect  of  glycerol  on  spreading  and  drying  of  vision  droplets  containing  Silwet  l‐77:  Relevance  to  rainfastness  and  herbicidal  activity  of  glyphosate  on  trembling  aspen  Populus  tremuloides  michx.  J  Environ  Sci  Health  Part  B  Pestic  Food  Contam Agric Wastes. 31(4):901‐912.    Sundaram A. 1990. Effect of a nalco‐trol II on bioavailability of glyphosate in laboratory trials. J Environ  Sci Health Part B Pestic Food Contam Agric Wastes. 25(3):309‐332.    Texto  Unificado  de  Legislación  Ambiental  Secundaria  del  Ministerio  del  Ambiente  (TULAS).  2003.  Decreto Ejecutivo 3516 del Registro Oficial.    The  Nobel  Prize  in  Chemistry  2009.  2009.  Structure  and  function  of  the  ribosome.  The  Royal  Swedish  Academy of Sciences. Stockholm, Sweden.      Thompson D, Pitt D, Buscarini T, Staznik B, Thomas D, Kettela E. 1994. Initial deposits and persistence of  forest herbicide residues in sugar maple (Acer saccharum) foliage. Can J Forest Res. 24(11):2251‐2262.    Thompson LH & West MG. 2000. XRCC1 keeps DNA from getting stranded. Mutat Res. 459:1‐18.    Tribunal  Administrativo  de  Cundinamarca  (TAC),  Colombia.  2003.  Segunda  sección.  Subsección  “B”.  “Claudia Sanpedro y Héctor Suárez contra Ministerio del Ambiente y otros”. 15.   


Tsui M & Chu L. 2003. Aquatic toxicity of glyphosate based formulations: Comparison between different  organisms and the effect of environmental factors. Chemosphere. 52:1189‐1197.    United States Drug Administration Forest Service. 2003. Glyphosate: Human health and ecological risk  assessment final report. USDA. Virginia, USA. 39.     United States Environmental Protection Agency, Office of Drinking Water (US EPA/ODW). 1992. Drinking  water criteria document for glyphosate. US EPA. Office of Assistant Administrator. Washington, DC. 92‐ 173392.    United  States  Environmental  Protection  Agency,  Office  of  Pesticide  Programs  (US  EPA/OPP).  2002.  Glyphosate: pesticide tolerances, 40 CFR Part 180. Federal Register. 67(188):60934‐60950.    United  States  Environmental  Protection  Agency,  Office  of  Prevention,  Pesticides  and  Toxic  Substances  (US  EPA/PTS).  1992.  Pesticides  in  groundwater  database.  A  compilation  of  monitoring  studies:  1971‐ 1991, national summary. Washington, DC.       United  States  Environmental  Protection  Agency  (US  EPA).  1991.  Description  and  sampling  of  contaminated soils. A field pocket guide. Technology Transfer. Ohio, USA.    United States Environmental Protection Agency (US EPA). 1999. Technical Fact Sheets on: Glyphosate.  National Primary Drinking Water Regulations.     Universidad Nacional del Litoral (UNL). 2010. Informe acerca del grado de toxicidad del glifosato. Santa  Fe, Argentina.     Van der Hammen T. 2000. Aspectos de historia y ecología de la biodiversidad norandina y amazónica.  Rev Acad Colomb Cienc. 24(91):231‐245.    Veiga F, Zapata JM, Marcos MLF, Alvarez E. 2001. Dynamics of glyphosate and aminomethylphosphonic  acid in a forest soil in Galicia north‐est Spain. Sci Total Environ. 271:135‐144.    Velasco AM. 2001. Propuesta de Ecuador para la formulación de la estrategia nacional de biodiversidad:  Vida silvestre, estudio nacional. Estrategia regional de biodiversidad para los países del trópico andino.  Quito, Ecuador.    Veyrunes  E.  2008.  Las  amenazas  percibidas  para  la  Amazonia:  un  estado  del  arte  en  términos  de  seguridad ambiental. Universidad del Rosario. Bogotá, Colombia. 7‐8.    Weiss G. 2002. Acrylamide in food: Uncharted territory. Science. 297:27.    Welten R. 2000. Ecotoxicity of contaminated suspended solids for filter feeders (Daphnia magna). Arch  Env Contam Tox. 39(3):315‐323.    Williams  GM,  Kroes  R,  Munro  IC.  2000.  Safety  evaluation  and  risk  assessment  of  the  herbicide   Roundup  and  its active  ingredient,  glyphosate,  for humans.  Regulat Toxicol Pharmacol. 31:117‐165.    World Health Organization (WHO). 1979. Medición del impacto nutricional: tablas. Ginebra.    World  Health  Organization  (WHO).  1994.  International  Program  on  Chemical  Safety  (WHO  IPCS).  Glyphosate. Geneva. Vol 159.    World Health Organization (WHO). 2005. The WHO recommended classification of pesticides by hazard  and guidelines to classification: 2004. (WHO IPCS). Ginebra, Suiza.    Wu  Y,  Fan  Y,  Xue  B.  2006.  Human  glutathione  S‐transferase  P1‐1  interacts  with  TRAF2  and  regulates  TRAF2‐ASK1 signals. Oncogene. 25:5787‐5800. 

178


Zendehdel K, Bahmanyar S, McCarthy S, Nyren O, Andersson B, Ye W. 2009. Genetic polymorphisms of  glutathione  S‐transferase  genes  GSTP1,  GSTM1,  and  GSTT1  and  risk  of  esophageal  and  gastric  cardia  cancers. Cancer Causes Control. 10552‐10557.    Zeneca to manufacture glyphosate, Agrow. 1995. 230.    Zhao  X,  Fan  Y,  Shen  J,  Wu  Y,  Yin  Z.  2006.  Human  glutathione  S‐transferase  P1  suppresses  MEKK1‐ mediated apoptosis by regulating MEKK1 kinase activity in HEK293 cells. Mol Cells. 21:395‐400.    Zhibin  H.  2005.  XRCC1  polymorphisms  and  cancer  risk:  A  meta‐analysis  of  38  case‐control  studies.  Cancer Epidemiol Biomark Prev. 14(7):1810‐1818.  

179 

                                             


Anexos  Anexo 1. Historia comunitaria

 

180

   


181 

   


182

   


183 

   


Anexo 2. Historia familiar  

 

184

   


185 

   


186

   


187 

     


Anexo 3. Historia clínica personal     

188

     


189 

     


Anexo 4. Historia clínica dermatológica     

190

     


Glosario 

191 

  Aberraciones  cromosómicas:  Anormalidad  en  el  número  o  en  la  estructura  de  los  cromosomas.    Absorción  (en  química  de  superficies  y  coloides):  Proceso  por  el  cual  un  componente  es  transferido entre dos fases en contacto integrándose en una de ellas.     Ácido  desoxirribonucleico  (ADN):  Molécula  compleja,  integrante  de  los  cromosomas,  que  almacena la información hereditaria en forma de variaciones en la secuencia de las bases de  purina y pirimidina; esta información se traduce en la síntesis de las proteínas, por lo que es  determinante de todas las características físicas y funcionales de las células y del organismo.    Ácido ribonucleico (ARN): Polímero lineal de ribonucleótidos cada uno de los cuales contiene  el azúcar ribosa asociada a un grupo fosfato y a una de las cuatro bases nitrogenadas: adenina,  guanina, citosina o uracilo; codifica la información para la secuencia de los aminoácidos en la  síntesis de proteínas.     Adenocarcinoma:  Tumor  benigno  desarrollado  en  el  epitelio  glandular  o  que  forma  estructuras de tipo glandular.    Alcaloide: Compuesto de origen vegetal, con uno o más átomos de nitrógeno que le confieren  carácter de base orgánica. También hay sintéticos y producidos a partir de proteínas.    Alelo: Cada  una de las diversas formas de un  gen  que aparece  en la  misma  posición relativa  (locus) de cromosomas homólogos.    Ambiente: Lo que rodea o cerca. Conjunto de todas las condiciones e influencias externas a la  que está sometido, en un determinado momento, el sistema sujeto a estudio.    Amplificación  de  genes:  Producción  de  copias  de  una  secuencia  de  ADN  intra  o  extra  cromosómico;  en  los  plásmidos,  se  refiere  a  un  aumento  de  copias  del  plásmido  por  célula,  inducido por un tratamiento específico de las células transformadas.     Apoptosis:  Proceso  fisiológico  previsto  de  muerte  y  desintegración  de  tejidos  dentro  del  desarrollo normal de los seres vivos.    Asfixia: Situación resultante de insuficiente absorción de oxígeno.    Asma:  Enfermedad  crónica  respiratoria  caracterizada  por  broncoconstricción,  secreción  mucosa  excesiva  y  edema  en  los  alveolos  pulmonares,  que  se  manifiesta  por  dificultad  respiratoria, jadeo y tos.    Biomarcador:  Medidas  en  los  niveles  molecular,  bioquímico  o  celular,  tanto  en  poblaciones  humanas, vegetales o animales, provenientes de hábitats contaminados, como en organismos  expuestos  experimentalmente  a  contaminantes,  y  que  indican  que  el  organismo  ha  estado  expuesto a sustancias tóxicas y la magnitud de la respuesta del organismo al contaminante.    Cáncer: Denominación de las tumoraciones malignas. Los carcinomas se originan en las células  epiteliales; los sarcomas en el tejido conjuntivo.    


Carcinogénesis:  Proceso  de  transformación  progresiva  de  las  células  normales  en  células  malignas, se produce la adquisición de autonomía por las mismas, lo que es un reflejo de una  regulación  y  expresión  anormal  de  su  carga  génica.  Este  proceso  puede  ser  resultado  de  eventos  endógenos  como  errores  en  la  replicación  del  ADN,  la  inestabilidad  intrínseca  de  ciertas  bases  del  ADN  o  el  ataque  de  radicales  libres  generados  durante  el  metabolismo  celular.  También  puede  ser  resultado  de  procesos  exógenos  como  radiaciones  ionizantes,  radiaciones ultravioletas (UV) y carcinógenos químicos.    Carcinógeno:  Agente  físico,  químico  o  biológico  capaz  de  incrementar  la  incidencia  de  neoplasias malignas.    Carcinoma: Tumor maligno de células epiteliales.    Caso‐control,  estudio:  Estudio  que  se  inicia  con  la  identificación  de  individuos  con  una  determinación  enfermedad  de  interés,  y  de  un  grupo  control  adecuado  sano.  Se  examina  la  relación  de  un  atributo  con  la  enfermedad  mediante  comparación  del  grupo  enfermo  y  del  sano respecto a la presencia o cantidad del atributo en ambos.     Citogenética: Rama de la genética que relaciona la estructura y número de los cromosomas en  células aisladas, con la variación del fenotipo y genotipo.    Coadyuvante:  En  farmacología,  sustancia  que  se  añade  a  un  medicamento  para  acelerar  o  incrementar  la  activación  del  componente  principal.  En  inmunología,  sustancia  u  organismo  que aumenta la respuesta a un antígeno.    Comunidad: En ecología, conjunto de poblaciones que viven en una misma área geográfica y  que se interrelacionan entre sí.     Concentración  letal:  Proporción  de  una  sustancia  tóxica  en  un  medio,  que  causa  la  muerte  después de un cierto período de exposición.    Confianza, intervalo de: Conjunto de valores ordenados en el que se encuentra comprendido  el valor de un parámetro de una población, con una probabilidad que viene determinada por  un nivel de confianza preestablecido. Mide la precisión de la estimación del parámetro.    Conjuntivitis: Inflamación de la conjuntiva.     Contaminante:  Agente  microbiano  indebidamente  presente  en  un  medio.  Impureza  menor  presente en una sustancia. Material extraño inadvertidamente añadido a una muestra antes o  durante el análisis químico o biológico. Componente indeseable de un alimento, medicamento  o  cualquier  otro  producto,  que  puede  entrañar  riesgo  al  usuario  consumidor.  Componentes  indeseables del medio ambiente.    Control,  grupo:  Grupo  seleccionado  o  establecido  necesariamente  antes  de  un  estudio,  integrado por humanos, animales, células, en todo idéntico al grupo que estudia, y mantenido  en la misma situación y condiciones que éste, pero sin someterlo a la exposición.     Cromátida:  Cada  uno  de  los  dos  filamentos  unidos  por  el  centrómero  que  forman  un  cromosoma.    Cromatina:  Complejo  coloreable  de  ADN  y  proteínas  presentes  en  el  núcleo  de  una  célula  eucariótica.  

192


193 

Cromosoma:  Estructura  autorreplicante  formada  por  ADN  asociado  con  proteínas  implicadas  en  el  almacenamiento  y  transmisión  de  la  información  genética;  la  estructura  física  que  contiene los genes.    Dermatitis:  Estado  inflamatorio  de  la  piel,  normalmente  en  una  zona  localizada,  como  consecuencia  de  una  exposición  directa  de  ésta  a  una  sustancia  sensibilizante,  irritante  o  infecciosa.     Deshidrogenasa:  Enzima  que  cataliza  la  oxidación  de  compuestos  por sustracción  de  átomos  de hidrógeno.     Desecho: Cualquier  cosa que se descarta deliberadamente o de la que se  dispone para fines  diferentes a los de su primera utilización.     Desnaturalización:  Cambios  en  la  estructura  molecular  de  las  proteínas,  que  impiden  sus  funciones normales; generalmente se producen por alteraciones de los enlaces de hidrógeno  intramoleculares, por causa de sustancias reactivas o el calor.    Disnea: Respiración dificultosa y entrecortada.    Dosis:  Cantidad  de  sustancia  administrada  o  absorbida  por  un  individuo  en  proporción  a  su  peso o volumen corporal, ordinariamente en 24 horas.     Dosis  letal  media  (DL50):  Dosis,  calculada  estadísticamente,  de  un  agente  químico  o  físico  (radiación)  que  se  espera  que  mate  al  50%  de  los  organismos  de  una  población  bajo  un  conjunto de condiciones definidas.    Ecología: Rama de la biología que estudia las interacciones entre los organismos vivos y todos  los factores de su ambiente, incluidos los demás organismos.     Enfermedad:  Situación  patológica  que  presenta  un  conjunto  de  síntomas  peculiares  que  la  distingue como entidad anormal de otras situaciones normales o patológicas.    Enzima:  Catalizador  de  las  reacciones  bioquímicas,  facilitando  la  transformación  de  los  sustratos.    Especie:  En  biología,  grupo  de  organismos  de  ancestros  comunes,  que  son  capaces  de  reproducirse entre sí dando descendencia fértil. En química, sustancia química pura.     Exposición:  Situación  en  la  cual  una  sustancia  puede  incidir,  por  cualquier  vía,  sobre  una  población, organismo, órgano, tejido o célula diana.     Faringe: Parte del tubo digestivo situada entre el esófago por debajo, y la boca y las cavidades  nasales, por arriba y por delante.     Fenotipo:  Características  observables  de  un  organismo,  estructurales  y  funcionales,  determinadas por el genotipo y moduladas por el ambiente.    Fertilizante: Sustancia usada en agricultura para mejorar la nutrición de las plantas y aumentar  el rendimiento de las cosechas y/o controlar la producción.   


Gen: Unidad básica estructural y funcional de material hereditario: una secuencia ordenada de  nucleótidos que codifica la síntesis de una cadena de polipéptido (traducción), o una secuencia  reguladora que hace posible la traducción.     Genotipo:  Composición  alélica  específica  de  una  célula,  bien  referida  al  total  del  genoma  o,  más comúnmente, a un gen o conjunto de genes.    Genotóxicos: Capacidad de los elementos físicos, químicos o biológicos de producir alteración  en el material genético por cambios en el ADN o en las estructuras intracelulares vinculadas al  funcionamiento o propiedades de los cromosomas. Las sustancias genotóxicas pueden unirse  directamente  al  ADN  o  actuar  indirectamente  mediante  la  afectación  de  las  enzimas  involucradas en la replicación del ADN y causando, en consecuencia, mutaciones que pueden o  no desembocar en un cáncer. Las sustancias genotóxicas no son necesariamente cancerígenas,  pero la mayor parte de los cancerígenos son genotóxicos.    Genotoxicidad:  Capacidad  para  causar  daño  al  material  genético;  el  daño  puede  ser  de  tipo  mutágeno o carcinógeno.     Herbicida: Sustancia para eliminar plantas.    Higiene: Ciencia de la salud y su conservación.     Incidencia: Número de casos de iniciación de enfermedad, o de personas que caen enfermas,  durante  un  determinado  período  de  una  población  específica;  usualmente  se  expresa  como  razón, en la que el denominador es el número medio de personas durante dicho período, o el  número estimado de personas en la mitad del período. La incidencia se refiere a casos nuevos,  mientras que el término prevalencia abarca a todos los casos, nuevos y antiguos.     Inhalación:  Entrada  en  las  vías  respiratorias  de  aire,  vapor,  gas  o  partículas  suspendidas  en  ellos.     Inmunitario, sistema: Conjunto de órganos, células, vasos y ganglios linfáticos que, participan  en la formación, activación, almacenamiento y distribución de anticuerpos y mediadores de las  reacciones de hipersensibilidad.     Intervalo  de  confianza:  Rango  de  valores  de  la  variable  que  se  mide,  que  tiene  gran  probabilidad de contener el valor verdadero de la media, o de la proporción en la población o  en la muestra.     Intoxicación: Proceso patológico, con signos y síntomas clínicos, causado por una sustancia de  origen exógeno o endógeno.    Irritante:  Sustancia  que  causa  inflamación  después  de  contacto  inmediato,  prolongado  o  repetido con la piel, mucosas u otro tejido.     Laringe: Órgano principal de la voz, parte del tracto respiratorio, situado entre la faringe y la  tráquea.     Linfocito: Tipo de célula inmunitaria elaborada en la médula espinal; se encuentra en la sangre  y el tejido linfático. Los dos tipos de linfocitos son los linfocitos B y los linfocitos T. Los linfocitos  B  elaboran  anticuerpos  y  los  linfocitos  T  ayudan  a  destruir  las  células  tumorales  y  ayudan  a  controlar las respuestas inmunitarias. Tipo de glóbulo blanco. 

194


195 

Meiosis: Proceso de división celular propio de células diploides, por medio de cual cada núcleo  hijo recibe la mitad del número de cromosomas característicos de las células somáticas de la  especie. Da por resultado gametos en los animales y esporas en las plantas.    Metabolismo:  Suma  de  todos  los  procesos  químicos  y  físicos  que  tienen  lugar  en  un  organismo; en sentido más estricto, cambios físicos y químicos que sufre una sustancia en un  organismo.  Incluye  la  incorporación  y  distribución  en  el  organismo  de  los  componentes  químicos, los cambios y la eliminación de los compuestos y de sus metabolitos.     Metástasis:  Movimiento  de  bacterias  u  otras  células,  especialmente  las  cancerosas,  de  una  parte  del  cuerpo  a  otra,  dando  lugar  a  modificaciones  en  la  localización  espacial  de  una  enfermedad  o  de  sus  síntomas.  Crecimiento  de  microorganismos  patógenos  o  de  células  anormales lejos de su lugar de origen en el cuerpo.     Mitocondria: Orgánulo de las células eucarióticas rodeado de una membrana externa y de una  membrana  interna.  La  interna  presenta  pliegues  llamados  crestas  en  las  que  tiene  lugar  la  síntesis  del  ATP  en  la  fosforilación  oxidativa  en  las  células  animales.  En  el  interior,  la  matriz  mitocondrial contiene ribosomas, muchas enzimas oxidativas y una molécula de ADN circular  portadora de la información genética para algunas de estas enzimas.     Mitosis: Proceso por el cual el núcleo celular se divide en dos núcleos hijos, cada uno de ellos  con  la  misma  dotación  genética  que  la  célula  primitiva.  Consta  de  cuatro  etapas:  profase,  metafase,  anafase  y  telofase.  La  división  de  la  célula  suele  tener  lugar  inmediatamente  después que la del núcleo durante la telofase mitótica.     Mortalidad:  Ocurrencia  de  muerte,  estudiada  en  una  población  o  subpoblación  dada.  La  palabra mortalidad se utiliza a menudo de forma incorrecta en lugar de índice de mortalidad.     Mutación:  Cualquier  cambio  heredable,  relativamente  estable,  del  material  genético  que  puede ser una transformación química de un gen individual (mutación génica o puntual) que  altera  su  función,  o  un  reordenamiento,  ganancia  o  pérdida  de  un  cromosoma,  visible  al  microscopio.  Las  mutaciones  pueden  ocurrir  en  células  germinales  y  transmitirse  a  la  descendencia o en células somáticas y pasar de una célula a otra al dividirse éstas.     Mutágeno:  Cualquier  sustancia  que  puede  inducir  cambios  heredables  (mutaciones)  en  el  genotipo  de  una  célula  como  consecuencia  de  alteraciones  o  de  pérdida  de  genes  o  de  cromosomas o de parte de los mismos.     Necrosis:  Muerte  masiva  de  áreas  de  tejido  rodeadas  de  zonas  sanas.  Cambios  morfológicos  subsiguientes a la muerte celular, caracterizados frecuentemente por cambios nucleares.     Neoplasia:  Formación  nueva  y  anormal  de  tejido  tumoral,  o  crecimiento  por  proliferación  celular más rápida de lo normal y que continúa después de haber cesado el estímulo inicial que  lo desencadenó.     Nocivo: Agente que, tras contacto o absorción, puede causar enfermedad o efectos adversos,  bien al tiempo de la exposición o posteriormente, en la generación presente o las futuras.     Odds ratio: Término inglés utilizado en estadística, sin equivalente en español. Es el cociente  obtenido al dividir un conjunto de “odds” por otro.    


Osteoporosis:  Disminución  significativa  de  la  masa  del  hueso  con  aumento  de  porosidad  y  mayor tendencia a fracturas.     Plaguicida:  En  sentido  estricto,  sustancia  que  mata  plagas;  en  el  uso  corriente,  cualquier  sustancia  que  se  utiliza  para  controlar,  evitar  o  destruir  plagas  animales,  microbianas  o  vegetales.    Población en riesgo: Grupo de personas que pueden desarrollar un efecto adverso y que están  potencialmente  expuestas  a  un  factor  de  riesgo  determinado.  Aquellas  personas  que  ya  han  desarrollado la enfermedad se excluyen en los estudios de incidencia.     Polimorfismo: Variación en la secuencia de un lugar determinado del ADN entre los individuos  de una población. Aquellos polimorfismos que afectan a la secuencia codificante o reguladora  y  que  producen  cambios  importantes  en  la  estructura  de  la  proteína  o  en  el  mecanismo  de  regulación de la expresión, pueden traducirse en diferentes fenotipos.    Polimorfismo genético: Situación en la que un carácter genético aparece en más de una forma  en una población, lo que produce la coexistencia de más de un tipo morfológico.     Población:  Conjunto  de  individuos  de  una  misma  especie  que  viven  en  la  misma  área  geográfica.     Psicosis: Desorden mental caracterizado por desajustes de personalidad y pérdida de contacto  con la realidad.     Reciclado  (de  desechos):  Proceso  que  permite  la  recuperación  de  una  parte  de  un  desecho  para material reutilizable o para energía.     Riesgo: Probabilidad de que se produzcan efectos adversos o daños por exposición a un agente  tóxico, a causa de las propiedades inherentes del mismo y a las circunstancias o grados de la  exposición.     Rinitis: Inflamación de la mucosa nasal.    Salud:  Estado  de  bienestar  completo,  físico,  mental  y  social,  y  no  meramente  la  ausencia  de  dolencia o enfermedad. Estado de equilibrio dinámico en el cual la capacidad de un individuo o  un grupo para hacer frente a las circunstancias, está en un nivel óptimo.     Seguridad: Inversa del riesgo; práctica certeza de que, en condiciones definidas, no se derivará  daño de un peligro. En toxicología, elevada probabilidad de que la exposición a una sustancia,  en condiciones definidas de cantidad y forma, que minimicen la exposición, no producirá daño.     Significación, grado de (p): En un estudio comparativo, valora la verosimilitud de una hipótesis  respecto  a  los  datos  empíricos.  Por  convenio  se  considera  significativo  (que  discrepa  de  la  hipótesis)  todo  desvío  con  un  grado  de  significación  p  <  0,05,  lo  que  lleva  a  rechazar  la  hipótesis.     Síndrome: Conjunto de signos y síntomas que caracterizan a una determinada enfermedad.     Síntoma: Evidencia subjetiva de una afección o enfermedad, percibida por el propio sujeto que  la sufre.    

196


197 

Sistema  nervioso:  Conjunto  de  nervios,  centros,  tejido  y  ganglios  nerviosos.  Existen  nervios  sensitivos y nerviosos.     Sistema  nervioso  central:  Está  constituido  por  el  encéfalo  (cerebro  y  cerebelo)  y  la  médula  espinal  (albergada  en  la  columna  vertebral),  conectados  por  el  tronco  cerebral  (bulbo  raquídeo).     Susceptibilidad: Condición en la que existe una disminución de la resistencia de un individuo  frente  a  determinada  enfermedad  o  intoxicación,  y  que  se  experimenta  con  dosis  a  exposiciones inferiores a las habitualmente nocivas para el resto de la población.      Teratógeno:  Agente  que  por  administración  a  la  madre  en  período  prenatal,  induce  malformaciones estructurales o defectos a la descendencia.    Toxicidad:  Capacidad  para  producir  daño  a  un  organismo  vivo,  en  relación  con  la  cantidad  o  dosis  de  sustancia  administrada  o  absorbida,  la  vía  de  administración  y  su  distribución  en  el  tiempo  (dosis  única  o  repetidas),  tipo  y  severidad  del  daño,  tiempo  necesario  para  producir  éste, la naturaleza del organismo afectado y otras condiciones intervinientes.      Tóxico: Cualquier agente  químico o físico capaz de  producir  un  efecto adverso para la salud.  Todos los agentes físicos y químicos son tóxicos potenciales, ya que su acción depende de la  dosis y de las circunstancias individuales y ambientales.     Toxicología: Disciplina científica dedicada al estudio del peligro actual o potencial presentado  por los efectos nocivos de las sustancias químicas sobre los organismos vivos y ecosistemas, de  las  relaciones  de  tales  efectos  nocivos  con  la  exposición,  y  de  los  mecanismos  de  acción,  diagnóstico, prevención y tratamiento de las intoxicaciones.     Transcripción: Proceso por el que la información genética, codificada en una secuencia lineal  de nucleótidos, en una rama de ADN, se copia en una secuencia exactamente complementaria  de ARN.    Transcripción reversa: Proceso por el cual se realiza la síntesis de una cadena de ADN a partir  de una de ARN.     Tumor: Inflamación o crecimiento anormal de un tejido, ya sea benigno o maligno.     Úlcera:  Pérdida  local  de  sustancia,  a  menudo  acompañada  de  inflamación,  que  afecta  a  la  superficie de un órgano o de un tejido, causada por desprendimiento de una zona de necrosis  y con escasa o nula capacidad de cicatrización.     Ventilación: Suministro de aire fresco a una habitación o a un edificio.            


Índice analítico    A   Aberraciones cromosómicas, 3 – 6  Aborto, 96 – 97   Acetil CoA carboxilasa, 21   Acetolactato sintetasa, 21  Ácido aminometilfosfónico, 16 – 18   Ácido pelargónico, 18  Ácido shikímico, 16 – 18   Ácido sórbico, 18  Acrilamida, 21  Acrocéntrico, 2  ADN, 1, 4 – 5, 70   Agua, 63, 140 – 142   Alelo, 1  Alergias, 109  Amazonia, 40  Ambiente, 5, 130  Análisis microbiológico, 140 – 141   Análisis parasitológico, 140 – 141   Aneuploidía, 3  Anfibios, 36, 40  Anticancerígeno, 151  Antimutagénico, 151  Antioxidante, 153  Arg399Gln, 70, 78 – 79   ARN, 1  Aspersiones aéreas, 5, 40, 50 – 51      

B  Bacterias, 141  Bandeo cromosómico, 2  Bases nitrogenadas, 1  Basura, 62  Benzisotiazolona, 18  Biomarcadores genéticos, 1, 4, 70   Bioremediación, 151   

C  Cáncer, 4  Cáncer infantil, 30  Carchi, 40  Carcinogénesis, 5  Cariotipo, 79 – 81   Centrómero, 2  Chi‐cuadrado, 71 – 79   Citogenética, 2, 79 – 81   Codón, 1, 74, 77, 79  Coliformes totales, 142 

198


Coordenadas UTM, 56  Conejo, 36  Corazón, 112  Cosmo‐Flux 411F, 20  Cultivos, 63  Cromatina, 2  Cromosoma, 2  Cromosoma sexual, 2 – 3   Cromosoma somático, 2 – 3    

D  199 

Deleción, 3  1‐4 dioxano, 19  Diploide, 3   

E  5‐enolpiruvilshikimato‐3‐fosfato sintetasa, 16, 21    Ensayo cometa, 5, 30  Enzima de restricción, 1, 71 – 79   Erizo de mar, 36  Escherichia coli, 142  Esmeraldas, 40  Especies oxígeno reactivas, 71  Estado nutricional agudo, 91  Estado nutricional crónico, 88  Estado nutricional global, 86   

F  Flora, 40  Fosforilación oxidativa, 16  Fósforo, 138  Frecuencia polimórfica, 4  Frecuencia alélica, 71 – 79    

G  Garganta, 112  Gen, 1, 4, 21   Gen BCR‐ABL, 4  Gen CP4 5‐enolpiruvilshikimato‐3‐fosfato sintetasa, 21  Gen CYP1A1, 4 – 5   Gen EGFR, 4  Gen GPX‐1, 4, 71  Gen GSTP1, 4, 71, 75  Gen hMSH2, 4 – 5   Gen RB1, 4  Gen SRD5A2, 4  Gen XRCC1, 71, 71, 77  Genotipo, 1, 71 – 79   Genotóxicos, 4 – 5, 30  Glifosato, 5, 16, 30, 130, 151 – 153     


H  Heces, 63  Hidrocarburos, 5  Hidróxido de potasio, 18 – 20   Hierro, 138  Histona, 2  Historia clínica dermatológica, 58, 190  Historia clínica personal, 58, 188  Historia comunitaria, 58, 180  Historia familiar, 58, 184  Hongos, 141 – 142    

I  Idiograma, 2  Ile105Val, 71 – 79   Indicadores biológicos, 136  Indicadores físicos, 135  Indicadores químicos, 135  Índice de masa corporal, 93  Ingrediente activo, 16, 19 – 20     Ingrediente inerte, 18 – 20   Inversión, 3  Isobutano, 18 – 20   Isopropilamina, 18 – 20    

L  Lactasa, 152  Linfoma no‐Hodgkin, 4, 30   

M  Macronutrientes, 139  Malformaciones, 97  Manganeso, 138  Metacéntrico, 2  Metafase, 81  Materia orgánica, 139  Metil pirrolidinona, 18 – 20   Micronutrientes, 139  Minisatélites, 1  Microsatélites, 1  Monosomía, 3  Mordeduras, 99  Mutación, 1, 4, 21, 71, 75, 77     Mutagénesis, 5, 30   

N  Nariz, 132  Nitrógeno, 137  N‐fosfometil glicina, 16, 19   N‐nitroso glifosato, 16, 20   Nucleosoma, 2 

200


O  Odds ratio, 71 – 79   Odontología, 111  Oídos, 111  Ojos, 109  Origen étnico, 59   Oxidación, 151, 153   

P  201 

PCR, 71   Pesticida, 5, 30    Peroxidasa, 153  Piel, 110  Pirimidina, 1  Plan Colombia, 40 – 41   Polimorfismo, 4, 74, 77, 79   Polioxietileno amina, 19  Potasio, 138  Pro198Leu, 71 – 74   Purina, 1   

Q  Quimioprevención, 151   

R  Rayos X, 5  Ratón, 36  Riñón, 113  RFLPs, 1, 71  Roundup, 18 – 20    

S  Salud, 5  Sangre, 114  Sistema digestivo, 110  Sistema endócrino, 114  Sistema locomotor, 113  Sistema nervioso central, 115  Síndrome de Turner, 3  Síndrome de Klinefelter, 3  SNPs, 1, 71, 74, 77, 79    Solenoide, 2  SSLPs, 1   STRs, 1   Submetacéntrico, 2  Succinato deshidrogenasa, 30  Sucumbíos, 40, 56   Suelo, 130, 133  Sulfato de amonio, 18 – 20   Sulfito sódico, 18 – 20   Sustitución nucleotídica, 74, 77, 79 


T  Teratógenos, 30  Test psicológico, 124  Testimonios de la comunidad, 61, 63, 98, 101 – 106, 115     Topoisomerasa II, 2  Toxicología genética, 30  Translocación, 3  Transgénico, 21  Triploide, 3  Trisomía, 3   

V  Vasos sanguíneos, 112  VNTRs, 1   

Y  3‐yodo‐2‐propinilbutilcarbamato, 18 – 20        

202



LIBRO GLIFOSATO: GENÉTICA, SALUD Y AMBIENTE