Issue 5 - Human Rights by The Horace Mann Review

Review THE HORACE MANN

Volume XXIII - February 2014

Human Rights OUR ROLE IN COMBATING GLOBAL OPPRESSION

Issue

Review

Letter From the Editor

THE HORACE MANN

Caroline Kuritzkes Editor-in-Chief

Samuel Henick Executive Editor

Will Ellison David Hackel Sahej Suri

Jenny Heon* Mihika Kapoor Isaiah Newman

Managing Content Editors

Managing Design Editors

*Chair of the Senior Board

Catherine Engelmann Senior Editor - Features

www.bbc.co.uk

Hello HM and Happy New Year! First of all, I have some very exciting news to share to wrap up 2013. Last year’s Review volume (Volume XXII) recently won two awards from The American Scholastic Press Association – the First Place with Special Merit Award and the Outstanding Theme Award in the political magazine category. Congratulations to the entire Review staff on this achievement! I’d also like to thank last year’s senior team and Mr. Donadio, our faculty advisor, for their leadership that helped us reach this accomplishment. The Review community should be enormously proud, as Sam and I are, of the hard work, careful research, and thoughtful analysis you have put into this publication, regardless of whether or not you played a part in last year’s organization. Still, I hope that this magazine has piqued your curiosity in contemporary global affairs and ultimately in the world beyond Horace Mann. Perhaps you will find this global-mindedness just as gratifying as the connections you form here on this staff, the successes you attain together, and the knowledge you gain as a writer, learner, and intellectual. And now for the Issue 5 Features section: a highlighted “Human Rights” topic has been in talk for almost two years, but we’ve decided that it’s finally time to put word to action. Our writers have spent weeks researching and drafting articles about some of the world’s most critical human rights abuses: child labor, the influence of human rights on American foreign policy, and women’s rights in Africa and the Middle East are just a few of the topics they have chosen to explore. I cannot imagine a more relevant Features topic to encourage dialogue about the pressing global issues that are so frequently overlooked. Paradoxically, the individuals who gain the least political and media attention are often those who need the most help. The Review’s mission is to educate and engage a community of analytical thinkers and global citizens through thoughtful, fact-driven discourse. In doing so, we strive to raise awareness among our writers and readers about the very problems that deserve far more scrutiny and deliberation than they receive. I hope you feel, as I do, that this human rights issue fulfills that purpose.

Ben Greene

Senior Editor - Domestic

Hana Krijestorac

Senior Editor - International

Jonah Wexler

Senior Editor - Economics

Jacob Haberman

Senior Editor - Science and Technology

Daniel Baudoin Hannah Davidoff Henry Luo Mohit Mookim Kelvin Rhee Namit Satara Lenn Uchima Jacob Zurita Senior Contibutors

Neil Ahlawat James Megibow Edmund Bannister Adam Resheff Jenna Barancik Harry Seavey Lauren Futter Brett Silverstein Matthew Harpe Ikaasa Suri Laszlo Herwitz Nathan Tillinghast-Raby Emily Kramer Mitchell Troyanovsky James McCarthy Elizabeth Xiong Junior Editors

Charles Cotton Samuel Fisch Robert Hefter Sam Stern Associate Editors

Gregory Donadio Caroline Kuritzkes Editor-in-Chief Volume XXIII

Faculty Advisor The Horace Mann Review is a member of the Columbia Scholastic Press Association, the American Scholastic Press Association, and the National Scholastic Press Association. Opinions expressed in articles or illustrations are not necessarily those of the Editorial Board or of the Horace Mann School. Please contact The Review for more information at www.cjkwebdesign.com/review.

Table of Contents

Miranda Bannister

Ankit Gupta

page 6

Cassandra Kopans-Johnson

INTERNATIONAL

Dayle Chung

The Gun Control Debate Pro: Lexi Kanter Con: Zachary Gaynor

Natasha Moolji

Looking Towards a New Future Daniel Rosenblatt

page 14

International Charity Ben Alexander

page 17

Food Stamp Crunch Jacob Chae

page 40

Raising the Minimum Wage Krystian Loetscher

page 42

The Watch Market Vaed Prasad

Teddy Kaplan

Rallying for Integration Eric Stein

Matthew Parker

page 20

page 45

page 22

Lauren Futter

Anna Kuritzkes

page 24

The Labor of Our Children Evan Greene

page 26

Alex Karpf

page 50

What Are You Eating? The GMO Revolution Elizabeth Xiong

page 52

The ADHD Dilemma Peter Shamamian

The Real Intention of American Aid

page 48

23andMe

SCI-TECH

A Missed Opportunity

page 46

Networking Freedom

Benjamin Shapiro

FEATURES

page 36

The Budget Agreement

Behind the Veil of Secrecy

page 34

Nelson Mandela: An Unrivaled Legacy

page 7

page 12

page 31

Fighting Poverty and Rights Abuses in Africa

Security Over Privacy

The Violation of Farm Workers’ Rights

Daniel Jin

page 4

ECONOMICS

DOMESTIC

Reforming Nothing: China’s “Changes” to its Re-education System

FISA and the End of Fourth Amendment Rights

page 56

The Case for Nuclear Energy page 28

Paul Jang

page 58

Domestic

FISA And The End of Fourth Amendment Rights Miranda Bannister

here seems to be a misconception about the NSA and the FBI’s ability to monitor civilians. Many are under the mistaken impression that these agencies have free reign to collect all phone calls, emails, documents, and search histories without warrants. However, under the Foreign Intelligence Surveillance Act (FISA), the NSA and the FBI are required to receive a special kind of warrant from the FISA Court before they acquire any private information. Although FISA Court exists as a compromise between complete inefficiency and government surveillance spiraling out of control, your fourth amendment rights are being ignored. FISA Court does nothing but justify and permit programs that should be inexistent in the first place. The history of FISA Court is rooted in the goal to prevent warrantless searches and violations of the Fourth Amendment. In 1978 the United States government was under massive scrutiny. Congress reviewed the activities of the NSA and the FBI in monitoring perceived threats within the United States- the outcome of their inquiries was FISA, because there were so many violations of warrant requirements. FISA Court was in-

tended to ensure that the government’s large intelligence agencies do not violate the Fourth Amendment which states:

The Horace Mann Review | Vol. XXIII

“The right of the people to be secure in their persons, houses, papers, and effects, against unreasonable searches and seizures, shall not be violated, and no warrants shall issue, but upon probable cause, supported by oath or affirmation, and particularly describing the place to be searched, and the persons or things to be seized.” Instead, FISA Court essentially grants warrants for the government to not get warrants. Until Edward Snowden’s leaks in 2013, the shameful metadata collection program was kept secret because collecting emails, phone calls, text messages, and private information in mass numbers, was- and is- the most extensive violation of the Fourth Amendment in American history. FISA does not ensure the government applies for warrants. It gives the government permission to not apply for any meta-data collection warrants, allowing information even as personal as bank records

to become the government’s business. Despite clear public disdain for the program, on January 3, 2014, FISA court renewed its approval for the metadata companies, for the next three years. Despite the intent of FISA to halt terrorism, there is a basic flaw to FISA Court that cannot be changed. The government is the only party involved, and the application for a warrant comes from a more powerful entity than the judges of FISA Court themselves. There is no representative currently who speaks opposed to the warrant’s being granted, which is why the Judiciary Committee considered a “Special Advocacy” bill in 2013. Although the bill is still in the process of review, it proposes an interesting idea, that an office that would stand in opposition to the application would also have a voice in the Court. Even with an office to consider more than just one view in the matter, the overwhelming power of the surveillance agencies and the executive branch in the United States make it impossible for FISA to have any real control. The Bush administration’s post 9/11 policy changes proved that FISA is vulnerable to the whims of the executive branch. Start-

Domestic ing in 2001 the Bush administration ordered a metadata collection program, without the endorsement of FISA Court. Only in 2003 did FISA Court rule these favorably. Had it not ruled favorably, it was too late anyway. The Bush Administration went further though, asking FISA Court to rule that section 215 of the Patriot Act applied in more broad termsany business data, not just that relevant to a search, became available to intelligence agencies. The sway of a presidential administration over FISA Court, and the inability for FISA to effectively govern intelligence agencies is why FISA Court is a flawed system. FISA’s lack of access to knowledge as to intelligence collection extends further to prove its inability to monitor the abuse of the Fourth Amendment effectively. Once a year the Attorney General and the National Intelligence Director provide reports to FISA Court on all the undertakings of the intelligence agencies. However, these annual reports to the eleven judges have been consistently lacking in adequate information in the past. It is not only because of the impossible nature of the undertaking- for eleven judges to review a year’s worth of intelligence activity- but because of the intentional veiling of the facts. In May of 2006 FISA Court began restricting the metadata collection of the NSA. However, the National Intelligence Director released information in 2009 summarizing how, after three years, the NSA never actually followed any of these restrictions. Clearly, FISA Court has no real power or means by which to ensure that their regulations are being upheld by such powerful agencies. The justification in part that FISA exceptions to regular warrant laws exist is that NSA and the FBI intercept terrorist threats more easily, by suspending the rules of the Fourth Amendment. However, the goal of terrorism aversion is often overlooked and abused in the vague terms of FISA, and the effectiveness of these programs is questionable. The Supreme Court summary of Amnesty International’s lawsuit against FISA stated, “the statute does not require the government to identify its surveillance targets at all.” In other words, the FBI and NSA do not need certain or even close to certain goals for terrorist apprehension. Furthermore, the extent of collection is ridiculous for the amount of information gleaned. Less than 50 possible terrorist threats have been apprehended within the United States in the past decade, almost none of which apprehensions benefited from mass data collection. A study by a senior researcher at the Mershon Center for International Security Studies described the

mass collection under FISA permission as “a quest that has involved following literally millions of leads that go nowhere.” Terrorist apprehension would be more effective if actual security threats received specific warrants traditionally, as opposed to blindly searching for a needle in a haystack. FISA Court’s behavior is not constitutional and FISA is not

effective in changing the violations of the Fourth Amendment. FISA Court is bullied into submission by presidential administrations and by the organizations it seeks to monitor. Worst of all, American liberties are sacrificed for no reason. FISA Court allows for inefficient collection of information, without benefiting the United States at all. HMR

“Although FISA Court exists as a compromise between complete inefficiency and government surveillance spiraling out of control, your Fourth Amendment rights are being ignored. FISA Court does nothing but justify and permit programs that should be inexistent in the first place.”

washingtonpost.com

February 2014

Domestic

Security over privacy Ankit Gupta

www.latimes.com

hen the issue of privacy and security is brought up, the American government needs to ensure that they have the right balance between its national security interests and the privacy of its citizens. This job belongs to the NSA (The National Security Agency), which has been receiving a lot of criticism lately for its controversial data collection program known as PRISM. This program, which is said to have collected data on U.S citizens through the usage of phone, email, and other electronic communication devices, was brought into question in two different courts, and received two different verdicts. The whole controversy over this data collection program began with Edward Snowden back in June of 2013. When Snowden exposed how much information the NSA could pull from our online profiles, he started a national debate over whether or not the government has the right to spy and peer into our personal lives. Many Americans called Snowden a traitor, while others deemed him a hero. The reality is that Edward Snowden betrayed his country. Snowden put out extremely sensitive information on how our country fights terrorism out in the air for all to see. This information was better left unknown, as the NSA collects information for the safety of our nation. Some of this collected information includes intelligence on US allies such as Brazil, China, France, Germany and the U.K., but the majority of the information is collected from US citizens. The fact of the matter is that the NSA protects US citizens by keeping an eye on suspicious behavior. Some, like Larry Klayman, fail to

see this. Klayman is a conservative lawyer who took the NSA and Obama to a Washington district court over the NSA’s bulk collection of metadata, which is literally ‘data about data.’ This case, ‘Klayman v. Obama’ was looked over by Judge Richard Leon who deemed that the actions performed by the NSA were unconstitutional under the fourth amendment, saying “I cannot imagine a more indiscriminate and arbitrary invasion than this systematic and high-tech collection and retention of personal data on virtually every citizen for purposes of querying and analyzing it without prior judicial approval.” This was one of many defeats for the NSA since the Edward Snowden controversy. Up until this point, all had been going well for opponents of the NSA, up until December of 2013, when Judge William Pauley in New York, using the same basis of facts as Judge Leon, ruled that the NSA’s program was lawful. This is an obvious success, as the NSA needs to protect our citizens no matter the cost. And, there has been no proof that this program has been used to spy on innocent civilians, contrary to popular opinion. As Judge Pauley put it, “There is no evidence that the government has used any of the NSA data for any purpose other than to investigate and disrupt terrorist attacks.” The win in Pauley’s court was the big win that the NSA was hoping for. However, as of now it looks as if this case is going to drag on and will be taken to the Supreme Court for the final decision on whether or not this program of the NSA is lawful. If this issue finds its path to the Supreme Court, the program will, in all likelihood, prevail. In 1979, a similar issue was brought to the Supreme

The Horace Mann Review | Vol. XXIII

Court in the case Smith v. Maryland. The Supreme Court, in its ruling, declared that when you dial the phone, you are letting the phone company know to whom and when you are calling. It is not something that you should expect to get any privacy from. If this information can be used and recorded by the phone companies with such ease for almost no purpose, then the NSA does have the right to use the same information to protect Americans if a possible threat is imminent. This decision is similar to Judge Pauley’s ruling, and if this issue does go to the Supreme Court, the NSA will have the edge. Fortunately, to the content of many citizens, the government has been working on amending its data collection programs. In a recent speech made by President Obama, he hinted at changing his platform, saying that the government would work hard to refine the system to give people more confidence. He currently has a team of advisors working to get this issue resolved, and it is rumored that they have already come up with about fifty changes that can be made to the NSA’s data collection program. All in all, this entire situation just proved to be bizarre. It is clear that the data collection and privacy issues will continue to be debated for quite a while before they is resolved and both parties are happy, which is unlikely. If no solution is found, President Obama could take the situation into his own hands to try and find something to please both parties. Until any of that happens, the program will remain as is, which is best for our country’s natural security, and may not be as invasive as people believe. HMR

Domestic

The Gun Control Debate Would Restricting Guns Make America Safer?

wordpress.com

February January 2014 2014

PRO

Domestic

“Gun control will achieve a safer country.”

n 2010, guns took the lives of 31,076 Americans in homicides, suicides and unintentional shootings. 82 of these deaths were of children under five years of age. This is the equivalent of more than 85 deaths each day and more than three deaths each hour. Eliminating guns altogether seems as if it would be the most effective way to save lives, and it probably would. However, guns are ingrained in American culture and history, so it is not realistic to focus on banning guns altogether, at least not at this point in time. What many people do not understand is that gun control will achieve a safer country without infringing on the rights of the citizens who desire to keep their guns. One of the first steps we have to take is to better inform the general public about the current state of our gun legislation. “Pro-gun” activists claim that the

Lexi Kanter

American public does not want new gun laws but that they simply want to enforce old ones. According to polls done by the New York Times, they are right: a slight majority says that they would rather enforce old laws than create new laws. The only problem is that those same people believe that we have laws in place that do not actually exist. For example, when the same participants of the previously mentioned polls executed by the New York Times were asked, a clear majority of people said they believed that the sale of guns to people on the terrorist watch list is prohibited. This is not the case. According to the Government Accountability Office (GAO), in 2010, 247 people on the terrorist watch list somehow passed the background check and legally purchased firearms. If the general public knew that the laws that they so adamantly want to enforce do

advocate-online.net

The Horace Mann Review | Vol. XXIII

not exist, then their opinion on future Congressional action might be very different. People need to understand what laws we have and what laws we do not, so they can make informed decisions. We must also be proactive in creating new legislation. There are currently countless loopholes in the laws for background checks that need to be addressed. One such loophole is that, although one must complete a background check when purchasing guns from a registered dealer, people can purchase firearms from private individuals without any background checks. There are also basic common sense laws that should be put in place, some of which include banning military-style assault weapons and high capacity magazines. These kinds of restrictions are proven to be effective. According to a study by Richard Florida published in the Atlantic, firearm

Domestic deaths are substantially lower in states with stricter gun legislation. A decrease in firearm deaths directly correlates to bans on assault weapons and mandated safe storage requirements for guns. We can also look to other countries such as Canada and England for examples of how legislation has lowered firearm violence. There were 59 firearm related homicides in England in 2011, while there were 77 in the District of Columbia alone, even though England has nearly 100 times more inhabitants. In response to this information, “pro-gun” activists would most likely

one thing. They believe that people in America are, as the New Yorker put it, “uniquely evil and incorrigibly violent,” and the result of this is that gun legislation will not be effective in the U.S., even though it has worked in other nations. The fact is that there are evil, violent, and unstable citizens in Canada and England, and the gun legislation has worked there. As for criminals obtaining guns regardless of the laws, new legislation may not solve every problem. Some people will still break the law, but the goal is to make it as difficult as possible for someone to commit gun vio-

guns will be banned and therefore any gun control laws will subsequently result in the violation of the Second Amendment. Economist and renown rhetorician Albert Hirschman calls this “lazy logic.” The opposing party is simply trying to scare the audience because they know that Reform “A” is plausible, sensible and likeable. They thus change the subject to reform “B,” which they anticipate and devise to be much worse. There are an infinite number of outcomes that could result from new legislation. This is not to say that we should not consider possible outcomes, but we cannot refuse to pass

“It is unfair and absurd that many Americans must live in fear of losing children, parents and spouses because some people refuse to give up their prized collectables.” argue that “guns don’t kill people, people kill people” and “laws don’t apply to criminals.” This is the notion that guns are not the issue. Instead the mentally unstable and unusually violent are the ones who are abusing weapons and will find ways to obtain guns anyway. This is what The New Yorker called “a form of American exceptionalism.” This is not something that “pro-gun” activists like to admit, but this logic comes down to

lence, so that, as President Obama said, “fewer parents have to endure the pain of losing a child to an act of violence.” Once people accept that gun control really is effective, they must realize that their rights are not in danger. The second amendment in the Constitution does state that all Americans have the right to bear arms. However “pro-gun” activists seem to think that it is our only constitutional right that is without limits. “Every right is subject to limitations when it threatens others” according to the Supreme Court in article 19 of the International Covenant on Civil and Political Rights (ICCPR). We have the right to practice our own religion, except if it involves human sacrifice. We have the right to freedom of speech, but you can be prosecuted for libel, incitement and conspiracy. Just like with any other of our rights and freedoms, the government has the lawful ability to create restrictions on the right to bear arms. One very prominent “pro-gun” defense against increasing gun control is the “slippery slope” argument. This is the reasoning that once a few gun laws are implemented, more and more laws will be created. Republicans such as Ted Cruz and Sarah Palin claim that eventually all

February 2014

new laws in the fear that one of the infinite outcomes could possibly be negative. In our modern society there is much violence that we have decided to accept. Yet this violence may be a consequence of some greater good. We can drive cars as an efficient transportation method, but many will die in accidents each year. We will fight terrorism to the best of our ability, but there will be some civilian casualties as a result of our methods. As a society, we have reached a moral conclusion that the ability to drive cars and fight terrorism is worth any inherent risks. Apparently, some have also reached a moral conclusion that over 100,000 firearm related injuries and 30,000 firearm casualties each year, many of them children, are just the price we have to pay for the joy that a gun in a chest supplies. It is unfair and absurd that many Americans must live in fear of losing children, parents and spouses because some people refuse to give up their prized collectables, and fatalities will continue to increase in number the longer we delay creating legislation. It is time that we act to prevent the next tragedy instead of helplessly waiting for it to occur, because if we continue to sit idly by, that next tragedy will become just an inevitability. HMR

CON

Domestic

“Restricting guns is unconstitutional.”

ellow Americans, do you think it morally correct to help criminals carry out violent acts against our citizens? Do you think it acceptable to support these criminals on their various illegal escapades? Do you think it right that we violate ourselves by retracting rights that as Americans we have held since the beginnings of our great country? Well the gun control advocates seem to, and I for one will not stand for these belligerent acts against the country that I know and love. Controlling guns to the nth degree is an unconstitutional act. It leaves our innocent citizens unprotected from criminals, who will obtain guns whether or not we outlaw them. Additionally, it takes away the gun culture in our country and activities like hunting and recreational shooting that are family pastimes in many states and a big part of bonding in many people’s lives. However, we cannot ignore the terrible mass shootings in our country and allow ourselves to use our right to bear arms without the government’s oversight. Gun control advocates and detractors would start to compromise if our country began using background checks, regulating dealers and prohibiting the mentally unstable and domestic violence offenders from purchasing, owning, and using guns. Firstly, restricting guns is unconstitutional. The Second Amendment states that “the right of the people to keep and bear arms shall not be infringed.” Now that can be interpreted in many ways. Many people think that our forefathers

Zachary Gaynor

could not have foreseen the technological advances achieved in the firearm industry, and therefore we must look at the spirit of the law rather than the words themselves. Some of the people that oppose our Second Amendment rights believe that while Americans should have partial gun ownership, semiautomatic weapons or large clips should be banned. Considering the reasoning for the constitional amendment in the first place, these notions are ridiculous. Our forefathers were protecting the right to bear arms in the context of the Revolutionary War and oppressive British colonial rule. If we allowed a ban on guns today, we could not protect our God given rights because the government also has more technologically advanced weapons now. To protect ourselves from the oppression of a tyrant or an invading forging force, we would need at least semiautomatics to help us. This is a very radical thought, and I absolutely do not propose that our government will at any time become oppressive to the point of rebellion, but that is the actual spirit of why our forefathers were protecting the right to bear arms. Let us be realistic and not assign meaning to the spirit of something when there is actually no basis behind those claims. Secondly in reference to the statement above, if we support gun control we are in turn supporting criminals. This conviction is unequivocally correct on many fronts. First of all, if we ban guns, we increase the already large amount of illegal gun trafficking. Sec-

ondly, criminals will still have guns because, by definition, criminals are people who break the law. If guns are banned but criminals still have them, would we not just be hurting innocent civilians? It has been said many times before the only thing that stops a bad guy with a gun is a good guy with a gun. Also for everyone out there who is thinking right now that violence is not the answer, that is absolutely correct: not only do guns protect a person when a situation escalates to a place of violence, but guns also act as deterrences against violence in the first place. Now, as a law-abiding citizen, can you stand for your right to protection being retracted? Protection is not the only reason that people have and love guns, but they also use guns as a hobby to bond over. Many advocates of gun control such as Representative Carolyn McCarthy say that is an unhealthy hobby and bonding activity, and if we ban guns they can find another activity to take part in. Is it not our right to decide which hobbies are enjoyable? Isn’t our country the land of the free? So I ask you again not if we can but if it is morally correct to regulate gun control. Gun control also parallels Prohibition, the US government’s failed attempt to bar citizens from selling and drinking alcohol. Both movements are both poorly thought-through attempts at helping to save the American people. Prohibition started because certain people thought that it was the government’s job to stop the drinking epidemic in the

“Now, as a law-abiding citizen, can you stand for your right to protection being retracted?” 10

The Horace Mann Review | Vol. XXIII

Domestic United States, and those people were powerful enough to make those rash changes. When the United States government stopped the American public from buying alcohol, there were huge economic repercussions. When prohibition hit, its advocates thought that the buying and selling of household goods and clothing would dramatically rise. What actually happened was that restaurants failed, as did saloons and distilleries, which led to the loss of thousands of jobs. The same would occur if full gun control were to take place, but instead of restaurants and distilleries failing, gun ranges, gun distributers, and gun factories would go out of business. We cannot and should not stand for this to occur. Moreover, from a purely economic standpoint, it is not feasible to limit or take away guns. Estimates say that we have a little less then ninety guns per one hundred people in America. Clearly many Americans want and value their guns. Additionally, the economic impact of the arms industry has to be brought into this conversation. The arms industry employs 220,000 people adding 37,000 jobs in the last 2 years. Wages paid $10.4 Billion, taxes paid $4.6 Billion, and the industry contributed $33.3 Billion to the GDP. While this is appalling to some, there is no doubt that in a time of such economic constraint we cannot eliminate an industry that produces so many jobs for so many people. Most Americans donâ&#x20AC;&#x2122;t realize how many jobs and industries would actually be eliminated or take a large hit along with both large and small businesses. These numbers just pertain to the actual manufacturers and present a myopic view of the industry. There are also other businesses that are based on the industry such as gun shops, advertising firms, recreational facilities, shooting clubs, metal companies that supply gun manufacturers, and gunpowder companies. How many additional jobs would that be? The number would range in the hundreds of thousands. Many people each year are viciously murdered in many ways, yet contrary to popular belief, guns actually are not the weapon of choice for most of these killings. According to the Federal Bureau of Investigation, the FBI, hammers and clubs are. While I still understand that people think to regulate guns because of the high profile murders and mass killings committed with them, Americans still

timesunion.com

must recognize this shocking statistic. One piece of evidence which supports furthering gun control laws is that in physiological studies, it has been proven that a high percentage of the people who perpetrate mass shootings become insane only after obtaining guns. And from seeing person after person become infamous through our news sources by committing these violent mass shootings, certain Americans start to crack and think in demented ways about killing innocents. While this is hard to believe, it has been proven many times, and so it must be addressed to make a proper argument against tyrannical gun control. Now assuming that the physiological studies above are correct, early detection is still possible. To go into a school full of innocent first graders and try to kill as many as you can for no apparent reason is nonsensical, and using purely common sense, it is apparent that the monsters who commit these acts must start out if not a lot then a little bit different from you or me. We must trust that if physiologists can research these conditions to a point of being able to make this evidence public, they can also detect it early in a subject. We must make changes if we want to change the outcome of the events of late, i.e. Sandy Hook, Columbine, etc. However, we cannot be rash and take away the rights of Americans to own and purchase arms, whether they are handguns

February 2014

or semiautomatics. We must reach compromise. The rights of Americans must be protected at all costs, and it is up to us as individuals to act responsibly, not big government to impose restrictions on the people. Obviously it hurts all of us to see innocent children being murdered while they go to be educated or law-abiding people get killed while they are trying to enjoy a movie as seen in many of the mass shootings of late. These are evidence of mental health issues and a system breakdown in identifying these troubled individuals before they become menaces to society. The only way any sort of gun control would be viable would be if it were minimal. Although this touches on infringement of our rights, if the government were to mandate background checks on all people attempting to purchase guns, it wouldnâ&#x20AC;&#x2122;t be too incredibly awful. The White House says that these background checks have already kept 2 million guns out of the wrong hands. For all of those who reject background checks, it is not any different from what many states like Maryland already have. If we do more than what these states already have, it would be an total breech of the rights of Americans like you and me, and if we cannot protect the right to bear arms, what will be taken away next? Free speech? The right to vote? The government should not be allowed to infringe on Americansâ&#x20AC;&#x2122; constitutional rights. HMR

Domestic

The Violation of Farm Worker Rights

And what we must do to end It

Cassandra Kopans-Johnson

e grow up in a United States of America that views its relation to slavery as nonexistent. We learn in our history classes about the abolition of slavery, and how it was a part of our nation’s past. However, time is fluid and past events leave behind remnants for the present and future. Today, in our local

area of New York State, farm worker’s human rights are violated on a daily basis. In the 1930’s the U.S. was enacting New Deal legislation, which included the Fair Labor Standards Act (FLSA). The FLSA proposal guaranteed workers a minimum wage and overtime pay among other provisions. However, the 1930’s was a period

The Horace Mann Review | Vol. XXIII

of prevalent and severe racial discrimination, and consequently the FLSA was met with opposition. Rep. J. Mark Wilcox of Florida claimed during debates over the FLSA in 1937: “There is another matter of great importance in the South, and that

Domestic is the problem of our Negro labor. There has always been a difference in the wage scale of white and colored labor. The Federal Government knows no color line and… it will prescribe the same wage for the Negro that it prescribes for the white man…You cannot put the Negro and the white man on the same basis and get away with it.” African Americans often worked in agricultural settings, such as farms. After debates of the kind shown above, the FLSA passed under the condition that it would exclude farm workers due to the desire to maintain racial segregation and distinction. Until 1966, the FLSA excluded farmworkers, and now its provisions relating to minimum wage and recordkeeping only apply to some agricultural workers and employers. The overtime pay provisions of FLSA, however, are still not applicable to farmworkers. Thus, employment abuses in agriculture are challenging to address because important labor protections pertaining to other workers in this country do not cover farm work. Employers of farm workers may at times practice types of wage theft. Employees work under unhealthy or dangerous conditions, and are made to live in abhorrently substandard housing. Many such farm workers are undocumented workers and depend upon their employers for security. Thus, they are vulnerable victims. This situation makes

recordkeeping difficult because employers often manipulate this factor to enable themselves to pass inspection regarding recordkeeping standards invalidly. Although not all farmworkers receive such treatment, some still lack the right to a

ness and health of workers and as a result increase productivity. We suffer from a vestige of an ingrained racist mindset that rots our social values pertaining to human rights. Now, we have the opportunity, the power, and the ability to begin

“We have the opportunity, the power, and the ability to begin putting an end to such abuse by starting in our own backyards.” day of rest and the right to collective bargaining, which implies that they are powerless to ask for equal rights and dignity. This interferes with a person’s right to be able to support oneself and one’s family. Today, the New York State Labor Relations Act, like the federal laws, excludes farmworkers from the rights and protections highlighted above. Senator Adriano Espaillat of Manhattan recently introduced the Farmworker’s Bill of Rights. It will ensure that farmworkers have the same rights as other workers in New York State. Its provisions will close an unpardonable chasm in rudimentary labor protections required for a strong workforce in the farm industry. This bill will codify existing practices and help both large and small farms. It will increase the happi-

February 2014

putting an end to such abuse by starting in our own backyards. Although some of us live our lives ignorant of the labor conditions that plague our community, we support it through buying the agricultural commodities farm work produces. Yes, it is important to buy locally because it is more environmentally friendly. But, locally grown food sometimes comes at the cost of a person’s rights. The world has ambiguity but we still must open our eyes to the reality of the foundations and the interworkings of our community. It is easier to acknowledge the human rights violations occurring in other parts of the world, but before we look to fix them, we should reflect on ourselves. Everybody has the duty to do so. After all, we are the United States of America, and unity requires equality and fairness. HMR

International

LOOKING TOWARDS A NEW FUTURE Daniel Rosenblatt

abc.net.au

he movement towards egalitarian and fair governance is often linked, or perhaps even considered synonymous to, progression to democracy. Yet recent uprisings like those of the Arab Spring have revealed that, despite the safest and most honorable of intentions, democratic revolutions and their resulting government changes introduce dangers that frequently outweigh the original causes of revolt. Thailand’s recent political crisis further complicates the matter. In a unique political landscape, neither a suppression of protests nor the successful recreation of the government can succeed. When calls for equality within the government are not those of democracy, the government system must be reconfigured to protect all while adhering to the voice of the majority. The Kingdom of Thailand is a constitutional monarchy of democratic nature

in which King Rama IX holds the position of Head of State, while the Prime Minister and an elected National Assembly control the government. However, unlike constitutional monarchies in Great Britain and Spain, and even in the neighboring Kingdom of Cambodia, the system of governance in Thailand is not completely separate from the monarchy. Through behind the scenes tactics and a group of government officials who are linked to the monarchy that create a system dubbed a “network monarchy,” the King and his family influence the political affairs of the country. The king is admired and revered by the people of Thailand as a ceremonial leader but is not viewed as political figure. His family’s involvement in government matters and their constant struggle with the threatening, frequently changing political leaders create a unique

The Horace Mann Review | Vol. XXIII

and

unstable political environment. Thailand has experienced a long history of political discontent, resignations, and government collapse. The monarchical nation, known as Siam, was officially established in 1782 with the beginning of the current dynasty under King Rama I. A nonviolent coup transformed the absolutist monarchy into a democracy, similar to its current form, in 1932, but a military regime took power in 1947 and would not fall until 1973. For 20 years, the nation moved in and out of democracy, mostly through a multitude of military coups. In fact, 17 removals of this type have occurred in the country’s short history. It is clear that underlying problems with the social and political systems in Thailand have existed for years; when the flaws are aggravated by acts of corruption or overuse of power, it is no surprise that the people react.

International

Recently, this aggravation has been caused by the aforementioned tension between the royalty, the upper classes, and the rising populist politicians. Following with the theme of aristocracy within democracy, the focus of the last decade’s conflicts has revolved around former Prime Minister Thaksin Shinawatra and his sister, the current Prime Minister, Yingluck Shinawatra. Thaksin, the leader of the Thai Love Thai party, rose to the office of Prime Minister in 2001 and 2005 as his party won the elections with strong margins. However, he was ousted and exiled by a military coup in 2006; soon after, the Thai Love Thai party was banned. For five years, with anti-Thaksin forces running the government, protests in support of Thaksin’s return were common; supporters wore red shirts to display their allegiance to the party. However in 2011, the Pheu Thai Party, led by Yingluck

Shinawatra won the election by a vast majority. The “red-shirt” protestors content, new anti-government protests, these of Thai citizens donning yellow, broke out. When Yingluck came to power, a majority of the populous seemed content. However, her approval rating, along with that of her government, has decreased dramatically. According to a poll conducted by Bangkok University, the Prime Minister now has just below 50% approval rating. Interestingly, the poll also revealed that 55.2% of Thai citizens say that it is unclear whether the government is leading the country in a good or bad direction. This new data is a testament to the disconnect between the government and the people. The cause of the decreasing approval is generally agreed upon: distrust. Many believe Prime Minister Shinawatra’s actions are influenced, if not completely con-

February 2014

trolled, by her exiled brother. For example, a proposed amnesty bill in November of 2013 seemed to provide a passage for Thaksin to return without legal action. Opposition to this leadership filled the streets, and these same protests continue today. Now, many call for Yingluck’s resignation. They demand justice, and believe this is the only solution. Others claim that the constant protests by a minority are inhibiting normal economic life within the nation and therefore must be quelled. Some call for a restructure of government to enhance democracy. Others demand a form of oligarchy in which representatives from each profession are selected to form a government and replace Parliament. This is not simply a matter of corruption in elections or an oppressive regime- this is a government system that is struggling to accommodate the various views that have

International been created by the nation’s instability. So far, the Prime Minister has refused demands for her to step down. She has also made it clear that she plans on holding fair elections in February in order to demonstrate the needs of the public. Surely her resignation would eliminate the current problem of corruption in the office, however the protestors, many of whom are of the upper class, would most likely not benefit from. a new election. Thus, the question is not whether or not the nation will recover from this period of crisis, but rather if it will find a system that will prevent future conflicts. In the unlikely event that the opposition movement succeeds in their calls for resignation, the resulting sudden shift of power would, even in a democracy, provide room for greater corruption. For far too long have we seen this cycle of instability continue. Conversely, if the elections proceed as planned, the current government will likely remain the same and many of the same politicians will be elected. This will further anger the parties opposed to Shinawatra, and while their political alignment represents a minority, the angered voices of these groups represents much more than an extreme, outspoken few; these

concerns are felt throughout the whole nation. In fear of losing the vote, however, the leaders of the demonstrations have called upon the nation to boycott the elections. “If you want to register, you will have to walk past our feet,” said Suthep Thausuban, an opposition leader said in December. This strategy is surely not the answer. It demonstrates the primary weakness of the movement: low support. The cause that these men and women are fighting for may attract Thai citizens from many classes and beliefs throughout the nation, but this tactic will only alienate the demonstrators. Additionally, it challenges the values of democracy the people are fighting for. Concern of the election’s validity is minimal, so withdrawing support from them is ultimately a withdrawal of support from democracy. Only the Pheu Thai Party, the majority party, can determine the prolongation of this instability. They have control in the Thai government and, while not in full, the voting support of most of the people. However, the party’s connection with Thaksin and return to his policies aggravate more than just the opposition, but also supporters of the party who never agreed to such actions. Therefore, the party must stop this unnecessary return to the past and look to-

wards a future of stability; resurfacing past issues will only further complicate political tensions. The party must focus on finding compromise through increasing the rights of all people and protecting the minorities, both in the upper and lower classes of the nation, the groups who cannot connect with their policies. With a concrete system of checks and balances, slight majority coalitions will not be able to dominate minority parties, and future conflicts may be avoided. In the new elections, the coalitions formed should be based on compromise and should take into serious account the Prime Minister that would result from such agreements. In doing so, the Pheu Thai Party could clean up its image and restore its strong base of support. For the last century, the country has struggled to maintain stable governments for more than periods of just a few years. Leaders rise and fall and then rise again. But today, the conflict is not violent, and it does not threaten the livelihoods of the citizens; it is something that can be saved without dramatic change or bloodshed. In a gradual return to focus on fair governance, the political landscape of one-sided domination may change, and the belief in democracy would finally translate to reality. HMR

“THE [PHEU THAI PARTY] MUST FOCUS ON FINDING COMPROMISE THROUGH INCREASING THE RIGHTS OF ALL PEOPLE AND PROTECTING MINORITIES, BOTH IN THE UPPER AND LOWER CLASSES OF THE NATION...”

channelnewsasia.com

The Horace Mann Review | Vol. XXIII

International

INTERNATIONAL CHARITY

BEN ALEXANDER

ere is an astonishing fact that will probably surprise you: in terms of income, an American at the poverty line, set at $11,490 in 2013, is in the richest 14% of the world’s population. That American, who is poor by U.S. standards, still makes more money than 86% of the people in the world. This fact is quite stunning, and is one of the main reasons that, in the U.S., the idea of charity beginning at home does not fully embrace the spirit of kindness and giving it is meant to evoke. Unfortunately, this viewpoint still predominates in the U.S. According to a report by Giving USA, Americans donated around $290 billion dollars to charity in 2011, with a mere 8% of that money going to international causes. U.S. charities are certainly worthwhile, but this 8% is embarrassingly low. Charity is about helping those in need of support, and many, many people who do not live in the U.S need help too. The range of international causes, from

the arts to wildlife conservation, may seem limitless, and they are all extremely important and deserve attention from American donors. Many charities exist that have proven to be quite effective at improving worldwide health. This article focuses on health because very few causes are more urgent than saving lives. One of the largest international health problems is a lack of proper sanitation. According to UNICEF, 2.5 billion people did not have sufficient sanitation facilities in 2011. Those 2.5 billion people were more susceptible to disease, especially diarrhea, which is usually preventable and treatable. According to the World Health Organization, each year there are almost 1.7 billion cases of diarrheal disease, leading to the deaths of 760,000 children under age 5. If Americans donate their money to helping bring proper sanitation to those who need it, many lives might be saved at a fraction of the cost of, for example, attempting to cure a person of can-

February 2014

cer in the U.S. According to a report by the UN Millennium Project, “The simple act of washing hands at critical times can reduce the number of diarrheal cases by as much as 35 percent.” Even more surprisingly, according to Therese Dooley, UNICEF’s Senior Adviser for Hygiene and Sanitation, “Soap is not in short supply, even in developing countries. The vast majority of poor households have soap in the home. The problem is that soap is used for laundry or bathing, but rarely for hand washing.” Progress has been made, as almost 1.9 billion people have gained access to an improved sanitation facility since 1990, but much more needs to be done. Another international issue that needs to be addressed is hunger and malnourishment. Americans often help local charities such as soup kitchens, and while these are great causes, at least some of this help could be directed towards other countries where hunger is a far greater problem. In 2012, according to the U.S. Department of Agriculture, “85.5

International percent of U.S. households were food secure throughout the year.” “Typically,” the report states, “households classified as having very low food security experienced the condition in 7 months of the year,” and only “for a few days in each of those months.” It is very sad that some Americans do not always have as much food as they need, but in other countries the problems are exponentially worse. From 2010-2012, according to the United Nations Food and Agriculture Organization, 868 million people—or approximately 1 in every 8 people in the world—suffered from chronic undernourishment. Of those people, 852 million lived in developing countries, with just 16 million of them residing in developed countries. If over 98% of undernourished people live in developing countries, the hunger charities that need the most support are not in the U.S. Some charities work with farmers to improve productivity, which can help keep the farmers well nourished and also allow them to make money by selling the surplus. Other charities even purchase livestock such as chickens, which reproduce and allow

the family they are given to to eat or sell the animals. Animals like cows and goats can also provide milk for the family. One type of undernourishment that is especially harmful is child malnourishment. For children, malnutrition is very dangerous, because it puts them at a higher risk of contracting illnesses or even dying, and weakens their brain, body, and immune system for life. In 2011, according to UNICEF, globally 26% of children under age 5 were “stunted,” meaning that their heights were severely below normal. Stunted children are more prone to sickness—a stunted child is 4.6 times more likely to die of diarrhea than one who is not— and are often less productive in adulthood than non-stunted children. Three-fourths of these stunted children come from either South Asia or sub-Saharan Africa, while the U.S. has very few. Charities have helped, and since 1990 the stunting rate in children under age 5 has declined from 40% to 26%, but even that number is unacceptable. Children are susceptible to many different health problems besides malnutrition that

“It is far easier to receive a tax deduction for domestic donations, because more domestic charities are registered with the IRS than international ones.”

The Horace Mann Review | Vol. XXIII

lead to mortality. On the bright side, there are now 17,000 fewer child deaths each day than there were in 1990, amounting to around 90 million lives saved since then. Still, in 2012, 6.6 million children died before turning 5, at a rate of around 18,000 per day. Sadly, most of these 18,000 deaths a day are preventable, including the 5,000 who die of pneumonia or diarrhea. Malaria is a huge worldwide problem and another example of how simple and affordable it can be to save lives through international charities. The World Health Organization estimates that 219 million people suffered from malaria in 2010, leading to around 660,000 deaths a year. One excellent charity is the Against Malaria Foundation, which, amazingly, protects people in 35 countries just by purchasing insecticide-treated bed nets at low prices. A $3 net protects an average of two people. These nets are very effective, because they physically keep out mosquitoes at night when most bites occur, and because they are treated with insecticide that kills the mosquitoes that land on the nets, helping to reduce the mosquito population. Worms and other parasitic or bacterial diseases called Neglected Tropical Diseases (NTDs) affect 2 billion people worldwide. Of these people, 300 million, or approximately the population of the U.S., have severe cases of NTDs. NTDs have a variety of negative impacts, including malnutrition, blindness, and increased mortality from malaria, tuberculosis, and AIDS. According to GiveWell, it costs about 35 cents to deworm a child, a price to save a life that is stunningly low by U.S. standards and again stresses the inexpensiveness and resulting effectiveness of international charities. Two charities that deal with NTDs are Schistosomiasis Control Initiative, and the Deworm the World Initiative. Immunization also needs attention. Vaccines are very effective and have eradicated diseases such as smallpox, and yet 22.4 million children worldwide still do not receive even basic vaccinations. This leads to 1.5 million deaths a year, or 1 death every 20 seconds. In the U.S., almost all children receive basic vaccinations. Diseases such as measles pose little danger to Americans, but still 158,000 people worldwide were killed by this disease in 2011. In the rest of the world these health problems and others are major issues, but in the U.S. we do not give a passing thought to many of them. For example, in the U.S., out of every 1,000 children under age 5, just 7 die. That means that 99.3% of children survive, so most Americans don’t worry much about

International

“From 2010-2012, according to the United Nations Food and Agriculture Organization, 868 million people—or 1 in every 8 people in the world— suffered from chronic undernourishment. Of those people, 852 million lived in developing countries.” child mortality. However, in Sierra Leone, for example, 182 out of every 1,000 children die before turning 5, meaning that nearly 1 out of every 5 children dies. Not only do international charities need as much as or more help than American ones, but they can also be much more cost-effective. Here is an interesting way to look at it economically. In 2012, the U.S. GDP per capita was $51,749, according to World Bank. In Kenya, the GDP per capita was just $943, and in India it was $1,489. Because GDP per capita in countries such as India or Kenya is so much smaller than in the U.S., spending an American dollar in those countries goes much further than spending a dollar in the U.S. For example, the minimum wage for an American worker is $7.25 per hour, whereas in India the minimum wage is just 28 cents

per hour. Five dollars can hire a minimum wage worker in the U.S. for around forty minutes, or it can hire an Indian minimum wage worker for around two days of work. You might be wondering why most people donate to domestic causes. The answer is that many people believe that we should help our own communities first, an idea which could perhaps be described as something like patriotism. It is also easier to see the results of donations, and to analyze whether the charity is using your money the way you want it to be used, near home, rather than overseas. In addition, many people see problems near home, but do not see firsthand the difficulties faced by people living tens of thousands of miles away. For example, many people see issues with education in the U.S., and consequently the second largest percentage of dona-

February 2014

tions in 2011, 13%, went to education. Interestingly, the largest amount of contributions by far went to religion. In 2011, a 32% of U.S. charitable donations went to religious causes, many of which are located in the U.S., including local churches. Lastly, it is far easier to receive a tax deduction for domestic donations, because more domestic charities are registered with the IRS than international ones. Finding a way to increase international donations is not easy. The main problem is that most people are not aware of or perhaps not interested in learning about the ways they can best use their money for charity. It is easy to see an advertisement on TV about a recent hurricane, or hear about the American college dropout rate, and then make a donation and feel content with having helped a cause. One cannot simply force people to be more interested in international affairs. In addition, advertising is expensive, so generally the charities with the most donations are the large ones that can afford to run commercials on TV or send out mailings. One solution might be to have more articles in newspapers and online to educate people about the benefits of international charities. In addition, the U.S. government can help out by making more of an effort to register international charities for tax deductions, which will create an incentive for donating internationally. Also, it is important to remember that many registered organizations based in the U.S. take the money you donate and send it to international causes. This way, donors can donate internationally and receive a tax deduction. Many American charities deal with issues such as improving education or helping people maintain jobs. Trying to solve these issues is noble, but it is not always easy and many do not have approaches which are proven to work, whereas in other parts of the world, millions of lives can be saved using simple, effective methods that are commonplace in the U.S., sometimes as simple as learning the importance of washing hands. In the U.S., discussions about preventable diseases are often about ones like heart disease, which can be prevented by eating healthily and exercising. However, those diseases are not always easy to prevent, whereas in other countries discussions about preventable diseases can often be about purchasing cheap, simple materials or educating people. These methods are very effective at saving lives at relatively little cost. There are no borders to pain and suffering. Doesn’t it make sense for Americans to make the most of their generosity by looking beyond our own borders? HMR

International

Rallying For Integration Ukraine’s Battle to Move Away From Russia and into the EU ERIC STEIN

n July of 2013, Russia halted imports from Ukraine because its products fell below the safety standards of Russia. Coming at a time where intense talks between Ukraine and the European Union were taking place, these restrictions can easily be seen as retaliation for Ukraine’s attempts to move itself further away from Russia and its economic and political influence. It seems very likely that there were no violations of safety standards, despite Russia’s claims, implying a threat of ceasing support to Ukraine on Russia’s part if the Ukraine integrates into the European Union. Russia opposes the country’s moving closer to the European Union because Russia fears it will lose influence over the region. In November, after Russia had halted imports from Ukraine, Ukraine abandoned talks with the European Union. Subsequently, tens of thousands of protesters took to the streets of central Kiev to express opposition towards the government’s succumbing to Russian pressure. The European Union offers a better future for Ukraine because it ensures long-term stability. On top of this, without an accord with the European

Union, Russia will continue to bully Ukraine. The European Union would develop Ukraine’s economy and would make the nation more prosperous. The European Union’s goal is to familiarize Ukraine with the other countries part of the European Union through democratization and free market economies. In exchange, the European Union will expand trade, liberalize the visa systems, and give financial assistance. Moving into the European Union would allow Ukrainian companies to open its common market of 500 million customers, and as a result boost the country’s GDP and profitability. On the other hand, Russia has been injecting Ukraine with huge amounts of money to promote its own influence in the region. The European Union would develop Ukraine’s economy, while Russia would simply boost Ukraine’s economy temporarily. During the fight over Ukraine between Russia and the European Union, Russian President Vladimir Putin said Russia would buy $15 billion dollars worth of Ukrainian government bonds and sharply cut the price of natural gas for Ukraine. This deal will not develop Ukraine’s

The Horace Mann Review | Vol. XXIII

economy and will engender further Ukranian dependence on Russia. This deal will merely keep the Ukraine out of bankruptcy. There is also no telling if Putin will keep these prices low in the future or if this is just an attempt to have Ukraine avoid the European Union. Poland is an example of the prosperity the European Union can bring to a country. In 1990, Poland had about the same gross domestic product (GDP) per capita as its neighbor Ukraine. Currently, Poland, a member of the European Union, has three times the GDP per capita than Ukraine. Ukraine has the geographical location, resources, size, transportation networks, and human capital to be a strong world power. Russia is trying to keep Ukraine in the “anti-EU.” The “anti-EU” is currently comprised of Belarus, Kazakhstan, and Russia. The “anti-EU” does not demand political, economic, and social modernization. Rather, members of the “anti-EU” receive political backing, financial subsidies, and security guarantees from Russia; when a country opts-out of the “anti-EU,” the country receives sanctions from Russia. Ukraine has

International

become reliant on the financial subsidies, the political backing, and security guarantees from Russia. The only way to lessen this reliance is to integrate into the European Union. Ukraine will forever be permanently bullied as long as it is reliant on Russia. Russia will give Ukraine a fish, while the European Union will teach Ukraine how to fish. Once Ukraine joins the European Union, Ukraine will also learn to become self-reliant. Russian President Vladimir Putin gave Ukraine a big fish on December 17 when he promised the country $15 billion in loans and discounts on natural gasses. There is no telling how long Russia will want to bailout Ukraine with generous donations. The European Union will not give Ukraine a donation, but instead will modernize their economy and government. Ukrainian President Viktor Yanukovich’s decision to suspend the agreement with the European Union was driven by personal considerations. Signing the agreement with the European Union would have democratized Ukraine’s political sphere, which is in opposition to Yanukovich’s personal inter-

ests. Ukraine is a very corrupt country and is ranked number 144 out of 177 countries in the Transparency International Corruption Perceptions Index. President Yanukovich’s party already underwent allegations that his party had rigged the voting in 2004, which initiated the “Orange Revolution.” The “Orange Revolution” forced President Yanukovich from office and gave power to his political opponents, including Yulia Tymoshenko, who later became prime minister. Not long after Yanukovich was elected President in 2010, Prime Minister Tymoshenko was imprisoned for abuse of office in a case many believed to be politically motivated because Tymoshenko was the biggest threat to the incumbent president. In the negotiations, the European Union was demanding that President Yanukovich free Tymoshenko, an action Yanukovich definitely does not want to take. A corrupt country is vulnerable to arbitrary rule. If Ukraine were to join forces with European Union, there would no longer be arbitrary rule. President Yanukovich is attempting to go neither East nor West in an effort to strengthen his power. In an alliance with

February 2014

Russia, Putin would most certainly allow Yanukovich to enhance his power. However, Putin would want control over important economic and political decisions thus removing some of President Yanukovich’s authority. President Yanukovich wants to stick with the status quo to consolidate his power. President Yanukovich should put all personal self-interest aside and make an agreement with the European Union in order to sure prosperity for Ukraine. Germany, now possibly the leading power in Europe, has shown that it is not afraid to confront Russia. Berlin has asked the European Union to respond to Russian pressure on Eastern Europe by giving Germany additional sales opportunities for products. President Yanukovich should look to German Chancellor Angela Merkel as an example of a great leader who is pushing back great powers for the protection of smaller powers. Instead of trying to follow the balancing act that Charles de Gaulle and Mao Zedong played in the 1960s and pitting two superpowers together, Ukraine should focus on reviving its economy thus ensuring potential future progress. HMR

International

BEHIND THE VEIL OF SECRECY Matthew Parker

japantimes.co.jp

orth Korea always seems to make headlines. Normally, focus is directed towards its secretive nuclear program, which continues to cause issues for diplomats around the world. More recently, however, news of trouble among the ruling class has surfaced, as the official media of North Korea announced that Kim Jong-Un’s uncle, Jang Sung-taek, was a traitor and was sentenced to death. He was a leading member of the government during the rule of Kim Jong-Il and took over most leadership duties when Kim Jong-Il started to decline in health. The news that Jang Song-taek was to be executed was shocking, and even North Korea’s closest ally, China, was shocked and appalled. Other government aides were reportedly executed, and in a break from tradition, the news was announced by the state -run media. It is odd enough that such an important political figure would be executed so suddenly, let alone a family member and mentor of the leader. This is just anoth-

er sign of the disorder and unpredictability that exists in North Korea. The leaders of this nation cannot be trusted, and action needs to be taken to remove the veil of secrecy surrounding North Korea and its policies. Kim Jong-Un is the son of Kim Jongil and grandson of Kim Il-sung. These three have ruled North Korea since 1948, when the Communist nation state was founded. The position of ruler was passed down from father to son upon death, and Kim Jong-Un has only held the position since 2011, when his father passed away. Jong-Un is in charge of all of North Korea; he holds posts as Commander of the Army as well as the position equivalent of president. Jong-Un is also the youngest head of state at the age of 31. He has so far had a short and tumultuous campaign as leader, which may be due to his young age. He has been far less stable than his predecessors, and has presented a challenge for President Obama and the Western world. Jong-Un continues to pursue a nuclear program for the country and

The Horace Mann Review | Vol. XXIII

has also tried, mostly unsuccessfully, to develop rockets that could have posed a threat to the US. Cracks in his regime have become apparent, starting with the execution of his uncle. Jang Sung-taek was born and raised in North Korea, and briefly went to a school in Moscow. He married Kim Jong-il’s only sister, Kim Kyong-hui, in the 1970’s. Sung-taek worked for the Worker’s Party of Korea and began to rise in power. His status fluctuated until in 1989 when he was conferred as a People’s Hero, or a Hero of Labour, and later as a member of the Order of Kim-Il Sung. In 2005, he briefly disappeared from the public eye. Sung-taek returned in 2007 and by 2010 he was given the position of second in command to Kim Jong-Il, the leader at the time. During this time, he visited China multiple times, and analysts of Chinese policy commented that the Chinese leadership trusted Sung-taek to guide North Korea’s economy towards the stable state that China had created. He was supposed to be China’s powerful advocate in

International Pyongyang, a powerful label that may have been what provoked Kim Jong-Un. After Kim Jong-Il’s death, Sung-taek briefly saw a small rise in perceived power after appearing on television in a general’s uniform and being given a position in charge of the National Sports Commission. While this may seem like an increase in power, many believe that this was a demotion, as sports were seen as games for the youth and not nearly as important as the economic or military posts Sung-taek had previously occupied. In May of 2013, Jang was passed over for a trip to China. This was likely the point of no return, as he had been making trips to Beijing for years. It was rumored that he and Jong-Un had conflicting views on North Korean foreign policy regarding China; that, in addition to a disagreement regarding fisheries between Jang and Jong-Un that resulted in the deaths of many soldiers loyal to Jong-Un and aides to Jang, was the final straw.

of economic advancement in the DPRK. Jang’s wife has remained in a position of power in North Korea. It is reported she and Jang were estranged and that she had no problems with this purge. She was listed as one of six top officials on a roster of party members in charge of a funeral for another member of the party who died from natural causes. Jang has since been removed from official photos and broadcasts that have re-aired which previously included his name and image. He has effectively been erased from any official party records, except for the public’s knowledge of his traitorous acts and subsequent execution. The North Korean government has succeeded in breaking down multiple rights, rights deemed unalienable in America and most other nations. They have infringed on the rights of free speech, free press, the right to fair trial, and have executed individuals solely because of their political beliefs. None

“Advocates of economic reform saw [Jang Sung-taek’s] execution as the end of economic advancement in the DPRK.” In early December of 2013, Jang was expelled from the ruling party of Korea. The state-run media called him a traitor and a weak link of the party, and he was arrested live on national TV at a Politburo meeting. It was the most public arrest in North Korea’s history, and many were shocked by the news not only because such a powerful figure was arrested, but also because his downfall had been made so public. The party released a 2700 word statement, stating, “[The] despicable human scum Jang, who was worse than a dog, perpetrated thrice-cursed acts of treachery in betrayal of such profound trust and warmest paternal love shown by the party and the leader for him.” The government accused Jang of attempting to gain power and overthrow the ruling party in North Korea. While it is up for debate as to whether or not Jang was planning to overthrow Jong-Un, it is clear that he was gaining power; regardless, this is not a justifiable reason for an execution. Jang’s execution was announced on TV later in the week, and many of his family and friends were recalled from posts around the world. Jang had served as the leading voice for economic reform in North Korea, which was part of the reason why the Chinese thought of him as an advocate for their style of economic growth, and other advocates for economic reform saw his execution as the end

of these acts would be tolerated in the US, so why do we tolerate them overseas? North Korea continues to evade questions about its nuclear policy. They claim they are not creating weapons, yet test launch rockets into the ocean. They say they are shutting down reactors and then satellite images show fuel rods being sent into the same plants. If the leading figures of North Korea are as unpredictable as the execution of a once revered leader make them out to be, then we can’t trust them with

any agreements in the future. This is not the first time North Korea has been accused of human rights abuses. Escapees from labor camps in North Korea have painted a picture of a depressing life of sadness, pain, hunger, and degradation for people in the camps. Almost 40% of the population is involved in either the active or reserve military, and very few outsiders are allowed in and only under strict guidelines. Americans have been held captive in North Korea, with Dennis Rodman as our only ambassador working to free them. Kim Jong-Un has become crazed with power, and is slowly strengthening his totalitarian government and hold over the people of North Korea. The UN and China need to impose sanctions and possibly pursue covert operations in North Korea to end the tyrannical rule of the Workers’ Party. The people of North Korea have suffered too long and without anyone pushing for reform, and hope is bleak for the country. While Kim Jong-Un asks for better relations with South Korea, he has not actively pursued them, and perhaps the US and South Korea can work together to try to break down the physical and cultural barriers between the two nations. This will start when we confront the tyrannical acts of violence and abuse by the North Korean government. The window into North Korea has been cracked open; their once top secret government is beginning to reveal its flaws. Now that we are starting to see what is going on in the Democratic People’s Republic of Korea, it is time to act and learn more about the country. There is still much hiding within North Korea, and the United States government must take this opportunity to unearth the secrets at the heart of the most unpredictable Asian nation. HMR

businessinsider.com

February 2014

Features

A Missed Opportunity ANNA KURITZKES

allying cries for equality and democracy ring out worldwide now more than ever, yet the notion of equality for women in the developing world is repeatedly ignored and scorned. A deep-rooted, archaic system of gender discrimination, embedded within the fabric of society, has caused women to be regarded as inferior to men. And as a result, while men in the developing world congratulate themselves on their freedom, women are left to wonder when they too will be share in this supposedly universal equality. The major obstacle in their way is violence. Millions of women worldwide struggle every day to survive and are unable to live life with their physical and mental health, security, and comfort intact. Violence against women is a human rights violation that is often overlooked, especially in the developing world, where cultural beliefs about male dominance cause women to be undermined. Accord-

ing to the World Health Organization, 35% of women have reported being abused in their lifetime. Despite the pervasiveness of this issue, the United States, a power that claims to champion human rights and fight for equality, is not doing its utmost to find a solution. Like the governments of the developing world, the United States ignores the victims of violence despite the countryâ&#x20AC;&#x2122;s extensive global influence. The world was galvanized to act on the problem of violence against women again after the story of a heinous rape of a woman in New Delhi became public. The woman, a young journalist, was attacked by a group of men on a bus, repeatedly raped, and left semi-conscious on the side of a road after her assailants had mutilated her body. The story picked up massive media traction because the rape was incredibly violent and became an international symbol of the horrific violent crimes committed against women on a daily basis.

The Horace Mann Review | Vol. XXIII

Rape, domestic violence, honor killings, and female genital mutilation are all examples of gender-based attacks committed against women worldwide. UN Women reports approximately 140 million women worldwide are victims of female genital mutilation, 64 million are child brides, and 4.5 million are forced into sexual slavery; all of these statistics are shockingly high. Additionally, there are many women who do not admit that they have been abused; their data would only add to the high statistic. Victims of gender based violence often feel as though they cannot come forward for a myriad of reasons: they fear that their sexually-based attack will be considered an impurity or a dishonor to their family, they think that no institution, legal or otherwise, will be able to help them, they know that there are no sufficient medical institutions to treat their mental and physical injuries, or they that fear they themselves will be

Features blamed for the attack. These factors that discourage or even prevent women from seeking the help they need after an attack can be eliminated with the help of the international community. With the support of donors, NGOs can set up health clinics and support systems for women in the developing world who otherwise would not have access to these institutions, and launch public service announcements (PSAs) and other campaigns to display to the public what women in the developing world are subjected to. A PSA launched in Egypt depicted the life of an average Egyptian woman in one day, as she was harassed by men on the street, successfully showing the violent attitude many Egyptian men have towards women. Other sources of support for women in the developing world who are victims of violence should come from the Western powers, which promote human rights and recognize violence against women as a terrible human rights violation. While strong Western influence may not be enough to convince men in the developing world to change their customs, it is enough to establish support for victims of abuse. The United States is generally regarded as a nation with an exceptional human rights record. The U.S. has claimed to include the empowerment of women into foreign policy for decades; under the Clinton Administration, USAID was tasked with connecting women’s rights to the historic American policy of promoting democracy, and, in more recent years the foreign policy of the Obama Adminis-

tration has also put a strong emphasis on the importance of women’s rights in the developing world. Yet the United States’ international influence in the sphere of women’s rights is weak, indicative in the Senate’s continued failure to ratify the United Nation’s Convention to Eliminate of All Forms of Discrimination Against Women (CEDAW), despite the fact that the document was enacted in 1981. CEDAW, which advocates for women’s equality and tries to protect women against all forms of violence, has not been ratified by the Senate during any of the 5 times it was debated. Conservatives have historically zealously opposed the ratification of this treaty as they believe it imposes unduly upon the sovereignty of the United States. Right-wing hard liners believe that the treaty will essentially force the United States government to supply contraception and abortion services for women. Interestingly enough, a Republican woman in the Nixon era convinced the United Nations to draft CEDAW. The importance of the treaty overpowers the necessity to confirm our sovereignty and dictate internal human rights on our own terms. The United States should ratify the treaty to give itself legitimacy when discussing the issue of women’s rights. The United States’ reputation of a land of equality for women is invalidated by the fact that the country is among one of 7 countries in the United Nations that has not ratified the treaty (the others include Somalia, Sudan, South Sudan, and Iran, as well as other small Pacific Island states). Furthermore, the

February 2014

United States’ legislature did not pass the International Violence Against Women Act, which was intended to further incorporate within American foreign policy the elimination of violence against women. As an influential world superpower and a humanitarian role model, the United States has a responsibility to promote women’s rights and strive to eliminate all forms of violence against women. Historic systems of gender inequality, allowing men to berate and abuse women, can be uprooted with the support of the international community, and especially strong powers such as the United States. The United States has the unique opportunity as a superpower to exert influence in the developing world by putting pressure on countries that have had continuous internal human rights violations. It is true that the United States has used this power in some spheres, stepping in to prevent domestic terrorism and chemical weapons abuse in Syria. Yet, we have shirked our responsibility to push for further action against gender-based violence. The United States should ratify CEDAW to show its commitment to ending the issue. Without a formal declaration of its commitment to ending violence against women, by ratifying CEDAW or passing an act similar to the International Violence Against Women act, the United States cannot put pressure on the developing world to recognize women as equal to men. It is time for the United States to hold up their end of the bargain and push for an end to violence against women worldwide. HMR

Features

THE LABOR OF OUR CHILDREN EVAN GREENE

The Horace Mann Review | Vol. XXIII

hroughout history, putting children to work at a very early age has been economically necessary for many families to make end meets and even put food on the table. Today, the idea that young children must work during their early years out of economic necessity is a reality in many countries. According to statistics from the International Labor Organization, “...there are about 73 million children between the ages of 10 and 14 that work in economic activities throughout the world and 218 million children working worldwide between the ages of 5 and 17.” Furthermore, there are countless other child laborers that have not even been accounted for in these statistics. The United States Department of Labor claims that “children are making bricks in Afghanistan, producing diamonds in Angola and cultivating enormous amounts of cotton in Argentina; just to name a few places where young people are being forced to work.” The practice of putting children to work, either voluntarily or by force, has plagued our globe for centuries. It is time for us to take a stand and put an end to child labor, by speaking up for more restrictive child labor laws and advocating for global enforcement of these laws. Historically, the practice of Child Labor has been a serious issue in the United States. Large numbers of children worked right here in New York City’s factories, especially in the early and mid -1800’s. Today, as a response to the ills and inequalities of American child labor, our laws state that children under twelve may not be employed at all. Furthermore, those children between 12-16 years are severely limited in the number of hours they can work and the kinds of work they can do. We have municipal, state and federal agencies that now regulate labor practices and deter children from working and enforce that they attend school. It seems that the United States has tried to solve its problem of potentially having large numbers of youngsters abused in the workplace – but it is quite the contrary in the global marketplace. Perhaps it is unfair to judge other less developed countries based on their child labor practices, compared to the higher standards of living here in the United States. Many countries

Features have unsophisticated infrastructures and poor economies and as a result are not able to provide enough food and sustenance for their citizens. How can others countries learn from the reforms in the United States when their economic situations are so diverse and difficult? Many starving kids from a family of seven need food, and are forced to find jobs to provide for their families. There are countless underlying internal structures in less developed countries that make it vital that young children find jobs. Places like Asia and Africa need major changes to education, welfare, health care, and government aid to help reduce and prevent child labor. In most third world countries, many parents and their children are forced to work for survival and it seems they will continue to work until there are changes to their countries’ economies. Vast amounts of children in Africa and Asia are forced to toil daily in dangerous and meager paying jobs, to help provide food and necessary resources for their families. There is no chance for them to attend school, as they are perhaps the only sources of income to their poverty-stricken families. Ideas to keep children out of the work force include more stringent labor laws that forbid children from obtaining jobs, and a task force in each country to ensure the enforcement of these laws. But the more important solution is to provide better aid and resources for food and basic needs so children won’t be forced to clandestinely work for to support their families. Also, world awareness must be increased to focus on the serious problems faced by children entering the work force. Countries with high poverty rates tend to have children working in dangerous job sectors like manufacturing, domestic laborers, factory assembly lines and agricultural jobs. Despite the few laws that are in place, there are loopholes and little supervision for enforcement that keep children in the workforce. Countries that are impoverished have few child welfare agencies and services that actually demand and enforce that children go to school. Aren’t the basic rights of all children not to have to work at a young age, and to able to go to school, read, and write? What kind of future do our children in the world have if they

February 2014

begin life working at such young ages? Currently there are few organizations or government agencies that have the power to make changes and provide resources so children will not have to enter the work force. In the past, the United Nations has provided some relief through various rescue missions and programs to end world hunger. But what is needed is an international task force, specifically designed to work with foreign governments and implement actual real changes to current laws that provide jail time for those hiring children under twelve. If the repercussions for violating child rights are strengthened, this will serve as deterrence to hiring children for jobs. Not only should the penalties for employing children be more severe and punitive, but the powers of government agencies must enforce these laws so that they become a reality. HMR

Features http://www.inserbia.info

the real intention of american aid Alex Karpf

t is pretty clear that the U.S. does not and should not prioritize human rights violations when establishing foreign policy. Consider Syria. The country’s civil war was ignited when peaceful protests initially requested political reform and then the resignation of President Bashar al-Assad. Syrian soldiers were deployed to end demonstrations and fire on dissenters. As conflicts between rebel groups and the government escalated, the Syrian government not only began to kill innocent civilians, but also used chemical weapons on its citizens, regardless of whether or not they were combatants. Even though more than 100,000 people have been killed, many of whom were innocent civilians, fighting still rages. No U.S. action has been taken in Syria to prevent citizens from being stripped of their right to free speech or to protect

them from violence, but sending troops into Syria would result in far too many casualties. America also isn’t certain if terrorist groups and extremists are supporting rebellion groups, vying for control of the war-torn nation. Just as importantly though, Syria’s conflict has not and almost certainly will not endanger the U.S,, as America is simply located too far away from Syria for it to be affected. Israel, the sole American ally that shares a border with Syria, has launched a bombing campaign of its own so that its borders are free of conflict. Civil war and human rights abuses also continue to devastate the Democratic Republic of Congo. Congo’s conflict is complicated, stemming from what has been dubbed “The Great War of Africa” fought between Congo and militias supported by Rwanda from 1997 to 2003. Human rights abuses in the DRC

The Horace Mann Review | Vol. XXIII

are not strictly one-sided. Rebel groups are known to rape, mutilate, and execute innocent civilians and recruit children into militias. The Congolese government, however, is just as bad. The UN has labeled Congo “the rape capital of the world,” and the country has significantly limited freedom of speech by persecuting opposition parties and political activists. Yet America is not going to stop it. Sending troops in to quell violence and stabilize the government would result in casualties and might not actually work, as demonstrated by both the failed American attempt to create a stable government in Iraq and the ineffectiveness of the thousands of UN peacekeepers currently present in the Congo. Pushing for sanctions on the Congo will sever America’s trade relationship with the Congo and hinder the African nation economically, encouraging even more violence.

Features www.foreignassistance.gov

U.S. Foreign Assistance in 2013 by Country These cases aren’t just isolated exceptions of risky situations. They are representatives of America’s attitude toward intervention in human rights abuses: it just isn’t worth it. But the country can’t just observe the suffering of civilians and accept these abuses. As a superpower, America has some duty to attempt to prevent these abuses and alleviate this suf-

and the welfare of their poverty-stricken citizens. But before taking such welfare for granted, it’s important to confirm that the heaps of money that America is pouring into foreign economies is actually being used to their benefit. Pakistan is the fourth largest recipient of U.S. aid and second largest in the Middle East after Israel, receiving

its nuclear arsenal under control, a top priority for U.S. security forces, while using Pakistan to help in negotiations with other nations. In short, Pakistan can act as America’s foothold in the Middle East. Pakistan’s weak tax base is in need of direct budget assistance, a method that allows donors, such as the United States, to inject aid directly into the budget of

“The country can’t just observe the suffering of civilians and accept these abuses. As a superpower, America has some duty to attempt to prevent these abuses and alleviate this suffereing. ” fering. And so the country sends aid. In 2011, the most recent year for which the U.S. has published its foreign assistance facts, America gave $49.6 billion in foreign aid, $31.9 billion in economic assistance and $17.9 billion in military assistance. These big numbers alone may seem to frame the United States as a truly benevolent and generous nation that cares about the prosperity of less developed countries

$1.7 billion in both economic and military assistance. Assisting Pakistan, from a diplomatic and political standpoint, makes a lot of sense. The nation borders regional and international powers like Afghanistan, where the U.S. is fighting a war, China, an important trade partner, Iran, an national security threat possibly developing a nuclear arsenal, and India, an important trade partner and ally. In addition, the U.S. can help Pakistan keep

February 2014

recipients. However, the nation is only in need of budgetary support because of its lacking tax base: of its population of 200 million people, only about 850,000 pay taxes. Much more importantly, only a third of the members of the Pakistani parliament, some of the wealthiest individuals in the country, pay income taxes. In other words, international aid, some of which is U.S. money, excuses the Pakistani government from enforcing tax

Features fraud, allows wealthy Pakistanis from having to pay taxes, and creates a culture of corruption. America doesn’t really even know where its money goes. The aid is not earmarked, other than that it is not to be allocated to the military. In other words, money is simply being dumped into Pakistan’s budget. It’s important to remember,

the General Assembly, the U.S. also increases aid to certain nations so that it will vote alongside it. Regardless of the human rights records of these nations, America increases aid in order to get its agenda passed in the United Nations and serve its own interests. It may sound harsh that the U.S. weighs its interests over the wellbeing

safety and wellbeing of others. The U.S. doesn’t care about human rights violations when reviewing its foreign policy, but its lack of interest is justified. American soldiers shouldn’t be put in danger to protect freedom of speech in the Congo, and crucial U.N. resolutions shouldn’t fail because the U.S. is more concerned about punishing another nation for its human

“American soldiers shouldn’t be put in danger to protect freedom of speech in the Congo, and crucial U.N. resolutions shouldn’t fail because the U.S. is more concerned about punishing another nation for its human rights abuses.” however, that Pakistan is the country that sheltered Osama bin Laden within one mile of its largest military academy. Pakistan is also a country that permits the murder of Shia Muslims, journalists, and activists, and still administers the death penalty for blasphemy. To put it differently, America, in prioritizing its own interests, is supporting a country which itself is allowing corruption and human rights abuses. Pakistan isn’t an exception or isolated situation, but rather another example of a consistent trend: America is giving aid to fund its own interests. In 2006, two Harvard graduates examining how U.S. aid to certain nations fluctuates as those members became temporary members of the UN Security Council, found that aid to these countries rises by 59%, on average, during the two year period when the nation enters the security council, and decreases back to its original value once the term ends. Another study shows that before important resolutions come up in

of others and that America is willing to look past human rights abuses. But such a policy is implemented to serve what is clearly the country’s priority: the safety and wellbeing of its own citizens over the

Pakistan’s Tax Policy

The Horace Mann Review | Vol. XXIII

rights abuses. Although U.S. foreign policy often looks the other way to egregious human rights abuses, its economic support is necessary and beneficial for the country. HMR

Features

Reforming Nothing China’s “Changes” to its Re-education System Daniel Jin

reflectionsbyken

February 2014

Features

n December, the world remembered renowned human rights activist Nelson Mandela, who won South Africans their freedom and equality. But to China, Mandela was someone else. President Xi Jinping praised Mandela, calling him “an accomplished politician of global standing,” and the state-owned CCTV called him “an old friend of China,” though there was no mention of his quest for political freedom. Instead, the government is covering up the basic right that the Chinese people lack: their freedom. In the past 30 years, China has enforced numerous reforms to bring great economic success to the people, but the government has dodged political reform. China’s Communist Party imposes strict censorship and draconian detention systems to quell any threat to its rule. Today, China’s authoritarian regime remains one of the world’s worst offenders of human rights. In November, President Xi announced a plan for reform at the Communist Party’s Third Plenum meeting. Among other ideas, the government would abolish the notorious Re-education Through Labor (RTL) system and increase the role of the market in the economy. At first glance, China’s upcoming reforms seem to be important steps to human rights and political freedom in the country. Reuters called the reforms the “boldest…in decades” and The Economist compared them to Deng Xiaoping’s reforms in 1978. However, the impact of these reforms has been far overblown – the Chinese economy is already essentially capitalist and many doubt that the abolition of re-education through labor camps is truly significant. Though the growing internal and external pressure for change is clearly influencing China, full human rights and political freedom is far from a reality, and the recent reforms are just a cover for the government’s unwillingness to change. For over 60 years, the government used RTL to detain people without trial, mainly those who were seen as threats to the Communist party, but did not commit any offense punishable by the law. Very quickly, labor camps became crowded with political activists, revolutionaries, and practically all people who refused to the will of centralized control. Hundreds of thousands of Chinese were imprisoned merely for exercising their basic civil and political rights. The conditions of labor camps, too, were oppressive. “If you don’t admit guilt or wrongdoing you get physical punishment, abuse and beatings,” says former labor camp detainee Liu Hua. “You’ll experience

unbearable suffering.” In response to protests from both inside the country and human rights organizations around the world, President Xi announced on November 15, 2013, that the RTL was to be abolished. However, the RTL’s abolition may just mean a simple name change to the system; recently, there has been a suspicious increase in other forms of detention. Old RTL camps have been turned into “drug rehabilitation centers,” where many former RTL detainees have been transferred. According to Human Rights Watch, inhabitants of China’s drug rehabilitation centers do not receive treatment, are often physically abused, and work up to 18 hours a day without being paid. Under China’s current laws, anyone who is caught using an illegal drug is automatically an “addict” and is eligible to be detained in drug rehabilitation centers. Additionally, Amnesty International finds that China has escalated the use of “brainwashing centers,” in which detainees are tortured into renouncing their beliefs. A growing number of prisoners are held at “black jails,” another system that functions similarly to RTL but under a different name. China’s new forms of detention are not only replacing RTL camps, but former RTL detainees who have exceeded the four-year limit in labor camps are being sent back. Essentially, China has changed the names of its labor camps and masqueraded this as “reform.” “This is how the country operates,” says Beijing lawyer Jiang Tianyong. “They can’t use re-education through labor camps to control people, so they just change the name and control people.” China has demonstrated little in-

The Horace Mann Review | Vol. XXIII

Inmates laboring at an RTL camp

northnews.cn

terest in enforcing serious and meaningful reforms to its detention systems and continues to enslave its own people for exercising freedom of speech, religion, and expression, though all these liberties are allowed by the nation’s constitution. China has been able to conceal lies like its “abolition” of RTL by censoring news and the Internet. The Great Firewall of China prevents users from viewing foreign periodicals and domestic content containing banned terms, such as “democracy.” This way, by limiting free speech, the government prevents individuals from obtaining information that could potentially threaten its power. Thus, China is able to slow the progress of democratic movements by taking away awareness of the freedom people enjoy in other countries. When one generation’s democratic leaders are jailed, the next generation has no knowledge of the past and must start again from scratch. So far, censorship has been the vital tool that has kept the democratic movement in check; the man often considered to be the “Chinese Mandela,” political activist Liu Xiaobo, is still in prison today despite winning the 2010 Nobel Peace Prize, and many young Chinese are not even aware of his work and the 1989 Tiananmen Square demonstrations. News censorship also prevented the details of Mandela’s fight for democracy in South Africa from reaching the Chinese public. In addition, China uses its stateowned newspapers to defend itself from foreign criticism. The China based Global Times attacked an unnamed Western country for referring to Liu as “China’s Mandela.”

Features The newspaper added that Liu was merely a criminal, and no exception would be made to free him. China’s use of corrupt detention systems and censorship shows that the Communist Party has no intentions of addressing political reform anytime soon, though democracy may be in the nation’s long-term future. The government’s first response to criticism is to mute it, rather than to respond with systematic reform. The result is an autocracy that neglects its people’s needs. China’s government boasts of its rapid economic growth in an effort to quiet the people’s desire for political reform. However, China’s economic rise had a greater effect on the rich than on the poor, and it was accompanied by a widened income gap. As the income gap becomes a bigger issue, the lower and middle classes will no longer accept this argument. China’s Gini coefficient, a measure of wealth inequality, is among the world’s worst. On a scale of 0 to 1, where 0 is when wealth is distributed evenly among all people and 1 is when one person holds all the wealth, China’s Gini coefficient is 0.48, up from 0.3 in the 1970s and 1980s. Still, Chinese economist Wang Xiaolu suspects that this figure is actually greater China’s upper classes are able to hide more than $2 trillion of gray income each year by bribing corrupt tax collectors. While millions of the poor are forced to work under terrible conditions in Chinese factories, some of the wealthy do not even pay taxes. In Chinese society, nearly all opportunities go to the rich, and little opportunity exists

for social mobility. Thus, China’s economic gains have had an overstated impact on the poor. Moreover, it is inherently wrong for China to believe that its economic growth allows it to take away people’s freedom. This belief, known as performance legitimacy, has been disproved in recent years; Brazil, Chile, Greece, South Korea, and Spain have all undergone successful democratization despite being economically success-

one.

Though the Chinese government has remained adamant in its stance to oppose political reform of any kind, there have been recent signs that its grip on power may be weakening. New ways to bypass China’s firewall are constantly being discovered, and maintenance of the firewall costs the government money. Micro-blogging sites such as “Weibo” allow the opportunity for

“China’s government boasts of its rapid economic growth in an effort to quiet the people’s desire for political reform.” ful. Though China’s autocracy has survived over 60 years, domestic problems such as corruption and a wide income disparity are causing increasing resentment among the public. At some point, resistance may reach the point that it may become too much for the government to bury. China has built its empire by covering up inconvenient truths with lies, an unstable system that will collapse if the truth is leaked. President Xi did announce plans to control corruption at the Third Plenum, but the easiest solution is a transition to democracy. When people are free to voice their opinions and able to vote for the leaders they want, power will no longer go unchecked as it is now with the Communist Party. However, as the Communist Party remains unwilling to cede any of its power, the road to democracy will be a long

thedailybeast.com

February 2014

people to freely discuss normally censored topics. Often bloggers use homonyms and code words, tricking the firewall. Recently, mirrored versions of foreign websites were found to be able to bypass the firewall, allowing users to access sites where they can find important censored material, such as Wikipedia and several online newspapers. China may be able to fix the firewall, but it is always one step behind. Information is gradually becoming more available. Moreover, some newspapers are starting to stand up against censorship. Most notably, in January 2013, the staff of Southern Weekly led protests outside of the newspaper’s headquarters after a pro-democracy editorial was censored. According to a study conducted by Wang Zhengxu of Nottingham University, anti-government sentiments are more common in younger Chinese generations. Despite the government’s obstacles, China’s democracy movement is making progress. China has once again shied away from political reform and has only pretended to abolish RTL. It continues to punish those who speak out and cover up truths with censorship. Many Chinese like Liu Xiaobohave fought for freedom only to be locked up and abused. Each day, China lives in fear of rebellion, of the truth. The fact that China even bothered to “abolish” RTL shows that it is feeling the pressure for change. However, as long as China disregards political reform, its problems worsen and its opposition grows. Slowly, China is inching towards democracy. A government that neglects its people cannot last. China’s communist elite can continue abusing the rest of the nation if it so chooses. But with 85 million oppressors against 1.3 billion oppressed – the odds are not in their favor. HMR

Features

FIGHTING POVERTY AND RIGHTS ABUSES IN AFRICA W

hen the United Nations and developed countries are faced with pressing issues such as poverty, child mortality, widespread disease, low rates of primary school enrollment, and gender inequality in developing countries, foreign aid aimed at long-term development seems like the most logical and effective solution. The positive effects of such aid, referred to as development aid, are indisputable. Development aid has prompted economic growth in several countries such as Bangladesh and India, and aid that helps build infrastructure (roads, irrigation systems, electricity generators, etc.), as well as aid intended to develop agriculture, industry, and trade, has been shown to positively affect growth rates relatively quickly. However, considering the billions of

dollars poured into foreign aid and the rate of improvement in recipient nations, it is difficult not to question the effectiveness of development aid and its ability to efficiently solve the issues at hand. Several African nations lie on top of large crude oil reserves, sources of natural gas, and deposits of minerals, giving Africa a significant economic and political advantage. However, despite the abundance of natural resources in Africa, the reality is that African nations make up 36 of the 48 countries on the UN’s list of the Least Developed Countries. Additionally, of the 900 million people who live in sub-Saharan Africa, over 40% live in absolute poverty. So why is a continent that is so rich in natural resources also the poorest and most underdeveloped? The answer lies in widespread dis-

The Horace Mann Review | Vol. XXIII

THE DAMAGING EFFECTS OF FOREIGN AID DAYLE CHUNG ease (such as malaria and HIV/AIDS), high levels of illiteracy, civil unrest, and corrupt government leaders. While foreign aid is expected to help ameliorate these issues and eventually eliminate them entirely, the billions of dollars that are given each year to Africa (the world’s largest receiver of foreign aid at $51 billion in 2011) are going straight from donors to corrupt governments, strengthening autocratic leaders. As the amount of donated money increases each year and the problems fail to be resolved, African nations only become more and more dependent on foreign aid. For example, the Democratic Republic of the Congo is Africa’s largest recipient of foreign aid and received $5.5 billion in 2011 alone. Despite development aid, extreme poverty and hunger remain endemic across

Features the nation. According to the African Development Bank, “72% of rural households and 59% of urban households are poor, nearly 40% of children under age five suffer from chronic malnutrition, and most of the population live under conditions of moderate to serious food insecurity.” Because of these extreme developmental issues, the DRC is not expected to reach the Millennium Developmental Goals on time, a set of eight goals ranging from poverty to primary education. Foreign aid not only seems to be ineffective, but even destructive towards development of countries such as the Democratic Republic of Congo. David Karanja, a former Kenyan member of parliament, explains that “foreign aid has done more harm to Africa than we care to admit. It has led to a situation where Africa has failed to set its own pace and direction of development free of external interference. Today, Africa’s development plans are drawn thousands of miles away in the corridors of the IMF and World Bank. What is sad is that the IMF and World Bank experts who draw these development plans are people completely out of touch with the local African reality.” Karanja highlights one of the most important issues of foreign aid: although development aid can have positive effects on its recipients, it also creates dependence, a factor that can often outweigh the value of the aid itself. The budgets of Ghana and Uganda are more than 50% dependent on foreign aid. As the amount of aid given to developing countries increases, these nations become more and more reliant on contributions from the UN and developed countries. As a result, development is halted, as countries focus on acquiring foreign aid instead of becoming self-sufficient. Corruption also accounts for much of the ineffectiveness of aid. In Ethiopia, for example, the government is abusing development aid and using aid funds in order to strengthen its autocracy. In this case, aid is not only unhelpful, but is actually hurting the development and wellbeing of the nation’s people. According to the Human Rights Watch, farmers are being denied seeds and fertilizer (which are supposed to be government-provided), and in the most extreme cases, women, children, and the elderly are being denied emergency food aid. The people who are denied aid are often those who refuse to join the ruling party, and instead support the opposition. As a result, the development aid that is given to Ethiopia ($3.3 billion in 2008) is working mostly to increase and perpetuate the power and control of the government and finance government funded human rights abuses. Another example of how misplaced aid

and corruption are hurting African nations is Nigeria. Nigeria has established a flourishing space program, with four satellites launched in recent years. While the nation has enough money to spend on their space program, it is still considered a developing country because of the large portion of the population that lives in extreme poverty. Additionally, it sits on large crude oil reserves containing an estimated 35 billion barrels and is in possession of 100 trillion cubic feet of natural gas reserves. However, 80% of oil revenues go to the government, where legislators are paid handsomely, earning a base wage of $167,000. The wealth goes straight into the pockets of high-ranking government officials, and the effects on the rest of Nigeria’s population are devastating: 70% lives below the poverty line of $2 a day, the infrastructure is failing, and the country is experiencing widespread fuel shortages. Despite its wealth in resources, Nigeria has received $400 billion in foreign aid since gaining independence in 1960 and is still in need of much today. Over the last decade, natural resources are at the root of many conflicts in African countries. The revenues from these resources are often exploited for personal wealth, to establish political support, or to build and sustain armies, which often leads to armed conflicts between different groups. In nations where there is peace, the profits from natural resources often go to a small group of government officials and wealthy elite who use the money for personal benefit instead of for the broader development of their country. When these nations continue to receive development aid, the aid also fails to

February 2014

go towards developing the country and instead ends up in the hands of the same elite. The country’s development is then halted, and the nation’s government is unwilling to put any effort towards actual development, as the elite are unwilling to sacrifice their personal fortunes and too much development would threaten aid flows from developed nations. In conclusion, while foreign aid does have some positive impacts on economic growth, progress is gradual and insufficient to ensure that the Millennium Developmental Goals will be reached by 2015. Billions of dollars are handed straight to corrupt governments instead of to the people who are the deserving recipients of aid, rendering donations virtually useless. Donor countries should acknowledge the corruption and make steps to prevent it, instead of just donating larger amounts of money each year in an effort to throw money at the problem. Instead of injecting development directly into the federal budgets of the recipient nations (also known as “direct budget support”), aid should be distributed via small organizations whose express goal is development. This way, the billions of dollars would be donated straight to the cause instead of to corrupt governments who use the money for personal gain. In addition, countries should try to become less dependent on foreign assistance and focus on the benefits from large mineral, oil, and gas reserves that are plentiful in Africa. Large and unexploited deposits of minerals could be catalysts for economic development, stimulating the African economy as soon as they are properly harnessed. HMR.

Features

Nelson Mandela An Unrivaled Legacy Natasha Moolji

efore he was prisoner 46664 on Robben Island, and before his first trial in 1961, Nelson Mandela was virtually unheard of outside South Africa. However, from ‘61 onwards, Mandela stood as an idol to many around the world. He was a man with messiah-like qualities. In 95 years, Mandela had a resounding impact on South Africa’s economy, government, worldwide racial equality, and human rights. His legacy is filled with beautiful accomplishments, as well as blatant contradictions, but he will forever be remembered as one of the greatest leaders of the 20th century. Mandela was born on July 18, 1918 in the village of Mvezo. His given name was Rolihlahla. When he attended primary school, his teacher gave him the name Nelson because it was customary for all students to get Christian names. He continued his education at Healdtown, a renowned secondary school, and proceeded to attend university. While pursuing a Bachelor of Arts degree at the University College of Fort Hare, Mandela was suspended from school because he took part in a student protest against the quality of food. This was one of the first instances he showed an interest in standing up for his rights. In the late 1930s, Mr. Mandela had friends in the African National Congress (ANC) and in the anti-imperialist movement, but was not affiliated with either. In fact, he continued to support Britain during the outbreak of World War II. It was not until 1940 that Mandela began his political career. After being suspended, Mandela returned to the village of Mqhekezweni, where his guardian, Chief Jongintaba, resided. Upon returning home, Mandela discovered that his guardian had arranged a marriage for him. In response, he fled to Johannesburg in April 1941. He held a job as a clerk at a law firm and attended ANC meetings with the people at his workplace. His political views started to take shape. He strongly believed that South Africa’s

problems were a result of racial divide rather than economic policies. In 1943 he befriended Anton Lembede, an African nationalist. Through his interaction with Lembede, he was convinced that black Africans should be independent from any outside influence while they attempted to achieve equality. Lembede and Mandela also founded the African National Congress Youth League. This was a precursor to his involvement with the ANC. When the National Party came into power in 1948 and implemented apartheid legislation, Mandela and his supporters advocated for direct action against the racism. They encouraged boycotts, strikes, and other forms of nonviolent resistance. Mandela had continuously been gaining influence in the ANCYL and was elected national president in 1950. He continued to advocate that blacks should not unite with any other groups (especially whites or Indians) to fight the apartheid. However, when friends and advisors informed him that this was not a popular policy, he switched his view and decided that African, Indian, and communist activists should all work together in an anti-apartheid movement. This was one of the first instances in which Mandela altered his personal, more radical beliefs in order to appeal to a wider base of the general public. By 1952, Mandela had been elected as the regional president of the Transvaal ANC. He helped organize the Defiance Campaign, which united thousands in protests. He participated in many of these protests and witnessed firsthand the brutality of the white police. A few months after being elected, Mandela was arrested for supporting communism, which was illegal under the Suppression of Communism Act. As a result of his arrest, Mandela was banned from attending ANC meetings for six months. He was for-

The Horace Mann Review | Vol. XXIII

“E po yo the

good

tion.

the over doe

que

lea

Education is the most the world.” “A good head an good heart are always a formidable com owerful weapon which tion. “I learned that courage wa of fear, but the tri ou the canabsence use to change over it. The brave man is not h e world. ” “A good head and a does not feel afraid, but he wh Features

d heart are always a formidable combina-

was not “It is bett absence of fear, but the triumph lead from behind an r it. The brave man is not he who es not feel afraid, but he who con put others in front,

. “I quers learned that courage that fear.”

ers that fear.” “Itwhen is better pecially youto c

adbrate from victory behind when and ton February 2014

Features

was not the absence of fear, not feel afraid, but he who conque man is not he who does not

hind and to put others that fear.” “You take th bidden from meeting with more than one person at a time. The government looked to decrease the number of protests and instances of civil disobedience. Because Mandela headed many of the marches, he was targeted. Without his help, the Defiance Campaign fell through. Protests and resistance continued on a smaller scale and the government continued to respond aggressively. The authorities conducted mass arrests and legalized martial law. Blacks dealt often with police brutality. At this point, Mandela stopped denouncing violence. He saw no alternative to armed resistance and led a violent insurgency. Again, Mandela changed his fundamental beliefs in order to appeal to the aggravated blacks that had seen friends, family members, and fellow protestors suffer at the hands of the police. He focused solely on gaining the support of South Africans for the anti-apartheid movement and disregarded foreign opinions. Margaret Thatcher’s dismissal of the ANC as another terrorist group had little impact on Mandela’s view. While Mr. Mandela continued to fight against a racially divided South Africa, his work was hindered by arrests and trials. In 1956, Mandela was arrested for high treason against the state and for inciting worker rebellions. The trial did not end until 1961, when he was acquitted of charges of high treason. Less than a year later, in a rever-

sal of fortunes, Mandela began what would become a 27 yearlong imprisonment. One of the conditions of his acquittal was that he was not allowed to leave South Africa without notifying the government. Despite this, Mandela traveled to Morocco, Mali, Guinea, Sierra Leone, Liberia, Senegal, England, and Ethiopia to raise funds and support for the anti-apartheid movement. In Morocco he studied guerilla warfare to help the ANC’s armed sector. As a result of his travels, Mandela was charged with leaving the country without permission. At his trial, Mandela represented himself. He used this as an opportunity to draw attention to the injustice of the apartheid government and to highlight the ANC’s fundamental opposition to racism. Because he was found guilty of these initial charges, he was sentenced to 5 years in prison. He remained in Pretoria until 1964, when the police discovered evidence of further plans to overthrow the government in the home of one of Mandela’s colleagues. He and several others were convicted of sabotage and conspiracy to violently overthrow the government. Their punishment was life imprisonment. While imprisoned on Robben Island, Mandela proved his compassion and tolerance once again. In the mid-1970s, members of the Black Consciousness Movement (BCM) started arriving in the prison. Out-

The Horace Mann Review | Vol. XXIII

side prison walls, there were disputes between members of the ANC and members of the BCM because of their conflicting ideals. Despite these outside conflicts, Mandela treated his fellow prisoners kindly and tolerantly. Even his imprisonment could not hinder Mandela’s compassion and did not change the fact that he was an incredible man. Mandela was finally released from prison on February 11, 1990, after the unbanning of the ANC and PAC. During his incarceration, he had denied three conditional releases from prison. He used his time in jail to show the world the unjust rule of the National Party and the tragedy of the apartheid. Even when ailing with tuberculosis, he remained in prison. Mandela was strong, brave, and devoted to achieving racial equality in South Africa. He allowed neither his poor health nor the promise of his own freedom to stand in the way of achieving his ultimate goal. Once released from prison, Mandela committed to reconciling with the white minority. In spite of this, he initially did not call off the armed resistance. He would only disperse the ANC’s armed unit when the violence of the apartheid had subsided. One of his main goals was to get blacks the right to vote in all South African elections. Renowned leaders around the world, such

Features

,ers butthat thefear. triumph over it. The bra ” “It is better t feel afraid, but he who conquer

s in front, especialhe front line when the as Pope John Paul II, Margaret Thatcher, and George H.W. Bush, received Mandela. He also met his long-time idol: Fidel Castro. Upon returning from his tour, he entered into negotiations with a delegation of members from the South African government. His actions were seen as a major reason the apartheid ended. Mandela was recognized in 1993 when he won the Nobel Peace Prize. In 1994, Mandela voted for the first time in his life and he became South Africa’s first democratically elected president. Mandela’s presidency was a success. He handled difficult and treacherous situations with ease and finesse. When ANC supporters denounced South Africa’s constitution, Mandela was able to garner enough support for it to be implemented. No other statesman was as convincing as he was. But Mandela was also forced to deal with the pre-existing racial prejudices in South Africa. When a white man murdered an ANC member, Chris Hani, the black community was outraged. Still, Mandela was able to mitigate the anger by emphasizing the role of certain Afrikaners in ensuring that justice was served. Few

politicians have ever been so successful at handling racism and unwarranted anger. No other leader would have been able to handle a recently liberated but highly fractious South Africa the way Nelson Mandela was able to. After one term, he stepped down. The three presidents that followed Mandela have failed to live up to his standards. When Mandela left office, South Africa’s economy was flourishing and its GDP was higher than the majority of other African nations. Under Thabo Mbeki, Kgalema Motlanthe, and Jacob Zuma, GDP growth has stagnated. In a country rich with natural resources and potential, around 24% of the population remains unemployed. No South African president has been as successful as Mandela was. Even though his presidency set a high bar for those to follow, Mandela still had his flaws. He had spent his entire life as an advocate for human rights, but in certain instances he pushed his morals aside. He ignored Chinese human rights activists’ pleas for support because China had given him financial and moral support from the commencement of the anti-apartheid

February 2014

movement. Mandela even refused to work against Libyan dictator Muammar Qaddafi because he had helped the ANC’s cause. Since he was a good friend to Fidel Castro, Mandela overlooked Castro’s forced labor camps and abuse of prisoners. Outside of politics, when Mandela was continually asked to support the HIV/AIDS cause and to help raise awareness about it, he was reluctant to get involved. He was reluctant to help sufferers of the disease get equal treatment and get medical assistance. In the end, Mandela was not perfect. As was proven by his refusal to act in certain instances, Mandela had his own prejudices. But these occasions only proved that Mandela was human. He was not the holy man with messianic attributes that many portrayed him to be. Instead, he was a courageous man who refused to give up on his pursuit for equality. His achievements during his lifetime far outweigh the few instances when he compromised his beliefs. Mandela inspired many during his lifetime and his legacy will continue to inspire others for years to come. He will be remembered as one of the most brilliant global leaders we have ever had. HMR

Economics

Food Stamp Crunch

www.morecontentnow.com

Jacob Chae

ood stamps have become a severe and serious issue in our country. Food Stamps are known today as the Supplemental Nutrition Assistance Program (SNAP), and it is a federal aided program administrated by the United States Department of Agriculture (USDA). SNAP is known for providing food-purchasing assistance to low or no income families living in the United States. However, on November 1, 2013, the United States government put an end to the 2009 Recovery Actâ&#x20AC;&#x2122;s temporary boost to SNAP. According to the Center on Budget and Policy Priorities, this event may later become a huge detriment to people who barely meet the poverty line. Brad Plumer from the Washington

Post reports that SNAP took a $5 billion cut which will greatly affect the 47 million people who use food stamps. Additionally, the 2014 Farm Bill has proposed that more than $20 billion in cuts be made towards SNAP. Although approximately 14% of American households are provided with food aid, this deficit is already coming down hard on millions of people. In 2014, an estimated 22 million children will be SNAP clients, in addition to 9 million people who are elderly or have serious disabilities. According to the Thrifty Food Plan from the USDA, this cut will be equivalent to taking away 21 meals per month for a family of four. This is extremely significant because it implies that if no other beneficial action takes place,

The Horace Mann Review | Vol. XXIII

families of four will lose about 252 meals a year! Just imagine if you missed lunch for just one day. How hungry would you get? For me, missing one meal is terrible, and it leads to doubling up on food for the next meal. However, for people being funded under SNAP, every three days, at least two meals are missed. It is important to note that the majority of SNAP participants do not choose to be part of the program, but rather are put into it. As poverty rates increase, so does the need of food stamps. However, very recently the usage of these food stamps has been questioned. According to The Washington Post, large portions of food stamps are being used for unhealthy products, such as soft drinks and

Economics

“In 2014, an estimated 22 million children will be SNAP clients, in addition to 9 million people who are elderly or have serious disabilities. According to the Thrifty Food Plan from the USDA, this cut will be equivalent to taking away 21 meals per month for a family of four.” candy. If financial aid is being provided, soft drinks and candy should not be an option. It clearly just defeats the whole purpose of providing people in need the right nutrients to live a strong and healthy life. Also, since 2000, poverty rates have started to decrease due to government programs such as food stamps and unemployment insurance. However, this is most likely going to take a turn in 2014. According to The Washington Post, the American population today would have a higher poverty rate than during the economic downfall in the 1960s if it were not for government funding. Nonetheless, as the food stamps program is taking a huge hit going into 2014, we are expecting to see an increase in the poverty rate. Congress has hinted at providing some beneficial help towards SNAP following the budget cut, but the GOP has quickly dispelled those rumors. Republican congressmen are urging for cuts to SNAP to be made not just once, but continuously during the coming years at a rate of $4 billion a year! The consequence of this will create a bigger gap between the rich and the poor of America. However, there is still a little bit of hope. While the Republican Party is urging for rapid and dramatic cuts to SNAP, the Democratic Party is still holding in. Led by Congressman Joseph Crowley and Congresswoman Barbara Lee, there have been some campaigns to promote SNAP. Food stamps are crucial to the lives of many poor and unfortunate people. They can make the difference between putting food on the table and a child going to bed hungry. Through a survey conducted by USA Today, one in four children go to bed hungry. This data is not just recorded in the United States, as the statistics get worse as we travel around the world. Hunger is a bigger issue in places such as China and Africa. Statistics have

shown that hunger and starvation are one of world’s top causes of death. As we can see from an analysis provided by the non-profit organization Action Against Hunger, the number of deaths from starvation is in a similar ballpark as the number of deaths from heart disease and cancer. Starvation causes the deaths of about 3.5 million children each year and threatens the lives of 19 million children worldwide. Also, starvation leads to other diseases too because if a person does not obtain the right and proper nutrients and vitamins, their body will simply falter. As companies such as the Center for Food Action and Tables to Tables tell us, the

problem of starvation and the need of food are greater than we think it is. We take so many things for granted. Do you remember what you had for dinner two nights ago? I guarantee you probably do not. Well for these people in need, of whom some are homeless, each and every meal is valued like it is their last. They do not know the next time when they will be able to eat, and food is not always waiting for them at the kitchen counter. It is extremely important to note the struggles and tough situations people around us have. As people are dying every single day from starvation, it is right to take a stance and support food stamps for the benefit of the general welfare of our country. HMR

www.occupy.com

February 2014

Economics

Raising the Minimum Wage Minimum Wage

Cost of Living

en.wikipedia.org

A Benefit to Our Workers and Economy Krystian Loetscher 42

The Horace Mann Review | Vol. XXIII

Economics

s our fragile economy continues to climb upwards, it is important to ensure that this steady growth presses on. With the Federal Reserve Board recently announcing that it will pull back on its stimulus campaign, it is now generally accepted that the economy is on the right path. According to Bloomberg.com, “An improving U.S. economy is underpinning inflation, limiting firings and lifting consumers’ moods, brightening the outlook for growth at the start of 2014.” From immigration laws to minimum wage, many factors can play a larger role in determining the fate of the economy than one might think. Minimum wage is a recent issue that has been the subject of debate between economists and legislators alike. The Obama administration has suggested a raise in the current federal minimum wage from $7.25 to $9. This new proposal has caused much controversy, considering that many people do not want to spoil the positive signs that our economy has shown. Although this is a large step, and the results are not entirely known, it is important that the minimum wage be raised. If what some economists think can be accomplished as a result of raising the minimum wage, the benefits will surely outweigh the harms. The present rate of $7.25 an hour is an extremely low figure, in fact, the lowest it has been since the 1960’s. Inflation is a factor that has to be taken into consideration, for as time goes on, the consumer price index (CPI), or the cost of living, can fluctuate. This can cause the minimum wage to be ineffective if it does not automatically adjust to the current value of the dollar, as the value of the minimum wage in 1980 might not have the same value in 2020. This is why it is necessary to raise the minimum wage at least to what it otherwise would have been if it had been adjusted for inflation. The Obama administration has also pushed for a policy to go along with the minimum wage raise, one that states that the minimum wage should be adjusted to inflation so that its value does not get lost over time. This federal price floor, or market distortion, is meant to address issues of income inequality. “Even with the tax relief we’ve put in place, a family with two kids that earns the minimum wage still lives below the poverty line. That’s wrong,” President Obama said in his State of the Union Address. Income

gulzar05.blogspot.com

“Income inequality is an issue that has not been entirely dealt with, and this new proposal is a large step in erasing that gap.” inequality is an issue that has not been entirely dealt with, and this new proposal is a big step in erasing that unacceptably large gap. As for its beneficial effects on the economy, minimum wage can definitely change many aspects of our lives, from consumerism to rewarding those who deserve a higher pay-grade. For those who are currently working at minimum wage, not only are they not content with the living conditions that come with such a low pay, they are also less willing to spend their money. With an increase in the amount they earn at work, the more willing they are to spend their money. This of course is what we all want; it is important that everyone contributes to the economy. A person then might ask, “Why should I care whether or not others are buying or selling anything?” The answer would be that the economy is made up of us; we are the economy, and we ultimately decide its fate. If those who receive minimum wage spend more money, this increases consumerism as a whole, meaning an increase in buying and selling interactions nationwide. Buying and selling is what fuels the economy; more interactions mean a healthier

February 2014

working economy. A hike in minimum wage is an excellent way to target the issue of income inequality and stimulate the economy without even raising state and/or federal budget deficits. This is probably the closest anyone has seen to a win-win; it pleases those who believe in raising the wage that workers receive while affecting neither the federal deficit nor the debt the federal government is currently in. According to Hale Stewart, a writer for The New York Times, as well as many other economists, consumer spending drives 70% of the economy, increasing the ease at which someone can attain, borrow and use capital (mainly cash). It also increases liquidity, which is a side benefit that more or less comes with the fact that people are buying and selling more, increasing the “liquidity” of money, which of course is a good thing. Liquidity is more or less how easily capital, or cash can flow: if money is easier to obtain, than the liquidity of money is higher. Research has shown how a higher minimum wage has raised many families out of poverty, creating an estimated 160,000 jobs, according to The Washington Post. Additioanlly, the White House

Economics

“If empirical research has yielded information that clearly states that there are no significant changes in employment, then this action is justified in targeting income inequality. A raise in the minimum wage will simply increase the earnings of hard-working Americans.” has claimed that there were “no detectable employment losses from the kind of minimum wage increases we have seen in the United States.” This derives from years of research and experiments on the economies of several states. It has been shown that even in states that have raised their minimum wage, there has been no significant decrease in employment. Many experts believed that if there was a rise in minimum wage, employers would be severely discouraged in hiring these now more expensive workers. Michael Saltsman of the Employment Policies Institute in Washington recently wrote how he believes “raising minimum wage won’t lower poverty.” Many other economists also argue that since an increase in the minimum wage will raise the cost of labor for businesses, employers will hire fewer workers and thus add to the pile of people still unemployed from the recession. It is a widely taught part in economics that any price floor, ceiling, quota or alteration would most likely “distort” the market. But this is not the case here. Paul Krugman, one of the most celebrated economists of his time, said in his article that “while there are dissenters, as there always are, the great preponderance of the evidence from these natural experiments points to little if any negative effect of minimum wage increases on employment.” He continues to explain,“workers aren’t bushels of wheat or even Manhattan apartments; they are human beings, and the human relationships involved in hiring and firing are inevitably more complex than markets for mere commodities. And one byproduct of this human complexity seems to be that modest increases in wages for the least-paid do not necessarily reduce the number of jobs.” Human interactions certainly expand beyond simple graphs and charts. They cannot be boiled down to an exact science, as there are many unpredictable factors that play in. If empirical research has yielded information that clearly states

that there are no significant changes in employment, then this action is justified in targeting income inequality. A raise in the minimum wage will simply increase the earnings of hard-working Americans and reward them for contributing to society, which of course is what is trying to be accomplished. In the last minimum wage increase in 1996, the decade following had one of the most prolific increases in job growth ever. One of the major studies made observing this time period, in fact probably the most referred to study on this debate, was made by economists at the University of Massachusetts, University of North Carolina, and University of California, who found that a raise in the minimum wage did not in fact cost jobs. Another argument that seems to arise is that businesses would leave a state if the minimum wage werehigher. This is simply not true, for most businesses are tied to their state. They are bound by their customers who are in that state and cannot afford the luxury of leaving and starting somewhere else.

The Horace Mann Review | Vol. XXIII

Employers can in fact benefit from an increase in minimum wage, research shows. A higher wage to the lowest paid workers means that there is a smaller turnover rate and an increase in productivity. It can be looked at from the perspective that the increases in productivity compensates for the small number of workers that may or may not have been let go due to the increase in wage. A study at the San Francisco Airport showed that when they increased the wage from $6.45 to $10 an hour, the turnover rate plunged from 95 to 19 percent. This means more experienced workers who provide better services. Through research and empirical knowledge, many economists and political leaders alike have realized the benefits of increasing the minimum wage. It boosts worker productivity and addresses income inequality, an issue that has not been properly dealt with since tax credits, without increasing either the federal or state budget. It is evident from all angles how this new proposal is justified. HMR

www.thenation.com

Economics

The Watch Market VAED PRASAD

ust like the mp3 player in 2001, the smart phone in 2007, and the tablet in 2012, the smart watch of 2014 will be the next big product featuring advanced portable technology. Smart watches are computerized wristwatches that have features extending far beyond simple timekeeping. These watches fulfill an unseen demand of the young adult marketplace. At the advent of the smartphone, many were skeptical of the use and feasibility of a phone that performs a wider range of functions than just calling. So now are the skeptics questioning the utility of these innovative watches. However, despite the concerns of the shrinking group of people who doubt the smart watch’s usefulness, this industry is the future of the technological marketplace due to its enormous upside potential for convenience and function. Business Insider predicts that 20 million smart watches will be sold in 2014. Already, many of the best tech-companies have identified the demand for and growth of the product. As of July 5, 2013, Acer, Apple, BlackBerry, Foxconn/Hon Hai, Google, LG, Microsoft, Qualcomm, Samsung, Sony, and Toshiba have all started development programs, and many of these reputable tech

corporations have already brought a smart watch product to market. With so many big names in the industry expressing an interest in product development, the smart watch is sure to become a thriving sector of the personal electronics market. As of September 4, 2013, three new and popular smart watches have been launched: the Samsung Galaxy Gear, Sony SmartWatch 2, and the Qualcomm Toq. Although sales figures for the initial release of these watches have been slightly below expectations, the demand will definitely increase as technological advancements permit cheaper and more pragmatic models. Apple plans to launch its iWatch this year and industry experts anticipate this will further the move toward cheaper and more accessible smart watches. This scenario seems eerily similar to the market climate a few years ago when subpar sales plagued initially marketed tablets until Apple released the stylish and efficient iPad that blew sales figures out of the water. Expectations are already high, as Apple has filed over 79 patents related to its individual smart watch technology. According to The Financial Times, the company is hiring

well-known engineers “aggressively” and has completed numerous “acqui-hires” to produce what is sure to be a cutting-edge watch. In a few years, telling time will be but a minor feature of watches, just as calling comprises only a small portion of the functionality of the modern smart phone. These watches can have dozens of features, and the ones that have hit the market are already making a difference in people’s lives. For example, the Fitbit and Jawbone provide health information by measuring activity and food intake as well as the length and quality of one’s sleep. These application opportunities are just the tip of the iceberg for additional smart watch content. Smart watches will soon be a titan in the mobile technology market. The outlook of the industry’s sales can only improve as further technological advancements, coupled with the sheer number of development programs, will propel the smart watch into the hands of the American consumer. With so much demand and potential, the question is not whether or not the smart watch will be the next smart phone, but what new innovative features it will have once it gets there. HMR

“Despite the concerns of the shrinking group of people who doubt the smart watch’s usefulness, this industry is the future of the technological marketplace due to its enormous upside potential for convenience and function.” February 2014

Economics

T N E M E E R G A THE BUDGET

epublicans and Democrats of the House and Senate had a deadline of January 15, 2014 to reach a new budget agreement. A failure to do so would have resulted in the second government shutdown in four months. Because of the fear of a second government shutdown, Republicans and Democrats, led by Paul Ryan (R-Wis) and Patty Murray (D-Wash), drafted the Bipartisan Budget Act of 2013. The budget passed through the House (332-94) on December 12, 2013 and the Senate (64-36) on December 18. Eight days later, President Obama signed the budget, allowing it to become official. However, this deal did

not address many pressing issues facing the government daily. The head of global strategy of the wealth management firm, Envestnet, stated that “they essentially said ‘we are really not able to make bigger decisions about Medicare or Medicaid or about taxes, so we’re just not gonna do that.’” The Bipartisan Budget increases government spending now, which will lead to budget cuts later. These actions will decrease spending on retirement programs for veterans and will raise airport security taxes. With the passing of the new budget agreement comes increased funding to certain programs and reduced

The Horace Mann Review | Vol. XXIII

TEDDY KAPLAN

spending on other programs. This deal reduces many of the impacts of the budget cuts on the Pentagon by $63 billion over two years. However, because of this increase, the government has lowered military retirement funds and raised airport security tax. Military retirement funds should not be reduced because reductions are unfair to the soldiers that fought for our country. House budget aides say that with this new budget “lifetime retirement pay [would be reduced] by about 6 percent for a man who enlisted at age 18 and retired at age 38 as a sergeant first class in the Army—leaving him with about

Economics $1.626 million in lifetime retirement pay instead of $1.734 million.” After the military, many veterans face problems that include lack of experience with civilian jobs, potential disabilities, and difficulty adjusting to life out of the military. The Washington Post reports that 44 percent of veterans who have served after 9/11 “were having trouble adjusting to civilian life.” Because of all of these potential problems that face veterans when coming out of the military, their unemployment rate is very high. The Washington Post reports that 6.9 percent of U.S. veterans were unemployed as of October, and 10% of veterans who finished serving after 9/11 remain unemployed. The government should be increasing, not decreasing the retirement pension for veterans. The retirement pension for veterans is that much more important because of their high unemployment rate and their inability to find jobs after serving. Not to mention, soldiers do a great deed for their country and deserve to be rewarded for it. The government is saving money in this deal by increasing the airport security tax and increasing fees that corporations are required to pay for government guaranteed pensions. These two actions will save over $85 billion; however, with the increases in airport security taxes, airline ticket prices will climb upward. Nicolas E. Calio, the president and CEO of the trade organization, Airlines for America, said, “Doubling the TSA passenger security tax would cost passengers more than $730 million annually, placing a huge additional tax on the traveling public, with no direct benefit to those who pay it.” Katie Connel,

an Airlines for American spokeswomen added, “As we have said consistently, airlines and our customers are already overtaxed, and we are disappointed that fees on air travel were increased and believe those higher taxes will impact demand, jobs and our economy.” The government cannot keep raising taxes, something essential for this deal to happen. Sen. Ted Cruz (R-TX) says that the budget “spends more, taxes more, and allows continued funding for Obamacare. I cannot support it… This proposal undoes the sequester’s modest reforms and pushes us two steps

back, deeper into debt. Supporters of this plan are asking for more spending now in exchange for minor changes that may possibly reduce spending later.” As Cruz mentions, this deal pushes the government into more debt. As they increase the spending now they will tax more over time, hurting the economy as a whole. While this budget may have been necessary to avoid a government shutdown, a better-constructed deal that covered more issues would have been better for everyone. Ultimately, the government was desperate when they made the deal and failed to make necessary changes. HMR

“The Bipartisan Budget increases government spending now, which will lead to budget cuts later. These actions will decrease spending on retirement programs for veterans and raise airport security taxes.”

February 2014

Science and Technology

Networking Freedom Social Netoworking is Aiding Independence Movements in their Struggle for Identity Lauren Futter

n November 21, 2013, Ukrainians took to Twitter and Facebook, decrying the government’s suspension of the signing of an agreement with the European Union to begin the process of incorporating the Ukraine into the EU. Leader of the Ukrainian opposition party Batkivshchya Arseniy Yatsenyuk asked his twitter followers to protest the Ukrainian government’s decision, calling the protest #euromaidan. Coupled with the urgings of other opposition leaders, Yatsenyuk’s posts resulted in 100,000 protestors arriving in Kiev to protest the government and by December 4, the official EuroMaidan Facebook page had over 126,000 likes. Events such as the Ukrainian protests demonstrate the efficacy of social media in allowing men and women to rally around a

cause in the name of their country. The prevalence of nationalism and the power of social media can further be demonstrated by desire of countries to be recognized as such by these social media websites. Facebook recently identified Kosovo as a country after an extensive campaign waged by its citizens to be recognized as Kosovars, as opposed to Serbians, on Facebook. Revolution and dissent appear contrary to the spirit of nationalism. After all, the definition of nationalism is a feeling of pride in one’s country and loyalty to that country. If people are enraged by the actions of their government, then how can they be proud of and loyal to their country? This definition of nationalism is based on an old and outdated notion: nationalism can only be experienced by enlisting in

The Horace Mann Review | Vol. XXIII

the military, supporting the national team in a soccer game, and feeling, and experiencing a sense of community when singing a national song. However, this definition of nationalism fails to take into account loyalty to the country’s well being over the government that runs that country. Social media has provided a forum that allows citizens to criticize events occurring in their country and express what they think is necessary to improve that nation. One common postion argues that social networking breaks down borders by expanding perspectives because citizens now feel that they are part of a global community and are less connected to their nation. However, this expansion in perspective has only facilitated the rise of nationalism by allowing people to see different forms of government, leading to

Science and Technology improve their own society through attempts such as the Arab Spring and Kosovo. The use of social media as a forum to facilitate protest has occurred since early 2000. On January 17, 2001, crucial evidence in the impeachment trial against Joseph Estrada, president of the Philippines, was disregarded. As a result, thousands of citizens of the Philippines decided to show their anger. In less than two hours, a text message that said “Go 2 ESDA. Wear blk” spread around the country and encouraged people to go to a major crossroads in the capitol of the Philippines. Because of the actions taken by those citizens, the evidence was reevaluated and the president was deposed. Social media created a sense of community, bringing together thousands of Filipinos to spread awareness. The example of the Philippines illustrates that nationalism is no longer expressed by blind obedience to a political order; rather, national identity can be expressed in other ways such as creating a cyber-community through social media and other similar types of media outlets to raise awareness about improving a nation. During the Arab Spring, protestors used social media in a similar manner. Throughout the Egyptian Revolution, protestors used twitter to call for marches in Tahrir Square in Cairo. Through the use of hashtags such as “#Cairo,” “#jan25,” “#suez,” protestors were able to spread awareness throughout the world, creating a sense of community and unity amongst protestors. Social media has also given nations another source of semi-official (or de facto) recognition even if they are not officially recognized by organizations such as the European Union (EU) and the United Nations (UN). In the past, countries relied on other countries to confer legitimacy. With the popularization of the Internet, though, nations can appeal directly to individuals to promote their legitimacy. For example, while Kosovo declared itself an independent nation five years ago, neither the EU nor the UN has ever given official legitimacy to Kosovo’s claim. Kosovars advocated on Facebook for legitimacy, and accomplished their goal in early December. According to the deputy foreign minister of Kosovo Petrit Selimi, Kosovo’s status on Facebook was a top priority for Kosovo because “it has far greater resonance than some back room in Brussels.” While some consider it strange that Kosovo bestowed upon Facebook the ability to declare nationhood, Kosovars see it as a matter of identity, according to the New York Times. The identification of Kosovo as a country by Facebook demonstrates the growth of social media as a means of promoting senses of com-

munity and identity. Through bypassing more well-established world bodies such as the EU or UN, other countries seeking statehood can further a sense of community in a more meaningful manner. Social media allows individuals to build their own identities without the interference and long delays associated with those official sanctioning bodies. Some argue that social media has created factions and only served to divide people instead of bringing them together. In a PEW Research survey, global IT consultant Fernando Botelho stated, “The internet enables much more narrowly targeted divisions so that we are not divided anymore into less than 200 national territories or three or four major religions, but into thousands or even millions of subgroups.” Within these groups are those that espouse sentiments such as “I hate Pakistan” and “Belgium Doesn’t Exist,” dividing nations instead of constructively building nations. In the past year, the Jewish human rights group the Simon Wiesenthal Centre found a 30% increase in these types of groups. While these subgroups have allowed people to connect with one another beyond the physical, geographical boundaries and sometimes create exclusive and racist online communities, these instances of divisiveness are few in comparison to the number of constructive examples of nationalism. Ziyad Rahim, a Pakistani citizen, deliberately decided to attempt to foster nationalism by setting records and posting about

February 2014

them using social media. Rahim set the record for completing a marathon on each continent in the shortest period of time. While breaking the record, Rahim finished the marathon while holding a Pakistani flag. In addition to increasing nationalism through setting records, Rahim raised funds for Pakistan Flood victims and the charity CARE Pakistan. “Inclusionary forms of nationalism help to prevent more malicious forms of exclusionary nationalism from taking root,” said Saleem Ali in an article for National Geographic. It is the acts of people like Ziyad Rahim and the protestors in the Ukraine who show that while this new nationalism has created divisions, it has bound more people of the same nation together in a positive manner than it has separated different nations. Social media has not only served as an incubator for revolutions and emerging nations but also supported and strengthened nationalism by fostering a greater sense of cultural identity. In an age when people are connected by more than just geographical borders and common heritage, people must expand their notions of what it means to show loyalty to one’s country. While the media has been used all throughout history to increase nationalistic thought through the use of pamphlets and the news, the Internet has allowed this thought to reach beyond city or town limits and move at a faster rate. Given the new prevalence of social media, nationalistic feelings are increasing instead of decreasing. HMR

Science and Technology

ACATTTGATTATGACCAGGTATGCTGGGGTATGCTGGGA TATGGGGTATGCATGCTGGAAAGATTAGCTGGAAAGAT

2 3 A N D M E

A C ATTTGATTATGACCAGGTATGCTGGGGTATGCTGGGG GATTATGACCAGGTATGCTGGGGTATGCTGGGA

Benjamin Shapiro

he technology used to sequence DNA isn’t especially new for biochemists; however, since the development of this technology, it has become increasingly fast and efficient, resulting in a cheap and easy way to decipher an individual’s entire genetic code. The procedure for deciphering human DNA first originated in 1986 through an international biological study called the Human Genome Project (HGP). The project’s goal was to sequence every single nitrogenous base or “building block” of DNA, and in doing so, to be able to identify all the human genes. It took fourteen years for the scientists to publish a rough draft of the human genome. Nevertheless, since the beginning of Human Genome Project, many advances have been made, allowing for scientists to sequence groups of genes in a matter of

minutes rather than a matter of days (as t they had towards the start of the HGP). Recently, many companies have been established that offer procedures for genetic sequencing to anybody willing to take the time and pay a small fee. For instance, AncestrybyDNA, DNA consultants, DNA Spectrum, and Family Tree DNA are all new organizations that offer sequencing tests at a low cost. One such sequencing company, called 23andMe, offers to sequence DNA for only 99 dollars; all the customer has to do is spit in a test tube. After being tested, 23andMe decrypts the complicated code of the patient’s DNA and interprets the results, which it sends back to that person. 23andMe’s results contain an assessment of the test recipient’s health, including whether that man or woman is particularly susceptible to certain diseases.

The Horace Mann Review | Vol. XXIII

In addition to the health assessment, the company includes information about the history of the subject’s ancestors. The process of DNA sequencing has caught the attention of many people who are intrigued by the idea of figuring out the instructions that built their bodies. Recently, the FDA has ordered 23andMe to stop the distribution of the health evaluation aspect of their DNA sequencing test. Many of the other companies in the field of DNA decoding do not typically offer detailed health reports based on their tests and therefore have not run into trouble with the FDA. However, until the FDA approves 23andMe’s process for obtaining decoded information and the accuracy of the information collected, the company has been forced to discontinue its services. A customer may still

Science and Technology receive a DNA test from 23andMe; however, he or she cannot be given a health report with the results of the test. The FDA is concerned with the dangers of releasing inaccurate medical information to the public, but issues involved in DNA sequencing go far beyond the problem of inaccurate results. Inaccurately interpreted information could lead to uninformed and rash medical decisions that could affect someone’s wellbeing for the worse. For example, an individual could receive test results from 23andMe that indicate that he is at a high risk for contracting appendicitis. Without further medical knowledge of the disease and without consulting a physician, this individual could decide to remove his appendix and not even have a trace of the disease in his body. The seeming authority of DNA, even if inaccurately interpreted, can easily persuade people to make a medical decision or alteration in their life styles. For example, when Angelina Jolie found out that she had a genetic risk for breast cancer, she decided to receive a mastectomy (a surgical operation to remove a breast). If people who are willing to make medical decisions like Angelina Jolie are being tested, it is possible for them to make bad decisions based on their information which may not be appropriate in their situation. It is a human being’s right to know their own genetic data, but if it causes people to make choices that end up harming them, it may be more important to protect these people from such harmful situations. The FDA is correct in trying to procure the most accurate information from 23andMe by requiring them to be certified. However, even when the information is confirmed to be accurate by the FDA, it must be made harder to obtain by individuals. At the very least, there should be regulations on who can receive this genetic information. A physician should have to approve their patients to receive this information, and those same physicians should be the people to interpret their patient’s DNA test. Though the genetic code offers an abundance of valuable secrets about our physical bodies, these secrets must be understood properly to avoid any chance that someone could make a harmful medical decision. It is important to understand that some genetic secrets, such as knowing one’s risk for cancer, do not have preventative measures, and would therefore simply result in negative effects such as increased anxiety. There-

fore, it may not be best to learn these secrets of the genetic code in the first place. Beyond protecting people from physical harm, it is of utter importance to protect certain key human values, one of which is privacy. When an individual decides to take part in 23andMe’s test, he or she is receiving the “set of instructions”, so to speak, to every physical trait in his or her body, but 23andMe is receiving the same information. It is fair to say that 23andMe is most likely not sharing this information with the general public; however, they are keeping it stored some-

As the process of genetic sequencing becomes more readily available, the issue of privacy becomes more relevant. Though getting your DNA decoded may seem harmless, the implications of giving away such precious information must be considered. Participants are readily giving up deeply personal details about themselves, and it is important to realize the delicate balance of privacy they are handling. Every human has a right to the vast stores of information held within their genetic code. 23andMe, along with many other small companies, has sought to

“Issues involved in DNA sequencing go far beyond the problem of inaccurate results.”

where in their databases. Before the FDA mandate to shut down medical interpretations, clients of 23andMe would receive updates on new medical information that 23andMe was testing for in their labs, indicating that 23andMe was already regularly examining and re-examining the patient’s genetic code. Though for many people this observation may not seem invasive, 23andMe has access to virtually all of its customers’ genetic makeups and can review their physical attributes at any given time. When someone’s genetic sequencing test goes through a process that is controlled by a company, that person is offering the company a complete synopsis of his or her physical characteristics. Giving away your genetic sequence to the wrong people could lead to embarrassment and discrimination if you’re not careful, especially in this day and age, when technology makes it so easy to store and share personal information. The information could potentially be sold to advertisers who could tailor ads to your genome.

February 2014

share this information with these individuals because they acknowledge every human’s right to this information. The goal of these companies to share such valuable information with their patients is admirable and courageous, (considering they have ventured into a rather new and constantly developing science); however, they have flown too close to the sun as pioneers of their business. Furthermore, the decision to share all of one’s genetic secrets with a company is a commitment that they should seriously consider before deciding to do so. The key to safeguarding one’s own privacy is to simply keep their private information from anyone who they do not trust. In this case sharing the schematic of one’s entire body with a company is the exact opposite of protecting their privacy. Ultimately, the idea of genetic sequencing is in no way ideal and it may be best for us all to refrain from sharing our genes with anyone. After all, maybe these secrets don’t mean to be shared at all. HMR

Science and Technology

The GMO Revolution 52

The Horace Mann Review | Vol. XXIII

Science and Technology

What Are You Eating? Elizabeth Xiong

o you know what you’re eating? Genetically modified (GM) foods are organisms that have been genetically altered to contain genes from other organisms that would not arise in the food naturally. This process allows for the optimization of these organism’s genetic traits, generally improving its productivity and consumer value. Adjustment of the organism’s bacterial and pest resistance, flavor, and aesthetics are just a few examples of how genetic modification is changing the foods we eat. Most Americans have eaten genetically modified foods without realizing it as 60% to 70% of processed foods on grocery shelves will contain GM ingredients. Researchers from the Food Policy Institute at Rutgers’ Cook College found that only 52% of Americans realized that genetically modified foods are sold in grocery stores, and only 26% believed that they have ever eaten genetically modified food. GM foods are incredibly commonplace, but a strong suspicion about crops that have been genetically engineered pervades the country. Despite the broad scientific consensus over the safety of GM foods, 9 out of 10 Americans support the labeling of GM foods, according to National Geographic. Some call for more extreme action, however. Groups such as GMWatch and The Institute of Science in Society have been created for the sole purpose of opposing GM crops. Americans do have the right to know what goes in their food and the right to avoid consumption of anything with GM ingredients if they so choose, and labeling of GM foods should be required. However, scientific studies have continuously shown the absolute safety of GM

February 2014

Science and Technology

foods, making most fears only paranoid misconceptions. GM foods should definitely not be banned and are a key technological development that could improve lives worldwide. Because GMO’s are an incredibly recent development, the public is still relatively uneducated on matters of genetic modification. The FDA approved of the first commercially grown, genetically engineered crop in 1994, and the Flavr Savr, a tomato designed to rot more slowly, began selling May that year. Since then, there has been an explosion of GM foods, as dozens of countries around the world, including Argentina, Canada, China, Australia, India, and Mexico, have also adopted genetic engineering techniques to adjust their crop’s genetic material. Since 1996, a total of 3.7 billion acres of land have been used overall to grow GM crops, showing the popularity of these hardier, modified crops within the agricultural industry. In response to these agricultural innovations, as in response to all technological advancements, unwarranted fears have cropped up all over. A New York Times survey shows that despite many scientific studies to the contrary, thirty-seven percent of those worried about GMO’s said they feared that such foods cause cancer or

allergies. However, testing for such allergens is part of the R&D process when developing GMO’s that are intended for food, and GM foods are required to be tested for allergenicity before they are marketed and approved by the FDA. A 2005 review in the journal Allergy of the results from allergen testing of current GM foods stated that “no biotech proteins in foods have been documented to cause allergic reactions,” making the risk of allergens null. Many anti-GMO groups have latched onto the population’s base fears, emphasizing the risk of cancer from GM foods. In fact, as a 2012 paper came out in a French science journal suggesting a correlation between GM corn and cancer in rats, politicians with anti-GMO agendas immediately began touting the study as proof of the devastating effects of all GMO’s. The paper, however, like other claims about GM foods’ correlation to cancer, was unsubstantiated. Within weeks, six French national academies of science, national food safety and regulatory agencies, and many independent scientists quickly dismissed the study for bias, logical fallacies, and methodological mistakes; the paper was retracted the following year. Furthermore, after twenty years, there are as yet no reported human clinical trials that have confirmed any cor-

The Horace Mann Review | Vol. XXIII

relation between GM foods and cancer, and America’s cancer rates have remained similar to that of the European Union (EU), which has heavily regulated GMOs and, as of 2012, only approved of 48 organisms in total. GMWatch and other groups against GMOs also assert with an absurd frequency the inconclusiveness of any tests or the lack of independent studies on the harmlessness of GMOs. However, over 600 safety assessments have confirmed the benignity of GM foods. These assessments come from groups such as the American Association for the Advancement of Society, an international, nonprofit organization; the Royal Society of Medicine, England’s top medical society; and the American Society for Cell Biology, an international community of biologists. Concerning long-term studies especially, the Journal of Agricultural Food Chemistry published a literature review covering 20 years of safety studies, in which the authors found “overwhelming evidence” that using biotechnology to genetically modify crops “is less disruptive of crop composition compared with traditional breeding, which itself has a tremendous history of safety.” As Ramez Naam, professional technologist and HG Wells Award recipient for Contributions

Science and Technology to Transhumanism says, “The scientific consensus around the safety of genetically modified foods is as strong as the scientific consensus around climate change.” If irrational fears of GM foods still persist, then Americans do deserve the right to choose non-modified foods. The US is the largest producer of GM crops, and crops such as corn, soybeans, canola, cotton, sugar beets, alfalfa, papaya, and small amounts of zucchini and squash, have been genetically engineered. Additionally because soybeans, cotton, maize, and rapeseed oil are the most common genetically modified foods, any food in the US containing corn syrup, including cereals, snacks, and soda, or soybeans, found in meat alternatives and many baby foods, will contain GM ingredients. The GM foods have completely permeated American lifestyle to the complete ignorance of most Americans, making it difficult for Americans to avoid GM foods when they are not labeled. Biotech companies firmly oppose labeling their modified products, going to extreme lengths to prevent any such legislation. Last year, a coalition of corporations spent $45 million to prevent the passage of California’s Proposition 37, which would have required labeling of all food products containing GMO’s within two years. The bill was narrowly defeated. The absence of labeling, however, grossly invalidates Americans’ basic rights. As consumers, they should be able to choose what kind of product they want to buy. Many companies that use genetic en-

all sorts of ethical and moral standards. Although the regulations should require labeling of GM foods to satisfy the suspicious customer, the public should not let its misgivings get in the way of an ingenious invention. According to the International Service for the Acquisition of Agri-biotech Applications, GMO farming has reduced use of pesticides and fossil fuels, decreased carbon dioxide emissions, and made a significant contribution to the income of more than 15 million small resource-poor farmers in developing countries. These small-scale farmers now make up over 90 percent of all farmers growing

“The public should not let its misgivings get in the way of an ingenious invention.” gineering fear the backlash that knowledge of their GM products might create. This, however, does not justify deceiving the public. Norman Braksick, an executive of a genetically engineered seed company put the intent of biotech corporations well: “If you put a label on genetically engineered food, you might as well put a skull and crossbones on it.” These corporations, to insure their profits, therefore adopt policies that keep the public in the dark, violating

GMO crops, the group states. More importantly, GM crops are the answer to the impending food shortage. By the middle of this century, the world is going to need 40% more food, 30% more water, and 50% more energy, according to The Guardian. UK’s chief scientist, Sir John Beddington, has indicated that every means to improve food production should now be employed, stressing the need for widespread use of new biotechnological tech-

February 2014

niques in farming. Almost a billion people now face starvation. The GMO’s must be “properly tested” to make sure they do not harm people or the environment, but GM crops are the answer, says Beddington. International relief organizations also argue that GM crops can potentially alleviate plant diseases, the effects of climate change, and other grave threats to food production that African farmers may face. The banana is one example of a way that GM crops can help Ugandan farmers and consumers. In the past year, bacterial wilt disease cut banana yields from 30 to 50 percent in Uganda. When one considers that Ugandans consume up to one pound of bananas each day, it is clear that this decrease in crop output means disastrous consequences for the Ugandans’ diet. Recently, the National Agricultural Research Organisation genetically engineered a bacteria-resistant version of the banana by breeding the fruit with pepper genes. Unless the government passes a law that allows for use of GM crops, however, the disease-resistant banana hybrid will remain in the lab, untouched. Thus restrictions on GMOs based off unsubstantiated fears can actively harm those in third-world countries. The evidence against genetic modification is as weak as can be. If we choose to deny ourselves this method of increasing food output and reducing fertilizer use, the current imbalance between food supply and demand will persist. Genetic engineering is a technique that should be exploited for its incredible uses, not feared for unsubstantiated health concerns. HMR

Science and Technology

The ADHD Dilemma Peter Shamamian

nce a condition that marked severely impulsive and hyperactive children as “bad seeds,” ADHD has now become a recognized neurological disease that has gained the attention of many in the medical community. Seeking to profit from the new diagnoses of ADHD, drug companies have taken advantage of the remarkably successful twenty-year campaign starting in the 1990’s to publicize the disorder. The over-diagnosing of ADHD in children and adults came around as a result of drug companies being able to access the public as well as sponsor doctor’s studies on ADHD medication, heavily influencing the interpretations of the results that cause the doctors to exaggerate and concentrate on the beneficial aspects of the drugs rather than the dangers or future risks. These drugs are advertised as necessary for tempering the traits of the now widely acknowledged condition of ADHD. With the onset of prominent drug companies’ paying doctors and other entities to endorse their ADHD medications, more and more parents are becoming pressured to have their children tested for this condition. Drug companies have used ads in parenting magazines to stretch the signs of a potential ADHD case to scant symptoms such as relatively normal actions of carelessness and impatience. The prescribing of ADHD medication is widely unregulated, leaving lots of doctors and physicians uneducated about the disorder to prescribe with their best judgment. Prescribing ADHD medication needs to be regulated, as the rates of diagnosing patients with ADHD have skyrocketed. Legislation is needed to control and contain drug companies profiting off of this enterprise. This is unfortunately happen-

ing at the expense of many children and adults who are incorrectly diagnosed with ADHD, since ADHD medications are considered dangerous if taken improperly. In a recent presentation given in Washington, D.C. to a group of ADHD specialists, Dr. Keith Conners, a psychologist and professor emeritus at Duke University, noted that recent data shows a diagnosis has been made in over 15% of high-school age children, and that number on medication has reached recently 3.5 million from a mere 600,000 in 1990. Dr. Conners said that the numbers made the condition look like an “epidemic,” and that these medications were being distributed at “unprecedented” levels. Doctors paid by drug companies such as Shire, the producer of the popular ADHD stimulant drug Adderall, have published research that encourages physicians to make diagnoses more often than not. By doing this, doctors would ultimately discredit the growing concerns about the overdiagnosing of medications to children and also adults, making it apparent that it is normal for many people to be diagnosed with the condition. These same doctors are also credited with statements that reassure the safety of these stimulant and non-stimulant drugs. Many doctors, encouraged by their corporate sponsors, have supported the drug companies’ campaign, advertising these stimulants as “Safer than Aspirin.” Drug companies like Shire depend on this “legacy of safety,” falsely convincing the public that for over 40 years their ADHD medications have only helped children and adults with their condition, when, in reality, it has lead to a myriad of problems in adults who have been taking

The Horace Mann Review | Vol. XXIII

the medication for their lives, such as abuse of and addiction to ADHD medication. Although this has occurred in only a few cases, it is still significant, as the improper use of ADHD medications has been on the rise as a result of the popularization of ADHD medication and its wide use. The Food and Drug Administration (FDA), as well as the Drug Enforcement Administration (DEA) repeatedly instructed drug companies to remove ads in magazines and commercials on TV that were false and misleading or exaggerated the positive effects of ADHD medication. Drug companies want to overplay the benefits of such medications, because ADHD medication is regulated within the same realm of drugs such as morphine and oxycodone, due to the risk of abuse of or addiction to medications such as Adderall. Shire agreed to pay $57.5 million in fines to resolve allegations of improper sales and advertising of several drugs, including Vyvanse and Adderall, according to the New York Times. Shire is one of many pharmaceutical companies that have been caught for improperly displaying its ADHD products to the public, who has no reason to not believe what Adderall and Concerta brochures say. Roger Griggs, former Kentucky schoolteacher and founder of Richwood Pharmaceuticals who introduced Adderall to the ADHD medication market, is a major opponent of advertising ADHD medications directly to parents. He believes that companies should not be able to advertise controlled substances like Adderall to the public, and that the DEA should work harder to press drug companies to discontinue the advertising of ADHD drugs

Science and Technology to the public. “You’re talking about a product that’s having a major impact on brain chemistry.” Parents with children who may have ADHD are very susceptible to concepts such as this. Griggs sold his company to Shire for $186 million, after Shire realized the potential and future of Adderall. Doctors paid by drug companies to perform research and lectures to promote ADHD medications have almost always been major advocates of prescribing medication to people who do not actually have ADHD. This is another aspect of corrupt dealing that drug companies enter into in order to market their drugs more effectively. With supposedly unbiased research, drug companies can use research that they have sponsored as a justification for why ADHD medications are safe, reliable, and useful. With this totally “positive” research, drug companies can downplay the negative effects of ADHD medication, such as insomnia and decreased appetite. Dr. Joseph Biderman, a prominent child psychologist at Harvard University and Massachusetts General Hospital, was one of many doctors that were heavily sponsored in their

term-effects of these medications, or the lack thereof. In order to successfully determine the safety and reliability of ADHD drugs, we need more research into their long-term effects on the human body and brain, because without it, parents and adults will blindly agree to take medication and tend to overlook the vagueness of future the future implications of taking these drugs. Dr. William R. Dodson, a psychiatrist from Denver, takes a similar stance, and said that children and parents need to be educated on the long-term effects of these medications. Conflicting with this statement, little is also known about the long-term effects of taking ADHD medication, leaving observation of adults who have been taking ADHD medication for the majority of their lives as the only way of assessing these long-term conditions. Despite the fact that it appears to be beneficial to take ADHD medication throughout one’s life until, in some cases, the condition has subsided enough to where the patient does not have to take any medication, patients often become somewhat attached to the medication, opening the door to potential abuse and addic-

“With supposedly unbiased research, drug companies can use research that they have sponsered as a justification for why ADHD medications are safe, reliable, and useful.” research of ADHD medications by drug companies, mainly Shire. Paid more than $1 million by drug companies to perform research and lecture series, Biderman is a strong advocate for the diagnosing of children and adults with small signs of ADHD and the subsequent prescription of ADHD medication. According to the New York Times and Dr. Conners, Biderman is by far one of the most quoted and referenced researchers used by drug companies to promote their ADHD medications. The results from Dr. Biderman’s research flooded pamphlets for ADHD medication. Drug companies were now able to justify the wide distribution of their ADHD stimulant drugs. Because of this, child and adult physicians are often pressured, by misinformed patients and parents, to write prescriptions for ADHD medication, even given scant symptoms. These doctors that prescribe the medication are also frequently primary-care physicians that are unqualified and not educated enough on the disorder to make such a decision. Another issue that seems to be increasing with the over-diagnosing of ADHD is the dubious quality of information concerning the long

tion. The brain’s tolerance to these drugs builds up almost exactly as tolerance would build up for illegal substances, resulting in the need for larger doses of the medication. This becomes especially concerning when doctors prescribe ADHD medication to patients that do not actually have the condition. ADHD medication can become addicting at some point, especially for misdiagnosed patients, because it has effects on the mood and activity of a patient, something that many drugs do, according to Psychology Today. The over-diagnosing of ADHD medications and the developed addictions and abusing of these medications has created a trend in the illicit buying and selling of these medications as a stimulant drug. These pills, especially Adderall, have become extremely popular in high schools and colleges for students, seeking improvements in their ability to concentrate. This is all a result of the ability to easily access these medications with a doctor’s prescription and the ability to source these drugs from patients actually diagnosed with ADHD that receive heavier doses of medication. From 5.4% in 2009, Adderall use in school has jumped to 7.4% in 2013, according to PR Newswire,

February 2014

a news outlet that discusses medications and pharmaceuticals. This black market of selling ADHD medications is a clear result of why they should be more regulated and monitored, and why doctors should be more educated on the disorder. ADHD medications are not made in the same environments as illegal substances like methamphetamine or cocaine; they are controlled substances that can only be obtained through medication, making doctors the center of the problem: they are overdiagnosing patients with the disorder, allowing too much room for ADHD medication to make its way into an illegal setting. According to an IMS Health statistic study, sales in ADHD medication have nearly quadrupled from under $2 billion in 2002 to more than $8 billion in late 2012. This startling number comes from drug companies’ massive endeavors to popularize and promote ADHD medications, attaching meaningless actions that children do such as being disorganized or being restless. In a chain reaction of events, parents are affected by these ads and are increasingly having their children tested for ADHD. These children’s doctors could be uneducated in the condition and misdiagnose their patients, resulting in an array of future complications that stem from extended periods of taking ADHD medication. Recently, however, British drug manufacturing giant GlaxoSmithKline announced that it would stop paying doctors to support their drugs, and, more specifically, their ADHD drug Vyvanse, according to the New York Times. Glaxo has already paid $3 billion in fines for inappropriately paying doctors to promote their drugs for unapproved uses. Although not stretched to other drug companies yet with the exception of Shire, cutting off payment for promotion of a drug may be near for many drug companies. A proposal for legislation to combat the issue of inappropriate and inaccurate advertising of ADHD medication could be to ban drug companies from paying doctors to promote their products. Although highly controversial and upsetting for drug companies, this could be a fundamental step, more specifically, in helping to relay more accurate drug information to patients with ADHD. The bond between drug companies and the consumer could also be broken by the monitoring of advertisements to the public for ADHD medications by unbiased doctors commissioned by the DEA and are learned in the background of the disorder and medications. Regardless, the drug industry has turned the ADHD market into a lucrative business, and sadly, at the expense of doctors’ patients that may or may not have ADHD. HMR

Science and Technology

The Case for Nuclear Energy

Paul Jang farm8.staticflickr.com

t was first used to obliterate a large city into nothing but rubble and ashes. Decades later, its power is harnessed to light a city of millions. Nuclear energy may be man’s cruelest invention, but at the same time, it is one of man’s most helpful. Despite the countless benefits of using nuclear energy today, the fear of what nuclear power can do, as first seen in Hiroshima, still lingers. If you heard the word “nuclear” shouted out, what would come to your mind? Most people would likely visualize a red mushroom cloud, the radioactive hazard symbol, cancer, or maybe the 2011 Fukushima reactor meltdown. Rarely do people think of better food and water, sanitation, or big cities with big lights. Though nuclear energy can be used for such contrasting objectives, the negative images of nuclear power may overwhelm the positive ones in peoples’ minds. Nuclear energy should be something that we embrace, not oppose, to create an environmentally friendly and advanced world. The benefits of nuclear power plants far outweigh their cons: its dangers can be contained, its efficiency for the production

of energy is the best in the world, and it can promote economic stability and world peace. Because of the extreme results caused by nuclear missiles in wars, people are constantly reminded of the dangers of nuclear energy. This fear has also been augmented by nuclear tests and nuclear reactor accidents worldwide. These accidents have led the general public, environmentalists, and scientists to oppose nuclear energy, without evaluating the benefits that nuclear power can bring. When not properly packaged and stored, radioactive waste can cause cancer if it is close to local populations. More importantly, nuclear reactors are prone to having a nuclear reactor meltdown, which can have devastating effects on people and the environment. However, maintaining as well as adding new safety measures can further reduce the risk of a nuclear reactor meltdown. “Nuclear energy must not be used because it is not safe,” opponents to nuclear power claim. But the IAEA International Expert Fact-Finding Mission concluded: “to date, no health effects have been reported in any person as a result of radiation ex-

The Horace Mann Review | Vol. XXIII

posure,” in response to the Fukushima disaster. On the other hand, oil pollution worldwide is extensive. Decreased crop production and the poisoning of people and animals poisoned are all results of oil spills. Major oil spills have caused environmental and economic devastation. For example, in the 2010 BP oil spill in the Gulf of Mexico, nearly 5 million barrels of oil were spilled into the ocean. The effects on Marine life can last for decades. Just six months after the spill, more than 8,000 marine animals were found dead or injured, according to the Indernational Wildlife Federation. Since oil is the most commonly used energy source, these disasters are likely to keep reoccurring unless we switch to different energy sources; thus, oil has a greater environmental harm. Nuclear power has a reputation for being used for conflict. Yet, we must not ignore the fact that other energy sources, specifically petroleum, have the potential to create conflict. According to the Right Livelihood Award, in Nigeria in 1993, 300,000 Ogoni people (a minority group) peacefully protesting against oil

Science and Technology exploitation by Shell Oil were brutally attacked by Nigerian troops. The conflict led to the death of 1,000 Ogoni people. Our long term conflict in the Middle East is also largely due to access to oil production. Because oil is so sought after, oil refineries can be used strategically when in conflict: in 1990, Iraq set fire to 789 Kuwaiti oil wells as part of the Persian Gulf War, leading to economic and ecological devastation to Kuwait. Additionally, as the world’s demand for an environmentally clean electricity source increases, the search for a clean, efficient, and sustainable source of energy has become a pressing issue. Currently, the five major sources of energy consumed worldwide are fossil fuel, natural gas, coal, renewable energy, and nuclear power. Out of all these energy sources, nuclear energy is the most viable source of energy for the world. According to the World-Nuclear Association, the world’s energy demands are rising much faster than the overall energy use, which is likely to rise at least 73% by 2035. Furthermore, the UN Population division predicts that by 2050, 70% of the world’s population will live in urban areas. Since currently, 70% of increased energy demand is from developing countries, primarily China and India, the demand for energy in these developing countries in particular will be substantially larger than current energy production. Energy con-

sumption is essential to developing countries since it brings better food supply, clean water, sanitation, health, education and communication facilities by creating a more efficient economy and a stable infrastructure. Therefore, we need to find a sustainable and efficient energy source that is “clean” at the same time. Renewable energy sources such as wind and solar power plants are environmentally friendly, but they cannot be primary energy sources due to their high construction cost and inefficiency. Yes, the Sun is the most abundant resource, but when it is cloudy, the efficiency of solar panels can drop to 50%. Simply put, we cannot rely on renewables for power. On the other hand, fossil fuels, natural gas, and coal are much more efficient sources of energy than renewables, as long as the power plants are constantly fueled. Yet, the combustion of these sources of electricity poses a serious environmental problem. Fossil fuels, natural gas, and coal pollute the environment by emitting substantial amounts of carbon dioxide, which, according to the United States Environmental Protection Agency, is the largest source of CO2 emissions in the nation. CO2 in the atmosphere traps heat from the sun, which warms the globe. According to the Intergovernmental Panel on Climate Change, global warming is projected to cause significant dis-

ruptions of ecosystems, severe weather patterns such as drought, pest infestations, and consequential effects on global food production. It is true that nuclear energy is much more expensive than fossil fuel and renewables in the long run; nuclear power plants are expensive to build, maintain, and operate. However, with stable and predictable long term shifts, population movement, and centers, it makes sense to invest in large nuclear power plants rather than in fossil fuels. Nuclear energy sources such as uranium will not run out as quickly as fossil fuels. The cost-benefit ratio of renewables is far higher in terms of cost, while the cost-benefit ratio for nuclear energy is much higher in terms of benefit. When developing nations reach economic stability, brought about mainly by a stable energy supply, the likelihood of global conflict is drastically reduced. The public is concerned that uranium intended for commercial nuclear power might be diverted for use in weapons. But ironically, under the Megatons to Megawatts program, Russia would convert 500 tons of HEU warheads and military stockpiles to be bought by the US for use in nuclear reactors. Nuclear energy is the safest, most efficient, and most viable energy source for the increasing energy needs of the world. HMR

targetmaps.com

Nuclear Power Plants Worldwide February 2014