Issuu on Google+

APRIL 2012

www.megalink.ch

Auf Herz und Nukleotid gepr체ft | Dummy ohne Crash Test | Jedes Watt z채hlt Gut zu Fuss | Frische Brise f체r Umrichter | Trends in der Leistungselektronik


Wie effizient ist Ihre Anlage? Exakte Werte für die Leitstelle!

MODBUS M ODBUS

RS-485

alternativ tiv

Stromsensor S tromsensor überwacht überw Anlagenstrang Der WAGO-Stromsensor WAGO-Stromsenso misst zuverlässig Ströme bis Messwerte über RS-485 und zu 140 A und stellt die M MODBUS-Protokoll über übergeordneten Steuerungen, Visualisierungen oder Leitstellen Le zur Verfügung.  Pro RS-485-Linie können könne 32 Sensoren bis zu einer Buslänge von 1200 m in Reihe geschaltet werden

Stromsensor Serie 789

 Messbereich von 0 bis 80 A und 0 bis 140 A Messgenauigkeit 0,5 % vom Endwert (DC) - Messgenauigke  Bei Umgebungstemperaturen Umgebungstempe von -20 °C bis +70 °C einsetzbar  Hohe EMV-Sicherheit

www.wago.com


E D I TO R I A L

4.12 megalink

Heute ist die gute Zeit von morgen Ach, wie viel besser war es doch früher. Feierabend, Wochenende oder Ferien waren wirklich arbeitsfreie Zeiten. Die Geschäfte liefen wie von selbst und die Margen verdienten noch ihren Namen. Doch dann kamen die chinesischen Billigprodukte, die den Markt komplett kaputt machten. Und der starke Franken gibt uns jetzt den Rest. Jammern und Kritisieren ist einfach. Etwas wagen, anpacken und selber aufbauen, erfordert hingegen Mut, Einsatz und Visionen. Thomas Watson, Senior, 1874–1956 langjähriger CEO von IBM Doch wer etwas wagt, kann auch scheitern. Und wer scheitert, ist ein Verlierer – zumindest bei uns. Ganz anders in den USA. Dort gehört es als dynamischer Unternehmer fast schon zum guten Ton, mindestens einmal mit einer Idee gescheitert zu sein.

«Wenn Sie schneller erfolgreicher sein wollen, müssen Sie die Anzahl Ihrer Misserfolge verdoppeln. Erfolg liegt auf der anderen Seite eines Berges von Misserfolgen.»

Anstatt in Gedanken vergangenen Zeiten nachzutrauern, sollte man besser nach vorn schauen. Nur wer jetzt etwas beginnt, kann morgen erfolgreich sein. Denn heute ist die gute Zeit von morgen.

Patrick Müller, Chefredaktor patrick.mueller@azmedien.ch

1


2

megalink 4.12

I N H A L T S VE R Z E I C H N I S

The power in relays and timers since 1954

Serie 39 imer T E C A F R INTE Das schmalste Zeitrelais mit dem breitesten Funktions-Angebot.

MasterTIMER

Das neue Multifunktions-Zeitrelais von Finder mit nur 6.2 mm breiten Bauform, hat neu 8 Funktionen und 4 Zeitbereiche von 0.1s bis 6h über DIP-Schalter einstellbar. Optional ist ein Sicherungs-Modul mit austauschbarer Standard-Feinsicherung von 5 x 20 mm erhältlich. Eigenschaften Schaltleistungen: EMR: 6A / 250VAC SSR: 2A / 24VDC 0.1A / 48VDC 2A / 240VAC Kontakte: EMR: 1NO oder 1CO, SSR: 1 NO Funktionen: AI: Ansprechverzögerung DI: Einschaltwischer GI: Impulsgeber (0.5s) SW: Symmetrischer Blinkgeber (impulsbeginnend) BE: Rückfallverzögerung über Startkontakt CE: Ansprech-Rückfallverzögerung über Startkontakt DE: Einschaltwischer über Startkontakt EE: Ausschaltwischer über öffnenden Startkontakt Zeitbereiche: 0.1…3s 3…60s 1…20min 0.3…6h Ansteuerung: 12..24 VAC/DC

www.finder-relais.ch

44 Leistungselektronik

52 Embedded

Frische Brise für Umrichter Heute richten sich die Schaltungstopologien in Mittelspannungskonvertern in erster Linie nach den Leistungsgrenzen der Halbleiter. Dieser Artikel beschreibt die Haupt-Topologien für Mittelspannungs-Windkraftumrichter. Zudem gibt er einen Ausblick auf die weitere Entwicklung bei den Leistungshalbleitern.

Auf Herz und Nukleotid geprüft Nahezu vollständig kann das Erbgut mithilfe von DNA-Sequenzierern entschlüsselt werden. Zur Prüfung des produzierten Gerätes braucht es aber eine ausgefeilte und weitgehend automatisierte Testumgebung.

THEMEN 1 Editorial 4 Veranstaltungskalender 5 Nachrichten 22 Auf der gleichen Funkwelle Nachschau Wago Funk-Roadshow 24 Eine Veranstaltung bewegt NIDays bereits zum 15. Mal ein voller Erfolg 28 Parlez vous technique? Interdisziplinäre Fachmesse der Zulieferbranche 29 Roboter, Weissbier und mehr Automatica 2012 30 Automation an einem Tag Nachschau ABB Automation Day 32 Hörst du mich? Nachschau Communication Conference 34 Gut zu Fuss Kleinantriebe in der Beinprothesenhydraulik 36 Dünne Leiter – fette Ströme Hohe Ströme sicher und effizient übertragen 39 Unterbrechungsfrei produzieren Mit Netzteilen Stromausfälle überbrücken 42 Jedes Watt zählt Höherer Wirkungsgrad dank 3-Level-IGBT-Modulen 44 Frische Brise für Umrichter Leistungshalbleiter, Topologien und Trends 49 Mehr Wirkungsgrad bitte! Wie Netzteile 95% Wirkungsgrad erreichen 52 Auf Herz und Nukleotid geprüft Testsystem für DNA-Sequenzierer 55 Analyse von der LED bis zur Leuchte Labor für lichttechnische Messungen 57 Mehr als nur schön verpackt Das optimale Gehäuse für jede Anwendung 59 Wenn Temperatur keine Rolle spielt Temperatureinfluss auf die Druckmessung

61 in motion Antriebe und Fluidik 62 Dummy ohne Crash Test Fussgänger-Detektionssysteme für Autos testen 65 swissT.net Networks & Communication 66 Kommunikation aus der Embedded-Box Industrial Communication Computer HIGHLIGHT 77 Bauelemente hochgenau charakterisieren Hochspannungs-Messinstrument PRODUKTE 64 in motion 67 Networks & Communication 69 Bauelemente 74 Automation 75 Messen und Prüfen 76 Industriebedarf 77 Lieferantenverzeichnis 80 Impressum


DC/DC-Wandler mit SFB-Technology

62 Automation Dummy ohne Crash Test Für die Sicherheit im Strassenverkehr hat Voraussicht oberstes Gebot. Eine neue Prüfanalage simuliert das aktive Fussgängerverhalten, um Sicherheitssysteme im Auto noch zuverlässiger zu machen.

Höchste Anlagenverfügbarkeit mit QUINT POWER Mit der SFB (Selective Fuse Breaking)Technology, dem 6-fachen Nennstrom für 12 ms, lösen die DC/DC-Wandler der QUINT POWER-Familie auch Leitungsschutzschalter zuverlässig und schnell aus. Wichtige Anlagenteile bleiben in Betrieb. Die präventive Funktionsüberwachung meldet kritische Betriebszustände bevor Fehler auftreten durch permanente Überwachung von Eingangsspannung, Ausgangsspannung und -strom.

ZUR TITELSEITE

Gut zu Fuss Unbeschwert Einkaufspassagen entlangschlendern oder mit Freunden Rad fahren. Dank einer neuen, hydraulischen Beinprothese ist ein aktiver Lebensstil für Betroffene wieder möglich. Die Charakteristik der Hydraulik wird durch zwei Ventile angepasst. Diese Ventile werden von DC-Motoren von Maxon mit kleinstem Durchmesser verstellt. Pro Prothese kommen zwei Motoren zum Einsatz.

Mehr Informationen unter Telefon 052 354 55 55 oder www.phoenixcontact.ch

maxon motor ag 6072 Sachseln Tel. 041 666 15 00 info@maxonmotor.com www.maxonmotor.com © PHOENIX CONTACT 2012


4

megalink 4.12

V E R A N S TA L TU N G S K A L E N D E R

Veranstaltungskalender Datum

Ort

4.5.2012

B & R, Frauenfeld

30.–31.5.2012

Thema

Kosten

Automation Studio Workshop. Das eintägige Seminar gibt Überblick über die Programmiersprachen der Norm IEC61131-3, zeigt Unterschiede zwischen textuellen und grafischen Programmiersprachen oder vertieft Arbeiten mit dem Strukturierten Text und Basiskonstrukten. swiss CAR Zü- Das LMI und swiss CAR veranstalten den 6. Lean Management rich / Summit Schweiz am GDI. Der Konferenztag am 30. Mai 2012 widGottlieb met sich den Themen Lean in der Dienstleistung, Lean DevelopDuttweiler ment, Lean Healthcare sowie Lean Production. Institut (GDI), Der Praktikertag am 31. Mai 2012 am GDI umfasst Workshops zu Rüschlikon den Themen Shopfloor Management, Lean Maintenance & Service oder Branchenübergreifender Lean Circle.

9.5.2012

Hochschule Luzern

Abend der Weiterbildung Die Hochschule Luzern bietet diverse kostenlos Weiterbildungen an. Am Abend vom 9. Mai können sich Interessenten über das Angebot und eine persönliche Laufbahnberatung informieren.

Diverse

Diverse

Seminarreihe von Rockwell Automation Schweiz. Die nächste Generation der Micro Steuerung – Micro800 Workshop.

24.5.2012 11.6.2012

HPC-CH Meeting. Handling huge amount of data for HPC Empa-Akademie, Dübendorf Electrical Overstress (EOS) – das «unbekannte» Phänomen in Schaltungstechnik und Ausfallanalyse. Innovation Day 2012. Design und Innovation durch neue Technologien. München Die Automatica 2012 – 5. Internationale Fachmesse für Automation & Mechatronik – zeigt die neuesten Lösungen zur Optimierung von Produktionsprozessen. Neben Robotik, Montageanlagen und Sondermaschinen präsentiert sie Komponenten und Systeme für die gesamte produzierende Industrie. Parallel findet die Ceramitec statt. Die Themenbereiche reichen von der klassischen Keramik und Rohstoffen über Pulvermetallurgie bis hin zur Technischen Keramik. An der Embedded Computing Conference (ECC) trifft sich die ZHAW schweizer Embedded Community. Experten von Unternehmen und Winterthur St.-GeorgenHochschulen präsentieren die neuesten Erkenntnisse und EntwickPlatz 2 lungen aus der Praxis und Wissenschaft. Hochstehende Vorträge sowie eine Tischmesse bieten eine effiziente Informations- und Kontaktplattform. Region Zürich DDS NetCom führt zusammen mit Hirschmann, Hersteller von aktiven Netzwerkkomponenten für Industrielösungen, verschiedene Zertifizierungskurse durch. Die Kurse finden im Raum Zürich statt, zu einmaligen Sonderkonditionen. Nutzen Sie das Know-how der hochqualifizierten Netzspezialisten aus erster Hand. Diverse Bosch Rexroth-Schulungen für Hydraulik, Pneumatik, Mechatronik, Linear- und Montagetechnik, Antriebs- und Steuerungstechnik. Kursinhalte und Termine: www.boschrexroth.ch/seminare

30.8.2012 22.–25.5.2012

5.6.2012

Diverse

Diverse

Diverse

Niederrohrdorf/ Online

Diverse

München

FlowCAD Trainings und Webinare in Kleingruppen und unterschiedlichen Niveaus für: Allegro, Orcad, PSpice, Boundary Scan, Reliability, 3D-Leiterplatten-Konstruktion, High-Speed-Design usw. Kursinhalte und Informationen: www.flowcad.ch/de/support-training/training www.flowcad.ch/de/support-training/webinar Standard-Trainings zu den Themen Funk- und Messtechnik oder speziell zugeschnittene Trainings. Detailbeschreibungen und Termine unter: www.rohde-schwarz.com = > «News & Events».

Veranstalter B & R Industrie-Automation AG 8500 Frauenfeld Tel. 052 728 00 55 office.ch@br-automation.com www.br-automation.com Lean Management Institut (LMI) Schweiz, 8092 Zürich Tel. 044 350 01 10 info@lean-management-institut.ch www.lean-management-institut.ch

Auf Anfrage

Online: Kostenlos

swiss Center for Automotive Research (swiss CAR), 8032 Zürich Tel. 044 632 06 32 swiss-car@ethz.ch www.swiss-car.ch Hochschule Luzern 6002 Luzern Tel. 041 228 42 42 info@hslu.ch www.hslu.ch Rockwell Automation AG 5001 Aarau Tel. 062 889 77 77 info@rockwellautomation.ch www.rockwellautomation.ch Empa-Akademie 8600 Dübendorf Tel. 058 765 45 62 empa-akademie@empa.ch www.empa-akademie.ch/ Dörgeloh Intermess AG 8001 Zürich Tel. 043 244 89 10 intermess@doergeloh.ch www.doergeloh.ch www.automatica-munich.com SwissT.net 8604 Volketswil ZH Tel. 044 945 90 90 info@swisst.net www.swisst.net DDS NetCom AG 8320 Fehraltorf Tel. 043 355 22 11 info@dds.ch www.dds.ch Bosch Rexroth Schweiz AG 5563 Buttikon Tel. 055 464 63 79 walter.bhend@boschrexroth.ch FlowCAD Schweiz AG 5443 Niederrohrdorf Tel. 056 485 91 91 info@flowcad.ch www.flowcad.ch

Roschi Rohde & Schwarz AG 3063 Ittigen, Tel. 031 922 15 22 sales@roschi.rohde-schwarz.com www.roschi.rohde-schwarz.ch Weitere Veranstaltungshinweise finden Sie auf www.megalink.ch


| FB11-08G |

N A C H R I C H TE N

Die kompakte Lösung für komplexe Signaltechnik.

4.12 megalink

5

Die Beckhoff EtherCAT Box.

www.beckhoff.ch/EtherCAT-Box Extrem kompakte und robuste IP-67-I/O-Module Highspeed-EtherCAT-Kommunikation bis in jeden Teilnehmer, ohne Subsystem Breites Signalspektrum von Standard-Digital-I/O bis zur komplexen Analogtechnik:

Analog Input ±10 V, 0 / 4…20 mA

4-Kanal, Differenzeingänge, 16 Bit

M12

Widerstandssensor

4-Kanal, PT100, PT1000, Ni100 etc., 16 Bit

Thermoelement

4-Kanal, Typ J, K, L , M etc., 16 Bit

4-Kanal, single-ended, 16 Bit

Analog Output

IPC

±10 V, 0 / 4…20 mA

I/O

Sonderfunktionen Winkel-/Wegmessung Kommunikation

M12 4-Kanal, 16 Bit 4-Kanal, 2 Inputs, 2 Outputs, 16 Bit

Motion

Motion

Automation

D-Sub M12 Inkremental-Encoder Serielle Schnittstelle IO-Link-Master Schrittmotormodul DC-Motor-Endstufe

Halle 9, Stand F06


6

megalink 4.12

N A C H R I C H TE N

Führungswechsel bei Schneider Electric Schweiz

Baumer expandiert in den Mittleren Osten

Seit dem 1. März 2012 steht mit Matthias Bölke ein neuer Mann als CEO und Country President an der Spitze von Schneider Electric Schweiz. Er folgt auf Roger Karner, der Schneider Electric Schweiz während zweieinhalb Jahren und die dazugehörige Feller AG während vier Jahren erfolgreich geführt hat. Karner verlässt die Schneider-Gruppe und widmet sich neuen Aufgaben in Deutschland. Mit Matthias Bölke tritt ein langjähriger Branchenkenner und Topmanager des Schneider-Konzerns an die Spitze der Landesorganisation. Matthias Bölke verfügt über zwanzig Jahre Erfahrung in der Elektroindustrie. Zuletzt war der promovierte Elektrotechniker während vier Jahren Geschäftsführer der Dependance in Österreich. Matthias Bölke will die Schweizer Standorte konsequent weiter Matthias Bölke ist neuer CEO von stärken. So etwa die TochtergeSchneider Electric Schweiz. sellschaft Feller mit Sitz in Horgen. In seiner Funktion verantwortet Matthias Bölke für Schneider Electric die gesamte Region Schweiz-Österreich. Dies bedeute aber keine Zusammenlegung der Vertriebseinheiten der beiden Länder, wie Bölke betont: «Energiemanagement verbindet solide Kenntnis der Energieverteilung mit Hightech aus Automation und Datenverarbeitung. Wir wollen die Erfahrung unserer Topspezialisten beider Länder bündeln und einen regen Informationsaustausch fördern. Dies soll unseren Kunden zugute kommen. Hierfür werden wir weiterhin sehr landesspezifisch arbeiten und unseren Kunden den gewünschten lokalen Service bieten.» Diese Neustrukturierung erfolgte mit Fokus auf das Kundenbedürfnis nach einem «One Solution Partner» mit dem Ziel, Kunden in sämtlichen Belangen des Energiemanagements vom Kraftwerk bis zur Steckdose kompetent aus einer Hand zu beraten und zu bedienen. Im Zuge dieser Neupositionierung wurden auch neue Arbeitsplätze geschaffen, insbesondere für den Aufbau des Service- und Projektcenters für Gesamtlösungen im Energiemanagement. Dieses zählt derzeit über hundert Arbeitsplätze – Tendenz steigend. www.schneider-electric.ch, www.feller.ch

Der neue Standort von Baumer Middle East in Dubai.

Die Baumer Group hat ihre internationale Vertriebspräsenz nun mit einer eigenen Gesellschaft in den Vereinigten Arabischen Emiraten ausgebaut. Baumer Middle East FZE in Dubai knüpft damit an die jahrzehntelange erfolgreiche Marktpräsenz der Marke Bourdon an. «Wir setzen die weltweite Erfahrung und Kompetenz von BourdonHaenni, seit 2005 Teil der Baumer Group als Kompetenzzentrum für mechanische Messinstrumente, am Standort Dubai fort. Gemeinsam mit ausgewählten lokalen Vertriebspartnern bieten wir zahlreiche Value-Added-Services an verschiedenen Orten an. Unsere Kunden, insbesondere aus den Branchen Öl, Gas und Wasseraufbereitung, profitieren von einer lokalen und qualifizierten Anlaufstelle für kompetenten Service zu allen Produkten und Dienstleistungen von Baumer», betont Rüdiger Förster, Vorstand Vertrieb und Marketing der Baumer Group. Eine weltweite Vertriebspräsenz mit einem breiten Produkt- und Technologie-Portfolio sowie Entwicklungs- und Produktionsstandorten in Deutschland, Frankreich, Dänemark, der Schweiz und Indien ermöglichen die Abwicklung von internationalen und komplexen Projekten mit hoher Flexibilität. So arbeitet Baumer mit der Marke Bourdon seit Jahrzehnten mit weltweit renommierten grossen Ölkonzernen in der Förderung, dem Transport und der Verarbeitung zusammen. Nach langer und intensiver Zusammenarbeit vertraut etwa der Mineralölkonzern Total auf Baumer als Hauptlieferant für Membrandichtungen und Druckmesser. www.baumer.com

ABB und Industrial Defender gehen strategische Partnerschaft ein ABB und Industrial Defender gaben eine globale strategische Partnerschaft bekannt. Die Angebote daraus umfassen Lösungen für Cyber-Sicherheit, Compliance und ChangeManagement-Automatisierung für hoch entwickeltes Energiemanagement, Energieerzeugung und Prozessleitsysteme in ganz Europa. Die Partnerschaft konzentriert sich auf die Bereitstellung hochsicherer und gesetzeskonformer Automatisierungslösungen für das Smart Grid, die Stromerzeugung und andere Industriebereiche mit kritischer Prozesssteuerung. «Nachdem die Stromversorgungsinfrastrukturen weltweit für ihre Sicherheit und Zuverlässigkeit immer abhängiger von IT-basierten

Steuerungssystemen geworden sind, werden erhöhte Standards bei der Cyber-Security notwendig», sagt Stefan Basenach, Product Manager Substation Automation Products bei ABB. «Die Zusammenarbeit mit Industrial Defender hilft ABB, den Kunden speziell zugeschnittene Lösungen anbieten zu können, mit denen die Integrität ihrer Automatisierungssysteme geschützt wird.» Auf der Grundlage der nicht-exklusiven Partnerschaft wird ABB die ASM-Lösungen von Industrial Defender für das Management von Automatisierungssystemen vertreiben. Es handelt sich dabei um eine einheitliche Plattform für zentralisierte Internet-Sicherheit sowie Compliance-

und Change-Management-Lösungen innerhalb von Leitsystem-Umgebungen. «ABB ist sowohl ein führendes Unternehmen bei Systemen für Energieerzeugung als auch bei der Prozessautomatisierung. Das sind genau die Bereiche, auf die sich Industrial Defender seit einem Jahrzehnt konzentriert, um mit kombinierten Steuerungssystemen und Cyber-Security-Know-how bereichsspezifische Lösungen zu schaffen,» sagte Brian Ahern, Präsident und CEO von Industrial Defender.

www.abb.ch, www.industrialdefender.com


N A C H R I C H TE N

4.12 megalink

7

Automatisierte Prüfsysteme – mehr als eine Ansammlung von Messgeräten

Anwender auf der ganzen Welt nutzen die softwaredefinierte PXI-Plattform als Eckpfeiler ihrer Prüfsystemarchitekturen. Über 8500 modulare Messgeräte von mehr als 70 Anbietern sorgen dafür, dass PXI die funktionellen Anforderungen für die Erstellung flexibler Prüfsysteme erfüllt und zudem Prüfkosten und Platzbedarf reduziert.

PRODUKTPLATTFORM Modulare PXI-Messgeräte Grafische Programmierumgebung NI LabVIEW Software NI TestStand

>> Mehr Informationen rund um PXI für Ihre automatisierten Prüfanwendungen unter ni.com/beyond/d

©2012 National Instruments. Alle Rechte vorbehalten. LabVIEW, National Instruments, ni.com und NI TestStand sind Warenzeichen von National Instruments. Andere Produkt- und Firmennamen sind Marken oder Handelsbezeichnungen der jeweiligen Unternehmen. Druckfehler, Irrtümer und Änderungen vorbehalten.

056 2005151


8

megalink 4.12

N A C H R I C H TE N

IV-Renten im 2011 erneut auf Rekordtief Seit die Suva 2003 das New Case Management eingeführt hat, sinkt die Zahl der Neurenten kontinuierlich. Mit 1727 neuen Invalidenrenten geht die Zahl allein 2011 um 12,7 Prozent zurück. Damit verzeichnet die Suva ein neues Rekordtief. Insgesamt reduzierte sich die Zahl seit dem Höchststand von 2003 (3357 Renten) um 48,4 Prozent. Auf der Kostenseite wirkt sich diese Entwicklung noch deutlicher aus: Die Suva stellte 2011 rund 482,4 Millionen Franken zurück, um die Renten zu finanzieren. Dieser Betrag entspricht einem Rückgang um 9,8 Prozent oder 52,5 Millionen Franken. Verglichen mit dem Höchststand von 2003 (1029 Millionen Franken) haben sich die Rentenkosten mehr als halbiert. Rund 100 000 Menschen erhalten eine Suva-Rente, davon sind gut drei Viertel Invalidenrenten und knapp ein Viertel Hinterlassenenrenten. «Die Zahlen bestätigen unsere erfolgreiche Strategie, die Wiedereingliederung von Verunfallten ins Berufsleben ins Zentrum zu rücken», sagt Felix Weber, Mitglied der Geschäftsleitung und Verantwortlicher für Versicherungsleistungen und Rehabilitation. Grosse Aufmerksamkeit schenkt die Suva dabei Verunfallten mit einem komplizierten Heilungsverlauf. Zusammen mit den Betroffenen, Ärzten, Arbeitgebern, den rund 130 Case Managern der Suva und weiteren Beteiligten gelang es erneut, zahlreiche schwer verunfallte Arbeitnehmende wieder in den Berufsalltag zu integrieren.

Die Zahl der neuen Invalidenrenten liegt auf einem Rekordtief.

2009 hat die Suva in Koordination mit der Invalidenversicherung die «Initiative Berufliche Reintegration» lanciert und damit ein Anreizsystem für Arbeitgeber geschaffen, Verunfallten einen Arbeitsplatz anzubieten, die sonst keine Möglichkeit mehr auf einen Wiedereinstieg hätten. Durch dieses Engagement konnte die Suva Kosten von gut 10 Millionen Franken einsparen. Die Bemühungen der Suva für die Wiedereingliederung werden auch von den Versicherten geschätzt. 2011 wurde eine Befragung von rund 30 000 Verunfallten durchgeführt, die ihre Zufriedenheit mit der Fallabwicklung mit insgesamt 87 von 100 Punkten bewerteten. Eine Zunahme verzeichnete die Suva 2011 jedoch bei den Unfallzahlen: Die Schadenfäl-

le sind um rund 1,6 Prozent auf 466 424 angestiegen. Der Anstieg der Unfallzahlen hat direkte Auswirkungen auf die Taggeld- und die Heilkosten. Diese sind 2011 erneut gestiegen: Die Suva entrichtete im vergangenen Jahr Taggelder in der Höhe von 1,19 Milliarden Franken, gut 3,3 Prozent mehr als im Vorjahr. Die durchschnittliche Taggeldbezugsdauer blieb unverändert bei 38,5 Tagen. Auch die Heilkosten stiegen 2011 um 2,2 Prozent und knackten erstmals die Milliardengrenze: rund 1 Milliarde Franken kosteten die ärztlichen und therapeutischen Behandlungen der Versicherten. «Weil wir allerdings mehr Fälle abgewickelt haben, sind die durchschnittlichen Kosten pro Fall von 1681 auf 1676 Franken gesunken», so Felix Weber. www.suva.ch

Automatisiertes Therapiegerät aus der ETH-Ideenschmiede ausgezeichnet

Der ArmeoPower wird spezifisch in der Neurorehabilitation für die Arm- und Handtherapie eingesetzt.

Zum neunten Mal wurde im Rahmen des European Robotics Forum vom 5. bis 7. März 2012 der Technology Transfer Award verliehen. In Odense, Dänemark, präsentierten die fünf Finalisten den über 330 Robotikexperten aus 26 Ländern ihre Projekte. Der Tech Transfer Award ehrt herausragende Innovationen und erfolgreiche Technologietransfers zwischen der Wissenschaft und der Industrie. Prof. Dr. Robert Riener, ETH Zürich, und Dr. Alexander Duschau-Wicke vom Schweizer Medizintechnik-Unternehmen Hocoma überzeugten mit ihrer Präsentation des ARMin die internationale Jury. Das Gerät wurde ursprünglich an der ETH Zürich unter der Leitung von Prof. Riener und dem damaligen Doktoranden Tobias Nef – heute Professor an der Universität Bern – für die roboterunterstützte Rehabilitation entwickelt und begleitend an der Uniklinik Balgrist in Zürich klinisch getestet. Ende 2011 wurde der ARMin von Hocoma unter dem Namen ArmeoPower auf den Markt gebracht. Der ArmeoPower ist das weltweit erste kommerziell erhältliche roboti-

sche Arm-Exoskelett für die Neurorehabilitation. Der ArmeoPower ist ein Therapiegerät, welches speziell für die Arm- und Handtherapie in der frühen Phase der Rehabilitation entwickelt wurde. Er bietet hoch repetitives Training für betroffene Patienten, die an den Folgen eines Schlaganfalls, Schädel-Hirn-Traumas oder anderer neurologischer Ursachen leiden. Dank der neuronalen Plastizität ermöglicht das hoch repetitive Training die Anpassung des Gehirns an veränderte Bedingungen und so das Wiedererlernen motorischer Fähigkeiten. Mithilfe der «assist-asneeded» Armunterstützung erkennt der ArmeoPower Situationen, in denen der Patient eine Bewegung nicht ausführen kann und steuert dann so viel Kraft wie notwendig zur Bewegung bei. Der ArmeoPower ist seit November 2011 auf dem Markt erhältlich und wird bereits in fünf Ländern erfolgreich im Therapiealltag und in der Forschung eingesetzt. www.ethz.ch, www.hocoma.ch


N A C H R I C H TE N

Besuchen Sie uns an den «Safety Days 2012»

4.12 megalink

Informationen und Anmeldung: siemens.ch/ automation/ events

Safety Integrated

Schneller und einfacher zur sicheren Maschine – bei höchster Produktivität. Mit Safety Integrated lassen sich alle Anforderungen an die Sicherheit und Wirtschaftlichkeit von Maschinen erfüllen.

Mit Safety Integrated liefert Siemens die intelligente Antwort auf kontinuierlich steigende Anforderungen an Produktivität und funktionale Sicherheit einer Maschine oder Anlage: die Integration der Sicherheitstechnik in die Standardautomatisierung. Von diesem durchdachten Konzept profitieren Maschinenbauer und Anlagenbetreiber gleichermassen. Safety Integrated unterstützt Sie dabei, den zuverlässigen Schutz von Mensch, Maschine und Umwelt wirtschaftlich und flexibel zu realisieren – und aktuelle Anforderungen geltender Sicherheitsnormen zu erfüllen.

www.siemens.ch/safety

9


10

megalink 4.12

N A C H R I C H TE N

Avnet und Adeunis machen europaweit gemeinsame Sache

Die Messe an der sich die Technologiebranche trifft

Avnet Memec geht eine paneuropäische Vertriebsvereinbarung mit Adeunis RF, Spezialist für drahtlose Übertragungssysteme, ein. Basierend auf der Vereinbarung kann Avnet nun auch Module für Near Field Communication anbieten; ein wichtiger Technologiebereich für die rasant wachsenden Marktsegmente RFID und das kontaktlose Bezahlen. «Die Entscheidung, Avnet Memec zu unserem Distributor für ganz Europa zu machen, stellt ein Schlüsselelement unserer langfristigen Strategie im Industriemarkt dar», erläutert Herve Vincent, Vorstandsvorsitzender und Geschäftsführer von Adeunis RF. Gemäss dem Präsidenten von Avnet Memec Steve Haynes hat das Unternehmen grosses technisches Potenzial. «Die Module von Adeunis RF ergänzen das bestehende Portfolio um eine komplette, auf ISM-Band basierende Modulreihe für Wireless-M-Bus oder anbieterspezifische Protokolle. Somit sind wir in der Lage, Lösungen auf Modulebene anzubieten, die bereits auf Chipebene verfügbaren Schlüsseltechnologien entsprechen, und dadurch die Markteinführungszeiten unserer Kunden verkürzen.»

Mit der Sindex, Schweizer Messe für Technologie, welche vom 4. bis 6. September auf dem Messeplatz Bern stattfindet, erhält die Branche einen Event in der Bundeshauptstadt. Die Messeorganisation rechnet mit 300 Ausstellern auf 12 000 m2 Ausstellungsfläche und einem Besucheraufmarsch von rund 12 000 Personen aus der ganzen Schweiz und dem angrenzenden Ausland. Den Auftakt der Messe bildet ein Eröffnungssymposium mit namhaften Referenten. Die Aussteller der Sindex präsentieren Produkte und Dienstleistungen aus diversen Bereichen wie zum Beispiel der Automation, Robotik oder Fluidtechnik. Hinter den Kulissen wird zurzeit die Hallen- und Standeinteilung vorgenommen. Das aktuelle Ausstellerverzeichnis wird laufend angepasst und ist unter online abrufbar. Eine Liste der Produkte und Dienstleistungen, welche von den Ausstellern präsentiert werden, ist ab Mai auf der Plattform einsehbar.

www.avnet-memec.eu, www.adeunis-rf.com

Rekordjahr für den MSR-Spezialisten Ifm 2011 war für Ifm Electronic ein Rekordjahr. Mit 570 Mio. Euro konnte der Hersteller von Sensor- und Automatisierungstechnik den höchsten Umsatz in der Unternehmensgeschichte verbuchen. Das entspricht einer Steigerung von über 20 ProMichael Marhofer, geschäftsführender Gesellschafter Ifm Electronic. zent gegenüber dem Vorjahr. Erstmals legte der familiengeführte Konzern im Rahmen einer Pressekonferenz am Firmensitz in Essen die aktuellen Unternehmenskennzahlen vor. Und die sind nach Aussage des geschäftsführenden Gesellschafters Michael Marhofer nahezu konstant von zweistelligen Wachstumsraten geprägt. Lediglich im Krisenjahr 2009 brachen die Umsätze ein. Durch antizyklische Investitionen in Vertrieb und Entwicklung konnte dies aber bereits im darauffolgenden Jahr wieder wettgemacht werden. In 2018 will das Unternehmen laut Marhofer die Marke von einer Milliarde Euro Umsatz erreichen. Voraussetzung dafür ist allerdings die erfolgreiche Rekrutierung von weiteren Ingenieuren. «Denn für ein Technologieunternehmen, wie uns, gilt: ohne Entwickler keine Innovationen und ohne Innovationen keine Entwicklung», so Marhofer. «Wir suchen am Standort Deutschland aktuell über 100 Ingenieure für 250 Entwicklungsprojekte. Aber der Bewerbermarkt ist nahezu leer gefegt. Das bremst unser Wachstum.» Der anhaltende Ingenieurmangel in Deutschland hat bereits dazu geführt, dass das Unternehmen im letzten Jahr weitere Entwicklungs- und Fertigungsstandorte in den USA, Singapur und Polen aufgebaut hat. Von den neuen Entwicklungsstandorten verspricht sich das Unternehmen einen Zugang zum Ingenieurnachwuchs in diesen Ländern. www.ifm.com

Das Wichtigste in Kürze Datum: Zeit: Ort: Anmeldung und Infos:

4. bis 6. September 2011 9 bis 17 Uhr (täglich) Messeplatz der Bernexpo AG, Bern, Schweiz www.sindex.ch

Der Bereich Automation nimmt rund 45 Prozent ein, gefolgt von der Elektronik und Elektrotechnik sowie dem Engineering und Dienstleistungen. Die Relevanz des Bereichs Automation widerspiegelt sich beispielhaft am Stand von Siemens: Unter dem Leitmotiv «create sustainable values – unser Weg zur nachhaltigen Wertsteigerung» präsentiert Siemens an der Messe Neuigkeiten und Trends aus der Automatisierungs- und Antriebswelt. Auftakt der dreitägigen Messe Sindex bildet das Symposium. Während an der Messe die Aussteller den Kundenkontakt pflegen, fokussiert das Symposium auf eine andere Zielgruppe: Hier steht der Austausch von Spitzenvertretern aus Wirtschaft, Politik und Wissenschaft mit dem Management im Zentrum. Gegenstand des Symposiums bildet ein konstruktiver Dialog über die Zukunft des Industrie- und Werkplatzes Schweiz, den Spitzenvertreter der Technologiebranche mit den Maschinen- und Anlagenbauern gemeinsam führen. www.sindex.ch

Schaffner bleibt optimistisch Die Schaffner Gruppe erwartet, dass der konsolidierte Nettoumsatz im ersten Halbjahr 2011/12 aufgrund der schwachen Auftragsentwicklung im Vorjahr zwischen 15 und 20 Prozent unter dem ersten Halbjahr 2010/11 (1. Semester 2010/11: CHF 99,2 Mio.) und damit leicht unter der zweiten Hälfte des Geschäftsjahres 2010/11 (2. Semester 2010/11: CHF 84,5 Mio.) liegen wird. Das operative Ergebnis EBIT nach sechs Monaten wird knapp positiv und deutlich unter dem Vergleichswert des Vorjahres erwartet (CHF 9,0 Mio.). Hingegen hat sich in den letzten Monaten die Auftragslage in allen Divisionen markant verbessert. Insbesondere konnten substanzielle neue Aufträge aus den Märkten Bahntechnik und Photovoltaik verbucht werden. Aufgrund der deutlich höheren Auftragseingänge geht die Schaffner Gruppe davon aus, in der zweiten Hälfte des Geschäftsjahres 2011/12 sowohl Nettoumsatz als auch EBIT gegenüber dem ersten Semester zu steigern. www.schaffner.ch


I

Die ABB hat Prith Banerjee als Technologiechef in die Konzernleitung berufen. Er wird die neue Position Mitte 2012 antreten und seinen Arbeitsort in Zürich haben. Banerjee tritt die Nachfolge von Peter Terwiesch an, der im Juli 2011 zum Vorstandsvorsitzenden der deutschen ABB und zum Leiter der Region Zentraleuropa von ABB ernannt wurde. Banerjee, 51, wechselt von Hewlett Packard, wo er die Funktion des Senior Vice President of Research innehatte und das HP Labs leitete. Davor war Banerjee als Professor für Elektrotechnik und Informatik an der University of Illinois, Chicago, tätig, wo er zudem als Dekan dem College of Engineering vorstand. Darüber hinaus übte Banerjee verschiedene leitende Positionen an Universitäten aus. Im Jahr 2000 gründete er das Unternehmen AccelChip, Inc., einen Anbieter von Produkten und Dienstleistungen im EDA-Bereich, der 2006 von Xilinx übernommen wurde. «Prith ist eine kreative und unternehmerisch denkende Forscher- und Führungspersönlichkeit mit umfassender Erfahrung in der Wirtschaft und der akademischen Welt», so Joe Hogan, Vorsitzender der Konzernleitung von ABB. www.abb.ch

11

BAUGRUPPEN

Prith Banerjee ist neuer CTO von ABB

4.12 megalink

KONFEKTIONIERUNG

N A C H R I C H TE N

Wonderware setzt auf Software von Preactor Preactor Europe, Spezialist für Planungs- und Scheduling-Software, und Wonderware sind in der Schweiz eine Partnerschaft eingegangen. Wonderware ist Anbieter von EchtzeitSoftwarelösungen für die Optimierung der betrieblichen Prozesse. Mit der Software können sichere und standardisierte Applikationen für alle Industriebereiche und die Infrastruktur erstellt und Instand gehalten werden. «Bei den Industrieunternehmen in der Schweiz handelt es sich zu über 90 Prozent um mittelständische Unternehmen mit bis zu 250 Mitarbeitenden. Trotz dieser geringen Grösse bleiben Planung und Scheduling der Produktion komplex. Sie werden mehr und mehr zu einer der Prioritäten der Industrie, mit denen wir konfrontiert werden», François Nomblot, Geschäftsführer von Wonderware SA. «Diese Partnerschaft ist die Frucht einer lang andauernden Zusammenarbeit zwischen Preactor und Wonderware Invensys», erläutert Thierry Faguet, Betriebsleiter Preactor Europe. «Unser Ansatz ist es, Anbietern von MES/APS- oder ERP-Lösungen ein einfaches und leistungsstarkes Produkt zu bieten, das leicht zu installieren ist und es ihnen ermöglicht, die Wünsche ihrer Kunden zu erfüllen.» François Nomblot (links), Geschäftsführer Wonderware SA und Valérie Goulevitch, Head of Global Marketing & Communication , Preactor.

www.wonderware.ch, www.preactor.ch

FLUIDTECHNIK

I

www.men.de

M E C H AT R O N I K

Men Mikro Elektronik hat die Wiederaufnahme der Standardisierungsaktivitäten für Vita 59, Rugged System-On-Module-Express RSE in einem Statement of Work bei der VITA Standards Organization (VSO) beantragt. Ansi/Vita 59 definiert eine COM-Technologie, die insbesondere für den Einsatz in rauer und kritischer Umgebung gedacht ist. Das Statement of Work für die Wiederaufnahme der Standardisierung enthält ausserdem eine signifikante Erweiterung zur bisherigen Spezifikation. Die bei MEN schon seit einigen Jahren unter dem Namen ESMexpress erfolgreichen Computer-On-Modules (COMs) sollen nach Abschluss der Arbeiten an der Spezifikation innerhalb der kommenden 12 Monate zum offiziellen ANSI-Standard werden.

I

ESMexpress werden Standard und kompatibel

Optische Sensoren für alle Fälle einzigartig vielfältig unglaublich funktional klein aber stark äusserst verlässlich innovativ zukunftsweisend

Tel. ++ 41 ( 0 ) 44 877 50 11 Tel. ++ 41 ( 0 ) 44 877 50 11 www.bibus.ch www.bibus.ch

• • • • • •


12

megalink 4.12

N A C H R I C H TE N

Kontron ist umsatzstark und zuversichtlich Kontron hat die dynamische Geschäftsentwicklung der vergangenen Monate auch im zweiten Quartal fortgesetzt und einen Umsatz von 145,2 Mio. Euro erzielt. Das entspricht einer Steigerung von rund 25 Prozent gegenüber dem Vorjahreszeitraum (116,1 Mio. Euro). Im 1. Halbjahr 2011 lag der Gesamtumsatz damit bei 275,3 Mio. Euro gegenüber 213,8 Mio. Euro im 1. Halbjahr 2010. Dies bedeutet ein Plus von ca. 29 Prozent. Die stärksten Umsatzzuwächse wurden mit 44 Prozent in den USA erzielt, aber auch in den Emerging Markets (23 Prozent) und Europa (20 Prozent) profitierte Kontron von einer starken Nachfrage. In den vertikalen Märkten belebten die Anwendungsbereiche Industrielle Automation, Energietechnik, Medizintechnik aber auch wieder das Segment Infotainment das Geschäft. Der Auftragsbestand von 424 Mio. Euro lag weiterhin auf sehr hohem Niveau (Vorjahreswert: 398 Mio. Euro). Auch auf der Gewinnseite konnte Kontron deutliche Steigerungsraten erzielen. Das operative Ergebnis (EBIT) wuchs von rund 7,4 Mio. Euro in den ersten drei Monaten 2011 auf rund 11,4 Mio. Euro im 2. Quartal. Als zukünftiger Wachstumstreiber sieht das Unternehmen neue Schlüsseltechnologien, wie zum Beipsiel Smart Grids für intelligente Stromnetze und Smart Services für intelligente Machine-to-Machine-Dienste in Märkten wie Telekommunikation, Transport oder auch Verkehr. Erst kürzlich hatte das Unternehmen mit einem Betreiber von Energieversorgungsnetzen in Russland ein langfristig angelegtes Technologie-Abkommen zur Entwicklung und Produktion von gemeinsamen neuen Hard- und Softwarelösungen für intelligente Stromnetze in Russland unterzeichnet. www.kontron.de

Südafrikaner gewinnt ersten «DesignSpark chipKIT Challenge» «Seit wir den Wettbewerb im November vergangenen Jahres ins Leben riefen, haben sich weltweit mehr als 1800 Teilnehmer angemeldet. Die Qualität der eingesandten Vorschläge ist bemerkenswert. Es reicht von der Datenerhebung und Robotik bishin zur gesamten Smart-Home-Sektor», stellte Mark Cundle, Technical Marketing Manager bei RS Components fest. Bei Nutzung der Software DesignSpark PCB von RS und der Digilent chipKIT Max32 Entwicklungsplattform, sind Anwender aufgerufen, Designs zu entwickeln, die Energieeffizienz in elektronischen Systemen voranbringt und umweltfreundliche Lösungen fördert. Die Experten-Jury durchforstete die Design Spark Website, um einen Gewinner für den «chipKIT Challenge Community Choice Award» – zu küren. Brian Connell aus Südafrika und sein «Hydroponics Water and Nutrient «Wir ermutigen Ingenieure, Control System» wurden ausgewählt. Um noch nützliche Designs zur Energieeinsparung in Embedden Wettbewerb zu gewinnen, musste der ded System gestützten AnwenTeilnehmer einen kreativen Vorschlag einreidungen einzureichen», so Mark chen, über Fortschritte berichten und DeCundle, Technical Marketing Manager bei RS Components. signSpark-Tools bei der Entwicklung nutzen. Connell erhält unter anderem einen Gutschein im Wert von 100 US-Dollar, um Produkte bei RS zu bestellen. «Wir gratulieren Herrn Connell zu seinem innovativen Projekt und ermutigen Ingenieure, sich noch an dem Wettbewerb zu beteiligen und nützliche Designs zur Energieeinsparung in Embedded System gestützten Anwendungen einzureichen», so Cundle. www.rsonline.ch

Moderate Prognose für europäischen PLC-Markt

Ihr Partner für Elektronik-Entwicklung Industrialisierung Elektronik-Produktion Gerätemontage

Iftest AG · CH-5430 Wettingen · www.iftest.ch Systempartner für Industrie- und Medizin-Elektronik

Der Europamarkt für speicherprogrammierbare Steuerungen (Programmable Logic Controllers, PLC) erlebte aufgrund der Rezession einen starken Rückgang im 2009. Allerdings erholte sich der Markt im Jahr 2010 wieder spürbar. Über die zukünftigen Aussichten im europäischen PLC-Markt wird die Staatsschuldenkrise der Eurozone entscheiden. In der Zwischenzeit wird er langsam und kontinuierlich bis 2017 aufgrund des Aufkommens osteuropäischer Schwellenländer als Produktionszentren für das restliche Europa anwachsen. Laut der aktuellen Studie der Unternehmensberatung Frost & Sullivan, erwirtschaftete der PLC-Europamarkt 1564 Millionen Euro im 2010 und soll bis 2017 auf 2597 Millionen Euro anwachsen. Die globale Wirtschaftskrise und die Schuldenkrise in Europa haben eine Atmosphäre der Unsicherheit geschaffen, die weniger Projekte in den nächsten zwei Jahren erwarten lässt», mahnt Frost & Sullivan Senior Research Analyst Karthik Sundaram. «Dies wird einen beträchtlichen Einfluss auf den allgemeinen industriellen Automatisierungsmarkt sowie auf den europäischen PLC-Markt haben.» Die wachsende Besorgnis der Endanwender im Hinblick auf Cyber Security wird zudem den Markt beeinflussen. «Cyber Security wird einer der wichtigsten Parameter in den Sicherheitsverordnungen und -standards sein, die im Januar 2012 eingeführt werden», erläutert Sundaram. «Das zukünftige Wachstum im europäischen PLC-Markt wird vom Bedarf an erweiterter Cyber Security, globalem Service-Support und bezahlbaren Produkmodellen angetrieben.» Neben dem Wettbewerb zwischen den Unternehmen im Markt sorgen Effizienzsteigerung, der Bedarf an gesetzlichen Vorschriften und verbesserte Sicherheit und Kontrollmöglichkeit für Verbesserungen im PLC-Markt, glauben die Experten. www.frost.com


N A C H R I C H TE N

4.12 megalink

International Fair for the Electrotechnics Supply Industry

BEAULIEU LAUSANNE 22 – 25 I 05 I 2012 www.lausannetec.com

13


14

megalink 4.12

N A C H R I C H TE N

Pilz hat einen neuen Markenauftritt

Pilz hat einen neuen Markenauftritt: Sein Markenzeichen, der gelbe Pfeil, wurde dreidimensional und dynamisch erweitert zu einem gelben Band, das sich durch alle gedruckten und digitalen Medien zieht. Es umspannt, verbindet oder kombiniert die Komponenten Systeme und Dienstleistungen, die Pilz heute anbietet. Der neue Markenauftritt versinnbildlicht die vierfache Sicherheit in der Automation: technisch, persönlich, ökologisch und wirtschaftlich. Technische Sicherheit, weil Sicherheit von Maschinen und Anlagen immer Bestandteil der Produkte und Lösungen von Pilz ist. Persönliche Sicherheit, weil sich Kunden auf eine professionelle Beratung und individuelle Abwicklung verlassen können. Die ökologische Dimension steht für energieeffiziente Produkte und umweltfreundliche Applikationen, weil die Umsetzung umweltschonender Anwendungen stets erste Priorität hat. Die wirtschaftliche Dimension schliesslich beinhaltet effiziente Produktionsabläufe und die Investitionssicherheit von Systemlösungen von Pilz. www.pilz.ch

Fünfter Bildungswettbewerb «xplore New Automation Award 2012» Gespannt war die Stimmung am Freitag, dem 23. März, im Innovation Center Electronics in Bad Pyrmont, als die Gewinner der fünf Kategorien des Bildungswettbewerbs «xplore New Automation Award 2012» bekanntgegeben wurden. Klaus Eisert (links), geschäftsführender Gesellschafter von Gewonnen haben in Phoenix Contact, mit dem Team der Berufsbildenden Schulen der Kategorie «GeMainz, das ein Quad mit einem Elektromotor umgerüstet hat. bäude» das Team von Avans aus den Niederlanden mit einer vom I-Pad aus zu steuernden Waschmaschine. In der Kategorie «Freizeit» überzeugte ein automatisierter Kickertisch der Staatlichen Gewerbeschule Energietechnik. Eine Testmaschine für Nadeln von Insulinspritzen der Lernia Education aus Schweden machte in der Sparte «Industrieanwendungen» das Rennen, eine ökologische Ladestation für Elektrobikes der Berufsbildenden Schulen in Mainz in der Kategorie «Umwelttechnik» sowie das Team der Central Dauphin Senior High School aus den USA für ihre Solar-Aufladestation für ihr selbst umgerüstetes Elektrobike in der Kategorie Bildung. 29 Gruppen aus mehr als 13 Nationen stellten ihre kreativen Automatisierungslösungen den acht Jurymitgliedern aus Wissenschaft, Wirtschaft und Verbänden vor. Einen ganzen Tag lang konnten die Ergebnisse begutachtet werden. Phoenix Contact hatte jeder Gruppe zur Realisierung der Projekte Produkte im Wert von 3000 Euro zur Verfügung gestellt. www.phoenixcontact.ch

Rutronik ist Distributor für Super Micro Rutronik und Super Micro haben einen paneuropäischen Distributionsvertrag geschlossen. Dieser umfasst das gesamte Super Micro-Portfolio an Servern, Workstations oder auch Blades. Damit erweitert Rutronik sein Angebot an embedded Systemen für den Industriemarkt. «Super Micro ist für seine hochperformanten und hocheffizienten Server Building Block Solutions bekannt. Jetzt erweitert der Hersteller sein Portfolio und bietet embedded Lösungen für die Märkte Industrial Automation und Controls mit einer erweiterten Unterstützung. Damit er-gänzen die Produkte unser Portfolio optimal», erklärt Mario Klug, Product Sales Manager Storage, Displays & Boards bei Rutronik. «Wir freuen uns über Rutronik als neuen Partner in Europa. Mit unserer Zusammenarbeit werden wir unsere Reichweite im Markt für embedded Server und Industrie-PCs in dieser Region ausweiten. Unsere Kunden werden von der umfassenden technischen Expertise, dem Service und Support Rutroniks für den Industriemarkt profitieren», so Perry Hayes, President, SuperMario Klug, Product Sales Manager Storage, Displays & Boards bei Rutronik. micro, Netherlands BV. www.rutronik.ch, www.supermicro.com

Neue Operative Leitung bei Feller Mit dem Führungswechsel bei Schneider Electric Schweiz verstärkt der Konzern auch das Management seiner Horgener Tochtergesellschaft. Thomas Lecher hat ab sofort die leitende Funktion bei Feller inne. Das Unternehmen ist für seine Steckdosen, Lichtschalter und Lösungen in der Kommunikationstechnik und Gebäudeautomation bekannt. Diese neu geschaffene Stelle des Chief Operating Officers umfasst die operative Leitung von Vertrieb, Marketing, Entwicklung und Produktion. In seiner vorherigen Thomas Lecher, Chief Operating Officer, Funktion war Lecher als Leiter im Feller AG. Verkauf und Marketing bei der Feller tätig: Mit dem Unternehmen ist er somit bestens vertraut. Schneider will das lokale Management von Feller sowie den Standort Horgen, mit dem Ziel der Fokussierung auf Innovation, Marktnähe und Effizienz, fördern. Seit 1993 ist Feller eine Tochtergesellschaft von Schneider Electric mit Hauptsitz in Paris. www.feller.ch


N A C H R I C H TE N

4.12 megalink

15

Neuer Account Manager bei Westermo Schweiz Ab sofort ist Roberto Serra beim schwedi- Schweiz verantwortlich. Serra kommt für Bruschen Spezialisten für Datenkommunikation no Müller, der sich neuen Aufgaben zuwendet. Westermo für den Sales-Bereich in der Als wichtige Aufgabe sieht der gelernte Informatiker die Weiterentwicklung des Vertriebs sowie die Schaffung von Mehrwerten für Industriekunden und Systempartner des Unternehmens. Dazu gehört auch die fortlaufende Unterstützung und Beratung der Kunden vor Ort sowie die Durchführung von Schulungen oder firmenspezifischen Trainings. «Die robusten Westermo-Produkte bieten im Hinblick auf Roberto Serra will die Nutzung von heutigen Internettechnologien die Marktposition von Westermo wie Mobilfunk oder VDSL für die Vernetzung ausbauen. von Anlagen oder Stützpunkten ein enormes

Potenzial für den wachsenden Schweizer Markt. Mein Ziel ist es, die Marktposition auszubauen und Westermo in seinen Segmenten weiter nach vorne zu bringen», so Roberto Serra. Zur Umsetzung der für die Zukunft gesteckten Ziele kann Serra auf rund vier Jahre Branchenerfahrung zurückgreifen. Der 24-Jährige war zuletzt als Sales Consultant beim ITDienstleister Würth ITensis AG beschäftigt, wo er unter anderem für die Neukundengewinnung zuständig war. Davor arbeitete Serra als Product Manager bei der Brack Electronics und Comsys. www.westermo.ch

ETH-Rat spricht mehr Geld für die Lehre Der ETH-Rat hat an seiner ersten Sitzung in neuer Zusammensetzung den sechs Institutionen ETH Zürich, EPFL, PSI, WSL, Empa und Eawag die Mittel für 2013 zugeteilt. Er folgte dabei dem Grundsatz, die beiden international bestens positionierten technischen Hochschulen weiter zu fördern und die in ihren spezifischen Gebieten erneut starken Leistungen der Forschungsanstalten anzuerkennen. Für ihren ordentlichen Betrieb (Erfüllung des akademischen Grundauftrages) stehen den sechs Institutionen – vorbehältlich der Genehmigung des Budgetantrags durch die Eidgenössischen Räte – im Jahre 2013 2,1 Prozent mehr Mittel zur Verfügung als im Vorjahr. Einen Akzent setzte der ETHRat, indem er den sechs Institutionen zusätzlich zweckgebunden für die Lehre 16,8 Mio. CHF zuspricht, welche bisher noch nicht zugeteilt oder für die strategischen Grossprojekte eingeplant waren. Den Institutionen sollen 2013 somit total 2099 Mio. CHF (+59,7 Mio. CHF) erhalten. Der Rat kommt somit den Forderungen der beiden ETH nach mehr Mitteln für die Lehre nach. «Die ETH Zürich und die EPFL sind aufgefordert, noch verstärkt in ihren eigenen Globalbudgets selbst weitere Prioritäten zu setzen und Mittel zugunsten der Lehre frei zu machen», so Präsident Dr. Fritz Schiesser.

automation

„PSS 4000 – bestechend einfach – einfach bestechend!“ Stellen Sie sich ein Automatisierungssystem vor, das einfach zu handhaben ist und Ihnen Freiraum für Ihre eigentlichen Aufgaben lässt. Ein System, das Ihren Engineeringaufwand wirklich senkt. Ein System, mit dem sich Sicherheits- und Standard-Steuerungsaufgaben einheitlich programmieren lassen. Ein System, das es zulässt, vorgefertigte oder selbsterstellte Komponentenbausteine wiederzuverwenden oder nach Belieben abzuändern. Ein System, das es Ihnen ermöglicht, Ihr Programm unabhängig von der benötigten Hardware zu erstellen. Ein System, das Ihnen die Dezentralisierung der Steuerungsfunktion ermöglicht, ohne auf die zentrale Sicht zu verzichten. Stellen Sie sich vor, dieses System ist da! Das neue Automatisierungssystem von Pilz. PSS 4000 – Simplify your Automation™

www.ethrat.ch Pilz Industrieelektronik GmbH, 5506 Mägenwil 062 889 79 30, pilz@pilz.ch, www.pilz.ch Bureau de vente: 2525 Le Landeron, 032 761 01 01


16

megalink 4.12

N A C H R I C H TE N

RS Components und Omron Europe schliessen strategische Partnerschaft

v.l.n.r.: Fabien Fournier, Global Account Manager, Electrocomponents; John Hickles, European Distribution Channel Marketing Manager, SSC Division Omron Europe B.V.; Marco Brunetti, General Manager EMEA Sales, SSC Division Omron Europe B.V.; Kevin Thompson, General Manager Maintenance, Electrocomponents; Maurizio Poli, SSC Division Manager Omron Europe B.V., und Lucian Dold, Division Marketing Manager, SSC Division Omron Europe B.V.

Der Vertrag zwischen Omron Europe und RS Components beinhaltet sämtliche Bereiche einer strategischen Partnerschaft – einschliesslich Vertrieb, Marketing, Lagerhaltung und gemeinsame Produktentwicklung. Dadurch soll die Zusammenarbeit erheblich

und Sicherheitstechnik, Bildverarbeitung und Sensorik sowie Kontroll- und Schaltkomponenten umfasst. «Dieser Vertragsabschluss ist ein wichtiges Zeichen für eine langfristige Zusammenarbeit. Er stärkt unsere strategische Partnerschaft und legt das Fundament für ein grösseres Engagement, um unseren Kunden in Europa noch bessere Leistungen bieten zu können,» fügt Maurizio Poli, Division Manager für den Bereich Sensing, Safety and Components bei Omron Europe B.V., an. Kevin Thompson, General Manager Maintenance bei Electrocomponents, erläutert: «Dieser Vertragsabschluss stärkt unsere Position auf dem Markt. Unsere Kunden werden die Verschmelzung des Know-hows im Bereich Automatisierungstechnik mit unseren Premium-Service-Angeboten, unserer logistischen Infrastruktur und unseren eCommerce-Lösungen zu schätzen wissen.»

erleichtert, neuer Raum für gemeinsame Projekte geschaffen und das Produkt- und Service-Portfolio für die europäischen Kunden ständig erweitert werden. RS bietet zukünftig das gesamte Produktspektrum von Omron an, das Automatisierungs-, Antriebs- industrial.omron.ch, www.rsonline.ch

APM Technica Deutschland zieht um Bereits ein Jahr nach der Gründung zieht die APM Technica GmbH an einen grösseren Standort um – nach Pürgen-Ummendorf bei München. Ausserdem will die Unternehmung ihr Dienstleistungsangebot vergrössern: Zur Beratung in den Bereichen Klebeund Oberflächentechnik kommen die Lohnfertigung für Klebeteile sowie die Herstellung von Kleb- und Dichtstoffen hinzu. Dank modernsten Einrichtungen erfüllt die neue

Produktion die Ansprüche der Elektronik, Optik und Medizinaltechnik. Eine Spezialität des Unternehmens ist die Herstellung von bereits gemischten, tiefgekühlten 2K-Klebstoffen. Neben der Beratung in den Bereichen Oberflächen-, Füge- und Klebetechnik bietet die APM Technica ihr Know-how auch als praktische Lohnarbeit an. Spezialisten stellen zum Beispiel optische und elektronische Baugruppen, Senso-

ren und anderer Fügeteile her. Die APM Technica GmbH wurde 2011 als deutsche Niederlassung der Schweizer APM Technica AG gegründet. Das gesamte Unternehmen beschäftigt heute über hundert Mitarbeiter an vier Standorten. Kunden von APM Technica sind Hersteller und Zulieferer aus der Medizintechnik, Optik oder Elektronik und weiteren Hightech-Industrien. www.apm-technica.ch

Speicherspezialist Swissbit mit mehr Produktion, Logistik- und Support-Services schäfts auswirkte. Die Industrieautomation und Communication/Network erwiesen sich als besonders wachstumsstark. Hier erwirtschaftete Swissbit das grösste Plus mit NAND-Flash-Speichermodulen, aber auch bei slim SATA, mSATA und CFast-Karten sowie Industrial SSDs (Solid State Discs) . Daraufhin hat der Bronschhofer Hersteller seine Produktion sowie den Logistik- und Support-Service ausgebaut. Die starke Kundennachfrage veranlasste Swissbit, seine Produktion in Berlin auszubauen und neue Mitarbeiter einzustellen. Der Speicherhersteller erhöhte seine Produktionskapazität, baute seine Produktionslinien speziell in der Swissbit hat guten Grund zur Freude. Der Bronschhofer Hersteller hat insgesamt 50 Prozent mehr Speicherlösungen verkauft. Waferverarbeitung und im Packaging aus Gut 50 Prozent mehr verkauft hat der Anbie- Am stärksten wuchs die Nachfrage in der und investierte in neue Stack-Technologien. ter für Speicherlösungen, Swissbit, 2011 als DACH-Region sowie in den USA, wo sich auch der Ausbau des Swissbit Amerikage- www.swissbit.ch im guten Geschäftsjahr 2010.


CLARE IXYS WESTCODE ABB KUNZE JUNIOR THERMACORE TELCON SWISSBREEZE ASSEMBLIES Solid State Relays

Reichle & De Massari mit mehr Umsatz und Investitionen in die Zukunft Der Schweizer Verkabelungsspezialist Reichle & De-Massari konnte sich 2011 in einem anspruchsvollen Umfeld gut behaupten. In zahlreichen Ländern gelang es, Marktanteile dazuzugewinnen und in den wichtigsten Märkten die Position zu konsolidieren. Infolge des starken Schweizer Frankens resultierte

Der Reichle & De Massari-Haupsitz in Wetzikon.

Verschlankungen in den Produktionsprozessen abgefedert werden. Durch den Aufbau eines neuen Produktionswerkes für Fiberoptikprodukte in Bulgarien will das Unternehmen die langfristige Wettbewerbsfähigkeit in diesen hart umkämpften Wachstumssegmenten sicherstellen. Nach wie vor versteht sich R & M als Schweizer Hersteller und will Arbeitsplätze auf dem heimischen Werkplatz erhalten. Daher bleiben Forschung und Entwicklung, das Marketing sowie der dominierende Teil der hoch automatisierten Produktion weiterhin am Hauptsitz in Wetzikon konzentriert. In Ergänzung dazu hat der Spezialist stark in die Entwicklung neuer Produkte investiert. Basierend auf einer eigenen Marktanalyse und KundenFeedbacks, wurden zudem die neuen Wachstumsbereiche Datencenter und FTTH gezielt ausgebaut. Der Wetzikoner verfügt über zahlreiche Ideen für neue Produkte und Projekte, wobei die firmeninternen Entwickler wichtige Unterstützung in der engen Zusammenarbeit mit Hochschulen und Forschungseinrichtungen finden.

ein bescheidenes Umsatzplus von gut fünf Prozent auf CHF 189,4 Mio. Die Währungssituation hat denn auch beim Ertrag deutliche Spuren hinterlassen und führte mit einer EBIT-Marge von –0,5 Prozent zu einem kleinen operativen Verlust. Ungeachtet dessen ist die Bilanz des Unternehmens weiterhin sehr gesund. Der entstandene Kostendruck konnte durch gezielte Neuverhandlungen mit langjährigen Lieferanten, www.rdm.ch ein verstärktes Natural Hedging sowie weitere

Bachmann Electronic übernimmt Certec Der HMI- und Scada-Anbieter Certec EDV gehört ab sofort zur Bachmann-Gruppe. Rückwirkend zum 1. Januar 2012 hat die Firma Bachmann mehrheitlich die Geschäftsanteile von Certec erworben. Certec hat sich seit seiner Gründung in Jahr 2005 auf die Entwicklung von webbasierten HMI- und SCADA-Lösungen spezialisiert. Mit derzeit 20 Mitarbeitern verfügt das Unternehmen über ein breites Anwendungs-Know-how. Bachmann, Anbieter kompletter Systemlösungen im Bereich Automatisierungstechnik, wird mit den Visualisierungs- und Scada-Technologien der atvice-Produktfamilie das bestehende Portfolio ergänzen. «Mit diesem Schritt tragen wir den Anforderungen unserer Kunden Rechnung, die Gesamtlösungen erwarten», begründet Bernhard Zangerl, CEO von Bachmann Electronic den Zusammenschluss. Michael Haas, CEO von Certec, erklärt: «Die nachhaltige Verbreitung neuer Technologien wird durch eine Partnerschaft mit Herstellern wie Bachmann erst möglich.» Die Geschäftsleitung von Certec bleibt ebenso unverändert wie der Hauptsitz in Eisenstadt und das bestehende Distributionsnetz. Bernhard Zangerl (rechts), CEO der Bachmann electronic GmbH, und Michael Haas, CEO der Certec EDV GmbH.

www.bachmann.info, www.atvise.com

Power Semiconductors

High Power Semiconductors

High Power Semiconductors

Foils & Powerclips

Heatsinks

Heatpipes

Current Sensors

AC-& DC-Fans by PowerParts

by PowerParts


18

megalink 4.12

N A C H R I C H TE N

Baumer ist erneut «Top-Arbeitgeber» Die Arbeitsbedingungen beim Sensorhersteller Baumer sind einmal mehr ausgezeichnet: das CRF Institute hat Baumer Electric erneut als «Top Employer Schweiz/Suisse» zertifiziert. Insgesamt wurden in diesem Jahr 19 Unternehmen in der Schweiz zertifiziert. Bewertet wurden dabei die primären und sekundären Benefits, Work-Life-Balance oder auch Karrieremöglichkeiten. «Top Employers zeigen, dass sie ihre Mitarbeitenden schätzen und dementsprechend auch fördern»; so fasst das CRF Institute, ein David Plink, CEO des CRF Institute, und Alfred Dumelin Spezialist auf dem Gebiet des internationalen (rechts), Leiter Personal und Ausbildung bei Baumer.

Personalmanagements, die Kriterien seiner unabhängigen Untersuchung zusammen. «Wir sind stolz darauf, auch in diesem Jahr wieder zu den Top-Arbeitgebern in der Schweiz zu gehören. Die Auszeichnung ist Anerkennung und Ansporn zugleich. Wir wollen auch künftig dafür sorgen, dass sich Mitarbeiter bei Baumer wohlfühlen. Denn wir sind uns der grossen Bedeutung von motivierten und begeisterten Talenten für den Unternehmenserfolg bewusst», so Alfred Dumelin, Leiter Personal und Ausbildung. www.baumer.com

Danfoss erhält Supplier Award von AL-KO Anlässlich seines runden Geburtstags wollte der Fahrzeugtechniker AL-KO aus dem byrischen Kötz seine Lieferanten feiern und prämierte sie in den Kategorien Leistung, Zuverlässigkeit, Qualität, Innovation und Kooperation. Seit fast 20 Jahren arbeiten AL-KO und die Danfoss VLT Antriebstechnik zusammen.

Das bayrische Unternehmen sieht sich mit Danfoss in dem Bestreben vereint, die Energieeffizienz von Lüftungs- und Klimageräten zu steigern und damit CO2-Emissionen zu senken. Mit dem Preis gewürdigt wurde das von der Danfoss VLT Antriebstechnik entwickelte Steuerungskonzept für unterschiedli-

Anwendung verstanden, clever gelöst

che Motortypen. Seinen Ausdruck findet der Lieferanten-Award in einer Miniaturausgabe der Skulptur des Künstlers Terence Carr, die dieser speziell für das 80-Jahr-Firmenjubiläum schuf. www.danfoss.ch

Passt

Schnellere Produktwechsel, höhere Präzision und das bei weniger Makulatur – der Markt verlangt viel. Wie erfüllen Sie alle diese Anforderungen gleichzeitig und verschaffen sich damit einen entscheidenden Wettbewerbsvorsprung? Mit flexiblen Systemlösungen von Rexroth, dem Automatisierungsspezialisten für alle Druckund Verarbeitungsprozesse. So realisieren Sie Produktwechsel auf Knopfdruck und höchste Produktqualität durch perfekte Synchronisation aller Maschinenprozesse – und das schon vom Produktionsstart an. Erfahren Sie von uns, wie wir auch Ihre Anwendung clever lösen. Besuchen Sie uns auf der drupa vom 3. Mai bis 16. Mai 2012 in Halle 3, Stand 3A70. Bosch Rexroth Schweiz AG www.boschrexroth.com/printing


c o s m i c . c h

N A C H R I C H TE N

Magelis STU Die Revolution in der Montagetechnik Mit der 22 mm Befestigungstechnik, bewährt in der Montage von Befehls- und Meldegeräten, kann das Magelis STU überall bequem, schnell und einfach eingebaut werden.

Optimale Visualisierung > 3.5” Farbdisplay mit 65 000 Farben in QVGA Auflösung > Umfangreiche Funktionalität der Konfigurationssoftware Vijeo Designer

Neuartiges Konzept > Modulares Design mit abnehmbarem Display und umfangreichen Kommunikationsschnittstellen. Da bleiben keine Wünsche offen!

Einfache Wartung > LED-Hintergrundbeleuchtung, abnehmbarer Versorgungsstecker, keine Batterie, und vieles mehr…

> USB-Stick zum Download der Applikation verwendbar

Offen für Kommunikation > Serienmässig integrierte serielle und Ethernet-Schnittstelle für Modbus TCP, EtherNet /IP, ISO-on-TCP, Sysmac Eth, Melsec TCP, uvm.

Schneider Electric (Schweiz) AG, 3063 Ittigen, Tel. 031 917 33 33, www.schneider-electric.ch

4.12 megalink

19


20

megalink 4.12

N A C H R I C H TE N

Zwölf neue Klebespezialisten

Wettbewerb für Leiterplattendesigner

12 Klebpraktiker wurden vom 19. bis 23. März 2012 bei Delo Industrieklebstoffe in Windach ausgebildet. Durchgeführt wurde das Seminar vom TechnologieCentrum Kleben. Das TC-Kleben ist öffentlich anerkannt und akkreditiert. Der Lehrgang ist europaweit anerkannt und wendet sich an Mitarbeiter, die in ihren Unternehmen für den Umgang mit Klebstoffen verantwortlich sind, wie zum BeiDen fachmännischen Umgang mit spiel Produktionsmitarbeiter, TechKlebstoffen lernen die Teilnehmer im niker oder Qualitätssicherer. Ziel Delo-Labor in ist es, Mitarbeitern Know-how Windach. über Klebstoffe und deren Anwendungen zu vermitteln. Nach entsprechender Prüfung erhalten die Teilnehmer das DVS-EWF-Zeugnis. www.delo.de

Auf der 20. Jahreskonferenz vom 20. bis 22. September 2012 in Dresden verleiht der Fachverband für Design, Leiterplatten und Elektronikfertigung (FED e.V.) erstmals den PCB Design Award. Leiterplattendesigner aus Deutschland, Österreich und der Schweiz sind darum eingeladen, ihr Design für den PCB Design Award 2012 einzureichen. Voraussetzung dafür ist, dass die Schaltung auf der Basis einer bestückten Leiterplatte realisiert wurde. Ausserdem muss von der eingereichten Lösung ein funktionsfähiger Prototyp existieren. Die Designs bewertet eine sechsköpfige Experten-Jury nach festgelegten Kriterien. Der Preis wird in den vier Kategorien 3D/Bauraum, HighPower, HDI und Kreativität verliehen. Die Ausschreibungs- und Bewerbungsunterlagen sind online hinterlegt. Der Einsendeschluss für die Bewerbung ist der 15. Juni 2012. www.pcb-design-award.de, www.fed.de

Erfahrene Anwender steigern Robotereinsatz Im Rahmen einer Untersuchung interviewte Quest TechnoMarketing 215 Firmen aus der Maschinenbau-Branche. Mit 45 Prozent setzt fast jeder zweite Befragte Roboter an den Maschinen ein. Damit sind sie längst keine Nischenanwendung mehr. In den nächsten drei Jahren werden neue Erstanwender hinzukommen, sodass 50 Prozent der Teilnehmer Roboter an den Maschinen einsetzen. Was die Maschinen betrifft, so rüsten die Maschinenbauer im Allgemeinen nur einen Teil ihres Maschinenprogramms mit Robotern aus. Die Anzahl dieser mit Robotern ausge-

rüsteten Maschinen steigt bis 2014 um 31 Prozent. Das dynamische Wachstum des Robotereinsatzes an den Maschinen geht zu 99 Prozent auf Maschinenbauer zurück, die bereits jetzt Roboter einsetzen. Aus diesem Ergebnis folgt zweierlei: die Maschinenbauer sind mit dem Robotereinsatz so zufrieden, dass sie ihn weiter ausdehnen und das wachsende Einsatzerfahrungen und erweiterte Anwendungen werden zu immer differenzierteren Anforderungen der Maschinenbauer führen. Auch für die Maschinenbauer selbst wird das Engineering der Roboter-Anwendung immer

anspruchsvoller werden. Knapp zwei Drittel machen das Engineering der Roboter-Anwendung komplett selbst. Dabei kauft ein Viertel dieser Maschinenbauer nur einzelne Roboter-Komponenten. Ein gutes Drittel hingegen kauft den Roboter komplett und realisiert dann das Engineering selbst. Mit immer stärker differenzierten Anforderungen wird nicht nur das Engineering anspruchsvoller, sondern eröffnen sich mehr Möglichkeiten für die Maschinenbauer, mehr Kundennutzen und Wettbewerbsvorteile zu schaffen. www.quest-technomarketing.de

Trotz Umsatzrekord im 2011 spürt Wago die konjunkturelle Unsicherheit In einem guten, aber auch durchwachsenden Geschäftsjahr 2011 hat die Wago-Gruppe ihren Umsatz gesteigert. Das Unternehmen erhöhte seinen Vorjahresumsatz von 503 Millionen Euro um 12,3 Prozent auf 565 Millionen Euro. Mit einem Anteil von knapp 40 Prozent erwirtschaftete der Anbieter von Komponenten der elektrischen Verbindungstechnik und Automatisierungslösungen den

grössten Teil seines Umsatzes in Deutschland und der Schweiz. Es folgten das sonstige Europa mit 33 und die restlichen Länder mit 27 Prozent. Demnach bleibt Europa weiterhin mit einem Umsatzanteil von insgesamt 73 Prozent der wichtigste Markt. Trotz der insgesamt positiven Geschäftsentwicklung war 2011 nach Angaben der Unternehmensleitung «kein einfaches Jahr». Wie

Geschäftsleitung Wago-Gruppe: (von links) Sven Hohorst, Axel Christian Börner und Ulrich Bohling.

(Bilder: Wago)

die drei Geschäftsführer Sven Hohorst, Axel Börner und Ulrich Bohling in Minden erklärten, hatte Wago seine Produktionsstandorte durch den Abbau der Auftragsüberhänge aus dem Vorjahr sowie den Aufbau des Lagerbestandes in den ersten Monaten des Jahres gut auslasten können. «Allerdings mussten wir in der zweiten Jahreshälfte im Vergleich zum Vorjahreszeitraum Auftragsrückgänge hinnehmen.» Der Spezialist will seine Wachstumsstrategie fortsetzen und weiterhin langfristig in die Entwicklung neuer Produkte für Zukunftsmärkte investieren, um in der Verbindungstechnik ebenso wie in der Automation weitere Marktanteile im Weltmarkt erobern zu können. Wago hat seit 1995 insgesamt 22 Tochtergesellschaften gegründet und verfügt derzeit über ein eigenes Vertriebsnetz in rund 30 Ländern. Hinzu kommen Landesvertretungen in weiteren 42 Ländern. Noch in der ersten Hälfte des Jahres 2012 gesellt sich eine weitere Vertriebstochtergesellschaft in Südkorea hinzu. www.wago.ch


Contrinex schafft mit SAP die Strukturen für Wachstum der Zukunft schaffen: Nach einer erfolgreichen Implementierung ist seit Jahresbeginn die Unternehmenssoftware SAP im Schweizer Headquarter und in den Produktionsgesellschaften Ungarn, Brasi-lien, China und Schweiz im Einsatz. Mit einem neuen Produktionsgebäude in Ungarn, dessen Rohbau im Februar fertiggestellt wurde, ist ab Sommer 2012 eine Verdopplung der Produktionsfläche auf 4 000 m2 geplant. Zudem konnte der Sensorikspezialist 2011 sowohl einen Umsatz- als auch einen Ergebnis-Rekordwert erzielen. Im letzten Jahr konnte der Umsatz erneut um 18 Prozent Der Sensorik-Spezialist führt SAP im Schweizer Headquarter und in auf nunmehr 60 Mio. Euro bei einem EBIT von den Produktionsgesellschaften weltweit ein. über 10 Prozent gesteigert werden. Der Hersteller von industrieller Elektronik, Contrinex, will Strukturen für profitables Wachstum in www.contrinex.ch

Trotz Verlust bleibt A123-Systems optimistisch Anstelle von Kobaltoxid benutzt A123-Systems ein Elektrodenmaterial aus Lithiumeisenphosphat-Nanopartikeln für seine Lithium-Ionen-Akkus, die mit Spuren anderer Metalle dotiert sind. Dadurch bekommen die Batterien nicht nur eine bemerkenswerte Leistungsdichte, sie sind auch weniger feuergefährlich, selbst wenn sie in einen Unfall geraten. Ausserdem halten die Akkus länger als normale Lithium-Ionen-Akkus. Versprechen dieser Art machte das Unternehmen zu einem der bestfinanzierten Start-ups der USA. Mit seinen Akkus wollte das von MIT-Forschern gegründete Unternehmen den Markt für Elektro-Autos gehörig aufmischen. Der 2001 gegründete Batteriespezialist aus Waltham, Massachusetts, stand unlängst im Mittel-

punkt einer Initiative der Obama-Regierung, die die Anzahl der Elektrofahrzeuge auf den Strassen massiv erhöhen wollte. Das einst gefeierte Startup muss nun schlechte Zahlen einräumen. 2011 habe man mit 258 Millionen US-Dollar Verlust abgeschlossen, nach einem Minus von 152 Millionen im Jahr 2010. Trotz der wirtschaftlich schwierigen Lage gibt sich die Firmenleitung weiterhin optimistisch. Betriebsund Kapitalkosten sollen 2012 deutlich gesenkt und der Umsatz um mindestens 45 Prozent gesteigert werden. Doch um diese Zahlen zu erreichen, müsste die Öffentlichkeit eines tun: mehr Elektrofahrzeuge kaufen. www.a123systems.com

Umfirmierung von Friedrich Lütze Mit Wirkung zum Januar 2012 ändert die Friedrich Lütze GmbH & Co. KG ihre Firmierung in Friedrich Lütze GmbH. Der Automatisierungsspezialist will damit ein Signal setzen und reagiert auf die weitere internationale Ausrichtung des Unternehmens. Die Lütze-Gruppe mit weltweiten Niederlassungen und Vertretungen erwirtschaftete 2011 einen Umsatz von rund 80 Mio. Euro. Das Familienunternehmen wird in zweiter Generation geführt. Die Friedrich Lütze GmbH in Weinstadt.

www.luetze.ch

Siemens als «Top-Arbeitgeber 2012» ausgezeichnet Das international tätige Research-Unternehmen CRF Institute hat die Siemens Schweiz AG für ihr herausragendes und modernes Personalmanagement mit dem Titel «Top-Arbeitgeber 2012» ausgezeichnet. Siemens Schweiz erreichte das Prädikat «sehr gut» in den Untersuchungskriterien «Karrieremöglichkeiten», «Unternehmenskultur», «Primäre Benefits» und «Training und Entwicklung». «Besonders freut mich, dass wir das Ergebnis des letzten Jahres übertroffen haben», sagt Garry

Wagner, Personalleiter der Siemens Schweiz AG. «Damit zeigen wir auf, dass wir unser Personalmanagement erfolgreich weiterentwickeln.» Sogar mit dem Maximum von fünf Sternen und dem Prädikat «hervorragend» wurde das Untersuchungskriterium «Sekundäre Benefits & Arbeitsbedingungen» bewertet. Bei diesem Punkt holte sich das Unternehmen die beste Bewertung aller teilnehmenden Firmen. www.siemens.ch


22

megalink 4.12

NACHSCHAU

WAGO FUNK-ROADSHOW 2012: 8. MÄRZ 2012 IN WINTERTHUR

Auf der gleichen Funkwelle Kabellose Technologien bieten viele Vorteile und ermöglichen neue Anwendungen – doch wo liegen die Grenzen? Diese und andere Fragen beantwortete Prof. Wollert von der Fachhochschule Bielefeld im Rahmen der Funk-Roadshow. Die eintägige Veranstaltung vermittelt neben aktuellem Wissen auch die praxisgerechte Umsetzung anhand von Referenzbeispielen.

Datenübertragung per Funk: geht oder geht nicht? Prof. Wollert wusste die präzise Erklärung. (Bilder: D. Wallimann)

B

ereits zum zweiten Mal veranstaltete Wago zusammen mit der Carl Geisser AG die Funk-Roadshow. Das Tagesseminar zum Thema «Wireless Experience im Maschinen- und Anlagebau» mit Stopps in Egerkingen und Winterthur richtete sich an Automatisierer, Maschinenbauer und Ingenieure, die nach Wireless-Lösungen und -Technologien im Maschinen- und Anlagebau suchten. Zwischen den Vortragsblöcken packten die Teilnehmer die Gelegenheit, ihre spezifischen Fragestellungen mit den Funkspezialisten zu klären.

Kommunikations-Know-how direkt aus der Forschung. Als Hauptredner führte Prof. Dr. Jörg F. Wollert von der Fachhochschule Bielefeld virtuos durch die Veranstaltung. «Trends der industriellen Kommunikation» war Thema des ersten Themenblockes. Der Professor für Mechatronik und Automatisierungstechnik erläuterte die Megatrends und ihre Entwicklung: von Ethernet über die durchgängige Kommunikation bis zu Safety. Dabei war er sich nicht zu schade, Grundlagen der Ethernet-Technologie nochmals mit einem sehr anschaulichen Foliensatz zu erläutern und Publikumsfragen zu beantworten. Auch die Rolle von IP und TCP für durchgängige Kommunikationssysteme, wie zum Beispiel Profinet, zeigte der Netzwerkspezialist auf. Die Grundlagen der Funkkommunikation wurden nach der Kaffeepause vermittelt, wie unter anderem die Signalausbreitung oder das Linkbudget. Mithilfe eines Sensors veranschaulichte er dies dem Fachpublikum. Auch regulatorische Anforderungen an die Funktechnik und mögliche Einsatzgebiete zeigte Prof. Wollert auf. Danach vermittelte der Experte Grundwissen verschiedener Funktechnologien wie Bluetooth, Wifi oder Zigbee, die privat wie auch im industriellen Einsatz an Bedeutung gewinnen. Da viele Standards im 2,4 GHz Band arbeiten,

ist in industriellen Anwendungen entscheiden zu wissen, wie zuverlässig und schnell eine Funkverbindung ist. Deshalb erläuterte der Referent die Kanalbelegung im 2,4 GHz Band, die Auswirkung der Kanalnutzung als auch wie WIFI, Bluetooth und koexistieren können, ohne sich gegenseitig zu stark zu stören. Wenn EMV dem Funk das Leben schwer macht. Thomas Schaller von Wago berichtete am Nachmittag in seinem Referat über Erfahrungen mit einer Applikation im ABB Hochleistungslabor in Baden, die Bluetooth in stark EMV-belasteten Umfeld einsetzt (lesen Sie dazu auch den Artikel «Mit Bluetooth genauer messen» in der Megalink 3/2012 auf Seite 77). Bruno Senn, Geschäftsführer der Carl Geisser AG, zeigte anhand von Appliaktionsbeispielen aus dem Maschinen- und Anlagenbau auf, wie und wo drahtlose Schaltgeräte und Sensoren eingesetzt werden können. Energie beziehen diese entweder aus einer Batterie oder gewinnen sie aus der Umwelt, was als «Energy Harvesting» bezeichnet wird. Der letzte Block - geleitet von Prof. Wollert - beinhaltete Funk in extremen Anforderungen, dieser beinhaltete die funktionale Sicherheit, wie zum Beispiel die Anforderungen an sichere Funksysteme. ■

INFOS Wago Contact 1564 Domdidier Tel. 026 676 74 36 Info.switzerland@wago.com www.wago.ch

Carl Geisser AG 8117 Fällanden Tel. 044 806 65 00 info@carlgeisser.ch www.carlgeisser.ch

Fach- und Praxiswissen wurde währen der Funk-Road-Show den Seminarteilnehmer direkt vor Ort vermittelt.


EBV LIGHTLAB Neue Gestaltungsmöglichkeiten für Ihre Individuelle Lichtwelt! EBV Elektronik ist der führende Spezialist für Optoelektronik in EMEAs Halbleiterdistribution und auch das erste Unternehmen, das Kunden europaweit kostenlosen Zugang zu einem Lichtlabor bietet. Das EBV LightSpeed-Team ermöglicht es Kunden nun im EBV LightLab radiometrische und photometrische Messungen über die gesamte Beleuchtungskette durchführen. Angefangen bei Messungen an einzelnen LEDs oder LED-Modulen über vergleichbare Messungen an Lichtquellen wie zum Beispiel Glühlampen gegenüber CFLoder LED-Lösungen bis hin zu Messungen kompletter Lampen. Für mehr Informationen wenden Sie sich bitte an Ihr EBV LightSpeedTeam vor Ort oder besuchen Sie ebv.com/lightlab.

Distribution is today. Tomorrow is EBV. CH-8953 Dietikon | & +41 (0)44 745 61 61 www.ebv.com


24

megalink 4.12

N A C H S C H AU N I D AY S

NIDAYS BEREITS ZUM 15. MAL EIN VOLLER ERFOLG

Eine Veranstaltung bewegt Bereits zum 15. Mal hat der Technologie- und Expertenkongress NIDays, der am 6. März 2012 im Swissôtel Zürich stattfand, seine rund 400 Besucher begeistert. Ein Highlight war unter anderem die von Prof. Dr. Rolf-Dieter Heuer, Generaldirektor des CERN in Genf, gehaltene Keynote zum Thema «Das Forschungszentrum CERN – von den höchsten Energien zu den kleinsten Teilchen».

Rahman Jamal, Technical & Marketing Director Europe bei NI, zeigte mit den «Angry Eagles», wie viel Spass es macht, mit LabView zu arbeiten.

Christian Moser, Managing Director National Instruments Schweiz, eröffnete die 15. NIDays.

Wir müssen jetzt etwas tun», forderte Christian Moser, Managing Director von National Instruments Schweiz, die rund 400 Besucher im bis zum letzten Platz besetzten grossen Saal des Swissôtel in seiner Eröffnungsrede auf. Und NI geht mit gutem Beispiel voraus: Bereits zum 15. Mal organisierte die Schweizer Niederlassung des Spezialisten für Mess-, Steuer- und Regelsysteme aus dem texanischen Austin die NIDays – und sowohl das Unternehmen als

auch der Kongress haben ein eindrückliches Wachstum hingelegt. Und das Unternehmen will weiter wachsen – hauptsächlich organisch sowie durch Partnerschaften. Die über 600 Partnerunternehmen in mehr als 40 Ländern weltweit sind eines der Erfolgsrezepte von NI, weshalb Christian Moser die Zuhörer ermunterte, Partnerschaften zu suchen – wozu die NIDays mit ihrem breiten Spektrum an Teilnehmern und Themenbereichen eine optimale Plattform boten.

« CERN

Das CERN, die Europäische Organisation für Kernforschung, ist eine Grossforschungseinrichtung bei Meyrin im Kanton Genf. Am CERN wird physikalische Grundlagenforschung betrieben, insbesondere wird mithilfe grosser Teilchenbeschleuniger der Aufbau der Materie erforscht. Das Akronym CERN leitet sich vom französischen Namen des Rates ab, der mit der Gründung der Organisation beauftragt war, dem Conseil Européen pour la Recherche Nucléaire. Die offiziellen Namen des CERN sind European Organization for Nuclear Research im Englischen beziehungsweise Organisation Européenne pour la Recherche Nucléaire im Französischen. Derzeit hat das CERN 20 Mitgliedstaaten. Mit über 3000 Mitarbeitenden ist das CERN das weltgrösste Forschungszentrum auf dem Gebiet der Teilchenphysik. Über 10 000 Gastwissenschaftler aus 85 Nationen arbeiten an CERN-Experimenten. Das Jahresbudget des CERN beträgt über 1 Milliarden Schweizer Franken. (Quelle: Wikipedia)

(Bilder: P. Müller)

Dem Ingenieur ist nichts zu schwer. Ingenieure haben keinen einfachen Job, wie der Managing Director von NI Schweiz aufzeigte. Immer kleinere Teams müssen immer komplexere Aufgaben in noch kürzerer Zeit lösen. Gleichzeitig soll natürlich die Effizienz des Endproduktes möglichst hoch sein, dessen Energieverbrauch minimiert werden und zudem das Know-how und die Investitionen vor Diebstahl geschützt sein. Beim Anblick dieser Tatsachen fragte sich wohl mancher Zuhörer: «Warum wurde ich nur Ingenieur?» Doch genau hier springt National Instruments ein. Das Unternehmen hat sich auf die Fahne geschrieben, Ingenieure und Wissenschaftler mit einem Werkzeug auszurüsten, das die Produktivität erhöht, Innovation beschleunigt und Entdeckungen fördert. So können sich Experten voll auf die Lösung des Problems konzentrieren und müssen sich nicht mit Tools und technischen Unzulänglichkeiten herumärgern, sodass die Arbeit Spass macht. Dass LabView Spass macht, bewiesen Dr. James Truchard, Mitgründer und CEO von


Mehr als 11000 Steckverbinder von 40 führenden Herstellern im Katalog oder Online Shop:

www.compona.ch National Instruments und Rahman Jamal, Technical & Marketing Director Europe bei NI, gleich selber – mit den «Angry Eagles» (siehe Bild), einem mit NI-Tools entwickelten Angry-Birds-Klon mit realer Stein- beziehungsweise Vogelschleuder. Zudem präsentierte das NI-Team an der Keynote aktuelle Technologietrends und neue Produkte. Das gezeigte Anwendungsspektrum reichte von der industriellen Mess- und Prüftechnik über automatisierte Tests bis hin zu Steuer- und Regeltechnik und allgemein Embedded Systemen. Erwähnenswert ist der Sprung im Frequenzbereich von NIs HFProdukten von 6 GHz auf 26,5 GHz innerhalb nur eines Jahres. Darüber hinaus wurden auch die vier neuen Einplatinen-Embedded-Systeme der Produktplattform NI Single-Board RIO gezeigt (siehe Megalink 3/2012). Das grösste Mikroskop der Welt. Prof. Dr. Rolf-Dieter Heuer, Generaldirektor des CERN in Genf, bot den Besuchern einen tiefen Einblick in die faszinierende Welt des Kleinsten. Mithilfe des 27 km langen Large Hadron Collider (LHC) jagen die Physiker die kleinsten Teile und versuchen so, die Geheimnisse des Universums etwas zu lüften, wie etwa, was alles zusammenhält oder was es mit der Dunklen Materie genau auf sich hat. Bei der Steuerung des LHC kommen mehrere Hundert PXISysteme von National Instruments zum Einsatz, ausserdem werden mit NI LabView Real-Time und NI LabView FPGA entlang des in einer Tiefe von rund 100 Metern liegenden Beschleunigers ca. 600 Motoren auf die Millisekunde genau synchronisiert. Vorträge im 30-Minuten-Takt. Nach der Keynote verteilten sich die Teilnehmer auf die sieben Vortragsräume, um einer der 50 Präsentationen zu lauschen. Das Spektrum war äusserst gross. Die Themen der einzelnen Tracks reichte von «Software Development Techniques», «Industrial Measurement & Control», «Automated Test & Measurement», «Real-Time Testing & HIL Simulation» bis zu «Advanced Measurements». 

«Ich habe die NIDays primär besucht, um meine CLAD-Zertifizierung zu erneuern. Mein persönliches Highlight war der Vortrag von Zühlke zum Thema ‹Usability›.»

FCI: Wire-To-Board-System im 1,25-mm-Raster

Andreas Ketterer, Software Development, Rena GmbH

«Die NIDays sind die ideale Plattform, um zu zeigen und zu sehen, welche Möglichkeiten die NI-Produkte bieten. Die NIDays bieten eine sehr gute Mischung aus aktiver Kundenpflege und Erfahrungsaustausch.» Alessandro Sebaste, Geschäftsleitung, Noser Engineering AG

Das neue, einreihige 1,25-mmWire-To-Board-System ist in den Polzahlen 2 bis 15 (ausbaubar bis 20-polig), in THT und SMD, mit Gold- und Zinn-Oberflächen sowie in geraden und abgewinkelten Versionen lieferbar. Besonders hervorzuheben ist, dass dieses Steckersystem «UL approved» ist und die Glühdrahtprüfung IEC 60695-2 (Glow Wire Test) erfüllt.

SMT-Universalkontakte von ITT

‹‹Die NIDays geben uns die Möglichkeit, aufzuzeigen, wie einfach Motion Control dank den hochpräzisen Maxon-Antriebssystemen mit LabView umgesetzt werden kann.›› Jan Braun, Technical Training, Maxon Motor A

«Zühlke hat über 20 Jahre Erfahrung mit LabView und NI-Produkten. Darum ist es für uns selbstverständlich, an den NIDays teilzunehmen, um Kontakte mit anderen professionellen Anwendern zu pflegen.» Amadeo Vergés, Business Unit Leiter, Zühlke Engineering AG

Diese robusten Universalkontakte sind mit mehr als 3000 Steckzyklen spezifiziert. Sie sind in einer 12-mm-«Tape and Reel»-Verpackung erhältlich (EIA-481-Standards). Der selektiv vergoldete Kontakt ist für Anwendungen von 2 A/3 A und den Temperaturbereich von –40 °C bis +85 °C konzipiert. Die Anpresskräfte liegen zwischen 3 N und 9 N. Die robuste Konstruktion und die Flexibilität auf der X-/Y-Achse sorgen bei Stössen und Vibrationen für eine resistente Verbindung zwischen Kontakt und Komponente. Vor Überdehnungen und Beschädigungen ist die Kontaktlasche ebenfalls geschützt. Sämtliche Ausführungen entsprechen den WEEE- und RoHS-Richtlinien.

Halogenfreies Flachbandkabel 1 mm von 3M Das neue Low Smoke Zero Halogen (LSZH) Flachband entspricht der IEC-61034-2:2005- beziehungsweise der NF-X-70-100-2:2006-Norm. Die Serie HF625 mit AWG-28-Kabel ist von 6- bis 50-polig erhältlich und für einen Temperaturbereich von –40 °C bis 105 °C ausgelegt.

«Die hohe Teilnehmerzahl und die qualitativ hochstehenden Referate haben den Erfolg der NIDays 2012 ausgemacht. Es herrschte ein sehr positiver NIDays-Geist, der die Teilnehmer inspiriert, Neues zu wagen, um effizienter und produktiver zu werden.» Christian Moser, Managing Director, National Instruments Schweiz COMPONA AG · 8320 Fehraltorf 0848 840 100 · www.compona.ch


26

megalink 4.12

N A C H S C H AU N I D AY S

Prof. Dr. Rolf-Dieter Heuer, Generaldirektor des CERN in Genf, bot einen faszinierenden Einblick in die Forschung.

Dr. James Truchard, Mitgründer und CEO von National Instruments, liess es sich nicht nehmen, für die NIDays in die Schweiz zu reisen.

Armin Brühwiler (links), Schmid Elektronik, erläutert einem Fachbesucher die Möglichkeiten von LabView auf Blackfin Prozessoren.

Im Track «Innovations» präsentierten durch das Swiss Startup Program von NI geförderte Unternehmen ihre Applikationen und Lösungen, die mithilfe von Graphical System Design realisiert wurden. Des Weiteren erläuterte Walter Steinlin von der Kommission für die Technologie und Innovation in seinem Vortrag «Switzerland as a Center of Innovation» das Potenzial des Standorts Schweiz. Die Veranstaltung schlug somit eine Brücke von der Spitzenforschung am CERN über die Industrie bis hin zu Start-up-Unternehmen.

Blick unter die «Haube». Neben zahlreichen Vorträgen, in denen die neuesten NI-Produkte und deren Möglichkeiten präsentiert wurden, bot National Instruments auch einen tiefen Blick «unter die Haube» von LabView. So erläuterte Christian Mergl, wie der LabView-Compiler arbeitet und wie er welchen Code optimiert, wie zum Beispiel identischen Code zusammenfasst, ungenutzte Anweisungen eliminiert oder die SSE-Einheit der CPUs einsetzt. Er zeigte auch die verschiedenen Strategien von LabView auf, den Speicherverbrauch möglichst tief zu halten.

www.mobi.ch

Besonders spannend war der Einblick in das «Execution System», das für die eigentliche Ausführung des Codes verantwortlich ist. Es versucht, möglichst viele Programmteile parallel abzuarbeiten, um die Performance zu maximieren. Dazu gibt es mehrere Stapel an abzuarbeitenden Aufgaben, die von speziellen Threads auf die vorhandenen Ausführungseinheiten verteilt werden. Das bedeutet, dass ein LabView-Programm auf einem System mit mehr Ausführungseinheiten normalerweise schneller läuft – ohne dass der Programmierer etwas ändern müsste. Bedingung dazu ist natürlich, dass

ERFO BETE LGSILIGU DANK NG GENO SS SCHA ENFT


N A C H S C H AU N I D AY S

Bitte hier drücken. Was nützt das beste und schnellste Programm, wenn der Benutzer von der grafischen Oberfläche (GUI – graphical user interface) total überfordert ist? Deshalb beschäftigten sich zwei Vorträge nur damit, wie das sogenannte «Benutzererlebnis» möglichst gut ausfällt. Amadeo Vergés und Thorsten Büring von der Zühlke Engineering AG zeigten an vielen, sehr praxisnahen Beispielen, was alles bei einem GUI beachtet werden muss – und was man alles falsch machen kann. Und Vincenzo Maira von NI Schweiz forderte die Zuhörer sogar dazu auf, nicht innovativ zu sein – zumindest wenn es um die Gestaltung der Benutzerschnittstelle geht. Bewährte und bekannte Konzepte sollte man übernehmen und höchstens im Detail anpassen und verbessern. Zudem gilt auch beim GUI: weniger ist mehr. Zu viel Information auf einmal überfordert, und alles Unwesentliche sollte somit ausgeblendet werden. Vincenzo Maira

27

Nach den Vorträgen standen die meisten Experten an den Ständen Rede und Antwort, wie hier Amadeo Vergés (rechts).

zeigte in seiner Präsentation sogleich, wie sich die diversen Techniken, Tipps und Tricks in LabView umsetzen lassen.

perten übernommen und kann die Kabelqualität selbstständig und zuverlässig bestimmen.

LabView denkt mit. Wie flexibel und universell LabView ist, zeigte die Anwendung, die von Dr. Stefan Messmer von der IWM AG präsentiert wurde. Darin wird LabView zum neuronalen Netzwerk. Tragseile von Seilbahnen müssen regelmässig überprüft werden. Eine Methode dazu ist das sogenannte Magnetinduktionsverfahren MRT (Magnetic rope testing). Dabei wird das Drahtseil magnetisiert und danach die magnetische Reaktion des Seils gemessen. Dazu fährt das Messgerät an der Gondel befestigt das zu prüfende Kabel ab. Mithilfe eines mit LabView implementierten neuronalen Netzwerks ist es danach möglich, Fehler zuverlässig zu erkennen. Zuerst wird das neuronale Netzwerk mit Testdaten trainiert. Dabei muss ein Experte die Antworten und somit den «Lernerfolg» des neuronalen Netzwerks bewerten. Danach hat das System das Wissen des Ex-

Zertifiziert gut. Von den Besuchern ebenfalls gut besucht wurden die kostenfreie Prüfung zum Certified LabView Associate Developer (CLAD), die kongressbegleitende Fachausstellung sowie die fünf «Lunch Sessions» unter dem Motto «Engineering Challenges of Mankind», in denen aktuelle Herausforderungen und Lösungsansätze zu den Themen Graphical System Design, Life Sciences, Electrical Infrastructure sowie Innovationsstandort Schweiz diskutiert wurden. Die nächsten NIDays werden Anfang März 2013 stattfinden. ■

INFOS National Instruments 5408 Ennetbaden Tel. 056 200 51 51 ni.switzerland@ni.com www.ni.com/switzerland

W

das Programm so geschrieben wurde, dass es gut parallelisierbar ist. Was dazu beachtet werden muss, erläuterte Christian Mergl natürlich auch. In einem weiteren Vortrag ging der LabView-Spezialist nur der Frage nach, wie man sein Programm schneller machen kann. Behandelten die beiden Vorträge von Christian Mergl Programme, die auf Prozessoren ausgeführt werden, so zeigte Joseph Tagg auf, wie LabView-Code für FPGAs kompiliert wird. Der NI-Compiler übersetzt das Programm in VHDL und die Xilinx-Tools mappen, platzieren und routen danach den VHDL-Code in dem FPGA und versuchen, die Vorgaben an Taktfrequenz und Grösse einzuhalten. Klappt dies nicht, so muss in einem iterativen Prozess das Design optimiert werden. Geschwindigkeitsprobleme lassen sich zum Beispiel mit Pipelining oder Parallelisierung lösen. Platz lässt sich zum Beispiel sparen, indem gemeinsamer Code in Sub-VIs ausgelagert wird.

4.12 megalink

Unsere Kunden freuen sich wieder: sie erhalten 120 Millionen. Dank genossenschaftlicher Verankerung beteiligen wir Kunden mit einer MobiPro Betriebs- und Gebäudeversicherung oder einer MobiCar Fahrzeugversicherung am Erfolg.


28

megalink 4.12

MESSE

LAUSANNETEC: INTERDISZIPLINÄRE FACHMESSE DER ZULIEFERBRANCHE VOM 22. BIS 25 MAI 2012 IN LAUSANNE

Parlez vous technique? Vom 22. bis 25. Mai 2012 steht das Messezentrum Beaulieu in Lausanne im Zeichen der Mikrotechnologie, Hochpräzisions- und Uhrenindustrie. Dann findet erstmals die internationale Fachmesse der Zulieferbranche statt – die Lausannetec.

Im Mai vereint die Lausannetec – in der neuen Halle Süd im Messezentrum Beaulieu Lausanne – alle wichtigen Akteure der Zuliefererbranche.

V

or wenigen Monaten wurde sie erst aus der Taufe gehoben. Bereits werden zu ihrer Erstausgabe knapp 140 Aussteller und mehrere Tausend Besucher erwartet. Bereits haben die wichtigsten Zulieferer der Uhren- und Schmuckindustrie und die branchenführenden Medtech- und Elektrotechnik-Unternehmen ihren Stand reserviert. Die Lausanntec – internationale Fachmesse für die Zulieferindustrie der Hochpräzisionstechnik und Mikrotechnologie – findet vom 22. bis zum 25. Mai 2012 in den neuen Hallen Süd des Messezentrums Beaulieu Lausanne statt und wird in Anwesenheit des

INFOS MCH Beaulieu Lausanne SA 1000 Lausanne Tel. 021 643 21 21 info@beaulieusa.ch www.beaulieu.org

Waadtländer Regierungsrates Philipp Leuba eröffnet. Der Neuling hat hohe Ziele. Die Messe will zum Treffpunkt der nationalen und internationalen Akteure und Entscheidungsträger unter den Zulieferern der Medizin-, Elektrotechnik und Uhren- und Schmuckindustrie avancieren. Sie ist der erste Schritt der MCH Group im Rahmen der Erweiterung ihres Messeprogramms in der Westschweiz, daher wird der Event durch das Volkswirtschaftsdepartement des Kantons Waadt unterstützt. Unter einem Dach. Durch drei internationale Fachmessen soll das breite Spektrum der Zulieferindustrie der beteiligten Wirtschaftszweige abgedeckt und den Teilnehmern die Möglichkeit geboten werden, Synergien auszuloten und sich auf neuen Märkten zu

(Bild: MHC Group)

positionieren. Ergänzt wird das Angebot durch branchenspezifische Referate und Veranstaltungen. Die Vortragszyklen sind öffentlich zugänglich und sollen einen Meinungsaustausch zu aktuellen Fragen wie Innovation, Marketing oder Qualitätsmanagement ermöglichen. Für Aussteller und Messebesucher ist dieses Forum eine Gelegenheit, sich an der Diskussion der zentralen Themen zu beteiligen und sich über die neusten Entwicklungen zu informieren. ■

Die Lausannetec in Kürze Datum: Zeit: Ort: Preis: Infos:

22. bis 25. Mai 2012 10.00 bis 17.00 Uhr Messezentrum Beaulieu Lausanne 20.– Franken für Tagesticket, online kostenlos bestellbar www.lausannetec.com


MESSE

4.12 megalink

29

«AUTOMATICA» VOM 22. BIS 25 MAI 2012: 5. INTERNATIONALE FACHMESSE FÜR AUTOMATION UND MECHATRONIK IN MÜNCHEN

Roboter, Weissbier und mehr Weissbier wird in München gern getrunken und gebraut. Dafür ist die Stadt auch bekannt. Vom 22. bis 25. Mai 2012 ziehen aber auch Roboter, Batterien und ihre Hersteller in die bayerische Metropole ein – denn dann findet die Automatica statt.

Die Automatica in Kürze Datum: Zeit: Ort: Infos:

Die 4-tägige Veranstaltung in München bietet Herstellern und Anwendern aus den Branchen eine ideale Plattform. (Bild: Messe München)

M

ünchen – bekannt für sein Bier und Brau-Know-how. Im Mai soll alles anders werden.Die Stadt wird zum Branchentreffpunkt der Montage- und Handhabungstechnik, Automation und Robotik. Europas Leitmesse der Enabler-Technologien – die Automatica – findet vom 22. bis 25. Mai 2012 auf dem Gelände der Neuen Messe München bereits zum 5. Mal statt. Von der Komponente bis zur konkreten Dienstleistung bildet der Event während den vier Tagen sämtliche Bereiche ab. Fachleuten bietet sie ausserdem eine ideale Plattform: insbesondere der Branchen Automobil, Phar-

INFOS Messe München GmbH D-81823 München Tel. +49 89 949 11438 info@automatica-munich.com www.automatica-munich.com

INTERMESS DÖRGELOH AG 8001 Zürich Tel. 043 244 89 10 intermess@doergeloh.ch www.doergeloh.ch

ma/Kosmetik/Medizin, Maschinen- und Anlagenbau oder Verpackung. Neben der Ausstellung bietet der Anlass ein vielfältiges Rahmenprogramm. Wissen kompakt vermittelt in Foren, Sonderschauen und Symposien. Auch 2012 halten Experten Fachvorträge zu aktuellen Trendthemen. Mit «BlueCompetence» greift die Messe am ersten Tag die Nachhaltigkeit

22. bis 25. Mai 2012 9.00 bis 17.00 Uhr Neue Messe München www.automatica-munich.com

von 2010 (Green Automation) wieder auf. Batterien und elektrische Energiespeicher spielen bei der omnipräsenten Elektromobilität eine Schlüsselrolle, weil sie unter anderem Leistung oder Preis des Systems mitbestimmen. Die Herausforderung dabei: Automatisierungstechnologien, die Produk-tionskosten minimieren, müssen in der Gross-Serienfertigung funktionieren. Daher sind Batterien und Energiespeicher-Fertigung Highlights der Messe. Im Rahmen einer Sonderschau wird der komplette Produktionsprozess einer Batteriezelle gezeigt. Die 7. Ausgabe der Robotik Conference findet am 21. und 22. Mai 2012 im Rahmen der Automatica statt. Sie ist die grösste nationale Konference zum Thema Robotik in Deutschland und wird organisiert von der Deutschen Gesellschaft für Robotik (DGR). Von der Schweiz direkt an die Messe. Für Besucher aus der Schweiz wird ein spezieller Service angeboten. Am 24. Mai fährt morgens ein Bus von Bern aus, über Winterthur, direkt nach München und abends wieder zurück (siehe Kasten). ■

Am Donnerstag 24. Mai komfortabel im Luxusbus an die Automatica Interessenten können sich bis zum 17. Mai per E-Mail (intermess@doergeloh.ch) oder Telefon (043 244 89 10) anmelden. Im Preis von Fr. 165.– sind die Fahrt nach München und zurück sowie ein Frühstück à discrétion eingeschlossen. Hinfahrt 03.40 Uhr Abfahrt Bern Neufeld (Park & Ride) 04.20 Uhr Abfahrt Hotel Egerkingen (Parken Fr. 10.00 mit Parkkarte – Karte bitte bestellen) 05.30 Uhr Abfahrt Winterthur Ohringen (Parken problemlos) 06.30 Uhr Abfahrt Bahnhof St. Margrethen (Parken Parkhaus) 10.00 Uhr Ankunft vor dem Messegelände Rückfahrt 18.15 Uhr Abfahrt vor dem Messegelände 21.15 Uhr Ankunft Bahnhof St. Margrethen 22.10 Uhr Ankunft Winterthur Ohringen 23.20 Uhr Ankunft Hotel Egerkingen 24.00 Uhr Ankunft Bern Neufeld


30

megalink 4.12

A B B A U TO M A T I O N D A Y

Automatisierer unter sich – am Automation Day 2012 in Baden.

(Bilder: D. Wallimann)

ABB AUTOMATION DAY AM 27. MÄRZ 2012 IN BADEN

Automation an einem Tag Die ABB rief – und sie kamen. Zum diesjährigen Automation Day im «Trafo» in Baden präsentierte der Industriegigant ein fulminantes Rahmenprogramm mit Fachvorträgen. Natürlich auch Kaffee und Gipfeli.

E

inst war im «Trafo» das Hochspannungslabor der BBC untergebracht. Heute finden darin unter anderem Kongresse statt. Anlass genug für ABB, in diesen Räumlichkeiten den Automation Day 2012 durchzuführen. Am 27. März drehte sich in Baden alles um effiziente Energienutzung, Roboter und die neusten Trends im Automationsuniversum. 120 Experten folgten dem Ruf. Der Event gliederte sich in drei parallel geführte Stränge. Gelegenheit für neue Kontakte und Fachgespräche boten

INFOS ABB Schweiz AG 8048 Zürich Tel. 058 586 05 15 get.info@ch.abb.com www.abb.ch/robotic

die Ausstellung, Mittag- und Nachmittagspause dazwischen. Nah dran, statt nur dabei. Empfangen wurden die Teilnehmer bei Kaffee und Gipfeli. Helmut Gänswein, Leiter Verkauf und Marketing Prozessautomation ABB Schweiz, begrüsste das Gremium in der grossen Trafohalle und stimmte sie auf die Tagung ein. «Wir möchten einen intensiven Dialog mit unseren Kunden pflegen. Denn nur eine enge Zusammenarbeit schafft Mehrwerte für beide Seiten», so Max Wüthrich, Leiter Verkauf ABB Schweiz, der im Anschluss die Rednerbühne betrat. Am Beispiel der Stadt Zürich, wobei es um die Speicherung der Energiespitzen mithilfe der grössten Batterie der Schweiz ging, zeigte der Redner auf, wie die ABB-Vertriebsstruktur darauf ausgerichtet ist, nahe beim Kunden zu sein. Know-how ist die Basis. «Wo stehen wir –

und wo steuern wir hin?» Fragen, die die Automation und ihre Experten beschäftigen. Alexander Hoch, Abteilungsleiter Forschungsbereich Automatisierung vom ABB Forschungszentrum Baden-Dättwil, zeigte, wie sich die Automatisierung in den letzten zehn Jahren entwickelte – kontinuierlich und in kleinen Schritten. Daher werden einige Innovationen gar nicht mehr richtig bewusst wahrgenommen. Gute Gespräche und grosse Gefühle. Am Mittag wurden die Tagungsbesucher mit einem Stehlunch verköstigt. Pünktlich um 12.45 Uhr betrat Jasmin Staiblin die Rednerbühne. Mit «Die ABB Schweiz im internationalen Vergleich» weckte die Vorsitzende der Geschäftsleitung ABB Schweiz das Interesse: «Innovation bedeutet Investition: 1,4 Mia. CHF wurden in die Forschung investiert – Wir glauben an den Standort Schweiz». In ihre Präsentation legte die Rednerin offen,


MASSGEBEND IN TECHNOLOGIE

Raum für Fachgespräch und Networking bot die Ausstellung zwischen den Vortragssträngen.

dass Forschung und Entwicklung immer ein Kerngeschäft bleiben muss.

system differenziert, auf die nur einzelne Benützer Zugriff haben.

Sicher, sicher. «Keiner will sie haben! Doch, regelmässige Nutzer kommen im privaten und geschäftlichen IT-System, wie zum Beispiel im Büro und Produktionsumgebungen, mit Viren oder Trojaner in Kontakt, wie Carsten Risch, ABB Business Unit Control Technologies, weiss. «Ist Isolation die Lösung zur einfachen Risikominimierung?», fragte sich der Experte in seinem Referat. Erfahrungswerte belege: im Cyber-Security-Management führt nur eine ganzheitliche Betrachtung ans Ziel. Dazu gehört unter anderem die Zoneneinteilung, die zwischen Firmen-, Standortnetzwerk und Prozessleit-

Ein Höhenflug braucht Bodenhaftung. Erfolgreiches Teamwork bedeutet ein Mehrwert: Ein effizientes Team erreicht meist mehr als gleichviele Einzelpersonen einzeln, zumal Synergien stärker genutzt werden. Das gilt auch bei über 1000 km/h und drei Meter Abstand in der Luft zum nächsten Flieger. Zum Tagesabschluss berichtete Daniel Siegenthaler, ehemaliger Staffelführer der Patrouille Suisse, wie die Kunstflugstaffel der Schweizer Luftwaffe Teamwork am Himmel Höchstleistungen umsetzt. ■

Die Schweizer Messe für Technologie Le salon suisse de la technologie La fiera svizzera della technologia Jetzt anmelden: www.sindex.ch/anmeldung

4.– 6. SEPTEMBER 2012

BERN Veranstalter:

Patronat: swiss technology network

«Innovation bedeutet Investition», so Jasmin Staiblin, Vorsitzende der Geschäftsleitung ABB Schweiz. x_Ins_69x267_DE.indd 1

24.05.11


32

megalink 4.12

C O M M U N I C A TI O N C O N FE R E N C E

Austragungsort der Fachtagung waren wiederum die Räumlichkeiten der Fachhochschule Brugg-Windisch.

(Bilder D. Wallimann

COMMUNICATION CONFERENCE AM 13. MÄRZ 2012 AN DER FACHHOCHSCHULE NORDWESTSCHWEIZ WINDISCH

Hörst du mich? Kommunizieren in der Industrie? Im Rahmen der zweiten Communication Conference an der Fachhochschule Windisch zeigten Experten anhand von Vorträgen, Lösungspräsentationen und Praxisworkshops, wie es geht: zum Beispiel unter harschen Bedingungen.

A

uch in der Industrie spielt die Kommunikation eine zentrale Rolle: Damit beispielsweise ein Signal von Sensor zu Sensor gesendet wird, muss die störungsfreie Übertragung dazwischen gewährleistet sein. Neue Technologien, wie zum Beispiel Überwachung mithilfe WLAN, tragen wesentlich dazu bei und sind darum wesentliche Herausforderungen, die die Anwender beschäftigen. Aus diesem Grund lud das Swiss Technology Network am 13. März 2012 zur Fachta-

INFOS Swiss Technology Network – swissT.net Industriestrasse 4a 8604 Volketswil Tel. 044 945 90 90 info@swisst.net www.swisst.net

gung «Communication Conference – Industrielle Kommunikation in Theorie und Praxis». Parallel fanden tagsüber Fachvorträge, Lösungspräsentationen und Parxisworkshops statt. Bereits zum zweiten Mal, nach ihrer erfolgreichen Premiere in 2010, war die Veranstaltung zu Gast an der Fachhochhochschule Brugg-Windisch. Mit nahezu 200 Besuchern verbuchte der Branchenevent einen Erfolg. Data Center: Architektur und Perspektiven. Am Morgen erklärte Matthias Gerber, Produktlinienmanager bei Reichle & De-Massari, in seinem Fachvortrag, warum die Lebensdauer der Aktivgeräte und die entsprechenden Lösungskonzepte für Rechenzentren kürzer sind, als die von Verkabelungslösungen. Dabei beantwortete der Referent, wie sichergestellt wird, dass die getätigten Investitionen in die passive Infrastruktur möglichst lange genutzt werden können. Der Vortrag

beschrieb unterschiedliche Aktivgeräte-Konzepte und zeigte einen Lösungsansatz auf,

Der Siemens-Referent, Andreas Gebhard, sprach über die funkbasierte Datenübertragung im harschen Umfeld.


Stabil & Präzise Schnell & Flexibel Rohde & Schwarz FSW Der neue Signal- und Spektrumanalysator für höchste Ansprüche im A&D Markt. Größte Signalanalysebandbreite, niedrigstes Phasenrauschen, einfachste Bedienung und eine Menge nützlicher Werkzeuge — alles auf dem größten Touchscreen. Der ¸FSW ist der perfekte Analysator für das Messen von Radarsignalen. Komplexe Analysen leicht gemacht. Sehen, was bisher nicht sichtbar war. Bislang Unbekanntes entdecken. Der ¸FSW Zwischen den einzelnen Vorträgen und Workshops bot die Veranstaltung Platz für angeregte Fachgespräche.

wie Rechenzentrenverkabelungen geplant werden können, um diese Konzepte zu unterstützen, und die notwendigen Leistungsreserven für die Zukunft zur Verfügung stellen zu können. Dazu wurde ein Ausblick für 40G- und 100G-Übertragungstechnologien im Kupfer- und Fiber-Optik-Bereich gemacht.

 Analyse von Oszillatoren und Synthesizern mit Phasenrauschen von –137 dBc (1 Hz)  Messen von Frequenzsprüngen und Chirp-Signalen über eine Bandbreite von bis zu 160 MHz  5x schnelleres Finden von Nebenwellen  Gleichzeitiges Messen von Pulssignalen, Nebenwellen und Modulation mit MultiView The R&S®FSW. Create the future. www.rohde-schwarz.com/ad/fsw

Drahtlose Datenübertragung unter harschen Bedingungen. «Systemlösung Profinet am Beispiel IWLAN» lautete der Arbeitstitel des Praxisworkshops – geleitet durch die Siemensmitarbeiter Andreas Gebhard, Productmanager, und Christian Beerli, Applikationsmanager. Wie Daten unter harschen Bedingungen sicher übermittelt werden, zeigten die beiden jungen Redner am Beispiel der SwissSteel. Nämlich: unter Einsatz von Automatisierungstechnik und einem Wireless-Netzwerk von Siemens – dem Sinema E. «Bei der Umsetzung habe man eine Reihe Herausforderungen bewältigen müssen, wie raue Bedingungen», so die Referenten.

MANAGEMENTSYSTEM ISO 9001 / 14001

Leichte Mittagspause. Zwischen 12.30 bis 14.00 Uhr konnten sich die Fachmessebesucher an einem schmackhaften Buffet verköstigen und mit Kollegen sowie Ausstellern bis zu den Nachmittagsvorträgen fachsimpeln. Doch das frühlingshafte Wetter lud dazu ein, den Kaffee auf der Terrasse zu geniessen. Ethernet-Implementierung flexibel und in Echtzeit. Am Nachmittag präsentierte Dr. Frank Iwanitz, Productmanager Softing, im Rahmen der Lösungspräsentationen flexible Real-Time Ethernet-Implementierung mithilfe Field Programmable Gate Arrays (FPGAs). In seiner «Speech» erklärte der Referent, was sich hinter «Real-Time-Ethernet» verbirgt und die damit verbundenen Vorteile – so die höhere Bandbreite. Dabei wurde der Einsatz von spezifischer Hardware, wie zum Beispiel bestimmten Umgebungsprogrammen, besprochen. Wie sich zeigte, bieten sich für flexible Lösungen Implementierungen mithilfe FPGAs an: So ist zum Beispiel ein Upgrade bei Spezifikations- und Anforderungsänderung ohne Hardware-Änderung möglich oder alle Anforderungen lassen sich effizient in einem Chip umsetzen.

SCS 097

Die Gewinner zum Schluss. Die gut besuchte Fachveranstaltung wurde mit einer Wettbewerbs-Auslosung abgerundet: Der glückliche Gewinner durfte ein neues IPad3 sein Eigen nennen. «Dazu müsse er aber anwesend sein», wie Christian Studer, Präsident Quersektion 200 Swiss T.net, in der Eröffnungsrede festhielt. ■

uct_FSW_105x280_d (Roschi).indd 1

20.09.11 14


34

megalink 4.12

T I TE L S TO R Y

Bild 1: Zurück zum Glück: mit passender Prothese gewinnen betroffene Personen an Lebensqualität.

KLEINANTRIEBE IN DER BEINPROTHESENHYDRAULIK SORGEN FÜR EINEN NATÜRLICHEN GANG

Gut zu Fuss Unbeschwert Einkaufspassagen entlang schlendern oder mit Freunden Rad fahren. Dank einer neuen, hydraulischen Beinprothese ist ein aktiver Lebensstil für Betroffene wieder möglich.

M

enschen, die mit einer Beinamputation leben, kämpfen häufig mit Alltagshürden, wie einer Treppe oder einem überwachsenen Waldweg. Mithilfe passender Beinprothesen sind solche Hindernisse einfacher überwindbar (Bild 1). Walking on Sunshine. Das C-Leg von Ottobock ist ein intelligentes Beinprothesensystem, das das Leben Betroffener mit Oberschenkelamputation erleichtert.

INFOS maxon motor ag 6072 Sachseln Tel. 041 666 15 00 info@maxonmotor.com www.maxonmotor.com

Das Kniegelenk erkennt, in welcher Gehphase sich der Prothesenträger befindet und passt sich ad hoc darauf an. Der Winkelsensor liefert die Informationen für die Regelung der Schwungphase in Abhängigkeit von der jeweiligen Schrittlänge und Frequenz. Das Gelenk wiederum begrenzt durch die Hydraulik die maximale Beugung in der Phase, in der sich das Prothesenbein während des Schrittes in der Luft befindet. Beim C-Leg erreichten die Entwickler durch mechanische und elektronische Anpassungen eine verbesserte Schwungphasenregelung – ein natürlicheres Gangbild und eine leichtere Bewegung des Kniegelenks sind die Folge (Bild 2). Auch unebenes Gelände stellen für den Prothesenträger kein unüberwindbares Problem

mehr dar, da durch den hohen Widerstand die Standphase gesichert ist und das Kniegelenk nur bei Bedarf in die Schwungphase schaltet. Die Sturzgefahr wird so deutlich reduziert. Stabil und flexibel – in jeder Situation. Zudem kann die Prothese mit einem Sondermodus auf besondere Aktivität, wie zum Beispiel Skilanglauf, eingestellt werden. Bei diesem Aktivitätsmodus wird der Hydraulikdämpfer kniewinkelabhängig gedämpft. Die Anfangsdämpfung und die Progression sind individuell einstellbar. Um den vielfältigen Belastungen des Alltags standzuhalten, besteht der HighActivity-Frame der Prothese aus Karbon. In Kombination mit den geeigneten Rohradaptern ist sie für ein Körpergewicht von bis zu 136 Kilogramm zugelas-


T I TE L S TO R Y

sen. Der Rahmen umschliesst die Elektronik, die Hydraulik und den Akku.

Prothese im Himalaya-Gebirge in bis zu 4000 Meter Höhe unterwegs.

Standfest, zurück im Leben. Für viele Anwender des C-Leg ist das Gehen eine ganz neue Erfahrung. «Es ist überhaupt nicht anstrengend, es ist beeindruckend einfach und ich war wirklich überrascht. Das Laufen bereitet mir jetzt Freude – beinahe so wie früher», so Ed aus Amerika, der sein Bein aufgrund eines Autounfalls verloren hatte. 2011 hat der 74-jährige Roland Zahn eine Deutschlanddurchquerung von Leipzig bis Tübingen absolviert – immer dabei war sein C-Leg. Und eine 60-jährige Frau war mit der

Die Technik dahinter. Die Steuerung erfolgt über eine mikroprozessorgeregelte Hydraulik, die das System an die Gehgeschwindigkeiten anpasst. Gleichzeitig ermöglicht sie die zuverlässige Sicherung der Standphase. Realisiert wird dieser Regelmechanismus durch ein Sensorsystem. Alle 0,02 Sekunden erfassen die Sensoren die Belastung. Das Gelenk erkennt somit, in welcher Phase des Gehens sich der Prothesenträger gerade befindet. Ein Lithium-Ionen-Akku versorgt das C-Leg für ca. 48 Stunden mit Strom. Die Charakteristik der Hydraulik wird durch zwei Ventile angepasst. Diese Ventile werden von Maxon RE10 DC Motoren verstellt (Bild 3). Pro C-Leg kommen zwei Motoren zum Einsatz. Der kleine Durchmesser der Antriebe war neben dem CLL-System für Longlife (capacitor long life), das den reibungslosen Betrieb ermöglicht, ein ausschlaggebender Punkt für Ottobock. Ihre eisenlosen Wicklungen und die Neodym-Magnete ermöglichen die hohe Leistung bei minimalem Bauvolumen. Zur mechanischen Kommutation der Motoren werden Edelmetallbürsten eingesetzt. Damit gewähren sie einen Rastmoment-freien Lauf und dies auch bei niedrigsten Drehzahlen. Beim Kommutierungsvorgang mit Bürsten werden ständig Kontakte über der induktiven Last einzelner Segmente der Motorwicklung geschlossen und wieder geöffnet. Die beim Öffnen auftretenden Funkenbildung greift Metallbürsten und Kollektor des Motors an, indem sie die Oberfläche aufschmelzen. Dieses «Bürstenfeuer» reduziert die Lebensdauer des Kommutierungssystems des Motors. Die in den Motoren integrierten Kondensatoren verlängern die Lebensdauer erheblich.

Bild 2: Die intelligente Beinprothese passt sich an den individuellen Gangzyklus an.

4.12 megalink

35

Bild 3: Die Aufwändige Bürstenkonstruktion sorgt für eine lange Lebensdauer. (Bilder: Maxon)

Bei dem CLL-Prinzip wird ein zusätzliches Glied zwischen zwei benachbarten Kollektorlamellen, das heisst parallel zum sich öffnenden Kontakt, geschaltet. Das CLLKonzept unterdrückt damit weitgehend das auftretende Bürstenfeuer und ausserdem hat diese Funken unterdrückende Wirkung auch einen positiven Einfluss auf die elektromagnetische Abstrahlung. Im C-Leg müssen die Maxon-Motoren im Pulsbetrieb oder intermittierenden Betrieb arbeiten, das heisst dass der Antrieb immer nur für kurze Verstellungen aktiviert wird und nicht im Dauerbetrieb ist. Ottobock erwartet über die Lebensdauer des C-Leg 9 Millionen Verstellungen dieser Art. In der Regel muss der Motor für diese Verstellungen zehn Umdrehungen machen. ■

› Laserlichtquellen › Laserlichtschranken › Lasersysteme

Alles aus einer Hand, www.ilee.ch Sie können auf 30 Jahre Erfahrung zählen. Wir lösen Ihre Probleme und nutzen dazu Lasersysteme, optische Sensoren, Optik, Opto-Mechanik und Messtechnik.

I.L.E.E. AG Laser Innovation CH-8902 Urdorf Tel. +41 44 736 11 11 Fax +41 44 736 11 12 office@ilee.ch, www.ilee.ch


36

megalink 4.12

L E I S TU N G S E L E K TR O N I K

HOHE STRÖME SICHER UND EFFIZIENT AUF HOCHSTROMLEITERPLATTEN ÜBERTRAGEN

Dünne Leiter – fette Ströme Alles wird besser: Elektroingenieure müssen sich über Hochstromanwendungen auf Leiterplatten nicht länger den Kopf zerbrechen. Eine Leiterplattenklemme macht Stromschienenkonstruktionen in vielen Fällen überflüssig.

wand in der Produktion, Installation und Wartung.

Bild 1: Innovative Produktionsverfahren wie die Inlay-Technologie ermöglichen Leiterplatten mit einer Stromtragfähigkeit von 800 Ampère. (Bilder: Weidmüller)

T

echnologietrends wie Energieeffizienz, höhere Leistungsdichte oder die durchgängige Integration von Signalen auf einer Plattform sind eine Herausforderung für das Engineering – aber auch ein entscheidender Erfolgsfaktor für eine Applikation.

Funktionalität, der Formfaktor und die Art der Anschlussmethode, da diese die technischen und wirtschaftlichen Faktoren der gesamten Applikation beeinflussen, wie die Flexibilität im elektrischen, thermischen und mechanischen Design oder den Kostenauf-

Ein Balanceakt. Bezogen auf Hochstromanwendungen sind Elektronikingenieure in der Regel mit zwei wesentlichen Herausforderungen konfrontiert. Einerseits steht die Frage nach effizienten Wärmemanagements und anderseits nach optimalem Design des Strom führenden Systems im Raum. Wachsende EMV-Anforderungen oder der ungebrochene Trend zu Miniaturisierung machen die Aufgabe zu einer Gratwanderung zwischen technischen und wirtschaftlichen Anforderungen. Selbst die Strom führenden Elemente eines Gerätes aus der Leistungselektronik, wie zum Beispiel die Anschlussleitung, müssen einzeln und als System betrachtet werden. Durch kontinuierliche Verbesserungen beispielsweise im Leiterplatten-Herstellungsprozess wurde die elektrische Leistungsfähigkeit von Hochstromleiterplatten in den letzten Jahren erheblich gesteigert. Galvanische Leiterbahnen mit 35–400 μm, ergänzt durch die Iceberg-Technologie oder drahtgeschriebene Leiterplatten ermöglichen heute

Vom Konzept bis zur Entsorgung spielen unterschiedliche Faktoren mit. Die steigende Leistungsdichte in der Leistungselektronik geht mit der wachsenden Nachfrage nach darauf basierenden Anwendungen wie zum Beispiel Frequenzumrichter, Servo-Antriebe oder auch Photovoltaik-Wechselrichter einher. Bereits bei der Entwicklung ist es darum erforderlich, die Spezifikationen aller Komponenten konsequent auf jede Phase im Lebenszyklus der Anwendung abzustimmen: von der Konzeption bis zur umweltverträglichen Entsorgung. Eine wichtige Rolle spielen dabei auch die

INFOS Weidmüller Schweiz AG 8212 Neuhausen am Rheinfall Tel. 0 52 674 07 07 Info@weidmueller.ch www.weidmueller.ch

Bild 2: Die schnelle Zugbügel-Anschlusstechnik der Hochstrom-Leiterplattenklemme verringert zusätzlich mit den Wartungszeiten auch die Stillstandszeiten.


L E I S TU N G S E L E K TR O N I K

Ströme von 800 A und mehr auf einer Hochstrom- oder kombinierten Leiterplatte (Bild 1).

ohne zusätzliche Abdeckung in «Leistungsantriebssysteme mit einstellbarer Drehzahl» integriert werden.

Klemme sorgt für schnelle Verbindung. Mit der Markteinführung der LXXX 15.00-Hochstrom-Leiterplattenklemme von Weidmüller hat der Entwickler die Möglichkeit, umfangreiche Stromschienenkonstruktionen in Anwendungen bis zu 150 A mit einer einzigen Komponente zu ersetzen. Sie wird in einem Arbeitsgang im Wellenlötverfahren in den Prozess und auf die Leiterplatte integriert und sorgt mit dem bewährten Stahlzugbügel für eine schnelle und sichere Verbindung – ganz ohne Kabelschuhe (Bild 2). Mit einem Klemmbereich bringt sie Leiterquerschnitte bis 50 mm² / AWG1 sicher und robust auf die Leiterplatte. Der selbsttätig konternde Stahlzugbügel hat sich als wartungsfrei bewährt. Der integrierte Leiter-Untersteckschutz «Wire Guard» verhindert zudem ein Fehlstecken des Leiters unterhalb des Zugbügels und schützt so vor einer – besonders im Hochstrombereich gefährlichen – Scheinkontaktierung.

Auf die Leiterplatte gebracht. Gerade im Leistungsbereich hat eine sichere Bedienung und Wartung hohe Priorität. Der als Zubehör lieferbare Prüfstecker ermöglicht auch Langzeitmessungen. Die LXXX 15.00 verbindet die bewährte Stahl- zugbügelAnschlusstechnologie mit einem kompakten Standard-Gehäuse und ist ein Ersatz für komplexe Stromschienenkonstruktionen oder Bolzen-Anschlusstechniken.

Sicher im Betrieb. Neben hohen Umweltstandards erfüllt ein halogen- und phosphorfreier Isolierstoff auch die besonderen Anforderungen, die unweigerlich mit höheren Strömen einhergehen. Mit einem RTI (Relativer Temperatur Index ) von 120 °C zum Beispiel übertrifft die LXXX 15.00 die Dauergebrauchstemperatur von Standard-PA (100 °C) um +20 °K. Daraus ergehen deutlich mehr Leistungsreserven für Sicherheit bei Temperaturschwankungen und Überlast. Sein «Multi-Tool»-Schraubenkopf für Flach- und Kreuzschlitzklingen sorgt für schnelles Ansetzen und starke Kraftübertragung. Die aus Sicht der Komponentenstandards «grenzüberschreitende» Perspektive in Richtung Anwendungsnormen vereinfacht und verkürzt den Zulassungsprozess der Applikation. Mit erweiterten Luft- und Kriechstrecken in Anlehnung an die GeräteNorm IEC 61800-5-1 beispielsweise kann die LXXX 15.00

4.12 megalink

Dadurch kann die Leiterplatte nun auch für leistungsstärkere Hochstrom-Anwendungen als durchgängige System-Plattform eingesetzt werden. Um die hohen Leistungen und die damit verbundenen Leiterquerschnitte auf die Leiterplatte zu bringen, sind allerdings Erfahrung und Kompetenz erforderlich. Angesichts der fingerdicken Anschlussleitungen müssen die Lötstellen und die gesamte Leiterplatte gegen mechanische Belastung geschützt werden. Dabei darf die Übertemperatur nicht ausser Acht gelassen werden: Die Arrhenius-Formel zeigt, 

Sie suchen Verbindungen, die Ihnen beste Aussichten bieten? Als führendes Handelsunternehmen der Steckverbindungstechnik beliefern wir die renommiertesten nationalen und internationalen Industrieunternehmen der Schweiz. Unser Vollsortiment umfasst die innovativsten und bedeutendsten Marken für die Wehr-, Bahn- und Medizintechnik, Industrieelektronik sowie Luft- und Raumfahrt. Für spezifische Problemstellungen entwickeln wir zusammen mit unseren Partnern auch individuelle Lösungen. Dank unserem Know-how profitieren Sie von garantiert besten Verbindungen.

www.precimation.ch

37


38

megalink 4.12

L E I S TU N G S E L E K TR O N I K

Bild 3: Die Thermografieaufnahmen einer Testplatine zeigen den Einfluss von Design und Verarbeitung auf die thermische Situation.

dass jeder Temperaturanstieg von 10 °C die gesamte Lebensdauer einer Baugruppe um 50 Prozent reduziert. Anders herum gesagt, ein Gerät im Nennbetrieb mit maximalem Temperaturanstieg von 30 °K weist die doppelte Lebensdauer und Zuverlässigkeit auf, im Vergleich zur gleichen Applikation. Also: Je höher der Strom, desto grösser ist die Wirkung von einfachen Einflussfaktoren wie die konstruktiven Merkmale des gesamten Strom führenden Systems, zum Beispiel der Querschnitt oder der Abstand der Leiterbahnen.

Der Wärme auf der Spur. Die unterschiedliche Temperaturverteilung eines Systems kann mit einer Wärmebildkamera leicht ermittelt und als Bild dargestellt werden (Bild 3). Dabei gilt – Stellen mit der höchsten Temperatur sind nicht zwingend die Quellen der Erwärmung: Mithilfe des FEM-Verfahrens (Finite-Elemente-Methode) kann die Temperaturverteilung in einem System auch schon im Vorfeld realitätsnah simuliert werden. Wenn das Thermografiebild die höchste Temperaturabstrahlung beispielsweise an der Leiter-

plattenklemme zeigt, bedeutet das, dass dieser Teil aufgrund seiner Masse und Oberfläche des Zugbügels nur die beste Wärmesenke darstellt, die in unterdimensionierten Leiterbahnen oder an schlechten Lötverbindungen entsteht. ■

Tel. 055 / 415 66 15 Fax 055 / 415 66 10 Churerstr. 168, 8808 Pfäffikon SZ e-mail: astrel@swissonline.ch

Kühlkörper für ICs

Embedded ist 15 Jahre Liefergarantie – keine Abkündigung vor der Ankündigung. Vertiefen Sie Ihr Know-how am 5. Juni 2012 an der Embedded Computing Conference an der ZHAW in Winterthur.

Die Veranstaltung ist kostenlos. Anmeldung und Informationen unter www.EmbeddedComputingConference.ch

Fakt ist: • für Pentium, Power PC, Alpha-Chip, ISO 9001:2000 Athlon und weitere • für PGA, BGA, PLCC, DIL und andere • Varianten für freie und erzwungene Konvektion • IC-Lüfterkühlkörper mit “High-End” Lüftermotoren • zum Kleben und Klammern • kundenspezifische Ausführungen und Lösungen auf Anfrage


L E I S TU N G S E L E K TR O N I K

4.12 megalink

39

MIT NETZTEILEN STROMAUSFÄLLE ÜBERBRÜCKEN

Unterbrechungsfrei produzieren Netzeinbrüche führen zu einer Unterbrechung des Produktionsprozesses oder bringen ihn schlimmstenfalls zum Erliegen. Puffermodule oder unterbrechungsfreie Stromversorgungen verhindern dies. Handelt es sich um Applikationen mit grossen Antrieben, erweisen sich Zwischenkreis-Stromversorgungen als vorteilhaft, die bei Netzausfall die kinetische Energie der Antriebe zur Versorgung der Lasten nutzen.

N

etzausfälle können unterschiedliche Ursachen haben und von wenigen Millisekunden bis zu mehreren Stunden dauern, wobei die meisten Unterbrechungen in der Schweiz weniger als 200 Millisekunden betragen. Kurze Spannungseinbrüche zwischen zehn und zwanzig Millisekunden treten auf, wenn beispielsweise der lokale Energieversorger zwischen zwei Netzen umschaltet. Aufgrund einer schlechten Netzqualität entstehen Spannungseinbrüche bis etwa vier Sekunden. Da Maschinen und Anlagen weltweit ausgeliefert werden, wird dies häufig zum Problem. Ein weiterer Grund für einen Ausfall dieser Zeitspanne liegt im Starten von Maschinen mit hoher Anlaufleistung im kundeneigenen Netz. Länger andauernde Unterbrechungen resultieren aus zerstörten Versorgungsleitungen oder anderen schwerwiegenden Fehlern. Wie lange darf es sein? Industrielle Netzteile wie zum Beispiel von Phoenix Contact verfügen standardmässig über eine hohe Netzausfall-Überbrückung. So werden kurze Ausfälle bis 20 Millisekunden auch unter Volllast ohne Ausfall überbrückt. Für Unterbrechungen bis 200 Millisekunden bei 40 A Laststrom ist ein Puffermodul nötig. Dieses arbeitet wartungsfrei, das es mit Kondensatoren arbeitet – im Gegensatz zu unterbrechungsfreien Stromversorgungen (USV), deren Akkus regelmässig ausgetauscht werden müssen. Mit externen Energiespeichern überbrücken USVs Ausfälle von mehreren Stunden (Bild 3). Als vierte Alternative bietet Phoenix Contact neu Stromversorgungen mit Anschluss an 600-VDC-Zwischenkreise von Frequenzumrichtern an.

INFOS PHOENIX CONTACT AG 8317 Tagelswangen Tel. 052 354 55 55 infoswiss@phoenixcontact.com www.phoenixcontact.ch

Bild 1: Fällt der Strom aus, verhindern Netzteile mit Stützfunktion mögliche Schäden und Ausfälle.

Dieses Trio Power Gerät ist eine wirtschaftliche Alternative um Lasten bei Netzausfall zuverlässig versorgen zu können. Bewegungsenergie überbrückt den Netzausfall. Dank dem besonders grossen Eingangsspannungsbereich für Gleichspannungen von 450 bis 900 VDC kann die Stromversorgung direkt an den 600-VDC-Zwischenkreis des Frequenzumrichters angekoppelt werden. Während eines Netzausfalls werden die an die Stromversorgung angebundenen 24-V-Verbraucher über die Bewegungsenergie des Motors weiter mit bis zu 20 A beliefert. Die Motoren wirken in diesem Fall wie Generatoren: So lange sie sich bewegen, speisen sie Energie in den Zwischenkreis. Aus dieser Energie kann die 24-V-Versorgung lange genug aufrechterhalten werden, um beispielsweise einen Industrie-PC kontrolliert herunterzufahren. Auf diese Weise lassen sich Werkzeuge in einen sicheren Zustand bringen und die Maschine kann bei Rückkehr der Versorgungsspannung prob-

(Bild: iStockphoto.com)

lemlos wieder anfahren. Diese Technologie ermöglicht eine zu USV-Geräten kostengünstige Netzausfall-Überbrückung und erschliesst einen grossen Anwendungsbereich. Filter erhöhen die Störfestigkeit. Es gibt keine besonderen Vorschriften, welche die elektromagnetische Verträglichkeit (EMV) am Zwischenkreis von Antrieben reglementieren. Daher treten hier oftmals hohe Störund Ableitströme auf. Deshalb wurde die Stromversorgung Trio-PS/600DC/24DC/20 mit entsprechenden Filtern ausgestattet, sodass sie selbst unter extremen Bedingungen einwandfrei arbeitet. Das Gerät übertrifft die von der EMV-Richtlinie 2004/ 108/EG geforderten Störfestigkeitswerte (Tabelle). Das Metallgehäuse hält hohen Schock- und Vibrationsbelastungen stand und erlaubt die Verwendung nahe an und direkt in der Maschine. Das gilt auch für den weiten Einsatztemperaturbereich von –25 bis 70 °C. Die hohe MTBF (Mean Time 


40

megalink 4.12

L E I S TU N G S E L E K TR O N I K

Bild 2: Die Stromversorgungsfamilien unterscheiden sich hinsichtlich ihrer Leistungsfähigkeit und Funktionalität. (Bilder: Phoenix Contact)

Between Failure) von über 700 000 Stunden unterstreicht die Zuverlässigkeit und lange Lebensdauer von Trio-PS/600DC/24DC/20. Batterie ist ein Unsicherheitsfaktor. Die von Phoenix Contact entwickelte IQ Technology macht die USV intelligent. Bei einer Netzunterbrechung kann sich der Anwender erst-

Bild 3: Mit der Produktfamilie Quint Power lassen sich Netzunterbrechungen verschiedener Längen auffangen.

mals zu 100 Prozent auf die Batterie verlassen, die die angeschlossenen Teilnehmer durchgängig beliefert. Ein Beispiel verdeutlicht die Funktionsweise der USV: Dem in einer Abfüllanlage installierten Industrie-PC

muss bei starken Spannungsschwankungen 24 VDC zugeführt werden. Nur so kann die Anlage weiter arbeiten oder bei länger andauernden Netzausfällen kontrolliert heruntergefahren werden. Je nach benötigtem

Kosten senken und Zuverlässigkeit erhöhen? Sicher. Die neue Generation von Motorschutz- und Schaltgeräten bis 18,5 kW / 20 HP bietet Vorteile punkto Kosten und Verfügbarkeit. Die Schaltschütze können sowohl für AC- als auch DC-Anwendungen eingesetzt werden. Einheitliches Gerätedesign ermöglicht die Anwendung von gleichem Zubehör. Das bedeutet: einfache Bestellung, hohe Flexibilität und niedrige Lagerhaltung. Weitere Informationen auf www.abb.ch/industrieautomation

ABB Schweiz AG, Industrieautomation Brown Boveri Platz 3 CH-5400 Baden Tel. +41 58 586 00 00 www.abb.ch/industrieautomation


mögliche starke Alterung aufgrund hoher Umgebungstemperaturen. Im letztgenannten Fall kann es durchaus vorkommen, dass die 5 A Laststrom nicht mehr 20 Minuten, sondern lediglich fünf Minuten überbrückt werden. Die Abfüllanlage könnte also infolge eines unzuverlässigen Versorgungsnetzes stillstehen, ohne dass prozessrelevante Daten gesichert worden sind. Restlaufzeit und Batterielebensdauer immer im Blick. Die Stromversorgung Quint UPS-IQ ermittelt deshalb alle relevanten Zustände der Batterie. Das schafft die notwendige Transparenz, um die Bild 4: Die unterbrechungsfreien Stromversorgungen Quint UPS-IQ sind flexibel zu kombinieren und einfach zu installieren. Stabilität der Versorgung jederzeit sowie unter bestmöglicher Ausnutzung der Batterie zu garantieren. Das intelligente Batterie-Management kennt den aktuellen Ladezustand der angeschlossenen Batterie und errechnet daraus die zur Verfügung stehende Restlaufzeit. Auf diese Weise werden Versorgungslücken der angebundenen Teilnehmer sowie das frühzeitige Herunterfahren von Industrie-PCs vermieden. Im Beispiel der Abfüllanlage informiert die unterbrechungsfreie Stromversorgung, ob die Pufferzeit tatsächlich 20 Minuten oder unter Umständen weniger beträgt. Sobald ein einstellbarer Sollwert erreicht ist, setzt sie über den potenzialfreien Relaiskontakt oder per Software Bild 5: Die intelligente USV für die Tragschienen-Montage liefert 5 bis 40 A bei 24 V für DC-Anwendungen respektive 500 VA für AC-Netze. eine Warnmeldung ab. Der Anwender hat also die Möglichkeit, frühzeitig zu reagieren (Bild 5). Auch die verbleibende Lebensdauer der Laststrom und der erforderlichen Pufferzeit wählt der Anwender die passende Batterie Batterie wird angezeigt, was Service-Einsätaus, im Beispiel ein 3,4-Ah-Akkumodul, das ze planbar macht. Wird die Batterie zum op5 A Laststrom für 20 Minuten puffern kann. timalen Zeitpunkt ausgewechselt, lassen Weil bereits kurze Ausfälle einen hohen sich zudem Kosten einsparen, die durch einen zu frühen Austausch oder Ausfall entSchaden verursachen, tauscht der Anwenstanden wären. In Windenergieanlagen wird der jeweils nach zwei Jahren die Batterie aus. Dieses Vorgehen soll eine zuverlässige beispielsweise die Notbeleuchtung im Inneren des Turms aus Batterien gespeist. Tritt Funktionsweise sicherstellen. Die Erfahrung zeigt, dass dies leider nicht ein Problem auf, kann der Monteur gefahrimmer zutrifft. Denn in allen derzeit am los in die Gondel gelangen. Das Ersetzen Markt angebotenen Lösungen erweist sich des Energiespeichers ist allerdings wegen die Batterie als unbekannte Grösse, denn der teils schlechten Erreichbarkeit mit hohen Kosten verbunden. Die Meldung über herkömmliche USV-Lösungen können nicht darüber Auskunft geben, ob sie voll geladen die aktuelle Lebenserwartung der Batterie ist. Ausserdem ist unbekannt, wie lange die reduziert hier unnötige Arbeitseinsätze und Materialkosten. ■ Batterie die angekoppelten Lasten bei Teilentladung und Ausfall der Eingangsspannung versorgen kann. Weitere Unsicherheitsfaktoren sind ihr Alter sowie eine


42

megalink 4.12

L E I S TU N G S E L E K TR O N I K

HÖHERER WIRKUNGSGRAD DANK 3-LEVEL-IGBT-MODULEN

Jedes Watt zählt Die Steigerung der Effizienz von Umrichtern ist eines der Hauptziele der Leistungselektronik. Im Vergleich zur 2-Level-Topologie benötigt die 3-Level-Topologie zwar mehr Halbleiter, senkt dafür die Schaltverluste deutlich und steigert so den Wirkungsgrad. Zudem ist das EMV-Verhalten besser und es können kleinere Filterspulen verwendet werden.

D

rei-Level-Topologien sind bei Umrichtern mit Leistungen im MW-Bereich seit vielen Jahren Standard. Hauptgrund ist die deutlich geringere erforderliche Spannungsfestigkeit, welche die leistungselektronischen Schalter aufweisen müssen, der höhere Wirkungsgrad sowie die geringeren EMV-Abstrahlungen. Bereits vor fast 30 Jahren wurde erstmals die 3-Level-Topologie für IBGT-Module vorgeschlagen, nun ist sie marktreif und für Anwendungen im KWBereicht verfügbar. Drei sind sparsamer als zwei. 2-Level-Converter haben am Ausgang nur zwei Spannungszustände, während beim 3-Level-Umrichter drei Zustände möglich sind. Im Gegensatz zum 2-Level-Design, bei dem der IGBT die gesamte Zwischenkreisspannung schalten muss, fällt im Fall der 3-Level-Architektur nur die halbe Zwischenkreisspannung am IGBT ab. Die Ausgangsspannung der einzelnen Phasen ist bei der Drei-Level-Anordnung dem gewünschten Sinus deutlich ähnlicher (Bild 2). Deshalb sind für die Glättung der geschalte-

ten Ausgangsspannung kleinerer Spulen nötig. Der Ausgangsfilter kann deutlich kleiner ausgelegt werden, was die Geräte kleiner und günstiger macht. Durch die geringeren Kupferverluste steigt der Wirkungsgrad. Da eine Schaltflanke bei einem Drei-Level nur die halbe Zwischenkreisspannung schaltet, kann auch das EMV-Filter weniger aufwändig ausgelegt werden. Es gibt mehrere Möglichkeiten, eine 3-LevelKonfiguration aufzubauen. Zwei bekannte Topologien tragen den Namen NPC1 und NPC2. Das neue 3-Level-NPC-Modul von Fuji Electric realisiert mit dem rückwärts blockierenden IGBT (RB-IGBT = reverse blo-

cking IGBT) eine neue Topologie, die weniger Gesamtverluste bis zu einer Schaltfrequenz von 30 kHz aufweist als die anderen beiden. Der RG-IGBT kann im Gegensatz zu konventionellen IGBTs einer negativen Eingangsspannung standhalten. So kann die Anzahl der Komponenten für einen 3-LevelUmrichter verringert werden. Ein ähnlicher Aufbau ist mit konventionellen IGBTs nur mit mehreren Schaltern und Dioden realisierbar (Bild 3). Leistungsmodul senkt Verluste. Das einphasige 1200-Volt-3-Level-Modul von Fuji mit seinen RB-IGBTs ist in einem optimierten Mo-

3-level (RB)

3-level (NPC)

2-level

Bild 2: Vergleich der Topologie von 2- (links) und 3-Level-Umrichtern. Die Ausgangsspannung der 3-Level-Topologie entspricht mehr einem Sinus, weshalb die nachgeschalteten Filter kleiner ausfallen. Bild 1: Die RB-IGBT-Module erhöhen den Wirkungsgrad von 3-Level-Umrichtern. (Bilder: Fuji) 7

3

3

7

7

7 7

7

&

INFOS Stolz Electronics AG 5405 Baden-Dättwil Tel. 056 484 90 00 peter.heimgartner@stolzelectronics.ch www.stolzelectronics.ch

7

0

0

8

8

7

7

7

7

7

7

7

1

1

Bild 3: Die Entwicklung von der 2-Level- (links) zur RB-IGBT-3-Level-Topologie (rechts) mit den Varianten NPC1 (2. von links) und NPC2 (2. von rechts).


dulgehäuse mit den Massen 110 x 80 mm erhältlich. Das Gehäuse besitzt eine sehr niedrige Streuinduktivität von weniger als 40 nH. Die beiden Hauptschalter T1 und T2 sind 1200-V-IGBT-Chips, da sie die komplette Zwischenkreisspannung, die am Modul angelegt ist, blockieren müssen. Der zentrale Knotenpunkt M liegt auf dem halben Potenzial der angelegten Spannung, also auf 600 V. Deshalb sind die beiden Transistoren T3 und T4 nur der halben Eingangsspannung ausgesetzt und mit einem 600-V-Chip realisiert.

3500

Power loss 䠄W)

2500

98.00%

fc=10kHz

3000

97.48%

97.59%

97.73%

97.06%

㼂㼛㼚㻌㼘㼛㼟㼟 㻿㼃㻌㼘㼛㼟㼟 㻲㼕㼘㼠㼑㼞㻌㼘㼛㼟㼟 㻲㼕㼤㼑㼐㻌㼘㼛㼟㼟 㻱㼒㼒㼕㼏㼕㼑㼚㼏㼥

97.00%

2000 1500 96.00%

1000 500

95.00%

0 2䠉Level

NPC 3-Level Advanced 3-LevelAdvanced 3-Level Reverse series RB-IGBT

Bild 4: Vergleich der Umrichterverluste für verschiedene Topologien.

Bild 4 zeigt den jeweiligen Anteil der Einschaltverluste (Von loss), Schaltverluste (SW loss), Filterverluste (Filter loss) sowie feste Verluste (Fixed loss) an den Gesamtverlusten auf. Eine 2-Level-Konfiguration dient als Referenz und besitzt aufgrund der hohen Schaltverluste bei 10 kHz sowie den Filterverlusten die höchsten Gesamtverluste. Die NPC1-Lösung besitzt viele Schalter, die komplette Spannung des Zwischenkreises blockieren müssen und dadurch höhere Einschaltverluste besitzen. NPC2 hingegen besitzt zwei Schalter, die nur die halbe Spannung sperren müssen. Dies führt zu niedrigeren Einschaltverlusten. Fuji’s NPC-3-Level (RB-IGBT) minimiert mit den oben genannten Eigenschaften die Gesamtverluste am stärksten. ■

IGBT Ein Bipolartransistor mit isolierter Gate-Elektrode (englisch insulated-gate bipolar transistor, kurz IGBT) ist ein Leistungshalbleiter, der die Vorteile des Bipolartransistors (gutes Durchlassverhalten, hohe Sperrspannung, Robustheit) und Vorteile eines Feldeffekttransistors (nahezu leistungslose Ansteuerung) vereinigt. Vorteilhaft ist auch eine gewisse Robustheit gegenüber Kurzschlüssen, da der IGBT den Laststrom begrenzt. Mit IGBTs können Spannungen bis 6,5 kV und Ströme bis 3600 A geschaltet werden, und decken Anwendungen bis 100 MW ab. Die durch die Schaltverluste begrenzte maximale Frequenz beträgt rund 200 kHz. (Quelle: Wikipedia)

Über die Hälfte aller elektronischen Flachbaugruppen in Deutschland werden mit REINHARDT-Testsystemen geprüft

– mehr als 2600 gelieferte Testsysteme im Einsatz in der Groß- und Autoindustrie, in mittelständischen Unternehmen und bei kleinen Dienstleistern – mehr als 57.000 kostengünstige Prüfadaptionen für REINHARDT-Adapter sowie Inlinesysteme sind im Einsatz – Incircuit- und Funktionstest vom Kompaktsystem zum High-PerformanceSystem mit hoher Prüfschärfe und Prüftiefe – schnelle, praxisnahe und anwenderfreundliche Testprogrammerstellung – breites Spektrum an Stimulierungs- und Messmodulen – ODBC-Schnittstelle, Flash-Programmierung, CAN-Bus, CANopen, LIN-Bus, DeviceNet, Profibus, I2C, COM, USB, Ethernet…, Boundary Scan – externe Programmeinbindung, CAD-Schnittstelle, Qualitätsmanagement – höchste Zuverlässigkeit und geringe Folgekosten – vorbildlicher Service mit sofortiger Reaktion und Hotline zum Entwickler – halbautomatisches Adaptererstellungssystem in typisch ½ Tag

REINHARDT

System- und Messelectronic GmbH Bergstr. 33 D-86911 Diessen Tel. 08196 934100 Fax 08196 7005 E-Mail: info@reinhardt-testsystem.de http://www.reinhardt-testsystem.de

Embedded ist Stabilität – kein Neustart nach der Kaffeepause. Erfahren Sie mehr am 5. Juni 2012 an der Embedded Computing Conference an der ZHAW in Winterthur.

Die Veranstaltung ist kostenlos. Anmeldung und Informationen unter www.EmbeddedComputingConference.ch


44

megalink 4.12

B A U E L E M E N TE

LEISTUNGSHALBLEITER, TOPOLOGIEN UND TRENDS BEI MITTELSPANNUNGSKONVERTER

Frische Brise für Umrichter Heute richten sich die Schaltungstopologien in Mittelspannungskonvertern in erster Linie nach den Leistungsgrenzen der Halbleiter. Dieser Artikel beschreibt die Haupt-Topologien für Mittelspannungs-Windkraftumrichter und er zeigt auf, wie unterschiedliche Leistungsklassen mit IGCTs und IGBTs realisiert werden können. Zudem gibt er einen Ausblick auf die weitere Entwicklung bei den Leistungshalbleitern.

U

m den hohen Anforderungen der Netzbetreiber in Bezug auf die Einspeisequalität ins Mittelspannungs-Netz gerecht zu werden ist es eminent wichtig, auch die Leistungselektronikkomponenten in die Betrachtungsweise einzubeziehen. Sie sorgen dafür, dass die Energie unabhängig der gerade an der Anlage produzierten Leistung möglichst verlustfrei in der richtigen Spannung und Frequenz ins Stromnetz eingespiesen wird. Ebenso sorgen sie dafür, dass die Anlage im Fehlerfall sicher vom Stromnetz genommen werden kann. Vom Wind ins Mittelspannungsnetz. Grundsätzlich existieren zwei unterschiedliche Grundkonzepte, um Strom ins Leitungsnetz einzuspeisen. Die immer noch am meisten verbreitete Technologie ist die Erzeugung des Stromes und die Anbindung ans Netz mittels eines doppelt gespeisten Asynchrongenerators (DFIG). Dabei übernimmt die Leistungselektronik in erster Linie die Funktion der Synchronisation mit dem Netz. Die Regelleistung des Umrichters ist in dieser Konfiguration eingeschränkt, die Bauform des Umrichters jedoch sehr kompakt und kostengünstig. Die zweite Technologie speist die erzeugte Energie direkt ab einem Mittelspannungspermanent-Synchrongenerator in einen DCZwischenkreis ein. Der nachgeschaltete Umrichter erzeugt dann die nötige Spannung in der richtigen Frequenz für das Mittelspannungsnetz. Diese Topologie erlaubt eine optimal Anpassung ans Netz und dabei bestmögliche Effizienz. Solche Umrichter sind jedoch wesentlich grösser gebaut und damit auch teurer. Für beide Topologien können zwei unter-

Bild 1: Dank Fortschritten bei den Leistungshalbleitern werden Umrichter immer kompakter und effizienter. (Bilder: ABB Schweiz AG)

schiedliche Schaltungen verwendet werden: 2-Level- oder 3-Level-Umrichter. Für tiefere Spannungen werden in der Regel 2Level-Umrichter eingesetzt (Bild 3). Die Schaltung ist verhältnismässig einfach aufgebaut und richtet sich in erster Linie nach der Verfügbarkeit von standardisierten, industriellen Bauteilen. Eine Serienschaltung

AUTOR Matthias Schütz, Verkaufsingenieur und Mitinhaber PowerParts AG Thema und Idee in Anlehnung an Artikel «Topologies, voltage ratings and state of the art high power semiconductor devices for medium voltage wind energy conversion», B. Backlund, M. Rahimo, S. Klaka, ABB Semiconductors und J. Siefken, 5S Components Inc. INFOS PowerParts AG, 5506 Mägenwil, Tel. 062 896 70 80 info@powerparts.ch, www.powerparts.ch

der einzelnen Bauteile um die maximal Eingangsspannung zu erhöhen, ist in dieser Anordnung praktisch nicht möglich, da sich grosse Schwierigkeiten in der Symmetrierung der Einzelbauteile ergeben würden. Um den Anforderungen nach höheren Leistungen und Spannungen gerecht zu werden, kommen in grösseren Anlagen vermehrt 3-Level-Umrichter zum Einsatz (Bild 4). Durch die Serieschaltung mehrerer Bauteile können wesentlich höhere Zwischenkreisspannungen erreicht werden. Mit identischen Leistungshalbleitern wie bei einem 2-Level-Umrichter ist die maximal erreichbare Ausgangsspannung doppelt so hoch. Der Schaltungsaufbau und Aufwand ist dabei jedoch einiges grösser. Die Hauptanwendung


B A U E L E M E N TE

4.12 megalink

45

was den Filteraufwand reduziert und Kosten spart.

Bild 2: Mittelspannungsfrequenzumrichter für Windturbinen müssen besonders zuverlässig und kompakt sein. Hier der PCS 6000 von ABB mit bis 12 MVA.

dieser Schaltung sind Applikationen der Mittelspannungstechnik. Hohe Spannungen schalten. Noch höhere Ausgangsspannungen können mit Multilevel-Konvertern erreicht werden. In allen Konzepten von Multilevel-Konvertern wird die maximale Spannung auf mehrere tiefere Spannungslevels aufgeteilt. Je mehr Levels involviert sind, desto komplexer wird so-

wohl der Aufbau als auch die Ansteuerungen der einzelnen Leistungshalbleitern. Je mehr Bauteile verwendet werden, desto höher sind auch die Ausfallrisiken der Anlage. Ein Vorteil bei Multilevel-Konvertern ist die in der der Regel tiefere Taktfrequenz. Dadurch lassen sich Schaltverluste reduzieren und ein besserer Gesamtwirkungsgrad erreichen. Zudem gleicht die Ausgangsspannung mehr dem gewünschten Sinus,

Bild 3: Prinzipschaltbild eines 2-Level Umrichters mit IGBTs.

Auf den Leistungshalbleiter kommt es an. Für einen Mittelspannungsumrichter kommen zwei unterschiedliche Leistungshalbleiter in Frage: IGBTs (Insulated Gate Bipolar Transistor) und IGCTs (Integrated Gate-Commutated Thyristor). Der IGBT wird in vielen Anwendungen wie Notstromversorgungen, Umrichtern für Motorantriebe oder Batterieladegeräten verwendet. Meistens werden mehrere Chips in einem Modul mit isolierter Bodenplatte zusammengefügt, wie zum Beispiel in der Gehäusebauform HiPak. Diese Module sind für Sperrspannungen von 1700–6500 V und Stromklassen von 150–3600 A erhältlich. Damit lassen sich Konverter mit einer Leistung von bis zu 500 kW ohne zusätzliche Parallel- oder Serienschaltung von Bauteilen realisieren, und dies bei einem geschickten Kühlkonzept lediglich mit forcierter Luftkühlung. Wird ein doppelt gespeister Asynchrongenerator (DFIG) damit gebaut, beträgt die Leistung der Anlage circa 2,5 MW. Diese Produktefamilie unterliegt intensiven Tests und Selektionskriterien, damit den erhöhten Anforderungen an die Lebensdauer in einem sehr harschen Umfeld Rechnung getragen werden kann. Zudem wird durch interne und externe Massnahmen die Lebensdauer erhöht. Sie unterscheiden sich damit ganz deutlich von den etablierten Standards für Industrieanforderungen. Höhere Sperrspannungen erfordern dickere Silizium-Chips. Je dicker die Chips, desto grösser werden die Schaltverluste. Deshalb werden höher sperrende Bauteile mit tieferen Frequenzen getaktet, 1700 V-Bauteile zum Beispiel in der Regel mit 2–4 kHz. Bild 6 zeigt die Abhängigkeit der Sperrspannung in Bezug zur Schaltfrequenz und der erzielbaren Leistung am Umrichter auf.

(Bilder: ABB Semiconductors)

Bild 4: 3-Level Umrichter mit rückwärts leitenden IGCTs erreichen höhere Spannungen als 2-Level-Umrichter und benötigen kleinere Ausgangsfilter.

IGCTs per Licht steuern. Der IGCT wurde 1997 von ABB Semiconductors in Lenzburg entwickelt und wird seither vor allem in Mittelspannungsumrichtern eingesetzt. Dabei finden sie in industriellen Antrieben ebenso Verwendung wie in Traktionsanwendungen. Kernelement ist ein GTO-Thyristor (Gate turn off Thyristor) der, im Gegensatz zu einem normalen Thyristor, in leitendem Zustand wieder in den Sperrzustand geschaltet werden kann. Dies geschieht mit einer zusätzlichen, fix angebauten Elektronik, der sogenannten GTU (Gate turn off Unit). Die Ansteuerung des Bauteils ist sehr simpel. Sie erfolgt mit Lichtwellenleiter, die angebaute Elektronik kümmert sich um den Rest. Somit lässt sich das Bauteil wie ein grosser Transistor verwenden. IGCTs sind sehr robuste und äusserst zuverlässige 


46

megalink 4.12

B A U E L E M E N TE

Bild 5: Mit IGBT (Insulated Gate Bipolar Transistor)-Modulen, hier die HiPak Familie von ABB Semiconductors, lassen sich mit relaiv geringem Aufwand Umrichter mit mehreren hundert Kilowatt Leistung bauen.

Bauelemente und kommen ohne zusätzliche Schutzbeschaltungen wie Snubber-Baugruppen aus. Die Schalt- und Leitverluste sind wesentlich geringer als bei IGBTs. Mit einem Bauteil der Klasse 4000 A und 4500 V lässt sich ein wassergekühlter 3-Level-Konverter mit einer Umrichter-Leistung von 8 MW ohne Parallel- und Serienschal-

tung von Einzelbauteilen realisieren. Durch die spezielle Montage in einem verpressten Verbund wird die Siliziumscheibe mit dem Leistungshalbleiter beidseitig gekühlt. Dies ergibt eine wesentlich höhere Lebensdauer der Bauteile im Vergleich zu Modulen. Neben der höheren Stromdichte ist auch das sogenannte Failsafe-Verhalten im Verbund mit Serienschaltung von Einzelelementen ein erheblicher Vorteil von IGCTs. Im Fehlerfall legiert das fehlerhafte Bauteil durch und wird komplett leitend. Dadurch lässt sich der Umrichter weiterhin betrieben, dies allerdings mit einer etwas tieferen Sperrspannung des Umrichterzweiges. Wohin geht die Reise? Generell und unabhängig der IGBT- oder IGCT-Technologie geht die Entwicklung bei Umrichtern hin zu grösseren Strömen, minimierten Verlusten und erhöhter Lebensdauer sowie die Bauteile im Fehlerfall im Umrichter robuster und sicherer zu machen. Die Leistungsdichte wird weiterhin steigen und gleichzeitig werden

Bild 6: Je höher die Schaltfrequez ist, desto tiefer ist die mögliche Ausgangsleistung der Halbleiter.

Bild 7: Mit modernen IGCTs (Integrated Gate-Commutated Thyristor) lassen sich ohne Parallel- und Serienschaltung Umrichter mit mehreren Megawatt bauen.

neue Felder an Applikationen hinzu kommen. Ein erfolgversprechendes Konzept ist der von ABB entwickelte BIGT (Bimode Insulated Gate Transistor), ein IGBT Chip mit eingebauter Freilaufdiode auf dem gleichen Chip. Bisher mussten diese immer extern als separate Chips beschaltet werden. Die Integration einer solchen Diode in die IGBT Struktur würde die Leistungsdichte nochmals wesentlich erhöhen und viel grössere Ströme in gleichen Modulgehäusen möglich machen. Durch die Reduktion der parasitären Induktivitäten kann auch ein weicheres Ausschaltverhalten und dadurch geringere Störimmissionen erwartet werden. Diese Technologie wird weiterhin bis zur Serienreife optimiert. Auch bei den IGCTs wird kräftig weiter geforscht. Die Beherrschbarkeit von Kurzschlüssen steht hier mit der HPT-IGCT Generation im Vordergrund. Das Bauteil in kritischen Situationen sicher zu kontrollieren und notfalls ausschalten zu können, sind Anforderungen, welche gerade bei sehr grossen Strömen und Spannungen sehr wichtig sind. Einen Kurzschluss oder Ausfall von Bauteilen nicht beherrschen zu können, wäre in diesen Strom- und Spannungklassen mit erheblichen Beschädigungen der restlichen Anlageteile verbunden. Die Leistungsgrenzen sind noch lange nicht erreicht. Die Leistungselektronik entwickelt sich noch immer unaufhaltsam weiter. Die Kenndaten der Bauteile werden immer besser. Dadurch erschliessen sich immer mehr neue Applikationen oder die Chance, bestehende Konzepte zu überdenken und neue Formen und Lösungen zu finden. ■

Bild 8: Aufbau und Struktur eines BIGT (Bimode Insulated Gate Transistor), der einen IGBT mit einer Freilaufdiode kombiniert.


#

4.12 megalink

47

Halbleiter

Mit kleinen Bauelementen große Sprünge machen Klein sind auf den ersten Blick alle Halbleiter, doch welche Leistung in ihnen steckt und welche Möglichkeiten sich eröffnen, wollen wir Ihnen sichtbar machen. Unsere FAEs unterstützen Sie, die besten Komponenten für Ihre Bedürfnisse zu wählen. In Sachen Halbleitern arbeiten bei MSC-Gleichmann die Teams MCU, Programmierbare Logik, Wireless und Power Hand in Hand. Wir finden für Sie die richtige Lösung für Ihre Anwendung, damit Sie mit richtig großen Sprüngen Ihr Ziel erreichen.

Mikrocontroller

Programmierbare Logik

Powerkomponenten

Analoge / Lineare Komponenten

Optoelektronik

Sensoren

RF-Wireless

V-2_2012-VCEK-5939

Sprechen Sie uns an.

MSC-Gleichmann Schweiz AG Hauptsitz Rotkreuz Tel. +41 41 785 82 00 Rotkreuz@msc-ge.com

Büro Biel/Bienne Tel. +41 32 366 85 65 Biel@msc-ge.com

www.msc-ge.com

Büro Montreux Tel. +41 21 965 35 00 Montreux@msc-ge.com

Büro Volketswil Tel. +41 43 355 33 66 Volketswil@msc-ge.com


#

Gehäuse

megalink 4.12

ROSE

BLOCAN® Profilmontagesysteme

48

Polyester-Gehäuse

Edelstahl-Gehäuse

Aluminium-Gehäuse

www.phoenix-mecano.ch Phoenix Mecano Komponenten AG

Hofwisenstrasse 6 Postfach 132 CH-8260 Stein am Rhein

Telefon +41 (0)52 742 75 00 Telefax +41 (0)52 742 75 90 e-mail: info@phoenix-mecano.ch


E N E R G I E TE C H N I K

4.12 megalink

49

MIT SCHALTUNGSTECHNOLOGIE UND KREATIVER MECHANIK ZU 95% WIRKUNGSGRAD

Mehr Wirkungsgrad bitte! Die Reduzierung der Baugrösse und die Verbesserung des Wirkungsgrades sind bei der Entwicklung von Netzteilen eine immerwährende Forderung. Zusätzlich spielt durch die stärkere Verbreitung von tragbaren Geräten nicht nur die Grösse, sondern auch das Gewicht eine immer wichtigere Rolle. Wie kann der Wirkungsgrad von Schaltnetzteilen auf bis zu 95 % erhöht werden?

U

m Netzteile kleiner zu bauen, gibt es eine einfache Lösung: Durch den Einbau eines Lüfters lässt sich das Volumen um 30 bis 50 % reduzieren. Allerdings sind die Lüftergeräusche zum Beispiel bei Medizingeräten ein grosser Nachteil, da diese die Patienten stören und irritieren können. Zudem sinkt dadurch die Zuverlässigkeit, da der Lüfter das einzige bewegliche Teil in der Stromversorgung ist und Wartung benötigt. Weniger ist mehr. Die Reduzierung der Bauteileanzahl hilft bei der Minimierung der Grösse und Kosten. Doch um die EMVGrenzwerte einhalten zu können, braucht es einfach eine gewisse Zahl an Komponenten – genau wie für die Gerätesicherheit, um die Anwender vor gefährlichen Spannungen zu schützen. Den grössten Einfluss auf die Netzteilgrösse haben Fortschritte bei den Leistungshalbleitern, gefolgt von den Verbesserungen bei den Kernmaterialien und den Kondensatoren. Wirkungsgrad lässt Netzteile schrumpfen. Konvektionsgekühlte Geräte, also solche ohne Lüfter, können die Abwärme nur über die Oberfläche abführen. Das bedeutet, je grösser das Gerät ist, desto mehr Verlustwärme darf es erzeugen. Je höher der Wirkungsgrad eines Gerätes ist, umso weniger Verlustwärme muss abgeführt werden und umso kleiner kann das Gerät werden. Schon ein etwas besserer Wirkungsgrad kann einen grossen Einfluss haben. Ein Netzteil mit 95% Wirkungsgrad muss zum Beispiel im Vergleich zu einem mit 90% die Hälfte weniger Verlustleistung abführen. Bei einem 250-W-Gerät wird dadurch zum Beispiel die Verlustleistung um 14,6 W reduziert.

INFOS XP Power AG 5210 Windisch Tel. 056 448 90 80 chsales@xppower.com www.xppower.com

Bild 1: Um möglichst kompakte Netzteile ohne Lüfter bauen zu können, muss der Wirkungsgrad über 90 % liegen. (Bilder: XP Power)

Der Wirkungsgrad ist sowohl von der Eingangsspannung wie auch von der Last abhängig. Daher lohnt es sich, den Wirkungsgrad unter den speziellen Einsatzbedingungen der Anwendung zu prüfen. Ein Weg, um die Grösse der magnetischen Bauteile und Kondensatoren zu reduzieren, ist die Erhöhung der Schaltfrequenz. Durch die höhere Schaltfrequenz steigen aber die Schaltverluste, die Kernverluste der Wickelgüter und zum Teil

durch den Skineffekt die Widerstandsverluste im Draht. Der Zusammenhang zwischen dem Wirkungsgrad und der Schaltfrequenz bei einem typischen 200-WattNetzteil zeigt Bild 2. Darf es ein bisschen mehr sein? Die besten der heutigen konvektionsgekühlten 250Watt-Stromversorgungen verfügen über einen Wirkungsgrad von über 90% im gesamten Eingangsspannungsbereich 


50

megalink 4.12

E N E R G I E TE C H N I K

teils dargestellt, das einen Wirkungsgrad von bis zu 95% bei 240 VAC und 92% bei 90 VAC erreicht.

94

Wirkungsgrad (%)

92

Kleinvieh macht auch Mist. Um jedes unnötige mW Verlustleistung zu vermeiden, wurde bei diesem Netzteil in jedem Schaltungsteil die Verlustleistung minimiert. So wurde zum Beispiel bei den Eingangsfilterdrosseln die Wicklungen mit extrem geringem Widerstand realisiert, wodurch die Kupferverluste nahezu eliminiert wurden. Der in diesem Design eingesetzte EMV-Filter ist ein zweistufiges Filter, mit Kernmaterial mit hoher Permeabilität. Dieses wurde sorgfältig ausgewählt, um sowohl die Schaltspitzen zu dämpfen als auch die Verlustleistung zu minimieren.

90

88

86

84

82 30

40

50

60

70

80

90

100 110 120 130 140 150 160 170 180 Schaltfrequenz (kHz)

190 200

Bild 2: Auswirkung auf den Wirkungsgrad eines 200 Watt Netzteils bei Erhöhung der Schaltfrequenz.

Bild 3: Dieses 250 W-AC/DC-Netzteil hat einen Wirkungsgrad von bis zu 95 %.

von 90 bis 240 VAC. Dieser muss mindestens erreicht werden, um bei der Standardgrösse von 6 x 4" die Verlustwärme ohne forcierte Kühlung oder grossen externen Kühlkörper abführen zu können.

Ein Wirkungsgrad von über 90% kann nur mit nahezu verlustleistungslosem Schalten im aktiven PFC-Kreis, dem Hauptwandler und der Gleichrichtung erreicht werden. In Bild 3 ist der Aufbau eines 250-Watt-Netz-

Im richtigen Moment schalten. Die Quasiresonanz PFC-Schaltung arbeitet im diskontinuierlichen Betrieb und generiert dadurch ebenfalls extrem geringe Verlustleistung. Die Schaltfrequenz bewegt sich zwischen 30 und 500 kHz um Zero Current Switching (ZCS) über den gesamten Last- und Eingangsspannungsbereich zu gewährleisten. Dies ist entscheidend, so sichergestellt wird, dass die Spannung nur im Stromnulldurchgang geschaltet wird, wodurch Schaltverluste minimiert werden. Ein weiterer Vorteil des ZCS sind die relativ geringen Störungen bei leitungsgebundener und abgestrahlter EMV sowie geringer Ausgangsripple und Störungen. Der Hauptwandler ist ein Halbbrückenresonanzwandler mit Festfrequenz, ebenfalls mit verlustleistungsarmer ZCS-Technologie. Es werden zwei Übertrager eingesetzt, da diese geringere Verluste als ein grosser Übertrager haben. Die Schaltfrequenz der beiden Wandler liegt bei 51,2 kHz, wobei die Ausgänge mit 90° Phasenverschiebung arbeiten. Durch das Zusammenschalten der beiden Ausgänge wird wie in Bild 3 dargestellt der Ripple reduziert und die Ripplefre-

Besuchen Sie uns: AUTOMATICA - Halle B3 Stand 502

Der Preis-Boxer:

Fünf-Achs-Gelenkarm ... Fliegengewicht mit schlagenden Argumenten für Maschinenbauer und Automatisierer: Extrem leichter (995 g), schmierfreier bionischer Gelenkarm aus Hochleistungskunststoff und Aluminium. Lasten zwischen 0,5 und 1kg. Alle Komponenten sind einzeln ab 24 h Lieferzeit erhältlich. Low-cost-Automation mit robolink® von igus®.

.ch/robolinkAb24h ®

Tel. 062 388 97 97 Fax 062 388 97 99 Mo.-Fr. 8 bis 20h Sa. 8 bis 12h plastics for longer life®

Die Begriffe "igus, robolink, plastics for longer life" sind in der Bundesrepublik Deutschland und gegebenenfalls international markenrechtlich geschützt.


E N E R G I E TE C H N I K

Bild 4: Die Kombination der Ausgänge von zwei Wandlern mit 90° Phasenverschiebung halbiert den Ripple und verdoppelt die Ripplefrequenz.

quenz verdoppelt. Dies wiederum halbiert die erforderliche Kapazität und Grösse der Ausgangskondensatoren. Die Regelung überwacht die Ausgangsspannung des Gerätes und verändert entsprechend die Spannung des Boost Converters, was wiederum die Eingangsspannung des Hauptwandlers verändert. Die Hauptaufgabe des Boost Converters besteht darin, die Spannung der PFC-Stufe von zirka 380 VDC auf 420 VDC zu erhöhen. Damit kann das Design des Haupt-

4.12 megalink

51

Bild 5: Zero Current Switching (ZCS) und der Einsatz von Resonanzwandlern ergibt einen hohen Wirkungsgrad über einen weiten Last- und Eingangsspannungsbereich.

wandlers optimal auf sehr eng definierten Spannungsparameter vorgenommen werden, was ein weiterer Faktor für das Erreichen des sehr hohen Wirkungsgrades ist. In der Ausgangsstufe werden anstatt normaler Dioden Synchrongleichrichter eingesetzt, um damit auch in diesem Schaltungsteil die Verlustleistung deutlich zu reduzieren. Wie in Bild 4 dargestellt, ergibt dieser Netzteilaufbau einen hohen Wirkungsgrad über einen weiten Last- und Eingangsspannungsbereich.

Kommt Zeit, kommt Wirkungsgrad. Durch kreatives mechanisches Design kann die thermische Performance deutlich verbessert werden. Die Vermeidung von Hotspots und der Sicherstellung der bestmöglichen Entlüftung der Bauteile sind wichtig. Die Kombination der besten Designtechnologien und kreativer Mechanik ermöglicht Netzteile mit einem Wirkungsgrad von 95%, was vor einigen Jahren als nicht machbar angesehen wurde. ■

nkt: ogistikpu istiker post .ch/l kt für Log n u p ff e tr e n li der On

Kuriersendungen in Bestzeit zustellen: Auch das ist Logistik. Die Post unterhält schweizweit das dichteste Netz für Kuriersendungen. Dokumente oder andere dringende Sendungen holen wir bei Ihnen ab und stellen sie auf schnellstem Weg zu. Direkt mit dem Auto oder, wann immer möglich, umweltfreundlich auf Schiene und Strasse. Bestellung und Informationen über die Gratisnummer oder unter post.ch/kurier. Was immer Sie wünschen, vertrauen Sie auf die Logistikerin mit dem umfassendsten Angebot. Für die anspruchsvollsten Kunden der Welt.

0800 888 888


52

megalink 4.12

EMBEDDED

Bild 1: Präzise Lasersensoren messen die Auslenkungen der Reagenzplatte in jede Richtung exakt aus.

EMBEDDED COMPUTING CONFERENCE 5. JUNI 2012 – TESTSYSTEM FÜR DNA-SEQUENZIERER

Auf Herz und Nukleotid geprüft Nahezu vollständig kann das Erbgut mithilfe von DNA-Sequenzierern entschlüsselt werden. Zur Prüfung des produzierten Gerätes braucht es aber eine ausgefeilte und weitgehend automatisierte Testumgebung.

M

ittlerweile gilt sie als die Schlüsseltechnologie in der modernen Mikrobiologie. Die DNA-Sequenzierung schlüsselt einzelne Basenpaare eines DNA-Strangs auf und entlockt dem Erbgut die Geheimnisse. Verschiedene technische Verfahren haben sich etabliert und bewährt – so auch DNASequenziergeräte.

AUTOR Dusan Markovic, Noser Patrice Guillet, Noser INFOS Noser Engineering AG 8404 Winterthur Tel. 052 234 56 11 info@noser.com www.noser.com

Auf die Pipette – Nukleotid – los. Für die Firma Qiagen entwickelte Noser ein Testsystem für ein solches Gerät mit dem Namen PyroMark Q96 ID (Bild 2). Der Sequenzierer ermittelt die Nukleotid-Abfolge in einem DNA-Molekül mithilfe der Pyrosequenzierung. Das heisst: durch Pipettieren von Nukleotiden in DNA-Proben erzeugen enzymatische Reaktionen kleine Lichtblitze, die eine CCD-Kamera, in der Sequenzierapparatur, detektiert (siehe Kasten). Die Intensität der Lichtblitze gibt an, wie viele Nukleotide aus der Enzymflüssigkeit an den Nukleotiden im DNA-Strang angehängt werden und quantifiziert so die Sequenz. Der Sequenzierer ist modular aufgebaut und wird nach dem Six-Sigma-Prinzip getestet. Jedes Modul wird einzeln geprüft, bevor es im Gesamtgerät verbaut wird. Im letzten Schritt wird das Gerät aus getesteten Modulen

zusammengebaut und ist dann bereit für die finale Prüfung, dem Unit-Test, bei dem eine Ausfallwahrscheinlichkeit kleiner 0,0000019 Prozent (Sigma-Level 6) gewährleistet ist. Die Komponenten des Geräts stellen hohe Anforderungen an das Prüfverfahren: Die

Genetik-Crashkurs Die DNA ist ein in allen Lebewesen vorkommendes Biomolekül und Trägerin der Erbinformation. Sie ist Träger der Gene, die die Information in Proteine umwandelt. Nukleotide sind die Grundbausteine der DNA. Es ist ein Molekül mit einem Phosphat-, einem Zuckerund einem Basenbestandteil. Viele Arten von Nukleotiden haben lebensnotwendige regulatorische Funktionen in Zellen. Ein Enzym ist ein Protein, das eine oder mehrere biochemische Reaktionen katalysieren kann. Enzyme haben Funktionen im Stoffwechsel von Organismen, sie steuern zum Beispiel die Verdauung. (Quelle: Wikipedia)


4.12 megalink

maximale Auslenkung (Peak-Peak) in der XAchse darf 0,1 mm nicht überschreiten. Aus diesem Grund wurden Lasersensoren mit einer Auflösung von 4 μm eingesetzt (Bild 1). Eine weitere Herausforderung war die Messeinrichtung für den Test des Pipettierdrucks, bei dem hochdynamische Drucksensoren zum Einsatz kommen. Die verwendeten Sensoren werden unter anderem auch bei Windkanalmessungen eingesetzt. Das multifunktionale Datenerfassungsgerät NI USB-6218 von National Instruments sorgt für den Anschluss aller externen Sensoren an das Testsystem. Der EmbeddedPC innerhalb des DNA-Sequenzierers steuert alle Sensoren und Aktoren im Gerät über eine vorhandene COM-DLL mithilfe von ActiveX Modulen aus LabView. Der Prüfling wächst an der Herausforderung. Um die Auslenkungen der Reagenzplatte zu erfassen, wurde eigens ein mechanischer Aufbau entwickelt, in dem das Reagenzmodul eingespannt und fixiert werden kann. Fünf Lasersensoren – zwei für X- und Y-Richtung und drei für die Z-Richtung – decken alle Richtungen ab. Für die Messung des Pipettierdrucks wurde eine Druckkassette angefertigt . Sämtliche Algorithmen für die Auswertung der Sensoren-Messdaten und die Ansteuerung entsprechender Aktoren wurden in LabView programmiert. LabView erlaubt ein iteratives Vorgehen: ein komplexer Ablauf wird durch Zerlegung in kleinere Zwischenschritte umsetzbar. So konnten im ersten Schritt die Sensor-Messdaten ausgelesen und dargestellt werden. Anschliessend entstand der eigentliche Auswertealgorithmus. Die übersichtliche Darstellung der Messdaten und Ergebnisse im GUI wurde durch die mitgelieferte Frontpanel Design-Bibliothek unterstützt. Das mit LabView gestaltete GUI (Bild 3) der Testsoftware erleichtert dem Testoperator durch die visuelle Führung den gesamten Testablauf mit entsprechenden Texten und Bildern pro Testschritt. Somit sind keine niedergeschriebenen Testinstruktionen nötig. Ein weiteres Feature des Testsystems war die Implementierung eines Barcode-Scanners, der es dem Testoperator ermöglicht, alle benötigten Angaben für den Testablauf, wie zum Beispiel Seriennummern der einzelnen Module einzulesen und nicht mehr von Hand eingeben zu müssen. Tests und ihre Technik. Moderne Testumgebungen haben ein Ziel: automatisiert und aufwandfrei testen. Die User-Interaktion wird auf ein Minimum reduziert. Um aber einen validierten Prozess zu gewährleisten, müssen die Möglichkeiten des Operators

53

Embedded Computing Conference 2012 Am 5. Juni 2012 trifft sich an der Embedded Computing Conference (ECC) an der ZHAW in Winterthur die Schweizer Embedded Community. Experten von Unternehmen und Hochschulen präsentieren die neuesten Erkenntnisse und Entwicklungen aus der Praxis und Wissenschaft. Hochstehende Vorträge sowie eine Tischmesse bieten eine effiziente Informations- und Kontaktplattform rund um das Thema Embedded Computing. Die Konferenz bietet einen optimalen Mix aus theoretischer und praktischer Forschung und Entwicklung und schlägt eine Brücke zwischen den Hochschulen und der Industrie. Sie deckt das gesamte Spektrum von industriellen Betriebssystemen, Software-Tools, Applikationssoftware, Hardware-Plattformen bis hin zu Entwicklungsdienstleistungen ab. Während der Kaffee- und Mittagspause stehen die Experten aus der Industrie und Forschung für Fragen zur Verfügung. Das Wichtigste in Kürze Datum: Zeit: Ort: Adresse: Infos und Anmeldung:

5. Juni 2012 8.30–18.00 Uhr ZHAW Winterthur School of Management and Law, St.-Georgen-Platz 2, 8401 Winterthur www.embeddedcomputingconference.ch

eingeschränkt sein. Er soll keine Parameter und Prüfabläufe am System ändern können. Der Administrator allein passt zum Beispiel bei einer neu verwendeten Kom-

ponente die Testlimiten an. Sie müssen bei einem validierten System neu verifiziert und freigegeben werden. Für jedes getestete Gerät muss ein Prüfprotokoll erstellt 

SmartReflect™ für transparente Objekte. SmartReflectTM – die erste Lichtschranke ohne Reflektor.

Der neue SmartReflect™ von Baumer funktioniert zuverlässig ohne Reflektor. Und das ab sofort auch bei hochtransparenten Gegenständen und Folien. Der neue SmartReflect™ von Baumer funktioniert zuverlässig ohne Reflektor. Und das ab sofort auch Mehr über die neuen SmartReflect™ bei hochtransparenten Gegenständen und Folien. erfahren Sie unter www.baumer.com/smartreflect Mehr über die neuen SmartReflect™ erfahren Sie unter


54

megalink 4.12

Aussteller Unternehmen Albis Technologies AG, Zürich Arendi AG, Hombrechtikon AVNET EMG Silica, Langenthal bbv Software Services AG, Luzern bytes at work AG, Winterthur CSA Engineering AG, Solothurn Computer Controls AG, Otelfingen Elma Electronic AG, Wetzikon Enclustra GmbH, Zürich EVOCEAN GmbH, Rotkreuz Fabrimex Systems AG, Schwezenbach Glyn GmbH & CO. KG, Esslingen Indel AG, Russikon Ineltro AG, Regensdorf Inovis Live Automation AG, Bubikon Neratec Solutions AG, Bubikon Noser Engineeering AG, Winterthur Schmid Elektronik AG, Münchwilen Simpex Electronic AG, Wetzikon Supercomputing Systems AG, Zürich Swissprime Technologies AG, Wädenswil Trenew Electronic AG, Rüti Triadem Solutions AG, Biel Zühlke Engineering AG, Schlieren Hochschulen BFH, Burgdorf FHNW, Institut für Mikroelektronik, Windisch HSLU T& A CC, Electronics, Horw ZHAW, Institut of Embedded Systems, Winterthur

und in der Unternehmensinfrastruktur entsprechend abgelegt werden. Das Protokoll muss ausserhalb des Testsystems gegen mögliche Modifikationen gesperrt sein. Das von Noser entwickelte Testsystem muss ähnliche Produkte mit möglichst geringen Anpassungen abdecken. Ein Umbau soll in einer möglichst kurzen Zeit realisiert werden können. Früher wurden für solche Prüfsysteme eigene Testprogramme in Programmierspra-

chen wie C++ oder Visual Basic entwickelt. Sie sind komplex und lassen sich nur aufwändig anpassen. Zudem müssen Treiber für Sensoren und andere Peripheriegeräte oft selbst geschrieben werden, was zusätzliche Komplexität und Risiken in der Testsoftware birgt. Demgegenüber basieren LabView und TestStand von National Instruments auf dem Konzept der grafischen Programmierung. Durch ihren Ansatz ist es einfacher, sich in ein bestehendes Programm einzuarbeiten und zu verstehen, was eine Routine bezweckt. Treiber und Funktionen, die in Testsystemen vorkommen, sind in wenigen Schritten implementierbar. Zwei stecken unter einer Decke. LabView besitzt zwei unterschiedliche Editierungsoberflächen: Das Frontpanel beinhaltet Bedienund Visualisierungsobjekte, während das Blockdiagramm die Bedien- und Visualisierungsobjekte funktional verknüpft. Die Funktionsbibliothek beschleunigt die Programmierung einzelner Abläufe und Algorithmen und gestaltet den Code durch die grafische Darstellung leserlicher als in textbasierten Programmiersprachen. Mittels der Testsoftware TestStand kann systematisch und wiederkehrend getestet werden. Damit lassen sich Prüfsequenzen entwickeln, die Codemodule aufrufen, die in beliebigen Programmiersprachen erstellt sein können. Diese Codemodule testen den Prüfling auf Herz und Nieren und leiten die Ergebnisse an TestStand weiter. Die erstellten Sequenzen definieren somit die Abarbeitungsreihenfolge, die Überprüfung der Messergebnisse, die Berichterstellung sowie die Anbindung an Datenbanken. Die Verbin-

Bild 2: Der Pyrosequenzierer kommt dem Ergbut auf die Spur. (Bilder: Noser)

dung von LabView mit TestStand ermöglicht in sehr kurzer Zeit die Entwicklung eines Prüfsystems für die Produktion. Durch die grafische Programmierung sind zukünftige Änderungen oder Erweiterungen mit wesentlich geringerem Einarbeitungsaufwand verbunden. ■

Die Pyrosequenzierung Beim Pyrosequenzing wird die DNA-Polymerase durch ein ausgeklügeltes Enzymsystem unter Beteiligung einer Luziferase dabei beobachtet, wie sie ein Nukleotid nach dem anderen an den neusynthetisierten DNA-Strang anhängt. Die zu sequenzierende DNA dient als Matrize (oberer Strang im Bild) und liegt einzelsträngig vor. Polymerase Primer

CGTCCGGAGGCCAAGTTCCA

GCAGGCCT

Bild 3: Die Operator GUI des Testsystems ist selbsterklärend, weshalb kein zusätzliches Handbuch nötig ist.

Die DNA-Polymerase verlängert von einem Primer ausgehend den komplementären DNA-Strang Nukleotid um Nukleotid. Der Einbau eines Nukleotids wird durch die Luziferase in einen Lichtblitz umgesetzt, der von einem Detektor erkannt und aufgezeichnet wird. Es wird nun nacheinander immer eine der vier Nukleotidsorten zum Ansatz hinzu gegeben. Bei Zugabe des passenden (komplementären) Nukleotids erhält man ein Signal; wurde ein an dieser Stelle ein nicht passendes Nukleotid zugegeben, bleibt der Lichtblitz aus. Danach werden die vorhandenen Nukleotide zerstört und eine andere Art wird zugesetzt, dieser Vorgang wird fortgesetzt, bis sich wieder eine Reaktion zeigt.


MESSEN UND PRÜFEN

4.12 megalink

55

EBV LIGHTLAB: VOLLER SUPPORT MIT ZWEI ULBRICHT-KUGELN, SPEKTRALRADIOMETER, GONIOFOTOMETER UND MEHR

Analyse von der LED bis zur Leuchte Als erster europäischer Distributor bietet EBV Elektronik mit dem EBV LightLab Zugang zu einem professionellen Lichtlabor. Im EBV LightLab können auch Newcomer im Bereich der LED-Beleuchtung unter sachkundiger Anleitung praktisch sämtliche relevanten lichttechnischen Messungen gemäss den CIE-Vorgaben durchführen – von einzelnen LEDs über LED-Module bis hin zu kompletten Leuchten.

V

iele Leuchtenhersteller möchten gerne den Sprung von konventionellen Glühfaden- und CFL-Lampen («Energiesparlampen») hin zur LED-Beleuchtung machen, verfügen aber derzeit weder über das notwendige Design-Know-how noch über das teure Mess-Equipment. Bereits seit mehreren Jahren unterstützt die EBV Elektronik diese Kunden beratend im Rahmen ihrer EBVLightSpeed-Aktivitäten. Ins rechte Licht rücken. Seit Februar 2012 bietet EBV Elektronik seinen Kunden in Poing bei München einen neuen Service: das EBV LightLab genannte Lichtlabor. Damit ermöglicht EBV als erster europäischer Distributor Kunden in EMEA kostenlos die Durchführung radiometrischer und lichttechnischer Messungen über die gesamte Lichtkette hinweg: von Messungen an einzelnen Leuchtdioden oder LED-Modulen über Vergleichsmessungen von Lichtquellen (zum Beispiel Glühlampe gegenüber CCFL- und LED-Lösungen) bis hin zur Komplettvermessung ganzer Leuchten. Dadurch erhalten selbst kleine Unternehmen Zugang zu hochpräziser Messtechnik – unter sachkundiger Betreuung durch einen EBVLightSpeed Experten. In dem EBV LightLab wird EBV auch Trainings- und Kundenseminare durchführen. In diesen Schulungen erklärt EBV Unterschiede, Vor- und Nachteile der einzelnen Lichtquellen, und gibt Tipps zur optimalen Implementierung von Leuchten, die an ihre jeweilige Anwendung angepasst sind. Mittelfristig beabsichtigt EBV auch, eigene Referenz-Designs für LED-Beleuchtungen zu entwickeln. «Mit dem EBV LightLab können Kunden ihre Lichtprojekte noch schneller und effizienter berechnen und auswerten und somit

INFOS EBV Elektronik 8953 Dietikon Tel. 044 745 61 61 dietikon@ebv.com www.ebv.com/lightlab

Mit den verschiedenen Messgeräten lassen sich im Lichtlabor von EBV einzelne LEDs bis zu komplette Leuchten vermessen. (Bilder: EBV)

ihre Time-to-Market entscheidend verkürzen», so Wolfgang Reis, EBV LightLab Manager. «Ein weiterer wichtiger Bestandteil des EBV LightLab wird die EBVLightAcadamy. Hier bieten wir Kunden Schulungen vor Ort im EBV LightLab aber auch online, sodass alle Kunden in EMEA live in Form von Webinaren an diesen Seminaren teilnehmen können.» Messgeräte für jedes Licht. Die Liste der Messeinrichtungen des EBV LightLab reicht von zwei Ulbrichtkugeln für 2␲- und 4␲Messungen über ein Spektralradiometer für Referenzmessungen und ein Goniofotometer bis zu einem Leuchtdichtemessgerät und einem Luxmeter. Ergänzt wird diese Palette durch eine spezielle Mess-/Auswerte- und Steuerungssoftware, Source- und Multimeter, eine Wärmebildkamera sowie ergänzende Werkzeuge. Das auf den ersten Blick auffälligste Element des EBV LightLab sind die beiden Ulbricht-Kugeln, in denen einerseits die zur Bestimmung der Lichtausbeute (gemessen in Lumen pro Watt) notwendige Messung des Lichtstroms sowie der Strahlungsleis-

tung erfolgt, andererseits aber auch farbmetrische Messungen von der quantitativen Spektralverteilung bis zur Bestimmung der Farbtemperatur und des Farbwiedergabeindexes durchgeführt werden. Im EBV LightLab befinden sich gleich zwei Ulbricht-Kugeln: eine 2␲-Kugel mit 250 mm Durchmesser und eine 4␲-Kugel mit 1000 mm Innendurchmesser. Ulbricht-Kugeln sind im Inneren mit Bariumsulfat (BaSO4) ausgekleidet, das etwa 98 % des Lichts diffus reflektiert. Damit erfolgt auf optischem Wege eine Integration des Lichts in der Kugel über die Reflektorflächen auf der Kugelinnenseite, sodass Lichtstrommessungen gemäss den Anforderungen der CIE 127 möglich werden. In der kleinen Ulbricht-Kugel erfolgt beispielsweise die Messung oder Selektion einzelner LEDs. Mit der 250-mm-Ulbricht-Kugel sind die Ingenieure in der Lage, den halbkugelförmigen Raum (Steradiant: 2␲) oberhalb einer kleinen Leiterplatte und damit eine LED auszumessen. So können beispielsweise LEDs mit einer exakt definierten Wellenlänge selektiert werden, wenn fünf exakt gleiche LEDs gebraucht werden. 


56

megalink 4.12

L E I S TU N G S E L E K TR O N I K

Für das Ausmessen einer ganzen Leuchte ist allerdings eine 4␲-Kugel entsprechender Grösse notwendig. Aus diesem Grund hat EBV zusätzlich zur 250-mm-Kugel auch eine Ulbricht-Kugel mit 1000 mm Innendurchmesser (Steradiant: 4␲) für «Rundummessungen» angeschafft. Diese grosse 4␲-Ulbricht-Kugel eignet sich sehr gut für das Vermessen von High-Power-LEDs sowie ganzer Leuchten von bis zu 90 cm Kantenlänge. Das Lichtspektrum exakt erfassen. Kernelement der gesamten Messtechnik im EBV LightLab ist das Spektralradiometer CAS 140CT-156 von Instrument Systems, das auf Referenzmessungen in der Industrie bei 24stündigem Dauerbetrieb ausgelegt ist. Dieses Präzisionsgerät misst im Millisekundenbereich die spektrale Leistungsverteilung einer Lichtquelle von 1100 nm (Infrarot) über das sichtbare Licht bis in den UV-Bereich bei 300 nm, mit einem Datenpunkt-Intervall von 0,8 nm über einen sehr hohen Intensitätsmessbereich von neun Dekaden hinweg, was einem Dynamik-Bereich von 1:1000000000 entspricht.

der gesamte Messprozess per Software steuern lässt: von der elektrischen Ansteuerung der LED bis zu den Details der Datenausgabe beziehungsweise Datenaufbereitung. Das zu messende Licht gelangt jeweils über CIE-konforme Einkoppel-Optiken und einen Lichtwellenleiter in das Analysegerät. Farbspektrum und Farbwiedergabe in der Praxis. Licht- und Leuchten-Designer sind sehr an der spektralen Aufteilung des Lichts interessiert. In diesem Zusammenhang stehen besonders die Lage von Intensitäts-Peaks sowie die spektrale Verteilung, aber auch der Farbwiedergabeindex CRI und die Farbtemperatur im Fokus der Untersuchungen. So besagt der CRI-Wert, wie ein Objekt bei der Bestrahlung mit einem bestimmten Licht wirkt. Ein gutes Beispiel hierfür sind die hellen Strassenlaternen, deren Natriumdampflampen ein gelbliches Licht abgeben. Natriumdampflampen sind sehr effizient und liefern für ihren elektrischen Leistungsverbrauch einen hohen, in Lumen gemessenen Lichtstrom und damit eine hohe Lichtausbeute (lm/W). Allerdings emittieren

Das Goniofotometer misst die winkelabhängige Abstrahlcharakteristik von Einzel-LEDs und kleineren LED-Modulen mit einer Winkelauflösung von 0,1°.

Die gesamte Messwertausgabe erfolgt über den USB-Bus an einen PC/Laptop/ Notebook, wo unter Windows (ab XP) die Software SpecWinPRO die weitere Aufarbeitung übernimmt. Diese Software liefert nicht nur die Messdaten als Einzeldaten in einer Tabelle, sondern sie zeigt die Spektralverteilung sowie die Position im Farbdiagramm grafisch an. So berechnet die Software aus den Messwerten zusätzlich die Farbtemperatur sowie den FarbwiedergabeIndex CRI (Color Rendering Index). Dabei misst das Gerät «lediglich» die radiometrische Leistung; zur Bestimmung der fotometrischen Leistung bewertet die Software die radiometrischen Spektralmessdaten anhand der Empfindlichkeitskurve des menschlichen Auges und gibt den Lichtstrom in der Einheit Lumen aus. Über ein Plug-In steuert die Software SpecWinPRO ein Source-Meter von Keithley, sodass sich

Natriumdampflampen relativ monospektral mit gelblichem Licht erhellen. Dadurch ist zwar erkennbar, ob sich Menschen, Tiere oder Fahrzeuge auf der Fahrbahn befinden, aber es ist nicht möglich, im Schein dieser Lampen auf einer Landkarte eine rote von einer grünen Linie zu unterscheiden. Gleichzeitig erscheinen die Bäume schwarz. Analog dazu weisen auch diverse Leuchtdioden gewisse farbtechnische Kompromisse auf, die sich allerdings mittlerweile sehr gut kompensieren lassen, sodass LED-Leuchten bei geschicktem Design Licht mit einem hervorragenden Farbwiedergabe-Index von erheblich über 90 erzeugen können. Zur Abstimmung derartiger Lichtquellen sind jedoch eine 4␲-Ulbricht-Kugel sowie ein Spektralradiometer erforderlich. Woher kommt das Licht? Mit einem Goniofotometer des Typs Ledgon 100 von Instrument

Systems ist EBV Elektronik in der Lage, die winkelabhängige Abstrahlcharakteristik von Einzel-LEDs und kleineren LED-Modulen zu ermitteln – und zwar mit einer Winkelauflösung von 0,1° über den gesamten Halbraum in Abstrahlrichtung der LED hinweg. In Kombination mit dem Spektralradiometer CAS 140CT lassen sich damit auch diverse spektrale Parameter wie Farbkoordinaten oder Farbtemperatur winkelabhängig vermessen. Da verschiedene Parameter weisser LEDs wie beispielsweise die Farbtemperatur erheblich mit dem Abstrahlwinkel variieren, kommt goniofotometrischen Messungen eine besondere Bedeutung zu. Während bei Messungen in einer UlbrichtKugel geometrisch bedingte Messfehler auftreten können, eignet sich dieses mit Servomotoren ausgerüstete und von der Software SpecWinPRO vollautomatisch gesteuerte Goniofotometer auch zur präzisen Bestimmung der Strahlungsleistung sowie des Lichtstroms und damit auch zur Bestimmung des so wichtigen Lichtausbeute-Quotienten, der in der Masseinheit lm/W angegeben wird. Da sowohl das Goniofotometer als auch die beiden Ulbricht-Kugeln komplett lichtdicht ausgeführt sind, eignen sich diese Geräte auch für Messungen in einem normal erleuchteten, nicht abgedunkelten Raum. Hot-Spots erkennen. Eine Wärmebildkamera des Typs TI25 von Fluke gestattet es, heisse Stellen auf Leiterplatten rechtzeitig zu erkennen, um auf Basis dieser Daten das thermische Management (ergo: die sinnvolle Ableitung von Verlustwärme) zu optimieren. Als Ergänzung dieser Messgeräte verfügt das LightLab auch über zwei BeleuchtungsMessgeräte von Gossen, die sich jeweils über eine USB-Schnittstelle an einen PC anschliessen lassen: Es handelt sich dabei um das Leuchtdichte-Messgerät Mavo-Spot 2 und um das Luxmeter Mavolux 5032B USB. Die «Leuchtdichte-Kamera» Mavo-Spot 2 ermöglicht durch Anvisieren von Objekten wie Strassen, Tunneln, Sportplätzen oder Flugplätzen aus der Ferne entsprechende Leuchtdichte-Messungen (Einheit: cd/m2). Auch die Bestimmung der Leuchtdichte von Displays, Monitoren oder Projektions-Bildschirmen ist damit möglich. Mit dem «Belichtungsmesser» Mavolux 5032B USB können Anwender die in Lux gemessene Beleuchtungsstärke an Arbeitsplätzen sowie auf sonstigen Flächen ermitteln. Diverse Tools von kleinen Werkzeugen über Mini-Bohrmaschinen bis hin zur speziellen Lötstation für das temperaturgenaue Löten von LEDs sorgen dafür, dass die Anwender kleine Modifikationen oder Reparaturarbeiten direkt im EBV LightLab vornehmen können. ■


I N D U S TR I E B E D A R F

4.12 megalink

57

DAS OPTIMAL GEHÄUSE FÜR JEDEN ANWENDUNGSBEREICH FINDEN

Mehr als nur schön verpackt Gehäuse werden in den verschiedensten Gebieten eingesetzt und müssen nach sehr genauen Vorgaben ausgewählt und gefertigt werden. Der Markt bietet eine grosse Auswahl an Gehäusen aus verschiedensten Materialien und in diversen Grössen. Welche Faktoren sind dabei besonders wichtig, wenn es um die Wahl des richtigen Gehäuses geht?

B

ei der Wahl eines Gehäuses muss zuerst das passende Material ausgewählt werden. Es wird grob unterschieden zwischen Gehäusen aus Metall (zum Beispiel Aluminium) und aus Kunststoff (beispielsweise Polycarbonat, Polyamid oder ABS) – beide Materialien haben Vor- und Nachteile, die in Abhängigkeit vom Einsatzzweck abgewägt werden müssen. Während Kunststoff ein sehr leichter Werkstoff ist, ist er jedoch weniger robust als Metall, das seinen Einsatz vorwiegend in raueren Umgebungen findet. Metalle erodieren unter bestimmten Einflüssen wie Regen oder Salzwasser – Kunststoffe können aggressiveren Umwelteinflüssen zum Teil besser standhalten. Wichtig ist es, sofern die Entscheidung für ein Kunststoffgehäuse gefallen ist, die verschiedenen Werkstoffe gegenüberzustellen: ABS, Polyamid und Polycarbonat sind verschiedene Kunststoffe mit verschiedenem Verhalten in Bezug auf Wärmebeständigkeit, Schlagfestigkeit und Chemikalienbeständigkeit (Bild 2). Die Materialentscheidung kann aber auch abhängig von den Einsatzbedingungen getroffen werden. Bei hochwertiger Elektronik kann die Wertigkeit zum Beispiel durch die Verwendung eines Aluminiumprofilgehäuses unterstrichen werden. Für den Einsatz im harten Industriealltag hat Bopla die robusten neuen Aluminiumgehäuse Alustyle entwickelt (Bild 3).

Bild 1: Ein gutes Gehäuse muss viele Aufgaben erfüllen: Es schützt die Elektronik, enthält Anschlüsse, Bedienelemente sowie Anzeigen und soll attratktiv aussehen. (Bilder: Bopla)

arbeiten. Damit dies reibungslos funktioniert, liegt ein Hauptaugenmerk bei der Gehäuseauswahl auf dem Berührungs- und Fremdkörperschutz sowie dem Wasserschutz, die als Schutzarten in der DIN EN 60529 festgelegt sind. Die dort beschriebe-

nen IP-Schutzarten sagen aus, wie dicht die Oberfläche des Gehäuses ist, das heisst welchen Schutz das Gehäuse gegen Wasser und Staub bietet. Einfluss auf die Schutzart haben das Nut-Feder-System, die Dichtung und die Verschraubungspunkte eines Gehäuses. Ein Sicherheitsschaltgerätehersteller wählte für einen neuen Verteiler das Euromas-IIGehäuse von Bopla. Oberste Priorität bei dieser Entscheidung war die Garantie, dass alle Faktoren bezüglich Sicherheit eingehalten werden, dazu zählen unter anderem Dichtheit, Temperaturresistenz und Robustheit. Das Euromas-II-Gehäuse ist aus hochwertigem Polycarbonat und erfüllt die Schutzart IP65 nach DIN EN 60529 (Bild 4). Dies bedeutet, dass das Gehäuse Schutz vor Staubablagerungen und Drahtschutz bietet – bezüglich des Wasserschutzes bietet es Schutz vor Strahlwasser aus jedem beliebigen Winkel. Die richtige Grösse bestimmen. Ein Gehäuse muss den Grössenanforderungen der 

Für Sicherheit und Schutz sorgen. Sehr eng verbunden mit den Anforderungen an ein Gehäuse bezüglich Material ist auch der Schutz der eingebauten Elektronik. Bei vielen Anwendungen müssen elektrische und elektronische Geräte unter erschwerten Umweltbedingungen über viele Jahre sicher

INFOS Phoenix Mecano Komponenten AG 8260 Stein am Rhein Tel. 052 742 75 00 info@phoenix-mecano.ch www.phoenix-mecano.ch

Bild 2: Ein Kunststoffgehäuse kann mit einer Kupferleitlackbeschichtung EMV-tauglich gemacht werden.


58

megalink 4.12

I N D U S TR I E B E D A R F

Bild 3: Das Alustyle Aluminium-Profilgehäuse zeichnet sich besonders durch seine Robustheit aus.

kundenindividuellen Elektronik gerecht werden. Häufig ist es so, dass zuerst die Platinenmasse der Elektronik feststeht und dazu schliesslich ein entsprechendes Gehäuse gesucht werden muss. Dabei kommt es auf die exakten Masse an – es geht oft um Millimeter. Das Vorhandensein von PlatinenBefestigungsmöglichkeiten an der richtigen Stelle ist dabei eine Selbstverständlichkeit. Liegen diese einmal nicht an der gewünschten Stelle oder in ausreichender Menge vor, so gehört es zum Angebot eines Gehäuseherstellers, diese an die gewünschten Stellen einzuschweissen. Um diesen Aufwand zu minimieren, sollte nach einem groben Platinenlayout, das die benötigten Platinen-

Bild 6: Durch seine Silberlackierung wirkt dieses BOS Streamline Gehäuse besonders edel.

Bild 7: Bocard mit Frontfolie und geprägten Tasten.

Bild 4: Euromas-II-Gehäuse in Sondereinfärbung mit kundenspezifischer Bedruckung.

Gehäuse aus der Schweiz Bopla, eine Tochtergesellschaft der weltweit operierenden Schweizer Phoenix Mecano Gruppe, stellt Gehäusesysteme sowie Eingabeeinheiten her und bietet Elektronik-Dienstleistungen an. Von Stein am Rhein aus, wo sich der Hauptsitz der Phoenix Mecano Gruppe befindet, werden mit rund 130 Mitarbeitenden vor allem die Wünsche der Kunden in der Schweiz erfüllt. Neben dem Programm von Bopla bietet Phoenix Mecano ein breites Sortiment von Industriekomponenten wie Gehäuse, Folientastaturen und elektrotechnische Komponenten an. Kundennah und innert Tagen wird beispielsweise eine Reihe von bedarfsgerechten Komplettlösungen angeboten, angefangen bei der mechanischen Bearbeitung der Gehäuse (Fräsen, Bohren, Senken oder Gewindeschneiden) über das Schneiden und Sägen der Alu-Profile der Gehäuse bis hin zum individuellen Chromatieren, Beschichten und Bedrucken der Gehäuse können alle Prozesse im Hause ausgeführt werden. Das bringt Geschwindigkeit und garantiert die Qualität. Standardgehäuse werden so individuell den Kundenwünschen angepasst und dem Kunden so ein Mehrwert geschaffen.

abmessungen ermittelt, ein Standardgehäuse ausgewählt werden und im Anschluss das endgültige Platinenlayout auf den im Gehäuse vorhanden Platz sowie auf Befestigungsmöglichkeiten modifiziert werden. Ist eine ganze «Gehäusefamilie» wie bei der Bopla Aluminium-Gehäuseserie «Alu-Topline» im Angebot eines Gehäuseherstellers, wird dem Kunden die Suche nach einem passenden Gehäuse stark vereinfacht. Bei der Suche nach einem optisch ansprechenden und kompakten Gehäuse für den Industriemaschinenbau wählte ein Steuerungshersteller das Alu-Topline Gehäuse. Besonders wichtig war bei der Gehäusewahl für die intelligente Steuerungseinheit, dass es bezüglich Grösse flexibel ist, da es je nach Kundenanforderung mit weiteren Komponenten ausgerüstet werden kann. Dies ist mit dem Alu-Topline Gehäuse gegeben, da es in unterschiedlichen Grössen und Längen lieferbar ist. Kleider machen Leute. Standardmässig werden Gehäuse in neutralen Grautönen oder in Schwarz angeboten. Verschiedene Ge-

Bild 5: Das kompakte Alu Topline Gehäuse ist bezüglich Grösse und Länge besonders flexibel.

häusekomponenten können das Design jedoch entscheidend verändern. Die Firma Bopla bietet unter anderem mit ihrem designorientierten Handgehäuse «BOS-Streamline» (Bild 6) zahlreiche Zubehörkomponenten wie farbige Dekordichtungen an. So besteht die Möglichkeit, das Gehäuse zu modifizieren und im gewünschten Design zu gestalten. Um die Gehäuse der jeweiligen Corporate Identity des Geräteherstellers farblich anzupassen, können die Gehäuse zusätzlich bedruckt oder lackiert werden. Speziell auf die verschiedenen Kunststoffe abgestimmte Lacke garantieren über einen langen Zeitraum eine optimale Haftung und eine hohe Kratzbeständigkeit. Ein Hersteller von Füllstandmesssystemen für trockene Schüttgüter suchte ein Gehäuse für die Steuereinheit. Bei der Entwicklung kam es besonders auf die Aufnahmefähigkeit für Eingabeelemente und ein Corporate Identity gerechtes Design an. Hierbei entschied sich der Kunde für das kleinste Gehäuse der Bocard-Serie (Bild 7), das Bocard 160. Exakt nach Kundenwunsch gestaltete Bopla zusätzlich eine kundenindividuelle Frontfolie mit geprägten Tasten. Diese Folie bildet zusammen mit den darunter liegenden Kurzhubtastern das Eingabefeld des Füllstandsensors. Die grafischen Vorgaben wurden bei der Gestaltung so umgesetzt, dass das Layout der Corporate Identity des Kunden entspricht. Ob Folientastaturen, Frontfolien oder Displays – um die Gehäuse nach den individuellen Anforderungen zu gestalten, gibt es verschiedenste Möglichkeiten. Eine Vielzahl von Technologien steht hinter der Konstruktion einer Folientastatur – als Beispiele sind die Kupfertechnologie oder die Profi-Linetechnologie als besonders interessant hervorzuheben. Zusätzlich bieten Gehäusehersteller in der Regel ein umfangreiches Dienstleistungs- und Serviceangebot. Der Übergang zwischen einem bearbeiteten Standardgehäuse und einem kundenspezifischen Sondergehäuse ist nahezu fliessend. Je nach der benötigten Stückzahl wird das geeignete Verfahren gewählt. ■


SENSORIK

4.12 megalink

59

TEMPERATUREINFLUSS AUF DIE DRUCKMESSUNG KOMPENSIEREN

Wenn Temperatur keine Rolle spielt Druckmessungen bei Medien mit sich ändernder Temperatur fordern jeden Anwender heraus, da diese das Ergebnis massiv beeinflussen. Entsprechende Verfahren wollen dies zu verhindern wissen.

Keramik, Silizium oder Stahl bestehen (Bild 1). Die beiden Paare sind über eine «Brücke» beziehungsweise ein Spannungsmessgerät quer verbunden. Bereits eine geringfügige Verformung der Membrane führt zu einer Änderung der Widerstände, die wiederum eine Spannung in der Messbrücke hervorruft. In der Fachsprache wird diese Anordnung als Wheatstone-Messbrücke bezeichnet (Bild 2).

Bild 1: Drucksensoren werden in der Industrie sehr oft verwendet.

D

rucksensoren kommen in Medien mit ganz unterschiedlicher Temperatur zum Einsatz, von der Kühlflüssigkeit über Motorenöl bis zu Wasser, das zu Sterilisationszwecken erhitzt wird. Konstrukteure und Anwender von Druckmessgeräten müssen sich des Fakts bewusst sein: Die Mediumstemperatur beeinflusst die Messergebnisse. Doch wie kommt es dazu und wie kann ihre temperaturbedingte Verfälschung verhindert werden?

(Bilder: Baumer)

ständen auf einer sich verformenden Membrane befestigt. Die Membranen können aus verschiedenen Trägermaterialien wie

Temperatur beeinflusst das Messergebnis. Die Widerstände auf einem für Druckmessung konzipierten Sensor ändern sich auch durch unterschiedliche Temperaturen. Steigt oder fällt sie, so beeinflusst sie das gemessene Signal – in der Sensortechnik besser als Temperaturkoeffizient (TK) bekannt. Dieser Koeffizient beschreibt einen linearen Fehler, ausgehend von einem Bezugspunkt, und entspricht der Abgleichtemperatur. Dabei gilt die Faustregel: je kleiner der Temperaturkoeffizient, desto hochwertiger der Drucksensor. So wird er für die Spanne (TKS) und den Nullpunkt (TKN) eines Sensors separat festgelegt. Grundsätzlich müssen die beiden Werte einzeln berücksichtigt werden. Der Fehler des Nullpunkts beschreibt den Einfluss der Temperatur auf 

Wenn aus Strom Druck wird. Druck, Kraft oder Dehnung werden meistens mit dem resistiven Messprinzip in ein elektrisches Signal umgewandelt. Dazu werden zwei Paare von jeweils hintereinandergeschalteten Wider-

INFOS Baumer Electric AG 8500 Frauenfeld Tel. 052 728 13 13 sales.ch@baumer.com www.baumer.com

Bild 2: Schaltbild einer Wheatstone-Messbrücke: Jeweils zwei Widerstände liegen parallel und bilden einen Spannungsteiler. Das Spannungsmessgerät misst die Querbeziehung dazwischen.


60

megalink 4.12

SENSORIK

Bild

Bild 3: Der Temperaturkoeffizient beschreibt den Temperatureinfluss auf das gemessene Signal.

Bild 4: Im Druckmessumformer integrierte aktive Temperaturkompensation garantiert für exakte Messwerte.

das Nullsignal (Bild 3). Der Fehler der Spanne gibt den Einfluss der Temperatur auf den Endwert der Messung wieder. Die einzelnen Koeffizienten des Nullpunkts und der Spanne werden als Beträge angegeben, sie sind entweder positiv oder negativ. Besitzen bei einem einzelnen Messgerät Nullpunkt- und Spannefehler dasselbe Vorzeichen, können sich im ungünstigsten Fall diese beiden Temperaturfehler addieren. Ziel von Drucksensoren-Herstellern ist ein möglichst geringer Einfluss von TKN und TKS. Der typische Wert eines BaumerDrucksensors der Baureihe PBMN für den mittleren Temperaturkoeffizienten – also den Mittelwert zwischen TKN und TKS – beträgt 0,02 Prozent pro 10 Kelvin. Um den Temperaturkoeffizienten zu minimieren, bedient man sich in der Sensor-

annähernd lineares Temperaturverhalten haben, lassen sich mit ihnen allerdings nur kleinere Abweichungen kompensieren. Die Methode erweist sich insgesamt als kostengünstig. Baumer bietet entsprechende Druckmessumformer in seiner PDxxReihe an (Bild 4). Geeignet ist die passive Temperaturkompensation auch für Anwendungen, bei denen die Temperaturschwankung von Natur aus begrenzt ist, etwa bei der Tiefenmessung in Flüssigkeiten (Bild 5).

technik der Temperaturkompensation. Dabei kommen je nach Anwendung zwei Verfahren zum Einsatz: passive und aktive Temperaturkompensation. Fehler durch passive Temperaturkompensation beheben. Ein gängiger Weg, Temperaturfehler von Drucksensoren zu reduzieren, ist die passive Temperaturkompensation. Das heisst: Während des Herstellungsprozesses werden Teile der Drucksensor-Kennlinie über verschiedene Temperaturen hinweg gemessen. Danach werden durch Widerstände in der Sensor-Elektronik oder durch Korrekturen an dafür bestimmten Widerstandsstrukturen auf dem Sensorelement, zum Beispiel durch Laser-Trimmen, die zuvor ermittelten Temperaturfehler kompensiert. Zumal die eingesetzten, passiven Widerstandselemente ein

Bild 5: Die passive Temperaturkompensation eignet sich für Anwendungen mit kleinen Temperaturschwankungen.

Die Temperaturschwankungen aktiv kompensieren. Auch bei der aktiven Temperaturkompensation wird während des Herstellungsprozesses die Kennlinie der Drucksensoren bei verschiedenen Temperaturen gemessen. Im Messfühler befindet sich zusätzlich ein Temperatursensor, der die aktuellen Werte misst und sie an die Signalverarbeitung weitergibt. In der Praxis haben sich zwei Verfahren der aktiven Temperaturkompensation durchgesetzt. Die erste Methode kompensiert mithilfe von sogenannten «Stützstellen» oder Einzelkorrekturwerten, zwischen denen interpoliert wird. Die zweite hinterlegt in der Elektronik des Sensors eine durch Regression aus den aufgenommenen Messwerten gewonnene Gleichung, um den erwarteten Fehler stetig zu kompensieren. Mithilfe dieser Daten kann im Betrieb die Signalverarbeitung im Drucksensor innerhalb eines bestimmten Temperaturbereichs den Temperaturfehler «aktiv», also selbstständig, kompensieren. Die aktive Kompensation kommt nur bei hochwertigen und dementsprechend leistungsfähigen Drucksensoren zum Einsatz, bei Baumer sind dies die Drucksensoren der PB-Familie. Aktiv kompensierte Drucksensoren von Baumer weisen in ihrem spezifizierten Temperaturbereich einen sehr geringen Temperaturfehler auf. Aufgrund der jahrelangen Forschung und Entwicklung von Baumer im Bereich der Temperaturkompensation ist jedoch auch die Temperaturabweichung der einfacheren, passiv kompensierten Druckmessgeräte sehr gering. ■


ANTRIEBE UND FLUIDIK

Sicherheitsprotokoll für alle Busse Der weltweite Standard für integrierte Sicherheitstechnik openSafety spart aufwendige Parallelverkabelung, ermöglicht eine schnellere Inbetriebnahme und höchste Taktzahl durch effiziente Kommunikation. Open Safety bietet maximale Produktivität bei zertifizierter Sicherheit. Garantiert kompatibel zu Ihrer Industrial Ethernet-Lösung.

B&R Industrie-Automation AG 8500 Frauenfeld Tel. 052 728 00 55 office.ch@br-automation.com www.br-automation.com

4.12 megalink

61


62

megalink 4.12

I N M O T I O N / A N TR I E B E U N D F L U I D I K

Bild 1: Keine Filmszene, sondern Teil des Versuchsprogramms zur Überprüfung und Weiterentwicklung von Hindernis-Warnsystemen.

(Bilder: B&R)

IM PRAXISTEST: VORAUSSEHENDE SICHERHEITSSYSTEME IM STRASSENVERKEHR

Dummy ohne Crash Test Für die Sicherheit im Strassenverkehr hat Voraussicht oberstes Gebot. Eine neue Prüfanalage simuliert das aktive Fussgängerverhalten, um Sicherheitssysteme im Auto noch zuverlässiger zu machen.

I

n der Automobilindustrie ist der vorausschauende Fussgängerschutz ein wichtiges Zukunftsprojekt. Bei Modellen mit intelligenten Systemen zur Aufprallvermeidung, müssen die dazu erforderlichen Sensoren unter realitätsnahen Bedingungen getestet werden. Dabei entgeht eine Fussgängerattrappe in einem eigens entwickelten Prüfstand durch Wegbeschleunigen mit über 14 g im letzten Moment dem Aufprall, wenn das Auto nicht rechtzeitig stoppt. Der Praxistest. Mit hoher Geschwindigkeit fährt der Audi auf die Querungsstelle zu. Der Fahrer weiss: ein Fussgänger steigt auf die Fahrbahn und wird bis knapp über die Fahrbahnmitte gehen, innehalten und wieder umkehren (Bild 1). Der Fahrer zeigt keine Absicht, die Geschwindigkeit zu drosseln, sondern bleibt seelenruhig auf der Spur. Der Hindernisde-

INFOS B & R Industrie-Automation AG 8500 Frauenfeld Tel. 052 728 00 55 office.ch@br-automation.com www.br-automation.com

tektor warnt auf höchster Stufe – doch völlig wirkungslos. Der Abstand beträgt keine drei Meter mehr, wenig bei 80 km/h. Ein Aufprall erscheint unvermeidlich. Im allerletzten Augenblick hebt die Puppe ab, schnellt in die Höhe und entgeht um Haaresbreite dem Aufprall des Autos. Das ist nicht Inhalt einer Filmszene, sondern Teil eines Programms zur Überprüfung und Weiterentwicklung von Hindernis-Warnsystemen auf dem Audi-Testgelände in Neustadt an der Donau. Alles ist echt, nur der Fussgänger ist ein Crash Test Dummy. Für den Radar unsichtbar. Dass die Puppe in die Luft schnellt und dem Aufprall entgeht, verhindert Beschädigungen am Fahrzeug und ist eine technologische Herausforderung an der trickreichen Versuchsanordnung. Ausgetüftelt und hergestellt wurde sie von der 4a engineering GmbH in Traboch, einem technologieorientierten Forschungs- und Entwicklungsunternehmen. Ihre Kompetenz im Bereich der Polymerwerkstoffe ist es, die das Unternehmen den Auftrag für den Prüfstand für die aktive Fussgängersicherheit brachte. Die Detektionssysteme im Auto arbeiten oft auf Basis

von Radar und die Versuchsanordnung sollte für sie möglichst unsichtbar sein. Sie besteht zu 95 Prozent aus speziellen Verbundwerkstoffen, um das Radarecho zu minimieren. Zudem ist der Prüfstand auch farblich der Umgebung angepasst: die Sensoren registrieren im Fahrzeug ausschliesslich die Puppe. Auf den ersten Blick erinnert der Prüfstand an einen Portalkran mit zweischieniger Fahrbahn. Auf ihr befindet sich eine Laufkatze, die sich mit bis zu 25 km/h hin- und herbewegt. Daran ist der Dummy befestigt. «Beim ursprünglichen Auftrag im Jahr 2007 war die Realisierungszeit mit nur 11 Wochen begrenzt», berichtet Engineering-Leiter Martin Fritz. «Daher mussten wir einige Kompromisse eingehen, die wir in einer Weiterentwicklungsphase durch technologisch bessere Dauerlösungen ablösten.» Dazu gehört der Mechanismus, mit dem der Dummy innerhalb von nur 100 ms nach oben schnellt. Die Beschleunigung erreicht dabei mit über 14 g Werte, die ein echter Mensch dauerhaft nicht überleben würde. In der Erstversion wurde das erreicht, indem die Puppe an einem vorgespannten Elastomerseil befestigt war und dieses entriegelt wurde.


I N M O T I O N / A N TR I E B E U N D F L U I D I K

Auf und ab mit wenig Strom. Diese Anordnung war wegen des Beschleunigungsverlaufes und der mangelnden Regelbarkeit nicht optimal und wurde durch einen motorischen Antrieb des an einem Stab befestigten Dummys ersetzt. Der entsprechende Trägerstab ist an einem Querbalken befestigt, der von zwei synchron laufenden Servomotoren auf und ab bewegt wird. «Diese Synchronizität war auch eine wesentliche antriebstechnische Herausforderung», so Fritz. «Nur bei Gleichlauf ist ein problemloses Hochlaufen des Attrappenträgers um 2 Meter innerhalb von 160 bis 180 ms gewährleistet.» Die Laufkatze selbst wird von einem B & R-Servomotor angetrieben, wie die Vertikalmechanik über die Antriebe der B & R-Baureihe ACOPOSmulti angesteuert. Die Ablaufsteuerung erfolgt mit einer CPU und den I/O-Modulen der B & R-Steuerungsbaureihe X20. Ebenso wie die Servoverstärker ACOPOSmulti sind sie kompakt und haben einen geringen Stromverbrauch. Um das Radarecho zu minimieren, kann der Schaltschrank klein gehalten werden. Dieser wiederum wird durch aktive Dämpfung getarnt. Zudem treten durch die aussergewöhnlich hohe Dynamik kurzzeitig Motorströme bis 170 A auf. Meist ist die Stromversorgung auf freien Versuchsgeländen schwach. In manchen Fällen versorgt ein mobiles Stromaggregat die Anlage wegen mangelnder Kabelzuführung. Die Anlage ist deshalb so ausgelegt, dass bei schwacher Spannungsversorgung ein zuverlässiger Betrieb gewährleistet ist. Kommunikation auf voller Fahrt. Die Anlage sendet per WLAN die Positionsdaten der Puppe und des herannahenden Autos an

das Fahrzeug. Dem Fahrer steht ein Terminal zur Verfügung, das ihm die vordefinierten Szenarien angezeigt und mit dem er den Ablauf startet. Eine einfache Symbolik vermittelt dem Fahrer das jeweilige Szenario rasch. Keine Zukunftsmusik mehr. Es benötigt noch Entwicklungszeit bis das Auto Fussgängerverhalten voraussehen kann. Voraussehen-

4.12 megalink

63

de Sicherheitssysteme, die etwa bei Erkennen von Gefahr die Bremsscheiben trocken fahren, um die Bremsbereitschaft zu erhöhen, werden bald nichts Aussergewöhnliches mehr sein. Mit fortgeschrittener Polymertechnologie von 4a engineering und der Automatisierungstechnik von B & R wurden bis heute bereits in tausenden Durchläufen die dazu erforderlichen Tests durchgeführt. ■

Bild 2: Für das Auge und das Radarecho lebensecht wirkende Dummys (2. von links) sind an einem Trägerstab befestigt und werden an einem Querbalken von zwei synchron laufenden Servomotoren mit über 14 g nach oben beschleunigt.


64

megalink 4.12

I N M O T I O N / A N TR I E B E U N D F L U I D I K

Linearantrieb-Komplettpaket

Encoder für flache Motoren

HMR ist ein optimal konfiguriertes und leistungsbezogen ausgelegtes Antriebskomplettpaket mit Spindel-, Riemen- oder Linearmotorachse sowie Getriebe, Motor und Regler aus einer Hand. Diese neue Baureihe elektrischer Linearantriebe ist hinsichtlich ihrer Montageund Anbaumöglichkeiten besonders flexibel und bietet erhebliches Einsparpotenzial bei Montage und Inbetriebnahme. Dies zeigt sich auch bei der Riemenachse bezüglich Montageposition des Motors, welcher beliebig an allen vier Seiten angebaut werden kann. HMR Linearantriebe sind in vier Baugrössen von 100 bis 240 mm in den beiden Profilvarianten Basis für Montage auf Maschinenbett und Reinforced für

Um die flache Bauweise des EC 90 flat-Motors auch für hochpräzise Anwendungen und Positionierungsaufgaben optimal nutzen zu können, kommt neu ein Mikrosystem zum Einsatz; der MILE-Encoder. Das System ist so klein, dass es in den Motor integriert werden kann, ohne diesen zu verlängern. Hinter dem Kürzel MILE versteckt sich Maxon’s Inductive Little Encoder. Das Wirkprinzip beruht auf der Messung von hochfrequenten Induktivfeldern, die Wirbelströme in einer elektrisch leitenden Zielscheibe generieren. Die hochfrequente induktive Messmethode zeichnet sich aus durch Robustheit gegenüber Staub oder Öldämpfen, womit auf weitere Schutzmassnah-

freitragende Montage erhältlich. Damit lässt sich eine breite Palette an Anwendungen abdecken, bei denen es auf die sichere Bewegung bei grossen Massen und Kräften, aber auch auf schnelle Bewegungen und hochpräzise Positionierung ankommt. Eine grosse Optionsvielfalt wie zentrale Nachschmierung, integrierte Endschalter und Encoder sowie verschiedene Montagemöglichkeiten unterstreicht die Modularität von HMR.

Parkem AG MotionControl | 5405 Baden-Dättwil | Tel. 056 493 38 83 info@parkem.ch | www.parkem.ch

Bewegungsmanagement leicht gemacht itsubishi Electric erweitert die MELSEC L-Serie um zwei neue Simple Motion-Module. Die 4und 16-Achsen-Motion-Module ergänzen die bestehenden Positioniermodule. Es stehen verschiedene Kontrollfunktionen wie Drehzahl- und Drehmomentregelung, Synchronisation und Kurvenscheiben zur Verfügung, die zuvor nur mit «echten» Motion-Controller-Systemen möglich waren. Die Motion-Module werden mit dem bekannten Softwarepaket GX Works2 nach IEC 61131 und mit standardisierten PLCopen-Funktionsbausteinen programmiert. Die standardmässig integrierte Schnittstelle für externe Encodersignale sowie schnelle Zählereingänge für zum Beispiel Druckmar-

kensensoren ermöglichen genauso gut eine Nutzung in klassischen Serienmaschinen wie in Verpackungs- und Abfüllanlagen oder Palettiersystemen ohne den Einbau weiterer optionaler Module. Eine Funktion zur automatischen Berechnung der Kurvenscheibendaten für eine rotierende Messerapplikation – nur durch Angabe der Produktlänge und Synchronisationsstrecke – ist ebenfalls implementiert.

OMNI RAY AG | 8600 Dübendorf | Tel. 044 802 28 80 info@omniray.ch | www.omniray.ch

men verzichtet werden kann, durch eine hohe Drehzahl und durch Unempfindlichkeit gegenüber Störimpulsen. Der EC 90 flat MILE verfügt über ein Dauerdrehmoment von 517 mNm und Auflösungen bis 3200 Impulse pro Umdrehung. Dies prädestiniert ihn für Anwendungen wie beispielsweise Türantriebe, Logistik-Roboter oder nachgeführte Solaranlagen.

maxon motor ag | 6072 Sachseln | Tel. 041 666 15 00 info@maxonmotor.com | www.maxonmotor.com

Motion-Logic-Control mit vorkonfigurierten Schnittstellen Die Komplettsteuerung IndraMotion MLC von Rexroth regelt sowohl dezentral als auch zentral hydraulische, hybride oder elektrische Achsen gleichermassen. Die Steuerungssoftware umfasst eine Vielzahl vordefinierter hydraulischer Regler. Damit erfordert die Parametrierung der Bewegungsprofile kein Spezial-Know-how in der Hydraulik. Diesen Vereinfachungsansatz verstärkt Rexroth jetzt auch bei der Auslegung und Konfektionierung der schnellen E/As. Die Bundled I/O-Strategie von Rexroth bietet speziell für hochdynamische Hydraulikanwendungen ausgelegte, standardisierte Schnittstellen. Die E/As stehen als vorkonfigurierte Block-Module für jeweils bis zu vier Achsen zur Verfügung. Maximale Flexibilität ermöglichen die In-

draControl S20 Einheiten, die das System in Einzelschritten erweitern. So müssen die Schnittstellen für hydraulische Antriebslösungen nicht mehr individuell in Eigenregie zusammengestellt und konfektioniert werden. Stattdessen erfüllen die vorkonfigurierten E/A-Module alle hydraulikspezifischen Anforderungen wie Kurzschluss- und Überlastfähigkeit. Sie übernehmen in Echtzeit über den Automationsbus sercos die Positions- und Druckerfassung sowie die Ansteuerung der Stetigventile.

Bosch Rexroth Schweiz AG | 8863 Buttikon | Tel. 055 46 46-111 info@boschrexroth.ch | www.boschrexroth.com


Q U E R S E K TI O N 2 0 0

«Networks & Communication»

Korenix-JetBoxen kombinieren Computer- mit Netzwerk-Funktionen Die Korenix-JetBoxen 9462 und 8150 kombinieren Computer- mit Netzwerk-Funktionen zu einer neuen Generation von Embedded-Systemen. Die JetBox hat periphere Kontrollfunktionen, die sie mit Ethernet-Konnektivität vereint, was eine einfache und günstige Verkabelung ermöglicht. Die programmierbaren Jet-Boxen machen solche Systeme sehr flexibel und können für die verschiedensten Applikationen angepasst werden. Spectra (Schweiz) AG 8132 Egg, Tel. 043 2 77 10 50 info@spectra.ch, www.spectra.ch


66

megalink 4.12

S W I S S T. N E T – N E TW O R K S & C O M M U N I C A T I O N

Bild 1: Die peripheren Kontrollfunktion der Embedded-Computer sorgen für eine einfachere Verkableung. (Bilder: Spectra)

INDUSTRIAL COMMUNICATION COMPUTER FÜR DEN EINSATZ IM HARSCHEN UMFELD

Kommunikation aus der Embedded-Box Periphere Kontrollfunktionen oder Ethernet-Konnektivität sind Voraussetzungen, um im harschen industriellen Umfeld zu kommunizieren. Neue Embedded-Computer erfüllen diese Bedingungen und vereinen Computer- und Netzwerkfunktionen in einer Box.

M

ittlerweile etablierte sich der Ethernet-Übertragungsstandard auch im harten industriellen Umfeld. Immer mehr Ethernet-Komponenten kommen in Bereichen zum Einsatz, die bisher von traditionellen Feldbussystemen bewirtschaftet wurden. Die Anbindung erfolgt heute meist mit Embedded Kommunikations-Computer. Flexibilität in einer Box. Der Kommunikationsspezialist Korenix hat Computer- mit Netzwerkfunktionen zu einer neuen Generation von Embedded-Systemen kompakt in einer Box kombiniert. Die JetBox9462 hat periphere Kontrollfunktionen, die sie mit Ethernet Konnektivität vereint, was eine einfache Verkabelung ermöglicht (Bild 1). Die programmierbaren Rechner machen solche Systeme flexibel und können für die ver-

Bild 3: Die Embedded Computer sorgen für mehr Sicherheit im öffentlichen Verkehr.


S W I S S T. N E T – N E TW O R K S & C O M M U N I C A T I O N

aufgaben. Je nach Aufgaben und CPU können verschiedene Betriebssysteme eingesetzt werden.

Bild 2: Das Betriebssystem ist auf der 8000er-Serie der Jetboxen bereits vorinstalliert.

schiedensten Applikation angepasst werden. Damit sind leistungsfähige, intelligente Lösungen auf den Markt, die sich aufgrund der robusten Ausführung für die industrielle Automation eignen. Unterschiedliche Modelle mit Risc- oder X86-basierenden CPUs stehen zur Verfügung. In den RISC-Boxen arbeitet ein Intel XScale-Prozessor und die X86-Lösungen setzten mehrheitlich auf einen AMD GEODE LX800 Prozessor für die Steuerung der vielfältigen Kommunikations-

Sicherheit geht vor. Industrial Router Computer sind mit Risc-Prozessoren ausgestattet und verfügen über Layer 3 Routing-Funktionen. Das Embedded-Linux (Korenix JetOS) Betriebssystem ist bereits auf einer Compact Flash Karte vorinstalliert. Neben den Router-Funktionen, Firewall oder IPv6-Unterstützung sind je nach Modell diverse Interfaces und Funktionen integriert. Diese Hutschienen-Router-Computer sind dank den Risc-Prozessoren verlustleistungsarm und werden lüfterlos betrieben. Sie werden dort eingesetzt, wo Sicherheit und managedbare WAN-Konnektivität gefordert ist. Ein weiterer Vorteil ist die PoE (Power over Ethernet)-Funktionalität. Angeschlossene periphere PoE-Devices wie zum Beispiel Sensoren brauchen keine zusätzliche Speisung, da sie über das Cat 5/Cat 6-Kabel direkt mit bis zu 15,4-Watt-Strom versorgt werden – gemäss der Norm IEEE 802.3af. Daher vereinfachen entsprechende Geräte und Devices die Verkabelung und senken die Installationskosten. Ausgepackt und betriebsbereit. Industrial Communication Computer sind entweder mit Risc- oder x86-Prozessoren ausgestattet und laufen mit Embedded-Linux, WinCE 5.0 oder WinXP embedded. Diese lüfterlosen High-Performance Embedded-Computer sind für die raue Industrieumgebung ausgelegt und auf der Hutschiene montierbar. Ein VGA-Ausgang erlaubt eine Visualisierung, zum Beispiel zur Kontrolle oder

4.12 megalink

67

zum Programmieren in der Peripherie. Die JetBox 8000-Serie wird mit vorinstalliertem Betriebssystem geliefert (Bild 2). Beide Serien der Embedded JetBox-Computer von Korenix sind je nach Modell mit zahlreichen Schnittstellen wie GBit-Ethernet, PoE, Boost PoE oder USB ausgestattet. Je nach Applikation können die entsprechenden Modelle mit den gewünschten Peripherien gewählt werden. Auf die Geräte mit einem Betriebstemperaturbereich von –40 bis +80 °C gibt der Hersteller 5 Jahre Garantie. Breite Einsatzmöglichkeiten. Die Einsatzmöglichkeiten für die industriellen Kommunikations-Computer von Spectra sind vielfältig und zeichnen sich durch ein gutes PreisLeistungs-Verhältnis aus. Mithilfe der Jetview Pro-Software (Industrial Intelligent Network Management System), die gratis dazu geliefert wird, können bis zu 1024 Netzwerkknoten, Level 3 SNMP Devices, wie zum Beispiel LAN, einfach konfiguriert werden. Diese Produkte eignen sich für Applikationen der Gebäudeautomation, industriellen Automation oder auch als Überwachungseinheit in öffentlichen Verkehrsmitteln wie Bussen oder Zügen (Bild 3). ■

INFOS Spectra (Schweiz) AG 8132 Egg Tel. 043 2 77 10 50 info@spectra.ch www.spectra.ch

Durchfluss-Messgeräte mit Ethernet/IP Endress+Hauser stellt das elektromagnetische Durchfluss-Messgerät Promag 53 vor, das mit einem Ethernet/IP-Anschluss zur einfachen Integration in das PlantPAx-Prozessautomatisierungssystem von Rockwell Automation ausgestattet ist. Promag 53 misst Durchflussraten von Flüssigkeiten mit einer elektrischen Leitfähigkeit >5 μS/cm. Über den integrierten Web-Server können aus der Ferne Durchflussdaten abgerufen, Diagnosen durchgeführt, das Durchfluss-Messgerät konfiguriert oder Prozessoptimierungen vorgenommen werden. Ein sicherer Datenzugriff ist ausserdem durch übergeordnete Software (zum Beispiel ERP-Systeme, ProzessHistorians, Programme zur Regelschleifen-Feinabstimmung oder Asset-Management-Systeme) möglich. Mithilfe von EtherNet/IP lassen sich bis

zu zehn Variablen für den Fernzugriff konfigurieren, darunter Volumendurchfluss, berechneter Massendurchfluss und aufsummierter Durchfluss. Geräte zum Messen und Kontrollieren von Prozessvariablen nutzen zur Datenübertragung meist ein Prozessinstrumentierungs-Netzwerk, während die übrigen Geräte in der Fabrik an ein vollkommen anderes Netzwerk angeschlossen sind. Wird eine so komplexe Netzwerkstruktur durch EtherNet/IP als einheitliche Netzwerkarchitektur ersetzt, können Anwender besser auf EchtzeitInformationen zugreifen, die allgemeine Performance überwachen, anormale Zustände beheben und Anlagenstillstände minimieren.

Rockwell Automation AG | 5001 Aarau | Tel. 062 889 77 77 info@rockwellautomation.ch | www.rockwellautomation.ch

Endress + Hauser Metso AG, 4153 Reinach | Tel. 061 715 75 75 info@ch.endress.com | www.ch.endress.com


68

megalink 4.12

S W I S S T. N E T – N E TW O R K S & C O M M U N I C A T I O N

Module mit Leistungsversorgung über PoE

Die Firma Moxa präsentiert mit den Modulen MiiNePort E3 Ethernet Device Module, die ein PoE «pass-through» unterstützen. Dadurch kann ein Gerät mit MiiNeModul über den Ethernet PoE-Port ohne externe Stromversorgung mit Leistung versorgt werden. Das MiiNePort E3- Modul verfügt über einen Standard TTL Port und einen Ethernet Port gemäss 10/100BASE-TX. Die Datenrate auf dem seri-

ellen Port kann bis zu 921,6 kBit/s betragen, und der Ethernet Port unterstützt die Funktion Autonegotiation, auch Auto MDI/MDIX genannt. Die Module nutzen die NetEZ-Technologien von Moxa, mit denen sie sich universell speisen lassen, über ein Java Applet direkt mit den angeschlossenen Geräten kommunizieren können und die ihre schnelle Konfiguration im Fabrikationsprozess ermöglichen. Die Module sind mit den Temperaturbereichen 0 bis 55 °C und –40 bis +85 °C erhältlich, sodass sie auch im Aussenbereich eingesetzt werden können. Für die Integration stehen ausführliche Dokumentationen und Starter-Kits zur Verfügung.

OMNI RAY AG | 8600 Dübendorf | Tel. 044 802 28 80 info@omniray.ch | www.omniray.ch

Security in Automationsnetzen

Moxa hat zwei Gigabit Ethernet Firewalls/Secure Router entwickelt. Mit den Geräten EDR-G903 und EDR-G902 lassen sich VPN Tunnels für die Verbindung von Ethernet-Segmenten über unsichere Netze bzw. einen sicheren Remote-Zugang realisieren. Auch eine Anbindung an eine DMZ (mehrstufiges Firewall-Konzept) ist mit dem EDR-G903 möglich, da das Gerät über zwei WANPorts verfügt. Diese zwei WAN-

Ports können auch für den Aufbau von redundanten WANVerbindungen genutzt werden. So kann ein WAN-Port als primärer Pfad, der zweite WAN-Port als «backup»-Verbindung konfiguriert werden. Die EDR-Geräte wurden speziell für die Automatisierung entwickelt und unterstützen Feldbus-Protokolle wie EtherCAT, EtherNet/IP, Foundation Fieldbus, Modbus/TCP und Profinet. Diese Protokolle lassen sich in der Konfiguration mit einem Klick auswählen. Alle Ethernet-Ports unterstützen Gigabit Ethernet, und es stehen Combo Ports für die Aufnahme von SFP-Modulen zur Verfügung. So lassen sich die Firewalls direkt an ein optisches GigabitNetzwerk anbinden, was die Ausfallsicherheit zusätzlich erhöht.

OMNI RAY AG | 8600 Dübendorf | Tel. 044 802 28 80 info@omniray.ch | www.omniray.ch

Kompakte Switches für Ethernet/IP

Das Portfolio der industriellen Lean Managed Switches aus der Produktlinie Factory Line von Phoenix Contact wurde um zahlreiche Switch-Varianten mit der Voreinstellung für Ethernet/IP ausgebaut. Die neuen Varianten der kompakten Switches zeichnen sich durch die im Auslieferungszustand aktivierten Funktionen IGMP Snooping und Multicast detection aus, mit denen die Switches mit minimalem Konfigurationsaufwand in Ethernet/IP-Applikationen integriert wer-

den können. Mit der neuen Firmware 3.40 verfügen die Switches über die Auto Query Port Erweiterung, die ein schnelles Weiterleiten der Ethernet/IP-Telegramme nach einer Redundanzumschaltung ermöglicht. Zusätzlich kann jetzt die Konfiguration der Lean managed Switches auf einen externen PC abgespeichert werden. Die Firmware 3.40 ist im DownloadBereich des E-shops von Phoenix Contact verfügbar.

PHOENIX CONTACT AG | 8317 Tagelswangen | Tel. 052 354 55 55 infoswiss@phoenixcontact.com | www.phoenixcontact.ch

Managed Switche für getrennte Netze Harting hat seine HaVIS mCon Familie 3000 weiterentwickelt und damit eine Ergänzung im Bereich Industrial Ethernet Switche geschaffen. Die Serie ermöglicht den Aufbau voneinander getrennten Netzen bis hin zu grösseren Netzen. Erweiterter Temperaturbereich, mechanische Stabilität und die umfangreiche Managementsoftware sorgen für eine hohe Betriebssicherheit und genügen den höchsten industriellen Anforderungen. Neben RSTP steht mit den neuen Switchen auch das Medium Red-

undanz Protokoll (MRP) zur Verfügung. Durch die Integration des Profinet IO Stacks können die Switche der Ha-VIS mCon 3000 Next Generation Familie als Profinet IO Device verwendet werden.

HARTING AG | 8604 Volketswil | Tel. 044 908 20 60 ch@HARTING.com | www.HARTING.ch


B A U E L E M E N TE

4.12 megalink

69

CompactPCI Serial Multi-Display Controller Kleine 32-Bit-Mikrocontroller für Audio und Touch

Die neueste CompactPCI-Serial-Peripheriekarte G214 von MEN sorgt mit der Radeon-E6760-GPU von AMD für exzellente Grafikleistung und ist besonders für Multi-DisplayAnwendungen geeignet. Zum Einsatz kommt sie in Leitständen und Kontrollräumen zur (Video-)Überwachung, in Simulatoren, bei professionellem Audio/Video-Equipment, sowie in Digital-Signage-Applikationen. Dank AMDs Eyefinity-Technologie können bis zu sechs verschiedene Displays unabhängig voneinander angesteuert werden. Standardmässig ist die G214 frontseitig mit vier DisplayPort-1.2-Schnittstellen ausgestattet, die eine maximale

Auflösung von 4096x2560 bei 60 Hz und eine Farbtiefe von 24 Bit ermöglichen. Durch die Wahl einer breiteren Frontplatte können zusätzlich zwei DisplayPorts mit einer Auflösung von 2560x1600 untergebracht werden. Der auf der E6760 GPU unterstütze OpenCLStandard macht eine zusätzliche Steigerung der Rechenleistung durch GPGPU-Berechnung (General Purpose Computation on Graphics Processing Unit) möglich. Durch die hohe Parallelität, mit der die GPU die Programme ausführt, wird deutlich an Geschwindigkeit gewonnen. Für die gesteigerte Grafikleistung sorgt eine 3D-Grafik-Engine und Microsofts DirectX 11. Die Videokonvertierungsfunktion (AMD Unified Video Decoder), unterstützt die Formate H.264, VC-1, MPEG-2 und MPEG-4. In einem reinen CompactPCI Serial System kann eine CPUKarte standardmässig und ohne Bridging maximal sieben der MultiDisplay-Karten und damit 28 verschiedene Displays ansteuern. Dabei können alle zu einem grossen Bild verschmelzen oder unterschiedliche Inhalte liefern.

MEN Mikro Eletronik Gmbh | D-90411 Nürnberg Tel. +49 911 99 33 50 | info@men.de | www.men.de

Funkuhrmodul für neues Zeitzeichensignal Die HKW-Elektronik GmbH ist seit über 20 Jahren bekannt für innovative Langwellen- und Funkuhrentechnik und bietet ein grosses Produktportfolio für die bekannten Funk-Systeme DCF77, MSF, WWVB und JJY. Die neu entwickelten Funkuhrmodule nutzen das Zeitzeichen der Europäischen Funkrundsteuerung GmbH. Das System bietet mit drei Sendern in Deutschland und Ungarn (DCF 49, DCF 39, HGA 22) eine hervorragende Abdeckung in Mittel- und Osteuropa. Die Funkuhrmodule FUM1 FSK

und FUM2 FSK zeichnen sich durch einen robusten Empfang, geringe Störanfälligkeit und eine hohe Empfindlichkeit aus. Das FUM2 FSK besitzt eine Zeitgenauigkeit von 5 ms. Diese Genauigkeit wird normalerweise nur von aufwändigen und teuren Empfängern für Industrieanwendungen erreicht.

stolz electronics AG | 5405 Baden-Dättwil | Tel. 056 484 90 17 info@stolzelectronics.ch | www.stolzelectronics.ch

Microchip verfügt über eine neue Serie geringpoliger 32-bit-Mikrocontroller (MCUs) vom Typ PIC32. Sie leisten 61 DMIPS und sind für eine platzsparende Bauweise in 5 x 5 mm grossen Gehäusen untergebracht. Bei den Typen PIC32 MX1 und MX2 MCUs handelt es sich um die kleinsten PIC32-Mikrocontroller und die ersten, die insbesondere mit Peripheriefunktionen für Audio-Anwendungen und kapazitiv-sensitive Berührungstechnik ausgestattet sind. Sie bieten

auch USB-On-the-Go (OTG), sodass sie für die Entwicklung von Audio-Zubehör und andere Anwendungen in der Konsumertechnik geeignet sind. PIC32 MX1 und MX2 MCUs sind für den Betrieb bis 105 °C vorgesehen. Sie enthalten 128 KByte Flash-Speicher und 32 KByte RAM, zwei I2S-Schnittstellen für Audioprozesse, eine integrierte Hardware-Peripherie für mTouch kapazitiv-sensitive Tasten oder hoch entwickelte Sensoren und einen parallelen 8-Bit-Masterport (PMP) für Grafik oder externen Speicher. Zusätzlich verfügen die neuen Controller auf dem Chip über einen dreizehnkanaligen Analog-DigitalKonverter (ADC) mit 10 bit Auflösung und 1 Msps Durchsatz.

Mero Microchip (Schweiz) | 5605 Dottikon | Tel. 056 610 15 01 r.ruetimann@mero.ch | www.mero.ch

PC-Serie mit Chromstahlgehäuse für Industrieumgebung Die lüfterlose Panel-PC Serie APC-3x82 und APC-3x83 ist mit dem neusten Dual-Core-Prozessor D525 ausgerüstet. Dank einer speziellen Gummi-Abdeckung (IP42) sind die Kontakte auf der Rückseite gut geschützt. Das passive Kühlkonzept in Kombination mit dem Stahl- bzw. Chromstahlgehäuse ergibt eine Vielzahl an Einsatzmöglichkeiten wie zum Beispiel in der Lebensmittelindustrie, Logistik und Chemie. Die angewendete Low Power-Technologie garantiert zusammen mit dem konsequenten exklusiven Einsatz von soliden Kondensatoren Zuverlässigkeit und Langlebigkeit. Die APC-3x82 und APC-3x83 können bei Umgebungstemperaturen von 0 bis 50 °C eingesetzt werden. Die Auflösung der Displays variieren

von 800x600 Pixel bei der 12,1"bis zu 1280x1024 Pixel bei der 19"-Lösung. Die Displays haben eine Helligkeit von 300 bis 450 nits und eine Lebensdauer von 50 000 Std. Das Rechnerboard mit der Atom D525 CPU und mit dem ICH8M Chipset wird standardmässig mit 2 GB RAM DDR3 800 MHz ausgerüstet. Der SBC hat einen internen CF-Slot, welcher den Einsatz von Flash-Drives ermöglicht.

MPI Distribution AG | 5405 Dättwil | Tel. 056 483 34 44 info@mpi.ch | www.mpi.ch


70

megalink 4.12

B A U E L E M E N TE

Drucktransmitter und -sensoren aus Titan

Netzgerät in 2 x 3-Zoll-Ausführung

Der deutsche Chemiker Heinrich Klaproth war 1795 von den Eigenschaften eines neu entdeckten Elementes derart angetan, dass er ihm – in Anlehnung an das griechische Göttergeschlecht der Titanen – den Namen Titan gab. Der bekannteste Titan ist Atlas, der von Zeus dazu verdonnert wurde, die Erdkugel zu tragen. Für den Einsatz in stark korrosiven Medien liefert die Keller AG für Druckmesstechnik seit geraumer Zeit Produkte in TitanAusführung. Grosse Überraschung ergab sich bei der Entwicklung eines Ø 9 mm implantierbaren Sensors aus Titan. Aus Stahl gefertigt darf ein solcher Sensor maximal 60 °C ausgesetzt werden. Bei höheren Temperaturen verformt die temperaturbedingte Ausdehnung des Öls die Stahlmembrane so weit, dass sie

Skynet ist es gelungen, auf einem 50,8 x 76,2 mm grossen Print (2 x 3 Zoll) eine Stromversorgung mit 55 Watt Peakleistung zu entwickeln. Die SNPG04-Serie erbringt konvektionsgekühlt eine Dauerleistung von 40 Watt. Die Geräte verfügen über umfangreiche Zulassungen wie 60950-1 2nd Edition (ITE) oder 60601-1 3rd Edition (Medizin) und werden in der gewohnt hohen Qualität von Skynet gefertigt. Die

nicht mehr in die Ursprungslage zurückkehrt. Im Gegensatz dazu weist die Titanmembrane bis 120 °C keinerlei Verformung auf, was auch Stabilitätsfehler viel unwahrscheinlicher macht gegenüber Produkten mit Stahlmembrane. Grund dafür ist der halb so grosse Elastizitätsmodul. Bei Keller werden hochwertige Transmitter mit höchsten Stabilitätsanforderungen vermehrt in Titan gefertigt.

KELLER AG für Druckmesstechnik | 8404 Winterthur | Tel. 052 235 25 25 marketing@keller-druck.ch | www.keller-druck.com

Abdeckplatten für Schalter in vier Holzvarianten

Mit ihrer eleganten Silhouette bereichern die Abdeckplatten der Serie kallysto.art seit 2008 den Schalter- und Steckdosenmarkt. Jetzt hat Hager die Angebotspalette noch erweitert: Die Holzrahmen in den vier Ausführungen Esche, Birnbaum, Nussbaum und Räuchereiche werden all jene begeistern, die Wert auf ein natürli-

ches Interieur legen. Die vier Edelholzrahmen zaubern eine einzigartige natürliche Atmosphäre ins Haus. Die stilvollen Modelle mit moderner Gehrung sorgen für den besonderen Touch und bieten eine willkommene Abwechslung im Design. Das Echtmaterial Holz macht aus jeder Abdeckplatte ein unverwechselbares Unikat. Alle Abdeckplatten sind mit einem hochwertigen Lack versehen. Dieser schützt das Holz vor Verschmutzung und UV-Strahlen und hilft so, den Farbton zu bewahren. Weiter können die Abdeckplatten mit kallysto Multidesign und den kallysto KNX-Multifunktionstastern kombiniert werden.

Hager AG | 6020 Emmenbrücke | Tel. 041 269 90 00 infoch@hager.com | www.hager.com

Netzteile arbeiten von –20 bis +70 °C Umgebungstemperatur. Verfügbar sind verschiedene Versionen mit Ausgangsspannungen zwischen 12 und 48 V.

Simpex Electronic AG | 8622 Wetzikon | Tel. 044 931 10 30 contact@simpex.ch | www.simpex.ch

Umfangreiche Produktpalette ab Lager lieferbar RS liefert über 10 000 elektronische Komponenten von Panasonic für den industriellen Einsatz ab Lager. Die umfangreiche Produktpalette enthält die Treiber-ICs der Serien AN30/32xx zur Steuerung von LED-Matrixschaltungen und LEDLichtanwendungen und die neue Serie der Bluetooth Klasse 1-Modem-Module ENW8981xx HCI. Darüber hinaus sind weitere Se-

rien von Halbleitern und passiven Bauelementen für industrielle Anwendungen lieferbar wie Kondensatoren, Widerstände und Spulen. Die Lieferfähigkeit von über 10 000 Elektronikkomponenten von Panasonic ist für RS ein weiterer Meilenstein in der durchgängigen Strategie der Angebotserweiterung im Bereich Elektronik.

RS Components GmbH | 8820 Wädenswil | Tel. 044 283 61 90 vertrieb@rsonline.ch | www.rsonline.ch

Modulares Netzteil, zertifiziert nach Medical 3rd Edition Die Xgen-Serie von Excelsys zeichnet sich durch ein besonders flexibles Modularsystem aus. Innert Minuten kann das Netzteil mit bis zu 12 Ausgängen von 1,5 bis 58 Volt bestückt werden. Dadurch werden Entwicklungskosten und Entwicklungszeit gespart. Die hohe Effizienz von 90 Prozent zeigt sich in den kompakten Abmessungen und der geringen Abwärme. Die 4-Slot-Variante in den Abmessungen 89 x 260 x 40,4 mm ist mit

Leistungen von 200–750 W, die 6-Slot-Variante in den Abmessungen 127 x 260 x 40,4 mm mit Leistungen von 400–1340 W erhältlich. Die Netzteile sind als Medizinund Industrieversion erhältlich.

Simpex Electronic AG | 8622 Wetzikon | Tel. 044 931 10 30 contact@simpex.ch | www.simpex.ch


B A U E L E M E N TE

Online-Shop in neuem Gewand In den letzten zehn Jahren hat sich der DistrelecOnline-Shop zwar angebotsmässig und technisch laufend weiterentwickelt, optisch hat sich aber nur wenig getan. Seit Beginn dieses Jahres tritt der Elektronik-Distributor nun mit einem neuen Logo auf, und auch der OnlineShop erstrahlt in einem neuen Design. Gleichzeitig wurden funktionale Anpassungen vorgenommen. Nützlich ist etwa eine neue Funktion, dank der man zwischen Geschäfts- und Privatkunde auswählen kann, wobei die Preise jeweils exkl. bzw. inkl. MwSt. angezeigt werden. Besonders gelungen sind die neu gegliederten Produktseiten und der neue Warenkorbverlauf. Die Produktseiten wurden

deutlich übersichtlicher und informativer gestaltet und sind nun direkt über die Suche zugänglich. Der Zugriff auf technische Dokumentationen wie Datenblätter, Manuals oder Videos wurde vereinfacht, und an selber Stelle kann nun direktes Feedback gegeben werden. Schliesslich ist jetzt der Warenkorb viel besser sichtbar, und der Kunde wird schrittweise durch den Bestellprozess geführt.

4.12 megalink

71

Vielseitig einsetzbare 32-Bit-Mixed-Signal-MCUs Viel Designflexibilität für den 32-Bit-Markt bietet die Precision32-Mikrocontroller(MCU-)Familie von Silicon Laboratories Inc., einem führenden Anbieter hochleistungsfähiger Analog-Mixed-Signal-ICs. Auf der Basis eines ARM Cortex-M3-Prozessors umfasst die neue Precision32-Familie 32 SiM3U1xx- und SiM3C1xx-MCUs mit Footprint-kompatiblen USBund Nicht-USB-Optionen. Mit ihrer hochintegrierten flexiblen Architektur, der umfangreichen Peripherie, niedrigen Stromaufnahme und mit Eclipse-basierten Entwicklungstools, die kostenlos zum Download zur Verfügung stehen, eignet sich die Precision32-Familie unter anderem für folgende An-

wendungen: tragbare Medizingeräte, Point-of-Sale-Peripherie, Motorsteuerungen, optische Touchscreen-Schnittstellen, Sensor-Controller und Home-AutomationSysteme. Um die Systemkosten und Bauteilanzahl zu verringern, bietet die Precision32-Familie umfangreiche Peripherie. Dank Silicon Labs’ patentierter Dual-Crossbar-Technologie und einer Dragand-Drop-GUI können Analogund Digitalperipherie und die dazugehörige Pinbelegung einfach ausgewählt werden.

Computer Controls AG | 8112 Otelfingen | Tel. 044 308 66 66 www. ccontrols.ch | info@ccontrols.ch

Distrelec, Bereich der Dätwyler Schweiz AG | 8606 Nänikon | Tel. 044 944 99 11 info@distrelec.com | www.distrelec.ch

2-Leiter-Drucksensor mit Display

CPU kombiniert Energieeinsparung und Leistungsverbesserung optimial

Die Drucksensoren von ifm electronic der Serie PI27 / / PI28 können nicht nur als 3- oder 4-Leiter angeschlossen werden, sondern auch in einer Stromschleife als 2-Leiter. Dies reduziert den Verdrahtungsaufwand in Neuanlagen und erleichtert den Austausch bei bestehender 2-Leiter-Verdrahtung. Die Drucksensoren PI in Ganzmetallausführung gibt es mit dem Aseptoflex Vario-Anschluss sowie mit konischem G 1-Prozessanschluss. Dieser erlaubt mittels Adapter ebenfalls einen frontbündigen Einbau. Zudem kann er für hygienische Applikationen genutzt werden. Dies vereinfacht den Geräteaustausch in bestehenden Anlagen. Alle Sensoren verfügen über ein LED-Display, einen programmierbaren Analogausgang im 2-Leiter-

Indem Kontron die kommende 3. Generation der Intel Core Prozessoren auf mehr als zehn Embedded Formfaktoren unterstützt, ergibt sich eine perfekte Kombination von Energieeinsparung und Leistungsverbesserung. Zu den ersten Kontron Plattformen mit der 3. Generation der Intel Core Prozessoren zählen ein COM Express basic Computer-on-Module, ein Flex-ATX Embedded Motherboard, 3HE und 6HE CompactPCI Prozessorboards sowie ein AMC-Prozessormodul und ein 3HE VPX Prozessorboard. Durch diese breite Auswahl an Embedded Computing Plattformen ermöglicht Kontron OEMs einen schnellen Einstieg in die Entwicklung vielfältiger rechenund grafikintensiver Applikationen für die industrielle Automatisierung, Kommunikation, Verteidigungstechnik und Luftfahrt, Medizintechnik und Infotainment. Da die neuen Prozessoren rückwärts-

Betrieb sowie einen zusätzlichen Schaltausgang im 3- und 4-LeiterBetrieb. Ihre Gesamtgenauigkeit beträgt 0,2 Prozent und sie verfügen über elektronische Temperaturkompensation. Dank hoher Temperaturbeständigkeit sind sie für SIP- und CIP-Prozesse geeignet. Die Drucksensoren PI entsprechen den Schutzklassen IP 67, IP 68 und IP 69 K und sind EHEGDzertifiziert.

ifm electronic ag | 4624 Härkingen | Tel. 0800 88 80 33 info.ch@ifm.com | www.ifm.com/ch

kompatibel zu Designs auf Basis der zweiten Generation von Intel Core Prozessoren sein werden, wird so auch die Skalierbarkeit und Langzeitverfügbarkeit bestehender Kontron Boards und Systeme erweitert, die so auch von der verbesserten Performance profitieren können. Mit den neuen Kontron Plattformen auf Basis der 3. Generation der Intel Core Prozessoren können OEMs neue Applikationen entwickeln oder bestehende Applikationen mit höherer Performance und einer mit Designs auf Basis der 2. Generation Intel Core Prozessoren vergleichbaren Verlustleistung umsetzen. Zu den weiteren Verbesserungen, die sich durch die Implementierung der neuesten Chiptechnologie auf Kontron Plattformen ergeben, zählen beispielsweise DirectX 11 für anspruchsvolle Grafikapplikationen, die bisher eine dedizierte Grafikkarte erforderten.

Kontron AG | D-85386 Eching | Tel. 0049 8165 77-777 sales@kontron.com | www.kontron.de


72

megalink 4.12

B A U E L E M E N TE

Prozessor-Blade für Telekommunikationsausrüster Das AdvancedTCA 10GbE Prozessor-Blade Kontron AT8060 mit zwei Prozessorsockeln basiert auf dem Advanced Telecom Computing Architecture (AdvancedTCA) Standard. Mit bis zu 16 Prozessorkernen und 32 Threads, vier 1600 MHz Speicherkanälen pro Prozessor, einem AdvancedMC-Schacht und seinem neuen intelligenten Powermanagement eignet sich das Kontron Prozessor-Blade AT8060 für sehr rechenintensive und inhaltsbezogene Netzwerkapplikationen auf Basis von Kontrons offenen modularen 10G und 40G AdvancedTCA Plattformen. Zudem präsentiert Kontron den NEBS-3 konformen

Communication Rack Mount Server Kontron CG2200. Der neue Server integriert zwei Sockel für die 8-Core Intel Xeon Prozessoren der E5-2600 Familie und bietet umfassende Optionen für Arbeitsspeicher, I/Os und Datenspeicher Kombinationen plus die Möglichkeit, ein redundantes AC- und DC-Netzteil zu integrieren, und das in einem kompakten, 20 Zoll (50,8 cm) tiefen 2HE Chassis.

Kontron AG | D-85386 Eching | Tel. 0049 8165 77-777 sales@kontron.com | www.kontron.de

Multitouch-Panel-Baureihe für die Industrie Durch Smartphones und Windows 7 werden Multifinger-Touchscreens immer populärer. Um diese Technologie auch für industrielle Anwendungen verfügbar zu machen, hat Beckhoff seine 1995 in den Markt eingeführten Control-Panel-Serien durch die Baureihen CP2xxx und CP3xxx ergänzt. Die vollständig neu konstruierten Panels ermöglichen neue, innovative Visualisierungskonzepte mit intuitiver Bedienung. Die neuen Control-Panelund Panel-PC-Serien sind in verschiedenen Displaygrössen und Formaten erhältlich. Um die Industrietauglichkeit zu gewährleisten, nutzt Beckhoff die Projective-Capacitive-Touchscreen-(PCT)-Technologie in seinen Multitouch-Panel-Baureihen. Die hohe Touchpunktdichte ermöglicht eine akkurate und sichere Bedienung. Selbst eine

«fliessende» Touchbedienung, in kleinsten Schritten, ist ruckfrei möglich. Eine entspiegelte Glasscheibe bildet die Displayfront; die Bedienung kann auch mit Arbeitshandschuhen erfolgen. FünffingerTouch ist genauso möglich wie Automatisierungslösungen mit Zweihandbedienung. Aus der Smartphone- und Touchpad-Welt bekannte Funktionen wie Zoomen, Blättern, Objekte drehen, Flicks usw. sind mit den Multitouch-Paneln von Beckhoff nun auch für industrielle Anwendungen nutzbar.

Beckhoff Automation AG | 8200 Schaffhausen | Tel. 052 633 40 40 info@beckhoff.ch | www.beckhoff.ch

Neues Konzept der Koppel-Relais Die Master-InterfaceSerie 39 von Finder verkörpert ein neues Konzept der Koppel-Relais in der 6,2 mm breiten Bauform. «Master-Basic» ist die Version, die wie die bekannten Koppel-Relais in allen Systemen einsetzbar ist. Die «Master-Plus»Version mit dem einsetzbaren Sicherungsmodul ist wie die Version Basic in allen Systemen einsetzbar und erfüllt darüber hinaus die Anforderung, dass jeder Koppel-Relais-Ausgang mit einer individuellen, austauschbaren StandardFeinsicherung von (5x2) mm innerhalb der gegebenen Baubreite von 6,2 mm absicherbar ist. Bei den «Master-Input»- und «Master-Output»-Versionen führen beide Leitungen der Eingänge einer Steuerung an dasselbe Eingangskoppel-Relais, den Master-Input,

Industrieller Mini-PC mit Dualcore-Prozessor

bzw. werden beide Leitungen der zu schaltenden Last am selben Ausgangskoppel-Relais, dem MasterOutput, angeschlossen. «MasterTimer» ist ein Zeitfunktions-Koppel-Baustein mit vier Zeitbereichen von 0,1 s bis 6 h und acht Zeitfunktionen, der wie ein Zeitrelais in der Bauform der 6,2 mm breiten Koppel-Relais eingesetzt wird. Zur Reduzierung des Verdrahtungsaufwandes gibt es Kammbrücken zum Verbinden von bis zu 16 Fassungen.

Finder (Schweiz) AG | 8157 Dielsdorf | Tel. 044 885 30 10 finder.ch@finder-relais.ch | www.finder-relais.ch

Spectra präsentiert mit dem NISE 104 einen Mini-PC für den lüfterlosen Betrieb, der mit dem Dualcore Intel Atom Prozessor D2700 mit 2,13 GHz Taktrate ausgestattet ist. Das 185 x 54x 131 mm grosse Gerät ist dank dem leistungsfähigen, stromsparenden Prozessor und der umfangreichen Ausstattung mit Schnittstellen für eine Vielzahl von Applikationen, insbesondere im Bereich der Automatisierungstechnik, sehr gut geeignet. Das System verfügt über vier serielle Schnittstellen (2 x RS-232 und 2 x RS 232/422/485), zwei Intel Gigabit LAN-Ports und 4 x USB 2.0. Als Grafikports werden 1 x HDMI und 1 x DVI-I angeboten. Der DVI-I-Port kann als DVI-Grafikschnittstelle

oder als VGA-Port verwendet werden. Ein Mini-PCIe-Steckplatz ermöglicht die Erweiterung des Gerätes mit einem WI-FI-Modul oder einer GSM 3G-Erweiterungskarte. Das NISE 104 wird als einschaltbereites Komplettsystem mit 80 GByte SSD, 4 GByte RAM und Microsoft Windows 7 Betriebssystem geliefert. Die Stromversorgung erfolgt durch ein externes 230-VAC-/12-VDC-Netzteil.

Spectra (Schweiz) AG | 8132 Egg | Tel. 043 277 10 50 info@spectra.ch | www.spectra.ch


B A U E L E M E N TE

Single Board-Computer für Applikationen mit höchsten Taktraten Ab Mai vertreibt Kontron das Advanced MC-Prozessormodul AM4150. Es eignet sich dank einem 64-Bit-Dual-Core-Freescale-QorIQ-P5020Prozessor bei einer Taktrate von 2,2 GHz und Hochgeschwindigkeits-Verbindungen sowohl für MicroTCA-Plattformen als auch für rechenintensive ATCA-Plattformen, in denen das Modul als Mezzanine-Karte einsetzbar ist. Das Prozessormodul basiert auf dem Dual-Core-Prozessor Freescale QorIQ P5020 auf Basis der e5500 Power Architecture. Mit High-SpeedFrame-Managern und zahlreichen Hochgeschwindigkeits-Verbindungen wie Serial Rapid IO (1.3/2.1) und PCI Express erfüllt das Kontron AM4150 höchste Anforderun-

gen an die Verarbeitungskapazität. Für maximalen Datendurchsatz und geringe Latenz bietet es bis zu 8 GByte schnellen DDR3 DualChannel RAM mit ECC-Unterstützung. Das Kontron AM4150 verfügt über flexibel konfigurierbare Hochgeschwindigkeits-Datenverbindungen. Auf den AMC Ports 4–7 sind vier Serdes-Verbindungen entweder als PCI Express (root complex oder end point) oder Serial Rapid IO (host oder agent) konfigurierbar.

Kontron AG | D-85386 Eching | Tel. 0049 8165 77-777 sales@kontron.com | www.kontron.de

Bandpass-LC-Filter für Kommunikationsanwendungen Die bei MSC erhältliche LC-Filter-Serie des USHerstellers Precision Device Inc eignet sich ideal für Funk-, Navigationsund Kommunikationsanwendungen. Bei der Bandpass-, Tiefpass-, Hochpass- und Sperrfilter-Familie handelt es sich um Bandpass-LC-Filter mit einer 10-prozentigen Bandbreite im Frequenzbereich von 5 bis 100 MHz. Die Dämpfung im Sperrbereich beträgt entweder 40 (Formfaktor 3:1) oder 60 dB (Formfaktor 3:1 oder 2,5:1). Die Filter sind für einen Betriebstemperaturbereich von –55 bis +105 °C ausgelegt. Die Reflexionsdämpfung der Standardserien wird mit minimal 12 dB im gewünschten Frequenzband garantiert. Bei S11- und S22-Messun-

4.12 megalink

73

32-Bit-Microcontroller ab Lager verfügbar RS Components liefert die 32-BitMicrocontroller (MCUs) der Kinetis-Familie von Freescale Semiconductor mit dem neuen ARM Cortex-M4 Kern ab Lager. Die MCUs der Kinetis-Serie sind in Freescales 90-nm-Dünnfilm-Speichertechnologie (TFS) mit FlexMemory – einem konfigurierbaren, integrierten EEPROM – aufgebaut. Dank neuester Technologie des Leistungsmanagements sind diese MCUs besonders energieeffizient und verfügen zudem über präzise Mixed-Signal-Fähigkeit. Der Support dieser Komponenten erfolgt durch Entwicklungs-Tools von

Freescale und anderen Partnern, die die ARM-Technologie unterstützen. Die fünf Kinetis-Familien enthalten unter anderem folgenden Funktionen: Hochgeschwindigkeits-Analog-Digital-Converter in 16-Bit-Technologie, 12-Bit-Digital-Analog-Converter mit integrierter analoger Spannungsreferenz, Mehrfach-HochgeschwindigkeitsKomparatoren und programmierbare Verstärker, Low-Power-Berührungssensor mit Aufwachfunktion sowie mehrfache serielle Schnittstellen mit UARTs gemäss ISO7816 und Inter-IC Sound (I2S)

RS Components GmbH | 8820 Wädenswil | Tel. 044 283 61 90 vertrieb@rsonline.ch | www.rsonline.ch

Netzteil für LED-Anzeigen Die HSP-150-Serie wurde speziell für die Stromversorgung von LED-Anzeigen entwickelt. Das Netzteil ist in den Ausgangsspannungen 2,5 VDC, 3,8 VDC und 5 VDC erhältlich und weist einen hohen Wirkungsgrad von bis zu 90 Prozent auf. Um den erhöhten Anforderungen bei feuchten oder staubigen Umgebungen gerecht zu werden, sind die Netzteile schutzlackiert. Bei sämtlichen Anwendungen mit tiefen Ausgangsspannungen ist diese Serie mit 150 W Ausgangsleistung

die ideale Lösung, um die Energieeffizienz zu steigern.

Simpex Electronic AG | 8622 Wetzikon | Tel. 044 931 10 30 contact@simpex.ch | www.simpex.ch,

SiC-JFETs korrekt ansteuern gen lag der typische Wert bei mindestens 15 dB. Filter mit 40 dB Dämpfung im Sperrbereich werden in einem 2,54 x 1,27 x 0,75 cm3 grossen SMD-Gehäuse angeboten; Filter, die 60 dB Dämpfung oder darüber benötigen, in einem 3,8 x 1,27 x 0,75 cm3 grossen SMDGehäuse. Für die Durchkontaktierung oder für Steckverbinder geeignete kundenspezifische Gehäusevarianten können ebenfalls geliefert werden.

MSC-Gleichmann Schweiz AG | 8604 Volketswil | Tel. 043 355 33 62 volketswil@msc-ge.com | www.msc-ge.com

Siliziumkarbid-JFETs sind eine neue Klasse von Leistungsschaltern, die etwas anders angesteuert werden als Silizium-Mosfets. Dafür hat SemiSouth Laboratories ein Demo-Board eines Zweikanal-Gatetreibers entwickelt. Das SGDR2500P2 bietet opto-isolierte High-Side- und Low-Side-Ausgänge, die für Spitzenströme von +20 und –10 A ausgelegt sind. Zusätzliche Trenntransformatoren sind überflüssig. Das Board wurde für das schnelle, «harte» Schalten

entwickelt wie das 1200-V/100A-Halbbrückenmodul APTJC1200 AM-13VCT1AG von Microsemi. Das SGDR2500P2 erzeugt galvanisch getrennte ± 15-V-Betriebsspannungen und macht dadurch zusätzliche Stromversorgungen überflüssig. Es erlaubt Schaltfrequenzen von 0–100 kHz und Tastverhältnisse von 0–100 %. Typische Anwendungen sind «hart» schaltende Brückentopologien, Wechselrichter und Wandler sowie Produktevaluierung.

Telion AG | 8952 Schlieren | Tel. 044 732 16 36 infoie@telion.ch | www.telion.ch


74

megalink 4.12

A U TO M A T I O N

PC-Steuerung für den universellen Einsatz Der Embedded-PC CX9020 ist eine hutschienenmontierbare PC-Steuerung mit Komponenten der neuesten Generation: ARMCortex-A8-CPU und MicroSD-Karten mit grosser Speicherkapazität. Der Embedded-PC integriert CPU, zahlreiche IT- und Optionsschnittstellen, Stromversorgung und ein direktes I/O-Interface zur Anreihung der Beckhoff I/O-Systeme in einem kompakten Gehäuse. Der CX9020 erkennt automatisch die angeschlossenen Bus-(K-Bus) oder EtherCAT-Klemmen (E-Bus) und schaltet in den entsprechenden Modus. Die CPU des CX9020 kann intern auf 1-GByte-DDR3-RAM-Speicher zugreifen. Zum Lieferumfang gehört eine 256-MByte-MicroSD-Karte für das Betriebssystem. Ein freier Mi-

croSD-Kartenslot kann für zusätzliche Anwenderdaten genutzt werden. Es stehen darüber hinaus 128 KByte Novram für die Datenspeicherung bei Stromausfall zur Verfügung. In der Basisausstattung sind zwei 10/100-MBit /s-Ethernet-Ports (interner Switch), vier USB-2.0- sowie eine DVI-D-Schnittstelle vorhanden. Das Multioptions-Interface ermöglicht die Integration einer zusätzlichen Schnittstelle.

Beckhoff Automation AG | 8200 Schaffhausen | Tel. 052 633 40 40 info@beckhoff.ch | www.beckhoff.ch

Softwareplattform zur Schaltungsoptimierung Die Multisim 12.0 Professional Edition von National Instruments basiert auf der als Industriestandard etablierten Spice-Simulation und wurde im Hinblick auf Bedienfreundlichkeit optimiert. Die Designeffizienz kann entsprechend der jeweiligen Anwendungen verbessert werden, indem Fehler und Überarbeitungen des Prototyps mithilfe von Simulationswerkzeugen in Multisim verringert werden. Diese Werkzeuge beinhalten sowohl in der grafischen Systemdesignsoftware NI LabView entwickelte, anpassbare Analysen als auch gängige Spice-Analysen und intuitive Messgeräte. Multisim 12.0 bietet neue Integrationsmöglichkeiten in LabView für die Regelungssimulation analoger und digi-

taler Systeme. Mit diesem neuen Designansatz können noch während der PC-basierten Simulationsphase neben Analogschaltkreisen auch digitale, auf FPGA-basierte (Field-Programmable Gate Array) Steuerungslogik validiert werden. Die Multisim Professional Edition wurde auch für das Routen von Layouts und Rapid Prototyping optimiert.

National Instruments, 5408 Ennetbaden, Tel. 056 200 51 51 ni.switzerland@ni.com, www.ni.com/switzerland

Die Zukunft ist mechatronisch Sicher Abschalten im Maschinenbau

Mechanik, Elektrik und Softwareentwicklung verschmelzen mehr und mehr. Umso verständlicher ist es, dass eine noch engere Anbindung der jeweiligen EngineeringSysteme erforderlich wird. B&R und Eplan gestalten diesen Wandel bereits proaktiv durch die Entwicklung einer durchgängigen Anbindung der Werkzeuge «B & R Automation Studio» und «Eplan Electric P8». Durch die einfache Übernahme von Hardwarekonfigurationen und dem dazugehörigen I/O Mapping in Automation Studio von B & R werden Doppeleingaben und redundante Arbeitsschrit-

te vermieden. Die in der Elektroplanung projektierte B & R Hardware wird auf Knopfdruck in den Hardwarebaum des Automation Studio-Projektes integriert. Ein intelligenter Vergleichsmechanismus zeigt übersichtlich, welche Komponenten bereits projektiert sind und an welchen Stellen ergänzt wird. Intelligente Importund Exportmechanismen erleichtern die tägliche Arbeit mit mehreren Werkzeugen erheblich. Mittels «Round-Trip Engineering» werden Elektroplanung und Automatisierungsprojekt synchronisiert.

B&R Industrie-Automation AG | 8500 Frauenfeld | Tel. 052 728 00 55 office.ch@br-automation.com | www.br-automation.com

Die Sicherheitsschalter der Serien SIN und SMS von Wieland Electric sind für sicherheitsgerichtete Anwendungen im Maschinenbau wie z. B. bei der sicheren Stellungsüberwachung von beweglich trennenden Schutzeinrichtungen nach EN 1088 einsetzbar. Sie vereinen die Funktionen Positionsüberwachung und Zuhaltung in einem Schalter. Die mechanischen Sicherheitsschalter mit Zuhaltung der Serie SIN sind insbesondere für die sichere Verriegelung mit integrierter Zuhaltung von Schutztüren, -gittern, -hauben, -klappen oder -toren geeignet. Die Zuhaltung bleibt dabei solange geschlossen, bis eine gefährliche Maschinenbewegung wie zum Beispiel der Nachlauf von grossen Maschinenteilen nach dem Abschalten be-

endet ist. Eine optionale, intelligente LED-Diagnose signalisiert den Betriebszustand und unterstützt einen ökonomischen Maschinenbetrieb dabei ebenso wie das hohe Schaltvermögen der Kontakte. Mit dem weiten Betriebstemperaturbereich bis +70 ºC sind die Sicherheitsschalter der Serie SIN auch unter rauen Bedingungen einsetzbar. Sie stehen sowohl mit federkraftverriegelter als auch mit magnetkraftverriegelter Zuhaltung in vielen Kontakt- und Spannungsvarianten zur Verfügung.

OMNI RAY AG | 8600 Dübendorf | Tel. 044 802 28 80 info@omniray.ch | www.omniray.ch


MESSEN UND PRÜFEN

Neue Vertriebspartnerschaft für Mess-Smartphone «Durch die Vertriebspartnerschaft mit SwissQual können wir nun eine zeitgemässe Walk-Test-Lösung auf Basis eines Smartphones zur Optimierung von Mobilfunknetzen aller Standards anbieten», so Dietmar Vahldiek, Leiter des Fachgebiets Systeme und Projekte bei Rohde & Schwarz. John May, Geschäftsführer SwissQual AG, ergänzt: «Unsere innovative Smartphone-basierte Testlösung steht nun dank des weltweiten Vertriebs- und Servicenetzes von Rohde & Schwarz weit mehr Kunden im Bereich Netzoptimierung zur Verfügung.» Ob am Flughafen oder im Fussballstadion – wo viele Smartphone-Nutzer aufeinandertreffen, steigt der Datenverkehr. Mit der Walk-Test-Lösung QualiPoc Android von SwissQual können

Netzbetreiber die Qualität ihrer Versorgung an solchen Orten sichern. Rohde & Schwarz vertreibt ab sofort weltweit dieses Smartphone-basierte Messhandy für Sprach- und Datendienste als das neue R & S ROMES2GO.

Roschi Rohde & Schwarz AG | 3063 Ittigen | Tel. 031 922 15 22 sales@roschi.rohde-schwarz.com | www.roschi.rohde-schwarz.ch www.swissqual.com

1200-W-Netzgerät mit zwei Ausgängen

Das Labornetzgerät QPX600D von Thurlby Thandar Instruments (TTI) mit 1200 W verfügt über zwei isolierte Ausgänge – 600 W pro Ausgang, bis zu 80 V und 50 A. Es bietet mit der PowerFlex genannten Regelung eine hohe Flexibilität für die Spannungs- und Stromeinstellungen. Das bedeutet: Bei 80 V ist eine Stromstärke von 7,5 A erreichbar, bei 15 V kann der Last-

strom bis 35 A betragen, und bei 10 V ist die Maximalstromstärke von 50 A nutzbar. Eine Besonderheit des Doppel-Netzgerätes sind die beiden Betriebsvarianten «unabhängig» und «Tracking» der beiden Ausgänge. Die Version QPX600DP verfügt zusätzlich über digitale Schnittstellen wie LAN, USB, RS232 und GPIB.

Computer Controls AG | 8112 Otelfingen | Tel. 044 308 66 66 www. ccontrols.ch | info@ccontrols.ch

4.12 megalink

75

Multimeter per Smartphone bedienen Das U1177A ist eine Bluetooth Wireless-Connectivity-Lösung, die bis zu drei Agilent Handheld-Digital-Multimeters mit Android Smartphones, Tablets und PCs linkt. Durch die Aktivierung der Fernanzeige und -steuerung aus Entfernungen von bis zu zehn Metern erhöht diese Lösung den Komfort und die Sicherheit bei der Fehlersuche oder bei der Arbeit unter extremen Bedingungen. Der kompakte Bluetooth-Wireless-Adapter wird auf der Rückseite in eines von elf Agilent Handheld Multimeter gesteckt. Die Lösung beinhaltet zwei kostenlose Handy-Anwendungen für das Android-Betriebssystem, eine für die einfache Überwachung und eine andere für die Datenprotokollierung. Die «Mobile Meter»-Anwendung ermöglicht die Echtzeit-Inter-

aktion mit angeschlossenen Multimetern auf dem Bildschirm eines Android-Smartphones oder Tablets. Die «Mobile Logger»-Anwendung vereinfacht die Datenerfassung und Fernüberwachung. Agilent bietet auch eine kostenlose Datenlogger-Anwendung, die auf Windows basierten PCs läuft.

Computer Controls AG | 8112 Otelfingen | Tel. 044 308 66 66 www. ccontrols.ch | info@ccontrols.ch

Erweiterte Interface-Produktpalette Die Interface-Produktpalette von Wieland Electric wird um mehrere neue Produktserien in den Bereichen Zeitrelais, Messund Überwachungsrelais sowie Analogwandler erweitert. Die Produktfamilie der elektronischen Zeitrelais enthält neu die beiden Multi-Timer-Serien für die Hutschiene flare Time M und flare Time HM. Für den Fronttafel-Einbau steht die Serie flare Time FM zur Verfügung. Ein Twin-Timer flare Time Twin und ein rückfallverzögerter Timer ohne Hilfsspannung flare Time OFF runden die Palette der Zeitrelais ab. Die Produktfamilie der Mess- und Überwachungsrelais wird um die beiden Serien flare Control U und flare Control I

ergänzt. Zu dieser Produktfamilie gehört auch die Serie flare Control P3, die 3-Phasen-Netze auf Phasen- bzw. Spannungsausfall und auf Spannungssymmetrie überwacht. In der Produktfamilie der Analogwandler sind die Analogkonverter-sSerien cores C1 und cores C2 neu. Sie lösen alle Aufgaben rund um eine galvanische Trennung von Messsignalen.

OMNI RAY AG | 8600 Dübendorf | Tel. 044 802 28 80 info@omniray.ch | www.omniray.ch


76

megalink 4.12

M E S S E N U N D P R Ü F E N / I N D U S TR I E B E D A R F

Energiespar-Rechner online und als App

Mit einem Tool von Rockwell Automation können Hersteller mittels mobiler Geräte oder Computer berechnen, welche Einsparungen durch den Einsatz von frequenzgestellten Antrieben für Pumpen und Lüfter möglich sind. Hierzu kann entweder der «Online Energy Savings Calculator» ge-

nutzt oder die für iPad, iPhone oder Android-Systeme verfügbare App heruntergeladen werden. Das neue Tool gibt Anwendern die Möglichkeit, konventionelle Methoden wie den Einsatz von Ventilen zum Steuern von Pumpen oder von Drosselklappen zur Lüftersteuerung mit frequenzgestellten Antrieben zu vergleichen und die beim Einsatz eines AllenBradley PowerFlex-Frequenzumrichters zu erzielenden Kostensenkungen zu berechnen. Das Tool bietet zwei Wege zum Ermitteln des Energieverbrauchs. Der Anwender kann entweder den minimalen Pumpen- oder Durchflussprozentsatz, die jährlichen Betriebsstunden, die Kosten pro Kilowatt und weitere fabrikspezifische Informationen eingeben oder die von Rockwell Automation integrierten Beispieldaten übernehmen.

Rockwell Automation AG | 5001 Aarau | Tel. 062 889 77 77 info@rockwellautomation.ch | www.rockwellautomation.ch www.rockwellenergycalc.com

Ein pH-neutraler Reiniger für Baugruppen und Power-Module

Zestron, ein führender Hersteller von Reinigungsmedien für die Elektronikfertigung, präsentiert die neueste Generation der pH-neutralen Baugruppen- und Power Module-Reiniger. Im Fokus steht dabei der neue Baugruppenreiniger Vigon N 600. Nachdem Zestron 2009 den weltweit ersten, pHneutralen Reiniger zur Flussmittelentfernung von Baugruppen vorstellte, wurde in diesem Bereich intensiv weiterentwickelt. Der neue Reiniger Vigon N 600 verträgt sich gut mit sensitiven Materialen der SMT-Produktion wie beispielsweise Aluminium, Kup-

fer, Messing, Nickel, Kunststoffe oder Barcode-Etiketten und entspricht so den neuesten technischen und wirtschaftlichen Anforderungen der Elektronikfertiger. Vigon N 600 ist wasserbasierend und erzielt in Spritzreinigungsanlagen sowie in Mehrkammertauchanlagen hervorragende Reinigungsergebnisse. Er ermöglicht sowohl kurze Kontaktzeiten als auch niedrige Einsatzkonzentrationen von 15 – 20 Prozent und stellt dank seiner pH-neutralen Formulierung einen weiteren Schritt in Richtung umweltfreundlicher Reinigungsprozesse dar.

POLYSCIENCE AG | 6330 Cham | Tel. 041 748 80 30 info@polyscience.ch | www.polyscience.ch

Add-ons für attraktivere Scopes

Agilent Technologies hat die Oszilloskop-Familie InfiniiVision 3000 X um vier 1-GHz-Modelle erweitert: ein Zweikanal- und ein VierkanalGerät mit 1 GHz sowie diese beiden Modelle (als Mixed-SignalScopes) mit jeweils zusätzlich 16 Digitalkanälen. Die neuen Oszilloskope sind Agilents Antwort auf den steigenden Bedarf an Laboroszilloskopen zu günstigeren Preisen. Bei einem Kauf bis Ende August bekommt man ohne Aufpreis noch zwei praxisgerechte

Add-ons: einen integrierten Funktions-/Arbiträrsignalgenerator, der Stimulus/Response-Messungen mit dem Gerät ermöglicht, und eine implementierte DigitalvoltmeterFunktion, die eine sehr gute Kombination aus Bargraph- und 3-stelliger Alphanumerik-Anzeige darstellt. Zusammen mit den Oszilloskopen stehen auch sehr kapazitätsarme, aktive 1-GHzTastköpfe unter der Bezeichnung N2795A zur Verfügung.

Computer Controls AG | 8112 Otelfingen | Tel. 044 308 66 66 www. ccontrols.ch | info@ccontrols.ch

Mit dem «WebGuide» schneller zum Wunschprodukt Der WebGuide von Igus verknüpft Print und Online, um die Übersicht zu erleichtern und schneller zum richtigen Produkt zu gelangen. Dazu trägt nicht nur die grösstmögliche Reduzierung der Informationsvielfalt bei, sondern auch eine enge Verzahnung mit Online-Konfiguratoren, Videos und CAD-Daten. In der übersichtlichen Broschüre stehen alle wichtigen Basisparameter für die Produktauswahl zur Verfügung. Spezielle «Quicklinks» führen direkt online zum Wunschprodukt und zu weiterführenden Informationen wie passenden Online-Tools für die einfache Konfiguration, Preise und natürlich CADDateien. Wer sich zuerst inspirieren lassen möchte, kann über die per Smartphone oder Tablet scan-

baren QR-Codes Anwenderberichte und Videos zu den Produktgruppen abrufen. Der Katalog umfasst Kunststoff-iglidur-Gleit-, igubal-Gelenk-, drylin-Linear- und xiros-Kugellager sowie den Energieketten-Baukasten für sichere Energiezuführungen mit den dazu passenden Leitungen der chainflex-Familie. Der WebGuide kann kostenlos unter www.igus.de/WebGuide bestellt oder unter www.igus.de/WebGuideOnline durchgeblättert werden.

Igus Schweiz GmbH | 4623 Neuendorf | Tel. 062 388 97 97 i_Schweiz_G@igus.de | www.igus.de


MESSEN UND PRÜFEN

4.12 megalink

77

HOCHSPANNUNGS-MESSINSTRUMENT FÜR DIE CHARAKTERISIERUNG UNTERSCHIEDLICHSTER LEISTUNGSHALBLEITER UND MATERIALIEN

Bauelemente hochgenau charakterisieren Das SourceMeter 2657A von Keithley ist ein Hochspannungsinstrument für die Charakterisierung unterschiedlichster Leistungshalbleiter und Materialien mit einer Messauflösung von 1 fA (Femtoampere). Die eingebaute 3000 V, 180-W-Quelle erlaubt die Einspeisung einer bis zu fünfmal grösseren Leistung in das Testobjekt als vergleichbare Systeme – bei deutlich niedrigeren Kosten.

D

as SourceMeter 2657A wurde speziell für Hochspannungsanwendungen wie den Test von Leistungshalbleitern wie Dioden, FETs und IGBTs sowie die Charakterisierung von neueren Materialien wie Galliumnitrid (GaN), Siliziumkarbid (SiC) und anderen Verbindungshalbleiter-Materialien und Bauteilen optimiert. Es eignet sich auch für die Charakterisierung von sehr schnellen Einschwingvorgängen sowie Durchbruchund Leckstromtests bis 3000 V. Wie alle Geräte der Serie 2600A zeichnet sich auch das Modell 2657A durch eine Kombination von einer sehr flexiblen Vierquadranten-Spannungs- und Stromquelle/ Last (± 3000V@20mA, ±1500V@120mA) mit hochgenauen Volt- und Amperemetern aus. Es kombiniert die Funktionalität von mehreren Instrumenten in einem einzigen Gerät: Halbleiter-Charakterisierungssystem, Präzisionsstromversorgung, Stromquelle, 6-1/2stelliges DMM, Arbitrary Waveform Generator, U- und I-Pulsgenerator, elektronische Last und Trigger-Controller. Mithilfe der TSP-Link-Technologie lässt es sich zudem auf ein voll synchronisiertes, mehrkanaliges System erweitern. Messmodi für Digitalisierung oder Integration. Das Modell 2657A unterstützt digitalisierende und integrierende Messungen zur genauen Charakterisierung von sowohl kurzzeitigen Ereignissen, als auch eines konstanten Verhaltens. Je zwei unabhängige A/D-Wandler stehen für jeden der beiden Modi zur Verfügung, einer für Strom und einer für Spannung. Somit ist gleichzeitig ein genaues Rücklesen der Quellen möglich, ohne dass der Testdurchsatz eingeschränkt wird. Die im digitalisierenden Messmodus verwendeten 18-Bit-A/D-Wandler ermöglichen eine Abtastung in Schritten von einer Mikrosekunde, sodass Spannungs- und Stromspitzen gleichzeitig erfasst werden INFOS Linktronix AG 8800 Thalwil Tel. 044 722 70 00 info@linktronix.ch www.linktronix.ch

Das SourceMeter 2657A von Keithley Instruments kombiniert die Funktionalität von mehreren Instrumenten in einem einzigen Gerät. (Bild: Linktronix)

können. Der integrierende Messmodus basiert auf einem 22-Bit-A/D-Wandler für höchstmögliche Messgenauigkeit.

des Spannungs- und Stromausgangs eines Instrumentes über einen einfachen Schieberegler.

Leistungsfähige Tools für die Testentwicklung. Mit TSP Express, der LXI-basierenden I-UTestsoftware von Keithley, ist eine grundlegende Bauteilcharakterisierung ohne Programmierung oder Softwareinstallation möglich. Hierzu wird einfach ein PC mit dem LXI-LAN-Port verbunden und TSP Express über einen Java-fähigen Webbrowser aufgerufen. Die Ergebnisse können entweder in grafischer oder tabellarischer Form dargestellt und in eine .csv Datei zur Verwendung in einer Tabellenkalkulation exportiert werden. Zwei zusätzliche Tools für die Erstellung von Testsequenzen werden mit dem Modell 2657A mitgeliefert. Die ACS Basic Edition Software ist ebenfalls als eine Option für die Bauteilcharakterisierung verfügbar. Die neuste Version bietet umfangreiche Funktionen für die Charakterisierung von Hochspannungs- und Hochstrombauteilen. Ein spezieller «Trace Mode» ermöglicht eine Echtzeitsteuerung

Flexible, hochgenaue Verbindungs- und Kontaktierlösungen. Das Modell 2657A kann mit anderen Instrumenten in einem Testsystem über standardmässige SHV-Koaxialkabel (Safe High Voltage) verbunden werden, die zu bestehenden Hochspannungstestanwendungen kompatibel sind. Für Anwendungen, die sehr kleine Ströme messen müssen, bietet Keithley spezielle (abgeschirmte) HV-Triaxial-Verbindungen an. Das neue optionale High Power Device Test Fixture Modell 8010 stellt die Verbindungen für den Test von Bauteilen mit hoher Leistung bis 3000 V oder 100 A her. Neben standardmässigen Bananen-Kurzschlussbrücken verfügt das Modell 8010 auf der Rückseite über Ports für ein Oszilloskop und einen thermischen Sensor, was die Systemintegration für eine weitere DUT-Charakterisierung vereinfacht. Das Modell 8010 bietet ausserdem umfassende Funktionen zur Sicherheitsverriegelung. ■


78

megalink 4.12

L I E F E R A N TE N V E R Z E I C H N I S

Antriebe/Fluidik

Hydraulik '#     ( # $%  **  #    !%     )  !%   **

 #  

   #  '# &

   

   

 & " $$$ & "

Industrie-PCs 

               

  '    % '   

    $   #     $ $  $   !"     !"  

         



       

"$   '! #



Antriebstechnik ZF Services Schweiz AG

Bildverarbeitung

Kabel     $   #     $ $  $   !"     !"                                  

    

Dienstleistungen

Automation           

Hermtech AG Tel. 033 823 22 77 Fax 033 823 25 67 info@hermtech.ch www.hermtech.ch

Messen + PrĂźfen

 

Entwicklung ¡ Schema ¡ Layout ¡ Disposition Materialbeschaffung ¡ Bewirtschaftung Print ¡ Baugruppen ¡ Steuerungsbau PrĂźfung ¡ ElektriďŹ zierung ¡ Inbetriebnahme

Hermtech AG Tel. 033 823 22 77 Fax 033 823 25 67 info@hermtech.ch www.hermtech.ch

kompetent ¡ erfahren ¡ efďŹ zient

Bauteile und Distribution

  !       !    &     %  &   &&

       

&&  #  $  $    "    &"  & &  %  &"  & &&

          

Sensoren

Entwicklung ¡ Schema ¡ Layout ¡ Disposition Materialbeschaffung ¡ Bewirtschaftung Print ¡ Baugruppen ¡ Steuerungsbau PrĂźfung ¡ ElektriďŹ zierung ¡ Inbetriebnahme kompetent ¡ erfahren ¡ efďŹ zient

Elektronikfertigung

3M (Schweiz) AG Tel. 044 724 93 52 Eggstrasse 93 Fax 044 724 94 40 8803 RĂźschlikon www.3m.com/interconnects

 

     

-  03 #4 #*# - - )

% &#+.#+! .4 4 2 &#+.#+! .4   ""$-""% 111%"$-""%

 )$3)  )$3) "/  ) ( $( -() $- $( -() ") $( -()  " -"()   ')%

Stecker

USV – Unterbrechungsfreie Stromversorgung $ $  %, $$  ," %! %! %!  $ $  )))$ $  * $ $ ' ( $( & $ & +$



                 




L I E F E R A N TE N V E R Z E I C H N I S

Ruederstr. 6 5040 SchĂśftland Tel.: 062 721 44 84 www.maurelma.ch Fax 062 721 44 85 Strom fĂźr jede Situation info@maurelma.ch

Beratung, Planung, Verkauf & Service Newave Energy AG 5432 Neuenhof, Tel. 056 416 01 01 2504 Biel, Tel. 032 366 60 30 www.newavenergy.ch info@newavenergy.ch

WerkstoffprĂźfmaschinen

WickelgĂźter

  

  $   "%+ ($ )))  

    + &+ + !  * + &+ & &!   

        

      

 

   %- '/ /* )

# $ !/"'+ &+ // // . $ !/"' /'+ &+ // // ,-#

4.12 megalink

79


80

megalink 4.12

IMPRESSUM

Impressum

Firmen in dieser Ausgabe ABB Schweiz AG,

6, 11, 30, 40, 44

Megalink - Elektronik + Automation ISSN 1662-9558 19. Jahrgang «Megalink» 28. Jahrgang «EC Woche» 33. Jahrgang «Precision» 51. Jahrgang «Elektroniker» www.megalink.ch Total verkaufte Auflage: 2310 Ex., Total Zielversand/Gratis: 5610 Ex.

APM Technica AG

16

Mero Microchip (Schweiz)

Astrel AG

38

Messe München GmbH

Avnet EMG AG

10

MPI Distribution AG

21, 69

MSC-Gleichmann Schweiz AG

47, 73

Kontakt Alle Mitarbeiter erreichen Sie unter vorname.name@azmedien.ch

Baumer Electric AG

Herausgeberin AZ Fachverlage AG, Neumattstrasse 1, 5001 Aarau Tel. +41 (0)58 200 56 50, Fax +41 (0)58 200 56 51 Geschäftsführer Dietrich Berg Leiterin Zeitschriften Ratna Irzan Redaktion Megalink, Neumattstrasse 1, Postfach, CH-5001 Aarau Tel. +41 (0)58 200 56 42, Fax +41 (0)58 200 56 61 Chefredaktor: Patrick Müller, Tel. +41 (0)58 200 56 59 Redaktor: Daniel Wallimann, Tel. +41 (0)58 200 56 30

B&R Industrie-Automation AG

61, 62, 74

Bachmann electronic GmbH

17 6, 18, 53, 59

Beckhoff Automation AG BERNEXPO AG Bibus AG Bosch Rexroth Schweiz AG Compona AG

Verleger: Peter Wanner CEO: Christoph Bauer www.azmedien.ch Namhafte Beteiligungen nach Art. 322 Abs. 2 StGB: AZ Anzeiger AG, AZ Fachverlage AG, AZ Management Services AG, AZ Regionalfernsehen AG, AZ TV Productions AG, AZ Verlagsservice AG, AZ Vertriebs AG, AZ Zeitungen AG, Basellandschaftliche Zeitung AG, Media Factory AG, Mittelland Zeitungsdruck AG, Solothurner Zeitung AG , Radio 32 AG, Vogt-Schild Druck AG, Vogt-Schild Vertriebs GmbH, Weiss Medien AG

Omni Ray AG

52 64, 68, 74, 75

Omron Electronics AG

16

Parkem AG

64

PHOENIX CONTACT AG

3, 14, 39, 68

Phoenix Mecano Komponenten AG

48, 57

Pilz Industrieelektronik GmbH

14, 15

Danfoss AG

18

PostLogistics AG

DELO

20

PowerParts AG

17, 44

Distrelec AG

71

Precimation AG

37

EBV Elektronik GmbH & Co. KG Endress+Hauser Metso AG

23, 55 67 8, 15

17 43

R & M Schweiz AG Roschi Rohde & Schwarz AG

Feller AG

14

Rockwell Automation AG

2

51

Reinhardt GmbH

20

Finder (Schweiz) AG

76

Reichle & De Massari AG

FED e. V.

RS Components GmbH

17 33, 75 67 12, 16, 70, 73

Frost & Sullivan

12

Rutronik Elektronische Bauelemente AG

GLYN GmbH & Co. KG

41

Schaffner Holding AG

Hager AG

70

Schneider Electric (Schweiz) AG

Harting AG

68

Schweizerische Mobiliar

ifm electronic ag igus Schweiz GmbH

9, 21

Simpex Electronic AG

70, 73

12

Spectra (Schweiz) AG

65, 66, 72

50, 76

Stolz Electronics AG SUVA

29

SwissBit AG

Keller AG

70

Swiss Technology Network

Kontron Embedded Computers 12, 71, 72, 73

Telion AG

Linktronix AG

WAGO CONTACT SA

MCH Beaulieu Lausanne SA

26, 27

Siemens Schweiz AG

35

maxon motor ag

10 6, 19

49

Intermess Dörgeloh AG

MathWorks GmbH

14

10, 71

ILEE AG

Lütze AG

Druck Vogt-Schild Druck AG, 4552 Derendingen Ein Produkt der

7, 24, 74

Noser Engineering AG

POLYSCIENCE AG

Iftest AG

Layout/Produktion Ursula Urech

25

National Instruments

21

Anzeigen Thorsten Krüger, Tel. +41 (0)58 200 56 32 Verena Müller, Tel. +41 (0)58 200 56 42 Anzeigentarif unter www.megalink.ch

Preise Abonnementspreis Fr. 84.–, Ausland Fr. 85.– plus Postgebühren

18, 64

29

71, 75, 76

Hochschule Luzern

Aboverwaltung abo@megalink.ch, Tel. +41 (0)58 200 55 64

11

69

Contrinex Schweiz AG

Leiter Werbemarkt Jürg Rykart, Tel. +41 (0)58 200 56 04

Leiter Lesermarkt/Online Valentin Kälin

10, 31

11, 69

Computer Controls AG

ETH Zürich Copyright Mit der Annahme von Manuskripten durch die Redaktion und der Autor-Honorierung durch den Verlag erwirbt der Verlag das Copyright und insbesondere alle Rechte zur Übersetzung und Veröffentlichung der entsprechenden Beiträge in anderen verlagseigenen Zeitschriften sowie zur Herausgabe von Sonderdrucken. Für unverlangt eingesandte Text- und Bildunterlagen übernimmt die Redaktion keine Gewähr. Produkte und Highlights sind kostenpflichtig. Nachdruck, auch auszugsweise, nicht gestattet.

5, 72, 74

MEN Mikro Elektronik GmbH

US 4, 77 21 US 3 US1, 34, 64 13, 28

42, 69 8 16 32, 38, 43, 52 73 US 2, 20, 22

Weidmüller Schweiz AG

36

Westermo Data

15

Wonderware Switzerland SA

11

XP Power AG

49

Vorschau Megalink 5-12 erscheint am 23. Mai 2012 Vorzugsthemen: LEDs, Antriebstechnik (Marktübersicht), Embedded Computing Conference / Embedded Systems, Bauteile (Optoelektronik, Solartechnik, LWL), Messen + Prüfen (Laser, Sensoren, Aktoren), Automation (Microsysteme, RFID), Kommunikation, Industriebdarf. Inserateschluss: 30. April 2012


Parlez-vous MATLAB? Über eine Million Menschen weltweit sprechen MATLAB. Ingenieure und Wissenschaftler in allen Bereichen – von der Luft- und Raumfahrt über die Halbleiterindustrie bis zur Biotechnologie, Finanzdienstleistungen und Geo- und Meereswissenschaften – nutzen MATLAB, um ihre Ideen auszudrücken. Sprechen Sie MATLAB?

Dieses Beispiel finden Sie unter: www.mathworks.ch/ltc

®

The language of technical computing

Image: Kim Young-Sang, Jung Hee-Jun, Quantum Device Lab, Hanyang Univ.©2011 The MathWorks, Inc.

Modellierung eines elektrischen Potentials in einem Quantum Dot.


Wärmebildkamera für industrielle Anwendungen > > > > > >

Exclusives IR-OptiFlex™-Fokussystem IR-Fusion®-Technologie Stabilität beim Einhandbetrieb Mehrfachmodus- Videoaufnahme IR-PhotoNotes™-Kommentierungssystem Elektronischer Kompass

Mit der neuen Wärmebildkamera von Fluke können Sie Zeit und Geld sparen, da potenzielle Probleme bereits erkannt werden, bevor sie teure Ausfälle verursachen. Dank der innovativen Features und Funktionalität der neuen Wärmebildkameras Ti100, Ti110 und Ti125 und ihrer Auflösung von 160 x 120 können Sie Infrarotinspektionen schneller und effizienter ausführen und gleichzeitig Problembereiche für weitere Nacharbeiten gründlich dokumentieren.

DOP/MSO3000 Serie Digital Phosphor Oszilloskop > > > > > > > >

Modelle mit 500, 300 oder 100 MHz Bandbreite NEW mit nachträglichem Bandbreiten Upgrade! 2 oder 4 Analoge Kanäle 16 Digitalen Kanälen (MSO Series) 2.5 GS/s Sampling Rate auf ALLEN Kanälen 5 Megapoint Aufzeichnung auf ALLEN Kanälen >50,000 wfm/s Maximum Waveform Capture Rate Set von Advanced Trigger Möglichkeiten

Source-Measure-Einheiten und SourceMeter-Instrumente für Strom und Spannung Wissenschaftler, Forscher und Ingenieure nutzen weltweit die branchenführenden Sourcemeter® Source-Measure-Unit(SMU)-Instrumente von Keithley für eine Vielzahl von elektronischen Testanwendungen wie zum Beispiel: > für die Halbleitercharakterisierung, Prozessentwicklung und Fertigung > zum Produktionstest von elektronischen Endprodukten wie mobilen Funkgeräten > Qualitätssicherung und Fehleranalyse von elektronischen Komponenten wie Solarzellen und HBLEDs > Forschung von neuen Werkstoffen wie Graphen für Anwendungen in der Nanotechnologie. Die Instrumente liefern eine einzigartige, nur bei Keithley erhältliche Kombination aus dynamischem Signalbereich, Geschwindigkeit und Genauigkeit.

Ihr Tektronix, Keithley & Fluke Partner in der Schweiz Linktronix AG > Zürcherstrasse 68 > 8800 Thalwil > Tel.: 044 722 70 00 > info@linktronix.ch > www.linktronix.ch


megalink 04 - 2012