Slovak Journal of Animal Science, volume 45, 2012 (1) by CVŽV Nitra

Number

2012 Volume 45 45 (1) 1-38 ISSN 1337-9984

Slovak Journal of

Animal Science ANIMAL PRODUCTION RESEARCH CENTRE NITRA

Slovak Journal of Animal Science

Formely Journal of Farm Animal Science

Aims and scope

Slovak Journal of Animal Science (ISSN 1337-9984) is an international scientific Editor-in-chief: journal that publishes original Ladislav Hetényi, Animal Production Research Centre Nitra, Slovak Republic scientific papers, reviews, Executive editor: short communications, Ludmila Hanuliaková, Animal Production Research Centre Nitra, Slovak Republic chronicles of important Technical editor: jubilees, reports of Marta Vargová, Animal Production Research Centre Nitra, Slovak Republic participation in important international conferences on animal science in English Editorial board language. Topic of the journal Daniel Bíro, Slovak University of Agriculture Nitra, Slovakia are problems of animal Zsuzsanna Bosze, Agricultural Biotechnology Center, Gödöllö, Hungary production, mainly in the Jan Brouček, Animal Production Research Centre Nitra, Slovakia sphere of genetics, breeding, Jozef Bulla, Slovak University of Agriculture Nitra, Slovakia nutrition and feeding, Ondrej Debrecéni, Slovak University of Agriculture Nitra, Slovakia physiological processes Andrzej Filistowicz, The Faculty of Biology and Animal Science, University of digestion, conservation of Enviromental and Life Science, Wroclaw, Poland and treatment of feeds, Roland Grossmann, Institute of Animal Science Mariensee, Germany biotechnology, reproduction, ethology, ecologization Peter Chrenek, Animal Production Research Centre Nitra, Slovakia of breeding, biology and Jozef Laurinčík, Constantine the Philosopher University Nitra, Slovakia breeding technology in farm Juraj Koppel, Institute of Animal Physiology SAS, Košice, Slovakia animals, quality of meat, Peter Massanyi, Slovak University of Agriculture Nitra, Slovakia milk, wool, economy Gábor Mészáros, University of Natural Resouces and Life Sciences, of breeding and production Division of Livestock Sciences, Vienna, Austria of farm animals, mainly: Štefan Mihina, Animal Production Research Centre Nitra, Slovakia cattle, pigs, sheep, goats, Shoukhart M.Mitalipov, Oregon Health & Science University, Beaverton, U.S.A. horses, poultry, small farm Jaana Peippo, MTT Agrifood Research Finland, Jokioinen, Finland animals and farm game. Dana Peškovičová, Animal Production Research Centre Nitra, Slovakia There are published also articles from the sphere Juraj Pivko, Animal Production Research Centre Nitra, Slovakia Josef Přibyl, Research Institute for Animal production, Praha – Uhříněves, Czech Republic of biochemistry, genetics, embryology, applied Ján Rafay, Animal Production Research Centre Nitra, Slovakia mathematical statistics as Alexander Sirotkin, Animal Production Research Centre Nitra, Slovakia well as economy of animal Pavel Suchý, Department of Nutrition, Dietetics, Zoohygiene and Plant Products, production. There can be University of Veterinary and Pharmaceutical Sciences Brno, Czech Republic published also articles from Milan Šimko, Slovak University of Agriculture Nitra, Slovakia the sphere of veterinary Peter Šútovský, University of Missouri – Columbia, U.S.A. medicine concerning the Vladimír Tančin, Animal Production Research Centre Nitra, Slovakia themes of the journal.

Editorial office

Manuel Tena-Sempere, University of Cordoba, Spain Miroslav Valent, West Virginia University, Morgantown, U.S.A. Igor Valocký, University of Veterinary Medicine, Košice, Slovakia Scientific English: Shubhadeep Roychoudhury; A. V. Makarevich

No part of this publication may be reproduced, stored or transmitted in any form without prior written permission of the Publisher.

Online version of the journal (ISSN 1338-0095) is at disposal at http://www.cvzv.sk/index.php/slovak-journal-of-animal-science. Permission of the Publisher is required to store or use electronically any material contained in this journal.

This journal is comprised in: AGRIS/FAO database (the full texts, too); CAB Abstracts; Knovel. Slovak Journal of Animal Science is published under the authorization and direction of the Animal Production Research Centre (APRC) Nitra, Slovak Republic. Editorial office, orders, subscription and distribution: APRC Nitra, Hlohovecká 2, 951 41 Lužianky, Slovak Republic. Phone +421 37 6546 249; e-mail: editor@cvzv.sk; http://www.cvzv.sk/ Filed at the Ministry of Culture of the Slovak Republic: EV 3659/09. © APRC Nitra in Publishing house Publica Nitra, 2012.

Polymorphism of calpastatin, calpain and myostatin genes in native Dalagh sheep in Iran

M. AHANI AZARI, E. DEHNAVI*, S. YOUSEFI, L. SHAHMOHAMADI Department of Animal Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Iran

ABSTRACT Calpains play a major role in post mortem tenderization and calpastatin is the endogenous inhibitor of calpain proteases and regulates the rate and extent of post mortem tenderization. Myostatin is an inhibitor of skeletal muscle growth and a mutation in the gene coding region leads to increased muscling. Therefore, they are considered as candidate genes for meat and growth traits. Blood samples were collected from 110 Dalagh sheep and DNA were extracted using modified salting out extraction method. Genotypes were determined by PCR amplification followed by single-strand conformation polymorphism (SSCP) method for calpain gene and restriction fragment length polymorphism (RFLP) method for calpastatin and myostatin genes. Based on results, calpastatin and calpain genes were found to be polymorphic but myostatin gene was monomorphic. Genotype frequencies were 36, 38, and 26 % for MM, MN and NN in calpastatin locus, respectively. In this population, calpastatin locus did not show Hardy-Weinberg equilibrium (P<0.05). Observed heterozygosity for this locus was good (0.38). Under the SSCP analysis, three different patterns (G1, G2 and G3) with frequencies of 8.2, 89.1, and 2.7 % were detected in calpain locus, respectively. Detected polymorphisms and assumed associations of genetic variation with meat production and tenderness may help to find the effective genotypes of Dalagh sheep for those economic traits. Key words: calpastatin; calpain; myostatin; molecular methods; polymorphism; sheep

INTRODUCTION Considerable progress in farm animal breeding has been made in the last few decades, but achieving greater understanding in the improvement of meat quality was very slow before molecular markers became an accessible technology with wide applications in breeding methods (Gao et al., 2007). In case of sheep, research on genetic polymorphism of three candidate genes, calpastatin, calpain (Palmer et al., 1999) and myostatin have been carried out (Kambadur et al., 1997). The calpain-calpastatin system (CCS) contains a family of Ca2+-dependent neutral proteases. This system is found in most animal tissues and influences many important processes including muscle development and degradation, meat tenderization post mortem, cataract formation and fertility (Palmer et al., 1999). Calpastatin

*Correspondence: E-mail: e.dehnavi@yahoo.com Elena Dehnavi, Animal Science Department, Basij Square, Gorgan, Golestan, �� Iran Tel.: 00989111704825 Fax: 00981714420438

and calpain deserves special attention because of their major role in meat production and quality. Calpastatin (CAST) is the endogenous and specific inhibitor of calpain proteases and regulates the rate and extent of post mortem tenderization (Kocwin and Kuryl, 2003). Calpain (CAPN) plays a major role in post mortem tenderization in beef, lamb and pork by degrading structure of muscles (Huff-Lonergan et al., 1996). A number of studies have shown that the calpain system is also important in normal skeletal muscle growth (Palmer et al., 1997; 1999; Goll et al., 2003). An increased growth rate of skeletal muscle may result from a decreased rate of muscle protein degradation due to reduction of calpain and increase in calpastatin activities. Myostatin (MSTN) or growth differentiation factor-8 (GDF-8) is a member of the mammalian growth transforming family (TGFbeta superfamily), which plays a role in the regulation

Received: November 21, 2011 Accepted: February 23, 2012

Original paper

Slovak J. Anim. Sci., 45, 2012 (1): 1-6

of embryonic development and tissue homeostasis in adults (Sonstegard et al., 1998). They are known to block myogenesis, hematogenesis and enhance chondrogenesis as well as epithelial cell differentiation in vitro. In mice, null mutants are significantly larger than wild-type animals, with 200–300 % more skeletal-muscle mass, because of hyperplasia and hypertrophy (McPherron et al., 1997). Muscular hypertrophy (mh), also known as “double-muscling” in cattle, has been recognized as a physiological character for years (Arthur, 1995) and is seen in Belgian Blue, and Piedmontese cattle (Kambadur et al., 1997). These animals had less bone, less fat, and 20 % more muscle on an average (Shahin and Berg, 1985; Hanset, 1991; Casas et al., 1998). Mutations within myostatin gene led to muscular hypertrophy allele (mh allele) in the double muscle breeds (Kambadur et al., 1997). Such a major effect of a single gene on processing yields opened a potential channel for improving processing yields of animals using knockout technology (Arif et al., 2002). Therefore, sequencing of calpastatin, calpain and myostatin genes of farm animals is important to produce genomic resources for development of knockout technology as well as for understanding the structure, function and evolution of the gene. In Iran, sheep meat is a major source of animal protein and investigation for meat quality and related genes is important. Dalagh is a kind of fat-tail sheep and also known as Semi fat-tailed Turkmen or Atabai. This breed is found mainly in the northeast region of the Turkmen plain, located in Golestan Province. The sheep is resistant to humid environment and parasites (Saadatnoori and Siahmansoor, 1990). The aim of present study was to identify genotypes of calpastatin, calpain and myostatin genes in Dalagh sheep using PCR-RFLP and PCR-SSCP methods in order to find effective alleles influencing meat quantity and quality traits in sheep.

MATERIAL AND METHODS Animals and DNA extraction Blood samples were randomly collected from 110 Dalagh sheep from Golestan province. DNA was extracted from blood as described by Miller et al. (1988). Quality and quantity of DNA were measured by visual and spectrophotometer methods. PCR

Two pairs of primers were used for amplifying each of CAST, CAPN and MSTN loci using primers suggested by Nassiry et al. (2007) and Timothy et al. (1997), respectively. The primer sequences are presented in Table 1. An aliquot of 100 ng genomic DNA was amplified in a total volume of 15 µl PCR mix. The PCR mix consisted of: 7.5 µl Master mix (Cinna clon, Iran), 2 µl forward and reverse primers (10 pmol/ µl), and 4.5 µl ddH2O. Amplification conditions are shown in Table 2. In every experiment, negative controls were used, aiming to avoid contaminations. Assays were performed in a thermal cycler (Personal Cycler™ - Biometra, CA, German), and the amplicons were analyzed by 1.5 % agarose gel electrophoresis. The gels were stained with ethidium bromide and visualized under ultraviolet light. Digestion reaction 10 µl of PCR products were incubated for 10 h at 37 oC with 1 µl (10 units) of MspI and HaeIII enzymes for calpastatin and myostatin genes, respectively. Digestion products were separated by electrophoresis on 2 % agarose gel, stained with ethidium bromide for calpastatin and 8 % non-denaturing polyacrylamide gels, stained by silver nitrate staining method for myostatin genes, respectively (Benbouza et al., 2006) (Figures 1 and 3).

Table 1: Locus, region, methods, primer sequence (5’→3’) and length of PCR products of the CAST, CAPN and MSTN genes Locus

Region

Method Primer sequence (5’→3’)

CAST

Exon and intron1

PCR-RFLP

F: TGGGGCCCAATGACGCCATCGATG

R: GGTGGAGCAGCACTTCTGATCACC

CAPN

F: AACATTCTCAACAAAGTGGTG

Exon 5 and 6 including intron PCR-SSCP

R: ACATCCATTACAGCCACCAT

MSTN

F: CCG GAG AGA CTT TGG GCT TGA

Exon 3

PCR-RFLP

F: forward and R: reverse

R: TCA TGA GCA CCC ACA GCG GTC

Length of fragment (bp) 622 190 337

Slovak J. Anim. Sci., 45, 2012 (1): 1-6

Original paper

Fig. 2: The SSCP patterns of 190 bp fragments of the ovine CAPN regulatory gene, on 8 % non-denatured polyacrylamide gel after silver nitrate staining. Three patterns demonstrating the 3 genotypes are presented.

Fig. 1: Restriction patterns of 622bp fragments of CAST gene after digesting with MspI on 2 % agarose gel and staining with ethidium bromide. Molecular marker was M100.

Fig. 3: Restriction patterns of 337 bp fragments of MSTN gene after digesting with HaeIII on 8% non-denatured polyacrylamide gel after silver nitrate staining. Molecular marker was M50.

Table 2: PCR conditions Locus Primary denaturation Denaturation Annealing Elongation in 1st cycle

Final extension

Number of cycles

°C/Sec

°C

Sec

°C

Sec

°C

Sec

°C/Sec

CAST

95/180

120

72/420

CAPN

95/180

72/600

MSTN

94/240

58.5

120

72/240

Table 3: Allele and genotype frequencies; observed, expected and average heterozigosity for CAST and CAPN loci Locus CAST CAPN

Allelic frequenciesa (%)

Genotype frequenciesb (%)

Heterozigosity

χ2

Obs.

Exp.

Ave.

55.45 -

44.55 -

36 8.2

38 89.1

26 2.7

0.38 -

0.49 -

5.908* -

a: A and A correspond to M and N alleles for CAST locus 1 2

b: G1, G2 and G3 correspond to MM, MN and NN genotypes for CAST locus. *: P<0.05

SSCP

Genotyping of calpain locus was performed by PCR-SSCP method. PCR products (3 µl) were diluted with 13 µl of running buffer (including 800 µl formamide 99 %, 100 µl loading dye, 100 µl glycerol 98 %, 3 µl 0.5M EDTA and 2 µl 10M NaOH). After heating at 95oC for 5 min, they were immediately placed on ice for 10 min. Polymorphisms were detected using 10 %

non-denaturing polyacrylamide gels (Figure 2). The mixture was electrophoresed for 4 h at 250 V and 10oC. DNA fragments were visualized using the silver nitrate staining method (Benbouza et al., 2006). Calculation of genotypes and allele frequencies, expected and observed heterozygosity and examination of Hardy-Weinberg equilibrium were performed using PopGene32 (Ver. 1.32) (Yeh et al., 2000) (Table 3).

Original paper RESULTS AND DISCUSSION CAST

A 622 bp fragment from CAST was amplified. The MspI restriction enzyme digested the PCR products and alleles of M and N were detected. The MspI digests the allele M, but not allele N. The MspI digestion of the allele M produced digestion fragments of 336 and 286 bp (Figure 1). The allelic frequencies were 55.45 and 44.55 % for M and N, respectively. The genotype frequencies in Dalagh sheep were 36, 38, and 26 % for MM, MN and NN, respectively (Table 3). In this population, this locus didn‘t show Hardy-Weinberg equilibrium (P<0.05) (Table 3). Observed heterozygosity for this locus was good (0.38) in the herd (Table 3). CAPN

The ovine calpain regulatory gene, exon 5 and 6 including intron (CAPN456), with 190 bp length was amplified. Under the SSCP analysis, different conformations were detected by electrophoresis on nondenaturing polyacrylamide gel (Figure 2). Genotype frequencies were 8.2, 89.1, and 2.7 % for G1, G2 and G3, respectively (Table 3). MSTN

A 337 bp fragment for exon 3 of MSTN locus was amplified. HaeIII restriction enzyme was used to digest the PCR products. The HaeIII digests the m allele, but not M allele. Digestion of the m allele produced three fragments of 83, 123, and 131 bp (Figure 3). All samples were digested by HaeIII enzyme and showed the mm genotype. As a result, all of them were monomorphs (Figure 3). Results showed polymorphism in CAST and CAPN loci but MSTN locus was monomorphic. Three different genotypes (MM, MN and NN) were showed in CAST locus. Similar result for calpastatin locus was observed in Iranian Karakul sheep by Eftekhari Shahroudi et al. (2006). A high degree of calpastatin polymorphism has also been reported in studies on Dorset Down hoggets, Dorset Down×Coopworth sheep, Corriedale rams and Angus bulls (Palmer et al., 1997; Chung et al., 1999). Palmer et al. (1997) detected three genotypes (MM, MN and NN) in unrelated Corriedale rams for this locus which was in agreement with the present results. Chung et al. (1999) observed AA, AB and BB genotypes for CASTI and CAST5 loci, and AA, BB, CC, AB, AC and BC genotypes for CAST10 locus in Angus bulls. In this population, this locus didn‘t show Hardy-Weinberg equilibrium. This confirmed that factors leading to disequilibrium, especially selection, may affect into

Slovak J. Anim. Sci., 45, 2012 (1): 1-6 genetic structure of the population. Based on our results, the investigated population showed a good degree of genotypic variability for the CAST gene. This may be explained by the conservation and breeding strategies, which have been carried out. The calpain gene was investigated as a potential candidate gene for quantitative trait locus (QTL) affecting meat tenderness (Chung et al., 1999). Under the SSCP analysis, three different patterns (G1, G2 and G3) were separated by electrophoresis on nondenaturing polyacrylamide gel. Genotype frequencies for G1, G2 and G3 genotypes were 8.2, 89.2, and 2.7 %, respectively. These results were similar to those obtained by Tahmoorespour et al. (2006), where they found three genotypes (AA, AB, and BB) in Baluchi sheep. In contrast to our result Nassiry et al. (2007) found two genotypes (AA, and AB) in Kurdi sheep. In myostatin locus, all samples were digested by HaeIII enzyme and showed the mm genotype. As a result, all of them were monomorphic. On the contrary Soufy et al. (2009 a and b) observed polymorphism for MSTN gene in Sanjabi Sheep and native kermanian cattle. This inconsistency may be ascribed to breed differences, population and sampling size, environmental factors, mating strategies, geographical position effect and frequency distribution of genetic variants. Although myostatin locus was monomorphic in the herd, but results showed acceptable polymorphism for calpastatin and calpain loci, which may open interesting prospects for future selection programmes, especially using marker-assisted selection for improving weight gain and meat quality. Furthermore, results showed that PCR-RFLP and PCR-SSCP techniques are appropriate tools for screening CAST and CAPN loci in sheep breeds. This was one of the first studies on polymorphism of calpastatin and calpain loci in Dalagh sheep. Due to lack of suitable phenotypic records it was not possible to observe association between different genotypes and animal production. Hence, detected polymorphisms and assumed associations of genetic variation with meat production and tenderness may help to find the effective genotypes of Dalagh sheep for such economic traits.

CONCLUSION The goal of this study was to determine genetic polymorphism of calpastatin (CAST), calpain (CAPN) and myostatin (MSTN) genes in Dalagh sheep. These results open up interesting prospects for future selection programmes, especially marker assisted selection. Results also confirmed that PCR-RFLP and PCR-SSCP are appropriate tools for evaluating genetic variability.

Slovak J. Anim. Sci., 45, 2012 (1): 1-6 ACKNOWLEDGMENT This work was financially supported by the Jahade-Agriculture, (Golestan, and I.R. Iran). The authors also acknowledge the staffs of Shirang Research Station for their help in collection of blood samples.

REFERENCES ARIF, M. K. – KUCUKTAS, H. – DUNHAM, R. A. – Liu. Z. 2002. Molecular characterization and differential expression of the myostatin gene in channel catfish (Ictalurus punctatus). Bioch. Biophys. Acta, vol, 157(5), 2002, p. 99-107. ARTHUR, P. F. 1995. Double muscling in cattle: A review. Aust. J. Agric. Res., vol. 46, 1995, p. 14931515. BENBOUZA, H. – JACQUEMIN, J. M. – BAUDIN, J. P. – MERGEAI, G. 2006. Optimization of a reliable, fast, cheap and sensitive silver staining method to detect SSR markers in polyacrylamide gels. Biotechnol. Agron. Soc. Environ., vol. 10(2), 2006, p. 77-81. CASAS, E. – KEELE, J. W. – SHACKELFORD, S. D. – KOOHMARAIE, M. – SONSTEGARD, T. S. – SMITH, T. P. L. – KAPPES, S. M. – STONE, R. T. 1998. Association of the muscle hypertrophy locus with carcass traits in beef cattle. J. Anim. Sci., vol. 76, 1998, p. 468-473. CHUNG, H. Y. – DAVIS, M. E. – HINES, H. C. – WULF, D. M. 1999. Effect of the calpain proteolysis and calpain genotype on meat tenderness of Angus Bulls. Ohio State University Research and Reviews: Beef and sheep. EFTEKHARI SHAHROUDI, F. – NASSIRY, M. R. – VALIZADEH, R. – HERAVI MOUSSAVI, A. – TAHMOORESPUR, M. – GHIASI, H. 2006. Genetic polymorphism at MTNR1A, CAST and CAPN loci in Iranian Karakul sheep. Iranian. J. Biotech., vol. 4(2), 2006, p.117-122. GAO,Y. – ZHANG, R. – HU, X. – LI, N. 2007. Application of genomic technologies to the improvement of meat quality of farm animals. Meat Sci., vol. 77, 2007, p. 36-45. GOLL, D. E. – THOMPSON, V. F. – LI, H. – WIE, W – CONG, J. 2003. The calpain system. Physio Rev., vol. 83, 2003, p. 731-801. HANSET, R. 1991. The major gene of muscular hypertrophy in the Belgian Blue cattle breed. In: “Breeding for Disease Resistance in Farm Animals” (ed. A. Owen). Commonwealth Agri. Bureaux International, London, UK, 1991, p. 467-478. HUFF-LONERGAN, E. – MITSUHASHI, T. – BEEKMAN, D. D. – PARRISH, F. C. – OLSON, D. G. – ROBSON, R. M. 1996. Proteolysis of specific

Original paper muscle structural proteins by m-calpain at low pH and temperature is similar to degradation in postmortem bovine muscle. J. Anim. Sci., vol. 74, 1996, p. 9931008. KAMBADUR, R. – SHARMA, M. – SMITH, T. P. L. – BASS, J. J. 1997. Mutations in myostatin (GDF8) in double muscled Belgian Blue and Piedmontese cattle. Genet. Res., vol. 7, 1997, p. 910-915. KOCWIN, M. P. – KURYL, J. 2003. The effect of interaction between genotype at loci CAST, RYRI and RN on pig carcass quality and pork traits. Anim. Sci. Pap. Rep., vol. 21, 2003, p. 61-65. MCPHERRON, A. C. – LAWLER, A. M. – LEE, S. J. 1997. Regulation of skeletal muscle mass in mice by a new TGF-b superfamily member. Nature, vol. 387, 1997, p. 83-90 MILLER, S. A. – DYKES, D. D. – POLESKY, H. F. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucl. Acid. Res., vol. 16(3), 1988, p. 1215. NASSIRY, M. R. – EFTEKHARI SHAHROUDI, F. – TAHMOORESPUR, M. – JAVADMANESH, A. 2007. Genetic variability and population structure in beta-lactoglobulin, calpastatin and calpain loci in Iranian Kurdi sheep. Pak. J. Biol. Sci., vol. 10(7), 2007, p. 1062-1067. PALMER, B. R. – MORTON, J. D. – ROBERT, N. – ILIAN, M. A. – BICKERSTAFFRE, R. N. 1999. Marker –assisted selection for meat quality and the ovine calpastatin gene. Proc. NZ Soc. Anim. Prod., vol. 59, 1999, p. 266-268. PALMER, B. R. – ROBERT, N. – KENT, M. P. 1997. A candidate gene approach to animal quality traits. Proc. NZ Soc. Anim. Prod., vol. 57, 1997, p. 294-296. SAADATNOORI , M. - SIAHMANSOOR, S. 1990. Sheep husbandry and management. forthed. Ashrafi publication, Tehran. 5th Edition. P. 494. SHAHIN, K. A. – BERG R. T. 1985. Growth patterns of muscle, fat and bone, and carcass composition of double muscled and normal cattle. Can. J. Anim. Sci., vol. 65, 1985, p. 279-293. SONSTEGARD, T. S. – Rohrer, G. A. – Smith, T. P. L. 1998. Myostatin maps to porcine chromosome 15 by linkage and physical analyses. Anim. Genet., vol. 29, 1998, p. 19-22. SOUFY, B. – SHOJAEIAN, K. – MOHAMMAD ABADI, M. – BAGHIZADEH, A. – MOHAMMADI, A. 2009a. Myostatin gene polymorphism in native kermanian cattle using molecular marker. The 6th National Biotechnology Congress of Iran 13-15 Aug, Milad Tower Conference Hall, Tehran-Iran. 2009a, 5p. SOUFY, B. – MOHAMMAD ABADI, M. R. – SHOJAEIAN, K. – BAGHIZADEH, A. – FERASATY, S. – ASKARI, N. – DAYANI, O. 2009b. Evaluation of myostatin gene polymorphism in Sanjabi sheep

Original paper by PCR-RFLP method. Anim. Sci. Reserches.Tabriz Univ., vol. 19 (1), 2009b, p. 81-89. TAHMOORESPUR, M. – NASSIRY, M. R. – JAVADMANESH, A. 2006. Calpastatin gene polymorphism in Baluchi and Kurdi sheep by SSCP. 1st Agric Biotechnol Conf., 23-24 July. 2006, p. 51. TIMOTY, P. L., – LOPEZ-CORRALES, N. L., – KAPPES, S.M. – SONSTEGARD, T. S. 1997.

Slovak J. Anim. Sci., 45, 2012 (1): 1-6 Myostatin maps to the interval containing the bovine mh locus. Mamm. Genome, 8: 742-744. YEH, F. C. – YANG, R. – BOYLE, T. J. – YE, Z. – XIYAN, J. M. 2000. POPGENE 32, Microsoft Window-based Freeware for Population Genetic Analysis, Version 1.32. Molecular Biology and Biotechnology Centre, University of Alberta: Edmonton, Canada.

Docosahexaenoic acid and alpha-tocopherol improve sperm cryosurvival in goat

M. Ansari1*, A. Towhidi1, M. Moradi Shahrbabak1, M. Bahreini2 Department of Animal Science, Faculty of Agricultural Science and Engineering, University of Tehran, Karaj, Iran Animal breeding center of Iran, Karaj, Iran

1 2

ABSTRACT The aim of this study was to investigate the effect of adding a polyunsaturated fatty acid source (n-3 fatty acids), accompanied by alpha-tocopherol, to extender on freezing ability and fatty acid (FA) composition of goat sperm. Mahabadi bucks were used in this research. In first experiment, the pooled semen was divided into 12 groups, in a 3×4 factorial design including four levels of n-3 FA (0, 0.1, 1 and 10 ng ml-1) and three levels of vitamin E (VE) (0, 0.1 and 0.2 mmol). The percentage of motility, progressive motility and viability of semen were evaluated. The treatment of 0.2 mmol VE and 10 ng ml-1 n-3 FA had the best semen quality in comparison to the control and the other treated groups, after thawing. The second trial was conducted to determine fatty acid content of sperm after the treatment with 0.2 mmol VE and 10 ng ml-1 n-3 FA and the treatment without VE and FA. Adding FA to the extender led to an increase in Docosahexaenoic acid (n-3) level before freezing (P≤0.01). The overall proportion of n-3 FA to n-6 FA was significantly higher in the FA group than in the other group (P≤0.01) before freezing, and the ratio of polyunsaturated fatty acids (PUFA) to saturated fatty acids (SFA) was higher (P≤0.05) in the FA group before freezing than that after thawing. Results suggest that the addition of n-3 FA with an antioxidant could improve freezing ability of goat semen via changing the lipid composition of sperm cell. Key words: goat; sperm; freezing; N-3 fatty acids; vitamin E

INTRODUCTION Cryopreservation as a technique for storage of goat semen has advantages but thawing and freezing induce the detrimental effects in terms of sperm ultrastructural, biochemical and functional damage (Watson, 2000), resulting in a reduction of motility, membrane integrity and fertilizing ability (Purdy, 2006). The purpose of a freezing extender is to supply a source of energy for sperm cells, and protect them from temperature-related damage and maintain a suitable environment for the spermatozoa to survive temporarily. Currently, egg yolk is used as a common component of semen cryopreservation extenders in domestic animals. It has been shown to have a beneficial effect on sperm cryopreservation as a protector of the plasma membrane

and acrosome against temperature-related injury because of the presence of phospholipids, in association with others components (Purdy, 2006). However, the dilution of goat semen into extenders containing egg yolk or milk can have a detrimental effect on the quality of the sperm cells during freezing and thawing, due to the presence of egg yolk-coagulating enzyme (EYCE) and bulbourethral gland secretion glycoprotein (BUSgp60), respectively (Pellicer-Rubio and Combarnous, 1998; Sias et al., 2005). Moreover, egg yolk can present a major risk of contamination (Bousseau et al., 1998). Hence commercial extenders with soybean lecithin as an egg yolk substitute have recently become available for freezing animal semen (Gil et al., 2003; Van Wagtendonkde Leeuw et al., 2000). Lecithin (phosphatidyl choline) is a major phospholipid in sperm cell membrane that

*Correspondence: E-mail: ansari9980@gmail.com M. Ansari, �� Department of Animal Science, Faculty of Agricultural Science and Engineering, University of Tehran, P.O.Box 4111, Karaj, Iran Tel.: 00989121404081 Fax: 00982612246752

Received: September 28, 2011 Accepted: March 28, 2012

Original paper plays an important role in sperm viability. The plasma membrane is a highly dynamic structure that regulates not only extracellular exchanges, but the process of fertilization as well (Flesch and Gadella, 2000). Differences in lipid composition of the sperm plasma membrane is a key factor in the differing freezing ability of sperm (Parks and Lynch, 1992). In many mammalian species, up to 60 % of the total fatty acids are long-chain polyunsaturated fatty acids (LCPUFA) of the n-3 series (Poulos et al., 1973). This specific lipid composition confers a greater fluidity and flexibility on the plasma membrane due to the presence of the many double bonds. This specific physical change in characteristics may give membranes a better resistance to damages arising from the formation of ice crystals (Maldjian et al., 2005). High concen¬tration of Docosahexaenoic acid (DHA) in both semen and sperm has been suggested to be positively associated with sperm motility in humans (Poulos et al., 1973; Rooke et al., 2001). Docosahexaenoic acid may contribute to the membrane fluidity that is necessary for the motility of sperm tails (Bwanga, 1991). Indeed, it was found that the sperm obtained from asthenozoospermic men had lower levels of DHA when compared with sperm from normozoospermic men (Poulos et al., 1973). In regards to cryotolerance, the spermatozoa collected from African elephants (Loxodontia africana) had higher levels of membrane docosahexaenoic acid (22:6, n-3) and docosapantaenoic acid (22:5, n-3 and n-6) as compared to spermatozoa collected from Asian male elephants (Elephas maximus). Interestingly, African elephant spermatozoa can be cryogenically frozen while the same protocols have failed to cryogenically freeze spermatozoa collected from Asian elephant (Swain and Miller, 2000). Therefore, the objective of current study was to evaluate the effects of adding different levels of n-3 fatty acid and vitamin E to a free egg-yolk extender on freezing ability of goat sperm.

Material and methods Animals and location Six three-year old Mahabadi bucks with average weight of 65±2.52 kg from the goat flock of the department of animal Science, university of Tehran, in Karaj (35°48´N, 51°2´E) were used during autumn 2008. Semen collection Semen samples were collected using an artificial vagina from the mentioned six bucks for 4 weeks (total ejaculations = 24). The collected samples of raw semen were transferred to the laboratory of the Animal Breeding Center of Iran, and kept in a water bath at 34°C. Samples

Slovak J. Anim. Sci., 45, 2012 (1): 7-13 were evaluated using a phase-contrast microscope at 400 x and those with motility value ≥70% were chosen. Then, the proper samples were pooled and used in each week (each sample was thawed 48 hours after freezing). Experimental design In the first experiment, pooled semen was extended using Bioxcell® extender with different levels of n3 FA (Viva Pharmaceutical Inc, Canada) (0, 0.1, 1 and 10 ng ml-1) and VE (Sigma Chemical Co., St. Louis, MO, USA) solved in ethanol (% 0.05) (0 , 0.1 and 0.2 mmol). The extended semen samples were placed into tubes and incubated at 37°C for 15 min for uptaking fatty acids and vitamin E by spermatozoa. Five samples of fresh and frozen-thawed semen from each treatment were used for semen quality evaluation. The treated group with 0.2 mmol VE and 10 ng ml-1 n-3 FA showed the best quality after thawing compared to the control and the other treated groups, so this treatment along with control (without FA and VE) were chosen for the third trial. In this experiment, fatty acid composition of sperm in two groups was determined before freezing and after thawing. Freezing and thawing process Diluted semen was cooled down to 4–5°C over 2 h and then frozen in straws. A Styrofoam box containing liquid nitrogen was used to cryopreserve the semen samples. The rack containing the samples was placed into the liquid nitrogen vapor at a height of 4 cm above the liquid for 8 min, after that, the straws were plunged in liquid nitrogen. The straws were thawed by placing them in a 37°C water bath for 30s (Purdy, 2006). Semen evaluation a) Post-thawed sperm motility and progressive motility A drop of fresh and frozen-thawed semen was placed on a pre-warmed slide and covered with a coverslip. Motility and progressive motility percentages were assessed under a phase-contrast microscope at 200 x magnification. Recovery rate of spermatozoa was also calculated (Hafez and Hafez, 2000). b) Sperm viability and abnormality A small drop of fresh or frozen-thawed semen was placed on a pre-warmed slide and mixed with a relatively larger drop of the supravital stain [1 % (w/v) eosin B, 5 % (w/v) nigrosin in 3 % tri-sodium. Three hundred and thirty three spermatozoa in ten view fields (thirty three spermatozoa per view field) were counted to detect unstained heads of spermatozoa (live) and/or stained/partially stained heads of spermatozoa (dead) under a magnification 400x. In this slide spermatozoa were examined for the following abnormal morphologies: detached head, abaxial head, malformed head, bent tail and coiled tail (Evans et al., 1989).

Slovak J. Anim. Sci., 45, 2012 (1): 7-13

Original paper

Fatty acid composition of sperm Fresh and frozen-thawed samples were diluted with an equal volume of 0.85 % (wt/vol) NaCl followed by centrifugation at 1000 g for 10 min at room temperature to separate the seminal plasma from the cell pellet (Sariozkan et al., 2010). The upper diluted plasma layer was transferred into a fresh test tube and the cell pellet was washed with 1 ml of 0.85 % (wt/vol) NaCl and recentrifuged as described above. The sperm cell pellet was resuspended in 2 ml of 0.85 % (wt/vol) NaCl. The resulting sperm pellet was washed twice with saline (Surai et al., 2000). The total lipid was extracted from the sperm after homogenization in a suitable excess of chloroform–methanol (2:1, v/v) (Folch et al., 1957). Trans-methylation of these sample was performed using Metcalf´ method (Metcalf et al., 1996). The resultant fatty acid methyl esters were analyzed by gas chromatography (HP6890 with FID detector and autosampler HP7683, Hewlett Packard,Wilmington, DE, USA) using a capillary column system Carbowax, 30 m × 0.25 mm in diameter, 0.25 µm film thickness (Alltech Ltd., Carnforth, Lancashire, UK). Statistical analysis The results were expressed as mean± SEM. Data were analyzed using GLM procedure of SAS 9.1 (SAS Institute, Cary, NC, USA). LSMean test was used for treatments´ mean comparisons. Differences with values of P<0.05 were considered statistically significant.

Results and discussion First experiment The mean percentages of post-thawed sperm characteristics of different groups are shown in table 1. a) Motility The effect of n-3 FA, VE (main effects) and their interaction (our twelve treatments were shown in table 1) on sperm motility percentage was significant. The MOT percentage of sperm was 44.16±0.16, 45.21±0.16 and 48.54±0.16 for 0, 0.1 and 0.2 mmol VE, respectively and the latter level had significantly highest value (P≤0.05). The MOT percentage was 43.88±0.79, 46.11±0.79, 45.27±0.79 and 48.61±0.79 for 0, 0.1, 1, and 10 ng.ml-1 FA, respectively and the latter level had significantly highest value (P≤0.05). The motility percentage was significantly higher in 0.1 FA and 0.2 VE and 10 ng ml-1 FA, 0.2 mmol VE groups than other treatment groups. b) Progressive motility The effect of n-3 FA, VE and their interaction on sperm progressive motility was significant. The PMOT percentage of sperm was 36.45± 0.59, 35.83± 0.59 and 40.21± 0.59 for 0, 0.1 and 0.2 mmol VE, respectively and the latter level had significantly highest value (P≤0.001). The PMOT percentage was 35.83±0.68, 37.77±0.68, 36.94± 0.68 and 39.44±0.68 for 0, 0.1, 1, and 10 ng.ml-1 FA, respectively and the latter level had

Table 1: In vitro characteristics of post-thawed sperm for different levels of n-3 FA and vitamin E in goat

Treatments

Semen Characteristics (%)

Motility

Progressively motility

Viability

Abnormality

Recovery rate

(SEM=1.95)

(SEM =0.84)

(SEM =0.72)

(SEM = 0.31)

(SEM = 3.01)

F0V (without Ethanol)

6.26

70.33a

F0V0 (with Ethanol )

bcd

48.37

5.31

20.79d

F0.1V0

15c

47.97cd

5.55

21.43cd

F1V0

16.66

11.66

41.71

5.24

20.95d

F10V0

21.66c

15de

41.40f

5.85

30.15c

F0V0.1

16.66

47.37

6.05

23.33cd

F0.1V0.1

16.66c

10f

44.44e

6.36

23.33cd

F1V0.1

11.66

43.85

5.24

27.77cd

F10V0.1

21.66c

11.66ef

50.52a

5.25

30c

F0V0.2

18.33

43.93

5.55

26.19cd

F0.1V0.2

31.66b

21.66c

49.19abc

5.65

44.13b

F1V0.2

21.66

16.66

45.45

6.36

30.95c

F10V0.2

33.33b

26.66b

50.42ab

5.35

46.35b

a,b,c,) Values in each column that do not have any common letter are significantly (P≤ 0.05) different 1. Fatty acid and vitamin amount in base extender

1 0

10f c

Original paper

Slovak J. Anim. Sci., 45, 2012 (1): 7-13

Table 2: Fatty acid composition of spermatozoa lipid from goat semen in the control group (without FA) and n-3 FA group (with FA).

Fatty acid

Before freezing

After thawing

SEM

Without FA

With FA

Without FA

With FA

C14:01

7.48a

6.64b

7.54a

7.74a

0.22

C16:0

38.14a

36.62b

37.36b

37.85b

0.58

C18:0

22.50

22.28

23.46

23.44

0.72

C18:1

9.02c

9.95a

9.17bc

9.33b

0.33

C18:2

16.5

15.84

C18:3

0.37a

0.73b

EPA2

0.29

DHA3

6.7b

n-3

7.36b

n-6

15.34

15.06

0.72

0.19a

0.22a

0.12

0.27

minor

0.16

8.12a

5.95c

5.24c

0.16

9.12a

6.14c

6.44c

0.16

16.5a

15.84a

15.34b

15.06b

0.72

Ratio of n-3/n-6

0.44

0.57

0.40

0.43

0.02

PUFA4

22.86b

24.96a

21.48b

20.52b

0.84

SFA

68.12

65.54

68.36

69.03

1.27

PUFA/SFA

0.33b

0.38a

0.31c

0.30c

0.009

MUFA6

9.02c

9.95a

9.17bc

9.33b

0.33

abc) Values in each row that do not have any common letter are significantly (P≤ 0.05) different 1) The numbers after C show the number of carbon and number of double bond between two carbons in the structure of fatty acid, respectively. 2) Eicosapantaenoic acid. 3) Docosahexaenic acid. 4) Polyunsaturated fatty acid. 5) Saturated fatty acid. 6) Monounsaturated fatty acid.

significantly highest value (P≤0.05). The progressive motility percentage was significantly higher in 10 ng.ml-1 FA, 0.2 mmol VE group than in other treatment groups. c) Abnormality There were no significant differences between the levels of VE, n-3 FA and their interactions. d) Viability The effect of n-3 FA, VE and their interaction on sperm viability percentage was significant. The viability percentage of sperm was 59.88±0.25, 62.22±0.25 and 61.70±0.25 for 0, 0.1 and 0.2 mmol VE, respectively and the former level had significantly lowest value (P≤0.001). The viability percentage was 61.45±0.29, 61.57±0.29, 60.01±0.29 and 62.02±0.29 for 0, 0.1, 1, and 10 ng ml-1 FA, respectively and 1 ng ml-1 FA group had significantly lowest value (P≤0.05). The viability percentage was significantly lower in 1 and 10 ng ml-1 FA with 0 mmol of VE groups than in other treatment groups. e) Recovery rate The effect of n-3 FA, VE and their interaction on sperm recovery rate was significant. The recovery rate of sperm 23.33± 1.51, 26.11± 1.51 and 36.9± 1.51 for 0, 0.1 and 0.2 mmol VE, respectively and the latter level had

significantly highest value (P≤0.001). The recovery rate was 23.44±1.74, 29.63±1.74, 26.56±1.74 and 35.5±1.74 for 0, 0.1, 1, and 10 ng ml-1 FA, respectively and the latter level had significantly highest value (P≤0.05). The 0.1 and 10 ng ml-1 FA with 0.2 mmol VE level had significantly higher recovery rates than the other treatment groups. Second experiment The percentage of fatty acids of sperm lipids, n3 and n-6 FA percentages, Monounsaturated Fatty Acids (MUFA) percentage, n-3/n-6 ratio and PUFA/SFA ratio are shown in table 2. The DHA percentage was significantly higher in the FA group before freezing and after thawing with comparison to the group without FA. The ratio of n-3/n-6 decreased after thawing in both groups but it was higher in the FA group before freezing. In the first experiment, adding n-3 FA and VE as a biological antioxidant improved motility parameters of frozen-thawed sperm. Addition of palmitic acid or linoleic acid into the ram semen´s extender have significantly increased motility and viability of post-thawed sperm, in vitro fertility and in vitro blastocyst production (Badr et al., 2004). In contrast, in the other experiment, vitamin A, cod liver and flaxseed oil as a n-3 fatty acid source

Slovak J. Anim. Sci., 45, 2012 (1): 7-13 loaded on cyclodextrin could not improve post-thawed sperm quality in bull (Amorim et al., 2008). In the current research, the level of DHA, n-3 FA, ratio of n-3/n-6 and PUFA in group FA was higher than the group without FA that reflects the effective incorporation of n-3 FA into sperm cell membrane. Before freezing, docosahexaenoic acid percentage was higher in the FA group (10 ng ml-1 FA, 0.2 mmol VE) than that in the group without FA (0 ng ml-1 FA, 0 mmol VE) and it decreased significantly in both groups after thawing. Possible reasons of this decrease could be as follows: lipid peroxidation has been reported as being enhanced during cryopreservation of spermatozoa and this could account to some extent for the decrease in LCPUFA observed in this experiment. Another plausible explanation for the decrease in the proportion of polyunsaturated fatty acids could be an increase in the amount of saturated fatty acids taken up or passively bound to the sperm membranes which would cause a decrease in the proportion of the LCPUFA (Maldjian et al., 2005). The positive effect of n-3 FA on sperm characteristics is probably related to an increase in DHA proportion in sperm membrane lipids. Spermatozoa from asthenozoospermic, oligozoospermic and oligoasthenozoospermic men had lower levels of docosahexaenoic acid than those from normozoospermic men. In addition, a significant positive correlation has been observed between DHA and sperm motility, sperm concentration and normal sperm morphology (Aksoy et al., 2006). The supplemented n-3 FA probably enhances PUFA proportion in sperm head and tail membrane which improves fluidity that is necessary for sperm motility. Furthermore, analysis of fatty acids from the head and tail of monkey sperm showed that DHA composed 1.1 and 19.6 percent of total fatty acids of head and tail, respectively; consequently, 99 % of sperm DHA is in the tail. This difference between lipid composition of the head and tail may be necessary for specific functions of sperm since fat plays a major role in integrity, fluidity, stability, and permeability of plasma membrane. Therefore, high proportion of DHA in the sperm tail may be necessary because they increase sperm motility via increasing membrane fluidity in sperm tail and thus, improving sperm tail flexibility required for motility (Connor et al., 1998). In addition, improved fluidity and flexibility increases a tolerance to freezing and preventing of sperm cell membrane from disintegrating by ice crystal formation during freezing process. It is assumed, that PUFA plays a major role in cell movements, lipid metabolism, and sperm ability to attach and penetrate the oocyte. Decreasing in DHA proportion of sperm phospholipids is accompanied by a decrease in sperm number and motility in aged bull ejaculations (Kelso et al., 1997). Comparison of PUFA composition in plasma and spermatozoa from infertile

Original paper men with idiopathic oligoasthenoteratozoospermia and normal men showed that the n-3 FA concentration was lower in plasma and spermatozoa from infertile men in comparison to normal men (Safarinejad et al., 2010). Experiments with rooster (Cerolini et al., 2006), boar (Rooke et al., 2001) goat (Dolatpanah et al., 2008) and turkey (Zaniboni et al., 2006) showed that inclusion of fish oil in the diet increased the number of progressively motile sperm. These reports certify the results of the current study. Even though using ethanol as a solvent for adding α-tocopherol and α-tocopherol succinate to equine semen extender had no harmful effect on sperm parameters (Almeida and Ball., 2005) but, in our study sperm parameters in positive control group in comparison with the negative control (ethanol-free) group were significantly decreased. It may be assumed that ethanol can have destructive effect on the sperm samples in this experiment. In fact, the observed loss of motility, progressive motility and viability may be the result of an interaction between damage due to freezing and due to the use of ethanol. Using other soluble substances (e.g. cyclodextrine) instead of ethanol during the semen freezing process is suggested (Brooks, 1990); which is, however in contrast with the oocyte-related experiments. However, it should be mentioned that the use of fatty acid and vitamin E can compensate to some extent for the destructive effects of ethanol. In the current study, sperm motility, progressive motility and viability were affected by different levels of VE. Results of this study were consistent with the previous observations where supplementation of the extender with α-tocopherol prevented oxidative damage and thus improved sperm motility (Breininger et al., 2005; Jeong et al., 2009). Extracellular antioxidants are extremely important for the protection of mammalian spermatozoa against oxidative stress because the cytoplasmic extrusion associated with sperm morphogenesis depletes these cells of their internal store of antioxidant enzymes (Jeong et al., 2009). Among the antioxidants, especially α-tocopherol can break the covalent links that reactive oxygen species (ROS) have formed between fatty acid side chains in membrane lipids. This result indicates that α-tocopherol plays an important role in reducing membrane damage caused by excessive ROS production during cryopreservation. Using egg yolk enriched in n-3 fatty acids without any antioxidant in diluents, failed to improve the quality of sperm following cryopreservation (Maldjian et al., 2005), but using FA accompanied by vitamin E in the present study increased post-thawed sperm quality. Therefore, for seeing the positive effects of n-3 FA, inclusion of an antioxidant into extender is useful. In conclusion, the present study showed that the adding n-3 FA accompanied by vitamin E to Bioxcell extender

Original paper increased post-thaw sperm quality in goat. Improved characteristics of frozen-thawed sperm may be due to effective incorporation of DHA into the cell membrane before freezing and that has protective effects on sperm membrane.

References AKSOY, Y. –�� AKSOY, �� H. –�� ALTINKAYNAK, �� K. – �� AYDIN, H. R. –�� OZKAN, �� A. 2006. Sperm fatty acid composition in subfertile men. Prostaglandins, Leukotrienes and Essential Fatty Acids, 2006, vol.75, p. 75-79. ALMEIDA, J. �� – BALL. �� B. A. 2005. Effect of [alpha]tocopherol and tocopherol succinate on lipid peroxidation in equine spermatozoa. Journal of Animal Reproduction Science, 2005, vol. 87, p. 321337. AMORIM, E. A. M. �� – �� GRAHAM, J. K. �� – �� SPIZZIRI, B. – MEYERS, �� M. –�� AMORIM, �� L. S. �� – TORRES, �� C. A. A. 2008. The effect of adding cholesterol, vitamin A, cod liver or flax oil loaded cyclodextrin on bull sperm cryosurvival. 16th International congress on animal reproduction, 2008, 29-P006. BADR, M. A. �� – ABDEL-MALEK, �� M. G. �� – SHAKER, �� M. H. 2004. Influence of some fatty acids and cholesterol addition to semen extender on freezability and in vitro fertilizing potentials of ram spermatozoa. Assiut Veterinary Medical Journal, 2004, vol. 50, p. 304-318. BOUUSSEAU, S. �� – �� BRILLARD, J. P. –�� MARQUANTLE GUIENNE, B. –�� GUERIN, �� B. �� – CAMUS, �� A. – �� LECHAT, M. 1998. Comparison of bacteriological qualities of various egg yolk sources and the in vitro and in vivo fertilizing potential of bovine semen frozen in egg yolk or lecithin based diluents. Theriogenology, 1998, vol. 50, p. 699-706. BREININGER, E. �� – �� BEORLEGUI, N. B. �� – �� OFLAHERTY, C. M. –�� BECONI, �� M. T. 2005. Alpha-tocopherol improves biochemical and dynamic parameters in cryopreserved boar semen. Theriogenology, 2005, vol. 63, p. 2126-2135. BROOK, D. E. 1990. Acid-Soluble Phosphorus Compounds in Mammalian Semen. Biochemistry Journal, 1990, vol. 118, p. 851-857. BWANGA, C. O. 1991. Cryopreservation of boar semen. Acta veterinaria Scandinavica I: a literature review, 1991, vol. 32, p. 431-453. CEROLINI, S. �� – �� ANIBONI, L. –�� MALDJIAN, �� A. – GLIOZZI, �� T. 2006. Effect of docosahexaenoic acid and [alpha]-tocopherol enrichment in chicken sperm on semen quality, sperm lipid composition and susceptibility to peroxidation. Theriogenology, 2006,

Slovak J. Anim. Sci., 45, 2012 (1): 7-13 vol. 66, p. 877-886. CONNOR, W. E. �� – �� LIN, D. S. �� – WOLF, �� D. P. ��– ALEXANDER, M. 1998. Uneven distribution of desmosterol and docosahexaenoic acid in the heads and tails of monkey sperm. Lipid Research, 1998, vol. 39, p. 1404-1411. DOLATPANAH, M. B. �� – TOWHIDI, �� A. –�� FARSHAD, �� A. –�� RAHIDI, �� A. �� – REZAYAZDI, �� A. 2008. Effect of dietary fish oil on semen quality of goats. Asian-Aust. Animal science, 2008,vol. 21, p. 29-34. EVANS, G. – Maxwell, W. M. S. 1989. Salmon‘s artificial insemination of sheep and goat. University Press, Sydney, NSW, Australia, 1989, p. 208. FLESH, F. M. �� – �� GADELLA, B. M. 2000. Dynamics of the mammalian sperm plasma membrane in the process of fertilization. Biochimica et Biophysica Acta (BBA) - Reviews on Biomembranes, 2008, vol. 1469, 2000, p. 197-235. FOLCH, J. �� – LEES, �� M. �� – STANLEY, �� G. 1957. A Simple method for the isolation and purification of total lipides from animal tissues. Biology chemistry, 1957, vol. 226, p. 497-509. GILL, J. –�� LUNDEHEIM, �� N. �� – SODERQUIST, �� L. – RODRIGUEZ-MARTINEZ, �� H. 2003. Influence of extender, temperature, and addition of glycerol on post-thaw sperm parameters in ram semen. Theriogenology, 2003, vol. 59, p. 1241-1255. HAFEZ, B. –�� HAFEZ, E. S. E. 2000. Reproduction of farm animals, 7th edn. 2000. Lippincott Williams and Wilkins, Phyladelphia, 2000, P123-210. JEONG, Y. J. –�� KIM, M. K. �� – �� SONG, H. J. –�� KANG, E. J. –�� OCK, �� S. A. –�� MOHANA �� KUMAR, B. S. –�� BALASUBRAMANIAN, RHO, G. J. 2009. Effect of [alpha]-tocopherol supplementation during boar semen cryopreservation on sperm characteristics and expression of apoptosis related genes. Cryobiology, 2009, vol. 58, p.181-189. KELSO, K. A. �� – �� REDPATH, A. �� – �� NOBLE, R. C. –� SPEAKE, B. K. 1997. Lipid and antioxidant changes in spermatozoa and seminal plasma throughout the reproductive period of bulls. Reproduction and Fertility, 1997, vol.109, p. 1-6. MALDJIAN, A. –�� PIZZI, F. –�� GLIOZZI, T. �� – �� CEROLINI, S. –�� PENNY, �� P. –�� NOBLE, �� R. 2005. Changes in sperm quality and lipid composition during cryopreservation of boar semen. Theriogenology, 2005, vol. 63, p. 411-421. METCALF, L. �� – SCHMITZ, �� A. –�� PELKA, �� J. 1996. Rapid preparation of metyl esters from lipid for gas chromatography analysis. Biological chemistry, 1996, vol. 38, p. 514-515. SWAIN, J. E. – MILLER, J. R. R. 2000. A post cryogenic comparison of membrane fatty acids of elephant spermatozoa. Zoo biology, 2000, vol. 19, p. 461-473. PARK, J. E. – LYNCH, D. V. 1992. Lipid composition and thermotropic phase behavior of boar, bull,

Slovak J. Anim. Sci., 45, 2012 (1): 7-13 stallion, and rooster sperm membranes. Cryobiology, 1992, vol.29, p. 255-266. PELLICER-RUBIO, M. T. �� – COMBARNOUS, �� Y. 1998. Deterioration of goat spermatozoa in skimmed milkbased extenders as a result of oleic acid released by the bulbourethral lipase BUSgp60. Reproduction and Fertility, 1998, vol. 112, p. 95-105. POULOS, A. –�� DARIN-BENNETT, A. –�� WHITE, L. G. 1973. The phospholipid-bound fatty acids and aldehydes of mammalian spermatozoa. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 1973, vol. 46, p. 541-549. PURDY, P. H. 2006. A review on goat sperm cryopreservation. Small Ruminant Research, 2006, vol. 63, p. 215-225. ROOKE, J. A. –�� SHAO, C. C. –�� SEAKE, B. K. 2001. Effects of feeding tuna oil on the lipid composition of pig spermatozoa and in vitro characteristics of semen. Reproduction, 2001, vol. 121, p. 315-322. SAFARINEJAD, M. R. –�� HOSSEINI, �� S. Y. –�� DADKHAH, F. �� – ASGARI, �� M. A. 2010. Relationship of omega-3 and omega-6 fatty acids with semen characteristics, and anti-oxidant status of seminal plasma: A comparison between fertile and infertile men. Clinical Nutrition, 2010, vol. 29, p. 100-105. SARIOZKAN, S. –�� BUCK, �� M. N. �� – TUNCER, �� P. B. ��– TASDEMIR, U. –�� KINET, H. �� – �� ULUTAS, P. A. 2010. Effects of different extenders and centrifugation/

Original paper washing on postthaw microscopic-oxidative stress parameters and fertilizing ability of Angora buck sperm. Theriogenology, 2010, vol. 73, p. 316-323. SIAS, B. �� – FERRATO, �� F. �� – PELLICER-RUBIO, �� M. T. – FORGERIT, �� Y. �� – GUILLOUT, �� P. �� – �� LEBOEUF, B. –�� CARRIERE, F. 2005. Cloning and seasonal secretion of the pancreatic lipase-related protein2 present in goat seminal plasma. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, 2005, vol. 1686, p. 169-180. SURAI, P. F. �� – �� NOBLE, R. C. �� – �� SPARK, N. H. �� – �� SPEAK, B. K. 2000. Effect of long-term supplementation with arachidonic or docosahexaenoic acids on sperm production in the broiler chicken. Reproduction Fertility, 2000, vol. 120, p. 257-264. VAN WAGTENDONK-DE LEEUW A. M. �� – �� HARING, R. M. �� – �� KAAL-LANSBERGEN, L. M. T. E. �� – �� DEN DAAS, J. H. G. 2000. Fertility results using bovine semen cryopreserved with extenders based on egg yolk and soy bean extract. Theriogenology, 2000, vol. 54, p. 57-67. WATSON, P. F. 2000. The causes of reduced fertility with cryopreserved semen. Animal Reproduction Science, 2000, vol. 60, p. 481-492. ZANIBONI, L. �� – RIZZI, �� R. –�� CEROLINI, �� S. 2006. Combined effect of DHA and [alpha]-tocopherol enrichment on sperm quality and fertility in the turkey. Theriogenology, 2006, vol. 65, p. 1813-1827.

Chemical composition and in vitro digestibility of rice straw treated with Pleurotus ostreatus, Pleurotus pulmonarius and Pleurotus tuber-regium A. Akinfemi1, O. A. Ogunwole2 Faculty of Agriculture, Department of Animal Science, Nasarawa State University, shabu-lafia campus, PMB 135, Lafia, Nasarawa State, Nigeria 2 Department of Animal Science, University of Ibadan, Ibadan, Oyo State, Nigeria 1

ABSTRACT The nutritive value of rice straw treated with three different edible mushrooms: Pleurotus ostreatus (POR), Pleurotus pulmonarius (PPR) and Pleurotus tuber-regium (PTR) were studied through analysis of their proximate composition, mineral composition, crude fibre fractions and in vitro digestibility. Results of the proximate analysis showed an increase in the crude protein from 4.69 % in control to 7.69 % for PTR. Fungal treatment decreased crude fibre from 32.89 % in control to 19.96 % in PTR. Treatment effect on cellulose, neutral detergent fibre, acid detergent fibre and acid detergent lignin was significant. The mineral contents (g.kg-1 DM) showed that PPR had the highest concentration of Ca (11.04) and Mg (5.00), and a significantly highest gas volume was obtained in PPR and the gas production rate constant (C) was not significant. The estimated metabolisable energy (ME) (MJ.kg-1 Dm), organic matter digestibility (OMD %) and short chain fatty acid (SCFA) (µm) ranged from 6.47 (control) to 7.54 (POR), 51.17 (control) to 57.02 (POR) and 0.657 (control) to 0.848 (POR). Treatment effect on the insoluble but degradable fraction (b) was significant ranging from 22 mL in control to 28.33 mL in PTR. It is therefore concluded from this study that treatment of rice straw with different edible mushrooms improved the potential feeding value of the resultant substrate. Therefore, the product of fungal treatment has a good potential as feed resources for ruminants. Key words: rice straw; nutritive value; edible mushroom; proximate composition; mineral composition; in vitro digestibility

INTRODUCTION All over the world, different species of livestock are reared in an attempt to meet man’s demand for animal protein. The high demand for protein occasioned by the increasing population can be tackled, simply by increasing ruminant livestock production. However, the ruminant livestock production in the developing countries, such as Nigeria is underdeveloped because livestock production is still very much at the subsistence level. For the few who are into commercial livestock production are faced with the problem of raising their animals predominantly on forages which are inherently poor in nutritive value. The availability of these forages is also seasonal. Ruminant livestock raised in this region, therefore tend

to reflect the cyclical variation in quantity and quality of these available forages (Bamikole and Babayemi, 2008). Although, ruminants are endowed with the ability to convert low quality feed into high quality protein and utilize feeds from land not suitable for cultivation of crops, however, the utilization of these low quality crop residues is hampered by its low protein content, fibre, digestibility, vitamin and minerals (Akinfemi, 2010a, b). Most of the rice straws generated from rice farming in Nigeria are either fed to livestock, burnt or allowed to rot. Apart from the inherent problem of air pollution caused by burning, it also releases particle matter into the atmosphere. In recent time, there is global concern on human activities such as burning of wastes or refuse with the view of reducing impact of burning

*Correspondence: E-mail: akinfemiabayomi2003@yahoo.com Abayomi Akinfemi , Faculty of Agriculture, Department of Animal Science, Nasarawa State University, shabu-lafia campus, PMB 135, Lafia, Nasarawa State, Nigeria Tel.: 2348033371818

Received: July 11, 2011 Accepted: February 2, 2012

Slovak J. Anim. Sci., 45, 2012 (1): 14-20 on ozone layer depletion. Such global concern, therefore, necessitated alternative option or method of recycling of waste or residues into beneficial products. The possibility of recycling rice straw into value added product therefore comes into view. The aim of this study therefore was to investigate the impact of edible mushrooms on the proximate composition, mineral content and in vitro digestibility of rice straw.

MATERIAL AND METHODS Preparation of samples Dried samples of rice straw were collected from the Teaching and Research Farm, Nasarawa State University, Shabu-Lafia, Nigeria. The materials were milled and oven-treated at 65°C to constant weight for dry matter determination. Fungi

The sporophores of Pleurotus tuber-ragium, Pleurotus pulmonarius and Pleurotus ostreatus growing in the wild were collected from University of Ibadan botanical garden. These were tissue cultured to obtain fungal mycelia (Jonathan and Fasidi, 2001). The pure culture obtained was maintained on plate of potato dextrose agar (PDA). Degradation of rice straw by P. tuber-regium, P. pulmonarius and P. ostreatus Preparation of substrate The jam bottles used for this study were thoroughly washed, dried for 10 min. at 100°C. 25.00 g of the dried milled substrates were weighed separately into a jam bottle and 70 ml of distilled water were added. The bottle was immediately covered with aluminium foil and sterilized in the autoclave at 121°C for 15 min. Each treatment was done in triplicates. Inoculation Each bottle was inoculated at the centre of the substrate with 2, 10.00 mm mycelia disc and covered immediately. They were kept in the dark cupboard in the laboratory at 30°C and 100 % relative humidity (RH). At day 21 of inoculation, the experimental bottles were autoclaved to terminate the mycelia growth. Samples of biodegradation were oven dried to turn to constant weight for chemical analysis and in vitro digestibility. In vitro gas production Rumen fluid with pH of 6.5 was obtained from three West African Dwarf female goats through suction tube via the oesophagus before morning feed. The animals were fed with 40 % concentrate (40 % corn,

Original paper 10 % wheat offal, 10 % palm kernel cake, 20 % groundnut cake, 5 % soybean meal, 10 % brewers grain, 1 % common salt, 3.75 % oyster shell and 0.25 % fishmeal) and 60 % Guinea grass. Incubation was carried out (Menke and Steingass, 1998) in 120 ml calibrated syringes in three batches at 39°C. The inoculums (30 ml) containing cheese cloth strained rumen liquor and buffer (9.8g NaHCO3 + 2.77g Na2HPO4 + 0.57g KCl + 0.47g NaCl + 0.12g MgSO4.7H2O + 0.16g CaCl2. 2H2O was added to 200 mg sample in the syringe in a ratio (1:4 v/v) under continuous flushing with CO2. The gas production was measured at 3, 6, 9, 12, 15, 18, 21, and 24 hrs. After 24 hrs of incubation, 4 ml of NaOH (10M) was added to estimate the amount of methane produced (Fievez et al., 2005). The average volume of gas produced from the blanks was deducted from the total volume of gas produced. Fermentation characteristics were estimated using the equation Y = a + b (1 – ect) (Orskov and McDonald, 1979), where Y = volume of gas produced at time ‘t’, a = intercept (gas produced from the soluble fraction), b = gas production rate constant for the insoluble fraction, (a + b) = final gas produced, C = gas production rate constant for the insoluble fraction (b), t = incubation time. Metabolizable energy (ME, MJ.kg-1 DM) and organic matter digestibility (OMD %) were estimated (Menke and Steingass, 1998) and short chain fatty acids (SCFA) were calculated (Getachew et al., 1999) as follows: ME MJ/kg DM = 2.20 + 0.136 *Gv + 0.057* + 0.0029*CF OMD = 14.88 + 0.88Gv + 0.45CP + 0.651XA; SCFA = 0.0239*Gv – 0.0601; where Gv = net gas production (ml/200mg DM), CP = crude protein, CF = crude fibre and XA = ash. Statistical Analysis Data obtained were subjected to analysis of variance (ANOVA) and significant difference occurred means were separated (Duncan (1955) using Statistical Analysis System (SAS) package.

RESULTS AND DISCUSSION Table 1 shows the result of the proximate composition and cell wall constituents of fungal treated rice straw. Crude fibre content was lowest in PTR and highest in control with significant differences (P<0.05) between control, POR and PTR. The CP content in the untreated group (control) was lower that the fungal treated rice straw. The EE content of 1.66 g.kg-1 DM was significantly (P<0.05) lowest in control and was highest in PTR with a value of 2.33 g.kg-1 DM. Variation in EE content of the fungal treated straw was not significant (P>0.05). Treatment effect on NDF, ADF, ADL and

Original paper

Slovak J. Anim. Sci., 45, 2012 (1): 14-20

cellulose was significant (P>0.05). Treatment effect on hemicelluloses was not significant. The mineral composition of fungal treated rice straw, as shown in Table 2, indicates that the impact of fungal treatment on Na and Cu was not significant (P>0.05). The value recorded for Mg in control was significantly (P<0.05) lower compared with the values recorded for the fungal treated straw. However, the variations in POR, PPR and PTR were not significant (P>0.05). Treatment effect on K, Mn, Fe and P was significant (P<0.05).

The data on gas volume and in vitro gas production characteristics are shown in Table 3; the data on estimated OMD, SCFA and ME are presented in Table 4. Gas volume increased significantly (P<0.05) in all the fungal treated compared with untreated (control). Gas volume at 24 hrs of incubation increased from 30 ml in control to 38 ml in POR. Similar trend of increase in gas volume was recorded at 72 hrs of incubation while gas volume at 48 hrs of incubation increased from 38 ml in control to 54 ml in POR. At all incubation times, POR had the highest gas volume followed by PPR. The estimated

Table 1: Proximate composition and cell wall contents (g.kg-1 DM) of fungal treated rice straw

Component

Control

POR

PPR

PTR

Dry matter

93.00a

86.75b

84.21c

86.00b

0.03

Crude protein

4.69b

7.39a

7.18a

7.69a

0.12

Crude fibre

32.89a

20.96b

21.59b

19.96c

0.17

Ether extract

1.66b

2.09a

2.13a

2.33c

0.07

Ash

11.95

8.26

8.31

9.26

0.003

Nitrogen free extract

48.81b

61.30a

60.79a

61.38a

0.13

Neutral detergent fibre

69.96

61.67

62.79

61.38

0.003

Acid detergent fibre

56.28a

48.12c

49.78b

47.12d

0.003

Acid detergent lignin

12.54

10.06

10.15

9.68

0.003

Cellulose

43.74a

38.06c

39.63b

37.44d

0.005

Hemicellulose

13.68

13.55

13.01

14.26

0.005

Row means with different superscripts differ significantly at (P<0.05), n=3 POR = Pleurotus ostreatus treated rice straw, PPR = Pleurotus pulmonarius treated rice straw, PTR = Pleurotus tuber-reguim treated rice straw, SEM = Standard error of mean

SEM

Table 2: Mineral compositions (mg.kg-1) of major minerals and trace minerals (ppm) of fungal treated rice straw

Component

Control

POR

PPR

PTR

SEM

Major minerals

0.0609a

0.0501c

0.0350b

0.0400d

0.010

0.957

0.789

0.817

0.760

0.002

2.24d

9.20c

11.04a

9.60b

0.020

0.39

1.57

0.61

0.400

0.017

2.35b

4.23a

5.00a

4.30a

0.170

Trace minerals

0.005

0.012

0.014

0.017

0.001

0.45

0.64

0.60

0.47

0.002

0.021b

0.053a

0.050a

0.030b

0.002

0.29

0.43

0.41

0.32

0.002

Slovak J. Anim. Sci., 45, 2012 (1): 14-20

Original paper

OMD was significantly (P<0.05) highest in the fungal treated compared with the control. The value was ranged from 51.17 % in control to 57.02 % in POR. Moreover, estimated SCFA and ME was highest in POR followed by PPR and PTR, and lowest in control. Variations in the gas production rate constant (C) between the control and the fungal treated were not significant values (P>0.05) recorded in the insoluble but fermentable fraction (b) as affected by fungal treatment was significant (P<0.05). However, the values recorded for POR and PTR were not significant (P<0.05). The proximate composition of fungal treated rice straw presented in this study showed that changes in the CP contents compared favourably with those reported for some fungal treated residues favourably with those reported for some fungal treated residues (Akinfemi et al., 2010c). Fungal treatment increased the CP and ash contents of the straw compared with the control. Such apparent increase could be due to the proliferation of fungi during degradation (Farkas, 1979; Belewu and Belewu, 2005). This agrees with the report published by Farkas (1979) and Jacqueline and Viser (1996), who noted

that the extracellular enzymes secreting fungus contain amorphous home and heteropolysaccharides, which are associated with fungal protein. Some authors (Zadrazil, 1993; Belewu and Okhawere, 1998, and Akinfemi et al., 2010b) reported that colonization of substrates by fungal mycelia results in increase in their nutritional values. The variations in the CP content as affected by the fungi used may be attributed to strain differences, length of fermentation and the physiological behaviour of the fungi. All the fungi used were effective in degradation of CF because the hyphae of these fungi were capable of penetrating deep into the cells of the straw. This means that fungi not only grow on the surface of the substrate but also penetrated deep into the substrates. This observation is consistent with such findings (Shoukry et al., 1985), in which CF decreased while CP increased. This trend is consistent with decrease in NDF, ADF and ADL (Albores et al., 2006). Earlier reports (Karunananda et al., 1995) concluded that lignifications of structural polysaccaharides not only inhibited ruminal microbial digestion of polysaccharides by forming 3-D matrix, but

Table 3: Gas volume and in vitro gas production characteristics

Component

Control

POR

PPR

PTR

SEM

C h-1

0.032

0.021

0.105

0.030

0.02

b (ml)

22.00

28.00

25.00

28.33

0.38

Gv 24hrs

30.00d

38.00a

35.00b

33.00c

0.37

Gv 48hrs

38.00

54.00

46.00

47.00

0.33

Gv 72hrs

44.00d

58.00a

56.00b

52.00c

0.33

CH4 (ml)

12.00a

10.00b

9.00c

10.00b

Means along the same row with different superscript are significant (P<0.05), n=3 POR = Pleurotus ostreatus treated rice straw, PPR = Pleurotus pulmonarius treated rice straw, PTR = Pleurotus tuber-reguim treated rice straw, SEM = Standard error of mean

Table 4: Estimated organic matter digestibility (OMD), short chain fatty acid (SCFA) and metabolisable energy (ME) of fungal treated rice straw

Component

Control

POR

Rice Straw PPR

PTR

SEM

ME (MJ.kg-1 DM)

6.49d

7.54a

7.14b

6.86c

0.05

SCFA (ÂľM)

0.657

0.0848

0.776

0.729

0.01

OMD (%)

51.17c

57.02a

54.32b

52.62c

0.30

Original paper also depicted liquefied tissues which formed a physical barrier. This prevented accessibility of highly digestible tissues to the action of hydrolytic enzymes of the rumen microorganisms. Furthermore, the decrease in cellulose, as affected by fungi, in this study suggested that the substrate is acceptable to the degrading fungi. It provides the fungi with the energy source for growth, as reported elsewhere (Rolz et al., 1986). The mineral composition of the treated substrate indicated that Ca and Mg are the most abundant. This was probably contributed by the fungi used. Reports of Onwuka and Akinsoyinu (1988) suggested that the presence of mineral elements in animal is vital for the animalsâ&#x20AC;&#x2122; metabolic process. The results obtained for Ca in this study after fungal treatment were higher than those reported later (Ayodeji, 2005; Ngamsaeng et al., 2006 and Oni et al., 2010). Generally, the major minerals were within the range of value previously reported (McDowell, 1985). The values are adequate to meet the requirement for growth, reproduction and milk in West Africa dwarf sheep and goats (Babayemi, 2006). The calcium and phosphorus ratio were not within the approved 1:1 to 2:1 range recommended (McDowell 1985). All the trace mineral contents in the present study were extremely deficient in the treated straw. This therefore implies that the feed may be fortified with minerals in form of either salt lick or diet inclusion (Babayemi, 2006). The fermentation of the insoluble but degradable fraction (b) increased with fungal treatment, a reflection of the beneficial effect of the fungi used. Furthermore, the high fermentation of the insoluble but degradable fraction (b) observed in the treated straw may possibly be influenced by the carbohydrate fractions readily available to the microbial population (Chumpawadee et al., 2007), a reflection of its improved nutritive value. The cumulative gas volume at 24, 48 and 72 h after incubation was higher in the treated substrates. The gas volumes ranked from the highest to the lowest were as follows: POR, PPR, PTR and control. Menke et al., (1979) suggested that gas volume at 24 h after incubation is in indirect relationship with metabolisable energy in feedstuffs. Others (Sommart et al., 2000) suggested that gas volume is a good parameter to predict digestibility, fermentation of end-product and microbial protein synthesis of the substrate by rumen microbes in the in vitro system. Report elsewhere (Sommart et al., 2000; Nitipot and Sommart, 2003) indicated that in vitro dry matter and organic matter digestibility were shown to have high correlation with gas volume. Gas volume has also shown to have a close relationship with feed intake (Blummel and Becker, 1997) and growth rate (Blummel and Orskov, 1993). The higher gas volume recorded in the treated straw was likely to have been caused by its reduced

Slovak J. Anim. Sci., 45, 2012 (1): 14-20 contents of cell wall, especially ADF and ADL. Lignin has been implicated in rations with depressed digestibility (Van Soest, 1994) due to its effect on lowering the rate of microbial colonization of such high fibre feed (Silva and Orskov, 1988). This implies good digestibility potential for the fungal treated rice straw when harnessed as feed resources for ruminant livestock. Although gas production is a nutritionally wasteful product (Mauricio et al., 1999), but provides a useful basis from which metabolisable energy (ME), organic matter digestibility (OMD) and short chain fatty acids (SCFA) may be predicted. High OMD was observed in POR and PPR suggesting that the microbes in the rumen and animal have high nutrient uptake (Chumpawadee et al., 2007). The higher fibre content in control probably resulted in lower OMD since high NDF and ADL content in feedstuffs result in lower fibre degradation (Van Soest, 1988). In general, tropical crop residues have a large proportion of lignified cell walls with low digestibility. Higher production of gas and the eventual preponderance of SCFA in the fungal treated rice straw probably showed an increased proportion of acetate and butyrate but may mean a decrease in proximate production (Babayemi et al., 2004b). However, since the treated straw yielded better SCFA than the control suggests a potential to make energy available to the ruminants (Babayemi et al., 2006). The estimated ME was found to be comparable to that reported for fungal treated millet stover (Akinfemi et al., 2010a), melon husk (Akinfemi et al., 2010b), sorghum stover (Akinfemi et al., 2010c) and maize cob (Akinfemi et al., 2010d). The in vitro gas production method has been widely used to evaluate the energy value of several classes of feed (Getachew et al. 1998; Getachew et al., 2002; Aiple et al., 1996). Others (Krishnamoothy et al., 1995) suggested that in vitro gas production technique should be considered for estimating ME in tropical feedstuffs. Evaluating ME using in vitro technique reduces cost, time and is comparable to those evaluated by in vivo method.

CONCLUSION This study validated earlier report that in vitro gas production technique can be used to evaluate the potential value of feedstuffs. Besides, fungal treatment of rice straw not only improved the CP contents but also enhanced digestibility: fungal treated rice straw have a good potential as feed resources for ruminant animals and could be used in combination with other feedstuffs. However, more work may be required before application to in vivo studies.

Slovak J. Anim. Sci., 45, 2012 (1): 14-20 REFERENCES AIPLE, K.P. �� –�� STEINGASS, H. �� –�� DROCHNER, W. 1996. Prediction of net energy concent of raw materials and compound feeds for ruminants by different laboratory methods. Arch. Anim. Nutr., 1996, vol. 49, p. 213. AKINFEMI, A. 2010a. Nutritional evaluation of mellon husk incubated with the fungi Pleurotus otreatus and Pleurotus pulmonarius. Africa J. Anim. Biomed Sci., 2010, vol. 2, p. 57-64. AKINFEMI, A. 2010d. Nutritive value and in vitro gas production of fungal treated maize cob. AJFAND, 2010, vol. 10, no 8, p. 2943-2955. AKINFEMI, A. �� –�� JONATHAN, S.G. –�� ADU, O.A. 2010b. Improving the nutritive value of millet stover using biological treatment. Libyan Agriculture Research Centre Journal International, 2010, vol. 1, no. 3, p. 195-201. AKINFEMI, A. �� –�� ADU, O. A. –�� DOHERTY, F. 2010c. Conversion of sorghum stover into animal feed with white-rot-fungi. Pleurotus oestreatus and Pleurotus pulmonarius. African Journal of Biotechnology, 2010, vol. 9, no. 1, p. 1706-1712. ALBORES, S. –�� PIANZZOLA, M. J. –�� SOUBES, M. –�� CERDEIRAS, M. P. 2006. Biodegradation of agro-industrial wastes by Pleurotus spp for its use as ruminant feed. Electronic J. Biotechnol., 2006, vol. 9, no. 3 (special issue), p. 1-5. AYODEJI, O. F. 2005.Nutrient composition and processing effects on cassava leaf (Manihot esculentus, cranz) antinutrients. Pakistan Journal of Nutrition, 2005, vol. 4, no.1, p. 37-42. BABAYEMI, O. J. 2006. Antinutritional factors, nutritive value and in vitro gas production of foliage and fruit of Enterolobium cyclocarpum. World Journal of Zoology, 2006, vol. 1, no. 2, p. 113-117. BABAYEMI, O. J. –�� DEMEYER, D. –�� FIEREZ, V. 2004b. In vitro fermentation of tropical browse seeds in relation to their content of secondary metabolites. Journal of Animal Feed and Science, 2004b, vol. 13, no.1, p. 31-34. BABAYEMI, O. J. �� –�� HAMZAT, R. A. –�� BAMIKOLE, M. A. –�� ANURUDU, N. F. –�� OLOMOLA, O. O. 2006. Preliminary studies on spent tea leaf: In vitro gas production as affected by chemical composition and secondary metabolitics. Pakistan Journal of Nutrition, 2006, vol. 5, no. 5, p. 497-500. BAMIKOLE, M. A. �� –�� BABAYEMI, O. J. 2008.Chemical composition and in sacco dry matter degradability of resdue and by-products of palm fruit processing in the rumen of steers. Animal Science Journal, 2008, vol. 79, p. 314-321. BELEWU, M. A –�� BELEWU, K. Y. 2005. Cultivation of mushroom (vovariella volvacea) on banana leaves. African Journal of Biotechnology, 2005, vol. 4, no. 1,

Original paper p. 1401-1403. BELEWU, M. A. �� – OKHAWERE, �� O. C. 1998. Evaluation of feeding fungi treated rice husk to West Africa dwarf sheep. In: Proceedings of the 25th Annual Conference and Silver Jubilee of the Nigerian Society for Animal Production held between 21st – 24th March, 1998. BLUMMEL, B. �� –�� MAKKAR, H. P. S. �� –�� BECKER, K. 1997. In vitro gas production: a technique revisited. Journal of Animal Physiology and Animal Nutrition, 1997, vol. 77, p. 24-34. BLUMMEL, M. �� –�� ORSKOV, E. R. 1993. Comparison of gas production and nylon bag degradability of roughages in predicting feed intake in cattle. Animal Feed Sci. Technol., 1993, vol. 40, p. 109. CHUMPAWADEE, S. �� –�� CHANTIRATIKUL, A. –�� CHANTIRATIKUL, P. 2007. Chemical compositions and nutritional energy feeds for ruminant using in vitro gas production technique. Pakistan Journal of Nutrition, 2007, vol. 6, no. 6, p. 607-612. DUNCAN, D. B. 1955. Multiple range and multiple F test. Biometrics, 1955, vol. 11, p. 1 FIEVEZ, V. �� –�� BABAYEMI, O. J. –�� DEMEYER, D. 2005. Estimation of direct and indirect gas production in syringes: A tool to estimate short chain fatty acid production requiring minimal laboratory facilities. Anim. Feed Sci. and Technol., 2005, vol. 123-124, p. 197-210. FARKAS, 1979. Biosynthesis of cell wall of fungi. Microbiol. Rev., 1979, vol. 43, no. 2, p. 117-130. GETACHEW, G. �� –�� BLUMMEL, M. �� –�� MAKKAR, H. P. S. �� –�� BECKER, K. 1998. In vitro gas measuring techniques for assessment of nutritional quality of feeds: a review: Anim. Feed Sci. Technol. , 1998, vol. 72, p. 261. GETACHEW, G. –�� MAKKAR, H. P. S. �� –�� BECKER, K. 2002. Tropical browses: content of phenolic compounds, in vitro gas production and stoichiometric relationship between short chain fatty acids and in vitro gas production. J. Agric. Sci., 2002, vol. 139, p. 341. JACQUELINE, E. W. – BROERSE, B –�� VISSER, B. 1996. Assessing the potential. In Biotechnology: Building on Farmers’ Knowledge edited by Joske Bunders, Biertus Harverkort and Wim Hiemstra. Published by Macmillan Education Ltd. London, Basingstoke. JONATHAN, S. G. �� –�� FASIDI, I. O. 2001. Effect of carbon, nitrogen and mineral sources on growth Psathyrella atroumbonata (Pegler), a Nigerian edition mushroom. Food. Chem., 2001, vol. 72, p. 479-483. KARUNANANDAA, K. –�� VARGA, G. A. - D. E. RIGSBY, L. L. –�� ROYSE, D. J. 1995. Botanical fractions of rice straw colonized by white-rot fungi: changes in chemical composition and structure. Anim. Feed Sci. Technol., 1995, vol. 55, p. 179-199.

Original paper KRISHNAMOORTHY, U. �� –�� SOLLER, H. ��–� STEINGASS, H. –�� MENKE, K. H. 1995. Energy and protein evaluation of tropical feedstuffs for whole tract and ruminal digestion by chemical analysis and rumen inoculum studies in vitro. Anim. Feed. Sci. Tech., 1995, vol. 52, p. 177. MAURICIO, R. M. �� –�� MOULD, F. L. �� –�� ABDALLA, A. L. –�� OWEN, E. 1999. The potential nutritive value for ruminants of some tropical feedstuffs as indicated by In vitro gas production and chemical analysis. Unpublished. MENKE, K. H. �� –�� STEINGASS, H. 1998. Estimation of the energetic feed value obtained from chemical analyses and gas production using rumen fluid. Anim. Res. Develop., 1998, vol. 28, no. 7, p. 7-55. MENKE, K. H. –�� RAAB, L. �� –�� SALEWSKI, A. �– STEINGASS, H. �� –�� FRITZ, D. �� –�� SCHNEIDER, W. 1979. The estimation of the digestibility and metabolisable energy content of ruminant feedstuffs from the gas production when they are incubated with rumen liquor. J. Agric. Sci., 1979, vol. 93, p. 217. McDowell, L. R., 1985. Nutrition of grazing ruminants in warm climates. Academic Press/Harcourt Brace Jovanovich, London. MCDONALD, L. R. 1985. Minerals in Animal and Human Nutrition, 1st eds. Academic Press. San Diego, CA, New York. NGAMSAENG, A. �� –�� WANAPAT, A. �� –�� KHAMP, S. 2006. Evaluation of local tropical plant by in vitro rumen fermentation and their effects on fermentation end product. Pakistan Journal of Nutrition, 2006, vol. 5, no. 5, p. 414-418. NITIPOT, P. –�� SOMMART, K. 2003. Evaluation of ruminant nutritive value of cassava starch industry by using in vitro gas production technique. In: Proceeding of Annual Agricultural Seminar for year 2003, 27-28 January, KKU, p: 179-190.

Slovak J. Anim. Sci., 45, 2012 (1): 14-20 ONI. A. O. –�� ONWUKA, C. F. I. –�� ARIGBEDE, O. M. �� – ONI, �� O. O. �� –�� ANELE, U. Y. –�� YUSUF, K. O. –�� ODUGUWA, B. O. �� –�� ONIFADE, O. S. 2010. Chemical composition and in sacco degradability of four varieties of cassava leaves grown in southwestern Nigeria in the rumen of sheep. Tropical Anim. Health Prod., 2010, vol. 42, p. 1385-1393. ONWUKA, C. F. I –�� AKINSOYINU, A. O. 1988.Mineral constituents of some browse plants used in ruminant feeding in southern Nigeria. Nigeria Journal of Animal Production, 1988, vol. 15, p. 57-62 ORSKOV, E. R. –�� MCDONALD, I. 1979. The estimation of protein degradability in the rumen from incubation measurements weighted according to rate of passage. J. Agri. Sci., (Camb), 1979, vol. 92, p. 499-504. SHOUKRY, M. M �� –�� HAMISSA, F. A. –�� SAWSAN, M. – �� AHMED, A. H. –�� EL-REFAI, H. M. –�� ALI ABDELMOTAGALLY, Z. M. Z. 1985. Nutritive improvement of some low quality roughages for ruminants. I. Effect of different microbial and chemical treatments on the quality of sugarcane bagasse. Egypt J. Anim. Prod., 1985, vol. 25, p. 329-42. SILVA, A. T. –�� ORSKOV, E. R. 1988.The effect of five different supplements on the degradation of straw in sheep given untreated barley straw. Animal Feed Science and Technology, 1988, vol. 19, p. 289-298. SOMMART, K. �� –�� PARKER, D. S. –�� ROWLINSON. P.��– � WANAPAT, M. 2000. Fermentation characteristics and microbial protein synthesis in an in vitro system using cassava, rice straw and dried ruzi grass as substrate. Asian-Australasian Journal of Animal Science, 2000, vol. 13, p. 1084-1093. VAS SOEST, P. J. 1994. Nutritional Ecology of Ruminants, 2nd ed. Cornell University Press, 476 pp. ZADRAZIL, F. 1993. Conversion of lignocellulosic wastes into animal feed with white-rot fungi. Proceedings of the international conference of mushroom Biology. 1993, p. 151-161

EFFECT OF USING SATURATED AND UNSATURATED FATS IN BROILER DIET ON CARCASS PERFORMANCE

H. A. MOHAMMED, E. HORNIAKOVÁ* Slovak University of Agriculture in Nitra, Slovak Republic

ABSTRACT In this work the effect of three types of fat substances based on the use of saturated fat (SF) and unsaturated fat (USF) and also mixing between them with different level proportions in the diet of broilers (Ross-308) chickens was investigated. The effect was observed on carcass yield, share of giblets and abdominal fat chicken part percentages. One-day old 800 chickens were divided to four testing groups C, T1, T2, and T3 and each group had 4 replications. The fattening was 42 days in length, divided to a diet’s pre-starter (7 d), starter (9 d), grower (17 d) and finisher (5 d). The testing group C had 5 % of animal fat, T1 2.5 % animal packed fat + 2.5 % sunflower oil, and T3 group 2.5 % packed fat +1.25 % rapeseed and 1.25% sunflower oil. Carcass yield was higher in group C (70.75 % and 70.17 % for female and male, respectively). The differences were not significant (P>0.05). The breast muscle percentage was not significantly higher in T3 (28.35 %) for female and also in T3 (29.46 %) for male, but it was with significant difference (P<0.05). No significant difference was observed in legs muscle between sex and groups (P>0.05). Abdominal fat was significantly lower in group T2 for female (1.036 %), while it was not significant in case of male (T3 - 0.66 %) as compared to C group. Key words: broiler; SF; USF; carcass performance

INTRODUCTION The main aim of broiler production is to increase breast yield and to reduce fat deposition and improve feed conversion without decreasing growth rate. Also, the fat inclusion in broiler diets must take into account the effect on carcass fat quality, because dietary fatty acids are incorporated with little change into body fat (Naji and Hamdy, 1989). Dressing percentage of birds is known as the percentage of carcass weight of processed birds slaughtered after the weight of the blood, feathers, and edibles parts, not consumed by humans. Parts are represented on both sides of the winged legs, and head to live body weight (Naji and Hamdy, 1989). The distribution of muscle is concentrated in the chest area, as is the case of strain (Cobb-500) type and it decreases with age (Hassan and Abboud, 2005). Sanz et al. (1999) observed that fat concentration will increase

accumulation of meat to the chest muscle and thus lead to a high percentage of dressing. Broilers in general are characterized by the rapid growth and accumulation of meat in the main parts of the sacrifice (breast and thigh). These strains differ from each other in the capacity of the chest and firmness of meat influence according to the type of nutrition used (Ibrahim, 2000). A study conducted by Mala et al. (2004) using the strain Cobb-500 showed that the content of the mixture of animal fat tallow with Soya bean oil (saturated and unsaturated fatty acids) reflects the inclusion of fatty acids, which are found in parts of the carcass. Kralik et al. (2003) when using two types of essential unsaturated fatty acids (α-linoleic and α-linolenic), they observed differences which were highly significant (P<0.01) for carcass weight and the weight of the chest and thigh. This means that even the type of fatty acid affects the quality of mass parts. The diet of vegetable oils led to a significant decrease in the

*Correspondence: E-mail: erika.horniakova@uniag.sk Erika Horniaková, Department of Animal Nutrition, Slovak �� University of Agriculture, Tr. A. Hlinku 2, �� 949 01 Nitra, Slovak �� Republic Tel.: +421 6414320

Received: December 2, 2011 Accepted: February 28, 2012

Original paper weights of carcass and muscle chest, while the thigh level remained insignificant (P>0.05) with different fat vegetarian diets but they did not affect significantly on the dressing percentage of the offering or the content of carcass fat at the age of 35-49 days (Rosa et al.,1999; Sanz et al.,1999). Conclusion was that muscles of chest and thigh were influenced by the content of the diet from fatty acids, whether saturated or unsaturated. The content of any food in these acids will be reflected on the content of the main parts of them. Included minor parts of both are the sacrifice of back, neck and wings, and in some cases, also the head and legs. Despite there are only rare information and studies on the reference to this issue some studies included parts on the ratio of the back and legs and neck. Kralik et al. (2003) found that the use of essential unsaturated fatty acids reflected two types, which are highly significant (P<0.01) and indicate the proportion of the back and legs. Ensiminger et al. (1990) and Sanz et al. (1999) had pointed out that the animal fats will increase the accumulation of grease to the neck area, which will increase the weight and the ratio of weight to the weight of the carcass. In general, the minor parts as part of the carcass weight are dependent on the proportion of fat deposited and the amount and type of fat used. Abdominal fat is defined as the amount of tissue fat or fat accumulated in the abdomen which is affected by the quantity and quality of the charge doses accumulated and the impact of fat sources used in the poultry diet. Sanz et al. (2000) found that the use of (SFO) with fat, especially animal tallow, will increase the amount of filling fat, predominantly over the recent period of breeding broilers with the sources of fat containing unsaturated fatty acids during the first phase of growth and replaced fats within, which is included just a few days before slaughter may cause depositions with flexible fats compared to using sources of saturated fat during the overall growth.

MATERIAL AND METHODS Experimental data The trial was conducted as a comparison group of four feeding trials in four replications in the biological testing centre ÚKSÚP Vigľaš under the auspices of the Department of Animal Nutrition and Regional Department ÚKSÚP in Zvolen. The experiment was done in one-day, (two genders) of Ross-308 chicken meat; the total number of the animals was 800. The animals were divided into groups by random selection of 50 birds in each flock. The material had to obey certain criteria compatible with STN 46 6410, which was verified by assessing the individual,

Slovak J. Anim. Sci., 45, 2012 (1): 21-29 the weight and exteriors assessed and 200 chicken were included in each experimental group. The feed mixture for the control (C) and trial groups (T1, T2 and T3) were differentiated by the quality of fat. In C group 5 % of animal packed fat was used, in T1 2.5 % packed fat +2.5 % rapeseed oil, in T2 2.5 % packed fat +2.5 % sunflower oil and in T3 2.5 % packet fat +1.25 % rapeseed +1.25 % sunflower oil. Each group had 4 replications. Collected data included the periods of 7 days for pre-starter, 9 days for starter, 17 days for grower, and 5 days for finisher. Feeding and management Birds were housed on the deep litter in the same technological conditions. Microclimate indicators in the range of temperature and humidity were measured and recorded three times a day at 7.00 AM, 12.00 Noon and 5.00 PM. Measurement indicated the zone of animals, the height from the floor and the largest part of the body of animals. The feed mixtures formulated for each period of feeding are presented in tables 1, 2, 3, and 4. Experimental procedure The heart and the liver were immediately removed from hot carcasses for both sexes, packed in plastic bags and stored in liquid nitrogen until the time of analysis. After removal of the heart and liver, carcasses were chilled to 4°C, and the abdominal fat pad (from the proventriculus surrounding the gizzard down to the cloaca) was removed and weighed (Cahaner and Nitsan, 1985). At the end of the experimental period (42 days old), one chicken from each replicate of treatments group (similar body weight) was slaughtered to determine the relative weight of the following parts: the hot carcass weight, breast, legs, thighs, drumstick, half back, wings, abdominal fat, gizzard, heart, liver and feathers. Statistical analysis The obtained data were statistically analyzed using complete random design with 4 treatments. Data in all experiments were subjected to ANOVA procedures appropriate for a completely randomized design and the significance of differences between the means were estimated using Duncan test (Duncan’s new multiple range test). Probability level of P<0.05 was considered for significance in all comparisons except with blood parameters for which P<0.01 was considered. Values in percentage were subjected to transformation of Arc sin v100. All statistical analyses were performed using the software SPSS 17.5 for Windows® (SPSS Inc., Chicago, IL).

Slovak J. Anim. Sci., 45, 2012 (1): 21-29

Original paper

Table 1: Pre-starter feed mixture formula

Groups

Components

Maize

44.20

Soybean meal

32.00

Wheat

10.00

Fish meal

5.00

Limestone (Ca Co3)

1.35

Monocalcium phosphate

1.00

*PX BR Unit

1.00

Methionine 99 %

0.12

Total salt

0.20

Threonine 99 %

0.13

Packed fat

5.00

2.50

Sunflower oil

2.50

1.25

Rapeseed oil

2.50

1.25

TOTAL

*vit. A=4,500,000 IU, vit. D=1,660,000 IU, vit. E=20,000 mg.kg , vit. K3=1 mg.kg , vit. B1=1,800 mg.kg , vit. B2=2,500 mg.kg-1, vit. B6=1,600 mg.kg-1, vit. B12=8.75 mg.kg-1, folic acid=600 mg.kg-1, calcium pentonite=5,500 mg.kg-1, niacin mid=18,000 mg.kg-1, biotin=60 mg.kg-1, cholin chloride=30,000 mg.kg-1, betain=65,000 mg.kg-1, Co=150 mg.kg-1, I=380 mg.kg-1, Mn=45,800 mg.kg-1, Cu=6,500 mg.kg-1, Si=110 mg.kg-1, Zn=28,300 mg.kg-1, Fe=27,200 mg.kg-1, Mo=350 mg.kg-1

100.00

100.00 -1

Table 2: Formula for starter feed mixture

Groups

Components

Maize

48.50

Soybean meal

29.00

Wheat

10.00

Fish meal

4.00

Limestone (Ca Co3)

1.30

Monocalcium phosphate

0.85

PX BR Unit

1.00

Methionine 99 %

0.05

Total salt

0.22

Lysine

0.03

Threonine 99 %

0.05

Packed fat

5.00

2.50

Sunflower oil

2.50

1.25

Rapeseed oil

2.50

1.25

TOTAL

*vit. A=4,500,000 IU, vit. D=1,660,000 IU, vit. E=20,000 mg.kg , vit. K3=1 mg.kg , vit. B1=1,800 mg.kg , vit. B2=2,500 mg.kg-1, vit. B6=1,600 mg.kg-1, vit. B12=8.75 mg.kg-1, folic acid=600 mg.kg-1, calcium pentonite=5,500 mg.kg-1, niacinamid=18,000 mg.kg-1, biotin=60 mg.kg-1, cholin chloride=30,000 mg.kg-1, betain=65,000 mg.kg-1, Co=150 mg.kg-1, I=380 mg.kg-1, Mn=45,800 mg.kg-1, Cu=6,500 mg.kg-1, Si=110 mg.kg-1, Zn=28,300 mg.kg-1, Fe=27,200 mg.kg-1, Mo=350 mg.kg-1.

100.00

100.00 -1

Original paper

Slovak J. Anim. Sci., 45, 2012 (1): 21-29

Table 3: Formula for grower feed mixtures

Groups

Components

Maize

42.40

Soybean meal

29.00

Wheat

20.00

Limestone (Ca Co3)

1.35

Monocalcium phosphate

0.80

*PX BR Unit

1.00

Methionine 99 %

0.05

Total salt

0.33

Lysine

0.02

Threonine 99 %

0.05

Packed fat

5.00

2.50

Sunflower oil

2.50

1.25

Rapeseed oil

2.50

1.25

TOTAL

*vit. A=4,500,000 IU, vit. D=1,660,000 IU, vit. E=20,000 mg.kg , vit. K3=1 mg.kg , vit. B1=1,800 mg.kg , vit. B2=2,500 mg.kg-1, vit. B6=1,600 mg.kg-1, vit. B12=8.75 mg.kg-1, folic acid=600 mg.kg-1, calcium pentonite=5,500 mg.kg-1, niacinamid=18,000 mg.kg-1, biotin=60 mg.kg-1, cholin chloride=30,000 mg.kg-1, betain=65,000 mg.kg-1, Co=150 mg.kg-1, I=380 mg.kg-1, Mn=45,800 mg.kg-1, Cu=6,500 mg.kg-1, Si=110 mg.kg-1, Zn=28,300 mg.kg-1, Fe=27,200 mg.kg-1, Mo=350 mg.kg-1

100.00

100.00 -1

Table 4: Formula for finisher feed mixtures

Groups

Components

Maize

40.50

Soybean meal

22.60

Wheat

28.00

Limestone (Ca Co3)

1.35

Monocalcium phosphate

0.80

*PX BR Unit

1.00

Methionine 99 %

0.20

Total salt

0.30

Lysine

0.15

Threonine 99 %

0.10

Packed fat

5.00

2.50

Sunflower oil

2.50

1.25

Rapeseed oil

2.50

1.25

TOTAL

*vit. A=4,500,000 IU, vit. D=1,660,000 IU, vit. E=20,000 mg.kg , vit. K3=1 mg.kg , vit. B1=1,800 mg.kg , vit. B2=2,500 mg.kg-1, vit. B6=1,600 mg.kg-1, vit. B12=8.75 mg.kg-1, folic acid=600 mg.kg-1, calcium pentonite=5,500 mg.kg-1, niacinamid=18,000 mg.kg-1, biotin=60 mg.kg-1, cholin chloride=30,000 mg.kg-1, betain=65,000 mg.kg-1, Co=150 mg.kg-1, I=380 mg.kg-1, Mn=45,800 mg.kg-1, Cu=6,500 mg.kg-1, Si=110 mg.kg-1, Zn=28,300 mg.kg-1, Fe=27,200 mg.kg-1, Mo=350 mg.kg-1.

100.00

100.00 -1

Slovak J. Anim. Sci., 45, 2012 (1): 21-29

Original paper

RESULTS AND DISCUSSION Some factors affecting diet on carcass quality The composition of the broiler carcass is now receiving considerable attention with the poultry industry’s major trust in further processing. Today the trend is towards specialized carcass types and composition of meet specific demands for cut-up, deboning, and subsequent new product manufacture. Carcass composition can, to a large extent, be modified through diet choice (Leeson and Summers, 1997). Obtained data on slaughter outputs are presented in table 5. Effect of diet on hot or fresh carcass percentage Hot or fresh carcass percentage values of trial groups are presented in table 5. At 42 days age of females and males, differences were insignificant (P>0.05). For females the difference between group C and T2 (70.75 and 70.35 % respectively) was higher than that between T1 and T3. Values obtained in this study for average

carcass are in accordance with results of some trial groups (Moharerry, 2005) in which different levels of soybean oil mixing with tallow was used. These results are in agreement with those of Kermanshahi et al. (1998), when they fed diets supplemented with commercial feed additives depending on a blend of essential oils’ source, for 42 days old chickens. Same results were found in the experiment performed by Mitchell and Burk (1993) where sunflower oil was used in broiler diets. It was mentioned that at advanced age after grower period till the end of trial at 42 days the growth of digestive system was better and there was increase of secretion of lipase enzyme. Effect of diet on breast percentage and share of meat in the breast Breast percentage and share of meat in mass breast values of trial groups are presented in table 5. The data on breast percentage at 42 days of age revealed the lowest average value in T2 group (2.5 % packed

Table 5: The effects of dietary natural feed additives on carcass interior organs of 42 days’ old broiler chickens Attributes (%)

C Female

Male

Groups

T1 Female

Male

T2 Female

T3 Male

Female

Male

The Carcass

70.75±1.40 70.17±0.16 69.59±0.85 70.26±0.91 70.35±1.21 68.56±1.70 69.61±0.62 69.14±0.63

The Breast

26.19±1.99 25.34±2.34a 27.05±0.90 26.61±0.92ab 25.42±0.51 23.89±1.73a 28.35±5.16 29.46±3.41b

Breast muscle

21.97±1.80 20.42±0.78 22.50±0.36 21.84±0.33 21.52±0.79 19.98±1.49 21.38±1.32 20.27±0.65

The Legs

20.05±1.16 17.78±1.13 19.37±0.13 15.80±1.10 19.32±0.62 17.31±2.70 19.06±1.08 18.50±3.39

Legs muscle

13.59±0.46 13.27±0.35 13.11±0.11 13.62±0.51 13.05±0.80 12.67±0.91 13.08±0.65 13.36±1.02

Thigh

6.11±0.40 7.123±0.62a 6.02±0.32 7.49±0.30ab 6.51±0.48

8.20±0.54b 6.72±0.50

8.01±0.43b

Drumstick

8.99±0.61

9.06±0.84

8.67±0.8

9.75±0.35

8.60±0.23

8.90±0.65

8.46±0.57

8.98±0.37

Drumstick muscle

5.76±0.26

5.48±0.29

5.54±0.26

5.54±0.20

5.47±0.33

5.24±0.56

5.48±0.36

5.53±0.48

The Wings

6.79±0.09a 7.04±0.20a 7.07±0.18ab 6.94±0.17a

7.24±0.38a 7.54±0.67ab 6.98±0.28ab 7.70±0.23b

The Back

7.16±1.15

7.96±1.63a

6.48±0.75

6.29±0.54a

6.86±1.43

Abdominal fat

1.98±0.34b

1.21±0.36

1.19±0.20a

0.77±0.36 1.036±0.27a 0.80±0.38 1.56±0.44ab 0.66±0.41

Total bowel

11.62±0.76 11.18±0.67ab 10.73±0.45 10.80±0.38a 10.64±0.95 11.36±0.27b 11.26±0.46 1.05±0.66ab

Stomach

1.41±0.15

1.42±1.96

1.39±0.13

1.39±0.20

1.48±0.14

1.51±0.21

1.49±0.16

1.31±0.16

Heart

0.55±0.05

0.55±0.03

0.49±0.11

0.47±0.04

0.46±0.09

0.52±1.01

0.52±0.11

0.55±0.02

Liver

1.97±0.17

1.93±0.13

2.00±0.36

1.75±0.17

1.74±0.13

1.87±0.07

1.83±0.41

1.86±0.10

Neck

2.67±0.35

2.51±0.45

2.60±0.07

2.60±0.41

2.35±0.63

2.55±0.13

2.54±0.52

2.65±0.53

Under skin breast fat 0.41±0.11b

0.30±0.11

0.19±0.08a

0.23±0.07 0.26±0.10ab 0.12±0.08

0.20±0.10a

0.31±0.23

Under skin thigh fat 0.68±0.23b

0.32±0.18

0.28±0.07a

0.24±0.10

0.37±0.05a

0.15±0.16

0.26±0.12a

0.31±0.08

7.04±0.91a

6.79±1.08 12.52±2.43b

Breast skin

0.52±0.08

0.29±0.11

0.51±0.28

0.23±0.07

0.62±0.12

0.12±0.08

0.71±0.10

0.31±0.23

Thigh skin

0.76±0.17

0.32±0.18

0.85±0.05

0.24±0.10

0.71±0.10

0.15±0.16

0.68±0.07

0.31±0.08

Plumage

5.02±0.50

5.03±0.36

5.30±0.99

4.25±0.71

4.80±0.47

5.01±0.38

5.02±0.88

4.62±0.54

Mean ±S.D, a, b means with different superscript within row are significantly different (P< 0.05) Values are expressed asx ± Std. Deviation of 50 birds

Original paper fat +2.5 % sunflower oil) for both sexes, further there were significant differences (P<0.05) among all groups for males but there were insignificant differences among all groups for females. The highest yield for males was established in group T3 (29.46 %) followed by T1, C and T2. This can be attributed to two points, first because of mixing type of fat with different levels which results in more concentrated growth of breast muscle, on the other hand the genetics and environment can also affect the concentrated growth of breast muscle in case different levels of unsaturated fats are used. These results are similar to those of Pardio et al. (2001) and Mala et al. (2004) when they used Cobb 500 strain and fed unsaturated fats to find improvement of breast muscle weight. Their explanation was that due to size of skeleton especially in breast half centimetre more accumulation can take place which is apart from other genetic factors, leading to more accumulation of muscle in that place. Anjum et al. (2004) disagreed with the same treatment of soybean oil. In regard to data on shares of muscle tissue in the breast for females, the lowest average value was obtained in T3 group (21.38 %) in which the highest yield of muscle tissue was established in group C (21.97 %). The net effect of adequate dietary protein on muscle may be enhanced by reducing its accompanying acid load by saturated fat components. Compounds in fat foods, which are SFA-producing, may help preserve bone and muscle mass because of soluble vitamin D which is related with precipitation of calcium ion that has role for building bone (Al-Janabi and Mohammed, 1989). Reducing the acid load that accompanies the typical high protein diet may also be important. USF metabolic environment reducing urinary nitrogen excretion is an indicator of reduced muscle wasting. These results agree with those of Moharrery (2005), when he observed metabolism of Malic acids on carcass performance at beta oxidation of SF. At 42 days of age, insignificant (P>0.05) differences were observed among all groups for both sex. The highest value for male was obtained in group T1 followed by C, T2 and T3 respectively, and the lowest were found in T2 (19.98 %). In the case of group T1, the higher deposition of protein could be attributed to the synergism of both additive components. This is may be linked to better anabolism related to amino acid digestion. On the other hand pepsinogen secretion, a precursor of pepsin increases due to the action of pungent components provided by mixing equal percentage of SFA and USFA consequence there is an improvement in protein digestion (Popescu and Criste, 2003). Involvement of high level of stearic and oleic acid in C group diet may reduce the utilization of the protein included in the diet. SFA are responsible for the bitterness and unavailability of nutrients to be absorbed

Slovak J. Anim. Sci., 45, 2012 (1): 21-29 by the intestinal tract (Ashild, 2005). The mechanism of action of SFA is due to the binding of SFA to carbohydrates, fats and peptide molecules by a phenol group, which provides many hydroxyl (OH) groups to produce hydrogen binding reaction, in which reducing availability of these nutrients for catalyst enzymes reduce the absorption from intestine tract wall (Flores et al., 1994). Ensminger et al. (1990) found that the effect of SFA on older birds is less than young chicks. The net effect of adequate dietary protein on muscle may be enhanced by reducing its accompanying acid load, in which chickens in treatments received emulation of SFA in the diet has lower value of USFA, which is responsible for the acid-production in the blood, thus influencing the reserve of protein in breast muscle indirectly (Ashild, 1985). Values obtained in this study for breast and thigh percentages are in accordance with results of Mohammed et al. (2005). Effect of diet on legs percentage and share of meat in legs Thigh percentage values of trial groups are presented in table 5. In regard to data on legs percentage, at 42 days of age results showed insignificant (P>0.05) differences between groups. The highest value obtained for male was in group T3 (18.50 %) and the lowest was in the group T1 (15.80 %). At 42 days of age for female groups C and T1 showed high values compared to other groups (20.05 and 19.37 %), respectively. However, the differences between groups were insignificant (P>0.01). In regard to data on shares of muscle tissue in the legs at 42 days of age high yield of muscles was obtained for male in group T1 (13.62 %) and the lowest in group T2 (12.67 %). This could be attributed to the increase of pH in the intestine by fat content of FA which allowed the increase in proteolysis reactions, thus enhancing protein hydrolyses and higher utilization from the diet. Values of group C for female was 13.59 % and of T1 13.11 % higher and were insignificant when compared to other groupsâ&#x20AC;&#x2122; yield (P>0.01). Lowest value was found in group T2 for male and female altogether. These results agree with study of Mohammed et al. (2005). Effect of diet on thigh percentage and share of meat in thigh Thigh percentage values of trial groups are presented in table 5. In regard to data on shares of muscle tissue in thigh at 42 days of age for male groups T2, T3 and T1 were insignificant (P>0.05), but significant (P<0.05) with group C while insignificant differences (P>0.05) differences were found among trial groups for female . Higher muscle yield were obtained in group T2 for male and female (8.20 and 6.51, respectively). This could be attributed to that type of mixing of fat promoted the bone building during the starter period.

Slovak J. Anim. Sci., 45, 2012 (1): 21-29 Effect of diet on drumstick percentage and share of meat in the drumstick Thigh percentage values for trial groups are presented in table 5. In regard to data on shares of muscle tissue in the drumstick at 42 days of age differed insignificantly (P>0.05). Higher values were obtained in group C for female and male (8.99 and 9.06, respectively) for drumstick, compared to other groups. Group C showed high yield of muscle in comparison to other groups, while differences among groups were insignificant (P>0.05). Effect of diet on the back and wings portions percentages The back and wings percentage values of trial groups are presented in table 5. In regard to data on the back portion of the female chicken an insignificant difference (P>0.05) was observed, but significant differences (P<0.05) were registered at 42 days of age. Values did not differ except between C, T1 and T2. At 42 days of age treatments containing natural additives had higher values in back portion than in both T1 and T2. This could be attributed to the influence of these additives on bone formation by affecting hormones responsible for the mineral or type of vitamin soluble involved in fat metabolism. In regard to data on wings percentage, there was a slight insignificant (P>0.05) difference between groups at 42 days of age except group T3. During the overall rearing period values of wings percentage in trial groups tended to be lower than group T2, even though the differences were statistically insignificant (P>0.05) with T1 and C groups. Wings percentage of birds consumed diets containing mixing of sunflower oil and packed fat equally showed slight decrease as compared to the T3 and C groups. Mala et al. (2004) found that wing percentage (on the base of dressed carcass) was insignificantly higher (P>0.01) than the control in groups, which consumed diet containing a group of essential oils. This finding is in agreement with Popescu and Criste (2003). Effect of diet on abdominal fat percentage Body fat deposition depends on the net balance among absorbed fat, endogenous fat synthesis and fat catabolism. Abdominal fat percentage values of trial groups are presented in table 5. An insignificant (P>0.05) difference was found among males among groups for abdominal fat. Lowest values were found in groupT3 containing mixing of different types of fat with different proportion as showed in material and methods. This means that the fat metabolism was shifted by the phytochemical included in the beta metabolism of fat cycle (Kamel, 1993) to be more available for the energy supply than precipitating in the abdomen. Also, male sex had no effect on fat accumulation in the abdomen. These results agree with the results of Collins et al. (1999) and Sanz et al. (1999), while they used mixing of USFA

Original paper with SFA, and found significant differences (P<0.05) on abdominal fat. Results obtained in present study are also in agreement with those obtained by Vila and Esteve Garcia (1996) who found that abdominal fat deposition increased with increasing fat inclusion level in birds fed tallow, whereas it remained constant in birds fed sunflower. Sanz et al. (1999) suggested that dietary fatty acid profile could affect abdominal fat deposition. Crespo and Esteve, (2001) reported that in males abdominal fat increased with increased fat concentration. Similar results were also obtained by Deaton et al. (1981), but these results are in contrast with the results of Fuller and Rendon (1977) and Sizemore and Siegel (1993) who did not find any effect of dietary fat concentration when the energy to protein ratio remained constant. Effect of diet on total bowel and stomach percentage Total bowel percentage values of trial groups are presented in table 5. At 42 days of age insignificant differences (P>0.05) were observed among trial groups for female. Bowel percentages were higher in group C (11.62 %), while the lowest value was noted in group T2 (10.64 %). On the other hand, for male sex there were significant differences (P<0.05) among groups. Bowel percentages for the male were higher in group T2 (11.36 %) and lowest in group T1 (10.80 % and 10.73 % for male and female, respectively) as compared to other groups. This could be attributed to the growth promoter effects of the type fat when fed to the birds during pre-starter and starter periods as indicated by higher feed consumption during starter and later in finisher phase of feeding. Increasing the digestion system volume is important to increase the capacity of consumption of more diet further that affects type of sex. Effect of diet on heart percentage Heart percentage values of trial groups are presented in table 5. During starter phase the heart weight was affected by including saturated fat in the diet, which decreased insignificantly (P>0.05), comparing to both sex of control group and among all groups. A similar result was registered for group C and T1. These results confirm the previous results from Mohammed et al. (2005). There were differences among groups and high percentage for male and female was noted in group C (0.55 %) which can be attributed to accumulation of saturated fat around heart. Effect of diet on liver percentage The liver is closely associated with digestive tract, as the organ responsible for metabolism and synthesis from absorbed nutrients (Shane, 2006). Liver percentage values of trial groups are presented in table 5. Percentages of liver were higher in groups consumed diets containing packed fat in C and also in group T1 for female even

Original paper though there were insignificant differences (P>0.05) among all groups a low value was noted in groupT2 for female and for male it was in group T1. Saleh et al. (2003) explained this state due to tri-carboxied cycle in liver for SFA which produce more ATP leading to increase of fat deposition in liver. Effect of diet on neck percentage Data from table 5 showed that there were insignificant defences (P>0.05) on neck percentage but the higher value for female was in group C (2.67 %) and for male it was in group T3 (2.65 %). Effect of diet on under skin fat for breast and thigh percentage Table 5 indicates that values for accumulated fat under skin in breast and thigh for both sex had insignificant differences (P>0.05). On the other hand for female there were significant differences (P<0.05). The high value observed in group C for breast and thigh under skin fat were 0.41 % and 0.68 %, respectively. This is due to using just SF and percentage of deposited fat in the thigh more than in breast which can be attributed to physiological properties of carcass and the ability of thigh to deposit more fat through tissue than breast muscles. Effect of diet on skin of breast and thigh muscles percentage Insignificant differences (P>0.05) were observed for both muscles and both sex on skin. Higher values were highlighted in group T3 for female breast skin (0.68 %) and in group T1 (0.85 %) for female thigh skin. For male it was in group C for both breast skin (0.29 %) and thigh skin (0.32 %). This is due to weight and area of tissue muscles in these groups. Effect of diet on plumage percentage Feather percentage values of trial groups are presented in table 5. For both sex insignificant (P>0.05) values were recorded. Values in groups containing high level of mixing packed fat and rapeseed tends to decrease the feather formation in male. This could be attributed to the influence of these additives on the pituitary hormone prolactin which is responsible indirectly for the feather formation. Prolactin appears to influence reproductive function by a direct action on the central nervous system (Buntin, 1993), or might be due the effect on availability of sulphuric amino acids by decreasing the feed consumption in groups which consumed diets supplied by mixing two high level SFA and USFA (table 5).

CONCLUSION From these results, it could be concluded that the best carcass percentage can be obtained by inclusion of

Slovak J. Anim. Sci., 45, 2012 (1): 21-29 the blend of 5 % packed fat in broilers diet. The higher yield of breast meat was obtained with inclusion of packed fat with rapeseed and sunflower oil into the diet in the group T3 for both sexes. The higher meat yield of the legs was obtained by inclusion of 5 % packed fat. Lower abdominal fat deposition was obtained by mixing 2.5 % packed fat with 2.5 % sunflower oil.

ACKNOWLEDGEMENT This work was financially supported by the Grant Agency of the Slovak Ministry of Education and the Slovak Academy of Sciences under VEGA commission for agricultural, veterinary and wood science (Project n. 1/0662/11). The title of the project is expanding nutrient transformation to suitable production standards of safety of animal food by effective utilization of organic natural resources. Thanks to the poultry farm VÍGLAŠ workers, especially to Ing. Dušan Jančik, for help and support throughout this study. Many thanks for the team of the department who are helpful and are really doing good job.

REFFERENCES ABDEL-SAMEI, A. H. 1983. Effect of dietary oil fat sources and levels on production performance of layers hen. M.Sc., Thesis, 241 Pages Fac. Agric., Cairo University. AL-JANABI, A. – MOUHAMED, A. 1989. The principle of poultry feeding. High Ministry education press, Baghdad, Iraq, 235. p. ISBN. 02-4654962-17. ANJUM, M. I. – MIRZA, I. – KHAN, A. G. – AZIM, A. 2004. Effect of fresh versus oxidized soybean oil on growth performance, organs weights and meat quality of broiler chicks, Animal Sciences Institute, National Agricultural Research. Pakistan Veterinary J., vol. 24, 2004, no. 4, p. 173-178. ASHILD, K. 1985. Digestion and Absorption of Lipids in Poultry. J. Nutrition, vol. 115, 1985, p. 675-685. BUNTIN, J. D. 1993. Prolactin-brain interactions and reproductive function. J. American Zoologist, vol. 33, 1993, no. 2, p. 229-243. (Abstract). http://icb. oxfordjournals.org/cgi/reprint/33/2/229. CAHANER, A. – NITSAN, Z. 1985. Evaluation of simultaneous selection for live body weight and against abdominal fat in broilers. J. Poultry Sci., vol. 54, 1985, p. 1257–1263. COLLINS, N. – MORAN, E. – STILLBORN, H. 1999. Effect of feeding optimum high oil corn on pellet quality broiler performance and carcass traits. J. Poultry Sci., vol. 78, 1999, p. 129-133. CRESPO, N. – ESTEVE, G. E. 2001. Dietary fatty acid

Slovak J. Anim. Sci., 45, 2012 (1): 21-29 profile modifies abdominal fat deposition in broiler chickens. J. Poultry Sci., vol. 80, 2001, p. 71-78. DEATON, J. – MCNAUGHTON, J. – REECE, F. – LOTT, B. 1981. Abdominal fat of broilers as influenced by dietary level of animal fat. J. Poultry Sci., vol. 60, 1981, p. 1250-1253. ENSMINGER, M. – OLD FIELD, J. – HENEMANN, W. 1990. Feeds and nutrition. 2nd Ed. The Ensminger Publishing Company. USA ,1990, p. 250-400. ISBN. 97-809412180-85. FLORES, M. P. – CASTANON, J. I. R. – Mc NAB, J. M. 1994. Effect of tannin on starch digestibility and TMEn of triticale and semi purified starches from triticale and field beans. British Poultry Sci., vol. 35, 1994, p. 281-286. FULLER, H. – RENDON, M. 1977. Energetic efficiency of different dietary fats for growth of young chicks. J. Poultry Sci., vol. 56, 1977, p. 549-559. HASAN, E. – ABOUD, M. 2005. Poultry Theory practical E1. Damascus, Syria, 2005, p. 251. ISBN 01-56423871-12 IBRAHIM, E. 2000. Poultry Feeding, Ed2. Ministry of High Education, Mousel press, Iraq. 2000, p. 192. ISBN 014654962-13 KAMEL, B. A. 1993. Principle of Biochemistry, Ed1. Chapter, 3. Metabolism of lipids Ministry of High Education, Iraq. Mousel University, 1993, p. 184225. ISBN 02-058496-12. KERMANSHAHI, H. 1998. The potential of dietary lipases to improve fat utilization in young birds [PhD]. Saskatoon (CA): University of Saskatchewan. KRALIK, G. – SKTIC, Z. – KUSEC, G. – KADLEC, J. 2003. The influence of rape seed / oil on the quality of chicken carcasses. Czech J. Anim. Sci., vol.48, 2003, no 2, p. 77-84. LEESON, S. – SUMMERS, J. D. 1997. Commercial poultry nutrition. 2nd ed. University books, p. 214. Guelph, Ontario, Canada. ISBN 0-9695600-2-8. MALA, S. – SLEZAČKOVA, I. – STRAKOVA, E. – SUCHY, P. – VECEREK, V. 2004. Plant–Based containing Ca – Salts of Fatty Acids and their Influence on performance, carcass characteristics and Heath status of broiler. J. Acta of Veterinary, vol. 73 2004, p. 321-328. MIELCHE, M. – BERTELSEN, G. 1994. Approaches to the prevention of warmed over flavour. J. of Trends in Food Sci. and Technol., vol. 5, 1994, p. 322-327. MOHAMMED, H. – SARDARY, S. – MIRAN, D. 2005. The effect of utilization vegetable fat and oil of sunflower seeds and marketing age on production performance and chemical composition of broiler’s carcass. Thesis, Salahaldeen University, Erbil, Iraq.

Original paper MOHARRERY, A. 2005. Effect of Malic Acid on Growth Performance, Carcass Characteristics, and Feed Efficiency in the Broiler Chickens. Int. J. Poultry Sci., vol. 4, 2005, no. 10, p. 781-786. NAJI, S. – HAMDY, A. 1989. Technologic of poultry production. High Education Press, Baghdad, Iraq. 1989, p. 360 ISBN 02-21569874-14 PARDIO, V. – LANDIN, L. – WALISZEWSKI, K. – BADILLO, C. – PEREZ, F. 2001. The effect of Acidified soapstocks on feed conversion and broiler skin pigmentation. J. Poultry Sci., vol. 80. 2001, p. 1236-1239. POPESCU, A. – CRISTE, R. 2003. Using full fat soybean in broiler Diets and its effect on the production and economic efficiency of fattening. J. Europe Agricult., vol. 4, 2001, no 1, p. 120-124. ROSA, F. C. 1999. Teor de ácidos graxos poliinsaturados ômega-3 no peito e coxa de frangos de corte alimentados com rações contendo três fontes de óleo Lavras, MG, 94p. Dissertação ( Mestrado em Zootecnia), Universidad Federal de Lavras, 1999. SALEH, E. – WATKINS, S. – WALDROUP, A. – WALDROUP, P. 2003. Effects of Dietary Nutrient Density on Performance and Carcass Quality of Male Broilers Grown for Further Processing. Int. J. Poultry Sci., vol. 3, 2003, no. 1, p.1-10. SANZ, M. – FLORES, P. – PEREZ, D. – AYALA, E. – LOPEZ- BOTE, C. 1999. Higher lipid accumulation in broilers fed on saturated fats than in those fed on unsaturated fats. British J. Poultry Sci., vol. 40, 1999, p. 95-101. SANZ, M. – LOPEZ-BOTE, C. – FLORES, C. – CARMONE, J. 2000. Effect of the inclusion time of dietary saturated and unsaturated fats before slaughter on the accumulation and composition of abdominal fat in female broiler chickens. J. Poultry Sci., vol.79. 2000, p. 1320-1325. SHANE, S. M. 2006. Nutritional and digestive disorders of poultry. Nottingham university press. Nottingham. UK. ISBN 1-904761-35-6. SIZEMORE, F. G. – SIEGEL, H. S. 1993. Growth, feed conversion and carcass composition in females of four broiler crosses fed starter diets with different energy levels and energy to protein ratios. J. Poultry Sci., vol. 72, 1993, p. 2216-2228. VILA, B. – ESTEVEGARCIA, A. 1996. Studies on acid oils and fatty acids for chickens. Influence of age. Rate of inclusion and degree of saturation on fat digestibility and metabolisable energy of acid oils. British J. Poultry Sci., vol. 37, 1996, p. 105-117.

IMPACT OF LACTATION STAGE AND MILK PRODUCTION ON MILK FAT FATTY ACIDS RATIO V. Foltys, K. Kirchnerová Animal Production Research Centre Nitra, Slovak Republic

ABSTRACT Milk fat is, from a nutritional point of view, of the negative value because of the prevalent content of saturated fatty acids with high atherogenic index. Intake of milk fat in the diet is important because of the content of monounsaturated fatty acids, acting favorably against cardiovascular diseases and especially of essential fatty acids: linoleic, alpha-linolenic and conjugated linoleic acid (CLA), which is found only in meat and milk of ruminants. The analysis of relations of fatty acids in milk fat to qualitative-production parameters of milk shows that the correlations of fatty acids with lactation stage and qualitative-production parameters of milk are quite weak in dairy cows with stable type of nutrition in form of whole-the-year feeding mixed feed ration in lowland agricultural area. Coefficients r>0.3 for the values of lactation sum were observed at monounsaturated fatty acids (MUFASC), r = 0.467 for days, 0.307 for milk, 0.353 for fat, and 0.340 for protein total production. The most important fatty acids, as far as their content is concerned, C12:0, C14:0, C16:0, C18:0, C18:1n9, the ratio of which is higher than 5 % in milk fat and they represent together about 75 % of milk fat, show no significant relations either to sum or to daily production parameters or to the content of basic components in milk. With the exception of C16:0, palmitic acid (30.93 ± 4.81 % in milk fat), which has negative relation to daily milk (r = -0.404) and protein (r = -0.345) production. This acid has positive relation to the content of fat in milk (r = 0.444) and negative relation to the content of lactose in milk (r = -0.311). CLA showed negative correlation with daily fat production (r = -0.407) and content of fat in milk (r = -0.269) and F/P index (r = -0.420). Key words: milk; fat; fatty acid; stage of lactation; correlation

INTRODUCTION Milk fat is from nutritional point of view evaluated negatively because of prevalent content of saturated fatty acids with atherogenic effect, as well as content of undesirable trans isomers, but this is negligible in milk fat compared with other fats. The occurrence of fatty acid trans isomers, which are put into connection with the incidence of cardio-vascular diseases, is an important factor that influences the effect of fat on health, because they affect negatively the ratio of HDL and LDL cholesterol similarly to hypercholesterolemic acids (Mensink, 2005). However, this is a problem mainly in hydrogenated fat. Trans-isomers of mono-unsaturated fatty acids are created in rumen during biohydrogenation process. This is a desirable process, which enables rise

of chains of essential fatty acids, linoleic and alphalinolenic, and the main of them, the acid delta 11 trans C18:1 is the precursor of conjugated linoleic acid (CLA), which occurs only in meat and milk of ruminants. These chains are precursors of biologically active substances – hormones and enzymes. Milk products are the main source of CLA, which is considered to be the functional component of foods with positive influence on health. The occurrence of other trans-isomers of monounsaturated fatty acids (MUFA) in milk fat is minimal with marginal detectability in relation to other fatty acids. The intake of milk fat in nutrition is important for the content of fatty acids increasing its biological value. Important are mainly unsaturated fatty acids in cis-configurations, first of all oleic acid C18:1n6 cis, which acts positively against cardio-vascular disorders (Haug, 2007). Positive

*Correspondence: E-mail: foltys@cvzv.sk Vladimír Foltys, Animal Production Research Centre Nitra, Hlohovecká 2, 951 41 Lužianky, Slovak Republic Tel.: +421 37 6546 281 Fax: +421 37 6546 418

Received: February 15, 2011 Accepted: March 15, 2012

Slovak J. Anim. Sci., 45, 2012 (1): 30-35 property of milk fat is also its good ratio, 1: (1.16-4), of omega-3 (n3) and omega-6 (n6) fatty acids (Colomb et al., 2004). Assessment of milk fat importance in nutrition should be done by complex studies, not only on the basis of effect of individual types of acids, when they are studied separately. The influence of lactation stage on milk fat composition corresponds with metabolic origin of fatty acids, when acids synthesized de novo are lower at the beginning of lactation than in later stages as a result of negative energy balance, and with their growth in the course of lactation decrease fatty acids with longer chain. There were found changes during the first third of lactation, which cease gradually up to 10 weeks or to first 100 days. During the beginning of lactation the content of lower acids synthesized de novo increases, and the content of higher acids from deposit fat decreases (Garnsworthy et al., 2006). Komprda et al. (2001) studied representation of fatty acids in first third of lactation. Content of myristic acid rose significantly and content of stearic acid decreased irrespective of feeding ration. Results from studies of composition changes in fatty acids (Kirchnerová et al., 1988) showed that during the first 18 weeks of lactation the total content of fatty acids C18:0 and C18:1 decreased from 40 to 30 %, and content of fatty acids C14:0 and C16:0 increased from 35 to 45 % of the total content of fatty acids, whereas the content of linoleic (C18:2) and linolenic (C18:3) acids was relatively stable. Changes in milk fat composition during early lactation were connected with different intensity of nutrition during the preparation for lactation during the period of drying off. The objective of this work was to study relations among lactation stage and qualitative and production parameters of milk and representation of fatty acids of milk fat in dairy cows with stable type of nutrition by the system of round-the-year feeding the mixed feed ration in lowland agricultural area.

MATERIAL AND METHODS The herds with stable type of nutrition by roundthe-year feeding the mixed feed ration based on maize silage with no farm differences were selected for this study. The dairy cows were at first lactation on different number of days of lactation evenly distributed in the interval of 22 - 309 days. The data on their milk performance were processed on the basis of milk recording. The group of dairy cows from herds with round-the-year feeding ration has quite high average daily production of milk, fat and proteins ([27.78 ± 6.27, 1.03 ± 0.29 and 0.85 ± 0,17] kg.day-1) with low variability (20 %). The milk was sampled from the whole amount of milked milk at regular milk recording. Single milk samples

Original paper collected from individual dairy cows (n = 100) on 6 farms (n = 15–30) in lowland agricultural area were analysed for physiological and biochemical parameters as mentioned below. They were also analyzed for fatty acids in milk fat using gas chromatography. Analysis of fatty acids by gas chromatography Milk fat was isolated from lyophilized milk samples by extraction in petroleum ether according to Röse-Gottlieb, then it was re-esterified by methanol potassium hydroxide solution, and methyl esters of fatty acids were extracted by hexane. Methyl esters of fatty acids were analysed by gas chromatography (apparatus GC Varian 3800, Techtron, USA), using FID detector in capillary column Omegawax 530; 30m. Irregular temperature gradient from 40 to 240°C, injection and detection at 250°C were used. Nitrogen flow rate was 6 ml.min-1. In the chromatography record 54 fatty acids inclusive of particular isomers were identified by standard reference sample of milk fat and analytical standards Supelco, followed by GCMS analysis. Their representation was expressed relatively in percents (%). Groups of fatty acids and their abbreviation as well as calculated indexes were created according to traditional structural-chemical and nutrition criteria in line with studies cited in References. Analyses of milk samples Content of fat, proteins and lactose was determined by infrared analyser Milkoscan FT 120 (FOSS Electric), with DID detector (diode array = diode field in whole red spectrum) according to ISO 9622: 1999 Whole milk – Determination of milk fat, protein and lactose content – Guidance on the operation of mid-infrared instruments. Somatic cells count (SCC) was determined in apparatus Somacount 150 (Bentley Instruments), on the principle of through-flow cytometry, according to STN EN ISO 13366-1: 2008. Temperature of milk freezing (TMF) was determined in thermistor cryoscopic apparatus Cryostar (Funke Gerber), according to the norm ISO 5764: 2002 Milk – Determination of freezing point. Content of urea was determined photocolorimetrically with Ehrlich’s agent at 530 nm wave length. Mathematic-statistical evaluation of results Results of analyses were processed by variationstatistical methods using the Statgraphics software. Following statistical characteristics were calculated: arithmetical mean (x), minimum and maximum value, standard deviation (sx), variation coefficient (v %). The test of two means agreement (t-test - type for uneven variances) was used to determine significance of difference. Coefficients of linear correlation (r) were calculated to express relations among the studied parameters, and their statistical significance was tested.

Original paper

Slovak J. Anim. Sci., 45, 2012 (1): 30-35

The results did not show waves or change in course in relation to the number of lactation days, which would indicate dissection of lactation into linear parts. On this basis we studied the relations among the detected parameters by means of linear regression for the total number of lactation days.

RESULTS AND DISCUSSION If we are seeking for possibilities how to improve the profile of fatty acids in milk fat, it is necessary to evaluate interrelations among production parameters in set of dairy cows as well as the qualitative properties of milk, which reflect their condition and spectrum of fatty acids. Changes in qualitative or production parameters and composition of milk fat during lactation were not very great with round-the-year feeding the mixed feed ration

in lowland agricultural area. This stability was manifested also in relations among the studied parameters. Tables 1 and 2 show that correlation coefficients are quite low. Correlations among volatile fatty acids (VFA) and values of lactation sum reached the limit of statistical significance (P<0.01), when r < -0.3. These coefficients are decreasing with the length of chain in individual acids C4:0, C6:0, C8:0 and C10:0. They are the highest in absolute value with butyric acid (C4:0), namely r = -0.418 to the number of lactation days, -0.342 to the amount of produced milk, -0.322 to the amount of fat, and -0.372 to the amount of proteins. Fatty acids with short chains up to C10 come from the biosynthesis in the milk gland. Acetic acid is the building stone, which arises at fermentation processes in rumen. In the process of reduction condensation it creates a prolonged chain in form of Acetyl-CoA, creating higher and higher fatty acids with even number of carbon atoms in this way

Table 1: Correlation coefficients for parameters of production and quality of milk to groups of fatty acids in milk fat

Days of Milk lactation kg

Fat kg

Protein Milk Fat Protein F/P Fat Protein Lactose SCC TFM Urea kg kg.D-1 kg.D-1 kg.D-1 index g.100g-1 of milk .103.ml-1 -m째C mg.l-1

SAFASC

-0,184 -0,203 -0,073 -0,204 0,046 0,198 0,023 0,122 0,041 -0,167 -0,121 0,167 0,092 -0,009

SAFAMC

0,013 -0,210 0,085 -0,165 -0,416 0,050 -0,357 0,376 0,446 0,170 -0,306 0,046 -0,269 -0,148

Sum of lactation

Daily production

Milk composition

Milk quality

SAFALC

0,003 0,161 -0,017 0,141 0,268 -0,020 0,237 -0,096 -0,128 -0,052 0,230 -0,124 0,027 -0,048

SAFA

-0,162 -0,296 -0,009 -0,269 -0,183 0,217 -0,170 0,370 0,337 -0,044 -0,269 0,148 -0,111 -0,139

VFA

-0,332 -0,298 -0,224 -0,316 0,170 0,266 0,096 0,188 0,014 -0,323 -0,057 0,173 0,098 0,018

HCHFA

0,052 -0,158 0,149 -0,112 -0,382 0,067 -0,308 0,316 0,408 0,192 -0,316 0,081 -0,189 -0,135

BCFA

0,206 0,038 0,127 0,073 -0,392 -0,233 -0,333 0,038 0,137 0,185 0,112 0,083 0,191 0,245

MUFASC

0,467 0,307 0,353 0,340 -0,265 -0,243 -0,168 -0,364 -0,151 0,330 -0,119 -0,012 -0,057 -0,160

MUFAMC

0,105 0,049 -0,024 0,048 -0,170 -0,145 -0,162 -0,077 -0,050 0,063 0,141 -0,023 0,038 0,121

MUFALC

0,087 0,256 -0,029 0,224 0,254 -0,151 0,227 -0,334 -0,336 -0,016 0,277 -0,136 0,148 0,169

MUFA

0,128 0,282 -0,006 0,252 0,224 -0,179 0,205 -0,367 -0,352 0,011 0,281 -0,140 0,148 0,167

PUFA

0,352 0,284 0,118 0,291 -0,205 -0,418 -0,165 -0,243 -0,087 0,278 0,068 -0,154 -0,211 -0,127

USFA

0,162 0,296 0,009 0,269 0,183 -0,217 0,170 -0,370 -0,337 0,044 0,269 -0,148 0,111 0,139

SCFA

-0,147 -0,176 -0,047 -0,175 0,027 0,176 0,011 0,094 0,030 -0,140 -0,125 0,161 0,085 -0,020

MCFA

0,022 -0,205 0,082 -0,160 -0,427 0,037 -0,368 0,367 0,439 0,174 -0,292 0,043 -0,264 -0,137

LCFA

0,099 0,259 -0,014 0,231 0,240 -0,156 0,216 -0,295 -0,290 0,000 0,273 -0,149 0,096 0,098

desC14

0,550 0,474 0,330 0,488 -0,133 -0,345 -0,059 -0,548 -0,340 0,337 0,080 -0,139 -0,084 -0,146

desC16

0,177 0,283 0,052 0,258 0,132 -0,128 0,125 -0,292 -0,270 0,037 0,257 -0,069 0,177 0,197

desC18

0,111 0,113 -0,013 0,104 -0,060 -0,197 -0,045 -0,286 -0,225 0,086 0,076 -0,028 0,191 0,317

0,316 0,354 0,078 0,328 0,017 -0,377 0,006 -0,464 -0,403 0,065 0,247 -0,168 -0,039 -0,149

0,146 -0,039 0,057 0,008 -0,392 -0,201 -0,317 0,231 0,391 0,342 -0,198 -0,048 -0,336 -0,092

n6/n3

0,015 0,185 -0,034 0,130 0,353 -0,026 0,272 -0,446 -0,557 -0,281 0,273 0,003 0,249 -0,018

-0,023 -0,148 0,113 -0,122 -0,173 0,174 -0,138 0,251 0,268 0,039 -0,306 0,141 -0,120 -0,162

EMK

0,365 0,306 0,122 0,309 -0,190 -0,433 -0,156 -0,277 -0,127 0,262 0,090 -0,154 -0,208 -0,138

Slovak J. Anim. Sci., 45, 2012 (1): 30-35

Original paper

(Melcher 1975, Jenkins and Mcguire 2006, Bauman et al., 2006). Coefficients r > 0.3 for the values of lactation sum were observed at monounsaturated fatty acids (MUFASC), r = 0.467 for days, 0.307 for milk, 0.353 for fat, and 0.340 for proteins, caused mainly by myristic acid (C14:1), which is out of all evaluated acids in the closest relation to the level of production for the past lactation period; r = 0.597 for days, 0.481 for milk, 0.431 for fat and 0.508 for proteins. In connection with it is also opposite to other desaturation indices, the extraordinary relation of des-C14 (r = 0.545 days, 0.474 milk, 0.330 fat, 0.488 proteins) to sum parameters. C14:1 has also a

high correlation coefficient to the content of proteins in milk r = 0.409. The most important fatty acids, as far as content is concerned, C12:0, C14:0, C16:0, C18:0, C18:1n9, the ratio of which is higher than 5 % in milk fat and they represent together about 75 % of milk fat, show no significant relations either to sum or to daily production parameters or to the content of components in milk. With the exception of C16:0, palmitic acid (30.93 Âą 4.81 % in milk fat), which has negative relation to daily milk production (r = -0.404) and proteins (r = -0.345). This acid has positive relation to the content of fat in milk (r = 0.444) and negative relation to the content of lactose

Table 2: Correlation coefficients for parameters of production and quality of milk to ratio of fatty acids in milk fat

Days of Milk lactation kg

Fat kg

Protein Milk Fat Protein F/P Fat Protein Lactose SCC TFM Urea kg kg.D-1 kg.D-1 kg.D-1 index g.100g-1 of milk .103.ml-1 -mÂ°C mg.l-1

C4:0

-0,418 -0,342 -0,322 -0,372 0,260 0,287 0,152 0,180 -0,043 -0,401 -0,028 0,107 0,093 0,046

C6:0

-0,353 -0,318 -0,259 -0,341 0,178 0,258 0,088 0,185 -0,010 -0,363 -0,055 0,161 0,072 -0,005

C8:0

-0,288 -0,280 -0,184 -0,293 0,113 0,242 0,054 0,198 0,047 -0,282 -0,068 0,189 0,100 0,007

C10:0

-0,197 -0,199 -0,084 -0,202 0,074 0,218 0,051 0,162 0,068 -0,182 -0,072 0,209 0,104 0,009

C12:0

-0,020 -0,084 0,069 -0,068 -0,066 0,120 -0,034 0,089 0,103 0,006 -0,120 0,173 0,083 -0,036

C14:0

0,196 0,109 0,278 0,141 -0,179 -0,009 -0,090 -0,024 0,116 0,228 -0,175 0,056 0,085 -0,001

C15:0

0,144 0,026 0,124 0,043 -0,208 -0,134 -0,176 -0,323 -0,212 0,120 -0,242 -0,053 -0,192 -0,219

C16:0

0,013 -0,205 0,090 -0,161 -0,404 0,057 -0,345 0,374 0,444 0,170 -0,311 0,045 -0,274 -0,158

C17:0

-0,176 -0,310 -0,242 -0,291 -0,298 -0,114 -0,314 0,097 0,069 -0,039 -0,113 -0,031 -0,190 -0,030

C18:0

-0,008 0,153 -0,026 0,132 0,277 -0,012 0,242 -0,097 -0,138 -0,069 0,239 -0,121 0,035 -0,044

Sum of lactation

Daily production

Milk composition

Milk quality

C20:0

0,301 0,330 0,253 0,343 0,004 -0,164 0,062 -0,107 0,070 0,323 -0,033 -0,181 -0,131 -0,104

C14:0i

-0,165 -0,315 -0,035 -0,270 -0,324 0,117 -0,283 0,477 0,464 0,037 -0,039 0,124 0,087 0,227

C15:0ai

0,254 0,097 0,200 0,120 -0,309 -0,190 -0,257 -0,162 -0,050 0,147 -0,018 0,110 0,126 0,025

C16:0i

0,068 -0,146 0,075 -0,095 -0,448 -0,049 -0,379 0,474 0,563 0,243 -0,063 0,127 0,119 0,357

C17:0i

0,053 0,140 -0,068 0,119 0,101 -0,170 0,074 -0,303 -0,350 -0,103 0,348 -0,090 0,212 0,128

C14:1

0,597 0,480 0,431 0,508 -0,213 -0,325 -0,105 -0,529 -0,275 0,409 -0,021 -0,113 -0,039 -0,151

C15:1

0,094 -0,148 0,088 -0,091 -0,475 -0,064 -0,384 0,366 0,511 0,328 -0,155 0,097 -0,052 0,088

C16:1n7cis POA 0,158 0,100 0,079 0,107 -0,170 -0,097 -0,139 -0,044 0,026 0,147 0,074 -0,038 0,009 0,108 C16:1

0,157 0,095 -0,064 0,085 -0,152 -0,301 -0,163 -0,280 -0,269 -0,006 0,241 -0,035 0,047 -0,006

C17:1n7cis

-0,277 -0,259 -0,322 -0,274 -0,008 0,053 -0,070 0,165 0,027 -0,221 0,101 0,073 0,091 0,214

C18:1n9cis OA 0,077 0,249 -0,030 0,218 0,259 -0,134 0,235 -0,313 -0,314 -0,010 0,271 -0,131 0,159 0,184 C18:1

0,143 0,272 -0,056 0,229 0,193 -0,298 0,137 -0,528 -0,553 -0,111 0,319 -0,169 0,029 -0,008

C20:1n9cis

0,355 0,411 0,319 0,421 0,009 -0,159 0,087 -0,211 -0,065 0,261 0,151 -0,151 0,049 0,132

C18:2n6cis LA 0,321 0,373 0,091 0,345 0,045 -0,358 0,034 -0,474 -0,417 0,062 0,259 -0,165 -0,042 -0,154 C18:3n3cisALA 0,167 -0,013 0,057 0,029 -0,386 -0,236 -0,319 0,196 0,351 0,327 -0,185 -0,044 -0,357 -0,110 C18:2 9,11 CLA 0,394 0,427 0,179 0,415 -0,034 -0,407 -0,007 -0,419 -0,269 0,248 0,136 -0,138 -0,047 0,021 C20:4n6cis ETA 0,026 -0,069 -0,071 -0,068 -0,226 -0,203 -0,233 -0,085 -0,062 0,002 0,069 -0,091 0,119 -0,042 C20:4n3cis

0,104 -0,030 0,139 0,028 -0,225 0,067 -0,115 0,270 0,443 0,387 -0,233 -0,057 -0,061 0,061

C20:5n3cisEPA 0,029 -0,110 0,064 -0,060 -0,283 0,021 -0,202 0,322 0,462 0,318 -0,251 0,028 -0,228 -0,022

Original paper in milk (-0.311), which manifested also in the relation of saturated fatty acids with medium chain length (SAFAMC) to the content of fat (r = 0.446) and lactose (r = -0.306) in milk. The relation to lactose was transferred also into the relation to TMF (r = -0.274), to which lactose has generally a positive relation. This fatty acid with medium chain usually does not change markedly its content in milk fat in the course of lactation, which was manifested also in lower milk yield, where more marked changes in other acids took place, also showed that it has a similar function among fatty acids as lactose among milk components; its production capacity, which is determining for milk amount, becomes exhausted at higher production. Hanuš et al. (2010) was engaged in the study of relations of fatty acids, which are important for health, to milk components. In their study they did not observe significant relations between the most important saturated palmitic fatty acid C16:0 and milk components. Higher saturated fatty acids from C18 come predominantly from blood plasma, into which they got from feed or from reducing depot fat of dairy cow. Fatty acids from C12 to C16 can be of both origins. Odd fatty acids arise by prolongation of propionyl-CoA instead of acetylCoA. Branched chain fatty acids arise by prolongation of chain that arose by oxidative deamination of branched amino acids (valine – isoaminovaleric acid, leucine – isoaminocaproic acid, isoleucine – anteisoaminocaproic acid). This construction can be realised by microorganisms in forestomachs at the synthesis of microbial fat, or by cells of secretion epithelium in milk gland (Melcher 1975, Jenkins and Mcguire 2006, Bauman et al., 2006). CLA and isomers C16:1 and C18:1 have negative correlation with daily fat production (for CLA -0.407) and content of fat in milk (for CLA -0.269) and index F/P (for CLA -0.420); for C18:1 -0.553 to fat in g/100g, and -0.528 to the F/P index. They indicate in this way that they are of another origin than other higher unsaturated fatty acids, which are resorbed from blood of dairy cow, namely that they are probably synthesized de novo in secretion epithelium, and their proportion in milk decreases with the increase of fat content in milk. CLA content in milk fat increases during lactation, most closely in connection with increasing total milk production, r = 0.427 and proteins r = 0.415. CLA biosynthesis increases in spite of gradual exhaustion of body fat reserves. Hanuš et al. (2010) observed statistically significant relations of CLA proportion in milk fat to fat content (r = 0.379; P<0.01) and to the content of lactose (r = -0.542; P<0.001). Total production of fat and lactose plays probably an essential role in these relations. Milk fat unsaturated fatty acids C18:1 and C16:1 can originate from resorption of the feed fat but more unsaturated fatty acids originate from own synthesis by milk gland, because unsaturated fatty acids from feed lipids are hydrogenated in forestomachs of ruminants. Higher organisms are able to incorporate

Slovak J. Anim. Sci., 45, 2012 (1): 30-35 double bonds in molecule by means of dehydrogenating enzyme system and reactions of chain growth (Melcher 1975, Jenkins and Mcguire 2006, Bauman et al., 2006). The content of n6 acids (mostly C18:2n6LA) increases slightly in connection with sum of lactation and decreases with the rise of daily production of fat, and it decreases significantly with increasing content of fat in milk (r = -0.403) and more markedly with F/P index (r = -0.464; P<0.01). It manifested itself also in marked decrease in the ratio n6/n3, mainly with fat content (r = -0.557; P<0.001). The less marked increase in n3 acids supported it also. Marked decrease in the content of polyunsaturated fatty acids (PUFA) (r = -0.418) and essential fatty acids (EFA) (r = -0.433) with the increase of daily fat production is the result. Hanuš et al. (2010) observed statistically significant relations of total sum of polyunsaturated fatty acids to the content of fat in milk (r=0.321; P<0.05) and to the content of lactose in milk (r=0.458; P<0.01). However, within this group it is important to evaluate separately n6 and n3 fatty acids. The relation of alpha linolenic acid (ALA) with the content of dry matter (r = 0.411) is positive, but it is negative with the absolute TMF value (expressed in –m°C) (r = -0.357). This is contradictory, because if dry matter is rising, TMF should expectedly rise also. This shows complexity of TMF parameter as well as the fact that this theory has no unambiguous confirmation by results; TMF is more influenced by other milk properties, e.g. acidity, which influences dissociation of salts in milk. SCC, which has low variation coefficient in the system with round-the-year feeding ration, and a standard maximum value to 400.103.ml-1 that was kept during the study, has in this span no significant influence on representation of fatty acids in milk fat. Similarly, Hanuš et al. (2010) did not observe significant relations between SCC and content of fatty acids in milk fat. Content of urea has a slightly positive relation to the content of branched chain fatty acids (BCFA) (0.245), mainly to C14:0i (0.227) and C16:0i (r=0.357), which can be explained by the origin of these isoacids from deaminated chains of amino acids from proteins, which are used as source of energy, the urea being created at the same time. Both these acids have negative correlation (r = -0.324 and -0.448) with rising daily production of milk, as well as with rising production of milk proteins (r = -0.283; -0.380), which means that their content is higher with the higher content of milk fat with which they have positive correlation (r = 0.464; 0.562). Also the odd C15:1 decreases with daily production of milk (r = -0.475) and proteins (r=-0.384), which is related to equal origin of its chain.

Slovak J. Anim. Sci., 45, 2012 (1): 30-35 CONCLUSION The analysis of relations of fatty acids in milk fat to qualitative-production parameters of milk shows that the correlations of fatty acids with lactation stage and qualitative-production parameters of milk are quite weak in dairy cows with stable type of nutrition in form of whole-the-year feeding mixed feed ration in lowland agricultural area. Changes in milk fat composition are caused by the change in the ratio of de novo and depot fatty acids. Relation of fatty acids to the evaluated parameters depends on their metabolic origin and neither acid nor group underlies the specific influence of the studied parameters, by the means of which it would be possible to influence its proportion in milk fat. Therefore, it is not possible to influence some group or desirable fatty acid e.g. CLA, without the influence on total milk fat.

Acknowledgment Contribution was based on the project-APVV 0153-07. This article was written during realization of the project „CEGEZ no. 26220120042“, supported by the Operational Programme Research and Development funded from the European Regional Development Fund.

REFERENCES BAUMAN, D. E. – MATHER, I. H. – WALL, R. J. – LOCK, A. L. 2006. Major advances associated with the biosynthesis of milk. J. Dairy Sci., vol. 89, 2006, no. 4, p. 1235-1243. COLOMB, M. – SOLLBERGER, H. – BÜTIKOFER, U. et al. 2004. Impact of basal diet of hay and fodder beet supplemented with rapeseed, linseed and

Original paper sunflowerseed on the fatty acid composition of milk fat. Int. Dairy J., vol. 14, 2004, no. 6, p. 549-559. GARNSWORTHY, P. C. – MASSON, L. L. – LOCK, A. L. – MOTTRAM, T. T. 2006. Variation of milk citrate with stage of lactation and de novo fatty acid synthesis in dairy cows. J. Dairy Sci., vol. 89, 2006, no. 5, p. 1604-1612. HANUŠ, O. – SAMKOVÁ, E. – ŠPIČKA, J. – SOJKOVÁ, K. – HANUŠOVÁ, K. – KOPEC, T. – VYLETĚLOVÁ, M. – JEDELSKÁ, R. 2010. Relationship between concentration of health important groups of fatty acids and components and technological properties in cow milk. Acta Univ. Agric. et Silvic. Mendel. Brun., vol. LVIII, 2010, no. 5, p. 137-154. HAUG, A. – HOSTMARK, A. T. – HARSTAD, O. M. 2007. Bovine milk in human nutrition - a review. Lipids in health and disease, 2007, no. 6, p. 25. JENKINS, T. C. – MCGUIRE, M. A. 2006. Major advances in nutrition: impact on milk composition. J. Dairy Sci., 2006, vol. 89, no. 4, p. 1302-1310. KIRCHNEROVÁ, K. – PETRIKOVIČ, P. – PAJTÁŠ, M. 1988. Vplyv reštrikčného kŕmenia dojníc pred otelením na fyzikálno-chemické vlastnosti mliečneho tuku. Vedecké práce VÚŽV v Nitre. 1988, XXIII, s. 5-11. KOMPRDA, T. – ŠUSTOVÁ, K. – DVOŘÁK, R. – TIEFFOVÁ, P. – POUL, J. 2001. Changes fatty acid pattern, composition and technological parameters of milk in dairy cows fed heat-treated rapeseed cakes in the first stage of lactation. Czech J. Anim. Sci., vol. 46, 2001, no. 5, p. 231-239. MELCHER, F. W. 1975. Untersuchungen über MinorFettsäuren des Milchfettes und ihre Variabilität. Giessen, Justus Liebig Universität, 1975, 165p. MENSINK, R. P. 2005. Effects of stearic acid on plasma lipid and lipoproteins in humans. Lipids, vol. 40, 2005, no. 12, p. 1201-1205.

Short communication

A SCIENTIFIC NOTE ON INCIDENCE OF NOSEMA APIS AND NOSEMA CERANAE IN SLOVAKIA DURING THE YEARS 2009 AND 2010 M. STAROŇ1*, J. JUROVČÍKOVÁ2, T. ČERMÁKOVÁ1, D. STAROŇOVÁ1 Animal Production Research Centre Nitra, Slovak Republic State Veterinary and Food Institute, Dolný Kubín, Slovak Republic

1 2

ABSTRACT During the last few years a new kind of nosemosis was diagnosed in the bee colonies in the territory of Europe. In Slovakia the causative agent Nosema ceranae was confirmed in 2008. The aim of our study was to monitor the prevalence of mono infection and co-infection of both species N. apis and N. ceranae by using polymerase chain reaction (PCR). The analysis was performed on 72 samples of dead bees, which were collected from bee colonies representing all regions of the country in the years of 2009 and 2010. Prior to PCR analyses positive samples were selected by microscopic examination, confirming the presence of Nosema sp. spores. In the year 2009, N. apis mono infection was diagnosed overall in one sample. The N. ceranae mono infection was diagnosed in 16 samples, while N. apis + N. ceranae co-infection was diagnosed in 2 samples. In three samples causative agent was not identified by differential diagnostics and those were considered as Nosema spp. positive. The ascertained prevalence of N. apis and N. ceranae was 14.3 % and 85.7 %, respectively. In the year 2010, the N. apis mono infection was not diagnosed, while N. ceranae mono infection was diagnosed in 27 samples and N. apis + N. ceranae co-infection was confirmed in 3 samples. The ascertained prevalence of N. apis and N. ceranae was 9.1 % and 90.9 %, respectively. During the period of two years (2009 - 2010), a gradual increase in the prevalence of Nosema ceranae and decrease in the prevalence of Nosema apis was recorded in Slovakia. Key words: Nosema apis; Nosema ceranae; prevalence; PCR

INTRODUCTION The Nosema apis was the only diagnosed microsporidian intracellular parasite in the bee colonies in Slovakia until 2008. During its own life cycle this parasite directly damages epithelial cells of the ventriculus. After that the individual bee digests the carbohydrates and protein components of food imperfectly and causes the worker bee rectum to become overfilled, which is followed by diarrhoea. The aging process of worker bees goes faster because of the insufficient evolution of pharyngeal glands and also the egg production by queen

bee decreases. After that, the bee colony is gradually weakened till its collapse. This is caused by decrease in fertility and by insufficient care for the bee brood (the lack of nurse bees for feeding larvae). During the last few years, the presence of a new kind of nosemosis was confirmed in the territory of Europe. This new infection is caused by the Nosema ceranae. It was probably introduced to Europe by humans, but the European bee eater (Merops apiaster) could play some role in its introduction, too (Higes et al., 2008). Nosema ceranae usually infects Apis ceranae in Asia. The presence of N. ceranae in Europe was

*Correspondence: E-mail: staron.martin@stonline.sk Martin Staroň, Animal Production Research Centre Nitra, Ústav včelárstva, Gašperíkova 599, 033 80 Liptovský Hrádok, Slovak Republic Tel.: +421 44 5221 141

Received: February 15, 2011 Accepted: March 15, 2012

Slovak J. Anim. Sci., 45, 2012 (1): 36-38 confirmed for the first time in Spain in 2006 (Higes et al., 2006). In Hungary it was confirmed in 2009 (Tapaszti et al., 2009). In Slovakia the first presence of this parasite was observed and confirmed in the territory of Plavečské Podhradie in 2008 (Staroň, 2009). Several researches present different observations about the virulence of N. ceranae . Some studies point out to the higher virulence of N. ceranae in comparison to N. apis (Paxton et al., 2007) and its possible role in the CCD syndrome (Higes et al., 2009). On the other side, Forsgren and Fries (2010) showed comparable virulence of both species where in the process of co-infection N. ceranae does not have any competitive advantage. Opinions about virulence of both pathogens are in contradiction, because many environmental factors affect the course of infection (Fries, 2010). N. ceranae causes higher immunosuppression in comparison to N. apis (Antúnez et al., 2009) and in combination with the impairment of bee colony by neonicotinoids. It also contributes to CCD syndrome (Alaux et al., 2010). The N. ceranae infection is tolerated more when bee colonies have enough glycid and protein reserves, because the parasite increases the host energy intake and when the host does not have enough reserves, it undergoes energy stress (Mayack and Naug, 2009; Naug and Gibbs, 2009). The objective of this study was to monitor the prevalence of mono infection and co-infection by N. apis and N. ceranae during the two year period of 2009 and 2010 in Slovakia. The aim was also to determine the participation of both pathogens in Nosema spp. positive samples, too as many authors observed that the N. ceranae is gradually replacing the original N. apis (Chen et al., 2009; Fries, 2010).

MATERIAL AND METHODS The tested samples originated from the queen breeders. They were brought to the laboratory to perform the periodical diagnostics of Nosema spp. Half of the sample was separated and the light microscopy examination was performed to identify Nosema spp. spores. The other half of dead bee bodies was left to perform PCR analysis. The selected samples, which showed medium and strong positivity of Nosema spp. spores during the light microscopy, were differentiated by PCR analysis. The reference material (Nosema ceranae, Nosema apis) was provided to us by Dr. Mariano Higes, Bee Pathology laboratory, Centro Apícola Regional, Spain. Sample for PCR analysis consisted of samples of abdomens of approximately 10 adult bees. Extracted abdomens were homogenized; afterwards the germinative buffer solution was added to suspension to ensure the swelling of the spores. The nucleic acid (DNA) was isolated from suspension by commercial kit Dneasy® Plant Mini Kit

Short communication (QIAGEN). The extracted DNA was stored at -20°C temperature till PCR analysis was carried out. During the PCR analysis the required thermal conditions and the reaction mixture including the Taq DNA polymerase as well as the specific primers were adequately maintained. The sections that are unique for Nosema genus and for individual species of this genus were amplified. Agarose gel electrophoresis was used to evaluate the results. The detected fragment size of 122 bp appeared on the gel in case of presence of a representative genus Nosema, while the fragment size of 219 bp was observed in case of Nosema ceranae and the fragment size of 321 bp in case of Nosema apis (Martín-Hernández et al., 2007).

RESULTS AND DISCUSSION In 2009, twenty-nine samples were examined according to the described methodology. N. apis mono infection was diagnosed overall in one sample (3.45 %), the N. ceranae mono infection was diagnosed in 16 samples (55.17 %), while N. apis + N. ceranae co-infection was diagnosed in 2 samples (6.9 %). There were 7 (24.14 %) Nosema spp. negative samples. Three samples (10.34 %) were not distinguished by differential diagnostics; they were set only as Nosema spp. positive. These were observed because the extremely sensitive primers were purposefully used for detection of the genus Nosema (common for Nosema ceranae, Nosema apis and Nosema bombi); those were able to detect pathogens from 10 spores already. However, the primers that are specific only for Nosema ceranae or Nosema apis can detect from 103 spores, therefore the sample with lower infection level seems to be negative (Klee et al., 2006). The ascertained prevalence of N. apis and N. ceranae was 14.3 % and 85.7 %, respectively. In the year 2010, forty-three samples were examined with this methodology. The N. apis mono infection was not diagnosed, N. ceranae mono infection was diagnosed in 27 samples (62.79 %), while N. apis + N. ceranae co-infection was confirmed in 3 samples (6.98 %). There were 13 (30.23 %) Nosema spp. negative samples. The ascertained prevalence N. apis and N. ceranae was 9.1 % and 90.9 %, respectively. The negative results of PCR analysis were probably caused by the separation of mixed sample and by the presence of artefacts during the light microscopy (mouldy samples of dead bee bodies). In Hungary, differentiation between N. ceranae and N. apis spores by PCR analysis from 38 samples also showed similar results. Only one sample contained N. apis, and in the other 37 samples N. ceranae was detected, which indicates the dominance of N. ceranae in Hungarian apiaries (Tapaszti et al., 2009). Results from Croatia showed that N. ceranae is the only Nosema

Short communication species found to infect honey bees in the geographic territory of Croatia (Tlak Gajger et al., 2010). Our two-year observation in Slovakia points out that the N. ceranae prevalence at the expense of N. apis is rising. We also found a possible co-infection of N. apis and N. ceranae of some bee colonies Apis mellifera.

CONCLUSION During the two year period 2009 and 2010, a gradual increase was recorded in the prevalence of Nosema ceranae and decrease in the prevalence of Nosema apis using polymerase chain reaction (PCR) analysis of bees (Apis mellifera) in Slovakia. Abnormal failure of the bee colonies leading to nosemosis is considered as the only reason of death of bee colonies in Slovakia. For strong bee colonies with enough food supplies, the virulence of N. ceranae against N. apis is probably not higher. It is necessary to monitor the prevalence of both species of Nosema in Slovakia in the forthcoming beekeeping seasons.

ACKNOWLEDGEMENT This work was supported by the Ministry of Agriculture of the Slovak Republic (under research task No. 2006 UO 27 091 05 02 091 05 14).

REFERENCES ALAUX, C. – BRUNET, J. L. – DUSSAUBAT, C. – MONDET, F. – TCHAMITCHAN, S. – COUSIN, M. – BRILLARD, J. – BALDY, A. – BELZUNCES, L. P. – CONTE, Y. L. 2010. Interactions between Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera). Environ. Microbiol., vol. 12, 2010, no. 3, p. 774-782. ANTÚNEZ, K. – MARTÍN-HERNÁNDEZ, R. – PRIETO, L. – MEANA, A. – ZUNINO, P. – HIGES, M. 2009. Immune suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol., vol. 11, 2009, no. 9, p. 2284-2290. CHEN, Y. – EVANS, J. D. – ZHOU, L. – BONCRISTIANI, H. – KIMURA, K. – XIAO, T. – LITKOWSKI, A. M. – PETTIS, J. S. 2009. Asymmetrical coexistence of Nosema ceranae and Nosema apis in honey bees. J. Invertebr. Pathol., vol. 101, 2009, no. 3, p. 204-209. FORSGREN, E. – FRIES, I. 2010. Comparative virulence of Nosema ceranae and Nosema apis in individual European honey bees. Vet. Parasitol., vol. 170, 2010, no. 3-4, p. 212-217.

Slovak J. Anim. Sci., 45, 2012 (1): 36-38 FRIES, I. 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr. Pathol., vol. 103, 2010, no. 1, p. 73-79. HIGES, M. – MARTÍN, R. – MEANA, A. 2006. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J. Invertebr. Pathol., vol. 92, 2006, no. 2, p. 93-95. HIGES, M. – MARTÍN-HERNÁNDEZ, R. – GARRIDOBAILÓN, E. – BOTÍAS, C. – GARCIA-PALENCIA, P. – MEANA, A. 2008. Regurgitated pellets of Merops apiaster as fomites of infective Nosema ceranae (Microsporidia) spores. Environ. Microbiol., vol. 10, 2008, no. 5, p. 1374-1379. HIGES, M. – MARTÍN-HERNÁNDEZ, R. – GARRIDO-BAILÓN, E. – GONZÁLES-PORTO, A. V – GARCIA-PALENCIA, P. – MEANA, A. – DEL NOZAL, M. J. – MAYO, R. v BERNAL, J. L. 2009. Honeybee colony collapse due to Nosema ceranae in professional apiaries. Environmental Microbiology Reports, vol.1, 2009, no. 2, p. 110-113. KLEE, J. – TAY, W. T. – PAXTON, R. J. 2006. Specific and sensitive detection of Nosema bombi (Microsporidia: Nosematidae) in bumble bees (Bombus spp.; Hymenoptera: Apidae) by PCR of partial rRNA gene sequences. J. Invertebr. Pathol., vol. 91, 2006, no. 2, p. 98-104. MARTÍN-HERNÁNDEZ, R. – MEANA, A. – PRIETO, L. – MARTINÉZ SALVADOR, A. – GARRIDOBAILÓN, E. – HIGES, M. 2007. Outcome of colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol., vol. 73, 2007, no. 20, p. 6331 – 6338. MAYACK, CH. – NAUG, D. 2009. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J. Invertebr. Pathol., vol. 100, 2009, no. 3, p. 185-188. NAUG, D. – GIBBS, A. 2009. Behavioral changes mediated by hunger in honeybees infected with Nosema ceranae. Apidologie, vol. 40, 2009, no. 6, p. 595-599. PAXTON, R. J. – KLEE, J. – KORPELA, S. – FRIES, I. 2007. Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis. Apidologie, vol. 38, 2007, no. 6, p. 558-565. STAROŇ, M. 2009. Nozematóza – 2. časť, Nosema apis vs. Nosema ceranae. Včelár, vol. 83, 2009, no. 11, p. 162-163. TAPASZTI, Z. – FORGÁCH, P. – KÖVÁGÓ, C. – BÉKÉSI ,L. – BAKONYI, T. – RUSVAI, M. 2009. First detection and dominance of Nosema ceranae in Hungarian honeybee colonies. Acta Vet. Hung., vol. 57, 2009, no. 3, p. 383-388. TLAK GAJGER, I. – VUGREK, O. – GRILEC, D. – PETRINEC, Z. 2010. Prevalence and distribution of Nosema ceranae in Croatian honeybee colonies. Veterinární Med., vol. 55, 2010, no. 9, p. 457-462.

Slovak Journal of Animal Science http://www.cvzv.sk/index.php/slovak-journal-of-animal-science

INSTRUCTIONS FOR AUTHORS The scientific journal Slovak Journal of Animal Science publishes original papers, review articles, short communications, reviews of important works, chronicles, and reports on participation in important international conferences. Topics of the journal include problems in biology of animals, animal production and veterinary medicine. The author is responsible for originality of the paper, subject-matter and formal attributes of the paper. Papers are published in English language. The author is responsible for translation into English. In case of linguistic shortcomings the paper will be sent back to the author. Copyright. The journal is protected by copyright held by the publisher after the manuscript has been accepted for publication. As regards the transfer of rights, the corresponding author assumes responsibility for all the authors.

Manuscript submission • Manuscripts should be sent by e-mail as attachments. Alternatively, they can be submitted on floppy �� disk, USB key, �� in hard copy and a properly labeled �� Compact �� Disk �� (CD) �� with identical contents, including figures. Unique MS Word file must be saved under the first author’s surname only�� . They are to be sent to the following address: Slovak Journal of Animal Science - Editorial Office Animal Production Research Centre Nitra Hlohovecká 2 951 41 Lužianky Slovak Republic Phone: +421 37 6546 249 Fax: +421 37 6546 311 e-mail: editor@cvzv.sk • The author’s declaration (find at www.cvzv.sk/index.php/slovak-journal-of-animal-science) that the paper has not been published anywhere else should be enclosed. The Declaration must be carefully completed and signed by the first author. • The Corresponding Author should include his or her full name including all academic, scientific and pedagogic titles and the detailed address of the institution with postal code, telephone and fax numbers, and e-mail address.

Reviewers�� ’ evaluation

All scientific contributions will be peer-reviewed on the criteria of originality and quality. Two reviewers, who have appropriate knowledge of the subject, are appointed for each paper. If need be third refree will be asked. The reviewers are asked to return papers within 3 weeks. Editorial �� board of the journal decides on contributing publications, taking into consideration the standpoint of reviewers, scientific significance and quality of manuscript. The manuscript can be rejected if it does not comply with the subject of the journal. The editor makes every effort to explain to authors the reasons of rejection.

After reviewers�� ’ evaluation

After the author receives the �� reviewers�’ opinion he owes to return the corrected manuscript to the editorial office within three weeks. The �� authors may, however, request an extension of the re-submission deadline if necessary. �� After incorporation of revisions it is necessary to send the new complete manuscript with tables and figures, also in case of minor revisions in the original manuscript. In an enclosure the author has to answer all the important comments of the reviewers�� clearly and in detail. The author is not obliged to respect the comments of reviewers�� but he has to explain in the enclosure why he does not accept the reviewers�� ’ comments. If the author does not keep the term of sending back the revised manuscript, his paper is liable to be excluded from further processing.

Sending the corrected proof

The author has to return the made-up manuscript for proof-reading. He must send it back within two days. Within this stage of manuscript preparation for printing, corrections are done only for such errors that arise

TECHNICAL LAYOUT OF MANUSCRIPT Type of contributions. Following categories of scientific contributions are accepted for publication: A. Original articles – original full-length papers which have not been published yet, should not exceed 8 000 words (including tables and illustrations). B. Review articles – focusing on special topics of interest and summarising latest scientific information, up to 10 000 words (including tables and illustrations). Contributions of authors with experimental experience and publications on the given topic are highly preferred. C. Short communications – these may be of a preliminary nature but sufficient for immediate publication, up to 2 500 words (including tables and illustrations) D. Chronicles, and reports on participation in important international conferences - should �� not exceed 1 500 words. Text - The paper should be delivered in text editor Microsoft Office (Word, Excel) for Windows. The text should be in non-formatted style (unjustified). - It is necessary to number all the lines in the text and pages. - If any abbreviations are used in the paper, they must be appropriately explained when they are used in the text for the first time. It is not advisable to use any abbreviation in the title of the paper or in the abstract; - Latin words are to be written in italics; - SI units must be used; - Tables, photographs, graphs and figures should not comprise a part of the text – approximate place is marked within the text where they should be placed as follows: one empty line, then the table No. should be written, followed by an empty line and then the text. They are to be submitted on separate pages appended to the article. - The words should not be divided; between words just one stroke should be left; no style, macro should be adjusted; should be written only as basic text, no reduction and increase in font size is admissible, indices should be written with upper index and lower index; only ‘enter’ should be used to end the paragraph; Tables Font type : Times New Roman, font size: 9; simple spacing; well-arranged and as much simple as possible, typed in format – Table : Insert (each entry has to be done in separate cells); width 16.4 cm x height 23 cm = one page per table (maximum size inclusive of title and explanatory notes below the table); Arabic numerals to be used for marking the tables (e.g. Table 1: …); no vertical lines should be used; significance of differences is marked in the same line as numbers, not as an index (e.g. 0.55++ or 0.55ab); abbreviations in description of tables should not be used; SI units have to be used. Graphs In MS Excel editor or as a figure; simple and well-arranged, without shadowy outline and background, and without grid, of width 16.4 x height 23 cm = one page per graph (maximum size of graph together with all explanatory notes below the graph); charts in MS Excel format (xls) will be accepted when submitted with their underlying table data. Photographs and figures Format tiff, gif, jpg, psd, eps – in CMYK; resolution min. 300 dpi; they are published black and white for the present, the author must expect the coloured photograph to be published in degrees of grey colour (on www.cvzv.sk are photographs in colour); width 16.4 x height 23 cm = one page per figure (maximum size inclusive of title and explanatory notes); photographs and figures including written text has to be in group format; photographs, graphs and drawings to be indicated as figures (Fig. 1: … etc).

Slovak Journal of Animal Science http://www.cvzv.sk/index.php/slovak-journal-of-animal-science Subscription and distribution

Subscription rates 2012 (journal + postage)

All orders should be sent direct to: Slovak Journal of Animal Science Editorial Office Animal Production Research Centre Nitra Hlohovecká 2 951 41 Lužianky Slovak Republic Phone: +421 37 6546 249 Fax: +421 37 6546 311 e-mail: editor@cvzv.sk

Print: 65,- € 75,- € 85,- € 95,- € 105,- €

collecting in editorial office directly Slovak Republic Czech Republic Europe ROW

Offprints: Editorial office will send on request the offprint in Portable Document Format (PDF) via e-mail.

Slovak J.Anim.Sci., 45, 2012 (1) Contents

Original papers AZARI, M. A. – DEHNAVI, E. – YOUSEFI, S. – SHAHMOHAMADI, L.: Polymorphism of calpastatin, calpain and myostatin genes in native Dalagh sheep in Iran

Ansari, M. – Towhidi, A. – Shahrbabak, M. M. – Bahreini, M.: Docosahexaenoic acid and alpha-tocopherol improve sperm cryosurvival in goat

Akinfemi, A. – Ogunwole, O. A.: Chemical composition and in vitro digestibility of rice straw treated with Pleurotus ostreatus, Pleurotus pulmonarius and Pleurotus tuber-regium

MOHAMMED, H. A. – HORNIAKOVÁ, E.: Effect of using saturated and unsaturated fats in broiler diet on carsass performance

Foltys, V. – Kirchnerová, K.: Impact of lactation stage and milk production on milk fat fatty acids ratio

Short communication STAROŇ, M. – JUROVČÍKOVÁ, J. – ČERMÁKOVÁ, T. – STAROŇOVÁ D.: A scientific note on incidence of Nosema apis and Nosema ceranae in Slovakia during the years 2009 and 2010

ISSN 1337-9984 (Print) ISSN 1338-0095 (Online)