Clinics E-Book December 2011 by eBook Clinics

CLINICS Editor Mauricio Rocha-e-Silva Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Area Editors Ana Maria de Ulhoa Escobar Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Geraldo Busatto Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Paulo Hoff Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Anuar Ibrahim Mitre Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Gustavo Franco Carvalhal Faculdade de Medicina da Pontifı´cia Universidade Cato´lica do Rio Grande do Sul Porto Alegre, Rio Grande do Sul, Brazil

Renato Delascio Lopes Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ashok Agarwal The Cleveland Clinic Foundation Cleveland, Ohio, USA Berenice Bilharinho Mendonça Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Bruno Zilberstein Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Carlos Serrano Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Carmen Silvia Valente Barbas Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Claudia Regina Furquim de Andrade Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Edmund Chada Baracat Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Eliete Bouskela Universidade do Estado do Rio de Janeiro Rio de Janeiro, RJ, Brazil Emilia Inoue Sato Universidade Federal de Saõ Paulo Saõ Paulo, SP, Brazil Fulvio Alexandre Scorza Universidade Federal de Saõ Paulo Saõ Paulo, SP, Brazil

Heitor Franco de Andrade Jr. Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Ivete Bedin Prado Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Joaquim Prado Moraes-Filho Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Ludhmila Abrahao Hajjar Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Luı´z Eugeˆnio Garcez-Leme Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Lydia Masako Ferreira Universidade Federal de Saõ Paulo Saõ Paulo, SP, Brazil Maria Cecı´lia Solimene Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Newton Kara-Junior Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Olavo Pires de Camargo Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Rubens Belfort Jr. Universidade Federal de Saõ Paulo Saõ Paulo, SP, Brazil Ruy Jorge Cruz Junior University of Pittsburgh Pittsburgh, PA, USA Sergio Paulo Bydlowski Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Silvia Vanessa Lourenço Faculdade de Odontologia da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Simone Appenzeller Universidade Estadual de Campinas Campinas, SP, Brazil Sophie Françoise Mauricette Derchain Faculdade de Cieˆncias Me´dicas, Universidade Estadual de Campinas Campinas, SP, Brazil Suely Kazue Nagahashi Marie Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Thelma Suely Okay Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Vale´ria Aoki Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Editorial Board Abhijit Chandra King George’s Medical College Lucknow, India Adamastor Humberto Pereira Universidade Federal do Rio Grande do Sul Porto Alegre, RS, Brazil Adauto Castelo Universidade Federal de Saõ Paulo Saõ Paulo, SP, Brazil Ademar Lopes Fundaçaõ Antoˆnio Prudente, Hospital do Caˆncer Saõ Paulo, SP, Brazil Alberto Azoubel Antunes Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Alexandre Roberto Precioso Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Andrea Schmitt University of Goettingen Goettingen, Germany Arnaldo Valdir Zumiotti Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Saõ Paulo, SP, Brazil Cesar Gomes Victora Faculdade de Medicina da Universidade Federal de Pelotas Pelotas, RS, Brasil Daniel Romero Munõz Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Edmund Neugebauer Witten/Herdecke University Witten, North Rhine - Westphalia, Germany Egberto Gaspar de Moura Jr. Universidade do Estado do Rio de Janeiro Rio de Janeiro, RJ, Brazil Ernest Eugene Moore University of Colorado Denver Denver, CO, USA Euclides Ayres Castilho Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Fa´bio Biscegli Jatene Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Artur Brum-Fernandes Universite´ de Sherbrooke Que´bec, Canada´

Francisco Laurindo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Carmita Helena Najjar Abdo Faculdade de Medicina da Universidade de Sa˜o Paulo

Hiroyuki Hirasawa Chiba University School of Medicine Chiba, Japan

Irismar Reis de Oliveira Faculdade de Medicina da Universidade Federal da Bahia Salvador, BA, Brasil Irshad Chaudry University of Alabama Birmingham, AL, USA Ivan Cecconello Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Ke-Seng Zhao Southern Medical University Guangzhou, China Laura Cunha Rodrigues London School of Hygiene and Tropical Medicine - University of London London, UK Marcelo Zugaib Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Marco Martins Amatuzzi Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Maria Aparecida Shikanai Yasuda Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Mauro Perretti William Harvey Research Institute London, UK Michael Gregory Sarr

Mayo Clinic Rochester, MN, USA Milton de Arruda Martins Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Mitchell C. Posner The University of Chicago Medical Center Chicago, IL, USA Moyses Szklo Johns Hopkins Bloomberg School of Public Health Baltimore, USA Navantino Alves Faculdade de Cieˆncias Me´dicas de Minas Gerais Belo Horizonte, MG, Brazil Noedir Antonio Groppo Stolf Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Pedro Puech-Leaõ Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Peter Libby Brigham and Women’s Hospital Boston, Boston, MA, USA Philip Cohen University of Houston Health Center Houston, Texas, USA Rafael Andrade-Alegre Santo Toma´s Hospital Republic of Panama´, Panama´

Ricardo Antonio Refinetti Faculdade de Medicina da Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil Roberto Chiesa San Raffaele Hospital Milan, Italy Ronald A. Asherson

Netcare Rosebank Hospital Rosebank, Johannesburg, South A´frica Samir Rasslan Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Tarcisio Eloy Pessoa de Barros Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Valentim Gentil Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Wagner Farid Gattaz Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Board of Governors Antonio Alci Barone Arnaldo Valdir Zumiotti Berenice Bilharinho de Mendonça Clarice Tanaka Claudia Regina Furquim de Andrade Dalton de Alencar Fischer Chamone Daniel Romero Munõz Edmund Chada Baracat Eduardo Massad Eloisa Silva Dutra de Oliveira Bonfa´ Euclides Ayres de Castilho Euripedes Constantino Miguel Evandro Ararigboía Rivitti Fa´bio Biscegli Jatene Flair Jose´ Carrilho Francisco Vargas Suso Gerson Chadi Giovanni Guido Cerri Irineu Tadeu Velasco Ivan Cecconello

Jorge Elias Kalil Jose´ Antonio Franchini Ramires Jose´ Eduardo Krieger Jose´ Eluf Jose´ Ota´vio Costa Auler Jose´ Ricardo de Carvalho Mesquita Ayres Luiz Augusto Carneiro D’Albuquerque Luiz Francisco Poli de Figueiredo Magda Maria Sales Carneiro-Sampaio Manoel Jacobsen Teixeira Marcelo Zugaib Marcos Boulos Marcus Castro Ferreira Maria Aparecida Shikanai Yasuda Maria Irma Seixas Duarte Miguel Lorenzo Barbero Marcial Miguel Srougi Milberto Scaff Mı´lton de Arruda Martins Noedir Antonio Groppo Stolf

Editorial Director Kavita Kirankumar Patel-Rolim Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Olavo Pires de Camargo Paulo Andrade Lotufo Paulo Hila´rio Nascimento Saldiva Paulo Marcelo Gehm Hoff Pedro Puech-Lea˜o Ricardo Ferreira Bento Roberto Zatz Roger Chammas Samir Rasslan Sandra Josefina Ferraz Ellero Grisi Selma Lancman Tarcı´sio Eloy Pessoa de Barros Uenis Tannuri Umbertina Conti Reed Valentim Gentil Venaˆncio Avancini Ferreira Alves Vicente Odone Wagner Farid Gattaz Wilson Jacob

Editorial Assistant Nair Gomes Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Daniela Aquemi Higa Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil Ariane Maris Gomes Faculdade de Medicina da Universidade de Saõ Paulo Saõ Paulo, SP, Brazil

Editorial Office: Rua Dr. Ovı´dio Pires de Campos, 225 - 6 ˚ Andar Email: clinics@hcnet.usp.br Website: www.scielo.br/clinics

CEP 05403-010 Sa˜o Paulo/SP Tel.: +55-11-2661-6235 Submission: http://www.editorialmanager.com/clinics

Indexations: LILACS; MEDLINE; PubMed; PubMed Central; SciELO; Science Citation Index Expanded (ISI Web of Knowledge); Scopus; Ulrich’s Periodical Directory; Qualis/Capes - Classified as an International Circulation Journal in Medicine. Clinics. Saõ Paulo: Scientific Journal of Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, 2005Monthly Periodical: January to December ISSN 1678-3379 Formerly Revista do Hospital das Clıńicas da FMUSP, 1946–2004. 1. Medicine-scientific production. 2. Medical Sciences I. Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo. CDD 610

PUBLICATION INFORMATION AND EDITORIAL POLICIES CLINICS publishes peer-reviewed articles of interest to clinicians and researchers in the medical sciences. CLINICS is registered with PubMed Central and SciELO. This complies with the policies of funding agencies, such as, the Wellcome Trust, the Research Councils UK - RCUK, the National Institutes of Health(NIH), and the DFG, German Research Foundation, which request or require deposition of the published articles that they fund into such publicly available databases. CLINICS supports the position of the International Committee of Medical Journal Editors (http://www.icmje.org/) on trial registration. All trials initiated after January 1, 2012 must be registered prospectively (before patient recruitment begins) in a publicly accessible registry. Trials initiated before January 1, 2012 must be registered before submission to our journals. See the ICMJE FAQ on trial registration for further details. Visit http://www. who.int/ictrp/network/list_registers/en/index.html for the WHO’s list of approved registries. CLINICS suggests: http://www. clinicaltrials.gov/, a user friendly site.

Publication Fees CLINICS uses a business model in which expenses are recovered in part by charging a publication fee to the authors or research sponsors for each article they publish. Our 2011 prices are: Original Articles: R$ 1.700,00 (US$ 1,000.00); Review Articles: R$ 1.700,00 (US$ 1,000.00); Case Reports, Technical Notes, and Rapid Communications: R$ 1.000,00 (US$ 600.00); Invited Reviews, Editorials and Letters to the Editors: No charge. Manuscripts involving human subjects or the use of laboratory animals must clearly state adherence to appropriate guidelines and approval of protocols by their institutional review boards. Photographs that may identify patients or other human participants of studies shall be acceptable only when a legally valid permission (form provided when necessary) is signed by the said patient or other human participant or by his/her legally constituted representative. Manuscripts should be submitted online, in English, digitalized in a word.doc-compatible software program. Authors are strongly advised to submit the manuscript in its final form to a spell check for English (USA). Submissions with excessive spelling or syntax mistakes, as well as articles in which the meaning is not sufficiently clear shall be returned to authors for correction. Authors are also very strongly advised to limit abbreviations to the minimum possible. Abbreviations tend to make text unreadable. All abbreviations must be defined when first used. Only terms or expressions used at least 5 times throughput the text should be abbreviated. Never use abbreviations spelt as common English words such as, for instance FUN, PIN, SCORE, SUN, etc. Please make sure to submit your manuscript in the exact format described below. Failure to do so will cause the submission to be returned to you during the preliminary examination by the Editorial Office.

Manuscripts are invited in the following categories: ORIGINAL STUDY: Complete original studies should be submitted in this category. Three sections are offered: Basic, Clinical, and Surgical Research. Original Studies must follow the following format:

Title page:

N N N N

Title (up to 250 characters); Running title (up to 40 characters, letters and spaces); Full address of corresponding author only; Authors’ names (without titles or graduations). Authors should have participated sufficiently in the work to take public responsibility for appropriate portions of the content. Such participation must be declared in this section of the manuscript.

Manuscript:

N N

Abstract: limited to 250 words and structured into: Objectives, Method, Results, Conclusions. Citations or abbreviations (except internationally recognized such as weights, measures, physical or chemical) are not allowed. Authors are strongly recommended not to display numerical statistical information, but merely to state what is significantly different (or not) between described parameters. Keywords: 3–6 items from the Medical Subject Headings (Mesh) should be used. Introduction: should set the purpose of the study, give a brief summary (not a review) of previous relevant works, and state what new advance has been made in the investigation. It should not include data or conclusions from the work being reported. A final sentence summarizing the novelty to be presented is permissible. Materials and Methods: should briefly give clear and sufficient information to permit the study to be repeated by others. Standard techniques need only be referenced. Previously published methods may be briefly described following the reference. Ethics: when reporting experiments on human subjects, indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional or regional) and with the Helsinki Declaration of 1975, as revised in 1983. When reporting experiments on animals, indicate whether the institution’s or a national research council’s guide for, or any national law on the care and use of laboratory animals was followed. Results: should be a concise account of the new information discovered, with the least personal judgment. Do not repeat in text all the data in the tables and illustrations, but briefly describe what such material contains. Discussion: should be limited to the significance of the new information and relate the new findings to existing knowledge. Only unavoidable citations should be included. Citation to review articles are not encouraged in this section. Acknowledgements: should be short and concise, and restricted to those absolutely necessary. References in text: CLINICS adopts the Vancouver format. Cite references in text with Arabic numerals, in order of appearance, within parentheses (1), after previous word, with spacing as in this example: ‘‘Diabetes (2), hypertension (3,4) and alcoholism (5–9)

are complex medical problems (10).’’ Under exceptional circumstances authors’ names may appear in text: Single author: ‘‘Einstein (11) proposed a new theory …’’ Two authors: ‘‘Watson & Crick (12) reported on the structure of …’’ Three or more authors: ‘‘Smith et al (13) described …’’ Reference List: Only citations that appear in the text should be referenced. Unpublished papers, unless accepted for publication, should not be cited. Work accepted for publication should be referred to as ‘‘in press’’ and a letter of acceptance of the journal must be provided. Unpublished data should only be cited in the text as ‘‘unpublished observations’’, and a letter of permission from the author must be provided. Authors are responsible for the accuracy and completeness of their references and for correct text citation. CLINICS adopts the Vancouver format; references must be restricted to directly relevant published works, papers, or abstracts that have been accepted for publication. Usually the total number of references should not exceed 35. For up to six authors, list all authors; for more than 6 authors, list first six, followed by ‘‘et al’’. Tables and Figures: The maximum number of tables plus figures is six. Tables: Do not be incorporate Tables into the Manuscript. Upload each table individually into the system. Tables should be constructed using the Table feature in your word processor or using a spreadsheet program such as Excel. Tables should be numbered in order of appearance in the text with Arabic numerals. Each table should have a title and, if necessary, an explanatory legend. All tables must be referred to and succinctly described in the text. Under no circumstances should a table repeat data presented in an illustration. Statistical measures of variation (i.e., standard deviation, standard error) should be identified, and decimal places in tabular data should be restricted to those with mathematical and statistical significance. Figures: Do not incorporate Figures into the Manuscript. Photographs, illustrations, charts, drawings, line graphs, etc are all defined as Figures. We do not publish Pictures Graphics, Photos, etc. Number your figures consecutively in Arabic numerals in order of appearance. Upload each Figure individually into the system. Legend(s) should be descriptive and allow examination of the figure without reference to text. Legends should be incorporated into the Main Document, after the Tables (if any) or after the references. Photographic illustrations should must be of professional quality and uploaded as *.tiff files, Typewritten or hand lettering is unacceptable, as are figures generated by dot matrix printers. Generally, figures will be reduced to fit one column of text. Actual magnification of all photomicrographs should be provided, preferably by placing a length scale on the print. Line graphs and charts must never be sent as jpeg illustrations. It is usually best to prepare these as ExcelH files. When ready copy the line graph or chart to a word.doc sheet. Comments: Authors should use this space to describe the novelty contained in their original study. Only the

Editor of CLINICS has access to this section of the submission. FAST TRACK ARTICLES: Fast track articles should follow the same format described above for original studies. Fast track articles must be complete original studies with justifiable urgency for publication. The Editorial Office undertakes to produce a first action response in the shortest possible time and to publish accepted Fast Track articles in the next available issue. Only one article may be submitted as Fast Track in any calendar year by any author or co-author. In Comments, authors must explain the reasons for the claim to Fast Track. Rejection by journals with a higher Impact Factor that ours is an acceptable reason for requesting FAST TRACK, provided that the reviewers’ reports from the previous submission be included in the present submission. Information contained in the comments is limited to the Editor and shall remain confidential. No publication fee discount is allowed for accepted Fast Track articles. REVIEW ARTICLES: Such articles should cover themes relevant to medical practice or mammalian function. Spontaneously submitted reviews are welcome, but potential authors should bear in mind that they are expected to have expertise in the reviewed field. The sections should be arranged as follows:

N N

Title page: as in Original Study. Manuscript: Abstract, keywords and text should be arranged as best suited to cover the subject being reviewed. If appropriate, the manner of reference collection should be described. The use of headings, subheadings, and paragraph titles is encouraged for sake of clarity. Abbreviations, acknowledgements, Tables and Figures as in original studies. The number of references is at the discretion of the authors. No publication fee discount is allowed for spontaneously submitted review articles accepted for publication.

RAPID COMMUNICATIONS:

N N

Title page: as in Original Study. Manuscript: Rapid communications are limited to 1,500 words, except for the reference list. Authors should format such contributions as best suited to the subject at hand. No abstract or key words are required. Please copy an introductory sentence into the abstract box on Page 1 of the submission procedure.

CASE REPORTS: Case Reports will be published only if justified by the extreme rarity of the case and/or novelty of adopted procedures. Case reports should be arranged as follows:

N N

Title page: as in Original Study. Manuscript: Case reports are limited to 1,500 words, except for the reference list. The text should be divided into Introduction, Case Description, and Discussion. No abstract or key words should be included, but please make sure to copy your Introduction into the abstract box of the submission form. Abbreviations, References, Tables and Figures (maximum of four, altogether) follow the format described for Original Studies. No publication fee discount is allowed for case reports accepted for publication.

LETTERS TO THE EDITOR: Letters to the Editor expressing comments or dissenting opinions concerning articles recently published in CLINICS are not submitted to peer review and are published at the discretion of the Editor. A letter is a single section untitled text, followed by references, to include the article under discussion. No publication fee is charged for this class of manuscripts. EDITORIAL: Editorials should cover broad aspects of Medical or Biological sciences. Such manuscripts are not submitted to peer review and are published at the discretion of the Editor. A letter is a single section untitled text, followed by references, if applicable. No publication fee is charged for this class of manuscripts. COMMENTARY: A commentary is an invited text with respect to an article being published by Clinics. No publication fee is charged for this class of manuscripts. INVITED REVIEW: Invited reviews follow the general pattern proposed for general reviews but are by invitation only. No publication fee is charged for this class of manuscripts. SPECIAL ISSUE ARTICLE: Special issue articles are by invitation only and follow a specific pattern set out by the Editor in charge of the collection.

Peer Review: Manuscripts are reviewed by at least two expert consultants. Accepted manuscripts are edited to comply with the Journalâ&#x20AC;&#x2122;s format, to remove redundancies, and to improve clarity and understanding without altering meaning. The edited text will be presented to authors for approval. Submission: A copyright transfer form, signed by all authors, must be submitted by fax (55-11-2661-7524) or by mail as soon as the manuscript is submitted. Any financial or other relationships that could lead to a conflict of interest must be disclosed in the copyright transfer form. If the Editor considers this conflict of interest relevant to the paper, a footnote will be added to show the equity interest in or affiliation with the identified commercial firm(s). As soon as authors are satisfied that the manuscript complies with the Journal format, our site should be accessed through www. clinics.org.br. The system will guide authors through the manuscript submission process and prompt authors to input information into specific fields as they are submitting their manuscript. The Editorial Office will be automatically notified of the submission and will send an email confirming it as soon as the submission letter reaches the office. Progress of the manuscript through the Editorial Office procedures will be available to authors at all times.

ISSN-1807-5932

CLINICS CONTENTS Clinics 2011 66(12):2001–2183

CLINICAL SCIENCES

A randomized controlled trial evaluating early versus traditional oral feeding after colorectal surgery Ahmet Dag, Tahsin Colak, Ozgur Turkmenoglu, Ramazan Gundogdu, Suha Aydin . . . . . . . . . . . . . . . . . . . . . . . 2001

Influence of perineal prostatectomy on anal continence Na´dia Ricci Guilger, Jose´ Marcio Neves Jorge, Renato Prado Costa, Fernando Cesar Salla, Magaly Gemio Teixeira, Sergio Carlos Nahas, Ivan Cecconello . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2007

Direct fluorescent antibody assay and polymerase chain reaction for the detection of Chlamydia trachomatis in patients with vernal keratoconjunctivitis Maria Cristina Nishiwaki-Dantas, Mariza Toledo de Abreu, Cynthia Mendonc¸a de Melo, Ivana Lopes Romero, Rubens Belfort Matos Neto, Paulo Elias Correa Dantas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2013

Analysis of the reactivity of indirect immunofluorescence in patients with pemphigus foliaceus and pemphigus vulgaris using rat bladder epithelium as a substrate Damaris G. Ortolan, Danielle P. G. Souza, Vale´ria Aoki, Claudia G. Santi, Tatiana V. B. Gabbi, Ligia M. F. Ichimura, Celina W. Maruta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2019

A multidetector tomography protocol for follow-up of endovascular aortic aneurysm repair Roberto Moraes Bastos, Alvaro Razuk Filho, Roberto Blasbalg, Roberto Augusto Caffaro, Walter Khegan Karakhanian, Antonio Jose´ Rocha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2025

Campaign, counseling and compliance with influenza vaccine among older persons Vivian lida Avelino-Silva, Thiago Junqueira Avelino-Silva, Joao Luiz Miraglia, Karina Takesaki Miyaji, Wilson JacobFilho, Marta Heloisa Lopes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2031

Lactate and base deficit are predictors of mortality in critically ill patients with cancer Ludhmila Abraha˜o Hajjar, Rosana Ely Nakamura, Juliano Pinheiro de Almeida, Julia T. Fukushima, Paulo Marcelo Gehm Hoff, Jean-Louis Vincent, Jose´ Ota´vio Costa Auler Ju´nior, Filomena Regina Barbosa Gomes Galas . . . . . . . 2037

Abnormal sensory integration affects balance control in hemiparetic patients within the first year after stroke Clarissa B. Oliveira, I´talo R. T. Medeiros, Mario G. Greters, Norberto A. F. Frota, Leandro Tavares Lucato, Milberto Scaff, Adriana B. Conforto . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2043

Off-pump coronary artery bypass surgery in selected patients is superior to the conventional approach for patients with severely depressed left ventricular function Guido Marco Caputti, Jose´ Hono´rio Palma, Diego Felipe Gaia, Enio Buffolo . . . . . . . . . . . . . . . . . . . . . . . . . . . 2049

Chronic hepatitis virus infection in patients with multiple myeloma: clinical characteristics and outcomes Chung-Jen Teng, Han-Tsung Liu, Chun-Yu Liu, Chi-Hsiu Hsih, Jih-Tung Pai, Jyh-Pyng Gau, Jin-Hwang Liu, Tzeon-Jye Chiou, Hui-Chi Hsu, Po-Min Chen, Cheng-Hwai Tzeng, Yuan-Bin Yu . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2055

A 3-year follow-up study of all-ceramic single and multiple crowns performed in a private practice: a prospective case series Gianluca M. Tartaglia, Ernesto Sidoti, Chiarella Sforza. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2063

Methicillin-resistant staphylococcus aureus (MRSA) carriage in a dermatology unit Renata L. Pacheco, Renata D. Lobo, Maura S. Oliveira, Elthon F. Farina, Cleide R. Santos, Silvia F. Costa, Maria Clara Padoveze, Cilmara P. Garcia, Priscila A. Trindade, Ligia M. Quite´rio, Evandro A. Rivitti, Elsa M. Mamizuka, Anna S. Levin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2071

Muscle strength and exercise intensity adaptation to resistance training in older women with knee osteoarthritis and total knee arthroplasty Emmanuel Gomes Ciolac, Ju´lia Maria D’Andre´a Greve . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2079

Total inspiratory and expiratory impedance in patients with severe chronic obstructive pulmonary disease Karla Kristine Dames Silva, Agnaldo Jose´ Lopes, Jose´ Manoel Jansen, Pedro Lopes de Melo . . . . . . . . . . . . . . . . 2085

Cryopreservation time does not decrease follicular viability in ovarian tissue frozen for fertility preservation Jacira Ribeiro Campos, Julio Cesar Rosa-e-Silva, Bruno Ramalho Carvalho, Alessandra Aparecida Vireque, Marcos Felipe Silva-de-Sa´, Ana Carolina Japur de Sa´ Rosa-e-Silva . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2093

BASIC RESEARCHES

Continuously Variable Rating: a new, simple and logical procedure to evaluate original scientific publications Mauricio Rocha e Silva, Editors CLINICS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2099

Moderate exercise training promotes adaptations in coronary blood flow and adenosine production in normotensive rats Fernanda R. Roque, Ursula Paula Reno´ Soci, Katia De Angelis, Marcele A. Coelho, Cristina R. Furstenau, Dalton V. Vassallo, Maria Claudia Irigoyen, Edilamar M. Oliveira . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2105

Expression of TGF-b1 in the blood during fracture repair in an estrogen-deficient rat model Mohamed Abdalla Estai, Farihah Suhaimi, Srijit Das, Ahmad Nazrun Shuid, Zahiah Mohamed, Ima-Nirwana Soelaiman . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2113

Curcumin, but not Prima-1, decreased tumor cell proliferation in the syngeneic murine orthotopic bladder tumor model Fa´bio T. Watanabe, Daher C. Chade, Sabrina T. Reis, Camila Piantino, Marcos Francisco Dall’ Oglio, Miguel Srougi, Katia R. M. Leite . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2121

The effects of heated vegetable oils on blood pressure in rats Kamsiah Jaarin, Mohd Rais Mustafa, Xin-Fang Leong . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2125

REVIEWS

The effects of dietary supplementation with Agaricales mushrooms and other medicinal fungi on breast cancer: Evidence-based medicine Maria Rita Carvalho Garbi Novaes, Fabiana Valadares, Mariana Campos Reis, Daniella Rodrigues Gonc¸alves, Marilia da Cunha Menezes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2133

Should we definitively abandon prophylaxis for patent ductus arteriosus in preterm new-borns? Vassilios Fanos, Michele Pusceddu, Angelica Dessı`, Maria Antonietta Marcialis . . . . . . . . . . . . . . . . . . . . . . . . . . 2141

Protective measures against ultrafiltration failure in peritoneal dialysis patients Anna Rita Aguirre, Hugo Abensur . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2151

A survey of recently published cardiovascular, hematological and pneumological original articles in the Brazilian scientific press Kavita Kirankumar Patel, Bruno Caramelli, Ariane Gomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2159

CASE REPORTS

Persistent pusher behavior after a stroke Taiza E. G. Santos-Pontelli, Octavio M. Pontes-Neto, Draulio B. de Araujo, Antonio Carlos Santos, Joao P. Leite . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2169

Spontaneous bacterial peritonitis complicating ovarian hyperstimulation syndrome-related ascites Leandro Utino Taniguchi, Cla´udia Gennari Lacerda Jorge, Lucas Fernandes de Oliveira . . . . . . . . . . . . . . . . . . . . 2173

Thymic hyperplasia in Graves’ disease Debora Lucia Seguro Danilovic, Regina Matsunaga Martin, Pedro Caruso, Suemi Marui . . . . . . . . . . . . . . . . . . . 2177

Herpes Zoster as a Sign of AIDS and nonadherence to antiretroviral therapy: a case report Helena Lucia Barroso dos Reis, Fernanda Sampain Cavalcante, Katia Regina Netto dos Santos, Mauro Romero Leal Passos, Bdennis de Carvalho Ferreira . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2179

ERRATA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2183

CLINICS 2011;66(12):2001-2005

DOI:10.1590/S1807-59322011001200001

CLINICAL SCIENCE

OBJECTIVE: This prospective randomized clinical study was conducted to evaluate the safety and tolerability of early oral feeding after colorectal operations. METHODS: A total of 199 patients underwent colorectal surgery and were randomly assigned to early feeding (n = 99) or a regular diet (n = 100). Patients’ characteristics, diagnoses, surgical procedures, comorbidity, bowel movements, defecation, nasogastric tube reinsertion, time of tolerance of solid diet, complications, and length of hospitalization were assessed. RESULTS: The two groups were similar in terms of gender, age, diagnosis, surgical procedures, and comorbidity. In the early feeding group, 85.9% of patients tolerated the early feeding schedule. Bowel movements (1.7¡0.89 vs. 3.27¡1.3), defecation (3.4¡0.77 vs. 4.38¡1.18) and time of tolerance of solid diet (2.48¡0.85 vs. 4.77¡1.81) were significantly earlier in the early feeding group. There was no change between the groups in terms of nasogastric tube reinsertion, overall complication or anastomotic leakage. Hospitalization (5.55¡2.35 vs. 9.0¡6.5) was shorter in the early feeding group. CONCLUSIONS: The present study indicated that early oral feeding after elective colorectal surgery was not only well tolerated by patients but also affected the postoperative outcomes positively. Early postoperative feeding is safe and leads to the early recovery of gastrointestinal functions. KEYWORDS: Early Feeding; Colorectal Surgery; Postoperative Complication; Fasting. Dag A, Colak T, Turkmenoglu O, Gundogdu R, Aydin S. A randomized controlled trial evaluating early versus traditional oral feeding after colorectal surgery. Clinics. 2011;66(12):2001-2005. Received for publication on April 14, 2011; First review completed on May 23, 2011; Accepted for publication on June 30, 2011 E-mail: dahmetdag@yahoo.com Tel.: 90 324 3374300

stomach and pancreas secrete one to two liters of fluid daily, which is readily absorbed in the small intestine.5 Therefore, patients without a nasogastric tube postoperatively are in fact tolerating high volumes of fluid.6-9 In addition, starvation changes the body’s metabolism within 24 hours by increasing insulin resistance and reducing muscle function. Several studies suggested that after surgery, optimal nutritional status and maintenance of bowel function contribute significantly to wound healing.10,11 Early oral intake has also been suggested to reduce sepsis risk because of decreased bacterial colonization and decreased translocation through defects on the bowel mucosa into the blood circulation.11 Based on these findings, the concept of withholding oral intake postoperatively does not seem to be reasonable. Standardized care pathways have been used over the last decade to reduce the length of stay after abdominal surgery. Another potential advantage of an early feeding scheme is that the patients tend to have shorter hospital stays. Because a clear rationale for delaying oral intake after colorectal surgery is lacking and there are potential benefits from early postoperative feeding, we planned a prospective randomized study. The aim of the present prospective randomized clinical study was to evaluate the safety and tolerability of early oral

INTRODUCTION After colorectal operations, traditional care regimens have usually included restricted oral intake to prevent signs of postoperative ileus and to protect the surgical anastomoses. This practice has been challenged by evidence from several gastrointestinal physiologic studies that examined the contractile activity of the intestine. Whereas postoperative dysmotility predominantly affects the stomach, the small bowel recovers normal function 4–8 hours after laparotomy.1-3 These data suggest that the concept of postoperative ileus as a paralysis of the entire bowel with the complete absence of any functional contractile activity is misleading. When postoperative ileus develops, it is usually transient and clinically not significant. Therefore, feeding within 24 hours after laparotomy is tolerated, and the feed is absorbed.4-5 The other rationale for withholding food or feeding animals orally is to allow anastomoses time to heal before being stressed by food. However, it is known that the Copyright ß 2011 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported.

2001

Oral feeding after colorectal surgery Dag A et al.

CLINICS 2011;66(12):2001-2005

Traditional postoperative care regimens after colorectal surgery in which postoperative oral feeding is gradually introduced following the resumption of bowel sounds and the passage of flatus or stools is based mainly on the fear that early oral feeding can increase anastomotic leakage and prolong paralytic ileus. The current practice is to reduce the withholding of oral intake as soon as possible. The current findings support this. The early feeding protocol that was administered in this study did not increase anostomotic leakage or prolong paralytic ileus or hospital stay.

time of tolerance of solid diet, and complications were secondary clinical endpoints. Primary hospital stay was expressed as days in hospital after surgery. All of the patients were monitored for bowel movements, nasogastric tube reinsertion, and time of tolerance of solid diet, complications, and the length of hospitalization. The presence of bowel movements was assessed daily by two independent investigators. Patients’ examinations were conducted and recorded by the colorectal unit doctors. The nasogastric tube was reinserted if two or more episodes of vomiting of more than 100 ml occurred in the absence of bowel movement. Patients in both groups were discharged once they fulfilled all the following discharge criteria, including the passage of flatus or stools, toleration of oral liquid and solid food, comfortable on oral analgesia and no complications that required hospital treatment.

MATERIALS AND METHODS

STATISTICAL ANALYSIS

Between August 2007 and September 2009, a total of 215 consecutive patients who were undergoing elective open colorectal cancer surgery were enrolled in this study. The study was approved by the local Ethical Committee at the University Hospital, Mersin, Turkey. Informed consent was obtained from all patients. All consecutive patients were included in this study, regardless of American Society of Anesthesiologists (ASA) score, comorbidity, localization and stage of the tumor, preoperative chemoradiotherapy, and diabetes. However, the patients that were scheduled to have an ileostomy or colostomy and patients who underwent an operation that was finished by creating a colostomy or ileostomy were excluded from the study. A total of 16 patients were excluded from the study: colostomy was necessary for four patients and ileostomy was necessary for three patients; three patients were excluded because of advanced metastatic disease, for which colonic resection was not performed; and six patients refused to participate. Finally, 199 patients were assigned randomly to the early oral feeding group (Group 1, n = 99) or regular feeding group (Group 2, n = 100). The perioperative care protocol in the early oral feeding group included early postoperative oral feeding commencing approximately 12 hours after the operation with a fluid diet; this was gradually increased to a solid diet as tolerated by the patient. The perioperative care protocol in the regular diet feeding group consisted of fasting until the patient passed first flatus or stools. Randomization was performed according to a computergenerated list immediately after surgery by an independent computer consultant. All patients underwent standard bowel preparation based on FleetH phospho-soda (Kozmed Ltd., Istanbul, Turkey) and received i.v. prophylactic antibiotics before surgery. A standard anesthetic protocol was followed and routine monitoring applied. A nasogastric tube was inserted before surgery and removed immediately after surgery. Postoperative pain management was similar in all patients and obtained with a patientcontrolled analgesic intravenous pump with meperidine hydrochloride 1 mg/mL solution 300 mg to 400 mg/ 24 hours for 48 to 72 hours, followed by intramuscular dipyrone (Sanofi Aventis Co., Istanbul, Turkey) or acetaminophen (650 mg) 4 to 6 times daily. Patient characteristics and comorbidity (e.g., with diabetes mellitus), diagnoses, and surgical procedures were recorded. Primary hospital stay was accepted as a primary clinical endpoint, whereas bowel movements, defecation,

In order to detect a mean difference of one day in the postoperative length of hospital stay, a minimum sample size of 81 patients for each group was calculated, with an alpha of 0.05, an expected standard deviation of less than two days, and a power of 0.90. The sample size was established before the study, and 100 patients were established in each arm to provide appropriate statistical power analyses. The results were expressed as mean¡standard deviation (SD). Differences between the treatment groups were analyzed with the x2 test and the Mann-Whitney U-test. The Mann Whitney U-test was performed for nonparametric data such as gender, comorbidity, diabetes mellitus, diagnosis, surgical procedures, nasogastric tube insertion, and complication rate. The Pearson x2 test was performed for dependent variables (age, bowel moment, time taken to tolerate a solid diet, time to first defecation, and hospital stay). Probability values of less than 0.05 were considered significant.

feeding after elective open abdominal colorectal surgery in terms of gastrointestinal recovery, complications, and the length of hospitalization.

CLINICAL RELEVANCY

RESULTS The early feeding group included 52 males and 47 females, with a mean age of 62¡12.33 years, whereas the regular feeding group consisted of 61 males and 39 females, with a mean age of 61¡15.82 years. There was no significant difference between the two groups in terms of gender or age of the patients (p = 0.254 and p = 0.981, respectively). In addition, there were no statistically significant differences between the two groups regarding patients’ comorbid diseases and diabetes mellitus (p = 0.563 and p = 0.500, respectively). The two groups were also similar on the basis of patients’ diagnosis and the type of operation performed (p = 0.279 and p = 0.143, respectively). The patients’ demographics are shown in Table 1. The majority of the patients in the early feeding group (85.9%) tolerated the early feeding schedule. When considering the gastrointestinal recovery, earlier intestinal movements (1.70¡0.89 vs. 3.27¡1.3, p,0.001) and defecation (3.40¡0.77 vs. 4.38¡1.18, p,0.001) were observed in the early feeding group’s patients as opposed to the regular feeding group’s patients. Moreover, the regular diet was tolerated by patients in the early feeding group significantly earlier than those in the regular feeding group (2.48¡0.85 vs. 4.77¡1.81, p,0.001). Eight patients required nasogastric tube reinsertion in the early feeding group, whereas six patients in the regular diet group required nasogastric tube

2002

CLINICS 2011;66(12):2001-2005

Oral feeding after colorectal surgery Dag A et al.

or nutrients until resolution of the postoperative ileus. Recently, this approach has been increasingly questioned, and intensive efforts have been made to obtain relevant clinical evidence. Today, a few studies have shown that nasogastric tube insertion has a limited role in postoperative care for abdominal surgery.9,12-14 In addition, trials comparing postoperative fasting and early enteral feeding after gastrointestinal resections have not shown a clear advantage. The authors suggested that early feeding might be of benefit in terms of morbidity and mortality.15-20 The reasons surgeons use nasogastric intubation is to prevent gastric dilatation, to treat postoperative paralytic ileus, and to decrease tension on intestinal anastomosis. However, studies investigating gastric emptying after transabdominal vascular surgery concluded that a normal diet may be started on the second day after surgery.21 Moreover, Han Geurts et al. removed nasogastric tubes directly after elective abdominal surgery in all cases. Their findings justified the conclusion that patients were able to judge their own food tolerance adequately.22 Similarly, in the present study, nasogastric tubes were inserted before surgery and removed immediately after surgery in all patients as a standard practice. This approach was tolerated by most of the patients, and the reinsertion of a nasogastric tube was rarely needed in either group. Furthermore, this condition was free from the concept of feeding. Postoperative ileus is an important factor determining and contributing negatively to postoperative convalescence. The mechanisms of this involve the stimulation of pain fibers, excessive sympathetic tone, and the release of inhibitory neurotransmitters from the gut wall.23 Gastrointestinal physiologic studies that examined the contractile activity of the intestine showed that the small bowel recovered normal function 4–8 hours after laparotomy and that gastric emptying resumed on the first postoperative day.1,2,7 It was suggested that the early resumption of an oral diet diminishes the duration of ileus. In the present study, the early enteral feeding group patients had an oral diet on the day after the operation without evidence of bowel motility, and most of these patients tolerated the early feeding schedule. This result showed that oral feeding can be started on the first postoperative day without waiting for the resolution of postoperative ileus. Thus, the patients can be protected from starvation and the related side effects, such as metabolic imbalance. This situation might diminish the complications and accelerate recovery. In the present study, early feeding resulted in early intestinal movements and defecation. These findings show that an early oral diet improved the gastrointestinal recovery parameters

Table 1 - The patients’ demographics and baseline data.

Sex (M/F) Age (years) Comorbidity Cardiac Pulmonary Cardiac and Pulmonary Urinary Diabetes Mellitus Diagnosis Rectum Sigmoid Colon Left Colon Transverse Colon Right Colon Surgical Procedures Very Low Anterior Resection Low Anterior Resection Anterior Resection Sigmoidectomy Left Hemicolectomy Transverse Colectomy Right Hemicolectomy Subtotal Colectomy

Early oral feeding (n = 99)

Regular diet (n = 100)

52 : 47 62 (35-85)

61 : 39 61 (17-89)

12 6 3 1 13

14 4 4 1 12

39 34 6 1 19

37 27 11 5 20

28 11 5 5 1 19 10

26 12 3 11 5 20 2

p-value 0.199 0.479 0.984

0.500 0.279

0.143

reinsertion. However, this difference was not statistically significant (p = 0.363). Table 2 shows the gastrointestinal recovery parameters. No statistical difference was found between the two groups when considering all the postoperative complications (p = 0.541). Fewer anastomotic leakages were shown in the early feeding group when compared with the regular feeding group. While six anastomotic leakages in the regular diet group developed, only two anastomotic leakages developed in the early feeding group. However, the difference was not statistically significant (p = 0.279). The postoperative complications are summarized in Table 2. The mean hospital stay was significantly shorter in the early feeding group when compared with the regular diet group (5.55¡2.35 vs. 9.00¡6.50, p,0.001).

DISCUSSION Traditionally, the postoperative management of patients undergoing colorectal surgery has involved the use of nasogastric tubes and avoidance of the oral intake of fluids

Table 2 - Gastrointestinal recovery parameters and postoperative complications. Early enteral

Regular diet

p-value

1.76 (1–6) 3.41 (2–6) 2.48 (2–7) 8 5.55 (4–22) 12 5 3 1 1 0 0 2

3.27 (1–10) 4.38 (2–10) 4.77 (2–16) 6 9.0 (4–49) 14 7 3 0 2 1 1 6

0.0001 0.0001 0.0001 0.363 0.0001 0.541

Time of intestinal movements (days) Time to defecation (days) Time to toleration of a regular diet (days) No reinsertion of the nasogastric tube Hospital stay (days) Complications Wound infection Pneumonia Toxic Hepatitis Sepsis Evisceration Cerebral Infarct Anastomotic leakage

2003

0.279

Oral feeding after colorectal surgery Dag A et al.

CLINICS 2011;66(12):2001-2005

2. Casto CJ, Krammer J, Drake J. Postoperative feeding: a clinical review. Obstetrical and Gynecological Survey. 2000;55:571–3, doi: 10.1097/ 00006254-200009000-00022. 3. Ortiz H, Armendariz P, Yarnoz C. Is early postoperative feeding feasible in elective colon and rectal surgery? International Journal of Colorectal Disease. 1996;11:119–21, doi: 10.1007/s003840050032. 4. Pearl ML, Valea FA, Fischer M, Mahler L, Chalas E. A randomized controlled trial of early postoperative feeding in gynecologic oncology patients undergoing intra-abdominal surgery. Obstet Gynecol. 1998;92:94–7, doi: 10.1016/S0029-7844(98)00114-8. 5. Bufo AJ, Feldman S, Daniels GA, Lieberman RC. Early postoperative feeding. Dis Colon Rectum. 1994;37:1260–5, doi: 10.1007/BF02257793. 6. Lassen K, Hannemann P, Ljungqvist O, Fearon K, Dejong CHC, von Meyenfeldt MF, et al. Patterns in current perioperative practice: survey of colorectal surgeons in five northern European countries. British Journal of Medicine. 2005;330:1420–1, doi: 10.1136/bmj.38478.568067. AE. 7. Bauer JJ, Gelernt JM, Salky BA, Keel J. Is routine postoperative nasogatric decompression really necessary? Ann Surg. 1985;201:233–6, doi: 10.1097/ 00000658-198502000-00017. 8. Nelson R, Edwards S, Tse B. Prophylactic nasogastric decompression after abdominal surgery. Cochrane Database Syst Rev. 2007;18 3:CD 004929. 9. Nathan BN, Pain JA. Nasogastric suction after elective abdominal surgery: a randomized study. Ann R Coll Surg Engl. 1991;73:291-4 10. Windsor JA, Knight GS, Hill GL. Wound healing response in surgical patients: recent food intake is more important than nutritional status. British Journal Surgery. 1988;75:135–7, doi: 10.1002/bjs.1800750215. 11. Deitch EA, Andrassy RJ, Booth FVM, Moore FA. Current concepts in postoperative feeding. Contemporary Surgery. 1991;39:37–55. 12. Rao W, Zhang X, Zhang J, Yan R, Hu Z, Wang Q. The role of nasogastric tube in decompression after elective colon and rectum surgery: a metaanalysis. Int J Colorectal Dis. 2011;26:423-9, doi: 10.1007/s00384-0101093-4. 13. Davila-Perez R, Bracho-Blanchet E, Tovilla-Mercado JM, HernandezPlata JA, Reyes-Lopez A, Nieto-Zermen˜o J. Unnecessary gastric decompression in distal elective bowel anastomoses in children: a randomized study. World J Surg. 2010;34:947-53, doi: 10.1007/s00268-010-0442-3. 14. Petrelli NJ, Stulc JP, Rodriquez-Bigas M, Blumenson L. Nasogastric decompression following elective colorectal surgery. Am Surg. 1993;59: 632-5. 15. Schoetz DJ Jr, Bockler M, Rosenblatt MS, Malhotra S, Roberts PL, Murray JJ, et al. ‘Ideal’ length of stay after colectomy: whose ideal? Dis. Colon Rectum. 1997;40:806–10, doi: 10.1007/BF02055437. 16. Lewis SJ, Egger M, Sylvester PA, Thomas S. Early enteral feding versus ‘nil by mouth’ after gastrointestinal surgery: systematic review and meta-analysis of controlled trials. BMJ. 2001;323:1–5, doi: 10.1136/bmj.323.7303.1. 17. Carr CS, Ling KD, Boulos P, Singer M. Randomised trial of safety and efficacy of immediate postoperative enteral feeding in patients undergoing gastrointestinal resection. BMJ. 1996;312:869-71. 18. Heslin MJ, Latkany L, Leung D, Brooks AD, Hochwald SN, Pisters PW, et al. A prospective, randomized trial of early enteral feeding after resection of upper gastrointestinal malignancy. Ann Surg. 1997;226:56777, doi: 10.1097/00000658-199710000-00016. 19. Arsalani-Zadeh R, Ullah S, Khan S, Macfie J. Current pattern of perioperative practice in elective colorectal surgery; a questionnaire survey of ACPGBI members. Int J Surg. 2010;8:294-8, doi: 10.1016/j.ijsu. 2010.01.014. 20. Hasenberg T, La¨ngle F, Reibenwein B, Schindler K, Post S, Spies C, et al. Current perioperative practice in rectal surgery in Austria and Germany. Int J Colorectal Dis. 2010;25:855-63, doi: 10.1007/s00384-010-0900-2. 21. Avrahami R, Cohen JD, Haddad M, Singer P, Zelikovski A. Gastric emptying after elective abdominal aortic aneurysm surgery: the case for early postoperative enteral feeding. Eur J Vasc Endovasc Surg. 1999;17:241-4, doi: 10.1053/ejvs.1998.0744. 22. Han-Geurts IJ, Jeekel J, Tilanus HW, Brouwer KJ. Randomized clinical trial of patient-controlled versus fixed regimen feeding after elective abdominal surgery. Br J Surg. 2001;88:1578-82, doi: 10.1046/j.0007-1323. 2001.01934.x. 23. Holte K, Kehlet H. Postoperative ileus: a preventable event. Br J Surg. 2000;87:1480, doi: 10.1046/j.1365-2168.2000.01595.x 24. Ozerhan IH, Ersoz N, Onguru O, Ozturk M, Kurt B, Cetiner S. Fascin expression in colorectal carcinomas. Clinics. 2010;65:157-64, doi: 10.1590/ S1807-59322010000200007. 25. Gonc¸alves CG, Groth AK, Ferreira M, Matias JE, Coelho JC, Campos AC. Influence of preoperative feeding on the healing of colonic anastomoses in malnourished rats. J Parenter Enteral Nutr. 2009;33:83-9, doi: 10.1177/ 0148607108327047. 26. Filiz AI, Sucullu I, Kurt Y, Karakas DO, Gulec B, Akin ML. Persistent high postoperative carcinoembryonic antigen in colorectal cancer patients—is it important? Clinics. 2009;64:287-94, doi: 10.1590/S180759322009000400004.

and shortened the duration of postoperative ileus. However, although the two groups were similar in terms of gender, age, diagnosis, surgical procedures, and comorbidity, there is a difference in the number of subtotal colectomies. In the early feeding group, subtotal colectomy was more common than in the other group. We accepted this condition as a bias of the study. Another common belief (which lacks evidence) is that patients should not eat for several days after colorectal surgery in order to avoid anastomotic leakage. However, there is evidence that adequate oral intake has a strengthening effect on intestinal anastomoses and does not lead to anastomotic complications. In addition, carcinomas negatively affect wound healing. Furthermore, it was shown that feeding reverses the mucosal atrophy induced by starvation and increases anastomotic collagen deposition and strength.24-26 Experimental data in both animals and humans suggest that enteral nutrition is associated with an improvement in wound healing.27-28 In agreement with the literature, in the present study, early oral feeding did not alter the incidence of anastomotic leakage and overall complications. The psychological impact of oral fluids and food following surgery was considered and an improved sense of well-being was observed in the patients who ate sooner.29 The psychological aspect also has a significant role throughout the postoperative recovery process. However, there are no trials comparing early feeding and conventional feeding after colorectal operations in terms of analgesic requirements. Lower pain perceptions and improved general health perceptions are advantageous. Earlier oral feeding has been shown to shorten the postoperative hospital stay in some trials following gastrointestinal surgery.30 In addition, early feeding leads to earlier discharge from the hospital after nongastrointestinal procedures.31 However, in studies following colorectal operations, the elimination of nasogastric tubes and earlier oral feeding have failed to show any association with a shorter length of hospital stay.15,22,32 A shorter hospital stay is a potential advantage of early postoperative feeding, and this feature was demonstrated in the present study. Because early feeding significantly shortens the length of ileus, it also significantly shortens the length of hospitalization. The overall reduction corresponded to approximately 3.5 days, which is clinically important. In our study, patients undergoing colectomy were started on early oral intake regardless of objective signs of the return of bowel functions; this protocol was demonstrated to be safe and effective, with a shortened hospital stay as the primary benefit.

ACKNOWLEDGMENT No financial support played a role in the trial. Our special thanks to Arzu Kanik, Professor of the Department of Biostatistics. We confirm that Tables 1–3 presented in this manuscript were created specifically for this manuscript and have not been borrowed or adapted from any other source.

AUTHOR CONTRIBUTIONS Dag A conceived and designed the study. Colak T was responsible for the data analysis and interpretation. Turkmenoglu O and Gundogdu R were responsible for the acquisition of data. Aydin S was responsible for the critical revision of the manuscript.

REFERENCES 1. Silk DBA, Gow NM. Postoperative starvation after gastrointestinal surgery. British Medical Journal. 2001;323:761–2, doi: 10.1136/bmj.323. 7316.761.

2004

CLINICS 2011;66(12):2001-2005

Oral feeding after colorectal surgery Dag A et al.

27. Demetriades H, Botsios D, Kazantzidou D, Sakkas L, Tsalis K, Manos K, et al. Effect of early postoperative enteral feeding on the healing of colonic anastomosis in rats. Eur Surg Res. 1999;31:57–63, doi: 10.1159/000008621. 28. Inan A, Sen M, Surgit O, Ergin M, Bozer M. Effects of the histamine H2 receptor antagonist famotidine on the healing of colonic anastomosis in rats. Clinics. 2009;64:567-70, doi: 10.1590/S1807-59322009000600012. 29. Schilder JM, Hurteau JA, Look KY, Moore DH, Raff G, Stehman FB, et al. A prospective controlled trial of early postoperative oral intake following major abdominal gynecologic surgery. Gynecol Oncol. 1997;67:235–40, doi: 10.1006/gyno.1997.4860.

30. Cheatham ML, Chapman WC, Key SP, Sawyers JL. A metaanalysis of selective versus routine nasogastric decompression after elective laparotomy. Ann. Surg. 1995;221:469–76, doi: 10.1097/00000658-199505000-00004. 31. Steed HL, Capstick V, Flood C, Schepansky A, Schulz J, Mayes DC. A randomized controlled trial of early versus ‘traditional’ postoperative oral intake after major abdominal gynecologic surgery. Am J Obstet Gynecol. 2002;186:861–5, doi: 10.1067/mob.2002.123057. 32. Feo CV, Romanini B, Sortini D, Ragazzi R, Zamboni P, Pansini GC, et al. Early oral feeding after colorectal resection: a randomized controlled study. ANZ J Surg. 2004;74:298-301, doi: 10.1111/j.1445-1433.2004.02985.x.

2005

CLINICS 2011;66(12):2007-2012

DOI:10.1590/S1807-59322011001200002

CLINICAL SCIENCE

Influence of perineal prostatectomy on anal continence Na´dia Ricci Guilger,I Jose´ Marcio Neves Jorge,I Renato Prado Costa,II Fernando Cesar Salla,II Magaly Gemio Teixeira,I Sergio Carlos Nahas,I Ivan CecconelloI I

Faculdade de Medicina da Universidade de Sa˜o Paulo, Digestive Surgery Division, Coloproctology Service of the Gastroenterology, Sa˜o Paulo,SP/Brazil. Hospital Amaral Carvalho, Section of Urology, Jau´, SP/Brazil.

OBJECTIVE: Perineal prostatectomy has been proposed as a less invasive and safe procedure, but the risk of anal incontinence has been studied. This study aimed to evaluate the effects of perineal access on anal continence mechanisms after perineal prostatectomy. METHODS: From August 2008 to May 2009, twenty three patients underwent perineal prostatectomy. These patients were evaluated before surgery and eight months postoperatively using the Cleveland Clinic Anal Incontinence Score, the Fecal Incontinence Quality of Life Score, and anorectal manometry. RESULTS: The mean age of the subjects was 65 (range, 54-72) years, and the mean prostate weight was 34.5 (range, 24-54) grams. Gleason scores ranged from 6-7, and the mean Cleveland Clinic Anal Incontinence Score (mean¡standard deviation) values were 0.9¡1.9 and 0.7¡1.2 (p.0.05) before and after surgery, respectively. The Fecal Incontinence Quality of Life Score did not change significantly after surgery. The mean values for anal manometric parameters before and after surgery were, respectively: Resting Pressures of 64¡23 mmHg and 65¡17 mmHg (p = 0.763), Maximum Squeezing Pressures of 130¡41 mmHg and 117¡40 mmHg (p = 0.259), High Pressure Zones of 3.0¡0.9 cm and 2.7¡0.8 cm (p = 0.398), Rectal Sensory Thresholds of 76¡25 ml and 71¡35 ml (p = 0.539), Maximum Tolerated Rectal Volumes of 157¡48 ml and 156¡56 ml (p = 0.836), and Sphincter Asymmetry Indexes 22.4¡9% and 14.4¡5% (p = 0.003). CONCLUSION: There was a significant decrease in the sphincter symmetry index after perineal prostatectomy. With the exception of the sphincter asymmetry index, perineal prostatectomy did not affect anal continence parameters. KEYWORDS: Anal incontinence; Anorectal manometry; Perineal prostatectomy; Prostate cancer. Guilger NR, Jorge JMN, Costa RP, Salla FC, Teixeira MG, Nahas SC, et al. Influence of perineal prostatectomy on anal continence. Clinics. 2011;66(12):2007-2012. Received for publication on May 19, 2011; First review completed on June 22, 2011; Accepted for publication on August 9, 2011 E-mail: coloproctologista@gmail.com Tel.: 55 11 2661-7561

Perineal prostatectomy is less time consuming, results in less blood loss and a faster postoperative recovery time with a consequent reduction in hospital stay; thus, perineal prostatectomy is an effective surgical approach for the treatment of localized prostate cancer.2 However, concerns remain regarding the effects of this technique on the anal sphincter mechanism and the development of incontinence. The correlation between anal incontinence and perineal prostatectomy has been described by many authors based on clinical observations.5-7 However, the correlation between this surgical approach and postoperative anal incontinence is still controversial. The use of a more standardized evaluation of the symptoms of anal incontinence that can be examined using anorectal manometry parameters, including sphincter asymmetry, may provide a better assessment of the effects of perineal access on the posterior pelvic floor compartment.8 Anal incontinence is the inability to exert voluntarily control over the release of gas and stool. Anal continence is preserved by complex mechanisms that involve the volume and consistency of stool, rectal capacity and compliance,

INTRODUCTION Prostate cancer is the second most common cancer worldwide, the sixth leading cause of cancer death. Seventy-five percent of cases are diagnosed after 65 years of age, and its diagnosis is increasing due to the diffusion of screening policies.1-3 There are many surgical techniques to treat this disease. The balance between cost-effectiveness and adverse events occurring due to these different techniques is being studied in the literature. In this context, perineal prostatectomy is distinguished from other approaches; this technique is less invasive and is safe and effective without compromising oncologic principles.4

Copyright ß 2011 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported.

2007

Perineal prostatectomy and anal incontinence Guilger NR et al.

CLINICS 2011;66(12):2007-2012

rectal sensitivity, and the anatomical and functional integrity of the anal sphincter and pelvic floor muscles. This complex interaction of mechanisms is also affected by other individual characteristics and behaviors.9 Vector volume analysis allows the visualization of the pressure conformation in the anal canal, and a high sphincter asymmetry index has been associated with sphincter defects and anal incontinence.9,10 The sphincter asymmetry index is based on an evaluation of the radial distribution of pressure along the anal canal. This parameter has primarily been used for research purposes, and it was first used to demonstrate anatomical sphincter disruption.11-13 This index has subsequently been used to evaluate continence status after different therapeutic procedures.8,14 The prevalence of anal incontinence in the elderly population is approximately 11%, and the most important risk factor for this disorder is age.15 Anal incontinence has a negative impact on a patient’s confidence, self-image and social life, which contributes to the development of depressive symptoms.16 The aim of this study was to evaluate the effects of perineal access on anal continence mechanisms after perineal prostatectomy.

Anorectal manometry Anorectal manometry was performed using an 8-channel water perfusion system (DynamedH model Dynapack II Slim; ProctoMaster version 7.0 software). A flexible plastic catheter with a diameter of 0.8 cm was used as a probe. The catheter contained eight channels that were radially distributed; each channel was perfused with distilled water at a constant flow rate of 0.56 ml/minute/channel using a pneumo-hydraulic system with hybrid nitrogen and electric propulsion. Channel one was positioned posterior to the anal canal (zero degree), and the other channels were sequentially positioned clockwise. The following parameters were evaluated: resting pressure (mmHg), maximum squeeze pressure (mmHg), high pressure zone (cm), fatigue rate (mmHg/min), fatigue rate index (min), sphincter asymmetry index (%), rectoanal inhibitory reflex, rectal sensory threshold (ml), and maximum tolerated rectal volume or capacity (ml). Pressure parameters were collected during intermittent catheter withdrawal 6.0 to 1.0 cm from the anal verge. The functional anal canal length comprised the extent of pressures equal to or greater than 50% of the highest mean value that was achieved among the eight channels at the same level. The catheter was placed 2 cm from the anal verge to evaluate the sustained voluntary contraction and the Resting Anal Inhibitory Reflex (RAIR) test. Finally, the catheter was placed and moved 6.0 cm from the anal verge, and the rectal sensitivity and capacity were evaluated by inflating the balloon with water at room temperature. Rectal sensitivity was considered to be the minimum amount of liquid that was perceived by the patient, and the maximum tolerated capacity was considered to be the maximum amount of liquid tolerated before an urge to defecate occurred.

METHODS Overall study design and setting A prospective before-after study17 was conducted to evaluate anal incontinence in patients with prostate cancer. All patients were sequentially selected in July 2008 and all perineal prostatectomy performed in the period between August 2008 to October 2008 at Fundaçaõ Amaral Carvalho. The procedures were performed by the same surgeon. Before surgery and eight months after surgery, a clinical evacuation evaluation, including the Cleveland Clinic Incontinence Score (CCIS),9 the Fecal Incontinence Quality of Life Score (FIQLS),18 and anorectal manometry,19 was used for the assessment. This study was approved by the Ethics Committee in Research of the two participating institutions, the Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Saõ Paulo, SP and Fundaçaõ Amaral Carvalho, Jau´, SP. Informed written consent was obtained from all volunteers.

Statistical analyses Fisher and McNemar tests were employed to analyze qualitative variables. Quantitative variables were analyzed using the Student’s t-test and the paired-sample Wilcoxon test. A sample size of 18 patients undergoing perineal prostatectomy provide an 85% power to detect 15-mmHg and 1-point differences in the resting pressure and the FIQLS and incontinence index scores, respectively, before and after surgery. A two-tailed significance level of 0.05 was considered to be statistically significant.

Sampling and subjects

RESULTS

Patients with previous perineal and anorectal diseases and anal surgery were excluded. All consecutive patients who were diagnosed with prostate cancer and indications20 for perineal prostatectomy were evaluated and underwent surgical procedures using the same standardized technique20,21 with the same team of urologists at Fundac¸a˜o Amaral Carvalho, Jau´, SP.

A total of 30 consecutive patients with prostate cancer and indications for perineal prostatectomy completed the preoperative evaluation from May to July 2008. However, one patient underwent a retropubic prostatectomy, and two patients were submitted to radiotherapy. These three patients were excluded from the study. Postoperative evaluations were performed approximately eight months after surgery. Four patients did not attend the postoperative evaluation, and consequently, 23 patients completed all of the steps of the postoperative evaluation. Thus, this study was conducted in 23 patients with a mean age of 66 years (range, 54-72) years, a mean prostatespecific antigen value of 8.8 ng/ml (range, 3.6 to 22.1 ng/ ml), a mean Gleason Score of 6 (range 6-7) and a mean prostate weight at ultrasound of 34.4 g (range, 24-54 g). The patients reported no change in anal continence after early post-operative perineal prostatectomy.

Measures All patients were evaluated using the clinical evacuation examination, CCIS,9 FIQLS,22 and anorectal manometry19 before surgery and eight months after surgery. The period of eight months after surgery was chosen based on previous studies to ensure that transitory symptoms would not be overestimated.22 All parameters were assessed by the same researcher. Anal incontinence was considered to be mild for a CCIS of 1-8 and moderate/severe for a CCIS greater than 9; an index of zero corresponds to complete continence.

2008

CLINICS 2011;66(12):2007-2012

Perineal prostatectomy and anal incontinence Guilger NR et al.

The pre- and postoperative mean CCIS were, respectively: total scores of 0.9 and 0.7 (p = 0.774), incontinence to gas values of 0.17 and 0.4 (p = 0.257), incontinence to liquid stool scores of 0.57 and 0.26 (p = 0.083), incontinence to solid stool scores of 0 and 0 (p = 1.0), wearing of a pad scores of 0.04 and 0 (p = 0.317) and lifestyle alteration scores of 0.09 and 0 (p = 0.317) (Figure 1). The prevalence of anal incontinence before and after surgery was 48% and 35%, respectively, using the index of anal incontinence (CCIS). These values were not significantly different based on the McNemar test (p = 0.508). The pre- and postoperative values of the FIQLS domains, respectively, were,as follows: depression values of 3.8 and 3.5 (p = 0.737), lifestyle scores of 3.9 and 4 (p = 0.256), behavior scores of 3.7 and 3.6 (p = 0.8) and constraint scores of 3.9 and 3.8 (p = 0.671) (Figure 2). The pre- and postoperative values of manometric parameters were, respectively: resting pressures of 64ยก23 mmHg and 65ยก17 mmHg (p = 0.763) (Figure 3), maximum squeezing pressures of 130ยก41 mmHg and 117ยก40 mmHg (p = 0.259), high pressure zones of 3.0ยก0.9 cm and 2.7ยก0.8 cm (p = 0.398), fatigue rate (p = 0.754) and fatigue rate index (p = 0.438), anorectal reflexes present in 78% (18 patients) and 82% (19 patients) (p = 0.398), rectal sensitivity thresholds of 76ยก25 ml and 71ยก35 ml (p = 0.539) and maximum tolerated rectal volumes of 157ยก48 ml and 156ยก56 ml (p = 0.836) (Table 1). However, the sphincter asymmetry index was significantly decreased after surgery. The pre- and postoperative index values were 22.4ยก9.1% and 14.4ยก4.5% (p = 0.003), respectively (Figure 4).

to 16%. However, an important limitation of this study was that there were no records of clinical complaints regarding anal incontinence before surgery.5 This bias may lead to the conclusion that perineal prostatectomy promoted anal incontinence. These earlier studies also detected that even patients who had severe symptoms and impaired quality of life only revealed their symptoms when actively asked by the physician.5,6 It was emphasized that urologists must be aware of anal incontinence symptoms during anamnesis and should appropriately inform patients about the potential risks of these complications.9,16,25 Dahm et al.6 have demonstrated that there is a significant correlation between perineal surgery and anal incontinence symptoms; however, most of these symptoms were transitory. In 2004, Korman et al.7 published the results of a validated bowel function domain questionnaire (University of Michigan) that was expanded to the Prostate Cancer Index Composite (EPIC) and applied to patients who underwent perineal and retropubic prostatectomy. The authors used patients who underwent prostate biopsy as a control group. There was no clinical difference between groups in terms of bowel control, fecal incontinence, rectal urgency, and global bowel function, which varied from 4.8% to 6.4%.6 Kirschner et al.26 found that 6% of the studied patients presented with anal incontinence and a decreased quality of life before perineal prostatectomy. The real prevalence of anal incontinence in the general population remains unknown. The results that are available are only estimated values because no standardized scores or specific scales for incontinence have been used. In the present study, most patients presented with mild symptoms, these results demonstrate the sensitivity of the applied instruments, which permits the detection of early forms of anal incontinence before its clinical features or the need for treatment of symptoms manifest. The present study validated the use of the Anal Incontinence Score (CCIS) not only in the quantification of clinical symptoms but also as a tool for the early detection of symptoms of anal incontinence. This instrument can be helpful as an aid to improve a patientโ s knowledge of the symptoms of anal incontinence before the disease has a greater impact on their quality of life.

DISCUSSION We found that perineal prostatectomy did not affect anal continence or quality of life in this subset of patients. This disease is socially stigmatized and an active investigation of patients who are at risk of this complication is crucial to its diagnosis.23,24 Bishoff et al.5 were the first to note the potential association between perineal prostatectomy and anal incontinence. According to these authors, the prevalence of anal incontinence after perineal prostatectomy ranged from 8%

Figure 1 - Comparative analyses of Cleveland Clinic Anal Incontinence Index scores before and after perineal prostatectomy.

2009

Perineal prostatectomy and anal incontinence Guilger NR et al.

CLINICS 2011;66(12):2007-2012

Figure 2 - Comparative analyses of Fecal Incontinence Quality of Life Scores before and after perineal prostatectomy.

Figure 3 - Resting pressure before and after surgery in 23 patients who underwent perineal prostatectomy.

2010

CLINICS 2011;66(12):2007-2012

Perineal prostatectomy and anal incontinence Guilger NR et al.

Table 1 - Anorectal manometry parameters in patients before and after perineal prostatectomy. Mean

High pressure zone (cm) Resting pressure (mmHg) Maximum squeezing pressure (mmHg) Fatigue rate (mmHg/ min) Fatigue rate index (min) Sphincter asymmetry index (%) Rectal sensitivity threshold (ml) Rectal capacity (ml)

Median

Standard Deviation

Minimum

Maximum

p-value*

Before

After

Before

After

Before

After

Before

After

Before

After

3 63.7

2.7 64.9

3 69

3 66

1 22.5

0.8 16.7

1 28

1 34

5 100

4 99

0.398 0.763

129.7

116.9

130

118

41.4

40.4

198

190

0.165

-46.6

-56.6

-34.9

-27.4

44.3

49.8

-161

-163

-28

-94

0.754

3 22.4

2.1 14.4

1.49 20

1.62 14.7

11.2 9.1

5.4 4.5

-16 9

-12 7

-54 46

-21 18

0.438 0.003

24.7

35.2

120

160

0.539

158

156

150

140

0.836

*Studentâ&#x20AC;&#x2122;s t-test and paired-sample Wilcoxon test.

There was no change in quality of life in relation to anal continence when the pre- and postoperative results of patients who underwent a radical perineal prostatectomy were compared. Therefore, the Anal Incontinence Index9 and Fecal Incontinence Quality of Life questionnaire18 enhanced the sensitivity of our evaluation and provide a more accurate evaluation of anal incontinence in the studied

patients because both instruments have been validated and are recognized worldwide. The anal canal is a naturally asymmetrical structure, especially considering the force vectors involved.27-29 These force vectors are related to the distribution of the anal canal muscles and other structures, including the submucosa hemorrhoidal plexus. 29,30,31 However, a high sphincter

Figure 4 - Sphincter Asymmetry Index scores before and after surgery in 23 patients who underwent perineal prostatectomy.

2011

Perineal prostatectomy and anal incontinence Guilger NR et al.

CLINICS 2011;66(12):2007-2012

10. Jorge JMN,Habr-Gama A. The value of sphincter asymmetry index in anal incontinence. Int J Colorectal Dis. 2000;15:303-10, doi: 10.1007/ s003840000249. 11. Roberts PL, Coller JA, Schoetz DJ, Jr, Viedenheimer MC. Manometric assessment of patients with obstetric injuries and fecal incontinence. Dis Colon Rectum. 1990;33:16-20, doi: 10.1007/BF02053195. 12. Braun JC, Treutner KH, Dreuw B, Klimaszewski M, Schumpelick V. Vectormanometry for differential diagnosis of fecal incontinence. Dis Colon Rectum. 1994;37:989-96, doi: 10.1007/BF02049310. 13. Williams N, Barlow J, Hobson A, Scott N, Irving M. Manometric asymmetry in the anal canal in controls and patients with fecal incontinence. Dis Colon Rectum. 1995;38:1275-80, doi: 10.1007/ BF02049152. 14. Taylor BM, Beart RW, Jr, Phillips SF. Longitudinal and radial variations of pressure in the human anal sphincter. Gastroenterol. 1984;86:693-7. 15. Nelson RL. Epidemiology of fecal incontinence. Gastroenterol. 2004;126:S3-S7, doi: 10.1053/j.gastro.2003.10.010. 16. Nelson R, Norton N, Cautley E, Furner S. Community-based prevalence of anal incontinence. JAMA. 1995;274:559-61, doi: 10.1001/jama.274.7.559. 17. Fletcher RH. Clinical epidemiology: the essentials. 4th ed. Philadelphia: Lippincott Williams & Wilkins; 2005. 18. Rockwood TH, Church JM, Fleshman JW, Kane RL, Mavrantonis C, Thorson AG, et al. Fecal incontinence quality of life scale fecal incontinence. Dis Colon Rectum. 2000;43:9-17, doi: 10.1007/BF02237236. 19. Jorge JMN, Wexner SD. Anorrectal Manometry: Techniques and clinical applications. Southern Medical Journal. 1993;86:924-31, doi: 10.1097/ 00007611-199308000-00016. 20. Costa RP, Schaal CH, Salla FC, Vanni AP, Cortez JP. Prostatectomia radical por via perineal: resultados dos 70 casos iniciais. J Bras Urol. 1999;25:204-09. 21. Dahm P, Yang BK, Gan TJ, Salmen CR, Cancel QV, Vieweg J. Radical perineal prostatectomy for treatment of localized cancer in obese and non obese patients: a matched control study. Urol. 2006;67:990-95, doi: 10.1016/j.urology.2005.11.046. 22. Yusuf SAI, Jorge JMN, Habr-Gama A, Kiss DR, Rodrigues JG. Avaliaçaõ da qualidade de vida na incontineˆncia anal: validaçaõ do questiona´rio FIQL (Fecal Incontinence Quality of Life). Arq Gastroenterol. 2004;41:202-08, doi: 10.1590/S0004-28032004000300013. 23. Shamliyan TA, Bliss DZ, Du J, Ping R, Wilt TJ, Kane RL. Prevalence and risk factors of fecal incontinence in community-dwelling men. Rev Gastroenterol Disord. 2009;9:E97-E110. 24. Macmillan AK, Merrie AEH, Marshall RJ, Parry BR. The prevalence of fecal incontinence in community-dwelling adults: a systematic review of the literature. Dis Colon Rectum. 2004;47:1341-9, doi: 10.1007/s10350004-0593-0. 25. Goode PS, Burgio KL, Halli AD, Jones RW, Richter HE, Redden DT, et al. Prevalence and correlates of fecal incontinence in communit-dwelling older adults. J Am Geriatr Soc. 2005;53:629-35, doi: 10.1111/j.1532-5415. 2005.53211.x. 26. Kirschner-Hermans R, Knispel C, Mo¨ ller M, Willis S, Jakse G. Stuhlbeschwerden nach radikaler perinealer prostatektomie eine prospektive studie. Der Urologe. 2003;42:677-84. 27. Kroesen AJ. Extended anal sphincter assessment by vector manometry. Int J Colorrectal Dis. 2000;15:311-2, doi: 10.1007/s003840000260. 28. Fritsch H, Brenner, Lienemann A, Ludwikowski B. Anal sphincter complex reinterpreted morphology and its clinical relevance. Dis Colon Rectum. 2002;45:188-94, doi: 10.1007/s10350-004-6144-x. 29. Shafik A. A new concept of the anatomy of the anal sphinter mechanism and the physiology of defecation: mass contraction of the pelvic floor muscles. Int Urogynecol J. 1998;9:28-32, doi: 10.1007/BF01900538. 30. Gordon PH. Anorectal anatomy and physiology of the anal canal. Gastroenterol Clin North Am. 2001;30:1-13, doi: 10.1016/S08898553(05)70164-3. 31. Petros PE. Internal resistance may be more important for continence than anal wall tension. Dis Colon Rectum. 2008;0:1-2. 32. Petros P. A new theory of ano-rectal function. Pelviperineology. 2008;27:85-124. 33. Shafik A, Sibai OE, Shafik AA, Shafik IA. A novel concept for the surgical anatomy of the perineal body. Dis Colon Rectum. 2007;50:2120-5, doi: 10. 1007/s10350-007-9064-8. 34. Harris MJ. The anatomic radical perineal prostatectomy: an outcomesbased evolution. European Urology. 2007;52:81-8, doi: 10.1016/j.eururo. 2006.10.041. 35. Siproudhis L, Bellissant E, Pagenault M, Mendler M-H, Allain H, Bretagne J-F, et al. Fecal incontinence with normal anal canal pressures: where is the pitfall? Am J Gastroenterol. 1999;94:1556-63, doi: 10.1111/j. 1572-0241.1999.01144.x. 36. Papa Petros PE. Cure of urinary and fecal incontinence by pelvic ligament reconstruction suggests a connective tissue etiology for both. Int Urogynecol J. 1999;10:356-53, doi: 10.1007/s001920050059.

asymmetry index has been associated with anal incontinence.10,13 There was no significant statistical change in anal pressure parameters after perineal prostatectomy. The only change noted was an improvement in the sphincter asymmetry index, and this finding may be related to the integral theory of the pelvic floor. This theory states that the involvement of anterior, medium and posterior pelvic floor compartments and the interrelation of its structures and organs with the pelvic fascia and ligaments are important in anal continence.31-33 In a perineal prostatectomy, structures important to the maintenance of the posterior pelvic floor dynamic are divided, including the rectouretheral muscle, the perineal body, and the centrum tendineum. Therefore, some aspects in the configuration of both the rectum and the anal canal may change.32-36 One step in the perineal prostatectomy consists of perineal reconstruction and perineal body reattachment. Although visually imperceptible, this technical approach may have contributed to the change in reading patterns of sphincter asymmetry without a change in the absolute resting pressure values. The improvement in anal canal symmetry may support the integral theory of the pelvic floor and the role of fibrosis and reattachment of the perineal body in anal continence.32,33 This finding may be of value in further studies in the identification of beneficial technical approaches during perineal surgery that may prevent anal incontinence.

AUTHOR CONTRIBUTIONS Guilger NR gathered the material and developed the discussion. Jorge JMN developed the statistical and discussion. Costa RP recruited patients. Teixeira MG drafted the article. Nahas S revised the article. Cecconello I revised the discussion of the article.

REFERENCES 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69-90, doi: 10.3322/caac.20107. 2. Inoue S, Shiina H, Sumura M, Urakami S, Matsubara A, Igawa M. Impact of a novel, extended approach of perineal radical prostatectomy on surgical margins in localized prostate cancer. BJU International. 2010;106:44-8, doi: 10.1111/j.1464-410X.2009.09180.x. 3. Harris MJ. Radical perineal prostatectomy: cost efficient, outcome effective, minimally invasive prostate cancer management. European Urology. 2003;44:303-8, doi: 10.1016/S0302-2838(03)00298-7. 4. Prasad SM, Gu X, Lavelle R, Lipsitz SR, Hu JC. Comparative effectiveness of perineal versus retropubic and minimally invasive radical prostatectomy. J Urol. 2011;185:111-5, doi: 10.1016/j.juro.2010.08. 090. 5. Bishoff JT, Motley G, Optenberg SA, Stein CR, Moon KA, Browning SM, et al. Incidence of Fecal and Urinary Incontinence Following Radical Perineal and Retropubic Prostatectomy in a National Population. J Urol. 1998;160:454-8, doi: 10.1016/S0022-5347(01)62924-0. 6. Dahm P, Silverstein AD, Weizer AZ, Young MD, Vieweg J, Albala DM, et al. A longitudinal assessment of bowel related symptoms and fecal incontinence following radical perineal prostatectomy. J Urol. 2003; 169:2220-4, doi: 10.1097/01.ju.0000065116.20997.a3. 7. Korman HJ, Mulholland TL, Huang R. Preservation of fecal continence and bowel function after radical perineal and retropubic prostatectomy: a questionnaire- based outcomes study. Prostate Cancer and Prostatic Diseases. 2004;7:249-52, doi: 10.1038/sj.pcan.4500723. 8. Perry RE, Blatchford GJ, Christensen MA, Thorson AG, Attwood SEA. Manometric diagnosis of anal sphincter injuries. Am J Surg. 1990; 159:112-7, doi: 10.1016/S0002-9610(05)80615-4. 9. Jorge JMN, Wexner SD. Etiology and management of fecal incontinence. Dis Colon Rectum. 1993;36:77-97, doi: 10.1007/BF02050307.

2012

CLINICS 2011;66(12):2013-2018

DOI:10.1590/S1807-59322011001200003

CLINICAL SCIENCE

Direct fluorescent antibody assay and polymerase chain reaction for the detection of Chlamydia trachomatis in patients with vernal keratoconjunctivitis Maria Cristina Nishiwaki-Dantas,I Mariza Toledo de Abreu,II Cynthia Mendonc¸a de Melo,I Ivana Lopes Romero,I Rubens Belfort Matos Neto,II Paulo Elias Correa DantasI,III I

Department of Ophthalmology, Corneal and External Disease Service, Santa Casa of Sa˜o Paulo, Brazil. University of Sa˜o Paulo, Brazil. III Sorocaba Eye Hospital.

Department of Ophthalmology, Federal

OBJECTIVES: To identify Chlamydia trachomatis via polymerase chain reaction and a direct fluorescent antibody assay in patients with vernal keratoconjunctivitis while comparing the efficacies of both tests for detecting Chlamydia trachomatis in these conditions. METHODS: Conjunctival scraping samples were obtained from 177 patients who were divided into two groups: a vernal keratoconjunctivitis group (group A) and a control group (group B). The polymerase chain reaction and a direct fluorescent antibody assay were performed. Sensitivity, specificity, receiver operating characteristic curves, and areas under the curve were calculated for both tests in groups A and B. Receiver operating characteristic curves were plotted using a categorical variable with only two possible outcomes (positive and negative). RESULTS: Statistical analysis revealed a significant association between vernal keratoconjunctivitis and Chlamydia trachomatis infection detected by a direct fluorescent antibody assay with high sensitivity and specificity. All patients in group A with positive polymerase chain reactions also presented with positive direct fluorescent antibody assays. CONCLUSION: The association between vernal keratoconjunctivitis and Chlamydia trachomatis infection was confirmed by positive direct fluorescent antibody assays in 49.4% of vernal keratoconjunctivitis patients and by positive polymerase chain reactions in 20% of these patients. The direct fluorescent antibody assay detected Chlamydia trachomatis in a higher number of patients than did the polymerase chain reaction. Although the diagnosis of trachoma is essentially clinical, the disease may not be detected in vernal keratoconjunctivitis patients. Due to the high frequency of chlamydial infection detected in patients with vernal keratoconjunctivitis, we suggest considering routine laboratory tests to detect Chlamydia trachomatis in patients with severe and refractory allergic disease. KEYWORDS: Vernal keratoconjunctivitis; Chlamydia trachomatis; Polymerase chain reaction; Direct fluorescent antibody assay. Nishiwaki-Dantas MC, Abreu MT, Melo CM, Romero IL, Neto RBM, Dantas PEC. Direct fluorescent antibody assay and polymerase chain reaction for the detection of Chlamydia trachomatis in patients with vernal keratoconjunctivitis. Clinics. 2011;66(12):2013-2018. Received for publication on March 23, 2011; First review completed on June 1, 2011; Accepted for publication on August 15, 2011 E-mail: pauloecdantas@uol.com.br Tel.: 55 11 21767225

conjunctiva and/or limbus. It is frequently associated with corneal involvement.1-3 Trachoma is a chronic follicular keratoconjunctivitis characterized by the presence of follicles in the upper palpebral conjunctiva and limbus. Mucous discharge may be present, along with itching, which is less intense than that experienced in VKC. Follicular necrosis and subconjunctival inflammation may lead to conjunctival scars, Arlt’s lines and Herbert’s pits, which are pathognomonic features of trachoma. Palpebral and secondary corneal involvement may also be present. Transmission occurs by direct eye-to-eye and hand-to-eye contact, usually by contaminated ocular discharge, clothes,

INTRODUCTION Vernal keratoconjunctivitis (VKC) is a chronic ocular allergy characterized by itching and conjunctival hyperemia with papillary hypertrophy of the upper palpebral or tarsal

2013

Chlamydia trachomatis in patients with VKC Nishiwaki-Dantas MC et al.

CLINICS 2011;66(12):2013-2018

criteria: a clinical history of chronic bilateral conjunctivitis (at least one year) with seasonal exacerbations (i.e., itching, photophobia, and foreign body sensation); hypertrophic papillae at the superior palpebral conjunctiva and/or limbus; and, eventually, Horner-Trantas dots, superficial punctate keratitis and shield ulcers or corneal scars from shield ulcers. Group B (the control group) consisted of 90 patients who presented for regular eye examinations (refractometry) and were neither complaining of allergic conjunctivitis nor taking topical or systemic antibiotics. All patients in groups A and B were informed of the purpose of the study, and all patients signed an informed consent. The institutional review ethical committee approved this study. Patients were asked about their disease length, symptoms, and familial and personal histories of atopy and other ocular diseases. The symptoms assessed included itching, tearing, photophobia, discharge, and reduced visual acuity. The following components were included in the examination: a measurement of visual acuity; slit lamp biomicroscopy to evaluate conjunctival hyperemia; a test for the presence of papillae at the conjunctiva and/or limbus and other conjunctival, limbal, and corneal alterations (follicles and scars); tonometry; and a fundus examination. All patients were examined by the same doctor. All patients underwent tissue sampling for the detection of Chlamydia trachomatis by DFA. The superior palpebral conjunctiva of the right eye was scraped five times with a Kimura spatula. The sample was then placed in a demarcated circle on the appropriate slide, dried for 5 minutes, fixed with absolute methanol and stained with the fluorescent monoclonal antibody (Microtrak-SyvaTM). After 30 minutes of incubation in a moist chamber at room temperature, the slides were washed with distilled water and were left to dry again. The samples were examined by an experienced technician under immersion fluorescent microscopy with epi-illumination at 1000X magnification. The material was considered adequate when it included at least 100 epithelial cells per field. The criterion for a positive diagnosis was the presence of five or more elementary bodies per sample. The PCR was calibrated by obtaining a positive control from a patient who had no allergic conjunctivitis and a clinical diagnosis of trachoma, which was confirmed by a positive DFA for Chlamydia trachomatis. The negative control was obtained from a patient who presented with no signs or symptoms of either trachoma or allergic conjunctivitis and had a negative DFA for Chlamydia trachomatis. The positive and negative controls were obtained to accurately calibrate the PCR for the detection of Chlamydia trachomatis. All patients in groups A and B had the superior palpebral conjunctiva of their right eye scraped with a Dacron swab. The part of the swab containing the collected material was placed in a plastic tube with the transportation medium. Samples were taken immediately to a Molecular Biology laboratory within 4 hours after collection. The material was processed according to the technique introduced by Bobo.11 For each sample, an initial PCR was performed to verify the presence of b-human globin to avoid false negative results. The primers had the following sequences: Primer HGH1: 59 – TGCCTTCCCAACCATTCCCTTA – 39 and Primer HGH2: 59 – CCACTCACGGATTTCTGTTGTGTTTC – 39. Detection of the fragment occurred at 420-bp long.

bed sheets, towels and the proliferation of flies in homes and schools.4,5 The diagnosis of both VKC and trachoma is essentially clinical. With trachoma, especially in endemic areas and in chronic and cicatricial trachoma, clinical diagnosis is straightforward. However, in the early stages of the infection, due to its relatively benign and asymptomatic course, it may not be easily differentiated from viral, bacterial, or allergic conjunctivitis. In these cases, laboratory tests become essential, especially direct fluorescent antibody assays (DFAs).6,7 DFAs are easily performed but require adequate transportation and storage of the samples in a refrigerator, a fluorescent microscope, and well-trained personnel. Polymerase chain reaction (PCR) has been suggested to test for Chlamydia trachomatis that has both the specificity of cell culture and a level of sensitivity similar to that of DFA. PCR is an in vitro method for detecting DNA sequences by enzymatic amplification of a specific fragment that can synthesize more than one million copies of one DNA sequence in a short period of time. VKC and trachoma share many features. They both affect school-age children and young adults in hot, dry climate areas. They are characterized by chronic keratoconjunctivitis, usually bilateral, that waxes and wanes throughout the year.8,9 One key difference is that whereas VKC stimulates a papillary reaction of the conjunctiva, trachoma stimulates a follicular response. However, following the early follicular hypertrophy of trachoma (phase TF), a papillary reaction (phase TI) may cover the follicles. Also, follicles and papillae may coexist. In these cases, giant papillae would be dominant and would obscure the follicles. Limbal follicles may also be obscured by the characteristic papillae and edema of limbal VKC. In this phase, we believe that many cases of trachoma may not be getting clinically diagnosed, especially in the presence of a common comorbid papillary disease such as VKC. Ve´rin et al. first described a possible association between VKC and trachoma in 1980.8 Later, in 1988, Friedlaender & Cameron presented four cases of possible association.3 One year later, Ve´rin et al. (1989) described 8 (23.5%) cases of Chlamydia trachomatis infection confirmed the Wang and Grayston technique in 34 patients with VKC.9 The possible association between VKC and trachoma was not addressed again until 2000, when Melo et al. studied 72 patients with allergic conjunctivitis, 38 (52.8%) of whom had a positive DFA for Chlamydia trachomatis.10 In that study, the control group (60 patients) did not have any positive DFAs. Statistical analysis identified a significant association between the diseases. The purpose of this study was to use PCR and DFA to detect the presence of Chlamydia trachomatis in patients with VKC compared with a control group and also to compare the efficacies of both tests for detecting Chlamydia trachomatis in patients with VKC.

MATERIALS AND METHODS One hundred seventy-seven patients were divided into two groups. Group A consisted of 87 patients with VKC from the Ocular Allergy Service of the Department of Ophthalmology. Patients using topical or systemic antibiotics were excluded. Patients were diagnosed with VKC using the following

2014

CLINICS 2011;66(12):2013-2018

Chlamydia trachomatis in patients with VKC Nishiwaki-Dantas MC et al.

In the samples in which b-human globin was detected, a second PCR was performed to detect and amplify a highly conserved region of the specific major outer membrane protein (MOMP) for Chlamydia trachomatis. The sequences of the primers used to detect Chlamydia trachomatis follow: Primer 1: 59 - GAT AGC GAG CAC AAA GAG AGC TAA – 39; Primer 2: 59 – TTC ACA TCT GTT TGC AAA ACA CGG TCG AAA ACA AAG – 39; Primer 3: 59 - TCT GCT TCC TCC TTG CAA GCA AGT CTG CC – 39; and Primer 4: 59 - CCA TAG TAA CCC ATA CGC ATG CTG – 39. The amplified fragment was then examined by electrophoresis in agarose gel that was stained with ethidium bromide. Detection of the fragment occurred at 151-bp long. Calculations of sensitivity and specificity were conducted, and a receiver operating characteristic (ROC) curve was plotted to evaluate and compare the diagnostic capabilities of both laboratory tests. Sensitivity, specificity, ROC curves, and areas under the curve were calculated with the assumption that DFA is the gold standard for Chlamydia spp. diagnosis. ROC curves were plotted using a categorical variable with only two possible outcomes (positive and negative), which can lead to underestimation of the area under the curve. MedCalc software version 9.3.7.0 was used for all calculations. We certify that all applicable institutional and governmental regulations concerning the ethical use of human volunteers were followed during this research.

All patients in group A presented with itching and red eyes. Symptoms of corneal involvement (i.e., punctate keratitis, superficial corneal opacities, shield ulcer, and peripheral neovascularization) were identified in 15 patients (17.2%). Seventeen patients (19.5%) in group A (i.e., patients with VKC) had conjunctival and limbal scars (i.e., scars in the upper tarsal conjunctiva and pits in the superior limbus), both of which were suggestive of trachoma (TS). Follicles (more than six), suggesting follicular trachoma (TF), were identified in the upper tarsal conjunctiva in two patients (2.3%) from group A. No patients presented with typically trachomatous corneal opacities or palpebral alterations.

Direct fluorescent antibody test All samples had more than 100 epithelial cells per field and were considered adequate for laboratory analysis. In group A, 44 samples (50.6%) were negative (less than five fluorescent elementary bodies), and 43 samples (49.4%) were positive (more than five fluorescent elementary bodies). Positive DFA was identified in all patients with suggestive signs of trachoma (two patients with more than six follicles in the upper tarsal conjunctiva and 13 of 17 patients with conjunctival and limbal scars). In group B, all samples were negative.

Polymerase Chain Reaction In group A, human b-globin was detected in 70 samples (80.4%); 14 (20.0%) were positive for Chlamydia trachomatis. In group B, human b globin was identified in 60 samples (66.7%), one (1.7%) of which was PCR-positive for Chlamydia trachomatis. Correlating the clinical findings with the results of the PCR, we observed that two patients from group A with suggestive signs of TF had positive PCR results. The PCR results were also positive in eight of the 17 patients with suggestive TS.

RESULTS Clinical evaluation Group A consisted of 87 patients with VKC. Patient ages in this group ranged from 2 to 23 years (mean age = 9.6¡4.8 years); 74 patients (73.6%) were white, and 23 (26.4%) were black; 27 (31.0%) were female, and 60 (69.0%) were male (Table 1). Group B (control group) consisted of 90 patients. Patient ages ranged from 2 to 23 years (medium age = 9.0¡5.0 years); 45 patients (50.0%) were male, and 45 (50.0%) female; 68 patients (75.6%) were white, and 22 (24.4%) were black (Table 1). No statistical differences were identified between groups A and B based on either race (x2 = 0, p = 1.0) or age (t = -0.862; p = 0.39). The majority of VKC patients (86.2%) were less than 15 years old. In group B, 88.9% of the patients were under the age of 15. Caucasians were predominant in both groups (73.6% in group A and 75.6% in group B). In group A, 69.0% of the patients were male, and in group B, 50.0% of the patients were male. This difference between the groups was statistically significant (x2 = 5.831, p = 0.016).

Direct Fluorescent Antibody Assay vs. Polymerase Chain Reaction All patients in group A with positive PCR results also had positive DFAs. Only one patient from group B with a negative DFA had a positive PCR result (Figures 1 and 2) Figure 3 displays ROC curves for DFA and PCR. Areas under the ROC curves were 1.0 (95% CI = 0.958 to 1.000) for the DFA and 0.663 (95% CI = 0.553 to 0.761) for the PCR. A pairwise comparison of ROC curves revealed a difference of 0.337 (95% CI = 0.223 to 0.451, p,0.001). The sensitivity and specificity of the DFA were 100 (95% CI = 91.7 to 100) and 100 (95% CI = 91.9 to 100), respectively.

Table 1 - Distribution by sex and race of patients with vernal keratoconjunctivitis (Group A) and controls (Group B). Group

Sex Female

A B

Race Male

White

Black

27 45

31 50

60 45

69 50

64 68

73.6 75.6

23 22

26.4 24.4

Legend: N: Number. x2 = 5.831 (for sex); 0 (for race). p = 0.016 (for sex); 1 (for race).

2015

Chlamydia trachomatis in patients with VKC Nishiwaki-Dantas MC et al.

CLINICS 2011;66(12):2013-2018

for DNA amplification, some Chlamydia trachomatis strains with no plasmid have been described.7 Therefore, we opted to amplify a conserved region of nucleotides in the MOMP gene. We obtained fewer positive PCRs than DFAs: 14 samples in group A (corresponding to 20.0%) and 1 sample in group B (corresponding to 1.7%). Frequent questions raised by practitioners include whether VCK causes trachoma, whether trachoma causes VKC or whether their co-occurrence is merely coincidental. These questions arise because both diseases affect the same group of patients (i.e., school children in hot and dry areas). VeÂ´rin et al. reported that Chlamydia trachomatis could act as an allergen or as the trigger of an allergic process, suggesting that a chronic chlamydial infection, which alters the immunologic events on the ocular surface, could be associated with the local allergic response.8,9 Friedlaender and Cameron observed that the infectious nature of trachoma was not relevant in the pathogenesis of VKC. Atopic patients, such as those with VKC, present with some local or systemic immunological compromise, which could explain the greater incidence of staphylococcal and herpetic infections and possibly chlamydial infections.3 In addition, the integrity of the epithelium is considered the first line of defense of the ocular surface in many infectious conditions. VKC patients have conjunctival alterations due to chronic inflammation, vascular hyperpermeability, and excoriation, all of which compromise the integrity of the ocular surface, rendering the patient more susceptible to secondary infections, such as trachoma.3 Another factor to be considered is that all VKC patients present with itching as their main symptom, and they excessively manipulate their eyes, thus transferring significant numbers of microorganisms, possibly including Chlamydia trachomatis, from their hands to their eyes. Chlamydia trachomatis can also be carried by contaminated secretions, which are commonly found in the eyes of VKC patients. SCARPI et al. observed in their study that itching was the main symptom in trachoma patients (11.47%); they likely also included some patients with concomitant trachoma and allergic conjunctivitis.12 Rao et al. investigated the presence of Chlamydia trachomatis in 127 patients with acute, chronic, and recurrent conjunctivitis.5 Of the 22 patients with clinically diagnosed allergic conjunctivitis, seven (31.8%) had a positive culture for Chlamydia trachomatis. Notably, DFA is still considered the gold standard for Chlamydia trachomatis detection. Without it, clinical diagnoses would have been made in only 19 of 43 patients (44.2%) with positive DFAs, indicating that trachoma would not have been diagnosed in 55.8% of patients. These cases would have been treated as severe and refractory allergic conjunctivitis. Despite its low sensitivity in this study, DNA amplification by PCR is still used for the detection of ocular chlamydial infection; more recently, however, nucleic acid amplification tests (NAATs) based on the amplification of rRNA have been developed, providing a potential advantage because bacterial rRNA is present at up to 10,000 times the copy numbers of genomic DNA and at up to 1,000 times the copy numbers of plasmid DNA. This development opens a field of new opportunities for the detection of chlamydial infections using these techniques.13,14

Figure 1 - Venn diagram from group A (43 DFA-positive results).

The sensitivity of the PCR was 23.56 (95% CI = 19.1 to 48.5), and the specificity of the PCR was 100 (95% CI = 91.9 to 100).

DISCUSSION In our study, as in previous publications, VKC occurred more frequently in children less than 15 years old (86.25%) and in males (69.0%).1,2 A clinical diagnosis of VKC was made in all patients from group A, and they all reported itching. A clinical diagnosis of Chlamydia trachomatis infection could also have been made by the presence of scars. However, in the earlier stages of infection, the relatively benign and asymptomatic course and the preponderance of signs and symptoms of VKC could obfuscate the correct diagnosis. In our study, scars suggestive of trachoma were detected in 17 patients (19.5%) from group A. All the samples that were prepared for DFA were used because all had the minimum of 100 epithelial cells per field. The presence of five or more fluorescent elementary bodies was considered a positive result in the analysis of the samples.6 In group A, 49.4% of the samples presented positive DFA, and in group B, all 90 samples were negative. Of the 43 patients with positive DFA, 19 had suggestive clinical signs of trachoma, and the majority of the remaining cases could be diagnosed only by laboratory tests. PCR is considered the most sensitive non-culture test for the detection of Chlamydia trachomatis in non-ocular samples. Problems related to contamination and the presence of DNA polymerase inhibitors, such as blood and lysozyme, could result in false-negative and false-positive results. The routine use of a negative control and an internal control (for the detection of human b-globin) would eliminate the risk of misreading for the methodology applied in this study. Human b-globin was detected in 70 of the 87 samples from group A and in 60 of the 90 samples from group B. Therefore, 80.4% and 66.7% of the samples, respectively, were used. Although many studies have used the plasmid

Figure 2 - Venn diagram from group B (1 positive PCR result).

2016

CLINICS 2011;66(12):2013-2018

Chlamydia trachomatis in patients with VKC Nishiwaki-Dantas MC et al.

Figure 3 - ROC curves for DFA and PCR. of Santa Casa in Saõ Paulo, Brazil, for the statistical review and analysis provided, FAPESP (Fundaçaõ de Amparo a` Pesquisa do Estado de Saõ Paulo) for financial support and Prof. Dra. Lia Mara Rossi, from Faculdade de Cieˆncias Me´dicas da Santa Casa de Saõ Paulo. Statement about Conformity with Author Information: This study was reviewed and approved by the Bioethics Committee from Santa Casa in Saõ Paulo, Brazil.

Although both trachoma and VKC have characteristic periods of waxing and waning even without treatment, the chronicity, the recurrent nature and the long duration of the diseases can be highly disabling. Patients are disabled not only by the severe symptoms in the acute phases but also by the more frequent occurrences of complications, such as lid abnormalities and conjunctival and corneal scars, which can cause reduced visual acuity, impairing the acquisition of reading skills in children.1,3 Trachoma is a self-limiting disease, resolving in approximately one year even without treatment. However, treatment is essential to avoid recurrences, scars, and other sequelae. Immunological diseases such as VKC are treated with anti-allergic and anti-inflammatory drugs such as corticosteroids that depress cell immunity and are implicated in the control of infections and trachoma. In contrast, trachoma is treated with antibiotics. Therefore, because the treatments differ for VKC and trachoma, it is essential to accurately determine their co-occurrence to initiate the appropriate treatment. Based on the population studied and the applied methodologies, we report several findings. First, there was an association between VKC and Chlamydia trachomatis infection that was confirmed by positive DFAs in 49.4% of VKC patients and by positive PCRs in 20.0% of patients. Second, DFA detected Chlamydia trachomatis in a greater number of patients than did PCR, making it the more sensitive and specific test. Third, although the diagnosis of trachoma is essentially clinical, the disease may not be detected in some VKC patients. In conclusion, we suggest considering laboratory tests to routinely detect Chlamydia trachomatis by DFA in patients with severe and refractory VKC.

AUTHOR CONTRIBUTIONS Nishiwaki-Dantas MC designed and conducted the study; collected, managed, analyzed, and interpreted the data; prepared, reviewed, and approved the manuscript. Abreu MT designed and conducted the study; managed, analyzed, and interpreted the data; prepared, reviewed, and approved the manuscript. Melo CM designed and conducted the study; collected, managed, analyzed, and interpreted the data; prepared, reviewed, and approved the manuscript. Romero IL designed and conducted the study; collected, managed, analyzed, and interpreted the data; prepared, reviewed, and approved the manuscript. Neto RBM designed and conducted the study; collected the data; prepared, reviewed, and approved the manuscript. Dantas PEC designed and conducted the study; managed, analyzed, and interpreted the data; prepared, reviewed, and approved the manuscript.

REFERENCES 1. Leonardi A, Smith LM, Secchi AG. Vernal Keratoconjunctivitis. In: Abelson MB. Allergic Diseases of the Eye. Philadelphia: WB Saunders; 2000;pp179-96. 2. Nishiwaki-Dantas MC, Finzi S. Conjuntivites ale´rgicas. In: Lima ALH, Nishiwaki-Dantas MC, Alves MR. Manual do Conselho Brasileiro de Oftalmologia. Doenc¸ as Externas Oculares e Co´ rnea. Rio de Janeiro:Editora Cultura Me´dica; 1999;pp199-221. 3. Friedlaender MH, Cameron J. Vernal keratoconjunctivitis and trachoma. Int Ophthalmol. 1988;12:47-51, doi: 10.1007/BF00133781. 4. Jones BR. The prevention of blindness from trachoma. Trans Ophthalmol UK. 1975;95:16-32. 5. Rao SK, Madhavan HN, Padmanabhan P, Lakshmi GS, Watarajan K, Garg D. Ocular chlamydial infections. Cornea. 1996;15:62-5, doi: 10.1097/ 00003226-199601000-00011. 6. Medina NH, Gentil RM, Carac¸a M, Suzuki CK, Melles HHB. Ana´lise de exames de imunofluoresceˆncia direta para o diagno´stico de tracoma. Rev Saude Pub. 1996;30:135-40.

ACKNOWLEDGMENTS The authors wish to acknowledge Niro Kasahara, MD, PhD, from the Statistics and Epidemiology Service of the Department of Ophthalmology

2017

Chlamydia trachomatis in patients with VKC Nishiwaki-Dantas MC et al.

CLINICS 2011;66(12):2013-2018

7. Stephens RS, Kuo CC, Tam MR. Sensitivity of immunofluorescence with monoclonal antibodies for detection of Chlamydia trachomatis inclusions in cell culture. J Clin Microbiol. 1982;16:4-7. 8. Ve´rin P, Gendre P. Conjonctivite printaniere et pathologie a` chlamydiae. Bull Soc Ophtalmol Fr. 1980;80:1163-5. 9. Ve´rin P, Gendre P, Aoizeratt F, Gaulthier L. Frequency of chlamydia in patients with vernal keratoconjunctivitis. Rev Int Trach Pathol Ocul Trop Subtrop Lante Publique. 1989;66:111-8. 10. Melo CM, Nishiwaki-Dantas MC, Finzi S, Guidugli T, Dantas PEC. Imunofluoresceˆncia direta para pesquisa de Chlamydia trachomatis em portadores de conjuntivite ale´rgica [abstract]. Arq Bras Oftalmol. 2000; 63(4)(Supl):20. 11. Bobo LD. Polymerase chain reaction detection of Chlamydia trachomatis. In: Persing DH, Smith TF, Tenover FC, White TJ. Diagnostic molecular

microbiology. Principles and applications. Washington DC: American Society of Microbiology;1993;pp235-41. 12. Scarpi MJ, Gentil R. Sinais e sintomas de tracoma em povoado do estado da Bahia, Brasil. Arq Bras Oftalmol. 1990;53:276-80. 13. Mouton JW, Verkooyen R, van der Meijden WI, van Rijsoort-Vos TH, Goessens WH, Kluytmans JA, et al. Detection of Chlamydia trachomatis in male and female urine specimens by using the amplified Chlamydia trachomatis test. J Clin Microbiol. 1997;35:1369–72. 14. Yang JL, Schachter J, Moncada J, Habte D, Zerihun M, House JI, et al. Comparison of an rRNA-based and DNA-based nucleic acid amplification test for the detection of Chlamydia trachomatis in trachoma. Br J Ophthalmol. 2007;91:293–5, doi: 10.1136/bjo.2006. 099150.

2018

CLINICS 2011;66(12):2019-2023

DOI:10.1590/S1807-59322011001200004

CLINICAL SCIENCE

Analysis of the reactivity of indirect immunofluorescence in patients with pemphigus foliaceus and pemphigus vulgaris using rat bladder epithelium as a substrate Damaris G. Ortolan, Danielle P. G. Souza, Vale´ria Aoki, Claudia G. Santi, Tatiana V. B. Gabbi, Ligia M. F. Ichimura, Celina W. Maruta Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Dermatology, Sa˜o Paulo, Brazil.

OBJECTIVES: To evaluate the reactivity of indirect immunofluorescence using rat bladder epithelium as a substrate in patients with pemphigus foliaceus and pemphigus vulgaris from the Department of Dermatology, University of Sa˜o Paulo Medical School, Brazil. METHODS: Thirty-two patients (8 male and 24 female) from the Department of Dermatology, University of Sa˜o Paulo Medical School, were selected. Three had mucosal pemphigus vulgaris, 20 had mucocutaneous pemphigus vulgaris, and 9 had pemphigus foliaceus. Patients’ sera were tested by indirect immunofluorescence performed on human foreskin and rat bladder epithelium and by ELISA assays utilizing baculovirus-expressed recombinant desmoglein 3 and desmoglein 1. RESULTS: No patients with mucosal pemphigus vulgaris, 5 of 20 patients with mucocutaneous pemphigus vulgaris (25%) and 4 of 9 patients with pemphigus foliaceus (44%) had positive indirect immunofluorescence using rat bladder epithelium as a substrate. CONCLUSION: Indirect immunofluorescence using rat bladder epithelium as a substrate is recommended whenever a diagnosis of paraneoplastic pemphigus is considered. The identification of a subset of pemphigus foliaceus and pemphigus vulgaris patients that recognizes desmoplakins by this laboratory tool is critical to avoid the misdiagnosis of paraneoplastic pemphigus. KEYWORDS: Pemphigus vulgaris; Paraneoplastic pemphigus; Indirect immunofluorescence; Rat bladder epithelium; Pemphigus foliaceus. Ortolan DG, Souza DPG, Aoki V, Santi CG, Gabbi TVB, Ichimura LMF, et al. Analysis of the reactivity of indirect immunofluorescence in patients with pemphigus foliaceus and pemphigus vulgaris using rat bladder epithelium as a substrate. Clinics. 2011;66(12):2019-2023. Received for publication on May 1, 2011; First review completed on May 26, 2011; Accepted for publication on August 18, 2011 E-mail: cwmaruta@terra.com.br Tel.: 55 11 26618036

autoantibodies have also been found in other diseases, including pemphigus foliaceus (PF), pemphigus vulgaris (PV), bullous pemphigoid (BP), and erythema multiforme major.4-12 A possible mechanism for the development of autoantibodies to DP in those dermatoses is explained by the epitope-spreading phenomenon.5,6 This phenomenon includes an initial autoimmune response against a specific antigen that may lead to the recognition of other antigens that are not necessarily related by homology but are physically linked or share proximal locations.13 The presence of anti-DP antibodies in IgG-mediated pemphigus does not seem to characterize a particular subgroup,7 and it is unlikely that these antibodies could be solely responsible for acantholysis. It is possible that anti-DP antibodies could potentiate the disruption in cell-cell adhesion originally initiated by anti-desmoglein antibodies.6 The urinary bladder epithelium has desmosomes that contain DP I and/or DP II but do not express PF or PV

INTRODUCTION Desmoplakin I (DP I) and desmoplakin II (DP II) are constitutive desmosomal plaque proteins that provide a link between the desmosomal cadherin and the intermediate filament cytoskeleton, thereby contributing to the functional integrity of the desmosome-keratin filament complex.1 DP autoantibodies are present in paraneoplastic pemphigus (PNP) as a component of a complex humoral immune reaction2 and were once considered to be a sensitive and specific feature in the diagnosis of PNP.3 However, these

2019

Reactivity of indirect immunofluorescence in patients with PF and PV Ortolan DG et al.

CLINICS 2011;66(12):2019-2023

Table 1 - Classification of disease activity. Complete remission

Off therapy

Partial remission

On therapy Off therapy

Absence of new or established lesions while the patient is off all systemic therapy for at least 2 months

On therapy On minimal therapy Relapse/Flare

Presence of transient new lesions that heal within 1 week without treatment and while the patient is off all systemic therapy for at least 2 months The presence of transient new lesions that heal within 1 week while the patient is receiving systemic therapy The presence of transient new lesions that heal within 1 week while the patient is receiving minimal therapy, including topical steroids Appearance of at least three lesions/month that do not heal spontaneously within 1 week, or by the extension of established lesions, in a patient who has achieved disease control

antigens.14 Therefore, the reactivity of indirect immunofluorescence using rat bladder epithelium (IIF-RBE) as a substrate in patients with PF or PV suggests the presence of anti-DP autoantibodies.

1. ELISA Sera samples (15100 dilution) were added to microwell plates coated with baculovirus-expressed desmogleins for 60 minutes. After washing, horseradish peroxidase-conjugated IgG was added and allowed to incubate for 60 minutes. Following another wash, the peroxidase substrate was added and allowed to incubate for an additional 30 minutes. Then, a 1.0-N sulfuric acid solution was added to each well to terminate the enzyme reaction and stabilize the color development. The absorbance was measured at 450 nm by an ELISA plate reader (MBL, Japan). A single PF serum sample and a single PV serum sample were selected as positive control serum samples for the Dsg1 and Dsg3 ELISAs, respectively. The index was calculated as follows: index = (optical density (OD) of the tested serum - OD of the negative control)/(OD of the positive control serum - OD of the negative control) 6100. The interpretation of results was conducted according to the following parameters.

OBJECTIVES The aim of this study was to analyze the reactivity of IIFRBE in patients with PF and PV from the Department of Dermatology, University of Sa˜o Paulo Medical School to evaluate whether this diagnostic tool could lead to a misdiagnosis of PNP for PF and PV patients.

MATERIALS AND METHODS Upon approval by the Ethics Committee, 32 patients (8 male and 24 female, with a mean age of 45 years) followed up by the Department of Dermatology, University of Sa˜o Paulo Medical School between 1994 and 2009 were selected for the study. Three of 32 patients had mucosal pemphigus vulgaris (MPV), 20 had mucocutaneous pemphigus vulgaris (MCPV), and 9 had pemphigus foliaceus (PF). All diagnoses were confirmed by clinical, histopathological, and direct immunofluorescence evaluations. No patients were diagnosed with PNP until the completion of this study. The disease activity was classified according to the criteria adapted from the consensus statement on definitions of the disease, end points and the therapeutic response for pemphigus (Table 1).15 Patients’ sera were tested by indirect immunofluorescence and an enzyme-linked immunosorbent assay (ELISA). IIF analysis of the patients’ sera was performed on human foreskin and rat bladder epithelium. ELISA tests utilized baculovirus-expressed recombinant desmoglein 3 (Dsg3) and desmoglein 1 (Dsg1). 1. Indirect immunofluorescence using human foreskin (IIF-HFS) or rat bladder epithelium (IIF-RBE) as a substrate: Four micrometer cryostat sections of HFS and RBE were incubated for 60 minutes with sera dilutions starting at 1520. The slides were washed in Tris-buffered saline (TBS) twice (20 minutes each) and then covered with fluorescein isothiocyanate-conjugated (FITC) goat anti-human IgG at a dilution of 1530 (Sigma, USA) for 30 minutes. After two additional 20-minute washes (TBS), the slides were mounted in buffered glycerol and examined under an epiluminescent microscope (Zeiss, Germany).

RESULTS Mucosal pemphigus vulgaris (MPV) All MPV patients (n = 3) were in partial remission on therapy, and the mean follow-up time was 4.6 months. All patients had negative IIF-RBE and positive IIF-HFS, with titers ranging from 1540 to 15320 (mean titer of 15160). All had positive ELISA results for Dsg3, and 1 patient also had a positive ELISA result for Dsg1.

Mucocutaneous pemphigus vulgaris (MCPV) Seventeen of 20 MCPV patients were classified as in partial remission on therapy, and 4 (23%) had positive IIFRBE. Three of 20 MCPV patients were classified as in partial remission on minimal therapy, and 1 (33%) had positive IIFRBE. Therefore, 5 of 20 (25%) PV sera showed reactivity in IIF-RBE, with titers ranging from 1540 to 15160 (mean titer of 1580) (Figure 1). Positive IIF-HFS was in 18 of 20 MCPV sera, with titers ranging from 1580 to 155,120 (mean titer of 151,280). The 2 PV patients with negative IIF-HFS were in partial remission on therapy. The mean IIF-HFS titer among patients with MCPV in partial remission on therapy was 151,280 (mean titer of 151,280 among patients with positive IIF-RBE and 151,280 among patients with negative IIF-RBE). The mean titer of

1. Dsg1 Less than 14 14 to 20 Greater than 20

1. Dsg3 Negative Indeterminate Positive

Less than 9 9 to 20 Greater than 20

2020

Negative Indeterminate Positive

CLINICS 2011;66(12):2019-2023

Reactivity of indirect immunofluorescence in patients with PF and PV Ortolan DG et al.

Figure 1 - (A) Clinical aspects of the lesions of a PV patient and (B) the results of direct immunofluorescence demonstrating intercellular IgG at the basal layers of the epidermis (6400); (C) indirect immunofluorescence using human foreskin as a substrate showing intercellular intraepidermal IgG deposits (6400); and (D) indirect immunofluorescence using rat bladder epithelium as a substrate demonstrating intercellular intraepithelial IgG deposits (6400).

Figure 2 - (A) Clinical aspects of the lesions of a PV patient and (B) the results of direct immunofluorescence demonstrating intercellular intraepidermal IgG deposits (6400); (C) indirect immunofluorescence using human foreskin as a substrate showing intercellular intraepidermal IgG deposits (6400); and (D) indirect immunofluorescence using rat bladder epithelium as a substrate demonstrating intercellular intraepithelial IgG deposits (6400).

IIF-HFS among the MCPV patients in partial remission on minimal therapy was 151,280 (mean titer of 152,560 among patients with positive IIF-RBE and 15160 among patients with negative IIF-RBE). Seventeen of 20 MCPV patients had positive ELISA results for Dsg3, and 10 were anti-Dsg1 positive. The mean follow-up time of the MCPV patients was five years. MCPV patients in partial remission on therapy had a mean follow-up of five years (three years among patients with positive IIF-RBE and six years among patients with negative IIF-RBE). MCPV patients in partial remission on minimal therapy had a mean follow-up of four years (four years among patients with positive IIF-RBE and three years among patients with negative IIF-RBE). The overall reactivity of IIF-RBE in all 23 PV patients was 22% (5/23).

The mean IIF-HFS titer among patients with PF in partial remission on therapy was 151,280 (mean titer of 152,560 among patients with positive IIF-RBE and 151,280 among patients with negative IIF-RBE). The mean IIF-HFS titer among patients with PF in partial remission on minimal therapy was 151,280 (mean titer of 151,280 among patients with positive IIF-RBE and negative IIF-RBE). PF patients with positive IIF-RBE had a long-term disease (4-15 years). The mean follow-up of the PF patients was five years. Patients with PF in partial remission on therapy had a mean follow-up of six years (ten years among patients with positive IIF-RBE and three years among patients with negative IIF-RBE). Patients with PF in partial remission on minimal therapy had a mean follow-up of six years (four years among patients with positive IIF-RBE and eight years among patients with negative IIF-RBE). The demographic data from the patients are shown in Table 2.

Pemphigus foliaceus (PF) Interestingly, four out of nine PF patients had a positive IIF-RBE with titers ranging from 1520 to 1580 (mean titer of 1540). All were in partial remission. The overall reactivity of IIF-RBE in all nine PF patients was 44% (4/9) (Figure 2). Five of nine PF patients were classified as in partial remission on therapy, and two (40%) had positive IIF-RBE. Four of nine PF patients were classified as in remission on minimal therapy, and two (50%) had positive IIF-RBE. All nine PF sera showed positive results for IIF-HFS, with titers ranging from 1580 to 155,120 (mean titer of 151,280). All nine PF sera showed negative results for Dsg3 ELISA, and one showed negative Dsg1 ELISA results. This patient was in partial remission on minimal therapy.

DISCUSSION The use of RBE as a substrate for IIF in PNP started in 1990 with Anhalt et al.16 The specificity of the RBE substrate for PNP was reported to be high, varying from 83% to 95%.3,14,17 However, Cozzani et al.7 found 21% positive IIFRBE in patients with PV, which is in accord with our data (22% in PV patients). These authors suggested a role for anti-DP in determining disease severity.6,7 In our study, all PV patients with positive IIF-RBE belonged to the mucocu-

2021

Reactivity of indirect immunofluorescence in patients with PF and PV Ortolan DG et al.

it is unlikely that anti-DP antibodies in our PF and PV patients played a role in the loss of keratinocyte adhesion, leading to acantholysis and blister formation. Moreover, the possible presence of anti-DP autoantibodies in these patients could be explained by long-term chronic autoimmune disease. IIF-RBE is a relevant tool when considering patients with PNP. The anti-desmoplakin response of IIF-RBE is not a routine technique employed to investigate PF or PV patients and should only be performed in patients with suspected PNP. The identification of a subset of PF and PV patients with positive IIF-RBE is relevant to avoid a misdiagnosis of PNP in doubtful cases. Therefore, the correlation of clinical features, histopathology, direct immunofluorescence, and indirect immunofluorescence is necessary to achieve correct diagnoses.

Table 2 - Clinical and immunological profile of pemphigus patients. Patient

Age/Sex

Follow-up

IgG IIFHFS

IgG IIFRBE

MPV – partial remission on therapy 1 40/M 8m 1540 2 25/M 4m 15320 3 27/M 2m 15320 MCPV – partial remission on therapy 4 28/F 5y 15640 5 39/F 1y 155120 6 44/M 5y 1580 7 47/F 2y 151280 1580 8 64/F 5y 15160 9 71/F 2y 10 25/F 11 y 151280 11 72/F 15 y 15640 12 31/F 6y 15320 15160 13 61/M 7y 151280 14 40/F 7m 15320 15 55/F 2y 15640 1540 16 57/F 12 y 17 41/F 3y 152560 18 38/F 4y 151280 19 60/F 6y 151280 20 40/F 1y 155120 1540 MCPV – partial remission on minimal therapy 21 35/F 4y 152560 1540 22 32/F 2y 15160 23 48/F 5y 15320 PF – partial remission on therapy 24 62/M 5y 151280 25 55/M 6y 151280 1520 26 56/F 15 y 155120 1540 27 62/F 3y 151280 28 29/F 2y 15320 PF – partial remission on minimal therapy 29 58/F 4y 1580 1580 30 42/M 5y 152560 1540 31 41/F 12 y 15320 32 51/F 4y 152560 -

ELISA Dsg1

ELISA Dsg3

+ -

+ + +

+ + + + + + Ind. Ind. + + +

+ + + + + + + + + + + + + + +

+ -

+ +

+ + + + +

+ + +

CLINICS 2011;66(12):2019-2023

ACKNOWLEDGMENTS We thank Ligia M. F. Ishii for her invaluable technical help.

AUTHOR CONTRIBUTIONS Ortolan DG was responsible for the data acquisition, data analysis and interpretation, and drafting of the manuscript. Souza DPG was responsible for the data acquisition, and drafting of the manuscript. Aoki V, Santi CG and Maruta CW conceived and designed the study, and were also responsible for the acquisition, analysis and interpretation of data, drafting and critical revision of the manuscript for important intellectual content and study supervision. Gabbi TVB was responsible for the data acquisition.

REFERENCES 1. Green KJ, Parry DA, Steinert PM, Virata ML, Wagner RM, Angst BD, et al. Structure of the human desmoplakins: implications for function in the desmossomal plaque. J Biol Chem. 1990;2603-12. 2. Anhalt GJ. Paraneoplastic pemphigus. Adv Dermatol. 1997;12:77-96. 3. Joly P, Richard C, Gilbert D, Courville P, Chosidow O, Roujeau JC, et al. Sensitivity and specificity of clinical, histologic, and immunologic features in the diagnosis of paraneoplastic pemphigus. J Am Acad Dermatol. 2000;145:838-40. 4. Jiao D, Bystryn JC. Antibodies to desmoplakin in a patient with pemphigus foliaceous. J Eur Acad Dermatol Venereol. 1998;11:169-72, doi: 10.1111/j.1468-3083.1998.tb00774.x. 5. Kim SC, Chung YL, Kim J, Cho NJ, Amagai M. Pemphigus vulgaris with autoantibodies to desmoplakin. Br J Dermatol. 2001;145:838-40, doi: 10. 1046/j.1365-2133.2001.04415.x. 6. Mimouni D, Foedinger D, Kouba DJ, Orlow SJ, Rappersberger K, Sciubba JJ, et al. Mucosal dominant pemphigus vulgaris with anti-desmoplakin autoantibodies. J Am Acad Dermatol. 2004;51:62-7, doi: 10.1016/j.jaad. 2003.11.051. 7. Cozzani E, Dal Bello MG, Mastrogiacomo A, Drosera M, Parodi A. Antidesmoplakin antibodies in pemphigus vulgaris. Br J Dermatol. 2006;154:624-8, doi: 10.1111/j.1365-2133.2005.06987.x. 8. Hashimoto T, Watanabe K, Ishiko A, Shimizu H, Hanyaku H, Kimura S, et al. A case of bullous pemphigoid with antidesmoplakin autoantibodies. Br J Dermatol. 1994;131:694-9, doi: 10.1111/j.1365-2133.1994.tb04985.x. 9. Okura M, Tatsuno Y, Sato M, Hashizume S, Kubota Y, Matumura K, et al. Vesicular pemphigoid with antidesmoplakin autoantibodies. Br J Dermatol. 1997;136:794-6, doi: 10.1111/j.1365-2133.1997.tb03677.x. 10. Delmonte S, Cozzani E, Drosera M, Parodi A, Rebora A. Rat Bladder Epithelium: A Sensitive Substrate for Indirect Immunofluorescence of Bullous Pemphigoid. Acta Derm Venereol. 2000;80:175-8, doi: 10.1080/ 000155500750042916. 11. Foedinger D, Anhalt GJ, Boecskoer B, Elbe A, Wolff K, Rappersberger K. Autoantibodies to desmoplakin I and II in patients with erythema multiforme. J Exp Med. 1995;181:169-79, doi: 10.1084/jem.181.1.169. 12. Foerdinger D, Sterniczky B, Elbe A, Anhalt G, Wolff K, Rappersberger K. Autoantibodies against desmoplakin I and II define a subset of patients with erythema multiforme major. J Invest Dermatol. 1996;106:1012-6, doi: 10.1111/1523-1747.ep12338566. 13. Chan LS, Vanderlugt CJ, Hashimoto T, Nishikawa T, Zone JJ, Black MM, et al. Epitope spreading: lessons from autoimmune skin diseases. J Invest Dermatol. 1998;110:103-9, doi: 10.1046/j.1523-1747.1998.00107.x 14. Helou J, Allbritton J, Anhalt GJ. Accuracy of indirect immunofluorescence testing in the diagnosis of paraneoplastic pemphigus. J Am Acad Dermatol. 1995;32:441-8, doi: 10.1016/0190-9622(95)90066-7. 15. Murrell DF, Dick S, Ahmed AR, Amagai M, Barnadas MA, Borradori L, et al. Consensus statement on definitions of disease, end points, and

IIF-HFS: indirect immunofluorescence using human foreskin; IIF-RBE: indirect immunofluorescence using rat bladder epithelium; MPV: mucosal pemphigus vulgaris; MCPV: mucocutaneous pemphigus vulgaris; PF: pemphigus foliaceus; F: female; M: male; m: months, y: years; Ind.: indeterminate; (–): negative; (+): positive.

taneous variant, and this observation supports that suggestion; however, those patients were in partial remission. In our study, there was not a clear correlation between the IIFRBE results and disease activity. Furthermore, the results of IIF-HFS and the follow-up time did not correlate with the reactivity of IIF-RBE. Anti-desmoglein 1 and/or 3 autoantibodies were detected in all patients except for one who had PF in clinical remission on minimal therapy. The presence of these autoantibodies reinforced the diagnosis of PF or PV. The sensitivity and specificity of ELISA with recombinant Dsg1 and 3 is reported to be approximately 95-98%.18 Anti-DP antibodies have previously been described in one PF patient,4 which is in contrast to our IIF-RBE results showing reactivity in 4 of 9 PF patients (44%). All PF patients had a long-term follow-up (4-15 years). The long-term follow-up of our positive IIF-RBE patients (three years for MCPV and six years for PF) may indicate that these patients will not develop PNP. A possible explanation for the presence of anti-DP antibodies in PF and PV is the epitope spreading phenomenon. However,

2022

CLINICS 2011;66(12):2019-2023

Reactivity of indirect immunofluorescence in patients with PF and PV Ortolan DG et al.

therapeutic response for pemphigus. J Am Acad Dermatol. 2008;58:10435, doi: 10.1016/j.jaad.2008.01.012. 16. Anhalt GJ, Kim SC, Stanley JR, Korman NJ, Jabs DA, Kory M, et al. Paraneoplastic pemphigus. An autoimmune mucocutaneous disease associated with neoplasia. N Engl J Med. 323:1729-35, doi: 10.1056/ NEJM199012203232503. 17. Liu AY, Valenzuela R, Helm TN, Camisa C, Melton AL, Bergfeld WF, et al. Indirect immunofluorescence on rat bladder transitional

epithelium: a test with high specificity for paraneoplastic pemphigus. J Am Acad Dermatol. 1993;28:696-9, doi: 10.1016/0190-9622(93) 70095-B. 18. Ide A, Hashimoto T, Amagai M, Tanaka M, Nishikawa T. Detection of autoantibodies against bullous pemphigoid and pemphigus antigens by an enzyme-linked immunosorbent assay using the bacterial recombinant proteins. Exp Dermatol. 1995;4:112-6, doi: 10.1111/j.1600-0625.1995. tb00232.x.

2023

CLINICS 2011;66(12):2025-2029

DOI:10.1590/S1807-59322011001200005

CLINICAL SCIENCE

A multidetector tomography protocol for follow-up of endovascular aortic aneurysm repair Roberto Moraes Bastos,I Alvaro Razuk Filho,II Roberto Blasbalg,I Roberto Augusto Caffaro,II Walter Khegan Karakhanian,II Antonio Jose´ RochaIII I

Santa Casa de Miserico´rdia de Saõ Paulo, Radiology, Saõ Paulo/SP, Brazil. II Santa Casa de Saõ Paulo, Surgery, Saõ Paulo/SP, Brazil. III Universidade de Saõ Paulo, Faculdade de Medicina, Instituto de Radiologia, Saõ Paulo/SP, Brazil.

OBJECTIVE: The purpose of this study was to improve the use of 64-channel multidetector computed tomography using lower doses of ionizing radiation during follow-up procedures in a series of patients with endovascular aortic aneurysm repair. METHODS: Thirty patients receiving 5 to 29 months of follow-up after endovascular aortic aneurysm repair were analyzed using a 64-channel multidetector computed tomography device by an exam that included pre- and postcontrast with both arterial and venous phases. Leak presence and type were classified based on the exam phase. RESULTS: Endoleaks were identified in 8/30 of cases; the endoleaks in 3/8 of these cases were not visible in the arterial phases of the exams. CONCLUSION: The authors conclude that multidetector computed tomography with pre-contrast and venous phases should be a part of the ongoing follow-up of patients undergoing endovascular aortic aneurysm repair. The arterial phase can be excluded when the aneurism is stable or regresses. These findings permit a lower radiation dose without jeopardizing the correct diagnosis of an endoleak. KEYWORDS: Multidetector Tomography; Aneurism; Aorta; Endoleak; Radiation. Bastos RM, Razuk Filho A, Blasbalg R, Caffaro RA, Karakhanian WK, Rocha AJ. A multidetector tomography protocol for follow-up of endovascular aortic aneurysm repair. Clinics. 2011;66(12):2025-2029. Received for publication on June 9, 2011; First review completed on August 2, 2011; Accepted for publication on August 18, 2011 E-mail: robertomb@uol.com.br Tel.: 55 11 30211658

aneurysmal sack, an undetected endoleak occurring in the late phases of the CT, an ultra-filtration of blood across the sleeve of the prosthesis, or a transmission of pressure by an aneurysmal thrombus. The incidence of endoleaks after EVAR ranges from 2.4% to 45.5%;2,4,7-9 several factors may contribute to the large disparity among the reported results. It is important to note that a variety of prosthesis types and diagnostic methods were used to evaluate the endoleaks in these studies.10-12 Despite the wide disparity in the reported results, multidetector CT (MDCT) has proven to be the most useful technique for preoperative evaluation. MDCT enables luminal and extra-luminal assessment of an aneurism using highresolution spatial images that provide a diagnostic sensitivity for endoleaks that is superior to DA.13,14 The images obtained using this technique also allow for three-dimensional reconstruction and multi-planar reformations, which are useful for evaluating the aneurysmal sack volume. However, there is still a need for examination methods with greater diagnostic accuracy and that use a lower dose of ionizing radiation.15-17 The objective of this study was to improve the use of MDCT in the follow-up of a series of patients with EVAR to ensure adequate evaluation of aneurysmal sack parameters and to accurately diagnose endoleaks with the lowest possible dose of ionizing radiation.

INTRODUCTION Endovascular aortic aneurysm repair (EVAR) has been shown to be a safe technique.1 It was first described by White et al.,2 and the most common complication is extra-luminal leakage from the prosthesis or from the interior portion of the aneurysmal sack (i.e., an endoleak). Experimental studies have supported the concept of ‘‘endotension,’’ which is the persistent or recurrent pressurization of the aneurysmal sack after EVAR.3 In theory, the pressure maintained in the interior of the sack by a low-flow endoleak outside of the prosthesis lumen is indicative of an increase in aneurism size. These endoleaks are not visible on conventional imaging exams, such as computed tomography (CT) or digital angiography (DA).3 Veith et al.4 proposed a detailed classification system for endoleaks (Figure 1) in an attempt to describe the features and to facilitate the management of patients with this complication. Endotension is considered a type-V endoleak5,6 and is defined as an elevation of pressure within the Copyright ß 2011 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported.

2025

Multidetector tomography protocol Bastos RM et al.

CLINICS 2011;66(12):2025-2029

Figure 1 - Illustration of endoleaks using the Veith classification (Veith et al.4).

and the common femoral arteries, was used in three phases. The pre-contrast phase was acquired with a collimation of 2.5 mm, 120 kVp, and 322 mAs. The arterial and venous post-contrast phases were both acquired with 0.625-mm slice collimation, a pitch of 0.703, a tube rotation velocity of 0.75 per second, 120 kVp, and 350 mAs; they were then reconstructed to a 1.0-mm slice thickness. X-ray tube current modulation was used to reduce the total radiation dose. Iodine contrast (concentration 300 mg/ml) at a dose of 1.5 ml/kg (average 100 ml per patient) was injected in the antecubital vein using a 20-gauge catheter and an injection pump with a 5 ml/second velocity followed by 30 ml of physiologic saline. For the post-injection phase, a device was placed on the aorta at the celiac trunk (bolus tracking) to detect when 180 Hounsfield Units (HU) were reached, which marked the arrival of half of the contrast material and the end of the arterial phase. The venous phase occurred 60 seconds after the first phase. The apneic period varied from 12 to 18 seconds for all phases of the exam.

MATERIALS AND METHODS Patients This study was approved by the research ethics committee of the Santa Casa de Miserico´rdia de Sa˜o Paulo, and all patients signed an informed consent form. We included 30 patients who were undergoing EVAR during a period of 5 to 29 months post-surgery (average 14.4 months; median 13.5 months). The post-operative follow-up protocol of our service and the MDCT predefined protocol were used in this study. All subjects were adults (26 men and 4 women) with an age range of 55–83 years (mean 70.9 years; median 72 years). The endoprostheses used were chosen based on anatomic criteria determined by pre-operative CTs without bias from this study. All prostheses were of the aorto-bi-iliac type and included a variety of brands: TalentH (Meditronic Vascular, Sunrise, FL; n = 18); ExcluderH Endoprothesis (W.L. Gore & Associates, Sunnyvale, CA; n = 1); ZenithH (Cook Inc., Bloomington, IN; n = 8); and ApoloH (Nano Endoluminal, Floriano´polis, Brazil; n = 3). Patients with renal failure or allergic problems or those who did not agree to participate in the protocol were not included.

Image Analysis All images were analyzed independently on a workstation (GE Medical Systems, Milwaukee, WI) by two radiologists (RMB and RB) who had 11 and 15 years of experience, respectively, with vascular CT imaging, and the final results were reached by consensus.

Exams A 64-channel MDCT (Brilliance, Philips, Eindhoven, Holland), which covered the region between the diaphragm

2026

CLINICS 2011;66(12):2025-2029

Multidetector tomography protocol Bastos RM et al.

RESULTS

Table 1 - Endoleaks from the arterial and venous phases. CT

ARTERIAL

VENOUS

Results Absent Present Type I Type II Type III Type IV Type V Total

25 (83.3%) 5 (16.7%) 0 (0%) 5 (100%) 0 (0%) 0 (0%) 0 (0%) 30

22 (73.3%) 8 (26.7%) 0 (0%) 8 (100%) 0 (0%) 0 (0%) 0 (0%) 30

The protocol utilized in this study yielded an average of 1079 image slices per exam (minimum 741; maximum 1263), with the average pre-contrast phase having 16.8% (181/ 1079), the arterial phase having 41.6% (449/1079), and the venous phase having 41.6% (449/1079) of the total slices obtained. The effective radiation dose in the pre-contrast phase was 732 mGy.cm (22%); for both arterial and venous phases, it was 1302 mGy.cm (39%). The venous phase analysis resulted in the diagnosis of type-II endoleaks for 8/30 cases (26.7%), while the arterial phase revealed only 5/8 leaks (Table 1). All diagnosed endoleaks were type II, three of which were fed by the inferior mesenteric artery, one of which was supplied by a lumbar artery (type IIA); the other four leaks were fed by two or more lumbar arteries (type IIB, Figure 2). The endoleak sites corresponded to the nutrient artery exits; the type-II endoleaks originating from the lumbar arteries (n = 5) were posterior, and the type-II leaks stemming from the inferior mesenteric arteries (n = 3) were anterior. The maximum transverse diameter of the endoleak sites was 4.8 cm in the arterial phase and 7.0 cm in the venous phase, with a trend toward increased size in the venous phase of the exam. One case was initially interpreted as a type-I leak on MDCT, but on consensus evaluation, it was decided that this represented a focal bulging of the aortic wall in the proximal segment free of tissue (i.e., free-flow). DA was not used for the majority of the subjects in this study due to the stability or reduction in the aneurysmal dimensions measured with MDCT. Only two patients had DA performed because of the expansion of the aneurysm and to determine the appropriate course of therapy. The first case was treated with a translumbar puncture and injection of glue, and the other case underwent conservative treatment with regression of the aneurysm. Comparative analysis of the preoperative tomographic study showed a reduction in the maximal transverse diameter of the aneurysm (p = 0.0003) in the majority of patients. Preoperative diameters ranged from 4.9 to 8.7 cm (mean 6.2 cm; median 6.05 cm); in the postoperative phase, the diameters ranged from 3.0 to 9.9 cm (mean 5.5 cm; median 5.65 cm). Only one patient had an increase in

An endoleak was deemed absent or present based on the classification criteria proposed by Veith et al.4 according to the characteristics of the leak and the pertinent information regarding the aneurism, the prosthesis and the prosthesis integrity. When present, the endoleak was measured at the largest transverse diameter. At the endovenous precontrast phase, calcifications or areas of greater attenuation of the aneurysmal sack due to recent bleeding that could hamper the post-contrast evaluation were assessed. Aneurism measurements were also assessed on pre-operative exams. The full set of arterial phase images was used to create the following three-dimensional angiographic image displays: ‘‘volume rendered’’ (VR) and ‘‘maximum intensity projections’’ (MIP).

Statistical Analysis The McNemar test was used to evaluate the difference in the detection of endoleaks between the arterial and venous phases. Wilcoxon’s Test was used to determine the differences in the dimensions of the endoleak sites between the arterial and venous phases and to compare the diameter of the neck and the aneurism between the preoperative phase and the time of our analysis. Fisher’s exact test was used to determine the presence of an endoleak based on the different types of endoprostheses. An ANOVA test for repeated measurement with transformation of ranks was used to compare the diameter of the neck of the aneurism preoperatively and postoperatively and in the presence or absence of an endoleak.

Figure 2 - Type-IIB from the lumbar arteries (arrows) in the arterial (A) and venous (B) phases of the MDCT reveal an increase at the site of contrast during the venous phase. Using the volume-rendering algorithm (C), it is clear that two distinct levels of lumbar arteries are filling the aneurysmal sack (arrows).

2027

Multidetector tomography protocol Bastos RM et al.

CLINICS 2011;66(12):2025-2029

undiagnosed type-II endoleak, possibly due to the lack of a venous phase exam, and may be interpreted as an endotension. In these cases, Iezzi et al.22 suggested the use of a complete protocol with three phases or ultrasound with contrast, as proposed by Napoli et al.23 Also in 2006, Macari et al.17 analyzed 110 triphasic CT exams with a 4- and 16-channel MDCT, calculated the effective radiation dose and found that of the 28 patients with type-II endoleaks diagnosed in the venous phase, only 25 were also diagnosed in the arterial phase. They concluded that the arterial phase did not diagnose additional endoleaks but did increase the radiation dose by 36.5%. However, Macari et al.17 had two reservations about eliminating the arterial phase in postoperative patients: there may be diagnostic difficulty in differentiating between type-II and type-III endoleaks, as modular prostheses are being used more frequently, and the elimination of the arterial phase may limit the diagnosis of arteriovenous fistulas or pseudo-aneurisms of the common femoral artery. To our knowledge, according to a search of the Medline database for reports in English, no previous reports in the literature have evaluated the incidence of endoleaks using 64-channel tomography. In this study, the equipment detected endoleaks in 26.7% (8/30) of the patients in our series. This detection rate agrees with the recent literature on multidetector equipment,17,22 but it is higher than that reported in exams using helicoid equipment with a single tier of detectors (9.2 to 18.5%).24,25 In agreement with the findings of Macari et al.,17 our protocol in the arterial phase, while exposing the patient to a larger dose of radiation (39%), was unable to reveal a number of the endoleaks that were visualized only in the venous phases (3/8). The venous phase had a greater capacity to diagnose endoleaks in the late follow-up of EVAR. We think that this finding could be better evaluated in a larger patient series or a longitudinal series. In our view, the lack of an endoleak diagnosis using a protocol with only an arterial phase could be erroneously interpreted as endotension (i.e., a type-V endoleak) if the diagnosis is principally associated with an increase in the diameter of the aneurysm. Consequently, a patient may be deprived of treatment for a type-II leak, which increases the risk of an aortic rupture and death. This possibility has been previously described by Iezzi et al.22, although they defended a protocol with only the arterial phase in the later patient follow-up visits. Tolia et al.19 demonstrated that although the rate of spontaneous resolution of type-II endoleaks was high (62.5%), an evaluation of the persistence and dimensions of a type-II endoleak is fundamental for prognosis. Similarly, in an evaluation of 348 EVAR patients followed for 10 years, Timaran et al.24 concluded that the maximum diameter of an endoleak is an important predictive factor for the increase in the size of an aneurysm in a patient with a type-II endoleak. They also established that endoleak sites with a diameter of 15 mm or more had a 10-fold greater chance of an increase in aneurysm size, which would justify a more aggressive therapeutic intervention. Because we encountered a tendency for an increase in the measurements during the venous phase compared to the arterial phase, our results reinforce the evidence that the venous phase is important for the precise evaluation of the dimensions of the endoleak site. In our patient series, the one case with an increase in the diameter of the aneurysm was associated

aneurysm diameter. This increase was associated with a type-II leak measuring 3.7 cm, which was only observed in the venous phase. No statistically significant relationship was identified between the maximum diameters of the aneurysms and the presence or absence of endoleaks. Measurement of the maximum transverse diameter of the neck proximal to the aneurysm revealed a statistically significant increase (p = 0.0084), ranging from 2.0 to 3.3 cm (mean 2.5 cm; median 2.4 cm) in the preoperative period and from 2.1 to 3.7 cm (mean 2.7 cm; median 2.6 cm) in the postoperative phase. There was no statistically significant relationship between the maximum transverse diameters of the necks of the aneurysms and the presence or absence of endoleaks. All of the prostheses used remained intact with no evidence of fracture. There was no statistically significant difference between the presence of endoleaks and the various brands of prostheses used (p = 0.0529). Excluder EndoprothesisH was used in only one patient, and it was not considered in the statistical analysis.

DISCUSSION The technical advances in endovascular surgery have yielded a safe alternative for the treatment of aortic aneurysms. However, although the perioperative complication rates of EVAR are lower than the rates of conventional surgical treatment,18 we believe that the short follow-up time of these patients prohibits the evaluation of late complications. Follow-up periods at 1, 6, and 12 months after surgery and then every year thereafter for the life of the patient have been suggested for cases with no complications.16,18,19 Endoleaks were the most frequent complication identified, and they require shorter follow-up intervals depending on the type of leak and the change in aneurysmal sack dimensions.18 The number of exams that these patients will undergo during their lifetimes, together with the continuing increases in radiation dose and the constant technological improvements of the imaging machines used, has led to a great deal of discussion regarding the best protocol for MDCT examinations. Some CT protocols have been proposed for better characterization of the aneurysm, the prosthesis and the complications of EVAR.7,20,21 Golzarian et al.21 proposed the use of a biphasic protocol with arterial and venous phases after the administration of an intravenous contrast agent. Rozenblit et al.7 demonstrated the advantages of using fine image slice sampling for diagnosing leaks, attributing the higher sensitivity in the diagnosis to the use of a biphasic protocol and advocating the use of the pre-contrast phases to resolve difficult cases. These authors stated that the increase in ionizing radiation associated with the use of a biphasic protocol is justified because it affords a more precise diagnosis of an endoleak. In 2006, Iezzi et al.22 used 4-channel MDCT to study 50 patients with follow-up times of 1, 6, and 12 months (150 exams) after the placement of a prosthesis. The results suggested that during follow-up visits within the first month, a protocol using pre-contrast and arterial phases was most appropriate. However, they reported that for the later follow-ups at 6 and 12 months, a protocol with only the arterial phase was sufficient. The authors acknowledged that any increase in the aneurysm size may be related to an

2028

CLINICS 2011;66(12):2025-2029

Multidetector tomography protocol Bastos RM et al.

with a type-II leak demonstrated only in the venous phase; it was later treated by a translumbar puncture. This study is limited by the small number of cases and the lack of correlation with DA, which was not performed on the majority of patients due to the stability or reduction in the size of their aneurysms. Additionally, this study was based on the retrospective evaluation of measurements of aneurysm diameters and their necks that were obtained from preoperative film examinations and provided by different services using varying protocols. We believe that Duplex Scan could also be an option in clinical practice for EVAR follow-up; it is noninvasive and could help to reduce ionizing radiation exposure. However, further studies are needed to define its most suitable application for the purpose of delineating endoleaks. In conclusion, the MDCT protocol in the late follow-up of patients undergoing EVAR must include the venous postcontrast phase, which depicted a significantly greater number of leaks compared to the arterial phase. The venous phase also more accurately demonstrated the niche dimensions compared to the arterial phase. The arterial phase should be avoided in patients with stable or decreasing aneurysm size, thereby reducing the radiation dose.

10.

11.

12. 13. 14. 15. 16.

AUTHOR CONTRIBUTIONS Bastos RM was responsible for the study design, collection, analysis and interpretation of data, statistical analysis, article writing, final approval, and overall procedures related to the study. Razuk Filho A was responsible for the study design, statistical analysis, and article revision. Blasbalg R was responsible for the collection, analysis and interpretation of data. Caffaro RA was responsible for the study design and final approval. Karakhanian WK was responsible for the data collection. Rocha AJ was responsible for the study design, statistical analysis, article revision, and final approval.

17.

18.

19.

REFERENCES

20.

1. Parodi JC, Marin ML, Veith FJ. Transfemoral endovascular stented graft repair of an abdominal aortic aneurysm. Arch Surg. 1995;130:549-52. 2. White GH, Yu W, May J, Chaufour X, Stephen MS. Endoleak as a complication of endoluminal grafting of abdominal aortic aneurysms: classification, incidence, diagnosis, and management. J Endovasc Surg. 1997;4:152-68, doi: 10.1583/1074-6218(1997)004,0152:EAACOE.2.0.CO;2. 3. Gilling-Smith G, Brennan J, Harris P, Bakran A, Gould D, McWilliams R. Endotension after endovascular aneurysm repair: definition, classification, and strategies for surveillance and intervention. J Endovasc Surg. 1999;6:305-7, doi: 10.1583/1074-6218(1999)006,0305:EAEARD.2.0.CO;2. 4. Veith FJ, Baum RA, Ohki T, Amor M, Adiseshiah M, Blankensteijn JD, et al. Nature and significance of endoleaks and endotension: summary of opinions expressed at an international conference. J Vasc Surg. 2002;35:1029-35, doi: 10.1067/mva.2002.123095. 5. Baum RA, Stavropoulos SW, Fairman RM, Carpenter JP. Endoleaks after endovascular repair of abdominal aortic aneurysms. J Vasc Interv Radiol. 2003;14:1111-17. 6. Mennander A, Pimenoff G, Heikkinen M, Partio T, Zeitlin R, Salenius JP. Nonoperative approach to endotension. J Vasc Surg. 2005;42:194-8, doi: 10.1016/j.jvs.2005.02.050. 7. Rozenblit AM, Patlas M, Rosenbaum AT, Okhi T, Veith FJ, Laks MP, et al. Detection of endoleaks after endovascular repair of abdominal aortic

21. 22.

23.

24. 25.

2029

aneurysm: value of unenhanced and delayed helical CT acquisitions. Radiology. 2003;227:426-33, doi: 10.1148/radiol.2272020555. Chernyak V, Rozenblit AM, Patlas M, Cynamon J, Ricci ZJ, Laks MP, et al. Type II endoleak after endoaortic graft implantation: diagnosis with helical CT arteriography. Radiology. 2006;240:885-93, doi: 10.1148/ radiol.2403051013. van Marrewijk C, Buth J, Harris PL, Norgren L, Nevelsteen A, Wyatt MG. Significance of endoleaks after endovascular repair of abdominal aortic aneurysms: the EUROSTAR experience. J Vasc Surg. 2002;35:46173, doi: 10.1067/mva.2002.118823. Hodgson R, McWilliams RG, Simpson A, Gould DA, Brennan JA, Gilling-Smith GL, et al. Migration versus apparent migration: importance of errors due to positioning variation in plain radiographic followup of aortic stent-grafts. J Endovasc Ther. 2003;10:902-10, doi: 10.1583/ 1545-1550(2003)010,0902:MVAMIO.2.0.CO;2. Raman KG, Missig-Carroll N, Richardson T, Muluk SC, Makaroun MS. Color-flow duplex ultrasound scan versus computed tomographic scan in the surveillance of endovascular aneurysm repair. J Vasc Surg. 2003;38:645-51, doi: 10.1016/S0741-5214(03)00909-1. van der Laan MJ, Bakker CJ, Blankensteijn JD, Bartels LW. Dynamic CEMRA for endoleak classification after endovascular aneurysm repair. Eur J Vasc Endovasc Surg. 2006;31:130-5, doi: 10.1016/j.ejvs.2005.08.014. Rozenblit A, Marin ML, Veith FJ, Cynamon J, Wahl SI, Bakal CW. Endovascular repair of abdominal aortic aneurysm: value of postoperative follow-up with helical CT. AJR. 1995;165:1473-79. Armerding MD, Rubin GD, Beaulieu CF, Slonim SM, Olcott EW, Samuels SL, et al. Aortic aneurysmal disease: assessment of stent-graft treatment CT versus conventional angiography. Radiology. 2000;215:138-46. Brenner DJ, Elliston CD. Estimated radiation risks potentially associated with full-body CT screening. Radiology 2004;232:735-8, doi: 10.1148/ radiol.2323031095. Stavropoulos SW, Charagundla SR. Imaging techniques for detection and management of endoleaks after endovascular aortic aneurysm repair. Radiology. 2007;243:641-55, doi: 10.1148/radiol.2433051649. Macari M, Chandarana H, Schmidt B, Lee J, Lamparello P, Babb J. Abdominal aortic aneurysm: can the arterial phase at CT evaluation after endovascular repair be eliminated to reduce radiation dose? Radiology. 2006;241:908-14, doi: 10.1148/radiol.2413051571. Eskandari MK, Yao JS, Pearce WH, Rutherford RB, Veith FJ, Harris P, et al. Surveillance after endoluminal repair of abdominal aortic aneurysms. Cardiovascular Surgery. 2001;9:469-71, doi: 10.1016/S09672109(01)00044-8. Tolia AJ, Landis R, Lamparello P, Rosen R, Macari M. Type II endoleaks after endovascular repair of andominal aortic aneurysms: natural history. Radiology. 2005;235:683-6, doi: 10.1148/radiol.2352040649. Balm R, Kaatee R, Blankensteijn JD, Mali WP, Eikelboom BC. CTangiography of abdominal aortic aneurysms after transfemoral endovascular aneurysm management. Eur J Vasc Endovasc Surg. 1996;12:1828, doi: 10.1016/S1078-5884(96)80104-3. Golzarian J, Dussaussois L, Abada HT, Gevenois PA, Van Gansbeke D, Ferreira J, et al. Helical CT of aorta after endoluminal stentgraft therapy: value of biphasic acquisition. AJR. 1998;171:329-31. Iezzi R, Cotroneo AR, Filippone A, Di Fabio F, Quinto F, Colosimo C, et al. Multidetector CT in abdominal aortic aneurysm treated with endovascular repair: are unenhanced and delayed phase enhanced images effective for endoleak detection? Radiology. 2006;241:915-21, doi: 10.1148/radiol.2413050959. Napoli V, Bargellini I, Sardella SG, Petruzzi P, Cioni R, Vignali C, et al. Abdominal aortic aneurysm: contrast-enhanced US for missed endoleaks after endoluminal repair. Radiology. 2004;233:217-25, doi: 10.1148/ radiol.2331031767. Timaran CH, Ohki T, Rhee SJ, Veith FJ, Gargiulo NJ3rd, Toriumi H, et al. Predicting aneurysm enlargement in patients with persistent type II endoleaks. J Vasc Surg. 2004;39:1157-62, doi: 10.1016/j.jvs.2003.12.033. Steinmetz E, Rubin BG, Sanchez LA, Choi ET, Geraghty PJ, Baty J, et al. Type II endoleak after endovascular abdominal aortic aneurysm repair: a conservative approach with selective intervention is safe and costeffective. J Vasc Surg. 2004;39:306-13, doi: 10.1016/j.jvs.2003.10.026.

CLINICS 2011;66(12):2031-2035

DOI:10.1590/S1807-59322011001200006

CLINICAL SCIENCE

Campaign, counseling and compliance with influenza vaccine among older persons Vivian Iida Avelino-Silva,I Thiago Junqueira Avelino-Silva,II Joao Luiz Miraglia,III Karina Takesaki Miyaji,I Wilson Jacob-Filho,II Marta Heloisa LopesI I

Faculdade de Medicina da Universidade de Saõ Paulo, Infectious and Parasitic Diseases Department, Saõ Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Saõ Paulo, Hospital das Clıńicas, Geriatrics Division, Saõ Paulo/SP, Brazil. III Butantan Foundation Clinical Trials Unit, Saõ Paulo/SP, Brazil.

OBJECTIVES: Population aging raises concerns regarding the increases in the rates of morbidity and mortality that result from influenza and its complications. Although vaccination is the most important tool for preventing influenza, vaccination program among high-risk groups has not reached its predetermined aims in several settings. This study aimed to evaluate the impacts of clinical and demographic factors on vaccine compliance among the elderly in a setting that includes a well-established annual national influenza vaccination campaign. METHODS: This cross-sectional study included 134 elderly patients who were regularly followed in an academic medical institution and who were evaluated for their influenza vaccination uptake within the last five years; in addition, the demographic and clinical characteristics and the reasons for compliance or noncompliance with the vaccination program were investigated. RESULTS: In total, 67.1% of the participants received the seasonal influenza vaccine in 2009. Within this vaccinationcompliant group, the most common reason for vaccine uptake was the annual nationwide campaign (52.2%; 95% CI: 41.4–62.9%); compared to the noncompliant group, a higher percentage of compliant patients had been advised by their physician to take the vaccine (58.9% vs. 34.1%; p,0.01). CONCLUSION: The education of patients and health care professionals along with the implementation of immunization campaigns should be evaluated and considered by health authorities as essential for increasing the success rate of influenza vaccination compliance among the elderly. KEYWORDS: Influenza immunization; Campaign; Medical recommendation; Adherence; Geriatric. Avelino-Silva VI, Avelino-Silva TJ, Miraglia JL, Miyaji KT, Jacob-Filho W, Lopes MH. Campaign, counseling and compliance with influenza vaccine among older persons. Clinics. 2011;66(12):2031-2035. Received for publication on June 23, 2011; First review completed on July 29, 2011; Accepted for publication on August 22, 2011 E-mail: viviansilva87@gmail.com Tel.: 55 11 2661-6530

influenza, occur more frequently among elderly individuals,2 who suffer the highest rates of serious illness and death that are associated with the disease.3,4,5 Therefore, influenza is a growing issue for public health and geriatric medicine concerns; consequently, seasonal vaccination is recommended for elderly individuals in several countries.6 Among the elderly, vaccination continues to be the most important tool for preventing influenza-related morbidity and mortality7,8 and is associated with reduced hospitalizations due to pneumonia or influenza and for any cause in community-dwelling older persons.3 In Brazil, a national influenza immunization campaign that targets individuals 60 years of age and older has been conducted since 1999;9 since its inception, reduced hospitalizations associated with respiratory diseases have been verified in this age group.10,11 Among high-risk groups, complying with this vaccination is essential to the success of preventive programs that target influenza; however, vaccination coverage among these groups has not reached the established aims in several developed or developing countries.12-16 The World Health Organization (WHO) has established goals for increasing

INTRODUCTION Population aging is a worldwide phenomenon, as the proportion of people who are age 60 years and older is increasing faster than any other age group, with an expected increase of 694 million (or 223%) from 1970 to 2025.1 Although the countries with the highest proportions of elderly people are in Europe, approximately 70% of the current global older population lives in developing countries; these countries must deal with the potential increases in economic, health and social demands that are related to aging. In addition to neoplastic and degenerative diseases, some infectious complications, including those that are caused by

2031

Compliance with the influenza vaccine among the elderly Avelino-Silva VI et al.

CLINICS 2011;66(12):2031-2035

the coverage of influenza vaccination among high-risk populations and has encouraged countries to implement initiatives to raise awareness of influenza and influenza vaccination among the public, although they have not indicated which initiatives should be adopted.17 Several studies that were conducted in Europe and North America identified risk factors for noncompliance with influenza vaccination among the elderly, including low income,18,19 African-American ethnicity,12,20 a good selfperception of health,21,22 younger age,12,14,19,21 cognitive impairments,19 living alone,19 and fear of adverse events following vaccination.18,22 In Brazil, two recent populationbased surveys reported that age, smoking, and a lack of an appointment with a physician in the previous year were all independently associated with vaccination noncompliance. In addition, other reasons that were reported were a fear of adverse events following vaccination and a lack of concern regarding the influenza disease itself. The most widely cited source of information regarding the vaccine was the television (66.4%), and the second most frequent source was friends (25.3%), whereas nurses and doctors were cited by only 10.4% and 5.3% of the interviewees, respectively. It was more alarming that in one of the studies, only 10% of the participants mentioned a recommendation by a physician as their motivation for vaccine compliance.23,24 The influence of counseling by physicians and other health care professionals regarding influenza vaccination compliance requires further investigation. It is also conceivable that health care professionals who are involved with primary health care or with the treatment of respiratory diseases, including family physicians, gerontologists, and pulmonologists, might be more prone to recommend the influenza vaccination to their patients, which is a hypothesis that needs to be explored further. This study was designed to evaluate the impacts of clinical and demographic factors on vaccine compliance among the elderly in a setting that includes a wellestablished annual national influenza vaccination campaign.

those who had been noncompliant with the seasonal influenza vaccination in 2009) were compared using the Pearson’s Chi-square test or the two-sided Fisher’s exact test for analyzing the categorical variables or using the twosample Student’s t-test, assuming equal variances for analyzing the continuous variables. The 95% confidence intervals for the percentages of the reasons for vaccination compliance or noncompliance were calculated using the exact binomial method. The percentages of physicians who had recommended the seasonal influenza vaccination in each clinic were compared using the two-sided Fisher’s exact test, and clinics were compared individually using the Pearson’s Chi-square test when the clinics were pooled. The following comparisons were performed when the clinics were pooled: the Geriatric clinic versus the other clinics, the Pulmonology clinic versus the other clinics, and the Geriatric and Pulmonology clinics versus the Urology and Rheumatology clinics. The Bonferroni correction was used to adjust for multiple comparisons. Logistic regression was performed to identify the variables that were associated with compliance with the seasonal influenza vaccination. The following variables were included in the initial model: age, ethnicity, years of education, income, hospital admissions during the previous year, whether they lived alone and/or attended the clinic alone, whether they had a caregiver, if they provided a good self-evaluation of health, the presence of any chronic health condition, the use of medication for a chronic health condition, memory loss, and the recommendation for vaccination by the physician. The backward stepwise regression procedure, with a p-value of 0.05 for backward selection, was used to obtain the final model for the logistic regression analysis. Each statistical test used a significance level of 0.05 and was performed using STATA version 10.1 software (StataCorp, College Station, TX, USA).

RESULTS METHODS

A total of 134 patients accepted to participate in the study. These patients had a mean age of 76.2 years (SD ¡ 8.1) and were primarily included in the Geriatrics clinic (65.7%), followed by the Pulmonology (14.2%), Rheumatology (12%), and Urology (8.1%) clinics. Overall, 67.1% (95% CI: 58.5– 75%) of the participants had taken the seasonal influenza vaccine in 2009. The characteristics of the patients were stratified by compliance or noncompliance with their seasonal influenza vaccine in 2009. The data are presented in Table 1. Within the vaccination-compliant group, a higher percentage of patients were receiving medication for a chronic condition than in the noncompliant group (98.9% vs. 90.9%, respectively; p,0.05), and a higher percentage had taken their influenza vaccine in 2008 (93.3% vs. 18.2%, respectively; p,0.05) or at least once in the previous four years (95.2% vs. 26.8%, respectively; p,0.05). In the compliant group, the most frequently cited motivation to take the vaccine was the annual nationwide campaign that was held by the Brazilian Ministry of Health (52.2%; 95% CI: 41.4– 62.9%), which was followed by a belief in the protective effect of the vaccine (37.7%; 95% CI: 27.8–48.6%) and recommendation by a physician (35.5%; 95% CI: 25.7– 46.3%). Other less frequently mentioned reasons included

This was a cross-sectional study that was conducted in the city of Sa˜o Paulo, Brazil, between two and five months after the close of the 2009 influenza seasonal vaccination national campaign. The study included patients who were 60 years of age or older and were followed regularly in four different outpatient services (i.e., the Geriatrics, Urology, Pulmonology, and Rheumatology clinics) in a tertiary academic medical institution. The study was approved by the Ethics Committee of the University of Sa˜o Paulo Medical School. Patients who attended any of the four aforementioned clinics were invited to participate in the study and were interviewed at the hospital after providing informed consent. The interviews were conducted twice weekly on various weekdays during the study period, and all patients who were attending the clinics for their medical appointments were invited to participate. Information was obtained regarding the influenza vaccination status for the previous five years, the demographic and clinical characteristics, and the reasons for compliance or noncompliance with the vaccination program. The reasons for vaccination compliance or noncompliance were obtained via an open question. The demographic and clinical characteristics of the two groups of patients (i.e., those who had been compliant and

2032

CLINICS 2011;66(12):2031-2035

Compliance with the influenza vaccine among the elderly Avelino-Silva VI et al.

Table 1 - Characteristics of the interviewed patients according to their seasonal influenza vaccine uptake in 2009. Vaccine Uptake Yes (n = 90)

No (n = 44) n (%)

Age (mean) Male Ethnicity Caucasian Black Mulatto Asian Years of education ,4 4 to 8 .8 Income{ ,2X minimum wage 2 to 4X minimum wage .4X minimum wage Had a housemate Attended health services alone Had a caregiver Had regular medical follow-up Personal physician recommended the vaccine Had any chronic disease Long-term use of medication Referred memory loss Good self-evaluation of health status Hospital admission during the previous year Took the seasonal influenza vaccine in 2008 Took the seasonal influenza vaccine at least once in the previous 4 years

p-value*

76.3 25 (27.8)

75.9 16 (36.4)

67 (74.4) 9 (10) 9 (10) 5 (5.6)

29 4 10 1

27 (30) 48 (53.3) 13 (29.5)

14 (31.8) 17 (38.6) 15 (16.7)

31 47 12 67 40 22 89 53 88 89 53 52 22 84 79

21 (47.7) 20 (45.5) 2 (4.6) 38 (86.4) 22 (50) 12 (27.2) 44 (100) 15 (34.1) 43 (97.7) 40 (90.9) 20 (45.5) 25 (56.8) 6 (13.6) 8 (18.2) 11 (26.8)

0.8{ 0.31 0.22

(65.9) (9.1) (22.7) (2.3) 0.16

0.15 (34.4) (52.2) (13.3) (74.4) (44.4) (24.4) (98.9) (58.9) (97.7) (98.9) (58.9) (57.8) (24.4) (93.3) (95.2)

0.12 0.54 0.72 1** 0.007 1** 0.04** 0.14 0.91 0.15 ,0.001 ,0.001

Chi-square test (unless otherwise indicated). Fisher’s exact test. Two-sample t-test. { The Brazilian minimum wage is approximately US$ 302.00 per month. ** {

the lack of side effects, the prevention of pneumonia, vaccination as part of their routine medical care, and frequent episodes of influenza disease (Table 2). A higher percentage of patients in the vaccination-compliant group had been advised by their personal physician to take the vaccine (58.9% vs. 34.1%; p,0.05). Within the vaccination-noncompliant group, the reason that was most frequently cited as their reason to not take the

vaccine was the belief that it could induce influenza (36.4%; 95% CI: 22.4–52.2%), which was followed by the belief that the vaccine causes other side effects (16%; 95% CI: 6.6–30%) and the idea that they rarely contracted influenza (16%; 95% CI: 6.6–30%). Other less frequently mentioned reasons included pain due to the vaccine administration and transportation difficulties. Previous vaccine side effects were not reported as reasons to avoid taking the vaccine (Table 2). The medical recommendation for the influenza vaccine was not statistically different among the four outpatient clinics when evaluated separately (p = 0.25) or when analyzed in the following combinations: Geriatrics versus the other clinics (p = 0.6), Pulmonology versus other clinics (p = 1.0), and Geriatrics and Pulmonology versus the Rheumatology and Urology clinics (p = 0.13). The logistic regression model revealed that a recommendation from a physician to take the vaccine was the only variable that was significantly associated with vaccine compliance. Patients in the vaccination-compliant group had a likelihood of receiving a recommendation that was 2.7-fold higher than the vaccination-noncompliant group (OR = 2.7; 95% CI = 1.29–5.6; p,0.05).

Table 2 - Referenced reasons for influenza vaccination compliance or noncompliance in 2009. For compliance National influenza vaccination campaign Believed the influenza vaccine is protective Physician recommended it Another health care professional recommended it For noncompliance Believed the influenza vaccine causes influenza disease Fear of adverse events Believed they would never contract influenza Lack of transportation Pain

% (95% CI) 52.2 (41.4–62.9) 37.7 (27.8–48.6) 35.5 (25.7–46.3) 1.1 (0–6) % (95% CI) 36.4 (22.4–52.2) 15.9 (6.6–30) 15.9 (6.6–30)

DISCUSSION

9 (0–17.9) 4.6 (0–15.8)

We believe that preventing influenza among the elderly through vaccination is certainly one of the primary public

2033

Compliance with the influenza vaccine among the elderly Avelino-Silva VI et al.

CLINICS 2011;66(12):2031-2035

Figure 1 - Strategies that were adopted by the Brazilian government to promote and maintain influenza vaccine coverage among older persons. Adapted from the National Influenza Immunization Campaign Targeting Older Persons Technical Report, Brazil, Ministry of Health, 2007.9

information regarding a specific subset of older individuals who are followed regularly in a tertiary teaching hospital and who likely have a number of comorbidities. A recommendation by a physician was found to be a key factor for compliance; this is consistent with other studies. However, doctors are also not a homogeneous population, even in an academic medical institution, and a high proportion of doctors did not advise their patients regarding the influenza vaccination. The association of counseling that is performed by physicians and other health care professionals with influenza vaccination should be explored further in future studies and should be considered in initiatives that seek to improve vaccination uptake, including vaccination campaigns. Another aspect that should be considered an essential element of any influenza vaccination program is the implementation of campaigns to instruct the population regarding the risks and benefits of the vaccine. The various reasons for vaccine uptake included the belief in vaccine efficacy, whereas the reasons for a lack of compliance included misinformation regarding influenza and the influenza vaccine. Finally, the most frequent reason that was cited by the patients as their motivation to take the vaccine was the

health goals that governments worldwide should pursue to promote their health and disease prevention policies and achieve an improved quality of life in old age, according to the ‘‘active aging’’ framework established by the WHO. A prerequisite for the widespread vaccination of high-risk groups is more equitable access to the vaccine, and this has been partially addressed by the Global Action Plan (GAP), outlined by the WHO, in which they projected a sharp increase for 2010 in the annual production capacity of trivalent seasonal influenza vaccine to more than 800 million doses and noted that production capacity is currently available, or is being established, in 25 countries, including developing countries.25 Once the influenza vaccine is available in sufficient quantities, governments then face the challenge of achieving high coverage among high-risk groups. This study gathered additional evidence to facilitate the planning and improvement of strategies and initiatives that seek to increase the uptake of influenza vaccinations among the elderly. This population is not homogeneous, and this is reflected by the various risk factors that were identified for poor vaccination uptake; the initiatives should reflect this heterogeneity. In this regard, this study provides valuable

Figure 2 - Percentage of Brazilian cities with at least 70% influenza vaccine coverage from 1999 through 2006. Adapted from the National Influenza Immunization Campaign Targeting Older Persons Technical Report, Brazil, Ministry of Health, 2007.9

2034

CLINICS 2011;66(12):2031-2035

Compliance with the influenza vaccine among the elderly Avelino-Silva VI et al. 4. Thompson WW, Shay DK, Weintraub E, Brammer L, Bridges CB, Cox NJ, et al. Influenza-associated hospitalizations in the United States. Jama. 2004;15;292:1333-40. 5. Thompson WW, Shay DK, Weintraub E, Brammer L, Cox N, Anderson LJ, et al. Mortality associated with influenza and respiratory syncytial virus in the United States. JAMA. 2003;289:179-86, doi: 10.1001/jama.289.2.179. 6. van Essen GA, Palache AM, Forleo E, Fedson DS. Influenza vaccination in 2000: recommendations and vaccine use in 50 developed and rapidly developing countries. Vaccine. 2003;21:1780-5, doi: 10.1016/S0264410X(03)00072-0. 7. Nichol KL. Improving influenza vaccination rates among adults. Cleve Clin J Med. 2006;73:1009-15, doi: 10.3949/ccjm.73.11.1009. 8. Gravenstein S, Davidson HE. Current strategies for management of influenza in the elderly population. Clin Infect Dis. 2002;15; 35:729-37, doi: 10.1086/341246. 9. Brasil, Ministe´rio da Sau´de. Campanha Nacional de Vacinaçaõ do Idoso. Informe tećnico. Secretaria de Vigilaˆncia em Sau´de. Departamento de Vigilaˆncia Epidemiolo´gica. Coordenaçaõ Geral do Programa Nacional de Imunizaço˜es. 2007 10. Francisco PM, Donalisio MR, Lattorre Mdo R. [Impact of influenza vaccination on mortality by respiratory diseases among Brazilian elderly persons]. Rev Saude Publica. 2005;39:75-81, doi: 10.1590/S003489102005000100010. 11. Daufenbach LZC, Eduardo Hage, Duarte, Elisabeth Carmen, Campagna, Aide de Souza, Teles, Carlos Antoˆnio Souza. Influenza-Related Causes of Hospitalization in Elderly in Brazil, 1992 to 2006. Epidemiologia e Serviços de Sau´de. 2009;18:29-44. 12. Lu PJ, Singleton JA, Rangel MC, Wortley PM, Bridges CB. Influenza vaccination trends among adults 65 years or older in the United States, 19892002. Arch Intern Med. 2005;165:1849-56, doi: 10.1001/archinte.165.16.1849. 13. Kroneman MW, van Essen GA. Variations in influenza vaccination coverage among the high-risk population in Sweden in 2003/4 and 2004/5: a population survey. BMC Public Health. 2007;7:113, doi: 10. 1186/1471-2458-7-113. 14. Lau JT, Yang X, Tsui HY, Kim JH. Prevalence of influenza vaccination and associated factors among community-dwelling Hong Kong residents of age 65 or above. Vaccine. 2006;24:5526-34, doi: 10.1016/j.vaccine.2006.04.014. 15. de Lataillade C, Auvergne S, Delannoy I. 2005 and 2006 seasonal influenza vaccination coverage rates in 10 countries in Africa, Asia Pacific, Europe, Latin America and the Middle East. J Public Health Policy. 2009;30:83-101, doi: 10.1057/jphp.2008.40. 16. Mereckiene J, Cotter S, D’Ancona F, Giambi C, Nicoll A, Levy-Bruhl D, et al. Differences in national influenza vaccination policies across the European Union, Norway and Iceland 2008-2009. Euro Surveill. 2010 Nov 4;(15).44pii:19700. 17. Influenza vaccines: WHO position paper. Weekly Epidemiological Record. 2005 19 August 2005. 18. Burns VE, Ring C, Carroll D. Factors influencing influenza vaccination uptake in an elderly, community-based sample. Vaccine. 2005;23:3604-8, doi: 10.1016/j.vaccine.2004.12.031. 19. Landi F, Onder G, Carpenter I, Garms-Homolova V, Bernabei R. Prevalence and predictors of influenza vaccination among frail, community-living elderly patients: an international observational study. Vaccine. 2005. 23:3896-901, doi: 10.1016/j.vaccine.2005.03.008. 20. O’Malley AS, Forrest CB. Immunization disparities in older Americans: determinants and future research needs. Am J Prev Med. 2006;31:150-8, doi: 10.1016/j.amepre.2006.03.021. 21. de Andres AL, Garrido PC, Hernandez-Barrera V, Del Pozo SV, de Miguel AG, Jimenez-Garcia R. Influenza vaccination among the elderly Spanish population: trend from 1993 to 2003 and vaccination-related factors. Eur J Public Health. 2007;17:272-7, doi: 10.1093/eurpub/ckl242. 22. Mangtani P, Breeze E, Stirling S, Hanciles S, Kovats S, Fletcher A. Crosssectional survey of older peoples’ views related to influenza vaccine uptake. BMC Public Health. 2006;6:249, doi: 10.1186/1471-2458-6-249. 23. Moura M SL. Pesquisas de Opiniaõ sobre as Campanhas de Vacinaçaõ contra a Influenza no Estado de Saõ Paulo. Boletim Epidemiolo´gico Paulista. 2004;4:8-10. 24. Dip RM, Cabrera MA. Influenza vaccination in non-institutionalized elderly: a population-based study in a medium-sized city in Southern Brazil. Cad Saude Publica. 2010;26:1035-44, doi: 10.1590/S0102311X2010000500025. 25. Partridge J, Kieny MP. Global production of seasonal and pandemic (H1N1) influenza vaccines in 2009-2010 and comparison with previous estimates and global action plan targets. Vaccine. 2010;28:4709-12, doi: 10.1016/j.vaccine.2010.04.083. 26. Patel MS, Davis MM. Could a federal program to promote influenza vaccination among elders be cost-effective? Prev Med. 2006;42:240-6, doi: 10.1016/j.ypmed.2005.12.004. 27. Takahashi H, Tanaka Y, Ohyama T, Sunagawa T, Nakashima K, Schmid GP, et al. Evaluation of a mass influenza vaccination campaign. Jpn J Infect Dis. 2001;54:184-8.

annual nationwide influenza vaccination campaign. National influenza immunization campaigns that target older persons have been conducted in Brazil since 1999, which was considered The International Year of Older Persons. Several strategies have been used by the Brazilian government to promote and maintain influenza vaccine coverage among older persons (Figure 1) including the participation of medical societies, social organizations, radio and TV stations, and the presence of additional health care professionals, thereby minimizing long waiting lines and system malfunctions.9 In the initial years of campaigning, population compliance with the vaccine was moderate; it was generally believed that vaccines should only be administered to children, and the benefits of influenza vaccination in the elderly were not yet fully understood. In addition, myths, such as the occurrence of flu-like symptoms following vaccination, helped propagate distrust towards the vaccine. However, the annual campaigns were continued, and after 2003, more than 90% of Brazilian cities reached the 70% vaccine coverage goal (Figure 2).9 In addition to this experience in Brazil, other authors have analyzed similar strategies for mass influenza vaccination in various settings26,27 and found that these strategies can be cost-effective. The primary limitations of this study are the sample size and source population, which came from a tertiary academic medical institution. Our sample included a large proportion of patients with more severe and complex diseases, and most of the patients were receiving medication for chronic conditions. For this particular population, the reasons for vaccination compliance may not reflect those of the elderly in the general; therefore, our findings cannot be generalized, and any inferences from our results should be carefully considered. The success of influenza vaccination program among the elderly will likely depend on multiple demographic and clinical factors that can vary from region to region and should be evaluated by local health authorities, along with actions, such as vaccination campaigns and educating both the target population and health care professionals.

ACKNOWLEDGMENTS The authors are grateful to the graduate students Maira Leite and Ricardo Costa, who contributed to the acquisition of data.

AUTHOR CONTRIBUTIONS Avelino-Silva VI participated in the design and coordination of the study, acquisition of the data and manuscript writing. Avelino-Silva TJ participated in the design of the study, acquisition of the data and manuscript writing. Miraglia JL participated in the statistical analysis and manuscript writing. Miyaji KT participated in the design of the study and acquisition of the data. Jacob-Filho W participated in the design of the study and manuscript writing. Lopes MH participated in the design of the study and manuscript writing.

REFERENCES 1. Active Ageing: A Policy Framework. World Health Organization. 2002. p.59. Available at: http://whqlibdoc.who.int/hq/2002/WHO_NMH_ NPH_02.8.pdf. 2. Pawelec G. Immunosenescence: impact in the young as well as the old? Mech Ageing Dev. 1999;108:1-7, doi: 10.1016/S0047-6374(99)00010-X. 3. Nichol KL. Influenza vaccination in the elderly: impact on hospitalisation and mortality. Drugs Aging. 2005;22:495-515, doi: 10.2165/00002512200522060-00004.

2035

CLINICS 2011;66(12):2037-2042

DOI:10.1590/S1807-59322011001200007

CLINICAL SCIENCE

Lactate and base deficit are predictors of mortality in critically ill patients with cancer Ludhmila Abrahaõ Hajjar,I Rosana Ely Nakamura,I Juliano Pinheiro de Almeida,I Julia T. Fukushima,I Paulo Marcelo Gehm Hoff,II Jean-Louis Vincent,III Jose´ Ota´vio Costa Auler Juńior,I Filomena Regina Barbosa Gomes GalasI I Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Cancer Institute, Department of Anesthesiology and Critical Care, Intensive Care Unit, Saõ Paulo/SP, Brazil. II Faculdade de Medicina do Hospital das Clıńicas da Universidade de Saõ Paulo, Cancer Institute, Chairman of Department of Oncology, Cancer Institute, Saõ Paulo/SP, Brazil. III Universite´ Libre de Bruxelles, Erasme Hospital, Department of Intensive Care, Bruxelles, Belgium.

OBJECTIVE: Cancer patients frequently require admission to intensive care unit. However, there are a few data regarding predictive factors for mortality in this group of patients. The aim of this study was to evaluate whether arterial lactate or standard base deficit on admission and after 24 hours can predict mortality for patients with cancer. METHODS: We evaluated 1,129 patients with severe sepsis, septic shock, or postoperative after high-risk surgery. Lactate and standard base deficit collected at admission and after 24 hours were compared between survivors and non-survivors. We evaluated whether these perfusion markers are independent predictors of mortality. RESULTS: There were 854 hospital survivors (76.5%). 24 h lactate .1.9 mmol/L and standard base deficit , -2.3 were independent predictors of intensive care unit mortality. 24 h lactate .1.9 mmol/L and 24 h standard base deficit , -2.3 mmol/Lwere independent predictors of hospital death. CONCLUSION: Our findings suggest that lactate and standard base deficit measurement should be included in the routine assessment of patients with cancer admitted to the intensive care unit with sepsis, septic shock or after highrisk surgery. These markers may be useful in the adequate allocation of resources in this population. KEYWORDS: Lactate; Mortality; Cancer; Critical Care. Hajjar LA, Nakamura RE, Almeida JP, Fukushima JT, Hoff PMG, Vincent JL, et al. Lactate and base deficit are predictors of mortality in critically ill patients with cancer. Clinics. 2011;66(12):2037-2042. Received for publication on July 4, 2011; First review completed on August 18, 2011; Accepted for publication on August 23, 2011 E-mail: ludhmila@terra.com.br Tel.: 55 11 3893-3867

significant outcome predictors were higher Simplified Acute Physiology Score (SAPSII) and the need for mechanical ventilation. In a recent multicenter and prospective study with 717 patients with cancer admitted over a two-month period into Brazilian ICUs,1 Soares and colleagues found that mortality was associated with the length of hospital days before ICU admission, the degree of organ dysfunction, the status performance, the need for mechanical ventilation and recurrent or progressing active malignancy.1 Lactate and standard base deficit (SBD), measured at admission and within the first days of the ICU stay, are important outcome markers in critically ill patients.5-8 However, there have been no studies evaluating serum lactate levels and SBD as predictive factors of mortality in patients with cancer. The aim of this study was to evaluate whether arterial lactate levels or SBD deficit taken on admission and after 24 h can predict ICU and hospital mortality for patients with cancer admitted to the ICU.

INTRODUCTION Over the last decades, management of cancer patients has changed significantly, resulting in significant improvements in survival rates.1 While admissions to intensive care units (ICU) are frequently required, admission criteria are often difficult to be defined.2,3 Due to the lack of definitive predictive factors for mortality in these patients, an ICU trial was proposed and conducted by Lecuyer and colleagues4 suggesting that treatment limitation decisions should be considered after at least six days of complete management, when organ dysfunction scores could differentiate the survivors from the non-survivors. A multicenter European study, the SOAP study,3 found that patients with hematologic malignancies and solid tumors had a 29% hospital mortality rate. The most

METHODS Study Design Following approval by the institutional Medical Ethics Committee, this prospective observational study was

No potential conflict of interest was reported.

2037

Lactate and base deficit as predictors of mortality Hajjar LA et al.

CLINICS 2011;66(12):2037-2042

sampled arterial blood collected through an arterial line at the same time of central venous blood samples. The central venous catheter positions were previously checked. All blood samples were analyzed in an AVL Omni Roche gas analyzer (Basel, Switzerland). Standard base deficit was calculated according to the Siggaard-Andersen (Van Slyke) equation. The serum lactate level and SBD collected at admission (0 h) and after 24 hours (24 h) were compared between survivors and non-survivors through mean values and subgroup analysis: lactate ,2, 2 to 4 and .4 mmol/L and SBD ,-10, -10 to -4 and .-4 mmol/L. The intensive treatment of patients was done according to the Surviving Sepsis Campaign guidelines.10 We evaluated whether arterial lactate and SBD were independent predictors of ICU and hospital mortality.

performed at the medical-surgical ICU of the Cancer Institute do Estado de Sao Paulo, an oncology reference hospital linked to the University of Sao Paulo. This is a closed 44-bed ICU that admits 1,500 to 2,000 patients per year, with approximately 60% postoperative and 40% medical patients, and a global ICU mortality rate of approximately 25%.9 We evaluated all patients admitted from August 2008 to July 2010. Patients were considered eligible for the study if they had a diagnosis of severe sepsis or septic shock according to the current definition,11 with less than 24 hrs of sepsis-related organ dysfunction or if they were at immediate postoperative of high risk surgery, defined as emergency surgical procedures or elective prolonged surgery (. 3 hours).11,12 Patients were excluded if their ICU stay was less than 24 hours or if palliative care was defined at the time of admission. Data were prospectively collected daily until hospital discharge or death, including age, gender, medical/surgical status, oncologic diagnosis, status of neoplasm, comorbidities, diagnosis for ICU admission, and performance status (Karnofsky scale). Clinical and laboratory data for the SAPS II and for the Acute Physiology and Chronic Health Evaluation II score (APACHE II) were recorded using the worst value within the first 24 hours after ICU admission.13,14 The need for mechanical ventilation, renal replacement therapy (RRT) or vasopressor agents was recorded. Serum lactate and SBD were collected at admission, after 24 hours and after an intervention involving a fluid challenge, use of inotropic agents or vasopressors. The SBD and arterial lactate levels were obtained from

Statistical Analysis All data were analyzed using SPSS version 18 (SPSS, Inc., Chicago, IL, USA). Data were considered normal using the Kolmogorov-Smirnov test. Results are expressed as means with 95% confidence intervals (CIs) or medians with interquartile ranges (IQRs). Single medians between the groups were compared using the Mann-Whitney U test, and categorical data were compared using a chi-square analysis. We used analysis of variance for repeated measures to analyze levels of lactate and base deficit at 0 h and 24 h between the survivor and non-survivor groups. A forward multiple logistic regression analysis was performed to estimate predictive factors for ICU mortality.

Table 1 - Demographic and clinical characteristics of the patients and their outcomes. Variable

Age (years), mean (95%CI) Male gender APACHE II score SAPS II score, median (IQR) Type of Admission Medical Sepsis Septic shock Surgical Gastrointestinal Thoracic Urologic Gynecologic Other Type of cancer Locoregional solid tumor Metastatic solid tumor Haematological malignancies Karnofski, median (IQR) Co-morbidities and therapies on admission COPD Chronic renal failure Diabetes Liver disease Chemotherapy Radiotherapy Mechanical Ventilation on ICU admission Dialysis on ICU admission Vasopressors on ICU admission ICU stay (days), median (IQR)

All patients

Survivors

Non-Survivors

(N = 1129)

(N = 864)

(N = 265)

61 (60 to 62) 615 (54.5%) 15 (11 to 23) 38 (24 to 53)

61 (60 to 62) 474 (54.9%) 12 (9 to 18) 30 (21 to 40)

61 (59 to 63) 141 (53.2%) 24 (18 to 28) 57 (43 to 78)

0.708 0.636 ,0.001 ,0.001

625 (55.4%) 400 (64%) 225 (36%) 504 (44.6%) 162 (32.1%) 34 (6.7%) 117 (23.2%) 63 (12.5%) 128 (25.4%)

394 (45.6%) 294 (74.6%) 100 (25.4%) 470 (54.4%) 144 (30.6%) 29 (6.2%) 111 (23.6%) 62 (13.2%) 124 (26.4%)

231 (87.2%) 106 (45.9%) 125 (54.1%) 34 (12.8%) 18 (52.9%) 5 (14.7%) 6 (17.6%) 1 (2.9%) 4 (11.8%)

,0.001 ,0.001

777 (68.8%) 210 (18.6%) 142 (12.6%) 80 (65 to 90)

628 (72.7%) 146 (16.9%) 90 (10.4%) 80 (70 to 90)

149 (56.2%) 64 (24.2%) 52 (19.6%) 80 (60 to 90)

,0.001

260 (23%) 40 (3.5%) 178 (15.8%) 48 (4.3%) 72 (6.4%) 4 (0.4%) 388 (34.4%) 45 (4%) 341 (30.2%) 4 (3 to 8)

197 (22.8%) 34 (3.9%) 145 (16.8%) 34 (3.9%) 48 (5.6%) 3 (0.3%) 251 (29.1%) 18 (2.1%) 195 (22.6%) 3 (2 to 6)

63 (23.8%) 6 (2.3%) 33 (12.5%) 14 (5.3%) 24 (9.1%) 1 (0.4%) 137 (51.7%) 27 (10.2%) 146 (55.1%) 6 (2 to 10)

0.742 0.198 0.091 0.341 0.041 0.942 ,0.001 ,0.001 ,0.001 ,0,001

p-value

0.007 0.055 0.426 0.081 0.059

0.612

Abbreviations: 95% CI, 95% confidence interval; IQR, interquartile range; APACHE, Acute Physiology and Chronic Health disease; SAPS, Simplified Acute Physiology Score; COPD, chronic obstructive pulmonary disease; ICU, intensive care unit. Parenthesis: % or CI or IQR.

2038

CLINICS 2011;66(12):2037-2042

Lactate and base deficit as predictors of mortality Hajjar LA et al.

group presented significantly higher APACHE II and SAPS II scores compared to the survivor group. A medical complication was the main reason for ICU admission. Non-survivors were more likely to have a medical diagnosis. There were 987 patients with solid tumors (87.4%) while 142 patients (12.6%) had hematological malignancies. The studied patients had a Karnofsky score of 80 (65-90). Non-survivors were more likely to have received chemotherapy in the last 30 days and in need of organ support at admission. They also had longer ICU stay durations. As shown in Figure 1, at the time of ICU admission (0 h), the mean (CI) initial lactate concentrations were 2.4 [95% CI, 2.3 to 2.6] mmol/L in the survivors and 3.7 [95% CI, 3.3 to 4.1] mmol/L in the non-survivors (p,.001). After 24 h, the lactate concentrations decreased to 1.8 [95% CI, 1.7 to 1.9] mmol/L in the survivors but remained at 3.8 [95% CI, 3.3 to 4.3] mmol/L in the non-survivors (differences p,0.001). Likewise, at baseline, the SBD was -3 [95% CI, -3.3 to -2.7] mmol/L in the survivors and -5.7 [95% CI, -6.6 to -4.9] mmol/L in the non-survivors (p,0.001). After 24 h, the SBD increased to 2 mmol/L in the survivors while it increased to 0.8 mmol/L in the non-survivors (p,0.001). (Figure 1). In a multivariate model, medical admission, RRT or vasopressor therapy on ICU admission, 24 h lactate

The variables which in the univariate anlaysis presented p#0.10 were used to build the model. A multiple Cox proportional hazards model was performed to estimate predictive factors for hospital mortality. Receiver operating characteristic (ROC) curves were built for each variable to analyze its discriminating power in predicting hospital mortality. The areas under the ROC curves (ยกSE) were determined. In logistic regression model for other significant variables, we built curves for each significant variable related to hospital mortality. A p-value of less than 0.05 was considered to indicate statistical significance, and all tests were two-tailed.

RESULTS Intensive Care Unit Mortality Of a total of 2,653 patients admitted into the ICU during the study period, 1,129 patients fulfilled the inclusion criteria. Their characteristics are described in Table 1. There were 854 ICU survivors (76.5%) and 265 ICU nonsurvivors (23.5%) during the hospital stay. There were no differences between the survivor and non-survivor groups regarding age or gender. As expected, the non-survivor

Figure 1 - Comparison between survivor and non-survivor groups of A) lactate (mmol/L) and B) standard base deficit (SBD in mmol/L) in two time points (0 and 24h). Mean +2 SEM (*) p,0.05 survivors versus non-survivors (#) p,0.05.

2039

Lactate and base deficit as predictors of mortality Hajjar LA et al.

CLINICS 2011;66(12):2037-2042

Table 2 - Multiple logistic regression to determine predictive factors for ICU mortality. Variable Medical admission RRT on ICU admission Vasopressors on ICU admission SBD (mmol/L) - 24 h ,-2.3 .-2.3 Lactate (mmol/L) - 24 h ,1.9 .1.9

Odds ratio

95%CI

4.216 4.212 3.049

2.761 1.848 2.077

6.436 9.602 4.477

2.400 Reference

1.635

3.523

2.704

5.972

Reference 4.018

p-value ,0.001 0.001 ,0.001 ,0.001 ,0.001 ,0.001 ,0.001 ,0.001

Abbreviations: ICU, intensive care unit; SBD, Standard base deficit in mmol/L; RRT, renal replacement therapy.

.1.9 mmol/L and SBD between –10 and -4 mmol/L were predictors of ICU mortality (Table 2).

Hospital Mortality Of the 1,129 patients, 324 (28.7%) died during their hospital stay. In an univariate analysis, higher APACHE II and SAPS II scores, medical admissions, metastatic solid tumors, hematological malignancies, mechanical ventilation at ICU admission, and vasopressors at ICU admission were associated with hospital mortality. Also, higher levels of lactate at 0 h and 24 h and lower levels of SBD at 0 h and 24 h were associated with death during the hospital stay (Figure 2 and Table 3). Abbreviations: ICU, intensive care unit; SBD, Standard base deficit iLactate values at 0 h and at 24 h that were higher than 2.3 mmol/L and 1.9 mmol/L, respectively, were observed to increase hospital mortality. Also, SBD values at 0 h and at 24 h that were lower than -3.6 mmol/L and -2.3 mmol/L was observed to increase hospital mortality (Table 3). From the ROC curves, the best predictors of hospital mortality in critically ill cancer patients were lactate values of greater than 2.3 mmol/L and a BD values lower than – 3.7 mmol/L at the time of admission. After 24 h, the best predictors of ICU mortality were lactate values greater than 1.9 mmol/L and a BD values lower than – 2.3 mmol/L. We graphically represented hospital survival curves for each parameter (Figure 3). In a multivariate model, medical admission, metastatic solid tumor or hematological malignancies, 24 h lactate values higher than 1.9 mmol/L and 24 h SBD values lower than -2.3 mmol/L were the independent predictors of hospital death (Table 4).

Figure 2 - Receiver Operating Characteristic (ROC) curve comparing the ability of A) lactate (mmol/L), B) standard base deficit (SBD in mmol/L) at baseline and after 24 and C) SAPS II SCORE after 24h in predicting ICU mortality.

Recently, patients with cancer are experiencing increased survival rates, leading to increases in the number of ICU admissions.15 Such findings highlight the need to better characterize patients with cancers and to evaluate the prognoses at ICU admission. Larche´ and colleagues described a third-day mortality of 65.5% in 84 patients with cancer and septic shock.2 In a report by Soares and colleagues, hospital mortality was 58% in cancer patients admitted due to medical complications and 37% in patients admitted after elective surgery.1 Our patients were severely ill, with a median SAPS II score of 38. Most were admitted due to sepsis or septic shock while a large percentage of patients had metastatic solid tumors or hematological cancers. Despite this, the overall ICU mortality rate in our study was 24%; 37% in medical patients and 7% in surgical

DISCUSSION This is the first study showing that lactate and standard base deficit levels are predictors of ICU and hospital mortality in patients with cancer admitted to intensive care units. In these patients with cancer, admission as well as 24 h lactate and SBD values can be used earlier and more accurately than other variables to identify patients who have a high risk for mortality. Moreover, our data suggest that these variables are more sensible and specific in their capacity to predict mortality in a mixed population of medical and surgical patients with cancer, 24 h after initial admission to the ICU.

2040

CLINICS 2011;66(12):2037-2042

Lactate and base deficit as predictors of mortality Hajjar LA et al.

of previous studies assessing lactate, lactate clearance and base deficits in critically ill patients.16-18 A high single lactate level and limited lactate reduction during treatment have prognostic importance. Smith and colleagues showed in 148 patients without cancer that both the base deficit and arterial lactate at admission have good prognostic abilities.17 The value of base deficit at the time of admission with the best predictive ability was a base deficit value of less than â&#x20AC;&#x201C;4 mmol/L and a lactate value of greater than 1.5 mmol/L. Nguyen and colleagues evaluated 111 septic patients and found that lactate values at admission are higher in nonsurvivors. Both lactate and lactate clearance are predictors of mortality in these patients.5 In a recent study, Khosravani and colleagues evaluated 11,581 patients and demonstrated that hyperlactatemia is common in both medical and surgical critically ill patients. Its presence at presentation or its development during ICU stay is associated with mortality.18 In our patients, lactate and SBD values at ICU admission were risk factors and 24 h lactate and SBD values were independent predictors of ICU and hospital mortality. These data suggest the addition of low cost markers to

Table 3 - Univariate Cox proportional hazard analysis with hospital mortality as the dependent variable. Variable Lactate (mmol/L) 0h ,2.3 (mmol/L) .2.3 (mmol/L) 24 h ,1.9 (mmol/L) .1.9 (mmol/L) SBD (mmol/L) 0h ,-3.6 .-3.6 24 h ,-2.3 .-2.3

95%CI

p-value

,0.001 reference 2.030

1.615

2.552

,0.001 ,0.001

reference 3.262

2.502

4.252

,0.001

2.170 reference

1.727

2.726

,0.001 ,0.001

2.448 reference

1.909

3.138

,0.001 ,0.001

Abbreviations: ICU, intensive care unit; SBD, Standard base deficit in mmol/L.

patients. Compared to the survivors, non-survivors presented with higher lactate levels and lower base deficit levels at admission and at 24 h. These findings are similar to the results

Figure 3 - Survival curves for type of admission, type of cancer and levels of lactate (mmol/L) and SBD (mmol/L) at 24h.

2041

Lactate and base deficit as predictors of mortality Hajjar LA et al.

CLINICS 2011;66(12):2037-2042

REFERENCES

Table 4 - Multivariate Cox proportional hazard analysis with hospital mortality as the dependent variable. Variable

95% CI

Medical admission Type of cancer Locoregional solid tumor Metastatic solid tumor Haematological malignancies Lactate (mmol/L) 24 h ,1.9 .1.9 SBD (mmol/L) 24 hs ,-2.3 .-2.3

2.180

1.562

3.041

,0.001 0.014

Reference 1.495 1.114 1.424 1.017

2.007 1.994

0.007 0.040

1. Soares M, Caruso P, Silva E, Teles JM, Lobo SM, Friedman G, et al. Characteristics and outcomes of patients with cancer requiring admission to intensive care units: a prospective multicenter study. Crit Care Med. 2010;38:9-15, doi: 10.1097/CCM.0b013e3181c0349e. 2. Larche J, Azoulay E, Fieux F, Mesnard L, Moreau D, Thiery G, et al. Improved survival of critically ill cancer patients with septic shock. Intensive Care Med. 2003;29:1688-95, doi: 10.1007/s00134-0031957-y. 3. Taccone FS, Artigas AA, Sprung CL, Moreno R, Sakr Y, Vincent JL. Characteristics and outcomes of cancer patients in European ICUs. Crit Care. 2009;13:R15, doi: 10.1186/cc7713. 4. Lecuyer L, Chevret S, Thiery G, Darmon M, Schlemmer B, Azoulay E. The ICU trial: a new admission policy for cancer patients requiring mechanical ventilation. Crit Care Med. 2007;35:808-14, doi: 10.1097/01. CCM.0000256846.27192.7A. 5. Vincent JL, Dufaye P, Berre J, Leeman M, Degaute JP, Kahn RJ. Serial lactate determinations during circulatory shock. Crit Care Med. 1983;11:449-51, doi: 10.1097/00003246-198306000-00012. 6. Mikkelsen ME, Miltiades AN, Gaieski DF, Goyal M, Fuchs BD, Shah CV, et al. Serum lactate is associated with mortality in severe sepsis independent of organ failure and shock. Crit Care Med. 2009;37:1670-7, doi: 10.1097/CCM.0b013e31819fcf68. 7. Vernon C, LeTourneau JL. Lactic acidosis: recognition, kinetics, and associated prognosis. Crit Care Clin 2010;26:255-283, doi: 10.1016/j.ccc. 2009.12.007. 8. Noritomi DT, Soriano FG, Kellum JA, Cappi SB, Biselli PJ, Libo´rio AB, et al. Metabolic acidosis in patients with severe sepsis and septic shock: a longitudinal quantitative study. Crit Care Med 2009;37:2733-2739, doi: 10.1097/CCM.0b013e3181a59165. 9. Galas F, Hajjar L, Almeida JP, Trielli T, Vieira S, Bazan M, et al. Outcomes of 1,000 patients with cancer admitted to the intensive care unit: a Brazilian prospective study. Crit Care. 2010;14(suppl 1):P425, doi: 10.1186/cc8657. 10. Dellinger RP, Levy MM, Carlet JM, Bion J, Parker MM, Jaeschke R, et al. Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic shock: 2008. Crit Care Med. 2008;36:296-327, doi: 10.1097/01.CCM.0000298158.12101.41. 11. Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, et al. SCCM/ESICM/ACCP/ATS/SIS. 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Crit Care Med. 2003;31:12506, doi: 10.1097/01.CCM.0000050454.01978.3B. 12. Pearse R, Dawson D, Fawcett J, Rhodes A, Grounds RM, Bennett ED. Early goal-directed therapy after major surgery reduces complications and duration of hospital stay. A randomised, controlled trial. Crit Care. 2005;9:R687-R93, doi: 10.1186/cc3887. 13. Le Gall JR, Lemeshow S, Saulnier F. A new Simplified Acute Physiology Score (SAPS II) based on a European/North American multicenter study. JAMA. 1993;270:2957-63, doi: 10.1001/jama.270.24.2957. 14. Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification system. Crit Care Med. 1985;13:818-29, doi: 10.1097/00003246-198510000-00009. 15. Lamia B, Hellot MF, Girault C, Tamion F, Dachraoui F, Lenain P, et al. Changes in severity and organ failure scores as prognostic factors in onco-hematological malignancy patients admitted to the ICU. Intensive Care Med. 2006;32:1560-8, doi: 10.1007/s00134-006-0286-3. 16. Park M, Azevedo LC, Maciel AT, Pizzo VR, Noritomi DT, da Cruz Neto LM. Evolutive standard base excess and serum lactate level in severe sepsis and septic shock patients resuscitated with early goal-directed therapy: still outcome markers? Clinics. 2006;61:47-52, doi: 10.1590/ S1807-59322006000100009. 17. Smith I, Kumar P, Molloy S, Rhodes A, Newman PJ, Grounds RM, et al. Base excess and lactate as prognostic indicators for patients admitted to intensive care. Intensive Care Med. 2001;27:74-83, doi: 10.1007/ s001340051352. 18. Khosravani H, Shahpori R, Stelfox HT, Kirkpatrick AW, Laupland KB. Occurrence and adverse effect on outcome of hyperlactatemia in the critically ill. Crit Care. 2009;13:R90, doi: 10.1186/cc7918. 19. Padilla GF, Garibay MA, Hummel HN, Avila R, Me´ndez A, Ramı´rez R. Fulminant non-Hodgkin lymphoma presenting as lactic acidosis and acute liver failure: case report and literature review. Acta Gastroenterol Latinoam. 2000;39:129-34.

p-value

,0.001 Reference 2.630 1.992 1.738 1.331 Reference

3.473 2.270

,0.001 ,0.001 ,0.001

Abbreviations: ICU, intensive care unit; SBD, Standard base deficit in mmol/L.

existing routine evaluations of cancer patients admitted to the ICU. Also, our findings highlight the importance of immediate and adequate treatments of these patients, as the serial improvement of these parameters is associated with a better prognosis. As stated in previous studies, usual risk scores in critically ill patients such as SAPS II, APACHE II, SOFA, and MPM scores do not apply well in patients with cancer.2 These patients now live longer and present with higher rates of ICU admission, which reinforces the need for more sensible and specific parameters to evaluate patient prognosis. In patients with cancer, it is important to emphasize that increased lactate levels may be due to causes other than tissue hypoxia liver disorders, lactate production by neoplastic cells, tumor lysis syndrome, or compromises in lactate clearance.19 A limitation of this study was that the study was performed in a single referral center, which could limit the generalizability of our findings. Another limitation is that we did not specifically address other causes for the high levels of lactate and the low levels of base deficit. The addition of lactate and standard base deficit measurement at ICU admission may represent a new issue in the prognostic evaluation of cancer patients. Our findings suggest the importance of the inclusion of lactate and base deficit measurements in the assessment of prognosis in cancer patients admitted to intensive care unit with sepsis, septic shock, or after high-risk surgery. More evidence is needed to clarify whether targeted therapy through lactate and base deficit level measurements can improve outcomes in cancer patients.

AUTHOR CONTRIBUTIONS Hajjar L and Almeida JP designed the study and were responsible for the draft of the manuscript. Fukushima JT was responsible for the statistical analysis and revision of the manuscript. Nakamura RE was responsible for the data collection. Hoff PM reviewed the manuscript and provided technical support. Vincent JL, Auler JOC and Galas FBG designed the study and reviewed the manuscript.

2042

CLINICS 2011;66(12):2043-2048

DOI:10.1590/S1807-59322011001200008

CLINICAL SCIENCE

Abnormal sensory integration affects balance control in hemiparetic patients within the first year after stroke Clarissa B. Oliveira,I,II I´talo R. T. Medeiros,III Mario G. Greters,III Norberto A. F. Frota,IV Leandro Tavares Lucato,II Milberto Scaff,I Adriana B. ConfortoI I AACD - Adult Physiotherapy, Saõ Paulo/SP, Brazil. II Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Neurology, Saõ Paulo/ SP, Brazil. III Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Otorhinolaryngology Department, Saõ Paulo/SP, Brazil. IV Fortaleza University - School of Medicine, Fortaleza/CE, Brazil.

OBJECTIVE: Impairments in balance can be a consequence of changes in the motor, sensory, and integrative aspects of motor control. Abnormal sensory reweighting, i.e., the ability to select the most appropriate sensory information to achieve postural stability, may contribute to balance impairment. The Sensory Organization Test is a component of Computerized Dynamic Posturography that evaluates the impact of visual, vestibular, and somatosensory inputs, as well as sensory reweighting, under conditions of sensory conflict. The aim of this study is to compare balance control in hemiparetic patients during the first year post-stroke and in age-matched neurologically normal subjects using the Berg Balance Scale and Computerized Dynamic Posturography. METHODS: We compared the Berg Balance Scale and Sensory Organization Test scores in 21 patients with hemiparesis after first-ever ischemic stroke and in 21 age-matched, neurologically normal subjects. An equilibrium score was defined for each Sensory Organization Test condition. RESULTS: Berg Balance Scale scores were significantly lower in the patients than in the neurologically normal subjects. Equilibrium scores were significantly lower in the patients than in the neurologically normal subjects for those Sensory Organization Test conditions that did not provide appropriate somatosensory information and under conditions of sensory conflict. A history of falls was more frequent in patients with lower equilibrium scores. CONCLUSION: During the first year after a stroke, defective sensory reweighting significantly impacts balance control in hemiparetic patients. These results are important for the planning of effective rehabilitation interventions. KEYWORDS: Posture; Rehabilitation, Cerebrovascular accident; Equilibrium; Posturography. Oliveira CB, Medeiros IRT, Greters MG, Frota NAF, Lucato LT, Scaff M, et al. Abnormal sensory integration affects balance control in hemiparetic patients within the first year after stroke. Clinics. 2011;66(12):2043-2048. Received for publication on August 10, 2011; First review completed on August 23, 2011; Accepted for publication on August 23, 2011 E-mail: cla-oliveira@uol.com.br Tel.: 55 11 5576-0924

Reductions in muscle strength and range of movement, abnormal muscle tone and loss of motor coordination and sensory organization can contribute to balance disturbances to varying degrees.12 The difficulties in determining the specific causes of balance impairments in hemiparetic patients are related to the diversity of mechanisms involved and the variety of strategies used to adapt to these changes.13 Clinical scales or laboratory measurements can be used to evaluate balance control. Laboratory measurements of postural reactions are more sensitive for investigating balance during standing and functional activities13-15 than clinical scales such as the Berg Balance Scale (BBS).16 One of the most widely used laboratory tools for evaluating balance is posturography,12 which is capable of quantifying postural asymmetry, instability17 and sensory contributions to balance control. Computerized Dynamic Posturography (CDP) is a specific type of posturography that challenges

INTRODUCTION Falls occur in up to 73% of patients within the first six months after a stroke1 due to balance abnormalities associated with impairments in the motor, sensory, cognitive, or integrative aspects of movement control. Falls can lead to complications, such as hip fractures, that have high individual and social costs.2-10 Even in high-functioning post-stroke populations, falls are common and are associated with limitations on activity and participation.11

2043

Abnormal sensory integration after stroke Oliveira CB et al.

CLINICS 2011;66(12):2043-2048

postural stability by providing different levels of sensory deprivation and conflict as part of the Sensory Organization Test. In this test, a subject stands on a force platform with sensors that provide kinetic data regarding postural reactions both during normal conditions and after the manipulation of visual, vestibular and somatosensory inputs.18 This manipulation allows for the quantification of the patient’s relative reliance on different sensory inputs that are required to maintain balance, as well as their integration. Decreased multisensory integration, with excessive reliance on visual information and consequent poor balance control, has been demonstrated during the chronic stages (.1 year) after a stroke.12 It is known that rehabilitation is more effective when delivered within the first months after a stroke, but the ways in which defective selection and integration of sensory input affect balance at this stage are not well understood. If the factors that influence postural impairment within the first year post-stroke can be determined, then rehabilitation programs can be tailored to target specific components of balance control and, hence, decrease the risk of falls. To better understand the mechanisms underlying balance disturbances at an earlier stage, within the first year after a stroke, we used an innovative approach that employed not only a clinical tool (the Berg Balance Scale)16 but also a sophisticated laboratory test, the CDP. In addition, we investigated the relationship between CDP results and a history of falls in post-stroke patients.

Figure 1 - Selection of participants. The number of patients included at each stage of the research is shown.

or cerebellar stroke (7.5% - 45 subjects). In addition, 19 patients (3.4%) were not able to stand on the platform for at least 30 seconds. In total, 21 patients (3.6%) were included in the study. All patients provided informed consent, and the protocol was approved by the institutional ethics committee. Table 1 shows the patients’ characteristics. Only patients with mild to moderate hemiparesis and neurological impairment were included because severe hemiparesis precludes complete posturographic evaluation. Motor and sensory impairments were characterized using the motor and sensory examination components of the Fugl-Meyer Assessment for the lower limbs.21 Neurological impairment was evaluated using the National Institute of Health Stroke Scale (NIHSS),22 and disability was evaluated using the Barthel Index23 and the Functional Ambulatory Category score.24 Ankle proprioception (evaluated as part of the FuglMeyer Assessment) was abnormal in three patients. Of the patients, seven (33.3%) had a history of at least one fall after stroke, and 19 (90.5%) were right-handed (laterality before the stroke was asked in the interview). Lesions encompassed the following cerebral areas/structures: frontal lobe

MATERIALS AND METHODS Subjects Stroke patients Patients diagnosed with stroke at Hospital das Clı´nicas/ Sa˜o Paulo University were consecutively screened between July 2006 and April 2008. The following inclusion criteria were used: hemiparesis after a first-ever ischemic stroke in a cerebral hemisphere one to twelve months previously, confirmed by computed tomography or magnetic resonance imaging; ability to stand unassisted for 30 seconds; no severe systemic disorders; ability to understand and cooperate with testing; normal visual fields; visual acuity of at least 20/60; and availability for evaluations. The exclusion criteria were as follows: other neurological diseases; brain stem or cerebellar stroke; vertigo; vestibular dysfunction in neurootological examination (electrooculography with positional tests and caloric tests with water at 44 ˚C and 30 ˚C); lower limb orthopedic disorders; hemineglect (evaluated using the cancellation test);19 and pusher syndrome, defined according to the Clinical Assessment Scale for Contraversive Pushing (the subject should present a contralesional tilted posture, a tendency to push toward the paretic side with the nonaffected limbs, and resistance to external correction of the tilted posture, in either a seated or standing position).20 The selection of participants was performed in three stages: evaluation of medical charts (I), telephone interviews (II), and personal interviews/evaluations at the hospital (III). Figure 1 illustrates the exclusions at each stage of research. The main reasons for non-inclusion were as follows: recurrent stroke (26.1% - 146 subjects), no hemiparesis (18.2% - 102 subjects), inability to be contacted by phone for screening (8.9% - 50 subjects), and brainstem

Table 1 - Characteristics of the patients. Age (years) Time from stroke (months) Men/women Hemiparesis (R/L) Handedness (R/L) Barthel Index NIHSS Fugl-Meyer Assessment for the lower limbs Functional Ambulatory Category

55.9¡13.9 4.8¡2.5 13/8 14/7 19/2 95 (80–100) 2 (0–8) 31 (17-33) 4 (2-5)

NOTE: M = men; W = women; R = right; L = left; NIHSS = National Institutes of Health Scale; FAC = Functional Ambulatory Category. Mean age (¡ standard deviation) and median (range) scores for the impairment and disability scales are given.

2044

CLINICS 2011;66(12):2043-2048

Abnormal sensory integration after stroke Oliveira CB et al.

(61.9% - 13 subjects), insula (52.4% - 11 subjects), parietal lobe (47.6% - 10 subjects), temporal lobe (19% - 4 subjects), internal capsule (19% - 4 subjects), basal ganglia (14.3% - 3 subjects), and thalamus (4.8% - 1 subject).

platform surface and background (in this situation, the subject uses mainly vestibular and somatosensory inputs to maintain balance because there is no visual information about his or her position in relation to the environment); 3. Eyes open, fixed platform surface and sway-referenced visual background (in this situation, the subject should rely mainly on vestibular and somatosensory information and not on visual inputs, which are not providing accurate information about his or her position in relation to the environment); 4. Eyes open and sway-referenced surface (in this situation, the subject uses mainly visual and vestibular inputs to maintain balance because the somatosensory information is distorted); 5. Eyes closed and sway-referenced surface (in this situation, the subject uses mainly vestibular inputs to maintain balance because there is no visual information about his or her position in relation to the environment, and the somatosensory information is distorted); and 6. Eyes open, sway-referenced surface and visual background (in this situation, the subject should use mainly vestibular inputs to maintain balance, because the somatosensory and visual information are distorted). Conditions 4, 5, and 6 provide challenging sensory inputs, and Conditions 3 and 6 introduce visual conflicts. For each subject, three trials of 20 seconds were performed with each condition. Sensory functions were assessed as the ratio between the average of the results of the following conditions and the average of Condition 1:

Neurologically normal volunteers For the control group, 21 age-matched neurologically normal subjects were recruited. The inclusion criteria were the absence of neurological disorders and visual acuity of at least 20/60. The exclusion criteria were a history of vertigo and orthopedic disorders in the lower limbs. In addition, subjects with abnormalities in the vestibular evaluation of the Sensory Organization Test in posturography were excluded because it is known that individuals with peripheral vestibular disorders cannot perform normally on Sensory Organization Test (SOT) conditions 5 and 6.25

Balance evaluation BBS and posturography were performed in the patients (the mean time after stroke ยก standard deviation was 4.8ยก2.5 months) and neurologically normal volunteers. The BBS16 is a simple test of functional balance composed of 14 items based on activities of daily living. Each item is rated using an ordinal scale, ranging from 0 to 4, and the maximum score is 56. Posturography was performed with the SOT and the Equitest protocol (NeuroCom International) of the CDP. During testing, the subjects stood barefoot in the upright position, protected by a harness, with their arms alongside their body and their feet on a predesignated site. A dualforce platform, with four transducer outputs, measured vertical forces and shear forces exerted in the anteroposterior direction, separately for each leg. The SOT assesses the three sensory components of balance under different visual and support-surface conditions. Figure 2 shows the six different conditions that were studied: 1. Eyes open, fixed platform surface and background (in this situation, the subject relies on visual, vestibular and somatosensory inputs); 2. Eyes closed, fixed

N N N

Somatosensory function (Condition 2); Visual function (Condition 4); and Vestibular function (Condition 5).

Visual preference was evaluated by comparing the sum of the equilibrium scores for Conditions 3 and 6 with the sum of the equilibrium scores for Conditions 2 and 5 (Conditions 3 + 6/Conditions 2 + 5). Visual preference reflects the ability to suppress visual information perceived as incorrect. An equilibrium score (ES) was calculated for each of the six SOT conditions. An ES is a measure of postural stability,

Figure 2 - The six test conditions of the Sensory Organization Test. Picture reprinted with permission from NeuroCom InternationalTM.

2045

Abnormal sensory integration after stroke Oliveira CB et al.

CLINICS 2011;66(12):2043-2048

based on sway during a 20-second SOT trial. A score of 100 indicates no sway, whereas 0 indicates sway beyond the limits of stability (8.5 ˚ anteriorly and 4 ˚ posteriorly; 12.5 ˚ is the theoretical limit of sway in the sagittal plane for normal stance). The score was calculated using the following formula: ES = (12.5 ˚ - [hmax – hmin]) 6100/12.5 ˚, where 12.5 ˚ is the normal limit of anteroposterior sway, and h is the angle between a line extending vertically from the center of foot support and a line extending from the center of foot support through the patient’s center of gravity.26 A composite equilibrium score (ES) was generated for each of the 21 patients. This ES represents the overall evaluation of all six Conditions (maximum score = 100) and was calculated by independently averaging all trial scores from Conditions 1 and 2, adding these two average scores to the individual trial scores from conditions 3 through 6 and then dividing the sum by 14.26

Table 2 - Posturography scores and sensory analysis in stroke patients and neurologically normal volunteers. Evaluation SOT 1{ SOT 2{ SOT 3{ SOT 4{ SOT 5{ SOT 6{ Equilibrium score{ Somatosensory function{ Visual function{ Vestibular function { Visual preference {

Study Group

Control Group

p-value

94.7 (86.7-97.7) 92.7 (73.3-97.3) 91.3 (72.3-97.7) 74.6¡13.4 52.9¡20.7 55.2¡17.6 71.8¡9.9 0.97¡0.04

94.7 (91.7-97.3) 93 (85.7-96.3) 94.0 (85.7-96.3) 82.9¡6.53 65.3¡7.9 64.5¡11.5 78.7¡4.90 0.98¡0.02

0.63 0.44 0.05* 0.02* 0.02* 0.05* 0.01* 0.41

0.79¡0.13 0.56¡0.22 1.02¡0.14

0.87¡0.06 0.69¡0.08 1.00¡0.07

0.02* 0.02* 0.45

NOTE: { Mann-Whitney test; { Student’s unpaired t test; * p#0.05; SOT = sensory organization test.

Statistical analysis For data normally distributed according to the Kolmogorov-Smirnov test, the means and standard deviations are given, and the stroke patients and neurologically normal volunteers were compared using unpaired t-tests. For categorical or non-normally distributed data, the median, minimum, and maximum values are reported. Comparisons between groups were performed using MannWhitney tests, which were also used for the post-hoc comparison of ES’s between patients with normal and impaired ankle proprioception, as evaluated using the FuglMeyer Assessment. Univariate logistic regression was performed to examine the relationship between ES (independent variable) and a history of falls (dependent variable). p- values #0.05 were considered significant. Minitab 15.0 and SPSS 10.0 were used for the statistical analysis.

In summary, the patients performed worse in conditions that provided challenging somatosensory information (Conditions 4, 5, and 6) or that introduced visual conflicts (Conditions 3 and 6). Somatosensory information was able to compensate for absent visual information (Condition 2), but it was not completely effective in a more demanding situation of visual and somatosensory conflict (Condition 3). Composite ES’s were significantly lower in the patients than in the neurologically normal subjects (Table 2). Composite ES’s were inversely associated with falls (odds ratio = 0.63, confidence interval = 0.41-0.99, p = 0.043), i.e., a history of falls was more frequent in patients with lower scores.

DISCUSSION The main finding of this study was that patients with mild to moderate hemiparesis performed better on the SOT in the presence of accurate somatosensory input, suggesting greater reliance on this sensorial modality to maintain their balance. Also, postural reactions were not sufficient for maintaining balance when the patients were challenged by the manipulation of somatosensory and visual information. Under these conditions, the patients performed worse than the neurologically normal subjects. BBS scores were significantly different between the groups, but the magnitude of the difference was small (three points, on average). This finding may be explained by a ceiling effect in the BBS, which does not offer challenges to postural control, unlike the SOT. In the BBS, there is only one condition involving the manipulation of sensory input, i.e., standing with eyes closed. Our results are consistent with the BBS ceiling effect reported in patients with stroke and mild neurological deficits by Garland and colleagues.27 In this study, the patients’ postural adjustments were only comparable to those of the neurologically normal volunteers under less challenging conditions (Conditions 1 and 2). The patients’ reliance mostly on vestibular and visual functions to maintain balance was inefficient, despite the absence of visual or vestibular impairments in clinical or otoneurological evaluations. This result indicates the presence of abnormal vestibular and visual integration or difficulties in ‘‘choosing’’ the more reliable sensorial modality in each condition (sensory reweighting).

RESULTS Subjects There were no differences in age (p = 0.76), sex (p = 0.76) or manual preference (p = 0.66) between the neurologically normal volunteers and patients with stroke.

Berg Balance Scores BBS scores were 53 (42-56) in the patients with stroke and 56 (55-56) in the neurologically normal volunteers. The difference between scores in the two groups was small but statistically significant (p = 0.01).

Computerized Dynamic Posturography The CDP results are shown in Table 2. There were no significant differences between the groups while standing on a fixed platform with eyes open (Condition 1) or eyes closed (Condition 2). However, ES’s were significantly lower in the patients than in the neurologically normal volunteers while standing on a fixed platform with sway-referenced vision (Condition 3), on a sway-referenced platform with their eyes either open (Condition 4) or closed (Condition 5) and with swayreferenced vision and a sway-referenced platform (Condition 6). Post-hoc analysis revealed that patients with impaired ankle proprioception had lower composite ES’s than those with normal ankle proprioception (p = 0.02).

2046

CLINICS 2011;66(12):2043-2048

Abnormal sensory integration after stroke Oliveira CB et al.

postural impairments and the risk of future falls. However, our results provide the basis for prospective studies that measure SOT scores over time, from the acute to chronic phases, to investigate this clinically relevant issue. The conclusions of the present study cannot be extended to patients with more severe motor impairments who obviously cannot undergo posturography. Our patients had mild neurological impairments and disabilities, as evidenced by low NIHSS scores and high BBS, FuglMeyer, Functional Ambulation Category and Barthel Index scores. Nevertheless, their balance was not normal, as evidenced by the posturography results. This finding is in line with previous reports in patients with comparable functional levels at either earlier or later stages after stroke.12,34 In addition, one-third of the patients had a history of falls at the time they were included in this study, and a history of falls was significantly correlated with composite ESâ&#x20AC;&#x2122;s. Altogether, these findings highlight the need for balance evaluation and, if necessary, rehabilitation in all patients with strokes, even those with mild neurological deficits. Sensory integration can improve after specific training. Manipulation of the standing surface by instructing patients to walk on soft surfaces and manipulation of visual input by eye closure, for instance, can improve somatosensory integration and have positive effects on postural stability in neurologically intact elderly people35,36 and in hemiparetic subjects at least six months post-stroke.37,38 Whether more specific programs based on posturography results can improve balance outcomes and decrease the risk of falls in patients at an earlier stage after stroke remains to be determined. In the first months after stroke, treatment strategies are likely to benefit from efforts to improve multisensory integration and to address the reweighting of sensory information. As a result, preferential reliance on somatosensory information or on visual input in situations of visual and somatosensory conflicts would become less critical for balance control. Hemiparetic stroke patients are heterogeneous in terms of their lesions, degrees of impairment, disabilities, and recovery potentials. Biomechanical components, sensory inputs, integration and reweighting, as well as motor strategies, cognitive processing and perception of verticality, contribute to balance control to different extents in different patients. Posturography sheds light on the choice and integration of afferent inputs for balance control in patients with mild motor deficits. We showed, for the first time, that sensory reweighting differs between neurologically normal controls and patients during the first year after stroke and that posturography results correlate with a history of falls. These results have important implications for the future design and assessment of balance-rehabilitation interventions in patients with stroke.

Although the patients relied more on somatosensory input than the control subjects to maintain their balance, and although most patients had normal ankle proprioception, somatosensory input was not completely effective, because the patients performed worse than the control subjects under conditions of visuovestibular conflict, characterized by a moving background, even in the presence of appropriate somatosensory input (Condition 3). The importance of sensory input in balance control in the stroke group was reinforced by the higher ESâ&#x20AC;&#x2122;s measured in patients with normal ankle proprioception. All except one of the published studies12 have found positive correlations between ankle proprioception and balance control in stroke patients.15,28 Tyson and colleagues29 found that changes in proprioception, along with motor impairments, were the best predictors of balance abnormalities. Sensory reweighting is defined as the ability to select the most appropriate sensory information to achieve postural stability. When multisensory integration is intact, the weight of one type of sensory input is enhanced to compensate for a decrease in or absence of information from another sensory channel. Thus, a neurologically normal subject does not lose balance during visual deprivation because the information provided from vestibular and somatosensory input is integrated to guide postural adjustments. Our results indicate that this ability is impaired in patients after one month, but to a less extent than one year after stroke, similarly to that described at an earlier phase (within one month).30 Our patients presented worse visuovestibular integration compared with patients at a more chronic stage after stroke.12 More than one year after stroke, patients have been reported to perform worse than control subjects when somatosensory input is more critical to guiding postural adjustments (Conditions 5 and 6) but not under less demanding circumstances (Conditions 3 and 4). Differences between our results and those obtained in patients in the chronic stage with comparable neurological impairments are likely to reflect different degrees of compensation or adaptive plastic changes due to injury at different phases after stroke. It is known that recovery from a stroke evolves dynamically.31 Over time, different neurophysiological mechanisms are likely to be used for sensory reweighting; most studies have shown greater reliance on visual input during more chronic stages.12,32 This study has some limitations. First, we included patients at early (one month - six months) and later stages (six months - one year) after stroke. Despite this heterogeneity in the time from lesion onset, we were able to find significant differences between the patient and control groups. Second, the sample size did not allow for an investigation into the specific roles of age or lesion location on sensory reweighting. Larger, multicenter studies will be necessary to further examine the roles of these factors on postural control. Another interesting subject for future studies is whether misperception of verticality, which has been reported to correlate with poor balance after stroke,33 interacts with abnormal sensory integration in patients at different stages and with various degrees of motor impairment and function after stroke. Third, we found a significant association between SOT score and a history of falls but did not determine the relationship between

AUTHOR CONTRIBUTIONS Oliveira CB wrote the project, collected and analyzed data, wrote manuscript. Medeiros IRT, Greters MG and Frota NAF were responsible for the project design, data collection and interpretation, and critical revision of the manuscript. Lucato LT was responsible for the data collection, critical revision of the manuscript. Scaff M was responsible for the project design, and critical revision of the manuscript. Conforto AB was responsible for the project design, data interpretation, and critically revision of the manuscript.

2047

Abnormal sensory integration after stroke Oliveira CB et al.

CLINICS 2011;66(12):2043-2048

18. Benvenuti F, Mecacci R, Gineprari I, Bandinelli S, Benvenuti E, Ferrucci L, et al. Kinematic characteristics of standing disequilibrium: reliability and validity of a posturographic protocol. Arch Phys Med Rehabil. 1999;80:278-87, doi: 10.1016/S0003-9993(99)90138-7. 19. Mesulan MM. Principles of behavioral neurology. Philadelphia: F.A. Davis Company; 1985. 20. Karnath HO, Ferber S, Dichgans J. The origin of contraversive pushing: evidence for a second graviceptive system in humans. Neurology. 2000;55:1298-304. 21. Fugl-Meyer AR, Jaasko L, Leyman I, Olsson S, Steglind S. The post stroke hemiplegic patient. I. A method for evaluation of physical performance. Scand J Rehabil Med. 1975;7:13-31. 22. Goldstein LB, Samsa GP. Reliability of the National Institutes of Health Stroke Scale. Extension to non-neurologists in the context of a clinical trial. Stroke. 1997;28:307-10, doi: 10.1161/01.STR.28.2.307. 23. Mahoney Fl, Barthel DW. Functional evaluation: the Barthel Index. Md State Med J. 1965;14:61-5 24. Holden MK, Gill KM, Magliozzi MR, Nathan J, Piehl-Baker L. Clinical gait assessment in the neurologically impaired. Reliability and meaningfulness. Phys Ther. 1984;64:35-40. 25. Black FO. What can posturography tell us about vestibular function? Ann N Y Acad Sci. 2001;942:446-64, doi: 10.1111/j.1749-6632.2001. tb03765.x. 26. NeuroCom Internacional Inc. Equitest system operator’s manual. Clackamas (OR): NeuroCom International; 1998. 27. Garland SJ, Ivanova TD, Mochizuki G. Recovery of standing balance and health-related quality of life after mild or moderately severe stroke. Arch Phys Med Rehabil. 2007;88:218-27, doi: 10.1016/j.apmr.2006.11.023. 28. Keenan M, Perry J, Jordan C. Factors affecting balance and ambulation following stroke. Clin Orthop. 1984;182:165-71. 29. Tyson SF, Hanley M, Chillala J, Selley A, Tallis RC. Balance disability after stroke. Phys Ther. 2006;86:30-8. 30. Al-Zamil. Dynamic posturography findings in stroke patients. Saudi Med J. 1997;18:64-9. 31. Ward NS, Cohen LG. Mechanisms Underlying Recovery of Motor Function After Stroke. Arch Neurol. 2004;61:1844-8, doi: 10.1001/ archneur.61.12.1844. 32. Rode G, Tiliket C, Boisson D. Predominance of postural imbalance in left hemiparetic patients. Scand J Rehab Med. 1997;29:11-6. 33. Bonan IV, Hubeaux K, Gellez-Leman MC, Guichard JP, Vicaut E, Yelnik AP. Influence of subjective visual vertical misperception on balance recovery after stroke. J Neurol Neurosurg Psychiatry. 2007;78:49-55, doi: 10.1136/jnnp.2006.087791. 34. Shumway-Cook A, Woollacott MH. Motor control: theory and practical applications. 2d ed. Philadelphia: Lippincott Willians & Willians, 2001. 35. Hu MH, Woollacott MH. Multisensory training of standing balance in older adults: I. Postural stability and one-leg stance balance. J Gerontol, 49:M52–M61. 36. Hu MH, Woollacott MH. Multisensory training of standing balance in older adults: II. Kinematic and electromyographic postural responses. J Gerontol 49:M62–M71. 37. Bayouk JF, Boucher JP, Leroux A. Balance training following stroke: effects of task-oriented exercises with and without altered sensory input. Int J Rehabil Res. 2006;29:51-9, doi: 10.1097/01.mrr.0000192100.67425.84. 38. Smania N, Picelli A, Gandolfi M, Fiaschi A, Tinazzi M. Rehabilitation of sensorimotor integration deficits in balance impairment of patients with stroke hemiparesis: a before/after pilot study. Neurol Sci. 2008;29:313-9, doi: 10.1007/s10072-008-0988-0.

REFERENCES 1. Forster A, Young J. Incidence and consequences of falls due to stroke: a systematic inquiry. BMJ. 1995;311:83–4. 2. Wing MA, Goodrich S, Virji-Babul N, Jenner J, Clapp S. Balance evaluation in hemiparetic stroke patients using lateral forces applied to the hip. Arch Phys Med Rehabil. 1993;74:292-9. 3. Chen IC, Cheng PT, Hu AL, Liaw MY, Chen LR, Hong WH, et al. Balance evaluation in hemiplegic stroke patients. Chan Gung Med J. 2000;23:33946. 4. De Haart M, Geurts AC, Huidekoper SC, Fasotti L, Van Limbeek J. Recovery of standing balance in postacute stroke patients: a rehabilitation cohort study. Arch Phys Med Rehabil. 2004;85:886-95, doi: 10.1016/j. apmr.2003.05.012. 5. Lamb SE, Ferrucci L, Volapto S, Fried LP, Guralnik JM, Gustafson Y. Risk factors for falling in home-dwelling older women with stroke: the Women’s Health and Aging Study. Stroke. 2003;34:494-500, doi: 10.1161/ 01.STR.0000053444.00582.B7. 6. Harris JE, Eng JJ, Marigold DS, Tokuno CD, Louis CL. Relationship of balance and mobility to fall incidence in people with chronic stroke. Phys Ther. 2005;85:150-8. 7. Belgen B, Beninato M, Sullivan PE, Narielwalla K. The association of balance capacity and fall self-efficacy with history of falling in community dwelling people with chronic stroke. Arch Phys Med Rehabil. 2006;87:554-61, doi: 10.1016/j.apmr.2005.12.027. 8. Chen IC, Cheng PT, Chen CL, Chen SC, Chung CY, Yeh TH. Effects of balance training on hemiplegic stroke patients. Chan Gung Med J. 2002;25:583-90. 9. Ikai T, Kamikubo T, Takehara I, Nishi M, Miyano M. Dynamic postural control in patients with hemiparesis. Am J Phys Med Rehabil. 2003;82:463-9. 10. Hyndman D, Ashburn A, Stack E. Fall events among people with stroke living in the community: circumstances of falls and characteristics of fallers. Arch Phys Med Rehabil 2002;83:165-70, doi: 10.1053/apmr.2002. 28030. 11. Schmid AA, Rittman M. Consequences of Poststroke Falls: Activity Limitation, Increased Dependence, and the Development of Fear of Falling. Am J Occ Ther. 2009;63:310-6. 12. Bonan IV, Colle FM, Guichard JP, Viacut E, Eisenfisz M, Huy TB, et al. Reliance on visual information after stroke. Part I: Balance on Dynamic Posturography. Arch Phys Med Rehabil. 2004;85:268-73. 13. Horak FB, Henry SM, Shumway-Cook A. Postural perturbations: new insights for treatment of balance disorders. Phys Ther. 1997;77:517-33. 14. Helbostad JL, Askim T, Moe-Nilssen R. Short-term repeatability of body sway during quiet standing in people with hemiparesis and in frail older adults. Arch Phys Med Rehabil. 2004;85:993-9, doi: 10.1016/j.apmr.2003. 07.020. 15. Niam S, Cheung W, Sullivan PE, Kent S, Gu X. Balance and physical impairments after stroke. Arch Phys Med Rehabil. 1999;80:1227-33, doi: 10.1016/S0003-9993(99)90020-5. 16. Berg K, Wood-Dauphinee SL, Williams J, Gayton D. Measuring balance in the elderly: preliminary development of an instrument. Physioter. 1989;41:304-8. 17. Genthon N, Gissot AS, Froger J, Rougier P, Pe´rennou D. Posturography in patients with stroke: estimating the percentage of body weight on each foot from a single force platform. Stroke. 2008;39:489. Epub 2008 Jan 3, doi: 10.1161/STROKEAHA.107.493478

2048

CLINICS 2011;66(12):2049-2053

DOI:10.1590/S1807-59322011001200009

CLINICAL SCIENCE

Off-pump coronary artery bypass surgery in selected patients is superior to the conventional approach for patients with severely depressed left ventricular function Guido Marco Caputti, Jose´ Hono´rio Palma, Diego Felipe Gaia, Enio Buffolo Universidade Federal de Sa˜o Paulo, Cardiovascular Surgery, Sa˜o Paulo/SP, Brazil.

OBJECTIVES: Patients with coronary artery disease and left ventricular dysfunction have high mortality when kept in clinical treatment. Coronary artery bypass grafting can improve survival and the quality of life. Recently, revascularization without cardiopulmonary bypass has been presented as a viable alternative. The aim of this study is to compare patients with left ventricular ejection fractions of less than 20% who underwent coronary artery bypass graft with or without cardiopulmonary bypass. METHODS: From January 2001 to December 2005, 217 nonrandomized, consecutive, and nonselected patients with an ejection fraction less than or equal to 20% underwent coronary artery bypass graft surgery with (112) or without (off-pump) (105) the use of cardiopulmonary bypass. We studied demographic, operative, and postoperative data. RESULTS: There were no demographic differences between groups. The outcome variables showed similar graft numbers in both groups. Mortality was 12.5% in the cardiopulmonary bypass group and 3.8% in the off-pump group. Postoperative complications were statistically different (cardiopulmonary bypass versus off-pump): total length of hospital stay (days)—11.3 vs. 7.2, length of ICU stay (days)—3.7 vs. 2.1, pulmonary complications—10.7% vs. 2.8%, intubation time (hours)—22 vs. 10, postoperative bleeding (mL)—654 vs. 440, acute renal failure—8.9% vs. 1.9% and left-ventricle ejection fraction before discharge—22% vs. 29%. CONCLUSION: Coronary artery bypass grafting without cardiopulmonary bypass in selected patients with severe left ventricular dysfunction is valid and safe and promotes less mortality and morbidity compared with conventional operations. KEYWORDS: Coronary artery bypass; cardiopulmonary bypass; off-pump surgery, ejection fraction, cardiac dysfunction. Caputti GM, Palma JH, Gaia DF, Buffolo E. Off-pump coronary artery bypass surgery in selected patients is superior to the conventional approach for patients with severely depressed left ventricular function. Clinics. 2011;66(12):2049-2053. Received for publication on July 12, 2011; First review completed on July 21, 2011; Accepted for publication August 23, 2011 E-mail: drgaia@terra.com.br Tel.: 55 11 55764055

and consistent outcomes. Nevertheless, it is known that the use of cardiopulmonary bypass has major drawbacks, such as the inflammatory reaction and the potential induction of multiple-organ dysfunction.2-5 However, there are a number of advantages of using the technique of myocardial revascularization without cardiopulmonary bypass (off-pump); myocardial ischemia is regional rather than global and the technique is performed only in the area of the coronary artery that is being grafted, which possibly reduces injury to the myocardium and contributes to better results. In this context, myocardial revascularization without the use of cardiopulmonary bypass was investigated and has demonstrated reduced complications related to cardiopulmonary bypass.4,6 Furthermore, there is doubt as to the effectiveness of the off-pump procedure, which may be relevant for only certain groups of patients, especially those at high risk.

INTRODUCTION Despite several advances in the treatment of coronary artery disease, many patients, especially those with multivessel disease and complex anatomies, benefit greatly when subjected to surgical treatment. In the presence of ventricular dysfunction, the difference between medical treatment or angioplasty compared with surgical intervention is even more impressive.1 Coronary artery bypass grafting (CABG) with cardiopulmonary bypass (CPB) and cardioplegic arrest is considered the gold standard in intervention with well-documented

2049

Off-pump revascularization in the low-ejection fraction Caputti GM et al.

CLINICS 2011;66(12):2049-2053

The presence of severe left ventricular dysfunction is an additional risk factor for CABG, but it has been demonstrated that even in this group of patients, both revascularization techniques may be safe.7-9 The aim of this study is to assess the safety and efficacy of myocardial revascularization without cardiopulmonary bypass in patients with markedly depressed ventricular function (,20%) by comparing the results with a series of patients operated upon in the conventional manner.

Table 1 - Demographic data in CPB and off-pump groups. Variable

n Number 112 Age (median) 67¡2 Sex Female 23 Reoperative 11 Tobacco Use 29 Diabetes 38 Chronic Renal Failure 10 Hemodialysis 7 Body Mass Index . 40 8 Emergency Procedure 7 Heart Failure 12 (NYHA.3) admission Heart Failure 13 (NYHA.3) previous Previous Myocardial 40 Infarction Unstable Angina 81 Hypertension 59 COPD 13 Dyslipidemia 48 Atrial Fibrillation 13 CVA 8 Peripheral Artery 14 Disease Left Ventricle Ejection 17¡2 Fraction (%)

METHODS AND PATIENTS Between January 2001 and December 2005, 217 nonrandomized, consecutive and unselected patients with an ejection fraction less than 0.20 underwent CABG as an isolated procedure; 112 who had undergone operations (the CPB group) and 105 without cardiopulmonary bypass (offpump group). The inclusion criteria were all patients with an echocardiographic ejection fraction below 20% undergoing CABG in one hospital and operated upon by the same surgical team. Operating with or without cardiopulmonary bypass was left to the surgeon’s discretion. The decision was made during the preoperative evaluation based primarily on the coronary anatomy (mainly position and diameter of the target vessel). Decreased vessel diameter and more diffuse disease were observed in the pump group. The protocol was approved by the institutional ethics committee (0369/02). The demographic data collected are shown in Table 1. Hospital mortality was defined as death during the same hospital stay. Stroke was defined as a new focal deficit or a comatose state lasting more than 24 hours. Acute myocardial infarction was defined as elevated serum CKMB.30 IU/L, the presence of new electrocardiographic changes indicative of necrosis, or new akinetic segments revealed by echocardiography. Acute renal failure was defined as a postoperative creatinine level greater than 2.0 mg/dL (with a history of prior normal renal function).

Offpump

CPB

p-value

100

20.5 9.8 25.9 33.9 8.9 6.25 7.1 6.25 10.7

105 71¡3 27 18 26 31 12 8 9 4 23

25.7 17.1 24.8 29.5 11.4 7.6 8.1 3.8 21.9

NS 0.36 0.11 0.84 0.48 0.54 0.69 0.69 0.41 0.55

11.6

15.2

0.43

35.7

0.51

72.3 52.7 11.6 42.8 11.6 7.1 12.5

75 70 14 40 12 4 16

71.4 66.7 13.3 38 11.4 3.8 15.2

0.88 0.05 0.7 0.47 0.96 0.28 0.55

16¡3

0.55

NYHA: New York Heart Association. COPD: Chronic Obstructive Pulmonary Disease. CVA: Cerebrovascular Accident. NS: Nonsignificant.

opening of the right pleural space and the use of a deep pericardial traction suture. Continuous 7-0 polypropylene monofilament sutures were placed. The visualization of target vessels was aided by intermittent instillation of saline with a syringe. Proximal anastomoses were performed using a partial occlusion clamp. Site selection was performed by ascending aorta palpation to avoid plaques. No additional methods, such as an epiaortic scan, were used. The left internal thoracic artery was used in all cases (unless it had been used before or presented with inadequate flow after dissection) for connection to the anterior descending artery. The remaining targets received saphenous vein grafts. Statistical Analysis was performed using the EPI-INFO of the World Health Organization (WHO), public domain, version 3.3.2, February 2005. The chi-square test was used for nominal variables, and the Mann-Whitney U test was used when appropriate.

Operative Technique The decision about whether to perform cardiopulmonary bypass was a personal decision made by the surgical team. Once the decision had been made, standard protocols were followed, including the administration of heparin at a dose of 4 mg/kg. Cardiopulmonary bypass was established through a cannula inserted in the ascending aorta and right atrium, with nonpulsatile blood flow of approximately 2.4 L/min/m2 associated with moderate hypothermia (28 ˚C) and a membrane oxygenator. Myocardial protection was achieved by anterograde blood perfusion at systemic temperature, with a hyperkalemic cardioplegia infusion, repeated during 3 minutes every 15 minutes to maintain an average pressure above 70 mmHg at the aortic root. Continuous 7-0 polypropylene monofilament sutures were placed. Proximal saphenous vein anastomoses were created in the aorta with a cross clamp during the cardiopulmonary bypass. In the patients who underwent revascularization without cardiopulmonary bypass, compression or suction stabilizers as well as intracoronary shunts were used at the discretion of the surgical team. Heparin was administered at a dose of 2 mg/kg. Additional maneuvers were used during cardiac exposure in order to maintain cardiac output, including the

RESULTS The mortality of patients undergoing intervention with CPB was 12.5% (14/112) versus 3.8% (4/105) in the offpump group (p = 0.008). There were no statistically significant differences in the following postoperative complications: acute myocardial infarction — three patients (2.7%) in the CPB group and four (3.8%) in the off-pump group; reoperation for graft occlusion — one patient (0.9%) in the CPB group and one patient (0.95%) in the off-pump group; and congestive heart failure — nine cases (8%) in the CPB group and six (5.7%) in the off-pump group. The other

2050

CLINICS 2011;66(12):2049-2053

Off-pump revascularization in the low-ejection fraction Caputti GM et al.

Table 2 - Postoperative variables. CPB

Grafts LIMA-LAD ICU stay (days) Length of Stay (days) IABP use Mechanical Ventilation (hours) Pneumonia Perioperative Myocardial Infarction Acute Renal Failure Hemodialysis Reoperation (graft occlusion) AF (postoperative) Bleeding (mL) Packed Red Blood Cells (units) Cardiac Failure Pulmonary Edema LVEF (postoperative) (%) Mortality Stroke Reoperation – Bleeding

p-value

Off-pump

p-value

2.6 105 3.76 11.3 5 22.3 12 3 10 4 1 13 654 3 9 9 22 14 3 3

4.5 10.7 2.7 8.9 3.6 0.9 11.6 0.8 8 8 12.5 2.7 2.7

2.15 100 2.12 7.2 0 10.2 3 4 2 1 1 10 440 2 6 6 29 4 1 1

0 2.8 3.8 1.9 0.95 0.95 9.5 0.2 5.7 5.7 3.8 0.95 0.9

0.060.62 0.004 0.001 0.028 0.02 0.022 0.95 0.023 0.19 0.96 0.62 0.022 0.01 0.90 0.9 0.02 0.008 0.34 0.205

LIMA-LAD: Left Internal Mammary Artery to Left Anterior Descending Artery. ICU – Intensive Care Unit. IABP – Intra-Aortic Balloon Pump. AF – Atrial Fibrillation. LVEF – Left-Ventricle Ejection Fraction.

variables presented significant differences, as described in Table 2, with significant reduction of mortality and morbidity in patients undergoing CABG without cardiopulmonary bypass. There was no incomplete revascularization in any group and no conversions (cross-over). The descending anterior artery territory was revascularized in all patients. The remaining territories (lateral and right) did not reveal any statistically significant differences between the CPB and offpump groups.

requirements, reoperation for bleeding, acute renal failure, hemodialysis, and stroke. This trend was also observed in the literature.4 Criticisms of the procedure without cardiopulmonary bypass addressed the incomplete revascularization, possibly reduced graft patency and long-term results. A common finding in the literature is a reduced number of grafts in the procedures performed without cardiopulmonary bypass, which raises questions about revascularization completeness. The mortality rate of our sample (12.5% CPB and 3.8% offpump) is comparable to findings in other series of patients with left ventricular dysfunction operated upon with and without cardiopulmonary bypass. However, most of those series involved an ejection fraction above the average found in our series.16-18 Most CABG studies in patients with ventricular dysfunction include patients with an ejection fraction below 35%, which promotes averages well above 20%,8,19 representing the focus of our study. There is a significant hemodynamics difference between patients with ejection fractions of 20% and 35%. Survival studies in patients with severe left ventricular dysfunction (EF 18%) after coronary artery bypass grafting in 86 patients demonstrated a mortality rate of 11%, and those who survived showed improvement of left ventricular contraction resulting from a significant decrease in left ventricle diastolic diameter and an increase in left ventricular ejection fraction, with a median survival of 59% at five years and significant improvement in NYHA functional class.20 These findings are similar to the data recorded for the CPB group of this study. A large retrospective series comparing patients with ventricular dysfunction who underwent operation with and without cardiopulmonary bypass failed to show

DISCUSSION One of the persistent challenges in coronary disease treatment is treating patients with ventricular dysfunction. It is known that the clinical treatment yields poor results with high mortality.10 CABG in these patients is challenging, with reduced ventricular function directly reflecting procedure risk and representing an independent risk factor for morbidity and mortality.11,12 Interestingly, these are the patients who benefit most from surgical treatment.13 Although operation with CPB is considered the gold standard, several strategies have been recently used in order to decrease the complications related to its use and to improve outcomes.14 The nonuse of cardiopulmonary bypass has been shown to be safe and effective, even superior to conventional operations,7,8 even in patients with left ventricular dysfunction.15 This finding would lead to more complications and postoperative mortality in patients with ventricular dysfunction who underwent the procedure with cardiopulmonary bypass. In our study, we observed that the mortality rate, intubation time, ICU and total stay were significantly greater in the group with CPB use. The significantly lower incidence of complications in the offpump group applied to postoperative bleeding, transfusion

2051

Off-pump revascularization in the low-ejection fraction Caputti GM et al.

CLINICS 2011;66(12):2049-2053

unlikely to be conducted, given the diversity of the technical limitations of off-pump CABG, especially in circumflex artery territory in patients with severe dysfunction. Another bias is the selection procedure, based on the surgeon’s selection of intraoperative clinical conditions, his or her personal experience, vessel diameter, the position and presence of diffuse disease, and whether or not the procedure was performed using CPB. A smaller number of grafts in the group without extracorporeal circulation also contributes to the imbalance between the groups (despite not being statistically different), but the fact that complete revascularization rate and risk factors are similar contributes to a more adequate comparison between groups. This sample follow-up includes only the in-hospital phase; studies of medium- and long-term effects must be conducted in order to determine the durability of this initial advantage in terms of comparative survival, such as hospital readmission, reintervention, and quality of life. Currently the long-term results are under review as part of a separate submission. Another concern is the retrospective analysis, which lacked randomization. Despite this fact, similarity between groups could reduce the selection bias. Few studies have evaluated patients with severe ventricular dysfunction. Our data show that, even in this group, the morbidity and mortality of the procedure is acceptable and favors the group operated upon without cardiopulmonary bypass. In this context, the use of cardiopulmonary bypass should be considered in assigning risk scores as well as contribute to the choice of surgical strategy in patients with ejection fractions below 20%. Coronary artery bypass surgery today is safe, efficient and low risk, but poor left-ventricular function still represents a significant risk factor.

differences between the two groups, even when paired, suggesting that the off-pump procedure is safe and possibly leads to fewer complications in spite of the lack of statistically significant findings.21 Admitting that a low ejection fraction is synonymous with a bad ventricle is controversial. There are patients with low ejection fractions who have good functional capacity for years and others with comparable ejection fractions that require high doses of medications and even a heart transplant.22 Thus, other ways of quantifying the functional cardiac reserve should be used in order to stratify these patients more effectively.23 That finding may partly explain the differences found in several studies. The finding of lower complication incidence in the group operated upon without extracorporeal circulation is consistent with the literature, even in patients with markedly reduced ejection fractions. Factors such as shorter duration of intubation and fewer pulmonary complications can be explained by the possibility of cardiopulmonary bypass inducing pulmonary dysfunction secondary to complement activation, neutrophil sequestration in pulmonary microcirculation and an increase in pulmonary capillary permeability, and interstitial pulmonary edema.24 The incidence of neurological complications in our sample was low and, although suggested to be lower in the off-pump group, did not reach statistical significance. A larger sample size might be able to more clearly document this difference. However, it is consistent with published findings (1%–5%) showing that most accidents are related to embolic events occurring during cannulation, cardiopulmonary bypass, and aortic surgical manipulation.25,26 The observation of minor renal failure in the CPB group is also compatible with literature findings demonstrating that patients undergoing CABG with CPB have a higher risk of developing acute renal failure because of decreased perfusion, the absence of pulsatile flow, excessive hemolysis, embolization of platelet aggregates, and fibrin.4 Another interesting finding is the fact that the applicability of the technique is very heterogeneous among different groups, showing that certain groups achieve unsatisfactory results with the off-pump technique.27 This demonstrates that the procedure is often highly dependent on the skill of the surgical team in performing beating-heart CABG in technically challenging scenarios, such as the presence of severe ventricular dysfunction. A recent meta-analysis demonstrated higher mortality in patients operated upon without cardiopulmonary bypass, possibly because of higher graft occlusion and a higher rate of incomplete revascularization.28 Unfortunately, these figures were heavily influenced by the Rooby Trial results, which yielded highly unsatisfactory results and demonstrated several methodological biases.27 Finally, studies comparing CABG with and without cardiopulmonary bypass often fail to demonstrate significant differences, especially because of the failure to include patients with multiple risk factors or very low ejection fractions. Recently, the ongoing CORONARY Trial has randomized patients with multiple and significant risk factors for revascularization with and without CPB in order to determine the possible benefits and disadvantages associated with both techniques. Several limitations are inherent to this study design, such as the fact that there is no randomization. Randomized studies in patients with severe ventricular dysfunction are

AUTHOR CONTRIBUTIONS Caputti GM was one of the operating surgeon, also responsible for the research conduction, data collection, and revision and writing of the manuscript. Palma JH was one of the operating surgeon, also responsible for the revision and writing of the manucript. Gaia DF was responsible for the data collection, revision and writing of the manuscript. Buffolo E was one of the operating surgeon, also responsible for the research conduction and revision of the manuscript.

REFERENCES 1. Mohr FW, Rastan AJ, Serruys PW, Kappetein AP, Holmes DR, Pomar JL, et al. Complex coronary anatomy in coronary artery bypass graft surgery: impact of complex coronary anatomy in modern bypass surgery? Lessons learned from the SYNTAX trial after two years. J Thorac Cardiovasc Surg. 2011;141:130-40, doi: 10.1016/j.jtcvs.2010.07. 094. 2. Rastan AJ, Bittner HB, Gummert JF, Walther T, Schewick CV, Girdauskas E, et al. On-pump beating heart versus off-pump coronary artery bypass surgery-evidence of pump-induced myocardial injury. Eur J Cardiothorac Surg. 2005;27:1057-64, doi: 10.1016/j.ejcts.2005.03.007. 3. Buffolo E. Coronary surgery without extracorporeal circulation. Eur J Cardiothorac Surg. 1991;5:223, doi: 10.1016/1010-7940(91)90034-H. 4. Buffolo E, Branco JN, Gerola LR, Aguiar LF, Teles CA, Palma JH, et al. Off-pump myocardial revascularization: critical analysis of 23 years’ experience in 3,866 patients. Ann Thorac Surg. 2006;81:85-9, doi: 10.1016/ j.athoracsur.2005.07.032. 5. Gaia DF, Moreira RS, Arrais M, Vinhola NCT, Buffolo E, Smith RL. Cardiac muscle apoptosis: a comparison of myocardium revascularization with and without cardiopulmonary bypass. Rev Bras Cir Cardiovasc. 2003;18:221-6, doi: 10.1590/S0102-76382003000300006. 6. Lima RdC, Escobar MASd, Filho JGL, Diniz R, Saraiva A, Ce´sio A, et al. Surgical results of coronary artery bypass grafting without cardiopulmonary bypass - analysis of 3,410 patients. Rev Bras Cir Cardiovasc. 2003;18:0102-7638, doi: 10.1590/S0102-76382003000300011.

2052

CLINICS 2011;66(12):2049-2053

Off-pump revascularization in the low-ejection fraction Caputti GM et al.

7. Youn YN, Chang BC, Hong YS, Kwak YL, Yoo KJ. Early and mid-term impacts of cardiopulmonary bypass on coronary artery bypass grafting in patients with poor left ventricular dysfunction: a propensity score analysis. Circ J. 2007;71:1387-94, doi: 10.1253/circj.71.1387. 8. Darwazah AK, Abu Shamâ&#x20AC;&#x2122;a RA, Hussein E, Hawari MH, Ismail H. Myocardial revascularization in patients with low ejection fraction , or = 35%: effect of pump technique on early morbidity and mortality. J Card Surg. 2006;21:22-7, doi: 10.1111/j.1540-8191.2006.00163.x. 9. Oliveira SF, Jatene AD, Solimene MC, de Oliveira SA, Meneguetti C, Jatene FB, et al. Coronary artery bypass graft surgery in patients with ischemic cardiomyopathy and severe left ventricular dysfunction: short and long-term results. Heart Surg Forum. 1999;2:47-53. 10. Anguita M, Arizon JM, Bueno G, Latre JM, Sancho M, Torres F, et al. Clinical and hemodynamic predictors of survival in patients aged , 65 years with severe congestive heart failure secondary to ischemic or nonischemic dilated cardiomyopathy. Am J Cardiol. 1993;72:413-7, doi: 10.1016/0002-9149(93)91132-2. 11. Christakis GT, Weisel RD, Fremes SE, Ivanov J, David TE, Goldman BS, et al. Coronary artery bypass grafting in patients with poor ventricular function. Cardiovascular Surgeons of the University of Toronto. J Thorac Cardiovasc Surg. 1992;103:1083-91; discussion 91-2 12. Bouchart F, Tabley A, Litzler PY, Haas-Hubscher C, Bessou JP, Soyer R. Myocardial revascularization in patients with severe ischemic left ventricular dysfunction. Long term follow-up in 141 patients. Eur J Cardiothorac Surg. 2001;20:1157-62, doi: 10.1016/S1010-7940(01)00982-4. 13. Alderman EL, Fisher LD, Litwin P, Kaiser GC, Myers WO, Maynard C, et al. Results of coronary artery surgery in patients with poor left ventricular function (CASS). Circulation. 1983;68:785-95, doi: 10.1161/01.CIR.68.4.785. 14. Darwazah AK, Bader V, Isleem I, Helwa K. Myocardial revascularization using on-pump beating heart among patients with left ventricular dysfunction. J Cardiothorac Surg. 2010;5:109. 15. Kerendi F, Morris CD, Puskas JD. Off-pump coronary bypass surgery for high-risk patients: only in expert centers? Curr Opin Cardiol. 2008;23:573-8, doi: 10.1097/HCO.0b013e328312c311. 16. Ascione R, Narayan P, Rogers CA, Lim KH, Capoun R, Angelini GD. Early and midterm clinical outcome in patients with severe left ventricular dysfunction undergoing coronary artery surgery. Ann Thorac Surg. 2003;76:793-9, doi: 10.1016/S0003-4975(03)00664-7. 17. Shennib H, Endo M, Benhamed O, Morin JF. Surgical revascularization in patients with poor left ventricular function: on- or off-pump? Ann Thorac Surg. 2002;74:S1344-7, doi: 10.1016/S0003-4975(02)03966-8.

18. Goldstein DJ, Beauford RB, Luk B, Karanam R, Prendergast T, Sardari F, et al. Multivessel off-pump revascularization in patients with severe left ventricular dysfunction. Eur J Cardiothorac Surg. 2003;24:72-80, doi: 10. 1016/S1010-7940(03)00174-X. 19. Hovnanian AL, Matos Soeiro A, Serrano CV, Oliveira SA, Jatene FB, Stolf NA, et al. Surgical myocardial revascularization of patients with ischemic cardiomyopathy and severe left ventricular disfunction. Clinics. 2010;65:3-8, doi: 10.1590/S1807-59322010000100002. 20. Carr JA, Haithcock BE, Paone G, Bernabei AF, Silverman NA. Long-term outcome after coronary artery bypass grafting in patients with severe left ventricular dysfunction. Ann Thorac Surg. 2002;74:1531-6, doi: 10.1016/ S0003-4975(02)03944-9. 21. Attaran S, Shaw M, Bond L, Pullan MD, Fabri BM. Does off-pump coronary artery revascularization improve the long-term survival in patients with ventricular dysfunction? Interact Cardiovasc Thorac Surg. 2010;11:442-6, doi: 10.1510/icvts.2010.237040. 22. Wechsler AS. Coronary artery bypass grafting in patients with an ejection fraction of twenty percent or less. J Thorac Cardiovasc Surg. 1996;111:998-1000, doi: 10.1016/S0022-5223(96)70376-8. 23. Pagley PR, Beller GA, Watson DD, Gimple LW, Ragosta M. Improved outcome after coronary bypass surgery in patients with ischemic cardiomyopathy and residual myocardial viability. Circulation. 1997;96:793-800. 24. Guler M, Kirali K, Toker ME, Bozbuga N, Omeroglu SN, Akinci E, et al. Different CABG methods in patients with chronic obstructive pulmonary disease. Ann Thorac Surg. 2001;71:152-7, doi: 10.1016/S00034975(00)02250-5. 25. Sedrakyan A, Wu AW, Parashar A, Bass EB, Treasure T. Off-pump surgery is associated with reduced occurrence of stroke and other morbidity as compared with traditional coronary artery bypass grafting: a meta-analysis of systematically reviewed trials. Stroke. 2006;37:2759-69, doi: 10.1161/01.STR.0000245081.52877.f2. 26. Clark RE, Brillman J, Davis DA, Lovell MR, Price TR, Magovern GJ. Microemboli during coronary artery bypass grafting. Genesis and effect on outcome. J Thorac Cardiovasc Surg. 1995;109:249-57; discussion 57-8, doi: 10.1016/S0022-5223(95)70386-1 27. Shroyer AL, Grover FL, Hattler B, Collins JF, McDonald GO, Kozora E, et al. On-pump versus off-pump coronary-artery bypass surgery. N Engl J Med. 2009;361:1827-37, doi: 10.1056/NEJMoa0902905. 28. Takagi H, Matsui M, Umemoto T. Off-pump coronary artery bypass may increase late mortality: a meta-analysis of randomized trials. Ann Thorac Surg. 2010;89:1881-8, doi: 10.1016/j.athoracsur.2010.03.010.

2053

CLINICS 2011;66(12):2055-2061

DOI:10.1590/S1807-59322011001200010

CLINICAL SCIENCE

Chronic hepatitis virus infection in patients with multiple myeloma: clinical characteristics and outcomes Chung-Jen Teng,I,II,V Han-Tsung Liu,II,V,VI Chun-Yu Liu,II,V Chi-Hsiu Hsih,II,V Jih-Tung Pai,I,II,V Jyh-Pyng Gau,II,V Jin-Hwang Liu,II,V Tzeon-Jye Chiou,II,III,V Hui-Chi Hsu,II,IV,V Po-Min Chen,II,V Cheng-Hwai Tzeng,II,V Yuan-Bin YuII,V I National Yang-Ming University Hospital, Department of Medicine, Division of Hematology and Oncology, Yilan, Taiwan, Republic of China. II Taipei Veterans General Hospital, Division of Hematology and Oncology, Taipei, Taiwan, Republic of China. III Taipei Veterans General Hospital, Taipei, Division of Transfusion Medicine, Taiwan, Republic of China. IV Taipei Veterans General Hospital, Division of General Medicine, Department of Medicine, Taipei, Taiwan, Republic of China. V School of Medicine, National Yang-Ming University, Department of Medicine, Taipei, Taiwan, Republic of China. VI Taipei City Hospital, Zhongxiao Branch, Department of Medicine, Taipei, Taiwan.

OBJECTIVES: Cytotoxic agents and steroids are used to treat lymphoid malignancies, but these compounds may exacerbate chronic viral hepatitis. For patients with multiple myeloma, the impact of preexisting hepatitis virus infection is unclear. The aim of this study is to explore the characteristics and outcomes of myeloma patients with chronic hepatitis virus infection. METHODS: From 2003 to 2008, 155 myeloma patients were examined to determine their chronic hepatitis virus infection statuses using serologic tests for the hepatitis B (HBV) and C viruses (HCV). Clinical parameters and outcome variables were retrieved via a medical chart review. RESULTS: The estimated prevalences of chronic HBV and HCV infections were 11.0% (n = 17) and 9.0% (n = 14), respectively. The characteristics of patients who were hepatitis virus carriers and those who were not were similar. However, carrier patients had a higher prevalence of conventional cytogenetic abnormalities (64.3% vs. 25.0%). The cumulative incidences of grade 3-4 elevation of the level of alanine transaminase, 30.0% vs. 12.0%, and hyperbilirubinemia, 20.0% vs. 1.6%, were higher in carriers as well. In a Kaplan-Meier analysis, carrier patients had worse overall survival (median: 16.0 vs. 42.4 months). The prognostic value of carrier status was not statistically significant in the multivariate analysis, but an age of more than 65 years old, the presence of cytogenetic abnormalities, a beta-2-microglobulin level of more than 3.5 mg/L, and a serum creatinine level of more than 2 mg/ dL were independent factors associated with poor prognosis. CONCLUSION: Myeloma patients with chronic hepatitis virus infections might be a distinct subgroup, and close monitoring of hepatic adverse events should be mandatory. KEYWORDS: Hepatitis B virus; Hepatitis C virus; Multiple myeloma; Cytogenetic abnormalities; Adverse events. Teng CJ, Liu HT, Liu CY, Hsih CH, Pai JT, Gau JP, et al. Chronic hepatitis virus infection in patients with multiple myeloma: clinical characteristics and outcomes. Clinics. 2011;66(12):2055-2061. Received for publication on May 10, 2011; First review completed on July 13, 2011; Accepted for publication on August 29, 2011 E-mail: ybyu@vghtpe.gov.tw Tel.: (886) 2-28712121 ext. 3247

have become the backbone of treatment for multiple myeloma. Over the past decade, there has been a dramatic increase in therapeutic options for treating multiple myeloma. These novel agents enhance efficacy and improve survival.2 Nevertheless, steroids remain a major component in these novel regimens. However, cytotoxic agents and immunosuppressive therapy, such as the use of steroids, may lead to uncontrolled replication of hepatitis viruses, followed by an exaggerated immunological response to virus-infected hepatocytes, which can trigger the reactivation or acute exacerbation of chronic hepatitis virus infection.3 In fact, early studies have shown that even the use of steroids alone can have a deleterious effect on patients with chronic hepatitis virus infections.4

INTRODUCTION Multiple myeloma is a B-cell malignancy characterized by the proliferation of clonal plasma cells in the bone marrow. Clinically, it often presents with hypercalcemia, renal dysfunction, anemia, and bone disability.1 Since the introduction of combination chemotherapy consisting of melphalan and prednisolone (MP) in the 1960s, steroids

Copyright Ă&#x; 2011 CLINICS â&#x20AC;&#x201C; This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported.

2055

Chronic viral hepatitis in myeloma patients Teng C-J et al.

CLINICS 2011;66(12):2055-2061

cytogenetic abnormality if either one of the following was observed: 1) a minimum of two mitotic cells with a gain of the same chromosome or with the same structural abnormality, or 2) three mitotic cells with the loss of the same chromosome. If diagnostic aspiration yielded fewer than 20 metaphase cells, then a repeat aspiration was usually indicated to fulfill the requirement.

Lymphoma patients experience a greater frequency of hepatitis B virus (HBV) reactivation during treatment with steroids and cytotoxic agents; such reactivation can be a fatal complication.5 Takai et al. reported that, in 601 patients with hematological malignancies, the incidence of postchemotherapy liver injury among patients with chronic HBV infection, i.e., HBV carriers, was significantly higher than that among non-carriers, suggesting that chronic hepatitis virus infection might interfere with chemotherapy and affect the outcomes of these patients.6 Another study that investigated chronic HBV infections in diffuse large Bcell lymphoma patients showed that the overall survival of carrier patients with hepatic dysfunction was significantly shorter than that of patients without liver dysfunction.7 In contrast, significant hepatic dysfunction and reactivation of the hepatitis C virus (HCV) are less common among HCVinfected patients treated with chemotherapy for hematological malignancies.3,8 Even so, HCV seropositivity has been reported to be a significant risk factor for non-relapse mortality after allogeneic hematopoietic stem cell transplantation (SCT).9 Despite the abundant research investigating the impact of hepatitis in lymphoid malignancies, previous studies have included only a small number of patients with multiple myeloma, and reports on the impact of chronic hepatitis virus infection in patients with multiple myeloma are lacking. Taiwan is an endemic area for HBV and HCV, with prevalences of 17.3% and 4.4%, respectively.10 We have previously reported a higher chronic HBV infection rate (23.5%) in patients with non-Hodgkinâ&#x20AC;&#x2122;s lymphoma, whereas the prevalence of chronic HCV infection was similar to that in the general population (4.8%).11 The aims of the current study were to assess the prevalence of chronic hepatitis virus infections and to investigate their characteristics and prognostic significance in a consecutive series of myeloma patients.

Treatment The general treatment strategy in this study adhered to the suggestions for multiple myeloma in international treatment guidelines.13 Briefly, for patients who were transplant eligible, induction chemotherapy consisting of vincristine, doxorubicin, and dexamethasone (VAD) and thalidomide-based regimens were the most commonly used front-line therapies. Hematopoietic stem cells were collected after four to six cycles of induction therapy, and then autologous transplantations proceeded with melphalanbased conditioning regimens. For those patients who were transplant ineligible, chemotherapy consisting of MP with or without thalidomide was the preferred regimen. Thalidomide was also used in relapsed or refractory settings, either alone or in combination with chemotherapy. Taiwan National Health Insurance has reimbursed the cost of bortezomib use in relapsed or refractory myeloma patients since 2007. Bortezomib was found to be commonly given as a single agent or in combination with dexamethasone. Lenalidomide was not available in Taiwan throughout our study period. Radiotherapy and adjunctive treatments, such as bisphosphonate, were given as clinically indicated.

Serology tests for chronic hepatitis virus infection and the definition of carriers HBsAg and antibodies to the hepatitis C virus (anti-HCV) were detected serologically using microparticle enzyme immunoassays (IMx-Abbott Laboratories, Abbott Park, IL, USA, and MEIA, Abbott IMx HCV version 3.0, USA).11 Carrier patients were defined as individuals who had positive serology tests for HBsAg or anti-HCV. The existence of antibodies to surface (anti-HBs) or core (antiHBc) antigens of HBV and the viral loads of HBV and HCV were not routinely checked in all patients. Such checks were performed at the discretion of the treating physicians. The grading of adverse events related to the hepatobiliary system was based on the Common Terminology Criteria for Adverse Events (CTCAE), version 3.0. Laboratory data on alanine transaminase (ALT), aspartate transaminase (AST), and total bilirubin levels were obtained at diagnosis and throughout the treatment course.

MATERIALS AND METHODS Patients From January 2003 to December 2008, 222 consecutive patients with multiple myeloma were diagnosed at Taipei Veterans General Hospital, a tertiary medical center in Taiwan. After excluding cases without serologic test results for hepatitis viruses, 155 patients (69.8%) were enrolled for analysis. The diagnosis of multiple myeloma was based on the criteria proposed by the International Myeloma Working Group,12 and all patients were staged at diagnosis according to the International Staging System. Patients diagnosed with monoclonal gammopathy of undetermined significance or POEMS (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes) syndrome were excluded from this study. Variables regarding clinical characteristics, laboratory data, and pathology reports were retrieved from the hospitalization database via a medical chart review. This study was approved by the Institutional Review Board of Taipei Veterans General Hospital.

Statistical analysis The correlations between variables and hepatitis virus carriage were assessed using Fisherâ&#x20AC;&#x2122;s exact test, a x2 test, or the Mann-Whitney U test, as appropriate. The date of the first adverse hepatic event after the diagnosis of multiple myeloma in each patient was recorded. The numbers of hepatic adverse events of each grade between the two groups were compared using Fisherâ&#x20AC;&#x2122;s exact test or a x2 test, as appropriate. Cumulative incidence curves of the first hepatic adverse events were plotted, and the time to the first event was compared based on the carrier status. The survival end-point was overall survival (OS) and was measured from the date of diagnosis to the date of death

Cytogenetic analysis A conventional cytogenetic analysis was performed using bone marrow samples collected at diagnosis using the Giemsa-banding staining technique. At least 20 metaphase cells were examined. A patient was considered to have

2056

CLINICS 2011;66(12):2055-2061

Chronic viral hepatitis in myeloma patients Teng C-J et al.

M-protein, presence of plasmacytoma, number of bone lesions, ISS stage, and laboratory parameters, were similar for patients regardless of carrier status. Approximately one-fourth of the patients was heavily treated, but the number of received therapies, the use of thalidomide and bortezomib, and the number of patients receiving stem cell transplantation did not differ between the two groups. Of the 94 patients with cytogenetic data available, cytogenetic abnormalities, all of which were complex karyotypes, were reported in 30.9% (29/94) of patients (Table 2). Abnormal karyotypes were noted in 9 of 14 carrier patients, and the incidence of abnormal karyotypes was significantly higher among carriers than among non-carriers (64.3% vs. 25.0%, p = 0.003). Hypodiploidy, chromosome 13 deletion, and chromosome 11q abnormalities, which have been previously reported as high-risk cytogenetic alterations,14-16 were found in 15 (16.0%), 14 (14.9%), and 5 (5.3%) patients, respectively. Carrier patients harbored a substantial number of these adverse cytogenetic abnormalities as well (21.4%, 21.4%, and 7.1%, respectively). A higher rate of post-chemotherapy liver injury has been reported in patients with hematological malignancies and HBV infections.6 To investigate the incidence of hepatic adverse events in carrier patients with multiple myeloma, alterations in the total bilirubin levels were recorded throughout the treatment course. Among the 17 patients who were HBV carriers, antiviral prophylaxis, either with lamivudine (n = 11) or entecavir (n = 1), was prescribed for 12 (70.6%). No prophylaxis was administered to HCV carriers. Table 3 shows the incidence of hepatic adverse events during the entire treatment course. The carrier group had a significantly higher incidence of grade 3-4 ALT elevation (30.0% vs. 12.0%, p = 0.014). Grade 3-4 events for AST elevation were also more common in the carrier group (20.0% vs. 8.8%, p = 0.078). Hyperbilirubinemia with all grades of adverse events or with grade 3-4 adverse events was more frequently encountered in the carrier group (rates of grade 3-4 events, 20.0% vs. 1.6%, p,0.001). Curves for the three-year cumulative incidence of hepatic adverse events were plotted. The grade 3-4 ALT elevations were observed in 39.6% of carriers and 16.6% of non-carriers (p = 0.006, Figure 1A). The incidence of hyperbilirubinemia also differed significantly between the carrier and non-carrier groups (15.3% vs. 4.1%, p,0.001, Figure 1B). The incidence of hyperbilirubinemia continued to increase in the carrier group beyond three years, in contrast to the plateau observed in the non-carrier group. One patient died of acute hepatitis attributable to HBV reactivation. Despite lamivudine prophylaxis, the patient developed severe jaundice, became seropositive for the hepatitis B envelope antigen, and showed a marked increase in the level of HBV DNA of up to 9.66108 copies/mL in the eleventh month after treatment. Otherwise, no HCV reactivation was observed in this cohort during the study period. The estimated probability of OS among carrier patients was less than that among non-carrier patients (median OS 16.0 vs. 42.4 months, hazard ratio [HR] 1.8, 95% CI, 1.07-3.0, p = 0.026). Regarding myeloma-related deaths, the median disease-specific survivals for carrier and non-carrier patients were 16.0 and 45.5 months, respectively. Eight patients died of causes not related to myeloma (two in the carrier group and six in the non-carrier group). Five of these deaths were attributed to cardiovascular complications, and one patient died of HBV reactivation with liver failure, as

or the last follow-up. Survival was estimated using the Kaplan-Meier method, and the log-rank test was used to compare the survival curves between each variable. The Cox proportional hazards model was used in univariate and multivariate analyses to determine the influence of variables on OS. Variables with p,0.10 in the univariate analysis were included in the multivariate analysis. A p-value,0.05 in a two-tailed test was considered statistically significant. SPSS (version 17.0, SPSS, Chicago, IL, USA) was used for all statistical analyses.

RESULTS Among 155 patients with multiple myeloma, 30 were chronic hepatitis carriers, and the estimated prevalence was 19.4% (95% confidence interval [CI], 13.0–25.7%). Among these carriers, 17 were HBsAg positive (11.0%, 95% CI, 5.9– 16.0%), 14 were anti-HCV positive (9.0%, 95% CI, 4.4– 13.6%), and one patient was co-infected with HBV and HCV. The median age of all 155 patients was 69.0 years old (range, 29–91 years), including 91 patients (58.7%) 65 years old or older. The median follow-up was 19.3 months (range, 0.2–83.9 months). According to the ISS definition, 54.2% (84/155) of the patients were classified as stage 3. Table 1 shows that the baseline characteristics, including age, sex, Table 1 - Characteristics of 155 patients with multiple myeloma according to their viral hepatitis carrier status. No. of patients (%) Non-carriers (n = 125) Age $65 years Male sex Serum M-protein IgG IgA Light chain disease Others{ Presence of plasmacytoma Bone lesion(s) None 1 $2 ISS stage 1 2 3 Baseline laboratory parameters b2m $3.5 mg/L Albumin ,3.5 g/L Hemoglobin ,10 g/dL Platelets ,1006109/L Serum calcium $12.0 mg/dL Serum creatinine $2.0 mg/dL Serum ALT .upper normal limit Number of therapies 0-1 2 $3 Use of thalidomide Use of bortezomib Stem cell transplantation

p-value*

Carriers (n = 30)

74 90

(59.2) (72.0)

17 23

(56.7) (76.7)

64 38 19 4 15

(51.2) (30.4) (15.2) (3.2) (12.0)

12 13 3 2 5

(40.0) (43.3) (10.0) (6.7) (16.7)

40 16 69

(32.0) (12.8) (55.2)

7 4 19

(23.3) (13.3) (63.3)

35 23 67

(28.0) (18.4) (53.6)

9 4 17

(30.0) (13.3) (56.7)

94 56 75 23 11 36 16

(75.2) (44.8) (60.0) (18.4) (8.8) (28.8) (12.9)

22 13 18 6 5 13 4

(73.3) (43.3) (60.0) (20.0) (16.7) (43.3) (13.3)

56 33 36 69 19 30

(44.8) (26.4) (28.8) (55.2) (15.2) (24.0)

17 5 8 11 5 5

(56.7) (16.7) (26.7) (36.7) (16.7) (16.7)

0.800 0.606 0.382

0.494 0.642

0.805

0.832 0.885 1.00 0.840 0.203 0.124 0.950 0.428

0.068 0.842 0.388

Fisher’s exact test or x2 test as appropriate. Including IgM, IgD, IgE, and non-secretory myeloma. ALT, alanine transaminase; b2m, beta-2-microglobulin; ISS, International Staging System. {

2057

Chronic viral hepatitis in myeloma patients Teng C-J et al.

CLINICS 2011;66(12):2055-2061

Table 2 - Cytogenetic abnormalities detected by conventional cytogenetic analysis in 94 myeloma patients. No. of patients (%)

Cytogenetic changes All patients (n = 94) Normal Abnormal Hypodiploidy Del(13) 11q abnormalities *

65 29 15 14 5

p-value*

Non-carrier patients (n = 80)

(69.1) (30.9) (16.0) (14.9) (5.3)

60 20 12 11 4

Carrier patients (n = 14)

(75.0) (25.0) (15.0) (13.8) (5.0)

5 (35.7) 9 (64.3) 3 (21.4) 3 (21.4) 1 (7.1)

0.003

By x2 test.

summary of these studies. Most studies regarding the prevalence of HCV infection have been conducted in HCVendemic areas, such as Southern Europe and East Asia, and these studies have suggested that HCV infection has a pathogenic role in lymphoproliferative disorders, including multiple myeloma.6,17-21 However, some reports have revealed similar incidences of HCV infection in myeloma patients and in controls.22-27 In addition, the results from several population-based studies that evaluated the incidence of myeloma among HCV carriers have produced contradictory results.28-31 Few studies have explored the association between HBV and multiple myeloma. Using a similar serologic method adopted by previous studies for detection, our study provided results from an endemic area and revealed a higher incidence of HCV infection in individuals with multiple myeloma. Nevertheless, larger epidemiologic studies and further experiments elucidating the molecular mechanisms connecting hepatitis viruses and the pathogenesis of myeloma are warranted. A unique feature of the carrier patients in our study was their greater incidence of cytogenetic abnormalities, which was a strong prognostic factor for a worse OS. As early as the 1970s, chromosome abnormalities were observed in the lymphocytes of patients with chronic hepatitis.32 Subsequent studies showed that oxidative DNA damage occurs in circulating leukocytes as an early event in chronic HCV infection.33 Furthermore, Cardin et al. demonstrated that the level of 8-hydroxydeoxyguanosine, an indicator of oxidative DNA damage, in circulating leukocytes correlated well with the severity of HCV-related liver disease in a population-based study.34 Another study also illustrated that the levels of DNA damage in lymphocytes correlated

described above. Other factors influenced OS in the univariate analysis. These factors included age, ISS stage, the presence of cytogenetic abnormalities, the platelet count, and the levels of b-2-microglobulin (b2m), albumin, serum calcium, and serum creatinine (Table 4). In the multivariate analysis, chronic hepatitis virus infection was not an independent factor related to OS. However, being more than 65 years old (HR 2.858, 95% CI, 1.412-5.785, p = 0.004), the presence of cytogenetic abnormalities (HR 3.036, 95% CI, 1.584-5.817, p = 0.001), and a serum creatinine level greater than 2 mg/dL (HR 3.050, 95% CI 1.541-6.035, p = 0.001) remained statistically significant prognostic factors.

DISCUSSION The results of the current study reveal that the impact of chronic HBV and HCV infections is not only clinically significant for patients with lymphoma, a population known to be vulnerable to viral hepatitis, but also for patients with multiple myeloma. Here, we showed that the prevalences of chronic HBV and HCV infections in myeloma patients were 11.0% and 9.0%, respectively. Carrier status was associated with the presence of cytogenetic abnormalities, and carriers experienced more hepatic adverse events during the entire treatment course. Moreover, patients who were hepatitis virus carriers had a worse OS. To the best of our knowledge, this is the first study to investigate the clinical significance of chronic hepatitis virus infection in patients with multiple myeloma. Many studies have investigated the prevalence of hepatitis virus infections in patients with hematological malignancies. However, only a few studies have included significant numbers of multiple myeloma patients. Table 5 provides a

Table 3 - Incidence of hepatic adverse events among 155 patients with multiple myeloma. Non-carriers, no. (%) (n = 125)

ALT elevation All grades Grade 3-4 AST elevation All grades Grade 3-4 Hyperbilirubinemia All grades Grade 3-4

No. of carrier patients (%) {

p-value* {

All (n = 30)

HBV carriers (n = 17)

82 (65.6%) 15 (12.0%)

17 (56.7%) 9 (30.0%)

9 (52.9%) 5 (29.4%)

9 (64.3%) 4 (28.6%)

0.360 0.014

64 (51.2%) 11 (8.8%)

17 (56.7%) 6 (20.0%)

10 (58.8%) 4 (23.5%)

8 (57.1%) 2 (14.3%)

0.590 0.078

29 (23.2%) 2 (1.6%)

13 (43.3%) 6 (20.0%)

7 (41.2%) 4 (23.5%)

6 (42.9%) 2 (14.3%)

0.026 ,0.001

Fisherâ&#x20AC;&#x2122;s exact test or x2 test as appropriate; carrier patients compared with patients who were not carriers. One patient was a carrier of both HBV and HCV. ALT, alanine transaminase; AST, aspartate transaminase. {

2058

HCV carriers (n = 14)

CLINICS 2011;66(12):2055-2061

Chronic viral hepatitis in myeloma patients Teng C-J et al.

Figure 1 - Cumulative incidences of (a) grade 3 alanine transaminase elevation and (b) grade 3 hyperbilirubinemia.

In addition to cytogenetic changes, we also found that myeloma patients who were chronic viral hepatitis carriers experienced more and earlier hepatic adverse events during treatment. This result is consistent with the finding of Takai et al. that the incidence of post-chemotherapy liver injury is higher in HBV carriers among patients with hematological malignancies.6 Moreover, the increase in hepatic adverse events during treatment could not be explained by the difference in the therapies received (as shown in Table 1). Taken together, the features of this patient subgroup

independently with the severity of both chronic hepatitis B and chronic hepatitis C.35 Recently, the genotoxic effects of HBV and HCV were demonstrated in peripheral blood lymphocytes via the occurrence of DNA fragmentation.36 According to the findings above, chronic viral hepatitis might contribute to the susceptibility of plasma cells, to the terminal differentiation of lymphocytes, to genomic instability and to subsequent cytogenetic abnormalities. However, the associations and the molecular mechanisms underlying these results require further exploration and confirmation.

Table 4 - Univariate and multivariate analyses for overall survival in patients with multiple myeloma. Univariate HR Viral hepatitis (carriers vs. non-carriers) Age ($65 vs. ,65) Sex (male vs. female) Plasmacytoma (presence vs. absence) ISS stage 2 vs. 1 3 vs. 1 Cytogenetics (abnormal vs. normal) Bone lesions ($2 vs. 0-1) b2m ($3.5 vs. ,3.5 mg/L) Albumin (,3.5 vs. $3.5 g/dL) Hemoglobin (,10 vs. $10 g/dL) Platelet count (, 1006109 vs. $1006109/L) Serum calcium ($12 vs. ,12 mg/dL) Serum creatinine ($2.0 vs. ,2.0 mg/dL) Serum ALT (abnormal vs. normal)

95% CI

Multivariate* p-value

95% CI

p-value

1.801 2.735 0.908 0.979

1.072 1.727 0.593 0.566

3.023 4.333 1.393 1.694

0.026 ,0.001 0.659 0.941

2.858 -

1.412 – 5.785 -

0.004 -

3.101 4.631 2.123 1.252 5.756 1.727 2.137 1.529 2.986 2.519 1.256

1.509 – 2.618 2.506 – 8.556 1.202 – 3.749 0.800 – 1.958 2.665 – 12.430 1.172 – 2.546 1.404 – 3.254 0.963 – 2.427 1.748 – 5.101 1.709 – 3.713 0.674 – 2.341

0.002 ,0.001 0.009 0.325 ,0.001 0.006 ,0.001 0.072 ,0.001 ,0.001 0.473

3.036 3.767 3.050 -

1.584 – 5.817 0.860 – 16.504 1.541 – 6.035 -

0.001 0.079 0.001 -

– – – –

* Variables significant at p,0.1 in the univariate model were entered in the Cox regression multivariate model using conditional backward analysis. HR, hazard ratio; CI, confidence interval; ALT, alanine transaminase; b2m, beta-2-microglobulin; ISS, International Staging System.

2059

Chronic viral hepatitis in myeloma patients Teng C-J et al.

CLINICS 2011;66(12):2055-2061

Table 5 - Summary of studies (with $50 enrolled patients) exploring the prevalence of chronic hepatitis virus infection in multiple myeloma patients. Author Year 1995 Cavanna20 1996 Silvestri17 1996 Musto21 1997 De Rosa18 2004 Bianco22 2004 De Sanjose23 2005 Takai6 2006 Takeshita19 2007 Veneri24 2008 Anderson25 2008 Okan26 2011 Franceschi27 Current study

No. of MM Country patients

No. (%) of HBV carriers

% of HBV among controls

No. (%) of HCV carriers

% of HCV among controls

Major findings

Italy

15 (16.7)

1.7

Higher prevalence of HCV infection in patients with LPDs

Italy

3 (3.8)

3.2

Italy

10 (11.1)

5.4

Italy

9 (16.1)

1.9

Italy

107

5 (4.7)

5.6

Spain

2 (2.7)

3.8

Japan

124

4 (3.2)

1.2

8 (6.5)

2.6

Japan

4 (4.9)

2.5

Prevalence and relative risk of being infected by HCV is higher in B-NHL but not MM patients Higher prevalence of HCV infection in patients with non-cryoglobulinemic B-LPD including MM Higher prevalence of HCV infection in patients with B-LPD including MM HCV infection may be associated with some lymphoid and myeloid malignancies but not MM and HD Excess risk associated with HCV in some lymphoma subtypes (not including MM), but not statistically significant Liver injury in HBV carriers was more severe than that in HCV carriers and non-carriers in the whole study population (acute leukemia, NHL, and MM) Higher prevalence of HCV infection in B-NHL including MM

Italy

139

1 (0.7)

5.4

No increase of HCV prevalence in patients with MM

U.S.

9,995

31 (0.3)

0.2

20 (0.2)

0.2

HCV is associated with elevated risk of NHL and AML but not MM*

Japan

2 (3.0)

4.9

1 (1.5)

1.1

European Union Taiwan

238

6 (2.5)

0.6

1 (0.4)

0.6

No significant difference in the combined prevalence of HBV and HCV infections in patients with LPD HBV is associated with the risk of MM, HD, and NHL

155

17 (11.0)

17.3

14 (8.4)

4.4

Hepatitis virus carriage was associated with the presence of cytogenetic abnormalities, more hepatic adverse events and worse survival

AML, acute myeloid leukemia; HBV, hepatitis B virus; HCV, hepatitis C virus; HD, Hodgkinâ&#x20AC;&#x2122;s disease; LPD, lymphoproliferative disorders; MM, multiple myeloma; NHL, non-Hodgkinâ&#x20AC;&#x2122;s lymphoma. * Diagnosis of HBV and HCV infection was based on the International Classification of Diseases codes for Medicare.

the context of secondary prophylaxis. This fact might be attributed to the limited reimbursement for prophylactic agents in previous years. Therefore, the impact of anti-viral prophylaxis on the development of hepatic adverse events might not have been observed. Future studies highlighting the role of anti-viral prophylaxis in myeloma patients with HBV infections are warranted. In conclusion, our study determined the prevalence of HBV and HCV infection in myeloma patients in an endemic area and proposed that these patients might comprise a distinct subgroup with more hepatic adverse events and worse survival rates. Serologic tests at diagnosis are necessary to identify these patients, and regular monitoring for liver dysfunction should be mandatory. Anti-viral prophylaxis should play a role in the treatment of HBV-infected patients, although the efficacy of such prophylaxis requires validation in subsequent studies. In addition, the association between cytogenetic abnormalities in multiple myeloma patients and hepatitis virus infection warrants further study to clarify the mechanism behind the relationship.

suggest that patients with chronic viral hepatitis are possibly a distinct subgroup of multiple myeloma patients. Determination of carrier status, especially in an endemic area, and close follow-up of liver dysfunction should be mandatory for these patients. Due to the retrospective nature of this study, molecularbased cytogenetic technique data, such as those from fluorescence in situ hybridization (FISH), were not available. However, conventional cytogenetic abnormalities retain their prognostic value in some circumstances. As reported, multiple myeloma cells are difficult to karyotype because of their low proliferative rates. Therefore, an abnormal karyotype is indicative of higher proliferation and a poor prognosis.37 Many studies have suggested the prognostic value of hypodiploidy or chromosome 13 deletion detected by conventional cytogenetic analysis in myeloma patients.14-16 In our study, the presence of complex karyotypes and a significant portion of patients with the two above-mentioned abnormalities might explain the adverse outcomes for patients with abnormal cytogenetic changes. Further studies incorporating FISH analysis are necessary to confirm the association between hepatitis carriage and cytogenetic abnormalities. To prevent HBV reactivation during chemotherapy, lamivudine is recommended as prophylaxis in lymphoma patients positive for HBsAg and in patients with past HBV infections.38-39 This strategy should perhaps also be applied to myeloma patients, although the basis for this recommendation is less clear. In this study, most of the anti-viral prophylaxis for HBV-infected patients (11/12) was given in

ACKNOWLEDGMENTS This study was supported by grants from Taipei Veterans General Hospital (V97B1-011 and V99A-153) and the Taiwan Clinical Oncology Research Foundation.

AUTHOR CONTRIBUTIONS Teng CJ, Yu YB initiated and designed the study, collected and analyzed the data, and wrote the manuscript. Liu HT, Liu CY, Hsih CH, Pai JT

2060

CLINICS 2011;66(12):2055-2061

Chronic viral hepatitis in myeloma patients Teng C-J et al. 21. Musto P, Dell’Olio M, Carotenuto M, Mangia A, Andriulli A. Hepatitis C virus infection: a new bridge between hematologists and gastroenterologists? Blood. 1996;88:752-4. 22. Bianco E, Marcucci F, Mele A, Musto P, Cotichini R, Sanpaolo MG, Iannitto E, et al. Prevalence of hepatitis C virus infection in lymphoproliferative diseases other than B-cell non-Hodgkin’s lymphoma, and in myeloproliferative diseases: an Italian Multi-Center case-control study. Haematologica. 2004;89:70-6. 23. de Sanjose S, Nieters A, Goedert JJ, Domingo-Domenech E, Fernandez de Sevilla A, Bosch R, et al. Role of hepatitis C virus infection in malignant lymphoma in Spain. Int J Cancer. 2004;111:81-5, doi: 10.1002/ ijc.11727. 24. Veneri D, Franchini M, Zanotti R, Frattini F, Randon F, Rinaldi M, et al. Prevalence of hepatitis C virus infection among patients with lymphoproliferative disorders: a single center survey. Am J Hematol. 2007;82:1031, doi: 10.1002/ajh.20965. 25. Anderson LA, Pfeiffer R, Warren JL, Landgren O, Gadalla S, Berndt SI, et al. Hematopoietic malignancies associated with viral and alcoholic hepatitis. Cancer Epidemiol Biomarkers Prev. 2008;17:3069-75, doi: 10. 1158/1055-9965.EPI-08-0408. 26. Okan V, Yilmaz M, Bayram A, Kis C, Cifci S, Buyukhatipoglu H, et al. Prevalence of hepatitis B and C viruses in patients with lymphoproliferative disorders. Int J Hematol. 2008;88:403-8, doi: 10.1007/s12185-0080175-3. 27. Franceschi S, Lise M, Tre´po C, Berthillon P, Chuang SC, Nieters A, et al. Infection with hepatitis B and C viruses and risk of lymphoid malignancies in the European Prospective Investigation into Cancer and Nutrition (EPIC). Cancer Epidemiol Biomarkers Prev. 2011;20:20814, doi: 10.1158/1055-9965.EPI-10-0889. 28. Dal Maso L, Franceschi S. Hepatitis C virus and risk of lymphoma and other lymphoid neoplasms: a meta-analysis of epidemiologic studies. Cancer Epidemiol Biomarkers Prev. 2006;15:2078-85, doi: 10.1158/10559965.EPI-06-0308. 29. Duberg AS, Nordstro¨m M, To¨rner A, Reichard O, Strauss R, Janzon R, et al. Non-Hodgkin’s lymphoma and other nonhepatic malignancies in Swedish patients with hepatitis C virus infection. Hepatology. 2005;41:652-9, doi: 10.1002/hep.20608. 30. Rabkin CS, Tess BH, Christianson RE, Wright WE, Waters DJ, Alter HJ, et al. Prospective study of hepatitis C viral infection as a risk factor for subsequent B-cell neoplasia. Blood. 2002;99:4240-2, doi: 10.1182/blood2002-01-0226. 31. ano TP, Henderson L, Landgren O, Chiao EY, Kramer JR, El-Serag H, et al. Risk of non-Hodgkin lymphoma and lymphoproliferative precursor diseases in US veterans with hepatitis C virus. JAMA. 2007;297:2010-7, doi: 10.1001/jama.297.18.2010. 32. Stefanescu DT, Moanga M, Teodorescu M, Brucher J. Chromosome abnormalities in chronic active hepatitis. J Clin Pathol. 1972;25:705-7, doi: 10.1136/jcp.25.8.705. 33. Farinati F, Cardin R, Degan P, De Maria N, Floyd RA, Van Thiel DH, et al. Oxidative DNA damage in circulating leukocytes occurs as an early event in chronic HCV infection. Free Radic Biol Med. 1999;27:1284-91, doi: 10.1016/S0891-5849(99)00161-6. 34. Cardin R, Saccoccio G, Masutti F, Bellentani S, Farinati F, Tiribelli C. DNA oxidative damage in leukocytes correlates with the severity of HCV-related liver disease: validation in an open population study. J Hepatol. 2001;34:587-92, doi: 10.1016/S0168-8278(00)00098-2. 35. Bolukbas C, Bolukbas FF, Kocyigit A, Aslan M, Selek S, Bitiren M, et al. Relationship between levels of DNA damage in lymphocytes and histopathological severity of chronic hepatitis C and various clinical forms of hepatitis B. J Gastroenterol Hepatol. 2006;21:610-6, doi: 10. 1111/j.1440-1746.2005.04069.x. 36. Grossi S, Sumberaz A, Gosmar M, Mattioli F, Testino G, Martelli A. DNA damage in peripheral blood lymphocytes of patients with cirrhosis related to alcohol abuse or to hepatitis B and C viruses. Eur J Gastroenterol Hepatol. 2008;20:22-5, doi: 10.1097/MEG.0b013e3282f163fe. 37. Rajkumar SV, Fonseca R, Dewald GW, Therneau TM, Lacy MQ, Kyle RA, et al. Cytogenetic abnormalities correlate with the plasma cell labeling index and extent of bone marrow involvement in myeloma. Cancer Genet Cytogenet. 1999;113:73-7, doi: 10.1016/S0165-4608(99)00009-6. 38. Hsu C, Hsiung CA, Su IJ, Hwang WS, Wang MC, Lin SF, et al. A revisit of prophylactic lamivudine for chemotherapy-associated hepatitis B reactivation in non-Hodgkin’s lymphoma: a randomized trial. Hepatology. 2008;47:844-53, doi: 10.1002/hep.22106. 39. Koo YX, Tan DS, Tan IB, Tao M, Chow WC, Lim ST. Hepatitis B virus reactivation and role of antiviral prophylaxis in lymphoma patients with past hepatitis B virus infection who are receiving chemoimmunotherapy. Cancer. 2010;116:115-21.

contributed to the study design, data collection, and data interpretation. Gau JP, Liu JH, Chiou TJ, Hsu HC, Chen PM, Tzeng CH were responsible for the treatment of patients, data interpretation, and revision of the manuscript. All authors approved the final draft.

REFERENCES 1. Katzel JA, Hari P, Vesole DH. Multiple myeloma: charging toward a bright future. CA Cancer J Clin. 2007;57:301-18, doi: 10.3322/CA.57.5.301. 2. Mark T, Niesvizky R, Coleman M. Novel agents in myeloma: an exciting saga. Cancer. 2009;115:236-42, doi: 10.1002/cncr.24040. 3. Vento S, Cainelli F, Longhi MS. Reactivation of replication of hepatitis B and C viruses after immunosuppressive therapy: an unresolved issue. Lancet Oncol. 2002;3:333-40, doi: 10.1016/S1470-2045(02)00773-8. 4. Lam KC, Lai CL, Trepo C, Wu PC. Deleterious effect of prednisolone in HBsAg-positive chronic active hepatitis. N Engl J Med. 1981;304:380-6, doi: 10.1056/NEJM198102123040702. 5. Cheng AL, Hsiung CA, Su IJ, et al. Steroid-free chemotherapy decreases risk of hepatitis B virus (HBV) reactivation in HBV-carriers with lymphoma. Hepatology. 2003;37:1320-8, doi: 10.1053/jhep.2003.50220. 6. Takai S, Tsurumi H, Ando K, et al. Prevalence of hepatitis B and C virus infection in haematological malignancies and liver injury following chemotherapy. Eur J Haematol. 2005;74:158-65, doi: 10.1111/j.1600-0609. 2004.00376.x. 7. Wang F, Xu RH, Luo HY, Zhang DS, Jiang WQ, Huang HQ, et al. Clinical and prognostic analysis of hepatitis B virus infection in diffuse large Bcell lymphoma. BMC Cancer. 2008;8:115, doi: 10.1186/1471-2407-8-115. 8. Zuckerman E, Zuckerman T, Douer D, Qian D, Levine AM. Liver dysfunction in patients infected with hepatitis C virus undergoing chemotherapy for hematologic malignancies. Cancer. 1998;83:1224-30, doi: 10.1002/(SICI)1097-0142(19980915)83:6,1224::AID-CNCR23.3.0.CO;2-6. 9. Ramos CA, Saliba RM, de Pa´dua L, Khorshid O, Shpall EJ, Giralt S, et al. Impact of hepatitis C virus seropositivity on survival after allogeneic hematopoietic stem cell transplantation for hematologic malignancies. Haematologica. 2009;94:249-57, doi: 10.3324/haematol.13756. 10. Chen CH, Yang PM, Huang GT, Lee HS, Sung JL, Sheu JC. Estimation of seroprevalence of hepatitis B virus and hepatitis C virus in Taiwan from a large-scale survey of free hepatitis screening participants. J Formos Med Assoc. 2007;106:148-55, doi: 10.1016/S0929-6646(09)60231-X. 11. Chen MH, Hsiao LT, Chiou TJ, Liu JH, Gau JP, Teng HW, et al. High prevalence of occult hepatitis B virus infection in patients with B cell non-Hodgkin’s lymphoma. Ann Hematol. 2008;87:475-80, doi: 10.1007/ s00277-008-0469-9. 12. International Myeloma Working Group. Criteria for the classification of monoclonal gammopathies, multiple myeloma and related disorders: a report of the International Myeloma Working Group. Br J Haematol. 2003;121:749-57, doi: 10.1046/j.1365-2141.2003.04355.x. 13. Anderson KC, Alsina M, Bensinger W, Biermann JS, Chanan-Khan A, Cohen AD, et al. NCCN clinical practice guidelines in oncology: multiple myeloma. J Natl Compr Canc Netw. 2009;7:908-42. 14. Kumar SK, Mikhael JR, Buadi FK, Dingli D, Dispenzieri A, Fonseca R, et al. Management of newly diagnosed symptomatic multiple myeloma: updated Mayo Stratification of Myeloma and Risk-Adapted Therapy (mSMART) consensus guidelines. Mayo Clin Proc. 2009;84:1095-110, doi: 10.4065/mcp.2009.0603. 15. Tricot G, Barlogie B, Jagannath S, Bracy D, Mattox S, Vesole DH, et al. Poor prognosis in multiple myeloma is associated only with partial or complete deletions of chromosome 13 or abnormalities involving 11q and not with other karyotype abnormalities. Blood. 1995;86:4250-6. 16. Smadja NV, Bastard C, Brigaudeau C, Leroux D, Fruchart C. Hypodiploidy is a major prognostic factor in multiple myeloma. Blood. 2001;98:2229-38, doi: 10.1182/blood.V98.7.2229. 17. vestri F, Pipan C, Barillari G, Zaja F, Fanin R, Infanti L, et al. Prevalence of hepatitis C virus infection in patients with lymphoproliferative disorders. Blood. 1996;87:4296-301. 18. De Rosa G, Gobbo ML, De Renzo A, Notaro R, Garofalo S, Grimaldi M, et al. High prevalence of hepatitis C virus infection in patients with B-cell lymphoproliferative disorders in Italy. Am J Hematol. 1997;55:77-82, doi: 10.1002/(SICI)1096-8652(199706)55:2,77::AID-AJH5.3.0.CO;2-#. 19. Takeshita M, Sakai H, Okamura S, Higaki K, Oshiro Y, Uike N, et al. Prevalence of hepatitis C virus infection in cases of B-cell lymphoma in Japan. Histopathology. 2006;48:189-98, doi: 10.1111/j.1365-2559.2005. 02311.x. 20. Cavanna L, Sbolli G, Tanzi E, Romano` L, Civardi G, Buscarini E, et al. High prevalence of antibodies to hepatitis C virus in patients with lymphoproliferative disorders. Haematologica. 1995;80:486-7.

2061

CLINICS 2011;66(12):2063-2070

DOI:10.1590/S1807-59322011001200011

CLINICAL SCIENCE

A 3-year follow-up study of all-ceramic single and multiple crowns performed in a private practice: a prospective case series Gianluca M. Tartaglia,I,II Ernesto Sidoti,II Chiarella SforzaI I

Functional Anatomy Research Center (FARC), Laboratorio di Anatomia Funzionale dell’Apparato Stomatognatico, Dipartimento di Morfologia Umana e Scienze Biomediche – Citta` Studi, Facolta` di Medicina e Chirurgia, Universita` degli Studi di Milano, Milano, Italy. II SST Studio Associato Sidoti & Tartaglia, Segrate (MI), Italy.

OBJECTIVES: Zirconia-based prostheses are commonly used for aesthetic crown and fixed restorations, although follow-up data are limited, especially for implant-supported crowns. The aim of this study was to evaluate the threeyear clinical results of the installation of 463 zirconia core crowns by a general dental private practice. METHODS: This study followed 142 patients (69 men and 73 women; aged 28-82 years) who had received 248 single crowns (202 tooth-supported, 36 implant-supported) and 225 multiple units of up to six elements (81 toothsupported, 144 implant-supported). Clinical events, including fracture and loss of retention, secondary caries, and marginal integrity, were recorded. The overall failure rate was computed for the fractured and lost prostheses. Aesthetic, functional, and biological properties were rated, and patient satisfaction was investigated. RESULTS: During the three-year follow-up period, four patients were lost from the study (18 crowns, 4% of the total crowns). Three of the zirconia prostheses suffered fractures in more than three units (11 crowns; one- vs. three-year follow-up, p,0.05, Wilcoxon signed-rank test), and the cumulative prosthesis survival rate was 98.2%. Twelve units lost retention and were re-cemented, and no secondary caries of the abutment teeth were reported. The aesthetic, functional, and biological properties were generally well-rated, and there were no differences between tooth- and implant-supported crowns. The lowest scores were given regarding the anatomical form of the crowns, as some minor chipping was reported. Relatively low scores were also given for the periodontal response and the adjacent mucosa. Overall, patient satisfaction was high. CONCLUSIONS: At the three-year follow-up, the zirconia-core crowns appeared to be an effective clinical solution as they had favorable aesthetic and functional properties. Only the marginal fit of the prostheses should be improved upon. KEYWORDS: Zirconia; Prostheses; Implants; All-ceramic crowns; Clinical performance. Tartaglia GM, Sidoti E, Sforza C. A 3-year follow-up study of all-ceramic single and multiple crowns performed in a private practice: a prospective case series. Clinics. 2011;66(12):2063-2070. Received for publication on June 2, 2011; First review completed on August 8, 2011; Accepted for publication on August 29, 2011 E-mail: chiarella.sforza@unimi.it Tel.: +39 02 503 15407

To overcome these problems, dental ceramics have been used as alternatives to metallic dental restoration. Feldspathic ceramics have met patient aesthetic demands but do not provide adequate structural integrity, especially for the posterior teeth. With the development of crystalline ceramics, alumina and zirconia came into use for prosthetic reconstructions; these were first used for orthopedics and later for dentistry.2-5 Overall, from a mechanical perspective, prosthetics composed of oxide/crystalline ceramics are superior to those made with feldspathic/glass ceramics,6,7 and these are considered a viable alternative to PFM restorations.2,5,8-12 Zirconia is a crystalline dioxide of zirconium. In particular, yttrium-oxide-partially-stabilized zirconia (3Y-TZP) has mechanical properties very similar to those of metals, yet it has a color similar to that of teeth.3,4,13 Its mechanical properties, which are similar to those of stainless steel, allow

INTRODUCTION Porcelain-fused-to-metal (PFM) restorations have been the prevailing technology for aesthetic crown and fixedprosthesis restorations for approximately 50 years.1 However, the failure of these restorations is often related to technical or clinical problems, such as ceramic breakage fractures from the metal substructure, or aesthetic complications, such as the unnatural appearance of the prosthesis.

2063

Clinical performance of zirconia crowns Tartaglia GM et al.

CLINICS 2011;66(12):2063-2070

for a substantial reduction in core thickness.4 Cyclical stresses are also well tolerated by this extremely biocompatible material.2-4,9 Exposure to moisture for an extended period of time, even at the low temperatures found in the mouth, can have a detrimental effect on the properties of zirconia.13 Therefore, zirconia crowns should be covered by ceramics to increase their resistance towards the conditions of the oral cavity.3,13 Coloring salt solutions can be added to zirconia without altering its microstructure, color, flexural strength, or aging resistance.13 A shaded zirconia core, which has a more natural appearance with an opaque, yellow dentin overlaid by translucent enamel, provides greater aesthetic results.10,13 Zirconia-based prostheses can be used for both singleand multiple-unit crowns that are anchored on either implants or teeth.1,7,8,10-12,14-16 However, there have not been a significant amount of data published regarding a comparison of long-term clinical results from the use of different kinds of zirconia-based crowns, particularly for patients who have attended private dental practices. Indeed, most published studies have been laboratory-controlled investigations,1,17,18 and the majority of these clinical evaluations have reported data on small numbers of patients.7,8,11,12,19 An extensive review of the relevant literature was recently performed by Denry and Kelly,2 who reported that the largest published comprehensive series included 68 patients who were rehabilitated with 81 total prostheses and were followed for four-five years. Only the studies from Ortorp et al.16 and Encke et al.15 followed a larger number of patients, but they analyzed only single crowns fixed on teeth. Schley et al.5 reviewed studies on tooth-supported fixed prostheses and analyzed 330 zirconiabased fixed prostheses over a minimum follow-up period of three years. From this review, only one study was conducted in a private practice, and the other nine were performed at universities. Two types of problems have been reported in the literature: biological and technical. Among the biological issues, many studies have reported caries and loss of tooth vitality, whereas the loss of retention and the chipping or fracturing of veneers have been the most frequently reported as technical complications.5,7,12,16 Additionally, marginal degrees of adaptation together with mediocre or inadequate periodontal conditions have been observed.8,15 The aim of the current clinical follow-up study was to evaluate the three-year clinical results of a large number of zirconia-core crowns that had been installed at a general dental private practice. Both single crown and multiple crown units, supported by either teeth or implants, were followed-up with for this study.

two independent evaluators (GMT, ES). Four patients were lost to follow up for various reasons (deceased, no contact, or moved). The inclusion criteria consisted of having received a zirconia crown from the same private practice during the aforementioned time span.

Clinical procedures for zirconia crowns All patients had indications for one or more, one to threesix unit fixed dentures supported by either implants or teeth. All of the patients were examined for oral hygiene by a dental hygienist and were found to have moderate or good oral hygiene with less than 25% marginal plaque. These patients also had low or moderate caries activity, with less than five new restorations during the preceding five-year period. Good general health without severe medical or psychological conditions was generally self-reported by patients. Preliminary dental treatment was performed to obtain the aforementioned inclusion criteria. All subjects provided informed consent for the clinical procedures, as required by current Italian law. For tooth-supported prostheses, preliminary clinical examinations found that the bone level of the supporting teeth was at least half the root length and was without signs of active bone resorption, furcation involvement, mobility, or periapical pathology. Furthermore, the residual coronal tooth structure was shown to have a tooth restorability index value equal to or less than 2.20 All teeth were root-canal treated or non-surgical re-root canal-treated and received prefabricated posts. A core was built using a composite material (LuxaCore, DMG Hamburg Germany) if the occlusal space had more than 2 mm of centric occlusion. All of the tooth preparations were made in a standardized manner. The occlusal reduction was 2 mm, and the axial reduction was 1.5 to 2 mm. There was also a 10-degree taper made that followed the scalloping of the free gingival margins. For aesthetic reasons and for a sound tooth structure, the facial side taper was located 0.5 mm deep subgingivally with a supragingival lingual side. Each of the multiple three-six units had a total gap that was equal to but did not exceed the crown-root surface area of the abutment teeth compared to the teeth to be restored. Moreover, these had at least 3 mm of occlusogingival height from the col of the interproximal papilla to the marginal ridge of the prospective abutments adjacent to the space to be restored.19 For implant-supported prostheses, all of the implants (Titanmed, Milde Implants, Bergamo, Italy) displayed good osseous integration in both the clinical and radiographic tests. Implant abutments (titanium) were prepared according to the principles outlined for teeth. In terms of crown thickness, the core generally supports a uniform thickness of veneering ceramic, and there should be a maximum of 2 mm of unsupported porcelain. Polyether (Impregum/Permadyne, 3M ESPE AG, Seefeld, Germany) was used for the impressions in a customized tray (Apex trays, Megadenta Dentalprodukte Radeberg, Germany). Individualized, provisional resin crowns (Takilon BB, Salmoiraghi srl, Melegnano, Lodi, Italia) were cemented using a temporary zinc oxide-eugenol (ZOE) cement (Temp Bond, Kerr Italia, Scafati, Salerno, Italia). A plaster model (Esthetic-base gold, Dentona AG, Dormund, Germany) was obtained and used to create an anatomical contour wax-up.

MATERIALS AND METHODS Patient selection This study consisted of a clinical follow-up examination of 142 patients who had been given single- or multiple-unit zirconia crowns at a general private practice in Italy. One hundred and forty two patients (69 men, 73 women), who were between 28 and 82 years of age (mean age 49.2 years, SD 13.4) and had received zirconia crowns between January 2005 and January 2006, were recalled to be evaluated during the follow-up between January 2009 and August 2009 by

2064

CLINICS 2011;66(12):2063-2070

Clinical performance of zirconia crowns Tartaglia GM et al.

The wax contour was then impressed on the plaster model. The plaster model, the silicone mask, and then both components together were scanned with a laser scanner (Everest Scan pro, Kavo, Biberach, Germany). The zirconia core was designed with respect to the ceramic support. A computer-aided manufacturing (CAM) device milled the zirconia core in the pre-sintered state (Zirite, Keramo, Tavernerio, Como, Italia) and then sintered it according to the manufacturerâ&#x20AC;&#x2122;s instructions (TRF, Udine, Italia). Feldspathic porcelain (CZR Noritake Kizai Co. Ldt, Nagoya, Japan) was fused to the core with zirconium oxide margins (Figure 1) by a master ceramist (SST Dental Lab, Segrate, Italy). Proximal contact points and occlusal contacts were adjusted as necessary for maximum intercuspation and to avoid interference from the lateral excursions. The abutment teeth or implants were cleaned prior to cementation. For final cementation, a glass-ionomer cement was used (Ketac, 3M ESPE AG, Seefeld, Germany). A final control step after cementation was performed using a surface electromyographic (EMG) analysis under static conditions to verify the equilibrium of the neuromuscular system.21 As described by Ferrario et al.,21 the right and left side masseters and the temporalis anterior muscles of each patient were analyzed during maximum voluntary jaw clenching. From the EMG standardized potentials, the percentage overlapping coefficient (POC), an index of neuromuscular symmetry, was computed. For all of the patients, POC indices greater than 85% were found, which corresponded to the values previously reported for patients with good neuromuscular equilibrium.21

of the prosthesis, secondary caries, marginal integrity, wear or surface roughness, and aesthetic characteristics, were recorded. The overall failure rate was computed for fractured and lost prostheses. In accordance with a study by Hickel et al.,22,23 the aesthetic, functional and biological properties of the analyzed crowns were rated. The aesthetic properties examined included surface luster and staining, color stability and translucency, and anatomic form. The functional properties that were scored included the existence of fractures, retention, marginal adaptation, contact points and their impact on chewing food, and radiographic aspects. The biological properties scored postoperatively included sensitivity of the endodontically treated teeth, loss of osseointegration for the implants, the recurrence of caries, erosion, abfraction, periodontal and mucosal aspects of the restored teeth, and oral and general health. The overall clinical evaluation was stratified according to the following five levels: clinically excellent/very good (A); clinically good (B); clinically sufficient/satisfactory (minor shortcomings without unacceptable defects but not adjustable without damaging the tooth) (C); clinically unsatisfactory but reparable (D); and clinically poor (necessary replacement of the prosthesis) (E). The overall aesthetic, functional, and biological scores were also compared across the acceptable (excellent, good, and sufficient scores) and the unacceptable (unsatisfactory and poor scores) categories. Patient satisfaction regarding both the aesthetics and the function of the zirconia prostheses was assessed using a questionnaire with five possible rating categories: (A) excellent/very good, the patient was entirely satisfied, and the prosthesis could not be detected with the tongue; (B) good, the patient was entirely satisfied, but the prosthesis could be detected with the tongue; (C) sufficient/satisfactory, aesthetic shortcomings and/or discomfort during chewing were reported, but a replacement was not necessary; (D) poor, the patient requested an improvement to be made to the prosthesis; and (E) unsatisfactory, the patient was completely dissatisfied and required a new prosthesis but declined replacements of the same type or made of the same material.22,23 Different groups of dentists comprised the evaluator and operator groups. A training session for the evaluators occurred prior to scoring. Inter-examiner agreement for the examined characteristics was 92% at the beginning of the study, 90% at 12 months, and 88% at 36 months. The clinical (aesthetic, functional, and biological properties) scores and the patient satisfaction scores obtained at the one- and three-year recall visits were compared using the Wilcoxon signed-rank test, and these were examined separately for the single- and multiple-unit crowns and for the implant- and tooth-supported crowns. The significance level was set to 5% (p,0.05).

Data collection and analysis Following the EMG control analysis, the patients were scheduled for oral-hygiene appointments at six-month intervals and were asked to contact the clinic if they experienced any problems with their prostheses. Additionally, the patients were examined by a dentist for follow-up at 12, 24, and 36 months after the procedure and before their scheduled oral hygiene appointments. These recall appointments were standard for patients at this private practice. For each patient, data were collected regarding the patientâ&#x20AC;&#x2122;s sex, age at the time of crown placement, number of crowns cemented, and the tooth or implant position. Also, clinical findings, including fracture or loss of retention

RESULTS A total of 238 single crowns were installed in 108 patients (56 women and 52 men). Of these, 202 tooth-supported single crowns were installed in 96 patients (51 women and 45 men), and 36 implant-supported single crowns were installed in 19 patients (9 women and 10 men) (Table 1). A total of 225 multiple-unit crowns (up to six elements) were installed in 34 patients (24 women and 10 men). Of

Figure 1 - Three-unit, all-ceramic prostheses for 14-16 rehabilitation crowns for implants. The zirconia core was surrounded by feldspathic ceramic.

2065

Clinical performance of zirconia crowns Tartaglia GM et al.

CLINICS 2011;66(12):2063-2070

reported symptoms related to periapical periodontitis during the follow-up period. Patient satisfaction with the zirconia crowns was also generally high. From a clinical point of view, the lowest scores were obtained in the aesthetic category and were related particularly to the anatomical form of the crowns and the existence of some minor chipping (Figure 2). Relatively low scores were also obtained in regards to the biological properties (for the sub-categories of periodontal response and adjacent mucosa) as more than half of the crowns received only sufficient/satisfactory scores (Figure 3). The scores were generally higher for crowns on anterior teeth and for single crowns. The overall aesthetic and biological clinical scores for the analyzed zirconia prostheses were universally acceptable (445 crowns, 100%). In general, the aesthetic and biological ratings did not change during the period of analysis. In contrast, the overall functional score was not acceptable for 23 crowns (5.2%) due to fractures or a loss of retention (most were multiple-unit prostheses on posterior teeth). These scores were significantly higher at the 12-month follow-up visits than at the 36-month follow-up visits for both implantand tooth-supported crowns (Wilcoxon signed-rank test, implant-supported, p,0.001; tooth-supported, p = 0.002).

Table 1 - Distribution of the single- and multiple-unit zirconia crowns on teeth and on implants by region. Single crowns

Anterior Posterior Total

Multiple-unit crowns

Teeth

Implants

Teeth

Implants

33 159 202

5 31 36

27 54 81

26 118 144

these, 81 tooth-supported zirconia crowns were placed in 14 patients (8 women and 6 men), and 144 implant-supported crowns were placed in 29 patients (13 women and 16 men). There were two men and four women who received both single- and multiple-unit tooth-supported restorations, four men who received both single- and multiple-unit implantsupported restorations, and nine men and 11 women who received both tooth- and implant-supported zirconia restorations in various combinations. Overall, a total of 463 single or multiple-unit crowns (up to six elements) were installed in 142 patients (67 women and 75 men). Most of the crowns were placed in the premolar to molar area (n = 362; 78%), and 59% of the crowns were toothsupported (n = 213). Fifty-one percent of the crowns were positioned in 68 women, and there was an average of 3.5 crowns per patient (with a maximum of 21 in a 51-year-old patient). For male patients, there were an average three crowns cemented per patient (with a maximum of 20 in a 66-year-old patient). All single crowns and bridges were in use at the recall appointments one- and two-years post-implantation. Of the 142 patients who had received zirconia crowns three years prior to the recall appointment, four patients had been dropped from the study for various reasons (deceased, no contact, or moved), and these patients represented a total of 18 crowns (4% of the total crowns). The crowns that were deemed lost to follow-up and the cumulative survival rate (CSR) are presented in Table 2. During the follow-up period, no core material in the single-, double-, or triple-unit crowns fractured. In three of the zirconia prostheses that had more than three units, we observed fractures at the interdental connectors or at the zirconia core near the connectors. There were 12 toothsupported units that lost retention, and these included one 5-unit prosthesis, one 4-unit prosthesis, and three singletooth prostheses. Each of these was able to be re-cemented. No secondary caries of the abutment teeth were reported. In all patients, the zirconia crowns were occluded against teeth or fixed dental prostheses (Tables 3, 4). At each of the recall visits (one, two, and three years postprocedure), the aesthetic, functional, and biological properties received high ratings for almost all of the crowns examined, and the ratings were equivalent for both the tooth- and implant-supported crowns. Also, no patients

DISCUSSION In this clinical follow-up study, a three-year follow-up analysis was performed to assess more than 400 zirconia core crowns supported either by teeth or implants. The number of prostheses included in this study was larger than most previously published studies; for example, this current study was approximately two to four times larger than those reported by Ortorp et al.16 and Encke et al.15 The number of tooth-supported prostheses (283) was comparable to that reviewed by Schley et al.5 To the best of our knowledge, this is the first investigation to analyze the long-term outcomes of implant-supported zirconia prostheses. Furthermore, in previous studies, only zirconia prostheses with up to five elements were longitudinally followed, whereas we included several sixelement units that were both implant- and tooth-supported. For example, one prior laboratory investigation that tested zirconia prostheses with only as many as five units found that these can withstand main chewing and clenching stresses.3 Furthermoe, only the study from Papaspyridakos and Lal10 described a 12-unit mandibular prosthesis, although this study did not examine longitudinal data regarding their rehabilitation performance. In this private-practice study, the loss of patients at the time of follow-up was minimal, as only 4% of the prostheses were unavailable for analysis at the three-year recall visit. Previous studies have documented much larger drop-out frequencies, including 10%,5 13%,15 17%,16 and 24%.7 The higher participation rate of our patients is in line with their high satisfaction towards the zirconia core prostheses.7,16 Perhaps the inclusion of patients from a private practice where the patient-dentist relationship is influenced by monetary considerations contributes to general satisfaction. According to the results of our study, only 11 crowns fractured during the time period analyzed, and each of these fracture events occurred between the two- and threeyear follow-up visits. As expected, the prostheses with a

Table 2 - Crowns lost to follow-up and the cumulative survival rate (CSR). Time Crown cementation 1 year 3 years

Examined crowns

Lost to follow-up Failed CSR (%)

463

100

463 445

0 18

0 11

100 98.2

2066

CLINICS 2011;66(12):2063-2070

Clinical performance of zirconia crowns Tartaglia GM et al.

Table 3 - Clinical evaluation of the analyzed single-crown zirconia prostheses, according to Hickel et al.22 at the threeyear follow-up examination. All values represent the number (and percentage) of prostheses. Clinical evaluation single crowns

Position

Support

Aesthetic properties Surface luster

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

0 0 0 0 5 (100) 39 (100) 31 (100) 145 (100) 0 0 0 0 0 0 0 0

5 (100) 39 (100) 31 (100) 145 (100) 0 0 0 0 5 (100) 39 (100) 31 (100) 145 (100) 5 (100) 39 (100) 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 31 (100) 145 (100)

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

5 (100) 39 (100) 31 (100) 142 (98) 5 (100) 39 (100) 31 (100) 145 (100) 5 (100) 39 (100) 31 (100) 138 (95) 5 (100) 39 (100) 31 (100) 145 (100) 5 (100) 31 (79) 9 (29) 61 (40)

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 (21) 22 (71) 84 (60)

0 0 0 0 0 0 0 0 0 0 0 7 (5) 0 0 0 0 0 0 0 0

0 0 0 3 (2) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

5 (100) 39 (100) 31 (100) 145 (100) 5 (100) 39 (100) 31 (100) 145 (100) 0 0 0 0 5 (100) 39 (100) 0 7 (5) 5 (100) 39 (100) 31 (100) 145 (100)

0 0 0 0 0 0 0 0 5 (100) 39 (100) 29 (94) 97 (67) 0 0 30 (97) 98 (67) 0 0 0 0

0 0 0 0 0 0 0 0 0 0 2 (6) 48 (33) 0 0 1 (3) 40 (28) 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Posterior Surface staining

Anterior Posterior

Color stability and translucency

Anterior Posterior

Anatomic form

Anterior Posterior

Functional properties Fractures and retention

Anterior Posterior

Marginal adaptation

Anterior Posterior

Contact point/food impact

Anterior Posterior

Radiographic examination

Anterior Posterior

Patientâ&#x20AC;&#x2122;s view

Anterior Posterior

Biological properties Postoperative (hyper-) sensitivity*

Anterior Posterior

Recurrence of caries, erosion, abfraction

Anterior Posterior

Periodontal response

Anterior Posterior

Adjacent mucosa

Anterior Posterior

Oral and general health

Anterior Posterior

Anterior: incisors, canines; Posterior: premolars, molars. A: clinically excellent/very good; B: clinically good; C: clinically sufficient/satisfactory; D: clinically unsatisfactory; E: clinically poor. * All the teeth were endodontically treated. For implants, we evaluated loss of osseointegration.

in accordance with published findings.2,7 Nevertheless, these 11 crowns represented only 9% of the total multipleunit (four to six) crowns, which indicated that multiple-unit zirconia core prostheses demonstrated greater clinical

greater number of units were more fragile than the single crowns. Fractures were found only in prostheses with more than three units and were located at the interdental connectors or in the zirconia core adjacent to the connectors,

2067

Clinical performance of zirconia crowns Tartaglia GM et al.

CLINICS 2011;66(12):2063-2070

Table 4 - Clinical evaluation of the analyzed multiple-unit zirconia prostheses, according to Hickel et al.22 at the 3-year follow-up examination. All values represent the number (and percentage) of prostheses. Clinical evaluation multiple units

Position

Support

Aesthetic properties Surface luster

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

0 0 0 0 26 (100) 27 (100) 118 (100) 54 (100) 0 0 0 0 0 0 0 0

26 (100) 27 (100) 118 (100) 54 (100) 0 0 0 0 26 (100) 27 (100) 118 (100) 54 (100) 26 (100) 9 (33) 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 18 (67) 118 (100) 54 (100)

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

26 (100) 27 (100) 111 (94) 41 (76) 26 (100) 27 (100) 118 (100) 54 (100) 26 (100) 27 (100) 118 (100) 54 (100) 26 (100) 27 (100) 118 (100) 54 (100) 10 (38) 9 (33) 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 (62) 18 (67) 118 (100) 54 (100)

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 9 (17) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 7 (6) 4 (7) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth Implants Teeth

26 (100) 27 (100) 118 (100) 54 (100) 26 (100) 27 (100) 118 (100) 54 (100) 0 0 0 0 0 0 0 0 26 (100) 27 (100) 118 (100) 54 (100)

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 26 (100) 27 (100) 118 (100) 54 (100) 26 (100) 27 (100) 118 (100) 54 (100) 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Posterior Surface staining

Anterior Posterior

Color stability and translucency

Anterior Posterior

Anatomic form

Anterior Posterior

Functional properties Fractures and retention

Anterior Posterior

Marginal adaptation

Anterior Posterior

Contact point/food impact

Anterior Posterior

Radiographic examination

Anterior Posterior

Patientâ&#x20AC;&#x2122;s view

Anterior Posterior

Biological properties Postoperative (hyper-) sensitivity*

Anterior Posterior

Recurrence of caries, erosion, abfraction

Anterior Posterior

Periodontal response

Anterior Posterior

Adjacent mucosa

Anterior Posterior

Oral and general health

Anterior Posterior

performance in this study than in previous studies with the same follow-up period.16 All of these fractures occurred in prostheses of posterior teeth, which is where most of the multiple-unit crowns were placed, and this is similar to that

reported by previous studies that examined prostheses at all locations within the mouth.2,11,12,16 After a one-year follow-up period, Encke et al.15 reported partial fractures in 4% of the single crowns on posterior

2068

CLINICS 2011;66(12):2063-2070

Clinical performance of zirconia crowns Tartaglia GM et al.

reduced the likelihood of this occurrence. Additionally, each of the crowns in this study had a sufficient ceramic thickness.15 From a clinical point of view, it was critical that occlusal reduction during preparation be meticulously verified, as suggested by previous investigations.15 In addition, no occlusal adjustments were deemed necessary,15 which may have been related to the proper functioning of the prostheses, as the surface EMG analysis found that all patients had good neuromuscular equilibrium and that the new occlusal conditions had been properly incorporated into the stomatognathic system.21 A strict relationship between neuromuscular equilibrium and variations in occlusal characteristics has been previously described.24,25 For 81% of the crowns analyzed by this study, the anatomical form was scored as sufficient or satisfactory, although no cases were scored as excellent. To avoid fractures in the zirconia prostheses, the occlusion adjustments were made after cementation and during maximum voluntary clench. Evidently, minimum and direct occlusal reshaping influenced this sub-category score. In contrast, Ortorp et al.16 reported excellent anatomical form for each of the 25 single crowns in their study (11% of the original group) after three years. Regarding the scores related to the biological properties of the crowns, 57 to 58% of the crowns had a sufficient or satisfactory periodontal response and a similar response regarding the adjacent mucosa (as compared to adjacent, unrestored teeth), which is in accord with the results of prior reports.5,12,16 In previous investigations, the fit of the prosthetic framework was only rated as sufficient, and further improvements in marginal accuracy were deemed necessary.7,15 Sailer et al.7 stated that the lack of marginal accuracy explained the secondary caries that they observed. In our patients, no secondary caries were found; however, marginal accuracy also influences the mucosal response and thus may explain the current findings. This result partially contrasts with data reported by Vult von Steyern et al.11 and C 存 ehreli et al.8 that demonstrated excellent marginal integrity in 80% of the crowns after a one- or two-year follow-up period. The different scores that were obtained for marginal adaptation and periodontal response may be explained by the technical procedure itself, as several patients may have experienced invasion of the biological dental/mucosal width. After analyzing these results, the procedure was modified, and we expect that patients treated with the new, modified protocol will experience improved periodontal responses. Furthermore, customized oral hygiene maintenance protocols could be developed with the dental hygienist. The lack of secondary caries in our patients was in contrast with previous studies.5,7 Indeed, Hickel et al.22 suggested that some clinical studies may have overstated the incidence of secondary caries. In fact, the diagnosis of recurrent caries can be made from the clinical point of view only, and the marginal discoloration that is often considered a sign of caries may instead represent a stained restoration margin. Unfortunately, only histological assessments can confirm this clinical diagnosis. Overall, the cumulative three-year prosthetic survival rate observed in this study is in agreement with the literature5,7,12 and is even greater than that reported from investigations where only tooth-supported single crowns were examined.15,16 No differences were observed for either

Figure 2 - Minor chipping of the anterior zirconia prosthesis on tooth 11.

teeth. After a two year follow-up period, Vult von Steyern et al.11 reported minor chip fractures in 15% of their three- to five-unit posterior prostheses. After a three year follow-up period, Sailer et al.7 reported that four out of 33 three- to five-unit posterior prostheses needed to be replaced due to technical problems (poor cementation, fracture, or porcelain chipping). From a four-year follow-up study, Wolfart et al.12 reported a 12 to 13% complication rate due to technical problems. In the current study, 12 units lost cementation, but each could be re-cemented, as seen in previous studies.12 In comparison to previously published reports, the current study observed a lower incidence of veneer chipping and fractures. Several technical and clinical aspects of the study may have contributed to this success rate. Sailer et al.7 emphasized the need for refined zirconia veneers, as surfaces made with crystalline ceramics have a higher fracture rate than do those made with feldspathic ceramics. For the patients in this study, feldspathic porcelain was fused to solid zirconia prostheses, which

Figure 3 - Poor gingival response at the 1-year follow-up.

2069

Clinical performance of zirconia crowns Tartaglia GM et al.

CLINICS 2011;66(12):2063-2070

9. Christensen GJ. Porcelain-fused-to-metal versus zirconia-based ceramic restorations, 2009. J Am Dent Ass. 2009;140:1036-9. 10. Papaspyridakos P, Lal K. Complete arch implant rehabilitation using subtractive rapid prototyping and porcelain fused to zirconia prosthesis: a clinical report. J Prosthet Dent. 2008;100:165-72, doi: 10.1016/S00223913(08)00110-8. 11. Vult von Steyern P, Carlson P, Nilner K. All-ceramic fixed partial dentures designed according to the DC-Zirkon technique. A 2-year clinical study. J Oral Rehabil. 2005;32:180-7, doi: 10.1111/j.1365-2842. 2004.01437.x. 12. Wolfart S, Harder S, Eschbach S, Lehmann F, Kern M. Four-year clinical results of fixed dental prostheses with zirconia substructures (Cercon): end abutments vs. cantilever design. Eur J Oral Sci. 2009;117:741-9, doi: 10.1111/j.1600-0722.2009.00693.x. 13. Shah K, Holloway JA, Denry IL. Effect of coloring with various metal oxides on the microstructure, color, and flexural strength of 3Y-TZP. J Biomed Mater Res B Appl Biomater. 2008;87B:329–37, doi: 10.1002/jbm. b.31107. 14. Papanagiotou HP, Morgano SM, Giordano RA, Pober R. In vitro evaluation of low-temperature aging effects and finishing procedures on the flexural strength and structural stability of Y-TZP dental ceramics. J Prosthet Dent. 2006;96:154-64, doi: 10.1016/j.prosdent.2006.08.004. 15. Encke BS, Heydecke G, Wolkewitz M, Strub JR. Results of a prospective randomized controlled trial of posterior ZrSiO(4)-ceramic crowns. J Oral Rehabil. 2009;36:226-35, doi: 10.1111/j.1365-2842.2008.01918.x. 16. Ortorp A, Kihl ML, Carlsson GE. A 3-year retrospective and clinical follow-up study of zirconia single crowns performed in a private practice. J Dent. 2009;37:731-6. 17. Att W, Grigoriadou M, Strub JR. ZrO2 three-unit fixed partial dentures: comparison of failure load before and after exposure to a mastication simulator. J Oral Rehabil. 2007;34:282-90, doi: 10.1111/j.1365-2842.2006. 01705.x. 18. Kohorst P, Herzog TJ, Borchers L, Stiesch-Scholz M. Load-bearing capacity of all-ceramic posterior four-unit fixed partial dentures with different zirconia frameworks. Eur J Oral Sci. 2007;115:161-6, doi: 10. 1111/j.1600-0722.2007.00429.x. 19. Raigrodski AJ, Chiche GJ, Potiket N, Hochstedler JL, Mohamed SE, Billiot S, et al. The efficacy of posterior three-unit zirconium-oxide-based ceramic fixed partial dental prostheses: a prospective clinical pilot study. J Prosthet Dent. 2006;96:237-44, doi: 10.1016/j.prosdent.2006.08.010. 20. Bandlish RB, McDonald AV, Setchell DJ. Assessment of the amount of remaining coronal dentine in root-treated teeth. J Dent. 2006;34:699-708, doi: 10.1016/j.jdent.2006.01.002. 21. Ferrario VF, Tartaglia GM, Galletta A, Grassi GP, Sforza C. The influence of occlusion on jaw and neck muscle activity: a surface EMG study in healthy young adults. J Oral Rehabil. 2006;33:341-8, doi: 10.1111/j.13652842.2005.01558.x. 22. Hickel R, Roulet JF, Bayne S, Heintze SD, Mjo¨r IA, Peters M, et al. Recommendations for conducting controlled clinical studies of dental restorative materials. Clin Oral Invest. 2007;11:5-33, doi: 10.1007/s00784006-0095-7. 23. Hickel R, Peschke A, Tyas M, Mjo¨r I, Bayne S, Peters M, et al. FDI World Dental Federation: clinical criteria for the evaluation of direct and indirect restorations—update and clinical examples. Clin Oral Invest. 2010;14:349–66, doi: 10.1007/s00784-010-0432-8. 24. Ferrario VF, Marciandi PV, Tartaglia GM, Dellavia C, Sforza C. Neuromuscular evaluation of post-orthodontic stability: an experimental protocol. Int J Adult Orthodon Orthognath Surg. 2002;17:307-13. 25. Di Palma E, Gasparini G, Pelo S, Tartaglia GM, Chimenti C. Activities of masticatory muscles in patients after orthognathic surgery. J Craniomaxillofac Surg. 2009;37:417-20, doi: 10.1016/j.jcms.2009.05.004.

single or multiple tooth- or implant-supported crowns. As the published literature on zirconia-core crowns for implants is limited, further investigations with more extensive follow-up periods are necessary. In particular, due to the problem of fatigue fractures with all-ceramic prostheses,1,3,13,14,17 a longer observation period is necessary.19 This is especially warranted for rehabilitations in young patients who likely exert greater bite forces on their prostheses. In conclusion, zirconia-core crowns appear to be a good clinical solution for both single- and multiple-unit prostheses, as they were shown to exhibit favorable aesthetic and functional properties. The marginal fit of these prostheses should be improved, as should the teamwork with the dental hygienist. Overall patient satisfaction was good, and the percentage of failures was limited in this clinical follow-up study. Undoubtedly, further longitudinal analyses are necessary, and the clinical performance of prosthetic reconstructions should be assessed five years after their placement.19

AUTHOR CONTRIBUTIONS Tartaglia GM was responsible for the concept, design, execution, and interpretation of the study. Sidoti E was responsible for the bibliographic review, execution, and interpretation of the study. Sforza C was responsible for the concept, design, statistical analysis, and interpretation of the study.

REFERENCES 1. Sundh A, Molin M, Sjogren G. Fracture resistance of yttrium oxide partially stabilized zirconia all-ceramic bridges after veneering and mechanical fatigue testing. Dent Mater. 2005;21:476–82, doi: 10.1016/j. dental.2004.07.013. 2. Denry I, Kelly JR. State of the art of zirconia for dental applications. Dent Mater. 2008;24:299-307, doi: 10.1016/j.dental.2007.05.007. 3. Manicone P, Iommetti P, Raffaelli L. An overview of zirconia ceramics: Basic properties and clinical applications J Dent. 2007;35:819-26. 4. Piconi C, Maccauro G. Zirconia as a ceramic biomaterial. Biomaterials. 1999;20:1–25, doi: 10.1016/S0142-9612(98)00010-6. 5. Schley JS, Heussen N, Reich S, Fischer J, Haselhuhn K, Wolfart S. Survival probability of zirconia-based fixed dental prostheses up to 5 yr: a systematic review of the literature. Eur J Oral Sci. 2010;118:443-50, doi: 10.1111/j.1600-0722.2010.00767.x. 6. Luthardt RG, Holzhuter M, Sandkuhl O, Herold V, Schnapp JD, Kuhlisch E, et al. Reliability and properties of ground Y-TZP-zirconia ceramics. J Dent Res. 2002;81:487–91, doi: 10.1177/154405910208100711. 7. Sailer I, Fehe´r A, Filser F, Gauckler LJ, Lu¨thy H, Ha¨mmerle CH. Fiveyear clinical results of zirconia frameworks for posterior fixed partial dentures. Int J Prosthodont. 2007;20:383-8. 8. C ¸ ehreli MC, Ko¨kat AM, Akc¸a K. CAD/CAM Zirconia vs. slip-cast glassinfiltrated Alumina/Zirconia all-ceramic crowns: 2-year results of a randomized controlled clinical trial. J Appl Oral Sci. 2009;17:49-55, doi: 10.1590/S1678-77572009000100010.

2070

CLINICS 2011;66(12):2071-2077

DOI:10.1590/S1807-59322011001200012

CLINICAL SCIENCE

Methicillin-resistant staphylococcus aureus (MRSA) carriage in a dermatology unit Renata L. Pacheco,I Renata D. Lobo,II Maura S. Oliveira,II Elthon F. Farina,I Cleide R. Santos,II Silvia F. Costa,I Maria Clara Padoveze,III Cilmara P. Garcia,II Priscila A. Trindade,I Ligia M. Quite´rio,IV Evandro A. Rivitti,IV Elsa M. Mamizuka,V Anna S. LevinI,II I

Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Department of Infectious Diseases and LIM-54, Saõ Paulo/SP, Brazil. Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Department of Infection Control of Saõ Paulo, Saõ Paulo/SP, Brazil. III Universidade de Saõ Paulo, Nursing School, Department of Collective Health, Saõ Paulo/SP, Brazil. IV Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Department and Division of Dermatology, Saõ Paulo/SP, Brazil. V Universidade de Saõ Paulo, Department of Clinical Analyses, Faculdade de Cieˆncias Farmaceûticas, Saõ Paulo/SP Brazil. II

OBJECTIVE: The aim of this study was to characterize Staphylococcus aureus (MRSA) carriage in a dermatology unit. METHODS: This was a prospective and descriptive study. Over the course of 26 weeks, surveillance cultures were collected weekly from the anterior nares and skin of all patients hospitalized in a 20-bed dermatology unit of a tertiary-care hospital. Samples from healthcare workers (HCWS) were cultured at the beginning and end of the study. Colonized patients were put under contact precautions, and basic infection control measures were enforced. Staphylococcus aureus colonization pressure was determined monthly. Colonized and non-colonized patients were compared, and isolates were evaluated for antimicrobial susceptibility, SCCmec type, virulence factors, and type. RESULTS: Of the 142 patients evaluated, 64 (45%) were colonized by MRSA (39% hospital acquired; 25% community acquired; 36% indeterminate). Despite isolation precautions, hospital-acquired Staphylococcus aureus occurred in addition to the continuous entry of Staphylococcus aureus from the community. Colonization pressure increased from 13% to 59%, and pemphigus and other bullous diseases were associated with MRSA colonization. Eleven out of 71 HCWs (15%) were Staphylococcus aureus carriers, although only one worker carried a persistent clone. Of the hospital-acquired MRSA cases, 14/28 (50%) were SCCmec type IV (3 PFGE types), 13 were SCCmec type III (46%), and one had an indeterminate type. These types were also present among the community-acquired Staphylococcus aureus isolates. SSCmec type IV isolates were shown to be more susceptible than type III isolates. There were two cases of bloodstream infection, and the pvl and tst virulence genes were absent from all isolates. CONCLUSIONS: Dermatology patients were colonized by community- and hospital-acquired Staphylococcus aureus. Half of the nosocomial Staphylococcus aureus isolates were SCCmec type IV. Despite the identification of colonized patients and the subsequent contact precautions and room placement, Staphylococcus aureus colonization continued to occur, and colonization pressure increased. Pemphigus and other bullous diseases were associated with Staphylococcus aureus. KEYWORDS: Transmission; Surveillance culture; Molecular typing; MRSA; Hospital infection. Pacheco RL, Lobo RD, Oliveira MS, Farina EF, Santos CR, Costa SF, et al. Methicillin-resistant staphylococcus aureus (MRSA) carriage in a dermatology unit. Clinics. 2011;66(12):2071-2077. Received for publication on July 3, 2011; First review completed on July 15, 2011; Accepted for publication on August 29, 2011 E-mail: gcih@hcnet.usp.br Tel.: 55 11 2661-7066

Staphylococcus aureus (MRSA) infections has increased in recent years.2 Methicillin resistance of Staphylococcus aureus is mediated by a penicillin-binding protein (PBP2A) that has a low affinity for b-lactam antibiotics and is encoded by the mecA gene.3,4 This gene is carried on a mobile genetic element designated as Staphylococcal Cassette Chromosome mec (SCCmec), which is integrated into the chromosome. Currently, 11 types of SCCmec have been reported.5-7 In healthcare settings, patients who are colonized by or infected with MRSA serve as a reservoir and a source for the spread of this microorganism, which occurs mainly through transiently colonized healthcare workers (HCWs).8,9

INTRODUCTION Staphylococcus aureus is a versatile pathogen capable of causing a wide variety of infections.1 The prevalence of nosocomial and community-acquired methicillin-resistant

2071

MRSA carriage in a dermatology unit Pacheco RL et al.

CLINICS 2011;66(12):2071-2077

Carriage of S. aureus is considered a risk factor for the development of infections, as infections are usually preceded by a period of colonization.10 The objective of this study was to characterize MRSA carriage in a hospital dermatology unit.

throughout the unit to report the weekly number of patients colonized by MRSA. Patients also received information regarding the contact precautions and their importance.

Surveillance cultures of healthcare workers (HCWs) METHODS

The anterior nares of the healthcare workers were cultured on two occasions: at the beginning and at the end of the study. HCWs who tested positive were not treated.

Hospital das Clı´nicas is a tertiary-care teaching hospital that is affiliated with the University of Sa˜o Paulo, Brazil. It has approximately 2,000 beds and is divided into 6 buildings. The dermatology unit has 20 beds, which are distributed across 10 rooms of one, two, or four beds each. This unit is used for the hospitalization of patients with severe dermatologic conditions. On average, there are 30 admissions per month and 4,500 patient-days each year.

Ethics The study protocol followed the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Commission of the Hospital das Clı´nicas (approval number: 1072/04).

Analysis of data

Surveillance cultures of patients

Continuous variables are herein presented as the means ¡ standard deviation or median and range. Frequencies were calculated for the categorical variables. MRSA-colonized patients were compared to non-colonized patients using the x2 test for categorical variables and the Mann Whitney test for continuous variables. The data were analyzed using Epi Info 6.04 software (CDC, Atlanta, USA). A p-value of 0.05 was considered statistically significant. For each period, we determined the total number of patient-days and the number of MRSA patient-days (by summing the days that each MRSA-colonized patient remained in the unit after the day that MRSA colonization was first identified). Colonization pressure was also determined for each period by dividing the number of MRSA patient-days by the total number of patient-days (expressed as a percentage).

Over a period of 26 weeks that began on May 31, 2005, weekly surveillance cultures for MRSA were obtained from all of the patients admitted to the unit. These samples were collected from the anterior nares and skin lesions. Patients who were positive for MRSA were not followed for further surveillance cultures. Patients who were negative for MRSA were cultured weekly until their discharge from the unit. Due to the high proportion of patients who tested positive on the first surveillance culture, patients were cultured upon admission and then weekly from the 13th week of the study onward. The swabs from the anterior nares were collected by introducing a swab into the nasal vestibulum and then rubbing with light pressure. The swabs were transported in sterile tubes containing culture medium and were sent immediately to the laboratory for further processing and analysis. The swabs from skin lesions were collected by gently scraping or rolling the swab across the lesion.

Microbiological methods Detection of MRSA. Samples were plated onto mannitol salt agar (MSA) and inoculated into brain heart infusion (BHI) broth. Mannitol-fermenting colonies were subcultured onto 5% sheep blood agar plates. If the initial MSA culture was negative, a subculture from the BHI broth was carried out on MSA plates to increase the sensitivity of detection. S. aureus was identified by Gram staining and DNAse and catalase tests. Methicillin resistance was determined using Mueller Hinton agar supplemented with 4% NaCl and 6 mg/mL oxacillin according to guidelines of the Clinical Laboratory Standards Institute (CLSI).11 If there was growth of at least one colony-forming unit, the culture was considered positive. S. aureus ATCC 29213 and NCTC 10442 were used as controls. The phenotypic identification was confirmed by polymerase chain reaction (PCR), amplifying 117 bp and 214 bp fragments from the coagulase and mecA genes, respectively, using the NCL-SA-PS kit (Novo Castra, United Kingdom), as previously described by Kearns et al.12 Susceptibility testing. Minimal inhibitory concentrations (MICs) were determined using the broth microdilution method and were interpreted according to CLSI guidelines11,13 for oxacillin, penicillin, chloramphenicol, ciprofloxacin, clindamycin, erythromycin, gentamicin, rifampicin, sulfamethoxazole/trimethoprim, tetracycline and vancomycin. Molecular typing. Molecular typing was performed by digesting whole-cell DNA with the SmaI macrorestriction

Definitions Nosocomial acquisition of MRSA was defined as a positive culture in a patient who had been in the hospital for more than 48 hours and whose previous surveillance cultures at both sites had been negative (nares and skin). For patients who were positive within the first 48 hours of hospitalization, MRSA was considered to have been present at the time of hospital admission. All other colonizations were considered indeterminate as to where MRSA acquisition occurred. The following patient data were registered upon admission to the study: age, sex, date of admission to the hospital, underlying diseases, hospitalization within the previous 12 months, and use of antimicrobial drugs. The patients were followed until their discharge from the unit. We evaluated the colonization of the patients by dividing the study into six periods.

Control measures All patients positive for MRSA were placed in separate rooms or were placed in a cohort with other MRSA carriers and put under contact precautions until hospital discharge or death. Hand hygiene was enforced by requiring the use of alcohol gel. There were two educational meetings with members of the staff in which the control measures and their objectives were discussed. Posters were spread

2072

CLINICS 2011;66(12):2071-2077

MRSA carriage in a dermatology unit Pacheco RL et al.

samples were denatured for 5 minutes at 94 ˚C; subjected to 30 cycles of denaturation at 95 ˚C for 30 seconds, annealing at 55 ˚C for 1 minute, and extension at 72 ˚C for 2 min; and then subjected to a final extension at 72 ˚C for 5 minutes. The MR108 (positive for pvl) and N315 (positive for lukE-lukD and tst) isolates were used as controls.

enzyme (Fermentas Life Sciences, Canada) and then determining the fragment-size patterns obtained with pulsed-field gel electrophoresis (PFGE) using a CHEF DRII apparatus (Bio-Rad Laboratories, USA).14 The patterns were analyzed as recommended by Tenover et al.15 Types were defined as isolates that differed by at least seven fragments and were identified using letters. Subtypes of a given clonal type were defined as those isolates that differed by fewer than seven fragments and were identified using numbers. Multilocus sequence typing was performed for 10 isolates according to methods described elsewhere.16 This sequence typing was performed for one isolate of each PFGE type (seven isolates), one isolate for which the SCCmec type could not be determined and two isolates in which mecA could not be detected. SCCmec typing. The determination of the SCCmec type was performed using the multiplex PCR method, as described by Oliveira & Lencastre.17 DNA was extracted using a commercial kit (Genomic Prep Cells and Tissue DNA Isolation, Amersham Pharmacia, Biotech, Germany). PCR amplifications were performed using a GeneAmp PCR System 2400 thermocycler (Perkin-Elmer, Waltham, MA, USA). The MRSA strains NTCT 10442, N315, 85/2082 and JSCS 1968, which belong to SCCmec types I, II, III, and IV, respectively, were used as positive controls. Detection of genes for virulence factors. One isolate from each PFGE subtype was evaluated for the Panton Valentine leukocidin (pvl), LukE-LukD leukocidin (lukElukD) and toxic shock syndrome toxin-1 (tst) virulence genes by PCR using primers described elsewhere.18 Briefly,

RESULTS During the study period, 153 patients were admitted to the dermatology unit. Of these, 11 were lost to follow-up, and 142 were evaluated until discharge and included in the analysis. Of the 142 patients, 64 (45%) were colonized by MRSA. There were 26 patients who were positive only from the culture of the anterior nares (one patient harbored two isolates), 11 who were positive only from skin culture and 27 who had tested positive from both sites (two patients each harbored three isolates). Thus, 94 MRSA isolates from 64 patients were microbiologically evaluated. Among the 64 patients (45%) who were colonized by MRSA, 25 (39%) had hospital-acquired infections, 16 (25%) were colonized at the time of admission and 23 patients (36%) had an indeterminate site of acquisition. The distributions over time of patients who were colonized at the time of admission and of those who acquired MRSA in the hospital are presented in Figure 1. Despite the control measures, the nosocomial acquisition of MRSA occurred during the entire study period. In addition, during the entire study period, there was a continuous entry of patients who were MRSA positive at the time of admission, and the

Figure 1 - The monthly distribution of patients colonized by MRSA at the time of admission, the distribution of patients who acquired MRSA in the hospital and the MRSA colonization pressure in the dermatology unit over a 6-month period.

2073

MRSA carriage in a dermatology unit Pacheco RL et al.

CLINICS 2011;66(12):2071-2077

colonization pressure also increased over the six-month study period (Figure 1). The characteristics of the MRSA-colonized and noncolonized patient populations are presented in Table 1. Bullous diseases, such as pemphigus and others, were significantly more frequent among colonized patients. The SCCmec types and molecular types of the 94 isolates were determined. When a patient harbored more than one isolate of the same SCCmec type and PFGE type, only one isolate for that patient was included in the final analysis. Therefore, 67 isolates from 64 patients were analyzed. There were seven molecular PFGE types (A to G) that were divided into 30 subtypes. The distribution of the patient isolates according to the origin of acquisition, SCCmec type and molecular type is presented in Table 2. The results of the MLST for isolates of each PFGE type (A to G) are presented in Table 3. The SCCmec type IV isolates belonged to four different PFGE molecular types (A-D) and four different sequence types (ST5, ST8, ST97 and ST1176). However, the PFGE type and ST did not correlate completely, as ST8 belonged to two different PFGE types (B and D), and there were 2 ST (ST97 and ST5) among the isolates of PFGE type C. Of the SCCmec type III isolates, there were 3 PFGE molecular types (E-G), all of which belonged to ST239, as does the multiresistant Brazilian Endemic Clone (BEC). Of the isolates obtained at the time of patient admission, most were SCCmec type IV, but there were also four isolates that were similar to the BEC. The hospital-acquired isolates were evenly distributed among SCCmec types IV and III. Among the 30 isolates tested (all carried SCCmec type IV), the pvl and tst virulence factors were absent from all of them, and the lukD-lukE gene was present in all of them.

During the study period, there were two cases of bloodstream infections. These were caused by MRSA of SCCmec type IV and PFGE type A. These patients had been colonized by the same subtypes at earlier time points (25 and 40 days prior). Thirty-seven healthcare workers (HCWs) were cultured at the beginning of the study, and 34 were cultured at the end of the study. Of these, five (14%) were positive on the first occasion, and six (18%) were positive on the second. The distribution of the isolates from healthcare workers according to SCCmec type and molecular type is presented in Table 4. Fifteen HCWs were cultured on both occasions, and three were positive on both occasions, but only one healthcare worker (belonging to the housekeeping staff) presented the same subtype twice (C3). However, none of the patients presented the C3 subtype. The antimicrobial susceptibilities of the isolates that colonized 60 patients and 11 healthcare workers are shown in Table 5.

DISCUSSION Colonization with MRSA was prevalent among patients hospitalized for dermatological diseases (45%), and this colonization was due to both hospital acquisition and colonization prior to admission. This study began by examining routine surveillance cultures to determine the extent of the problem and to identify patients who should be placed under contact precautions, such as placement in a private room or in a patient cohort. Through the enforcement of these measures, we expected to halt the nosocomial transmission of MRSA. Community-acquired MRSA (CA-MRSA) has been rarely described in Brazil and has been shown to occur mainly in

Table 1 - Characteristics of MRSA-colonized patients and non-colonized patients in the dermatology unit over a 6month period. Characteristics

Male sex Age (years) -mean (SD) -median (range) Total days of hospitalization -mean (SD) -median (range) Days of hospitalization until MRSA detection -mean (SD) -median (range) Hospitalization within the previous 12 months -in our hospital Previous use of antimicrobial drugs Underlying diseases Bullous diseases Pemphigus Other bullous Atopy Cancer Erythrodermia Infectious Auto-immune Psoriasis Eczema Death during hospitalization

Colonized (n = 64)

Non-colonized (n = 78)

p-value

n (%)

28 (44%) 42.8 (21.8) 42 (1-84)

37 (47%) 38.8 (25.7) 35 (0-92)

0.66 0.33

24.3 (20.8) 17 (2-118)

15.4 (24.4) 8.5 (1-168)

0.02

9.5 (10.4) 6 (0-49)

NA NA

30 (47%) 18 (60%) 38 (59%)

25% (32%) 15 (60%) 36 (46%)

0.07 0.21 0.12

22 (34%) 15 (23%) 7 (11%) 11 (17%) 5 (8%) 8 (13%) 7 (11%) 4 (6%) 6 (9%) 4 (6%)

6 (8%) 3 (4%) 3 (4%) 10 (13%) 9 (12%) 6 (8%) 8 (10%) 8 (10%) 8 (10%) 7 (9%) 1 (1%)

,0.001 ,0.001 0.10 0.47 0.46 0.34 0.90 0.10 0.86 0.14 0.11

SD: standard deviation NA: not applicable.

2074

CLINICS 2011;66(12):2071-2077

MRSA carriage in a dermatology unit Pacheco RL et al.

Table 2 - SCCmec type and molecular type of 67 MRSA isolates according to the origin of acquisition. Origin of the MRSA (n) Hospital acquired (n: 28)

SCCmec type (n)

Molecular PFGE type (n)

III (13)

E (9) F (2) G (2) B (6) A (5) C (3) C (1) E (4) A (7) C (4) C (1)

IV (14)

Positive at hospital admission (n:16)

ND (1) III (4) IV (11) ND (1)

Table 4 - The SCCmec and molecular types of 11 MRSA isolates obtained from healthcare workers at the beginning and the end of the study.

A1 B1 C1 C6 D E1 E8 E9 F G

1176 8 97 5 8 239 239 239 239 239

IV IV IV ND IV III III III

IV (5)

End of study (n: 34) 6 (18%) positive for MRSA

IV (5)

C (3) B (1) A (1) A (1) B (3) C (1) E (1)

decrease in the nosocomial acquisition of MRSA to the extensive efforts of the staff, which included improving the isolation conditions and the infection control measures. Our original goal was the complete eradication of nosocomial transmission, but this goal was not achieved. The colonization pressure was first evaluated for vancomycin-resistant enterococci.22 This type of resistance has been studied in MRSA and has been shown to play a role as a risk factor for nosocomial transmission.23 In one study, a colonization pressure above 30% led to a 5-fold increase in the risk of MRSA colonization.24 Due to the large number of patients who are colonized at the time of admission, the use of routine surveillance cultures and the placement of colonized patients into cohorts may not affect the rates of colonization unless all patients are immediately placed under contact precautions even before the surveillance cultures are analyzed. Furthermore, the success of MRSA control that is based mainly on the identification of carriers through the analysis of surveillance cultures depends on the sensitivity of these cultures, which may not be sufficiently high to detect all colonized patients. Some authors have reported that the lack of throat culturing may lead to an underestimation of the percentage of MRSA carriers by as much as 8 to 18%.25, 26 The clinical impact and the relevance of routine patient culturing may be contested because, despite a high proportion of colonized patients, there were only two cases of bloodstream infection in our six-month study period. Routine culturing and the use of patient cohorts and private rooms for positive patients are expensive and laborintensive measures. In our hospital, most rooms are meant to hold two or four patients, and there are very few private rooms. During patient isolation, the rooms are not used at full capacity, which is a problem because there is a nationwide shortage of hospital beds. In addition, although the carriage of S. aureus is considered a risk factor for the development of infection,10 one prospective study found that nasal colonization with MRSA was a poor predictor of the subsequent occurrence of MRSA respiratory tract or bloodstream infection.27 This study also addressed the role of HCWs in the transmission of MRSA. Among HCWs, MRSA was observed in 15% of the cultures. Only three HCWs were positive on both occasions, but two HCWs harbored different molecular types of MRSA at each culture, suggesting transient carriage. Interestingly, half of the HCWs who were positive for MRSA harbored isolates of subtypes that were not present among the patients. This result suggests that a large

Table 3 - Multilocus sequence typing results for 10 methicillin-resistant S. aureus subtypes that colonized patients hospitalized in the dermatology unit over a period of 6 months. SCCmec type

Beginning of study (n: 37) 5 (14%) positive for MRSA

MRSA: methicillin-resistant S. aureus; PFGE: pulsed-field gel electrophoresis.

the southern region of the country19, 20 near the border with Uruguay, which is a country in which CA-MRSA is a significant problem. In addition, in a previous study of MRSA isolates obtained from bloodstream infections,21 there were six cases of hospital-acquired MRSA bacteremia the dermatology unit. Thus, we expected most of the cases of MRSA colonization to be hospital acquired. However, in our dermatology unit, we observed that approximately half of the colonization cases were hospital-acquired and that a significant proportion of patients were positive for MRSA at the time of admission. Our results suggest that many patients are colonized by community-acquired MRSA or are colonized at other healthcare facilities and may be a source of MRSA transmission to other patients in the hospital. There was a significantly higher proportion of patients with pemphigus and other bullous diseases among MRSA carriers, which suggested that disseminated bullous disease is a risk factor for MRSA colonization. During the entire study period, nosocomial transmission of MRSA occurred as well as admission of colonized patients. This likely generated or increased colonization pressure and made control more difficult despite the efforts directed to prevent nosocomial MRSA transmission. Over the six-month study period, the frequency of nosocomialacquired cases tended to decrease, but the colonization pressure increased from 13% to 59%. We attributed this

Sequence type

Molecular PFGE type (n)

III (1)

MRSA: methicillin-resistant S. aureus; PFGE: pulsed-field gel electrophoresis; ND: not determined.

Subtype determined by PFGE

SCCmec type (n)

Healthcare workers

PFGE: pulsed-field gel electrophoresis; SCCmec: staphylococcal chromosomal cassette mec; ND: not determined; -: absence of mecA.

2075

MRSA carriage in a dermatology unit Pacheco RL et al.

CLINICS 2011;66(12):2071-2077

Table 5 - Antimicrobial susceptibility according to SCCmec type of 71 MRSA isolates that colonized 60 patients and 11 healthcare workers in the dermatology unit over a period of 6 months. Number of susceptible isolates (%)

Antimicrobial drug

Chloramphenicol Ciprofloxacin Clindamycin Erythromycin Gentamicin Rifampicin Sulfamethoxazole/ trimethoprim Tetracycline Vancomycin

SCCmec type III (n: 25)

SCCmec type IV (n: 46)

Total (n: 71)

20 (80%) 0 0 0 0 9 (36%) 0 0 25 (100%)

46 (100%) 43 (93%) 35 (76%) 15 (33%) 27 (59%) 46 (100%) 45 (98%) 40 (87%) 46 (100%)

66 (93%) 43(61%) 35 (49%) 15 (21%) 27(38%) 55 (77%) 45 (63%) 40 (56%) 71 (100%)

proportion of the HCW colonizations were acquired outside of the hospital, either in the community or at other institutions. MRSA with SCCmec type III was multidrug resistant and belonged to the Brazilian Endemic Clone (BEC). Molecular typing by pulsed-field gel electrophoresis (PFGE) revealed three different types and one predominant type (79%). Within this predominant type, there were nine different subtypes. The BEC has been endemic in Brazil for more than a decade.28 During this time, it is likely that changes occurred that made Tenover’s criteria17 inadequate to interpret its clonality. In this situation, multilocus sequence typing (MLST) is more useful because it evaluates seven housekeeping genes that are more stable over time.29 BEC presents as sequence type ST-239,28 and all of the SCCmec type III isolates tested in our study also belonged to this ST. The presence of MRSA with SCCmec type IV at our hospital is a more recent phenomenon than the existence of the BEC. Therefore, the PFGE typing reflected clonality that was similar although not identical to the MLST.21 Furthermore, we expected that the SCCmec type IV would be mainly community acquired. However, similar to other geographic areas,30 it seems as though this type has crossed hospital borders and circulates not only in the community but also in the hospital environment. As observed in other studies conducted at our hospital,21,31 SCCmec type IV MRSA isolates from dermatologic patients did not express the Panton-Valentine leukocidin (PVL) virulence factor. The tst gene was also absent from all of the isolates. This finding is interesting because PVLproducing clones have been associated with skin and soft tissue infections32,33 and because TSST-1 is the cause of skin lesions. On the other hand, in a hospital environment, where patients are severely ill and have many diseases, a virulent strain of S. aureus would probably not be successful because it would cause severe infection and high mortality, as it does in the community. Our study has limitations. First, it was our original intention to use the CDC definitions, but the necessary information was not available for a large proportion of the included patients. Because of this lack of information, we had to introduce the ‘‘indeterminate’’ category. There was a large proportion of patients for which the origin of colonization was deemed indeterminate, which was in part due to the fact that surveillance culturing immediately upon admission was only initiated halfway into the study. In addition, we did not observe SCCmec types other than types

I to IV, and there were a few isolates for which we could not determine the type. Finally, it was not possible to perform MLST analyses on each of the PFGE subtypes. In summary, almost half of the dermatology patients in this study were colonized by MRSA at the time of hospital admission or acquired MRSA while in the hospital. Half of the nosocomial MRSA cases were SCCmec type IV. Nosocomial MRSA colonization continued throughout the study period despite the identification of colonized patients, the use of contact precautions and patient cohorting or the placement of patients in private rooms based on their surveillance cultures. Colonization pressure continuously increased during the study period, which may partly explain the difficulty in controlling the spread of MRSA. Pemphigus and other bullous diseases were significantly associated with MRSA colonization. The healthcare workers were predominantly colonized by SCCmec type IV MRSA, and this colonization was found to be transient and predominantly community acquired.

ACKNOWLEDGMENTS This study was funded by grants from the Fundaçaõ de Amparo a` Pesquisa do Estado de Saõ Paulo (FAPESP)- 06/03003-7; 05/5754-0 and 06/ 00569-0. We thank Robson E. Soares for his suggestions in the laboratory and with the manuscript.

AUTHOR CONTRIBUTIONS Pacheco RL was responsible for the collection of patient data and clinical specimens, laboratory procedures and analysis of data. Lobo RD was responsible for the collection of data and specimens, implementation of control measures and contributed to the writing of the manuscript. Oliveira MS was responsible for the collection of data and specimens, implementation of control measures and contributed to the writing of the manuscript. Farina EF was responsible for the laboratory procedures and analysis of data. Santos CR was responsible for the collection of data and specimens and implementation of control measures. Costa SF supervised the laboratory work. Padoveze MC and Garcia CP contributed to the writing of the manuscript. Trindade PA was responsible for the laboratory procedures. Quite´rio LM and Rivitti EA were responsible for the organization of the unit and implementation of control measures. Mamizuka EM was responsible for the laboratory procedures. Levin AS was responsible for the general supervision and the writing of the manuscript.

REFERENCES 1. Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis. 2008;46:S350-9, doi: 10.1086/533591.

2076

CLINICS 2011;66(12):2071-2077

MRSA carriage in a dermatology unit Pacheco RL et al.

2. Boucher HW, Corey GR. Epidemiology of methicillin-resistant Staphylococcus aureus. Clin Infect Dis. 2008;46:S344-9, doi: 10.1086/ 533590. 3. Ito T, Hiramatsu K. Acquisition of methicilin resistance and progression of multiantibiotic resistance in methicilin-resistant Staphylococcus aureus. Yonsei Med J. 1998;39:526-33. 4. Hiramatsu K, Ito T, Hanaki H. Mechanisms of methicillin and vancomycin in Staphylococcus aureus. Clin Infect Dis. 1999;5:221-42. 5. Shore AC, Deasy EC, Slickers P, Brennan G, O’Connell B, Monecke S, et al. Detection of Staphylococcal Cassette Chromosome mec Type XI Carrying Highly Divergent mecA, mecI, mecR1, blaZ, and ccr Genes in Human Clinical Isolates of Clonal Complex 130 Methicillin-Resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2011;55:3765-73, doi: 10.1128/AAC.00187-11. 6. Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob Agents Chemother. 2004;48:2637-51, doi: 10.1128/AAC.48.7.2637-2651.2004. 7. Oliveira DC, Milheirico C, Lencastre H. Redefining a structural variant of staphylococcal cassette chromosome mec, SCCmec type VI. Antimicrob Agents Chemother. 2006;50:3457-9, doi: 10.1128/AAC.00629-06. 8. Harbarth S, Masuet-Aumatell C, Schrenzel J, Francois P, Akakpo C, Renzi G, et al. Evaluation of rapid screening and pre-emptive contact isolation for detecting and controlling methicillin-resistant Staphylococcus aureus in critical care: an interventional cohort study. Crit Care. 2006;10:R25, doi: 10.1186/cc3982. 9. Albrich WC, Harbarth S. Health-care workers: source, vector, or victim of MRSA? Lancet Infect Dis. 2008;8:289-301, doi: 10.1016/S14733099(08)70097-5. 10. Kluitmans J, Wertheim HF. Nasal carriage of Staphylococcus aureus: and prevention of nosocomial infections. Infection. 2005; 33:3-8, doi: 10.1007/ s15010-005-4012-9. 11. Clinical and Laboratory Standards Institute, Performance standard for antimicrobial susceptibility testing. Document M100–S17. Wayne, Pennsylvania: CLSI, 2007. 12. Kearns AM, Seiders PR, Wheeler J, Freeman R, Steward M. Rapid detection of methicillin-resistant staphylococci by multiplex PCR. J Hosp Infect. 1999;43:33-7, doi: 10.1053/jhin.1999.0631. 13. National Committee for Clinical Laboratory Standards: Methods for dilution antimicrobial susceptibility test for bacteria that grow aerobically. In Approved standard M7-A5 5th edition. NCCLS. Wayne, Pa, 2002. 14. Bannerman TL, Hancock GA, Tenover FC, Miller JM. Pulsed-field gel electrophoresis as a replacement for bacteriophage typing of Staphylococcus aureus. J Clin Microbiol. 1995;33:551-5. 15. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233-9. 16. Enright MC, Day NP, Davies CE Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptile clones of Stapylococcus aureus. J Clin Microbiol. 2000;38:1008-15. 17. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002;46:2155-61, doi: 10.1128/AAC.46.7.2155-2161.2002. 18. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70:631-41, doi: 10.1128/IAI.70.2.631-641.2002. 19. Ribeiro A, Coronado AZ, Silva-Carvalho MC, Ferreira-Carvalho BT, Dias C, Rozenbaum R, et al. Detection and characterization of international community-acquired infections by methicillin-resistant Staphylococcus

20.

21.

22.

23.

24.

25. 26. 27.

28.

29.

30.

31.

32. 33.

2077

aureus clones in Rio de Janeiro and Porto Alegre cities causing both community- and hospital- associated diseases. Diagn Microbiol Infect Dis. 2007; 59:339-45, doi: 10.1016/j.diagmicrobio.2007.05.007. Ribeiro A Dias C, Silva-Carvalho MC, Berquo´ L, Ferreira FA, Santos RN, Ferreira-Carvalho BT, et al. First report of infection with communityacquired methicillin-resistant Staphylococcus aureus in South America. J Clin Microbiol. 2005;43:1985-8, doi: 10.1128/JCM.43.4.1985-1988.2005. Trindade PDA, Pacheco RL, Costa SF, Rossi F, Barone AA, Mamizuka EM, et al. Prevalence of SCCmec Type IV in Nosocomial Bloodstream Isolate of Methicillin-Resistant Staphylococcus aureus Clone. J Clin Microbiol. 2005;43:3435-7, doi: 10.1128/JCM.43.7.3435-3437.2005. Bonten MJ, Slaughter S, Ambergen AW, Hayden MK, van Voorhis J, Nathan C, et al. The role of ‘‘colonization pressure’’ in the spread of vancomycin-Resistant enterococci-an important infection control variable. Arch Intern Med. 1998;158:1127-32, doi: 10.1001/archinte.158.10. 1127. Williams VR, Callery S, Vearncombe M, Simor AE. The role of colonization pressure in nosocomial transmission of methicillinresistant Staphylococcus aureus. Am J Infect Control. 2009;37:106-110, doi: 10. 1016/j.ajic.2008.05.007. Merrer J, Santoli F, Appe´re´ de Vecchi C, Tran B, De Jonghe B, Outin H. ‘‘Colonization pressure’’ and risk of acquisition of methicillin-resistant Staphylococcus aureus in a medical intensive care unit. Infect Control Hosp Epidemiol. 2000;21:718-23, doi: 10.1086/501721. Mertz D, Frei R, Jaussi B, Tietz A, Stebler C, Fluckiger U, et al. Throat Swabs Are Necessary to Reliably Detect Carriers of Staphylococcus aureus. Clin Infect Dis. 2007;45:475–7, doi: 10.1086/520016. Nilsson P, Ripa T. Staphylococcus aureus throat colonization is more frequent than colonization in the anterior nares. J Clin Microbiol. 2006;44:3334–9, doi: 10.1128/JCM.00880-06. Sarikonda KV, Micek ST, Doherty JA, Reichley RM, Warren D, Kollef MH. Methicillin-resistant Staphylococcus aureus nasal colonization is a poor predictor of intensive care unit-acquired methicillin-resistant Staphylococcus aureus infections requiring antibiotic treatment. Crit Care Med. 2010;38:1991-5. Vivoni AM, Diep BA, de Gouveia Magalha˜es AC, Santos KR, Riley LW, Sensabaugh GF, et al. Clonal composition of Staphylococcus aureus isolates at a Brazilian university hospital: identification of international circulating lineages. J Clin Microbiol. 2006;44:1686-91, doi: 10.1128/JCM. 44.5.1686-1691.2006. Faria NA, Carrico JA, Oliveira DC, Ramirez M, de Lencastre H. Analysis of typing methods for epidemiological surveillance of both methicillinresistant and methicillin-susceptible Staphylococcus aureus strains. J Clin Microbiol. 2008;46:136-44, doi: 10.1128/JCM.01684-07. Schuenck RP, Noue´r SA, Winter Cde O, Cavalcante FS, Scotti TD, Ferreira AL, et al. Polyclonal presence of non-multiresistant methicillinresistant Staphylococcus aureus isolates carrying SCCmec IV in health care-associated infections in a hospital in Rio de Janeiro, Brazil. Diagn Microbiol Infect Dis. 2009;64:434-41, doi: 10.1016/j.diagmicrobio.2009.04. 007. Vidal PM, Trindade PA, Garcia TO, Pacheco RL, Costa SF, Reinert C, et al. Differences between ‘‘classical’’ risk factors for infections caused by methicillin-resistant Staphylococcus aureus (MRSA) and risk factors for nosocomial bloodstream infections caused by multiple clones of the staphylococcal cassette chromosome mec type IV MRSA strain. Infect Control Hosp Epidemiol. 2009;30:139-45, doi: 10.1086/593954. Boyle-Vavra S, Daum RS. Community-acquired methicillin-resistant Staphylococcus aureus: the role of Panton-Valentine leukocidin. Lab Invest. 2007;87:3-9, doi: 10.1038/labinvest.3700501. Jahamy H, Ganga R, Al Raiy B, Shemes S, Nagappan V, Sharma M, et al. Staphylococcus aureus skin/soft-tissue infections: the impact of SCC type and Panton-Valentine leukocidin. Scand J Infect Dis. 2008;40:601-6, doi: 10.1080/00365540701877312.

CLINICS 2011;66(12):2079-2084

DOI:10.1590/S1807-59322011001200013

CLINICAL SCIENCE

Muscle strength and exercise intensity adaptation to resistance training in older women with knee osteoarthritis and total knee arthroplasty Emmanuel Gomes Ciolac,I,II Ju´lia Maria D’Andre´a GreveI I

Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Institute of Orthopedics and Traumatology, Laboratory of Kinesiology, Saõ Paulo/SP, Brazil. II Universidade do Grande ABC.

OBJECTIVES: To analyze muscle strength and exercise intensity adaptation to resistance training in older women with knee osteoarthritis and total knee arthroplasty. METHODS: Twenty-three community-dwelling women were divided into the following groups: older, with knee osteoarthritis and total knee arthroplasty in the contralateral limb (OKG; N = 7); older, without symptomatic osteoarthritis (OG; N = 8); and young and healthy (YG; N = 8). Muscle strength (1-repetition maximum strength test) and exercise intensity progression (workload increases of 5%–10% were made whenever adaptation occurred) were compared before and after 13 weeks of a twice-weekly progressive resistance-training program. RESULTS: At baseline, OKG subjects displayed lower muscle strength than those in both the OG and YG. Among OKG subjects, baseline muscle strength was lower in the osteoarthritic leg than in the total arthroplasty leg. Muscle strength improved significantly during follow-up in all groups; however, greater increases were observed in the osteoarthritic leg than in the total knee arthroplasty leg in OKG subjects. Greater increases were also seen in the osteoarthritic leg of OKG than in OG and YG. The greater muscle strength increase in the osteoarthritic leg reduced the interleg difference in muscle strength in OKG subjects, and resulted in similar posttraining muscle strength between OKG and OG in two of the three exercises analyzed. Greater exercise intensity progression was also observed in OKG subjects than in both OG and YG subjects. CONCLUSIONS: OKG subjects displayed greater relative muscle strength increases (osteoarthritic leg) than subjects in the YG, and greater relative exercise intensity progression than subjects in both OG and YG. These results suggest that resistance training is an effective method to counteract the lower-extremity strength deficits reported in older women with knee osteoarthritis and total knee arthroplasty. KEYWORDS: Knee Osteoarthritis; Total Knee Arthroplasty; Muscle Strength; Resistance Exercise; Elderly. Ciolac EG, Greve JMD. Muscle strength and exercise intensity adaptation to resistance training in older women with knee osteoarthritis and total knee arthroplasty. Clinics. 2011;66(12):2079-2084. Received for publication on July 26, 2011; First review completed on August 10, 2011; Accepted for publication on August 29, 2011 E-mail: egciolac@hcnet.usp.br (Dr. EG Ciolac)

of their association with functional activities (i.e., walking and stair climbing) and lower limb loading distribution,3,4 quadriceps muscle strength deficits following TKA have considerable long-term consequences, and these deficits are even associated with the progression of OA in the uninvolved leg.4,5 Resistance training has been shown to be the most effective exercise for improving muscle strength.6 Aging has not been shown to affect the ability to improve muscle strength through resistance training, and both older men and women without physical limitations have been shown to increase muscle strength and training intensity in the same way as young subjects.7,8 However, there is a paucity of research analyzing the effects of resistance training on muscle strength of older subjects following knee replacement surgery, and the data that are available are inconclusive.9,10 Although an individualized resistance training program (2–3 sets of 10 repetition maximum (RM)) applied four weeks after TKA was safe and effective

INTRODUCTION Knee osteoarthritis (OA) is a common clinical condition that has a major impact on the functioning and independence of the elderly.1 Knee OA patients with radiographic evidence of joint damage, moderate to severe persistent pain, and clinically significant functional limitations that diminish quality of life are candidates for total knee arthroplasty (TKA).2 Although TKA reduces pain and improves perceived function, patients continue to exhibit reduced muscle strength, voluntary muscle activation, and functional performance even years after surgery.3 Because

2079

Resistance training in knee OA and TKA Ciolac EG and Greve JMD

CLINICS 2011;66(12):2079-2084

for improving isometric muscle strength,9 a standard resistance training program (three sets of 10–12 repetitions at 70% of 1-RM) failed to increase isometric muscle strength when applied one to four years after surgery.10 Moreover, to the best of our knowledge, there are no studies analyzing the dynamic muscle strength and resistance training progression in older subjects with TKA and OA in the contralateral knee. An understanding of the musculoskeletal adaptation to resistance training in subjects with TKA and OA in the contralateral knee may inform the design of future therapeutic programs to mitigate the muscle impairments and related functional limitations in this population. Thus, the aim of the present study was to analyze the muscle strength response and exercise intensity progression to resistance training in older women with knee OA and TKA.

Table 1 - Subject characteristics at baseline. Variable N Age (years) BMI (kg/m2) Waist Circumference (cm) Blood Pressure (mmHg) Systolic Diastolic

OKG

7 75.3¡3.1 32.4¡4.8 107.8¡12.5

8 70.4¡5.3 28.1¡5.2 92.9¡11.2

8 23.7¡3.5 23.0¡3.4 81.3¡8.4

120.2¡7.7 69.7¡4.7

119.3¡15.0 65.3¡12.7

103.4¡8.1 a,d 62.1¡7.3 b

a,c a,d a,d

OKG: Older knee osteoarthritis and total knee arthroplasty group. OG: Older control group. YG: Young control group. N: number of subjects; BMI: body mass index. Significantly different from OKG: a = p,0.001; b = p,0.05. Significantly different from OG: c = p,0.001; d = p,0.05.

measurements were conducted two to five days after the last exercise session) by a 1-RM strength test. Exercise training workload was monitored and recorded at each session to measure exercise intensity progression throughout the study period. The study was approved by the ethics committee at our institution. All volunteers read a detailed description of the study protocol and provided their written informed consent.

METHODS Participants and Study Design We recruited seven older women with unilateral TKA for at least 14 months (38.5¡18.5 months; range, 14–66 months) due to severe OA and an established diagnosis of knee OA11 in the contralateral limb (Kellgren/Lawrence scale grades12 of 2–4) (OKG; 70–79 years); eight older women without symptomatic OA (OG; 65–79 years); and eight healthy young women (YG; 21–30 years). Subjects in all three groups underwent physical exercise screening for participation in the Cardiovascular and Muscular Fitness Program of the Laboratory of Kinesiology at the Institute of Orthopedics and Traumatology, Medical School, University of Sao Paulo. All volunteers were physically inactive and did not practice resistance training for at least the 12 months preceding the study. Before beginning the study, a structured history, medical record review, and physical evaluation of each the participants were performed to document symptoms, history of chronic diseases, current medications, cardiac risk factors, and cardiac events and procedures. None of the volunteers had uncontrolled cardiovascular or metabolic diseases, insulin-dependent diabetes, chronic psychological disorders and /or cardiac disease (defined as those with a history of myocardial infarction, angiographically documented coronary artery disease, coronary angioplasty, coronary bypass surgery or chronic heart failure). The OG and YG subjects also did not have any musculoskeletal limitations to physical exercise. The demographic characteristics of the women included in the study are summarized in Table 1. Volunteers in the OKG group were more obese than those in the OG and YG groups. All OKG and OG volunteers had controlled hypertension (diuretics, n = 7; angiotensin-converting enzyme inhibitors, n = 8; calcium channel blockers, n = 4; and bblockers, n = 2); three OKG volunteers and two OG volunteers had osteopenia (alendronate sodium, n = 5); and one OKG volunteer and two OG volunteers had dyslipidemia (simvastatin, n = 3). None of the YG women was taking any medication. After screening, all volunteers participated in a twiceweekly lower limb resistance-training program for 13 weeks, and muscle strength and exercise intensity progression were compared between groups. Muscle strength was measured both before and after the intervention (postintervention

Strength Test To determine muscle strength and the initial workload for each resistance exercise, the 1-RM test was performed after four familiarization sessions and 2–5 days after the last exercise session, as described previously.7,8 In brief, the 1RM test was performed on the leg press, knee curl and calf raise using the same weight-lifting machines that were used for training (Biodelta Inc., Sao Paulo, Brazil). All volunteers performed the tests unilaterally following the exercise order described above (after proper warm-up), and both legs were tested. 1-RM workload was defined as the maximum weight that could be moved once through the full or pain-free (OA leg of OKG) range of motion with proper form and without performing the Valsalva maneuver. The muscle strength data were normalized for body mass with the allometric method (strength [kg] x body mass [kg]20.67) for inter- and intragroup comparisons.13 All tests were conducted by the same investigator both before and after the exercise training period. In our laboratory, the intraclass correlation for 1-RM test-retest measures was 0.983 (95% confidence interval = 0.964–0.997).

Exercise program The exercise training program, designed to develop muscle mass and strength, was performed twice-weekly for 13 weeks. Each exercise session was monitored by an exercise specialist and lasted for approximately 25 minutes, including warm-up and cool-down (5 minutes each). The resistance exercises consisted of two sets of 8–12 repetitions each of the same three exercises described in the explanation of the 1-RM test. The resistance exercises were performed unilaterally, and the initial workload was 60% of the 1-RM of the weaker leg. The volunteers were encouraged to perform at their maximum capacity during the sets of 8–12 repetitions prescribed, using proper form and avoiding the Valsalva maneuver. All subjects were instructed to take a 30- to 60-second rest between sets, which were performed alternately between legs.

2080

CLINICS 2011;66(12):2079-2084

Resistance training in knee OA and TKA Ciolac EG and Greve JMD

(p = 0.035). Among the OKG subjects, the OA leg also showed lower pretraining muscle strength than the TKA leg in the leg press (p = 0.033) but not in the knee curl and calf raise exercises. Resistance training increased muscle strength in all groups, but the OA leg of OKG subjects showed a greater muscle strength increase than the dominant leg of YG subjects in all exercises (p,0.05) and than the TKA leg in the leg press exercise (Figure 1). With these greater increases, the OA leg of OKG subjects showed similar posttraining muscle strength to the TKA leg in all exercises. Moreover, the OA leg of OKG subjects also showed similar posttraining muscle strength to the dominant leg of OG subjects in both the knee curl and calf raise strength exercises. There were no significant differences between the TKA leg of OKG subjects and the dominant leg of OG subjects and YG subjects in resistance training-induced muscle strength increases.

Exercise intensity progression To promote a sufficient workload to produce improvements throughout the 13 weeks of training, the exercise intensity was increased by 0.5–10 kg (5%–10%) whenever the subjects had adapted to the exercise workload. Exercise adaptation was considered to be achieved when two sets of 12 repetitions using proper form and avoiding the Valsalva maneuver were performed in both legs.

Statistical Analyses All data are reported as the mean ¡ standard deviation. The statistical program SigmaStat 3.5 for Windows (Systat Software Inc., Chicago, IL USA) was used for statistical analyses. The Kolmogorov–Smirnov test was applied to ensure a Gaussian distribution of the data. Differences in the characteristics of volunteers and postexercise muscle strength improvements were analyzed by one-way ANOVA. Two-way ANOVA (group vs. time) for repeated measurements was used to analyze the 1-RM strength test data. The Bonferroni post hoc analysis was used to determine the significant data indicated by ANOVA. Because of its nonparametric distribution, exercise intensity progression was analyzed by the Kruskal-Wallis test, and Dunn’s post hoc test was used to determine the significant data indicated by Kruskal-Wallis. The significance level was set at p,0.05. To obtain an estimate of the size effect expected for the variables in our sample, we relied on the results of exercise training studies similar to ours.7,8 Considering that the results of those studies produced a 17%–40% increase in muscle strength with no difference between younger and older adults, we estimated that an overall sample of 7 subjects for each age group would be required to provide a power of 80% to detect a muscle strength change of 20% with a two-sided alpha of ,0.05.

Exercise intensity progression Resistance exercise relative workload increase curves are displayed in Figure 2. Because exercise intensity was increased only when both legs performed two sets of 12 repetitions with the proper form and avoiding the Valsalva maneuver, the relative workload increase curves were the same for both the OA leg and the TKA leg of OKG subjects or the dominant and nondominant legs of OG and YG subjects. Despite their lower muscle strength levels, OKG subjects showed greater resistance training intensity progression than YG subjects in all exercises (p,0.01). The leg press and calf raise resistance training intensity progression were also greater in OKG subjects than in OG subjects (p,0.01). No significant differences in the resistance training intensity progression were observed between OG and YG subjects. The exercise intensity progression method used in this study was found to be safe because no injuries, muscle damage or major muscle or joint pain were observed in the three groups during the study period.

RESULTS Muscle strength Because no significant differences were observed between the dominant and nondominant legs in the 1-RM tests (preand posttraining) or in the muscle strength increase between the YG and OG groups, only the dominant leg data for the YG and OG are provided in the manuscript. Data from the 1-RM tests are displayed in Table 2. At baseline, the OA leg of OKG subjects showed lower muscle strength than the dominant leg of both OG and YG subjects in all exercises (p,0.05). The TKA leg of OKG subjects showed lower pretraining muscle strength than the dominant leg of YG subjects in all exercises (p,0.01) and lower muscle strength than the dominant leg of OG subjects only in the leg press

DISCUSSION To the best of our knowledge, this is the first study that focused on analyzing the muscle strength response to resistance training and exercise intensity progression in older women with TKA and symptomatic OA in the contralateral knee. The primary findings of the present study are as follows: a twice-weekly resistance training program was effective in improving the muscle strength of older women with TKA and knee OA, the muscle strength

Table 2. 1-repetition maximum strength test before and after 13 weeks of exercise training. Exercise

OKG (N = 7) OA TKA OG (N = 8) YG (N = 8)

Leg Press (kg.kg20.67)

Knee Curl (kg.kg20.67)

Pre

1.23¡0.15 1.74¡0.09 2.02¡0.15 2.75¡0.79

Post

a a,b a,b,c

1.91¡0.21 2.20¡0.19 2.77¡0.34 3.28¡0.81

d d a,b,d a,b,d

0.31¡0.06 0.37¡0.09 0.47¡0.15 1.04¡0.13

Calf Raise (kg.kg20.67)

Post

a a,b,c

0.53¡0.09 0.57¡0.12 0.66¡0.14 1.36¡0.12

Pre d d d a,b,c,d

1.35¡0.41 1.64¡0.30 2.15¡0.49 3.68¡0.83

Post

a a,b,c

2.21¡0.63 2.43¡0.36 2.89¡0.47 4.52¡0.65

d d d a,b,c,d

OKG: Older knee osteoarthritis and total knee arthroplasty group. OG: Older control group. YG: Young control group. OA: Lower limb with knee osteoarthritis. TKA: lower limb with total knee arthroplasty. a: difference from OA limb at the same period (P , 0.05). b: difference from TKA limb at the same period (P,0.05). c: difference from OC at the same period (P,0.05). d: difference from pre-exercise at same group (P,0.001).

2081

Resistance training in knee OA and TKA Ciolac EG and Greve JMD

CLINICS 2011;66(12):2079-2084

Figure 1 - Muscle strength (1-RM test) increase after 13 weeks of resistance training. OKG: Older knee osteoarthritis and total knee arthroplasty group. OG: Older control group. YG: Young control group. OA: Lower limb with knee osteoarthritis. TKA: lower limb with total knee arthroplasty. a denotes significant difference between TKA and OA legs (p,0.05).

lower than the deficits observed in these previous studies. However, the methodology used to analyze muscle strength (isokinetic knee extension or isometric contraction vs. leg press 1-RM strength) might explain this lower deficit. Another interesting finding of the present study was that the contralateral leg showed 29.6%¡6.7% lower leg press 1RM strength than the TKA leg, whereas previous studies have shown 12%–31% greater quadriceps muscle strength in the contralateral leg.3,15 The probable explanation for this discrepancy is the population studied. Previous studies have analyzed quadriceps muscle strength in TKA individuals without symptomatic OA in the contralateral knee,3,15 and we studied only TKA women with symptomatic OA in the contralateral knee. Thus, it is possible that the damage in the OA knee explains its lower muscle strength. Resistance training is the most effective intervention for improving muscle strength and has been recommended in guidelines for knee OA management16,17 and in clinical reviews for TKA rehabilitation.3 Previous studies have shown a 6%–46% increase in the quadriceps and hamstring strength of subjects with knee OA performing moderate- to high-intensity resistance exercise programs.18-20 These increases are lower than the 56%–74% increase observed in the OA leg of OKG subjects in the present study. The different exercise type and intensity performed, as well as the different methods used to analyze muscle strength, are possible explanations for the greater muscle strength

improvements observed in the OA limb were greater than those in the TKA limb, and the muscle strength improvements observed in the OA limb were greater than those observed in both young and older women without OA who performed the same exercise program. The present study also showed greater resistance exercise intensity progression in older women with TKA and knee OA than in younger and older women without OA. The greater muscle strength increases in the OA leg resulted in restored muscle strength deficits between the OA and TKA legs of OKG subjects. Moreover, the OA leg knee curl and calf raise muscle strength were restored to levels similar to those of OG subjects. Muscle strength impairment is of particular concern after TKA. Although hamstring strength deficits are reported after TKA, quadriceps weakness has received greater attention because of its strong association with normal functional activities, such as walking and stair climbing.3 Quadriceps muscle strength improvements do occur during the first year after surgery, but residual strength deficits persist for years in individuals following TKA.3 Previous studies comparing TKA individuals with healthy agematched subjects have shown 19%–35% deficits in quadriceps muscle strength measured 1.7–2.8 years after TKA.14,15 In the present study, the approximately 13.9% baseline leg press 1-RM strength deficit observed in the TKA leg of OKG subjects compared with OG subjects was

Figure 2 - Relative workload increase curves. OKG: Older knee osteoarthritis and total knee arthroplasty group. OG: Older control group. YG: Young control group. a denotes significant difference from OKG - OA (p,0.05). b denotes significant difference from YG (p,0.01).

2082

CLINICS 2011;66(12):2079-2084

Resistance training in knee OA and TKA Ciolac EG and Greve JMD

older women with knee OA and TKA can safely increase resistance exercise intensity more than both older and younger women without musculoskeletal limitations. It is important to note that no injuries, muscle damage or major muscle or joint pain were observed in the OKG subjects. Because muscle strength may play an important protective role in the progression of knee OA,16,18 and muscle weakness is strongly associated with the physical function of both knee OA and TKA individuals,3,25,26 the traininginduced muscle strength increases observed in the OKG subjects may have important prognostic implications for older women with knee OA and TKA. Future investigations addressing knee OA progression and physical functioning in this population are necessary. The statistical power of the present study is adequate for the outcome being evaluated (muscle strength increase); however, caution must be taken in generalizing the present results. The small number of women studied may not represent the greater population of patients with knee OA and TKA. Although we demonstrated the short-term efficacy and safety of a resistance training program in improving the muscle strength of patients with knee OA and TKA, future larger studies with a control group and long-term follow-up, focused on analyzing end-points such as radiographic evaluation of disease progression or a second TKA, would offer additional compelling evidence for the validity of the present findings. In summary, OKG subjects displayed a greater muscle strength increase and resistance exercise intensity progression than OG and YG subjects. The exercise intensity and criteria adopted for workload progression did not promote any injury, muscle damage or major muscle or joint pain in our study population. These results suggest that resistance training is an effective method to counteract the lowerextremity strength deficits reported in older women with knee OA and TKA.

increase observed in the present study. There is a lack of information regarding the appropriate intensity of resistance training in patients with knee OA.21 In the present study, the OKG subjects trained at the same intensity as that recommended for younger and older people without limitations,6,22 and no adverse events due to the exercise protocol were observed. Moreover, OKG subjects showed a greater leg press muscle strength increase in the OA leg than the TKA leg and a greater muscle strength increase in the OA leg than the dominant leg of YG subjects in all exercises. The OA leg of OKG subjects also showed a greater muscle strength increase than the dominant leg of OG subjects in all exercises. Although these greater increases did not reach statistical significance, they were enough both to increase the OA leg knee curl and calf raise muscle strength of OKG subjects to levels similar to those of OG subjects and to reduce the leg press muscle strength deficit between the OA leg of OKG subjects and the dominant leg of OG subjects. The low baseline muscle strength levels in the OA leg of OKG subjects, which is generally a consequence of disuse due to OA pain,23 may explain the greater muscle strength increase in the OA leg found in the present study. Although muscle weakness is of particular concern after TKA, and interventions to improve muscle strength in subjects with TKA are recommended,3 there are few studies analyzing the effects of resistance training in this population.9,10,24 Most studies have assessed TKA outpatients who initiated rehabilitation soon after discharge from the hospital,9,24 and the greater muscle and mobility impairments in the early postoperative phase makes comparison with the present results unreasonable. The only study analyzing the effects of resistance training in subjects at least one year after TKA compared the effects of an eccentric versus traditional (concentric/eccentric) resistance training program in subjects with TKA (one to four years after surgery) and found an approximate 12.7% increase in isometric muscle strength after 12 weeks of eccentric resistance training. No significant differences were observed after traditional resistance training.10 The inclusion of subjects with unilateral and bilateral TKA, the use of bilateral exercises and the methodology used to analyze muscle strength are possible explanations for the lower muscle strength increase observed in the previous study compared with the increases observed here. Another important finding of the present study was that resistance exercise intensity progression was greater in OKG subjects than in OG and YG subjects. Resistance exercise recommendations for both younger and older people include 1–3 sets of 8–12 repetitions of 8–10 exercises, 2–3 days/week.6,22 However, it has been generally suggested that resistance exercise intensity should have a slower and decreased rate of progression in older adults than in younger adults, mainly in older adults with physical limitations.6,22 Previous studies from our group do not support this recommendation, showing that healthy older subjects who were previously sedentary are able to increase resistance exercise intensity in the same way as younger subjects when the same resistance training program is performed.7,8 Moreover, we have shown that older men who are trained aerobically are able to increase resistance exercise intensity even more than sedentary young men.7 The present study confirms the ability of healthy older women to safely increase resistance exercise intensity in the same manner as younger women and further suggests that

AUTHOR CONTRIBUTIONS EG Ciolac participated in the study design, data collection and analysis, and manuscript preparation. JMD Greve participated in the study design and manuscript preparation.

REFERENCES 1. Bitton R. The economic burden of osteoarthritis. Am J Manag Care. 2009;15:S230-5. 2. American Academy of Orthopedic Surgeons. Total knee replacement. 2006. 3. Meier W, Mizner RL, Marcus RL, Dibble LE, Peters C, LaStayo PC. Total knee arthroplasty: muscle impairments, functional limitations, and recommended rehabilitation approaches. J Orthop Sports Phys Ther. 2008;38:246-56. 4. Mizner RL, Snyder-Mackler L. Altered loading during walking and sitto-stand is affected by quadriceps weakness after total knee arthroplasty. J Orthop Res. 2005;23:1083-90, doi: 10.1016/j.orthres.2005.01.021. 5. Shakoor N, Block JA, Shott S, Case JP. Nonrandom evolution of endstage osteoarthritis of the lower limbs. Arthritis Rheum. 2002;46:3185-9, doi: 10.1002/art.10649. 6. American College of Sports Medicine. Position Stand on Exercise and physical activity for older adults. Med Sci Sports Exerc. 2009;41:1510-30, doi: 10.1249/MSS.0b013e3181a0c95c. 7. Ciolac EG, Garcez-Leme LE, Greve JMD. Resistance exercise training progression in older men. Int J Sports Med. 2010;31:433-8, doi: 10.1055/ s-0030-1249087. 8. Ciolac EG, Brech GC, Greve JMD. Age does not affect exercise intensity progression to exercise among women. J Strength Con Res. 2010;24:302331, doi: 10.1519/JSC.0b013e3181d09ef6. 9. Petterson SC, Mizner RL, Stevens JE, Raisis L, Bodenstab A, Newcomb W, et al. Improved function from progressive strengthening interventions after total knee arthroplasty: a randomized clinical trial with an imbedded

2083

Resistance training in knee OA and TKA Ciolac EG and Greve JMD

10.

11.

12. 13. 14.

15.

16.

17.

18.

CLINICS 2011;66(12):2079-2084

prospective cohort. Arthritis Rheum. 2009;61:174-83, doi: 10.1002/art. 24167. LaStayo PC, Meier W, Marcus RL, Mizner R, Dibble L, Peters C. Reversing muscle and mobility deficits 1 to 4 years after TKA: a pilot study. Clin Orthop Relat Res. 2009;467:1493-500, doi: 10.1007/s11999009-0801-2. Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, et al. Development of criteria for the classification and reporting of osteoarthritis: classification of osteoarthritis of the knee. Arthritis Rheum. 1986;29:1039-49, doi: 10.1002/art.1780290816. Ravaud P, Auleley GR, Amor B, Dougados M. Radiographic assessment of progression in knee osteoarthritis. Rheumatol Eur. 1995;24:S129â&#x20AC;&#x201C;31. Slobodan J. Muscle strength testing: Use of normalization for body size. Sports Med. 2002;32:615-31, doi: 10.2165/00007256-200232100-00002. Berth A, Urbach D, Awiszus F. Improvement of voluntary quadriceps muscle activation after total knee arthroplasty. Arch Phys Med Rehabil. 2002;83:1432-6, doi: 10.1053/apmr.2002.34829. Walsh M, Woodhouse LJ, Thomas SG, Finch E. Physical impairments and functional limitations: a comparison of individuals 1 year after total knee arthroplasty with control subjects. Phys Ther. 1998;78:248-58. Jordan KM, Arden NK, Doherty M, Bannwarth B, Bijlsma JW, Dieppe P, et al. EULAR Recommendations 2003: an evidence based approach to the management of knee osteoarthritis: report of a Task Force of the Standing Committee for International Clinical Studies Including Therapeutic Trials (ESCISIT). Ann Rheum Dis. 2003;62:1145-55, doi: 10.1136/ard. 2003.011742. Ottawa Panel. Ottawa panel evidence-based clinical practice guidelines for therapeutic exercises and manual therapy in the management of osteoarthritis. Physical Therapy. 2005;85:907-71. King LK, Birmingham TB, Kean CO, Jones IC, Bryant DM, Giffin JR. Resistance training for medial compartment knee osteoarthritis and

19.

20.

21. 22. 23.

24.

25. 26.

2084

malalignment. Med Sci Sports Exerc. 2008;40:1376-84, doi: 10.1249/MSS. 0b013e31816f1c4a. Baker KR, Nelson ME, Felson DT, Layne JE, Sarno R, Roubenoff R. The efficacy of home based progressive strength training in older adults with knee osteoarthritis: a randomized controlled trial. J Rheumatol. 2001;28:1655-65. Fisher NM, Kame VD Jr, Rouse L, Pendergast DR. Quantitative evaluation of a home exercise program on muscle and functional capacity of patients with osteoarthritis. Am J Phys Med Rehabil. 1994;73:413-20, doi: 10.1097/00002060-199411000-00006. Brosseau L, MacLeay L, Robinson V, Wells G, Tugwell P. Intensity of exercise for the treatment of osteoarthritis. Cochrane Database Syst Rev. 2003;(2):CD004259. American College of Sports Medicine Position Stand. Progression models in resistance training for healthy adults. Med Sci Sports Exerc. 2009;41:687-708, doi: 10.1249/MSS.0b013e3181915670. American Geriatrics Society Panel on Exercise and Osteoarthritis. Exercise prescription for older adults for osteoarthritis pain: Consensus practice recommendations: A supplement to the AGS clinical practice guidelines on the management of chronic pain in older adults. J Am Geriat Soc. 2001;49:808-23, doi: 10.1046/j.1532-5415.2001.00496.x. Moffet H, Collet JP, Shapiro SH, Paradis G, Marquis F, Roy L. Effectiveness of intensive rehabilitation on functional ability and quality of life after first total knee arthroplasty: a singleblind randomized controlled trial. Arch Phys Med Rehabil. 2004;85:546-56, doi: 10.1016/j. apmr.2003.08.080. Maly MR, Costigan PA, Olney SJ. Determinants of self efficacy for physical tasks in people with knee osteoarthritis. Arthritis Rheum. 2006;55:94-101, doi: 10.1002/art.21701. Costa RA, Oliveira LM, Watanabe SH, Jones A, Natour J. Isokinetic assessment of the hip muscles in patients with osteoarthritis of the knee. Clinics. 2010;65:1253-9, doi: 10.1590/S1807-59322010001200006.

CLINICS 2011;66(12):2085-2091

DOI:10.1590/S1807-59322011001200014

CLINICAL SCIENCE

Total inspiratory and expiratory impedance in patients with severe chronic obstructive pulmonary disease Karla Kristine Dames Silva,I Agnaldo Jose´ Lopes,II Jose´ Manoel Jansen,II Pedro Lopes de MeloI,III I

State University of Rio de Janeiro, Faculty of Engineering, Institute of Biology, Biomedical Instrumentation Laboratory, Rio de Janeiro/RJ, Brazil. II State University of Rio de Janeiro, Faculty of Medical Sciences, Pulmonary Function Laboratory, Rio de Janeiro/RJ, Brazil. III State University of Rio de Janeiro, Institute of Biology, BioVasc Research Laboratory, Rio de Janeiro/RJ, Brazil.

OBJECTIVES: Several studies have confirmed the high potential of the forced oscillation technique for the assessment of respiratory modifications related to chronic obstructive pulmonary disease. However, most of these studies did not employ within-breath analyses of the respiratory system. The aim of this study is to analyze respiratory impedance alterations in different phases of the respiratory cycle of chronic obstructive pulmonary disease patients and to evaluate their clinical use. METHODS: 39 individuals were evaluated, including 20 controls and 19 individuals with chronic obstructive pulmonary disease who experienced severe airway obstruction. We evaluated the mean respiratory impedance (Zm) as well as values for inspiration (Zi) and expiration cycles (Ze), at the beginning of inspiration (Zbi) and expiration (Zbe). The peak-to-peak impedance (Zpp), and the impedance change (DZrs) were also analyzed. The clinical usefulness was evaluated by investigating the sensibility, specificity and the area under the receiver operating characteristic curve. RESULTS: The respiratory impedance increased in individuals with chronic obstructive pulmonary disease in all of the studied parameters (Zm, Zi, Ze, Zbi, Zbe, DZrs and Zpp). These changes were inversely associated with spirometric parameters. Higher impedances were observed in the expiratory phase of individuals with chronic obstructive pulmonary disease. All of the studied parameters, except for DZrs (area under the receiver operating characteristic ,0.8), exhibited high accuracy for clinical use (area under the receiver operating characteristic .0.90; Sensibility $ 0.85; Sp $ 0.85). CONCLUSIONS: The respiratory alterations in severe chronic obstructive pulmonary disease may be identified by the increase in respiratory system impedance, which is more evident in the expiratory phase. These results confirm the potential of within-breath analysis of respiratory impedance for the assessment of respiratory modifications related to chronic obstructive pulmonary disease. KEYWORDS: COPD; Within-breath analyses; Forced oscillation technique; Diagnostic; Respiratory diseases. Silva KKD, Lopes AJ, Jansen JM, Melo PL. Total inspiratory and expiratory impedance in patients with severe chronic obstructive pulmonary disease. Clinics. 2011;66(12):2085-2091. Received for publication on July 5, 2011; First review completed on July 25, 2011; Accepted for publication on August 31, 2011 E-mail: plopes@uerj.br Tel.: 55 021 2334-0705

usually evaluated by spirometric tests. However, these tests require good cooperation and maximal effort by the subject. Thus, these tests may be unreliable and variable if suboptimal maneuvers are performed.3 Forced oscillation technique (FOT) offers a simple, detailed approach for investigating the mechanical properties of the respiratory system. In practice, sinusoidal excitations are superimposed on the subject’s spontaneous breathing at the airway opening by a loudspeaker, requiring little patient cooperation.4-6 The resulting oscillations in air flow and pressure are recorded and used to estimate the mechanical impedance of the respiratory system. These features make this technique potentially suitable for the routine evaluation of respiratory function in COPD.7-9 Studies using the FOT often use several excitation frequencies (multifrequency FOT) to obtain an average result from several breathing cycles.5-9 This approach does

INTRODUCTION Chronic obstructive pulmonary disease (COPD) is a major cause of morbidity and mortality worldwide.1 According to World Health Organization estimates, 80 million people have moderate to severe COPD, and more than 3 million people died of COPD in 2005, which corresponds to 5% of all deaths globally.2 The airway obstruction resulting from COPD is associated with a progressive increase in airflow limitation,1 which is

2085

Total inspiratory and expiratory impedance Silva KKD et al.

CLINICS 2011;66(12):2085-2091

individuals were the following: older than 50 years, being of either sex, having a diagnosis of COPD according to the criteria of GOLD1 and the Brazilian Society of Pneumology and Tisiology,25 and being classified as having accentuated obstructive lung disease according to Jansen.7,26-28 The exclusion criteria were the following: COPD exacerbation occurring less than 90 days previously, the presence of other chronic lung diseases, tuberculosis or pneumonia, the presence of thoracic trauma or surgery, respiratory infections occurring less than 30 days previously and the inability to perform examinations. The control group consisted of healthy volunteers of both sexes who were older than 50 years with no history of pulmonary disease, cardiovascular disease or smoking. The individuals selected for the control group had normal spirometry results7,26-28 and underwent a clinical examination to observe their general health and the absence of respiratory infections. Baseline data, including age, sex, and height, were obtained from each patient at the time of the test procedures.

not allow a detailed, individual analysis of the inspiratory and expiratory phases of the respiratory cycle. Recently, a version of the FOT that uses a single excitation frequency (monofrequency FOT) was developed, and this technique allows within-breath analysis of respiratory mechanics.10 For within-breath analysis, the system evaluates, in real time, the module of the respiratory impedance (Zrs), which is associated with respiratory system resistance (Rrs) and reactance (Xrs) as described in equation 1: pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi Zrs~ Rrs2 zXrs2

ð1Þ

These measurements are related to the total mechanical load provided by the respiratory system. This method has been successfully used to study the fast events associated with sleep apnea10,11 and swallowing.12 Other research groups have obtained promising results using the monofrequency forced oscillation technique (MnFOT) for the detection of expiratory flow limitations in patients with COPD,13,14 investigating physiological recovery from an exacerbation of COPD15 and analyzing responses to deep inhalation in asthmatic children16 and adults.17 A detailed evaluation of the short-term variability of airway caliber in asthma was also recently accomplished using this technique.18,19 Dellaca´ et al.20 recently used MnFOT to assess response to salbutamol in COPD patients, and Veiga et al.21 obtained promising results using this technique to investigate the pathophysiology of asthmatic patients in the diagnosis of this disease. However, there are limited data reported on the use of respiratory impedance in the analysis of different phases of the breathing cycle22-24 and its use in the diagnosis of COPD. The cited studies were based on an impulse oscillation system, which has some differences from classical FOT, including the data processing and the parameters used to interpret raw data. The objectives of the present study were the following: (1) to compare the respiratory mechanics of normal individuals and those with COPD, with an emphasis on the differences between phases of the respiratory cycle and (2) using spirometry as a reference technique, to evaluate the ability of MnFOT in the clinical diagnosis of increased airway obstruction in patients with severe COPD.

Study protocol The exams were previously scheduled by phone, and the subjects were informed of the need to suspend the use of bronchodilators during the 12 hours that preceded the tests. On the scheduled date, the examination sequence was carried out as follows: the evaluation of clinical history, the collection of anthropometric measurements (age, body weight and height) and risk factors associated with the disease, testing FOT impedance, and, finally, gathering spirometric measurements.

Within-breath respiratory impedance measurements The system used for respiratory impedance analysis was developed in our laboratory. It is based on equipment described previously by our group for the study of respiratory disorders during sleep.10,11 Briefly, the instrument applies a single frequency (5 Hz), low pressure (2.0 cmH2O) sinusoidal signal to the subject’s respiratory system, which remains under spontaneous ventilation. Pressure (P) and flow (V’) transducers placed near the subject’s mouth are used in the measurement of these variables. The resulting signals are recorded by an analog signal processing circuit to perform calculations to obtain the Zrs (Zrs = P/V’) in real time. This variable is known as the impedance module and describes the total mechanical load of the respiratory system, including the effects of resistance and reactance.11,21 The instrument was calibrated by means of a reference mechanical load and, after this, measurement errors were ,0.5%.10,11 The system program was developed in the LabView 8.2 environment and permits the control of the beginning and end of the exam as well as the visualization of respiratory impedance alterations that occur during the phases of the breathing cycle.10,11 This allows an easy evaluation of the reproducibility of a patient’s impedance values during the tests. We discarded distortions during the recording that were due to artifacts such as coughs or sneezes. Whenever the impedance time series was not considered adequate, the maneuver was not considered valid and was repeated. When correct maneuvers could not be obtained, the volunteers were excluded from the study.

MATERIALS AND METHODS Study design and ethical considerations The present work is a controlled cross-sectional study that was developed at the State University of Rio de Janeiro. The examinations included spirometry and FOT measurements. These measurements were performed at the Biomedical Instrumentation Laboratory in the Institute of Biology in conjunction with the Pulmonary Function Laboratory at Pedro Ernesto University Hospital. The Research Ethics Committee of this institution approved this study. The objectives of the study were explained to all individuals, and their written consent was obtained before their inclusion in the study.

Subjects This study involved volunteers with normal spirometric evaluations who never smoked and patients with COPD from our outpatient clinic. Inclusion criteria for COPD

2086

CLINICS 2011;66(12):2085-2091

Total inspiratory and expiratory impedance Silva KKD et al.

group of studied subjects. These tests were carried out using OriginH 6.0 (Microcal Software, MA, USA). The clinical potential of using FOT indices for the detection of respiratory alterations in patients with COPD was evaluated with receiver operating characteristic (ROC) analyses, which were conducted using MedCalcH 8.2 (Medicalc Software Mariakerke, Belgium).

The mechanical alterations during different phases of the respiratory cycle were characterized using the following secondary parameters:

N N N N N N N

The mean respiratory impedance (Zm), calculated for the complete exam; The mean impedance during the inspiration cycles (Zi); The mean impedance during the expiration cycles (Ze); The mean impedance at the beginning of inspiration (Zbi); The mean impedance at the beginning of expiration (Zbe); The peak-to-peak impedance (Zpp), the difference between Zbe and Zbi; The mean change in the impedance (DZrs), the difference between Ze and Zi.

RESULTS A total of 48 subjects completed the evaluation protocol; of these subjects, 39 had technically satisfactory measurements. Four patients with COPD (17% of the original COPD group) and five controls (20% of the total control group) produced unsatisfactory measurements due to irregular breathing changes during FOT measurements. The anthropometric and spirometric characteristics of the studied subjects are summarized in Table 1. Body weight and BMI values were significantly smaller in the COPD group as compared to the control group (p,0.001) while age and height were similar between these groups. As shown in Table 1, patients with COPD exhibited significant reductions in all of the studied spirometric parameters (p,0.03). Table 2 shows the results obtained from evaluation of respiratory system impedance during the respiratory cycle of patients with COPD as compared to controls. The respiratory impedances were always significantly higher in COPD patients than in the control group (Zm, Zbi, Zi, Zbe and Ze; p,0.001). Similar comparisons revealed that Zpp (p,0.001) and DZrs (p,0.005) were significantly increased in patients with COPD. Comparisons of the different respiratory cycle phases in COPD and healthy subjects are shown in Figure 1. The respiratory impedance did not change significantly during the respiratory cycle in the control group (ANOVA, p = ns). Conversely, the Zrs were significantly increased in the COPD group when the cycle from the beginning of the inspiratory phase to the end of the expiratory phase was considered (ANOVA, p,0.005). Figure 1 also shows that Ze was significantly higher than Zi (p,0.001) and Zbe was significantly higher than Zbi (p,0.001) in patients with COPD.

Spirometry Spirometry tests were performed using a flow spirometer (Micro Medical, model MicroLoop, SP, Brazil). The tests followed procedures recommended by the Brazilian Consensus on Spirometry29 and were performed by a trained technician, as described by the Brazilian Thoracic Society.25 The following parameters were considered:

N N N N N

Forced expiratory volume in one second (FEV1); Forced vital capacity (FVC); FEV1/FVC ratio; Forced expiratory flow between 25-75% of FVC (FEF25-75); The FEF/FVC.

All parameters were assessed as absolute and percentage values relative to the value predicted for gender, age and height according to Pereira et al.30 and following the criteria established by the American Thoracic Society and European Respiratory Society.31,32 FOT exams were carried out first, and the delay between FOT and spirometric exams was less than thirty minutes.

Sample size and statistical analysis To estimate the sample size, a pilot study in a group of 20 subjects (10 subjects with COPD and 10 controls) was conducted using a protocol identical to that described above. Based on these preliminary results, the software MedCalcH 8.2 (Medicalc Software Mariakerke, Belgium) was used to calculate the sample size based on the difference between means, assuming type I and type II errors of 1%. The minimum calculated value for this study consisted of 12 individuals for each group. Data are presented as means¡SD. Initially, the characteristics of the samples were evaluated using the Shapiro-Wilk test. Next, depending on the characteristic, we used the independent Student’s t test or Mann-Whitney U test to assess differences between-groups and the paired t test and one-way ANOVA analysis for intra-group differences. These analyses were performed using STATISTICAH 5.0 for Windows (StatSoft Inc., Tulsa, USA). Differences were considered statistically significant when p,0.05. The associations between variables related to spirometry and within-breath respiratory impedance tests were investigated using Pearson’s correlation coefficient for the entire

Table 1 - Biometric and spirometric characteristics of the studied subjects.

M/F Age (years) Weight (kg) Height (m) BMI (kg/m2) FVC (L) FVC (%) FEV1 (L) FEV1 (%) FEV1/FVC FEF/FVC FEF25-75 (L) FEF25-75 (%)

COPD (n = 19)

Control (n = 20)

p-value

14/05 71.3¡8.1 56.8¡10.4 1.60¡0.10 21.90¡3.50 2.38¡0.8 76.6¡21.8 0.84¡0.28 36.5¡11.0 37.3¡9.0 12.7¡6.7 0.28¡0.1 12.2¡5.2

07/13 68.3¡8.3 73.5¡12.3 1.63¡0.08 27.79¡4.4 2.89¡0.61 94.4¡15.42 2.33¡0.59 97.4¡14.64 80.25¡6.23 78.09¡22.23 2.31¡0.94 97.25¡28.1

ns 0.001 ns 0.001 0.03 0.005 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001

COPD: Chronic Obstructive Pulmonary Disease; n: number of subjects; ns: non-significant; BMI: body mass index; FEV1: forced expiratory volume in one second; FVC: forced vital capacity; FEF: forced expiratory flow; %: percentage of the predicted value.

2087

Total inspiratory and expiratory impedance Silva KKD et al.

CLINICS 2011;66(12):2085-2091

Table 2 - Comparative analysis between COPD and control subjects considering the impedance in different phases of the ventilatory cycle.

Zm (cmH2O\L\s) Zi (cmH2O\L\s) Ze (cmH2O\L\s) Zbi (cmH2O\L\s) Zbe (cmH2O\L\s) Zpp (cmH2O\L\s) DZrs (cmH2O\L\s)

COPD

Control

p-value

10.0¡2.8 9.0¡2.5 10.5¡3.1 8.1¡2.0 11.0¡3.1 2.93¡2.02 1.49¡1.65

4.6¡1.2 4.4¡1.2 4.7¡1.3 4.3¡1.3 4.8¡1.3 0.50¡0.74 0.27¡0.57

0.001 0.001 0.001 0.001 0.001 0.001 0.005

Table 3 - Area under the curve (AUC), sensitivity (Se), specificity (Sp) and cut-off point of the Forced Oscillation parameters.

Zm (cmH2O/L/s) Zi (cmH2O/L/s) Ze (cmH2O/L/s) Zbi (cmH2O/L/s)

Zm – Mean impedance of the respiratory system; Zi – inspiratory impedance; Ze – expiratory impedance; Zbi – impedance at the beginning of inspiration; Zbe – impedance at the beginning of expiration. Zpp – peak-to-peak variation of the impedance; DZrs – variation of the mean impedance.

Zbe (cmH2O/L/s) Zpp (cmH2O/L/s) DZrs (cmH2O/L/s)

The associations between FOT and spirometric parameters are described in Table 3. Zm, Zi, Ze, Zbi and Zbe values presented statistically significant inverse correlations with all spirometric parameters. Similar behavior was observed for Zpp and DZrs, but Zpp was not associated with FVC (L) and DZrs was not associated with FVC (%). When the correlation coefficients are compared, Zm, Zi, Ze, Zbe and Zpp were observed to have a higher association with FEV1 (%),Zbi was more associated with FEF25-75% and DZrs was more closely associated with FEV1 (L). Table 4 summarizes the results for the evaluation of the clinical potential of the studied indices. Six of the seven studied parameters presented AUC $ 0.9.

AUC

Se (%)

Sp (%)

Cut-off

0.974 (0.86-1.00) 0.963 (0.85-0.99) 0.976 (0.87-1.00) 0.958 (0.84-0.99) 0.971 (0.86-1.00) 0.903 (0.76-0.97) 0.766 (0.60-0.89)

94.7 (73.9-99.1) 94.7 (73.9-99.1) 100.0 (82.2-100.0) 94.7 (73.9-99.1) 94.7 (73.9-99.1) 89,5 (66.8-98.4) 78.9 (45.7-88.0)

95.0 (75.1-99.2) 90.0 (68.3-98.5) 90.0 (68.3-98.5) 90.0 (68.3-98.5) 95 (75.1-99.2) 85 (62.1-96.6) 78.9 (54.4-93.8)

6.2 5.6 5.7 5.4 6.2 1.3 0.37

Values are presented as mean and confidence interval (95%); Zm – mean impedance of the respiratory system; Zi – inspiratory impedance; Ze – expiratory impedance; Zbi – impedance at the beginning of inspiration; Zbe – impedance at the beginning of expiration. Zpp – peak-to-peak variation of the impedance; DZrs – variation of the mean impedance.

study due to inadequate FOT measurements. This percentile values may be associated with a characteristic of this sample of volunteers, because these volunteers do not presented experience with FOT. Individuals comprising the group of patients with COPD had body mass and BMI values that were smaller than those in the control group (Table 1). This difference is likely due to the clinical condition of these patients, who suffer from advanced COPD. The alterations in routine lung function parameters in COPD patients were consistent with the presence of severe airway obstruction,1,32 leading to decreased spirometric results (Table 1). An FEV1/FVC ratio below 70% indicates the presence of airflow obstruction,1,32 while an FEV1(%) below 50% indicates the presence of severe obstructive ventilatory insufficiency,1,33 The FVC was reduced in these patients, indicating the presence of a predominantly obstructive process with probable pulmonary hyperinsuflation.34 In this study, we evaluated the respiratory system impedance module, which is associated with the resistive and reactive properties of the entire respiratory system, including the lung and chest wall.4-6 COPD is characterized by the presence of airway wall inflammation, and the consequent reduction in bronchial and bronchiolar quality, as well as mucus hypersecretion, results in airway obstruction.1,7 These factors, alone or associated, are responsible for increased airway resistance. In addition to the increased resistance observed in COPD, a decrease in dynamic compliance is also present. This decrease may be explained using the concept of a ‘‘choke point’’, introduced by Dellaca` et al.,13 and describes the difficulty that the oscillatory signals emitted by the FOT encounter when crossing segments of the bronchial tree; this difficulty is associated with increased small airway resistance.35 This event induces a fall in the dynamic compliance and a consequent increase in the impedance module. Consistent with this theory, all of the analyzed parameters were significantly increased in COPD subjects (Table 2). The observed changes in Zm describe the increase in respiratory work associated with the previously mentioned changes.

DISCUSSION In this study, we observed that severe COPD may be identified by the increase in within-breath respiratory system impedance. Our data suggested that this is more evident in the expiratory phase, and confirms the clinical potential of within-breath impedance analysis for the diagnosis of respiratory modifications related to COPD. Twenty percent of the initial control group and 17% of the initial group of patients with COPD were excluded from the

Figure 1 - Mean Zrs values during the ventilatory cycle in COPD (red lines) and healthy subjects (blue lines).

2088

CLINICS 2011;66(12):2085-2091

Total inspiratory and expiratory impedance Silva KKD et al.

Table 4 - Pearson correlation coefficient (r), and p-value (p) between FOT and spirometry. Zm (cmH2O/L/s) FVC (L) FVC (%) FEV1 (L) FEV1 (%) FEV1/FVC FEF/FVC FEF25-75 (L) FEF25-75 (%)

r p r p r p r p r p r p r p r p

-0.57 0.001 -0.59 0.001 -0.77 0.001 -0.79 0.001 -0.71 0.001 -0.74 0.001 -0.73 0.001 -0.78 0.001

Zi (cmH2O/L/s)

Ze (cmH2O/L/s)

Zbi (cmH2O/L/s)

Zbe (cmH2O/L/s)

Zpp (cmH2O/L/s)

DZrs (cmH2O/L/s)

-0.53 0.001 -0.59 0.001 -0.74 0.001 -0.78 0.001 -0.69 0.001 -0.72 0.001 -0.70 0.001 -0.76 0.001

-0.57 0.001 -0.56 0.001 -0.77 0.001 -0.78 0.001 -0.71 0.001 -0.75 0.001 -0.74 0.001 -0.77 0.001

-0.56 0.001 -0.55 0.001 -0.75 0.001 0.75 0.001 -0.69 0.001 -0.74 0.001 -0.72 0.001 -0.76 0.001

-0.48 0.002 -0.54 0.001 -0.76 0.001 -0.80 0.001 -0.74 0.001 -0.76 0.001 -0.74 0.001 -0.78 0.001

-0.25 0.1 -0.38 0.02 -0.56 0.001 -0.63 0.001 -0.60 0.001 -0.57 0.001 -0.54 0.001 -0.60 0.001

-0.40 0.02 -0.20 0.2 -0.50 0.002 -0.40 0.02 -0.40 0.02 -0.46 0.004 -0.46 0.004 -0.40 0.01

In a previous study, Clement et al.36 investigated the behavior of Rrs and Xrs in individuals with and without airway obstruction. These authors associated higher values of Rrs and Xrs with increased degrees of airway obstruction, findings that were associated with the pathophysiological progression of COPD. Van Noord et al.34 evaluated the respiratory system resistance of 125 individuals with severe airway obstruction using the FOT at 6 Hz. The authors observed increased resistance values in patients with COPD as compared to healthy subjects. The increase in Rrs due to COPD was also demonstrated by Zerah et al.,9 who studied the effect of a bronchodilator using multifrequency FOT. According to these authors, this resistance pattern, which is consistent with the lower FEV1 values identified in this population, is associated with the presence of airway obstruction and consequent non-homogeneous lung capacity. The study conducted by FarreÂ´ et al.38 evaluated respiratory impedance in mechanically ventilated COPD patients. Rrs and Xrs curves showed that resistance values increased and that reactance values were more negative, which are consistent with our results (Table 2, Figure 1). By analyzing the mechanical changes in the respiratory system resulting from increased levels of airway obstruction in COPD, Di Mango et al.7 also found that resistance values were increased and that reactance values were more negative. Other characteristics may contribute to the presence of higher Zm values, such as reductions in the homogeneity of the lung time constants.7,13,27,39 Based on equation (1), the increase in Zm observed in our study (Table 2) as well as the significant inverse correlations between Zm and spirometric parameters (Table 3) are consistent with these previously published results23,24,39 and physiological aspects of COPD.1,35 In the present study, subjects with COPD exhibited higher impedance in all phases of the ventilatory cycle when compared to control subjects (Table 2; Figure 1). The advanced stage of COPD observed in our patients is associated with peribronchial fibrosis and consequent airway tissue remodeling. Thus, this reduced airway compliance may introduce more negative Xrs, contributing to higher Zrs (equation (1)). Higher values of inspiratory and expiratory impedances were also observed by Cavalcanti et al.21 in their comparison between asthmatic and healthy subjects using methodology similar to that used in this paper. One possible contributing factor for these

results is the recruitment of accessory muscles in COPD subjects due to impaired diaphragmatic mechanics. In COPD, the change in the tidal volume operating point favors lung hyperinflation, reducing the efficiency of the diaphragm as a pump and inducing the use of accessory muscles. Because respiratory impedance measurements include the influence of the chest wall, we believe that abnormal accessory muscle contraction during inspiration may contribute to the increased Zi in our patients. The Zrs values observed throughout the respiratory cycle were similar in both groups (Figure 1); Zrs values increased from the beginning of inspiration to expiration. Paredi et al.22 observed only minimal changes in Rrs and Xrs values between inspiration and expiration in normal individuals. Consistent with these results, we observed only nonsignificant changes in Zrs in healthy subjects (Figure 1). However, patients with COPD showed significant changes in Zrs among the phases of the respiratory cycle (Figure 1; p,0.005). Consistent with the results obtained by Dellaca` et al.13 and Johnson et al.,15 Zrs values were higher during expiration than inspiration in patients with COPD. Analysis of Zrs during expiration has been used to establish the presence of expiratory flow limitation (EFL).13,15 During EFL events, increased Zrs values are observed. In this context, Zbe and Ze are expected to be higher than Zbi and Zi in patients with COPD. The results described in Figure 1 indicate that EFL may be a significant component affecting respiratory impedance in the studied subjects. Using an impulse oscillation system, Paredi et al.22 investigated whether oscillometric indices differ between patients with asthma and patients with COPD. Consistent with the results of the present work, these authors observed that expiratory reactances at 5 Hz were significantly less than inspiratory reactances in patients with COPD. These results are also consistent with those recently described by Kubota et al.23 and Kanda et al.24 The control subjects exhibited minimal variations in DZrs and Zpp (Table 2, Figure 1), which are consistent with previous studies.13-15,24 Conversely, Table 2 shows that COPD subjects experienced significant increases in DZrs and Zpp. Previous authors have also observed more substantial expiratory-inspiratory differences in patients with COPD than in healthy subjects.22-24

2089

Total inspiratory and expiratory impedance Silva KKD et al.

CLINICS 2011;66(12):2085-2091

In our understanding as well as that of other authors,40,41 the behavior of Zrs throughout the respiratory cycle in patients with COPD is a controversial topic with several unclear components of the pathophysiology. Further studies are needed to improve our understanding, e.g., concerning the effects of a process dominated by emphysema (elastic changes) or chronic bronchitis (obstructive changes). Zm, Zi, Ze, Zbi and Zbe were significantly and inversely associated with FEV1 and FVC (Table 3), which link these impedance parameters with airway obstruction and pulmonary volume reductions. Notably, the highest coefficient of determination was observed between FEV1 (%) and Zbe, whereas weaker associations were observed when Zpp and DZrs were considered. Johnson and colleagues39 compared Rrs and Xrs at 5 Hz with pulmonary resistance (RL), as assessed by the use of an esophageal balloon. Their results indicated that these parameters can be used as predictors of RL. In this case, the greatest advantage of FOT from the perspective of clinical application lies in the fact that the evaluation of Rrs and Xrs by FOT does not involve the use of an invasive procedure, which is necessary for the evaluation of RL with an esophageal balloon. These authors highlighted the strong potential of this approach for scientific and clinical application of real-time assessment of Rrs and Xrs and suggested that the clinical use of these parameters should be systematically evaluated.39 To contribute in this direction, ROC curves were elaborated. According to the literature, ROC curves with AUCs between 0.50 and 0.70 indicate low diagnostic accuracy, AUCs between 0.70 and 0.90 indicate moderate diagnostic accuracy, and AUCs between 0.90 and 1.00 indicate high diagnostic accuracy.42,43 An AUC.0.80 is usually considered to be adequate for clinical use.42,43 Thus, AUC values for Zm, Zi, Ze, Zbi, Zbe and Zpp represented highly accurate measurements (Table 4). However, DZrs values do not attain adequate values for clinical use. Under these conditions, Ze was the most suitable for correctly identifying the effects of COPD, with a sensitivity of 100% and a specificity of 90%. These promising results are consistent with those obtained previously21,44 and suggest that the Zrs observed in different phases of the respiratory cycle may be useful in the detection of COPD. When the results of the present study are compared with those obtained in a previous study our group conducted in asthmatic subjects,21 both studies were found to provide similar results with AUCs above 0.9, indicating high diagnostic accuracy. The AUC values determined in these studies are superior to those obtained in previous studies using multifrequency FOT that were performed in patients with COPD45 (maximum AUCs of 0.85), in asthmatic patients27 (maximum AUCs of 0.88), and in patients with sarcoidosis28 (maximum AUCs of 0.84). Thus, our results confirm the hypothesis that monofrequency FOT can attain higher diagnostic accuracy than its corresponding multifrequency counterpart.21 There are three potential limitations in the present study. First, it is important to note that the description of sensitivity, specificity and accuracy is dependent on the population studied, and that the present work was conducted in patients with severe airway obstruction. Studies in patients with mild and moderate airflow obstruction are still necessary to confirm this hypothesis.

The second possible limitation is that the reproducibility of the FOT measures was not evaluated in our patients with COPD. Dellaca` et al.46 recently evaluated the reproducibility of within breath respiratory resistance during home monitoring. These authors showed a discrepancy of resistance of 0.10¡0.01 cmH2O/L/s in COPD patients, and pointed out that FOT yields accurate and reproducible data in COPD patients. Therefore, the lack of reproducibility evaluation probably is not a problem in the present study. The third possible limitation is that, in order to evaluate the contribution of the MnFOT in the diagnosis of COPD, we performed a study using spirometry as a reference. One could argue that a comparison between these methods would also be useful. In fact, our research group recently performed this comparison in groups of smokers with very interesting results. FOT parameters were more accurate than spirometric indices to identify small alterations due to smoking,44,47 while in patients with higher tobacco consumption, the diagnostic performance of the FOT was similar to that observed in spirometry.44 These studies were conducted using multifrequency FOT. However, in the present paper, the spirometry is used as a reference technique, and therefore we cannot make a direct comparison between spirometry and FOT. In the previously cited papers,44,47 we compared these two techniques using the amount of tobacco consumption (pack-years) as a reference. Thus, although it is a really intriguing question, we cannot evaluate it in the present paper. Individuals with COPD and severe airway obstruction present respiratory impedances higher than those observed in healthy individuals in all phases of the respiratory cycle. Thus, the impedance changes observed in individuals with COPD reflect the high mechanical load imposed on the respiratory system of these patients, and these changes are consistent with the pathophysiology of the disease. These patients experience higher impedances in the expiratory phase than in the inspiratory phase, indicating that expiratory flow limitation may play a significant role in severe COPD. Several of the studied parameters demonstrated high accuracy for the diagnosis of COPD. These results indicate that the evaluation of respiratory impedance in different phases of the respiratory cycle may be a promising clinical diagnostic tool, representing an alternative and/or complementary technique to other conventional exams used to clinically evaluate patients with COPD.

AUTHOR CONTRIBUTIONS Silva KKD conducted the measurements for this study, analyzed the data, and drafted the manuscript. Lopes AJ provided data and subject identification. Jansen JM, mentored Silva KKD and participated in data analysis process. Melo PL mentored Silva KKD organized the study and helped to draft the manuscript. All authors have read and approved this manuscript.

REFERENCES 1. GOLD - Global Initiative For Chronic Obstructive Lung Disease – UPDATE (2007). ‘‘Global Strategy for the Diagnosis, Management, and prevention of Chronic Obstrutive Pulmonary Disease.’’ NHLBI/WHO, http://www.goldcopd.com. Acessed in June 2011. 2. World Health Organization. Chronic respiratory diseases.Available at: http://www.who.int/respiratory/copd/burden/en/index.html. 3. Kaminsky AD, Irvin CG. New insights from lung function. Curr Opin Allergy Clin Immunol. 2001;1:205-9. 4. Navajas D, Farre´ R. Forced oscillation technique: from theory to clinical applications. Monaldi Arch Ches Dis. 2001;56:555-62.

2090

CLINICS 2011;66(12):2085-2091

Total inspiratory and expiratory impedance Silva KKD et al.

5. Oostven E, MacLeod D, Lorino H, Farre´ R, Hantos Z, Desager K, et al. The Forced Oscillation Technique in clinical practice: methodology, recommendations and future developments. Eur Resp J. 2003;22:1026-41, doi: 10.1183/09031936.03.00089403. 6. Melo PL, Werneck MM, Giannela-Neto A. Avaliaçaõ de mecaˆnica ventilato´ria por oscilaço˜es forçadas: fundamentos e aplicaço˜es clıńicas. J Pneumol. 2000;26:194-206. 7. Di Mango AMTG, Lopes AJ, Jansen JM, Melo PL. Changes in respiratory mechanics with increasing degree of airway obstruction in COPD: Detection by forced oscillation technique. Resp Me´d. 2006;100:399-410, doi: 10.1016/j.rmed.2005.07.005. 8. Ionescu C, Derom E, De Keyser R. Assessment of respiratory mechanical properties with constant-phase models in healthy and COPD lungs. Comput Methods Programs Biomed. 2010;97:78-85, doi: 10.1016/j.cmpb. 2009.06.006. 9. Zerah F, Lorino AM, Lorino H, Harf A, Macquin-Mavier I. Forced oscillation technique vs spirometry to assess broncodilation in patients with asthma and COPD. Chest. 1995;108:41-7, doi: 10.1378/chest.108.1. 41. 10. Melo PL, Lemes LNA. Instrumentation for the analysis of respiratory system disorders during sleep: design and application. Rev Sci Instrum. 2002;73:3926-32, doi: 10.1063/1.1511793. 11. Lemes LNA, Melo PL. Forced Oscillation Technique in the sleep apnea/ hypopnea syndrome: identification of respiratory events and nasal continuous positive airway pressure titration. Physiol Meas. 2003;24:1125, doi: 10.1088/0967-3334/24/1/302. 12. Souza CS, Mesquita Juńior JA, Melo PL. A novel system using the forced Oscillation Technique for the biomechanical analysis of swallowing. Technol Health Care. 2008;16:331-341. 13. Dellaca` RL, Santus P, Aliverti A, Stevenson N, Centanni S, Macklem PT, et al. Detection of expiratory flow limitation in COPD using the forced oscillation technique. Eur Respir J. 2004;23:232-40. 14. Dellaca` RL, Duffy N, Pompilio PP, Aliverti A, Koulouris NG, Pedotti A, et al. Expiratory flow limitation detected by forced oscillation and negative expiratory pressure. Eur Respir J. 2007;29:363-74, doi: 10.1183/ 09031936.00038006. 15. Johnson MK, Birch M, Carter R, Kinsella J, Stevenson RD. Measurement of physiological recovery from exacerbation of chronic obstructive pulmonary disease using within-breath forced oscillometry. Thorax. 2007;62:299-306, doi: 10.1136/thx.2006.061044. 16. Schweitzer C, Moreau-Colson C, Marchal F. Respiratory impedance response to a deep inspiration in asthmatic children with spontaneous airway obstruction. Eur Respir J. 2002;19:1020-5, doi: 10.1183/09031936. 02.00992001. 17. Salome CM, Thorpe CW, Diba C, Brown NJ, Berend N, King GG. Airway re-narrowing following deep inspiration in asthmatic and nonasthmatic subjects. Eur Respir J. 2003;22:62-8, doi: 10.1183/09031936.03.00117502. 18. Que CL, Kenyon CM, Olivenstein R, Macklem PT, Maksym GN. Homeokinesis and short term variability of human airway caliber. J Appl Physiol. 2001;91:1131-41. 19. Diba C, Salome CM, Reddel HK, Thorpe CW, Toelle B, King GG. Shortterm variability of airway calibre – a marker of asthma? J Appl Physiol. 2007;103:296-304, doi: 10.1152/japplphysiol.00420.2006. 20. Dellaca` RL, Pompilio PP, Walker PP, Duffy N, Pedotti A, Calverley PM. Effect of bronchodilation on expiratory flow limitation and resting lung mechanics in COPD. Eur Respir J. 2009;33:1329-37, doi: 10.1183/ 09031936.00139608. 21. Veiga J, Jansen JM, Melo PL. Within-breath analysis of respiratory mechanics in asthmatic patients by forced oscillation. Clinics. 2009;64:649-56, doi: 10.1590/S1807-59322009000700008. 22. Paredi P, Goldman M, Alamen A, Ausin P, Usmani OS, Pride NB, et al. Comparison of inspiratory and expiratory resistance and reactance in patients with asthma and chronic obstructive pulmonary disease. Thorax. 2010;65:263-7, doi: 10.1136/thx.2009.120790. 23. Kubota M, Shirai G, Nakamori T, Kokubo K, Masuda N, Kobayashi H. Low frequency oscillometry parameters in COPD patients are less variable during inspiration than during expiration. Respir Physiol Neurobiol. 2009;166:73-9, doi: 10.1016/j.resp.2009.01.007. 24. Kanda S, Fujimoto K, Komatsu Y, Yasuo M, Hanaoka M, Kubo K. Evaluation of respiratory impedance in asthma and COPD by an impulse oscillation system. Intern Med. 2010;49:23-30, doi: 10.2169/internalmedicine.49.2191.

25. Sociedade Brasileira de Pneumologia e Tisiologia (SBPT). II Consenso Brasileiro de Doença Pumonar Obstrutiva Croˆnica (DPOC). J Pneumol. 2004;26:S1-S40. 26. Jansen JM. Classificaçaõ da Sıńdrome Obstrutiva Broˆnquica – Uma Proposta Estatı´stica [Tese]. Rio de Janeiro, RJ: Universidade Federal Fluminense, 1994. 27. Cavalcanti JV, Lopes AJ, Jansen JM, Melo PL. Detection of changes in respiratory mechanics due to increasing degrees of airway obstruction in asthma by the forced oscillation technique. Resp Med. 2006;100:2207-19, doi: 10.1016/j.rmed.2006.03.009. 28. Faria ACD, Lopes AJ, Jansen JM, Melo PL. Assessment of respiratory mechanics in patients with sarcoidosis using forced oscillation: correlations with spirometric and volumetric measurements and diagnostic accuracy. Respiration. 2009;78:93-104, doi: 10.1159/000213756. 29. Sociedade Brasileira de Pneumologia e Tisiologia (SBPT). Diretrizes para Testes de Funçaõ Pulmonar. J Pneumol. 2002;28 3:S1-S238. 30. Pereira CAC, Barreto SP, Simo˜es JG, Pereira FWL, Gerstler JG, Nakatani J. Valores de refereˆncia para espirometria em uma amostra da populaçaõ brasileira adulta. J Pneumol. 1992;18:10-22. 31. American Thoracic Society. Lung Function testing: selection of reference values and interpretative strategies. Am Rev Respir Dis. 1991;144:120218, doi: 10.1164/ajrccm/144.5.1202. 32. American Thoracic Society/European Respiratory Society. Standards for diagnosis and management of patients with COPD. Eur Respir J. 2004;23:932–946. doi: 10.1183/09031936.04.00014304. 33. National Institute for Health and Clinical Excellence. NICE clinical guideline 101, Chronic obstructive pulmonary disease. http://guidance.nice.org.uk/CG101. Acessed in July 2011. 34. Pereira CAC, Sato T. Limitaçaö ao fluxo ae´reo e capacidade vital reduzida: distu´rbio ventilato´rio obstrutivo ou combinado? J Pneumol. 1991;17:59-67. 35. Levitzky MG. Pulmonary Physiology, 7th edition, McGraw-Hill Company, 2007. 36. Cle´ment J, La`ndse´r FJ, Van de Woestijne KP. Total resistance and reactance in patients with respiratory complaints with and without airways obstruction. Chest. 1983;83:215-20, doi: 10.1378/chest.83.2.215. 37. Van Noord JA, Smeets J, Cle´ment J, Van de Woestijne KP, Demets M. Assessment of reversibility of airflow obstruction. Am J Respir Crit Care Med. 1994;150:551-4. 38. Farre´ R, Ferrer M, Rotger M, Torres A, Navajas D. Respiratory mechanics in ventilated COPD patients: forced oscillation versus occlusion techniques. Eur Respir J. 1998;12:170–6. doi: 10.1183/09031936.98.12010 170. 39. Johnson MK, Birch M, Carter R, Kinsella J, Stevenson RD. Use of reactance to estimate transpulmonary resistance. Eur Respir J. 2005;25:1061-9, doi: 10.1183/09031936.05.00082504. 40. Thorpe CW, Salome CM, Berend N, King GG. Modeling airway resistance dynamics after tidal and deep inspirations. J Appl Physiol. 2004;97:1643-53, doi: 10.1152/japplphysiol.01300.2003. 41. Amigo H, Erazo M, Oyarzuń M, Bello S, Peruga A. Smoking and chronic obstructive pulmonary disease: attributable risk determination. Rev Me´d Chile. 2006;134:1275-82. 42. Swets JA. Measuring the accuracy of diagnostic systems. Science. 1988;240:1285–93, doi: 10.1126/science.3287615. 43. Golpe R, Jimene´z A, Carpizo R, Cifrian JM. Utility of home oximetry as a screening test for patients with moderate and severe symptoms of obstructive sleep apnea. Sleep. 1999;22:932-7. 44. Faria AC, Costa AA, Lopes AJ, Jansen JM, Melo PL. Forced oscillation technique in the detection of smoking-induced respiratory alterations: diagnostic accuracy and comparison with spirometry. Clinics. 2010;65:1295-304, doi: 10.1590/S1807-59322010001200012. 45. Guo YF, Hermann F, Michel JP, Janssens JP. Normal values for respiratory resistance using forced oscillation in subjects .65 years old. Eur Respir J. 2005;26:602-8, doi: 10.1183/09031936.05.00010405. 46. Dellaca` RC, Gossi A, Pastena M, Pedotti A, Celli B. Home monitoring of within breath respiratory mechanics by a simple and automatic forced oscillation technique device. Physiol. Meas. 2010;31:11-24, doi: 10.1088/ 0967-3334/31/4/N01. 47. Faria AC, Lopes AJ, Jansen JM, Melo PL. Evaluating the forced oscillation technique in the detection of early smoking-induced respiratory changes. Biomed Eng Online. 2009;25;8-22

2091

CLINICS 2011;66(12):2093-2097

DOI:10.1590/S1807-59322011001200015

CLINICAL SCIENCE

Cryopreservation time does not decrease follicular viability in ovarian tissue frozen for fertility preservation Jacira Ribeiro Campos,I,II Julio Cesar Rosa-e-Silva,I Bruno Ramalho Carvalho,I Alessandra Aparecida Vireque,I Marcos Felipe Silva-de-Sa´,I Ana Carolina Japur de Sa´ Rosa-e-SilvaI I Universidade de Saõ Paulo, Faculty of Medicine of Ribeiraõ Preto, Department of Obstetrics and Gynecology, Ribeiraõ Preto/SP, Brazil. II Oregon Health & Science University - Division Reproduction. Oregon/US.

OBJECTIVE: To determine the effect of storage duration on cryopreserved ovarian tissue using fresh and frozenthawed samples. METHODS: Seventeen fertile patients underwent an ovarian biopsy during elective laparoscopic tubal ligation. The tissue sample was divided into three parts: one part was processed fresh (FG), and two were slowly frozen, cryopreserved for 30 (G30) or 180 days (G180), thawed and analyzed. Follicular density, follicular viability, and steroidogenic capacity were assessed. RESULTS: We observed no differences between the groups in follicular density, which was assessed in hematoxylin and eosin–stained tissue sections. A heterogeneous follicular distribution was observed in the parenchyma, with a mean density of 361.3¡255.4, 454.9¡676.3, and 296.8¡269.0 follicles/mm3 for FG, G30 and G180, respectively (p = 0.46). Follicular viability was greater in FG (93.4%) when compared with the cryopreserved tissues (70.8% for G30 (p,0.001) and 78.4% for G180 (p,0.001)), with no difference in viability between the frozen samples (p.0.05). The steroidogenic capacity of the tissue was not significantly reduced following cryopreservation. CONCLUSION: The slow freezing procedures used for ovarian cryopreservation are capable of preserving follicular viability and maintaining the steroidogenic capacity of the tissue despite a roughly 30% decrease in follicular viability. Furthermore, short-term storage of ovarian tissue does not appear to compromise follicle integrity. KEYWORDS: Ovarian tissue; Cryopreservation; Tissue damage; Ovarian steroidogenesis; Tissue culture. Campos JR, Rosa-e-Silva JC, Carvalho BR, Vireque AA, Silva-de-Sa´, MF, Rosa-e-Silva ACJS. Cryopreservation time does not decrease follicular viability in ovarian tissue frozen for fertility preservation. Clinics. 2011;66(12):2093-2097. Received for publication on August 8, 2011; First review completed on August 22, 2011; Accepted for publication on September 21, 2011 E-mail: juliocrs@usp.br/jacirarc@gmail.com Tel.: 55 16 3602-2804

patients treated for neoplastic diseases, including hormonal manipulation and ovary transposition, as well as cryopreservation of embryos, gametes and ovarian cortical tissue.1 The primary objective of freezing of ovarian tissue is the preservation of ovarian function both in terms of fertility and hormone production, a goal that has not been attained using other methods. The freezing of ovarian tissue is currently used primarily for specific groups of patients for whom the remaining techniques are not recommended, such as the following: (1) prepubertal patients in which ovulation can not be induced for the conservation of embryos and gametes, (2) women without a partner who do not desire embryos obtained by fertilization with donor semen, (3) patients with estrogen-dependent neoplasms, such as breast cancer, and (4) women with malignant neoplasms requiring an immediate intervention for whom a delay in treatment initiation to induce ovulation might negatively impact the prognosis. In this last situation in particular, the collection of ovarian cortical tissue for cryopreservation is advantageous in that it can be performed at any time during the menstrual cycle and allows

INTRODUCTION As a result of earlier diagnoses and appropriate treatments, an increasing number of patients are surviving cancer. However, the cytotoxicity of ionizing radiation and chemotherapeutic drugs frequently leads to premature ovarian failure, a condition with serious long-term consequences, including a reduced bone mass that can lead to osteoporosis, an increased incidence of cardiovascular disease, and the early occurrence of climacteric symptoms and infertility. The continuous evolution of assisted reproduction techniques has allowed us to develop various strategies to maintain reproductive function in female

2093

Cryopreservation and ovarian function Campos JR et al.

CLINICS 2011;66(12):2093-2097

for the acquisition of hundreds of thousands of primordial follicles.2 Ernst et al.3 reported that one of their patients was transplanted with six fragments of ovarian tissue after experiencing a period of menopause and has since conceived naturally for a second time, giving birth to a healthy baby girl. This woman is the first reported patient to have had two children from separate pregnancies as the result of a transplant of frozen-thawed ovarian tissue. This result is encouraging and provides support for the development of better techniques to cryopreserve ovarian tissue to maintain the fertility of girls and young women undergoing gonadotoxic treatments. Considerable success has been achieved in terms of the restoration of patients’ hormonal cyclicity, and to date, 15 healthy children have been born worldwide as a result of transplanted frozenthawed ovarian tissue.4 When considering the reproductive possibilities of women treated for cancer, it is desirable to wait for a disease-free interval for a planned pregnancy. As a result, the ovarian tissue sample must often remain frozen for variable and possibly long periods of time. This is especially true for prepubertal female patients. Because the influence of the storage time on the magnitude of tissue damage has not been fully explored in cryopreserved ovarian tissue samples, the objective of the present study was to determine whether tissue damage progresses during sustained periods of cryopreservation by assessing the follicular viability and steroidogenic capacity of fresh ovarian tissue and that of frozen tissue tissues thawed after 30 and 180 days of cryopreservation.

salts, L-glutamine and NaHCO3). For sample preparation, medullary tissue remnants, corpus luteum and eventual hemorrhagic cysts were eliminated by scraping with a surgical knife5 so that the tissue would have a maximum thickness of 2.0 mm with preservation of only the ovarian cortex for the appropriate penetration of the cryoprotectant solution. The tissue was then divided into three pieces and processed as follow: 1) fresh tissue analyzed directly (FG), 2) ramp frozen and thawed after 30 days (G30), and 3) ramp frozen and thawed after 180 days (G180). Each fresh fragment was immediately processed and evaluated using hematoxylin and eosin (H&E) staining to quantify the follicular density, LIVE/DEAD staining5 to measure the follicular viability, and tissue culture with measurement of steroids in the medium to quantify the steroidogenic capacity. Tissue culture was performed only in the last seven cases (Figure 1).

Histological evaluation The first tissue fragment was fixed in 4% paraformaldehyde (Merck, UN 2213 Paraformaldehyd, 4.1, III) and embedded in paraffin. Serial, 4-mm-thick sections were cut and stained with H&E. The stained sections were examined using light microscopy (4006 magnification), and the number of follicles was counted. For the area calculations, a macro camera was used that permits the user to choose the previously captured image, generate its calibration (the pixel (image unit) 6millimeter relationship), and determine the structural measurements.6 The total number of follicles per mm3 was calculated using the following formula: Nt = (No6St6t), where Nt is the number of follicles, No is the mean number of follicles observed in 1 mm2, St is the total number of sections in 1 mm3 of tissue, and t is the section thickness.7

MATERIALS AND METHODS Patients and study design This was a prospective study conducted on 17 healthy patients undergoing elective tubal ligation via video laparoscopy. The mean patient age was 29.0¡2.78 years, and all patients had at least two healthy living children. The study was approved by the local Research Ethics Committee, and all patients provided written informed consent to participate. Ovarian tissue biopsies measuring approximately 2.062.0 cm were collected with laparoscopic scissors and prepared by immersion in nutrient M199 medium (Medium 199, Sigma; sterile filtered and supplemented with Earle’s

Viability The second tissue fragment was digested in an enzymatic solution for 45 minutes containing PBS (Dulbecco’s PBS with Ca2+ and Mg2+ (16), Invitrogen Gibco) and 1 mg/ml collagenase (Collagenase Crude Type IA Cell Culture*T, Sigma) for analysis of follicular viability using a LIVE/DEAD Viability/Cytotoxicity Kit (Molecular Probes, Invitrogen). Although this level of structural evaluation was beyond the scope of the present study, we determined the mean follicular

Figure 1 - Study design.

2094

CLINICS 2011;66(12):2093-2097

Cryopreservation and ovarian function Campos JR et al.

7 ˚C, held for 10 minutes at -7 ˚C, and when the actual temperature reached -7 ˚C, manual seeding was performed using a cotton swab saturated with liquid nitrogen. Cooling was continued at 0.3 ˚C/minute until the sample temperature reached -70 ˚C. The tubes were then immersed and stored in liquid nitrogen (-196 ˚C). The two frozen samples were thawed after 30 and 180 days and analyzed as described above. We used the rapid thawing method described by Gosden et al to thaw the samples.11

Statistical analysis All data were analyzed using GraphPad 5.0 for Windows (GraphPad Software, San Diego, CA, USA). The mean and standard deviation of all variables were first calculated, and the normality was determined using the KolmogorovSmirnov test. The level of significance was set at p,0.05. The differences in the follicular density, follicular viability and estradiol and progesterone production in the culture medium at the different times studied (48, 96, and 144 hours for the identification of the peak production of these hormones) between groups were compared using the Kruskal-Wallis test followed by Dunn’s multiple comparison test.

Figure 2 - A histological section of cryopreserved ovarian tissue, stained with H&E for the assessment of follicular density. The arrows indicate primordial and primary follicles.

viability using a technique that indirectly assesses the functional capacity of the follicle. The LIVE/DEAD staining kit exploits the capacity of the cell to metabolize calcein using calcium as a co-factor. The produced metabolite fluoresces, and this fluorescence can be detected using microscopy. The cell must be viable and functional for this fluorescence to occur. The viability is reported as the percentage of viable follicles, with follicles considered viable when they contained a viable oocyte and more than 90% viable granulosa cells.8

RESULTS A heterogeneous follicular distribution in the parenchyma, with a mean density of 361.3¡255.4, 454.9¡676.3, and 296.8¡269.0 follicles/mm3 for FG, G30, and G180, respectively, was detected following H&E staining (Figure 2). There were no differences observed between the groups (p = 0.46). The follicular viability was higher in FG (93.4%) samples when compared with the cryopreserved samples (70.8% for G30 (p,0.001) and 78.4% for G180 (p,0.001)). There was no difference in the viability of the frozen samples (p.0.05). The steroid levels in the culture medium at time zero were undetectable, confirming the absence of hormonal contamination during the manipulation of the medium. The average production of E2 and P4 during the seven days of culture did not decrease significantly after cryopreservation. There was no observable hormonal peak at the different culture times (48, 96, and 144 h) among samples of the same study group. Therefore, to more accurately represent the levels of these hormones, the mean estradiol (E2) and progesterone (P4) levels for each study group were calculated over all of the culture time points. The mean E2 levels were 2026¡1782 pg/ml, 1272¡1081 pg/ml and 849.6¡366.2 pg/ml (p = 0.19) for FG, G30 and G180, respectively; and the mean P4 levels were 0.45¡0.37 ng/ ml, 0.26¡0.08 ng/ml and 0.45¡0.54 ng/ml (p = 0.86) for FG, G30, and G180, respectively.

In vitro culture The third tissue fragment was cultured in a-MEM (Minimum Essential Medium, Invitrogen) supplemented with 0.1% polyvinylpyrrolidone (PVP-40, Sigma), 100 ng/ ml bovine insulin (Sigma), 10 ng/ml human recombinant IFG-1 (Invitrogen), 10-7 M androstenedione (Sigma), 11 mM non-essential amino acids (Gibco), 5 mg/ml human transferrin (Sigma), 1.4 ng/ml sodium selenite (Acros Organics), 10 mM sodium bicarbonate (Gibco), 0.02 M HEPES (Sigma), and antibiotics (10,000 IU penicillin and 10,000 IU streptomycin) (Sigma).9 Four fragments (2.0 mm62.0 mm) from each patient were cultured per ml of medium in 4-well NUNC plates and incubated in a humidified 5% CO2 atmosphere at 37 ˚C for 144 hours.10 Samples of the culture samples were taken at 48-hour intervals (0, 48, 96, and 144 hours of culture) and stored at -20 ˚C until the progesterone (P4) and 17b-estradiol (E2) concentrations were determined using an ELISA (Siemens).

Cryopreservation of ovarian tissue The tissue samples were equilibrated in three sequential freezing solutions containing medium 199 (Medium 199, Sigma; sterile filtered and supplemented with Earle’s salts, L-glutamine and NaHCO3), 20% human albumin and 0.5 M (first step), 1 M (second step), or 1.5 M MS2SO4 (third step and freezing media), for a duration of 5 minutes each on ice. Following the last incubation, individual tissue samples were placed into cryovials containing 1 ml of freezing media. The tubes were moved to a controlled-rate freezer (Freeze Control System, CryoLogic, Victoria, Australia) with the temperature controlled by CryoGenesis V software (CryoLogic). The samples were cooled at 2 ˚C/minute to -

DISCUSSION In this study, we aimed to determine the quality of frozen-thawed ovarian tissue after cryopreservation by assessing different aspects of the recovered tissue, including follicular density, follicular viability, and steroidogenic capacity. Follicular density refers to the number of follicles present in the tissue per unit volume and can vary both with patient age and within the same patient. Follicular density has been proposed by several authors as a quality control criterion to evaulate tissue after thawing.1,12-14 According to

2095

Cryopreservation and ovarian function Campos JR et al.

CLINICS 2011;66(12):2093-2097

Poirot et al.2, a mean density of 30 to 400 follicles/mm3 tissue is expected in patients aged 20 to 30 years; however, it should be noted that follicle distribution is usually not homogeneous throughout the ovarian cortex. In the present study, we detected mean follicular densities ranging from 300 to 460 follicles/mm3, in agreement with the literature, and confirmed the heterogeneous distribution of the follicles. The objective of the assessment of follicular density was to guarantee that the various tissue samples would contain an adequate number of follicles, which would allow for the evaluation of functional status and viability, as the fresh and frozen-thawed tissue sections stained with H&E were obtained from side-by-side fragments. We also demonstrated the consistency of follicular density after tissue freezing and thawing, an expected result, as the loss of follicles due to the process would not have promoted a significant morphological change. To assess the real structural integrity of a follicle, it would have been necessary to examine markers of apoptosis or to perform an ultra-structural study by electron microscopy, procedures that were not performed as part of this study. Previous studies examining the effects of cryopreservation on ovarian tissue have reported a follicular recovery rate and viability of 40% to 60% when frozen-thawed tissues were compared with fresh tissue.15,16 In the present study, slow ramp-freezing was used to preserve human ovarian biopsies, and this process preserved highly viable immature oocytes. Obviously, given the careful manipulation of the recently extracted tissue, the fresh samples were expected to demonstrate near 100% viability, a finding which was confirmed in our study. While various degrees of damage to cryopreserved tissues have been presented by other authors,5,12,15 a recovery rate of approximately 60% viable follicles is considered acceptable5. Indeed, the 30% losses obtained in this study would be clinically significant compared with the possibility of using never-frozen tissues; however, in the clinical situations described (i.e., patients at risk for ovarian failure), the only options are cryopreservation of the tissue or gametes or no action at all. Obviously the potential gonadotoxicity of the chemotherapy to be used and the patients age must be taken into account. Ovarian tissue cryopreservation techniques should be offered only to patients at a high risk of ovarian failure; in all other cases, the less the ovary is manipulated, the better. In this study, whatever damage occurred in the first 30 days appears unaltered after 180 days, as the percentage of viable follicles remained the same. We believe that the tissue damage occurs as a result of surgical manipulation and tissue processing, which may cause ischemia, and not the freezing process itself. Previous studies have shown that the majority of follicle loss occurs during the ischemic period before implantation and revascularization rather than during freezing and thawing. In sheep, it was estimated that approximately 7% of follicles are lost due to the cryopreservation procedure, whereas 60â&#x20AC;&#x201C;70% are lost during the revascularization process in conjunction with transplantation.17 We found no data contesting or supporting our results in the literature, indicating that this is the first report to assess the influence of freezing time on tissue damage when using tissue cryopreservation techniques. Based on these findings, we can infer that after the sample is preserved, storage time should not decrease the quality of the tissue. Given that the clinical situations in which this

technique is used usually require long periods of conservation, this information is extremely valuable for the management of these cases. Several authors have reported the implantation or use of samples preserved for different periods of time with promising results.18 In the same way that structural integrity does not reflect tissue viability, it also does not guarantee tissue functionality. We therefore assessed the steroidogenic capacity of the tissue, which in turn allowed us to infer the quality of its function in terms of hormone production. Ovarian tissue culture has been described by some authors as a way of assessing the functional capacity of ovarian tissue or of obtaining follicles in more advanced developmental stages for reproductive purposes.19,20 Sadeu et al.21 reported maintaining the viability of and inducing partial follicle maturation in human fetal ovarian cultures for up to 63 days. Thus, in light of the proven capacity for tissue survival in culture medium, we chose this model for functional evaluation of the cryopreserved tissue. It should be noted that one of the premises underlying the cryopreservation of ovarian tissue rather than isolated gametes is the possibility of maintaining the steroidogenic capacity of the tissue and not simply retaining the reproductive capacity. In this study, the levels of estradiol and progesterone released by the ovarian tissue into the culture medium indicated that the steroidogenic capacity of the tissue was preserved. In addition, the cultured tissue continued to produce equivalent hormone quantities throughout the duration of culture and maintained the same rates of hormone production, indicating good tissue conservation during culture. It must be noted that the size of the cultured samples was standardized so that the tissue volume would not influence the hormone concentrations in the medium and thus generate a methodological bias. In addition, hormone production did not differ between cultures of tissue frozen for 30 or 180 days, demonstrating that the capacity to produce hormones was preserved after cryopreservation, regardless of storage time. This result emphasizes the lack of further tissue damage due to the maintenance of low temperatures and supports the follicular viability findings, namely that the tissue damage is more likely due to the manipulation and processing of the sample than to the freezing process. Finally, steroidogenic function does not necessarily indicate that reproductive function is maintained, as the ovary naturally first loses its reproductive capacity and then its steroidogenic capacity. This is best illustrated by normal ovarian physiology: fecundity abruptly decreases after 40 years of age (e.g., pregnancy rates of less than 5% after 40 years), whereas menopause occurs, on average, between 50 and 55 years of age. Although ovarian tissue cryopreservation is still considered an experimental technique,1 many assisted reproduction centers have been routinely performing this procedure despite the lack of consensus statements concerning the selection of appropriate candidates22 or formal support from the relevant professional societies (e.g., the American Society of Oncology and the American Society for Reproductive Medicine) for its large-scale application.1 However, if the risk of ovarian failure related to oncologic treatment is high, then we believe that the patient should have autonomy in deciding whether or not to undergo the procedure after receiving in-depth information about the risks, benefits and effectiveness of the technique.

2096

CLINICS 2011;66(12):2093-2097

Cryopreservation and ovarian function Campos JR et al. 4. Donnez J, Dolmans MM. Preservation of fertility in females with haematological malignancy. Br J Haematol. 2011;154:175-84, doi: 10. 1111/j.1365-2141.2011.08723.x. 5. Yeoman RR, Wolf DP, Lee DM. Coculture of monkey ovarian tissue increases survival after vitrification and slow-rate freezing. Fertil Steril. 2005;83 S1:1248-54, doi: 10.1016/j.fertnstert.2004.11.036. 6. Lara LA, Useche B, Ferriani RA, Reis RM, de Sa´ MF, de Freitas MM, et al. The effects of hypoestrogenism on the vaginal wall: interference with the normal sexual response. J Sex Med. 2009;6:30-9, doi: 10.1111/j.1743-6109. 2008.01052.x. 7. Gougeon A & Chainy GB. Morphometric studies of small follicles in ovaries of women at different ages. J Reprod Fertil. 1987;81:433-42, doi: 10.1530/jrf.0.0810433. 8. Martinez-Madrid B, Dolmans MM, Langendonckt AV, Defrere S, Van Eyck AS, Donnez J. Ficoll density gradient method for recovery of isolated human ovarian primordial follicles. Fertil Steril. 2004;82:1648-53, doi: 10.1016/j.fertnstert.2004.05.084. 9. Vireque AA, Camargo LS, Serapia˜o RV, Rosa E Silva AA, Watanabe YF, Ferreira EM, et al. Preimplantation development and expression of Hsp70 and Bax genes in bovine blastocysts derived from oocytes matured in alpha-MEM supplemented with growth factors and synthetic macromolecules. Theriogenology. 2009;71:620-7, doi: 10.1016/j.theriogenology. 2008.09.028. 10. Morimoto Y, Oku Y, Sonoda M, Haruki A, Ito K, Hashimoto S, et al. High oxygen atmosphere improves human follicle development in organ cultures of ovarian cortical tissues in vitro. Hum Reprod. 2007;22:3170-7, doi: 10.1093/humrep/dem314. 11. Gosden RG, Baird DT, Wade JC, Webb R. Restoration of fertility to oophorectomized sheep by ovarian autografts stored at -196 degrees C. Hum Reprod. 1994;9:597–603. 12. Demirci B, Lornage J, Salle B, Frappart L, Franck M, Guerin JF. Follicular viability and morphology of sheep ovaries after exposure to cryoprotectant and cryopreservation with different freezing protocols. Fertil Steril. 2001;75:754-62, doi: 10.1016/S0015-0282(00)01787-8. ` Errico A, Iannascoli C, Gabusi E, Valeri B, et al. 13. Fabbri R, Venturoli S, D Ovarian tissue banking and fertility preservation in cancer patients: histological and immunohistochemical evaluation. Gyneol Oncol. 2003;89:259-66, doi: 10.1016/S0090-8258(02)00098-7. 14. Gandolfi F, Paffoni A, Brambilla EP, Bonetti S, Brevini TAL, Ragni G. Efficiency of equilibrium cooling and vitrification procedures for the cryopreservation of ovarian tissue: comparative analysis between human and animal models. Fertil Steril. 2006;85(Suppl 1):1150-6, doi: 10.1016/j. fertnstert.2005.08.062. 15. Maltaris T, Dragonas C, Hoffmann I, Mueller A, Beckmann MW, Dittrich R. Simple prediction of the survival of follicles in cryopreserved human ovarian tissue. J Reprod Dev. 2006;52:577-82, doi: 10.1262/jrd.18012. 16. Silber S, Kagawa N, Kuwayama M, Gosden R. Duration of fertility after fresh and frozen ovary transplantation. Fertil Steril. 2010;94:2191-6, doi: 10.1016/j.fertnstert.2009.12.073. 17. Baird DT, Webb R, Campbell BK, Harkness LM, Gosden RG. Long-term ovarian function in sheep after ovariectomy and transplantation of autografts stored at -196 C. Endocrinology. 1999;140:462-71, doi: 10.1210/ en.140.1.462. 18. von Wolff M, Donnez J, Hovatta O, Keros V, Maltaris T, Montag M, et al. Cryopreservation and autotransplantation of human ovarian tissue prior to cytotoxic therapy - A technique in its infancy but already successful in fertility preservation. Eur J Cancer. 2009;45:1547-53, doi: 10.1016/j.ejca. 2009.01.029. 19. Telfer EE, McLaughlin M, Ding C, Thong KJ. A two-step serum-free culture system supports development of human oocytes from primordial follicles in the presence of activin. Hum Reprod. 2008;23:1151–8, doi: 10. 1093/humrep/den070. 20. Fabbri R, Pasquinelli G, Keane D, Mozzanega B, Magnani V, Tamburini F, et al. Culture of cryopreserved ovarian tissue: state of the art in 2008. Fertil Steril. 2009;91:1619-29, doi: 10.1016/j.fertnstert.2009.03.109. 21. Sadeu JC, Cortvrindt R, Ron-El R, Kasterstein E, Smitz J. Morphological and ultrastructural evaluation of cultured frozen-thawed human fetal ovarian tissue. Fertil Steril. 2006;85(Suppl 1):1130-41, doi: 10.1016/j. fertnstert.2005.09.038. 22. Kim SS. Time to re-think: ovarian tissue transplantation versus whole ovary transplantation. Reprod Biomed Online. 2010;20:171-4, doi: 10. 1016/j.rbmo.2009.11.019.

Many questions have arisen regarding ovarian tissue cryopreservation, such as the determination of the best candidates for this procedure, the best methods for tissue removal, the best form of freezing and thawing, whether one or both ovaries should be cryopreserved in full or in fragments, what the best site for re-implantation would be and whether vascular anastomosis should be performed. Further clinical and experimental studies are needed in order to address these concerns. Despite the aforementioned points, we consider the technique to be adequate regarding the conservation of tissue and the maintenance of tissue viability and functional capacity, although the reproductive aspects of this procedure have yet to be explored. Nonetheless, there are enormous ethical implications involved in this type of evaluation. Only embryo fertilization, implantation and the birth of a healthy baby would confirm preservation of ovarian function and reproductive capacity. Based on our findings, we conclude that although some loss in viability is observed after cryopreservation, the duration of cryopreservation does not interfere with the morphology or steroidogenic capacity of ovarian tissue. These findings permit the implementation of a safe and reliable standardized technique for human ovarian tissue freezing. It should be noted that the primary limitation regarding cryopreservation is currently the limited use of this tissue after thawing, with the published results still limited to case reports and studies examining small series of patients. FUNDING: This work was supported by the CNPq, Brazil.

AUTHOR CONTRIBUTIONS Campos JR contributed to the development of freezing protocol and was also responsible for the sample cryopreservation (freezing-thawing), follicle isolation, DEAD-LIVE staining and manuscript preparation. Rosa-e-Silva JC was responsible for the sample collection (ovarian biopsy), statistical analysis and manuscript preparation. Carvalho BR contributed to the development of freezing protocol and was also responsible for the patient follow-up and manuscript preparation. Vireque AA was responsible for the sample cryopreservation (freezing-thawing), follicle isolation, DEAD-LIVE staining and manuscript preparation. Silva-de-Sa´ MF was responsible for the patient follow-up and manuscript preparation. Rosa-e-Silva ACJS contributed to the development of freezing protocol and was also responsible for the patient follow-up, sample cryopreservation (freezing-thawing), follicle isolation, DEAD-LIVE staining and manuscript preparation.

REFERENCES 1. Lee SJ, Schover LR, Partridge AH, Patrizio P, Wallace WH, Hagerty K, et al. American Society of Clinical Oncology: American Society of Clinical Oncology recommendations on fertility preservation in cancer patients. J Clin Oncol. 2006;24:2917-31, doi: 10.1200/JCO.2006.06.5888. 2. Poirot CJ, Vacher-Lavenu MC, Helardot P, Guibert J, Brugie`res L, Jouannet P. Human ovarian tissue cryopreservation: indications and feasibility. Hum Reprod. 2002;17:1447-52, doi: 10.1093/humrep/17.6. 1447. 3. Ernst E, Bergholdt S, Jørgensen JS, Andersen CY. The first woman to give birth to two children following transplantation of frozen/thawed ovarian tissue. Hum Reprod. 2010;25:1280-1, doi: 10.1093/humrep/ deq033.

2097

CLINICS 2011;66(12):2099-2104

DOI:10.1590/S1807-59322011001200016

BASIC RESEARCH

Continuously Variable Rating: a new, simple and logical procedure to evaluate original scientific publications Mauricio Rocha e Silva, Editor CLINICS

OBJECTIVE: Impact Factors (IF) are widely used surrogates to evaluate single articles, in spite of known shortcomings imposed by cite distribution skewness. We quantify this asymmetry and propose a simple computer-based procedure for evaluating individual articles. METHOD: (a) Analysis of symmetry. Journals clustered around nine Impact Factor points were selected from the medical ‘‘Subject Categories’’ in Journal Citation Reports 2010. Citable items published in 2008 were retrieved and ranked by granted citations over the Jan/2008 - Jun/2011 period. Frequency distribution of cites, normalized cumulative cites and absolute cites/decile were determined for each journal cluster. (b) Positive Predictive Value. Three arbitrarily established evaluation classes were generated: LOW (1.3#IF,2.6); MID: (2.6#IF,3.9); HIGH: (IF$3.9). Positive Predictive Value for journal clusters within each class range was estimated. (c) Continuously Variable Rating. An alternative evaluation procedure is proposed to allow the rating of individually published articles in comparison to all articles published in the same journal within the same year of publication. The general guiding lines for the construction of a totally dedicated software program are delineated. RESULTS AND CONCLUSIONS: Skewness followed the Pareto Distribution for (1,K,2). Observed Positive Predictive Values ranged from 24 - 43% for over 98% of the selected journals in the ISI database. Continuously Variable Rating is shown to be a simple computer based procedure capable of accurately providing a valid rating for each article within the journal and time frame in which it was published. KEYWORDS: Scientometrics; Scientific Article Evaluation; Impact Factors; Citations. Rocha-e-Silva M. Continuously Variable Rating: a new, simple and logical procedure to evaluate original scientific publications. Clinics. 2011;66(12):2099-2104. Received for publication on September 1, 2011; First review completed on October 10, 2011; Accepted for publication on October 10, 2011 E-mail: mauricio.silva@pobox.com Tel.: 55 11 2661-6235

most human driven events, 80% of actions come from 20% of agents.2 If peer review and stringent selection were an effective antidote one might expect that articles published in the most prestigious journals would attain a more symmetrical distribution of citations. To test these ideas, I collected data from 60 journals listed in the ISI Journal Citations Report 2010.3 All journals were retrieved from Subject Categories with a direct interest to Medicine, at nine different Impact Factor points. Medicine was chosen because of the direct interest to a medical journal, but also to ensure a homogeneous collection of journals from the point of view of inherent citation strength. The result of this analysis prompted me to define and launch a new concept of article evaluation which can be made effective through relatively simple arithmetic computer programs.

INTRODUCTION It is universally acknowledged in the realm of Scientometrics that Impact Factors (IF) reflect, albeit imperfectly, the importance of scientific journals, but come nowhere near evaluating the individual research articles published therein. The discrepancy stems from a wellknown fact: distribution of citations amongst authors is skewed for the vast majority of periodicals.1 At first sight, it might be tempting to suppose that peer review would be an antidote against asymmetry. A reasonable corollary would then follow: the higher and mightier the journal, the more stringently selected the published science, the less skewed the citation distribution might be. In other words, peer review and a high level of rejection might defeat the Pareto principle, also known as the 80/20 rule which states that for

METHOD Copyright ß 2011 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Three separate procedures were performed. (a) Analysis of symmetry. Journals classified under medically related ‘‘Subject Categories’’ clustered around nine different Impact Factor points were selected from the 2010 Journal Citation Reports. Figure 1 illustrates the general

No potential conflict of interest was reported.

2099

Continuously variable rating Rocha-e-Silva M

CLINICS 2011;66(12):2099-2104

Figure 1 - Content of and mean Impact Factor (IF) of nine clusters containing 60 journals. Major clusters M1 and M2 are centrally placed with respect to groups LOW and MID, M3 adequately above the lower limit of group HIGH. Minor clusters C1, C2, C3 mark the limits of groups, whereas C4, C5 and C6 cover higher IF levels. In each cluster, ‘‘n’’ represents the number of included journals.

diagnostic procedure, also known as its Precision Rate2 is given by the following relation

content of these groupings. The following exclusion criteria were adopted: (i) Review Journals; (ii) Journals with very small numbers of citable items, to reduce the chance of a deviant, extremely well cited individual article deforming the total result; (iii) Journals with very large numbers of citable items, to reduce potential mistakes associated with hand picking. All citable items (original research and review articles) published during the year 2008 were retrieved from the Tables provided under the Cited Reference Search heading of ISI-THOMSON Web of Sciences site posted during the first week of July, 2011.4 An excel table was compiled for each journal to include all the posted data. A ‘‘clean’’ excel spread sheet was derived therefrom as follows: (a) obviously identifiable duplicate citation entries were merged together, (b) doubtful entries (no Article ID, no ‘‘View Record’’), editorial material and other non-citable items were excluded, (c) misquotes were discarded. This ‘‘clean’’ database for each journal contained all granted citations obtained by each article within the window stretching from Jan/2008 to Jun/2011. An estimate of citations/year was obtained based on the following assumptions:

PPV~

True Positives=(

ðTrue Positives z False PositivesÞ

To determine PPV, three arbitrarily established journal classes were generated: a LOW class (IFLOW) comprising journals with an Impact Factor such that 1.3#IFLOW,2.6; a MID class (IFMID) containing journals satisfying the relation 2.6#IFMID,3.9; a HIGH class with IFHIGH$3.9. Positive Predictive Value was determined for journal clusters within each classification class range as follows: an article published in a journal within a given classification class was deemed a True Positive if it was granted N cites/year, N being comprised within the class boundaries; it was deemed a False Positive if this condition was not met. To exemplify, an article published in a HIGH class journal is a true positive if it is granted 3.9 or more cited per year, whereas an article published in a mid class journal is a true positive if it is granted 2.6 or more AND less that 3.9 cites/year. Figure 1 illustrates the class boundaries and the positions of Journal Clusters with respect to class boundaries. (c) Continuously Variable Rating (CVR). A new system is proposed that allows the rating of individually published articles in comparison to all articles published by the same journal within the same year. Data for calculating this parameter are readily available in the Half-life tables of ISITHOMSON Journal Citations Report.3 Half-life Tables cover a ten year span. Table 1 exhibits the data required for the calculation of CVR of an article published in journal ‘‘J’’: If an article ‘‘A’’ was published in Year ‘‘n’’ its CVR for Year Zero is given by the relation:

1. On harvest week, the ‘‘oldest’’ papers were 42 months old (01/01/2008 – dd/mm/yyyy - to 01/07/2011); the ‘‘newest’’ 30 months old (31/12/08 to 01/07/2011); assuming a steady flow of articles through the year, the average article ‘‘age’’ of each article is 36 months. 2. A six months latency between publication and first cites was assumed, as suggested by Eugene Garfield is his classical 2004 lecture.1 Thus the collection had an average citation window of 30 months. 3. The total number of cites/article was therefore divided by 2.5; this was assumed as a cites/year reading for the life of these articles.

CVRA0 ~IFJ0 GCAn SAAn SGCn {1

Each excel table was reordered by decreasing number of cites/year. Frequency distribution of cites per article, normalized cumulative cites and absolute cites/decile of distribution were determined for all articles within each Journal cluster. (b) Determination of Positive Predictive Value. The use of the Impact Factor of a journal as a surrogate for evaluating the citability of articles published therein was evaluated by applying the concept of Positive Predictive Value to the procedure. The Positive Predictive Value of a

Where IFJ0 is the Impact Factor of Journal ‘‘J’’ in the Year Zero; GCAn is the number of cites granted in year zero to article ‘‘A’’ (published in Year n). SAAn and SGCn are defined in Table 2. Two features of CVR should be noted: 1. Year Zero is mobile, so that CVRA0 can be recalculated on a yearly basis;

Table 1 - A modified version of half-life tables from ISI Journal Citations Report. Year Cites granted in Year Zero to articles published in Year ‘‘N’’ Number of articles published in Year ‘‘N’’ Cites/Article granted in Year Zero

2100

N=0

N = -1

N = -2

…N

SGC0 SAA0 SGC0/SAA0

SGC-1 SAA-1 SGC-1/SAA-1

SGC-2 SAA-2 SGC-2/SAA-2

SGCn SAAn SGCn/SAAn

CLINICS 2011;66(12):2099-2104

Continuously variable rating Rocha-e-Silva M

Factor of 53.49 in 2010. If anything, the distribution for the New England Journal of Medicine is slightly more skewed than the average. Figure 3B represents theoretical Pareto cumulative distributions for three different values of K.5 Cumulative citations lie between K1 and K2 values. Figure 4 displays distributions of individual articles within the journals in the three major clusters. As expected, citations/year is a strict function of Impact Factor. (b) Positive Predictive Value (PPV). The use of the Impact Factor of journals as a surrogate measure of the impact Factor was tested for the three arbitrarily selected classification groups. PPV for the HIGH Impact Factor Class (Fig. 5). For articles published in journals with IF$3.9, a cutoff value of 3.9 cites/ year was used to define PPV: true positives for the HIGH group are all articles with (cites/year$3.9). Conversely, articles with (cites/year,3.9) are False Positives. When data from the Major Cluster IF = 4.3 are analyzed, True Positives represent 43% of the sample of 3,170 articles, 57% being False Positives. All False Positives are articles upgraded into this class. Thus for this cluster, PPV = 0.43; As might be logically expected, journals in cluster 3.9, have a lower PPV (0.28), while the three high clusters (IF 6.0, 8.0 and 10.0) exhibit progressively increasing PPVs, which tend to 1.00 in the latter group. PPV for the MID Impact Factor Class (Fig. 5). The boundaries of this class are IF 2.6 (lower) and 3.9 (higher). Consequently articles published in Journals within this class exhibiting the adequate number of granted cites/year are True Positives, whereas all others are False Positives. At the mid-point of this class, (Major Cluster IF = 3.1) PPV equals 0.24. False Positives are (a) upgraded with cites/yr ,2.6, representing 49% of the collection, (b) downgraded with cites/yr$3.9, 27% of the articles. Sitting between LOW and HIGH, this group has very different properties from the HIGH group, as shown in Figure 5: moving from the lower to the higher boundary has very little effect on the PPV: at the lower boundary, upgraded False Positives are maximal, while downgraded ones are minimal; at the upper border, the opposite happens.

Table 2 - Average Impact Factor (2010) vs. calculated cites/ year for 10 journals per group as defined in Figure 1. Group

Impact Factor 2010

cites/yr(2008-10)

significance

LOW MID HIGH

1.84¡0.10 3.14¡0.07 4.36¡0.14

1.92¡0.34 3.11¡0.26 4.35¡0.36

p.0.5 p.0.6 p.0.9

2. Year ‘‘n’’ can be any year from zero backwards to ‘‘-9’’, so that articles published within a ten-year interval, including those published in Year Zero can be evaluated. The general guiding lines for the construction of a totally dedicated software program may be deducted from the supplied algorithm.

RESULTS (a) Analysis of Symmetry. Table 2 compares the calculated cites/year parameter as described above for the three major journal clusters to their respective mean 2010 Impact Factors: no significant differences occur for any of the three levels. This result validates the use of this procedure to evaluate citations to articles over these first three years of their published life: consequently all data transformed in this manner shall be referred to as cites/year. Figure 2 plots frequency distribution of cites/year for three journal clusters (impact factors 1.8, 3.1 and 4.3). As expected, distribution shifts gradually leftward as Impact Factor increases but no symmetry is apparent for any of the clusters. Figure 3A shows normalized cumulative citations for each decile, from one (highest) to ten for each of the three major clusters: the 20% most cited papers collect 50% of cites. In contrast, the bottom 50% are left with no more than 20% of cites. The lower 20% of papers add only 3% to the total. The same applies to smaller samples of higher impact and even to extremely high Impact Factor Journals such as the New England Journal of Medicine, with an Impact

Figure 2 - Frequency distribution of articles according to cites/year: Groups LOW, MID and HI.

2101

Continuously variable rating Rocha-e-Silva M

CLINICS 2011;66(12):2099-2104

Figure 3 - (A) Normalized cumulative frequency distribution of granted citations to articles in the three major clusters (HIGH, MID and LOW), and for the New England Journal Medicine (NEJM). The ‘‘New England Journal of Medicine’’ exhibits significantly higher values (p,0.01) for deciles 10 to 50. (B) Pareto cumulative distribution functions for various ‘‘k’’.

Journal of Citations Report 2010 were used.3 For any journal, this table contains the total number of citations granted in the current year (2010 in the illustration) to articles published in that same year and in the nine preceding years. Table 3 reproduced and modified from ISI-THOMSON JCR refers to Journal ‘‘ISSN XXXX-X322’’ (Impact Factor2010 = 3.20). To the published data I have added one line for the number of citable items in every year, also obtained from the same source, and one for the corresponding average cites/article for each year. Three imaginary papers ‘‘published’’ in this journal, as shown in Table 4 were granted 3 citations each in 2010. The three papers can be matched to the corresponding average values in Table 3 (respectively 3.88, 3.11, and 1.64 citations in 2010) and their performance calculated as Observed/ Expected ratios. Multiplied by the Journal’s Impact Factor these ratios produce a corrected rating for each paper. This would be, per definition, the Continuously Variable Rating for each of these three articles in 2010.

PPV for the LOW Impact Class (Fig. 5). Any journal within the boundaries Impact Factor 1.3 to 2.6 is a LOW journal. Articles published therein are True Positives with cites/year between 1.3 and 2.6, but False Positives otherwise. At the mid-point of this class (Cluster IF = 1.84) PPV = 0.28. False Positives come in three categories: (a) 39% of overrated articles, with less than 1.3 cites/year; (b) 18% underrated articles which truly belong in the MID class; (c): 15% underrated articles which truly belong in the HIGH class. As occurs with the MID class, and for the same reasons, PPV here is low and fairly constant throughout the class. Continuously Variable Rating is best explained through an example. Data from the half-life tables published by

DISCUSSION This digression relates to the manner in which scientific production is rated by many educational or grant distributing agencies which use the Impact Factor as a surrogate measure for the citation potential of articles published therein. This policy contradicts common sense and ignores the very wellknown Garfield recommendation on the subject: ‘‘The use of journal impact factors instead of actual article citation counts to evaluate individuals is a highly controversial issue. Granting and other policy agencies often wish to bypass the work involved in obtaining actual citation counts for individual articles and authors. … Thus, the impact factor is used to estimate the expected influence of individual papers, which is rather dubious considering the known skewness observed for most journals.’’1 Maybe it would not be inappropriate to add here that after examining circa 60 journals (approximately 8,000 articles) with Impact Factors ranging from 1.3 to 55.0 I still have not encountered a single journal which does not very approximately follow a 50/20 distribution: 50% of citations

Figure 4 - Probability density functions for granted citations/year in the three major clusters (HIGH, MID and LOW). Density is a highly significant (p,0.001) function of Impact Factor.

2102

CLINICS 2011;66(12):2099-2104

Continuously variable rating Rocha-e-Silva M

Figure 5 - Average Positive Predictive Value (PPV) for 8,273 articles published in 60 journals divided into nine Impact Factor clusters (classes LOW, MID, HIGH). Boundary clusters are repeated in each class. An article is deemed a ‘‘True Positive’’ if its cites/year is within its class, as a ‘‘False Positive’’ if otherwise. PPVs are extremely low (23-27%) in all clusters of the ‘‘LOW’’ and ‘‘MID’’ groups, but rise progressively with IF in the HIGH group.

come from the top 20% articles, 20% come from the 50% less cited items. This is obviously reminiscent of the Pareto rule (also known as the 80/20 rule – 80% of actions come from 20% of agents). Figure 3B represents the expanded Pareto distribution, which is a power law probability distribution, comprising a family of curves which are a function of K. Journal citations conform to the Pareto cumulative distribution function for k ,2. Generally used justifications for the ‘‘surrogate’’ policy are: (a) the acceptance of a paper for publication by a high impact journal is an implied indicator of prestige and (b) recently published articles may not have had enough time to be cited, so that journal impact factor is the only valid evaluation tool. There can be no question that acceptance of a paper by a prestigious journal (and prestigious journals do have high impact factors – the two tend to go together) must be taken into consideration in any evaluation process worth its salt. However, it is definitely not synonymous with citations as demonstrated, by applying the concept of positive predictive value to the analysis. It is appropriate to remember that PPV is also known as the precision rate of a test. It is a critical measure of the performance of a diagnostic method, as it measures the probability of a ‘‘positive result’’ be the reflex of the underlying condition being tested.2 The second caveat alleged by supporters of the ‘‘surrogate’’ policy is that recently published papers cannot be properly evaluated. No evidence has ever been produced to support this concept, which has been qualitatively and quantitatively refuted elsewhere.1 I shall return to the point further along. PPV cannot be calculated for a single journal if defined as the proportion of articles with cites .IF. The result would be absurd because IF is an average and thus represents the

central tendency of cites/document/year. Even for a symmetrical distribution, this incongruous PPV might never exceed 0.5. The asymmetrical condition of this particular distribution guarantees that less that 30% of articles in any journal are cited in excess of its IF. This in itself exposes the flawed characteristics of ‘‘surrogate’’ evaluation. In this study, I calculated PPV within the framework of classification classes. The best PPV is found for a top class (such as the HIGH class in this article), with no upper boundary. Journals above the class cutoff limit will necessarily exhibit progressively higher PPVs. Journals close to the cutoff point for this class will have low PPVs. All False Positives will actually be upgraded articles which do not make the expected cites/year. Thus, if an agency defines only one cutoff point it will create a system whereby publishing in a journal as close as possible to the cutoff is the most advantageous way of making the most of the system. Publishing in such a journal will be presumably easier than publishing further up the scale and maximizes the authors’ chances of an upgrade. Publishing in journals with a much higher impact than the cutoff point virtually ensures that the publication will not be a False Positive. However, in the immortal words of the bard, ‘‘there needs no ghost, my Lord, come from his grave to tell us that’’. But the really critical problems occur when we look at agencies which define two or more classification classes. All but the highest class will necessarily have lower and upper boundaries, such as the MID and LOW classes of this Table 4 - The use of CONTINUOUSLY VARIABLE RATING: an imaginary example.

Table 3 - Data derived from the Half-life table for Shock, 2010 (lines 1 & 2) to which lines 3 and 4 were added using data from the ISI JCR.1 year

Yr published Imaginary #1 Imaginary #2 Imaginary #3

2010 2009 2008 2007 2006 2005 2004 2003 2002 2001

cites in 2010 302 588 703 684 675 647 439 373 391 288 # articles 184 177 226 199 174 195 170 183 105 164 cites/article 1.64 3.32 3.11 3.44 3.88 3.32 2.58 2.04 3.72 1.76

2006 2008 2010

Cites in 2010 3 3 3

Observed/ Expected*

(CVR)**

0.77 0.96 1.83

2.48 3.09 5.86

*(Observed vs Expected) is (cites in 2010 to imaginary journal #n)/average cites/article under the same year heading. **CVR = (observed/Expected)*Impact Factor2010.

2103

Continuously variable rating Rocha-e-Silva M

CLINICS 2011;66(12):2099-2104

simulation. PPVs are very low here. False positives mainly comprise upgraded articles, as a consequence of skewness. However, a substantial number of articles published in these journals are downgraded. Thus the surrogate procedure is great for lowly cited, but terrible for highly cited articles. If this sounds bad, it is definitely not all of the bad news. Because of the known tendency of citation granters to favor citing top, rather than not-quite-so-top journals, downgraded articles are suffering a double penalty for their infelicitous choice of a journal. One might well inquire why such a system was ever put into practice. The answer probably lies in the utter convenience of a procedure that allows the rating of a very large number of articles through a computer-generated software command. The essential concept behind CVR can be simply stated: how well does a paper published in any given journal perform in comparison to all other papers published in the same journal, within the same time frame? Such an analysis can be attempted through several of the available metrics, such as Eigen Factor, Scimago Journal Ranking, or through simple citation readings. For the sake of simplicity I have decided to use citations. The described result, to the best of my knowledge, has never been spelt out in this detail, so I termed it CONTINUOUSLY VARIABLE RATING. When this procedure is adopted, as in the example of Table 3 and 4, a number of facts become immediately obvious:

also grow by a factor of approximately ‘‘2’’. Consequently CVRnew of Imaginary #1 paper would be CVRnew ~ IFhigh ½observed cites =&2 ½expected cites ~6:4 ½3 cites=½&7:76 cites &2:48 In other words, duplication would cancel off in the ‘‘IF’’ and in the ‘‘expected’’ terms. Consequently, in this scenario, CVR would be relatively independent of Impact Factor. If this were to be the case (and only a thorough simulation might determine this), CVRs would be way ahead of the ‘‘surrogate’’ procedure in assessing published science. It may certainly be argued that by being published in a higher IF journal Imaginary #1 would harvest more cites and that consequently its CVR would effectively grow. But here we go into a truly wild speculative world. Because no paper, whether real or imaginary can be ethically published in two different journals, all we can do is live with analogies. The laws of nature mercifully dictate that one cannot run a control experiment on one’s own life. A practical limitation is that half-life data change on a yearly basis, even though the basic pattern remains fairly constant for any journal over the years. A second limitation applies to journals in the Scimago-Scopus collection but not present in the ISI-JCR. Citation rates in the two collections are virtually identical, but data required for the calculation of CVR are not directly available in the SCIMAGO-SCOPUS site.6 In contrast with these limitations, the gains to be reaped in terms of coherence and simplification are enormous. CVR does away with the need of ranking journals, a cumbersome and awkward process. To illustrate this point suffice it to say that CAPES, the Brazilian Federal Agency in charge of rating Brazilian Graduate Courses lists and ranks over 3,000 journals for Medicine.7 Conversely, because different Areas of Evaluation have different inherent citation properties, any journal may be (and often is) rated differently in different Areas. For CONTINUOUSLY VARIABLE RATING to be adopted a fair amount of groundwork must be performed, either directly by rating agencies, or by commission to the rating institutions. The final result however will be a fair, rational and transparent rating system where the plague of excessive false negatives may be truly minimized. In summary a new evaluation system is proposed for published original research, CONTINUOUSLY VARIABLE RATING, which takes into account the citation potential of individual articles within the context of the periodical in which it is published and performance vis-a`-vis the ensemble of articles published in the same journal. The system can be operated through totally dedicated relatively simple software.

1. Granted Citations in themselves are not a good guide. In the imaginary series of Table 4, the three articles get identical numbers of citations, but the corrected ratings show how differently they performed. 2. Data relating to real papers can be collected from applications submitted to the rating agency; all the examiner program requires is journal identification, and the year of publication. 3. Cites accorded to the paper in the year of evaluation can be retrieved from the appropriate source. 4. The method is simple enough to be handled by a relatively unsophisticated arithmetical program and yields CVRs for each paper submitted to evaluation. The entire system operates within the domain of rational numbers. 5. CVR is dynamic, because it can be recalculated on a yearly basis, subject to the practical limitation mentioned below. An appropriate database can store such information and create a history for each published article. 6. CVR takes into account the IF of the journal where the article is published. Articles with identical observed/ expected ratios published in journals with different IF will reflect such differences in their CVRs. 7. Last, but certainly not least, VERY RECENTLY PUBLISHED PAPERS can be accurately evaluated. I believe this will lay to rest the unsubstantiated claims of naysayers.

REFERENCES 1. Garfield E. The Agony and the Ecstasy—The History and Meaning of the Journal Impact Factor. International Congress on Peer Review And Biomedical Publication Chicago, September 16, 2005. Retrieved from www.eugenegarfield.org. 2. Positive predictive value. Retrieved September 10th, 2011 from http:// en.wikipedia.org/wiki/Positive_predictive_value. 3. ISI Thomson Web of Knowledge. Retrieved from Journal of Citations Report, in www.isiknowledge.com. 4. ISI Thomson Web of Knowledge. Retrieved from Web of Science, Science Citation Search in www.isiknowledge.com. 5. Kleiber C, Kotz S. (2003). Statistical Size Distributions in Economics and Actuarial Sciences. Wiley. ISBN 0-471-15064-9. 6. SCImago. (2007). SJR — SCImago Journal & Country Rank. Retrieved from www.scimagojr.com. 7. Capes-Qualis, retrieved from http://qualis.capes.gov.br/webqualis/

A final step might be for the agency to match corrected ratings to its standards. What if Imaginary #1 paper had been published in a journal with an impact factor say 6.4 (twice higher). Further, what if it had harvested the same 3 cites it got where it was published. What would its CVR be? Obviously there is no mathematically exact answer to this question. But because IFs are related to cites, it would not be far-fetched to suppose that the corresponding ‘‘expected cites’’ should

2104

CLINICS 2011;66(12):2105-2111

DOI:10.1590/S1807-59322011001200017

BASIC RESEARCH

Moderate exercise training promotes adaptations in coronary blood flow and adenosine production in normotensive rats Fernanda R. Roque,I Ursula Paula Reno´ Soci,I Katia De Angelis,II Marcele A. Coelho,I Cristina R. Furstenau,I Dalton V. Vassallo,III Maria Claudia Irigoyen,II Edilamar M. OliveiraI I University of Saõ Paulo, School of Physical Education and Sports, Laboratory of Biochemistry, Saõ Paulo/SP, Brazil. II Medical School of University of Saõ Paulo, Heart Institute, Hypertension Unit, Saõ Paulo/SP, Brazil. III Federal University of Espı´rito Santo, School of Medicine, Department of Physiological Sciences, Vito´ria/ES, Brazil.

OBJECTIVES: Aerobic exercise training prevents cardiovascular risks. Regular exercise promotes functional and structural adaptations that are associated with several cardiovascular benefits. The aim of this study is to investigate the effects of swimming training on coronary blood flow, adenosine production and cardiac capillaries in normotensive rats. METHODS: Wistar rats were randomly divided into two groups: control (C) and trained (T). An exercise protocol was performed for 10 weeks and 60 min/day with a tail overload of 5% bodyweight. Coronary blood flow was quantified with a color microsphere technique, and cardiac capillaries were quantified using light microscopy. Adenine nucleotide hydrolysis was evaluated by enzymatic activity, and protein expression was evaluated by western blot. The results are presented as the means ¡ SEMs (p,0.05). RESULTS: Exercise training increased the coronary blood flow and the myocardial capillary-to-fiber ratio. Moreover, the circulating and cardiac extracellular adenine nucleotide hydrolysis was higher in the trained rats than in the sedentary rats due to the increased activity and protein expression of enzymes, such as E-NTPDase and 59nucleotidase. CONCLUSIONS: Swimming training increases coronary blood flow, number of cardiac capillaries, and adenine nucleotide hydrolysis. Increased adenosine production may be an important contributor to the enhanced coronary blood flow and angiogenesis that were observed in the exercise-trained rats; collectively, these results suggest improved myocardial perfusion. KEYWORDS: Swimming; Myocardial perfusion; Adenine nucleotides; Cardiac capillaries; Cardiovascular benefits. Roque FR, Soci UPR, De Angelis K, Coelho MA, Furstenau CR, Vassallo DV, et al. Moderate exercise training promotes adaptations in coronary blood flow and adenosine production in normotensive rats. Clinics. 2011;66(12):2105-2111. Received for publication on July 7, 2011; First review completed on August 8, 2011; Accepted for publication on August 8, 2011 E-mail: feroberta@usp.br Tel.: 55 11 3091-3136

are considered physiologically beneficial to the heart by improving myocardial perfusion and function.3-5 Adenosine is one of the principal factors that regulates tissue function, particularly when the energy supply fails to meet the cellular energy demand. In this manner, adenosine accumulates during ischemia or hypoxia due to the imbalance between oxygen supply and demand.6 During exercise, myocardial oxygen demand increases, and adenosine release is increased to levels that are similar to those of restricted oxygen supply conditions.7,8 One important factor that contributes to adenosine accumulation is an increase in the substrate from which the nucleoside is formed. Therefore, the cleavage of ATP and the subsequent increase in AMP concentration, associated with an increase in the activity of the adenosine-forming enzymes (nucleotidases), lead to the accumulation of adenosine to increase the energy supply by vasodilatation and to decrease the energy demand through a negative-feedback mechanism.6

INTRODUCTION Exercise training is an important factor for preventing cardiovascular risk and has been associated with several cardiovascular benefits. To characterize the benefits of exercise, resting bradycardia has been considered to be the hallmark of cardiovascular effects for exercise-training adaptation in animals.1,2 Left ventricular hypertrophy and angiogenesis also result from aerobic exercise training and

2105

Exercise training and coronary blood flow Roque FR et al.

CLINICS 2011;66(12):2105-2111

identified and weighed weekly to determine their adaptation to the workload. The animal protocol was conducted according to the Guideline for the Care and Use of Laboratory Animals and was approved by the Ethics Committee of the School of Physical Education of the University of Sa˜o Paulo (No. 2006/05).

Adenine nucleotides are continuously present in the extracellular space of the heart. Extracellular ATP is considered to be a powerful signaling molecule, and a variety of extracellular enzymes utilize this nucleotide to induce biological responses. The release of endogenous nucleotides represents a critical component for the initiation of a signaling cascade. An important route of nucleotide appearance in the extracellular milieu is nucleotide efflux via various pathways, which include ATP release channels, nucleotide-specific transporters and vesicular exocytosis.9 The mechanism of sequential ATP hydrolysis via the conversion of ADP into AMP is mediated by a family of Ecto-nucleoside triphosphate diphosphohydrolase (E-NTPDases 1-8) enzymes, which have been classified in order of their discovery and classification. E-NTPDases 1, 2, 3, and 8 are expressed as cell surface enzymes, E-NTPDases 5 and 6 exhibit intracellular localization and undergo secretion after heterologous expression, and E-NTPDases 4 and 7 are exclusively intracellular. Significant homology has been confirmed between E-NTPDase 1 and human CD39. Moreover, 59-nucleotidase, which is otherwise known as CD73, hydrolyses 59-AMP and is expressed in different tissues, including the heart, where it is located both in the extracellular and intracellular compartments.9 Changes in the activities of ectonucleotidases may modify the production of adenosine and affect myocardial blood flow. In fact, increased 59-nucleotidase enzyme activity has been observed following a single session of endurance and sprint training,10 and increased ecto-59-nucleotidase activity in the rat heart was also observed following a higher intensity program of chronic swimming training.11 The increase in enzyme activity that was observed in these studies suggests alterations in the production of adenosine, but the relationships of these alterations with blood flow have not yet been investigated. Adenosine, which is produced primarily through the metabolism of ATP, interacts with adenosine receptors (the four subtypes of ARs are A1, A2A, A2B, and A3), which are G-protein-coupled receptors. The divergence of the coupling between each receptor and various G proteins, which are linked to different enzymes, channels or transporters, can elicit varied responses in different tissues or cells. Multiple cardiac cells, including fibroblasts, endothelial cells, smooth muscle cells, and myocytes, express adenosine receptors. Among other effects, these G-protein-coupled receptors in the heart mediate responses of coronary flow modulation and cardioprotection.12 Therefore, the present investigation was intended to verify whether a chronic, low-intensity swimming training protocol could alter coronary blood flow, cardiac capillaries and the hydrolysis of extracellular adenine nucleotides in normotensive rats.

Exercise Training Protocol The swimming training was performed as previously described;1 it was executed five times each week with a duration of 60 min in a swimming system with warm water at 30-32 ˚C for 10 weeks. Adaptation sessions were performed for the first two weeks of the protocol; during these sessions, the exercise duration and workload were gradually increased until the rats could swim for 60 min while wearing caudal dumbbells that were 5% of their body weight. The adaptation sessions avoids the excessive physiological stress observed on the immune system.13 This protocol is defined as low- to moderate-intensity and long-term training, which is effective for the promotion of cardiovascular adaptations and increases in muscle oxidative capacity.14

Hemodynamic and Blood Flow Analysis Coronary blood flow was evaluated by the colored microsphere technique, which was previously described.15 Briefly, 24 hours after the last exercise session, the rats were anesthetized with ketamine (90 mg/kg) and xylazine (10 mg/kg, ip) to facilitate the implantation of two catheters that were filled with saline solution into the femoral artery and left ventricle. A PE-10 catheter was positioned into the abdominal aorta through the femoral artery for the direct measurement of arterial pressure (AP). The second PE-50 catheter was inserted into the left ventricle through the right carotid artery for colored microsphere infusion. The catheter position was determined by observing the characteristic left ventricular pressure waveform during surgery. To show that the aortic valves were not injured, arterial pressure was measured before and after ventricular catheterization. If the diastolic arterial pressure decreased, suggesting an aortic valve lesion, the animal was discarded. The catheters were anchored with silk sutures and exteriorized at the back of the neck. Rats that received food and water ad libitum were studied one day after the procedure, and the animals were conscious and allowed to move freely during the experiments.16 The femoral artery catheter was connected to a pressure transducer, and arterial pressure signals were monitored continuously, except during microsphere infusion and withdrawal of a reference blood sample. The recorded data were analyzed on a beat-to-beat basis to quantify changes in the heart rate and the systolic, diastolic and mean blood pressure. Dye-Trak colored microspheres (15 mm; Triton Technology, San Diego, CA, USA) were infused at rest (red: 200 000 CM) for blood flow and cardiac output determination. Microsphere infusion, reference blood samples and tissues were processed according to the method of Hakkinen et al.15 After the microsphere infusion, the animals were sacrificed, and their hearts were removed to determine blood flow. The absorption spectrum peak for the red microspheres was obtained at 530 nm, and the minimum acceptable measurement was 0.010 absorbance units.

METHODS Animals Male Wistar rats (weighing 180-250 g) were used in these experiments. The rats were randomly divided into control (C) and trained (T) groups and were kept separated in standard cages. Food and water were provided ad libitum. The room temperature was maintained at 23¡1 ˚C, and a 12:12 hours light-dark cycle was maintained throughout the experiment. The rats were

2106

CLINICS 2011;66(12):2105-2111

Exercise training and coronary blood flow Roque FR et al.

concentrations were chosen to ensure the linearity of the reaction. The reactions were stopped by the addition of 0.2 mL of 10% trichloroacetic acid (TCA). The serum samples alone were centrifuged at 5,000 x g for 15 min to eliminate any precipitated protein, and the supernatant was used for the colorimetric assay. All of the samples were chilled on ice, and the amount of inorganic phosphate (Pi) that was liberated was measured according to the procedure of Lanzetta et al.21 To correct for non-enzymatic hydrolysis, we performed controls by adding the serum after the reaction was stopped with TCA. The enzyme activities were expressed as nanomoles of Pi released per minute per milligram of protein. Measurement of AMP Hydrolysis. The enzyme activity was routinely determined at 37 ˚C in the following incubation media: (a) in the blood serum, the reaction mixture, which contained AMP as a substrate (2.0 mM) in 100 mM Tris–HCl, pH 7.5, was incubated with 1.0-1.5 mg serum protein at 37 ˚C in a final volume of 0.2 mL;22 (b) in the cardiac sarcolemmal fraction, the reaction mixture, which contained AMP (2.0 mM) as a substrate in 100 mM Tris-HCl buffer, pH 7.5, and 1.5 mM MgCl was incubated with 1-2 mg of protein in a final volume of 0.2 mL. All of the other procedures were the same as for the ATPdiphosphohydrolase activity, which was described above. The protein concentration was measured according to the method of Bradford,23 and bovine serum albumin was used as a standard.

For each infusion, the tissue flow rates were calculated according to the following formula: Qt ~At (Qb 7Ab ), where Qt and Qb represent the flow in the sample tissue and in the reference blood, respectively, and At and Ab represent the peak absorbance of the tissue sample and of the reference blood, respectively. The calculation of Qb, in mL.min-1, was:

Qb ~ reference blood sample weight71:05 g:mL , reference blood sample volume70:5 mL:min

where 1.05 g.mL-1 is the specific gravity of blood, and 0.5 mL.min-1 is the withdrawal rate. The blood flow rates were divided by the tissue weights to yield mL.min-1.g-1.

Adenine Nucleotides and Nucleoside Hydrolysis Isolation of Blood Serum Fraction. The blood samples were drawn following decapitation, and they were subsequently centrifuged in plastic tubes at 5,000 x g for 15 min at 4 ˚C. The serum samples were stored at -20 ˚C until they were used in the experiments. Isolation of Sarcolemmal Fraction. The sarcolemmal preparation was isolated from the rat hearts as described by Velema and Zaasgma.17 The ventricles were minced and homogenized in 80 mL of 20 mM Tris-HCl that contained 1.0 mM EDTA, pH 7.0, using a tissue homogenizer for four periods of 7-s periods at maximum speed with 15-s resting intervals. The homogenate was centrifuged for 20 min at 8,800 x g. The supernatant (S1) was centrifuged for 20 min at 12,500 x g. This step was repeated with supernatant S2, and the resulting supernatant S3 was recentrifuged for 60 min at 44,000 x g. The obtained pellet (P4) was resuspended in 15 mL of 20 mM Tris-oxalate, 0.6 M KCl and 1.0 mM EDTA, pH 6.8, and was centrifuged for 60 min at 44,000 x g. The pellet obtained from this final centrifugation step (sarcolemmal fraction) was suspended in 20 mM Tris-HCl and stored at -20 ˚C. This preparation was used as the enzyme source. All of the procedures were performed at 4 ˚C. Measurement of ATP and ADP Hydrolysis. ATP and ADP hydrolysis were determined using a modification of the method described by Yegutkin.18 The enzyme activity was routinely determined at 37 ˚C in the following incubation media: (a) the blood serum was incubated with 112.5 mM Tris-HCl, pH 8.0, with approximately 1.0 mg of serum protein at 37 ˚C for 40 min in a final volume of 0.2 mL, and the reaction mixture contained ADP or ATP as a substrate19 (2.0 mM or 3.0 mM, respectively); (b) the cardiac sarcolemmal fraction was incubated with 50 mM TrisHCl buffer, pH 7.5, 1.5 mM CaCl, and 0.8–1.0 mg of protein in a final volume of 0.2 mL, and the reaction mixture contained ADP or ATP as a substrate20 (3.0 mM or 2.0 mM, respectively). Both of the reactions were initiated by adding the substrate to the reaction mixture, which was preincubated for 10 min at 37 ˚C. The incubation times and protein

Western Blot Analysis The protein levels of E-NTPDase 1 (CD 39) and ecto-59nucleotidase (CD 73) in the heart muscle were analyzed by western blotting. The frozen heart muscles (100 mg) were homogenized in cell lysis buffer that contained 100 mM Tris-HCl, 50 mM NaCl, 1% Triton X-100, and a protease inhibitor cocktail (1:100, Sigma Aldrich, Saint Louis, MO, USA). Insoluble heart tissues were removed by centrifugation at 3,000 x g at 4 ˚C for 10 min. The samples were subjected to SDS-PAGE (10%). After electrophoresis, the proteins were electro-transferred onto a nitrocellulose membrane (BioRad Biosciences, NJ, USA). Equal loading of the samples (50 mg) and an even transfer efficiency were monitored with the use of 0.5% Ponceau S staining of the blot membrane. The blot membrane was then incubated in a blocking buffer (5% non-fat, dry milk; 10 mM Tris-HCl, pH 7.6; 150 mM NaCl; and 0.1% Tween-20) for 2 h at room temperature. The membrane was then incubated overnight at 4 ˚C with a rabbit polyclonal antibody directed against CD39 and CD73 (1:1,000; Santa Cruz Biotechnology, CA, USA). The binding of the primary antibody was detected with the use of peroxidase-conjugated secondary antibodies, and enhanced chemiluminescence reagents (Amersham Biosciences, NJ, USA) were used to visualize the autoradiogram, which was later exposed to photographic film. The film was developed, and the bands were analyzed using the Scion Image software program (Scion Corporation, based on the NIH image program). The heart muscle GAPDH expression levels were used to normalize the results. The results are expressed in arbitrary units (AU).

Cardiac Morphometric Analysis Twenty-four hours after the last exercise session, the rats were sacrificed by decapitation, and their hearts were immediately excised and rinsed in physiological solution,

2107

Exercise training and coronary blood flow Roque FR et al.

CLINICS 2011;66(12):2105-2111

dried on filter paper and weighed. For the morphometric analysis, the LV was fixed in 6% formaldehyde and embedded in paraffin; it was cut into 5-mm sections at the level of the papillary muscle and subsequently stained with Periodic Acid Schiff (PAS) to visualize the cellular structures. From each sample, three microscopic fields were randomly chosen from the transversal sections using a light microscope (with an oil immersion objective, x400 magnification). The capillaries were identified as small vessels, and they contained a uniform lumen with a diameter ,12 mm, which was previously described.5 The quantification of the capillaries was determined in microscopic fields that measured 0.04 mm2, and the measurement was expressed as a capillary-to-fiber ratio (number of capillaries per myocyte). Figure 1 - Coronary blood flow (mL.kg-1.min-1). The values are represented as the means ¡ SEMs; (*) p,0.05 compared with the control group. The number of animals (n) is indicated in the figure.

Statistical Analysis The data are reported as the mean ¡ standard error of the mean (SEM). An unpaired Student’s t-test was used to compare the means. To indicate how closely two variables changed in relationship to each other, Pearson’s correlation coefficient was used. For all of the analyses, values of p,0.05 were considered to be significant.

and AMP (C: 1.9¡0.2 vs. T: 3.8¡0.6 nmol Pi.min-1.mg-1 protein; p,0.05).

Western Blot

RESULTS

In the heart muscle, the swimming training increased the protein expression of both ectonucleoside triphosphate diphosphohydrolase (protein expression CD39: C 0.44¡0.1 vs. T 1.63¡0.2 AU; p,0.001) and ecto-59-nucleotidase (protein expression CD73: C 0.72¡0.1 vs. T 1.62¡0.2 AU; p,0.01) (Figures 3A and B, respectively).

Arterial Pressure, Heart Rate and Coronary Blood Flow Although the systolic, diastolic, and mean blood pressures were not different between the untrained and trained groups, the exercise training significantly decreased the resting heart rate, as demonstrated in Table 1. Figure 1 demonstrates the increased coronary blood flow that was observed in the swimming-trained group compared with that of the control group (C: 2.46¡0.33 vs. T: 5.45¡1.47 mL.min-1.g-1; p,0.05).

Cardiac Capillaries Figure 4A demonstrates that the swimming training induced angiogenesis by the capillary-to-fiber ratio increased (C 0.89¡0.02 vs. T 1.20¡0.05 capillaries/myocyte; p,0.001). Additionally, Figure 4B shows a high positive correlation between the capillary/myocyte ratio and coronary blood flow (r = 0.83; p,0.01).

Hydrolysis of Adenine Nucleotides in Blood Serum and Cardiac Sarcolemmal Fraction Swimming training increased the hydrolysis of adenine nucleotides in the blood serum fraction as follows (Figure 2A): ATP (C: 0.62¡0.03 vs. T: 0.85¡0.08 nmol Pi.min-1.mg-1 protein; p,0.05), ADP (C: 0.88¡0.07 vs. T: 1.41¡0.08 nmol Pi. min-1.mg-1 protein; p,0.001), and AMP (C: 0.47¡0.03 vs. T: 0.60¡0.04 nmol Pi.min-1.mg-1 protein; p,0.05). Similarly, the hydrolysis of nucleotides in the cardiac sarcolemmal fraction (Figure 2B) were increased by swimming training as follows: ATP (C: 101¡8 vs. T: 217¡14 nmol Pi.min-1.mg-1 protein; p,0.001), ADP (C: 50¡2 vs. T: 109¡7 nmol Pi.min-1.mg-1 protein; p,0.001),

DISCUSSION The primary findings reported here show that swimming training increases coronary blood flow, capillary supply in the myocardial and extracellular nucleotide hydrolysis. This increased nucleotides hydrolysis produces more adenosine, a potent vasodilator that may contribute to augmented coronary blood flow and angiogenesis. Moreover, the exercise-traininginduced angiogenic process that was observed in the heart contributes to improved cardiac perfusion. Regular exercise improves the autonomic control of cardiovascular function and results in the adaptation of the autonomic nervous system, which is commonly observed as a reduced resting heart rate24 and is considered to be a physiological marker for the aerobic adaptation to exercise training.1,2 Indeed, resting bradycardia was observed in the trained group, which confirmed the effectiveness of the exercise training protocol; however, blood pressure did not change as an effect of exercise training. The effect of aerobic exercise training on the blood pressure of normotensive animals and humans seems to be minimal, and our results are consistent with other studies.1,2,25,26 In contrast to the pathological left ventricular hypertrophy that was observed in hypertensive heart disease,27

Table 1 - Hemodynamic parameters. SBP

C (n = 5) T (n = 5)

DBP

MBP

mm Hg

bpm

115.9¡3.5 118.3¡6.4

94.5¡1.6 87.7¡4.7

107.2¡2.1 103.4¡5.1

328.5¡7.3 285.8¡6.7*

Systolic blood pressure (SBP), diastolic blood pressure (DBP), mean blood pressure (MBP) and heart rate (HR) are presented for the control (C) and trained (T) groups. The values are represented as the means ¡ SEMs; n = number of observations. (*) p,0.01, comparing the trained group versus the control group.

2108

CLINICS 2011;66(12):2105-2111

Exercise training and coronary blood flow Roque FR et al.

Figure 2 - Activity of ATP diphosphoydrolase and 59-nucleotidase enzymes (nmol Pi.min-1.mg-1 protein) on the blood serum fraction (A) and cardiac sarcolemmal fraction (B). The values are represented as the means ÂĄ SEMs. (*) p,0.05 compared with the control group. The number of animals (n) is indicated in the figure. All of the samples were assayed in duplicate, and only samples in which the two absorbance values were in accordance were considered in the experiment.

display heightened susceptibility to inflammatory vascular reactions.9,31 Although we only evaluated E-NTPDase 1 (CD39) expression in the myocardium, we cannot rule out the participation of other E-NTPDases that are involved in extracellular nucleotide hydrolysis, primarily E-NTPDase 2 (CD39L1) and E-NTPDase 6 (CD39L2), which are highly expressed in the heart.32 Moreover, circulating nucleotides are also known to be important signaling molecules. Therefore, in this work, we evaluated nucleotide hydrolysis in blood serum. Similar increases were observed in the activity of both soluble enzymes. Therefore, circulating blood serum enzymes, such as E-NTPDases and 59nucleotidase, may contribute to the reduction of excess nucleotides and the increase in the concentration of adenosine. It has been well documented that functional and structural adaptive changes, such as angiogenesis, are induced by chronic exercise training.33 Our results demonstrated an angiogenic process in response to swimming training (Figure 4A). An increased capillary supply in the myocardium of exercised rats has already been described by other researchers.5,34 Regular exposure to the increased shear stress that results from increased blood flow during exercise is considered to be the primary signal for exercisetraining-induced adaptations.35 Indeed, we demonstrated a positive correlation between increased coronary blood flow and the number of cardiac capillaries (Figure 4B). One of the effects of adenosine is the promotion of vessel growth, and evidence has indicated that adenosine plays an important role in neovascularization (including angiogenesis and vasculogenesis).12 Higher levels of adenosine may be an important factor for the angiogenesis that is induced by exercise training due to adenosineâ&#x20AC;&#x2122;s capacity to increase levels of pro-angiogenic molecules (e.g., VEGF). Studies in humans and animals have confirmed myocardial capillary proliferation in response to exogenous adenosine or

chronic endurance exercise led to physiological left ventricular hypertrophy3 and coronary vascular adaptations that can improve the myocardial oxygen supply.28 Oxygen supply can also be improved by increased blood flow; in this study, we observed that swimming training increased coronary blood flow (Figure 1), which was previously demonstrated in dogs that had performed a single session of treadmill exercise29 and during hypoxemic conditions that were designed to promote coronary dilatation in rats that underwent treadmill training.30 The alteration in myocardial blood flow may have resulted from the production of adenosine, which is a purine nucleoside that is recognized as a major local tissuefunction regulator. Nucleoside production is increased in conditions in which ATP utilization increases, such as during shear stress, hypoxia, and stretching. In the cardiovascular system, the nucleotide hydrolysis chain represents the major route for the generation of extracellular adenosine.9 This study describes for the first time that in the myocardium of normotensive rats that were submitted to chronic swimming training, the activity (Figure 2) and expression (Figure 3) of nucleotidases, such as E-NTPDase (expression of CD39) and 59-nucleotidase (CD73), were higher than in sedentary rats; this increased the hydrolysis of extracellular nucleotides and contributed to adenosine production. E-NTPDase 1/CD39 is one of the most studied members of the E-NTPDase family, and it has the same preference for ATP and ADP hydrolysis (1:1). This enzyme has a welldescribed role in regulating blood flow and platelets by converting ATP and ADP, which are the vasoconstrictor and promoter of platelet aggregation, respectively, to AMP. The association of this enzyme with 59-nucleotidase/CD-73 converts AMP into adenosine, which is a potent anti-platelet vasodilator. Indeed, the phenotype of the CD39-null mouse is consistent with thromboregulation disorders, which

2109

Exercise training and coronary blood flow Roque FR et al.

CLINICS 2011;66(12):2105-2111

Figure 3 - Representative western blot and densitometric analyses of the heart homogenates (AU). CD39 (A) and CD73 (B) protein expression. The expression of GAPDH is shown as a loading control. The values are represented as the means ยก SEMs. (*) p,0.001 compared with the control group. The number of animals (n) is indicated in the figure.

augmented endogenous adenosine.12 Therefore, enhanced angiogenesis is an adaptive response to functional adaptations, such as augmented local blood flow and higher adenosine levels, which are induced by exercise, and angiogenesis is a prominent beneficial effect of exercise training on the myocardium. The present study demonstrated that chronic swimming training is efficient for producing functional and structural adaptations of the cardiovascular system. Changes in the extracellular hydrolysis of adenine nucleotides by augmented activity and the expression of enzymes, such as ENTPDase and 59-nucleotidase, may increase adenosine production and could be among the mechanisms that contribute to the increased coronary blood flow and angiogenesis that is observed in exercise-trained rats.

ACKNOWLEDGMENTS FR Roque was the recipient of a FAPESP scholarship (no. 05/52100-2), and UPR Soci was the recipient of a CNPq-PIBIC scholarship. EM Oliveira and MC Irigoyen hold scholarships from CNPq, Brazil.

AUTHOR CONTRIBUTIONS Roque FR is the principal investigator of the study, obtained a student scholarship from FAPESP for project development, and participated in all stages of the study. Soci UPR assisted in the training of animals and in the experimental protocol for the cardiac capillaries. De Angelis K performed the protocol for the investigation of coronary blood flow (colored microspheres). Coelho MA performed the surgical process on the animals. Furstenau CR assisted in the western blot experiments. Vassallo DV assisted in the discussion of the results and in the manuscript preparation. Irigoyen MCC is responsible for the Laboratory of Hypertension, where the hemodynamic and coronary blood flow experiments were performed and provided all the necessary materials and equipment for the experiments. Oliveira EM is the investigator responsible for the project, and is the one who obtained scholarships from CNPq.

REFERENCES 1. Medeiros A, Oliveira EM, Gianolla R, Casarini DE, Negraห o CE, Brum PC. Swimming training increases cardiac vagal activity and induces cardiac hypertrophy in rats. Braz J Med Biol Res. 2004;37:1909-17, doi: 10.1590/ S0100-879X2004001200018. 2. Oliveira EM, Sasaki MS, Cerencio M, Barauna VG, Krieger JE. Local renin-angiotensin system regulates LV hypertrophy induced by swimming training independent of circulating renin: a pharmacological study. J Renin Angiotensin Aldosterone Syst. 2009;10:15-23, doi: 10.1177/ 1470320309102304.

Figure 4 - A: Capillary-to-fiber ratio. The values are represented as the means ยก SEMs. (*) p,0.001 compared with the control group. The number of animals (n) is indicated in the figure. B: The increase of cardiac capillaries was positively correlated with increased coronary blood flow (control group, n = 5; trained group, n = 5) (r = 0.83, p,0.01).

2110

CLINICS 2011;66(12):2105-2111

Exercise training and coronary blood flow Roque FR et al.

3. Fenning A, Harrison G, Dwyer D, Rose’Meyer R, Brown L. Cardiac adaptation to endurance exercise in rats. Mol Cell Biochem. 2003;251:519, doi: 10.1023/A:1025465412329. 4. Laughlin H, Oltman CL, Bowles DK. Exercise training-induced adaptations in the coronary circulation. Med Sci Sports Exerc. 1998;30:352-60. 5. Melo RM, Martinho E JR, Michelini LC. Training-induced, pressurelowering effect in SHR: wide effects on circulatory profile of exercised and nonexercised muscles. Hypertension. 2003;42:851-7, doi: 10.1161/01. HYP.0000086201.27420.33. 6. Mubagwa K and Flameng W. Adenosine, adenosine receptors and myocardial protection: An updated overview. Cardiovasc Res. 2001;52:25-39, doi: 10.1016/S0008-6363(01)00358-3. 7. McKenzie JE, McCoy FP, Bockman EL. Myocardial adenosine and coronary resistance during increased cardiac performance. Am J Physiol. 1980;239:H509-15. 8. Watkinson WP, Foley DH, Rubio R, Berne RM. Myocardial adenosine formation with increased cardiac performance in the dog. Am J Physiol. 1979;296:H13-21. 9. Yegutkin GG. Nucleotide- and nucleoside-converting ectoenzymes: Important modulators of purinergic signaling cascade. Biochim Biophys Acta. 2008;1783:673-94, doi: 10.1016/j.bbamcr.2008.01.024. 10. Langfort J, Czarnowski D, Pilis W, Wo´jcik B, Go´rski J. Effect of various types of exercise training on 59-nucleotidase and adenosine deaminase activities in rat heart: Influence of a single bout of endurance exercise. Biochem Mol Med. 1996;59:28-32, doi: 10.1006/bmme.1996.0060. 11. Pierce GN, Parshotam SS, Meng HP, Maddaford TG. Effects of chronic swimming training on cardiac sarcolemmal function and composition. J Appl Physiol. 1989;66:1715-21. 12. Headrick JP, Peart JN, Reichelt ME, Haseler LJ. Adenosine and its receptors in the heart: Regulation, retaliation and adaptation. Biochim Biophys Acta. 2011;1808:1413-28, doi: 10.1016/j.bbamem.2010.11.016. 13. Ferreira CKO, Prestes J, Donatto FF, Verlengia R, Navalta JW, Cavaglieri CR. Phagocytic responses of peritoneal macrophages and neutrophils are different in rats following prolonged exercise. Clinics. 2010;65:1167-73, doi: 10.1590/S1807-59322010001100020. 14. Backer MA, Horveth SM. Influence of water temperature on oxygen uptake by swimming rats. J Appl Physiol. 1964;19:1215-8. 15. Hakkinen JP, Miller MW, Smith AH, Knight DR. Measurement of organ blood flow with coloured microspheres in the rat. Cardiovasc Res. 1995;29:74-9. 16. De Angelis K, Gama VM, Farah VA, Irigoyen MC. Blood flow measurements in rats using four color microspheres during blockade of different vasopressor systems. Braz J Med Biol Res. 2005;38:119-25, doi: 10.1590/S0100-879X2005000100018. 17. Velema J, Zaagsma J. Purification and characterization of cardiac sarcolemma and sarcoplasmatic reticulum from rat ventricle muscle. Arch Biochem Biophys. 1981;212:678-88, doi: 10.1016/0003-9861(81) 90412-4. 18. Yegutkin GG. Kinetic analysis of enzymatic hydrolysis of ATP in human and rat blood serum. Biochemistry. 1997;62:619-22. 19. Oses JP, Cardoso CM, Germano RA, Kirst IB, Ru¨cker B, Fu¨rstenau CR, et al. Soluble NTPDaes: An additional system of nucleotide hydrolysis in rat blood serum. Life Sci. 2004;74:3275-84, doi: 10.1016/j.lfs.2003.11.020.

20. Oliveira EM, Battastini AMO, Meirelles MN, Moreira CM, Sarkis JJF. Characterization and localization of an ATP diphosphohydrolase activity (EC 3.6.1.5) in sarcolemmal membrane from rat heart. Mol Cell Biochem. 1997;170:115-23, doi: 10.1023/A:1006848701467. 21. Lanzetta PA, Alvarez LJ, Reinach OS, Candia OA. An improved assay for nanomole amounts of inorganic phosphate. Anal Biochem. 1979;100:95-7, doi: 10.1016/0003-2697(79)90115-5. 22. Bruno AN, Oses JP, Bonan CD, Walz R, Battastini AMO, Sarkis JJF. Increase of nucleotidase activities in rat blood serum after a single convulsive injection of pentylenetetrazol. Neurosci Res. 2002;43:283-8, doi: 10.1016/S0168-0102(02)00043-3. 23. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-54, doi: 10.1016/0003-2697(76)905273. 24. Wichi RB, De Angelis K, Jones L, Irigoyen MC. A brief review of chronic exercise intervention to prevent autonomic nervous system changes during the aging process. Clinics. 2009;64:253-8, doi: 10.1590/S180759322009000300017. 25. Negra˜o CE, Irigoyen MC, Moreira ED, Brum PC, Freire PM, Krieger EM. Effect of exercise training on RSNA, baroreflex control, and blood pressure responsiveness. Am J Physiol. 1993;265:R365-70. 26. Krieger EM, Brum PC, Negra˜o CE. Role of arterial baroreceptor function on cardiovascular adjustments to acute and chronic dynamic exercise. Biol Res. 1998;31:273-9. 27. Zamo FS, Lacchini S, Mostarda C, Chiavegatto S, Silva ICM, Oliveira EM, et al. Hemodynamic, morphometric and autonomic patterns in hypertensive rats – Renin-angiotensin system modulation. Clinics. 2010;65:8592, doi: 10.1590/S1807-59322010000100013. 28. Dunker DJ and Bache RJ. Regulation of coronary blood flow during exercise. Physiol Rev. 2008;88:1009-86, doi: 10.1152/physrev.00045.2006. 29. McKenzie JE, Steffen RP, Haddy FJ. Relationships between adenosine and coronary resistence in conscious exercising dogs. Am J Physiol. 1982;242:H24-9. 30. Spear KL, Koener JE, Terjung RL. Coronary blood flow in physically trained rats. Cardiovasc Res. 1978;12:135-43, doi: 10.1093/cvr/12.3.135 31. Atkinson B, Dwyer K, Enjyoji K, Robson SC. Ecto-nucleotidases of the CD39/NTPDase family modulate platelet activation and thrombus formation: Potential as therapeutic targets. Blood Cells Mol Dis. 2006;36:217-22, doi: 10.1016/j.bcmd.2005.12.025. 32. Rucker B, Almeida ME, Libermann TA, Zerbini LF, Wink MR, Sarkis JJF. E-NTPDases and ecto-5`-nucleotidase expression profile in rat heart left ventricle and the extracellular nucleotide hydrolysis by their nerve terminal endings. Life Sci. 2008;82:477-86, doi: 10.1016/j.lfs.2007.12.003. 33. Egginton S. Invited review: activity-induced angiogenesis. Pflugers Arch. 2009;457:963-77, 2009, doi: 10.1007/s00424-008-0563-9. 34. Marini M, Falcieri E, Margonato V, Trere´ D, Lapalombella R, di Tullio S, et al. Partial persistence of exercise-induced myocardial angiogenesis following 4-week detraining in the rat. Histochem Cell Biol. 2008;129:479-87, doi: 10.1007/s00418-007-0373-8. 35. Newcomer SC, Thijssen DHJ, Green DJ. Effects of exercise on endothelium and endothelium/smooth muscle cross talk: role of exercise-induced hemodynamics. J Appl Physiol. 2011;111:311-20, doi: 10.1152/japplphysiol.00033.2011.

2111

CLINICS 2011;66(12):2113-2119

DOI:10.1590/S1807-59322011001200018

BASIC RESEARCH

Expression of TGF-b1 in the blood during fracture repair in an estrogen-deficient rat model Mohamed Abdalla Estai,I Farihah Suhaimi,I Srijit Das,I Ahmad Nazrun Shuid,II Zahiah Mohamed,III Ima-Nirwana SoelaimanII I

Department of Anatomy, Faculty of Medicine, Universiti Kebangsaan Malaysia Medical Center, Kuala Lumpur, Malaysia. II Department of Pharmacology, Faculty of Medicine, Universiti Kebangsaan Malaysia Medical Center, Kuala Lumpur, Malaysia. III Department of Radiology, Faculty of Medicine, Universiti Kebangsaan Malaysia Medical Center, Kuala Lumpur, Malaysia.

OBJECTIVES: Previous studies have reported that osteoporosis due to estrogen deficiency influences fracture healing. Transforming growth factor (TGF-b) has been found to be involved in fracture healing via the regulation of the differentiation and activation of osteoblasts and osteoclasts. The current study aimed to determine the effects of estrogen on the expression of TGF-b1 during fracture healing in ovariectomized rats. METHODS: Thirty female Sprague-Dawley rats weighing 200–250 g were assigned to: (i) a sham-operated group that was given a normal saline; (ii) an ovariectomized control group that was given a normal saline; or (iii) an ovariectomized + estrogen (100 mg/kg/day) group that was treated with conjugated equine estrogen. The right femur of all rats was fractured, and a Kirschner wire was inserted six weeks post-ovariectomy. Treatment with estrogen was given for another six weeks post-fracture. At the end of the study, blood samples were taken, and the right femur was harvested and subjected to biomechanical strength testing. RESULTS: The percentage change in the plasma TGF-b1 level before treatment was significantly lower in the ovariectomized control and estrogen groups when compared with the sham group (p,0.001). After six weeks of treatment, the percentage change in the plasma TGF-b1 level in the estrogen group was significantly higher compared with the level in the ovariectomized control group (p = 0.001). The mean ultimate force was significantly increased in the ovariectomized rats treated with estrogen when compared with the ovariectomized control group (p = 0.02). CONCLUSION: These data suggest that treatment with conjugated equine estrogen enhanced the strength of the healed bone in estrogen-deficient rats by most likely inducing the expression of TGF-b1. KEYWORDS: Estrogen; Biomechanics; Fracture; Osteoporosis; Ovariectomy; Repair; TGF-b1. Estai MA, Suhaimi F, Das S, Shuid AN, Mohamed Z, Soelaiman IN. Expression of TGF-b1 in the blood during fracture repair in an estrogen-deficient rat model. Clinics. 2011;66(12):2113-2119. Received for publication on June 4, 2011; First review completed on July 8, 2011; Accepted for publication on August 8, 2011 E-mail: imasoel@medic.ukm.my / abdalla177@gmail.com Tel.: 03-92897263

morphogenetic proteins (BMPs), insulin-like growth factor (I-LGF), transforming growth factor-beta (TGF-b), platelet derived growth factor (PDGF), and fibroblast growth factor (FGF), which are all secreted by osteoblasts, and blood cells have been reported to have a role in maintaining bone metabolism and improving fracture healing by regulating the differentiation of bone cells.5 The TGF-b superfamily is a group of cytokines that includes TGF-b, activins, BMPs, and GDFs that regulate the growth and differentiation of osteoblasts.6 TGF-b is an extracellular protein that is produced mainly by osteoblasts and platelets.7 There are three isoforms of TGF-b found in mammals: TGF-b1, TGF-b2, and TGF-b3. These cytokines are involved in the regulation of cell proliferation and differentiation and in the suppression of the immune system.8 Serum TGF-b has been correlated with the platelet count as most TGF-b is produced by platelets. Therefore, the TGF-b level is commonly measured in the plasma.8 Several studies have investigated the role of

INTRODUCTION Osteoporotic fracture is of great clinical importance as it carries a high risk of morbidity and mortality.1 Osteoporosis is a metabolic bone disease that results in decreased bone mass and an increased risk of fracture.2 Postmenopausal osteoporosis is considered the most frequent cause of pathological fracture. Albright (1947) was the first to report the primary role of estrogen deficiency in the pathogenesis of postmenopausal osteoporosis.3 Bone is the only tissue in the body that can regenerate without leaving a scar after injury.4 Various local growth factors including bone

2113

Expression of TGF-b1 during Fracture Repair Estai MA et al.

CLINICS 2011;66(12):2113-2119

agents (Troy Laboratories, Australia) (1:1) at a dose of 0.1 ml/100 g I.M. to all of the rats prior to the fracture procedure. To approach the anterior intercondylar notch, a transverse incision was made on the right knee, and the patella was displaced laterally. A Kirschner wire (K-wire, 1.0 mm) (Jorgensen Lab, USA) was inserted into the anterior intercondylar notch toward the femoral medullary canal as a fixator. Following internal fixation with the K-wire, a guillotine-like blade device weighing 0.5 kg was dropped from 30 cm of height to fall on the middle of the right femur to generate standardized closed fracture with minimal soft tissues trauma. X-ray images were immediately obtained post-fracture to confirm both the intramedullary placement of the K-wire and the fracture. To prevent infection, 5% Enrofloxacin was given at a dose of 10 mg/kg I.M. (Bayer, Thailand) daily for 10 days with the daily dressing. On the first day postfracture, the sham (SX, n = 10) group was given a normal saline vehicle, while the ovariectomized rats were further subdivided into two groups: (i) the ovariectomized control (VC, n = 10) group was given a normal saline vehicle; (ii) the ovariectomized + estrogen (CEE, n = 10) group was treated with conjugated equine estrogen (conjugated estrogen, Premarin-Wyeth, Canada) at a dose of 100 mg/ kg/day. The estrogen dose used in this study was adopted from earlier studies.20 Animals were weighed every three days to adjust the given dose. Treatment was given daily for six weeks via oral gavage immediately after fracture of the right femur. At the end of the experiment, blood samples were taken from the retro-orbital sinus of the rats just before euthanasia. After euthanasia, the right femur was dissected, and the K-wires were removed. All bone samples were kept at -70 ˚C until use for biomechanical testing. In addition, the uterus was removed from each rat and weighed.

TGF-b in promoting bone healing. It has been reported that the topical application of estrogen improved the incisional wound healing associated with increased expression of TGF-b1 in ovariectomized rats when compared with untreated ovariectomized rats.9 Furthermore, it has been found that TGF-b is expressed at high levels in healing fracture calluses.10 Cigarette smoking has been reported to reduce the level of TGF-b1 after surgery, which may delay healing.11 Another study reported that decreased expression of TGF-b1 by osteoblasts may have negative effects on fracture healing in ovariectomized rats.12 Zinc supplementation has been reported to induce the expression of TGF-b in vitro, and therefore, TGF-b1 is essential for the healing process.13 Altogether, these studies suggest that TGF-b may have a role in enhancing bone fracture healing. Bone loss following post-menopausal estrogen loss can be reversed by estrogen replacement therapy. Hormonal replacement therapy has been used since in the 1930s to manage post-menopausal symptoms.14 It has also been shown to protect against the development of osteoporosis, coronary heart disease, and colorectal carcinoma.15 It has been shown that estrogen replacement therapy (ERT) prevents bone resorption, resulting in the maintenance of skeletal mass and a reduced risk of fracture.16 Despite the beneficial effects of ERT in reducing the risk of fracture, it has been reported that the long-term, unopposed use of estrogen therapy after menopause can increase the risk of endometrial carcinoma and that this risk is reduced when estrogen is combined with progesterone.15,17 However, there have been few reports examining the level of TGF-b1 in the blood during estrogen replacement therapy. The current study aimed to determine the effects of the administration of conjugated equine estrogen on the level of TGF-b1 in the plasma during fracture healing in ovariectomized rats.

Biochemical Analysis (TGF-b1) Blood samples were collected three times: at the beginning of the study (before ovariectomy), before the closed fracture (before treatment), and just before sacrifice. All blood samples were taken from the retro-orbital sinus of the rats while they were under anesthesia with diethyl ether. All of the samples were kept in an ice box to prevent clotting. The blood was centrifuged at 4 ˚C and 4,000 rpm for 10 minutes to obtain plasma. Plasma samples were placed in Eppendorf tubes and stored at -70 ˚C. The plasma TGF-b1 level was measured using an enzyme-linked immunosorbent assay (ELISA), as recommended by the manufacturer (TGF-b1 EIA Kit; Assay designs, USA). An ELISA plate reader (Versamax, Sunnyvale, USA) was calibrated against a blank substrate, and the microplate was read at 450 nm. The average net OD was calculated for each standard and sample by subtracting the average blank OD from the average OD for each standard and sample. All sample values that were obtained using the TiterZyme TGF-b1 kit were converted to the NIBSC/WHO TGF-b1 Standard using the following equation: NIBSC/WHO 87514 value (pg/ml) = Obtained human TGF-b1 value (pg/ml)60.915

MATERIALS AND METHODS Animals Thirty female Sprague-Dawley rats weighing 200–250 g were purchased from the Laboratory Animal Resource Unit, Universiti Kebangsaan Malaysia (UKM). The rats were housed individually in clean cages at room temperature with a normal 12-hour light-dark cycle and free access to water and food. The rats were acclimatized for two weeks before they were randomly assigned to the sham-operated (SX, n = 10) or ovariectomized (n = 20) groups. Following a previously described protocol, the rats in the SX group underwent a sham operation, whereas the rats in the ovariectomized group underwent a bilateral ovariectomy at the beginning of the study.18 This study was approved by the Animal Ethics Committee of Universiti Kebangsaan Malaysia (UKM).

Experimental Protocol Osteoporosis was allowed to develop in the animals for six weeks after the ovariectomy. A pilot study was carried out prior to the main study to confirm the induction of osteoporosis based on the bone-structural histomorphometry.19 Following a previously described protocol, the right femur of all rats underwent a closed fracture at mid-diaphysis six weeks post-ovariectomy.20 Xylazil and ketamine were given in combination as anesthetic

Biomechanical strength testing Following a previously described protocol, the frozen bone samples were thawed slowly at room temperature

2114

CLINICS 2011;66(12):2113-2119

Expression of TGF-b1 during Fracture Repair Estai MA et al.

overnight.21 On the following day, the bone samples were then analyzed using an Instron Microtester 5848 (Instron, USA) to measure the ultimate force. A load was applied to the middle of the femur diaphysis corresponding to the fracture callus area until the bone was fractured. The ultimate force was then calculated using the Bluhill software package.

Biochemical Analysis (TGF-b1) Biochemical testing was carried out to determine the plasma level of TGF-b1. Blood samples were collected from the rats at baseline (time zero), before treatment and after treatment. The percentage change in the TGF-b1 level before and after treatment with CEE were calculated as follows: Percentage change before treatment = [TGF-b1 before treatment – baseline] / baseline. Percentage change after treatment = [TGF-b1 after treatment – baseline] / baseline. Before treatment, the percentage change in the TGF-b1 level was significantly lower in the CEE and VC groups compared with the SX group (p,0.001). In the VC group, the percentage change in the TGF-b1 level after treatment was significantly lower when compared with the percentage change before treatment (p,0.045). The percentage change in the TGF-b1 level after treatment was significantly higher in the CEE group when compared with the VC group (p = 0.001), and it was identical in the CCE and SX groups (p.0.05; Figure 2). The percentage change in the plasma levels of TGF-b1 is summarized in Table 1.

Statistical Analysis Statistical analyses were carried out using SPSS Version 17. The baseline TGF-b1 data were not homogenous, and the homogeneity of the variance (Levene’s test) was significant (p,0.05). Because the assumption of the homogeneity of variance was violated, the percentage difference of the TGFb1 levels was compared instead of the TGF-b1 levels alone. Variables were analyzed using a 2-way mixed repeated measure ANOVA with a post-hoc Tukey’s test. The results are presented as the mean¡SEM. The level of significance was set at p,0.05.

RESULTS Uterine weight

Biomechanical strength testing

Following six weeks of treatment, marked uterine atrophy was observed in the VC group when compared with the SX group (p,0.05). The uterine weight of the rats treated with ERT was unchanged when compared with the SX group. Finally, the uterine weight in the CEE group was considerably increased following treatment with ERT when compared with the VC group (p,0.05; Figure 1).

Biomechanical analyses were performed to evaluate the strength of the healed femur following six weeks of treatment. The mean ultimate force (N) of the CEE group was significantly greater than that of the VC group (p = 0.02), and there was no significant difference between the CEE and SX groups (p.0.05) (Figure 3).

Figure 1 - Mean uterine weights after six weeks of treatment. SX, sham-operated group given normal saline; VC, ovariectomized control group given normal saline; CEE, ovariectomized group treated with conjugated equine estrogen at a dose of 100 mg/kg/day; n = 10. * Significant difference compared with the SX group (p,0.05). # Significant difference compared with the VC group (p,0.05). The values are expressed as the mean¡SEM.

2115

Expression of TGF-b1 during Fracture Repair Estai MA et al.

CLINICS 2011;66(12):2113-2119

Figure 2 - The percentage change differences in the plasma TGF-b1 level. SX, sham-operated group given normal saline for six weeks; VC, ovariectomized control group given normal saline for six weeks; CEE, ovariectomized group treated with conjugated equine estrogen (100 mg/kg/day) for six weeks; n = 10. * Significant difference when compared with the sham group (p,0.001). # Significant difference when compared with the BT-BL within the same group (p = 0.045). a Significant difference when compared with the VC group (p = 0.001).

ovariectomy-induced estrogen deficiency resulted in marked uterine atrophy in rats.22 The uterine weight in the CEE group was significantly greater than that of the VC group. Although the ovariectomized rats treated with ERT had a significantly increased uterine weight, the increased uterine weight in the CEE group was still lower than that of SX group. Zhang et al. also demonstrated that the uterine weight is markedly increased in ovariectomized rats treated with estrogen when compared with non-estrogen-treated, ovariectomized rats.23 The treatment with CEE was able to increase the uterine weight of ovariectomized rats, suggesting that the dose of the estrogen therapy used in the current study was adequate. Several studies have shown that ERT prevents bone resorption, resulting in the maintenance of skeletal mass and a reduction in the risk of fracture.24 The relationship between estrogen and the TGF-b is complex and not completely understood. It has been shown that treatment with estrogen prevents excessive bone loss via the TGF-bmediated promotion of osteoclast apoptosis.25 Furthermore, Atti et al. reported that TGF-b has a role in the regulation of bone homeostasis as it regulates osteoblast and osteoclast activity.26 Previous studies have found that the local application of TGF-b around the fracture site enhanced fracture healing.27,28

DISCUSSION The uterine weight was significantly decreased in the VC when compared with the SX group. Additionally, ovariectomy resulted in marked uterine atrophy in the ovariectomized rats when compared with the SX group, indicating the success of the ovariectomy procedure. The same pattern has been reported in a previous study performed by Fazliana et al., who concluded that the Table 1 - The percentage change in the plasma TGF-b1 level. Group SX VC CEE

BT-BL (%)

AT-BL (%)

11.7¡5.64 -46.7¡3.68* -34.8¡5.92*

-0.75¡11.08 a -67.4¡4.53*,# -18.7¡8.08 a

BT-BL, percentage change before treatment; AT-BL, percentage change after treatment. SX, sham-operated (vehicle normal saline, six weeks); VC, ovariectomized control (normal saline, six weeks); CEE, ovariectomized + estrogen (conjugated equine estrogen 100 mg/kg/day, six weeks); n = 10. # Significant difference when compared with the BT-BL within the same group (p = 0.045). * Significant difference when compared with the sham group (p,0.001). a Significant difference when compared with the AT-BL of the VC group (p = 0.001).

2116

CLINICS 2011;66(12):2113-2119

Expression of TGF-b1 during Fracture Repair Estai MA et al.

Figure 3 - The mean ultimate force (strength) of the fractured right femur after 6 weeks of treatment. SX, sham-operated group treated with normal saline for six weeks; VC, ovariectomized control group treated with normal saline for six weeks; CEE, ovariectomized + estrogen group treated with 100 mg/kg/day of conjugated equine estrogen for six weeks; n = 10. # p,0.05 compared with the VC group. The values are expressed as the meanยกSEM.

compared with the VC group. Treatment with estrogen likely improved osteoporotic fracture healing in ovariectomized rats by inducing the expression of TGF-b1 in osteoblasts.33 Liu et al. found that the TGF-b level in the sham and ovariectomized + ERT groups was greater than the level in the ovariectomized control group.29 In addition, Hughes et al. found that estrogen prevented bone loss through the TGF-b1-mediated induction of osteoclast apoptosis.25 Altogether, this suggests that TGF-b1 may play a role in fracture healing by preventing osteoporotic changes and inducing callus formation. The TGF-b1 level in the CEE group after six weeks of treatment was not significantly different than the level before treatment. It was also not significantly different when compared with the SX group at the same time point. The TGF-b1 level was increased six weeks post-ovariectomy, and it was nearly identical to the normal concentration of TGF-b1 in the SX group. This suggests that the administration of estrogen enhanced fracture healing in ovariectomized rats by increasing TGF-b1 expression. The restoration of the biomechanical strength of fractured bones in patients is of great clinical importance.34 Therefore, the biomechanical strength of the fractured femurs was measured to evaluate fracture healing in estrogen-deficient rats. Ultimate force is the most widely used biomechanical parameter for measuring bone strength, and it represents the ultimate compressive force applied to a bone until a fracture occurs.35 There was a significant decrease in the mean ultimate force in ovariectomized rats treated with normal saline when compared with the SX group. Estrogen

The plasma TGF-b1 level prior to treatment was significantly decreased in the VC and CEE groups when compared with the SX group. Six weeks after ovariectomy, all of the ovariectomized groups showed a significant decrease in the plasma TGF-b1 level when compared with the SX group. Estrogen deficiency resulted in a significant decrease in the expression of TGF-b1 in ovariectomized rats. A similar decreased expression of TGF-b1 in ovariectomized rats (when compared with un- ovariectomized controls) has been reported in other studies.29 This pattern suggests that estrogen deficiency suppresses the expression of TGF-b1, which may interfere with fracture healing. Following treatment, the percentage change in the TGF-b1 level was significantly lower in the VC group compared with the SX group at the same time point. It was also significantly lower than the mean level before treatment within the same group. Estrogen deficiency has been shown to induce the production of various cytokines and decrease the expression of TGF-b1, thereby inducing osteoclastogenesis.30 Previous studies have demonstrated that estrogen loss results in decreased expression of TGF-b in osteoblasts in ovariectomized rats when compared with the control group.12,29,31 Furthermore, it has been reported that the concentration of TGF-b1 in the blood is lower in patients with delayed fracture healing.32 Therefore, the level of TGFb1 in the blood may be a marker for fracture healing. The percentage change in the TGF-b1 level after treatment was significantly higher in the CEE group when compared with the VC group. Therefore, rats treated with estrogen had a higher concentration of TGF-b1 in the blood when

2117

Expression of TGF-b1 during Fracture Repair Estai MA et al.

CLINICS 2011;66(12):2113-2119

loss following ovariectomy resulted in a delay in fracture healing, which led to the incomplete restoration of the biomechanical strength of the fractured femurs. Previous studies have found that the biomechanical strength of fractured femurs in non-treated ovariectomized rats was not restored when compared with normal control rats.21,36,37 There was a significant increase in the ultimate force in the CEE group when compared with the VC group. However, the ultimate force was identical in the CEE and SX groups. Treatment with estrogen enhanced fracture healing by restoring the biomechanical strength of healed femur. This is in line with Cao et al., who reported that the strength of the fractured bone in ovariectomized rats treated with estradiol was identical to that in normal control animals.38 Estrogen replacement therapy has been shown to be beneficial in preventing bone loss and decreasing fracture risk.16 Estrogen likely prevents bone loss or excessive resorption of bone by suppressing the differentiation and activity of osteoclasts.30 These data suggest that the restoration of the biomechanical strength of the healed femurs following treatment with estrogen may be attributed to the increased expression of TGF-b1. The current study demonstrated that estrogen deficiency results in a significant decrease in the expression of TGF-b1 in the blood six weeks post-ovariectomy. Treatment with estrogen induced the expression of TGF-b1 in the blood of estrogen-deficient rats. Therefore, estrogen treatment may have contributed to the restoration of bone strength in the healed bone by increasing the expression of TGF-b1 in the blood. Further studies are required to understand the role of TGF-b in the regulation and differentiation of bone cells.

8. 9.

10. 11.

12. 13. 14. 15. 16. 17. 18.

19. 20.

21.

ACKNOWLEDGMENTS 22.

The authors would like to acknowledge the Universiti Kebangsaan, Malaysia for providing the financial support to conduct the study (UKMFF-314-2009).

23.

AUTHOR CONTRIBUTIONS

24.

Estai MA carried out all aspects of the experiments and data analysis and drafted and critically revised the manuscript. Suhaimi FH supervised the project and critically revised the manuscript for important intellectual content. Das S revised the manuscript and provided technical assistance in preparing the manuscript. Mohamed Z critically revised the manuscript. Shuid AN critically revised the manuscript. Soelaiman IN is the corresponding author; interpreted the results, critically revised the manuscript for important intellectual content, and carried out the statistical analysis and design.

25. 26.

27.

REFERENCES

28.

1. Satomi E, Sitta Mdo C, Machado AN, Garcez Leme LE. Identification and treatment of osteoporosis among elderly patients with hip fractures. Clinics. 2009;64:1201-4, doi: 10.1590/S1807-59322009001200010. 2. Yanik B, Ayrim A, Ozol D, Koktener A, Gokmen D. Influence of obesity on bone mineral density in postmenopausal asthma patients undergoing treatment with inhaled corticosteroids. Clinics. 2009;64:313-8, doi: 10. 1590/S1807-59322009000400008. 3. Albright F. Osteoporosis. Ann Intern Med. 1947;27:861-82. 4. Hernandez-Gil IFT, Gracia MAA, del Canto Pingarrn M, Jerez LB. Physiological bases of bone regeneration I. Histology and physiology of bone tissue. Med Oral. 2006;11:E47-51. 5. Kalfas IH. Principles of bone healing. Neurosurg Focus. 2001;10:E1, doi: 10.3171/foc.2001.10.4.2. 6. Centrella M, Horowitz MC, Wozney JM, McCarthy TL. Transforming Growth Factor-{beta} Gene Family Members and Bone. Endocr Rev. 1994;15:27-39. 7. Roberts AB, Sporn MB. Peptide growth factors and their receptors I. Transforming growth factor-b. In: Roberts AB and Sporn MB, editor.

29. 30. 31.

32. 33.

2118

Peptide growth factors and their receptors. Berlin: Springer-Verlag. 1990;419-72 Kropf J, Schurek JO, Wollner A, Gressner AM. Immunological measurement of transforming growth factor-beta 1 (TGF-beta1) in blood; assay development and comparison. Clin Chem. 1997;43:1965-74. Ashcroft GS, Dodsworth J, van Boxtel E, Tarnuzzer RW, Horan MA, Schultz GS, et al. Estrogen accelerates cutaneous wound healing associated with an increase in TGF- 1 levels. Nature Med. 1997;3:120915, doi: 10.1038/nm1197-1209. Joyce ME, Jingushi S, Bolander ME. Transforming growth factor-beta in the regulation of fracture repair. Orthop Clin North Am. 1990;21:199-209. Moghaddam A, Weiss S, Wo¨lfl CG, Schmeckenbecher K, Wentzensen A, Gru¨tzner PA, et al. Cigarette smoking decreases TGF-[beta]1 serum concentrations after long bone fracture. Injury. 2010;41:1020-5, doi: 10. 1016/j.injury.2010.03.014. Xu SW, Yu R, Zhao GF, Wang JW. Early period of fracture healing in ovariectomized rats. Chin J Traumatol. 2003;6:160-6. Igarashi A, Yamaguchi M. Increase in bone growth factors with healing rat fractures: the enhancing effect of zinc. Int J Mol Med. 2001;8:433-8. Cuzick J. Hormone replacement therapy and the risk of breast cancer. Eur J Cancer. 2008;44:2344-9, doi: 10.1016/j.ejca.2008.07.041. Vecchia CL, Brinton LA, McTiernan A. Menopause, hormone replacement therapy and cancer. Maturitas. 2001;39:97-115, doi: 10.1016/S03785122(01)00213-4. Ribot C, Tre´mollie`res F. Hormone replacement therapy in the management of postmenopausal osteoporosis and prevention of fracture risk. Presse Med. 2006;35:1557-63, doi: 10.1016/S0755-4982(06)74851-5. Garrett A, Quinn MA. Hormonal therapies and gynaecological cancers. Best Pract Res Clin Obstet Gynaecol. 2008;22:407-21, doi: 10.1016/j. bpobgyn.2007.08.003. Adam SK, Das S, Othman F, Jaarin K. Fresh soy oil protects against vascular changes in an estrogen-deficient rat model: an electron microscopy study. Clinics. 2009;64:1113-9, doi: 10.1590/S1807-5932200 9001100012. Estai MA, Suhaimi F, Soelaiman IN, Shuid AN, Das S. Bone histomorphometric study of young rats following oestrogen deficiency. AJB. 2011;10:12064-70. Estai MA, Suhaimi FH, Das S, Fadzilah FM, Alhabshi SMI, Shuid AN, Soelaiman IN. Piper sarmentosum enhances fracture healing in ovariectomized osteoporotic rats: a radiological study. Clinics. 2011;66:865-72, doi: 10.1590/S1807-59322011000500025. Shuid AN, Mohamad S, Mohamed N, Fadzilah FM, Mokhtar SA, Abdullah S, et al. Effects of calcium supplements on fracture healing in a rat osteoporotic model. J Orthop Res. 2010;28:1651-6, doi: 10.1002/jor.21180. ¨ stenson CG. Labisia pumila Fazliana M, Wan Nazaimoon WM, Gu HF, O extract regulates body weight and adipokines in ovariectomized rats. Maturitas. 2009;62:91-7, doi: 10.1016/j.maturitas.2008.10.004. Zhang R, Liu ZG, Li C, Hu SJ, Liu L, Wang JP, et al. Du-Zhong (Eucommia ulmoides Oliv.) cortex extract prevent OVX-induced osteoporosis in rats. Bone. 2009;45:553-9, doi: 10.1016/j.bone.2008.08.127. Compston J. How to manage osteoporosis after the menopause. Best Pract Res Clin Rheumatol. 2005;19:1007-19, doi: 10.1016/j.berh.2005.06. 010. Hughes DE, Dai A, Tiffee JC, Li HH, Mundy GR, Boyce BF. Estrogen promotes apoptosis of murine osteoclasts mediated by TGF-beta. Nat Med. 1996;2:1132-6, doi: 10.1038/nm1096-1132. Atti E, Gomez S, Wahl SM, Mendelsohn R, Paschalis E, Boskey AL. Effects of transforming growth factor-[beta] deficiency on bone development: A Fourier Transform-Infrared imaging analysis* 1. Bone. 2002;31:675-84, doi: 10.1016/S8756-3282(02)00905-5. Wildemann B, Bamdad P, Holmer C, Haas NP, Raschke M, Schmidmaier G. Local delivery of growth factors from coated titanium plates increases osteotomy healing in rats. Bone. 2004;34:862-8, doi: 10.1016/j.bone.2004. 01.015. De Ranieri A, Virdi AS, Kuroda S, Shott S, Leven RM, Hallab NJ, et al. Local application of rhTGF- 2 enhances peri-implant bone volume and bone-implant contact in a rat model. Bone. 2005;37:55-62, doi: 10.1016/j. bone.2005.03.011. Liu H, Xu K, Qiao L. Effects of estrogen on the expression of TGF-B in early fracture healing of ovariectomized rats. Bone. 2008;43:S54-S55, doi: 10.1016/j.bone.2008.08.048. Chen FP, Wang KC, Huang JD. Effect of Estrogen on the Activity and Growth of Human Osteoclasts In Vitro. Taiwan J Obstet Gynecol. 2009;48:350-5, doi: 10.1016/S1028-4559(09)60323-5. Ikeda T, Shigeno C, Kasai R, Kohno H, Ohta S, Okumura H, et al. Ovariectomy decreases the mRNA levels of transforming growth factor-beta 1 and increases the mRNA levels of osteocalcin in rat bone in vivo. Biochem Biophys Res Commun. 1993;194:1228-33, doi: 10.1006/bbrc.1993.1954. Zimmermann G, Henle P, Ku¨sswetter M, Moghaddam A, Wentzensen A, Richter W, et al. TGF-[beta]1 as a marker of delayed fracture healing. Bone. 2005;36:779-85, doi: 10.1016/j.bone.2005.02.011. Oursler MJO, Cortese C, Keeting P, Anderson MA, Bonde SK, Riggs BL, et al. Modulation of Transforming Growth Factor-{beta} Production in Normal Human Osteoblast-Like Cells by 17 {beta}-Estradiol and

CLINICS 2011;66(12):2113-2119

Expression of TGF-b1 during Fracture Repair Estai MA et al.

Parathyroid Hormone. Endocrinology. 1991;129:3313-20, doi: 10.1210/ endo-129-6-3313. 34. Fu L, Tang T, Miao Y, Hao Y, Dai K. Effect of 1, 25-dihydroxy vitamin D3 on fracture healing and bone remodeling in ovariectomized rat femora. Bone. 2009;44:893-8, doi: 10.1016/j.bone.2009.01.378. 35. Comelekoglu U, Bagis S, Yalin S, Ogenler O, Yildiz A, Sahin NO, et al. Biomechanical evaluation in osteoporosis: ovariectomized rat model. Clin Rheumatol. 2007;26:380-4, doi: 10.1007/s10067-006-0367-2. 36. Namkung-Matthai H, Appleyard R, Jansen J, Hao Lin J, Maastricht S, Swain M, et al. Osteoporosis influences the early period of fracture

healing in a rat osteoporotic model. Bone. 2001;28:80-8, doi: 10.1016/ S8756-3282(00)00414-2. 37. Kubo T, Shiga T, Hashimoto J, Yoshioka M, Honjo H, Urabe M, et al. Osteoporosis influences the late period of fracture healing in a rat model prepared by ovariectomy and low calcium diet. J Steroid Biochem Mol Biol. 1999;68:197-202, doi: 10.1016/S0960-0760(99)00032-1. 38. Cao Y, Mori S, Mashiba T, Westmore MS, Ma L, Sato M, et al. Raloxifene, estrogen, and alendronate affect the processes of fracture repair differently in ovariectomized rats. J Bone Miner Res. 2002;17:2237-46, doi: 10.1359/jbmr.2002.17.12.2237.

2119

CLINICS 2011;66(12):2121-2124

DOI:10.1590/S1807-59322011001200019

BASIC RESEARCH

Curcumin, but not Prima-1, decreased tumor cell proliferation in the syngeneic murine orthotopic bladder tumor model Fa´bio T. Watanabe,I Daher C. Chade,II Sabrina T. Reis,I Camila Piantino,I Marcos Francisco Dall’ Oglio,II Miguel Srougi,I Katia R. M. LeiteI I

Faculdade de Medicina da Universidade de Saõ Paulo, Laboratory of Medical Investigation, Department of Urology (Lim55), Saõ Paulo/SP, Brazil. Faculdade de Medicina da Universidade de Saõ Paulo, Instituto do Caˆncer do Estado de Saõ Paulo (ICESP), Department of Urology, Saõ Paulo/SP, Brazil.

OBJECTIVE: Cigarette smoking is the main risk factor for bladder cancer development. Among the mediators of this effect of smoking is nuclear factor-kappa B. Curcumin suppresses cellular transformation by downregulating the activity of nuclear factor-kappa B. Prima-1 is a compound that induces apoptosis in human tumor cells, restoring the function of mutant p53. Our study aimed to evaluate the effects of curcumin and prima-1 in an animal model of bladder cancer. METHODS: Tumor implantation was achieved in six- to eight-week-old female C57BL/6 mice by introducing MB49 bladder cancer cells into the bladder. Intravesical treatment with curcumin and Prima-1 was performed on days 2, 6, 10, and 14. On day 15, the animals were sacrificed. Immunohistochemistry was used to determine the expression of cyclin D1, Cox-2, and p21. Cell proliferation was examined using PCNA. RESULTS: Animals treated with curcumin exhibited a higher degree of necrosis than animals in other groups. Immunohistochemistry showed reduced expression of cyclin D1 in the curcumin-treated group. All of the cells in mice treated with curcumin were p21 positive, suggesting that the p53 pathway is induced by this compound. Prima-1 did not induce any change in tumor size, necrosis, cell proliferation, or the expression of proteins related to the p53 pathway in this animal model. CONCLUSION: Curcumin showed activity in this animal bladder cancer model and probably acted via the regulation of nuclear factor-kappa B and p53. Therefore, curcumin is a good choice for the use in clinical trials to treat superficial bladder cancer as an alternative to bacillus Calmette-Guerin. In contrast, Prima-1 does not seem to have an effect on bladder cancer. KEYWORDS: Bladder cancer; Treatment; Curcumin, Prima-1; Apoptosis. Watanabe FT, Chade DC, Reis ST, Piantino C, Dall’ Oglio MF, Srougi M, et al. Curcumin, but not Prima-1, decreased tumor cell proliferation in the syngeneic murine orthotopic bladder tumor model. Clinics. 2011;66(12):2121-2124. Received for publication on July 7, 2011; First review completed on August 8, 2011; Accepted for publication on August 10, 2011 E-mail: katiaramos@uol.com.br Tel.: 55 11 30617183

alternative, but this treatment has no impact on long-term survival or disease progression. The toxicity and inefficacy of these intravesicular agents prompted us to explore new treatments for superficial urothelial carcinoma of the bladder. The use of tobacco is one of the main causes of bladder cancer development, which is due to the presence of certain compounds present in cigarette smoke (CS). Exposure to some of these compounds is associated with the induction of nuclear factor-kappa B (NF-kB). We previously studied the effects of curcumin in an orthotopic murine bladder tumor model, demonstrating that curcumin has an inhibitory effect on bladder urothelial cancer, possibly by downregulating NFkB-related genes,6 Therefore, curcumin could be an option for the treatment of urothelial neoplasms.7 The tumor suppressor protein p53 inhibits tumor growth primarily through its ability to induce apoptosis. Mutations in p53 occur in at least 50% of human tumors, and p53 is characteristically mutated in high-grade, invasive urothelial carcinoma. Prima-1 is a lowmolecular-weight compound able to induce apoptosis in

INTRODUCTION Cancer of the urinary bladder is diagnosed in approximately 71,500 people in the United States, and approximately 14,500 individuals die of the disease each year.1 The condition affects individuals 60 to 70 years of age, and racial and ethnic variations in its incidence have been observed.2-4 Current treatment for superficial urothelial carcinoma includes endoscopic tumor resection, followed by intravesicular administration of bacillus Calmette-Guerin (BCG), a treatment that has well-known side effects.5 Topical chemotherapy with mitomycin, thiotepa, and epirubicin has been used as an Copyright ß 2011 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported.

2121

Curcumin and Prima-1 in an in vivo bladder cancer model Watanabe FT et al.

CLINICS 2011;66(12):2121-2124

human tumor cells by restoring the transcriptional transactivation function of mutant p53. In the presence of Prima-1, mutant p53 proteins regain their sequence-specific DNA binding ability and their active conformations in vitro and in living cells. In vivo studies in mice revealed that Prima-1 has an anti-tumor effect with no apparent toxicity.8 Now, using the same animal model,9 we assessed whether curcumin function is enhanced by Prima-1 or if there is a specific role of curcumin that could be used to treat bladder cancer.

15100), p21 (Millipore, 1550), and PCNA (Dako, 15200). The LSAB system was used for immunostaining. The color was developed using a 3,39-diaminobenzidine substrate-chromogen solution, followed by counterstaining with Harris hematoxylin. Samples were then dehydrated, preserved with a cover slip and reviewed using light microscopy.

Statistical analysis Statistical analyses were performed using ANOVA and chi-squared tests for the evaluation of histological characteristics and immunohistochemistry findings between different groups of animals using the GraphPad Prism 5.0 software.

MATERIALS AND METHODS Orthotopic Tumor Implantation Six- to- eight-week-old female C57BL/6 mice were put under general anesthesia with an intraperitoneal injection of 150 mL of a mixture of xylazine-ketamine-PBS (15158). Then, a 24-gauge Teflon intravenous IV catheter was inserted through the urethra into the bladder using xylocaine gel. To prepare the bladder for tumor implantation, a chemical lesion on the bladder wall was made by intravesicular administration of 0.15 M AgNO3 (10 mL). This promoted an adequate and controlled diffuse cauterization of the bladder wall. After 10 seconds, the contents were washed out by transurethral infusion of PBS. Then, a suspension of 56105 viable tumor cells of the murine transitional cell carcinoma cell line MB49 (MB49) was introduced into the bladder. The day of the administration of tumor cells was considered to be Day 1.

RESULTS Initially, the study included 50 animals distributed among the groups. Five animals in the control (saline) group were excluded from the study due to a possible bladder infection observed by microscopy. Two animals died prematurely, probably as the result of the anesthesia. Five mice died later, possibly due to the neoplasm. In four animals, the tumor implantation was not successful. These animals were also excluded from the study. After these exclusions, the study included 34 mice. The results are shown in Table 1. We found that animals treated with curcumin showed a higher degree of necrosis than the mice in all other groups. The mean percentage of tumor necrosis in mice treated with curcumin was 67%, whereas in the other groups, the mean was only 27% (p,0.001). The mean tumor sizes at the end of the study in the untreated and saline-injected groups were 4.2 mm and 6.2 mm, respectively. Although these sizes seem much larger than that in the curcumin-treated group (mean size 2.9 mm), there were no statistically significant differences. We next compared the expression of genes regulated by NFkB. Cyclin D1 was expressed in fewer cells in the group treated with curcumin, with a mean percentage of 23% compared with 34%, 53%, 50%, and 60% in the Prima-1, curcumin and Prima1, saline control, and untreated control groups, respectively (p,0.001). There was no statistically significant difference in Cox-2 expression between groups (p = 0.064). We also analyzed the expression of p21, which is regulated by p53, a frequently mutated gene in invasive bladder cancer. Because Prima-1 restores the activity of the mutated p53 protein, we expected to find some difference in the expression of p21 among these groups of animals. However, there were no differences in the expression of p21 between the different groups of mice (p = 0.55). In addition, proliferative activity, as measured using PCNA, was similar among the treatment groups.

Treatment Treatment was performed by administering the tested drugs four times. Twenty-four hours following tumor cell introduction (Day 2), therapy with 100 mL intravesicular curcumin (100 mM - Sigma) or 100 mL Prima-1 (100 mM) was initiated. The ‘‘curcumin+Prima-1’’ treatment group received 100 mL of a 151 mixture of curcumin (200 mM) and Prima-1 (200 mM). Mice were assigned to 1) the control group, which received 100 mL saline (n = 10); 2) the ‘‘only tumor’’ group (n = 10), which received tumor cells and were not handled again until sacrifice; and 3) treatment groups receiving curcumin (n = 10), Prima-1 (n = 10) or a mixture of both (n = 10). The other three drug applications occurred on days 6, 10, and 14.

Assessment of the tumors The mice were evaluated on a daily basis for viability and gross hematuria. At Day 15, they were sacrificed by CO2 inhalation. The bladder, lungs, kidneys, and liver were resected for histological examination.

Histopathology analysis The specimens were fixed in 10% buffered formalin and sectioned for histological examination. For the bladder slides, tumors were measured, and the degree of necrosis was recorded. Sections of the lungs, kidney, and liver were also analyzed to identify the presence of metastases.

DISCUSSION Our results confirm our previous finding that intravesicular injection of curcumin was able to promote bladder tumor necrosis. Although there was no statistically significant difference in tumor size between the different groups, tumors treated with curcumin were smaller, especially when compared with those exposed to saline alone (mean 2.85 mm vs. 6.23 mm). Recently, we showed that curcumin promotes apoptosis in MB49 mouse bladder tumor cells in vitro and causes a

Immunohistochemistry Three-micrometer sections from the paraffin block were placed on adhesive-coated slides. For antigen retrieval, the slides were placed in citrate buffer (1 mM, pH 6.0) and heated for 30 min in the steamer. The slides were then incubated overnight at 4 ˚C with monoclonal antibodies targeting cyclin D1 (Spring, 15100 dilution), Cox-2 (Spring,

2122

CLINICS 2011;66(12):2121-2124

Curcumin and Prima-1 in an in vivo bladder cancer model Watanabe FT et al.

Table 1 - Summary of the findings for the different groups of animals treated with curcumin, Prima-1, or curcumin+Prima-1 and the control animals. Morphological aspects

Group Curcumin (N = 6) Prima-1 (N = 8) Curcumin+Prima-1 (N = 8) Control (saline) (N = 4) Control (N = 8)

Immunohistochemistry

Percentage of necrosis (Mean)

Size (mm)

PCNA (Mean)

Cyclin D1 %(Mean)

Cox-2 %(Mean)

p21 %(Mean)

67% 28% 26% 38% 23% p = 0.001

2.88 3.46 3.10 6.23 4.94 p.0.05

66% 47% 69% 66% 71% p.0.05

23% 34% 53% 50% 60% p,0.001

33% 25% 75% 0% 28% p = 0.064

100% 43% 63% 67% 67% p = 0.55

pathways important in the carcinogenesis of this neoplasia. In contrast, Prima-1 does not seem to have an effect on this tumor.

decrease in tumor size in vivo in the syngeneic orthotopic murine bladder cancer model.7,8 Garg and Aggarwal10 previously discovered that curcumin functions by modulating TNF-induced NF-kB activation. NF-kB activates the transcription of genes related to cell proliferation, including cyclin D1 and Cox-2. We confirmed that curcumin affects NF-kB function in our animal model, reducing the expression of cyclin D1 in mice treated with this substance compared to untreated animals, in agreement with our previous results. The mean percentage of cyclin D1-positive tumor cells was 23% in animals treated with curcumin and 49% in untreated mice (p,0.01). However, we did not find differences in the regulation of other genes related to the NF-kB pathway among the groups of animals. The Cox-2 expression profile varied widely in animals treated with curcumin, Prima-1, or both. In addition, there was no difference in terms of cell proliferation. Chen et al.11 were able to show that BCG activates multiple intracellular signaling pathways, including NF-kB, in MB49 cultures. BCG is the standard of care for the treatment of low-grade pTa and pT1 urothelial carcinomas and reduces tumor recurrence without affecting specific cancer survival rates. However, one-third of patients fail to respond to BCG, and BCG can cause many side effects. In this in vivo mouse model, we demonstrated that curcumin affects tumor behavior in a manner similar to that of BCG without side effects. Curcumin, a compound derived from Curcuma longa Linn, is not easily absorbed, and the possibility of using it as an intravesicular anti-cancer drug is very attractive. The rationale for testing Prima-1 in this animal model was that Prima-1 can restore p53 transcriptional activity. We expected to observe an effect of Prima-1 on tumor size, apoptotic index or p21 protein expression either when Prima-1 was used alone or when it was used together with curcumin. The transcription of p21/WAF1 is controlled by p53, and the loss of its expression has been related to poor prognosis in bladder cancer.12 However, we saw no differences in these studies between animals treated with or without Prima-1. We can speculate that p53 plays no role in this tumor model. However, 100% of tumor cells in mice treated with curcumin were p21 positive, suggesting that p53 can be induced by this compound, as previously observed in in vitro and in vivo models of bladder cancer13 and in other tumors, such as neuroblastomas14 and adenocarcinomas of the prostate15 and colon.16 We conclude that curcumin is a good choice for use in clinical trials as an alternative to BCG to treat superficial bladder cancer because curcumin controls the genetic

AUTHOR CONTRIBUTIONS Watanabe FT conceived and designed the study and was also responsible for the draft of the manuscript. Chade DC was responsible for the data collection. Reis ST conceived and designed the study and was also responsible for the statistical analysis. Piantino C was responsible for the administrative support. Dall’Oglio MF was responsible for the data collection, critical revision and important intellectual content of the manuscript. Leite KRM conceived and designed the study and was responsible for the critical revision and important intellectual content of the manuscript. Srougi M supervised the study.

REFERENCES 1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics. 2010. CA Cancer J Clin. 2010;60:277-300, Epub 2010 Jul 7, doi: 10.3322/caac.20073 2. Lynch CF, Cohen MB. Urinary system. Cancer. 1995;75:316-29, doi: 10. 1002/1097-0142(19950101)75:1+,316::AID-CNCR2820751314.3.0.CO;2T. 3. Scosyrev E, Noyes K, Feng C, Messing E. Sex and racial differences in bladder cancer presentation and mortality in the US. Cancer. 2009;115:6874, doi: 10.1002/cncr.23986. 4. Howe HL, Wu X, Ries LA, Cokkinides V, Ahmed F, Jemal A, et al. Annual report to the nation on the status of cancer, 1975-2003, featuring cancer among U.S. Hispanic/Latino populations. Cancer. 2006;107:171142, doi: 10.1002/cncr.22193. 5. Herr HW, Wartinger DD, Fair WR, Oettgen HF. Bacillus CalmetteGuerin therapy for superficial bladder cancer: a 10-year followup. J Urol. 1992;147:1020-3. 6. Leite KR, Chade DC, Sanudo A, Sakiyama BY, Batocchio G, Srougi M. Effects of Curcumin in an Orthotopic Murine Bladder Tumor Model. Int Braz J Urol. 2009;35:599-607, doi: 10.1590/S1677-55382009000500012. 7. Chade DC, Andrade PM, Borra RC, Leite KR, Andrade E, Villanova FE, et al. Histopathological characterization of a syngeneic orthotopic murine bladder cancer model. Int Braz J Urol. 2008;34:220-6; discussion 226-9, doi: 10.1590/S1677-55382008000200013 8. Bykov VJ, Issaeva N, Shilov A, Hultcrantz M, Pugacheva E, Chumakov P, et al. Restoration of the tumor suppressor function to mutant p53 by a low-molecular-weight compound. Nat Med 2002;8:282-8, doi: 10.1038/ nm0302-282. 9. Gu¨nther JH, Jurczok A, Wulf T, Brandau S, Deinert I, Jocham D, et al. Optimizing syngenic orthotopic murine bladder cancer (MB49). Cancer Res. 1999;59:2834-7. 10. Garg A, Aggarwal BB. Nuclear transcription factor kB as a target for cancer drug development. Leukemia. 2002;16:1053-68, doi: 10.1038/sj. leu.2402482. 11. Chen F, Zhang G, Cao Y, Hessner MJ, See WA. MB49 Murine Urothelial Carcinoma: Molecular and Phenotypic Comparison to Human Cell Lines as a Model of the Direct Tumor Response to Bacillus Calmette-Guerin. J Urol. 2009;182:2932, doi: 10.1016/j.juro.2009.08.018. 12. Korkolopoulou P, Konstantinidou AE, Thomas - Tsagli E, Christodoulou P, Kapralos P, Davaris P. WAF1/p21 protein expression is an independent prognostic indicator in superficial and invasive bladder cancer. Appl. Immunohistochem. Mol. Morphol. 2000;8:285-92, doi: 10. 1097/00022744-200012000-00005. 13. Tian B, Wang Z, Zhao Y, Wang D, Li Y, Ma L, et al. Effects of curcumin on bladder cancer cells and development of urothelial tumors in a rat bladder carcinogenesis model. Cancer Lett. 2000;264:299–308, doi: 10. 1016/j.canlet.2008.01.041.

2123

Curcumin and Prima-1 in an in vivo bladder cancer model Watanabe FT et al.

CLINICS 2011;66(12):2121-2124

anti-inflammatory agent, during the promotion/progression stages of colon cancer. Cancer Res. 1999;59:597â&#x20AC;&#x201C;601. 16. Chauhan DP. Chemotherapeutic potential of curcumin for colorectal cancer. Curr Pharm Des. 2002;8:1695-706, doi: 10.2174/1381612023394 016.

14. Liontas A, Yeger H. Curcumin and resveratrol induce apoptosis and nuclear translocation and activation of p53 in human neuroblastoma. Anticancer Res. 2004;24:987â&#x20AC;&#x201C;98. 15. Kawamori T, Lubet R, Steele VE, Kelloff GJ, Kaskey RB, Rao CV, et al. Chemopreventive effect of curcumin, a naturally occurring

2124

CLINICS 2011;66(12):2125-2132

DOI:10.1590/S1807-59322011001200020

BASIC RESEARCH

The effects of heated vegetable oils on blood pressure in rats Kamsiah Jaarin,I Mohd Rais Mustafa,III Xin-Fang LeongI,II I Department of Pharmacology, Faculty of Medicine, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia. II Department of Clinical Oral Biology (Pharmacology), Faculty of Dentistry, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia. III Department of Pharmacology, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia.

OBJECTIVES: The goal of this study was to determine the possible mechanism that is involved in the blood pressureraising effect of heated vegetable oils. METHODS: Adult male Sprague-Dawley rats were divided into 11 groups; the control group was fed with rat chow, and the other groups were fed with chow that was mixed with 15% weight/weight palm or soy oils, which were either in a fresh form or heated once, twice, five, or ten times. Blood pressures were measured at the baseline and throughout the 24-week study. Plasma nitric oxide levels were assessed prior to treatment and at the end of the study. Following 24 weeks, the rats were sacrificed to investigate their vascular reactivity using the thoracic aorta. RESULTS: Palm and soy oils had no detrimental effects on blood pressure, and they significantly elevated the nitric oxide contents and reduced the contractile responses to phenylephrine. However, trials using palm and soy oils that were repeatedly heated showed an increase in blood pressure, enhanced phenylephrine-induced contractions, reduced acetylcholine- and sodium nitroprusside-induced relaxations relative to the control and rats that were fed fresh vegetable oils. CONCLUSIONS: The blood pressure-raising effect of the heated vegetable cooking oils is associated with increased vascular reactivity and a reduction in nitric oxide levels. The chronic consumption of heated vegetable oils leads to disturbances in endogenous vascular regulatory substances, such as nitric oxide. The thermal oxidation of the cooking oils promotes the generation of free radicals and may play an important contributory role in the pathogenesis of hypertension in rats. KEYWORDS: Palm oil; Soy oil; Heating; Blood Pressure; Aorta. Jaarin K, Mustafa MR, Leong XF. The effects of heated vegetable oils on blood pressure in rats. Clinics. 2011;66(12):2125-2132. Received for publication on June 2, 2011; First review completed on June 6, 2011; Accepted for publication on for August 31, 2011 E-mail: kamsiah@medic.ukm.my Tel.: 60 3 92895285

oxidative stress and BP via changes in endothelium-derived factors.6 A previous study has reported that rats fed oxidized oil experienced a significant increase in BP relative to a control group and rats that were fed fresh oil.7 Cooking oil is sometimes reused due to its stability at high temperatures.8 During the frying process, various chemical reactions occur, such as thermal oxidation, hydrolysis, and polymerization, due to the exposure of the oil to high temperatures in the presence of air and moisture. As a result, cooking oil decomposes and forms volatile compounds and various monomers, and polymers.9 Several factors can affect the quality of cooking oil during heating, including ventilation, temperature, heating duration, the type of oil, the saturation ratio of the oil, and the presence of a catalyst/antioxidant.8 The repeated heating of oil at high temperatures ($180˚C) results in the thermal oxidation of the oil, which causes the configuration of the fatty acid to change from the cis isomer to the trans isomer. This configuration change causes the PUFAs to acquire undesirable properties associated with SFAs, such as their correlation with increased serum cholesterol levels and higher low-density lipoprotein (LDL) cholesterol in

INTRODUCTION Various studies have been performed in humans and animals to determine the role of saturated and unsaturated fatty acids in hypertension. The consumption of a diet that is rich in monounsaturated fatty acids (MUFAs) and polyunsaturated fatty acids (PUFAs), such as olive oil and fish oil, has been found to decrease blood pressure (BP).1,2 Conversely, diets that are rich in saturated fatty acids (SFAs) have been found to increase BP.3,4 The pathogenesis of hypertension is often associated with endothelial dysfunction and oxidative stress. Palm oil has been found to decrease the mean arterial BP in rats by reducing thromboxane levels and vascular resistance in the aorta and renal arteries.5 Furthermore, palm oil can reduce

2125

Effects of heated vegetable oils on blood pressure Jaarin K et al.

CLINICS 2011;66(12):2125-2132

particular.10 The fats that are found in processed foods are exposed to high heat primarily during preparation and may be affected by these configuration changes. The practice of reusing oil during food preparation processes is widespread. This practice is not only confined to roadside food stalls; established food outlets in large cities throughout Malaysia also use this method to reduce costs. The repeated heating of cooking oil will result in oil that is more prone to lipid peroxidation.11 However, the potential adverse effects that are associated with this practice are quite insidious. The purpose of this study was to elucidate the possible mechanism of the BP-raising effect of heated palm and soy oils in rats.

Measurement of blood pressure (BP) A non-invasive BP monitoring method was employed. A monitoring cuff was placed proximally on the tail to detect changes in blood flow that occurred during the occlusion or release of the cuff. The rats were placed in an appropriately body-sized plastic container prior to obtaining the BP measurement. This step ensured that the animals were acclimated and provided a faster BP measurement. The animals were pre-warmed for 15 min to enhance blood flow to the tail. The measurements were taken using a PowerLab data acquisition system (ADInstruments, Castle Hill, NSW, Australia) at room temperature (27 ˚C¡2 ˚C) to avoid a reduction in the tail blood flow in a cool environment. The BP was obtained as an average of five readings.

MATERIALS AND METHODS

Measurement of nitric oxide (NO)

Experimental animals and study design

Plasma NO levels were assessed by the presence of nitrite metabolites according to the manufacturer’s instructions (Sigma-Aldrich, St. Louis, MO, USA). Samples of 50 mL each were transferred to a microtiter plate, and 50 mL of modified Griess reagent was added (Sigma-Aldrich, St. Louis, MO, USA). After 15 min of incubation at room temperature, the nitrite concentrations were measured spectrophotometrically at 540 nm using an Emax ELISA microplate reader with the SoftMax Pro software (Molecular Devices, Sunnyvale, CA, USA). The procedures were performed in a dark environment. The nitrite concentrations were quantified with a standard curve generated using known concentrations of sodium nitrite (Sigma-Aldrich, St. Louis, MO, USA).

A total of 110 three-month-old adult male Sprague-Dawley rats were randomly and equally divided into eleven groups. The control group was fed a basal diet (rat chow), and the diets of the remaining groups were fortified with 15% weight/weight (w/w) of one of the following oils: fresh palm oil (FPO); palm oil that was heated once (1HPO), twice (2HPO), five times (5HPO), or ten times (10HPO); fresh soy oil (FSO); or soy oil that was heated once (1HSO), twice (2HSO), five times (5HSO), or ten times (10HSO). The rats were kept in stainless-steel cages and maintained with a 12:12-hour lightdark schedule at room temperature (27 ˚C¡2 ˚C). All of the rats were provided with food and water ad libitum for 24 weeks. The animals were handled according to the guidelines set down by Commonwealth and Malaysian legislation and the recommendations of the University Federation of Animal Welfare. The studies were approved by the University Animal Ethics Committee (UKMAEC: FP/FAR/ 2008/KAMSIAH/9-APR/220-APR-2008-FEB-2011). Blood pressure measurements were recorded at the baseline and once every four weeks for 24 weeks. Non-fasting blood samples were collected over ethylenediaminetetraacetic acid (EDTA) through the orbital sinus prior to treatment and at the end of the study. The blood samples were then centrifuged to separate the plasma. The plasma aliquots were stored at -70 ˚C until the analysis. The rats were then sacrificed, after 24 weeks of study, and their thoracic aortas were dissected to measure the vascular reactivity. All of the animals were anesthetized by placing them into a jar that contained cotton soaked in diethyl ether, and they were allowed to go into an unconscious state during the blood collection and after the end of the feeding protocol when the tissue was harvested.

Aortic rings preparation and vascular reactivity The descending thoracic aorta of each rat was excised using a midline incision, and the aorta was cleaned of fat and connective tissues. The aorta was cut into 3- to 5-mm ring segments and were suspended in individual 5-mL organ baths that were filled with Krebs solution containing the following components (mM): NaCl (118.0), KCl (4.7), CaCl2?2H2O (2.5), KH2PO4 (1.2), MgSO4 (1.2), glucose (11.7), NaHCO3 (25.0), and EDTA (0.026). The bathing solution was warmed to 37˚C and was continuously bubbled with a mixture of 95% oxygen and 5% carbon dioxide. Care was taken to not injure the endothelium during the preparation of the rings. Changes in the tension of the tissues (g) were measured isometrically and recorded using a forcedisplacement transducer (F-D-Transducer FT03E, Grass Instruments, West Warwick, RI, USA) that was connected to a MacLab computerized system (model 8S, ADInstruments, Castle Hill, NSW, Australia). The aortic rings were then progressively stretched to a basal tension of 1 g. Each ring preparation was allowed to equilibrate for 30 min prior to the initiation of the experimental protocol. During this period, the incubation media was changed every 15 min, and the resting tension was readjusted to a basal tension of 1 g. After the equilibration period, the vascular reactivity experiments were initiated by obtaining a reference contractile response to an isotonic KCl solution (high K+, 80 mM). To confirm the stability of the tissue, three consecutive equal contractions were performed. Following the washout of the responses to high K+, the relaxation responses (vasodilatations) to cumulatively increasing concentrations of acetylcholine (ACh, 10210 M to 1025 M) and sodium nitroprusside (SNP, 10211 M to 1026 M) were recorded in phenylephrine (PE, 1026 M) pre-contracted aortic rings. In addition, the contractile responses (vasoconstrictions) to cumulatively increasing concentrations of PE (10210 M to 1025 M) were

Preparation of heated-oil diets Commercially purchased palm and soy oils were either used fresh or were heated according to the modified method of Owu et al.12 In the heating process, the oils were used to fry sweet potatoes in a stainless-steel wok for ten minutes. The temperature of the heated oils reached approximately 180 ˚C. The hot oils were cooled to room temperature, and the entire frying process was repeated to fry a fresh batch of sweet potatoes without the addition of oils. The process was repeated up to ten times. Standard rat chow (Gold Coin, Port Klang, Selangor, Malaysia) was ground and formulated by mixing 15% w/w of the respective prepared oils; the chow was then dried in an oven at 70 ˚C overnight. The oil diets were stored in the dark and prepared weekly.

2126

CLINICS 2011;66(12):2125-2132

Effects of heated vegetable oils on blood pressure Jaarin K et al.

groups displayed a significant increase (p,0.05) in BP at the end of the study with increases of 22.4%, 23.9%, and 25.4%, respectively, when compared to the control group (4.3%). The BP increases in the 1HSO, 2HSO, 5HSO, and 10HSO groups (16.0%, 23.0%, 25.9%, and 34.4%, respectively) were higher than those of the heated palm oil groups. In addition, we observed that the BP increase was significantly higher in the 10HSO group than in the 10HPO group (Figure 1).

recorded in the rings. The rings were constricted with PE (1027 M) to test the endothelial integrity with the addition of ACh (1025 M) after the washout of the responses to high K+. Only the endothelium-intact rings (i.e., rings showing greater than 50% relaxation in response to ACh) were used.13 Different aortic rings with an intact endothelium were used in each experiment.

Drugs used in the vascular reactivity studies

Effect of heated vegetable oils on nitric oxide (NO) contents

Acetylcholine chloride, phenylephrine-HCl (Sigma Chemical Co., St. Louis, MO, USA), sodium nitroprusside, and Krebs salts (BDH Limited and BDH Laboratory Supplies, Poole, England) were used.

The rats that were fed FPO- and FSO-amended diets displayed NO metabolite (nitrite) levels that increased by 22.5% and 23.1%, respectively, when compared to their baseline values. However, the groups that were fed heated palm and soy oils displayed reduced levels of nitrites when compared to the fresh oil groups (Figure 2).

Statistical analyses The results were expressed as the means¡SEM. The level of statistical significance was fixed at 0.05. The distribution of the data was determined using the Kolmogorov-Smirnov test. The data were analyzed using an unpaired Student’s t test or a one-way ANOVA followed by a post-hoc Tukey’s HSD test using the SPSS software package version 13.0 (SPSS Inc., Chicago, IL, USA). The data that were not normally distributed were analyzed using non-parametric tests, such as the Kruskal-Wallis H and Mann-Whitney U tests.

Effect of heated vegetable oils on vascular reactivity in aortic rings i. Relaxation in response to acetylcholine (ACh) and sodium nitroprusside (SNP) ACh and SNP relaxed the phenylephrine pre-contracted aortic rings from various rat groups. The relaxant effect of ACh at the maximum tested concentration (10-5 M) was significantly reduced (p,0.05) in the aortic rings that were obtained from the 5HSO, 5HPO, 10HSO, and 10HPO groups when compared to the control and other test groups (Figure 3). In addition, vasodilatation in response to the highest tested SNP concentration (10-6 M) was significantly attenuated

RESULTS Effect of heated vegetable oils on blood pressure (BP) The rats in the control, FPO and FSO groups did not show any significant changes in BP. The 2HPO, 5HPO, and 10HPO

Figure 1 - Changes in blood pressure after 24 weeks of feeding with a basal diet (control) or chow amended with one of the following oils: fresh palm oil (FPO); palm oil that was heated once (1HPO), twice (2HPO), five times (5HPO), or ten times (10HPO); fresh soy oil (FSO); or soy oil that was heated once (1HSO), twice (2HSO), five times (5HSO), or ten times (10HSO). The results are the means ¡ SEM (n = 10). Significant difference (p,0.05) versus the *control, #fresh oil group, 1once-heated-oil group, or £twice-heated-oil group. + Significant difference (p,0.05) between the palm and soy oil groups. The data are expressed as percentage based on baseline values.

2127

Effects of heated vegetable oils on blood pressure Jaarin K et al.

CLINICS 2011;66(12):2125-2132

Figure 2 - Changes in plasma nitric oxide levels after 24 weeks of feeding with a basal diet (control) or chow amended with one of the following oils: fresh palm oil (FPO); palm oil that was heated once (1HPO), twice (2HPO), five times (5HPO), or ten times (10HPO); fresh soy oil (FSO); or soy oil that was heated once (1HSO), twice (2HSO), five times (5HSO), or ten times (10HSO). The results are the means ¡ SEM (n = 10). Significant difference (p,0.05) versus the *control or #fresh oil group. The data are expressed as percentage based on baseline values.

Figure 3 - Endothelium-dependent relaxation induced by acetylcholine (ACh) in aortic rings that were isolated from rats that were fed for 24 weeks with a basal diet (control), fresh palm or soy oil, or palm or soy oil that was heated once (1x), twice (2x), five times (5x) or ten times (10x). The results are the means¡SEM (n = 10). Significant difference (p,0.05) versus the *control, #fresh-oil group, 11x heated-oil group, £2x heated-oil group, or ¥5x heated-oil group. Dose response curves are plotted as percentage of relaxation against the maximal phenylephrine (PE, 1026 M).

2128

CLINICS 2011;66(12):2125-2132

Effects of heated vegetable oils on blood pressure Jaarin K et al.

aspect to the pathogenesis of diet-induced hypertension that follows the prolonged intake of heated vegetable oils. In this study, we found that feeding with heated palm and soy oils led to reduced plasma NO contents. However, feeding with FPO or FSO increased the plasma nitrite levels. These findings suggest that fresh oils, which have higher antioxidant contents, led to increased NO levels. We postulate that thermally oxidized oils generate free radicals, such as the superoxide anion, which react with NO to form peroxynitrite.18 The reduction in the plasma nitrite levels could be explained by the enhanced NO sequestration by free radicals and its inactivation due to the imbalance between the antioxidant/oxidant status. Therefore, it appears that the BP increase occurs due to the loss of NOdependent relaxation. It is possible that increased peroxynitrite levels are responsible for endothelial dysfunction, which leads to increased BP.19 The generation of free radicals from thermally oxidized oils may be due to a significant reduction in antioxidant levels. Previous findings from our laboratory have shown that vitamin E contents progressively diminish as palm and soy oils are repeatedly heated.20 In this present study, the rats that were fed with FPO or FSO displayed increased plasma nitrite levels. It has been suggested that natural antioxidants found in fresh oils may provide protective effects by decreasing oxidative stress or stimulating NO formation, which subsequently preserves the bioavailability of NO.21 Soy intake was also inversely associated with BP.22,23 Dietary soy has been shown to enhance nitric oxide synthase expression, which further promotes NO production.24 The identification of increased plasma NO metabolite levels after 24 weeks in both of the

(p,0.05) in the aortic rings obtained from the 5HSO, 5HPO, 10HSO, and 10HPO groups. The relaxation effects remained unaltered in the aortic rings of the rats fed fresh oils relative to the control rats (Figure 4).

ii. Contractile response to phenylephrine (PE) The vasoconstriction in response to the highest tested concentration of the alpha-1 adrenergic agonist PE (10-5 M) was significantly augmented (p,0.05) in the aortic rings of the 5HSO, 5HPO, 10HSO, and 10HPO groups when compared to the control and other dietary groups (Figure 5).

DISCUSSION The chronic ingestion of heated palm and soy oils for 24 weeks caused a significant increase in BP. The increased BP was affected by the number of heating repetitions as evidenced by a greater increase in BP when the oils were heated ten times compared to the BP increase when the oils were heated two or five times. The BP increase was significantly higher for the 10HSO group than the 10HPO group, and it is possible that the higher degree of PUFA lipid peroxidation may contribute to this result. The results of this study were in agreement with earlier studies that reported that repeatedly heated oils increased BP.14,15 However, FPO and FSO had a tendency to reduce BP, although the effect was not significant. In this study, the effect of fresh oils on BP was not in agreement with previous studies.5,6,16 The results could be due to differences in duration of the study, the types of oils and the animals used. NO plays a vital contributory role in BP regulation.17 The impairment of NO bioavailability may be an important

Figure 4 - Endothelium-independent relaxation induced by sodium nitroprusside (SNP) in aortic rings isolated from rats that were fed for 24 weeks with a basal diet (control), fresh palm or soy oil, or palm or soy oil that was heated once (1x), twice (2x), five times (5x) or ten times (10x). The results are the means ÂĄ SEM (n = 10). Significant difference (p,0.05) versus the *control, #fresh-oil group, 11x heated-oil group, or ÂŁ2x heated-oil group. Dose response curves are plotted as percentage of relaxation against the maximal phenylephrine (PE, 1026 M).

2129

Effects of heated vegetable oils on blood pressure Jaarin K et al.

CLINICS 2011;66(12):2125-2132

Figure 5 - Contractile response induced by phenylephrine (PE) in aortic rings isolated from rats that were fed for 24 weeks with a basal diet (control), fresh palm or soy oil, or palm or soy oil that was heated once (1x), twice (2x), five times (5x), or ten times (10x). The results are the means¡SEM (n = 10). Significant difference (p,0.05) versus the *control, #fresh oil group, 11x heated-oil group, £2x heated-oil group, or ¥ 5x heated-oil group. Dose response curves are plotted as percentage of maximum contraction obtained with high K+.

Palm oil is widely used as cooking oil in both household and food outlets due to its low cost. FPO contains an approximately 1:1 ratio of saturated and unsaturated fatty acids32 and contains lower levels of PUFAs, but higher MUFA levels, relative to soy oil. Attack by free radicals typically targets the unsaturated bonds in fatty acid chains. Therefore, a frying oil with a greater number of unsaturated bonds is less stable and more readily broken down by heat. The repeated heating of edible oils that are rich in PUFAs increases the formation of toxic compounds, which are associated with an increased risk of hypertension. Soy oil has a higher percentage of PUFAs than palm oil and is therefore more prone to oxidation. Both palm and soy oils contain vitamin E, which is an antioxidant that can scavenge free radicals. During the frying process, the oil is aged and becomes more oxidized when the natural antioxidants are depleted; thus, after repeated heating, the antioxidants can no longer prevent the oxidation of the fatty acids in the oil. Previous studies have reported that vitamin E is destroyed when frying oil is repeatedly heated.9,10 The reduction in the vitamin E content of frying oils may contribute to the increased production of reactive oxygen species (ROS) and may cause oxidative damage. Palm oil contains both tocopherol and tocotrienol compounds, whereas tocotrienols are not present in soy oil. Tocotrienols have a stronger antioxidant activity than tocopherols,33,34 the presence of tocotrienols in palm oil may contribute to the greater resistance to oxidation with repeated heating relative to soy oil observed in this study. This study had several limitations. The number of animals that were investigated was relatively large. A smaller study using eight rats from each group instead of ten may have

fresh oil groups reinforces the importance of the influence of NO levels on BP in rats. Previous studies have documented that NO has a vasodilatory effect, and its release may be triggered by several pharmacologically vasoactive substances, such as ACh.25,26 NO is synthesized predominantly in the vascular endothelium and diffuses into the adjacent smooth muscle cells to activate guanylate cyclase (GC); this increases the formation of cyclic guanosine monophosphate (cGMP) and causes vascular smooth muscle relaxation.27 In the aorta, endothelium-dependent relaxation induced by ACh increases NO bioavailability via the release of NO from the endothelium. SNP breakdown spontaneously generates exogenous NO and causes endothelium-independent relaxation. The data presented here suggest that the treatment with heated vegetable oils may decrease the endotheliumderived NO bioavailability and enhance the contraction that is induced by PE when compared to the control and fresh oil groups. The increased vascular contractile reactivity contributes to increased vascular tone.28 Heated vegetable oils have reduced radical-scavenging properties, which may result in reduced NO bioavailability in the aorta. A previous study has also reported impaired vasorelaxation following the ingestion of heated palm oil.29 In addition, the consumption of heated oils has been reported to cause abnormal ultrastructural changes in the aorta.30,31 As observed in this current study, the effect of repeatedly heated palm oil had a more stable effect on BP than repeatedly heated soy oil. This effect may be due to the unique composition of fatty acids and vitamin E in palm oil.

2130

CLINICS 2011;66(12):2125-2132

Effects of heated vegetable oils on blood pressure Jaarin K et al. 7. Osim EE, Owu DU, Etta KM. Arterial pressure and lipid profile in rats following chronic ingestion of palm oil diets. Afr J Med Med Sci. 1996;25:335-40. 8. Gupta MK. Frying oil. In: Shahidi F, editor. Edible Oil and Food Products: Products and Applications. New Jersey: John Wiley & Sons Inc. 2005;1-31. 9. Andrikopoulos NK, Kalogeropoulos N, Falirea A, Barbagianni MN. Performance of virgin olive oil and vegetable shortening during domestic deep-frying and pan- frying of potatoes. Int J Food Sci Tech. 2002;37:177-90, doi: 10.1046/j.1365-2621.2002.00555.x. 10. Mensink RP, Katan MB. Effect of dietary trans fatty acids on high-density and low- density lipoprotein cholesterol levels in health subjects. N Engl J Med. 1990;323:439-45, doi: 10.1056/NEJM199008163230703 11. Garrido-Polonio C, Garcıá-Linares MC, Garcıá-Arias MT, Lo´pez-Varela S, Garcıá- Fernańdez MC, Terpstra AHM, et al. Thermally oxidised sunflower-seed oil increases liver and serum peroxidation and modifies lipoprotein composition in rats. Br J Nutr. 2004;92:257-65, doi: 10.1079/ BJN20041174. 12. Owu DU, Osim EE, Ebong PE. Serum liver enzymes profile of Wistar rats following chronic consumption of fresh or oxidized palm oil diets. Acta Trop. 1998;69:65-73, doi: 10.1016/S0001-706X(97)00115-0. 13. Ajay M, Mustafa MR. Effects of ascorbic acid on impaired vascular reactivity in aortas isolated from age-matched hypertensive and diabetic rats. Vascul Pharmacol. 2006;45:127-33, doi: 10.1016/j.vph.2006.05.001. 14. Soriguer F, Rojo-Martıńez G, Dobarganes MC, Garcıá Almeida JM, Esteva I, Beltrań M, et al. Hypertension is related to the degradation of dietary frying oils. Am J Clin Nutr. 2003;78:1092-7. 15. Leong XF, Aishah A, Nor Aini U, Das S, Jaarin K. Heated palm oil causes rise in blood pressure and cardiac changes in heart muscle in experimental rats. Arch Med Res. 2008;39:567-72, doi: 10.1016/j. arcmed.2008.04.009. 16. Medeiros FJ, Mothe´ CG, Aguila MB, Mandarim-de-Lacerda CA. Longterm intake of edible oils benefits blood pressure and myocardial structure in spontaneously hypertensive rat (SHR) and streptozotocin diabetic SHR. Prostaglandins Other Lipid Mediat. 2005;78:231-48, doi: 10. 1016/j.prostaglandins.2005.09.001. 17. Hermann M, Flammer A, Lu¨scher TF. Nitric oxide in hypertension. J Clin Hypertens. 2006;8:17-29, doi: 10.1111/j.1524-6175.2006.06032.x. 18. Hayashi Y, Sawa Y, Nishimura M, Fukuyama N, Ichikawa H, Ohtake S, et al. Peroxynitrite, a product between nitric oxide and superoxide anion, plays a cytotoxic role in the development of post-bypass systemic inflammatory response. Eur J Cardiothorac Surg. 2004;26:276-80, doi: 10. 1016/j.ejcts.2004.03.033. 19. Gao YJ, Lee RMKW. Hydrogen peroxide induces a greater contraction in mesenteric arteries of spontaneously hypertensive rats through thromboxane A2 production. Br J Pharmacol. 2001;134:1639-46, doi: 10.1038/sj. bjp.0704420. 20. Adam SK, Sulaiman NA, Mat Top AG, Jaarin K. Heating reduces vitamin E content in palm and soy oils. Malays J Biochem Molec Biol. 2007;15:76-9. 21. Carr A, Frei B. The role of natural antioxidants in preserving the biological activity of endothelium-derived nitric oxide. Free Radic Biol Med. 2000;28:1806-14, doi: 10.1016/S0891-5849(00)00225-2. 22. He J, Gu D, Wu X, Chen J, Duan X, Chen J, et al. Effect of soybean protein on blood pressure: a randomized, controlled trial. Ann Intern Med. 2005;143:1-9. 23. Yang G, Shu XO, Jin F, Zhang X, Li HL, Li Q, et al. Longitudinal study of soy food intake and blood pressure among middle-aged and elderly Chinese women. Am J Clin Nutr. 2005;81:1012-7. 24. Mahn K, Borra´s C, Knock GA, Taylor P, Khan IY, Sugden D, et al. Dietary soy isoflavone induced increases in antioxidant and eNOS gene expression lead to improved endothelial function and reduced blood pressure in vivo. FASEB J. 2005;19:1755-7. 25. Moncada S, Palmer RM, Higgs EA. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev. 1991;43:109-42. 26. Moncada S, Higgs EA. The L-arginine-nitric oxide pathway. N Engl J Med. 1993;329:2002-12, doi: 10.1056/NEJM199312303292706. 27. Hansen K, Nedergaard OA. Methodological aspects of acetylcholineevoked relaxation of rabbit aorta. J Pharmacol Toxicol Methods. 1999;41:153-9, doi: 10.1016/S1056-8719(99)00035-0. 28. McIntyre M, Bohr DF, Dominiczak AF. Endothelial function in hypertension: the role of superoxide anion. Hypertension. 1999;34:539-45. 29. Owu DU, Orie NN, Osim EE. Altered responses of isolated aortic smooth muscle following chronic ingestion of palm oil diets in rats. Afr J Med Med Sci. 1997;26:83-6. 30. Adam SK, Das S, Jaarin K. A detailed microscopic study of the changes in the aorta of experimental model of postmenopausal rats fed with repeatedly heated palm oil. Int J Exp Pathol. 2009;90:321-7, doi: 10.1111/j. 1365-2613.2009.00658.x. 31. Adam SK, Das S, Othman F, Jaarin K. Fresh soy oil protects against vascular changes in an estrogen-deficient rat model: an electron microscopy study. Clinics. 2009;64:1113-9, doi: 10.1590/S180759322009001100012. 32. Cottrell RC. Introduction: nutritional aspects of palm oil. Am J Clin Nutr. 1991;53:989S-1009S.

yielded similar results. We used ten rats to avoid a true difference between tested groups from not being detected. Although indirect BP measurements may yield results with a lower accuracy, we chose a non-invasive technique (the tail-cuff method) because it was possible to take repeated BP measurements without injuring the rats. Regardless of the lower accuracy, this method enabled us to detect substantial differences in BP between the groups and changes in BP over time for a large numbers of rats. Our earlier laboratory findings reported that heated vegetable cooking oils caused increased lipid peroxidation as indicated by elevated serum acid thiobarbituric acid (TBARS) levels.35,36 We suggest that repeated heating may increase the number of free radicals. In addition, our laboratory also documented that heating causes a reduction in vitamin E levels in cooking oils.20 Therefore, the reduction in the antioxidant levels of palm and soy oil was inversely proportional to the increase in lipid peroxidation. We conclude that fresh palm and soy oils do not detrimentally affect blood pressure, and they significantly elevate nitric oxide levels and reduce contractile responses. When these oils are heated repeatedly during the cooking process, they generate free radicals and reduce the levels of antioxidants and vitamins, which lead to oxidative stress. Increased ROS and the altered balance between NO and ROS lead to impaired NO bioavailability, which results in decreased endothelium-dependent vasorelaxations leading to hypertension. Project location: this project was conducted at the Universiti Kebangsaan Malaysia and the University of Malaya.

ACKNOWLEDGMENTS The study was funded by grant UKM-GUP-SK-08-21-299. The authors would like to thank the staff members of the Pharmacology Department of the Universiti Kebangsaan Malaysia and the University of Malaya for their technical assistance.

AUTHOR CONTRIBUTIONS Jaarin K designed and organized the study, interpreted the results and drafted the manuscript. Mustafa MR designed and organized the study, interpreted the results and revised the manuscript. Leong XF performed the studies, collected the data, performed data analyses, interpreted the results and revised the manuscript. All of the authors have read the final manuscript.

REFERENCES 1. Bairati I, Roy L, Meyer F. Effects of a fish oil supplement on blood pressure and serum lipids in patients treated for coronary artery disease. Can J Cardiol. 1992;8:41-6. 2. Psaltopoulou T, Naska A, Orfanos P, Trichopoulos D, Mountokalakis T, Trichopoulou A. Olive oil, the Mediterranean diet, and arterial blood pressure: the Greek European Prospective Investigation into Cancer and Nutrition (EPIC) study. Am J Clin Nutr. 2004;80:1012-8. 3. Langley-Evans SC, Clamp AG, Grimble RF, Jackson AA. Influence of dietary fats upon systolic blood pressure in the rat. Int J Food Sci Nutr. 1996;47:417-25, doi: 10.3109/09637489609006955. 4. Lahoz C, Alonso R, Ordova´s JM, Lo´pez-Farre´ A, de Oya M, Mata P. Effects of dietary fat saturation on eicosanoid production, platelet aggregation and blood pressure. Eur J Clin Invest. 1997;27:780-7, doi: 10. 1046/j.1365-2362.1997.1860735.x. 5. Bayorh MA, Abukhalaf IK, Ganafa AA. Effect of palm oil on blood pressure, endothelial function and oxidative stress. Asia Pac J Clin Nutr. 2005;14:325-39. 6. Ganafa AA, Socci RR, Eatman D, Silvestrov N, Abukhalaf IK, Bayorh MA. Effect of palm oil on oxidative stress-induced hypertension in Sprague-Dawley rats. Am J Hypertens. 2002;15:725-31, doi: 10.1016/ S0895-7061(02)02963-1.

2131

Effects of heated vegetable oils on blood pressure Jaarin K et al.

CLINICS 2011;66(12):2125-2132

33. Yoshida Y, Saito Y, Jones LS, Shigeri Y. Chemical reactivities and physical effects in comparison between tocopherols and tocotrienols: physiological significance and prospects as antioxidants. J Biosci Bioeng. 2007;104:439-45, doi: 10.1263/jbb.104.439. 34. Maniam S, Mohamed N, Shuid AN, Soelaiman IN. Palm tocotrienol exerted better antioxidant activities in bone than alphaâ&#x20AC;&#x201C;tocopherol. Basic Clin Pharmacol Toxicol. 2008;103:55-60, doi: 10.1111/j.1742-7843.2008. 00241.x.

35. Adam SK, Das S, Soelaiman IN, Umar NA, Jaarin K. Consumption of repeatedly heated soy oil increases the serum parameters related to atherosclerosis in ovariectomized rats. Tohoku J Exp Med. 2008;215:21926, doi: 10.1620/tjem.215.219. 36. Adam SK, Soelaiman IN, Umar NA, Mokhtar N, Mohamed N, Jaarin K. Effects of repeatedly heated palm oil on serum lipid profile, lipid peroxidation and homocysteine levels in a post-menopausal rat model. Mcgill J Med. 2008;11:145-51.

2132

CLINICS 2011;66(12):2133-2139

DOI:10.1590/S1807-59322011001200021

REVIEW

The effects of dietary supplementation with Agaricales mushrooms and other medicinal fungi on breast cancer: Evidence-based medicine Maria Rita Carvalho Garbi Novaes, Fabiana Valadares, Mariana Campos Reis, Daniella Rodrigues Gonc¸alves, Marilia da Cunha Menezes Universidade de Brası´lia, School of Medicine, Institute of Health Science (ESCS), Brası´lia/DF, Brazil.

Breast cancer is the most prevalent cancer in women. The most frequent therapeutic approaches for the treatment of this disease are chemotherapy, radiotherapy, hormone therapy, and surgery. Conventional pharmacological treatments cause many harmful side effects in patients. To improve the quality of life of breast cancer patients, researchers have sought alternative adjuvant treatment strategies. To assess the effects of fungi and other basidiomycetes Agaricales on the co-adjuvant treatment of breast cancer, we conducted a literary review of the available scientific evidence. We selected articles published in refereed journals from 1990 to 2011 in Medline, Lilacs, CAPES, Scielo, and Pubmed. Articles written in English, Spanish, and Portuguese were reviewed. We used the following descriptors: Agaricales, medicinal mushroom/fungus, breast cancer, dietary supplementation, synonyms, and related terms. The pharmacological effects of nutritional and medicinal mushrooms have been reported in several experimental clinical studies and have shown promising results in the adjuvant treatment of breast cancer. Adjuvant treatment with mushrooms is associated with improvements in the immunological and hematologic parameters of breast cancer, as well as in the quality of life of these patients. Randomized clinical studies are needed to elucidate the possible mechanisms of action and clinical benefits of these fungi with respect to survival time, disease progression, and metastasis in breast cancer. KEYWORDS: Nutritional supplement; Agaricus sylvaticus; Medicinal mushroom; Adjuvant treatment; Basidiomycetes. Novaes MRCG, Valadares F, Reis MC, Gonc¸alves DR, Menezes MC. The effects of dietary supplementation with Agaricales mushrooms and other medicinal fungi on breast cancer: Evidence-based medicine. Clinics. 2011;66(12):2133-2139. Received for publication on May 26, 2011; First review completed on June 26, 2011; Accepted for publication on July 18, 2011 E-mail: ritanovaes@ig.com.br Tel.: 55 61 3254-0925

Previous studies have sought to identify ways to improve the quality of life and nutritional status of cancer patients using adjuvant therapy with mushrooms.4-10 The most recent studies have shown that dietary supplementation with Agaricales mushrooms and other medicinal fungi in breast cancer patients can provide benefits, such as antiproliferative and immunomodulatory effects on tumor cells.11-15 The aim of this study is to analyze the effects of mushrooms and other basidiomycetous Agaricales as adjuvant treatments in breast cancer.

INTRODUCTION Breast cancer is highly prevalent in women. In 2008, the IARC/OMS estimated that breast cancer was the second biggest incidence of cancer in the world (1.29 million cases). In Brazil, it would be responsible for 49,000 new cases in women from 2010 to 2011 and the mortality rate for this type of cancer remains high, on one side, due to the fact that this disease continues to be diagnosed at advanced stages.1,2 Treatment for breast cancer is complex and varies according to the histological diagnosis of the patient, the patient’s age, the disease stage and the therapeutic approaches taken.3 Factors associated with tumor growth and the conventional treatments used to treat cancer often result in malnutrition in breast cancer patients. Side effects caused by conventional treatments, significantly reduced caloric intake and decreased absorption of nutrients can all complicate cancer treatment and reduce the quality of life of cancer patients.4

MATERIALS AND METHODS A critical review of articles published in refereed journals between January, 1990 to March, 2011 was performed. Articles were identified in the Medline, Lilacs, Scielo, and Pubmed, Health Science Descriptors (DeCS) and Medical Subject Heading (MeSH) databases by searching for the following terms: in English (Agaricales, Agaricus, medicinal mushroom/fungus, breast cancer, dietary supplementation, edible mushroom effects, lectin), in Portuguese (caˆncer de mama, cogumelo medicinal), in Spanish (ca´ncer de mama, suplementacio´n nutricional/diete´tica, cogumelos, hongos medicinales).

2133

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al.

CLINICS 2011;66(12):2133-2139

Table 1 - Mechanisms of action of various modulating substances present in mushrooms. References

Substances

Wang et al. (1996)

Novaes et al. (2005a),5 Novaes et al. (2005b),6 Fortes & Novaes et al. (2006),32 Fortes et al. (2008),31 Fortes & Novaes (2011)9

Benefits

Mechanism of Action

Inhibits the growth of tumor cells

Two lectins (TML-1 and TML-2) were isolated from the mushroom Tricholoma mongolicum. Both stimulated the production of nitrite ions and activated macrophages in mice

Cytotoxic activity against human tumor cells, breast cancer and sarcoma 180 cells, inhibited proliferation of mastocytoma cells in vitro and sarcoma 180 cells in mice

Inhibits cell proliferation by blocking the import of protein into the nucleus

Antiproliferative activity toward hepatoma and breast cancer cells

Showed antiproliferative activity toward hepatoma Hep G2 cells and breast cancer MCF7 cells with an IC(50) of 2.1 mM and approximately 3.2 mM, respectively

Tumor-suppressing function via apoptosisinducing activity in cancer cells

Dimerization of AAL is a prerequisite for tumor cell apoptosisinducing activity and requires galactose and glucose as basic moieties of functional carbohydrate ligands for lectin bioactivity

Induces an immune response with tumorassociated glycan specificity and biological activity similar to that of ABL

Shows high-affinity binding to T antigen and reversible noncytotoxic inhibitory effects on epithelial tumor cell proliferation

Tumoricidal activity

Directly inhibits tumor cell growth in vitro by inducing apoptotic processing, increasing expression of the Apo2.7 antigen on the mitochondrial membranes of tumor cells and selective cytotoxicity toward tumor cells

Represses cancer progression, hinders metastatic progress, lessens the expression of tumor markers and increases NK cell activity in all patients

Antitumor effect in tumor-bearing mice due to enhancement of the immune system through the activation of macrophages, T cells, and natural killer (NK) cells

Enhances the immune system effects

Increases cellular and humoral immunity, the number and size of the phagocytic cells, stimulates cytokine production by T cells and increases the number of NK cells

Dose-dependently reduces proliferation and viability of MCF-7 breast cancer cells (cancercell growth was decreased by 50%)

Time-dependently induces cell cycle G1 arrest in approximately 90% of the cells by down-regulating the cyclin D1 and cyclin E expression in MCF-7 breast cancer cells Induces apoptosis through DNA alterations in subG1 cells Induces depletion of the anti-apoptotic Bcl-2 protein

Stimulates proliferation and activation of peripheral blood monocytes in vivo in patients with advanced breast cancer

Stimulates innate immunity by activating monocytes/ macrophages (CD95, CD45RA, CD14+)

Inhibits growth of tumor cells in vivo and affects expression of several important genes in breast cancer cells

Yeast-derived b-Glucan causes significant stimulation of phagocytic activity as well as potentiation of synthesis and release of interleukin (IL)-1, IL-2, IL-4, IL-6, IL-8, IL-13, and tumor necrosis factor-alpha.

Lectin Zhang et al. (2009)

Yang et al. (2009)

Sendra et al. (2010)

Fujimiya et al. (1998)

Kodama et al. (2003)

Novaes et al. (2005a)5, Novaes et al. (2005b),6 Fortes & Novaes (2006),32 Fortes et al. (2008),31 Fortes & Novaes (2011)9 b-Glucan Zhang et al. (2006)

Demir et al. (2007)

Vetvicka et al. (2008)

Jiang et al. (2010)

Inhibition of cell proliferation and cell cycle arrest at G2/M phase Inhibits cell proliferation and suppresses the in highly invasive MDA-MB-231 human breast cancer cells; linked to the suppression of secretion of the urokinase plasminogen metastatic behavior of MDA-MB-231 breast activator (uPA) from these cells. cancer cells Inhibition of cell adhesion, cell migration and cell invasion

2134

CLINICS 2011;66(12):2133-2139

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al.

Table 1 - Cont. References

Substances

Takaku et al. (2001)

Novaes et al. (2005a),5 Novaes et al. (2005b),6 Fortes & Novaes (2006),32 Fortes et al. (2008),31 Fortes & Ergosterol Novaes (2011)9 Wu et al. (2007)

Lee et al. (2009)

Thohinung et al. (2010)25 Novaes et al. (2005a),5 Novaes et al. (2005b),6 Fortes & Novaes (2006),32 Fortes et al. (2008),31 Fortes & Arginine Novaes (2011)9 Zhang et al. (2011)

Tada et al. (2011)

Benefits

Mechanism of Action

Direct inhibition of angiogenesis induced by solid tumors

Tumor growth was retarded by the oral administration of the lipid fraction extracted from A. blazei in sarcoma 180-bearing mice. Intraperitoneal and subcutaneous administration of ergosterol inhibited the neovascularization induced by Lewis lung carcinoma cell-packed chambers and Matrigel, respectively, in female C57BL/6 mice.

Inhibition of tumor growth without causing collateral damage

Inhibition of neovascularization induced by tumor growth

Strong antitumor activity

Decrease of tumor size (60%) by cytotoxicity â&#x20AC;&#x201C; exhibits a significant inhibitory effect on B16-induced melanoma in C57BL/6 mice.

Strong anti-migratory effect on human cancer cells

Ergosterol peroxide and daucosterol inhibited the migration of MDA-MB-231 cells.

Anti-proliferation effect.

Cytotoxicity against the human breast cancer and cholangiocarcinoma cell lines.

Inhibits tumor growth, reduces nitrogen losses and contributes to a positive nitrogen balance

Increases the number of NK cells and T-helper lymphocytes, stimulates the synthesis of cytokines, promotes the increase of immunity through the release of growth hormone and produces nitric oxide, hydroxyproline and polyamines

Anti-proliferation effect

Depletion of ARGLU1 significantly impairs the growth, as well as anchorage-dependent and -independent colony formation of breast cancer cells.

Improved anticancer activity

Mutated arginine on EGFR-lytic peptide produces higher binding ability to EGFR on cancer cells.

lectins can also down-regulate telomerase activity and inhibit angiogenesis.16-20 b-glucan is a glucose polymer present in medicinal mushrooms. It exhibits immunomodulatory effects as well as tumoricidal and antiproliferative activities in cancer patients through the stimulation of natural killer cells, neutrophils, monocytes, macrophages, and T-cells.21-28 Ergosterol (or provitamin D2) is a precursor of ergocalciferol, an important substrate in vitamin D biosynthesis and is found in the lipid fraction of Agaricales extracts. This substance has antitumor, antiproliferation, and antimigratory effects on human cancer cells.25-27 It has also been shown to inhibit angiogenesis. In a study on sarcoma 180 cells, patients treated with ergosterol demonstrated delayed tumor growth with minimal side effects. For example, the decrease in lymphocyte count that is commonly caused by chemotherapy was not observed in these patients. Ergosterol appears to have no direct in vitro cytotoxic effects on tumor cells, although it inhibits tumor-induced neovascularization.28 Arginine is a semi-essential amino acid used as a dietary supplement in cancer patients. It has been associated with a reduction of tumor growth and metastasis progression, and it is reported to have beneficial effects on the immune system, weight gain, and the time of survival of cancer patients.29,30 A complete understanding of the actions of these fungi and their bioactive molecules in the prevention and treatment of cancer will require further investigation. However, research shows that many of these substances exert anticarcinogenic, antiviral, antithrombotic, antibiotic,

Articles identified in the indexing databases mentioned above, including both original articles and reviews of the bioactive effects of edible mushrooms on cancer, were selected for inclusion in this study. Experimental trials in animals evaluating the efficacy of medicinal fungi treatments in breast cancer and randomized clinical trials with Agaricales mushrooms (and other medicinal fungi) in humans with breast cancer were also included.

RESULTS AND DISCUSSION Bioactive substances found in mushrooms and other Agaricales medicinal fungi The therapeutic effects of medicinal mushrooms are due to the presence of lectin, b-glucan, ergosterol, arginine, and other bioactive substances in mushrooms.5-9 The benefits and possible mechanisms of action of these substances are described in Table 1. Lectins have been shown to be therapeutic agents with anticancer properties in animals and in clinical studies. They cause cytotoxicity and apoptosis and inhibition of tumor growth by preferentially binding to cancer cell membranes. Lectins function by sequestering the bodyâ&#x20AC;&#x2122;s polyamines, thereby inhibiting cancer cell growth. Lectins also alter the production of many interleukins, activate protein kinases, bind to ribosomes, and inhibit protein synthesis. In addition, lectins modify the cell cycle by inducing cell cycle arrest at the G2/M phase, promoting apoptosis, and stimulating nonapoptotic G1-phase accumulation mechanisms. Finally,

2135

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al.

CLINICS 2011;66(12):2133-2139

Table 2 - The effects of Agaricales mushrooms and other medicinal fungi on breast cancer: experimental studies in animals, in vivo and in vitro. References

Mushroom Species

Target Group/Tumor

Results

Grube et al. 37 (2001)

Agaricus bisporus

Breast cancer cells

Q aromatase enzyme activity, tumor cell proliferation and estrogen production

Zhao et al. (2003)34

Breast cancer cells (MCF-7)

Q proliferation of tumor cells (via DNase)

Chen et al. (2006)36

Breast cancer cells (MCF-7) inoculated in mice

Q tumor cell proliferation and tumor growth

Breast cancer cells (MCF-7)

Q cell proliferation

Talorete et al. (2002)44

Agaricus blazei

q natural killer activity of spleen cells in na覺穡ve BALB/c Na覺穡ve BALB/c and meth A- mice Potentiated cytotoxic activity in innate and adaptive bearing BALB/c mice immunity in meth A-bearing BALB/c mice

Takimoto et al. 33 (2004)

Coriolus versicolor

Mice inoculated with mastocytoma cells and mammary tumor

Q tumor cells growth

Ganoderma lucidum

Breast cancer cells (MDA-MB-231)

Q tumor cell proliferation Inhibited NF-kb messenger activity

Breast cancer cells (MDA-MB-231)

Q tumor growth and metastasis

Breast carcinoma cells (MDA-MB-453 and MCF-7)

q antiproliferative activity

Breast carcinoma cells (MCF-7)

Q tumor cell proliferation q immune response

Phelinus linteus

Breast cancer cells (MDA-MB-231)

Q tumor cell proliferation Q angiogenesis

Jedinak et al. (2008)42

Pleurotus ostreatus

Breast cancer cells (MCF-7 and MDA-MB-231)

Suppressed tumor cell proliferation

Gu & Leonard (2006)40

Several types of mushrooms Several types of mushrooms

Breast cancer cells (MCF-7, MDA-MB-231 and BT-20)

Inhibited tumor growth

Petrova et al. (2007)39

Breast cancer cells (MCF-7)

Inhibited messenger activity of NF-K b

Vetvicka et al. (2008)45

Breast cancer cells

Q tumor cell proliferation

Mastocytoma cells (P815)

Inhibited tumor growth (via apoptosis-inducing)

Chu et al. 35 (2002) Jiang et al. (2004)43 Thyagarajan et al. (2007)38 Fang et al. (2006)41

Lentinus edodes

Israilides et al. (2008)46 Sliva et al. (2008)47

Zhao et al. (2003)34

Tricholoma mongolicum

contained in Tricholoma mongolicum has been shown to have an inhibitory effect on mastocytoma cells (P815) in vitro. In an in vivo study, extracts of Coriolus versicolor promoted significant tumor reductions in mice inoculated with mastocytoma tumor cells and mammary tumors.35 Chen et al.36 examined the ability of an Agaricus bisporus extract to inhibit aromatase at the estrogen receptor in vitro in MCF-7 cells and rat ovarian cells and in vivo in rats. The extract inhibited cell proliferation. The linoleic and linolenic acid present in the extract inhibited aromatase activity by altering or mutating the active sites. The in vivo study showed that the extract decreased proliferation and tumor growth without affecting apoptosis in rats. In studies of breast cancer cells (MFC-7), Grube et al.37 showed that Agaricus bisporus extract suppresses the activity of aromatase, resulting in a reduction of estrogen production, which is a major contributor to postmenopausal breast cancer in women. In experiments with breast cancer cells (MDA-MB-231), Thyagarajan et al.38 showed that Ganoderma lucidum extract inhibits cell proliferation and the formation of new cell

and anti-inflammatory effects in addition to many other activities that provide health benefits.5,6,9,31-32

Experimental studies with mushrooms and other Agaricales medicinal fungi Promising results have been reported in animals and in vitro using medicinal mushrooms in the treatment of breast cancer and several other cancers.33-49 Table 2 provides a summary of the studies mentioned below. Takimoto et al.33 demonstrated that rats administered Agaricus blazei extract orally exhibited increased cytotoxic T lymphocyte growth, increased levels of interferon-gamma and an increase in NK cells when compared to water-treated controls. This study indicates that mushroom extracts estimulate cytotoxic activity on both, innate and adaptive immunological systems. Immunomodulatory, antitumor, and antiproliferative effects of lectin isolated from various types of Agaricaceae mushrooms have been demonstrated by Zhao et al.34 The lectin contained in Agaricus bisporus has been shown to exhibit an antiproliferative effect on breast cancer cells, and the lectin

2136

CLINICS 2011;66(12):2133-2139

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al.

Table 3 - The results of clinical studies using Agaricales and other medicinal fungi for dietary supplementation and adjuvant treatment in patients with breast cancer. References

Mushroom Species

Active Principle

Target Group

Results

Grifola frondosa

D-fraction-b-Glucan and total mushroom

15 women with breast cancer

Q tumor size improvement in clinical and biochemical parameters Q of vomiting and anorexia

Kodama et al. (2002)13

Grifola frondosa

Mushroom powder

Liver, lung and breast cancer patients

increasing immune-competent cell activity cancer regression or significant symptom improvement

Gennari et al. (2002)48

Agaricus sylvaticus

Mushroom Capsule

1 patient with breast cancer and lung metastasis

q the number of NK cells and CD 56 total remission of lung metastasis

See et al. (2002)49

Agaricus blazei

Mushroom tea

5 stage VI breast cancer patients

q the number of NK cells stimulate macrophages and other immunomodulatory effects

Hong et al. (2008) 7

Several types of mushroom

Mushroom total

362 women with breast cancer in menopause

the consumption of dietary mushrooms may decrease breast cancer risk in postmenopausal women

Shin et al. (2010)14

Several types of mushroom

Mushroom total

358 women with breast cancer

q mushroom consumption Q risk of breast cancer in premenopausal women (stronger with hormone receptor positive tumors)

Dolby (1997)

A study by Jiang et al.43 revealed that Ganoderma lucidum inhibits proliferation of MDA-MB-231 breast cancer cells. By inhibiting Akt and NF-kappab activity in MDA-MB-231 cells, Ganoderma lucidum reduced their growth. Talorete et al.44 isolated breast cancer cells (MCF-7) and exposed them to an aqueous extract of Agaricus blazei. The results indicated that this extract was able to reduce cell proliferation in 26% compared to the control group, by significantly enhancing the expression of an API gene regulatory complex in the human breast cancer cell line MCF7. This, again, highlights the anticarcinogenic potential of mushrooms. In a study of rats inoculated with breast cancer cells, Vetvicka et al.45 observed a reduction in cell proliferation after oral supplementation of b-Glucan extracted from medicinal mushrooms. Likewise, a decrease in the proliferation of cancer cells has been reported in studies carried out by Israilides et al.46 with breast cancer cells (MCF-7) and by Sliva et al.47 using the MDA-MB-231 cell line.

colonies through the negative regulation of the expression of c-myc, an oncogene. The combination of G. lucidum extract with green tea extract demonstrated a synergistic effect by suppressing secretion of urokinase plasminogen, which is a breast cancer cell activator, and thereby suppressed the growth and invasion of metastatic breast cancers. In a study of breast cancer cells (MCF7), Petrova et al.39 noted that extracts of fungi significantly inhibited the reporter activity of nuclear factor-kappa b (NF-kb) by interfering negatively in its activation pathway. The study was conducted with 28 fungi extracts, 40% of which were found to inhibit NF-kb activity. Gu & Leonard40 reported the activities of 38 species of edible mushrooms in estrogen receptor-positive (MCF-7) and negative (MDA-MB-231, BT-20) human breast cancer cells. In aqueous extracts from Coprinellus sp., Flammulina velutipes, and Coprinus comatus, anticancer agents were identified that actively inhibited tumor growth. Fang et al.41 conducted an in vitro investigation of fractions of ethyl acetate extracts from Shiitake mushrooms (Lentinus edodes) via biological assays of apoptosis and cell cycle analysis in two human breast carcinoma cell lines (MDA-MB-453 and MCF-7). The authors observed antiproliferative activity in all strains. Apoptosis was induced in 50% of the tumor cell lines via the positive regulation of bax, a pro-apoptotic protein. Cell cycle analysis revealed a decrease in the percentage of cells in S phase, an induction of cdk inhibitors and p21 and a suppression of CDK4 and cyclin D1 activities, thus indicating cell cycle arrest. Studies using MCF-7 and MDA-MB-231 cells evaluated the effectiveness of various types of edible mushroom extracts. Jedinak & Sliva,42 using flow cytometry, revealed that Pleorotus ostreatus inhibited the proliferation of these cells in breast and colon cancers via p53-dependent and p53independent mechanisms. This fungus exerted its effect by inducing the expression of the tumor suppressor p53 and the cyclin-dependent kinase inhibitor p21 (CIP1/WAF1), but at the same time inhibited the phosphorylation of retinoblastoma protein (Rb) in MCF-7 and HT-29 cells, breast and colon cells respectively.42

Clinical studies with breast cancer patients using Agaricales mushrooms and other medicinal fungi Although there are some inconsistencies in the results of clinical studies regarding the use of medicinal mushrooms as an adjuvant therapy in breast cancer treatment, the majority of studies suggest a beneficial effect (Table 3). A study in patients with breast cancer who received four daily doses (1.6 g each) of Agaricus sylvaticus revealed that Agaricus sylvaticus supplementation resulted in an increased number of natural killer (NK) cells in 75.7% of the patients. More than half of the patients were receiving chemotherapy or radiotherapy, which typically reduces the numbers of NK cells in the body.45,11 In a clinical study of various cancers, including breast cancer (stage IV), Sliva et al.47 provided patients with a complex of immunomodulatory components, including Agaricus blazei tea (10 mg/day). After six months of treatment, some patients had increased NK cell activity, as well as increased levels of TNF-a (tumor necrosis factor),

2137

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al.

CLINICS 2011;66(12):2133-2139

3. Brito C, Portela MC, Vasconcellos MTL. SUS oncological care to women with breast cancer in Rio de Janeiro. Rev Public Health. 2005;39:874-81. 4. Shang EC, Weiss S, Kaehler G. The Influence of Early Supplementation of Parenteral Nutrition on Quality of Life and Body Composition in Patients with Advanced Cancer. JPEN J Parenter Enteral Nutr. 2006;30:222-30, doi: 10.1177/0148607106030003222. 5. Novaes MRCG, Fortes RC. Antitumor effects of edible Agaricaceae mushrooms. Rev Nutr Bras. 2005;4:207-17. 6. Novaes MRCG, Novaes LCG. Drug-nutrient in edible mushrooms and other basidiomycetous Agaricales. Rev Bras Nutr Clin. 2005;20:181-7. 7. Hong SA, Kim K, Nam SJ, Kong G, Kim MK. A case-control study on the dietary intake of mushrooms and breast cancer risk among Korean women. Int J Cancer. 2008;122:919-23, doi: 10.1002/ijc.23134. 8. Ahn WS, Kim DJ, Chae GT, Lee JM, Bae SM, Sin JI, et al. Natural killer cell activity and quality of life were improved by consumption of a mushroom extract, Agaricus blazei Murill Kyowa, in gynecological cancer patients undergoing chemotherapy. Int J Gynecol Cancer. 2004;14:589-94, doi: 10.1111/j.1048-891X.2004.14403.x. 9. Fortes RC, Novaes MRCG. The effects of Agaricus sylvaticus fungi dietary supplementation on the metabolism and blood pressure of patients with colorectal cancer during post surgical phase. Nutr Hosp. 2011;26:176-86. 10. Costa JV, Novaes MRCG, Asquieri ER. Chemical and antioxidant potential of Agaricus sylvaticus mushroom grown in Brazil. J Bioanal Biomed. 2011;3:049-054. 11. Gennari J, Gennari M, Fellipe JR. O Agaricus sylvaticus aumenta o nu´mero de ce´lulas natural killer em pacientes com caˆncer. Revista de Medicina Complementar. 2001;7:42-9. 12. Dolby V. An extract from maitake mushroom is an important anticancer. Better Nutr. 1997;59:38-59. 13. Kodama N, Komuta K, Nanba H. Can maitake MD-fraction aid cancer patients? Altern Med Rev. 2002;7:236-9. 14. Shin A, Kim J, Lim SY, Kim G, Song MK, Lee ES, et al. Dietary mushroom intake and risk of breast cancer based on hormone receptor states. Nutr Cancer. 2010;62:476-83, doi: 10.1080/01635580903441212. 15. Jiang J, Sliva D. Novel medicinal mushroom blend suppresses growth and invasiveness of human breast cancer cells. Int J Oncol. 2010;37:152936, doi: 10.3892/ijo_00000689. 16. Sendra VG, Zlocowski N, Nores GA, Irazoqui FJ. Anti-idiotypic antibody mimicking a T-antigen-specific lectin inhibits human epithelial tumor cell proliferation. Immunol Cell Biol. 2010;88:787-94, doi: 10.1038/icb. 2010.49. 17. Zhang GQ, Sun J, Wang HX, Ng TB. A novel lectin with antiproliferative activity from the medicinal mushroom Pholiota adiposa. Acta Biochim Pol. 2009;56:415-21. 18. Yang N, Li DF, Feng L, Xiang Y, Liu W, Sun H, et al. Structural basis for the tumor cell apoptosis-inducing activity of an antitumor lectin from the edible mushroom Agrocybe aegerita. J Mol Biol. 2009;387:694-705, doi: 10.1016/j.jmb.2009.02.002. 19. De Mejı´a EG, Prisecaru VI. Lectins as bioactive plant proteins: a potential in cancer treatment. Crit Rev Food Sci Nutr. 2005;45:425-45, doi: 10.1080/ 10408390591034445. 20. Wang HX, Liu WK, Ng TB, Ooi VE, Chang ST. The immunomodulatory and antitumor activities of lectins from the mushroom Tricholoma mongolicum. Immunopharmacology. 1996;31:205-11, doi: 10.1016/01623109(95)00049-6. 21. Fujimiya Y, Suzuki Y, Oshiman K, Kobori H, Moriguchi K, Nakashima H, et al. Selective tumoricidal effect of soluble proteoglucan extracted from the basidiomycete, Agaricus blazei Murill, mediated via natural killer cell activation and apoptosis. Cancer Immunol Immunother. 1998;46:147-59, doi: 10.1007/s002620050473. 22. Kodama N, Komuta K, Nanba H. Effect of Maitake (Grifola frondosa) DFraction on the activation of NK cells in cancer patients. J Med Food. 2003;6:371-7, doi: 10.1089/109662003772519949. 23. Demir G, Klein HO, Mandel-Molinas N, Tuzuner N. Beta glucan induces proliferation and activation of monocytes in peripheral blood of patients with advanced breast cancer. Int Immunopharmacol. 2007;7:113-6, doi: 10.1016/j.intimp.2006.08.011. 24. Zhang M, Chiu LC, Cheung PC, Ooi VE. Growth-inhibitory effects of a beta-glucan from the mycelium of Poria cocos on human breast carcinoma MCF-7 cells: cell-cycle arrest and apoptosis induction. Oncol Rep. 2006;15:637-43. 25. Thohinung S, Kanokmedhakul S, Kanokmedhakul K, Kukongviriyapan V, Tusskorn O, Soytong K. Cytotoxic 10-(indol-3-yl)-[13]cytochalasans from the fungus Chaetomium elatum ChE01. Arch Pharm Res. 2010;33:1135-41, doi: 10.1007/s12272-010-0801-5. 26. Wu JY, Zhang QX, Leung PH. Inhibitory effects of ethyl acetate extract of Cordyceps sinensis mycelium on various cancer cells in culture and B16 melanoma in C57BL/6 mice. Phytomedicine. 2007;14:43-9, doi: 10.1016/j. phymed.2005.11.005. 27. Lee DY, Lee SJ, Kwak HY, Jung L, Heo J, Hong S, et al. Sterols isolated from Nuruk (Rhizopus oryzae KSD-815) inhibit the migration of cancer cells. J Microbiol Biotechnol. 2009;19:1328-32.

erythrocytes, hemoglobin, and glutathione. In contrast, the number of TNF-a receptors was reduced. Diarrhea and occasional nausea were reported, but the quality of life had improved. The combination of immune-active components was effective in increasing NK cell function and other immunological parameters in patients with advanced stages of cancer, thus providing an effective nutritional combination for the treatment of the late stages of cancer.47 Gennari et al.48 reported a case study of a patient with breast cancer and showed that dietary supplementation with Agaricus sylvaticus increased the number of CD56+ NK cells in the blood and caused a total regression of lung metastasis. Dolby12 reported that the D-fraction ob-D-Glucan (extracted from Maitake) and mushroom tablets of Grifola frondosa had a positive effect on the health status of the 15 breast cancer patients included in the study. This study reported an improvement in the clinical parameters and laboratory test results of patients as well as improvements in their hematological parameters, reductions in the amount of vomiting caused by chemotherapy, increased appetite and reduced anorexia, which can be a side effect of conventional treatments. Hong et al.7 conducted a study with 362 breast cancer patients between 30 and 65 years of age. The frequency of ingestion of mushrooms was measured through a specific questionnaire. It was found that both the daily intake and the frequency of consumption were inversely related to the risk of breast cancer, especially in postmenopausal women. Similar results were reported by Shin et al.14; however, in the Shin study, the consumption of medicinal mushrooms showed a strong protective effect against breast cancer in premenopausal women as well. Several published experimental clinical studies have reported that medicinal mushrooms exhibit beneficial effects on the health and quality of life in breast cancer patients. The use of supplements as adjunctive therapies for the treatment of breast cancer has shown promising results, such as antiproliferative effects on tumor cells and immunomodulatory activities in the body. However, few articles have examined the effects of supplementation with medicinal mushrooms for the treatment of breast cancer. Therefore, new protocols for the purpose of conducting clinical trials are required to elucidate the possible mechanisms of action and clinical benefits of these fungi with respect to the survival time, clinical progression and quality of life of breast cancer patients.

ACKNOWLEDGMENTS Financial Support: This review is part of a research project that was supported by the scholarship Scientific Iniciation Project - PIC from the Institute of Health Science - FEPECS.

AUTHOR CONTRIBUTIONS Novaes MRCG participated at the heading, analysis and preparation of the manuscript, obtained a scholarship from the Scientific Iniciation Project of the Institute of Health Science - PIC/FEPECS. Valadares F, Reis MC, Gonc¸alves DR and Menezes MC were responsible for the collection and analysis of data and production of the final scientific work.

REFERENCES 1. Brazil. Ministry of Health Ministry of National Health Care National Cancer Institute [INCA]. Estimates October 20: incidence of cancer in Brazil. Rio de Janeiro, INCA, Brazil in 2009. 2. Guerra MR, Gallo CVM, Mendonc¸a GAS. Risk of cancer in Brazil: trends and recent epidemiological studies. Rev Cancer. Brazil. 2005;51:227-34.

2138

CLINICS 2011;66(12):2133-2139

Dietary effects of medicinal fungus on breast cancer Novaes MRCG et al. 39. Petrova RD, Mahajna J, Reznick AZ, Wasser SP, Denchev CM, Nevo E. Fungal substantiate modulators of NF-kappaB activation pathway. Mol Biol Rep. 2007;34:145-54, doi: 10.1007/s11033-006-9027-5. 40. Gu YH, Leonard J. In vitro effects on proliferation, apoptosis and colony inhibition in ER-dependent and ER-independent human breast cancer cells by selected mushroom species. Oncol Rep. 2006;15:417-23. 41. Fang N, Li Q, Yu S, Zhang J, He L, Ronis MJ, et al. Inhibition of growth and induction of apoptosis in human cancer cell lines by an ethyl acetate fraction from shiitake mushrooms. J Altern Complement Med. 2006;12:125-32, doi: 10.1089/acm.2006.12.125. 42. Jedinak A, Sliva D. Pleorotus ostreatus inhibits proliferation of human breast cancer and colon cancer cells through p53-dependent as well as p53-independent pathway. Int J Oncol. 2008;33:1307-13. 43. Jiang J, Slı´vova V, Harvey K. Valachovicova T, Sliva D. Ganoderma lucidum suppresses growth of breast cancer cells though the inhibition of Akt/NF- Kappa b signaling. Nutr Cancer. 2004;49:209-16, doi: 10. 1207/s15327914nc4902_13. 44. Talorete TP, Isoda H, Maekawa T. Agaricus blazei (class Basidiomycotina) aqueous extract enhances the expression of c-Jun protein in MCF-7 cells. J Agric Food Chem. 2002;50:5162-6, doi: 10.1021/jf011566p. 45. Vetvicka V, Vashisht A, Saraswat-Ohri S, Vetvickova J. Immunological effects of yeast and mushroom derived beta-glucans. J Med Food. 2008;11:615-22, doi: 10.1089/jmf.2007.0588. 46. Israilides C, Klets D, Arapoglou D, Philippousis A, Pratsinis H, Ebringero´va A, et al. In vitro cytostatic and immunomodulatory properties of the medicinal mushroom Lentinus edodes. Phytomedicine. 2008;15:512-9, doi: 10.1016/j.phymed.2007.11.029. 47. Sliva D, Jedinak A, Kawasaki J, Harvey K, Shirov V. Phellinus linteus suppresses growth, angiogenesis and invasive behaviour of breast cancer cells through the inhibition of AKT signalling. Br J Cancer. 2008;98:134856, doi: 10.1038/sj.bjc.6604319. 48. Gennari JL, Veronesi R, Gennari MS. Edible mushroom Agaricus sylvaticus used as therapeutics complement in a patient with breast cancer and lung metastasis. Rev Bras Med. 2002;59:537-8. 49. See D, Mason S, Roshan R. Increased tumor necrosis factor alpha (TNFalpha) and natural killer cell (NK) function using an integrative approach in late stage cancers. Immunol Invest. 2002;31:137-53, doi: 10. 1081/IMM-120004804.

28. Takaku T, Kimura Y, Okuda H. Isolation of an Antitumor Compound from Agaricus blazei Murill and Its Mechanism of Action. J. Nutr. 2001;131:1409-13. 29. Zhang D, Jiang P, Xu Q, Zhang X. Arginine and Glutamate-rich 1 (ARGLU1) Interacts with Mediator Subunit 1 (MED1) and Is Required for Estrogen Receptor-mediated Gene Transcription and Breast Cancer Cell Growth. J Biol Chem. 2011;286:17746-54, doi: 10.1074/jbc.M110. 206029. 30. Tada N, Horibe T, Haramoto M, Ohara K, Kohno M, Kawakami K. A single replacement of histidine to arginine in EGFR-lytic hybrid peptide demonstrates the improved anticancer activity. Biochem Biophys Res Commun. 2011;407:383-8, doi: 10.1016/j.bbrc.2011.03.030. 31. Fortes RC, Melo AL, Recoˆva VL, Novaes MRCG. Alterac¸o˜es lipı´dicas em pacientes com caˆncer colorretal em fase po´s-operato´ria: ensaio clı´nico randomizado e duplo-cego com fungos Agaricus sylvaticus. Rev bras. colo-proctol. 2008;28:281-8. 32. Fortes RC, Novaes MRCG. Effects of dietary supplementation with Agaricales mushrooms and other fungi in medicinal therapy against cancer. Revista Brasileira de Cancerologia. 2006;52:363-71. 33. Takimoto H, Wakita D, Kawaguchi K, Kumazawa Y. Potentiation of cytotoxic activity in naı¨ve and tumor-bearing mice by oral administration of hot-water extracts from Agaricus brazei fruiting bodies. Biol Pharm Bull. 2004;27:404-6, doi: 10.1248/bpb.27.404. 34. Zhao C, Sun H, Tong X, Qi Y. An antitumour lectin from the edible mushroom Agrocybe aegerita. Biochem J. 2003;374:321–7, doi: 10.1042/ BJ20030300. 35. Chu KK, Ho SS, Chow AH. Coriolus versicolor: a medicinal mushroom with promising immunotherapeutic values. J Clin Pharmacol. 2002;42:976-84. 36. Chen S, Oh SR, Phung S, Hur G, Ye JJ, Kwok SL, et al. Anti-aromatase activity of phytochemicals in white button mushrooms (Agaricus bisporus). Cancer Res. 2006;66:12026-34, doi: 10.1158/0008-5472.CAN-06-2206. 37. Grube BJ, Eng ET, Kao YC, Kwon A, Chen S. White button mushroom phytochemicals inhibit aromatase activity and breast cancer cell proliferation. Journal of Nutrition. 2001;131:3288-93. 38. Thyagarajan A, Zhu J, Sliva D. Combined effect of green tea and Ganoderma lucidum on invasive behavior of breast cancer cells. Int J Oncol. 2007;30:963-9.

2139

CLINICS 2011;66(12):2141-2149

DOI:10.1590/S1807-59322011001200022

REVIEW

Should we definitively abandon prophylaxis for patent ductus arteriosus in preterm new-borns? Vassilios Fanos, Michele Pusceddu, Angelica Dessı`, Maria Antonietta Marcialis Neonatal Intensive Care Unit, Puericulture Institute And Neonatal Section, AOU University of Cagliari, Italy.

Although the prophylactic administration of indomethacin in extremely low-birth weight infants reduces the frequency of patent ductus arteriosus and severe intraventricular hemorrhage, it does not appear to provide any long-term benefit in terms of survival without neurosensory and cognitive outcomes. Considering the increased drug-induced reduction in renal, intestinal, and cerebral blood flow, the use of prophylaxis cannot be routinely recommended in preterm neonates. However, a better understanding of the genetic background of each infant may allow for individualized prophylaxis using NSAIDs and metabolomics. KEYWORDS: Ductus Arteriosus, Preterm Newborn, Prophilaxis, Indometacin, NSAIDs. Fanos V, Pusceddu M, Dessı` A, Marcialis MA. Should we definitively abandon prophylaxis for patent ductus arteriosus in preterm new-borns? Clinics. 2011;66(12):2141-2149. Received for publication on June 7, 2011; First review completed on July 5, 2011; Accepted for publication on August 12, 2011 E-mail: baire@unica.it Tel.: +390706093403

prolonged neonatal respiratory distress, intraventricular hemorrhage (IVH), necrotizing enterocolitis (NEC), bronchopulmonary dysplasia (BPD), and death.7,8 The incidence of PDA in full-term neonates has been estimated to be 57 per 100,000 live births,3 whereas persistence of the duct occurs in approximately one-third of premature neonates with a birth weight between 501 and 1,500 grams.9 In neonates weighing less than 1,000 g, it has been reported that 55% develop a symptomatic PDA requiring pharmacological treatment.10,11 The spontaneous closure of a PDA takes place between the second and sixth day of life in 34% of extremely low birth weight (ELBW) neonates12 and within the first year of life in the majority of very low birth weight (VLBW) neonates. Postnatal ductal closure is regulated by exposure to oxygen and vasodilators. The ensuing vascular response, which is mediated by potassium channels, voltage-gated calcium channels, mitochondria-derived reactive oxygen species, and endothelin 1, depends on the gestational age. Platelets are recruited to the luminal surface of the DA during closure and are hypothesized to promote the thrombotic sealing of the constricted DA.13 It has been estimated that 60% to 70% of preterm infants less than 28 gestational weeks receive medical or surgical therapy for a PDA, usually with the intention to prevent respiratory decompensation, heart failure, IVH/brain injury, BPD, NEC, and death.14,15 The natural history of PDA in premature infants remains unknown, and its management is highly controversial. The following four strategies are most often used in the treatment of PDA: 1) symptomatic treatment when the duct is deemed hemodynamically relevant by clinical or ultrasonographic evaluation;16 2) targeted treatment of ducts echocardiographically detected in the first 24 hours of life but before a significant left-right shunt has developed;17 3)

INTRODUCTION Botallo’s duct is a blood vessel that connects the pulmonary artery to the aorta during fetal development, and our knowledge of the pathophysiology of this duct is increasing steadily.1 Clinically, ‘patent DA’ (ductus arteriosus) is often used synonymously with ‘persistent DA’, and both are frequently abbreviated as ‘PDA’ even though they differ in morphology and therapeutic implications.2,3 The term ‘patent DA’ is an umbrella term that is used for all situations in which the DA is either physiologically or pathologically open. In this review, we will use the abbreviation ‘PDA’ to refer to patent ductus arteriosus. A patent ductus arteriosus (PDA) is a physiologic shunt in healthy full-term and preterm infants that tipically presents during the first three days of life.4 PDA in preterm infants may have clinical consequences depending on the degree of left-to-right shunting. The increase in pulmonary blood flow in premature infants may lead to pulmonary edema, loss of lung compliance, and deterioration of the respiratory status, which ultimately lead to chronic lung disease (CLD) and an increased morbidity and mortality.5 A shunting of blood between the aorta and pulmonary artery, which is favored by the postnatal decrease in pulmonary vascular resistance,6 causes the hemodynamic and clinical consequences of PDA. The shunt also modifies the distribution of blood to the lungs and other organs and may contribute to an increased risk of serious and

2141

Should we definitively abandon prophylaxis? Fanos V et al.

CLINICS 2011;66(12):2141-2149

conservative management with only ventilation adjustments and fluid restriction; 4) a prophylactic approach, which medically or surgically treats all neonates at risk for PDA in the first 24 hours of life.18 Despite numerous studies, some controversies regarding PDA prevention remains. The prophylactic use of indomethacin, whether the DA is patent or not, is the beststudied regimen. The timing of this approach is important (it is given very early, within the first 24 hours) because its effectiveness clearly decreases with increasing postnatal age; however, this treatment involves the risks associated with exposing infants to drugs that they might not need. Importantly, prophylactic trials can examine the association between PDA and the incidence of IVH or pulmonary hemorrhage, which typically occurs within the first moments of life, whereas symptomatic trials cannot examine this relationship. Conversely, symptomatic trials can examine the relationship between PDA and NEC, which occurs later in postnatal life, whereas prophylactic trials would be unlikely to do so.19,20 In this paper, we will only address the prophylactic approach for PDA management.

In this study, 1,202 ELBW infants (500–999 g) were randomly assigned to receive either indomethacin (0.1 mg per kilogram of body weight) or placebo intravenously once daily for three days soon after birth. The primary outcomes investigated were death, cerebral palsy, cognitive delay, deafness, and blindness at a corrected age of 18 months. The secondary long-term outcomes were hydrocephalus necessitating placement of a shunt, seizure disorder, and microcephaly within the same time frame. Secondary short-term outcomes were PDA, pulmonary hemorrhage, chronic lung disease, ultrasonographic evidence of intracranial abnormalities, necrotizing enterocolitis, and retinopathy. Of the 574 infants with primary outcome data who received indomethacin prophylaxis, 271 (47%) died or survived with impairments, as compared with 261 of the 569 infants (46%) assigned to placebo (odds ratio, 1.1; 95 percent confidence interval, 0.8 to 1.4; p = 0.61). Indomethacin reduced the incidence of PDA (24% vs. 50% in the placebo group; odds ratio, 0.3; p,0.001) and severe PVH and IVH (9%, vs. 13% in the placebo group; odds ratio, 0.6; p = 0.02). No other outcomes were altered by the prophylactic administration of indomethacin. However, indomethacin prophylaxis increased the need for supplemental oxygen from day 3 to at least day 7 of life. Indomethacin also decreased the urine volume during the first four days of life and reduced weight loss by the end of the first week. These papers concluded that in ELBW infants, indomethacin prophylaxis does not improve the survival rate without neurosensory impairment at 18 months, despite the fact that it reduces the frequency of PDA (NNT 4) and severe PVH and IVH. The reduction in IVH can be explained by the maturation of the cerebral vascular basement membrane, improvement in cerebrovascular self-regulation and anti-inflammatory effects.27,28 More recent data detailing reduced germinal matrix hemorrhaging via inhibition of angiogenesis indirectly support this hypothesis.29 In a follow-up to the TIPP study, 999 ELBW were given indomethacin prophylaxis. The treatment did not prevent BPD, although it reduced the frequency of PDA.30 The frequency of CLD was higher, which may be associated with the reduced weight loss, the greater need for oxygen and perhaps the increase in extracellular liquid at the pulmonary level. Reducing the frequency of PDA may be important for those children requiring surgical closure, although twenty prophylactic treatments with indomethacin are required to avoid surgical treatment. In another follow-up to the TIPP study that was continued up to 18 months of life, prophylactic indomethacin reduced the rate of early serious pulmonary hemorrhage because of its effects on PDA. However, prophylactic indomethacin was less effective in preventing serious pulmonary hemorrhages that occur after the first week of life.31 Currently, the main limitations of the TIPP trial are methodological concerns, such as the use of composite outcomes and a lack of statistical power. Another important study was published by Vohr.32 Their cohort consisted of 328 VLBW (birth weight of 600–1,250 g) infants who were enrolled in a low-dose, prophylactic indomethacin prevention trial and IVH negative at six postnatal hours.

PROPHYLACTIC USE OF INDOMETHACIN Indomethacin is used prophylactically to close the PDA before hemodynamic distress occurs, which has been associated with an increased morbidity and mortality, without the need for screening or echocardiographic surveillance. This approach exposes a large number of neonates, in whom the duct would close spontaneously, to a pharmacologic treatment that is not without risk. Intravenous indomethacin, a non-selective cyclooxygenase inhibitor, is the standard pharmacological treatment for PDA in preterm neonates and has a reported effectiveness of 66–80%.21-23 Since the 1980s, several risk-benefit studies have been conducted to evaluate the intravenous administration of indomethacin for prophylactic treatment of PDA. The first small, controlled, randomized trials suggested that early prophylaxis (i.e., within the first 24 hours) with indomethacin reduced the incidence of serious IVH. Interestingly, a significant increase in the use of indomethacin prophylaxis occurred after the Ment et al. trial was published; however, a significant decrease in the use of indomethacin prophylaxis followed the TIPP trial.24 In 1994, Ment et al.25 was the first to publish a prospective, randomized, placebo-controlled trial to investigate whether low-dose indomethacin (0.1 mg/kg intravenously at 6 to 12 postnatal hours and every 24 hours for two more doses) would lower the incidence and severity of IVH. The authors enrolled 431 neonates with a birth weight of 600 to 1,250 g and no evidence of IVH at 6 to 11 hours of age. Serial cranial ultrasounds and echocardiograms were performed. Within the first five days, 25 (12%) indomethacin-treated and 40 (18%) placebo-treated neonates developed IVH (p = 0.03, trend test). However, only one indomethacin-treated patient experienced grade 4 IVH versus 10 placebo-treated neonates (p = 0.01). In 2001, Schmidt26 published the results of another largescale, controlled, randomized trial, the Trial of Indomethacin Prophylaxis in Preterm (TIPP), that evaluated the long-term effects of indomethacin on motor, sensory and cognitive outcomes.

2142

CLINICS 2011;66(12):2141-2149

Should we definitively abandon prophylaxis? Fanos V et al.

but there was no effect on reading. Finally, newborns given indomethacin prophylaxis at birth had better connectivity between specific areas of the two hemispheres (from the right BA 40 and BA 44-45 to the left BA 22). However, indomethacin did not affect the intellectual function of children who were born preterm.41,42 The only major side effect of indomethacin reported in the 2010 Cochrane review was the increased incidence of oliguria, but it was not associated with any documented kidney damage. In the same review, no differences in the incidence of NEC or excessive bleeding were demonstrated. However, there were several side effects following the use of indomethacin demonstrated that raise serious concerns, including a reduction in cerebral blood flow,27,43,44 the volume of blood delivered to the brain and the release of brain tissue oxygen;45 oliguria and transitory kidney insufficiency;46,21-23 necrotizing enterocolitis; isolated intestinal perforation; and gastrointestinal hemorrhage.21,47 It is important to note that administering furosemide before each indomethacin dose resulted in a significant increase in the serum creatinine level and hyponatremia without increasing urine output.48 Although most of the included studies were high quality, the drug dosage varied from one study to another, and the patient population was not homogeneous in terms of weight or gestational age. Some studies included case histories that occurred before the use of prenatal steroids or endotracheal surfactants was widespread. Furthermore, in each study, some patients in the control group were contaminated (crossed-over) because they had received indomethacin outside the limits of the study.5 Interestingly, some authors found that the timing of the first dose of indomethacin was significantly associated with the closure rate and that early administration reduced the need for surgical ligation. Up to 85.2% of DAs closed if the first dose of indomethacin was administered within 24 hours of birth; however, this rate decreased to 48.1% when treatment was started 72 hours or later after birth. The corresponding rates for surgical ligation were 3.7% and 25.9%, respectively.49 In conclusion, various clinical trials have demonstrated the effectiveness of indomethacin prophylaxis in closing Botalloâ&#x20AC;&#x2122;s duct, but none have answered the fundamental question of whether the prophylactic closure improved the outcome. Prophylaxis does not appear to influence the development of CLD, septicemia, ROP or mortality. Although prophylaxis is associated with a reduction in serious IVHs, an important predictor of long-term neurological outcome, why prophylaxis does not influence longterm neuromotor outcomes is not known. In an observational study, a longer duration of indomethacin exposure was associated with less white matter injury in infants delivered before 28 weeks of gestation.50 In a study by Madan,51 29% of 881 ELBW patients received indomethacin prophylaxis within the first 24 hours of life. The authors found that prophylaxis had no effect on outcomes except for a borderline increase in NEC frequency in those subjects who received prophylaxis and indomethacin therapy. In a recent study, the indomethacin prophylaxis was directed by echocardiography.52 Recently, the prophylactic administration of indomethacin in extremely premature infants (i.e., those born between 23 and 24 weeks of gestation) decreased the incidence of symptomatic PDA without increasing the incidence of adverse effects.53

The cohort was divided into the following four subgroups for analysis: indomethacin plus IVH, indomethacin without IVH, saline plus IVH, and saline without IVH. The children were evaluated prospectively at eight years old. Children in both IVH groups had more cerebral palsy and hearing impairment as well as lower daily living skills scores, IQ scores, and vocabulary, reading and mathematics achievement test scores. Additionally, these children had greater educational resource needs. Logistic regression analyses showed that grade 3 to 4 IVH, periventricular leukomalacia and/or ventriculomegaly, male gender, maternal education, and the language spoken at home contributed to the outcomes. The authors concluded that although biological factors contribute significantly to school-related outcomes in VLBW survivors, social and environmental factors are also important contributors. Importantly, no effects of indomethacin or gestational age were identified in this study. Cordero et al.33 compared the clinical responses of ELBW infants to indomethacin prophylaxis to that of other infants who were managed with indomethacin or surgical treatment only after a symptomatic PDA was detected. The study was a retrospective cohort investigation of 167 ELBW infants who received indomethacin prophylaxis (study) and 167 ELBW infants treated after detecting a symptomatic PDA (control) who were matched by year of birth (1999 to 2006), birth weight, gestational age (GA) and gender. Indomethacin prophylaxis did not show any advantages over early treatment for managing a symptomatic PDA in ELBW infants. The incidence of IVH was the same in the newborns receiving indomethacin prophylaxis and those in the control group. The use of indomethacin to prevent PDA has been demonstrated to reduce the incidence of a symptomatic duct, the need for surgical closure and the occurrence of pulmonary hemorrhage.34,35 However, whether this reduction is significant has been controversial.36 A recent meta-analysis of 19 studies in Cochrane (involving 2,872 preterm infants) that also included the trials by Ment and Schmidt discussed above, confirmed that prophylactic indomethacin has short-term benefits for preterm infants, including a reduction in the incidence of symptomatic PDA, the need for surgical PDA ligation, and severe IVH. However, there was no evidence of its effect on mortality or neurodevelopment.5 Four neonates must be treated to close one DA (i.e., four is the number needed to treat) and twenty to avoid IVH. The same number 20 is needed to avoid surgical closure and pulmonary hemorrhage, and 25 are required to avoid a periventricular leukomalacia. Unfortunately, there was no effect on mortality or the long-term neurological outcomes. However, prophylactic indomethacin does not reduce the incidence of pneumothorax, the duration of ventilation, the duration of oxygen therapy or the incidence of CLD (at 28 days or 36 weeks). CLD, brain injury and ROP were predictive factors of late death or neurosensory impairment in the follow-up to the TIPP study.37 There are recent data on the long-term alterations that are observed at school age in preterm children who were treated with indomethacin or saline.38,39 At 12 years of age, those children who had received indomethacin prophylaxis had an increased amount of gray matter in the left inferior parietal lobe, which is responsible for phonologic processes. Males had better phonological scores than saline-treated males.40 Again, newborns given indomethacin prophylaxis had greater parenchyma in the left lingual lobe at 8 years,

2143

Should we definitively abandon prophylaxis? Fanos V et al.

CLINICS 2011;66(12):2141-2149

Based on the current clinical data, there are no benefits and possibly some harm with both the early use of ibuprofen as either prophylaxis or treatment in the first 24 hours of life17,66 (e.g., pulmonary hypertension)67-69 and prolonged courses of indomethacin (e.g., NEC).16 Ibuprofen therapy for PDA closure in preterm baboon neonates was not associated with any increased risk of neuropathology or alterations in brain growth and development.70 Treatment with ibuprofen is safer than indomethacin because there is a decreased risk of renal failure, thrombocytopenia, and hyponatremia with ibuprofen.71 Renal safety should be emphasized because this is a major consideration in choosing ibuprofen instead of indomethacin for early treatment. There is sufficient evidence to suggest that ibuprofen, at the currently proposed dosing regimen, has an efficacy similar to that of indomethacin but is better tolerated by the neonatal kidney when used to treat established PDA.72 This finding has been also observed in animals. In suckling rats, indomethacin suppressed PGE2 and COX-2 expression and increased PGF2 expression, whereas ibuprofen increased COX-2 and angiotensin II expression. Although both NSAIDs suppressed 6-ketoPGF1 and TxB2 expression in suckling rats, the effect was sustained in weanling rats with indomethacin. Thus, indomethacin exhibits more potent suppressive effects on the expression of renal COX-2 and vasodilator prostanoids, which are important regulators of renal development and function. These long-term, sustained effects may partly explain why indomethacin has more severe adverse renal effects than ibuprofen when administered early in postnatal life.73 Based on our personal experience,75-80 although ibuprofen is less nephrotoxic than indomethacin, it may still have adverse renal effects, even when administrated orally.73 These negative renal effects are only partially compensated by the protection against oxidative stress.81 A recent paper by Vieux has confirmed our findings.82 They found that ibuprofen-induced oligo-anuria is not associated with a change in AQP2 activity and that ibuprofen does not affect AQP2 activity during the first month of life in very preterm neonates.83 This is in apparent contrast with the findings from a long-term renal follow-up of premature infants with and without perinatal indomethacin exposure. In an older study,84 perinatal indomethacin did not affect longterm renal growth, morphology or function in children born before completing 33 weeks of gestation. However, in this study, the duration of umbilical artery catheterization, furosemide treatment and assisted ventilation were associated with the later renal structural and functional anomalies. Similar results have been obtained by other investigators.85 Therefore, prophylaxis unnecessarily exposes infants to a drug with worrisome renal side effects without conferring any significant short-term benefits. Prophylactic ibuprofen treatment is not recommended. Ibuprofen prophylaxis is associated with a higher incidence of CLD. The conclusions to date do not support the use of ibuprofen in PDA prophylaxis.17,66

In a study conducted in Asia, the incidence of IVH and other episodes of bleeding were significantly higher than in the controls, and the study was stopped early.54 Lower platelet counts have been associated with a higher failure rate of indomethacin-induced PDA closure in human newborns, which is pertinent to clinical practice.55 Additionally, administering cortisol to immature fetal lambs in utero results in a ductus that responds to oxygen and prostaglandin inhibition similar to that of a mature fetus, which explains the decreased incidence of PDA in preterm humans who are born to mothers who received antenatal corticosteroids.56,14 Two commentary articles in the Journal of Pediatrics emphasized that the consequences of treatment for PDA, including the pharmacological side effects and surgery, might be more harmful to the infant than the PDA itself.57,19 Moreover, there has been concern about the use of NSAIDs and their long-term renal effects in ELBW infants. In fact, ELBW infants treated with NSAIDs and aminoglycosides have been found to have a renal volume less than the 10th percentile at 7 years of age in 40% of cases, which is associated with a1 microglobinuria.58 Recently, Evans has adopted a new, targeted refinement of prophylactic indomethacin, which consists of giving indomethacin for early post-natal duct constriction assessed echocardiographically. The author has also cited the ongoing Australian DETECT trial, which includes infants born before 29 weeks of gestation who, before being treated (within the first 12 hours and, ideally, in the first 6 hours), were examined using an echocardiogram to assess the duct diameter. In this trial, preterm infants with well-constricted ducts were not treated.59

PROPHYLACTIC USE OF IBUPROFEN Preliminary experimental and clinical studies60,61 have shown that ibuprofen, another cyclooxygenase inhibitor, effectively closes the PDA without reducing the blood flow to the brain 45,62 or influencing circulation in the intestines63 or kidneys.64 Van Overmeire performed a randomized, placebo-controlled trial to determine whether ibuprofen could reduce class III and IV IVH in patients with a gestational age of 24 to 30 weeks. This study showed that a significant reduction in the incidence of PDA (16%) was associated with a lack of differences in the primary outcome of serious IVH (ibuprofen does not reduce the frequency of IVH). Additionally, a lack of differences was not seen in any secondary outcomes, including mortality, PVL, combined CLD outcomes or death at 36 weeks. In those receiving prophylaxis, there was a significant increase in oliguria or an increase in creatinine when compared with the group that did not receive prophylactic treatment.65 A recent meta-analysis66 of prophylactic ibuprofen for PDA showed a reduced incidence of PDA, a reduced need for symptomatic treatment with cyclooxygenase inhibitors and a reduced need for surgical ligation. No advantage in the short-term outcomes was demonstrated; no statistically significant difference in the mortality or the incidence of BPD, NEC, gastrointestinal hemorrhage, intestinal perforation, or ROP was demonstrated between the ibuprofen-treated and placebo groups. There was a statistically significant negative effect on kidney function. In the control group, the PDA closed spontaneously by day three in 58% of the neonates.

PROPHYLACTIC SURGICAL LIGATION The results of only one study that enrolled 84 ELBW infants have been reported. The prophylactic group underwent ductal ligation within 24 hours of life following a pre-specified

2144

CLINICS 2011;66(12):2141-2149

Should we definitively abandon prophylaxis? Fanos V et al.

protocol, whereas the control group received standard care without indomethacin.86 Whereas prophylactic surgical ligation of the PDA did not decrease mortality or BPD in ELBW infants, the incidence of stage II and III NEC was significantly reduced. Based on the current evidence, high rate of spontaneous closure, availability of effective safe medical therapies, and potential short- and long-term complications of surgical ligation, the use of prophylactic surgical ligation is not indicated.87 Recently, a re-examination of this controlled trial by the authors found that prophylactic ligation significantly increased the incidence of BPD (defined as a need for supplemental oxygen at 36 weeks postmenstrual age) and the incidence of mechanical ventilation at 36 weeks. These findings suggest that although surgical prophylactic ductus ligation eliminates the PDA, it may contribute to the problem it is trying to prevent. Experimental studies have been initiated to answer this question.88 Recently, in a study examining premature baboons versus baboons with a persistent PDA, ibuprofen treatment had no effect on the expression of genes that regulate pulmonary inflammation but did increase the expression of alphaENaC, the transepithelial sodium channel that is critical for alveolar water clearance. Although ligation eliminates the PDA, it does not improve pulmonary mechanics or increase the alveolar surface area. In contrast with no intervention, PDA ligation resulted in a significant increase in the expression of genes associated with pulmonary inflammation (e.g., COX-2, TNF-alpha, and CD14) and a significant decrease in alpha-ENaC expression. The authors speculated that these changes may decrease the rate of alveolar fluid clearance and contribute to the lack of improvement in pulmonary mechanics following PDA ligation.89 The last report from the TIPP study reported that surgical closure of a PDA reduced mortality to an almost significant extent. However, neurosensory impairment was also significantly increased by 18 months of age, as were retinopathy of prematurity and BPD.90 These findings are also supported by others.91 Furthermore, it has been shown that there is a general association between any surgery in the neonatal period and neurosensory impairment at five years of age, indicating that surgery and anesthesia might be independent risk factors in VLBW infants.92 Bratlid recently confirmed that the surgical closure of a patent DA in a small premature infant is associated with neurosensory impairment.93 The following adverse events have been reported to be associated with the surgical closure of PDA: recurrent laryngeal nerve damage, chylothorax (thoracic duct injury), pneumothorax, a period of left ventricular dysfunction immediately after ligation, and the development of scoliosis.94-98 Moreover, PDA ligation is sometimes associated with impaired left ventricular systolic performance, which is most likely attributable to altered loading conditions. Neonates weighing 1,000 g or less are at an increased risk of impaired left ventricular systolic performance, which is probably due to maturational differences.99 Finally, it has very recently been confirmed that ligation in preterm neonates has a considerable risk. Total mortality in this vulnerable group of patients was 15%. Moreover, severe complications and post-operative morbidity have been reported.100

In conclusion, the current evidence does not support the use of prophylactic surgical ligation of DAs in preterm infants.101 However, it is vital for clinicians to understand the fluid and cardiovascular changes that occur at birth and during PDA management to gain a better appreciation of the pathologic processes that may influence the clinical course of an affected infant.102

FUTURE DIRECTIONS: THE IMPORTANCE OF GENETIC FACTORS It has been hypothesized that genetic factors play a significant role in the pathophysiology of PDA.103 A retrospective study (1991–2006) from two centers was performed using zygosity data from premature twins born at 36 weeks of gestational age and surviving beyond 36 weeks of postmenstrual age. Data from 333 dizygotic twin pairs and 99 monozygotic twin pairs from two centers (Yale University and the University of Connecticut) were obtained. The conclusion was that preterm PDA is highly familial.103,104 While this is the first study that formally isolated and quantified the overall heritability, other studies have addressed the problem. In a candidate gene study of 141 LBW newborns, Derzbach et al.105 reported that boys with the ‘‘p’’ allele of the estrogen receptor gene PvuII pP polymorphism were at a lower risk for PDA but with a wide CI (OR: 0.24, 95% CI: 0.05–0.97). In another candidate gene study of 153 LBW newborns, Bokodi et al.106 showed that carriers of the interferon gamma (+874) T allele were protected against PDA (OR: 0.43, 95% CI: 0.19–0.97) with a similarly wide CI. Because approximately 30% of infants with PDA do not respond to pharmacologic treatments for closure, some authors have investigated whether single nucleotide polymorphisms (SNPs) in genes that regulate smooth muscle contraction, xenobiotic detoxification, inflammation or other processes are markers for the persistent patency of the DA. Initially, 377 SNPs from 130 genes of interest were evaluated in DNA samples collected from 204 infants with a gestational age of less than 32 weeks. SNPs in the AP-2 beta (TFAP2B) and TNF receptorassociated factor 1 (TRAF1) genes remained significant, both with p-values of 0.005. These data support a genetic contribution to the risk of PDA in preterm infants.107 Genetic polymorphisms in the cytochrome P450 (CYP) family of enzymes can contribute to the pharmacokinetic (PK) variability of drugs. PK variability is observed as a bimodal distribution of extensive metabolizers (EMs) and poor metabolizers (PMs). PK variability may also exist between individuals genotyped as homozygous EMs and heterozygous EMs. This can have implications for drug dosing and the drug response (e.g., the risk of therapeutic failure or drug toxicity), especially for NSAIDs.108 However, CYP2C8 and 2C9 polymorphisms do not appear to be involved in the response of preterm infants to ibuprofen therapy for PDA and cannot be used to optimize the ductal closure rate by modulating the ibuprofen-dosing strategy.109 In contrast, this study reported the role of ethnicity in the interindividual variability of the response to ibuprofen and subsequent PDA closure in preterm infants. Interethnic differences in the neonatal PDA clinical course should be further explored and correlated to ibuprofen pharmacokinetics.109 Additionally, recent studies have reported that three

2145

Should we definitively abandon prophylaxis? Fanos V et al.

CLINICS 2011;66(12):2141-2149

Table 1 - Ten reasons to definitively abandon PDA prophylaxis. 1) The DA closes spontaneously in 60% of patients. 2) Surgical prophylaxis cannot be recommended because it significantly increases the incidence of BPD. 3) Ibuprofen prophylaxis cannot be recommended, as it does not prevent IVH. 4) Routine indomethacin prophylaxis cannot be recommended for the prevention of long-term morbidities and mortality, especially in centers where severe IVH is comparable to the national average and surgical complications are minimal. 5) In Europe, only 5% of neonatologists use prophylaxis (data from a recent review); in the US, 23% use it. 6) The commonly used NSAIDs are associated with short-term (and probably) long-term side effects. 7) Indomethacin prophylaxis unethically exposes newborns who will never have a persistent patent DA to the side effects of drugs. 8) Differences in patient genetics, drug response, ethnicity, gender, history, and biohumoral profiles and procedures in single centers make it extremely difficult to predict the efficacy and safety of prophylaxis. 9) Epigenetic influences, which are not completely understood, may further complicate the scenario. 10) New technologies, such as pharmacogenomics and pharmacometabolomics, will allow the practice of personalized neonatal medicine.

independent risk factors (immature gestation, the absence of antenatal glucocorticoid exposure, and the presence of the rs2817399(A) allele of the gene, TFAP2B) are associated with DAs that fail to close with prostaglandin inhibition. Furthermore, these risk factors affected a common set of genes that increase the risk of persistent PDA after birth. In a study examining the ductus in term, preterm, and glucocorticoid-treated preterm baboon fetuses, it was found that both immature birth and the absence of antenatal glucocorticoids decreased the RNA expression of the calcium- and potassiumchannel genes involved in oxygen-induced constriction and phosphodiesterase genes, which modulate cAMP/cGMP signaling. Furthermore, in a study in which ductus obtained from second trimester human pregnancies were genotyped for TFAP2B polymorphisms, when present, the rs2817399(A) allele was also associated with the decreased expression of calcium- and potassium-channel genes. In contrast, alleles of two other TFAP2B polymorphisms, rs2817419(G) and rs2635727(T), were not correlated with the incidence of PDA after birth and had no effect on RNA expression. Three calcium- and potassium-channel genes (CACNA1G/ alpha1G, CACNB 2/CaL-beta2, and KCNA2/Kv1.2) were similarly affected by each of the risk factors associated with PDA. The authors speculated that these channels may play a significant role in closing the preterm ductus following prostaglandin inhibition and may be potential targets for future pharmacologic manipulations.110 Therefore, knowing the genes responsible for maintaining the balance between patency and closure and the related epigenetic factors is an important step toward developing pharmacogenetic strategies tailored to individual genomes. A better understanding of the genetic background of this developmental process can help develop new strategies to manipulate the DA in premature infants, neonates with duct-dependent cardiac anomalies, and patients with syndromic and non-syndromic PDA.104 The practical message is that, if these data are true, we must individualize NSAID treatment and prophylaxis.112 Metabolomics may provide the answer to this question.112,113 In fact, a metabolic signature for PDA in preterm infants has been identified using an NMR-based metabolomic analysis of urine.113 By collecting the first urine at birth, it is possible to anticipate the persistence of PDA at day 4.

Currently, it is unclear whether and when a conservative, pharmacologic or surgical approach for PDA closure may be advantageous,13 and this is also the opinion of the authors.118,119 Based on the current literature, we can offer some suggestions regarding prophylaxis. Al Faleh, who supports the prophylactic use of indomethacin, has recently hypothesized that the results of the TIPP study were influenced by fluid overload and pulmonary edema. In his opinion, fluid restriction might decrease the rate of BPD in ELBW infants who receive indomethacin prophylaxis.120 Prophylaxis with ibuprofen cannot be recommended, as it does not prevent IVH; it is important to avoid ibuprofen in infants in whom the DA may spontaneously close. Routine prophylaxis with indomethacin cannot be recommended for the prevention of long-term morbidities and mortality, especially in centers where severe IVH is comparable to the national average and surgical complications are minimal.120 Table 1 presents ten reasons for definitively abandoning PDA prophylaxis. In conclusion, because they expose a significant number of preterm infants who will never develop PDA (40–60%) to potential severe, drug-related complications, all types of PDA prophylaxis, including indomethacin, cannot be considered a ‘standard of care’ until their long-term efficacy is proven in clinical trials.

AUTHOR CONTRIBUTIONS Fanos V had the original idea and wrote the manuscript together with Marcialis MA. Pusceddu M and Dessi A collected all the references, compared all the papers, and had minor participation in the writing of the manuscript.

REFERENCES 1. Gournay V. The ductus arteriosus: Physiology, regulation, and functional and congenital anomalies. Arch Cardiovasc Dis, 2010, doi: 10.1016/j.acvd.2010.06.006. 2. Gittenberger-de Groot AC. Persistent ductus arteriosus: most probably a primary congenital malformation. Br Heart J. 1977;39:610–8, doi: 10. 1136/hrt.39.6.610. 3. Chuaqui B, Piwonka G, Farru´ O. The wall in persistent ductus arteriosus (in German). Virchows Arch A Pathol Anat Histol. 1977;372:315–24, doi: 10.1007/BF00432406. 4. Skinner J. Diagnosis of patent ductus arteriosus. Semin Neonatol. 2001;6:49–61, doi: 10.1053/siny.2000.0037. 5. Fowlie PW, Davis PG, McGuire W. Prophylactic intravenous indomethacin for preventing mortality and morbidity in preterm infants. Cochrane Database of Systematic Reviews. 2010;7:CD000174, doi: 10.1002/14651858.CD000174.pub2 6. Evans N, Kluckow M. Early determinants of right and left ventricular output in ventilated preterm infants. Archives of Disease in Childhood. Fetal and Neonatal Edition. 1996;74:F88-94, doi: 10.1136/fn.74.2.F88.

CONCLUSIONS There has been much debate in recent years as to when a PDA is pathologic and when closure is indicated. There is a pressing need to better understand the benefits and risks of all PDA treatments.114-122

2146

CLINICS 2011;66(12):2141-2149

Should we definitively abandon prophylaxis? Fanos V et al.

7. Brown ER. Increased risk of bronchopulmonary dysplasia in infants with patent ductus arteriosus. J Pediatr. 1979;95:865-6, doi: 10.1016/ S0022-3476(79)80454-0. 8. Lipman B, Server GA, Brazy JE. Abnormal cerebral haemodynamics in preterm infants with patent ductus arteriosus. Pediatrics. 1982;69:77881. 9. Investigators of the Vermont-Oxford Trials Network Database Project. The Vermont- Oxford Trials Network: very low birth weight outcomes for 1990. Pediatrics. 1993;91:540–5. 10. Koch J, Hensley G, Roy L, Brown S, Ramaciotti C, Rosenfeld CR. Prevalence of spontaneous closure of the ductus arteriosus in neonates at a birth weight of 1000 grams or less. Pediatrics. 2006;117:1113–21, doi: 10.1542/peds.2005-1528. 11. Richards J, Johnson A, Fox G, Campbell M. A second course of ibuprofen is effective in the closure of a clinically significant PDA in ELBW infants. Pediatrics. 2009;124:e287-e293, doi: 10.1542/peds.20082232. 12. Herrman K, Bose C, Lewis K, Laughon M. Spontaneous closure of the patent ductus arteriosus in very low birth weight infants following discharge from the neonatal unit. Arch Dis Child Fetal Neonatal Ed. 2009;94:F48–F50. 13. Hamrick SE, Hansmann G. Patent ductus arteriosus of the preterm infant. Pediatrics. 2010;125:1020-30, doi: 10.1542/peds.2009-3506. 14. Clyman RI. Ibuprofen and patent ductus arteriosus. N Engl J Med. 2000;343:728–30, doi: 10.1056/NEJM200009073431009. 15. Knight DB. The treatment of patent ductus arteriosus in preterm infants. A review and overview of randomized trials. Seminars in Neonatology. 2001;6:63-73. 16. Herrera C, Holberton J, Davis P. Prolonged versus short course of indomethacin for the treatment of patent ductus arteriosus in preterm infants. Cochrane Database of Systematic Reviews. 2007;2:CD003480, doi: 10.1002/14651858.CD003480.pub3 17. Ohlsson A, Walia R, Shah S. Ibuprofen for the treatment of patent ductus arteriosus in preterm and/or low birth weight infants. Cochrane Database of Systematic Reviews. 2010;4:CD003481, doi: 10.1002/ 14651858.CD003481.pub4 18. Golombek SG, Sola A, Baquero H, Borbonet D, Caban˜as F, Fajardo C, et al. Primer Grupo de Consenso Clı´nico SIBEN. [First SIBEN clinical consensus: diagnostic and therapeutic approach to patent ductus arteriosus in premature newborns]. An Pediatr (Barc). 2008;69:454-81, doi: 10.1157/13128002. 19. Clyman RI, Chorne N. Patent ductus arteriosus: evidence for and against treatment. J Pediatr. 2007;150:216–9, doi: 10.1016/j.jpeds.2006. 12.048. 20. Evans N. Patent ductus arteriosus and effects of low oxygen saturation limits. J Perinatol. 2009;29:529-30, doi: 10.1038/jp.2009.63. 21. Gersony WM, Peckham GJ, Ellison RC, Miettinen OS, Nadas AS. Effects of Indomethacin in premature infants with patent ductus arteriosus: results of a national collaborative study. Journal of Pediatrics. 1983;102:895–906, doi: 10.1016/S0022-3476(83)80022-5. 22. Van Overmeire B, Smets K, Lecoutere D, Van De Broek H,Weyler J, De Groote K, et al. A comparison of ibuprofen and indomethacin for closure of patent ductus arteriosus. New England Journal of Medicine. 2000;334:674–81, doi: 10.1056/NEJM200009073431001. 23. Lago P, Bettiol T, Salvadori S, Pitassi I, Vianello A, Chiandetti L, et al. Safety and efficacy of ibuprofen versus indomethacin in preterm infants treated for patent ductus arteriosus: a randomised controlled trial. European Journal of Pediatrics. 2002;161:202–7, doi: 10.1007/s00431002-0915-y. 24. Clyman RI, Saha S, Jobe A, Oh W. Indomethacin prophylaxis for preterm infants: the impact of 2 multicentered randomized controlled trials on clinical practice. J Pediatr. 2007;150:46-50.e2, doi: 10.1016/j. jpeds.2006.09.001. 25. Ment LR, Oh W, Ehrenkranz RA, Philip AG, Vohr B, Allan W, et al. Low-dose indomethacin and prevention of intraventricular hemorrhage: a multicenter randomized trial. Pediatrics. 1994;93:543-50. 26. Schmidt B, Davis P, Moddemann D, Ohlsson A, Roberts R, Saigal S, et al. Long-term effects of indomethacin prophylaxis in extremely low-birthweight infants. NEJM. 2001;344:1966–72, doi: 10.1056/NEJM20010628 3442602. 27. Edwards AD, Wyatt JS, Richardson C, Potter A, Cope M, Delply DT, et al. Effects of indomethacin on cerebral hemodynamics in very preterm infants. Lancet. 1990;335:1491–5, doi: 10.1016/01406736(90)93030-S. 28. Ment LR, Stewart WB, Ardito TA, Huang E, Madri JA. Indomethacin promotes germinal matrix microvessel maturation in the newborn beagle pup. Stroke. 1992;23:1132–7, doi: 10.1161/01.STR.23.8.1132. 29. Ballabh P, Xu H, Hu F, Braun A, Smith K, Rivera A, et al. Angiogenic inhibition reduces germinal matrix hemorrhage. Nat Med. 2007;13:477– 85, doi: 10.1038/nm1558. 30. Schmidt B, Roberts RS, Fanaroff A, Davis P, Kirpalani HM, Nwaesei C, et al. TIPP Investigators. Indomethacin prophylaxis, patent ductus arteriosus, and the risk of bronchopulmonary dysplasia: further

31.

32.

33.

34.

35.

36. 37.

38.

39.

40.

41. 42.

43. 44.

45.

46. 47.

48.

49.

50.

2147

analyses from the Trial of Indomethacin Prophylaxis in Preterms (TIPP). J Pediatr. 2006;148:730-4, doi: 10.1016/j.jpeds.2006.01.047. Alfaleh K, Smyth JA, Roberts RS, Solimano A, Asztalos EV, Schmidt B. Prevention and 18-month outcomes of serious pulmonary hemorrhage in extremely low birth weight infants: results from the trial of indomethacin prophylaxis in preterms. Trial of Indomethacin Prophylaxis in Preterms Investigators. Pediatrics. 2008;121:e233-8, doi: 10.1542/peds.2007-0028. Vohr BR, Allan WC, Westerveld M, Schneider KC, Katz KH, Makuch RW, et al. School-age outcomes of very low birth weight infants in the indomethacin intraventricular hemorrhage prevention trial. Pediatrics. 2003;111:e340-6, doi: 10.1542/peds.111.4.e340. Cordero L, Nankervis CA, Delooze D, Giannone PJ. Indomethacin prophylaxis or expectant treatment of patent ductus arteriosus in extremely low birth weight infants? J Perinatol. 2007;27:158-63, doi: 10. 1038/sj.jp.7211659. Couser RJ, Ferrara TB, Wright GB, Cabalka AK, Schilling CG, Hoekstra RE, et al. Prophylactic Indomethacin therapy in the first twenty four hours of life for the prevention of patent ductus arteriosus in preterm infants treated prophylactically with surfactant in the delivery room. Journal of Pediatrics. 1996;128:631–7, doi: 10.1016/S0022-3476(96)801272. Domanico RS, Waldman JD, Lester LA, McPhillips HA, Catrambone JE, Covert RF. Prophylactic indomethacin reduces the incidence of pulmonary hemorrhage and patent ductus arteriosus in surfactant treated ,1250 g. Pediatric Research. 1994;35:331A. Knight DB, Laughon MM. Evidence for active closure of patent ductus arteriosus in very preterm infents. J Pediatrics. 2008;152:446-7, doi: 10. 1016/j.jpeds.2007.10.016. Schmidt B, Asztalos EV, Roberts RS, Robertson CM, Sauve RS, Whitfield MF. Trial of Indomethacin Prophylaxis in Preterms (TIPP) Investigators. Impact of bronchopulmonary dysplasia, brain injury, and severe retinopathy on the outcome of extremely low-birth-weight infants at 18 months: results from the trial of indomethacin prophylaxis in preterms. JAMA. 2003;289:1124-9, doi: 10.1001/jama.289.9.1124. Gozzo Y, Vohr B, Lacadie C, Hampson M, Katz KH, Maller-Kesselman J, et al. Alterations in neural connectivity in preterm children at school age. Neuroimage. 2009;48:458-63, doi: 10.1016/j.neuroimage.2009.06. 046. Mullen KM, Vohr BR, Katz KH, Schneider KC, Lacadie C, Hampson M, et al. Preterm birth results in alterations in neural connectivity at age 16 years. Neuroimage. 2010;54:2563-70, doi: 10.1016/j.neuroimage.2010.11. 019. Myers EH, Hampson M, Vohr B, Lacadie C, Frost SJ, Pugh KR, et al. Functional connectivity to a right hemisphere language center in prematurely born adolescents. Neuroimage. 2010;51:1445-52, doi: 10. 1016/j.neuroimage.2010.03.049. Luu TM, Ment LR, Schneider KC, Katz KH, Allan WC, Vohr BR. Lasting effects of preterm birth and neonatal brain hemorrhage at 12 years of age. Pediatrics. 2009;123:1037-44, doi: 10.1542/peds.2008-1162. Luu TM, Vohr BR, Schneider KC, Katz KH, Tucker R, Allan WC, et al. Trajectories of receptive language development from 3 to 12 years of age for very preterm children. Pediatrics. 2009;124:333-41, doi: 10.1542/ peds.2008-2587. Van Bel F, Vande Borm, Stijnen T, Baan J, Ruys JH. Cerebral blood flow velocity changes in preterm infants after a single dose of indomethacin: duration of its effect. Pediatrics. 1989;84:802–7. Ohlsson A, Bottu J, Govan J, Ryan ML, Fong K, Myhr T. The effect of indomethacin on cerebral blood flow velocities in very low birth weight neonates with patent ductus arteriosus. Developmental Pharmacology and Therapeutics 1993;20:100–6. Patel J, Roberts I, Azzopardi D, Hamilton P, Edwards AD. Randomised double blind controlled trial comparing the effects of ibuprofen with indomethacin on cerebral hemodynamics in preterm infants with patent ductus arteriosus. Ped Res. 2000;47:36–42, doi: 10.1203/00006450200001000-00009. Betkerur MV, Yeh TF, Miller K, Glasser RJ, Pildes RS. Indomethacin and its effect on renal function and urinary kallikrein excretion in premature infants with patent ductus arteriosus. Pediatrics. 1981;68:99–102. Grosfeld JL, Chaedt M,Molinari F. Increased risk of necrotizing enterocolitis in premature infants with patent ductus arteriosus treated with indomethacin. Annals of Surgery. 1996;224:350–7, doi: 10.1097/ 00000658-199609000-00011. Andriessen P, Struis NC, Niemarkt H, Oetomo SB, Tanke RB, Van Overmeire B. Furosemide in preterm infants treated with indomethacin for patent ductus arteriosus. Acta Paediatr. 2009;98:797-803, doi: 10. 1111/j.1651-2227.2009.01224.x. Yang CZ, Lee J. Factors affecting successful closure of hemodynamically significant patent ductus arteriosus with indomethacin in extremely low birth weight infants. World J Pediatr. 2008;4:91-6, doi: 10.1007/ s12519-008-0017-7. Miller SP, Mayer EE, Clyman RI, Glidden DV, Hamrick SE, Barkovich AJ. Prolonged indomethacin exposure is associated with decreased white matter injury detected with magnetic resonance imaging in

Should we definitively abandon prophylaxis? Fanos V et al.

51.

52. 53.

54. 55. 56.

57. 58.

59. 60.

61.

62.

63.

64.

65.

66. 67. 68.

69. 70.

71. 72. 73.

CLINICS 2011;66(12):2141-2149

premature newborns at 24 to 28 weeks’ gestation at birth. Pediatrics. 2006;117:1626-31, doi: 10.1542/peds.2005-1767. Madan JC, Kendrick D, Hagadorn JI, Frantz ID3rd. National Institute of Child Health and Human Development Neonatal Research Network. Patent ductus arteriosus therapy: impact on neonatal and 18-month outcome. Pediatrics. 2009;123:674-81, doi: 10.1542/peds.2007-2781. Carmo KB, Evans N, Paradisis M. Duration of indomethacin treatment of the preterm patent ductus arteriosus as directed by echocardiography. J Pediatr. 2009;155:819–822.e1, doi: 10.1016/j.jpeds.2009.06.013. Yoshimoto S, Sakai H, Ueda M, Yoshikata M, Mizobuchi M, Nakao H. Prophylactic indomethacin in extremely premature infants between 23 and 24 weeks gestation. Pediatr Int. 2010;52:374-7, doi: 10.1111/j.1442200X.2009.02977.x. Kumar Nair PA, Pai MG, Gazal HA, Da Costa DE, Al Khusaiby SM. Indomethacin prophylaxis for intraventricular hemorrhage in very low birth weight babies. Indian Pediatr. 2004;41:551-8. Boo NY, Mohd-Amin I, Bilkis AA, Yong-Junina F. Predictors of failed closure of patent ductus arteriosus with indomethacin. Singapore Med J. 2006;47:763–8. Clyman RI, Ballard PL, Sniderman S, Ballard RA, Roth R, Heymann MA,et al. Prenatal administration of betamethasone for prevention of patient ductus arteriosus. J Pediatr. 1981;98:123–6, doi: 10.1016/S00223476(81)80557-4. Bose CL, Laughon ML. Treatment to prevent patency of the ductus arteriosus: Beneficial or harmful? J Pediatr. 2006;148:713–4, doi: 10. 1016/j.jpeds.2006.03.015. Zaffanello M, Brugnara M, Bruno C, Franchi B, Talamini G, Guidi G, et al. Renal function and volume of infants born with a very low birthweight: a preliminary cross-sectional study. Acta Paediatr. 2010;99:1192-8, doi: 10.1111/j.1651-2227.2010.01799.x. Evans N. Management of the patent ductus arteriosus in the preterm infant. Paediatrics and Child Health. 2011; 6:247-53, doi: 10.1016/j.paed. 2010.12.003. Varvarigou A, Bardin LC, Beharry K, Chemtob S, Papageorgiu A, Aranda JV. Early ibuprofen administration to patent ductus arteriosus in premature newborn infants. JAMA. 1996;275:539-44, doi: 10.1001/ jama.275.7.539. Van Overmeire B, Follens I, Hartmann S, Creten WL, Van Acker KJ. Treatment of patent ductus arteriosus with ibuprofen. Archives of Disease in Childhood. Fetal and Neonatal Edition. 1997;76:F179-84, doi: 10.1136/fn.76.3.F179. Mosca F, Bray M, Lattanzio M, Fumagalli M, Toscetto C. Comparative evaluation of the effect of indomethacin and ibuprofen on cerebral perfusion and oxygenation in preterm infants with patent ductus arteriosus. Journal of Pediatrics. 1997;131:549-54, doi: 10.1016/S00223476(97)70060-X. Speziale MV, Allen RG, Henderson CR, Barrington KJ, Finer NN. Effects of ibuprofen and indomethacin on the regional circulation in newborn piglets. Biology of the Neonate. 1999;76:242-52, doi: 10.1159/ 000014165. Pezzati M, Vangi V, Biagiotti R, Bertini G, Cianciulli D, Rubaltelli FF. Effects of indomethacin and ibuprofen on mesentric and renal blood flow in preterm infants with patent ductus arteriosus. J Pediatr. 1999;135:733-8, doi: 10.1016/S0022-3476(99)70093-4. Van Overmeire B, Allegaert K, Casaer A, Debauche C, Decaluwe´ W, Jespers A, et al. Prophylactic ibuprofen in premature infants: a multicentre, randomised, double-blind, placebo-controlled trial. Lancet. 2004;364:1945-9, doi: 10.1016/S0140-6736(04)17477-1. Shah SS, Ohlsson A. Ibuprofen for the prevention of patent ductus arteriosus in preterm and/or low birth weight infants. Cochrane Database Syst Rev. 2006;1:CD004213. Gournay V, Savagner C, Thiriez G, Kuster A, Roze JC. Pulmonary hypertension after ibuprofen prophylaxis in very preterm infants. Lancet. 2002;359:1486-8, doi: 10.1016/S0140-6736(02)08424-6. Gournay V, Roze JC, Kuster A, et al. Prophylactic ibuprofen versus placebo in very premature infants: a randomised, doubleblind, placebocontrolled trial. Lancet. 2004;364:1939-44, doi: 10.1016/S01406736(04)17476-X. Mosca F, Bray M, Stucchi I, Fumagalli M. Pulmonary hypertension after ibuprofen prophylaxis in very preterm infants. Lancet. 2002;360:1023–4, doi: 10.1016/S0140-6736(02)11109-3. Loeliger M, Shields A, McCurnin D, Clyman RI, Yoder B, Inder TE, et al. Ibuprofen treatment for closure of patent ductus arteriosus is not associated with increased risk of neuropathology. Pediatr Res. 2010;68:298-302, doi: 10.1203/PDR.0b013e3181ed1864. Linder N, Bello R, Hernandez A, Rosen C, Birk E, Sirota L, et al. Treatment of patent ductus arteriosus: indomethacin or ibuprofen? Am J Perinatol. 2010;27:399-404, doi: 10.1055/s-0029-1243315. Giniger RP, Buffat C, Millet V, Simeoni U. Renal effects of ibuprofen for the treatment of patent ductus arteriosus in premature infants. J Matern Fetal Neonatal Med. 2007;20:275-83, doi: 10.1080/14767050701227950. Hasan J, Beharry KD, Gharraee Z, Stavitsky Y, Abad-Santos P, AbadSantos M, et al. Early postnatal ibuprofen and indomethacin effects in

74.

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

87. 88.

89.

90.

91.

92.

93.

94.

95.

96.

2148

suckling and weanling rat kidneys. Prostaglandins Other Lipid Mediat. 2008;85:81-8, doi: 10.1016/j.prostaglandins.2007.10.006. Erdeve O, Sarici SU, Sari E, Gok F. Oral-ibuprofen-induced acute renal failure in a preterm infant. Pediatr Nephrol. 2008;23:1565-7, doi: 10. 1007/s00467-008-0835-9. Antonucci R, Cuzzolin L, Arceri A, Fanos V. Urinary prostaglandin E2 in the newborn and infant. Prostaglandins Other Lipid Mediat. 2007;84:1-13, doi: 10.1016/j.prostaglandins.2007.04.006. Antonucci R, Cuzzolin L, Arceri A, Dessı` A, Fanos V. Changes in urinary PGE2 after ibuprofen treatment in preterm infants with patent ductus arteriosus. EurJ Clin Pharmacol. 2009;65:223-230, doi: 10.1007/ s00228-008-0586-3. Fanos V, Benini D, Verlato G, Errico G, Cuzzolin L. Efficacy and renal tolerability of ibuprofen vs. indomethacin in preterm infants with patent ductus arteriosus. Fundam Clin Pharmacol. 2005;19:187-193, doi: 10.1111/j.1472-8206.2004.00314.x. Fanos V, Cuzzolin L, Causes and manifestation of nephrotoxicity. In: Shaefer F, Geary F. Clinical Pediatric Nephrology. Mosby Elsevier: Philadelphia 2008. Cuzzolin L, Dal Cere M, Fanos V. NSAID-induced nephrotoxicity from the fetus to the child. Drug Saf. 2001;24:9-18, doi: 10.2165/00002018200124010-00002. Cataldi L, Leone R, Moretti U, et al. Potential risk factors for the development of acute renal failure in preterm newborn infants: a casecontrol study. Arch Dis Child Fetal Neonatal Ed. 2005;90:F514-9. Longini M, Perrone S, Vezzosi P, Proietti F, Marzocchi B, Buonocore G, et al. Isoprostane levels in urine of preterm newborns treated with ibuprofen for patent ductus arteriosus closure. Pediatr Nephrol. 2011;26:105-9, doi: 10.1007/s00467-010-1651-6. Vieux R, Desandes R, Boubred F, Semama D, Guillemin F, Buchweiller MC, et al. Ibuprofen in very preterm infants impairs renal function for the first month of life. Pediatr Nephrol. 2010;25:267-74, doi: 10.1007/ s00467-009-1349-9. Vieux R, Zelenina M, Aperia A, Hascoe¨t JM. The renal adverse effects of ibuprofen are not mediated by AQP2 water channels. Pediatr Nephrol. 2010;25:1277-84, doi: 10.1007/s00467-010-1487-0. Ojala R, Ala-Houhala M, Ahonen S, Harmoinen A, Turjanmaa V, Ikonen S, et al. Renal follow up of premature infants with and without perinatal indomethacin exposure. Arch Dis Child Fetal Neonatal Ed. 2001;84:F28-33. Li Y, Zelenina M, Plat-Willson G, Marcoux MO, Aperia A, Casper C. Urinary aquaporin-2 excretion during ibuprofen or indomethacin treatment in preterm infants with patent ductus arteriosus. Acta Paediatr. 2011;100:59-66, doi: 10.1111/j.1651-2227.2010.01943.x. Cassady G, Crouse DT, Kirklin JW, Strange MJ, Joiner CH, Godoy G, et al. A randomized, controlled trial of very early prophylactic ligation of the ductus arteriosus in babies who weighed 1000 g or less at birth. New England Journal of Medicine. 1989;320:1511-6, doi: 10.1056/ NEJM198906083202302. Mosalli R, Paes B. Ductus Arteriosus: Optimal Fluid Requirements in Preterm Infants NeoReviews. 2010;11:495-502. Clyman R, Cassady G, Kirklin JK, Collins M, Philips JB3rd. The role of patent ductus arteriosus ligation in bronchopulmonary dysplasia: reexamining a randomized controlled trial. J Pediatr. 2009;154:873-6, doi: 10.1016/j.jpeds.2009.01.005. Waleh N, McCurnin DC, Yoder BA, Shaul PW, Clyman RI. Patent ductus arteriosus ligation alters pulmonary gene expression in preterm baboons. Pediatr Res. 2011;69:212-6. Kabra NS, Schmidt B, Roberts RS et al. Neurosensory impairment after surgical closure of patent ductus arteriosus in extremely low birth weight infants. Results from the Trial of Indomethacin Prophylaxis in Preterms. J Pediatr. 2007;150:229–34, doi: 10.1016/j.jpeds.2006.11.039. Chorne N, Leonard C, Piecuch R, Clyman RI. Patent ductus arteriosus and its treatment as risk factors for neonatal and neurodevelopmental morbidity. Pediatrics. 2007;119:165–74, doi: 10.1542/peds.2006-3124. Victorian Infant Collaborative Study Group. Surgery and the tiny baby: sensorineural outcome at 5 years of age. J Paediatr Child Health. 1996;32:167–72, doi: 10.1111/j.1440-1754.1996.tb00916.x. Bratlid D, Farstad T. Treatment of a patent ductus arteriosus in premature infants. Tidsskr Nor Legeforen (The Journal of the Norwegian Medical Association). 2009;129:1455–8, doi: 10.4045/ tidsskr.09.31363. Mandhan P, Brown S, Kukkady A, Samarakkody U. Surgical closure of patent ductus arteriosus in preterm low birth weight infants. Congenit Heart Dis. 2009;4:34–37, doi: 10.1111/j.1747-0803.2008.00241.x Malviya M, Ohlsson A, Shah S. Surgical versus medical treatment with cyclooxygenase inhibitors for symptomatic patent ductus arteriosus in preterm infants. Cochrane Database Syst Rev. 2008;23:CD003951. Spanos WC, Brookes JT, Smith MC, Burkhart HM, Bell EF, Smith RJ. Unilateral vocal fold paralysis in premature infants after ligation of patent ductus arteriosus: vascular clip versus suture ligature. Ann Otol Rhinol Laryngol. 2009;118:750–3.

CLINICS 2011;66(12):2141-2149

Should we definitively abandon prophylaxis? Fanos V et al.

97. Moin F, Kennedy KA, Moya FR. Risk factors predicting vasopressor use after patent ductus arteriosus ligation. Am J Perinatol. 2003;20:313–20, doi: 10.1055/s-2003-42693. 98. Seghaye MC, Grabitz R, Alzen G, Trommer F, Ho¨rnchen H, Messmer BJ,et al. Thoracic sequelae after surgical closure of the patent ductus arteriosus in premature infants. Acta Paediatr. 1997;86:213–6, doi: 10. 1111/j.1651-2227.1997.tb08871.x. 99. McNamara PJ, Stewart L, Shivananda SP, Stephens D, Sehgal A. Patent ductus arteriosus ligation is associated with impaired left ventricular systolic performance in premature infants weighing less than 1000 g. J Thorac Cardiovasc Surg. 2010;140(1):150-7. Erratum in: J Thorac Cardiovasc Surg. 2010 Oct;140:944, doi: 10.1016/j.jtcvs.2010.01.011 100. Cristel M, Sørensen, Jesper N. Steensberg, Greisen G. Surgical ligation of patent ductus arteriosus in premature infants. Dan Med Bul 2010;57:A4160. 101. Mosalli R, AlFaleh K, Paes B. Role of prophylactic surgical ligation of patent ductus arteriosus in extremely low birth weight infants: Systematic review and implications for clinical practice. Ann Ped Cardiol. 2009;2:120-6, doi: 10.4103/0974-2069.58313. 102. Mosalli R, Alfaleh K. Prophylactic surgical ligation of patent ductus arteriosus for prevention of mortality and morbidity in extremely low birth weight infants. Cochrane Database Syst Rev. 2008;(1):CD006181. 103. Bo¨kenkamp R, DeRuiter MC, van Munsteren C, Gittenberger-de Groot AC. Insights into the pathogenesis and genetic background of patency of the ductus arteriosus. Neonatology. 2010;98:6-17, doi: 10.1159/ 000262481. 104. Bhandari V, Zhou G, Bizzarro MJ, Buhimschi C, Hussain N, Gruen JR, Zhang H. Genetic contribution to patent ductus arteriosus in the premature newborn. Pediatrics. 2009;123:669-73, doi: 10.1542/peds. 2008-1117. 105. Derzbach L, Treszl A, Balogh A, Vasarhelyi B, Tulassay T, Rigo JJ. Gender dependent association between perinatal morbidity and estrogen receptor-alpha Pvull polymorphism. J Perinat Med. 2005;33:461–2, doi: 10.1515/JPM.2005.082. 106. Bokodi G, Derzbach L, Banyasz I, Tulassay T, Vasarhelyi B. Association of interferon gamma T_874A and interleukin 12 p40 promoter CTCTAA/GC polymorphism with the need for respiratory support and perinatal complications in low birthweight neonates. Arch Dis Child Fetal Neonatal Ed. 2007;92:F25–F29, doi: 10.1136/adc.2005. 086421. 107. Dagle JM, Lepp NT, Cooper ME, Schaa KL, Kelsey KJ, Orr KL, et al. Determination of genetic predisposition to patent ductus arteriosus in preterm infants. Pediatrics. 2009;123:1116-23, doi: 10.1542/peds.20080313. 108. Ma JD, Nafziger AN, Bertino JS Jr. Genetic polymorphisms of cytochrome P450 enzymes and the effect on interindividual, pharmacokinetic

109.

110.

111. 112. 113. 114. 115. 116. 117.

118.

119.

120. 121. 122.

2149

variability in extensive metabolizers. J Clin Pharmacol. 2004;44:447-56, doi: 10.1177/0091270004264642. Durrmeyer X, Hovhannisyan S, Me´dard Y, Jacqz-Aigrain E, Decobert F, Barre J, Alberti C, Aujard Y, Danan C, Baud O. Are cytochrome P450 CYP2C8 and CYP2C9 polymorphisms associated with ibuprofen response in very preterm infants? PLoS One. 2010;5:e12329, doi: 10. 1371/journal.pone.0012329. Waleh N, Hodnick R, Jhaveri N, McConaghy S, Dagle J, Seidner S, et al. Patterns of gene expression in the ductus arteriosus are related to environmental and genetic risk factors for persistent ductus patency. Pediatr Res. 2010;68:292-7, doi: 10.1203/PDR.0b013e3181ed8609. Fanos V, Yurdako¨k M. Personalized neonatal medicine. J Matern Fetal Neonatal Med. 2010;23(Suppl 3):4-6, doi: 10.3109/14767058.2010.513103. Atzori L, Antonucci R, Barberini L, Griffin JL, Fanos V. Metabolomics: a new tool for the neonatologist. J Mat Fetal Neonatal Med. 2009;22:50-53, doi: 10.1080/14767050903181500. Atzori L, Antonucci R, Barberini L, Locci E, Marincola FC, Scano P, et al. 1H NMR-based metabolomic analysis of urine from preterm and term neonates. Front Biosci (Elite Ed). 2011;3:1005-12. Gien J. Controversies in the management of patent ductus arteriosus. NeoReviews. 2008;9:e477-e482, doi: 10.1542/neo.9-10-e477 Laughon M, Bose C, Benitz WE. Patent ductus arteriosus management: what are the next steps? J Pediatr. 2010;157(3):355-7. Noori S. Patent ductus arteriosus in the preterm infant: to treat or not to treat. J Perinat 2010;30S:S31-S3, doi: 10.1038/jp.2010.97. Jones LJ, Craven PD, Attia J, Thakkinstian A, Wright I. Network metaanalysis of indomethacin versus ibuprofen versus placebo for PDA in preterm infants. Arch Dis Child Fetal Neonatal Ed. 2011;96:F45-52, doi: 10.1136/adc.2009.168682. Sweet DG, Carnielli V, Greisen G, Hallman M, Ozek E, Plavka R, et al. European Association of Perinatal Medicine. European consensus guidelines on the management of neonatal respiratory distress syndrome in preterm infants - 2010 update. Neonatology. 2010;97:40217, doi: 10.1159/000297773. Antonucci R, Bassareo P, Zaffanello M, Pusceddu M, Fanos V. Patent ductus arteriosus in the preterm infant: new insights into pathogenesis and clinical management. J Matern Fetal Neonatal Med. 2010;23(Suppl 3):34-7, doi: 10.3109/14767058.2010.509920. Alfaleh K. Indomethacin prophylaxis revisited: changing practice and supportive evidence. Acta Paediatrica. 2011;100:641-6, doi: 10.1111/j. 1651-2227.2011.02189.x. Sekar KC, Corff KE. Treatment of patent ductus arteriosus: indomethacin or ibuprofen? J Perinatol. 2008;28(Suppl 1):S60-2, doi: 10.1038/jp. 2008.52. Chiruvolu A, Jaleel MA. Therapeutic management of patent ductus arteriosus. Early Hum Dev. 2009;85:151-5, doi: 10.1016/j.earlhumdev. 2008.12.007.

CLINICS 2011;66(12):2151-2157

DOI:10.1590/S1807-59322011001200023

REVIEW

Protective measures against ultrafiltration failure in peritoneal dialysis patients Anna Rita Aguirre, Hugo Abensur Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Nephrology Division, Saõ Paulo/SP, Brazil.

Ultrafiltration failure in patients undergoing peritoneal dialysis is a condition with an incidence that increases over time. It is related to increased cardiovascular morbidity and mortality and is a major cause of the abandonment of the treatment technique. Because the number of patients undergoing renal replacement therapy is increasing with society aging and because approximately 10% of this population is treated with peritoneal dialysis, this matter is becoming more common in everyday practice for clinicians involved in the care of patients with chronic renal failure. In this review, we summarize the available measures used to prevent and treat ultrafiltration failure and the current state of research in the field, both in the experimental and clinical settings, focusing on the possible clinical applications of recent findings. KEYWORDS: Peritoneal membrane; Peritoneal dialysis fluids; Peritoneal fibrosis; End-stage renal disease; Ultrafiltration. Aguirre AR, Abensur H. Protective measures against ultrafiltration failure in peritoneal dialysis patients. Clinics. 2011;66(12):2151-2157. Received for publication on June 28, 2011; First review completed on August 6, 2011; Accepted for publication on August 18, 2011 E-mail: annaritanefro@gmail.com Tel.: 55 11 2661-7629

˚ . Aquaporin-1 (AQP1) has also which have diameters of 43 A been identified in the PM6 and has been called ‘‘ultrapore’’ or ‘‘ultrasmall pore’’ because only water molecules can move through it. Forty percent of the osmosis during the first 4 hours of a dwell duration is attributed to transport through AQP1. The fluxes through these channels are dependent on the Starling forces that act in the peritoneal cavity and blood compartments, and more recently, importance has been assigned to the distance of each pore from the cavity, which is referred to as the ‘‘distributive model.’’7 Because of longer patient survival, PD is used for increasingly long periods. Dysfunctions in the peritoneal transport system have been found to develop over time, with the most prevalent problem being ultrafiltration failure (UFF).

INTRODUCTION Peritoneal dialysis (PD) is an effective therapeutic strategy for managing both acute and chronic kidney disease (CKD) and has been employed as a renal replacement therapy (RRT) modality for CKD for the last five decades.1 During this time, technical improvements have led to reduced morbidity and mortality rates. In the last decade, better outcomes have been noted with PD, whereas mortality rates have remained stable with hemodialysis (HD).2 However, the percentage of patients who begin RRT with PD remains approximately 10% worldwide,3 and although PD and HD should be considered as complementary therapy modalities, PD is not routinely offered to incident patients. Over the last century, our understanding of the mechanisms involved in solute and fluid transport across the peritoneal membrane (PM) has improved, and this growing knowledge has allowed apparatus development and PD prescription in consonance with peritoneal physiology.4 ‘‘Pore theory,’’5 the most commonly applied description of the dynamics of molecular transport through the PM, basically considers three pore sizes in the walls of submesothelial capillaries through which molecules can travel. A ˚ , are called minority of the pores, with diameters of 250 A large pores and allow the movement of proteins across the PM. Most small solutes can pass through the small pores,

Ultrafiltration failure UFF, which can be defined as ultrafiltration (UF) of less than 400 mL after a 4-hour dwell duration with a 4.25% dextrose-based peritoneal dialysis fluid (PDF), is a clinical condition that has an increasing incidence with chronic PD duration. Thirty to fifty percent of patients develop UFF after 6 years of PD, and in 24% of cases, changing the RRT modality is required to maintain clinical stability. 8,9 Signs and symptoms of fluid overload, such as high arterial pressure, pulmonary congestion and a worsening of cardiac function are the usual manifestations of UFF, and a differentiation from the loss of residual renal function (RRF) or dietary noncompliance is necessary. To this end, measuring the UF volume after 4 hours is of great value.10,11 Morbidity and mortality rates have been shown to be significantly higher among PD patients with UFF;12,13 these higher morbidity and mortality rates have been attributed to

2151

Ultrafiltration failure prevention Aguirre AR and Abensur H

CLINICS 2011;66(12):2151-2157

history, the association with autoimmune diseases31 and the frequent occurrence in individuals not being treated with PD and even in other species favor this hypothesis. In addition, animal models for these conditions require different aggressors to be simulated.32 In this hypothesis, PD would act as a risk factor, not as the etiologic agent of the condition. This review focuses on the established clinical measures and ongoing research on the possible interventions aimed at preventing the gradual degeneration of PM related to chronic PD.

excess fluid and its effects on the cardiovascular system, such as arterial hypertension and left ventricular hypertrophy.14 Atrial natriuretic peptide and brain natriuretic peptide have been studied in PD patients as markers of volume overload, and high levels of each have been linked to an eight-fold increase in mortality relative to patients with low levels.15 Also important is the correlation between insulin resistance and metabolic syndrome with the fast peritoneal transport,17 since these metabolic changes can potentially contribute to the development of cardiovascular disease.16 Therefore, prevention, early identification, and proper clinical management of UFF are crucial elements of cardiovascular risk reduction strategies. UFF generally develops as the result of one or more of the following phenomena: a significant increase in the peritoneal vascular surface area, a decrease in the osmotic conductance of the PM, increased lymphatic absorption, and the reduction of the peritoneal surface area by scars or adhesions.18 Uremia,19 infectious peritonitis,20 high glucose concentrations in PDF,21 glucose degradation products (GDPs) formed during heat sterilization,22 and the generation of advanced glycation end-products (AGEs)23 have all been implicated in UFF development. These factors are primarily related to chronic and acute inflammation of the peritoneum,24 which in turn leads to local neoangiogenesis, vasculopathy, the epithelial-to-mesenchymal transition (EMT) of mesothelial cells25 and collagen deposition in the compact submesothelial zone with subsequent PM thickening.26 These morphological changes translate clinically into faster small-solute transport with rapid vanishing of the osmotic gradient between the blood and the cavity and diminished osmotic conductance of the membrane, meaning that there is less osmosis even though a gradient is present. Both effects are associated with a functional decline in the peritoneum as a dialyzing membrane. There is evidence that the decrease in the peritoneal osmotic conductance is related to AQP1 dysfunction27 and that the acceleration of small-solute transfer is related to the thickening of the collagen layer and high vascular density. A rare, though dramatic, clinical condition also associated with the loss of dialyzing and UF capacity is known as sclerosing peritonitis, encapsulating sclerosing peritonitis (ESP) or abdominal cocoon. One possible explanation for the development of this condition is a ‘‘two-hit’’ model, in which a denuded, thickened PM resulting from longterm PD undergoes a second inflammatory insult.28 These second stimuli, even when very slight, could trigger the development of ESP in a severely damaged peritoneum, while a less-damaged membrane would likely require more potent stimuli. The most characteristic feature of ESP is the formation of a peritoneal capsule as the result of the deposition and organization of fibrin, which are likely the key events in ESP’s pathogenesis. The fibrin seems to derive from increased plasma exudation from the peritoneal microvessels, and the adhesion of the peritoneum causes serious intestinal immobility, thus resulting in ileus.29 However, some researchers believe this condition to be a separate nosological entity as opposed to a further stage of progressive peritoneal damage caused by bio-incompatible PDFs.30 These researchers argue that the different natural

UFF prevention Peritonitis. Because peritonitis episodes are consistently related to the loss of UF capacity,33 adequate prevention and early treatment are essential to the success of the technique. It is believed that compliance with the antiseptic routine is related to a reduction in the number of infectious episodes,34 which consequently results in lower dropout rates. Specific measures to reduce the incidence of peritonitis begin with catheter insertion. These measures include positioning the tip downward, not using stitches to close the exit site wound and using prophylactic intravenous antibiotics, all of which have been shown to decrease infection.35,36 Over the long term, hand washing is crucial for the prevention of contamination; the training nurse is the most important professional for this activity. There is evidence that, in addition to hand washing, topical prophylaxis with mupirocin37,38 or gentamycin39 reduces peritonitis rates. Because exit site infections are also related to peritoneal cavity infections, early and aggressive treatment of exit site lesions and infections should be started as soon as the first signs appear and should be maintained until the lesion or infection has been resolved.40 Avoiding contamination from other sources through antibiotic prophylaxis is also recommended when invasive procedures are performed and when there is another intraabdominal source of contamination. Liquid and salt balance. It is prudent to frequently remind PD patients of the importance of fluid and salt restriction because the ability of the kidneys to reach a neutral sodium balance is diminished with the loss of RRF. In PD, sodium removal occurs through diffusive transport with glucose-based solutions. When icodextrin is employed, convective transport contributes to global sodium loss as well.41 In the initial phase of the glucosebased fluid dwell, the osmotic gradient is maximal, and intense osmotic water transport occurs through the ultrasmall pores (AQP1), leading to sodium sieving. Sodium sieving is a consequence of the exclusive traffic of water free of solutes, leaving significant sodium loss restricted to the later phase of the dwell.4 The shorter the prescribed dwells are, the more important sodium retention becomes. Clinically, patients treated with automated peritoneal dialysis (APD) tend to lose less sodium than patients treated with chronic ambulatory peritoneal dialysis (CAPD) due to the short night dwells.42,43 For APD patients, sodium restriction is even more important in achieving sodium and fluid balance. With icodextrin, the removal of salt through convection can be enhanced because with every 100 mL of UF, approximately 0.9 mg of sodium chloride is removed.44

2152

CLINICS 2011;66(12):2151-2157

Ultrafiltration failure prevention Aguirre AR and Abensur H

how the PM of patients will respond over the long term with chronic exposure to these new solutions. Oxidative stress. Many links have been identified between oxidative stress and the activation of fibrogenic and angiogenic pathways, mostly through TGF-b and VEGF. The expression of growth factors induced by GDPs, such as methylglyoxal and acetaldehyde, have been successfully blocked in in vitro and in vivo studies by the antioxidant agents N-acetylcysteine (NAC)56 and catalase.57 Our group has also shown that NAC prevents PM thickening in vivo58. GDPs are precursors of AGEs, which also induce the production of cellular reactive oxygen species (ROS),59,60 and ROS in turn promote AGE formation and thus signal amplification.61 In the PM, GDPs, and AGEs play an essential role in chronic inflammation when glucose-based fluids are employed, and it has been found that NAC and angiotensin receptor antagonists (ARBs) prevent PDF-induced collagen I and heat shock protein accumulation in the omentum, results that strongly suggest that ROS are major mediators of peritoneal fibrosis.62 In addition, cyclooxygenase-2 inhibitors63 and peroxisome proliferator-activated receptor-c (PPAR-c) antagonists64 have been tested in HPMC studies and in animal studies to determine the ability of these drugs to prevent the connection between inflammatory stimuli and profibrotic pathways; positive results have been reported. The final goal is the translation of these results into clinical practice. In patients, NAC, angiotensin-converting enzyme inhibitors (ACEis) and ARBs have been tested, and the results are discussed in the following sections. Fibrosis. TGF-b1 is the most important cytokine involved in peritoneal fibrosis, and its synthesis in peritoneal mesothelial cells and the synthesis of its receptors are stimulated by bio-incompatible PDFs.65,66,67 Interleukin-1 (IL-1) and tumor necrosis factor-a (TNF-a), which are released during peritonitis episodes, also contribute to peritoneal fibrogenesis, probably through the induction of EMT,68 which is a phenomenon experiencing growing interest amongst recent publications. Other cytokines, such as TGF-b2, TGF-b3, platelet-derived growth factor, fibroblast growth factor-2, and connective tissue growth factor69 are involved, together with plasminogen activator inhibitor-1,70 in the initiation of fibrosis. There is also evidence that angiotensin II induces fibronectin expression in mesothelial cells via extracellular-signal-regulated kinase 1 (ERK-1), ERK2 and mitogen-activated protein kinase (MAPK)71,72 and that it takes part in the membraneâ&#x20AC;&#x2122;s cellular immune response.73 In experiments with cultured HPMCs and animal models, attempts to block fibrosis through interference with these factors have been made, with variable results. Among the tested interventions, positive results for fibrosis and EMT prevention were achieved with bone morphogenic protein7,74 emodin,75 mammalian target of rapamycin inhibitors,76 pentoxifylline,77 diltiazem,78 tranilast,79 and dipyridamole.80 In collaboration with Spanish colleagues, we have tested the beta-blocker nebivolol in vivo and have achieved success in reducing fibrogenesis and neoangiogenesis, in the PM.81 The adenovirus-mediated gene transfer of decorin has also been tested and was shown to reduce peritoneal collagen content in an animal model of PD.82 In addition to the prevention of fibrogenesis, collagen turnover is becoming an object of scrutiny in PD. The matrix metalloproteinases 2 and 9 (MMPs) are gelatinases involved in the regulation of inflammation and in the degradation of

In individuals who respond, who are generally those with residual clearance, the use of high-dose loop diuretics may help in achieving dry weight through an increase in renal fluid and sodium excretion without an additional increase in the glucose load â&#x20AC;&#x201C; a measure that does not interfere in RRF.45,46 Initial and continuous counseling regarding the importance of complying with the dietary restrictions and adjusting these recommendations according to RRF loss over time may allow the prescription of fewer antihypertensive drugs47 and a lower glucose concentration to promote adequate osmosis and maintain dry weight. To ensure an objective approach to patient management, the reassessment of dietary intake and the renal component of Kt/V (RRF) should be routine practice. Dialysis fluids. In most countries, glucose is the primary osmotic agent used in PD. It has been demonstrated that glucose acts as a promoter of angiogenesis and fibrosis in the peritoneal cavity in a manner similar to that seen in damaged end-organs in diabetes.48,49 The greater the necessity to promote UF, which is related to the RRF and fluid and salt ingestion, the bigger the required glucose load. Also important is the baseline small-solute transfer rate of an individual patient, which influences the glucose load prescribed by the nephrologist.10 As the speed of solute transport and the dissipation of the osmotic gradient increase, the amount of glucose required to obtain adequate fluid balance also increases. Avoiding unnecessary glucose overload in the cavity is recommended during long-term follow-up to prolong the modality lifespan. Alternatives to glucose have been researched in the last decade, and the glucose polymer icodextrin is already routinely available in some countries. It is an isosmolar compound that promotes UF through colloid osmosis, and its use is currently restricted to 1-2 daily exchanges to avoid systemic accumulation.50 In general, it is prescribed for the longest dwell, which is the night dwell in CAPD and the day dwell in APD. A slower decline in peritoneal function over time has been demonstrated with icodextrin than with high glucose concentrations. The avoidance of glucose-based PDF also helps minimize the exposure of the membrane to GDPs and AGEs, which are also associated with a fast transport profile and UFF. GDPs are toxic to mesothelial cells and lead to the faster formation of AGEs in the membrane than glucose does.51 Fluids with neutral pH and low GDP content lead to an increase in effluent cancer antigen 125 (CA-125), a mesothelial cell mass marker in PD, indicating preservation of the mesothelium.52 Minimizing AGEs is also of interest, but it should be remembered that the PDF is not the only source of these molecules; the uremic serum is a site of AGE formation as well, but the peritoneal accumulation of AGEs can be reduced if PDFs with lower glucose concentration are prescribed. An alternative is to prescribe purely bicarbonate-buffered low-GDP fluids, which seem to improve peritoneal membrane integrity, as indirectly evaluated using human peritoneal mesothelial cell (HPMC) culture;53 preserve host defense mechanisms as shown in animal models;54 and provide a better effluent marker profile, with lower levels of transforming growth factor-b (TGF-b) and vascular endothelial growth factor (VEGF) levels in patients.55 However, these fluids are not widely available. Additionally, these fluids seem to have a positive effect on RRF, but it is not yet possible to foresee

2153

Ultrafiltration failure prevention Aguirre AR and Abensur H

CLINICS 2011;66(12):2151-2157

the extracellular matrix, and thus they facilitate the migration of cells in processes such as EMT. When in excess, MMP activity may impair wound healing.83 ACEis have been studied in this context and have shown direct anti-MMP-2 activity in PD by binding to its active site and forming complexes in the drained effluent.84 This activity could possibly blunt EMT. These experiments have been extremely useful in further improving our understanding of UFF pathogenesis independent of the clinical application of the specific drug employed. Comprehension of the involved mechanisms has been essential in adapting PD to peritoneal physiology and in determining which drugs could be beneficial to patients with signs of fibrosis progression and PM degeneration in PD. Angiogenesis. The inhibition of angiogenesis has been tested in vitro and in vivo in different scenarios, such as wound healing,85 carcinoma metastasis,86 and PD.82 Inhibition has been achieved with anti-proliferative agents such as angiostatin and anti-VEGF antibodies.87 In the context of wound healing, slower or incomplete tissue repair has been found to be a consequence of this inhibition.88 In carcinomas, the results have been positive, and anti-VEGF antibodies are already clinically available as adjuvant drugs to inhibit the growth and metastases of a variety of tumors. In vivo, systemic angiogenesis inhibition has been related to different clinically undesirable effects, which differ according to the developmental phase. In adults, one of the most prominent unwanted events is the worsening of or de novo proteinuria,89,90 which can lead to additional loss of RRF. In retinal vascular proliferative diseases, however, where AGEs stimulate the expression of VEGF mRNA,91 anti-VEGF agents are used locally with success.92 The possibility of using locally active agents without systemic side effects is an attractive idea in the management of progressively accelerating small-solute transport because VEGF activation is thought to play an essential role in the observed membrane damage93 and because the preservation of RRF is related to survival in dialysis patients.94 Experimental protocols are currently under development. Captopril, enalapril and losartan have also been studied in HPMC culture and have been shown to lead to a decrease in VEGF production after exposure to TNF-a and IL-1.95 In humans, a retrospective analysis comparing small-solute transport in 36 patients receiving an ACEis or ARBs with that in 30 controls revealed that in the treated group, smallsolute transport decreased over 2 years of follow-up, whereas transport increased among controls.96 Although the available evidence is not considered strong, as discussed in a recent meta-analysis,97,98 the use of either ACEis or ARBs in PD patients is commonly advocated to preserve RRF and prevent cardiovascular events. Most of the experimental protocols targeting the vascular component of UFF pathogenesis are focused on its prevention, and important answers concerning the reversal of established excessive vascularization are still lacking.

guaranteed in severe cases of UFF in which histological damage is clear or when the diagnosis is only made at later stages. A delayed diagnosis can be common in patients with significant RRF who can maintain adequate fluid balance without being dependent on peritoneal clearance. In cases of established tissue damage, such as diffuse fibrosis and significant established neoangiogenesis, no satisfactory clinical or pharmacological intervention has been found. Mesothelial cell transplantation has been studied as another possibility for promoting PM repair, as these cells play a central role in local inflammatory responses, in the regulation of peritoneal microcirculation and in maintaining the balance between fibrin deposition and degradation.102 A few studies have been published evaluating this intervention in animals and in humans,103,104,105 but activation of the PM, with prolonged inflammation and increased thickness in the early post-transplant phase, has been noticed.106 Whether this activation is a result of the cell culturing conditions or of the transplant itself has yet to be established; therefore, the applicability of this technique is not yet clear. Another possible intervention for the future could be the transplantation of bone marrow-derived cells because markers indicative of their implantation were detected in the PM 7-42 days after their intraperitoneal injection; however, this result is very preliminary, and it is not possible to define the role of bone marrow-derived cells in the context of membrane failure.107

UFF reversal

AUTHOR CONTRIBUTIONS

CONCLUSION In the near future, it is possible that new pharmacological interventions aiming to minimize the occurrence of UFF will emerge as a result of ongoing worldwide research in this field because many of the processes involved in the progression of damage have been unveiled. However, few strategies are available to date. ACEis or BRAs are already frequently prescribed to the PD population in an attempt to preserve RRF and prevent UFF, regardless of the limited available evidence supporting their use. It is desirable to avoid the current bio-incompatible PDFs, which allow immediate control of fluid overload but accelerate the degeneration of the membrane; thus, more compatible fluids must be made available. Adequate training, nutritional advice and surveillance, and patient compliance to the diet and to sterile techniques are already feasible procedures and should be monitored on a routine basis as part of PD preservation strategies. Collectively, the cited studies show that many distinct parallel event chains can ultimately lead to the fast transporter phenotype and that it is probably necessary to simultaneously block different triggers to effectively minimize inflammation and its local consequences. Beyond considering one factor as the defining step, the balance between the activation of pro- and anti-inflammatory pathways seems to define the final phenotype.

A few strategies have led to recovery from UFF, including membrane rest involving four weeks of hemodialysis, with which positive results have been obtained in recently diagnosed cases.99,100 In addition, in cases of UFF associated with beta-blockers, where scant tissue damage is observed, the reversal of the dysfunction has been described with the discontinuation of the drug.101 However, reversal is not

Aguirre AR was responsible for searching the literature for relevant data, and manuscript writing. Abensur H was responsible for searching the literature for relevant data, manuscript draft, and manuscript revision.

REFERENCE 1. Boen ST, Curtis FK, Tenckhoff H, Scribner BH. Chronic hemodialysis and peritoneal dialysis. Proc Eur Dial Transplant Assoc. 1964;1:221-3.

2154

CLINICS 2011;66(12):2151-2157

Ultrafiltration failure prevention Aguirre AR and Abensur H

2. Mehrotra R. Changing patterns of peritoneal dialysis utilization in the United States. Perit Dial Int. 2007;27: S51–S2. 3. Lameire N, Van Biesen W. Epidemiology of peritoneal dialysis: a story of believers and nonbelievers. Nat Rev Nephrol. 2010;6:75-82, doi: 10. 1038/nrneph.2009.210. 4. Rippe B, Venturoli D, Simonsen O, de Arteaga J. Fluid and electrolyte transport across the peritoneal membrane during CAPD according to the three-pore model. Perit Dial Int. 2004;24:10-27. 5. Rippe B, Stelin G. Simulations of peritoneal solute transport during CAPD. Application of two-pore formalism. Kidney Int. 1989;35:1234–44, doi: 10.1038/ki.1989.115. 6. Pannekeet MM, Mulder JB, Weening JJ, Struijk DG, Zweers MM, Krediet RT. Demonstration of aquaporin-chip in peritoneal tissue of uremic and CAPD patients. Perit Dial Int. 1996;16:S54-7. 7. Flessner MF, Dedrick RL, Schultz JS. A distributed model of peritonealplasma transport: theoretical considerations. Am J Physiol. 1984;246: 597-607. 8. Kawaguchi Y, Hasegawa T, Nakayama M, Kubo H, Shigematu T. Issues affecting the longevity of the continuous peritoneal dialysis therapy. Kid Int Suppl. 1997;62:S105-S107. 9. Heimbu¨rger O, Waniewski J, Werynski A, Tranaeus A, Lindholm B. Peritoneal transport in CAPD patients with permanent loss of ultrafiltration capacity. Kidney Int. 1990;38:495-506, doi: 10.1038/ki. 1990.231. 10. Mujais S, Nolph K, Gokal R, Blake P, Burkart J, Coles G, et al. Evaluation and management of ultrafiltration problems in peritoneal dialysis. Perit Dial Int. 2000;20:S5-21. 11. Lo WK, Bargman JM, Burkart J, Krediet RT, Pollock C, Kawanishi H, et al. Guideline on targets for solute and fluid removal in adult patients on chronic peritoneal dialysis. Perit Dial Int. 2006;26:520–2. 12. Brown EA, Davies SJ, Rutherford P, Meeus F, Borras M, Riegel W, et al. Survival of functionally anuric patients on automated peritoneal dialysis: the European APD outcome study. J Am Soc Nephol. 2003;14: 2948-57, doi: 10.1097/01.ASN.0000092146.67909.E2. 13. Jansen MA, Termorshuizen F, Korevaar JC, Dekker FW, Boeschoten E, Krediet RT, et al. Predictors of survival in anuric peritoneal dialysis patients. Kidney Int. 2005;68:1199–205, doi: 10.1111/j.1523-1755.2005. 00512.x. 14. Krediet RT, Balafa O. Cardiovascular risk in the peritoneal dialysis patient. Nat Rev Nephrol. 2010;6:451-60, doi: 10.1038/nrneph.2010.68. 15. Rutten JH, Korevaar JC, Boeschoten EW, Dekker FW, Krediet RT, Boomsma F, et al. B-Type natriuretic peptide and amino-terminal atrial natriuretic peptide predict survival in peritoneal dialysis. Perit Dial Int. 2006;26:598-602. 16. Fortes PC, de Moraes TP, Mendes JG, Stinghen AE, Ribeiro SC, PecoitsFilho R. Insulin resistance and glucose homeostasis in peritoneal dialysis. Perit Dial Int. 2009;29:S145-8. 17. Chen H-Y, Kao T-W, Huang J-W, Chu T-S, Wu K-D. Correlation of metabolic syndrome with residual renal function, solute transport rate and peritoneal solute clearance in chronic peritoneal dialysis patients. Blood Purif. 2008;26:138-44, doi: 10.1159/000113506. 18. Flessner MF. Peritoneal ultrafiltration: physiology and failure. Contrib. Nephrol. 2009;163:7-14, doi: 10.1159/000223773. 19. Williams JD, Craig KJ, Topley N, Von Ruhland C, Fallon M, Newman GR, et al. Morphologic changes in the peritoneal membrane of patients with renal disease. J Am Soc Nephrol. 2002;13:470-9. 20. Davies SJ, Bryan J, Phillips L, Russell GI. Longitudinal changes in peritoneal kinetics: the effects of peritoneal dialysis and peritonitis. Nephrol Dial Transplant. 1996;11:498-506. 21. Ha H, Yu MR, Lee HB. High glucose-induced PKC activation mediates TGF-beta 1 and fibronectin synthesis by peritoneal mesothelial cells. Kidney Int. 2001;59:463–70, doi: 10.1046/j.1523-1755.2001.059002463.x. 22. Witowski J, Wisniewska J, Koryblaska K, Bender TO, Breborowicz A, Gahl GM, et al. Prolonged exposure to glucose degradation products impairs viability and function of human peritoneal mesothelial cells. J Am Soc Nephrol. 2001;12:2434-41. 23. Nakayama M, Kawaguchi Y, Yamada K, Hasegawa T, Takazoe K, Katoh N, et al. Immunohistochemical detection of advanced glycosylation end-products in the peritoneum and its possible pathophysiological role in CAPD. Kidney Int. 1997;51:182-6, doi: 10.1038/ki.1997.22. 24. Aroeira LS, Aguilera A, Sańchez-Tomero JA, Bajo MA, del Peso G, Jimeńez-Heffernan JA, et al. Epithelial to mesenchymal transition and peritoneal membrane failure in peritoneal dialysis patients: pathologic significance and potential therapeutic interventions. J Am Soc Nephrol. 2007;18:2004–13, doi: 10.1681/ASN.2006111292. 25. Yań˜ez-Mo´ M, Lara-Pezzi E, Selgas R, Ramı´rez-Huesca M, DomıńguezJimeńez C, Jimeńez-Heffernan JA, et al. Peritoneal dialysis and epithelial-to-mesenchymal transition of mesothelial cells. N Engl J Med. 2003;348:403-13, doi: 10.1056/NEJMoa020809. 26. Krediet RT, Lindholm B, Rippe B. Pathophysiology of peritoneal membrane failure. Perit Dial Int. 2000;4:S22-42. 27. Ni J, Verbavatz JM, Rippe A, Boisde´ I, Moulin P, Rippe B, et al. Aquaporin-1 plays an essential role in water permeability and

28. 29. 30. 31. 32. 33. 34. 35. 36. 37.

38.

39. 40. 41. 42.

43. 44.

45. 46. 47. 48. 49. 50.

51. 52.

53. 54.

2155

ultrafiltration during peritoneal dialysis. Kidney Int. 2006;69:1518–25, doi: 10.1038/sj.ki.5000285. Honda K, Oda H. Pathology of encapsulating peritoneal sclerosis. Perit Dial Int. 2005;25:S19-29. Goodlad C, Brown EA. Encapsulating Peritoneal Sclerosis: What Have We Learned? Seminars in Nephrology. 2011;31:183-98, doi: 10.1016/j. semnephrol.2011.01.007. Garosi G, Di Paolo N, Sacchi G, Gaggiotti E. Sclerosing peritonitis: a nosological entity. Perit Dial Int. 2005;25:S110-2. Odama UO, Shih DJ, Korbet SM. Sclerosing peritonitis and systemic lupus erythematosus: a report of two cases. Perit Dial Int. 1999;19:160-4. Garosi G, Di Paolo N. Peritoneal sclerosis: one or two nosological entities? Semin Dial. 2000;13:297-308, doi: 10.1046/j.1525-139x.2000. 00080.x. Voinescu CG, Khanna R. Peritonitis in peritoneal dialysis. Int J Artif Organs. 2002;25:249-60. Bender FH, Bernardini J, Piraino B. Prevention of infectious complications in peritoneal dialysis: best demonstrated practices. Kidney Int Suppl. 2006;70:S44–54, doi: 10.1038/sj.ki.5001915. Flanigan M, Gokal R. Peritoneal catheters and exit-site practices toward optimum peritoneal access: a review of current developments. Perit Dial Int. 2005;25:132-9. Lye WC, Lee EJ, Tan CC. Prophylactic antibiotics in the insertion of Tenckhoff catheters. Scand J Urol Nephrol. 1992;26:177-80. Thodis E, Passadakis P, Panagoutsos S, Bacharaki D, Euthimiadou A, Vargemezis V. The effectiveness of mupirocin preventing Staphylococcus aureus in catheter-related infections in peritoneal dialysis. Adv Perit Dial. 2000;16:257-61. Bernardini J, Piraino B, Holley J, Johnston JR, Lutes R. A randomized trial of staphylococcus aureus prophylaxis in peritoneal dialysis patients: Mupirocin calcium ointment 2% applied to the exit site versus cyclic oral rifampin. Am J Kidney Dis. 1996;27:695-700, doi: 10.1016/ S0272-6386(96)90105-5. Sheth HS, Bernardini J, Bender F, Piraino B. Follow-up evaluation of gentamicin cream prophylaxis for peritoneal dialysis catheter infections. Perit Dial Int. 2007;27:S26-c. Vychytil A, Lorenz M, Schneider B, Ho¨rl WH, Haag-Weber M. New criteria for management of catheter infections in peritoneal dialysis patients using ultrasonography. J Am Soc Nephrol. 1998;9:290-6. Van Biesen W, Vanholder R, Veys N, Lameire N. Improving salt balance in peritoneal dialysis patients. Perit Dial Int. 2005;25:S73-5. Ortega O, Gallar P, Carrenõ A, Gutierrez M, Rodriguez I, Oliet A, et al. Peritoneal sodium mass removal in continuous ambulatory peritoneal dialysis and automated peritoneal dialysis: Influence on blood pressure control. Am J Nephrol. 2001;21:189-93, doi: 10.1159/000046246. Rodrı´guez–Carmona A, Fontań MP. Sodium removal in patients undergoing CAPD and automated peritoneal dialysis. Perit Dial Int. 2002;22:705-13. Konings CJ, Kooman JP, Schonk M, Gladziwa U, Wirtz J, van der Wall Bake AW, et al. Effect of icodextrin on volume status, blood pressure and echocardiographic parameters: A randomized study. Kidney Int. 2003;63:1556–63, doi: 10.1046/j.1523-1755.2003.00887.x. van Olden RW, Guchelaar HJ, Struijk DG, Krediet RT, Arisz L. Acute effects of high dose furosemide on residual renal function in CAPD patients. Perit Dial Int. 2003;23:339-47. Medcalf JF, Harris KP, Walls J. Role of diuretics in the preservation of residual renal function in patients on CAPD. Kidney Int. 2001;59:112833, doi: 10.1046/j.1523-1755.2001.0590031128.x. ¨ zkahya M, To¨z H, Asci G, Akçiçek F, et al. Strict Gu¨nal AI, Duman S, O volume control normalizes hypertension in peritoneal dialysis patients. Am J Kidney Dis. 2001;37:588-93, doi: 10.1016/S0272-6386(01)80017-2. Krediet RT, Zweers MM, van der Wal AC, Struijk DG. Neoangiogenesis in the peritoneal membrane. Perit Dial Int. 2000;20:S19-25. Mateijsen MA, van der Wal AC, Hendriks PM, Zweers MM, Mulder J, Struijk DG, et al. Vascular and interstitial changes in the peritoneum of CAPD patients with peritoneal sclerosis. Perit Dial Int. 1999;19:517-25. Sav T, Oymak O, Inanc MT, Dogan A, Tokgoz B, Utas C. Effects of twice-daily icodextrin administration on blood pressure and left ventricular mass in patients on continuous ambulatory peritoneal dialysis. Perit Dial Int. 2009;29:443–9. Wieslander AP, Andreń AH, Nilsson-Thorell C, Muscalu N, Kjellstrand PT, Rippe B. Are aldehydes in heat-sterilized peritoneal dilaysis fluids toxic in vitro? Perit Dial Int. 1995;15:348-52. Jones S, Holmes CJ, Krediet RT, Mackenzie R, Faict D, Tranaeus A, et al. Bicarbonate/lactate-based peritoneal dialysis solution increases cancer antigen 125 and decreases hyaluronic acid levels. Kidney Int. 2001;59:1529-38, doi: 10.1046/j.1523-1755.2001.0590041529.x. Grossin N, Wautier MP, Wautier JL, Gane P, Taamma R, Boulanger E. Improved in vitro biocompatibility of bicarbonate-buffered peritoneal dialysis fluid. Peritl Dial Int. 2006;26:664-70. Mortier S, De Vriese AS, Mcloughlin RM, Topley N, Schaub TP, Passlick-Deetjen J, et al. Effects of conventional and new peritoneal dialysis fluids on leukocyte recruitment in the rat peritoneal membrane.

Ultrafiltration failure prevention Aguirre AR and Abensur H

55.

56.

57.

58. 59. 60.

61.

62.

63.

64.

65. 66.

67.

68. 69. 70.

71. 72.

73.

74.

75.

CLINICS 2011;66(12):2151-2157

76. Patel P, Sekiguchi Y, Oh KH, Patterson SE, Kolb MR, Margetts PJ. Smad3-dependent and -independent pathways are involved in peritoneal membrane injury. Kidney Int. 2010;77:319-28, doi: 10.1038/ki.2009. 436. 77. Hung KY, Huang JW, Chen CT, Lee PH, Tsai TJ. Pentoxifylline modulates intracellular signalling of TGF-beta in cultured human peritoneal mesothelial cells: implications for prevention of encapsulating peritoneal sclerosis. Nephrol Dial Transplant. 2003;18:670-6, doi: 10. 1093/ndt/gfg141. 78. Fang CC, Yen CJ, Chen YM, Chu TS, Lin MT, Yang JY. Diltiazem suppresses collagen synthesis and IL-1beta-induced TGF-beta1 production on human peritoneal mesothelial cells. Nephrol Dial Transpl 2006;21:1340-7. 79. Kaneko K, Hamada C, Tomino Y. Peritoneal fibrosis intervention. Perit Dial Int. 2007;27:S82–6. 80. Hung KY, Chen CT, Huang JW, Lee PH, Tsai TJ, Hsieh BS. Dipyridamole inhibits TGF-beta-induced collagen gene expression in human peritoneal mesothelial cells. Kidney Int. 2001;60:1249-57, doi: 10. 1046/j.1523-1755.2001.00933.x. 81. Aguirre AR, Gonza´lez-Mateo G, Abensur H, Albar-Vizcaı´no P, Pe´rezLozano ML, Selgas R, et al. Nebivolol (NV) prevents peritoneal membrane (PM) failure induced by peritoneal dialysis (PD) fluids. SA-PO2652. In 2010 ASN Renal Week; Denver, CO. 82. Margetts PJ, Gyorffy S, Kolb M, Yu L, Hoff CM, Holmes CJ, et al. Antiangiogenic and antifibrotic gene therapy in a chronic infusion model of peritoneal dialysis in rats. J Am Soc Nephrol. 2002;13:721–8. 83. Xue M, Le NT, Jackson CJ. Targeting matrix metalloproteases to improve cutaneous wound healing. Expert Opin Ther Targets. 2006; 10:143-55, doi: 10.1517/14728222.10.1.143. 84. Yamamoto D, Takai S, Hirahara I, Kusano E. Captopril directly inhibits matrix metalloproteinase-2 activity in continuous ambulatory peritoneal dialysis therapy. Clin Chim Acta. 2010;411:762-4, doi: 10.1016/j.cca. 2010.02.059. 85. Ekici Y, Emiroglu R, Ozdemir H, Aldemir D, Karakayali H, Haberal M. Effect of rapamycin on wound healing: An experimental study. Transplant Proc. 2007;39:1201–3, doi: 10.1016/j.transproceed.2007.04. 013. 86. O’Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, et al. Angiostatin: A novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell. 1994;79: 315-28, doi: 10.1016/0092-8674(94)90200-3. 87. Ferrara N, Hillan KJ, Novotny W. Bevacizumab (Avastin), a humanized anti-VEGF monoclonal antibody for cancer therapy. Biochem Biophys Res Commun. 2005;33:328–35, doi: 10.1016/j.bbrc.2005.05.132. 88. Scha¨ffer M, Schier R, Napirei M, Michalski S, Traska T, Viebahn R. Sirolimus impairs wound healing. Langenbecks Arch Surg. 2007;392: 297–303, doi: 10.1007/s00423-007-0174-5. 89. Hara A, Wada T, Furuichi K, Sakai N, Kawachi H, Shimizu F, et al. Blockade of VEGF accelerates proteinuria, via decrease in nephrin expression in rat crescentic glomerulonephritis. Kidney Int. 2006;69: 1986–95, doi: 10.1038/sj.ki.5000439. 90. Izzedine H, Massard C, Spano JP, Goldwasser F, Khayat D, Soria JC. VEGF signalling inhibition-induced proteinuria: Mechanisms, significance and management. Eur J Cancer. 2010;46:439–48, doi: 10.1016/j. ejca.2009.11.001. 91. Lu M, Kuroki M, Amano S, Tolentino M, Keough K, Kim I, et al. Advanced glycation end products increase retinal vascular endothelial growth factor expression. J Clin Invest. 1998;101:1219-24, doi: 10.1172/ JCI1277. 92. Arevalo JF, Sanchez JG, Lasave AF, Wu L, Maia M, Bonafonte S, et al. Intravitreal bevacizumab (Avastin) for diabetic retinopathy: The 2010 GLADAOF lecture. J Ophthalmol. 2011;2011:1-13, doi: 10.1155/2011/ 584238. 93. De Vriese AS, Tilton RG, Stephan CC, Lameire NH. Vascular endothelial growth factor is essential for hyperglycemia-induced structural and functional alterations of the peritoneal membrane. J Am Soc Nephrol. 2001;12:1734–41. 94. Wang AY. The ‘‘heart’’ of peritoneal dialysis: residual renal function. Perit Dial Int. 2007;27:116-24. 95. Sauter M, Cohen CD, Wo¨rnle M, Mussack T, Ladurner R, Sitter T. Ace inhibitor and AT-1-receptor blocker attenuate the production of VEGF in mesothelial cells. Perit Dial Int. 2007;27:167-72. 96. Kolesnyk I, Dekker FW, Noordzij M, le Cessie S, Struijk DG, Krediet RT. Impact of ACE inhibitors and AII receptor blockers on peritoneal membrane transport characteristics in long-term peritoneal dialysis patients. Perit Dial Int. 2007;27:446-53. 97. Zannad F, Kessler M, Lehert P, Gru¨nfeld JP, Thuilliez C, Leizorovicz A, et al. Prevention of cardiovascular events in end-stage renal disease: results of a randomized trial of fosinopril and implications for future studies. Kidney Int. 2006;70:1318-24, doi: 10.1038/sj.ki.5001657. 98. Akbari A, Knoll G, Ferguson D, McCormick B, Davis A, Biyani M. Angiotensin-converting enzyme inhibitors and angiotensin receptor blockers in peritoneal dialysis: systematic review and meta-analysis of randomized controlled trials. Perit Dial Int. 2009;29:554-61.

J Am Soc Nephrol. 2003;14:1296-306, doi: 10.1097/01.ASN.0000060681. 91079.30. Williams JD, Topley N, Craig KJ, Mackenzie RK, Pischetsrieder M, Lage C, et al. The Euro-Balance Trial: the effect of a new biocompatible peritoneal dialysis fluid (Balance) on the peritoneal membrane. Kidney Int. 2004;66:408-18, doi: 10.1111/j.1523-1755.2004.00747.x. Che W, Asahi M, Takahashi M, Kaneto H, Okado A, Higashiyama S, et al. Selective induction of heparin-binding epidermal growth factorlike growth factor by methylglyoxal and 3-deoxyglucosone in rat aortic smooth muscle cells: The involvement of reactive oxygen species formation and a possible implication for atherogenesis. J Biol Chem. 1997;272:18453-9, doi: 10.1074/jbc.272.29.18453. Greenwel P, Domıńguez-Rosales JA, Mavi G, Rivas-Estilla AM, Rojkind M. Hydrogen peroxide: A link between acetaldehyde-elicited a1(I) collagen gene up-regulation and oxidative stress in mouse hepatic stellate cells. Hepatology. 2000;31:109-16, doi: 10.1002/hep.510310118. Bui DS, Seguro AC, Shimitzu MH, Schliemann I, Martini D, Romaõ JE, et al. N-Acetylcisteine protects the peritoneum from the injury induced by hypertonic dialysis solution. J Nephrol. 2011 in press. Yim MB, Yim HS, Lee C, Kang SO, Chock PB. Protein glycation: creation of catalytic sites for free radical generation. Ann N Y Acad Sci. 2001;928:48-53, doi: 10.1111/j.1749-6632.2001.tb05634.x. Wautier MP, Chappey O, Corda S, Stern DM, Schmidt AM, Wautier JL. Activation of NADPH oxidase by AGE links oxidant stress to altered gene expression via RAGE. Am J Physiol Endocrinol Metab. 2001;280:E685-94. Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura T, Kaneda Y, et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature. 2000;404:787-90, doi: 10. 1038/35008121. Noh H, Kim JS, Han KH, Lee GT, Song JS, Chung SH, et al. Oxidative stress during peritoneal dialysis: Implications in functional and structural changes in the membrane. Kidney Int. 2006;69:2022–8, doi: 10.1038/sj.ki.5001506. Aroeira LS, Lara-Pezzi E, Loureiro J, Aguilera A, Ramı´rez-Huesca M, Gonza´lez-Mateo G, et al. Cyclooxygenase-2 mediates dialysate-induced alterations of the peritoneal membrane. J Am Soc Nephrol. 2009;20:58292, doi: 10.1681/ASN.2008020211. Sandoval P, Loureiro J, Gonza´ lez-Mateo G, Pe´rez-Lozano ML, Maldonado-Rodrı´guez A, Sańchez-Tomero JA, et al. PPAR-gamma agonist rosiglitazone protects peritoneal membrane from dialysis fluidinduced damage. Lab Invest. 2010;90:1517-32, doi: 10.1038/labinvest. 2010.111. Naiki Y, Maeda Y, Matsuo K, Yonekawa S, Sakaguchi M, Iwamoto I, et al. Involvement of TGF-beta signal for peritoneal sclerosing in continuous ambulatory peritoneal dialysis. J Nephrol. 2003;16:95-102. Kim YS, Kim BC, Song CY, Hong HK, Moon KC, Lee HS. Advanced glycosylation end products stimulate collagen mRNA synthesis in mesangial cells mediated by protein kinase C and transforming growth factor-beta. J Lab Clin Med. 2001;138:59-68, doi: 10.1067/mlc.2001. 115494. Kang DH, Hong YS, Lim HJ, Choi JH, Han DS, Yoon KI. High glucose solution and spent dialysate stimulate the synthesis of transforming growth factor-b1 of human peritoneal mesothelial cells: effect of cytokine costimulation. Perit Dial Int. 1999;19:221-30. Margetts PJ, Kolb M, Galt T, Hoff CM, Shockley TR, Gauldie J. Gene transfer of transforming growth factor-beta1 to the rat peritoneum: effects on membrane function. J Am Soc Nephrol. 2001;12:2029-39. Moussad EE, Brigstock DR. Connective tissue growth factor: what’s in a name? Mol Genet Metab. 2000;71:276–92, doi: 10.1006/mgme.2000.3059. Rougier JP, Guia S, Hage`ge J, Nguyen G, Ronco PM. PAI-1 secretion and matrix deposition in human peritoneal mesothelial cell cultures: transcriptional regulation by TGF-beta 1. Kidney Int. 1998;54:87-98, doi: 10.1046/j.1523-1755.1998.00955.x. Noh H, Ha H, Yu MR, Kim YO, Kim JH, Lee HB. Angiotensin II mediates high glucose-induced TGF-beta1 and fibronectin upregulation in HPMC through reactive oxygen species. Perit Dial Int. 2005;25:38-47. Kiribayashi K, Masaki T, Naito T, Ogawa T, Ito T, Yorioka N, et al. Angiotensin II induces fibronectin expression in human peritoneal mesothelial cells via ERK1//2 and p38 MAPK. Kidney Int. 2005;67: 1126–35, doi: 10.1111/j.1523-1755.2005.00179.x. Belline P, da Melo PS, Haun M, Palhares FB, Boer PA, Gontijo JA, et al. Effect of angiotensin II and losartan on the phagocytic activity of peritoneal macrophages from Balb/C mice. Mem Inst Oswaldo Cruz. 2004;99:167-72, doi: 10.1590/S0074-02762004000200009. Loureiro J, Schilte M, Aguilera A, Albar-Vizcaıńo P, Ramı´rez-Huesca M, Pe´rez-Lozano ML, et al. BMP-7 blocks mesenchymal conversion of mesothelial cells and prevents peritoneal damage induced by dialysis fluid exposure. Nephrol Dial Transplant. 2010;25:1098-108, doi: 10. 1093/ndt/gfp618. Chan TM, Leung JK, Tsang RC, Liu ZH, Li LS, Yung S. Emodin ameliorates glucose-induced matrix synthesis in human peritoneal mesothelial cells. Kidney Int. 2003;64:519-33, doi: 10.1046/j.1523-1755. 2003.00113.x.

2156

CLINICS 2011;66(12):2151-2157

Ultrafiltration failure prevention Aguirre AR and Abensur H

99. de Alvaro F, Castro MJ, Dapena F, Bajo MA, Fernandez-Reyes MJ, Romero JR, et al. Peritoneal resting is beneficial in peritoneal hyperpermeability and ultrafiltration failure. Adv Perit Dial. 1993;9:56-61. 100. Rodrigues A, Cabrita A, Maia P, GuimaraË&#x153;es S. Peritoneal rest may succesfully recover ultrafiltration in patients who develop peritoneal hyperpermeability with time on continuous ambulatory peritoneal dialysis. Adv Perit Dial. 2002;18:78-80. 101. Stegmayr BG. Beta-blockers may cause ultrafiltration failure in peritoneal dialysis patients. Perit Dial Int. 1997;17:541-5. 102. Mutsaers SE. Mesothelial cells: their structure, function and role in serosal repair. Respirology. 2002;7:171-91, doi: 10.1046/j.1440-1843.2002.00404.x. 103. Di Paolo N, Sacchi G, Vanni L, Corazzi S, Terrana B, Rossi P, et al. Autologous peritoneal mesothelial cell implant in rabbits and peritoneal dialysis patients. Nephron. 1991;57:323-31, doi: 10.1159/000186283.

104. Nagy JA, Shockley TR, Masse EM, Harvey VS, Jackman RW. Mesothelial cell-mediated gene therapy: feasibility of an ex vivo strategy. Gene Ther. 1995;401:393-401. 105. Hekking LH, Harvey VS, Havenith CE, van den Born J, Beelen RH, Jackman RW, et al. Mesothelial cell transplantation in models of acute inflammation and chronic peritoneal dialysis. Perit Dial Int. 2003;23: 323-30. 106. Hekking LH, Zweers MM, Keuning ED, Driesprong BA, de Waart DR, Beelen RH, et al. Apparent successful mesothelial cell transplantation hampered by peritoneal activation. Kidney Int. 2005;68:2362â&#x20AC;&#x201C;7, doi: 10. 1111/j.1523-1755.2005.00698.x. 107. Sekiguchi Y, Hamada C, Inaba M, Shimaoka T, Ro Y, lo H, et al. Roles of bone marrow derived cells in development of morphological alterations in the peritoneum. Perit Dial Int. 2006;26(suppl 2):S20.

2157

CLINICS 2011;66(12):2159-2168

DOI:10.1590/S1807-59322011001200024

REVIEW

A survey of recently published cardiovascular, hematological and pneumological original articles in the Brazilian scientific press Kavita Kirankumar Patel, Bruno Caramelli, Ariane Gomes Hospital das Clı´nicas, Faculdade de Medicina, Universidade de Sa˜o Paulo/SP, Brazil.

Recent original scientific contributions published in selected Brazilian periodicals and classifiable under cardiovascular and pulmonary subject categories cover a wide range of sub specialties, both clinical and exprimental. Because they appear in journals with only recently enhanced visibility, we have decided to highlight a number of specific items appeared in four Brazilian journals, because we understand that this is an important subsidy to keep our readership adequately informed. These papers cover extensive sub-areas in both fields. KEYWORDS: Cardiovascular; Pneumology; Clinical science; Basic research. Patel KK, Caramelli B, Gomes A. A survey of recently published cardiovascular, hematological and pneumological original articles in the Brazilian scientific press. Clinics. 2011;66(12):2159-2168. Received for publication on September 27, 2011; First review completed on November 7, 2011; Accepted for publication on November 7, 2011 E-mail: bcaramel@usp.br Tel.: 55 11 2661-5376

were our most frequent hits. Within this category 5 articles covered the themes of scores and risks. Magedanz et al.1 constructed a score risk model for use in daily practice to predict the risk of mediastinitis for patients undergoing coronary artery bypass grafting. The score includes routinely collected variables and is simple to use. Cadore et al.2 develop a score system capable to predict mortality in patients submitted to myocardial revascularization surgery, using clinical variables easy to obtain, which showed capability to predict mortality in patients submitted to myocardial revascularization surgery in our Hospital. Three papers focused on EuroSCORE: de Carvalho et al.3 critically analyzed the EuroSCORE logistic model application in 2,692 patients undergoing Coronary Artery Bypass Grafting in four public hospitals in the Rio de Janeiro and claim that the differences in the prevalence rates for the risk factors associated with its low power of discrimination, hamper recommendation for its use in Brazil, without essential adjustments. Sa et al.4 evaluated EuroSCORE applicability in patients undergoing coronary artery bypass graft surgery at the Division of Cardiovascular Surgery of Pernambuco Cardiologic Emergency Medical Services and found it to be a simple and objective index, revealing a satisfactory discriminator of postoperative evolution in patients undergoing CABG surgery at their institution. Nery et al.5 compared the Cleveland Clinical Score and EuroSCORE when evaluating patients submitted to elective coronary artery bypass grafting in Rio Grande do Sul and found both to be effective to evaluate risk of death in patients electively submitted to CABGS. Two papers looked at the interaction of exercise with Coronary Artery bypass surgery: Botega et al.6 assessed the behavior of cardiovascular variables during an in-hospital cardiovascular rehabilitation program in patients after myocardial revascularization surgery and conclude that

INTRODUCTION Recent original scientific contributions published in selected Brazilian periodicals and classifiable under Cardiovascular, Hematological and Pulmonary subject categories cover a wide range of sub specialties, both clinical and experimental. Journals in which they appeared (Arquivos Brasileiros de Cardiologia, Jornal Brasileiro de Pneumologia, Revista Brasileira de Cirurgia Cardiovascular, Revista da Associac¸a˜o Me´dica Brasileira) have only recently acquired an enhanced level of visibility. Hence we understand that is appropriate and necessary to highlight a number of specific items appeared in these four Brazilian journals, because we understand that this is an important subsidy to keep our readership adequately informed. These 113 papers (49 Cardiovascular, 3 Hematological, 64 Pneumological, 4 of which are interdisciplinary) cover extensive sub-areas in both fields. Selection of papers to be highlighted was directed towards giving not only information about the research but also to show the range of distribution of this work. Most (but not all) of it stems from Brazilian based work. Tables 1 and 2 specify how they are distributed between the sub-specialties of the three major biomedical areas of knowledge. Table 1 displays relative distribution frequencies of 52 selected papers papers on Cardiology. Thirty six papers are surgical, sixteen clinical. Within the surgical papers, Coronary Artery bypass surgery reports, not surprisingly

2159

Cardiopneumology in Brazilian scientific press Patel KK et al.

CLINICS 2011;66(12):2159-2168

Table 1 - Distribution of highlighted Cardiology, Hematology articles by subject categories. General subjects surgical

clinical

Hematology Renal

Sub-categories

# of hits

reference

Coronary Artery Bypass Surgery Valve Congenital Heart pathology Transplant Other Hypertension Exercise Congestive Heart Failure other General Cardiovascular related

1-11

9 4

12-20 21-24

3 8 4 2 3 8 3 2

25-27 28-36 37-40 40-41 42-44 45-52 53-55 56,57

Table 2 - General distribution of highlighted themes in Pneumology broken down into subject specialties. General themes asthma Mechanics and Ventilation Lung Infections COPD Oncology Other

hits

reference

13 11 10 5 5 11

58-70 8,9,33, 71-78 79-88 89-93 94-98 99-113

Benfatti et al.13 analyzed the influence of using of epsilon aminocaproic acid in the bleeding and in red-cell transfusion requirement in the first twenty-four hours postoperative of mitral valve surgery. They conclude that the epsilon aminocaproic acid was able to reduce the bleeding volume and the red-cell transfusion requirement in the immediate postoperative of patients submitted to mitral valve surgery. Guedes et al.14 describe a technique and results of mitral valve treatment by right anterolateral thoracotomy using aortic cannulation for cardiac pulmonary bypass and claim it is a simple, safe, and reproducible technique. Guedes et al.15 also analyzed cardiac morphology and function using real time tridimensional echocardiography in individuals submitted to mitral valve repair with Double Teflon technique. They describe a left atrial and ventricle reverse remodeling associated with an improvement in left atrial function during the study. Gaia et al.16 developed a catheter-mounted aortic bioprosthesis for aortic implant and conclude that transapical implantation of cathetermounted bioprosthesis is a feasible procedure. do Amaral et al.17 stress the need for replacement of the valve, ascending aorta and aortic with coronary reimplantation in patients where anti-coagulation is undesirable, is increasing. They evaluated the hemodynamic performance of an aortic valved conduit made with glutaraldehyde treated bovine pericardium (AVCP) in animals and find that hemodynamic outcomes found are similar to physiological parameters. Dias et al.18 analyzed early and late results of aortic root reconstruction with aortic valve sparing operations and the composite mechanical valve conduit replacement. And claim that this has a low early and late mortality, a high survival free of complications and low need for reoperation. Lavitola et al.19 compared the effectiveness of Aspirin vs. Warfarin in thromboembolism prevention in patients with Atrial fibrilation and claim that in patients presenting fibrillation for less than a year and no previous embolism, aspirin is little effective. However, in patients with lower-risk mitral valvulopathy (mitral regurgitation and mitral biological prosthesis), especially in cases presenting contraindication to or low adherence to warfarin, aspirin use can present some benefit in thromboembolism prevention. de Campos et al.20 To evaluate the occurrence of complications in patients with mechanical heart valve prostheses undergoing anticoagulant therapy optimized through specialized clinics. And find that the period of time in which patients remain within the desired anticoagulation interval directly relates with occurrence of complications. Congenital heart pathology was studied in four selected papers. Maluf et al.21 studied patients with complex congenital heart disease, characterized by right ventricle hypoplasia, had a palliative surgical option with one and a half ventricular repair and claim that surgical treatment

the exercises proposed proved to be safe with the change in key physiologic variables throughout the experiment below recommended values for the hospitalization phase. Furthermore, the RPE scale appears to have a correlation with some hemodynamic variables and thus may be a useful tool for this group of patients. Martini and Barbisan7 investigated the effect of physical activity in leisure time on the prognosis of patients two years after coronary artery bypass grafting and found that such activity does not modify the late prognosis but that the bypass graft itself promotes physical activity and improves long-term functional capacity. Pulmonary function interested two cardiac surgery research groups: Guizilini et al.8 evaluated early postoperative pulmonary function in patients submitted to offpump coronary artery bypass grafting, comparing the conventional midsternotomy with the ministernotomy approach and found that ministernotomy led to better preservation and recovery of pulmonary function. Barros et al.9 evaluated respiratory muscle training, performed after the revascularization surgery and found that it may increase ventilatory capacity. Saphenous harvesting was studied by Hijazi10, who compared the difference in wound complication and infection rates between two saphenous vein harvesting techniques, long incision versus multiple short interrupted incisions (tunneling) for coronary artery bypass grafting at King Abdullah University Hospital â&#x20AC;&#x201C; Jordan and found that veins harvested using saphenous vein tunneling were associated with fewer wound complications than the traditional longitudinal method. Gabriel et al.11 assessed whether the main pulmonary artery controlled perfusion over cardiopulmonary bypass modifies brain natriuretic peptide levels expressed by the ventricular myocardium and found that main pulmonary artery controlled perfusion for 30 minutes did not yield substantial modifications in brain natriuretic peptide expression or in the histological pattern of the right ventricular myocardium. Valve surgery was the object of nine papers, four on mitral valve surgery, three on the aortic valve and two general. Lins et al.12 studied aims to evaluate the surgical treatment of atrial fibrillation with ultrasound ablation concomitant to mitral surgery in patients with permanent atrial fibrillation and claim that patients who received treatment for atrial fibrillation simultaneously with valvar surgery had advantages related to the control group.

2160

CLINICS 2011;66(12):2159-2168

Cardiopneumology in Brazilian scientific press Patel KK et al.

in cardiac surgery and its relationship with the postoperative pulmonary complications but found that preoperative respiratory strength couldnâ&#x20AC;&#x2122;t be a predictor of postoperative pulmonary complication. Leal et al.34 report on a method of removing intravascular foreign bodies, catheters with the use of various endovascular techniques and procedures. Conclusion Percutaneous retrieval of intravascular foreign bodies is considered gold standard treatment because it is a minimally invasive, relatively simple, safe procedure, with low complication rates compared to conventional surgical treatment. Laizo et al.35 analyzed the complications that increase the permanence of the patients submitted to cardiac surgery at intensive care unit and conclude that they are related to respiratory function, chronic obstructive pulmonary disease, tabagism, pulmonary congestion, time of permanence under MV, diabetes, infections, renal insufficiency, stroke and hemodynamic instability. Sa et al.36 studied clinical features, complications and in-hospital outcomes of patients operated for postinfarction ventricular septal rupture and claim that the need for vasoactive drugs, hemodynamic instability and cardiogenic shock were associated with higher rates of mortality. Patients who had adverse outcomes had less ventricular function and higher score in the EuroSCORE. Of the twenty papers selected on Clinical Cardiology, hypertension was the most frequent hit. Ferreira et al.37 investigated the prevalence of cardiovascular risk factors among the elderly treated by SUS in the city of Goiania, state of Goias, Brazil and found that factors occur simultaneously in more than half of the elderly individuals, and the most prevalent ones were: arterial hypertension, central obesity and sedentary lifestyle. Arruda et al.38 estimated the prevalence of hypertension and describe the characteristics of patients with hypertension infected by HIV/AIDS. They conclude that a high frequency of uncontrolled hypertensive patients and cardiovascular risks in HIV-infected patients point out to the need for preventive and therapeutic measures against hypertension in this group. Queiroz et al.39 evaluate the prevalence of high blood pressure in schoolchildren from public schools and its association with anthropometric indicators. They identified an association between excess weight with high blood pressure levels, which emphasizes the need for intervention and for nutritional status control measures, such as dietary education programs aimed at the prevention and treatment of obesity as a risk factor for cardiovascular diseases in the pediatric and older age ranges. Monteiro et al.40 analyzed the effect of a 13-week aerobic training program on blood pressure, body mass index and glycemic levels in elderly women with type-2 diabetes mellitus and found that the program was enough to promote significant decrease in the diastolic blood pressure and glycemic levels. Exercise in itself was examined by Camara et al.41 who compared the cardiovascular responses recorded during the assessment of muscle strength and endurance for two exercises commonly used in patients with intermittent claudication and conclude that isokinetic strength and endurance testing in such patients results in elevation of heart rate, systolic blood pressure and double product values during the exercises. These increases are higher during the muscle endurance exercises and in those involving greater muscle mass, suggesting that strength testing of small muscle groups causes less cardiovascular overload in these patients.

of the congenital cardiac anomalies in the presence of a hypoplastic right ventricle by means of one and a half ventricle repair has the advantages of reducing the surgical risk of biventricular repair compared to the Fontan circulation. da Rocha et al.22 assessed the morbidity and mortality after Jateneâ&#x20AC;&#x2122;s operation using lactate as the main marker and claim that morbidity and mortality can be assessed with the serum lactate levels, suggesting increased values in the third hour is suggestive of a worse prognosis. de Souza et al.23 studied the mortality rate of children undergoing to Fontan operation and determined whether the hypoplastic left heart syndrome is not a risk factor for hospital mortality. Rosa et al.24 checked on the frequency and types of congenital heart defects in a sample of patients with oculo-auriculovertebral spectrum, in an effort to correlate presence of these defects with other clinical characteristics and evolution. They find that cardiac malformations, mainly conotruncal and septal defects, are frequent among such patients. Frequency found in our study was statistically similar to the majority of works described in literature where it ranged from 18 to 58%. Cardiac Transplants. Coronel et al.25 described and compared pre-and postoperative physical and pulmonary capacity of patients who underwent heart transplantation and conclude that changes in ventilatory function of subjects undergoing cardiac transplantation are predictable: respiratory muscle strength and lung capacity recover within two weeks and a good strategy is to aim at at an improvement of functional capacity above pre-operative levels. Yoshimori et al.26 studied cardiovascular behavior and safety regarding a low-intensity exercise program for heart transplant candidates with severe heart failure and find that it proved to be safe and well tolerated, but requires monitoring. Dinkhuysen et al.27 evaluated pulmonary artery pressure with sodium nitroprusside before transplanting and claim that the procedure may allow conversion to orthotopic technique. Nine papers on cardiac surgery fall under various categories. Abreu-Silva et al.28 evaluated the association between plaque volume before the stenting through angiography and clinical outcomes and conclude that the volume of atheromatous plaques before stenting was higher in patients with MACE on clinical follow-up in one year, regardless of other predictors of events. Moriel et al.29 endeavored to associate clinical variables with Quality of Life scores in patients with stable coronary artery disease before percutaneous coronary intervention and with unfavorable outcomes, 12 months after the procedure. In the presence of coronary artery disease, patients with comorbidities present a higher degree of Quality of Life impairment. Duarte et al.30 determined the reliability of central atrial venous blood gasometry data as estimates of cardiac index in patients who underwent cardiac surgery and found that SvO2 and the C(a-v)O2 correlated with low cardiac output. Silva et al.31 proposed and developed a risk index to predict Atrial fibrillation after cardiac surgery. Because of concern about adverse hemodynamic effects of closure of the pericardium most heart surgeons prefer to avoid the procedure even though it may reduce the risk of cardiac injury during chest re opening, especially to the right ventricle, aorta and coronary bypass grafts. Within this context, Dantas et al.32 propose a simple method to facilitate resternotomy during subsequent re-operative procedures. Riedi et al.33 determined the strength of respiratory muscle

2161

Cardiopneumology in Brazilian scientific press Patel KK et al.

CLINICS 2011;66(12):2159-2168

the myocardium function recovery. Minicucci et al.52 analyzed the presence of different patterns of remodeling in a murine model and its functional implications and found that animals that underwent coronary occlusion showed two different patterns of remodeling, neither of which constitute a predictor of ventricular dysfunction. Three Hematology studies are highlighted. Azambuja and Garrafa53 studied the extent of knowledge and acceptance of hemocomponents and hemoderivatives, fresh and stored, by Jehovah’s Witnesses and proposed bioethical tools for any ethical and moral conflicts identified in their relationship with physicians and dentists. They conclude that Jehovah’s Witnesses are seen by their ‘‘moral outsiders’’ (i.e., physicians and dentists) as the religious group that simply ‘‘does not use blood’’. Although, several blood treatments are nowadays permitted it does not deprive them from a free conviction to refuse blood treatments. Ammirati et al.54 used epoetin to correct anemia and found a decrease in morbidity and increases survival and quality of life in end-stage renal disease. Macedo et al.55 evaluated the adequacy of anticoagulation therapy in patients with atrial fibrillation followed in a private clinic specialized in cardiology, in accordance with the American and European societies of cardiology guidelines/2006 and with the Brazilian Guidelines/2003. They conclude that anticoagulant therapy has been adequately prescribed for the majority of patients, although still far from ideal, especially in a cardiology clinic. Two papers are highlighted in the field of interaction of renal and cardiovascular pathophysiology. Correia et al.56 evaluated whether moderate renal dysfunction is associated with cTnT elevation in patients with acute coronary syndrome and found that moderate renal dysfunction is not associated with cTnT elevation in these patients. Carvalho et al.57 evaluated the frequency and type of cardiovascular and renal/collecting system abnormalities seen in a sample of patients with Turner Syndrome and found that the frequency of such abnormalities was similar to that of previous studies, but most were found in routine exams after Turner Syndrome diagnosis. In the field of Pneumology, we highlight 59 articles, the most frequent theme being asthma, with 13 hits. Roxo et al.58 developed and validated a Portuguese-language version of the Asthma Control Test (ACT) for use in Brazil. Santos et al.59 evaluated treatment compliance and use of inhaled medications of patients with asthma receiving complementary pharmaceutical care. and found that counseling provided by the pharmacist to the patient was important to assist in the implementation of the appropriate inhalation technique. Sarinho et al.60 compared BCG vaccination involving a single intradermal dose and that involving multiple doses, and claim that the prevalence of asthma among individuals having received multiple doses of the BCG vaccine was no different than that observed among those having received a single dose. Sarria et al.61 assessed the psychometric properties of the official Brazilian Portuguese-language version of the Paediatric Asthma Quality of Life Questionnaire (PAQLQ) in a representative group of Brazilian children and adolescents with asthma. and conclude that the Brazilian Portuguese-language version of the PAQLQ showed good psychometric performance, confirming its cultural adequacy for use in Brazil. Razi and Moosavi62 determined whether serum total IgE levels and total eosinophil counts have any relationship

Heart Failure is highlighted in three articles. Ribeiro et al.42 evaluated the cost-effectiveness of Implantable Cardioverter Defibrillators in congestive heart failure patients under two perspectives in Brazil: public and supplementary health systems. They conclude that the incremental cost-effectiveness ratio of Implantable Cardioverter Defibrillators is elevated in the general heart failure population, in either the public or private perspective. A more favorable result occurs in patients with a high sudden death risk. De Aguiar et al.43 To evaluate the predictors of morbidity and mortality in acute coronary syndrome in the long term. And conclude that heart failure upon admission, creatinine, age and HR were independent predictors of mortality. They also claim that heart failure patients treated before 2002 had a worse survival when compared with that seen after 2002 and the that change in therapy was responsible for the improvement. Aguiar et al.44 evaluated the role of severe depression in the outcome of patients with decompensated heart failure. And conclude that patients with severe depression showed a higher degree of neurohormonal stimulation despite their lower degree of ventricular dysfunction. The pathophysiological changes related to depression, leading to increased neurohormonal stimulation and cytokines, probably contributed to this more intense clinical manifestation even in the presence of less cardiac damage. Under a general category of sundry themes, Alves et al.45 evaluated whether the chronic and regular use of statins, for a period of six months, prevents atrial fibrillation after elective cardiac surgery and claim the the strategy reduced the incidence of atrial fibrillation after elective cardiac surgery. Da Silva et al.46 evaluated the effects of nandrolone decanoate on the electrocardiographic profile, glycogen content and total-protein profile of skeletal and cardiac muscles, as well as the plasma albumin concentrations in rats, concluding that major cardiac changes are triggered at an early stage, which indicates a hierarchy in the sequence of changes that compromise the homeostasis of the body. Diogo et al.47 evaluated the possible association between NSAIDs and Contrast-Induced Nephropathies and conclude that there was no association. Fagundes and Castro48 endeavored to determine the predictive value of resting heart rate before exercise stress testing for cardiovascular and all-cause mortality, concluding that it is an independent predictor of cardiovascular and all-cause mortality. Feliciano-Alfonso et al.49 estimated prevalence and distribution of cardiovascular risk factors and Metabolic Syndrome in young individuals admitted to the National University of Colombia in Bogota and encountered a prevalence of modifiable cardiovascular risk factors which justifies promotion of therapeutic lifestyle changes among this age group in Colombia. Kalil et al.50 tested the safety, feasibility and early myocardial angiogenic effects of transthoracic intramyocardial phVEGF165 administration for refractory angina in no option patients. They claim that the procedure resulted feasible and safe. Early clinical and scintillographic data are presented which showed improvements in symptoms and myocardial perfusion, with regression of ischemia severity in treated areas. Myocardial contractility alterations of isolated hearts of rats, submitted to ischemia and reperfusion with and without administration of the omeprazole was evaluated by Gomes et al.51 who concluded that omeprazole administration before ischemia induction significantly protected

2162

CLINICS 2011;66(12):2159-2168

Cardiopneumology in Brazilian scientific press Patel KK et al.

leads to better preservation and recovery of pulmonary function. Barros et al.9 evaluated respiratory muscle training, performed after the revascularization surgery and found that it may increase ventilatory capacity. Riedi et al.33 checked respiratory muscle strength in cardiac surgery and the relationship with the postoperative pulmonary complications and conclude that preoperative respiratory strength is not a predictor of postoperative pulmonary complication. Fonseca et al.71 compared two respiratory muscle training programs for improving the functional autonomy of institutionalized elderly and found that the trained groups improved functional autonomy. Silva et al.72 assessed the relationship between clinical and preoperative pulmonary functional evaluation and occurrence of postoperative pulmonary complications. They claim that the most important factors associated with postoperative pulmonary complications were surgical site, time of anesthesia, and ASA classification. Costa et al.73 compared mean inspiratory and expiratory pressures in healthy subjects with those predicted using the equations proposed in previous studies and claim that previously proposed equations were unable to predict the pressures for all of the subjects in their sample. They conclude that the results of their study can facilitate the prediction of respiratory muscle strength in healthy adult subjects in Brazil. D’Aquino et al.74 used clinical and spirometric findings in order to distinguish between the restrictive and nonspecific patterns of pulmonary function test results in patients with low FVC and a normal or elevated FEV(1)/FVC ratio. They found that In many patients with reduced FEV(1), reduced FVC, and a normal FEV(1)/FVC ratio, the restrictive pattern can be identified with confidence through the use of an algorithm that takes the clinical diagnosis and certain spirometty measurements into account. Logrado et al.75 endeavored to determine the impact of positive reinforcement during spirometry on the measurement of VC in healthy volunteers They claim their results indicate the Importance of using the behavioral strategy in combination with traditional practice in order to obtain better results. The use of positive reinforcement during the determination of VC is described as an effective, simple and easily applied strategy. Rodrigues et al.76 evaluated the contribution of a new coefficient, the FEF(50%)/0.5FVC ratio, obtained from the maximal expiratory flow-volume curve, to the diagnosis of obstructive lung disease and to test this coefficient in differentiating among patients considered normal, those with obstructive lung disease and those with restrictive lung disease They conclude that the FEF(50%)/ 0.5FVC ratio is a potentially useful parameter in the differential diagnosis of OLD and correlates positively with the FEV(1)/FVC ratio. Silveira et al.77 endeavored to determine whether inspiratory muscle training can increase strength and endurance of these muscles in quadriplegic patients and found that quadriplegic patients can benefit from training at low loads (30% of MIP), which can improve inspiratory muscle strength, FVC and expiratory muscle performance. Felix et al.78 compared the influence of two different ventilation strategies-volume-controlled ventilation (VCV) and pressure-controlled ventilation (PCV)-on the functional performance of lung grafts in a canine model of unilateral left lung transplantation using donor lungs harvested after three hours of normothermic cardiocirculatory arrest under mechanical ventilation. Their data indicate that in this model of lung transplantation showed that the functional performance of lung grafts was not influenced by

with the response to routine pharmacological treatment in patients with acute asthma and conclude that serum total IgE levels, peripheral white blood cell counts and eosinophil counts cannot predict the response to the pharmacological treatment of patients with acute asthma. Reck et al.63 determined the proportion of asthma patients with a poor perception of dyspnea, correlating the level of that perception with the severity of acute bronchoconstriction, bronchial hyper-responsiveness, use of maintenance medication, and asthma control. Their results suggest that a significant proportion of asthma patients have a poor perception of dyspnea. Melo et al.64 evaluated whether the exhaled breath temperature, measured by a noninvasive method, is an effective means of monitoring patients with uncontrolled asthma and conclude that uncontrolled asthma, especially during exacerbations, is followed by an increase in exhaled breath temperature, which decreases after appropriate asthma control. Lima et al.65 endeavored to determine whether children and adolescents are able to perceive acute exercise-induced bronchoconstriction (EIB), as well as to measure the discriminatory power of a word labeled visual analog dyspnea scale in relation to the intensity of the FM. They note that among children and adolescents with asthma, the accuracy of this dyspnea scale improves as the post-exercise percentage fall in FEV(1) increases. However, the predictive value of the scale is suboptimal when the percentage fall in FEV(1) is lower. Dela Bianca et al.66 determined the prevalence and severity of wheezing in infants, using the standardized protocol devised for the ‘‘Estudio Internacional de Sibilancias en Lactantes’’ (EISL, International Study of Wheezing in Infants), as well as to determine the relationship between such wheezing and physician-diagnosed asthma, in the first year of life. They conclude that the prevalence of wheezing episodes among infants in their first year of life was high and had an early onset. The proportion of infants diagnosed with and treated for asthma was low. de Castro et al.67 determined the prevalence of symptoms of asthma, rhinitis and atopic eczema among students between 6 and 7 years of age in the city of Londrina, Brazil. and found that the prevalence of symptoms of asthma, rhinitis and atopic eczema in our sample was within the range found at the facilities that participated in phases 1 and 111 of the ISAAC in Brazil. The low prevalence of physician-diagnosed asthma suggests that asthma continues to be under-diagnosed. Brandao et al.68 examined the clinical characteristics and the predictors of hospital admission due to asthma among children and adolescents with asthma under treatment at a referral center. and found that the principal predictor of hospital admission was greater asthma severity, calls for special attention being given to the care of these patients. Borges et al.69 develope and validated an asthma knowledge questionnaire for use in adult asthma patients in Brazil. Almeida et al.70 endeavored to describe socio-economic and behavioral aspects of pregnant women with asthma and to analyzed the effects of maternal asthma on certain perinatal parameters in a birth cohort. They found that socioeconomic level appears to be a risk factor for asthma. Pulmonary mechanics and ventilation contribute 11 papers to this review. As reported above, Guizilini et al.8 evaluated early postoperative pulmonary function in patients submitted to off-pump coronary artery bypass grafting, comparing the conventional midsternotomy with the ministernotomy approach. They conclude that ministernotomy

2163

Cardiopneumology in Brazilian scientific press Patel KK et al.

CLINICS 2011;66(12):2159-2168

potential risk factors for severe impairment of pulmonary function. They claim that such patients had a common pattern of severe pulmonary function impairment, characterized by marked airway obstruction and pronounced increases in RV and sRaw. The combination of spirometric and plethysmographic measurements is described as more useful for assessing functional damage, as well as in the follow-up of these patients, than are either of these techniques used in isolation. Known risk factors for respiratory diseases do not seem to be associated with severely impaired pulmonary function in PIBO. Senturk et al.87 determined the incidence of local and systemic infection in a sample of patients catheterized with thoracic catheters (TCs) and identified the prognostic factors for catheter-related infection. They claim that risk factors, such as advanced age, prolonged catheterization, comorbidities, and inoperable malignancy, increase the risk of catheterrelated infection. Melo et al.88 report a case series of patients with descending necrotizing mediastinitis (DNM) who were treated with minimally invasive thoracic surgery. Conclusions: We conclude that video-assisted thoracoscopy is an effective technique for mediastinal drainage in the treatment of DNM, with the benefits common to minimally invasive surgery: less postoperative pain, lower production of inflammatory factors, earlier return to activities of daily living, and better aesthetic results. Chronic Obstructive Pulmonary Disease is the subject of four articles. Fernandes et al.89 evaluated the short-term impact of tiotropium in patients with severe or very severe COPD who complain of dyspnea despite being currently treated with other bronchodilators and claim that the introduction of tiotropium into the treatment of such patients using long-acting beta(2) agonists improves pulmonary function and provides symptomatic relief, as perceived by patients in the short term. They claim that these results, obtained under real life treatment conditions, support the use of the salmeterol+tiotropium combination in specific treatment protocols for these patients. Ferrari et al.90 evaluated the health status (HS) of COPD patients and identified the main predictors of HS in these patients according to gender and claim that their results show an association between gender and HS in COPD patients. Age and dyspnea are determinants of HS in both genders. Araujo and Holanda91 determined whether Body mass index, airway Obstruction, Dyspnea, and Exercise capacity (BODE) index correlates with health-related quality of life in patients with COPD. and found that the BODE index score correlated with the scores of all of the mSGRQ domains in COPD patients with FEV(1) ,50%. Therefore, COPD patients with FEV(1) ,50% die sooner and have a poorer quality of life. Camargo and Pereira92 determined the correlations among various dyspnea scales, spirometric data, exercise tolerance data, and the Body mass index, airway Obstruction, Dyspnea, and Exercise capacity (BODE) index in patients with COPD. They suggest that multidimensional dyspnea scales should be applied in the evaluation of COPD patients. Chatkin et al.93 measured exhaled carbon monoxide (COex) levels in smokers with and without COPD. which did not differ significantly between smokers with COPD and those without, suggesting that there seems to be no major contraindications to their use in smokers with COPD.

the ventilation strategy employed during the first six hours after reperfusion. Pulmonary and mediastinal infection contributes nine papers to this study, five of which on tuberculosis. Goncalves et al.79 described the epidemiological monitoring of exposure to tuberculosis in a hospital environment and to analyze the profile of the disease in a general teaching hospital and suggest that the proposed indicators can potentially help standardize epidemiological monitoring procedures for nosocomial tuberculosis. Gupta et al.80 In developing countries, sputum smear microscopy is the main tool for pulmonary tuberculosis case finding. The objective of the present study was to evaluate the diagnostic efficacy of Gabbettâ&#x20AC;&#x2122;s staining (GS) and modified cold staining (MCS), both of which are two-step methods, in comparison with that of fluorescent staining (FS), which is a three-step method, for the detection of AFB in sputum smears. Conclusions: Although MCS and GS were found to be less sensitive than was FS, which is evaluated under fluorescence microscopy, the first two are promising methods for the diagnosis of tuberculosis. Lundgren et al.81 determined the main causes of hemoptysis and endeavored to classify this symptom, in terms of the amount of blood expectorated, in patients hospitalized at a referral hospital for pulmonology. They suggest that all patients who present with hemoptysis should be investigated for tuberculosis and other possible infectious agents. Maciel et al.82 determined the principal adverse effects of the tuberculosis treatment regimen recommended by the Brazilian Ministry of Health and find that the overall incidence of adverse effects related to the new treatment regimen recommended by the Brazilian Ministry of Health was high, even though none of those effects demanded a change in the regimen, which was effective in the patients evaluated. Marques et al.83 determined the drug resistance profile of Mycobacterium tuberculosis in the state of Mato Grosso do Sul, Brazil, between 2000 and 2006. and found high levels of resistance which undermine the efforts for tuberculosis control in Mato Grosso do Sul. Pedrozo et al.84 evaluated the efficacy of the scoring system, recommended by the Brazilian National Ministry of Health (NMH), for the diagnosis of pulmonary tuberculosis (TB) in children and adolescents, regardless of their HIV status. They conclude that the NMH system scores were significantly higher in the TB and TB/HIV groups than in the other two groups. Therefore, this scoring system was valid for the diagnosis of pulmonary TB in this population, regardless of HIV status. Away from tuberculosis, three other papers deal with pulmonary and mediastinal infections. Martinelli et al.85 determined the prevalence of nosocomial pneumonia in autopsies at a public university hospital in an attempt to identify the risk factors for nosocomial pneumonia and the potential prognostic factors associated with fatal nosocomial pneumonia and with fatal aspiration pneumonia and to determine whether patho-anatomical findings correlate with nosocomial pneumonia or aspiration pneumonia. They found a high prevalence of nosocomial pneumonia, which was responsible for almost 25% of all of the deaths. Smoking-related structural lesions and bilateral pneumonia all favored mortality. These findings corroborate the results of various clinical studies on nosocomial pneumonia. Mattiello et al.86 describe pulmonary function in children and adolescents with post-infectious bronchiolitis obliterans and evaluate

2164

CLINICS 2011;66(12):2159-2168

Cardiopneumology in Brazilian scientific press Patel KK et al.

Lung Cancer is the subject of five articles. Machado et al.94 evaluated the effect of chemotherapy on the physical condition of patients with advanced lung cancer and observed a beneficial effect on the performance status of the patients. No significant changes in BMI or 6MWD were found during the study period, which might suggest the maintenance of the physical condition of the patients. Franceschini et al.95 assessed the quality of life of ling cancer patients, through the Treatment of Cancer Core Quality of Life Questionnaire (EORTC QLQ-C30) in conjunction with its supplemental 13-item lung cancerspecific module (QLQ-LC13). The objective of this study was to assess the reproducibility of the Brazilian Portuguese version of these questionnaires and findings show that these instruments were reproducible in this sample of patients with lung cancer in Brazil. Rodrigues et al.96 analyzed the association between paracoccidioidomycosis (Pcm) and cancer in a series of 25 cases and to review the literature on this topic and claim that a diagnosis of Pcm appears to increase the risk of lung cancer. Marchi et al.97 evaluated how pleurodesis is performed in South and Central America and found considerable variation among the countries evaluated in terms of the indications for pleurodesis, techniques used, and outcomes. Talc slurry is the agent most commonly used, and thoracoscopy is the technique of choice in Brazil. Brandao et al.98 analyzed the clinical and pathological aspects of bronchiolo-alveolar carcinoma and the survival in a sample of patients at clinical stage I. Their data indicate these aspects were similar to those of patients with bronchiolo-alveolar carcinoma evaluated in previous studies. A number of studies fell into sundry categories. Coelho et al.99 evaluated predictors of health-related quality of life (HRQoL) in patients with interstitial lung disease and found that these in patients the degree of dyspnea had a major impact on the physical and mental HRQoL, and depression had an impact on mental HRQoL. Antunes et al.100 determine the interobserver and intraobserver agreement in the diagnosis of interstitial lung diseases based on HRCT scans and the impact of observer expertise, clinical data and confidence level on such agreement. They conclude that interobserver and intraobserver agreement in the diagnosis of ILDs based on HRCT scans ranged from fair to almost perfect and was influenced by radiologist expertise, clinical history and confidence level. Navarro et al.101 evaluated the biological and functional behavior of decellularized pulmonary homografts (Decell-H), treated by a sodium dodecil sulfate solution (0.1%) and found that in their experimental model, the Decell-H behaved as an excellent valve substitute. Pego-Fernandes et al.102 report on the functional evaluation experience with ex vivo perfusion of twelve donor lungs deemed unacceptable in Sao Paulo, Brazil. They claim that ex vivo evaluation model can improve oxygenation capacity of ‘‘marginal’’ lungs rejected for transplantation. It has a great potential to increase lung donor availability and, possibly, to reduce the waiting time on the list. Athanazio et al.103 profiled the characteristics of adult patients with bronchiectasis, drawing comparisons between cystic fibrosis patients and those with bronchiectasis from other causes in order to determine whether it is rational to extrapolate the bronchiectasis treatment given to CF patients to those with bronchiectasis from other causes. They conclude that causes and clinical manifestations of bronchiectasis are heterogeneous, and it

is important to identify the differences. It is crucial that these differences be recognized so that new strategies for the management of patients with bronchiectasis can be developed. de Souza et al.104 determined the prevalence of respiratory symptoms and smoking, as well as pulmonary function parameters among charcoal production workers in three cities in southern Brazil. They indicate that respiratory symptoms and airflow reduction were more common in the smoking workers. Desalu et al.105 determined whether respiratory symptoms and chronic bronchitis are associated with the use of biomass fuels among women residing in rural areas of the Ekiti State, in southwestern Nigeria and claim that their results underscore the need for women using biomass fuels in their households to replace them with a nontoxic type of fuel, such as electricity or gas. Desalu et al.106 also determined factors associated with nocturnal, productive and dry cough among young adults in Nigeria. Their results indicate that early prevention and treatment of conditions associated with cough, as well as the modification of social factors commonly associated with cough, are needed in order to reduce respiratory morbidity. Ferreira et al.107 surveyed the main congenital lung malformations treated and the principal diagnostic methods employed, as well as the indications for surgical treatment and the results obtained, at a referral facility for pediatric thoracic surgery. Their analysis shows that pulmonary resection for the treatment of congenital lung malformations is a safe procedure. presenting low morbidity and no mortality at a referral facility for pediatric thoracic surgery. Forgiarini et al.108 evaluated structural alterations of the lung in rats with diabetes mellitus, by quantifying oxidative stress and DNA damage; they alos determined the effects that exogenous superoxide dismutase has on such alterations and conclude that exogenous SOD can reverse changes in the lungs of animals with induced diabetes mellitus. Maranhao et al.109 propose a new classification criterion for the differentiation between pleural exudates and transudates quantifying total proteins in pleural fluid (TP-PF) and lactate dehydrogenase in pleural fluid (LDH-PF) exclusively; they also compare this new criterion with the classical criterion in terms of diagnostic yield. They understand that the diagnostic tool was comparable to the classical one and can be used in daily practice. Melo et al.110 determined the lung age of patients with morbid obesity and compared it with the chronological age of these patients, emphasizing the premature damage that morbid obesity does to the lungs. Pereira et al.111 evaluated the efficacy and safety of two inhalers for Mometasone furoate administration in patients with asthma and find that the use of the single-dose inhaler developed in Brazil is as effective and safe as is that of a standard inhaler in the treatment of patients with asthma. Pinheiro et al.112 compared the effects of early vs. late tracheostomy in patients with acute severe brain injury and conclude that early tracheostomy should be considered a first choice for patients with acute severe brain injury. Santana et al.113 endeavored to quantify fibrin thrombi in the small and medium-sized pulmonary arteries of patients with Wegener’s granulomatosis and report that confocal laser scanning microscopy revealed a significant association between pulmonary microvascular thrombosis and Wegener’s granulomatosis.

2165

Cardiopneumology in Brazilian scientific press Patel KK et al.

CLINICS 2011;66(12):2159-2168

21. Maluf MA, Carvalho AC, Carvalho WB. One and a half ventricular repair as an alternative for hypoplastic right ventricle. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:466-73. 22. da Rocha TS, da Silveira AS, Botta AM, Ricachinevsky CP, Mulle LD, Nogueira A. Serum lactate as mortality and morbidity marker in infants after Jateneâ&#x20AC;&#x2122;s operation. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:350-8. 23. de Souza AH, da Fonseca L, Franchi SM, Lianza AC, Baumgratz JF, da Silva JP. The hypoplastic left heart syndrome is not a risk factor for Fontan operation. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:506-9. 24. Rosa RFM, Dallâ&#x20AC;&#x2122;Agnol L, Zen PRG, Pereira VLB, Graziadio C, Paskulin GA. Oculo-auriculo-vertebral spectrum and cardiac malformations. Revista Da Associacao Medica Brasileira. 2010;561:62-6. 25. Coronel CC, Bordignon S, Bueno AD, Lima LL, Nesralla I. Ventilatory function and physical function perioperatives variables in heart transplantation. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:190-6. 26. Yoshimori DY, Cipriano G, Mair V, Branco JNR, Buffolo E. Assessment and medium-term follow up of heart transplant candidates undergoing low-intensity exercise. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:333-40. 27. Dinkhuysen JJ, Cipullo R, Contreras C, Finger MA, Manrique R, Magalhaes HM, et al. Farmacologic test pre implants in hypertension pulmonary elevated and still in candidates to heterotopic transplantation. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:371-6. 28. de Abreu-Silva EO, de Quadros AS, Zanettini MT, Gottschall CA. Angiographic Evaluation of Plaque Volume and Cardiovascular Events after Coronary Stent Implantation. Arquivos Brasileiros De Cardiologia. 2010;956:679-84. 29. Moriel G, Roscani MG, Matsubara LS, Cerqueira A, Matsubara BB. Quality of Life in Patients with Severe and Stable Coronary Atherosclerotic Disease. Arquivos Brasileiros De Cardiologia. 2010;956:691-6. 30. Duarte JJ, Pontes J, Gomes OM, da Silva GVR, Gardenal N, da Silva AF, et al. Correlation between right atrial venous blood gasometry and cardiac index in cardiac surgery postoperative. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:160-5. 31. da Silva RG, de Lima GG, Guerra N, Bigolin AV, Petersen LC. Risk index proposal to predict atrial fibrillation after cardiac surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:183-9. 32. Dantas CEP, de Sa MPL, Bastos ES, Magnanini MMF. Pericardium closure after heart operations: a safety option? Revista Brasileira De Cirurgia Cardiovascular. 2010;25(3):365-70. 33. Riedi C, Mora CTR, Driessen T, Coutinho MDG, Mayer DM, Moro FL, et al. Relation between respiratory muscle strength with respiratory complication on the heart surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:500-5. 34. Leal JMD, Carnevale FC, Nasser F, Santos ACB, Sousa WD, Zurstrassen CE, et al. Endovascular techniques and procedures, methods for removal of intravascular foreign bodies. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:202-8. 35. Laizo A, Delgado FED, Rocha GM. Complications that increase the time of hospitalization at ICU of patients submitted to cardiac surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:166-71. 36. Sa M, Sa M, Barbosa CH, Silva NPD, de Escobar RR, de Rueda FG, et al. Clinical and surgical profile of patients operated for postinfarction interventricular septal rupture. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:341-9. 37. Ferreira CCD, Peixoto MDG, Barbosa MA, Silveira EA. Prevalence of Cardiovascular Risk Factors in Elderly Individuals treated in the Brazilian Public Health System in Goiania. Arquivos Brasileiros De Cardiologia. 2010;955:621-8. 38. de Arruda ER, Lacerda HR, Moura L, de Albuquerque M, Miranda DD, Diniz GTN, et al. Profile of Patients with Hypertension Included in a Cohort with HIV/AIDS in the State of Pernambuco, Brazil. Arquivos Brasileiros De Cardiologia. 2010;955:640-7. 39. de Queiroz VM, Moreira PVL, de Vasconcelos THC, Vianna RPD. Prevalence and Anthropometric Predictors of High Blood Pressure in Schoolchildren from Joao Pessoa - PB, Brazil. Arquivos Brasileiros De Cardiologia. 2010;955:629-34. 40. Monteiro LZ, Fiani CRV, de Freitas MCF, Zanetti ML, Foss MC. Decrease in Blood Pressure, Body Mass Index and Glycemia after Aerobic Training in Elderly Women with Type 2 Diabetes. Arquivos Brasileiros De Cardiologia. 2010;955:563-70. 41. Camara LC, Ritti-Dias RM, Forjaz CLD, Greve JM, Santarem JM, Jacob W, et al. Cardiovascular Responses during Isokinetic Muscle Assessment in Claudicant Patients. Arquivos Brasileiros De Cardiologia. 2010;955:571-6. 42. Ribeiro RA, Stella SF, Zimerman LI, Pimentel M, Rohde LE, Polanczyk CA. Cost-Effectiveness of Implantable Cardioverter Defibrillators in Brazil in the Public and Private Sectors. Arquivos Brasileiros De Cardiologia. 2010;955:577-86.

REFERENCES 1. Magedanz EH, Bodanese LC, Guaragna J, Albuquerque LC, Martins V, Minossi SD, et al. Risk score elaboration for mediastinitis after coronary artery bypass grafting. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:154-9. 2. Cadore MP, Guaragna J, Anacker JFA, Albuquerque LC, Bodanese LC, Piccoli JDE, et al. A score proposal to evaluate surgical risk in patients submitted to myocardial revascularization surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:447-56. 3. de Carvalho MRM, Silva N, Klein CH, de Oliveira GMM. Application of the EuroSCORE in coronary artery bypass surgery in public hospitals in Rio de Janeiro, Brazil. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:209-17. 4. Sa M, Soares EF, Santos CA, Figueiredo OJ, Lima ROA, Escobar RR, et al. EuroSCORE and mortality in coronary artery bypass graft surgery at Pernambuco Cardiogologic Emergency Medical Services Pronto Socorro Cardiologico de Pernambuco. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:474-82. 5. Nery RM, Pietrobon RC, Mahmud MI, Zanini ME, Barbisan JN. Comparison of two models of risk stratification in patients submitted to elective coronary artery bypass surgery. Revista Da Associacao Medica Brasileira. 2010;565:547-50. 6. Botega FD, Cipriano G, Lima F, Arena R, da Fonseca JHP, Gerola LR. Cardiovascular behavior during rehabilitation after coronary artery bypass grafting. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:527-33. 7. Martini MR, Barbisan JN. Influence of physical activity during leisure time in patients in the follow-up two years after CABG. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:359-64. 8. Guizilini S, Bolzan DW, Faresin SM, Alves FA, Gomes WJ. Ministernotomy in Myocardial Revascularization Preserves Postoperative Pulmonary Function. Arquivos Brasileiros De Cardiologia. 2010;955:587-92. 9. Barros GF, Santos CD, Granado FB, Costa PT, Limaco RP, Gardenghi G. Respiratory muscle training in patients submitted to coronary arterial bypass graft. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:483-90. 10. Hijazi EM. Comparative study of traditional long incision vein harvesting and multiple incisions with small skin bridges in patients with coronary artery bypass grafting at King Abdullah University Hospital - Jordan. Revista Brasileira De Cirurgia Cardiovascular. 2010;252:197-201. 11. Gabriel EA, Locali RF, Matsuoka PK, Almeida LS, Silva PSV, Ishigai MMD, et al. Pulmonary artery perfusion does not improve brain natriuretic peptide (BNP) levels in suine experimental research. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:516-26. 12. Lins RMM, Lima RD, Silva FPV, de Menezes AM, Salerno PR, The EC, et al. Treatment of atrial fibrillation using ultrasonic cardiac ablation, during valvular heart surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:326-32. 13. Benfatti RA, Carli AF, da Silva GVR, Edgardo A, Dias MAS, Goldiano JA, et al. Epsilon-aminocaproic acid influence in bleeding and hemotransfusion postoperative in mitral valve surgery. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:510-5. 14. Guedes MAV, Pomerantzeff PMA, Brandao CMD, Vieira MLC, Grinberg M, Stolf NAG. Mitral valve surgery using right anterolateral thoracotomy: is the aortic cannulation a safety procedure? Revista Brasileira De Cirurgia Cardiovascular. 2010;253:322-5. 15. Guedes MAV, Pomerantzeff PMA, Brandao CMD, Vieira MLC, Leite OA, da Silva MF, et al. Mitral valve repair by Double Teflon technique: cardiac remodeling analysis by tridimensional echocardiography. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:534-42. 16. Gaia DF, Palma JH, Ferreira C, de Souza JAM, Agreli G, Guilhen JCS, et al. Transapical aortic valve implantation: results of a Brazilian prosthesis. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:293302. 17. do Amaral JJM, Pomerantzeff PMA, Casagrande ISJ, Cestari IA, Gutierrez PS, Stolf NG. Analysis of hemodynamic performance of the bovine pericardium valved conduit, implanted in the aortic position in ovines. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:543-51. 18. Dias RR, Mejia OAV, Fiorelli AI, Pomerantzeff PMA, Dias AR, Mady C, et al. Analysis of aortic root surgery with composite mechanical aortic valve conduit and valve-sparing reconstruction. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:491-9. 19. Lavitola PD, Sampaio RO, de Oliveira WA, Boer BN, Tarasoutchi F, Spina GS, et al. Warfarin or Aspirin in Embolism Prevention in Patients with Mitral Valvulopathy and Atrial Fibrillation. Arquivos Brasileiros De Cardiologia. 2010;956:749-54. 20. de Campos N, de Andrade RR, Silva MAD. Oral anticoagulation in carriers of mechanical heart valve prostheses. Experience of ten years. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:457-65.

2166

CLINICS 2011;66(12):2159-2168

Cardiopneumology in Brazilian scientific press Patel KK et al.

43. de Aguiar AAF, Mourilhe-Rocha R, Esporcatte R, Amorim LC, Tura BR, de Albuquerque DC. Long-Term Analysis in Acute Coronary Syndrome: are there any Differences in Morbidity and Mortality? Arquivos Brasileiros De Cardiologia. 2010;956:705-12. 44. Aguiar VB, Ochiai ME, Cardoso JN, Del Carlo CH, Morgado PC, Munhoz RT, et al. Relationship between Depression, BNP Levels and Ventricular Impairment in Heart Failure. Arquivos Brasileiros De Cardiologia. 2010;956:732-7. 45. Alves RJ, Campos RN, Nakiri K. Chronic and Regular Use of Statin Prevents Atrial Fibrillation in Period after Cardiac Surgery. Arquivos Brasileiros De Cardiologia. 2010;955:614-9. 46. da Silva CA, Pardi ACR, Goncalves TM, Borin SH. Electrocardiographic Profile and Muscle Glycogen Content of Rats Treated with Nandrolone. Arquivos Brasileiros De Cardiologia. 2010;956:720-4. 47. Diogo LP, Saitovitch D, Biehl M, Bahlis LF, Gutierres MC, O’Keeffe CF, et al. Is There an Association between Non-steroidal Anti-inflammatory Drugs and Contrast Nephropathy? Arquivos Brasileiros De Cardiologia. 2010;956:726-30. 48. Fagundes JE, Castro I. Predictive Value of Resting Heart Rate for Cardiovascular and All-cause Mortality. Arquivos Brasileiros De Cardiologia. 2010;956:713-8. 49. Feliciano-Alfonso JE, Mendivil CO, Ariza IDS, Perez CE. Cardiovascular risk factors and metabolic syndrome in a population of young students from the national university of Colombia. Revista Da Associacao Medica Brasileira. 2010;563:293-8. 50. Kalil RAK, de Salles FB, Giusti, Rodrigues, II CG, Han SW, Sant’Anna RT, et al. VEGF gene therapy for angiogenesis in refractory angina: Phase I/II clinical trial. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:311-21. 51. Gomes OM, Magalhaes MD, Abrantes RD. Myocardium functional recovery protection by omeprazole after ischemia-reperfusion in isolated rat hearts. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:388-92. 52. Minicucci MF, Azevedo PS, Ardisson LP, Okoshi K, Matsubara BB, Matsubara LS, et al. Relevance of the Ventricular Remodeling Pattern in the Model of Myocardial Infarction in Rats. Arquivos Brasileiros De Cardiologia. 2010;955:635-8. 53. de Azambuja LEO, Garrafa V. Jehovah’s witnesses attitude towards hemocomponents and hemoderivatives. Revista Da Associacao Medica Brasileira. 2010;566:705-10. 54. Ammirati AL, Watanabe R, Aoqui C, Draibe SA, Carvalho AB, Abensur H, et al. Hemoglobin levels in hemodialysis patients treated with epoetin: A brazilian experience. Revista Da Associacao Medica Brasileira. 2010;562:209-13. 55. Macedo PG, Neto EF, da Silva BT, Barreto JR, Maia H, Novakoski C, et al. Oral anticoagulation in patients with atrial fibrillation from guidelines to bedside. Revista Da Associacao Medica Brasileira. 2010;561:56-61. 56. Correia LCL, Barbosa CE, Cerqueira T, Vasconcelos A, Merelles S, Reis T, et al. Moderate Renal Dysfunction is not Associated with Elevated Troponin T in Acute Coronary Syndromes. Arquivos Brasileiros De Cardiologia. 2010;955:600-4. 57. Carvalho AB, Guerra G, Baptista MTM, de Faria APM, Marini S, Guerra ATM. Cardiovascular and renal anomalies in turner Syndrome. Revista Da Associacao Medica Brasileira. 2010;566:655-9. 58. Roxo JPF, Ponte EV, Ramos DCB, Pimentel L, D’Oliveira A, Cruz AA. Portuguese-language version of the Asthma Control Test: validation for use in Brazil. Jornal Brasileiro De Pneumologia. 2010;362:159-66. 59. Santos DD, Martins MC, Cipriano SL, Pinto RMC, Cukier A, Stelmach R. Pharmaceutical care for patients with persistent asthma: assessment of treatment compliance and use of inhaled medications. Jornal Brasileiro De Pneumologia. 2010;361:14-22. 60. Sarinho E, Kunz FC, Bellesi N, Maia P, Rizzo JA, Silva AR. Can multiple doses of BCG vaccine protect against asthma? Jornal Brasileiro De Pneumologia. 2010;363:281-5. 61. Sarria EE, Rosa RCM, Fischer GB, Hirakata VN, da Rocha NS, Mattiello R. Field-test validation of the Brazilian version of the Paediatric Asthma Quality of Life Questionnaire. Jornal Brasileiro De Pneumologia. 2010;364:417-24. 62. Razi E, Moosavi GA. Serum total IgE levels and total eosinophil counts: relationship with treatment response in patients with acute asthma. Jornal Brasileiro De Pneumologia. 2010;361:23-8. 63. Reck CL, Fiterman-Molinari D, Barreto SSM, Fiterman J. Poor perception of dyspnea following methacholine challenge test in patients with asthma. Jornal Brasileiro De Pneumologia. 2010;365:539-44. 64. Melo RE, Popov TA, Sole D. Exhaled breath temperature, a new biomarker in asthma control: A pilot study. Jornal Brasileiro De Pneumologia. 2010;366:693-9. 65. Lima PB, Santoro IL, Caetano LB, Cabral ALD, Fernandes ALG. Performance of a word labeled visual analog scale in determining the degree of dyspnea during exercise-induced bronchoconstriction in children and adolescents with asthma. Jornal Brasileiro De Pneumologia. 2010;365:532-8.

66. Dela Bianca ACC, Wandalsen GF, Mallol J, Sole D. Prevalence and severity of wheezing in the first year of life. Jornal Brasileiro De Pneumologia. 2010;364:402-9. 67. de Castro LKK, Neto AC, Ferreira OF. Prevalence of symptoms of asthma, rhinitis and atopic eczema among students between 6 and 7 years of age in the city of Londrina, Brazil. Jornal Brasileiro De Pneumologia. 2010;363:286-92. 68. Brandao HV, Cruz CS, Guimaraes A, Camargos PAM, Cruz AA. Predictors of hospital admission due to asthma in children and adolescents enrolled in an asthma control program. Jornal Brasileiro De Pneumologia. 2010;366:700-6. 69. Borges MC, Ferraz E, Pontes SMR, Cetlin A, Caldeira RD, da Silva CS, et al. Development and validation of an asthma knowledge questionnaire for use in Brazil. Jornal Brasileiro De Pneumologia. 2010;361: 8-13. 70. Almeida MLD, Santana PA, Guimaraes A, Gurgel RQ, Vianna EO. Asthma and pregnancy: repercussions for neonates. Jornal Brasileiro De Pneumologia. 2010;363:293-300. 71. Fonseca MD, Cader SA, Dantas EHM, Bacelar SC, da Silva EB, Leal SMD. Respiratory muscle training programs: impact on the functional autonomy of the elderly. Revista Da Associacao Medica Brasileira. 2010;566:642-8. 72. Silva DR, Gazzana MB, Knorst MM. Merit of preoperative clinical findings and functional pulmonary evaluation as predictors of postoperative pulmonary complications. Revista Da Associacao Medica Brasileira. 2010;565:551-7. 73. Costa D, Goncalves HA, de Lima LP, Ike D, Cancelliero KM, Montebelo MID. New reference values for maximal respiratory pressures in the Brazilian population. Jornal Brasileiro De Pneumologia. 2010;363:30612. 74. D’Aquino LC, Rodrigues SC, Barros JA, Rubin AS, Rosario NA, Pereira CAD. Predicting reduced TLC in patients with low FVC and a normal or elevated FEV(1)/FVC ratio. Jornal Brasileiro De Pneumologia. 2010;364:460-7. 75. Logrado VS, Sena EM, Matos RJD, da Silva TML, de Oliveira TR, Mendes KMB, et al. Impact that positive reinforcement during spirometry has on the measurement of VC in healthy volunteers. Jornal Brasileiro De Pneumologia. 2010;362:205-9. 76. Rodrigues MT, Fiterman-Molinari D, Barreto SSM, Fiterman J. The role of the FEF(50%)/0.5FVC ratio in the diagnosis of obstructive lung diseases. Jornal Brasileiro De Pneumologia. 2010;361:44-50. 77. Silveira JM, Gastaldi AC, Boaventura CD, Souza HC. Inspiratory muscle training in quadriplegic patients. Jornal Brasileiro De Pneumologia. 2010;363:313-9. 78. Felix EA, Andrade CF, Cardoso PFG, Thiesen GC, Antonio ACP, Martins LK, et al. Ventilation strategy and its influence on the functional performance of lung grafts in an experimental model of single lung transplantation using non-heart-beating donors. Jornal Brasileiro De Pneumologia. 2010;365:554-61. 79. Goncalves BD, Cavalini LT, Valente JG. Epidemiological monitoring of tuberculosis in a general teaching hospital. Jornal Brasileiro De Pneumologia. 2010;363:347-55. 80. Gupta S, Shenoy VP, Bairy I, Muralidharan S. Comparison among three cold staining methods in the primary diagnosis of tuberculosis: a pilot study. Jornal Brasileiro De Pneumologia. 2010;365:612-6. 81. Lundgren FLC, Costa AM, Figueiredo LC, Borba PC. Hemoptysis in a referral hospital for pulmonology. Jornal Brasileiro De Pneumologia. 2010;363:320-4. 82. Maciel ELN, Guidoni LM, Favero JL, Hadad DJ, Molino LP, Jonhson JL, et al. Adverse effects of the new tuberculosis treatment regimen recommended by the Brazilian Ministry of Health. Jornal Brasileiro De Pneumologia. 2010;362:232-8. 83. Marques M, Cunha EAT, Ruffino-Netto A, Andrade SMD. Drug resistance profile of Mycobacterium tuberculosis in the state of Mato Grosso do Sul, Brazil, 2000-2006. Jornal Brasileiro De Pneumologia. 2010;362:224-31. 84. Pedrozo C, Sant’Anna CC, March M, Lucena SC. Efficacy of the scoring system, recommended by the Brazilian National Ministry of Health, for the diagnosis of pulmonary tuberculosis in children and adolescents, regardless of their HIV status. Jornal Brasileiro De Pneumologia. 2010;361:92-8. 85. Martinelli LMB, Boas P, Queluz TT, Yoo HHB. Morphological prognostic factors in nosocomial pneumonia: an autopsy study. Jornal Brasileiro De Pneumologia. 2010;361:51-8. 86. Mattiello R, Mallol J, Fischer GB, Mocelin HT, Rueda B, Sarria EE. Pulmonary function in children and adolescents with postinfectious bronchiolitis obliterans. Jornal Brasileiro De Pneumologia. 2010;364:4539. 87. Senturk E, Telli M, Sen S, Cokpinar S. Thoracic catheter-related infections. Jornal Brasileiro De Pneumologia. 2010;366:753-8. 88. Melo CBD, Sarmento PA, Imaeda CJ, Daud DF, Hasimoto FN, Leao LEV. Descending necrotizing mediastinitis: minimally invasive thoracic surgical treatment. Jornal Brasileiro De Pneumologia. 2010;366:812-8.

2167

Cardiopneumology in Brazilian scientific press Patel KK et al.

CLINICS 2011;66(12):2159-2168

89. Fernandes FLA, Pavezi VAL, Dias SA, Pinto RMC, Stelmach R, Cukier A. Short-term effect of tiotropium in COPD patients being treated with a beta(2) agonist. Jornal Brasileiro De Pneumologia. 2010;362:181-9. 90. Ferrari R, Tanni SE, Lucheta PA, Faganello MM, do Amaral RAF, Godoy I. Gender differences in predictors of health status in patients with COPD. Jornal Brasileiro De Pneumologia. 2010;361:37-43. 91. Araujo ZTD, Holanda G. Does the BODE index correlate with quality of life in patients with COPD? Jornal Brasileiro De Pneumologia. 2010;364:447-52. 92. Camargo L, Pereira CAD. Dyspnea in COPD: Beyond the modified Medical Research Council scale. Jornal Brasileiro De Pneumologia. 2010;365:571-8. 93. Chatkin G, Chatkin JM, Aued G, Petersen GO, Jeremias ET, Thiesen FV. Evaluation of the exhaled carbon monoxide levels in smokers with COPD. Jornal Brasileiro De Pneumologia. 2010;363:332-8. 94. Machado L, Saad IAB, Honma HN, Morcillo AM, Zambon L. Evolution of performance status, body mass index, and six-minute walk distance in advanced lung cancer patients undergoing chemotherapy. Jornal Brasileiro De Pneumologia. 2010;365:588-94. 95. Franceschini J, Jardim JR, Fernandes ALG, Jamnik S, Santoro IL. Reproducibility of the Brazilian Portuguese version of the European Organization for Research and Treatment of Cancer Core Quality of Life Questionnaire used in conjunction with its lung cancer-specific module. Jornal Brasileiro De Pneumologia. 2010;365:595-602. 96. Rodrigues GD, Severo CB, Oliveira FD, Moreira JD, Prolla JC, Severo LC. Association between paracoccidioidomycosis and cancer. Jornal Brasileiro De Pneumologia. 2010;363:356-62. 97. Marchi E, Vargas FS, Madaloso BA, Carvalho MV, Terra RM, Teixeira LR. Pleurodesis for malignant pleural effusions: A survey of physicians in South and Central America. Jornal Brasileiro De Pneumologia. 2010;366:759-67. 98. Brandao DS, Haddad R, Marsico GA, Boasquevisque CHR. Clinicopathological aspects of and survival in patients with clinical stage 1 bronchioloalveolar carcinoma. Jornal Brasileiro De Pneumologia. 2010;362:167-74. 99. Coelho AC, Knorst VM, Gazzana MB, Barreto SSV. Predictors of physical and mental health-related quality of life in patients with interstitial lung disease: a multifactorial analysis. Jornal Brasileiro De Pneumologia. 2010;365:562-70. 100. Antunes VB, Meirelles GDP, Jasinowodolinski D, Pereira CAD, Verrastro CGY, Torlai FG, et al. Observer agreement in the diagnosis of interstitial lung diseases based on HRCT scans. Jornal Brasileiro De Pneumologia. 2010;361:29-36. 101. Navarro FB, da Costa FDA, Mulinari LA, Pimentel GK, Roder JG, Vieira ED, et al. Evaluation of the biological behavior of decellularized

102.

103.

104.

105. 106.

107. 108. 109.

110. 111.

112. 113.

2168

pulmonary homografts: an experimental sheep model. Revista Brasileira De Cirurgia Cardiovascular. 2010;253:377-87. Pego-Fernandes PM, Mariani AW, de Medeiros IL, Pereira AED, Fernandes FG, Unterpertinger FD, et al. Ex vivo lung evaluation and reconditioning. Revista Brasileira De Cirurgia Cardiovascular. 2010;254:441-6. Athanazio RA, Rached SZ, Rohde C, Pinto RC, Fernandes FLA, Stelmach R. Should the bronchiectasis treatment given to cystic fibrosis patients be extrapolated to those with bronchiectasis from other causes? Jornal Brasileiro De Pneumologia. 2010;364:425-31. de Souza RM, de Andrade FM, Moura ABD, Teixeira PJZ. Respiratory symptoms in charcoal production workers in the cities of Lindolfo Collor, Ivoti and Presidente Lucena, Brazil. Jornal Brasileiro De Pneumologia. 2010;362:210-7. Desalu OO, Adekoya AO, Ampitan BA. Increased risk of respiratory symptoms and chronic bronchitis in women using biomass fuels in Nigeria. Jornal Brasileiro De Pneumologia. 2010;364:441-6. Desalu OO, Salami AK, Seidu OA, Olokoba AB, Fadeyi A. Factors associated with nocturnal, productive and dry cough in the young adult population of Nigeria. Jornal Brasileiro De Pneumologia. 2010;363:32531. Ferreira HPD, Fischer GB, Felicetti JC, Camargo JDP, Andrade CF. Surgical treatment of congenital lung malformations in pediatric patients. Jornal Brasileiro De Pneumologia. 2010;362:175-80. Forgiarini LA, Kretzmann NA, Tieppo J, Picada JN, Dias AS, Marroni NAP. Lung alterations in a rat model of diabetes mellitus: effects of antioxidant therapy. Jornal Brasileiro De Pneumologia. 2010;365:579-87. Maranhao BL, Silva CT, Chibante AMD, Cardoso GP. Determination of total proteins and lactate dehydrogenase for the diagnosis of pleural transudates and exudates: redefining the classical criterion with a new statistical approach. Jornal Brasileiro De Pneumologia. 2010;364:468-74. Melo SMD, de Melo VA, de Melo EV, de Menezes RS, de Castro VL, Barreto MSP. Accelerated lung aging in patients with morbid obesity. Jornal Brasileiro De Pneumologia. 2010;366:746-52. Pereira CAD, Vianna FF, Cukier A, Stelmach R, de Oliveira JCA, Carvalho EV, et al. Efficacy and safety of two dry-powder inhalers for the administration of mometasone furoate in asthma patients. Jornal Brasileiro De Pneumologia. 2010;364:410-6. Pinheiro BD, Tostes RD, Brum CI, Carvalho EV, Pinto SPS, de Oliveira JCA. Early versus late tracheostomy in patients with acute severe brain injury. Jornal Brasileiro De Pneumologia. 2010;361:84-91. Santana ANC, Abâ&#x20AC;&#x2122;Saber AM, Teodoro WR, Capelozzi VL, Barbas CSV. Thrombosis in small and medium-sized pulmonary arteries in Wegenerâ&#x20AC;&#x2122;s granulomatosis: A confocal laser scanning microscopy study. Jornal Brasileiro De Pneumologia. 2010;366:724-30.

CLINICS 2011;66(12):2169-2171

DOI:10.1590/S1807-59322011001200025

CASE REPORT

Persistent pusher behavior after a stroke Taiza E. G. Santos-Pontelli,I Octavio M. Pontes-Neto,I Draulio B. de Araujo,II Antonio Carlos Santos,I Joao P. LeiteI I University of Saõ Paulo School of Medicine at Ribeiraõ Preto, Department of Neuroscience and Behavior, Ribeiraõ Preto/SP, Brazil. II Federal University of Rio Grande do Norte (UFRN), Brain Institute Natal/RN, Brazil.

Email: taiza@fmrp.usp.br Tel.: 55 16 3602-1222

Until now, PB has only been reported as a temporary and transitory phenomenon with a maximum recovery time of six months.8,22-24 Moreover, it has been suggested that PB does not negatively influence the functional outcomes of rehabilitation.10,22 Nevertheless, those assumptions have primarily emerged from case series of stroke patients admitted to stroke units or followed in rehabilitation centers in developed countries.10,22-24 Therefore, the actual impact of the disorder on stroke patients in developing countries may be underestimated. Here, we report three cases of stroke patients that had persistent PB with important disabling consequences on their functional outcomes.

INTRODUCTION Pusher behavior (PB) is a postural control disorder characterized by actively pushing away from the nonparetic side and resisting passive correction with a tendency to fall toward the paralyzed side.1 These patients have no awareness that their active pushing is counterproductive, which precludes the patients from standing without assistance. Several studies have already demonstrated that PB can occur in patients with lesions in both hemispheres, and PB is distinct from neglect and anosognosia.2-8 The high frequency of the association between PB and neurophysiological deficits might reflect an increased vulnerability of certain regions to stroke-induced injury rather than any direct involvement with the occurrence of PB.9,10 Traditionally, PB has only been reported in stroke patients; however, it has also been described under nonstroke conditions.8 Previous imaging studies have suggested the posterolateral thalamus as the brain structure that is typically damaged in pusher patients.4,11 Nevertheless, other cortical and subcortical areas, such as the insular cortex and post-central gyrus, have also been highlighted as structures that are potentially involved in the pathophysiology of PB.2,12-16 The mechanisms underlying PB have been attributed to vertical perception dysfunction that leads to postural reactive behavior.3,14,17-19 Nevertheless, the true changes in the verticality perception of these patients are still unclear. In this context, Karnath et al. identified five patients with severe PB who experience their body (subjective postural vertical [SPV]) as oriented ‘‘upright’’ when it is actually tilted approximately 18 ˚ toward the side of the brain lesion and with no subjective visual vertical (SVV) bias.3 Johansen et al. also found no SVV bias in 15 PB patients.20 In contrast, Pe´rrenou et al. found SPV, SVV, and subjective haptic vertical (SHV) biases toward the side opposite the brain lesion in six pusher patients.21 It is clear that, to state which vertical perception is disturbed in PB patients, the studies’ designs require a meticulous methodology, including the analysis of neglect and the influence of haptics on SVV in a large sample of PB patients.

CASE DESCRIPTION Patient 1: A 77-year-old right-handed male with a history of hypertension was admitted after being found confused and left-hemiparetic with an NIH stroke scale25 score of 20. Cranial CT revealed a right-middle cerebral artery ischemic stroke (Figure 1a; Table 1). The PB was identified 10 days after the onset of ictus with a Scale for Contraversive Pushing (SCP)3 score of 6, and he was discharged 10 days later. The patient was reevaluated 318 days after the onset of ictus and still presented severe PB (SCP = 6) and a Barthel Index25 score of zero. He died because of pneumonia a few weeks after his last reevaluation. Patient 2: A 74-year-old right-handed male with a history of alcohol and tobacco abuse was admitted with right hemiparesis and aphasia. A CT scan revealed ischemic strokes in the branches of his left-anterior and middle cerebral arteries (Figure 1b; Table 1). PB was identified nine days after the onset of ictus (SCP = 6). He was discharged after 20 days. Upon his last reevaluation 763 days after the onset of ictus, severe PB was still present, and he had a Barthel Index score of zero. Patient 3: A 65-year-old right-handed man with a history of a ruptured right-middle cerebral artery aneurysm treated by surgical clipping in another institution was referred to our outpatient stroke clinic 1.6 years after the onset of ictus when severe PB was identified (Figure 1c; Table 1). Severe PB was still present 729 days after the onset of ictus, and he had a Barthel Index score of 10. (The patient had occasional bladder and bowel incontinence.) He was found dead by his family members a few weeks after his final evaluation. In all of the cases, after the identification of PB, the patients were referred to public rehabilitation centers, but their adherence to their rehabilitation programs was neither optimized nor controlled. All of the patients had restricted access to physiotherapy (the mean number of sessions per

2169

Persistent pusher behavior Santos-Pontelli TEG et al.

CLINICS 2011;66(12):2169-2171

Figure - 1 a. CT scan from patient 1. Note an ischemic stroke of the M1 segment of the middle cerebral artery with a small hemorrhagic transformation in the perforating arteries territory. b. CT scan from patient 2 showing infarcts in branches of left anterior and middle cerebral arteries. c. MRI scan from patient 3 with an area of right frontotemporal encephalomalacia, 1.6 years after the surgical clipping of a right middle cerebral artery aneurysm.

which might reflect the maladaptive mechanisms underlying the lack of plasticity. Additional studies will be needed to understand the neuroplastic mechanisms of PB recovery using brain-activation techniques (functional magnetic resonance, single-photon emission computed tomography, positron emission tomography, magnetoencephalography, and eventrelated potential) and transcranial magnetic stimulation techniques. Spatial neglect has been identified as a factor that worsens the prognosis of PB,6,10,24 and this clinical characteristic was found in two of our patients. Thus, we cannot suggest that the poor recovery observed in our patients could be entirely due to the presence of spatial neglect. Moreover, we were unable to evaluate the perception of verticality. Future studies should explore whether the vertical misperceptions of the pusher patients influence the duration and severity of PB. The absence of sitting balance soon after stroke has consistently been shown to predict a poor recovery.33 Moreover, predicting the outcome of a stroke is important for triage decisions, prognostic estimates for the family, and the appropriate utilization of resources.34 It is noteworthy that while the patients presented PB, all of their daily life activities were compromised. Thus, this study highlights that PB can be much more incapacitating than generally believed.

week was less than 1) and remained lying in bed almost the entire day. Furthermore, upon their final reevaluations, all of the patients were completely dependent on their activities of daily living with a modified Rankin scale score of 5, the strengths of their arms and legs opposite their brain lesions did not change over time, and they had a persistent fear of falling.

DISCUSSION This is the first demonstration that PB can persist for more than two years, with disastrous impacts on functional outcomes. Certainly, the factors that negatively influenced the duration of PB were the limited frequency of physiotherapy and the absence of specific strategies for treating PB. In fact, some well-described physiotherapy approaches have been proposed,23,26-29 but there have been no randomized control trials that have confirmed their effectiveness. Still, there is strong evidence that stroke rehabilitation that is initiated early after onset and sustained across the healthcare continuum significantly reduces the probability of disability within the first year.30,31 Furthermore, the poor socioeconomic conditions of the patients restricted their home care and led to the patients lying in bed almost the entire day, despite their physiotherapeutic recommendations. Thus, the privation of experience in the vertical position after their strokes could have negatively influenced the patients’ prognoses. This observation raises the question of whether the duration of PB could be shortened by the simple attitude of remaining in a vertical position for several daylight hours. PB has been considered to be a neurological behavior that is not strongly associated with the recovery of motor control in the upper and lower limbs.24,32 Nevertheless, we observed poor concomitant PB recovery and other neurological deficits,

ACKNOWLEDGMENTS The authors acknowledge CAPES (Coordenaçaõ de Aperfeiçoamento de Pessoal de Nı´vel Superior) and FAPESP (Fundaçaõ de Amparo a` Pesquisa do Estado de Saõ Paulo) for their financial support.

AUTHOR CONTRIBUTIONS Santos-Pontelli TEG and Pontes-Neto designed and conceived the study, collected, analyzed, interpreted the data, and drafted the manuscript.

Table 1 - The demographic and clinical data of the patients.

Patient 1 2 3

Recovery time NIHSS SCP 318 763 789

20 21 14

6 6 6

Neglect Anosognosia Yes No Yes

Yes No No

Sensitive deficit

Muscle strengh Contralesioinal limbs/Ipsilesional limbs

Hemianopia

Aphasia

Hypoesthesia Hypoesthesia Hypoesthesia

0/5 1/5 2/4

Yes Yes Yes

No Yes No

Previous encephalic Barthel Dysarthria lesion Index Yes Yes Yes

No No No

0 0 10

PB, pusher behavior; NIHSS, National Institutes of Health Stroke Scale;25 BI, Barthel Index;25 SCP, Scale for Contraversive Pushing.3 Spatial neglect was evidenced by typical clinical behavior and positive results on the ‘‘clock-drawing’’, ‘‘cancellation’’ and ‘‘line-bisection’’ tests.35

2170

CLINICS 2011;66(12):2169-2171

Persistent pusher behavior Santos-Pontelli TEG et al. 19. Perennou DA, Amblard B, Leblond C, Pelissier J. Biased postural vertical in humans with hemispheric cerebral lesions. Neurosci Lett. 1998;252:758, doi: 10.1016/S0304-3940(98)00501-1. 20. Johannsen L, Fruhmann Berger M, Karnath HO. Subjective visual vertical (SVV) determined in a representative sample of 15 patients with pusher syndrome. J Neurol. 2006;253:1367-9, doi: 10.1007/s00415-0060216-x. 21. Perennou DA, Mazibrada G, Chauvineau V, Greenwood R, Rothwell J, Gresty MA, et al. Lateropulsion, pushing and verticality perception in hemisphere stroke: a causal relationship? Brain. 2008;131:2401-13, doi: 10. 1093/brain/awn170. 22. Karnath HO, Johannsen L, Broetz D, Ferber S, Dichgans J. Prognosis of contraversive pushing. J Neurol. 2002;249:1250-3, doi: 10.1007/s00415002-0824-z. 23. Broetz D, Johannsen L, Karnath HO. Time course of ’pusher syndrome’ under visual feedback treatment. Physiother Res Int. 2004;9:138-43, doi: 10.1002/pri.314. 24. Danells CJ, Black SE, Gladstone DJ, McIlroy WE. Poststroke ‘‘pushing’’: natural history and relationship to motor and functional recovery. Stroke; a journal of cerebral circulation. 2004;35:2873-8, doi: 10.1161/01. STR.0000147724.83468.18. 25. Cincura C, Pontes-Neto OM, Neville IS, Mendes HF, Menezes DF, Mariano DC, et al. Validation of the National Institutes of Health Stroke Scale, modified Rankin Scale and Barthel Index in Brazil: the role of cultural adaptation and structured interviewing. Cerebrovascular diseases (Basel, Switzerland). 2009;27:119-22, doi: 10.1159/000177918. 26. Paci M, Nannetti L. Physiotherapy for pusher behaviour in a patient with post-stroke hemiplegia. J Rehabil Med. 2004;36:183-5, doi: 10.1080/ 16501970410029762. 27. Paci M, Rinaldi LA. Physiotherapy for pusher behaviour. NeuroRehabilitation. 2005;20:347. 28. Broetz D, Karnath HO. New aspects for the physiotherapy of pushing behaviour. NeuroRehabilitation. 2005;20:133-8. 29. Shepherd RB, Carr JA. New aspects for the physiotherapy of pushing behaviour, D. Broetz and H.-O. Karnath, Neurorehabilitation 20 (2005), 133-138. NeuroRehabilitation. 2005;20:343-5. 30. Miller EL, Murray L, Richards L, Zorowitz RD, Bakas T, Clark P, et al. Comprehensive overview of nursing and interdisciplinary rehabilitation care of the stroke patient: a scientific statement from the American Heart Association. Stroke; a journal of cerebral circulation. 2010;41:2402-48, doi: 10.1161/STR.0b013e3181e7512b. 31. Cumming TB, Thrift AG, Collier JM, Churilov L, Dewey HM, Donnan GA, et al. Very early mobilization after stroke fast-tracks return to walking: further results from the phase II AVERT randomized controlled trial. Stroke; a journal of cerebral circulation. 2011;42:153-8, doi: 10.1161/ STROKEAHA.110.594598. 32. Santos-Pontelli TE, Pontes-Neto OM, Colafemina JF, Araujo DB, Santos AC, Leite JP. Pushing behavior and hemiparesis: which is critical for functional recovery in pusher patients? Case report. Arq Neuropsiquiatr. 2007;65:536-9, doi: 10.1590/S0004-282X2007000300035. 33. Tyson SF. Measurement error in functional balance and mobility tests for people with stroke: what are the sources of error and what is the best way to minimize error? Neurorehabil Neural Repair. 2007;21:46-50, doi: 10.1177/1545968306290662. 34. Wright CJ, Swinton LC, Green TL, Hill MD. Predicting final disposition after stroke using the Orpington Prognostic Score. Can J Neurol Sci. 2004;31:494-8. 35. Kerkhoff G. Spatial hemineglect in humans. Prog Neurobiol. 2001;63:127, doi: 10.1016/S0301-0082(00)00028-9.

Araujo DB and Santos AC designed the study, analyzed, interpreted the data and revised the manuscript. Leite JP designed and conceived the study, analyzed and interpreted the data, and revised the manuscript.

REFERENCES 1. Davies PM. Steps to follow: a guide to the treatment of adult hemiplegia. New York: Springer 1985. 2. Pedersen PM, Wandel A, Jorgensen HS, Nakayama H, Raaschou HO, Olsen TS. Ipsilateral pushing in stroke: incidence, relation to neuropsychological symptoms, and impact on rehabilitation. The Copenhagen Stroke Study. Arch Phys Med Rehabil. 1996;77:25-8, doi: 10.1016/S00039993(96)90215-4. 3. Karnath HO, Ferber S, Dichgans J. The origin of contraversive pushing: evidence for a second graviceptive system in humans. Neurology. 2000;55:1298-304. 4. Karnath HO, Ferber S, Dichgans J. The neural representation of postural control in humans. Proc Natl Acad Sci U S A. 2000;97:13931-6, doi: 10. 1073/pnas.240279997. 5. Premoselli S, Cesana L, Cerri C. Pusher syndrome in stroke: clinical, neuropsychological, and neurophysiological investigation. Eur Med Phys. 2001;37:143-51. 6. Pe´rrenou DA, Laassel B, Benaim EM, Herisson C, Pelissier C. J. Understanding the pusher behavior of some stroke patients with spatial deficit: A pilot study. Phys Med Rehabil. 2002;83:570-5, doi: 10.1053/ apmr.2002.31198. 7. Bohannon RW. Pusher syndrome. Phys Ther. 2004;84:580-1; author reply 2-3. 8. Santos-Pontelli TE, Pontes-Neto OM, Colafemina JF, de Araujo DB, Santos AC, Leite JP. Contraversive pushing in non-stroke patients. J Neurol. 2004;251:1324-8, doi: 10.1007/s00415-004-0532-y. 9. Rorden C, Karnath HO. Using human brain lesions to infer function: a relic from a past era in the fMRI age? Nature reviews. 2004;5:813-9, doi: 10.1038/nrn1521. 10. Karnath HO. Pusher syndrome-a frequent but little-known disturbance of body orientation perception. J Neurol. 2007;254:415-24, doi: 10.1007/ s00415-006-0341-6. 11. Karnath HO, Johannsen L, Broetz D, Kuker W. Posterior thalamic hemorrhage induces ‘‘pusher syndrome’’. Neurology. 2005;64:1014-9, doi: 10.1212/01.WNL.0000154527.72841.4A. 12. Reding M, David A, Volpe B. Neuroimaging study of the pusher syndrome post stroke. XVI World Congress of Neurology, Buenos Aires, Argentina, September 14-19. J Neurol Sci. 1997;150:S129, doi: 10.1016/ S0022-510X(97)85489-5. 13. Johannsen L, Broetz D, Naegele T, Karnath HO. ‘‘Pusher syndrome’’ following cortical lesions that spare the thalamus. J Neurol. 2006;253:45563, doi: 10.1007/s00415-005-0025-7. 14. Saj A, Honore J, Coello Y, Rousseaux M. The visual vertical in the pusher syndrome: influence of hemispace and body position. J Neurol. 2005;252:885-91, doi: 10.1007/s00415-005-0716-0. 15. Paci M, Nannetti L. The pusher syndrome in a patient with cerebellar infarction. Physiother Res Int. 2005;10:176-7, doi: 10.1002/pri.8. 16. Karnath HO, Suchan J, Johannsen L. Pusher syndrome after ACA territory infarction. Eur J Neurol. 2008;15:e84-5, doi: 10.1111/j.1468-1331. 2008.02187.x. 17. Karnath HO, Broetz D. Understanding and treating ‘‘pusher syndrome’’. Phys Ther. 2003;83:1119-25. 18. Johannsen L, Broetz D, Karnath HO. Leg orientation as a clinical sign for pusher syndrome. BMC Neurol. 2006;6:30, doi: 10.1186/1471-2377-6-30.

2171

CLINICS 2011;66(12):2173-2175

DOI:10.1590/S1807-59322011001200026

CASE REPORT

Spontaneous bacterial peritonitis complicating ovarian hyperstimulation syndrome-related ascites Leandro Utino Taniguchi,I,II Claúdia Gennari Lacerda Jorge,I Lucas Fernandes de OliveiraI I Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Discipline of Emergency Medicine, Saõ Paulo/SP, Brazil. II Hospital Sı´rio Libaneˆs, Intensive Care Unit, Saõ Paulo/SP, Brazil.

Email: leandrout@hotmail.com Tel.: 55 11 2261-6336

small bilateral pleural effusions were observed on the thoracic radiographs. Transabdominal ultrasonographic examination at admission revealed a viable intrauterine twin pregnancy with bilateral multiloculated cystic ovaries (right ovary 5.864.464.8 cm, estimated volume 64 cm3; left ovary 5.964.565.3 cm, estimated volume 86 cm3) and ascites. Laboratory values were as follows: hemoglobin, 15 g/dL; hematocrit, 42.7%; leukocyte count, 18,540/mm3; platelet count, 450,000/mL; serum sodium, 133 mmol/L; potassium, 4.7 mmol/L; creatinine, 0.6 mg/dL; and albumin, 3.5 g/dL. The levels of hepatic transaminases were slightly elevated (AST 45 IU/L, ALT 27 IU/L), but the bilirubin levels were normal. The results of a hormonal assay for thyroid function were normal. The serum E2 level was 6,204 pg/mL, and the human chorionic gonadotropin level was 14,765 mIU/mL. Serology results for viral hepatitis were negative. OHSS was suspected, and supportive care in the intensive care unit (ICU) was initiated. Intravenous crystalloid hydration and 20% albumin (150 mL/day) was started. Heparin (5,000 IU three times a day) was administered for thromboembolic prophylaxis. The patient responded well and maintained adequate urine output. The hemoconcentration resolved, and the patient was discharged to an obstetric ward. After one week, the patient developed fever, shivering, and renal failure (creatinine 1.68 mg/dL). C-reactive protein increased from 42.7 to 116 mg/L. Because of the respiratory compromise, transvaginal paracentesis was performed during which 4 L of ascites was aspirated. Fluid analysis revealed 520 cells/mm3 with 400 polymorphonuclear (PMN) cells/mm3 and a total protein concentration of 5.0 g/dL. Escherichia coli was recovered from the ascitic fluid culture. Ceftriaxone was initiated, guided by a culture antibiogram. Human albumin was administered at 1.5 g/kg on the first day and at 1.0 g/kg on the third day of antibiotic treatment. The patient’s general condition and renal function improved. No other source of infection was discovered. After 48 h of treatment, another transvaginal paracentesis was necessary to alleviate discomfort from tense ascites. Fluid analysis demonstrated improvement of the cell count (from 520/mm3 to 280/mm3). Ceftriaxone was discontinued after eight days of treatment. The patient remained in the hospital for another month because of two further episodes of bacteremia documented by blood cultures (one episode with Escherichia coli ESBL and the other with Acinetobacter baumannii). Both episodes were successfully treated with antibiotics (E. coli treated

INTRODUCTION Ovarian hyperstimulation syndrome (OHSS) is a lifethreatening iatrogenic complication of in vitro fertilization (IVF).1 One of the characteristic features of OHSS is increased vascular permeability due to the overproduction of vasoactive mediators from hyperstimulated and enlarged ovaries. Such altered permeability leads to fluid shifts from intravascular to interstitial or third-space compartments.2-4 Clinical manifestations, therefore, include hemoconcentration, hypovolemia, decreased renal perfusion, hypotension, electrolyte imbalance, and in severe forms (0.5%–5% of cases), tense ascites.5,6 In addition, lower-than-normal levels of plasma immunoglobulin have been detected in patients with severe OHSS,7 which may predispose patients to serious infections.8 In this report, we describe a woman with OHSS without previous liver disease who developed a previously unreported infectious complication: spontaneous bacterial peritonitis (SBP).

CASE DESCRIPTION A 36-year-old woman was admitted to Hospital das Clı´nicas, University of Sa˜o Paulo, Brazil during her pregnancy five weeks after IVF was performed at another health service. She was previously healthy but had attempted IVF three times without success. The previous IVF procedure had been complicated with mild OHSS that did not require hospitalization or treatment. The protocols for ovarian stimulation and ovulation induction were unknown. The patient had also noticed abdominal enlargement at the time of oocyte retrieval (25 oocytes collected). Five days later, two embryos were transferred, and human albumin was administered intravenously. Three weeks after embryo transfer, she was admitted to our service due to abdominal discomfort, hyperemesis, low urine output, and weight gain (7 kg in the previous seven days). The patient’s core temperature and blood pressure were normal. Her abdomen was distended, and ascites was detectable during physical examination. Although her breathing and oxygen saturation in room air were normal,

2173

Spontaneous bacterial peritonitis in OHSS Taniguchi LU et al.

CLINICS 2011;66(12):2173-2175

with piperacillin/tazobactam and A. baumannii with meropenem) and by transvaginal paracentesis (5 L of ascites aspirated) with albumin infusion for the alleviation of abdominal hypertension and discomfort. The patient was discharged from the hospital after a total of two months of hospitalization. At 31 weeks of gestation, the patient was readmitted for assessment of fetal vitality. At 34 weeks of gestation, premature rupture of membranes occurred. Caesarean section was performed without complications. The mother and both babies were discharged in good condition two days after the delivery.

typically has a high protein concentration, with elevated levels of albumin and IgG.7,18 Therefore, elevated opsonic activity is expected, and SBP is likely to be a rare event. Nevertheless, hypogammaglobulinemia occurs in cases of severe OHSS and might predispose patients to severe infections.7,8 Our patient had 400 PMN cells/mm3 and a positive culture for Enterobacteriaceae, which is diagnostic of SBP, and two additional severe infections, suggesting a predisposition for infections. Albumin administration has been suggested to be an effective plasma expander in OHSS, and it has also been demonstrated to be beneficial in the treatment of cirrhotic patients with SBP.1,11,19 Sort et al.19 established that in addition to antibiotics, albumin reduces mortality and renal impairment if given early at a dose of 1.5 g/kg of body weight at the time of diagnosis followed by 1 g/kg on day 3. The mechanisms of action might be related to the prevention of circulatory dysfunction and to the subsequent activation of vasoconstrictor systems. Because the pathogenesis of OHSS and cirrhosis share some features (low arterial pressure, vasodilation, activation of vasoconstrictor systems),18,20 albumin administration for the prevention of hemodynamic derangement in patients with OHSS may be beneficial. Clinical trials specifically designed to evaluate this aspect are needed. In our case, we decided to treat the patient as suggested for cirrhotic patients despite the lack of evidence for good recovery when applied to OHSS.

DISCUSSION Ovarian hyperstimulation syndrome is an iatrogenic complication of the ovarian stimulation commonly used for IVF. The condition is potentially life-threatening; therefore, it represents one of the most serious complications of assisted reproduction treatments.9 In this case report, we describe SBP as a new infectious complication of OHSS.

Summary of the case report and SBP as a novel infection in OHSS We presented a patient with serious illness due to OHSS. Some laboratory findings for our patient were characteristic of severe OHSS, including leukocytosis (white blood cell count .15,000), electrolyte imbalances (hyponatremia: sodium ,135 mEq/L), and elevated liver enzymes.1 The evolution of this condition was complicated by the occurrence of SBP due to E. coli, which was successfully treated with antibiotics and intravenous human albumin administration. SBP is characterized by the spontaneous infection of ascitic fluid in the absence of an intraabdominal source of infection.12 The occurrence of peritonitis associated with OHSS was the subject of a previous case report, but in that case, the infection was due to perforated appendicitis.13 No previous report of an association between SBP and OHSS was found. Therefore, the occurrence of this infectious complication during OHSS appears to be novel.

Risk factors and the prevention of OHSS Recognition of the risk factors for OHSS is a crucial step in the identification of patients with a high-risk profile who would demand careful follow-up after ovulation induction and might benefit from prevention strategies. The described risk factors for OHSS include young age, low body weight, polycystic ovary syndrome, and previous episodes of OHSS.1,6-8 The large number of retrieved oocytes in this case is also of concern because it may be associated with OHSS.11 Our patient also reported a previous episode of OHSS, and importantly, described symptoms at the time of embryo transfer. The transfer of two embryos into a patient with this condition, as in this case, is perhaps inadvisable for a high-risk patient already exhibiting OHSS symptoms. The transfer of a single embryo would eliminate the possibility of multiple pregnancies and, perhaps, reduce the incidence of OHSS.5 Several strategies have been reported to prevent OHSS, including albumin administration, coasting, dopamine agonists, in vitro maturation of oocytes, reduced human chorionic gonadotropin (hCG) dosage, non-steroidal antiinflammatory administration, GnRH antagonist protocol, and using a GnRH agonist instead of hCG to induce oocyte maturation.4,5,9 The last two strategies have been reported to achieve good results in preventing OHSS.4 A recent update of a Cochrane review comparing GnRH antagonists with agonists demonstrated that the OHSS rate in women receiving antagonists is significantly lower than in those treated with the agonist protocols.21 Although albumin was administered and has previously been used in high-risk women for OHSS prevention,4,5 most recent evidence does not support this practice.22 In conclusion, we describe SBP as a novel life-threatening infectious complication of OHSS. In cases of sepsis with unknown causes, prompt paracentesis to determine the cell count may reveal SBP. The timely administration of

The occurrence of SBP in OHSS The most important aspect of our case report is the evidence of SBP as a cause of sepsis during OHSS. The presence of .250 PMN cells/mm3 in the ascitic fluid is diagnostic of this condition and mandates immediate treatment.12 Ascitic fluid cultures are negative in 30-50% of cases and, when positive, usually grow gram-negative enteric bacteria (typically Escherichia coli and Klebsiella pneumoniae). When $250 PMN cells/mm3 are present in ascites, patients with positive or negative ascitic fluid cultures share common clinical, prognostic, and therapeutic characteristics. A delay in antibiotic treatment could result in a significant and potentially fatal deterioration in clinical status.14 Such infections are typically associated with advanced cirrhosis, rather than non-cirrhotic ascites.14 This finding probably reflects the constellation of derangements that occur with cirrhosis, such as increased intestinal permeability with bacterial translocation into the bloodstream, alteration in the systemic immune system, and impaired ascitic fluid defense mechanisms.14 Specifically, a low protein concentration in the ascitic fluid predisposes patients to SBP.15-17 The ascitic fluid in OHSS patients

2174

CLINICS 2011;66(12):2173-2175

Spontaneous bacterial peritonitis in OHSS Taniguchi LU et al. 10. Navot D, Relou A, Birkenfeld A, Rabinowitz R, Brzezinski A, Margalioth EJ. Risk factors and prognostic variables in the ovarian hyperstimulation syndrome. Am J Obstet Gynecol. 1988;159:210–5. 11. Vlahos NF, Gregoriou O. Prevention and management of ovarian hypestimulation syndrome. Ann N Y Acad Sci. 2006;1092:247-64, doi: 10.1196/annals.1365.021. 12. Rimola A, Garcia-Tsao G, Navasa M, Piddock LJV, Planas R, Bernard B, Inadomi JM, et al. Diagnosis, treatment and prophylaxis of spontaneous bacterial peritonitis: a consensus document. International Ascites Club. J Hepatol. 2000;2:142–53, doi: 10.1016/S0168-8278(00)80201-9. 13. Fujimoto A, Osuga Y, Yano T, Kusumi M, Kurosawa T, Fujii T, et al. Ovarian hyperstimulation syndrome complicated by peritonitis due to perforated appendicitis. Hum Reprod. 2002;17:966–7, doi: 10.1093/ humrep/17.4.966. 14. Such J, Runyon BA. Spontaneous bacterial peritonitis. Clin Infect Dis. 1998;27:669–76, doi: 10.1086/514940. 15. Llach J, Rimola A, Navasa M, Gine`s P, Salmeroń JM, Gine`s A, et al. Incidence and predictive factors of first episode of spontaneous bacterial peritonitis in cirrhosis with ascites: relevance of ascitic fluid protein concentration. Hepatology. 1992;16:724-7, doi: 10.1002/hep.1840160318. 16. Runyon BA. Patients with deficient ascitic fluid opsonic activity are predisposed to spontaneous bacterial peritonitis. Hepatology. 1988;8:632–5, doi: 10.1002/hep.1840080332. 17. Runyon BA. Low-protein-concentration ascitic fluid is predisposed to spontaneous bacterial peritonitis. Gastroenterology. 1986;91:1343-6. 18. Fa´bregues F, Balasch J, Gine`s P, Manau D, Jimeńez W, Arroyo V, et al. Ascites and liver test abnormalities during severe ovarian hyperstimulation syndrome. Am J Gastroenterol. 1999;94:994-9. 19. Sort P, Navasa M, Arroyo V, Aldeguer X, Planas R, Ruiz-del-Arbol L, et al. Effect of intravenous albumin on renal impairment and mortality in patients with cirrhosis and spontaneous bacterial peritonitis. N Engl J Med. 1999;341:403-9, doi: 10.1056/NEJM199908053410603. 20. Balasch J, Arroyo V, Fa´bregues F, Juan S, Jimeńez W, Pare´ JC, et al. Neurohormonal and hemodynamic changes in severe cases of the ovarian hyperstimulation syndrome. Ann Intern Med. 1994;121:27–33. 21. Al-Inany HG, Youssef MA, Aboulghar M, Broekmans F, Sterrenburg M, Smit J, et al. GnRH antagonists are safer than agonists: an update of a Cochrane review. Hum Reprod Update. 2011;17:435, doi: 10.1093/ humupd/dmr004. 22. Bellver J, Munoˆz EA, Ballesteros A, Soares SR, Bosch E, Simoń C, et al. Intravenous albumin does not prevent moderate-severe ovarian hyperstimulation syndrome in high-risk IVF patients: a randomized controlled study Human Reproduction. 2003;18:2283-8.

antibiotics is indicated if the diagnosis of SBP is made. Minimizing the risk of OHSS is a key issue, and the importance of the prevention of OHSS cannot be overemphasized.

AUTHOR CONTRIBUTIONS All authors collected the data and helped to draft the manuscript. All authors read and approved the final manuscript.

REFERENCES 1. The Practice Committee of the American Society for Reproductive Medicine. Ovarian hyperstimulation syndrome. Fertil Steril. 2008; 90(Suppl 3):S188-93. 2. Budev MM, Arroliga AC, Falcone T. Ovarian hyperstimulation syndrome. Crit Care Med. 2005;33(Suppl):S301–6, doi: 10.1097/01.CCM. 0000182795.31757.CE. 3. Soares SR, Gomez R, Simon C, Garcia-Velasco JA, Pellicer A. Targeting the vascular endothelial growth factor system to prevent ovarian hyperstimulation syndrome. Hum Reprod Update. 2008;14:321–33, doi: 10.1093/humupd/dmn008. 4. Nastri CO, Ferriani RA, Rocha IA, Martins WP. Ovarian hyperstimulation syndrome: pathophysiology and prevention. J Assist Reprod Genet. 2010; 27:121-8, doi: 10.1007/s10815-010-9387-6. 5. Delvigne A, Rozenberg S. Epidemiology and prevention of ovarian hyperstimulation syndrome (OHSS): a review. Hum Reprod Update. 2002;8:559–77, doi: 10.1093/humupd/8.6.559. 6. Golan A, Ronel R, Herman A, Soffer Y, Weinraub Z, Caspi E. Ovarian hyperstimulation syndrome: an update review. Obstet Gynecol Surv. 1989;44:430-40, doi: 10.1097/00006254-198906000-00004. 7. Abramov Y, Naparstek Y, Elchalal U, Lewin A, Schechter E, Schenker JG. Plasma immunoglobulins in patients with severe ovarian hyperstimulation syndrome. Fertil Steril. 1999;71:102–5, doi: 10.1016/S00150282(98)00399-9. 8. Abramov Y, Elchalal U, Schenker JG. Febrile morbidity in severe and critical ovarian hyperstimulation syndrome: a multicentre study. Hum Reprod. 1998;13:3128–31, doi: 10.1093/humrep/13.11.3128. 9. Ata B, Seyhan A, Orhaner S, Urman B. High dose cabergoline in management of ovarian hyperstimulation syndrome. Fertil Steril. 2009;92:1168.e1-e4, doi: 10.1016/j.fertnstert.2009.05.021.

2175

CLINICS 2011;66(12):2177-2178

DOI:10.1590/S1807-59322011001200027

CASE REPORT

Thymic hyperplasia in Graves’ disease Debora Lucia Seguro Danilovic,I Regina Matsunaga Martin,II Pedro Caruso,III Suemi MaruiII I

Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Unidade de Tireoide, Endocrinology and Metabolism Department. Saõ Paulo/SP, Brazil. II Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Endocrinology and Metabolism Department, Saõ Paulo/ SP, Brazil. III Hospital das Clıńicas da Faculdade de Medicina da Universidade de Saõ Paulo, Pneumology Department, Saõ Paulo/SP, Brazil. Email: suemimar@usp.br Tel.: 55 11 30617253

Therefore, Graves’ disease was diagnosed, and a thymus growth was then attributed to hyperplasia caused by Graves’ disease. Methimazol (20 mg/day) was initiated, and after four months of treatment, symptoms had improved, and thyroid hormones had normalized. Goiter and TRab values had reduced. After six months of thyroid hormonal control, a new CT revealed marked thymus shrinkage (Figure 1B). After 24 months, the patient was in remission of Graves disease, with negative TRab values and a normal thoracic CT scan. Graves ophthalmopathy was never presented.

CASE DESCRIPTION Over the last year, a 40-year-old man had complained of weekly episodes of facial flushing, diaphoresis, irritability,and diarrhea, which were triggered by emotional stress or exercise. He also presented with chest discomfort and had lost 6 kg. He had poorly controlled essential hypertension that had lasted over the last six years. On examination, his systolic blood pressure was 160 mm Hg, his diastolic blood pressure was 110 mm Hg, his heart rate was 110 beats/min, and his body mass index was 32 kg/m2; he did not present with postural hypotension. A small goiter without nodules and a slight lid retraction were noted. He had no facial flushing or hand tremor. During the chest discomfort investigation, the chest X-ray revealed an anterior mediastinal enlargement. A thoracic computed tomography (CT) scan revealed a homogeneous mass with no adjacent structure invasion or calcification at the topography of the thymus enlargement (Figure 1A). Goiter was also detected but did not extend to the intrathoracic compartment. A carcinoid syndrome caused by a primary neuroendocrine tumor was suspected. The patients exams depicted normal values of urinary 5hydroxyindoleacetic acid (2.8 and 3.1 mg/24 h, normal values-NV 2-6), urinary metanephrines (1.0 and 0.09 mcg/ mg creatinine, NV ,1.2), serum calcitonin (7.3 pg/mL, NV ,11.5), negative tumoral markers b-hCG and alpha-fetoprotein. Thyrotoxicosis was diagnosed from the following fluoroimmunoassay measurements: total T3, 371 ng/dL (NV 40–180 ng/dL); total T4, 20.9 mcg/dL (NV 4.5– 12 mcg/dL); free T4, 4.9 ng/dL (NV 0.7–1.5 ng/dL); and a suppressed TSH,0.03 mUI/L (NV 0.4–4.5 mUI/L). Serum antiperoxidase and antithyroglobulin antibodies measured by fluoroimmunoassay were positive (859 and 72 U/mL, NV,35 U/mL), with levels of TSH-receptor antibody (TRab) of 49% (radioimmunometric assay NV,8%). Ultrasound thyroid imaging revealed a 43.2 g homogeneous hypoechogenic goiter, which did not have nodules and was limited to the neck.

DISCUSSION We described a patient with systemic arterial hypertension and thoracic discomfort that presented an anterior mediastinal mass and Graves disease. In adults, thymoma is a common neoplasm of the anterior mediastinal compartment and occurs between 40 and 60 years of age with a slightly male predominance. Chest discomfort or pain is the most common symptom. However, our patient also presented episodic flushing, diaphoresis, and diarrhea, which are common symptoms for carcinoid syndrome. Together with the anterior mediastinal enlargement, carcinoid syndrome that had resulted from a neuroendocrine tumor was initially suspected. Primary neuroendocrine tumors of the thymus account for less than 5% of all anterior mediastinal neoplasms. They are highly aggressive and more prevalent in men during the fourth and fifth decades of life. The symptoms are related to structure compression, distant metastasis, or endocrinopathies, including carcinoid syndrome. A CT-scan usually shows a lobulated thymic mass with heterogeneous enhancement and central areas of low attenuation, before necrosis and hemorrhage, and eventually calcifications.1 The presence of normal 24-hour urinary vanillylmandelic acid and metanephrine levels ruled out the possibility of neuroendocrine tumors. Normal testing physical examination and undetectable alphafetoprotein and beta human chorionic gonadotropin levels also ruled out the possibility of nonseminomatous germcell tumors.1 Combining the hormonal thyroid abnormalities with the thoracic CT characteristics, thymic hyperplasia due to Graves disease was diagnosed. Thymic hyperplasia is commonly associated with Graves’ disease, but it is not emphasized in major endocrinology texts and must be recognized by all physicians.

2177

Thymic hyperplasia in Graves’ disease Danilovic DLS et al.

CLINICS 2011;66(12):2177-2178

Figure 1 - CT-scan images showing a thymus enlargement before (A) and after (B) treatment for hyperthyroidism due to Graves9 disease, with remarkable shrinkage of the thymus (arrows).

There are two morphologic forms of thymus hyperplasia associated with Graves’ disease: lymphoid hyperplasia and true hyperplasia. The first is characterized by a thymus medullary lymphoid-follicle formation that is not visualized as an enlargement of the anterior mediastinal compartment.2 In contrast, the second form, true hyperplasia, presents as an increase in thymic tissue. The mechanism of both hyperplasias is not well established and could be caused by excessive stimulation by the thyroid hormone or TRab itself.3,4 Few cases of detectable massive enlargements of the thymus have been reported; most of these cases involved thymectomy or biopsies to exclude the thymomas and treatment of the remaining tissue with hyperthyroidism.5,6 Because the association between Graves disease and thymic hyperplasia is unclear, unnecessary approaches such as sternotomy and transthoracic biopsy may be used.7 In conclusion, thymic enlargement associated with Graves’ disease, especially when a homogeneous mass without a surrounding invasion, calcifications or a cystic image is revealed from a thoracic CT-scan, allows for judicious clinical and radiologic follow-up during the hyperthyroidism treatment.

AUTHOR CONTRIBUTIONS Danilovic DLS and Martin RM were responsible for the clinical diagnosis. Caruso P was the first investigator and Marui S was the mentor of the study.

REFERENCES 1. Chaer R, Massad MG, Evans A, Snow NJ, Geha AS. Primary neuroendocrine tumors of the thymus. Ann Thorac Surg. 2002;74:173340, doi: 10.1016/S0003-4975(02)03547-6. 2. Gunn A, Michie W. Biopsy of the thymus. British Journal of Surgery. 1965;52:957-63, doi: 10.1002/bjs.1800521212. 3. Murakami M, Hosoi Y, Negishi T, Kamiya Y, Miyashita K, Yamada M, et al. Thymic hyperplasia in patients with Graves’ disease. Identification of thyrotropin receptors in human thymus. J Clin Invest. 1996;98:2228-34. 4. Nakamura T, Murakami M, Horiguchi H, Nagasaka S, Ishibashi S, Mori M, et al. A case of thymic enlargement in hyperthyroidism in a young woman. Thyroid. 2004;14:307-10, doi: 10.1089/105072504323030979. 5. Kirkeby KM, Pont A. Image in endocrinology: thymic hyperplasia in a patient with Graves’ disease. J Clin Endocrinol Metab. 2006;91:1, doi: 10. 1210/jc.2005-1811. 6. Yamanaka K, Nakayama H, Watanabe K, Kameda Y. Anterior mediastinal mass in a patient with Graves’ disease. Ann Thorac Surg. 2006;81:1904-6, doi: 10.1016/j.athoracsur.2005.07.081. 7. Popoveniuc G, Sharma M, Devdhar M, Wexler JA, Carroll NM, Wartofsky L, et al. Graves’ disease and thymic hyperplasia: the relationship of thymic volume to thyroid function. Thyroid. 2010; 20:1015-8, doi: 10.1089/thy.2009.0383.

2178

CLINICS 2011;66(12):2179-2181

DOI:10.1590/S1807-59322011001200028

CASE REPORT

Herpes Zoster as a Sign of AIDS and nonadherence to antiretroviral therapy: a case report Helena Lucia Barroso dos Reis,I Fernanda Sampaio Cavalcante,II Katia Regina Netto dos Santos,II Mauro Romero Leal Passos,III Dennis de Carvalho FerreiraII I

Federal University of Espı´rito Santo (UFES), Gynecology and Obstetrics Department, Espı´rito Santo, Vito´ria/ES, Brazil. II Federal University of Rio de Janeiro, Paulo de Go´es Microbiology Institute, UFRJ. III Microbiology Institute, Rio de Janeiro/RJ, Brazil, Fluminense Federal University (UFF), STD Sector, Nitero´i/RJ, Brazil. Email: hbarroso@unimedvitoria.com.br Tel.: 55 27 3335-7180

INTRODUCTION The reactivation of varicella-zoster virus (VZV) infection may occur during the course of human immunodeficiency virus (HIV) infection as an initial indicator of the disease. Post-herpetic neuralgia and multiple vesiculobullous lesions have been described in HIV-infected patients with herpes zoster.1,2 Nonadherence to highly active antiretroviral therapy (HAART) has a significant impact on the patient’s quality of life and increases the risk of mortality.3 We report a case of an HIV-infected patient who developed herpes zoster due to nonadherence to HAART.

CASE DESCRIPTION

Figure 1 - Grouped erythematous vesiculous and crusted herpes zoster lesions on the right thoracic region along the intercostal nerve path.

A 55-year-old female patient of afro-descendant was diagnosed with AIDS in 1999, when she developed chronic diarrhea and weight loss. This patient was a homemaker born in Bahia and residing in Serra-ES (Brazil) with an HIVpositive and nonexclusive sexual partner and three children. She had been in menopause for six years at the time of VZV diagnosis. Antiretroviral treatment was initiated with zidovudine (AZT) + didanosine in 2001 because her CD4+ count fell below 350 cells/mm3. Because of noncompliance, she remained without anti-retroviral medication for 31 months, which, in 2008, allowed her to be susceptible to a very aggressive clinical episode of herpes zoster with severe neuralgia, which led to a seven-day hospitalization. Initially, she presented with maculopapular lesions that progressed into vesicles and then pustules and crusts on the right thoracic region following the nerve path (Figure 1 and Figure 2) that lasted for 12 days. Laboratory tests showed a normal complete blood count (CBC), a viral load (VL) of 27,500 copies/mL and a CD4+ T lymphocyte count of 328 cells/mm3. The patient was treated with intravenous acyclovir for seven days, with marked improvement of the lesions. She started therapy with AZT + lamivudine + abacavir. At the same time, the cervical oncotic cytology was suggestive of

cervical intraepithelial neoplasia I (CIN I) and infection with human papillomavirus (HPV). Colposcopy suggested CIN I, and the cytological samples from the cervix after 3, 6, 12, and 18 months were normal. A hypochromic scar remained in the affected area after the herpes zoster was treated (Figures 3A and B), which caused constraints on the

Figure 2 - Grouped erythematous vesiculous and crusted herpes zoster lesions on the right thoracic region along the intercostal nerve path – back view.

No potential conflict of interest was reported.

2179

Herpes Zoster as a Sign of AIDS: A Case Report Reis HLB et al.

CLINICS 2011;66(12):2179-2181

Figure 3 - A) Hypochromic scars after herpes zoster on the thoracic region along the intercostal nerve path. B) Hypochromic scars after herpes zoster on the thoracic region along the intercostal nerve path – back view.

when to take the medicine, the influence of other people in their social life, the amount of medicine to take and the emotional state (Kaishusha Mupendwa et al., 2009).7 Other factors associated with noncompliance include age, education, injecting drug use, alcohol use, drug regimens with protease inhibitors, the presence of clinical signs and symptoms, loss of companions, time of diagnosis of HIV infection, a break in the continuity of care by one doctor or hospital and depression (Glass et al., 2010).8 Two of these issues are particularly notable: the ‘‘emotional state’’ and depression. The patient in this report was depressed and exhibited an altered emotional state, which were considered possible causes for her refusal to use the proposed antiretroviral therapy. The patient, at present, is on HAART therapy and antidepressants in outpatient care. Adherence measures are currently being reassessed because of flaws in their evaluation standards (Zijenah, 2006; Bangsberg 2002).9,10 The search for a better quality of life for HIV-infected individuals should be the central aim when following this clinical group. This goal includes good doctor-patient communication, respect for the specifics of the infection and the life dynamics of each individual, support from a multidisciplinary team, and a continual, active search for these patients, if necessary, to increase adherence. In conclusion, increasing adherence to HAART plays an important role in reducing opportunistic infections, such as VZV, and in improving the patient’s life by reducing mortality.

patient’s social life and affected her quality of life. Moreover, she suffered from persistent post-herpetic neuritis that lasted for 12 months. The patient remains in a clinical follow-up program in the infectious and parasitic diseases sector at a public hospital in Espı´rito Santo state. Currently, the patient adheres correctly to the antiretroviral therapy and has had no relapses of herpes zoster, and her quality of life has improved significantly. Above, we described an aggressive form of infection caused by VZV that served as a warning flag for AIDS in a patient who did not adhere to HAART. The next section describes the factors involved in noncompliance and provides support for a more effective approach to the clinical follow-up of individuals with HIV.

DISCUSSION Patients who meet the definition of AIDS, such as the patient described in this report, exhibit significant inhibition of the immune system and are susceptible to new bacterial, fungal, and viral infections and to the reactivation of prior infections. Some of these infections are considered AIDS defining and can be categorized as opportunistic infections (OI).4 Some viral agents, especially herpesviruses, can cause acute and persistent lytic infections, signaling immunosuppression in an early symptomatic phase of AIDS. Among these, VZV stands out as one viral agent that can be reactivated by the HIV-positive patient’s immunological changes,5 manifesting clinically as vesicles that break down into ulcers following the nerve path and as pre- and post-injury neuralgia associated with intense pain. All of these events, associated with the immunosuppression, occurred were experienced by the patient described in this report. The current literature indicates that noncompliance is the largest cause of failure of highly active antiretroviral therapy (HAART). HAART must be understood as an action in which the patient not only follows medical advice but also understands and agrees to follow the guidelines and requirements. Adherence to HAART includes following schedules, maintaining proper dosage with no interruptions (regardless of social life or travels) and even making use of a balanced diet to support the therapy. Adverse effects or fear of exposure may influence the patient’s motivation for not adhering to the therapy, thereby jeopardizing the efficacy of the recommended treatment and potentially impairing the quality of life (Ferreira et al., 2011).6 Studies have identified different factors as causes of patient noncompliance with antiretroviral treatment, including fear of side effects, lack of adequate food, difficulty integrating the treatment routine into their lives, forgetting

AUTHOR CONTRIBUTIONS Reis HLB, Ferreira DC, Santos KR participated in all the stages of the study, specially in clinical diagnosis and follow up. Cavalcante FS, Passos MRL helped to structure the study and were responsible for the critical analysis and organization of the results.

REFERENCES 1. Arvin A. Aging, immunity, and the varicella-zoster virus. N Engl J Med. 2005;352:2266–7, doi: 10.1056/NEJMp058091. 2. Johnson RW. Zoster-associated pain: what is known, who is at risk and how can it be managed? Herpes. 2007;14(Suppl 2):30A–34A. 3. Abaasa AM, Todd J, Ekoru K, Kalyango JN, Levin J, Odeke E, et al. Good adherence to HAART and improved survival in a community HIV/ AIDS treatment and care programme: the experience of The AIDS Support Organization (TASO), Kampala, Uganda. BMC Health Serv Res. 2008;8:241, doi: 10.1186/1472-6963-8-241. 4. Kirk O, Reiss P, Uberti-Foppa C, Bickel M, Gerstoft J, Pradier C, et al. Safe interruption of maintenance therapy against previous infection with four common HIV-associated opportunistic pathogens during potent antiretroviral therapy. Ann Intern Med. 2002;137:239-50. 5. Gebo KAMD, Kalyani R, Moore RD, Polydefkis MJ. The Incidence of, Risk Factors for, and Sequelae of Herpes Zoster Among HIV Patients in the Highly Active Antiretroviral Therapy Era. J AIDS. 2005;40:169-74. 6. Ferreira DC, Passos MRL, Rubini NPM, Knupp RRS, Curvelo JAR, Reis HLB, Herdy GVH. Validation study of a scale of life quality evaluation in

2180

CLINICS 2011;66(12):2179-2181

Herpes Zoster as a Sign of AIDS: A Case Report Reis HLB et al.

a group of pediatric patients infected by HIV. Cien Saude Colet. 2011;16:2643-52, doi: 10.1590/S1413-81232011000500034. 7. Kaishusha Mupendwa BP, Kadima Ntokamunda JL. Treatment adhesion and factors affecting it at the Kadutu Clinic (Democratic Republic of the Congo). Sante. 2009;19:205-15. 8. Glass TR, Battegay M, Cavassini M, De Geest S, Furrer H, Vernazza PL, et al. Longitudinal analysis of patterns and predictors of changes in self-reported adherence to antiretroviral therapy: Swiss HIV Cohort Study. J AIDS. 2010;54:197-203.

9. Zijenah LS, Kadzirange G, Tobaiwa O, Rusakaniko S, Gwanzura C, Kufa T, et al. Immunologic and virologic efficacy of generic nevirapine, zidovudine and lamivudine in the treatment of HIV-1 infected women with pre-exposure to single dose Nevirapine or short course zidovudine, in Zimbabwe. Thirteenth Conference on Retroviruses and Opportunistic Infections, Denver, 2006. 10. Bangsberg DR, Deeks SG. Is average adherence to HIV antiretroviral therapy enough? J Gen Intern Med. 2002;17:812-3, doi: 10.1046/j.15251497.2002.20812.x.

2181

CLINICS 2011;66(12):2183

DOI:10.1590/S1807-59322011001200029

ERRATA CLINICS 2011;66(4):529-33 Page 529 Replace Lourenc存o DM Junior For Lourenc存o DM Jr

2183