This article was downloaded by: [Consortium for e-Resources in Agriculture] On: 16 September 2009 Access details: Access Details: [subscription number 912062045] Publisher Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Journal of Environmental Science and Health, Part B Publication details, including instructions for authors and subscription information: http://www.informaworld.com/smpp/title~content=t713597269
Enrichment and isolation of endosulfan-degrading microorganism from tropical acid soil Surya Kalyani S a; Jitender Sharma b; Surender Singh c; Prem Dureja d; Lata c a Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India b Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India c Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India d Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, India Online Publication Date: 01 September 2009
To cite this Article Kalyani S, Surya, Sharma, Jitender, Singh, Surender, Dureja, Prem and Lata(2009)'Enrichment and isolation of
endosulfan-degrading microorganism from tropical acid soil',Journal of Environmental Science and Health, Part B,44:7,663 — 672 To link to this Article: DOI: 10.1080/03601230903163665 URL: http://dx.doi.org/10.1080/03601230903163665
PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf This article may be used for research, teaching and private study purposes. Any substantial or systematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material.
Journal of Environmental Science and Health Part B (2009) 44, 663–672 C Taylor & Francis Group, LLC Copyright ISSN: 0360-1234 (Print); 1532-4109 (Online) DOI: 10.1080/03601230903163665
Enrichment and isolation of endosulfan-degrading microorganism from tropical acid soil SURYA KALYANI S1 , JITENDER SHARMA2 , SURENDER SINGH3 , PREM DUREJA4 and LATA3 1
Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India 3 Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India 4 Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, India Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
2
Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,3,4-benzo-dioxathiepin-3-oxide) is a cyclodiene organochlorine currently used as an insecticide all over the world and its residues are posing a serious environmental threat. This study reports the enrichment and isolation of a microbial culture capable of degrading endosulfan with minimal production of endosulfan sulfate, the toxic metabolite of endosulfan, from tropical acid soil. Enrichment was achieved by using the insecticide as sole sulfur source. The enriched microbial culture, SKL-1, later identified as Pseudomonas aeruginosa, degraded up to 50.25 and 69.77 % of α and β endosulfan, respectively in 20 days. Percentage of bioformation of endosulfan sulfate to total formation was 2.12% by the 20th day of incubation. Degradation of the insecticide was concomitant with bacterial growth reaching up to an optical density of 600 nm (OD600) 2.34 and aryl sulfatase activity of the broth reaching up to 23.93 µg pNP/mL/hr. The results of this study suggest that this novel strain is a valuable source of potent endosulfan–degrading enzymes for use in enzymatic bioremediation. Further, the increase in aryl sulfatase activity of the broth with the increase in degradation of endosulfan suggests the probable involvement of the enzyme in the transformation of endosulfan to its metabolites. Keywords: Biodegradation; endosulfan; endosulfan sulfate; Pseudomonas aeruginosa; tropical acid soil.
Introduction Endosulfan (6, 7, 8, 9, 10, 10-hexachloro-1, 5, 5a, 6, 9ahexahydro-6, 9-methano-2, 3, 4-benzodioxyanthiepin- 3oxide) is widely employed as an insecticide in world agriculture. Technical grade endosulfan contains two stereoisomers, α and β endosulfan in the ratio of 7: 3. In the close vicinities of agricultural fields, the contamination of atmosphere, soils, sediments, surface and rain waters and foodstuffs by endosulfan has been documented in numerous previous studies.[1] The persistence of endosulfan in soil and water environments has been observed by different researchers under different conditions.[2,3] Its harmful impacts on aquatic fauna and numerous mammalian species including human beings have been reported several times in literature.[4−7] Detoxification of pesticides through biological means is receiving serious attention as an alternative to existing methods, such as incineration and landfill. A preliminary Address correspondence to Jitender Sharma, Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India; E-mail: jksharma.kuk@gmail.com Received December 3, 2008.
step in the investigation of enzymatic technologies for endosulfan detoxification is the definitive identification of a biological source of endosulfan–degrading activity. In a bioremediation process, heterotrophic microorganisms break down substrates (hazardous compounds) to obtain chemical energy, hence organic pollutants can serve as carbon, energy and nutrient sources for microbial growth. Some studies have described endosulfan as a sulfur source for microbial growth and a poor biological energy source when used as a sole carbon source.[8,9] Sutherland et al.[8] selected microorganisms for their ability to release the sulfite group from endosulfan and to use this insecticide as a source of sulfur for bacterial growth. Awasthi et al.[10] isolated a bacterial co-culture using endosulfan as a sole carbon source. To date, some physicochemical and biological remedial strategies have been described by researchers which lead to degradation of endosulfan into both toxic and non-toxic metabolites.[8−22] In this study we are reporting a bacterial strain SKL-1, isolated using enrichment with endosulfan as sole sulfur source. The organism identified as Pseudomonas aeruginosa, is the most active endosulfan-degrading single strain of microorganism, with minimal production of endosulfan sulfate, the toxic metabolite of endosulfan degradation.
664 This strain will be further investigated for its endosulfandegrading potential in soil and for the enzymatic reactions in detoxification of endosulfan.
culture). Thereafter, 0.1 mL of the enriched medium was transferred into 10 mL of fresh sterile enrichment medium containing 100 ppm endosulfan and further incubated for two weeks (Round 2 enrichment culture).
Materials and methods
Endosulfan degrading monocultures
Pesticide standards
To obtain pure cultures of single strains, 1 mL aliquots of round 2 enrichment culture was centrifuged (8000 rpm, 10 min), the supernatant was removed and cell residues were resuspended in 50 µL of sterile enrichment media by vortexing. Aliquots of this suspension were plated on enrichment medium agar by spread plating and incubated under aerobic conditions at 28◦ C 7d. Isolates were further purified by streaking on fresh plates. Intrinsic antibiotic resistance pattern of the selected cultures was carried out to avoid redundancy among the isolates.
Endosulfan isomers and metabolites, viz., endosulfan sulfate (C9 H8 Cl4 S), endosulfan diol (C9 H8 Cl6 O), endosulfan ether (C9 H6 ClO2 ) and endosulfan lactone (C9 H4 Cl6 O2 ) to be used as standards were purchased from Merck, Germany. Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Kalyani et al.
Sample collection for enrichment studies Samples of laterite, coastal sandy and red loam soils were collected from Kerala (India) having a history of endosulfan application. Top 0–15 cm of soil was collected using core samplers and covered with plastic bags to minimize changes in physical parameters. The samples were stored at 4◦ C. Enrichment of microbial communities Soil (approximately 50 g) was first enriched for endosulfandegrading organisms by the addition of 5 mg of technical grade endosulfan in 200 µL of acetone to remoistened soil, followed by incubation in the dark at room temperature for 1 month. Further enrichment was achieved by initiating shake flask enrichment cultures from these samples by using endosulfan as the only added source of sulfur. The enrichment medium (pH 6.8) consisted of 0.225 g of K2 HPO4 , 0.225 g of KH2 PO4, 0.225 g of NH4 Cl, 0.845 g of (MgCl)2 .6H2 O, 0.005 g of CaCO3, 0.005 g of FeCl2 .4H2 O, 1.0 g of D-glucose and 1 mL of a trace element solution per liter. The stock trace element solution contained 198.0 mg of MnCl2 .4H2 O, 136.0 mg of ZnCl2, 171.0 mg of CuCl2 .2H2 O, 24.0 mg of CoCl2 .6H2 O and 24.0 mg of NiCl2 .6H2 O per liter. Erlenmeyer flasks (50 mL) and nutrient culture media were autoclaved separately for 20 min at 121◦ C. Fifty microliters of acetone containing 1.0 mg of technical-grade endosulfan (99% pure) was aseptically added to each sterilized flask in a laminar flow hood allowing the acetone to evaporate. Nine milliliters of enrichment medium was added to each flask. Microbial inoculums for the enrichment studies were prepared by shaking 20 g of the enriched soil sample overnight in 100 mL of enrichment medium at 25◦ C and 160 rpm. The solid particles were allowed to settle for one hour and 1 mL of supernatant solution from the source flasks was used to inoculate the spiked flasks. Uninoculated spiked flasks were also set up as a control to compensate for any chemical degradation. The flasks were incubated at 28◦ C with orbital shaking (160 rpm) for two weeks (Round 1 enrichment
Screening of isolates for endosulfan degradation in liquid culture media Four isolates of bacteria exhibiting luxury growth on the enrichment medium were selected, and grown in nutrient culture broth containing 100 ppm endosulfan. Cultures were incubated (28◦ C, 160 rpm) for one week and cells were harvested by centrifugation (5000 rpm, 20 min) and washed thrice in 30 mL of nutrient culture media. Cells were thereafter resuspended in the same media. Endosulfan dissolved in acetone was used to spike Erlenmeyer flasks as described earlier to obtain a final concentration of 100 ppm endosulfan in the media. Two milliliters of inoculum was added to each spiked flask except the control flasks after adjusting their optical densities and incubated (28◦ C, 160 rpm) for 20 d. This study was performed in triplicates. For studying degradation of endosulfan sulfate by SKL1, endosulfan sulfate dissolved in acetone was used to spike Erlenmeyer flasks as described earlier to obtain a final concentration of 10 ppm endosulfan sulfate in the media. Molecular identification of bacterial isolate The bacterial isolate, tentatively designated SKL-1, was identified by analysis of 16S rDNA. Amplification of 16S r DNA was carried out by polymerase chain reaction using a thermal cycler (M. J. Research PTC-100). The polymerase chain reactions (PCR) were carried out with 50–90 ng of pure genomic DNA. The forward (PA) and reverse primers (PH) were custom synthesized from Bangalore Genei Pvt. Ltd. The sequence of the oligonucleotide primers used for amplification of 16S rDNA genes were: PA: 5 CACGGATCCAGAGTTTGAT(C/T)(A/C)TGGCTCAG3 PH: 5 GTGCTGCAGGGTTACCTTGTTACGACT3 The primers PA and PH, located at the extreme 5 and 3 ends, respectively, of the ribosomal rDNA sequence, enable the amplification of the entire gene. Purity of the PCR
Endosulfan-degrading microorganism
665
product was checked by agarose gel electrophoresis. Sequencing of the purified PCR product was carried out at an automated fluorescent sequencing facility of Banglore Genei Pvt. Ltd. DNA sequence similarity search was done by computing at Basic Local Alignment Search Tool (BLAST), developed by National Center for Biotechnology Information (NCBI), US[23] for searching the DNA and protein database.
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Analytical procedures For determination of endosulfan and endosulfan sulfate concentration, 5 mL of broth sample kept for incubation was centrifuged (10000 rpm; 10 min) and the supernatant was mixed with 0.5 g of activated charcoal. The sample was poured in a funnel containing 4 cm layer of anhydrous sodium sulfate over a plug of cotton. The sample was eluted with 100 mL of n-hexane:acetone (7:3) and the solvent was evaporated to dryness and final volume was made with nhexane at the time of analysis. Appropriate dilutions of the sample extract were then analyzed with a Hewlett Packard 5890, Series II gas chromatograph equipped with a methyl silicon column (10 m × 0.53 mm × 2.65 µm film thickness) packed with HP - 1 and electron capture detector (ECD) 63 Ni. The oven temperature was 200◦ C, injector temperature was 250◦ C and the detector temperature was 250◦ C. Nitrogen was the carrier gas at a flow rate of 60 mL min−1 . Bacterial densities in liquid cultures were determined spectrophotometrically by measuring the absorbance at 600 nm. Aryl sulfatase activity was also measured spectrophotometrically.[24] Calculation of degradation Percentage of biodegradation of endosulfan is the difference between the percentage of degradation of endosulfan in the inoculated flasks and the uninoculated control. Percentage of bioformation of endosulfan sulfate to total formation of endosulfan sulfate was calculated according to Equation 1. BES = [(Ein − Eun ) × 100] /Ein
(1)
Where, BES = Percentage of bioformation of endosulfan sulfate to total formation of endosulfan sulfate (%) Ein = Endosulfan sulfate formation in inoculated flask (ppm) and Eun = Endosulfan sulfate formation in uninoculated flask (ppm) Progressive rate of degradation of endosulfan was calculated according to Equation 2. K = dx/dy
(2)
Where, K = Progressive rate of degradation of endosulfan for nth day (ppm/day)
dx = endosulfan degraded on nth day (ppm) – endosulfan degraded on n-1th day (ppm) and dy = 1 (day)
Results and discussion Enrichment of endosulfan degrading microorganisms from soil The different colonies of bacteria isolated from the enrichment media were numbered SKL-1 to 11. Intrinsic antibiotic resistance has been used extensively as a technique for strain identification in soil bacteria and it has been reported that the pattern of antibiotic resistance of each strain is a stable property by which the strains could be recognized.[25] Keeping this in mind, the colony morphology and intrinsic antibiotic resistance pattern of the eleven different isolates was studied and it was revealed that only four of them were essentially unique and hence were used for further studies. The method of enrichment relies on bacteria being able to grow in the minimal media and hence the number of culturable bacteria is severely restricted. Screening microbial isolates for their ability to utilize endosulfan for growth Regression analysis of bacterial population (106 CFU/mL) on OD600 revealed that it followed a linear kinetics, the regression equation being y=34.204x with an R2 value of 0.9045 indicating perfect fit. Hence measurement of OD600 was performed to quantify the growth of the isolate in broth. The isolates were screened for their ability to utilize endosulfan as the sole sulfur source. Endosulfan is a poor biological energy source, as it contains only six potential reducing electrons. But it has a relatively reactive cyclic sulfite diester group and can serve as a good sulfur source.[26] This selection procedure enriches for a culture capable of either the direct hydrolysis of endosulfan or the oxidation of the insecticide followed by its hydrolysis, thereby reducing formation of toxic endosulfan sulfate.[8] SKL-1 was the only isolate able to grow utilizing endosulfan as a sulfur source and hence was used for further studies. Endosulfan degradation by enriched culture The gas chromatography (GC) Rt (retention times) for α endosulfan and β endosulfan were 2.70 and 3.70 minutes, respectively (Fig. 1). The total degradation of α endosulfan and β endosulfan was 94.40 and 96.38% , respectively after 20 days of incubation (Figs. 2 and 3). Thus the total degradation of β endosulfan was more than that of α endosulfan. This may be because of the fact that the rate of non-biological degradation involving hydrolysis and
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
666
Fig. 1. Separation of endosulfan and its metabolites by gas liquid chromatography. (A) Uninoculated control – Day 0; (B) inoculated with SKL-1– Day 0; (C) uninoculated control– Day 20; and (D) inoculated with SKL-1 – day 20. 1 – solvent peak; 2 – endosulfan diol; 3 – endosulfan ether; 4 – α endosulfan; 5 – endosulfan lactone; 6 – β endosulfan; 7 – endosulfan sulfate.
photodecomposition is more for the β isomer and the difference is all the more prominent in alkaline conditions.[13,27,28] Further, the recent discovery that the isomers form a eutectic mixture indicates that application of a mixture is most likely to enhance the volatilization of the β isomer.[29] The biodegradation of α endosulfan and β endosulfan by SKL- 1 was 71.78 and 69.77% , respectively after 20 days of incubation (Figs. 2 and 3) indicating that biodegradation of the α isomer is more than that of the β isomer. Earlier studies have shown that microbial species prefer α endosulfan for degradation over β endosulfan.[10,22] However,
Kalyani et al. recently, Siddique et al.[18] reported that bacteria degraded relatively more β endosulfan than α endosulfan. The percentage of biodegradation to total degradation was 76.04 and 72.39% for α and β isomers, respectively after 20 days of incubation. Thus biotransformation contributed to a major portion of total transformation of both the isomers in the present study. The predominance of biological degradation over non-biological degradation or vice versa depends on the culture conditions in addition to the efficiency of the microbial culture. Endosulfan is susceptible to alkaline hydrolysis, with approximately ten fold increase in hydrolysis occurring with each increase in pH unit.[12] Many previous studies have been unable to differentiate between chemical and biological hydrolysis of endosulfan because microbial growth has led to increases in the alkalinity of the culture medium.[12,13] To minimize non-biological hydrolysis, the enrichment medium was buffered to pH 6.8 and cultures were monitored constantly for change in pH. The progressive rate of degradation of endosulfan exhibited a prominent increase by the 3rd day of incubation and reached its peak value of 13 ppm/day. Afterwards, there was a steady decrease in the progressive rate of degradation (Fig. 4). The low initial rate of degradation might represent a lag phase while it got accelerated as the incubation proceeded, most likely due to induction/activation of enzymes in the inoculated cultures. Similar observations were made by Hussain et al.[19] The steady decrease in rate of degradation afterwards may be due to exhaustion of nutrients in the media. The metabolites formed during the degradation of endosulfan were identified as endosulfan diol (Rt = 0.89 min), endosulfan ether (Rt = 2.21 min) endosulfan lactone (Rt = 3.21 min) and endosulfan sulfate (Rt = 4.90 min) (Fig. 1). Miles and Moy[13] and Katayama and Matsumura[20] have confirmed the formation of these metabolites by microbial isolates during biodegradation of endosulfan. Endosulfan diol, endosulfan ether and endosulfan lactone are nontoxic, where as endosulfan sulfate is toxic in nature. Unlike the isomers of endosulfan, the toxic metabolite endosulfan sulfate can accumulate in animal fat and hence the formation of endosulfan sulfate was studied in detail.[30] It was observed that by the 20th day 15.91% of the applied endosulfan was transformed to endosulfan sulfate. Of the total endosulfan degraded 16.74% was converted to endosulfan sulfate. There was a steady decrease in the percentage of bioformation of endosulfan sulfate to total formation as period of incubation progressed. By the 20th day of incubation, the percentage of bioformation of endosulfan sulfate to total transformation was only 2.12% (Table 1). In order to clarify whether endosulfan sulfate was further degraded by SKL-1, biodegradation of endosulfan sulfate by SKL-1 was studied by spiking the medium with 10 ppm endosulfan sulphate. Table 2 indicates that there was no further degradation of endosulfan sulfate by SKL-1. Similar
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Endosulfan-degrading microorganism
667
Fig. 2. Progressive degradation of Îą endosulfan by SKL-1 in pure culture.
observations were also made by Sutherland et al.[8] and Shivaramaiah and Kennedy[21] in their studies on biodegradation of endosulfan by soil bacteria. The inability to transport the more polar compound into the cell or the absence of an enzyme capable of hydrolyzing the oxidized compound may be reasons for the lack of biodegradation of endosulfan sulfate. The different oxidation states of the sulfur in endosulfan and endosulfate make it unlikely that the same enzyme will be capable of releasing the sulfur containing moiety from both. Thus the decrease in the percentage of bioformation of endosulfan sulfate to total formation of endosulfan sulfate during the course of incubation may be attributed to the reduction in the rate of formation of endosulfan sul-
fate by SKL-1 with time. This suggests that the metabolism of endosulfan is mediated by two divergent pathways, one hydrolytic leading to the production of endosulfan diol, endosulfan ether and endosulfan lactone and the other oxidative leading to the production of the toxic metabolite, endosulfan sulfate, which is resistant to further biodegradation. Kullman and Matsumura[15] while working with Phanerochaete chrysosporium suggested similar mechanism of degradation of endosulfan.
Bacterial density, culture pH and aryl sulfatase activity The bacterial density, culture pH and aryl sulfatase activity were measured to assess the relationship between growth
Fig. 3. Progressive degradation of β endosulfan by SKL-1 in pure culture.
668
Kalyani et al.
Table 1. Progressive formation of endosulfan sulfate from endosulfan by SKL-1 in pure culture.
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Days of incubation 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CV (%) SEmÂą CD (P = 0.05)
Endosulfan Percentage of Endosulfan sulfate bioformation of sulfate formed formed to endosulfan endosulfan to endosulfan sulfate to applied (%) degraded (%) total formation 0.00 0.23 1.04 2.18 3.83 7.02 7.08 7.57 7.83 8.59 8.88 10.29 10.69 11.49 11.78 12.39 13.00 13.67 14.63 15.16 15.91 4.20 0.76 1.49
0.00 4.41 8.84 5.15 8.11 13.55 12.29 11.81 11.16 11.57 11.58 13.05 13.26 13.84 13.73 13.98 14.45 14.98 15.71 16.11 16.74 4.59 2.16 4.23
0.00 11.02 7.38 5.28 3.26 1.92 2.04 1.91 2.13 2.24 2.17 1.87 1.89 2.04 1.99 2.10 2.02 2.20 2.08 2.03 2.12 4.38 2.24 4.39
Table 2. Incubation of endosulfan sulfate with SKL-1 in vitro. Endosulfan sulfate remaining in broth (ppm) Days of incubation 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CV (%) SEmÂą CD (P=0.05)
Control (Media) 10.00 9.98 9.97 9.95 9.91 9.92 9.90 9.87 9.88 9.87 9.88 9.87 9.84 9.85 9.82 9.81 9.82 9.80 9.78 9.79 9.79 4.78 Days 0.03 0.06
Fig. 4. Change in optical density (OD600 ) of medium inoculated with SKL-1 during endosulfan degradation.
Incubation with SKL-1 10.00 9.98 9.97 9.96 9.92 9.91 9.91 9.88 9.89 9.87 9.86 9.85 9.85 9.84 9.83 9.83 9.83 9.82 9.80 9.81 9.80 Treatment 0.01 0.02
Endosulfan-degrading microorganism
669
Table 3. Correlation coefficients between transformation of endosulfan and OD600 , pH and aryl sulfatase activity in vitro. At
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
OD 0.061 pH 0.205∗ As −0.140
Ab
Bt
0.332∗∗ 0.068 0.284∗∗ 0.201∗ ∗∗ 0.310 −0.135
Bb
St
Sb
0.468∗∗ −0.041 −0.164 0.371∗∗ −0.355∗∗ 0.007 0.422∗∗ −0.131 −0.065
At = Progressive rate of degradation of α endosulfan (total) (%). Ab = Progressive rate of degradation of α endosulfan (biological) (%). Bt = Progressive rate of degradation of β endosulfan (total) (%). Bb = Progressive rate of degradation of β endosulfan (biological) (%). St = Progressive rate of formation of endosulfan sulfate (total) (%). Sb = Progressive rate of formation of endosulfan sulfate (biological) (%). OD = Optical density of growth (600nm). pH = pH of the broth. As = Aryl sulfatase activity of the broth (µg/mL/hr). ∗ Significant at 5% level. ∗∗ Significant at 1% level.
and metabolic activities of the organism and its capability to degrade endosulfan. The growth of SKL-1 quantified by OD600 followed the progressive rate of degradation of endosulfan (Fig. 4). The OD600 reached 2.34 as progressive rate of α and β endosulfan reached its peak. Growth of SKL-1 exhibited highly significant positive correlation with biodegradation of α endosulfan and β endosulfan (Table 3) indicating that the microorganism utilizes endosulfan for its growth. OD600 had no significant correlation with formation of endosulfan sulfate suggesting the limited role of the microbial isolate in the formation of endosulfan sulfate. Change in pH exhibited significant positive correlation with total degradation and biodegradation of both α and β endosulfan (Fig. 5 and Table 3). The growth and biodegra-
dation of endosulfan by SKL-1 resulted in an increase in the pH of the culture medium. Though this observation is in conformity with the observations of Miles and Moy[13] and Martens,[12] it is contradictory to the observations of Hussain et al.[19] and Siddique et al.[18] In either case the change in pH depends on the products of degradation. The increase in pH in the present study due to biological activity of SKL-1 could have further accelerated the alkaline hydrolysis of endosulfan, especially the β isomer.[27] Interestingly, pH change exhibited highly significant negative correlation with total formation of endosulfan sulfate (Table 3). This may be due to the fact that under alkaline conditions hydrolysis of endosulfan is predominant over its oxidation and hence formation of endosulfan sulfate, the product of oxidative degradation of endosulfan is minimized. The aryl sulfatase activity of the broth followed the progressive rate of degradation of endosulfan closely (Fig. 6). Aryl sulfatase activity exhibited highly significant positive correlation with biodegradation of α endosulfan and β endosulfan (Table 3). Aryl sulfatase activity reached 23. 93 µg pNP/mL/hr as progressive rate of α and β endosulfan reached its peak. Further, aryl sulfatase activity did not exhibit any significant correlation with endosulfan sulfate formation. Aryl sulfatase enzyme catalyzes the removal of sulfur moiety from organic sulfur compounds.[24] Katayama and Matsumura[20] studying biodegrdation of endosulfan by Trichoderma harzianum had suggested that endosulfan sulfate was further converted to endosulfan diol by hydrolysis in presence of sulfatase enzyme. However, since in our study endosulfan sulfate was not degraded further by SKL-1, aryl sulfatase enzyme may be involved in the direct hydrolysis of endosulfan to endosulfan diol.
Fig. 5. Change in pH of medium inoculated with SKL-1 during endosulfan degradation.
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
670
Kalyani et al.
Fig. 6. Change in aryl sulfatase activity of medium inoculated with SKL-1 during endosulfan degradation.
Phylogenetic identity of bacterial strain SKL-1 The 16S rDNA gene of the microbial isolate was ampliďŹ ed and sequenced. Homology search in the BLAST server developed by NCBI, USA revealed that the organism exhibited 99% homology with many of the Pseudomonas
Fig. 7. Phylogenetic tree of Pseudomonas aeruginosa SKL-1.
aeruginosa strains (Fig. 7). The sequence was submitted in Genbank and the accession number was allotted as EF443060. Earlier reports of degradation of endosulfan involved mixed bacterial cultures, bacterial co-cultures, Aspergillus niger, Phanerochaete chrysosporium, Mucor
Endosulfan-degrading microorganism thermohyalospora, Anabaena spp. and Fusarium ventricosum.[8,10,14−18] Recently, Hussain et al.[19] reported that Pseudomonas spinosa, P. aeruginosa and Burkholderia cepacia degraded endosulfan efficiently. The bacteria belonging to Pseudomonas sp. are gram negative soil bacteria and have been previously documented as excellent degraders of a wide range of xenobiotics and recalcitrant compounds both in soil and water environment.[31,32]
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Conclusion We have successfully enriched and isolated endosulfan degrading bacterial strain Pseudomonas aeruginosa SKL-1 that can utilize endosulfan as sole sulfur source in broth culture. After approximately 100 rounds of subculturing, the culture metabolizes 100 ppm endosulfan to undetectable levels in less than 30 days. This rate of degradation is significantly higher than those previously measured for bacteria, considering the fact that non-biological degradation has been minimized. Further, it was also observed that there is a significant correlation between endosulfan degradation and aryl sulfatase activity suggesting the possible involvement of this enzyme in the degradation of endosulfan by this organism. The results have valuable applications for endosulfan bioremediation in polluted sites. From this study, we cannot predict the efficiency of the microbial isolate to utilize endosulfan as a sulfur source in the soil environment. The majority of the sulfur content of soils is found in an organic form, with over 95% present as sulfonates and sulfate esters. Soil bacteria have numerous enzymes capable of releasing sulfur from organic compounds. The ability of the microbial isolate to degrade endosulfan in natural soil conditions, where other sulfur sources are also present needs to be investigated. The use of microorganisms for bioremediation requires an understanding of all the physiological and biochemical aspects involved in chemical transformations. Future research will focus on identification and isolation of the enzymes involved, including a study of their regulation and optimization of conditions. Modern molecular approaches developed for remediation would be suitably applied to achieve these objectives.
Acknowledgements The first author gratefully acknowledges the University Grants Commission for providing fellowship during the tenure of the research work at the Indian Agricultural Research Institute.
References [1] United States Department of Health and Human Services. Toxicological Profile for Endosulfan; Agency for Toxic Substances and Disease Registry: Atlanta, GA, 1990.
671 [2] Rao, D. M.R.; Murty, A. S. Persistence of endosulfan in soils. J. Agric. Food Chem. 1980, 28, 1099–1101. [3] Guerin, T. F.; Kennedy, I. R. Distribution and dissipation of endosulfan and related cyclodienes in sterile aqueous systems: implications for studies on biodegradation. J. Agric. Food Chem. 1992, 40, 2315–2323. [4] Sunderam, R.I.M.; Cheng, D.M.H.; Thompson, G.B. Toxicity of endosulfan to native and introduced fish in Australia. Environ. Toxicol. Chem. 1992, 11, 1469–1476. [5] Paul, V.; Balasubramaniam, E. Effect of single and repeated administration of endosulfan on behaviour and its interaction with centrally acting drugs in experimental animals: A mini review. Environ. Toxicol. Pharmacol. 1997, 3, 151–157. [6] Sinha, N.; Narayan, R.; Saxena, D.K. Effect of endosulfan on testis of growing rats. Bull. Environ. Contam. Toxicol. 1997, 58, 79–86. [7] Chaudhuri, K.; Selvaraj, S.; Pal, A.K. Studies on the genotoxicology of endosulfan in bacterial system. Mutat. Res. 1999, 439, 63–67. [8] Sutherland, T.D.; Horne, I.; Lacey, M.J.; Harcourt, R.L.; Russel, R.J.; Oakeshott, J.G. Enrichment of an endosulfan-degrading mixed bacterial culture. Appl. Environ. Microbiol. 2000, 66, 2822–2828. [9] Guerin, T.F. The anaerobic degradation of endosulfan by indigenous microorganisms from low-oxygen soils and sediments. Environ. Pollut. 1999, 106, 13–21. [10] Awasthi, N.; Manickam, N.; Kumar, A. Biodegradation of endosulfan by a bacterial coculture. Bull. Environ. Contam. Toxicol. 1997, 59, 928–934. [11] Knoevenagel, K.; Himmelreich, R. Degradation of compounds containing carbon atoms by photo-oxidation in the presence of water. Arch. Environ. Contam. Toxicol. 1976, 4, 324–333. [12] Martens, R. Degradation of endosulfan-8, 9-Carbon-14 in soil under different conditions. Bull. Environ. Contam. Toxicol. 1977, 17, 438–446. [13] Miles, J. R.W.; Moy, P. Degradation of endosulfan and its metabolites by a mixed culture of soil microorganisms. Bull. Environ. Contam. Toxicol. 1979, 23, 13–19. [14] Mukherjee, I.; Gopal, M. Degradation of beta-endosulfan by Aspergillus niger. Toxicol. Environ. Chem. 1994, 46, 217–221. [15] Kullman, S.W.; Matsumura, F. Metabolic pathways utilized by Phanerochaete chrysosporium for degradation of the cyclodiene pesticide endosulfan. Appl. Environ. Microbiol. 1996, 62, 593– 600. [16] Shetty, P.K.; Mitra, J.; Murthy, N.B.K.; Namitha, K.K.; Savitha, K.N.; Raghu, K. Biodegradation of cyclodiene insecticide endosulfan by Mucor thermo-hyalospora MTCC 1384. Curr. Sci. 2000, 79, 1381–1383. [17] Lee, S.E.; Kim, J.S.; Kennedy, I.R.; Park, J.W.; Kwon, G.S.; Koh, S.C.; Kim, J.E. Biotransformation of an organochlorine insecticide, endosulfan, by Anabaena species. J. Agric. Food Chem. 2003, 51(5), 1336–40. [18] Siddique, T.; Okeke, B.C.; Arshad, M.; Frankenberger, W.T. Jr. Enrichment and isolation of endosulfan degrading microorganisms. J Environ Qual. 2003, 32, 47–54. [19] Hussain, S.; Arshad, M.; Saleem, M.; Khalid, A. Biodegradation of α - and β -endosulfan by soil bacteria. Biodegradation 2007, 18(6), 731–740. [20] Katayama, A.; Matsumura, F. Degradation of organochlorine pesticides particularly endosulfan by Trichoderma harzianum. Environ. Toxicol. Chem. 1993, 12, 1059–1065. [21] Shivaramaiah, H. M.; Kennedy, I. R. Biodegradation of endosulfan by a soil bacterium. J. Environ. Sci. Health Part B. 2006, 41, 895– 905. [22] Kwon, G.S.; Kim, J.E.; Kim, T.K.; Sohn, H.Y.; Koh, S.C.; Shin, K.S.; Kim, D.G. Klebsiella pneumoniae KE-1 degrades endosulfan without formation of the toxic metabolite, endosulfan sulfate. FEMS Microbiol. Lett. 2002, 215, 255–259. [23] Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410.
672
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
[24] Tabatabhai, M.A.; Bremner, J.M. Aryl sulfatase activity of soils. Soil. Sci. Soc. Am. Proc. 1970, 34, 427–429. [25] Josey, D.P.; Beynon, J. L.; Johnston, A.W.B.; Beringer, J.E. Strain identification in Rhizobium using intrinsic antibiotic resistance. J. Appl. Microbiol. 2008, 46(2), 343–350. [26] Van Woerden, H.F. Organic sulfites. Chem. Rev. 1963, 63, 557–571. [27] Walse, S.S.; Scott, G.I.; Ferry, J.L. Stereo selective degradation of aqueous endosulfan in modular estuarine mesocosms. J. Environ. Monit. 2003, 5, 373–379. [28] Singh, N.C.; Dasgupta, T.P.; Roberts, E.V.; Mansingh, A. Dynamics of pesticides in tropical conditions. 1. Kinetic studies of volatilization, hydrolysis and photolysis of dieldrin and alpha and betaendosulfan. J. Agric. Food Chem. 1991, 39, 575–579. [29] Schmidt, W.F.; Bilboulian, S.; Rice, C.P.; Fettinger, J.C.; McConnell, L.L.; Hapeman, C. J. Thermodynamic, spectroscopic and computa-
Kalyani et al. tional evidence for the irreversible conversion of β- to α-endosulfan. J Agric Food Chem. 2001, 49, 5372–5376. [30] Dorough, H.W.; Huhtanen, K.; Marshall, T.C.; Bryant, H.E. Fate of endosulfan in rats and toxicological considerations of apolar metabolites. Pest. Biochem. Physiol. 1978, 8, 241– 252. [31] Radehaus, P.M.; Schmidt, S.K. Characterization of a novel Pseudomonas sp. that mineralizes high concentrations of pentachlorophenol. Appl. Environ. Microbiol. 1992, 58, 2879– 2885. [32] Filonov, A.E.; Puntus, I.F.; Karpov, A.V.; Kosheleva, I.A.; Akhmetov, L.I.; Yonge, D.R.; Petersen, J.N.; Boronin, A.M. Assessment of naphthalene biodegradation efficiency of Pseudomonas and Burkholderia strains tested in soil model systems. J. Chem. Technol. Biotechnol. 2006, 81, 216–224.