Biodiversitas vol. 12, no. 1, January 2011 by Biodiversitas Unsjournals

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Journal of Biological Diversity Volume

12 – Number 1 – January 2011

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan), Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Poorbabaei (Iran), Hwan Su Yoon (USA), Jamaluddin (India), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mariela A. Marinoff (Argentine), Mochamad A. Soendjoto (Indonesia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana (sudianai@yahoo.com) Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com) Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTATION AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai (pmkrai@hotmail.com), Salvador Carranza (salvicarranza@gmail.com), Sonia Malik (sonia.unicamp@gmail.com). SPECIES DIVERSITY: Dato A. Latiff Mohamad (latiff@ukm.my), Joko R. Witono (jrwitono@yahoo.com), Katsuhiko Kondo (k3kondo@nodai.ac.jp), Livia Wanntorp (livia.wanntorp@nrm.se), Thaweesakdi Boonkerd (Thaweesakdi.B@chula.ac.th). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Ali Saad Mohamed (alisaad48@yahoo.com), Bambang H. Saharjo (bhsaharjo@gmail.com), Charles H. Cannon Jr. (chuck@xtbg.ac.cn), Edi Rudi (edirudi@yahoo.com), Guofan Shao (shao@purdue.edu), Hassan Poorbabaei (hassan_pourbabaei@yahoo.com), Jamaluddin (jamaluddin_125@hotmail.com), Mochamad A. Soendjoto (masoendjoto@gmail.com), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (sugiyarto_ys@yahoo.com). ETHNOBIOLOGY: María La Torre Cuadros (angeleslatorre@lamolina.edu.pe), Mariela A. Marinoff (marinoff@fai.unne.edu.ar).

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 1-6

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120101

Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences CHARIS AMARANTINI1,â&#x2122;Ľ, LANGKAH SEMBIRING2, HARIPURNOMO KUSHADIWIJAYA3, WIDYA ASMARA4 1

Faculty of Biology, Duta Wacana Christian University (UKDW). Jl. Dr. Wahidin Sudirohusodo No. 5-27, Yogyakarta 55224, Indonesia. Tel.: +62-274563929. Fax.: +62-0274-4513235. email: charis@ukdw.ac.id 2 Faculty of Biology, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia. 3 Field Epidemiology Training Program, Department of Public Health, Faculty of Medicine, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia. 4 Department of Microbiology, Faculty of Veterinary Medicine, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia. Manuscript received: 9 April 2010. Revision accepted: 23 August 2010.

ABSTRACT Amarantini C, Sembiring L, Kushadiwijaya H, Asmara W (2011) Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences. Biodiversitas 12: 1-6. The incidence rate of typhoid fever in the Southwest Sumba District, East Nusa Tenggara was approximately about 725/100,000. In spite of such rate, there was not much known-yet about the molecular epidemiology of the disease. Thus, having accurate data and a strong discriminatory ability was crucial to scrutinize the molecular epidemiology of S. typhi with a molecular phylogenetic approach based on 16S rRNA gene sequences. Sixteen isolates representative of S. typhi from different geographical regions in Southwest Sumba District along with the reference strain S. typhi NCTC 786 had been identified and characterized based on 16S rRNA gene sequences using PCR amplification and sequencing. The 16S rRNA sequences data were aligned with the corresponding available S. typhi sequences retrieved from the NCBI database by using CLUSTAL X software. Phylogenetic trees were generated with PHYLIP software package. Molecular phylogenetic analysis indicated that all the isolates belong to S. typhi species were suggested by their relativity with the type strain of S. typhi ATCC19430T. It was also found that the isolates which belong to S. typhi species formed several different centers of diversity within the 16S rRNA gene tree. Each clade consisted of the strains from different geographical places in the District. Thus, to conclude the inquiry, there was evident inter-geographical spread of the strains and it tended to spread further into more remote areas in the District. Key words: Salmonella typhi strains, typhoid fever, 16S rRNA gene sequences, molecular phylogenetic analysis.

INTRODUCTION There are 17 to 22 million cases of typhoid fever worldwide per year and it causes 216,000 to 600,000 deaths annually (Steele 2008). Based on a preliminary survey, the fever was highly endemic in Southwest Sumba District, East Nusa Tenggara and it infected 725/ 100,000 people per year in the District according to the report made by Karitas Hospital in 2006. Until recently however it has not been under controlled because the limitations of health service units to diagnose the typhoid through laboratory studies. The incidence rate in the area was higher than the incidence in rural areas (358/100,000) or semi rural areas (157/100,000 inhabitants). It was nearly the same as the total number of people infected in urban areas (810/100,000) annually in Indonesia (WHO 2003). Typhoid fever is an acute systemic infection caused by Salmonella enterica subsp. enterica serotype typhi (Salmonella typhi). The acute systemic infection causes S. typhi get into the blood stream after passing through several organs in the host. This disease shows clinical

symptoms ranging from mild illness with slight fever, the body feels uncomfortable, coughing and the clinical circumstances such as severe abdominal pain and complications. This condition could often cause difficulties to diagnose it when merely based only on clinical symptom (Muliawan and Surjawidjaja 1999). In addition to such high rate, information about the molecular epidemiology of the disease was unknown. Thus, it was indispensable to have accurate data and a strong discriminative ability to distinguish the types of the strains of the pathogenic bacteria needed in the epidemiological study. The application of the molecular detection methods for the epidemiological study was advantageous because the genetic profile of the bacteria is a source of information to map the spread of the bacteria in the community. Henceforth it is beneficial to determine best-fitted control strategies over the disease. With the given rationale, this study was aimed to unravel the strain diversities belonging to the S. typhi species isolated from typhoid fever patients using a molecular phylogenetic approach based on 16S rRNA gene sequences, and also to understand the spread of S. typhi based on its varieties and interrelations among the

B I O D I V E R S IT A S 12 (1): 1-6, January 2011

strains isolated from the infected patients in Southwest Sumba District, East Nusa Tenggara.

MATERIALS AND METHODS Bacterial strains In this inquiry, there were 16 representative isolates of S. typhi from different geographical regions in Southwest Sumba District. They were from infected patients in Karitas Hospital in Weetabula, a private clinic in Elopada Subdistrict in Southwest Sumba District, and Lende Moripa Hospital in Waikabubak, West Sumba District. Specimen collection and microbiological identification methods were described in the journal article published previously (Amarantini et al. 2009). Extraction of bacterial DNA, PCR amplification and DNA sequencing Bacterial DNA was extracted in accordance with the protocol’s instructions using a PurelinkTM Genomic DNA Mini Kit (Invitrogen K1820-00). The bacterial DNA and control were amplified with 0.2 µM primers (InvitrogenTM) and PCR SuperMix (InvitrogenTM 11306-016). PCR amplification for the 16S rRNA sequences showed bands of 428 bp, 484 bp, and 483 bp. These fragments were amplified using primer SR1/SR2, SR3/SR4, and SR5/SR6 respectively. The primers which were used to amplify these fragments showed at Table 1 (Massi et al. 2005). The PCR mixtures were amplified for 40 cycles at 94ºC for 1 minute, 55ºC for 1 minute, and 72ºC for 2 minutes, with a final extension at 72ºC for 10 minutes in automated Applied Biosystems GeneAmp PCR System 2400. An aliquot of 10 µL of each amplified product was electrophorezed in 1.5% (wt/vol) agarose gel, with a DNA Molecular Weight Marker (Gel Pilot 100bp Ladder 100 Lanes, Qiagen, Germany) in parallel. The PCR product was gel purified with a QIAquick PCR purification kit (QIAgen, Germany). The purified PCR product was sequenced with ABI Prism 3100-Avant Genetic Analyzer in accordance with the manufacture’s instructions (Applied Biosystems, USA) using PCR primers (Massi et al. 2005).

edited and assembled with Finch TV 1.4.0 and DNA Baser sequence analysis software. Complete assembled sequences were aligned with the corresponding S. typhi sequences retrieved from the NCBI database with CUSTAL X software (Thompson et al. 1997). Construction of phylogenetic tree Based on 16S rRNA nucleotide sequences, a phylogenetic tree was constructed with PHYLIP software package (Felsenstein 1993) with the neighbor-joining algorithm (Saito and Nei 1987). The evolutionary distance matrix for the neighbor-joining method was generated in accordance with the description introduced by Jukes and Cantor (1969). The phylogenetic distances were obtained by adding only the values of the horizontal components. Eventually, the matrix of the nucleotide similarity and difference was generated with PHYDIT software (Chun 1999). Mapping the spread of S. typhi strains in Southwest Sumba District, East Nusa Tenggara The spread of S. typhi strains was isolated from the endemic regions in Southwest Sumba District was mapped according to the infected patients’ residences using a satellite navigation system (Global Positioning System /GPS). The spread of the strain types and the phylogenetic relationships among the strains, as the results of the 16S rRNA gene sequencing, were also mapped according to the geographical distribution of the diseases.

RESULTS AND DISCUSSION

Molecular characterization of S. typhi strains using phylogenetic approach based on 16S rRNA gene sequences Based on 16S rRNA gene, the phylogenetic analysis of the 16 isolates of S. typhi from different geographical origins in Southwest Sumba District is shown in Figure 1. There were 29 isolates of 16S rRNA gene sequences used in constructing the phylogeny tree. It consisted of 18 S. typhi strains, including the type strain of S. typhi ATCC 19430T (accession no. Z47544) which belonged to S. enterica, one strain belonged to S. bongori BR 1859 (AF029227), and 11 strains from Enterobacteriaceae family [Escherichia coli ATCC 25922 (X80724.1), Citrobacter Analysis and alignment of 16S rRNA nucleotide sequences The 16S rRNA nucleotide sequences were analyzed, freundii ATCC 29935 (M59291.1), Serratia marcescens (M59160.1), Erwinia carotovora ATCC 15713 (M59149.1), Yersinia Table 1. The primers used for PCR amplification of 16S rRNA gene sequence of S. typhi ruckeri ATCC 29473 (X75275.1), (Massi et al. 2005). Yersinia intermedia ER-3854 (X75279.1), Hafnia alvei ATCC Primer Sequence Nucleotide position 13337 (M59155.1), Photobacter 5’ AGTTTGATCCTGGCTCAG 3’ luminescens DSM 3368 (X82248.1), SR1 3-20 (AC: Z47544) 5’ AGTACTTTACAACCCGAAGG 3’ Xenorhabdus nematophilus DSM SR2 411-430 (AC: Z47544) 5’ AAGTACTTTCAGCGGGGA 3’ 3370 (X82251.1), Proteus vulgaris SR3 424-441 (AC: Z47544) 5’ TTGAGTTTTAACCTTGCGG 3’ IFAM 1731 (X07652.1), and SR4 898-916 (AC: Z47544) 5’ AACTCAAATGAATTGACGG 3’ SR5 901-919 (AC: Z47544) Plesiomonas shigelloides (M59159)]. 5’ AGGCCCGGGAACGTATTCAC 3’ SR6 1364-1383 (AC: Z47544) Plesiomonas shigelloides was used as Note: AC: GenBank accession no. the out group strain in the root position since this species belongs to

AMARANTINI et al. â&#x20AC;&#x201C; Identification of Salmonella typhi based on 16S rRNA

Enterobacteriaceae family and it formed a separate sub-line of descent of the evolution of Salmonella, E. coli, and C. freundii (Chang et al. 1997). The result of the phylogenetic analysis (Figure 1) showed that 16 representative isolates of S. typhi from various regions in Southwest Sumba District, East Nusa Tenggara belonged to S. typhi species because of their relativity with the type strain of S. typhi ATCC 19430T. They formed several different centers of diversity within the 16S rRNA gene tree. All the strains fell into four clades and form a clear center of diversity with the reference strain of S. typhi ATCC 19430T. The first clade consisted of eight strains, namely BPE 121.1-MC isolates from Weedindi in East Wewewa Subdistrict, RSK 32.1-CCA isolates from Pakamutu in Kodi Subdistrict, two isolates (BPE 122.1-CCA and BPE 122.4-CCA) from Durru Lodo in East Wewewa Subdistrict, other two isolates (BPE 127.1-MC and BPE 127.2-MC) from Elopada in East Wewewa Subdistrict, BPE 123.1-CCA isolates from Kongge in East Wewewa, and one isolates (BPE 120.1-MC) from Omba Rade in East Wewewa Subdistrict. According to the previous research (Amarantini et al. 2009), two isolates (BPE 121.1-MC and BPE 127.1-MC) were categorized as Biotype III (d-xilose +; l-arabinose +). All the others (RSK 32.1-CCA, BPE 122.1-CCA, BPE 122.4-CCA, BPE 127.2-MC, BPE 123.1-CCA and BPE 120.1-MC) were categorized as Biotype I (d-xilose +; larabinose -). Both categories were classified as one single clade. In the first clade, it was evident that the resistant strains and the sensitive strains from the same geographical area could be separated into different subclades. The strains were BPE 127.1-MC and BPE 127.2-MC from Elopada in East Wewewa and BPE 122.1-CCA and BPE 122.4-CCA from Durru Lodo in East Wewewa. This research proved that the phylogenetic classification for the first clade could differentiate two strains with different characters in terms of their nalidixic acid resistance in separate subclade even though they were originally from the same geographical origin. The second clade consisted of four strains, they were BPE74.1-CCA isolates from Weerambo, East Wewewa, RSL 1.3-SSA isolates from Kampung Sawah, Waikabubak, BPE 7.10-MC isolates from Ombawawi, North Wewewa, BPE 1.1-SSA isolates from Wanowitu, East Wewewa. It meant that four isolates in this clade were closely related with S. typhi NCTC 786. According to the database, this strain was a culture collection of HPA in United Kingdom deposited by the Lister Institute (accession data: 01.01.1920). It was isolated in 1920 from a single colony of S. typhi Rawlings strains, NCTC 160. According to WHO standard, this strain was categorized in the third group as hazardous pathogens. Thus, people should be very cautious to these strains. The third clade consisted of three strains; they are RSK 5.1-SSA isolates from Watubero in North Kodi Subdistrict and two isolates (RSK 22.2-CCA and RSK 22.4-CCA) from Pala Mata Loko in North Wewewa. In this clade, the strains belong to Biotype I and Biotype III. All these isolates were sensitive to nalidixic acid.

The last clade was named Clade Palekki since it comprised of the isolates originally from Palekki in North Wewewa Subdistrict. It belonged to Biotype I. This clade was the most different isolates among the sixteen isolates because it was a single-member clade which contained only one isolate (BPE 88.1-CCA). The 16S rRNA nucleotide similarity values (%) and the number of nucleotide differences among 16 S. typhi isolates from the infected patients in different geographical regions in Southwest Sumba District and the reference strain of S. typhi ATCC 19430T are shown in Table 2. All the tested strains possess a 16S rRNA sequence with â&#x2030;Ľ99% similarity with the reference strain of S. typhi ATCC 19430T. Based on the similarity scores, these strains were identified as S. typhi (Drancourt et al. 2000). They were entirely congruent either between similarity values and nucleotide differences or based on the phylogenetic analysis. Thus, this inquiry concluded that the isolates belong to S. typhi species even though they formed several different centers of diversity within the 16S rRNA gene tree. It was also evident that in terms of similarity and difference of nucleotide (Table 2), BPE 122.4-CCA was identical with BPE 122.1-CCA. BPE 122.1-CCA was also like BPE 121.1-MC and BPE 120.1-MC. The last two strains (BPE 121.1-MC and BPE 120.1-MC) were identical. All these strains were originally from East Wewewa Subdistrict and classified into the first clade. Consequently, the similarity values and the number of nucleotide differences between the strains were completely congruent with the results of the phylogenetic analysis. Analysis of S. typhi isolates according to geographical distribution of the diseases using global positioning system and its public health implications The map of the S. typhi isolates according to the geographical distribution of the diseases using Global Positioning System is shown in Figure 2. It revealed that the phylogenetic relationships of S. typhi strains were based on the phylogenetic distance value. In addition, the result of phylogeny tree analysis also shows that each clade was made up of the strains from different places of origin in Southwest Sumba District, East Nusa Tenggara. This fact indirectly answers the hypothesis of inter-geographical spread of the strains. The spread of the strains within the first clade originated from Durru Lodo, East Wewewa. It reached out Weedindi in East Wewewa Subdistrict and went further out to Pakumutu in Kodi Subdistrict. The transmission was indicated with the brown line. The other three strains of the same clade spread circulatory in the territory of East Wewewa Subdistrict. As indicated by the red line, the strain from Ombarade spread outward to Elopada and Kongge (Figure 2). In the second clade, the strain from Wanowitu in East Wewewa Subdistrict spread outward to Ombawawi in North Wewewa Subdistrict, and then went further out to Kampung Sawah in Waikabubak Subdistrict and Weerambo in East Wewewa Subdistrict. The spread of these strains is indicated with the purple line (Figure 2).

B I O D I V E R S IT A S 12 (1): 1-6, January 2011

Figure 1. Neighbor-joining (Saitou and Nei 1987) dendogram represents the phylogenetic relationships of the 16S rRNA gene of S. typhi strains from different geographical areas in Southwest Sumba District, East Nusa Tenggara and the representative strains of Enterobacteriaceae family. The arrow indicates estimated root.

DISTRICT

Figure 2. The map of diversity and distribution of S. typhi strains in Southwest Sumba District, East Nusa Tenggara based on phylogenetic relationships.

AMARANTINI et al. – Identification of Salmonella typhi based on 16S rRNA

Table 2. 16S rRNA similarities value (%) and the number of nucleotide difference between the sixteen strains of S. typhi originated from different geographical places in Southwest Sumba District, East Nusa Tenggara and the reference strain of S. typhi ATCC 19430T. AMARANTINI et al. – Identification of Salmonella typhi based on 16S rRNA

Strain A P E R K O J B L M D N F H I Q G Z47544 code A --5/1384 4/1382 5/1381 4/1382 6/1382 4/1382 6/1382 4/1381 4/1382 5/1380 11/1381 5/1381 3/1381 6/1381 5/1381 4/1381 7/1381 P 99.64 --3/1382 4/1381 1/1382 3/1382 1/1382 3/1382 1/1381 1/1382 6/1380 8/1381 4/1381 2/1381 5/1381 4/1381 3/1381 6/1381 E 99.71 99.78 --3/1381 2/1382 4/1382 2/1382 4/1382 2/1381 2/1382 4/1380 9/1381 3/1381 1/1381 4/1381 3/1381 2/1381 5/1381 R 99.64 99.71 99.78 --3/1381 5/1381 3/1381 5/1381 3/1381 3/1381 6/1380 10/1381 4/1381 2/1381 5/1381 4/1381 3/1381 6/1381 K 99.71 99.93 99.86 99.78 --2/1383 0/1383 2/1382 0/1381 1/1383 5/1380 7/1381 3/1381 1/1381 4/1381 3/1381 2/1381 5/1381 O 99.57 99.78 99.71 99.64 99.86 --2/1383 4/1382 2/1381 3/1383 7/1380 8/1381 5/1381 3/1381 6/1381 5/1381 4/1381 7/1381 J 99.71 99.93 99.86 99.78 99.86 --3/1383 0/1381 1/1384 5/1381 7/1382 3/1382 1/1381 4/1381 3/1381 2/1381 5/1381 100 B 99.57 99.78 99.71 99.64 99.86 99.71 99.78 --2/1381 3/1383 7/1381 10/1382 6/1382 3/1381 6/1381 5/1381 4/1381 7/1381 L 99.71 99.93 99.86 99.78 99.86 99.86 --3/1381 1/1381 4/1381 3/1381 2/1381 5/1381 100 100 0/1381 5/1380 7/1381 M 99.71 99.93 99.86 99.78 99.93 99.78 99.93 99.78 --5/1381 7/1382 3/1382 1/1381 4/1381 3/1381 2/1381 5/1381 100 D 99.64 99.57 99.71 99.57 99.64 99.49 99.64 99.49 99.64 99.64 --10/1381 6/1381 4/1380 7/1380 6/1380 5/1380 8/1380 N 99.2 99.42 99.35 99.28 99.49 99.42 99.49 99.28 99.49 99.49 99.28 --10/1382 8/1381 12/1382 11/1382 9/1381 12/1381 F 99.64 99.71 99.78 99.71 99.78 99.64 99.78 99.57 99.78 99.78 99.57 99.28 --2/1381 5/1381 4/1381 3/1381 6/1381 H 99.78 99.86 99.93 99.86 99.93 99.78 99.93 99.78 99.93 99.93 99.71 99.42 99.86 --3/1381 2/1381 1/1381 4/1381 I 99.57 99.64 99.71 99.64 99.71 99.57 99.71 99.57 99.71 99.71 99.49 99.13 99.64 99.78 --1/1382 4/1381 7/1381 Q 99.64 99.71 99.78 99.71 99.78 99.64 99.78 99.64 99.78 99.78 99.57 99.2 99.71 99.86 99.93 --3/1381 6/1381 G 99.71 99.78 99.86 99.78 99.86 99.71 99.86 99.71 99.86 99.86 99.64 99.35 99.78 99.93 99.71 99.78 --3/1381 Z47544 99.49 99.57 99.64 99.57 99.64 99.49 99.64 99.49 99.64 99.64 99.42 99.13 99.57 99.71 99.49 99.57 99.78 --Note: A (RSK 5.1-SSA); B (RSK 32.1-CCA); C (RSL 2.1-CCA); D (RSK 22.2-CCA); E (RSK 22.4-CCA); F (BPE 7.10-MC); G (BPE 88.1-CCA); H (BPE 1.1-SSA); I (BPE74.1-CCA); J (BPE 120.1-MC); K (BPE 121.1-MC); L (BPE 122.1-CCA); M (BPE 122.4-CCA); N (BPE 123.1-CCA); O (BPE 127.1-MC); P (BPE 127.2-MC); Q (RSL 3.1-SSA); R (S. typhi NCTC 786); Z47544 (S. typhi ATCC 19430T).

B I O D I V E R S IT A S 12 (1): 1-6, January 2011

In the second clade, the strain from Wanowitu in East Wewewa Subdistrict spread outward to Ombawawi in North Wewewa Subdistrict, and then went further out to Kampung Sawah in Waikabubak Subdistrict and Weerambo in East Wewewa Subdistrict. The spread of these strains is indicated with the purple line (Figure 2). In the third clade, the strain from Mataloko in North Wewewa Subdistrict spread outward to Watubero in North Kodi Subdistrict (blue line). There was one strain (RSK 22.4-CCA) from North Wewewa Mataloko, which was originally able to use l-arabinose (biotype III). Later on it shifted into a strain of RSK 22.2-CCA which has no ability to use carbon sources (biotype I). The phylogenetic distance showed that the horizontal line of the strain was longer than that of the strains capable of using arabinose as the source of carbon. This fact proved that the strain of S. typhi Biotype I strains came up after the strain of S. typhi biotype III. Based on the distribution of S. typhi strains in Southwest Sumba District NTT, it was evident to conclude that the diversity and the spread of the strains were high only in East Wewewa Subdistrict. From the region, it spread outward to nearby subdistricts such as North Wewewa and Waikabubak, and then went further out to Kodi and North Kodi. The phylogenetic relationships of S. typhi strains based on the phylogenetic distance value significantly showed that the spread of the diseases as indicated with the blue line and the brown line tends to widen to more remote areas. This tendency should get attention because the strains which were originally from East Wewewa were very diverse, some of which were known to be resistant to nalidixic acid. Moreover, the people who lived in the remote rural areas have difficult lives, not only poor in economy but also poor in sanitation, food, water, commodities, and limited medical care. Thus, it was necessary to prevent the spread of the disease from East Wewewa Subdistrict and to cut off all related factors supporting its transmission.

CONCLUSION All S. typhi isolates from the infected patients in Karitas Hospital in Southwest Sumba District, East Nusa Tenggara belonged to S. typhi species because of their relativity with the type strain of S. typhi ATCC 19430T. The genetic diversity of the strains within S. typhi species could be disclosed using a molecular genetic approach based on 16S rRNA gene sequences. It was evident that the isolates belonging to S. typhi species form several different centers of diversity within the 16S rRNA gene tree. Each clade consisted of the strains from different places of origin in

Southwest Sumba District, East Nusa Tenggara. Therefore, it was reasonable to conclude that there was intergeographical spread of the strains and it tended to spread outward to more remote areas.

ACKNOWLEDGEMENTS A special gratitude is given to Karitas Hospital in Weetabula in Southwest Sumba District and Lende Moripa Hospital in Waikabubak in West Sumba District, East Nusa Tenggara for their assistance in collecting the samples. I should also thank Sr. Sili Bouka ADMâ&#x20AC;&#x201D;the Director of Karitas Hospital, dr. Loeta Lapoe Moekoeâ&#x20AC;&#x201D;the Director of Lende Moripa Hospital and all doctors of Karitas Hospital for their assistance during the research.

REFERENCES Amarantini C, Sembiring L, Kushadiwijaya H, Asmara W (2009) Isolation, characterization and grouping of Salmonella typhi strains in the Southwest Sumba Regensy East Nusa Tenggara based on phenotypic characteristics. J Biol Res 14: 191-196. Chang HR, Loo LH, Jeyaseelan K, Earnest L, Stackebrandt, E (1997) Phylogenetics relationships of Salmonella typhi and Salmonella typhimurium based on 16S rRNA sequence analysis. Int J Syst Bacteriol 47: 1253-1254. Chun J (1999) Phylogenetic Editor (PHYDIT). Windows Version. Drancourt M, Bollet C, Carlioz A, Martelin R, Gayral JP, Raoult D (2000) 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J Clin Microbiol 38: 3623-3630. Felsenstein J (1993) Phylogeny Inference Package version 3,5c. Distributed by the author. Departement of Genetics, University of Washington. Seattle USA. Juke TH, Cantor CR (1969) Evolution of protein molecules. In: Munro HN (eds) Mammalian protein metabolism. Academic Press, New York. Massi MN, Shirakawa T, Gotoh A, Hatta M, Kawabata M (2005) Identification and sequencing of Salmonella enterica Serotype Typhi isolates obtained from patients with perforation and non-perforation typhoid fever. Southeast Asian J Trop Med Public Health. 36: 118122. Muliawan SY, Surjawidjaja JE (1999) Early diagnosis of typhoid fever by using outer membrane protein of S. typhi as specific antigen. Cermin Dunia Kedokteran. 124: 11-13. [Indonesia] Saitou N, Nei M (1987) The Neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425. Steele D (2008) The importance of generating evidence on typhoid fever for implementing vaccination strategies. J Infect Developing Countries 2: 250-252. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882. WHO (2003) Background document: the diagnosis, treatment and prevention of typhoid fever. Communicable Disease Surveillance and Response Vaccines and Biologicals. whqlibdoc.who.int/hq/2003/ WHO_V&B_03.07.pdf.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 7-11

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120102

Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson AGUNG KURNIAWANâ&#x2122;Ľ, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE Bali Botanic Garden, Indonesian Institute of Science (LIPI), Candikuning, Baturiti, Tabanan 82191, Bali, Indonesia. Tel.: +62-368-21273; Fax.: +62368-22051; ď&#x201A;Šemail: agung_kurnia1@yahoo.com Manuscript received: 2 July 2010. Revision accepted: 16 August 2010.

ABSTRACT Kurniawan A, Wibawa IPAH, Adjie B (2011) Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson. Biodiversitas 12: 7-11. Amorphophallus belongs to Araceae family that consists of more than 170 species worldwide and distributed predominantly in tropical countries, especially in Asia and Africa. The study of Amorphophallus in Bali and Lombok Islands had been conducted to reveal its diversity. Genetic study was also conducted among Amorphophallus paeoniifolius species to recognize the variation within the species. The fieldworks showed three species Amorphophallus distributed in Bali, notably A. muelleri Blume, A. paeoniifolius (Dennst.) Nicolson, A. variabilis Blume and two species in Lombok, notably A. muelleri and A. paeoniifolius. Var. hortensis and var. sylvestris were two varieties of A. paeoniifolius that commonly found either in Bali or in Lombok. Genetic study on A. paeoniifolius indicated that there was no genetic variation in cpDNA region of trnL-F IGS within the species. Key words: Amorphophallus paeoniifolius, diversity, genetic variation, cpDNA.

INTRODUCTION Amorphophallus is belonging to Araceae family that consists of more than 170 species worldwide and distributed predominantly in tropical countries, especially in Asia and Africa. This genus mostly grow in secondary forests or disturbed spots in primary forests and forest margins, also in tropical humid forest, seasonal forest and sometimes in humus deposits on rocks (limestone). The majority of Amorphophallus species seem to be pioneers in disturbed vegetations. Many are found at forest margins, in open savannah forests, on (steep) slopes, in disturbed parts of primary forest. Relatively few species are known to live in dense forest (Hetterscheid and Ittenbach 1996; Mayo et al. 1997; Sugiyama and Santosa 2008). The genus of Amorphophallus has seasonally dormant. The leaves are emerging from tuber, solitary in adult plants; the petiole is long, smooth, conspicuously spotted and marked in a variety of patterns. Blade divided in three main branches, primary divisions pinnatisect, secondary and tertiary divisions approximately regularly pinnatifid to pinnatisect. Inflorescence always solitary, usually flowering without leaves. Spathe variously coloured, inner surface smooth. Spadix sessile or stipitate; female zone shorter, equaling or longer than male zone; subglobose, terminal appendix usually present, erect. Flowers unisexual. Male flower: stamens free, short, filaments absent or distinct. Female flower: stigma variably shaped, entire and sub-globose or 2-4 lobed or stellate or rarely punctiform. Infructescence usually long-peduncled; fruiting part globose or elongate; berries globose or elongate, red,

orange-red, white, white-and-yellow, blue. Seeds globose, subglobose, ovate, elliptic (Hetterscheid and Ittenbach 1996; Jansen et al. 1996; Mayo et al. 1997). Amorphophallus paeoniifolius (Dennst.) Nicolson or A. campanulatus Decne is widely distributed and cultivated in Indonesia and other Asian countries. It has large variation in petiole color, such as light to dark green, blackish green, gray, reddish or pinkish white. Petiole structure divide in two varies, notably rough and smooth. Usually classified into two groups A. campanulatus (A. paeoniifolius) var. hortensis (smooth petiole) and A. campanulatus (A. paeoniifolius) var. sylvestris (rough petiole) (Sugiyama and Santosa 2008). Bali is closely neighboring to Lombok that laid on the Middle to East Indonesia and just separated with 35 km strait but the existence of Wallacea line between these islands make them unique and interesting. Wallace line was known as imaginary line separating the Oriental (Sunda Shelf) and Australian (Sahul Shelf) biotas-extends Bali and Lombok and between Sulawesi and Borneo/Philippines. Alfred Russell Wallace was one of the first to draw worldwide attention to the dramatic change in especially the fauna of central Malesia region between Southeast Asian and New Guinean-Australian fauna (van Welzen et al. 2005). The fauna studies in Wallacea areas are more extensive than flora studies especially in Bali and Lombok. The diversity of Amorphophallus never been studied specifically in Bali and Lombok Islands except globally mentioned on Jansen et al. (1996) and Mayo et al. (1997). Technical progress in the determination of DNA sequence has resulted in an enormous amount of DNA

B I O D I V E R S IT A S

12 (1): 7-11, January 2011

sequence data, with technical innovations such as the polymerase chain reaction (PCR) accelerating the rate of increase of this data. This combination of data and techniques makes it possible now to exploit sequence differences between individuals. Such studies can answer biological questions, such as genetic variation, allele diversity and hybrid origin. Making comparative studies between individuals inevitably deals with a large number of samples, thus the methods employed in such studies should be simple (Hayasi 1991). One such method is PCR-singlestrand conformation polymorphism (SSCP) analysis. SSCP is an accurate method for detecting nucleotide differences among PCR products (Lessa and Appelbaum 1993; Yap and McGee 1994; Sunnucks et al. 2000). This possibility promoted our interest in exploring genetic variation in Amorphophallus paeoniifolius. MATERIALS AND METHODS Species diversity Fieldworks conducted at several districts in Bali and Lombok to obtain the recent data of Amorphophallus species. Some reports from fieldworks of Bali Botanic Garden staff in both areas are also examined to figure out the Amorphophallus diversity in the past. The living Amorphophallus collections of Bali Botanic Garden and its herbarium specimens in Herbarium Hortus Botanicus Baliense also checked. Genetic study To study intraspecific genetic variation, multiple samples were examined for Amorphophallus paeoniifolius. The total DNA was extracted from dried leaf samples from 24 accessions using DNeasy Plant Mini Kit (Qiagen, Tokyo, Japan). The region from trnL (UAA)5´exon to trnF (GAA), later called trnL-F, was amplified with primer e and primer f of Taberlet et al. (1991). The PCR products were analyzed using the single-strand conformation polymorphism (SSCP) method following the procedure of Watano et al. (2004). The gel was made by using MDE™ gel solution (Cambrex Bio Science Rockhland, Inc., USA)

with 2% glycerol concentration. Electrophoresis was carried out at 18o C, and 300 volts run for 7 hours in 0.5X TBE buffer. The DNA bands were then visualized using a DNA Silver Staining method (Pharmacia Biotech, Sweden).

RESULTS AND DISCUSSION Amorphophallus species Based on fieldwork activity, there are three species of Amorphophallus obtained from Bali and two species from Lombok. Amorphophallus muelleri Blume, A. paeoniifolius (Dennst.) Nicolson and A. variabilis Blume represent the Bali’s Amorphophallus. The Amorphophallus species that recorded in Lombok are A. muelleri and A. paeoniifolius (Table 1). Jansen et al. (1996) reported that Indonesian A. muelleri is found in Sumatra, Java, Flores and Timor. It is not mentioned in Bali and Lombok Island. This species is cultivated in Java especially in East Java, conversely cultivated A. muelleri is never found in Bali or Lombok. This species is still uncommonly for farmer in Indonesia (Soemarwoto 2005). It is still wild and can be found in the natural area, such as forest, in the river sides or in undisturbing area in Bali and Lombok Islands. Two varieties of A. paeoniifolius are found either in Bali or Lombok. A. paeoniifolius var. hortensis (known as suweg in Bali and lombos in Lombok) is frequently planted in Bali and Lombok, because its tuber is edible and easily processing before consumed. Another variety is A. paeoniifolius var. sylvestris (known as tiyih in Bali and lombos babi/lombos sawak in Lombok). The last variant is almost not cultivated, whereas it’s commonly found wild in the forest boundary or in disturbed/unused land. Actually, Jansen et al. (1996) separated wild species of A. paeoniifolius into two varieties, notably var. sylvestris Backer and var. paeoniifolius. The cultivated species also divided into two varieties, such as var. hortensis Backer and var. campanulatus (Decaisne) Sivadasan.

Table 1. Amorphophallus Species in Bali and Lombok Islands Samples from Bali

Scientific name A. muelleri A. paeoniifolius var. hortensis

A. paeoniifolius var. sylvestris A. variabilis

Samples from Lombok West Central Buleleng Jembrana Karangasem Tabanan Lombok Lombok Ag.225 Ag.173 Ag.183, Ag.184, Ag.185 Ag.195, Ag.196*, Ag.139*, Ag.140* Wb.10, Wb.11*, Ag.148*, Ag.153, Ag.155*, Ag.197*, Ag.210*, Wb.12a*, Ag.223*, Ag.156*, Ag.160*, Ag.213*, Ag.216*, Wb.12b*, Wb.13, Ag.224*, Ag.162. Ag.171*, Ag.225a, Ag.227* Ag.175*, Ag.181, Ag.182 Ag.205*, Ag.207*, Ag.146*, Ag.147* Wb.14 Ag.228* Ag.161, -

Ag.200, Ag.202, Wb.16, Wb.17, Ag.203, Ag.204, Ag.206, Ag.208, Ag.209, Ag.211 Note: * = leaves samples of A. paeoniifolius were used in genetic test.

KURNIAWAN et al. – Species diversity of Amorphophallus in Bali and Lombok

Amorphophallus variabilis is only known wild in several Island in Indonesia such as Java, Madura and Kangean Islands (Jansen et al. 1996). In fact, this species also distribute in some districts in Bali Island. It could be a new record for uncommon A. variabilis in Bali although it can be recognized easily from its bad smell flowers when come close to the night. The diversity of Amorphophallus that mentioned above represented that the Wallace line is not to be the strict boundaries between Bali and Lombok although each island is separated with this line. This result is probably agreed with van Welzen et al. (2005) that mentioned the Wallacea area comprises Java, the Philippines, Sulawesi, the Lesser Sunda Islands (include Bali and Lombok Island), and Maluku. So the diversity between Bali and Lombok is similar because it’s still in the same region, Wallacea. Amorphophallus descriptions Amorphophallus muelleri Diameter tuber 20 cm and up to 28 cm, dark brown, smooth, often without nodes or bud, with densely whitishivory root in petiole base. Petiole about 40-50 cm long, diameter 1-5 cm, smooth, pale green and rarely brownish, with numerous whitish green continuous spot. Lamina or blade very dissected, carrying epiphyllar bulbils on the major ramifications on the venation intersections; leaflets lanceolate, 10-35 cm x 4-9 cm. Peduncle 30 cm and up 60 cm (Jansen et al. 1996), diameter 1-3 cm. Inflorescence smaller than A. paeoniifolius but wider and bigger than A. variabilis, inflorescence is absent during fieldwork. According to Jansen et al. (1996), spathe size is 7.5-27 cm x 6-27 cm, limb semi erect or spreading, brownish-purple or grayish-greenish outside, inside purplish or brownish with greenish or brownish spots; spadix longer than spathe, 8-30 cm long. Inflorescence does not produce unpleasant odors. Infructescence cylindrical to narrowly triangular, berry cylindrical to ovoid, 12-18 mm long, bright red. Amorphophallus paeoniifolius Diameter tuber 25 cm and up to 30 cm, dark brown, rough with several nodes and producing seasonal rhizomatous buds. Petiole 100 cm and up to 200 cm height, diameter 5-10 cm; strongly verrucose-echinate until shallowly corrugate surface, dark green to brownish green (wild species), slightly verrucose to smooth surface, pale green to green (cultivated species); with whitish green spots either in wild or cultivated species. Lamina or blade 100-150 in diameter, deeply dissected, rachises winged; leaflets ovate to lanceolate, 3-35 cm x 2-12 cm. Peduncle 3-15 cm in height and elongating when fruiting until 75 cm, peduncle surface is similar with petiole both in wild and cultivated species; peduncle turns brownish greenbrown when fruit is ripening. Inflorescence is biggest among two other Amorphophallus. Spathe 10-30 cm x 1550 cm, limb spreading and strongly undulate, pale green to brown with pale green-whitish green spot outside, glossy dark brown to dark red-purple inside. Spadix is longer than spathe, 10-25 cm long. Inflorescence produces very upleasant odors like carcass smell. Infructescens cylindric; berry cylindrical, less than 2 cm, bright red.

Amorphophallus variabilis Diameter tuber is commonly small, about 10-15 cm, very dark, rough, producing seasonal rhizomatous buds. Petiole 50-75 cm long and up to 120 cm according to Jansen et al. (1996), smooth, sometimes glossy, variegated surface color from pale green, greenish brown, pure green to pale brown, with randomly whitish green to dark green irregular spots. Lamina or blade 50-75 cm in diameter and up to 125 cm (Jansen et al. 1996); almost similar with A. paeoniifolius lamina, leaflets elliptical to lanceolate, 4-34 cm x 2-12 cm. Peduncle about 50-60 cm, 1-2 cm diameter. Inflorescence is longest than A. muelleri and A. paeoniifolius; spathe narrowly short, up to 20 cm or 1/3-1/4 spadix length, limb pale green-green with randomly whitish spots outside, creamy white-ivory inside. Spadix is commonly very longer than spathe. When inflorescence is flowering, it’s commonly known with bad smell that appearing early in the evening. Only unripening infructescens found during fieldwork, cylindrical, densely arranged, green. Jansen et al. (1996) reported the ripening fruit is orange-red with 1-3 seeded. Key to Bali and Lombok of Amorphophallus species 1.a. Leaflets without bulbils on the venation intersections ............................................................ 1.b. Leaflets with several bulbils on the venation intersections ........................................ A. muelleri 2.a. Petiole smooth or slightly glabrous .......................... 2.b. Petiole strongly verrucose-echinate or corrugate ..... ............................. A. paeoniifolius var. sylvestris

3.a. Inflorescence bigger and wider; limb spreading and strongly undulate, pale green to brown with pale green-whitish green spot outside, glossy dark brown to dark red-purple inside ............................. ............................. A. paeoniifolius var. hortensis 3.b. Inflorescence narrowly long, smaller. limb pale green-green with randomly whitish spots outside, creamy white-ivory inside ................. A. variabilis Genetic study on A. paeoniifolius The extracted DNA showed high concentration (Figure 1), and the PCR products were easily amplified about 400 bp of the trnL-F IGS region (Figure 2) which is suitable size for SSCP analysis. The SSCP gels showed only single banding pattern for all accessions, this can be interpreted there is no sequence variation among the PCR products. The accessions which include two varieties of A. paeoniifolius (var. hortensis and var. sylvestris); however, the region examined was not differentiated. The cpDNA known to have very slow mutation rate (Clegg et al. 1994) and would be better to use in the study between species. Thus, the placement of two varieties in one species A. paeoniifolius may be appropriate. The application of PCRSSCP method was widely used in various taxa such as ferns (Ebihara et al. 2005; Terada and Takamiya 2006; Adjie et al. 2007; 2008; Adjie and Lestari 2009), gymnosperm (Watano et al. 2004) to human (Orita et al. 1989).

B I O D I V E R S IT A S

12 (1): 7-11, January 2011

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Figure 1. Total DNA extracted from Amorphophallus paeoniifolius. M=DNA marker Ń&#x201E;X174 HaeIII digest (Takara, Tokyo, Japan), 1=Ag139, 2=Ag175, 3=Ag140, 4=Ag146, 5=Ag147, 6=Ag148, 7=Ag156, 8=Ag160, 9=Ag171, 10=Ag196, 11=Ag197, 12=Ag205, 13=Ag207, 14=Ag210, 15=Ag213, 16=Ag216, 17=Ag223, 18=Ag224, 19=Ag227, 20=Ag228, 21=Wb11, 22=Wb12a, 23=Wb12b and 24=Ag155

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Figure 2. PCR product of trnL-F IGS about 450 bp. M=100bp DNA Ladder (Toyobo, Japan).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Figure 3. PCR-SSCP gels show no sequence variations within accessions.

Using AFLP and SSR markers (Sugiyama et al. 2006; Santosa et al. 2007) also suggest little variation within A. paeoniifolius collected from Java. These results suggest that people play important role in the selection and distribution of A. paeoniifolius, reducing genetic variation in a region (Sugiyama and Santosa 2008). They also suggest the effectiveness of farmersâ&#x20AC;&#x2122; participation in the selection of new cultivars in the breeding program.

ACKNOWLEDGEMENTS We wish to acknowledge I Nyoman Sudiatna and I Nengah Nada for fully assistance in this project. We thank Dr. Tadashi Kajita and Prof. Yasuyuki Watano (Chiba University, Japan) for invitation and permission to use their laboratory. This research was funded by Incentive Programs in 2009 Researchers and Engineers-DIKTI LIPI (No.: 22/SU/SP/Insf-Dikti/VI/09).

CONCLUSION REFERENCES This study concluded that: (i) There are three species Amorphophallus in Bali, notably Amorphophallus muelleri Blume, A. paeoniifolius (Dennst.) Nicolson and A. variabilis Blume. Whereas, only two species in Lombok are A. muelleri and A. paeoniifolius. A. paeoniifolius consists of two varieties, such as A. paeoniifolius var. hortensis and A. paeoniifolius var. sylvestris. (ii) There is no genetic variation in cpDNA region of trnL-F IGS within the Amorphophallus paeoniifolius accessions.

Adjie B, Masuyama S, Ishikawa H, Watano Y (2007) Independent origins of tetraploid cryptic species in the fern Ceratopteris thalictroides. J Plant Res 120: 129-138. Adjie B, Takamiya M, Ohta M, Ohsawa TA, Watano Y (2008) Molecular phylogeny of the lady fern genus Athyrium in Japan based on chloroplast rbcL and trnL-trnF sequences. Acta Phytotax Geobot 59 (2): 79-95. Adjie B, Lestari WS (2009) Genetic diversity in the fern genus Ceratopteris Brongn. Biosaintifika 1 (2): 139-146. [Indonesia]

KURNIAWAN et al. â&#x20AC;&#x201C; Species diversity of Amorphophallus in Bali and Lombok Clegg MT, Gaut BS, Learn GH, Morton BR (1994) Rates and patterns of chloroplast DNA evolution. Proc Natl Acad Sci USA 91: 6795-6801. Ebihara A, Ishikawa H, Matsumoto S, Lin S, Iwatsuki K, Takamiya M, Watano Y, Ito M (2005) Nuclear DNA, chloroplast DNA, and ploidy analysis clarified biological complexity of the Vandenboschia radicans complex (Hymenophyllaceae) in Japan and adjacent areas. Am J Bot 92:1535-1547. Hayasi K (1991) PCR-SSCP: A Simple and sensitive method for detection of mutation in genomic DNA. Genome Res 1: 34-38. Hetterscheid WLA, Ittenbach S (1996) Everything you always wanted to know about Amorphophallus, but were afraid to stick your nose into!!!! Aroideana 19: 7-131. Jansen PCM, van der Wilk C, Hetterscheid WLA (1996) Amorphophallus Blume ex Decaisne. In: Flach M, Rumawas F (eds) Plant Resources of South-East Asia No. 9. Plants yielding non-seed carbohydrate. Prosea, Bogor. Lessa EP, Appelbaum G (1993) Screening techniques for detecting allelic variation in DNA sequences. Mol Ecol 2: 121-129. Mayo SJ, Bogner J, Boyce PC (1997) The Genera of Araceae. Royal Botanic Garden, Kew. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T (1989) Detection of polymorphisms of human DNA by gel electrophoresis as singlestrand conformation polymorphism. Proc Natl Acad Sci USA 86: 2766-2770. Santosa E, Lian C, Paisooksantivatana Y, Sugiyama N (2007) Isolation and development of polymorphic microsatellite markers in Amorphophallus paeoniifolius (Dennst.) Nicolson, Araceae. Mol Ecol Notes 7 (5): 814-817.

Soemarwoto (2005) Iles-iles (Amorphophallus muelleri Blume); description and other characteristics. Biodiversitas 6 (3): 185-190 [Indonesia] Sugiyama N, Santosa E, Lee ON, Hikosaka S, Nakata M (2006) Classification of elephant foot yam (Amorphophallus paeoniifolius) cultivars in Java using AFLP markers. Japanese J Trop Agric 50: 215218. Sugiyama N, Santosa E (2008) Edible Amorphophallus in Indonesiapotential crops in agroforestry. Gadjah Mada University Press. Yogyakarta. [Indonesia] Sunnucks P, Wilson ACC, Beheregaray LB, Zenger K, French J, Taylor AC (2000) SSCP is not so difficult: the application and utility of single-stranded conformation polymorphism in evolutionary biology and molecular ecology. Mol Ecol 9: 1699-1710. Taberlet P, Gielly L, Pautau G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17: 1105-1110. Terada Y, Takamiya M (2006) Cytological and genetic study of two putative hybrids and their parents of Athyrium (Woodsiaceae; Pteridophyta) in Yakushima island, southwestern Japan. Acta Phytotax Geobot 57 (1): 95-106. van Welzen PC, Silk JWF, Alahuhta J (2005) Plant distribution patterns and plate tectonics in Malesia. Biol Skr 55: 199-217. Watano Y, Kanai A, Tani N (2004) Genetic structure of hybrid zones between Pinus pumila and P. parviflora var. pentaphylla (Pinaceae) revealed by molecular hybrid index analysis. Am J Bot 9:65-72. Yap EPH, McGee JOD (1994) PCR Technology current innovation. CRC, London.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 12-16

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120103

Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana HADIWIYONO1,♥, JAKA WIDADA2, SITI SUBANDIYAH2, MARK FEGAN3 1

Departement of Agronomy, Faculty of Agriculture, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central Java, Indonesia. Tel.: +62-21-0271637457, Fax.: +62-21-0271637457 , email: hadi_hpt@yahoo.com 2 Post Graduate School, Faculty of Agriculture, Gadjah Mada University (UGM), Yogyakarta 55281, Indonesia 3 School of Molecular and Microbial Sciences, and Cooperative Research Center for Tropical Plant Protection, University of Queensland, Australia Manuscript received: 30 April 2010. Revision accepted: 10 August 2010.

ABSTRACT Hadiwiyono, Widada J, Subandiyah S, Fegan F (2011) Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana. Biodiversitas 12: 12-16. Blood disease bacterium (BDB) is the most important pathogen of bananas in Indonesia. In some field, the disease incidence reaches over 80%. Epidemiologically, the disease is similar to Moko disease in South America and Bugtok disease in the Philippines caused by Ralstonia solanacearum race 2. However, BDB is different in phenotype and genotype from the two diseases. Previously BDB was limited in South Sulawesi since 1920s – 1980s and recently was reported in 27 of 30 provinces in Indonesia. Pulsed-Field Gel Electrophoresis (PFGE) is a genomic DNA fingerprinting method, which employs rare cutting restriction endonucleases to digest genome prior to electrophoresis using specialized condition to separate of large DNA fragments. The results showed that PFGE analysis was a discriminative tool to study the genetic diversity of BDB. Based on the PFGE analysis, BDB isolates obtained from different localities in Yogyakarta and Central Java were quit diverse. Key words: blood disease bacterium, banana, PFGE.

INTRODUCTION In growing bananas (banana and plantain), blood disease was a major obstacle of banana production in Indonesia (Supriadi 2005). The causal agent of the disease is called blood disease bacterium (BDB) that formerly was called Pseudomonas celebensis by Gauman and used to reinstatement by Eden-Green at al. (1988), but it is no longer valid and has disappeared in the latest literatures (Supriadi 2005). Epidemiologically, the disease is similar to Moko disease in South America and Bugtok disease in the Philippine caused by Ralstonia solanacearum race 2. However, BDB is different in phenotype and genotype from the two diseases (Eden-Green 1994; Eden-Green et al. 1998; Prior and Fegan 2005). In the fields, the pathogen is high virulent in cooking banana (ABB genomic group) varieties (Eden-Green 1994) but other varieties were also susceptible to BDB by artificial inoculation (Sudirman and Supeno 2002). The national loss of banana production due to the blood disease was estimated around 36% in 1991 (Muharam and Subijanto 1991). The damage of banana plants in certain districts where ABB genomic group are planted such as Bondowoso and Lombok, were extremely serious. The disease incidence could reach over 80%s (Mulyadi and Hernusa 2002; Supeno 2002; Supriadi 2005). Cahyaniati et al. (1997) estimated the actual loss from Lampung Province was about 64%s. The pathogen has been distributed in 90%s of provinces in Indonesia with the

disease incidences varied from 10 thousands to millions of banana cluster (General Directorate of Horticulture of Indonesia 2006; Subandiyah et al. 2006). Up to now, the blood disease is still difficult to control due to a poor fundamental knowledge about ecology and epidemiology of the disease such as how the pathogen survive in soil, whether the pathogen associates with root systems of non-host plants, and whether widespread is the problem in naturally occurring Heliconia and Musa spp. etc. It is obvious that in-depth studies on the ecology and epidemiology of blood disease bacterium of banana are urgently required (Fegan 2005). Genetic variability of pathogen is one of the important themes in ecological study on bacterial wilt disease (Persley et al. 1985). Ecologically, Cook and Baker (1983) viewed that the occurrence of a plant disease epidemic indicated that some aspect of the biological network is not equilibrium: (i) the pathogen is genetically homogeneous and highly virulent, in high inoculums density, or not in equilibrium with the antagonists; (ii) the abiotic environment is relatively more favorable to the pathogen than to the host and/or antagonists; (iii) the host plant is genetically homogeneous, highly susceptible, and continuously or extensively grown; (iv) the antagonists are absent or in low populations, lack nutrients, or the proper environment to function as antagonist, are inhibited by other microorganisms. Conversely, the absence of a disease epidemic indicates that the pathogen is absent, or its

HADIWIYONO et al. – PGFE for blood disease bacterium of banana

population genetically diverse, the host is highly resistant or at least minimally diverse, the abiotic environment is unfavorable to the pathogen in a part or all of the time, or antagonists are inhibitory to the pathogen. Ecologically, to sustain their generation, to survive, to persist and to adapt a life in their habitat or varies unfavorable environmental condition, organism species evolve a complex genetic character and each character is genetically diverse in a species. A complex interaction among many different gene products determines the ability of a bacterium to cause disease (Brown and Caitilyn 2005). Among the genetic characters are pathogenicity fitness, virulence, aggressiveness, penetration capability in host, survival capability in host and/or environment etc. The capacity to cause plant disease has evolved in relatively small number of bacterial species which are phenotypically and genetically diverse. Below the level of the species the strains that make up these species also vary in genotype and phenotype. Traditionally phenotypic techniques such as substrate utilization profiles and total fatty acid composition have been employed to characterize plant pathogenic bacteria. Recently more reliable DNAbased methods have been applied which provide a more complete understanding of genetic and evolutionary relationships of bacteria (Fegan and Hayward 2004). Pulsed-field gel electrophoresis (PFGE) is a genomic DNA fingerprinting method, which employs rare cutting restriction endonucleases to digest the genomic DNA of bacteria which is then subjected to electrophoresis using specialized condition for separation of large fragments of DNA (Fegan and Prior 2005). Coenye et al. (2002) suggested that PFGE are the best method to study epidemiology of human bacterial diseases, such as Neisseria meningitides (Popovic at al. 2001), Campylobacter jejuni (Ribot et al. 2002), Stenotrophomonas maltophilia (Berg et al. 1999, Valdezate 2004) Staphylococcus aureus (Schlichting at al. 1993) Salmonella enterica, Shigella sonnei and Listeria monocytogenes (Hunter et al. 2005; Kubota 2005). Clinically, it is an invaluable tool in detecting the occurrence of an outbreak and trying to determine its source (Hentea 2004). This paper reports the evaluation of PFGE analysis as a tool for analyzing diversity of BDB isolates from some district in Yogyakarta and Central Java.

MATERIALS AND METHODS The PFGE method used in this study was based upon procedures as described by Popovic et al. (2001) with some modifications. Plugs were prepared with 1 mL of the bacterial suspension with OD600nm=0.1 ( 108 cfu/mL), harvested from 5 days BDB culture on CPG broth. Proteinase-K was used for lysing of the bacterial cells in the plugs with conditioning at 50 oC over night, continued by soaking the plugs in 3 mL TE and shaking for an hour. This washing step was done 4 times, and then the plugs were placed in a final volume of 1 mL TE (Tris-EDTA) and stored at 4oC. Restriction enzyme XbaI was used for digesting the bacterial DNA genome (at 20 units per 20 µl prepared in restriction buffer) and incubated at 37 oC for 4 hours. After

digestion, 1 mL of 0.5xTBE was added to the Eppendorf tube to stop the reaction and allowed the plugs to sit in running buffer for at least 15 minutes. The λ marker was also pre-incubated in the running buffer for 15 minutes. CHEF type (BioRadTM) was used for PFGE running. Running conditions: the electrophoresis chamber was filled with 2.2 L of fresh 0.5xTBE buffer, and chiller was adjusted to get 14°C. The running program was consisted of initial switch time, 2.16s; final switch time, 54.17 s; duration of run, 19 h, angle, 120°; gradient, 6 V/cm with a linear ramping factor. DNA fragments were stained with EtBr. DNA fragments were visualized under UV transilluminator and documented using digital camera. NTSYS soft ware was used to analyze the similarity of DNA banding pattern and dendrogram. PFGE grouping was based on reproducibility of the technique. The reproducibility was determined by repeating PFGE with isolate PTI-1 on three separate occasions. In addition, DNA from this isolate was run three times in each gel as standard for PFGE typing (Valverde et al. 2007).

RESULTS AND DISCUSSION Fourteen isolates of BDB were analyzed to investigate the genetic diversity of the isolates. DNA fragments generated by XbaI restriction endonuclease digestion of genomic DNAs of the isolates prior to PFGE analysis were presented in Figure 1. The results showed that PFGE analysis was a discriminative tool to study genetic diversity of BDB. Using 14 isolates from Yogyakarta and Central Java areas, BDB were quit diverse. Digestion of BDB genome with XbaI and visualization with PFGE showed that each isolate could generate between 14 to 17 convenient fragments with average 15.64±0.74. Whereas based on position of the fragments within 14 isolates of BDB, the PFGE could generate 21 fragments. Through analysis with the un-weighted pair group method arithmetic average (UPGMA) to fragment pattern of 14 isolates of BDB generated a tree plots with coefficient of similarity among the isolates (Figure 2). In reproducibility testing, the banding pattern of the reference isolate was obtained a baseline of the level of similarity between three different replicates, at 94%. Therefore, a cut off the value of 94% was used to define as a PFGE type. Based on the criterion, the PFGE analysis generated 5 strains of 14 isolates of BDB. It means that BDB in Yogyakarta and Central Java are diverse. At least 9 isolates from Yogyakarta and Central Java were grouped in one pulsed-field gel types (strain III). The isolates were GRG-1, KRA-1, SRG-1, MGL-1, TMG-1, TMG-2, SMG-1, BTL-1, and KLT-1, implying that those strains were the most common pathogen in the provinces. Whereas the other isolates (strains I, II, IV, V) were the minor strain in the provinces. The PFGE method is excellent in type ability, reproducibility, and discriminatory (Basim and Basim 2001; Coenye at al. 2002). Whereas Hielm et al. (1998) suggested that PFGE analysis is a reproducible and

B I O D I V E R S IT A S 12 (1): 12-16, January 2011

discriminating epidemiological method for studying Clostridium botulinum group II at the molecular level. The present results indicated that BDB was a diverse pathogen. In facts, previously reported that BDB was limited in Sulawesi Island (Eden-Green 1994) and significant explosive incidence of the disease occurred in the latest

decades (Supriadi 2005). It is possible that blood disease epidemics in out of Sulawesi Islands are related to blood disease epidemic in the first island and it should be confirmed with farther researches using a number of BDB isolates originated from different provinces in Indonesia.

—727.5kb — 582.0kb — 339.5kb —194.0kb — 97.0kb — 48.5kb — 30kb Figure 1. DNA fragments generated by Restriction endonuclease digestion of total DNAs from isolates of BDB with XbaI after pulsed field gel electrophoresis (PFGE), where 1. PTI-1 (Pati), 2. GRB-1, 3. GRB 3 (Grobogan), 4. PWR-1 (Purworejo), 5. KRA-1 (Kranganyar), 6. SRG-1 (Sragen), 7. BYL-1 (Boyolali), 8. KLT-1 (KLT), 9. SMG-1 (Semarang), 10. BTL-1 (Bantul), 11. TMG-1, 12. TMG-2 (Temanggung), 13. MGL-1 (Magelang), 14. SLM-1 (Sleman), M. Marker (Lambda Ladder).

Groups/ Types

0.94 PTI-1

—I

GRG- — II 1 GRG3 KRA-1 SRG-1 MGL-1 TMG-2

III

TMG-1 BTL-1 SMG-1 KLT-1 BYL-1 SLM-1

PWR-1 — V

0.70

0.77

0.85 Coefficient of similarity

0.92

1.00

Figure 2. The UPGMA-dendrogram presenting the diversities of BDB isolates based on DNA fragments generated by restriction endonuclease digestion of total DNAs with XbaI visualized by PFGE, where 1. PTI-1 (Pati), 2. GRB-1, 3. GRB 3 (Grobogan), 4. PWR-1 (Purworejo), 5. KRA-1 (Karanganyar), 6. SRG-1 (Sragen), 7. BYL-1 (Boyolali), 8. KLT-1 (Klaten), 9. SMG-1 (Semarang), 10. BTL-1 (Bantul), 11. TMG-1, 12. TMG-2 (Temanggung), 13. MGL-1 (Magelang), 14. SLM-1 (Sleman), M. Marker (Lambda Ladder)

HADIWIYONO et al. – PGFE for blood disease bacterium of banana

Basically, BDB is diverse in population. The spreading BDB to other provinces in Indonesia may lead to an increase the heterogeneousness of BDB due to its internal interaction within strains and with others environmental conditions in where pathogen was introduced. Goto (1990) explained that bacteria have a great capacity to adapt to diverse environments through mutation, gene transfer, of metabolic regulator. Basim et al (1999) opinioned the frequency of horizontal gene transfer among bacterial strains could be in a high level. The authors verified that the frequency of kanamycin resistance transfer to recipient was more than 75 times greater in planta (paper leaves) than in vitro. This gene transfer explains the great frequent among strains of bacterial spot pathogen (X. axonopodis pv. vesicatoria) in term of polymorphism, which is indicated by the high diversity in population. Comparing to the diversity of BDB generated by repPCR with BOXAIR primer (Subandiyah et al. 2006), this results showed that PFGE is more distinctive than those rep-PCR. rep-PCR could generated 10 fragments with different position and among 20 isolates only isolate 29LPG and 32-PLU (Central Sulawesi) showed specific fragment pattern. Whereas the PFGE could generate 21 different positioned fragments and generated 5 groups or pulsed field gel types of 14 isolates. Moreover, Coenye et al. (2002) suggested that PFGE was more reproducible than RAPD (random amplified polymorphic DNA) and BOXPCR finger printing in genomic typing of Burkholderia cepacia Genomovar III. Frey et al. (1996) characterized a number isolate of P. solanacearum. Comparison of among data obtained clearly identified that PFGE is the most discriminatory method delineating 17 pulse-field gel types, rep-PCR and bacteriocin typing identified nine rep-PCR profile types and nine bacterioncin groups. In a research employed by Smith et al. (1995), showed that genomic fingerprinting of P. solanacearum by PFGE revealed a level of genetic diversity previously unrealized using both ERIC-PCR and BOX-PCR. Basim et al. (1999) used PFGE for investigating the frequency of chromosomal gene transfer by conjugation and PFGE could verified the transfer gene occurrence among strain of Xanthomonas axonopodis pv. vesicatoria in a natural niche of the bacterium. Zhang and Geider (2005) observed isolates of Erwinia amylovora using PFGE analysis, and through this way the bacteria were grouped and differentiated into several strains correlated to their origin. So it is useful to hints about course and distribution of the plant disease.

CONCLUSION Pulsed-field gel electrophoresis (PFGE) analysis was a discriminative tool to study the genetic diversity of blood disease bacterium (BDB). Based on the PFGE analysis, BDB isolates obtained from different localities in Yogyakarta and Central Java were quit diverse.

ACKNOWLEDGEMENTS This research was major founded by Fundamental Research Program of The General Directorate of the Graduate School, The Department of Indonesian National Education, Contract No. 017/SP2H/PP/DP2M/III/2008 and partially by Gadjah Mada University (GMU)-Australian Center for International Agricultural Researches, Contract No. ACIAR CP2004/034 with Prof. Dr. Siti Subandiyah as a leader of the project.

REFERENCES General Directorate of Horticulture of Indonesia (2006) Distribution pattern of plant pests and diseases. www.deptan.go.id/ditlinhorti. [Indonesia]. Basim H, Stall RE, Minsavage GV, Jones JB (1999) Chromosomal gene transfer by conjugation in the plant pathogen Xanthomonas axonopodis pv. vesicatoria. Phytopathology 89: 1044-1049. Basim E, Basim H (2001) Pulsed-field gel electrophoresis (PFGE) techniques and its use in molecular biology. Turk J Biol 25: 408-418. Berg G, Roskot N, Smalla K, (1999) Genotypic and phenotypic relationships between clinical, and environmental isolates of Stenotrophomonas maltophilia. J Clin Microbiol 37: 3594-3600. Brown D, Caitilyn (2005) Understanding the molecular basis of bacterial wilt disease: a view from the inside out. In: Allen C, Prior P, Hayward AC (eds). Bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. Cahyaniati C, Mortensen N, Mathur SB (1997) Bacterial wilt of banana in Indonesia. Technical Bulletin. Directorate Plant Protection of Indonesia, Jakarta. Coenye T, Spilker T, Martin A, LiPuma JJ (2002) Comparative assessment of genotyping method of Burkholderia cepacia genevor III. J Clin Microbiol 40: 3300-3307. Eden-Green SJ (1994) Diversity of Pseudomonas solanacearum and related bacteria in South East Asia: new direction for moko disease. In: Hayward AC, Hartman GL (eds) Bcaterial wilt: the disease and its causative agent, Pseudomonas solanacearum. CAB International, California. Eden-Green S.J, Supriadi, Hastati SY (1998) Characteristics of Pseudomonas celebensis, the cause of blood disease of banana in Indonesia. In: Proceedings of the 5thinternational congress of plant pathology (abstract). Kyoto, August 20-27, 1998. Fegan M (2005) Bacterial wilt diseases of banana: evolution and ecology. In: Allen C, Prior P, Hayward AC (eds) Bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. Fegan M, Prior P (2005) How complex is the “Ralstonia solanacearum species complex”? In: Allen C, Prior P, Hayward AC (eds) Bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. Fegan M, Hayward C (2004) Genetic diversity of bacterial pathogen. In: Gillings M, Holmes A (eds) Plant microbiology. Bios Scientific, London. Frey P, Smith JJ, Albar L, Prior P, Saddler GS, Trigalet-Demery D, Trigalet A (1996) Bacteriocin typing of Burkholderia (Pseudomonas) solanacearum race 1 of the Frence West Indies and correlation with genomic variation of pathogen. Appl Environ Microbiol 62: 473-479. Goto M (1990) Fundamental of bacterial plant pathology. Academic Press, San Diego, CA. Hentea C (2004) Pulsed-field gel electrophoresis: a microbial experience. http//www.cdc.gov/pulse net/publication/2004/Hnetea_e.htm. Hielm B, Bjorkroth J, Hyytia E, Koreala H (1998) Genomic analysis of Clostridium botulinum group ii by pulsed-field gel electrophoresis. Appl Environ Microbiol 64: 703-708. Hunter SB, Vauterin P, Lambert-Fair MA, van Duyne MS, Kubota K, Graves L, Wrigley D, Barrett T, Ribot E (2005) Establishment of universal size standard strain for use with the pulsed-field gel electrophoresis protocols: converting the national databases to new size standard. J Clin Microbiol 43 : 1045-1050.

B I O D I V E R S IT A S 12 (1): 12-16, January 2011

Kubota K, Barrett TJ, Ackers ML, Brachman PS, Mintz ED (2005) Analysis of Salmonella enterica serotypic pulsed-field gel electrophoresis patterns associated with international travel. J Clin Microbiol. 43: 1205-1209. Mulyadi, Hernusa T (2002) Blood disease intensity on banana caused by bacterium of Pseudomonas solanacearum in Bondowoso. In: Proceeding of the 16th congress and national seminar of the Indonesian Phytopathological Society. Bogor, 22-24 August 2001 [Indonesia]. Persley GJ (ed). 1985. Bacterial Wilt Disease in Asia and the South Pacific. ACIAR Proceedings No. 13, 15-24, Canberra, Australia. Popovic T, Schmink S, Rosentein NA, Ahello GW, Reeves MW, Plikaytis B, Hunter SB, Ribot EM, Boxrud D, Tondella MI, Kim C, Noble C, Mothershed E, Besser J, Perkins BA (2001) Evaluation pulsed-field gel electrophoresis in epidemiological investigations of meningococcal disease outbreaks caused by Neisseria meningitidis serogrop. J Clin Microbiol 39: 75-85. Prior P, Fegan M (2005) Diversity and molecular detection of Rasltonia race 2 strains by multiplex PCR. In: Allen C, Prior P, Hayward AC (eds) Bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. Ribot EM, Fitzgerald C, Kubota K, Swaminatan B, Barett TJ (2002) Rapid pulsed-field gel electrophoresis protocol for subtyping of Campylobacter jejuni. J Clin Microbiol 39: 1889-1894. Schlichting C, Branger C, Fournier JM, Witte W, Boutonnier A, Woltz C, Goullet P, Doring G (1993) Typing of Staphylococcus aureus by pulsed-field gel electrophoresis, zymotyping, capsular typing, and phage typing resolution of clonal relationships. J Clin Microbiol 20: 2599-2605.

Smith JJ, Offord LI, Holddrness M, Saddler GS (1995) Genetic diversity of Burkholderia solanacearum (synonym Pseudomonas solanacearum) race 3 in Kenya. Appl Environ Micribiol 61: 42634268. Subandiyah S, Hadiwiyono, Nur E, Wibowo A, Fegan M, Taylor P (2006) Survival of blood disease bacterium of banana in soil. In: Proceeding of the 11th international conference on plant pathogenic bacteria. Edinburgh, 10-14 July 2006. Sudirman, Supeno B (2002) Screening some varieties of banana to infection of blood disease of banana. In: Proceeding of the 16th congress and national seminar of the Indonesian Phytopathological Society. Bogor, 22-24 August 2001 [Indonesia]. Supeno B. 2002. Isolation and characterization of banana blood disease in Lombok. In: Proceeding of the 16th congress and national seminar of the Indonesian Phytopathological Society. Bogor, 22-24 August 2001 [Indonesia]. Supriadi (2005) Present status of blood disease in Indonesia. In: Allen C, Prior P, Hayward AC (eds) bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. Valdezate S, Vindel A, Martin-Davila P, Del Saz BS, Baguero F, Canton R (2004) High genetic diversity among Stenotrophomonas maltophilia strains despite their originating at a single hospital. J Clin Microbiol 42: 693-699. Valverde A, Hubert T, Stolov A, Dagar A, Kopelowitz J, Burdman S (2007) Assessment of genetic diversity of Xanthomonas campestris pv. campestris isolates from Israel by various DNA fingerprinting techniques. Plant Pathol 56: 17-25. Zhang Y, Geider K (2005) Differentiation of Erwinia amylovora strains by pulsed-field gel electrophoresis. Appl Environ Microbiol 63: 44214426.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 17-21

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120104

Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem SRI WIDAWATI♥ Microbiology Division, Research Centre for Biology, Indonesian Institute of Sciences (LIPI), Jl. Raya Bogor-Jakarta km 46, Cibinong-Bogor 16911, West Java, Indonesia, Tel.: +62-21-8765 066-67, Fax.: +62-21-8765 , email: widadomon@yahoo.com Manuscript received: 5 June 2010. Revision accepted: 30 July 2010.

ABSTRACT Widawati S (2011) Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem. Biodiversitas 12: 1721. Soil, water, sand, and plant rhizosphere samples collected from coastal ecosystem of Laki Island, Jakarta, Indonesia were screened for phosphate solubilizing bacteria (PSB). While the population was dependent on the cultivation media and the sample type, the highest bacterial population was observed in the rhizosphere of Ipomoea aquatica. The PSB strains isolated from the sample registered 18.59 g1 -1 L , 18.31 g-1L-1, and 5.68 g-1L-1 of calcium phosphate (Ca-P), Al-P and rock phosphate solubilization after 7-days. Phosphate solubilizing capacity was the highest in the Ca-P medium. Two strains, 13 and 14, registered highest phosphomonoesterase activities (2.01 µgNP.g-1.h-1 and 1.85NP µg.g-1.h-1) were identified as Serratia marcescens, and Pseudomonas fluorescens, respectively. Both strains were isolated from the crops of Amaranthus hybridus and I. aquatica, respectively, which are commonly observed in coastal ecosystems. The presence of phosphate solubilizing microorganisms and their ability to solubilize various types of phosphate species are indicative of the important role of both species of bacteria in the biogeochemical cycle of phosphorus and the plant growth in coastal ecosystems. Key words: phosphate solubilization, coastal ecosystem, Serratia marcescens, Pseudomonas fluorescens.

INTRODUCTION Soil microorganisms play a significant role in the food chain and the various biogeochemical cycling of carbon, nitrogen, sulfur and phosphorus (Kummerer 2004; Das et al. 2007; Banig et al. 2008). Though phosphate solubilizing bacteria (PSB) like Pseudomonas, Serratia, Bacillus, Flavobacterium and Corynebacterium have been reported from various ecosystem types such as terrestrial ecosystem especially soil, and water ecosystem including coastal, offshore and mangrove ecosystems (Seshadri et al. 2002; Young et al. 2006), their population has been occasionally very low, about less than 10-2 CFU per gram (Peix et al. 2004). A series of observation indicates that the highest population of PSB (an average of 108 CFU per gram of sample) was found in fertile soil of forests, organic farming and rhizosphere (Widawati et al. 2005; Widawati and Suliasih 2006; Widawati and Suliasih 2009), as well as mangrove and shorelines (De Souza et al. 2000). Phosphate solubilizing bacteria form sea sediments were reported to be capable of accelerating the dissolution of apatite phosphate within the phosphorus cycle interacting with the carbon cycle (Thingstad and Rossouzadegan 1995). Phosphate solubilizing bacteria (PSB) living in both terrestrial and water ecosystem play a vital role in supplying phosphorus to plants (Gyaneshwar et al. 2002; Widawati and Rahmansyah 2009), which improves and maintain the fertility of farmlands (Shekar et al. 2000). They are capable of producing organic acids (acetate, formate,

lactate, oxalate, malate and citrate), amino acids, vitamin and growth promoting substances like (IAA/indole-3-acetic acid) as well as gibberellic acid that stimulate the growth of the plants (Richardson 2001; Gyaneshwar et al. 2002; Ponmurugan and Gopi 2006). The mineralization of organic phosphate have been reported to be mediated through the production of phosphatase enzymes (phosphomonoesterase, phosphodiesterase, triphosphomonoesterase and phosphoramidase) which hydrolyse organic-P into H2PO4- and HPO4= (Pang and Kolenk 1986; Mearyard 1999; Lal 2002). Research on the phosphatase enzyme can benefit sustainable organic farming systems especially in coastal ecosystems, and reduce the utilization of agrochemicals in agricultural fields in Indonesian coasts. As isolation of PSB from the highly saline farmlands have been termed important prior to the use of PSB as biofertilizer in those areas (Bashan et al. 2000), this study was conducted to determine the potentials of PSB isolated from Laki Island coasts, Jakarta bay, Indonesia and surroundings to enhance the organic farming in the high saline areas.

MATERIAL AND METHODS Isolation and enumeration of PSB Samples were collected from soil and rhizosphere of plant in coastal areas, mangrove, and sea water (Figure 1). About 0.2 mL of serially diluted sample was put into a sterile petridish containing Pikovskaya’s medium - PM1 [5

B I O D I V E R S IT A S 12 (1): 17-21, January 2011

g of Ca3(PO4)2. 0.5 g of (NH4)2SO4; 0.2 g of NaCl; 0.1 g of MgSO4. 7H2O; 0.2 g of KCl; 10 g of Glucose; 0.5 g of yeast extract; 20 g of agar; MnSO4 and a little FeSO4, 1000 l-1 of aquadest] (Gaur 1981). For the preparation of other media, the same media composition was retained but were changed as follows; PM1 + 1% NaCl (media 2), PM1 substituted with seawater (media 3), PM1 with Al3(PO4) (media 4), PM1 with rock phosphate (media 5). All the flasks were incubated at 30oC and observed for 3 to 7 days for bacterial growth. Population was enumerated daily by plate count method (Rao 1982). The PSB showing formation of halozones on around the colonies were scored as positive. The colony of PSB was then purified and subcultured in Pikovskaya’s medium for further studies. PSB qualitative test The size of halozones determines the ability level of microbes to dissolve the bonded P The purified PSB were then streaked on plates to test their ability to dissolve Ca3(PO4)2., Al3(PO4) and rock phosphate. The solubilization was marked with halozone formation around the growing colonies and the halozones size were expressed as solubilization efficiency as described by Nguyen et al. (1992) and Seshadri et al. (2002) method: E = Solubilization diameter/growth diameter x 100. Broth assay The PSBs were grown in 100 mL Pikovskaya broth in 250 mL Erlenmeyer flasks containing 5 g L-1 of Ca3(PO4)2 and Al3(PO4) (Gaur 1981). Each flask was inoculated with 1 mL (109 cfu mL-1) of culture and incubated in a rotary shaker at 120 rpm and 30oC for 7 days. The cultures were centrifuged and analyzed for soluble phosphates (Allen, 1974), pH, and PME activity. pH, acid and alkaline of PME The pH of culture supernatant was measured directly using a pH meter. The phosphomonoesterase activities (acid and alkaline) were measured following the technique

in Schinner et al. (1996). One mL of culture supernatant was added to 1 mL of 115 mM p-NPP phosphate substrate and 4 mL of buffer at pH 6.5 for acid PMEase and pH 7.5 for alkaline PMEase and incubated at 38oC for 1 hour. Subsequently 1 mL 0.5M CaCl2 was added to the reaction. A control reaction was also maintained along with the sample. The absorbance of both the sample and control was measured spectrophotometrically at 400 nm. Identification of PSB Identification of the best isolates was carried out through a 16S RNA analysis (Pitcher et al. 1989). The method of amplification and sequencing of 16S rDNA according to Rivas et al. (2001) and the sequence obtained was compared with those in GenBank by using the FASTA program (Pearson and Lipman 1988). RESULTS AND DISCUSSION Population of PSBs observed from different environmental samples grown on various media is shown in Table 1. Only Fifteen isolates from twenty five isolates showed formation of halozones around the growing colonies. Phosphate tested (Ca3(PO4)2. Al3(PO4) and rock phosphate) were clearly dissolved by growing colonies (Table 1). Similar results was also found by Antoun (2009, pers. comm.), which proves that only 10 out of 31 tested bacteria were able to form halozones within the media that contain Ca-P and AlP as the source of P. Halozones are formed because of transformation of glucose into organic acids (Sudiana 2010, personal communication). Glucose was the carbon source used in the test of PSB isolated from the sea to dissolve the bonded phosphor marked by halozones (De Souza et al. 2000). De Souza et al. (2000) and Seshadri et al. (2002) reported that the PSB isolated from coastal, offshore, mangrove and sea water were able to dissolve P from zinc phosphate (30%), from calcium triphosphate (19%) and from calcium triphosphate (18%).

Table 1. Population of PSB in various types of habitats enumerated using five different media; and phosphate dissolution by PSB on plates containing five different media Altitude Isolate Population of PSB (∑pop.107) Phosphate dissolution by PSB (EP) The ecosystem type of sample collected asl. (feet) no. 1 2 3 4 5 1 2 3 4 5 0 Sediment, mangrove, Banten (1) SMJ 12 cd 11 ab 9 ab 0.9 a 7 ab 200 a 100 a 100 a 80 a 50 a 0 Sediment, mangrove, Laki Island (2) SMLI 12 cd 11 ab 9 ab 0.8 a 7 ab 200 a 100 a 100 a 90 a 50 a 0 Sand, Coastal area, Jakarta (3) SCJ 11 cd 10 ab 9 ab 0.8 a 7 ab 200 a 150 a 100 a 100 a 50 a 0 Sand, Coastal area, Laki Island (4) SCLI 11 cd 10 ab 8 ab 0.8 a 6 b 200 a 150 a 100 a 90 a 50 a 0 Sea water, 50 meter from Jakarta (5) SWJ50 8 d 9 b 7 ab 0.7 ab 5 b 200 a 200 a 100 a 80 a 50 a 0 Sea water, 50 meter from Laki Island (6) SWLI50 8 d 9 b 6 b 0.6 ab 5 b 200 a 100 a 100 a 100 a 50 a 0 Sea water (between Jakarta-Laki Island) (7) SWJLI1 7 d 9 b 9 ab 0.5 b 4 b 200 a 150 a 100 a 100 a 100 a 0 Sea water (between Jakarta-Laki Island) (8) SWJLI2 7 d 9 b 8 ab 0.4 b 8 ab 200 a 150 a 100 a 70 a 100 a 23 Rhizosphere mangrove, Banten (9) RMJ 15 c 12 ab 7 ab 0.9 a 9 ab 200 a 100 a 100 a 80 a 100 a 32 Rhizosphere mangrove, Laki Island (10) RMLI 15 c 12 ab 8 ab 0.8 a 10 ab 200 a 200 a 100 a 100 a 150 a 32 Rhizosphere L. leucocephala, Jakarta (11) RLJ 27 b 13 ab 7 ab 0.9 a 10 ab 200 a 200 a 100 a 100 a 100 a 32 Rhizosphere O. sativa, Banten (12) ROJ 30 b 13 ab 9 ab 0.6 ab 10 a 200 a 200 a 100 a 100 a 100 a 32 Rhizosphere A. hybridus, Banten (13) RAJ 32 b 14 a 10 a 0.9 a 11 a 200 a 200 a 200 a 200 a 200 a 32 Rhizosphere I. aquatica, Banten (14) RIJ 40 a 14 a 10 a 0.9 a 11 a 200 a 200 a 200 a 200 a 200 a 32 Soil without plant (15) SWP 15 c 10 ab 7 ab 0.6 ab 10 ab 200 a 200 a 100 a 90 a 100 a Note: Alphabets followed by the same letters in the column are not significantly different analyzed through Duncan’s Multiple Range Test (0.5% level). Nos. 9-15 are the ebb and tide farmlands in the coastal areas. Ability of phosphate dissolution by PSB were recorded after 7-days.

WIDAWATI â&#x20AC;&#x201C; Phosphate solubilizing bacteria from Laki Island

10 11 1 0 1 02 4 000 6000 1 1 000 0001 00 00 1 1

7 1 8 1

5 1

3 19

1 1

15 12 1 0 1 0 000 000 000 000 00 Figure 1. Sampling site location. No. of 1-15 00 refer to Table 1.1 1

14 1 0 1 000 000 000 000 00 000 1 1 13

PM 1 PM 2 PM 3 PM 4 PM 5 Figure 2. The ability of isolate 14 to dissolve the bonded phosphor within 5 types of Pikovskaya media (PM) and the isolate was identified as Pseudomonas fluorescens species.

Though maximum P solubilization efficiency of 15 was observed in two isolates 13 and 14 isolated from rhizosphere of Amaranthus hybridus and Ipomoea aquatica, there were differences among the fifteen isolates (Table 1). The size of halozones determines the ability level of microbes to dissolve the bonded P (Rachmiati 1995). The more the size of the halozones formed, the more likely the isolates dissolving the bonded P (Figure 2). The PSB population from 15 in 5 types of pikovskaya media show that highest population observed in rhizosphere sample of I. aquatica plant. The average number was 40x107 (media 1), 14x107 (media 2), 10x107 (media 3), 0.9x107 (media 4), and 11x107 (media 5). Thus, more population of PSB was observed in terrestrial (rhizosphere soil) than in water (sea, coastal areas, offshore areas and mangrove). The results can be seen in Table 1 and were supported by a research conducted by Kucey et al. (1989), which shows that the population of PSB in the rhizosphere areas is more than that in the areas without vegetation. Research conducted by De Souza et al. (2000) and Seshadri et al. (2002) reveals that the population of

PSB on backwaters (16.7%) is more than that in the coastal areas (15.6%), in the offshore areas (8.7%), and in the beaches (8.1%). This is due to the fact that the organic phosphate is rare in the offshore areas and thus the population of PSB is low. The growth of PSB is impeded with the absence of soluble organic P (Hoppe and Ullrich 1999) and low absorption of C (De Souza et al. 2000). The ability of PSB to quantitatively dissolve phosphate and pH of the liquid media with various P sources after 7day incubation was measured using spectrophotometer. It shows that all of the tested isolates were able to dissolve the inorganic phosphate of Ca3(PO4)2. Al3(PO4)2 and rock phosphate within the medium of liquid Pikovskaya. The highest concentration of dissolve P was found in isolate number 14: 18.59 L-1, 18.31 L-1 and 5.68 L-1 (Table 2). Meanwhile, isolate number 13 dissolves the highest P source only in rock phosphate. The lowest concentration was found in the isolates from the sea water, namely isolates number 7 and 8 (Table 3). When the phosphate in 5 media of liquid pikovskaya was dissolved, the pH in all of the media decreased (Table 3). The dissolution of

B I O D I V E R S IT A S 12 (1): 17-21, January 2011

phosphate involving alteration in pH with the occurrence of synthetic organic compounds released to the medium, oxidation-reduction reactions, and organic ligand competitor (Cunningham and Kuiack 1992). A test conducted by Jeon et al. (2003) shows that Pseudomonas fluorescens dissolves Ca3(PO4)2 after 5-day incubation and pH drops to 4.4. Perez et al. (2007) stated the acidity of a liquid culture is the main mechanism of phosphate dissolution. Whitelaw et al. (1999) also stated that the concentration of phosphate dissolved in the culture media is in line with the acidity and concentration of amino acid as well as pH shift. Rao (1982) stated that the mechanism of inorganic phosphate dissolution, including Ca3PO4, involves pH alteration due to the production of organic acids, such as acetate, citrate and oxalate. Ramachandran et al. (2007) stated that since the isolate is able to release inorganic phosphate from Ca3(PO4)2 in the liquid media, the bacteria have the potentials to dissolve the bonded P and thus make it available for the plants. All of the isolates were grown in the media using 3 different sources of phosphate (Ca3(PO4)2. ), Al3(PO4)2. and rock phosphate). All of the tested isolates produce fosfomonoesterse enzyme (PME-ase acid and base). Isolate 13 reaches the highest value, namely: 2.01 ugPNP g-1h-1 (PME-ase acid), 1.85 ugPNP g-1h-1 (PME-ase base), 2.01 ugPNP g-1h-1 (PME-ase acid), 1.36 ugPNP g-1h-1 (PME-ase base), and 3.14 ugPNP g-1h-1 (PME-ase acid), 0.57 ugPNP g-1h-1 (PME-ase base) (Table 2). Isolate number 14 also reaches the highest value: 2.01 ugPNP g-1h-1 (PME-ase acid and base), 2.01 ugPNP g-1h-1 (PME-ase acid) and 1.92 (PME-ase base), and 3.23 ugPNP g-1h-1 (PME-ase acid) and 0.57 ugPNP g-1h-1 (PME-ase base) (Table 2). The highest activities of both acid enzyme and base enzyme were found in the PSB isolated from the soil where Amaranthus hybridus and Ipomoea aquatica plants grow. The tests show that the activities of the enzymes were determined by the number of PSB population, habitat types and vegetation types. However, the research conducted by Pang and Kolenk (1986) reveals that the activities of the enzyme are determined by types of vegetation that grow on the surface and yet the PSB population has no impacts on the activities. The activities of enzyme PMEase-acid and base increased during incubation. This may due to induced when the amount of P in the culture growth was limited, which proves that P is much in demand (Savine et al. 2000). The activity of PMEase-acid and base reach its lowest and highest point during the 7-day incubation (Table 2). Phosphate is released from fosfomonoester by phosphomonoesterase through an enzyme-based hydrolysis (Ponmurugan and Gopi 2006). Research shows that isolate number 13 and 14 were the most excellent P-solubilizing capacity throughout all tests (Table 1, 2, 3). Those isolates were identified using gene 16S RNA analysis (Pitcher et al. 1989). It shows that isolate number 13 and 14 belongs to the species Serratia marcescens and Pseudomonas fluorescens, with homology reaching 99%. The results support and elaborate the previous research. Rodriguez and Fraga (1999), for example, stated that Pseudomonas was the strain that best

WIDAWATI – Phosphate solubilizing bacteria from Laki Island

dissolves the bonded P from any source of P and is dominant in the mineralization of organic phosphorus. This type of bacteria is found as a dominant cluster primarily on East Indian coast (Seshadri et al. 2002) and in on extreme saline water habitat and alkaline (De Souza et al. 2000).

CONCLUSION Phosphate solubilizing bacteria (PSB) were found in the coastal, offshore, shorelines and mangrove ecosystem indicating that their wide distribution. Serratia marcescens, and Pseudomonas fluorescens were isolated from the rhizosphere of Amaranthus hybridus and Ipomoea aquatic respectively showed highest population in media 1, 2, 3, 4 and 5, and dissolved wide range of P including Al-P, Ca-P and rock phosphate and also produced both alkaline and acid phosphatases.

ACKNOWLEDGEMENTS This research was conducted with the support of DIPA project. The author expresses her gratitude to Yohanes B. Subowo, project leader of DIPA project and Prof. Dr. I Made Sudiana for guidance.

REFERENCES Allen SE (1974) Chemical analysis of ecological materials. Blackwell, Oxford, England. Peix A, Rivas R, Santa-Regina I, Mateos PF, Martínez-Molina E, Rodríguez-Barrueco C, Velázquez E (2004) Pseudomonas lutea sp. nov., a novel phosphate-solubilizing bacterium isolated from the rhizosphere of grasses. J Syst Evol Microbiol 54: 847-850. Banig AE, Aly EA, Khaled AA, Amel KA (2008) Isolation, characterization and application of bacterial population from agricultural soil at Sohag Province, Egypt. Malaysian J Microbiol 4 (2): 42-50. Bashan Y, Moreno M, Troyo E (2000) Growth promotion of the seawaterirrigated oil seed halophyte Salicornia bigelovii inoculated with mangrove rhizosphere bacteria and halotolerant Azospirillum spp. Biol Fert Soils 32: 265-272. Cunningham JE, Kuiack C (1992) Production of citric and oxalic acid and solubilization of calcium phosphate by Penicillium billail. Appl Environ Microbiol 58: 1451-1458 Das S, Lyla PS, Ajmal-Khan S (2007) Biogeochemical processes in the continental slope of Bay of Bengal: I. Bacterial solubilization of inorganic phosphate. Rev Biol Trop (Int J Trop Bio) 55 (1): 1-9 De Souza MJBD, Nair S, Chandramohan D (2000) Phosphate solubilizing bacteria around Indian Peninsula. Indian J Mar Sci 29: 48-51. Gaur AC (1981) Phospho-microorganism and varians transformation In Compost Technology, Project Field Document No. 13 FAO, Rome, Italy. P.106-111 Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil microorganism in improving P nutrition of plants. Plant Soil 245: 83-93. Hoppe HG, Ullrich S (1999) Profiles of ectoenzymes in the Indian Ocean: phenomena of phosphatase activity in the mesopelagic zone. Aquat Microb Ecol 19: 139-148. Jeon JS, Lee SS, Kim HY, Ahn TS, Song HG (2003) Plant growth promotion in soil by some inoculated microorganisms. J Microbiol 41 (4): 271-276 Kucey RMN, Tanzen HH, Leggett ME (1989) Microbially mediated increases in plant available phosphorus. Adv Agron 42: 199-228 Kummerer (2004) Resistance in the environment. J Antimicrob Chemotax 45: 311-320.

Lal L (2002) Phosphate biofertilizers. Agrotech Publ Acad, Udaipur, India. Mearyard B (1999) Phosphate enzymes from plants. J Biol Educ 33(2): 109-112. Nguyen C, Yan W, Tacon FL, Lapeyrie F (1992) Genetic viability of phosphate solubilizing activity by monocaryotic and dicatyotic mycelia of the ectomycorrhyzal fungus Laccaria bicolor (Maire) PD Orton. Plant Soil 143: 193-199. Pang PCK, Kolenk H (1986) Phosphomonoesterase activity in forest soils. Soil Biol Biochem 18 (1): 35-40. Pearson W, Lipman D (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85: 2444-2448. Perez E, Sulbaran M, Ball MM, Yarzabal LA (2007) Isolation and characterization of mineral phosphate solubilizing bacteria naturally colonizing a limonitic crust in the south-eastern Venezuela region. Soil Biol Biochem 39: 2905-2914. Pitcher DG, Owen RJ (1989) Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol 8: 151-156. Ponmurugan P, Gopi C (2006) In vitro production of growth regulators and phosphatase activity by phosphate solubilizing bacteria. African J Biotech 5(4): 348-350. Rachmiati Y (1995) Phosphate solubilizing bacteria from rhizosphere crop and his ability in dissolving phosphate. National congres proceeding VI HITI, Jakarta, 12-15 Desember 1995. [Indonesia] Ramachandran K, Srinivasan V, Hamza S, Anandaraj M (2007) Phosphate solubilizing bacteria isolated from the rhizosphere soil and its growth promotion on black pepper (Piper nigrum L.) cutting. Plant Soil Sci 102: 325 -331. Rao NS (1982) Soil microorganism and plant growth. 2nd ed. Indonesia University Press, Jakarta. Richardson AE (2001) Prospect for using soil microorganisms to improve the a quisition of phosphorus by plants. Aust J Plant Physiol 58: 797-906. Rivas R, Velazquez E, Valverde A, Mateos PF, Martinez-Molina E (2001) A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species. Electrophoresis 22: 1086-1089. Rodriguez H, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promotion. Biotech Adv 17: 319-339. Savine MC, Taylor H, Görres JH, Amador JA (2000) Seasonal variation in acid phosphatase activity as a function of landscape position and nutrient inputs. Agron Abst 92: 391. Schinner FE, Kandeler E, Ohlinger R, Margesin R (1996) Method in Soil Biology. Springer, Berlin. Seshadri S, Ignacimuthu S, Lakshminarsimhan C (2002) Variations in heterotrophic and phosphate solubilizing bacteria from Chennai, southeast coast of India. Indian J Mar Sci 31: 69-72. Shekar NC, Shipra B, Kumar P, Lal H, Monhal R, Verma D (2000) Stress induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol Lett 182: 291-296. Thingstad TF, Rassoulzadegan F (1995) Nutrient limitations, microbial food webs, and ‘biological pumps’: suggested interactions in a Plimited Mediterranean. Mar Ecol Prog Ser 117: 299-306. Widawati S, Rahmansyah M (2009) The influence of bacteria inoculation to jarak pagar (Jatropha curcas L.) growth. J Biol Indon 6 (1): 107117 [Indonesia] Widawati S, Suliasih, Latupuapua HJD, Sugiharto A (2005) Biodiversity of soil microbes from rhizospore at Wamena Biological Garden (WBiG), Jayawijaya, Papua. Biodiversitas 6 (1): 6-11. Widawati S, Suliasih (2006) Augmentation of potential phosphate solubilizing bacteria (PSB) stimulate growth of green mustard (Brassica caventis Ocd.) in marginal soil. Biodiversitas 7(1): 10-14 (Indonesia) Widawati S, Suliasih (2009) The role of phosphate solubilizing bacteria and free living nitrogen fixing bacteria on the growth and adaptation of Gmelina arborea Roxb. grown on degraded land. International Seminar to Protect Diversity of Bioresources in the Tropical Area. Research Center for Biology LIPI, Cibinong, 25-26 November 2009. Whitelaw MA, Harden TJ, Heylar KR (1999) Phosphate solubilization in solution culture by the soil fungus Penicillium radicum. Soil Biol Biochem 31: 655-665. Young CC, Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA (2006) Phosphate solubilizing bacteria from tropical soil and their tricalsium phosphate solubilizing bacteria abilities. Appl Soil Ecol 34: 33-34.

BIODIVERSITAS Volume 12, Number 1, January 2011 Pages: 22-27

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120105

Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java NINA DWI YULIA♥, SUGENG BUDIHARTA Purwodadi Botanic Garden-Indonesian Institute of Sciences (LIPI). Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia. Tel.: +62 341 426046; Fax.: +62 341 426046; ♥e-mail: ndyulia@yahoo.com Manuscript received: 1 July 2010. Revision accepted: 1 September 2010.

ABSTRACT Yulia ND, Budiharta S (2011) Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java. Biodiversitas 12: 22-27. Natural forests in Wilis Mountain have been destroyed by forest fires, landslides and illegal logging. As a consequence, biological diversity in this area is threatened by local extinctions, particularly of orchid species. This study was aimed to explore, document and analyze the diversity of epiphytic orchids at Gunung Manyutan Forest Reserve, a natural forest area in Wilis Mountain. Purposive sampling on 1 hectare (50 x 200 m2) contiguous plot was used. This plot was divided into eight subplots (25 x 50 m2). All data on orchid species were recorded including its number, host trees and zone of the host tree where the orchid attached. The results showed that there were 29 epiphytic orchid species recorded. Flickingeria angulata was the most abundant species (Relative Abundance of orchids/ %Fo = 38.74), continued by Appendicula sp. (%Fo = 10.91) and Eria hyacinthoides (%Fo = 6.57). The three most important host trees were Pinus merkusii, Schima wallichii and Engelhardia spicata. Zone 3 (bottom part of the branches) was revealed as the most favorable part at the host tree (281 individuals), while Zone 1 (bottom part of the main stem) was the least preferable one. Key words: diversity, epiphytic orchid, Flickingeria angulata, host tree, Wilis Mountain.

INTRODUCTION The orchid arguably gets more attention than any other kind of plant because of its unique shape and variety of colors of its flowers. According to Puspitaningtyas (2005), even though orchids are not heavily used for basic human needs they are commonly cultivated as ornamental plants, thus awareness arises about their extinction due to the accelerating rate of destruction as their natural forest habitats. Epiphytic vascular plants, including epiphytic orchids, are major components in tropical wet forests in terms of diversity and biomass (Gravendeel et al. 2004; Cardelus and Mack 2010). One of orchids’ natural habitats in Java which has not been explored so far is Gunung Manyutan Forest Reserve in Wilis Mountain. Previous study revealed that the diversity of medicinal plants in Wilis Mountain was very high, totaling 61 species in the eastern part of Wilis slope at Purut, Parang Village, District of Kediri (Tyas et al. 1999). However, there is no accurate information on orchid diversity of the area. Nowadays, the natural forest in Wilis Mountain is destroyed by various causes including forest fires, landslides and illegal logging. Inevitably, these processes have threatened biological diversity of the area, and particularly orchid species, which are further threatened by illegal harvesting (Perhutani’s forest rangers, pers. comm.). This local decline in orchid diversity and abundance in Wilis is being repeated in many protected areas throughout Java (Puspitaningtyas 2005, 2007).

Therefore, data and information gathering on the occurrence of orchids in their natural habitats is urgently required in order to develop potential conservation strategies. This effort is important considering the fact that in Java, large expanses of natural forest have been converted into human settlements, agricultural lands and plantations, which can lead to local population extinction of orchids. The impacts of such land conversion will be exaggerated if extinction occurs before species can be described and documented. Comber (1990) mentioned that there are 731 orchid species recorded in Java; with 390 among them are recorded in East Java. This study aims at documenting and analyzing the diversity and abundance of epiphytic orchids at Gunung Manyutan Forest Reserve. This was achieved by conducting a fieldwork in order to record all data on orchid in the area. Orchids diversity and abundances were calculated in order to reveal the most important orchid species. Local forest rangers reported that the studied area is rich in epiphytic orchids species particularly from the genus Vanda (Perhutani’s forest rangers, pers. comm.). This was used as baseline information in conducting this research. MATERIALS AND METHODS Study site This study was conducted from 26 April to 3 May 2010 at Gunung Manyutan Forest Reserve, Wilis Mountain

YULIA & BUDIHARTA – Orchid diversity and its host tree in Wilis Mountain

(7º46.751’ S; 111º39.637’ E) (Figure 1). This area is administratively located at Pupus Village, Sub-district of Ngebel, District of Ponorogo, East Java and managed by Kesatuan Pemangkuan Hutan (Sub-forest District) Wilis Barat under Perum Perhutani (State Owned Forest Company). Sampling We used purposive sampling at site with the richest orchid’s diversity based on information from forest rangers. At this site, which was located in the forest interior, we established a 50 x 200 m2 (1 ha) plot. Within this plot we created eight subplots (25 x 50 m2) contiguously (Muñoz et al. 2003). All epiphytic orchid species attached to trees within the subplots were recorded. Various data were also collected including the species name of host tree and the zone on the tree where the orchid attached. Epiphyte position on the host tree was divided into five zones based on Dressler (1990), which are: (i) Zone 1: the bottom part (1/3) of the main stem; (ii) Zone 2: the upper part (2/3) of the main stem; (iii) Zone 3: the bottom part of the branches; (iv) Zone 4: the middle part of the branches; and (v) Zone 5: the outer part of the branches. Environmental

Wonogiri

data were also recorded including temperature, humidity and elevation. Data analysis All data were recorded in a spreadsheet, and the following parameters were calculated: Nt is the number of trees in the plot hosting a particular orchid species; No is the number of individuals of a particular orchid species within the plot. Based on these two parameters, Relative Frequency of host tree (%Ft) and Relative Abundance of orchid (%Fo) were computed as below: %Ft =

Nt × 100 Total number of all host trees

%Fo =

No × 100 Total number of all orchids

Orchids were identified to species level if possible, and the genus level otherwise using the books by Comber (1990, 2001) as references.

Madiun

B Pacitan

C Trenggalek

D Figure 1. Location of study site at Gunung Manyutan Forest Reserve, in Wilis Mountain (dashed circle), and some of orchid species at this area: (A) Eria flavescens, (B) Coelogyne longifolia, (C) Coelogyne speciosa, (D) Dendrobium linearifolium and Flickingeria angulata.

BIODIVERSITAS

12 (1): 22-27, January 2011

RESULTS AND DISCUSSION The results showed that of eight subplots of 25 x 50 m2 at Gunung Manyutan Forest Reserve, there were 29 epiphytic orchid species belonging to 14 genera recorded. The most abundant species in the area were Flickingeria angulata (RA = 38.74%), Appendicula sp. (RA = 10.91%) and Eria hyacinthoides (RA = 6.57%) (Table 1). These three are very abundant in Java and found mostly at elevations between 500 and 1500 m asl. Table 1. List of epiphytic orchid species at the study site and the value of parameters (Nt is the number of trees in the plot hosting a particular orchid species; No is the number of individuals of a particular orchid species within the plot; %Ft is Relative Frequency of host tree; %Fo is Relative Abundance of orchid) Orchid species

%Ft

%Fo

Agrostophyllum majus Agrostophyllum sp. Appendicula sp. Bulbophyllum sp. Bulbophyllum sp.3 Bulbophyllum sp.4 Coelogyne longifolia Coelogyne speciosa Dendrobium linearifolium Dendrobium sp. Dendrochilum sp. Eria flavescens Eria hyacinthoides Eria javanica Eria moluccana Eria monostachya Eria oblitterata Eria sp. Flickingeria angulata Flickingeria sp. Liparis condylobulbon Liparis sp. Luisia zollingeri Trichoglottis sp. Thrixspermum sp. Thrixspermum subulatum Trichotosia angulata Vanda limbata Vanda tricolor

1 1 20 9 3 3 2 1 1 3 5 5 9 3 6 12 1 13 46 3 5 2 4 1 10 3 1 1 16 190

1 1 78 30 21 16 2 2 1 10 8 13 47 5 9 37 1 37 277 19 9 7 7 2 21 13 1 1 39 715

0.53 0.53 10.53 4.74 1.58 1.58 1.05 0.53 0.53 1.58 2.63 2.63 4.74 1.58 3.16 6.32 0.53 6.84 24.21 1.58 2.63 1.05 2.11 0.53 5.26 1.58 0.53 0.53 8.42 100

0.14 0.14 10.91 4.20 2.94 2.24 0.28 0.28 0.14 1.40 1.12 1.82 6.57 0.70 1.26 5.17 0.14 5.17 38.74 2.66 1.26 0.98 0.98 0.28 2.94 1.82 0.14 0.14 5.45 100

The dominance of F. angulata over other epiphytic orchids is also recorded at Penanggungan Mountain in East Java (Yulia and Yanti 2010). Lugrayasa et al. (2004) noted that F. angulata is at most abundant on the slope of mountains with altitude of ca. 500 m asl. and humidity 8992%. All orchid species recorded at the study site (Table 1) are known as euryecious orchids (kind of orchid that is usually adaptable to various types of environment and has

wide-ranging geographic distribution), and therefore not classified as endemics. Puspitaningtyas et al. (2003) mentioned that in general, orchid diversity is highest at altitudes 500 and 1500 m asl. and tends to decrease out of this range. The high level of Eria diversity is presumably related to relatively low temperature (28o-30o C during the day) and middle range humidity (60-80%). Most Eria species were recorded at altitudes between 500 and 2500 m asl (Mahyar and Sadili 2003). Preliminary communication indicated that Vanda tricolor was abundant at Gunung Manyutan Forest Reserve (Perhutaniâ&#x20AC;&#x2122;s forest rangers, pers. comm.). However, we only find V. tricolor at four plots with a total of 39 individuals, much fewer than F. angulata (277 individuals). The low abundance of V. tricolor is presumably caused either by illegal exploitation by outsiders or gathering by local communities to be planted at their home gardens. The survival of epiphytic orchids depends on its host trees. In this study, 13 species of host trees were recorded, with 91 individuals (Table 2). The most important host trees were Pinus merkusii (24 individuals), Schima wallichii and Engelhardia spicata (19 individuals each). Table 2. Environmental conditions at Gunung Manyutan Forest Reserve Environmental data

Value

Air temperature (during day)

28o-30o C

Relative humidity

60-80%

Elevation

1300-1413 m asl

All host trees recorded are mountain specialist species and characterized by rough bark that made them favorable by orchids for root attachment. This fact is in line with Flores-Palacios and Ortiz-Pulido (2005) that epiphytic orchids are likely to attach to host trees with rough bark rather than smooth one. In addition, the typical peeling bark with cracked and soft texture apparently catches more water and nutrients than the smooth bark. Therefore, orchid seeds lodged in the crevices of bark more readily grow because of the available substrate necessary for the growth of seeds. However, the result of Bergstrom and Carter (2008) suggests that the structure of the bark is not the most important factor to the occurrence of epiphytic orchid since they found a host tree with smooth and relatively thin bark that preferred by a particular orchid. Also, due to the canopy structure of the host trees, which is not too dense, sunlight is allowed to penetrate to the part the tree where orchids grow. According to Seitske et al. (2001), epiphytic orchids in Indonesia are rarely found on trees with dense canopy since sunlight is hindered to go through. Epiphytic orchids are not positioned randomly on all parts of the host. Dressler (1990) divides the part of host tree where the epiphytic orchid grows into five zones. The occurrence of orchids at each zone depends on its requirements for light and nutrients. Naturally, most orchids tend to grow at the particular part of the host tree that optimizes their resource acquisition. This study

YULIA & BUDIHARTA â&#x20AC;&#x201C; Orchid diversity and its host tree in Wilis Mountain

showed that epiphytic orchids were found mostly at Zone 3 (281 individuals), followed by Zone 4 (201 individuals) (Figure 2). In contrast, Zone 1 and Zone 5 were disfavored by orchids, in that only 17 and 52 individuals were attached at these zones, respectively (Table 3).

300

Number of individual

250 200 150 100 50 0 Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Zone

Figure 2. Number of epiphytic orchids at each zone of host tree (Zone 1: the bottom part (1/3) of the main stem; Zone 2: the upper part (2/3) of the main stem; Zone 3: the bottom part of the branches; Zone 4: the middle part of the branches; Zone 5: the outer part of the branches)

There are some environmental factors important for orchids to grow, such as light, temperature, wind speed and water availability (Parnata 2005). The distributional patterns of epiphytic orchids on the stems and branches of host trees are influenced by the needs of sunlight and humidity that make epiphytic orchids favor specific zones (Yulia and Yanti 2010). In addition, Oâ&#x20AC;&#x2122;Malley (2009) stated that branch height and position on host tree highly

correlate with substrate availability. In this study, Zone 3, which is located at the bottom part of the branches, is the most favorable zone for epiphytic orchids to grow. This is presumably in relation with the structure of Zone 3, which allows seeds to be trapped easily and then nourished with light, water and nutrients. In contrast, there were small numbers of orchids recorded at Zone 1. The rationale is that at this zone, light intensity is very low. Puspitaningtyas and Fatimah (1999) mentioned that orchids grew at Zone 3, Zone 4 and Zone 5 are those that favor plenty of sunlight. However, the individual state of the host tree also influences the occurrence of epiphytic orchids in terms of creating appropriate conditions such as light intensity, aeration and humidity (Zotz and Hietz 2001). Table 3 suggests that epiphytic orchid at Gunung Manyutan Forest Reserve may attach to more than one host tree, implying either orchid or host tree listed in Table 4 above are generalist species. A study on specific associations between host trees and epiphytic orchids in Meru Betiri National Park (Puspitaningtyas 2007) also stated a similar conclusion with our study. A study on the relationship between epiphytic orchids and host trees in sub-tropical forest in Taiwan also showed that generalist orchid species tend to grow on various host tree with no specific association with a particular tree species (Martin et al. 2007). Also in Panamanian lowland forest, the relationship between host tree and epiphytic vascular plants is random without any host specificity (Laube and Zotz 2006). However, the occurrence of some particular epiphytic orchids is highly associated with the occurrence of particular host tree, showing strong preferences of an orchid to a host tree species such as Epidendrum magnoliae with Quercus virginiana (Bergstrom and Carter 2008), and Dendrobium capra with Tectona grandis (Yulia and Ruseani 2008). CONCLUSION

Table 3. List of host tree species recorded and numbers of individuals at each plot Species of host tree Lithocarpus sp. Schima wallichii Pinus merkusii Engelhardia spicata Callophyllum sp. Lithocarpus teysmannii Lithocarpus sundaicus Proteacea Nauclea sp. Eudia sp. Litsea sp. Bridelia sp. Tree stump Sum

SP SP SP SP SP SP 1 2 3 4 5 6 2 3 3 13 1 2 4 4 7 1 8 1 2 2 1 4 1 1

SP SP Total number 7 8 of individual 5 19 24 8 6 19 1 1 1 7 4 3 8 3 3 1 1 1 1 1 1 1 1 1 1 19 12 91

Epiphytic orchid diversity and abundance at Gunung Manyutan Forest Reserve in Wilis Mountain is relatively high. Within one hectare contiguous area, there were 29 epiphytic orchid species (totally 715 individuals) recorded. The most abundant orchid species were Flickingeria angulata, followed by Appendicula sp. and Eria hyacinthoides. In addition, there were 13 host tree species recorded, with three most important host species being Pinus merkusii, Schima wallichii and Engelhardia spicata. Zone 3 (bottom part of the branches) was noted as the most preferred zone on host trees to be attached by epiphytic orchid species, while Zone 1 (bottom part of the main stem) was the least preferred.

BIODIVERSITAS

12 (1): 22-27, January 2011

Table 4. Recapitulation of orchid species at each zone of host tree

Species of orchid

Species of host tree

F host tree

Flickingeria angulata

Lithocarpus sp. Schima wallichii Pinus merkusii Lithocarpus teysmannii Lithocarpus sundaicus Engelhardia spicata Lithocarpus sp. Engelhardia spicata Lithocarpus sundaicus Proteaceae Bridelia sp. Lithocarpus sp. Schima wallichii Pinus merkusii Lithocarpus teysmannii Engelhardia spicata Lithocarpus sundaicus Lithocarpus sp. Lithocarpus teysmannii Schima wallichii Pinus merkusii Lithocarpus sundaicus Lithocarpus sp. Schima wallichii Lithocarpus teysmannii Nauclea sp. Lithocarpus sundaicus Engelhardia spicata Lithocarpus sp. Lithocarpus teysmannii Lithocarpus sundaicus Lithocarpus sp. Schima wallichii Engelhardia spicata Calophyllum sp. Calophyllum sp. Schima wallichii Engelhardia spicata Lithocarpus sp. Schima wallichii Engelhardia spicata Lithocarpus teysmannii Lithocarpus sundaicus Eudia sp. Litsea sp. Bridelia sp. Pinus merkusii Lithocarpus teysmannii Lithocarpus sundaicus Engelhardia spicata Eudia sp. Lithocarpus teysmannii Lithocarpus sundaicus Lithocarpus sundaicus Pinus merkusii Lithocarpus teysmannii Lithocarpus sundaicus Lithocarpus sundaicus Engelhardia spicata Tree stump Proteaceae Lithocarpus sundaicus Proteaceae Lithocarpus sundaicus Engelhardia spicata Lithocarpus sundaicus Engelhardia spicata Lithocarpus teysmannii Lithocarpus sundaicus Engelhardia spicata Lithocarpus sundaicus Lithocarpus sundaicus Engelhardia spicata Lithocarpus teysmannii Lithocarpus sundaicus Lithocarpus teysmannii Engelhardia spicata Lithocarpus sundaicus Bridelia sp. Engelhardia spicata Engelhardia spicata Engelhardia spicata

5 12 20 4 4 1 1 10 3 1 1 3 2 2 2 2 1 1 1 1 2 1 1 1 3 1 3 4 1 1 1 1 6 2 1 1 1 1 1 3 11 1 2 1 1 1 1 3 3 2 1 1 2 3 2 1 2 1 3 1 1 2 1 1 3 4 4 1 2 1 1 2 2 1 1 1 1 1 1 1 1 1

Vanda tricolor

Eria mononstacya

Eria moluccana

Eria sp.

Eria javanica Thrixspermum sp.

Thrixspermum subulatum Coelogyne speciosa Appendicula sp.

Agrostophyllum majus Bulbophyllum sp.

Dendrobium sp. Dendrochilum sp. Flickingeria sp. Luisia zollingeri Vanda limbata Bulbophyllum sp.4 Eria flavescens Eria hyacinthoides Bulbophyllum sp.3 Eria oblitterata Liparis condylobulbon Liparis sp. Agrostophyllum sp. Coelogyne longifolia Trichoglottis sp. Trichotosia annulata Dendrobium linearifolium Sum of individual

Number of orchids at each zone 1 2 3 4 5 13 14 57 8 1 1 3

3 2

19 33 40 22 7 1 2 6

27 15 5 8 7 9 6

5 1

1 5 1

4 3 3

6 5 3

1 1 1 2 4 1 1 2 9

1 3

4 7 4

5 3 1 1

2 6

6 1 1

3 2 2

9 2 2 1

4 27 1 6 2

3 11

7 1

2 1 5

9 2 1 2 1 5 2 3

4 6 1 3 3

4 15 1 1

1 1

10 3

3 1

2 1 5 3

5 7 4 2 10 10

4 3 15 1

1 1 1 3

2 1 3

2 2 1 1 1 2

1 17

164

281

1 201

Total number 59 62 102 38 15 1 2 24 12 0 1 4 8 4 6 12 3 1 1 1 2 4 1 4 8 2 5 17 3 1 1 2 15 3 1 2 9 2 2 7 52 1 13 2 1 2 1 18 8 2 2 1 9 5 3 4 15 1 6 1 10 6 1 2 10 23 22 2 10 11 1 3 3 3 5 2 1 1 1 2 1 1 715

YULIA & BUDIHARTA – Orchid diversity and its host tree in Wilis Mountain

ACKNOWLEDGEMENTS This research is funded by ‘Insentif Ristek Peneliti dan Prekayasa 2010’ on project entitled ‘Evaluation of orchid in southern part of East Java’. We acknowledge the contributions of exploration team members (Pa’i, Suhadinoto and Totok Hartoyo) and Perhutani’s forest rangers (Narlan and Sukardi) during fieldwork.

REFERENCES Bergstrom BJ, Carter R (2008) Host tree selection by an epiphytic orchid, Epidendrum magnoliae Muhl., in an inland hardwood hammock in Georgia. Southeastern Naturalist 7:571-580. Cardelus CL, Mack MC (2010) The nutrient status of epiphytes and their host trees along an elevational gradient in Costa Rica. Plant Ecol. 207 (1): 25-37. Comber JB (1990) Orchids of Java. Royal Botanic Gardens, Kew. Comber JB (2001) Orchids of Sumatra. Royal Botanic Gardens, Kew. Dressler RL (1990) The Orchid: natural history and classification. Harvard University Press, USA. Flores-Palacios A, Ortiz-Pulido O (2005). Epiphyte orchid establishment on termite carton trails. Biotropica 37 (3): 457-461. Gravendeel B, Smithson A, Silk FJW, Schuiteman A (2004) Epiphytism and pollinator specialization: drivers for orchid diversity? Phil Trans R Soc Lond B 359: 1523-1535. Laube S, Zotz G (2006) Neither host-specific nor random: vascular epiphytes on three tree species in a Panamanian lowland forest. Ann Bot 97 (6): 1103-1114. Lugrayasa IN, Mudiana D, Meiningsih D, Pendra IK (2004) Orchids collection of Eka Karya Bali Botanic Garden. Eka Karya Bali Botanic Garden, LIPI, Bali. [Indonesia] Mahyar UW, Sadili A (2003) Orchid of Gunung Halimun National Park. Biodiversity Conservation Project LIPI-JICA-PHKA, Bogor. [Indonesia]

Martin CE, Lin TC, Hsu CC, Lin SH (2007) No effect of host tree species on the physiology of the epiphytic orchid Bulbophyllum japonicum in subtropical rainforest in Northeastern Taiwan. J For Sci 22(3): 245251. Muñoz AA, Chacon P, Perez F, Barnert ES, Armesto JJ (2003) Diversity and host tree preferences of vascular epiphytes and vines in a temperate rainforest in southern Chile. Austral J Bot 51: 381 – 391. O’Malley K (2009) Patterns of abundance and diversity in epiphytic orchid on Parashorea malaanonan tress in Danum valley, Sabah. Plymouth Stud Sci 2 (2): 38-58. Parnata AS (2005) Guidance on propagation and treatment of orchid. Agromedia Pustaka, Jakarta. 23-39. [Indonesia] Puspitaningtyas DM, Fatimah E (1999) Orchids inventory in Kersik Luway Wildlife Sanctuary, East Kalimantan. Bull Kebun Raya Indonesia 9 (1): 18-25. [Indonesia] Puspitaningtyas DM, Mursidawati S, Sutrisno, Asikin D (2003) Wild orchid in conservation areas in Java Island. Bogor Botanic GardenLIPI, Bogor. [Indonesia] Puspitaningtyas DM (2005) Study on orchid diversity in Gunung Simpang Wildlife Sanctuary, West Jawa. Biodiversitas 6 (2): 103-107. [Indonesia] Puspitaningtyas DM (2007) Inventory of orchids and their host trees in Meru Betiri National Park, East Java. Biodiversitas 8 (3): 210-214. [Indonesia] Seitske K, Wanggai K, Husodo BB (2001) The diversity of epiphytic orchid in North Biak Wildlife Sanctuary. Buletin Beccariana 3 (1): 610. [Indonesia] Tyas KN, Hadiah JT, Soejono (1999) A study on medicinal plants at Parang Village, Grogol, District of Kediri, East Java. Proceeding Seminary Perhiba. Pharmacy Department, FMIPA, University of Indonesia, Jakarta. [Indonesia] Yulia ND, Ruseani N (2008) Habitat study and inventory of Dendrobium capra J.J. Smith in Madiun and Bojonegoro. Biodiversitas 9 (3): 190193. [Indonesia] Yulia ND, Yanti RM (2010) Epiphytic orchids and their host trees in Penanggungan Mountain, Pasuruan, East Java. Berkala Penelitian Hayati Edisi Khusus 4A: 37-40. [Indonesia] Zotz G, Hietz P (2001) The physiological ecology of vascular epiphytes: current knowledge, open question. J Ex Bot 52 (364): 2067-2078.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 28-33

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120106

Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi DEWI AYU LESTARI♥, WIDJI SANTOSO Purwodadi Botanic Garden-Indonesian Institute of Sciences (LIPI), Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia. Tel.: +62 341 426046; Fax.: +62 341 426046; email: chunyang_dee@yahoo.co.id Manuscript received: 3 June 2010. Revision accepted: 1 August 2010.

ABSTRACT Lestari DA, Santoso W (2011) Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi. Biodiversitas 12: 28-33. Orchid is one of the ornamental plants which have been high commercial value. Therefore, orchid often has been over exploitation. Finally, some of orchid species are becoming threatened or even endangered. Purwodadi Botanical Garden as an institute of ex-situ conservation play role with it. The aim of this research is to inventory orchid’s species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi by explorative method. Observation for habitat study was focused on some ecological factors supported to orchids growth like host tree, zone growth on host tree, abundance of sunlight, thickness of substrate (moss), orchid species and number of individual species. The result showed that there were 27 orchids species, consist of, 25 species (16 genera) epiphytic orchid and 2 species terrestrial orchid such as Eulophia keithii var. celebica and Goodyera rubicunda (Blume) Lindl. The host preference for the epiphytic orchid is the group of Myrtaceae family like Syzygium sp., Metrosideros vera Niederen and Metrosideros sp. They mostly grow on the main stem of the tree zone 1 on thick substrate (moss) and get a little abundance of sunlight (calm). Key words: orchid, inventory, explorative, Lamedai Nature Reserve.

INTRODUCTION Lamedai stated as nature reserve according to KepMenHut No. 209/Kpts-II/1994 on April 30, 1994 covers of 635,16 hectare landmass, where habitat of kayu kuku (Pericopsis mooniana Thwaites). Geographically, Lamedai Nature Reserve range between 3°57’-3°59’ LS and 122°48’-122°50’ BT, located in Lamedai Village, Watubangga Subdistrict, Kolaka District, Southeast Sulawesi Province. The altitude is from sea level up to 50200 m asl., the topography is flat and hilly with slope of 15-30°. Soil type is generally alluvial. Climate type is C with dry season on July-December and rainy season on January-July, with rain fall is 2815 mm/year. Humidity is about 80,3% with temperature of 20-34°C (Bugiono 2006). Lamedai Nature Reserve has been damaged by deforestation or nickel mining activities. It else abuts with road which connects Kolaka – Kendari and transmigrate village. This condition will change flora composition in the area; effect to the reduction of a particular species of host trees, so that the number of orchid species decline in the nature. Park et al. (2000) said that many Asian orchids are threatened by extinction because of over-collection and habitat destruction. Moreover, destruction of habitat due to narrowness of the land, plantation (Djuita et al. 2004), forest fires, logging wild, natural disasters and transfer of forest functions settlements also encourage the extinction of orchids (Yulia and Ruseani 2008). Added to the capture of wild orchids especially without consider sustainability,

which led to the extinction of certain orchids. The rate of destruction of this orchid natural habitat accelerates the existence of such threats. Data from the World Conservation Monitoring Centre (1995) showed that when compared with other species plants native to Indonesia with the status of other threatened the orchid is a plant that receives the highest extinction of 203 species (by 39%). Not even a possibility when it many orchids, which became extinct before he described or documented (Puspitaningtyas 2005); and 253 species (± 80%) of the total orchid species endemic to Indonesia in Sulawesi (Peneng et al. 2004). Insitu or ex-situ conservation and preservation of natural habits of orchid is the most suitable way for sustaining these endangered species. Orchid is one of the ornamental plants which have been high commercial value. Therefore, it has been often over exploitation. Finally, several of orchid’s species are becoming threatened or even endangered. Conservation of them must be done, because they have a good prospect as commodity for trading such as parent stock, medicinal plant and material for cosmetic or perfume. Therefore, it’s necessary to conserve it through both in situ and ex situ conservation (Siregar et al. 2005). The aim of this research was to inventory orchid’s species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi, to gain information about orchid species in this area. Furthermore, the species of orchids collected can be revealed by its potential for the benefit of education, conservation, display, reintroduction and others.

LESTARI & SANTOSO – Inventory of Lamedai orchids species

MATERIALS AND METHODS Inventory was done in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi, Indonesia (Figure 1) on July 21th to August 5th 2009. Identification species were based on orchid flower, and unidentified species were collected as fresh material. Explorative methods were used to inventory orchids species. Observation was focused on some ecological factors supported to orchids growth like host tree (for epiphytic orchid), zone growth on host tree, abundance of sunlight and thickness of substrate (moss), orchid species

and number of individual species. Number of individual species for sympodial orchid such as Bulbophyllum, Acriopsis, Cymbidium, Dendrobium, etc. are counted per clump. Determinations of zone used Johansson (1975) method, which divide host tree, into 5 zones, as follow: (i) Zone 1: basal parts of the trunk (⅓ part of the trunk), (ii) Zone 2: the upper basal of the trunk to the first ramification (⅔ part of the upper trunk), (iii) Zone 3: the basal part of the large branches (⅓ part of the total length of the branch), (iv) Zone 4: the middle part of the large branches (⅓ part in the

F Figure 1. Lamedai Nature Reserve (circle) at Kolaka, Southeast Sulawesi, and some of orchid species at this area: (A). Dendrobium platygastrum Reichb.f., (B). Dendrobium section strongyle, (C). Grosourdya appendiculata (Blume) Reichb.f., (D). Thrixspermum sp., (E). Goodyera rubicunda (Blume) Lindl., and (F). Eulophia keithii var. celebica.

B I O D I V E R S IT A S

12 (1): 28-33, January 2011

middle of the total length of the branch), and (v) Zone 5: The outer part of the large branches (⅓ outer part of the total length of the branch) Determination of substrate thickness used measurement standard to measure thickness of substrate from orchid in their zone, as follow: (i) thick (>5 cm), medium (2-5 cm), and (iii) thin (<1 cm) (Yulistyarini et al. 2001). Determination of sunlight abundance used measurement standard for quality of light into the plant (Tirta et al. 2010), as follow:

Table 3. Orchid’s species in Lamedai Nature Reserve, Kolaka, Sulawesi Tenggara

Table 1. Criteria of sunlight abundance Sunlight abundance Calm Rather calm Open

Nature Reserve (Puspitaningtyas and Fatimah 1999). Accordance by type of growth, know 18 species of sympodial orchids and 9 species monopodial orchids in Lamedai Nature Reserve such as Grosourdya appendiculata (Blume) Reichb.f., Phalaenopsis sp., Pteroceras emarginatum (Blume) Hollt, Schoenorchis juncifolia Blume ex. Reinw., Taeniophyllum sp., T. biocellatum J.J. Smith, Thrixspermum sp., T. arachnites (Bl.) Reichb. and T. accuminatissimum (Blume) Reichb.f.

Criteria

Species

If substrate closed by trees, so that get a little sunlight If substrate get an enough sunlight If substrate get more sunlight

Acriopsis sp. Agrostophyllum sp. Bulbophyllum sp. B. macranthum Lindl. B. lepidum (Blume) J.J. Smith B. odoratum (Blume) Lindl. Cymbidium sp. C. finlaysonianum Lindl. Dendrobium sp.1 Dendrobium sp.2 D. crumenatum Sw. D. platygastrum Reichb.f. Eulophia keithii var. celebica Goodyera rubicunda (Blume) Lindl. Grammatophyllum scriptum Blume Grosourdya appendiculata (Blume) Reichb.f. Luisia sp. Phalaenopsis sp. Pteroceras emarginatum (Blume) Holtt Pomatocalpa sp. P. spicata Breda Schoenorchis juncifolia Blume ex. Reinw. Taeniophyllum sp. T. biocellatum J.J. Smith Thrixspermum sp. T. arachnites (Bl.) Rchb. T. accuminatissimum (Blume) Reichb.f.

Table 2. Criteria of Light intensity Light intensity

Criteria

Luxmeter

Heavy shade Open shade Full sun

Low light intensity Medium light intensity High light intensity

<35 lux 35-70 lux >70 lux

RESULTS AND DISCUSSION More less 27 orchids species were found in Lamedai Nature Reserve, consist of 25 epiphytic orchids (in 16 genera), and 2 terrestrial orchid species such as Eulophia keithii var. celebica and Goodyera rubicunda (Blume) Lindl. (Table 3). Those orchids mostly grow at elevation from sea level up to 500-600 m, evenly at 700 m (Puspitaningtyas 2005). From all the species, which are 11 orchids still unidentified species because they were not in flowering for species identification. According to Arditti (1992), epiphytic is one of the conspicuous characters in orchid comparison with terrestrial orchid in the way of living. Approximately, ⅔ from total of orchid species were epiphyteon the stem of several plants (Koopowitz 2001). Mostly, total of orchid individual from each species are Bulbophyllum sp. (126 individual), Bulbophyllum lepidum (Blume) J.J. Smith (44 individual) and Dendrobium sp.1 (36 individual). Mostly, total of orchid species from 16 genera were Dendrobium and Bulbophyllum (4 species). Dendrobium also found dominant in the Mount Tinombala Natural Reserve, Tolitoli District, Central Sulawesi (Putri 2006). Then Thrixspermum (3 species), Cymbidium, Pomatocalpa and Taeniophyllum (2 species). Grosourdya, Luisia, Phalaenopsis, Pteroceras and Schoenorchis have one species. In Lamedai, Grammatophyllum scriptum Blume found in the forest line and epiphytic on the Castanopsis buruana. But this species can be found on the terrestrial habitat such as G. speciosum Blume in the Kersik Luway

Habitat Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Terrestrial Terrestrial Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic Epiphytic

Total of individual 1 1 126 16 44 30 10 21 36 5 12 1 3 1 1 1 1 1 1 7 13 23 1 2 2 5 1

Host tree Epiphytic orchid need host tree in association to live in suitable environment. Host trees provide the substrate for epiphytes, so establishment seems to be affected by host tree traits (Hirata et al. 2008). The result showed that there were 32 species host trees for epiphytic orchid in this area. Table 4 showed that 5 species were the most preference host tree for epiphytic orchid such as Metrosideros vera Niederen, Syzygium sp., Cratoxylum formosum (Jack.) Dyer., Vitex sp. and Barringtonia sp. This result was supported by Tirta et al. (2010), that epiphytic orchid in Senturan forest mostly grow on Syzygium racemosum, Syzygium sp., Glochidion rubrum, Artocarpus sp., Baccaurea sp., Trema orientalis and Shorea sp. In the other case, epiphytic orchid grow well on other species trees out group of Syzygium family such as Lagerstroemia speciosa, Tectona grandis (Yulia and Ruseani 2008; Puspitaningtyas 2007), Clausena indica, Mangifera indica (Puspitaningtyas 2007), Saraca declinata and Dipterocarpus sp. (Yulia

LESTARI & SANTOSO – Inventory of Lamedai orchids species

2007). Epiphytic orchid in Sibolangit mostly grow on Durio sp. (Hartini and Puspitaningtyas 2009), same with research orchid in Sintang District, West Kalimantan (Ariyanti and Pa’i 2008). Syzygium was not the most preference host tree for orchid; depend on the type of vegetation in the area. Sanford (1974) said that habitat of orchid is has correlation with their environment. Pouteria sp., Cratoxylum sp., Barringtonia sp., Lophopetalum sp. and Syzygium sp. are suitable host tree for orchid grow, that indicated by the highest population of orchid. But Syzygium sp., Metrosideros sp., Barringtonia sp., Cratoxylum sp. and Lophopetalum sp. are suitable host trees for a number of orchid species. Host tree species determines traits, such as bark characteristics (Hirata et al. 2008). According to Yulistyarini (2001), Host trees such as Cratoxylum sp., Vitex sp. and Syzygium sp. usually have specific character like rough bark with mossy substrate. Bulbophyllum sp. can associate growing on some host trees like Metrosideros vera Niederen, Metrosideros sp., Palaquium obovatum (Griff.) Engl., Eusideroxylon sp., Cratoxylum sp., Pouteria sp., Vitex sp., Maranthes sp., Cratoxylum formosum (Jack.) Dyer., Lophopetalum sp.,

Antidesma sp. and Cleistanthus sp. Bulbophyllum sp. is genera that have more diversity in Malesia area, beside of Dendrobium sp. (Comber 1990). Same with research of Yulia (2007) that found more Bulbophyllum sp. (15 species) in the natural forest at the Petarikan village, West Kotawaringin District, Central Kalimantan. Data recapitulation of orchid’s species on the 10 host trees in Lamedai Nature Reserve is represented at Figure 1. Metrosideros vera Niederen is the preference host tree for orchid (Figure 1). Base on number of individual orchid on host tree, showed that many orchid species in Lamedai prefer growing on Pouteria sp., then on Syzygium and Sapotaceae family. M. vera synonims with Xanthostemon verus (Lindl.) Peter G. Wilson have bark surface smooth, greyish, branches often low on the bole and slough (Sosef et al. 1998). Orchid preference choose host with rough bark surface (Whitner 1974) because seed of orchid can be drawee on the bark comparison with smooth bark surface (Puspitaningtyas 2007). Mostly, orchid in Lamedai Nature Reserve found epiphytic on the smooth bark surface but slough. So they can be grow on the bark.

Table 4. Relationship between host tree and orchid in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi Species of host tree

Family

Syzygium sp. Metrosideros vera Niederen Cratoxylum formosum (Jack.) Dyer. Vitex sp. Calophyllum sp. Pouteria sp. Metrosideros sp. Barringtonia sp. Cratoxylum sp. Lophopetalum sp.

Myrtaceae Myrtaceae Clusiaceae Verbenaceae Clusiaceae Sapotaceae Myrtaceae Lecythidaceae Clusiaceae Celastraceae

The frequency as host tree 7 14 6 5 4 4 4 5 4 3

∑ orchid species 7 10 3 4 3 3 4 5 4 3

∑ individual Orchid species/ Individual of of orchid host tree orchid/host tree 27 1 3.86 52 0.72 3.71 20 0.5 3.33 12 0.8 2.4 7 0.75 1.75 35 0.75 8.75 14 1 3.5 31 1 6.2 33 1 8.25 15 1 5

60 50 40 30 20 10

the frequency of host tree

∑ orchid species

∑ individual of orchid

orchid spesies/host tree

Lophopetalum sp.

Cratoxyllum sp.

Barringtonia sp.

Metrosideros sp.

Pouteria sp.

Calophyllum sp.

Vitex sp.

Cratoxyllum formosum

Metrosideros vera

Syzygium sp.

individual of orchid/host tree

Figure 1. Recapitulation of orchids spesies on the 10 host tree in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi

B I O D I V E R S IT A S

12 (1): 28-33, January 2011

Height zone of tree Epiphytic orchids always patch grow on the trunk or ramification of specific tree. Height of tree is divided into 5 zone, there are zone 1, zone 2, zone 3, zone 4 and zone 5. Those zone were correlated with the way of epiphytic orchid to get sunlight. According to Solikin et al. (2010), epiphytic orchids rarely grow on the basal trunk . Usually, epiphytic orchid like growing on the zone 3 because in this zone get properly sunlight for orchid growth. Meanwhile some specific orchid can grow on the zone 1 when they need high humidity and low intensity light. Epiphytic orchid in Lamedai Nature Reserve mostly grow on the zone 1. It is showed that they need high humidity and the conservation status is easy exploitation. Orchid will stay on the zone 3-5 when they need medium to high light intensity. Result of zone observed for epiphytic orchid in Lamedai Nature Reserve as follow (Table 5): Table 5. Zone of epiphytic orchid in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi Zone Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Total

Frequency 49 28 16 8 1 102

Dendrobium sp.1 grow on every zone and almost all of orchid species in Lamedai Nature Reserve grow on the zone 1, except Agrostophyllum sp., Dendrobium platygastrum Reichb.f., Grammatophyllum scriptum Blume, Grosourdya appendiculata (Blume) Reichb.f., Luisia sp., Phalaenopsis sp. and Thrixspermum sp. Only once orchid found on zone 5, it means that epiphytic orchid cannot stand under full sunlight. Usually, epiphytic orchid will choose appropriate zone of host tree to get light for growing. Based on the research of Tirta and Lugrayasa (2006), epiphytic orchid mostly grow on zone 2 (36%) and only few orchids grow on zone 5 (6%). But Dendrobium capra J.J. Smith in Madiun and Bojonegoro can found at 5th zone because it needs to get a direct sunshine (Yulia and Ruseani 2008). Sometimes epiphytic orchid found on zone 3 and 4 (Tirta et al. 2010; Hirata et al. 2008). Dressler (1982) said that zone 2 and 3 are the most suitable zone for epiphytic orchid. Substrate Category of substrate thickness on the habitat of epiphytic orchid divided into thin, medium and thick. Usually, thick or thin of substrate depend on physically condition of host tree. Thick substrate showed that high humidity in their habitat. In Lamedai Nature Reserve, humidity was about 60-80% and temperature 22-32Â°C, this condition created thick humus deposits There were 51 orchid species growing on thick humus and 7 species on thin humus, such as Bulbophyllum sp., Cymbidium finlaysonianum Lindl., Dendrobium sp.1, Dendrobium

crumenatum Sw., Schoenorchis juncifolia Blume ex. Reinw., Thrixspermum arachnites (Bl.) Rchb. and Thrixspermum accuminatissimum (Blume) Reichb.f. and usually found lichen on their habitat. Yulistyarini et al. (2001) said that in Pleihari, Martapura, epiphytic orchid mostly grew on medium to thick humus on zone 2. According to Rahayu (2004), lichen supply water to epiphytic orchid that influence to photosynthesis plant. Substrate thickness of epiphytic orchid in Lamedai Nature Reserve presented on Table 6. Table 6. The correlation between substrate and the occurrence of epiphytic orchid Substrate thickness Thick Medium Thin Total

Frequency 51 44 7 102

Whether orchids grow perched on the branches of trees in tropical forests, or barely holding their leaves above the water in temperate marshy meadows, they are well adapted to survive in their own particular environment (Rahayu 2004). Epiphytics find themselves in an unusually harsh environment. High up in the canopy, water is only abundant when it rains. Even though it may rain regularly, there are often times when precipitation is reduced. Nearly all exposed epiphytic orchids tend to have heavily waxed leaves or a thick cuticle, which helps to conserve moisture. Sunlight intensity Usually, orchids need sunlight with ratio 20-90% and depend on species of orchid. Several of orchids can be growing on the place with enough sunlight or not. Characteristic of epiphytic orchid is one of the adaptations to sunlight. Every orchid species need different sunlight, lower or higher sunlight intensity from optimum requirement cause obstacle growth (Harwati 2007). The result showed that species of epiphytic orchids in Lamedai Nature Reserve more founded in shady condition (Table 7). Sunlight intensity are acceptance more and more little if orchid reside in the forest, because had the hands tied with crown of tree and high humidity relatively. Frequency epiphytic orchid in heavy shady was 40 individual, open shade was 43 individual and full sun was 9 individual. This condition show that epiphytic orchid in Lamedai commonly grow in high humidity, frequently on zone 1. Relatively same with research from (Tirta and Lugrayasa 2006) in Malinau that epiphytic orchid oftenly grow in zone 2 and rarely grow in zone 5. Yulia and Ruseani (2008), stated that usually on zone 5, epiphytic orchid get more sunlight intensity and low humidity relatively with dry substrate condition. In Lamedai, Phalaenopsis sp. rarely grows under full sunlight. They generally grow in shady condition. Phalaenopsis sp. and Paphiopedillum sp. need low light intensity (Pridgeon and Morrisson 1992). But Dendrobium sp. Thrixspermum sp. and other orchidâ&#x20AC;&#x2122;s species commonly grow under open shade area. From the

LESTARI & SANTOSO – Inventory of Lamedai orchids species

result know that light intensity interfered with growth and development of these orchids (Stancato et al. 2002). Table 7. Abundance of sunlight for epiphytic orchid in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi. The correlation between sunlight intensity and the occurrence of epiphytic orchid. Sunlight intensity

Frequency

Heavy shade Open shade Full sun Total

40 43 9 102

CONCLUSION In Lamedai Nature Reserve, there were 27 orchids species, consist of 25 species (16 genera) epiphytic orchid and 2 species terrestrial orchid such as Eulophia keithii var. celebica and Goodyera rubicunda (Blume) Lindl. Member of Myrtaceae such as Syzygium sp., Metrosideros vera Niederen and Metrosideros sp. were the most preference host tree for epiphytic orchid. They frequently grow on zone 1 with thick mossy substrate and low sunlight intensity.

ACKNOWLEDGEMENTS We would like to thank to Head of Purwodadi Botanical Garden who supported exploration in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi, Head of Natural Resource Conservation Institute (BKSDA) Southeast Sulawesi, Head of Area Section II Kolaka Kendari, Head of Resort Tanggetada Watubangga, PEH BKSDA of Southeast Sulawesi and their staff, as well as exploration team Lamedai from Purwodadi Botanical Garden.

REFERENCES Arditti J (1992) Fundamentals of orchids biology. John Wiley and Sons, New York. Ariyanti EE, Pa’i (2008) Orchids inventory in Sintang District, West Kalimantan. Biodiversitas 9: 21-24. Bugiono (2006) Information of conservation area in Southeast Sulawesi. Natural Resource Conservation Institute of Southeast Sulawesi, Kendari. [Indonesia] Comber JB (1990) Orchids of Java. Royal Botanic Garden, Kew England. Djuita NR, Sudarmiyati S, Candra H, Sarifah, Nurlaili S, Fathony R (2004) Orchids diversity of Situ Gunung, Sukabumi. Biodiversitas 5: 77-80. Dressler RL (1982) The orchids natural history and classification. Harvard University press, Cambridge.

Hartini S, Puspitaningtyas DM (2009) Plant diversity in Sumatra island. Bogor Botanic Garden, Bogor. [Indonesia] Harwati CT (2007) Influence of sunlight intensity to orchid growth. Innofarm: J Agric Innov 6 (1): 121-126 [Indonesia] Hirata A, Kamijo T, Saito S (2008) Host trait preference and distribution of vascular epiphytes in a warm-temperate forest. J Plant Ecol 201: 247-254. Johansson DR (1975) Ecology of epiphytic orchids in West African rain forests. Am Orchid Soc Bull 44: 125-136. Koopowitz H (2001) Orchids and their conservation. Timber press, Oregon. Park SY, Murthy HN, Paek KY (2000) In-vitro seed germination of Calanthe sieboldii, an endangered orchid species. J Plant Biol 43: 158-161. Peneng IN, Pendit IMR, Tirta IG, Sukiada IM, Gede IDP, Sandi IK, Budiarsa IM (2004) Exploration and inventory of orchid in Batu Putih forest, Batu Putih subdistrict, South Kolaka District, Southeast Sulawesi. Technical report of “Eka Karya” Bali Botanical Garden. Bali. Pridgeon A, Marrisson A (1992) The illustrated encyclopedia of orchids. Timber press, Oregon. Puspitaningtyas DM, Fatimah (1999) Inventory of orchids species in Kersik Luway Nature Reserve, East Kalimantan. Bul Kebun Raya 9: 18-25. [Indonesia] Puspitaningtyas DM (2005) Study on orchid diversity in Gunung Simpang Nature Reserve, West Java. Biodiversitas 6: 103-107. Puspitaningtyas DM (2007) Orchid inventory and the host in Meru Betiri National Park, East Java. Biodiversitas 8: 210-214. Putri DMS (2006) Inventory of orchids in Mount Tinombala Natural Reserve, Tolitoli District, Central Sulawesi. Biodiversitas 7: 30-33. Rahayu S (2004) Species of orchid, Hoya and Aeschynanthus in Menoreh mountain range. Warta Kebun Raya 4: 31-36. [Indonesia] Sanford WW (1974) The ecology of orchids. John Wiley and Sons, New York. Siregar C, Listiawati A, Purwaningsih (2005) Orchids species of West Kalimantan. Institute of Tourism Research and Development in West Kalimantan, Pontianak. [Indonesia] Solikin, Suhartono, Tarmudji (2010) Composition and dispersal of orchids species in Lejja, South Sulawesi; proceeding of national seminary on basic science. Brawijaya University, Malang, 21 February 2010. [Indonesia] Sosef MSM, Hons LT, Prawirohatmodjo S (1998) Plant resources of Southeast Asia: No. 5 (3) timber trees – lesser known timbers. Prosea, Bogor. Stancato GC, Mazzafera P, Buckeridge MS (2002) Effect of light stress on the growth of the epiphytic orchid Cattleya forbesii Lindl. X Laelia tenebrosa Rolfe. Rev Brasil Bot 25: 229-235. Tirta IG, Lugrayasa IN (2006) Exploration and inventory of epiphytic orchid in mount Sidi, Malinau, East Kalimantan; proceeding of a day seminary conservation and efficiency of lowland plant diversity II. Purwodadi Botanic Garden, Purwodadi, 28 January 2006. [Indonesia] Tirta IG, Lugrayasa IN, Irawati (2010) A study on epiphytic orchids at three locations in Malinau District, East Kalimantan. Bul Kebun Raya 13: 35-39. [Indonesia] Whitner CL (1974) The orchids: scientific studies. John Wiley and Sons, New York. World Conservation Monitoring Centre (1995) Indonesian threatened plants. Eksplorasi 2: 8-9. Yulia ND (2007) The diversity of epiphytic orchids in the natural forest of Petarikan, the district of West Kotawaringin, Central Kalimantan. Bul Kebun Raya 10: 46-50. [Indonesia] Yulia ND, Ruseani NS (2008) Inventory and habitat study of Dendrobium capra J.J. Smith in Madiun and Bojonegoro. Biodiversitas 9: 190-193. Yulistyarini T, Ariyanti EE, Yulia ND (2001) Inventory of orchids species in Pleihari, Martapura, South Kalimantan. Proceeding of Seminary on Days of Flower Love and National Fauna. Bogor Botanic Garden, Bogor. [Indonesia]

BIODIVERSITAS Volume 12, Number 1, January 2011 Pages: 34-37

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120107

Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta EKO SETYOBUDI♥, SOEPARNO, SENNY HELMIATI Department of Fisheries, Faculty of Agriculture, Gadjah Mada University (UGM), Jl. Flora, Gedung A-4 Bulaksumur, Yogyakarta 55281, Indonesia, ♥ email: setyobudi_dja@ugm.ac.id Manuscript received: 12 March 2010. Revision accepted: 28 July 2010.

ABSTRACT Setyobudi E, Soeparno, Helmiati S (2011) Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta. Biodiversitas 12: 34-37. The prevalence, intensity and distribution of Anisakis sp. larvae which infected some fishes at the southern coast of Kulon Progo District were investigated. Totally 95 fish specimens were collected during December 2007. Results of the present study indicated that the Anisakis sp. larvae infected various fish species i.e: Trichiurus lepturus, Parupeneus sp., Lutjanus malabaricus, Terapon jarbua and Caesio sp. Prevalence and mean intensity of infection showed the differences between fish species. The highest mean intensity of infection was found in L. malabaricus (7.71 larvae/infected host) and T. Lepturus (3.18 larvae/infected host), while the lowest intensity of infection was found in Parupeneus sp., T. jarbua and Caesio sp. (1 larvae/infected host). Infected host organs were body cavities (peritoneum), digestive tract, gonads, and liver. Presence of this parasite may be harmful for consumer; however it can be used for several ecological studies as biological tags. Key words: Anisakis sp., infection, southern coast of Kulon Progo District.

INTRODUCTION Anisakis sp. (Nematode: Anisakidae) is a common parasite of marine organisms world-wide. Their life cycles involve crustaceans, fishes, cephalopods and marine mammals. These organisms act as intermediate, paratenic or transport host and definitive host. Numerous species of fish (Hutomo et al. 1978; Chao 1985; Strømnes and Andersen 1998; Wharton et al. 1999; Manfredi et al. 2000; Margarena 2002; Shih 2004; Nuchjangreed 2006; Jacob and Palm 2006; Setyobudi et al. 2007; Suadi et al. 2007; Palm et al. 2008) and cephalopods especially belonging to the family of Sepiidae and Ommastrephidae (Abollo et al. 2001) have been reported to be infected by Anisakis sp. larvae. Occurrence of Anisakis sp. larvae in the fish may be reducing the quality and be harmful for consumer. These nematode cause human health implication and reduce the commercial value of fish. Human can act as incidental host by ingestion of raw or undercooked infected fish. Several symptoms in humans caused by Anisakis infection are: stomach pain, nausea, vomiting (Smith and Wooten 1978), allergic reaction (Ancillo et al. 1997; Audicana et al. 2002) and gingivostomatitis (Eguia et al. 2003). However, its occurrence can be used as biological tags for many purposes of ecological studies and applied fishery science e.g. fish stock discrimination, migration and feeding habits. Marcogliese et al. (2003) has been used parasite to identify marine fish stock and its movement pattern. Using Anisakis sp. larvae as biological tags have been conducted for some fish species, for example Chilean hake (Merluccius gayi gayi) (Oliva and Ballon 2002), swordfish (Xiphias gladius)

(Pampillon et al. 2002), herring (Clupea sp.) (Horbowy and Podolska 2001; Podolska and Horbowy 2003; Tolonen and Karlsbakk 2003; Podolska et al. 2006), and also walleye pollock (Theragra chalcogramma) (Konisi and Sakurai 2002). There were limited studies related to Anisakis sp. larvae infection in Indonesian water especially in the southern coast of Java Island. The aims of this research were to know the prevalence and mean intensity of Anisakis sp. larvae which infected some fishes at the southern coast of Kulon Progo District. This data provide some information of the infection levels on each fish species which can guide for fish handling and processing, as well as possibility for biological indicator. The fishes with high prevalence of Anisakis sp. larvae infection should be avoid to be consumed as raw or undercooked. However, understanding of the parasites distribution and specific site of infection may be used as biological indicator for several ecological studies. MATERIALS AND METHODS Sample collection Samples were collected from fish landing-places in (i) Glagah (Temon Subdistrict), (ii) Bugel (Panjatan Subdistrict), and (iii) Trisik (Banaran Village, Galur Subdistrict), Kulon Progo District (7°54’-7°58’ S, 110°03’110°11’E), Yogyakarta, Indonesia (Figure 1). A total of 95 individuals fish were randomly collected as samples during December 2007. The number of sample for each species was taken proportionally to the total fish caught by

SETYOBUDI et al. â&#x20AC;&#x201C; Infection of Anisakis in Kulon Progo marine fishes

fisherman. The fish was transported to the laboratory and immediately frozen until the parasites examination or identification. Samples examination Each fish sample was thawed, measured the total length (nearest 0.1 cm) and body weight (nearest 0.1 g) and examined for the parasites. External examination was conducted on body surface and gill, internal examination

were conducted on body cavity, digestive tract, liver, gonad, and muscle. Parasites collected were preserved in 70% ethanol for morphological analysis under microscope Anisakis sp. identification was based on morphological feature. Population descriptor are prevalence (a number of host infected with parasites divided by the number of host examined, expressed as percentage) and mean intensity (average of infection of parasite among the infected fish, expressed as larvae/infected host) (Bush et al. 1997). Magelang

ADMINISTRATIVE MAP OF KULON PROGO DISTRICT

LEGEND:

Purworejo

Subdistrict border Village border River Rail road National road Provincial road District road

Bantul

2 3 Figure 1. Fish sampling site of southern coast of Kulon Progo District, Yogyakarta. Note: 1. Glagah, 2. Bugel, and 3. Trisik beaches.

BIODIVERSITAS

RESULTS AND DISCUSSION

12 (1): 34-37, January 2010

and mean intensity 14.2 larvae/infected host. The high mean intensity was achieved in Evynnis cardinalis and Many commercially important fish species were Nemipterus virgatus, 80.3 and 76.2 larvae/infected host, captured at Indian Ocean, southern coast of Kulon Progo respectively. Several studies of Anisakis sp. larvae District. This dominantly by economic important fish e.g. infection in some marine fishes from Indonesian waters Pampus argenteus, Trichiurus lepturus, Lutjanus have been conducted, and showed different prevalence and malabaricus, Terapon jarbua, Caesio sp. and Arius mean intensity for each fish species. Fishes belonging maculatus. Anisakis sp. larvae infection showed the Gempylidae family (Gempylus serpens, Thyrsitoides difference of prevalence and mean intensity between fish marleyi) exhibited high prevalence and mean intensity of species. Species, total number of individuals and size of Anisakis sp. infection (Tabel 4). Many studies shown the fish samples and the infection of Anisakis sp. larvae were infection was more often found in feeding area than given in Table 1. There were only 5 of 11 observed fish nursery area. Prevalence in the feeding area reached 83species infected by Anisakis sp. larvae. The presence of 100% with mean intensity 6.0±4.7-9.9±15 larvae/infected Anisakis sp. larvae in marine organisms have been host, whereas in nursery area the prevalence reached 7investigated in several previous studies and a great number 54% with mean intensity 1-3.7±2.9 larvae/infected host of fish species and cephalopods have been found and (Tolonen and Karlsbakk 2003). The distribution and locality of infections by Anisakis reported to be receptive to anisakid infection (Smith and sp. showed that the majority of nematodes were found in Wooten 1978; Abollo et al. 2001). This study showed the highest mean intensity observed digestive tract, peritoneum and gonad (Table 2). Mostly on L. malabaricus (7.71 larvae/infected host), following T. Anisakis sp. larvae was found in peritoneum than other lepturus (3.18 larvae/infected host), whereas in Parupeneus organs, for example in Trichiurus lepturus (Margarena sp., T. jarbua and Caesio sp. just a few (around 1 2002), some commercial flatfish (Alvarez et al. 2002) and larvae/infected host) were obtained. Reports on the Merluccius gayi gayi (Oliva and Ballon 2002). Wharton et distribution of Anisakis sp. larvae on some fish species al. (1999) found that the majority of larvae were associated from different area shown a great variation of prevalence, with the visceral organs, mesenteries, and peritoneum. Due intensity and distribution. Margarena (2002) reported the to the infection and distribution of Anisakis sp. occur differences of prevalence and intensity of Anisakis sp. through food web by predator-prey relationship, factors infection in Trichiurus lepturus from different regions in like the feeding habits of the host or time period of larvae southern coast of Bantul District. The higher prevalence the within the host have been used to explain the (49.23%) were observed in Pandansimo fish landing place preferences of larvae to muscles or visceral organs. than Depok fish landing place (42.90%), conversely, the Strømnes and Andersen (1998) revealed the distribution higher intensity were obtained in Depok fish landing place patterns of A. simplex L3 between muscle and viscera were (7.46 larvae/infected host) compared to Pandansimo (5.35 not significantly affected by host size but might be larvae/infected host). Similar prevalence, ranged 31.26- governed by the conditions encountered within host tissues, 53.33% was obtained in Trichiurus spp. landed in Cilacap and are possibly related to the availability of nutrients. (Suadi et al. 2007). In contrast, the higher prevalence were These parasites seem to be capable of living for several showed Anisakis sp. infecting Trichiurus sp. in southern years. The larvae will penetrate the digestive tract and coast of Purworejo District, that is 62.68% but only has entered to the abdomen. In contrast, Valero et al. (2006) lower intensity (3.30 larvae/infected host) (Setyobudi et al. reported the clearly higher prevalence of larvae in viscera than in the muscle tissue of Merluccius merluccius and an 2007). Chao (1985) reported the Anisakis sp. larvae infection increase in parasitization with increasing host length. Presence of Anisakis sp. larvae in the mouth cavity of in some marine fish, with mean prevalence reached 37.7% the host as shown in T. lepturus in this study was rarely case and Table 1. Species, total numbers, size of fish sampled and the infection of Anisakis sp. unusual. The possibly the larvae was larvae move toward of digestive tract, from stomach to the mouth after previous No. of Infection Total Length host has been ingested. indivi(prevalence (%), Species (local and scientific name, family) (cm) Occurrence of Anisakis sp. in duals mean intensity) some marine fishes has been Layur (Trichiurus lepturus; Trichiuridae) 24 48.0-85.0 45.83 % (3.18) investigated for health and ecological Kuniran (Parupeneus sp.; Mullidae) 36 15.4-20.6 33.33% (1.08) reason. Indonesia has thousands fish Tombol (Lutjanus malabaricus; Lutjanidae) 13 16.3-26.1 53.85% (7.71) Manyung (Arius maculatus; Ariidae) 4 21.0-25.1 0 (0) species but only little amount have Kerong-kerong (Terapon jarbua; Terapontidae) 3 17.9-21.4 66.67% (1.00) been studied for Anisakis sp. Bawal (Pampus argenteus; Stromateidae) 2 19.6-20.6 0 (0) (Anisakidae) infestation. In the future, Ikan kelelawar (Platax orbicularis; Ephippidae) 1 36.1 0 (0) a long term survey and more detailed Kakap (Gymnocranius microdon; Lethrinidae) 3 17.9-22.0 0 (0) studies about its eco-biology in largeKetang-ketang (Drepane punctata; Drepaneidae) 5 14.5-35.3 0 (0) scale area are necessary for providing Ekor kuning (Caesio sp.; Caesionidae) 2 18.0-20.3 50.00% (1.00) useful information of anisakids Peperek (Leiognathus fasciatus; Leiognathidae) 2 20.0-21.0 0 (0) infection in Indonesian waters.

SETYOBUDI et al. – Infection of Anisakis in Kulon Progo marine fishes Table 2. Distribution of Anisakis sp. larvae on each organ in some marine species from southern coast of Kulon Progo District Locality Digestive Mouth Peritoneum tract T. lepturus 2.9% 14.3% 57.1% Parupeneus sp. 53.8% 30.8% L. malabaricus 59.3% 25.7% T. jarbua* 100.% Caesio sp.* * = 1 fish sample Fish species

Liver Gonad 14.3% -

11.4% 15.4% 15.0% 100.%

Table 3. Related studies of Anisakis sp. larvae infection in some marine fishes from Indonesian waters Prevalence (%) Decapterus russelli 15-83.94 2.9-28.6 Rastrelliger kanagurta 4-87.72 Sardinella sirm 16.98-78 Auxis rochei rochei 20-74.3 Trichiurus lepturus 62.68 97.1 46.07 Brama dussumieri 10.5 Gempylus serpens 97.1 Thyrsitoides marleyi 100 Fish species

Intensity

References

1-15.06 1-1.9 1.5-13 1.22-3.77 2.9-4.6 3.30 1-70 6.41 1-2 1-32 9-25

Hutomo et al. 1978 Palm et al. 2008 Hutomo et al. 1978 Hutomo et al.1978 Palm et al. 2008 Setyobudi et al. 2007 Jacob and Palm 2006 Margarena 2002 Jacob and Palm 2006 Jacob and Palm 2006 Jacob and Palm 2006

CONCLUSION Anisakis sp. larvae infecting various fish species i.e.: T. lepturus, Parupeneus sp., L. malabaricus, T. jarbua and Caesio sp. Prevalence and intensity of infection showed the differences between fish species. The high intensity of infection was found in L. malabaricus and T. lepturus. These larvae mostly found in body cavities (peritoneum) and digestive tract. Presence of this parasite may be harmful for consumer; however it can used for several ecological studies as biological tags. ACKOWLEDGEMENTS This research was financed by a grant that provided by Faculty of Agriculture, Gadjah Mada University, Yogyakarta. REFERENCES Abollo E, Gestal C, Pascual S (2001) Anisakis infestation in marine fish and cephalopods in Galician waters: an update perspective. Parasitol Res 87: 492-499. Alvarez, Iglesias R, Parama AI, Leiro J, Sanmartın M (2002) Abdominal macroparasites of commercially important flatfishes (Teleostei: Scophthalmidae, Pleuronectidae, Soleidae) in northwest Spain (ICES IXa). Aquaculture 213: 31-53. Ancillo M, Cabalerro MT, Cabanas R, Contreras J, Baroso JAM, Barranco P, Serrano MCL (1997) Allergic reactions to Anisakis simplex parasitizing seafood. Ann Allerg Asthma Im 79: 246-250. Audicana MT, Ansotegui IJ, Corres LF, Kennedy MW (2002) Anisakis simplex: dangerous-dead and alive? Trends Parasitol 18: 20-25.

Bush AO, Lafferty KD, Lotz JM, Shostak A W (1997) Parasitology meets ecology on its own terms: Margolis et al. revisited. J Parasitol 83: 575-583. Chao D (1985) Survey of Anisakis larvae in marine fish of Taiwan. Int J Zoonoses 3: 233-237. Eguia A, Aguirre JM, Echevarria MA, Conde RM, Ponton J (2003) Gingivostomatitis after eating parasitized by Anisakis simplex: Case report. Oral Surg Oral Med Pathol Oral Radiol Endod 96: 437-440. Horbowy J, Podolska M (2001) Modelling infection of Baltic herring (Clupea harengus) by larval Anisakis simplex. ICES J Mar Sci 58: 321-330. Hutomo M, Burhanuddin, Hadidjaja P (1978) Observations on the incidence and intensity of infection of nematode larvae (Fam. Anisakidae) in certain marine fishes of waters around Panggang Island, Seribu Islands. Mar Res Indonesia 21: 49-60. Jacob E, Palm HW (2006) Parasites of commercially important fish species from the southern Java coast, Indonesia, including the distribution pattern of trypanorhynch cestodes. Verhandlungen der Gesellschaft für Ichthyologie 5: 165-191. Konisi K, Sakurai Y (2002) Geographic variations in infection by larval Anisakis simplex and Contracaecum osculatum (Nematoda, Anisakidae) in walleye pollock Theragra chalcogramma stocks off Hokkaido, Japan. Fish Sci 68: 532-542. Manfredi MT, Crosa G, Galli P, Ganduglia S (2000) Distribution of Anisakis simplex in fish caught in the Ligurian Sea. Parasitol Res 86: 551-553. Marcogliese DJ, Albert E, Gagnon F, Sevigny JM (2003) Use of parasites in stock identification of Deepwater Redfish (Sebastes mentella) in the Nortwest atlantic. Fish Bull 101: 1883-1888. Margarena R (2002) The prevalence, intensity, and distribution of Anisakis simplex in hairtail (Trichiurus lepturus) landed at Bantul District. [Thesis]. Gadjah Mada University, Yogyakarta. [Indonesia] Nuchjangreed C, Hamzah Z, Sunthornthiticharoen P, Nuntawarasilp PS (2006) Anisakids in marine fish from the coast of Chon Buri Province, Thailand. Southeast Asian J Trop Med Public Health 37: 35-39. Oliva ME, Ballon I (2002) Metazoan parasites of the Chilean hake Merluccius gayi gayi as a tool for stock discrimination. Fish Res 56: 313-320. Palm HW, Damriyasa IM, Linda and Oka IBM (2008) Molecular genotyping of Anisakis Dujardin, 1845 (Nematoda: Ascaridoidea: Anisakidae) larvae from marine fish of Balinese and Javanese waters, Indonesia. Helminthologia 45: 3-12. Pampillon JAC, Bua MS, Dominguez HR, Garcia JM, Fernadez CA, Estevez JMG (2002) Selecting parasites for use in biological tagging of the Atlantic swordfish (Xiphias gladius). Fish Res 59: 259-262. Podolska M, Horbowy J (2003) Infection of Baltic herring (Clupea harengus) with Anisakis simplex larva, 1993-1999: a statistical analysis using generalized linear models. ICES J Mar Sci 60: 85-93. Podolska M, Horbowy J, Wyszynski M (2006) Discrimination of Baltic herring populations with respect to Anisakis simplex larvae infection. J Fish Biol 68: 1241-1256. Setyobudi E, Senny H, Soeparno (2007) Infection of Anisakis sp. in Hairtail (Trichiurus sp.) in Southern coast of Purworejo Regency. J Fish Sci IX (1): 142-147. Shih HH (2004) Parasitic helminth fauna of the cutlass fish, Trichiurus lepturus L., and the differentiation of four anisakid nematode third-stage larvae by nuclear ribosomal DNA sequences. Parasitol Res 93: 188-195. Smith JW, Wooten R (1978) Anisakis and anisakiasis. Adv Parasit 16: 93-163. Strømnes E, Andersen K (1998) Distribution of whale worm (Anisakis simplex, Nematoda, Ascaridoidea) L3 larvae in three species of marine fish; saithe (Pollachius virens L.), cod (Gadus morhua L.) and red fish (Sebastes marinus L.) from Norwegian waters. Parasitol Res 84: 281-285. Suadi, Helmiati S, Widaningroem R (2007) Population and parasite parameter in hairtail (Trichiurus spp.) landed at PPS Cilacap. J Fish Sci 9 (2): 226-232. Tolonen A, Karslbakk E (2003) The parasite fauna of the Norwegian spring spawning herring (Clupea harengus L.). ICES J Mar Sci 60: 77-84. Valero A, Lopez-Cuello AM, Benítez R, Adroher FJ. (2006) Anisakis spp. in European hake, Merluccius merluccius (L.) from the Atlantic off north-west Africa and the Mediterranean off southern Spain. Acta Parasitol 51: 209-212. Wharton DA, Hassal ML, Aalders O (1999) Anisakis (Nematoda) in some New Zealand inshore fish. NZ J Mar Freshw Res 33: 643-648.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 38-44

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120108

Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia AWAL RIYANTO♥ Zoology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Widyasatwaloka Building, Jl. Raya Jakarta-Bogor Km. 46, Cibinong, West Java, Indonesia. Tel.: 021-8765056 Fax.: 021-8765068 email: awal_lizards@yahoo.com Manuscript received: 1 March 2010. Revision accepted: 2 August 2010.

ABSTRACT Riyanto A (2011) Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia. Biodiversitas 12: 38-44. Community structure and habitat associations of amphibians and reptiles on both rainy and dry seasons of six habitat types of three sites in Gunung Ciremai National Park, West Java were investigated in March and October 2008. The data of herpetofauna was obtained by opportunistic searches. Herpetofaunal diversity for each habitat was determined by using Shannon Wiener index, the species abundance per unit area was calculated by using Margalef’s index, and the homogeneity of distribution of species in relation to other species in a sampled per unit area was evaluated using Evenness index. The similarity in herpetofauna communities among habitat types was determined using Sorensen’s coefficient, meanwhile the Jaccard’s index was used to estimate similarities in habitat utilization. Thus, both community similarities and habitat utilization displayed in cluster dendrogram. A total of 46 amphibian and reptile taxa were recorded, comprising 16 anurans, 22 lizards and 8 snakes. Of the total taxa, four anurans are endemic and unusual specimens probably new in sciences referred to the genus Cyrtodactylus and Eutropis. There were differed in sequential of biological indices among habitat types but not much different in their values. The result of cluster analysis showed different patterns on the community similarity among habitat type and habitat utilization during rainy and dry seasons. Key words: community, habitat utilization, amphibians, reptiles, Gunung Ciremai, Indonesia.

INTRODUCTION Mount Ciremai is the highest (3,078 m above sea level) mountain in West Java and is one of the most important assets for Kuningan and Majalengka Districts. The mountain has extensive natural resources including rich agricultural land and a natural, spring-fed water supply. However, the extinctions of forest dependent amphibians and reptiles due to forest loss and degradation as well as the isolation of once continuous populations are serious problems. Along with decree of the Ministry of Forestry No.424/Menhut-II/2004, the area of approximately 15,500 ha on mount Ciremai should be set aside as a national park. However, very few data are available regarding the biota of this region. Herpetofauna is not an exception despite the fact that amphibians and reptiles form an important part of the ecosystem as significant predators on invertebrates as well as smaller vertebrates, and are themselves important food items for birds and mammals (Howell 2002). Knowledge of biodiversity and organization of its communities is essential for the development of conservation policies and a sustainable environmental management system. Given the limited conservation resources, such knowledge provides the basis for identifying important areas to be conserved and threats that needs to be mitigated. This may only be achieved if sound knowledge exists of systematic, taxon distributions and habitat associations (Gillespie et al. 2005). The data of their

diversity and abundance are needed and essential for planning effective conservation and resource management strategies (Das 1997). Furthermore, documentation of the biodiversity of this area would enable better understanding of its community organization and the impact of disturbance processes. The only available data on diversity of herpetofauna come from the recent study of Riyanto (2007, 2008a, b). This study intends to promote future conservation efforts in this area by providing biodiversity and ecological data on the herpetofauna. The aimed of this study is to investigate structure community and habitat associations of different species on rainy and dry seasons in Gunung Ciremai National Park, West Java, Indonesia.

MATERIALS AND METHODS Study area. Gunung Ciremai National Park is located in West Java and a proximally 200 km southeast of Jakarta with altitude between 500 and 3,078 above sea level. Annually rain fall in this area is 2,000 to 4,500 mm. The survey were focused on three sites, they are Palutungan, Linggarjati and Seda, Kuningan District, West Java (Figure 1). Palutungan site is southern part of mount Ciremai and begin from 1,400 m in elevation. The habitat types of this site are included agro-ecosystem, shrub-old pine forest, secondary and primary forest. Linggarjati site is eastern

RIYANTO – Herpetofauna in Gunung Ciremai National Park

rocky substrate. Shrub-old pine forest was defined as old pine forest with full shrub, historically this habitat is pine plantation in the long time ago. Secondary forest was defined as regenerating forest historically cleared for coffee and pine plantation, the canopy was semi covered. The 3 secondary forest habitat also included a small stream with rocky substrate. Primary forest in this study included the forest area with canopy height 20 up to 50 m, full cover canopy and these areas have variety gentle ground 2 and also included small stream with rocky substrate. Field sampling. The surveys were conducted in March and October 2008. The March sampling period was represented rainy season, meanwhile the October sampling period was represented dry season. All habitat types in every survey sites 1 were surveyed by active opportunistic searches twice both of during days or during nights. The active opportunistic search is the researcher Figure 1. Map showing position of the study sites of (1) Palutungan, (2) Linggarjati and active looking for the herpetofauna on (iii) Seda at Gunung Ciremai National Park and around. all microhabitats such as under logs, debris, rocks etc. Night census was part on the mount and begin from 600 m in elevation with undertaken by four people wearing headlamp, slowly habitat type included agro-ecosystem, pine forest, walking across an area of broadly consistent habitat type secondary and primary forest. Meanwhile, Seda site is a with time duration. The time searching was consistently lowland area with elevation about 550 m asl., two habitat applied seven hours for day censuses and three hours for types was identified from this area, they are agro- night censuses. ecosystem and primary lowland forest. The lowland forest Species identification. The following literature was in Seda has been holy by the local society so this forest was consulted for identification, taxonomy and nomenclature protected and in good condition, composing by big trees. Rooij (1915, 1917), Brongersma (1942), Musters (1983), Canopy cover was classified into three categories based Manthey and Grossmann (1997), Stuebing and Inger on qualitative description: full cover, semi cover and open. (1999), Iskandar and Colijn (2000, 2001) and Mausfeld et A location were note as full cover if the canopy is dense al. (2002) for reptiles; and van Kampen (1923), Inger and enough to shade out the majority (>50%) of sunlight. Semi Stuebing (1989), Iskandar (1998, 2004), Manthey and cover was noted if the canopy broken where the sunlight Grossmann (1997) and Frost et al. (2006) for amphibians. penetrated to the forest floor, and open was noted if no Data analysis. All data collected was separated in wet canopy existed at all. The habitat were classified into six and dry periods to analysis. The species diversity for each types: (i) agro-ecosystem in low elevation (AE 1), 600-900 habitat was determined by using the Shannon Wiener Index m asl.; (ii) agro-ecosystem in high elevation (AE 2), 1100- (H’). The higher value of H’, the greater the diversity and 1500 m asl.; (iii) lowland forest (LF), 550-600 m asl.; (iv) supposedly the cleaner the environment (Ludwig and shrub-old pine forest (SOP); 1500-1600 m asl., (v) Reynolds 1988; Metcalfe 1989). secondary forest (SF), 1600-1700 m asl.; and (vi) primary forest (PF), 1700-2000 m asl. Agro-ecosystem included all H’ =-Σ [ (ni / N ) ln (ni / N ) ] areas under cultivation outside of villages but in the border of national park, including plantations (cabbages, potato, H’ = Shannon -Wiener index onions, banana, coffee and durian) and crop (young pine). N = Total individuals of population sampled Majority the canopies were open, except at durian and ni = Total individuals belonging to the i spesiec coffee plantations were semi covered. The agro-ecosystem habitat especially in Palutungan site includes a small water Richness Index that has been used was Margalef’s fall as a micro habitat (the water fall is named Curug Index (R). This index indicates the number of species in a Ciputri). Lowland forest was defined as forest area with sample or the abundance of the species per unit area canopy height 20 up to 30 m with large diameter up to 2.5 (Ludwig and Reynolds 1988; Metcalfe 1989). m, classified as full cover; include a small stream with

B I O D I V E R S IT A S

12 (1): 38-44, January 2011

R = S -1 / ln (N) R = Margalef richness index S = Total of species N = Total of individuals sampled Homogeneity or pattern of distribution of species in relation to other species in a sampled per unit area was calculated using Evenness Index (E) (Southwood 1971). E = Hâ&#x20AC;&#x2122; / ln S E = Evenness index Hâ&#x20AC;&#x2122; = Shannon -Wiener diversity index S= Total of species To assess degree of similarity in herpetofauna communities among habitat types surveyed, Sorensen coefficient were used. Meanwhile, the Jaccardâ&#x20AC;&#x2122;s index was used to estimate similarities in habitat utilization based on presence/absence of each taxon in each habitat types. Thus, both of community similarities and habitat utilization displayed in cluster dendrogram were produced by using unweighted pair group methods using arithmetic averages (UPGMA) (Gillespie et al. 2005) using NTSYSpc 2.1. (Rohlf 2000). RESULTS AND DISCUSSION Species composition A total of 46 amphibian and reptile species were recorded during both of rainy and dry season in 2008 (Table 1) comprising 16 anurans, 22 lizards and 8 snakes. Of the 46 species recorded, four anurans are endemic to Java (Huia masonii, Megophrys montana, Microhyla achatina and Rhacophorus margaritifer) and two reptiles are listed in CITES app. II (Varanus salvator and Python reticulatus). Unidentified and possibly undescribed lizards species of unusual specimen referred to the genus Cyrtodactylus and Eutropis. Rainy season In the rainy season, a total of 15 amphibians and 22 reptiles were recorded that comprising 15 anurans, 16 lizards and 6 snakes. The Dicroglossidae was dominated the frog fauna (four species, 26.67%), followed by Ranidae and Rhacophoridae (each three species, 20%), Bufonidae and Megophryidae (each two species, 13.33%), and Microhylidae (one species, 6.67%). Meanwhile for lizards, Agamidae and Scincidae were dominant with each represented six species (37.5%), and followed by Gekkonidae (four species, 25%). Snake species was represented by two families, Colubridae (five species, 83.33%) and Pythonidae (one species, 16.67%). A total of 26 species were associated with agroecosystem (non forest habitation) comprising 11 anurans, 11 lizards and 4 snakes. Twelve species were restricted to lowland agro-ecosystem consisted by five anurans (Fejervarya cancrivora, Leptobrachium hasseltii, Limnonectes macrodon, M. achatina and Polypedates

leucomystax), three lizards (Dasia olivacea, Draco volans and Eutropis sp.A), and four snakes (Ahaetulla prasina, Dendrelaphis pictus, Oligodon bitorquatus and Xenodermus javanicus). Meanwhile, only one species was restricted to high land agro-ecosystem (H. masonii). Six species were restricted to both of low and high land agroecosystem consisted by three anurans (Duttaphrynus melanostictus, Phrynoidis aspera and Rhacophorus reinwardtii) and three lizards (Cosymbotus platyurus, Gehyra mutilata and Eutropis multifasciata). In the lowland forest, ten species were found consisted by three anurans (Rana chalconota, Limnonectes kuhlii and Occidozyga sumatrana), six lizards (Gonocephalus chamaeleontinus, Cyrtodactylus fumosus, Hemidactylus frenatus, Eutropis sp.B, Sphenomorphus sanctus and Sphenomorphus temminckii) and one snake (P. reticulatus). Four of them were countered restrict to lowland forest (Eutropis sp.B, G. chamaeleontinus, P. reticulatus and O. sumatrana). Eight species were encountered in shrub old pine forest comprising three anurans (M. montana, Rana hosii and Philautus aurifasciatus), four lizards (Gonocephalus kuhlii, Pseudocalotes tympanistriga, C. fumosus and S. temminckii) and one snake (Calamaria virgulata). R. hosii was recorded restrict to this habitat type. Two species of anurans associated with the secondary forest include M. montana and P. aurifasciatus; meanwhile the reptiles represented by seven species, include six lizards (B. jubata, B. cristatella, G. kuhlii, Pseudocalotes tympanistriga, C. fumosus and S. temminckii) and one snake (C. virgulata). B. cristatella was restricted to secondary forest. In the primary forest, only one anuran was encountered that is P. aurifasciatus, three lizards (G. kuhlii, P. tympanistriga and S. temminckii) and one snake (C. virgulata). Dry season In the dry season, a total of 14 amphibians and 23 reptiles were recorded; comprising 14 anurans, 19 lizards and 4 snakes. The Rhacophoridae was dominated the frog fauna (four species, 28.57%), followed by Ranidae (three species, 21.43%), Bufonidae, Dicroglossidae and Megophryidae (each two species, 14.26%) and Microhylidae (one species, 7.14%). Meanwhile for lizards, Agamidae was dominant with represented by eight species (42.1%), followed by Gekkonidae (six species, 31.58%), Scincidae (three species, 19.79), Lacertidae and Varanidae (each one species, 5.26). Snake species was represented by two families, Colubridae (three species, 75%) and Elapidae (one species, 25%). A total of 25 species were associated with the agroecosystem comprising 10 anurans, 12 lizards and 3 snakes. Eleven species were restricted to lowland agro-ecosystem (D. melanostictus, Microhyla achatina, L. hasseltii, H. masonii, F. cancrivora, Polypedates leucomystax, R. reinwardtii, B. jubata, Draco fimbriatus, D. volans, C. platyurus, G. mutilata, E. multifasciata, Taxidromus sexlineatus, V. salvator, A. prasina, Calamaria schlegeli and Bungarus fasciatus). Two species were only found on highland agro-ecosystem (H. masonii and Calamaria schlegeli). Five species were associated both of high and

RIYANTO â&#x20AC;&#x201C; Herpetofauna in Gunung Ciremai National Park

Table 1. Species of amphibians and reptiles recorded on six different habitat types during rainy and dry season 2008 in Gunung Ciremai National Park, West Java. Taxa

AE1 (600-900) R D

LF (550-600) R D

Habitat Types and elevation AE2 SOP (1,100-1500) (1500-1600) R D R D

SF (1600-1700) R D

PF (1700-2000) R D

Bufonidae Duttaphrynus melanostictus 8 6 0 0 7 6 0 0 0 0 0 0 Phrynoidis aspera 13 7 0 0 10 3 0 5 0 0 0 0 Microhylidae Microhyla achatina 13 15 0 0 0 0 0 0 0 0 0 0 Megophryidae Leptobrachium hasseltii 7 3 0 0 0 0 0 0 0 0 0 0 Megophrys montana 0 0 0 0 0 0 1 0 7 5 0 0 Ranidae Huia masonii 0 0 0 0 13 15 0 0 0 0 0 0 Rana chalconota 15 20 23 15 8 5 0 5 0 0 0 0 Rana hosii 0 0 0 0 0 0 12 8 0 0 0 0 Dicroglossidae Limnonectes macrodon 1 0 0 0 0 0 0 0 0 0 0 0 Limnonectes kuhlii 20 16 8 3 9 7 0 7 0 0 0 0 Fejervarya cancrivora 15 13 0 0 0 0 0 0 0 0 0 0 Occidozyga sumatrana 0 0 14 0 0 0 0 0 0 0 0 0 Rhacophoridae Philautus aurifasciatus 0 0 0 0 0 0 5 23 16 13 16 13 Polypedates leucomystax 7 3 0 0 0 0 0 0 0 0 0 0 Rhacophorus margaritifer 0 0 0 0 0 0 0 1 0 0 0 0 Rhacophorus reinwardtii 6 4 0 0 4 0 0 0 0 0 0 0 Agamidae Bronchocela jubata 19 16 0 0 3 2 0 0 3 0 0 0 Bronchocela cristatella 0 0 0 0 0 1 0 0 1 1 0 0 Draco fimbriatus 0 1 0 0 0 0 0 0 0 0 0 0 Draco haematopogon 0 0 0 0 0 0 0 3 0 0 0 0 Draco volans 20 12 0 0 0 0 0 0 0 0 0 0 Gonocephalus kuhlii 0 0 0 0 0 0 2 2 10 7 3 4 Gonocephalus chamaeleontinus 0 0 5 6 0 0 0 0 0 0 0 0 Pseudocalotes tympanistriga 0 0 0 0 0 0 31 21 57 29 28 7 Gekkonidae Cosymbotus platyurus 6 4 0 0 5 3 0 0 0 0 0 0 Cyrtodactylus fumosus 0 0 8 5 4 3 2 1 4 3 0 0 Cyrtodactylus sp.A 0 0 0 2 0 0 0 1 0 5 0 0 Cyrtodactylus sp.B 0 0 0 0 0 0 0 2 0 0 0 0 Gehyra mutilata 3 2 0 0 1 1 0 0 0 0 0 0 Hemidactylus frenatus 3 2 2 1 2 2 0 0 0 0 0 0 Scincidae Dasia olivacea 2 0 0 0 0 0 0 0 0 0 0 0 Eutropis multifasciata 19 12 0 0 19 11 0 0 0 0 0 0 Eutropis sp.A 1 0 0 0 0 0 0 0 0 0 0 0 Eutropis sp.B 0 0 1 0 0 0 0 0 0 0 0 0 Sphenomorphus sanctus 2 1 24 21 0 0 0 0 0 0 0 0 Sphenomorphus temminckii 8 0 2 3 0 0 5 0 30 23 9 1 Lacertidae Taxidromus sexlineatus 0 3 0 0 0 0 0 0 0 0 0 0 Varanidae Varanus salvator 0 1 0 0 0 0 0 0 0 0 0 0 Colubridae Ahaetulla prasina 1 1 0 0 0 0 0 0 0 0 0 0 Calamaria schlegeli 0 0 0 0 0 1 0 0 0 0 0 0 Calamaria virgulata 0 0 0 0 0 0 1 0 2 2 2 0 Dendrelaphis pictus 1 0 0 0 0 0 0 0 0 0 0 0 Oligodon bitorquatus 1 0 0 0 0 0 0 0 0 0 0 0 Xenodermus javanicus 1 0 0 0 0 0 0 0 0 0 0 0 Elapidae Bungarus fasciatus 0 1 0 0 0 0 0 0 0 0 0 0 Pythonidae Python reticulatus 0 0 1 0 0 0 0 0 0 0 0 0 24 21 10 8 12 13 8 12 9 9 5 4 Number of species 192 143 88 56 85 60 59 79 130 88 58 25 Number of Individuals 2.804 2.653 1.870 1.680 2.252 2.226 1.448 1.984 1.608 1.778 1.265 1.118 Shannon (Hâ&#x20AC;&#x2122;) 0.882 0.871 0,812 0.808 0.906 0.868 0.696 0.798 0.732 0.809 0.786 0.807 Pielou (E) 4.375 4.030 2.010 1.739 2.476 2.931 1.717 2.517 1.644 1.787 0.955 0.932 Margalef (R) Note: AE1-agro-ecosystem in low elevation, LF-lowland forest, AE2-agro-ecosystem in high elevation, SOP-shrub old pine forest, SFsecondary forest, PF-primary forest, R-rainy season and D-dry season.

B I O D I V E R S IT A S

12 (1): 38-44, January 2011

lowland agro-ecosystem (D. melanostictus, Bronchocela jubata, C. platyurus, G. mutilata and E. multifasciata). Eight species were associated with lowland forest comprising two anurans (R. chalconota and L. kuhlii) and six lizards (G. chamaeleontinus, C. fumosus, Cyrtodactylus spA., H. frenatus, S. sanctus and S. temminckii). G. chamaeleontinus was restricted to lowland forest. Twelve species were encountered in shrub old pine forest consisted of six anurans (P. aspera, R. chalconota, R. hosii, L. kuhlii, P. aurifasciatus and R. margaritifer), and six lizards (Draco haematopogon, G. kuhlii, P. tympanistriga, C. fumosus, Cyrtodactylus sp.A and Cyrtodactylus sp.B). Four of them were found restrict to this habitat type (R. hosii, R. margaritifer, D. haematopogon and Cyrtodactylus sp.B). Nine species were recorded associated to secondary forest comprising two anurans (M. montana and P. aurifasciatus), six lizards (Bronchocela cristatella, G. kuhlii, P. tympanistriga, C. fumosus, Cyrtodactylus spA., and S. temminckii) and one snake (C. virgulata). Two of them were restrict to secondary forest (M. montana and C. virgulata). Four species were encountered associated to primary forest, comprising one anuran (P. aurifasciatus) and three lizards (G. kuhlii, P. tympanistriga and S. temminckii). Biological indices Calculations of biological indices presented in Table 1. During rainy season, the agro-ecosystem in low elevation demonstrated the highest value of richness index (R) which was 4.375 followed by agro-ecosystem in high elevation (R = 2.476), lowland forest (R=2.010), shrub old pine forest (R=1.717), secondary forest (R=1.644), and primary forest (R=0.955). Meanwhile in the dry season, the highest value of richness index was demonstrated by lowland agroecosystem (R= 4.030), followed by highland agroecosystem (R=2.931), shrub old pine forest (R= 2.517), secondary forest (R=1.787), lowland forest (R= 1.739), and primary forest (R= 0.932). These values showed that between rainy and dry season the distribution changes of the species was not much influenced on species richness. During rainy season in this study, the highest diversity was recorded in lowland agro-ecosystem (H’=2.804), agroecosystem in high elevation (H’= 2.252), lowland forest (H’= 1.870), secondary forest (H’= 1.608), shrub old pine forest (H’= 1.448), and primary forest (H’= 1.265). Meanwhile in the dry season, the agro-ecosystem in low elevation was demonstrated the highest diversity (H’= 2.653), followed by agro-ecosystem in high elevation (H’= 2.226), shrub old pine forest (H’= 1.984), secondary forest (H’= 1.778), lowland forest (H’= 1.680), and primary forest (H’= 1.118). Sequentially any difference of diversity between rainy and dry season, but in the value was not much different. For the homogeneities among habitat types based on species distribution during rainy season, the agroecosystem in high elevation was demonstrated highest homogeny (E= 0.906), followed by agro-ecosystem in low elevation (E= 0.882), lowland forest (E= 0.812), primary forest (E= 0.786), secondary forest (E= 0.732), and shrub old pine forest (E= 0.696). In dry season, the most

homogeny was demonstrated by agro-ecosystem in low elevation (E= 0.871), followed by agro-ecosystem in high elevation (E= 0.868), secondary forest (E= 0.809), lowland forest (E= 0.808), primary forest (E= 0.807), and shrub old pine forest (E= 0.798). Like as richness and diversity indices, the evenness index also showed same phenomena. Although change in sequential, the value of index was not much different in both of rainy and dry season. Community similarities and habitat utilization The cluster of the herpetofaunal community among habitat types based on Sorensen index presented in Figure 2. With respect to Sorensen’s coefficient at the point 60.00 that was shown a difference cluster between during dry and rainy seasons. During dry season the habitat types were pooled in five main groups with secondary and primary forest pooled in one group at point 62.00 meanwhile there was only consisted four main groups during rainy season with three habitat types (shrub old pine, secondary and primary forest) pooled in one group. The differences of clustering between dry and rainy seasons probably were caused by distribution changes of the herpetofauna as the response of climate difference in two seasons. The cluster of habitat utilization displayed in Figure 3. This cluster was also shown changes in habitat utilization between dry and rainy season, except for G. chamaeleontinus. This lizard is specialist low land forest.

Figure 2. Dendrogram of the similarity of herpetofaunal community among habitat types based on Sorensen coefficient during dry (A) and rainy (B) season. AE1-lowland agroecosystem, LF-lowland forest, AE2-highland agro-ecosystem, SOP-shrub old pine forest, SF-secondary forest, and PF-primary forest.

RIYANTO â&#x20AC;&#x201C; Herpetofauna in Gunung Ciremai National Park

Figure 3. Dendrogram of the similarities in habitat use among taxa based on Jaccardâ&#x20AC;&#x2122;s coefficient during dry season (A) and (B) during rainy season. AE1-lowland agro-ecosystem, LF-lowland forest, AE2-highland agro-ecosystem, SOP-shrub old pine forest, SF-secondary forest, PF-primary forest, R-rainy season and D-dry season.

B I O D I V E R S IT A S

12 (1): 38-44, January 2011

CONCLUSION A total of 46 amphibian and reptile taxa were recorded, comprising 16 anurans, 22 lizards and 8 snakes. Of the total taxa, four anurans are endemic and unusual specimens probably new in sciences referred to the genus Cyrtodactylus and Eutropis. This finding can be used as baseline data for further researches and manage on the fauna of the Gunung Ciremai National Park. There were differed in sequential of biological indices among habitat types but not much different in their values between rainy and dry seasons. It means all habitat types in Gunung Ciremai National Park are important for herpetofaunal life both in rainy and dry seasons. The distribution change of the herpetofauna is the consequence of the climate change between rainy and dry season. This distribution change was reflected in difference of cluster patterns of the community similarity among habitat types. It seems that in order considered the seasonal variation and to understand on herpetofauna distribution patterns as reflection of biological adaptations of thermal requirements, the study should be continued or done monitoring seasonally year to year.

ACKNOWLEDGEMENTS I thank to the Head of Gunung Ciremai National Park and staffs for the permit, facilities and supporting of this study. I also thank to Mulyadi and Wahyu Trilaksono (technician on Herpetology laboratory, MZB, CibinongBogor, West Java) and Arif Mulyanto (Faculty of Biology, Jenderal Soedirman University, Purwokerto, Central Java) for the assistance during field-work. The fieldwork was funded by Nagao Natural Environment Foundation, Japan.

REFERENCES Brongersma LD (1942) Notes on scincid lizards. Zool Meded 24 (1-2): 153-158. Das I (1997) Conservation problem of tropical Asiaâ&#x20AC;&#x2122;s most threatened turtle. In: Van Abbema J (ed.). Proceedings: Conservation, restoration, and management of tortoises and turtles. New York Turtle and Tortoise Society and WCS Turtle Recovery Program, New York. Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, de SĂĄ RO, Channing A, Wilkinson M, Donnellan SC, Raxworthy CJ,

Campbell LA, Blotto BL, Moler P, Drewes RC, Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006) The amphibian tree of life. Bull Am Mus Nat Hist 297: 1-370. Gillespie G, Howard S, Lockie D, Scroggie M, Boeadi (2005) Herpetofaunal richness and community structure of offshore islands of Sulawesi, Indonesia. Biotropica 37: 279-290. Howell K (2002) Amphibians and reptiles: the reptiles. In: Davies G, Hoffmann M (eds) African forest biodiversity: a field survey manual for vertebrates. Earthwatch Institute, London. Inger RF, Stuebing RB (1989) Frogs of Sabah. Sabah Park Publication No.10, Kota Kinabalu. Iskandar DT (1998) The amphibians of Java and Bali. Research and Development Centre for Biology -LIPI -GEF -Biodiversity Collection Project, Bogor. Iskandar DT (2004) The amphibians and reptiles of Malinau region, Bulungan research forest, East Kalimantan: annotated checklist with notes on ecological preferences of the species and local utilization. Center for International Forestry Research, Bogor. Iskandar DT, Colijn E (2000) Preliminary checklist of Southeast Asian and New Guinean herpetofauna. I. Amphibians. Treubia 31 (3): 1133. Iskandar DT, Colijn E (2001) A checklist of Southeast Asian and New Guinean reptiles Part I: Serpentes. The Gibbon Foundation, Jakarta. Ludwig JA, Reynolds JF (1988) Statistical ecology: a primer on methods and computing. John Willey and Sons, New York. Manthey U, Grossmann W (1997) Amphibien and reptilien Sudostasiens. Natur & Tier-Verlag, Berlin. Mausfeld P, Schmitz A, Bohme W, Misof B, Vricradic D, Rocha CFD (2002) Phylogenetic affinities of Mabouya atlantica Schmidt, 1945, endemic to the Atlantic ocean archipelago of Fernando de Noronha (Brazil): necessity of partitioning the genus Mabuya Fritzinger, 1826 (Scincidae: Lygosoma). Zoologischer Anzeiger 241: 281-293. Metcalfe JL (1989) Biological water quality assessment of running waters based on microinvertebrates communities: history and present status in Europe. Environ Poll 60: 101-139. Musters CJM (1983) Taxonomy of the genus Draco L. (Agamidae, Lacertilia, Reptilia). Zoologische Verhandelingen No. 199. EJ Brill, Leiden. de Rooij N (1915) The reptiles of the Indo-Australian archipelago I (Lacertilia, Chelonia, Emydosauria). EJ Brill, Leiden. de Rooij N (1917) The reptiles of the Indo-Australian archipelago II (Ophidia). EJ Brill, Leiden. Stuebing RB, Inger RF (1999) A field guide to the snakes of Borneo. Natural History Publication, Kota Kinabalu. Riyanto A (2008a) Herpetofaunal community in Gunung Ciremai National Park, West Java. J Biologi Indonesia 4 (5): 349-358 [Indonesia] Riyanto A (2008b) Herpetofauna diversity patterns along disturbance gradients in Gunung Ciremai National Park, West Java: implications for effective conservation. An annual report to Nagao Natural Environment Foundation, Japan. Riyanto A (2007) The amphibians and reptiles of Gunung Ciremai National Park. An annual report to Nagao Natural Environment Foundation, Japan. Rohlf FJ (2000) NTSYS-pc: Numerical taxonomy and multivariate analysis system, v. 2.1. Exeter Software, New York. Southwood TRE (1971) Ecological methods. Chapman and Hall, London. van Kampen PN (1923) The amphibians of the Indo-Australian archipelago. EJ Brill, Leiden.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011 Pages: 45-51

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120109

A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm SERAFINAH INDRIYANI1,2,♥, ENDANG ARISOESILANINGSIH2, TATIK WARDIYATI3, HERY PURNOBASUKI4 1

Post-graduate program, Study Program of Mathematics and Natural Sciences, Airlangga University (UNAIR), Surabaya 60115, East Java, Indonesia ² Biology Department, Faculty of Mathematics and Natural Sciences, Brawijaya University (UNIBRAW), Jl. Veteran, Malang 65145, East Java, Indonesia. Tel. & Fax.: +62-341-575841. e-mail: s.indriyani@ub.ac.id 3 Agronomy Department, Faculty of Agriculture, Brawijaya University (UNIBRAW), Malang 65145, East Java, Indonesia 4 Biology Department, Faculty of Science and Technology, Airlangga University (UNAIR), Surabaya 60115, East Java, Indonesia Manuscript received: 6 July 2010. Revision accepted: 27 July 2010.

ABSTRACT Indriyani S, Arisoesilaningsih E, Wardiyati T, Purnobasuki H (2011) A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm. Biodiversitas 12: 45-51. The abiotic environment as well as the biotic environment, involved climate and soil affect directly or indirectly to plant growth as well as plant substance. The objective of the research was to obtain a model of relationship between climate and soil factors related to oxalate content in porang corm. Porang corms were collected from five locations of porang agroforestry in East Java. The locations were (i) Klangon Village, Saradan Subdistrict, Madiun District; (ii) Klino Villlage, Sekar Subdistrict, Bojonegoro District; (iii) Bendoasri Village, Rejoso Subdistrict, Nganjuk District; (iv) Sugihwaras Village, Nggluyu Subdistrict, Nganjuk District and (v) Kalirejo Village, Kalipare Subdistrict, Malang District. Geography variable consist of altitude. Climate variables consist of percentage of radiation, temperature and rainfall. Soil variables consist of electrical conductivity, pH, soil specific gravity, soil organic matter, available of calcium, and cation exchange capacity (CEC). Vegetation variables consist of species of plant tree and percentage of coverage. Porang vegetative growth variables consist of plant height, number of bulbil, canopy diameter, and petiole diameter. Corm variables consist of corm diameter, corm weight, and corm specific gravity. Oxalate variables consist of total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal. Oxalate contents were measured based on AOAC method. All of variables were collected from first to fourth growth period of porang. Data were analyzed by smartPLS (Partial Least Square) software. The results showed that there were significantly direct effect between altitude and temperature, altitude and CEC of soil, temperature and CEC of soil, altitude and percentage of coverage, temperature and percentage of coverage, CEC of soil and percentage of coverage, CEC of soil and petiole diameter, petiole diameter and corm diameter, and petiole diameter and corm oxalate content. There were no significantly direct effect among altitude, temperature, percentage of coverage and petiole diameter; and among corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and corm diameter. The value of Goodness of Fit of the developing model was R²=0.99. Key words: corm, climate, model, oxalate, smartPLS, porang, soil.

INTRODUCTION Porang is a seasonal herb and perennial plant that produces corm, grouped in Araceae. Porang stem is erect, smooth, green color with pale spots. Actually, stem of porang is a petiole that known as false stem. Petiole is divided to three and then divided again to support leaves blade. At the junction between false stem and petiole is produced bulbil with dark brown color and it used as vegetative reproduction (Yuzammi 2000). The height of porang can reach 1.5 m depend on the fertile soil. Porang tolerant to shading, it need 40-60% light intensity. Appropriate shading plants for porang planting are Tectona grandis, Swietenia mahagoni, and Pterocarpus sp. Porang can grow until 700 m above sea level. Planting of porang need pH of soil 6-7. Porang corms consist of high fiber without cholesterol, and 20-65% glucomannan as a healthy food for diet (Jansen et al. 1996; Sulaeman 2004; Lase 2007).

Processing of porang corm produces noodle, tofu, rangginang, some Japanese food such as konyaku and shirataki, industrial material, etc. Porang corm produces glucomannan that can used as a waterproof material if it is mixed with sodium hydroxide; beside that it can utilized to purify water and floating colloid in beer, sugar, and oil industry. Pharmacy industries utilize glucomannan in porang corm for tablet glue and capsule coat. The product of porang corms are exported to Japan, Taiwan, Korea, and some countries in Europe. The economic value of porang corm is very high especially in Japan (Sulaeman 2004; Lase 2007). The cultivation of porang is conducted in some agroforestry in East Java. The plantation area consist of six KPH (Kesatuan Pemangkuan Hutan), there are (i) the area in KPH Jember is 121.3 ha, (ii) the area in KPH Nganjuk is 759.8 ha, (iii) the area in KPH Padangan is 3.9 ha, (iv) the area in KPH Saradan is 615.0 ha, (v) the area in KPH Bojonegoro is 35.3 ha, and (vi) the area in KPH Madiun is

B I O D I V E R S IT A S

12 (1): 45-51, January 2011

70.0 ha. In the early of porang plantation, it was developed in 1975 in KPH Blitar with 100 ha for cultivation, and in KPH Saradan in 1990 with 20 ha. Porang cultivation in KPH Nganjuk was done since 2003 by farmers in Sugihwaras Village (Lase 2007). Porang production in Bogor (rainfall > 3000 mm.year-1) higher than in Blitar or Blora, whereas the climate of each location based on Schmidth-Ferguson involved B and C (Afriyol 1993). The rainfall and climate type correlate with porang corm production. Production of porang corm depends on life cycle phase during 38-43 months. Sumarwoto (2005) explained scheduling of life cycle: time of seedling was 1.5-2 months, time of growth of seedling was 1.5-2 months, time of each of vegetative phase in year one to three was 5-6 months, time of each of dormancy in year one to three was 4 months, time of flowering to fruit maturing was 8-9 months. Flowering occurs in corm weight more than 500 g and minimally two times of life cycle or growth period. Then the plant growth predicted alternately between vegetative and generative phase. Monoculture cultivation in Bogor resulted the information that planting distance for first growth period was 37.5x37.5 cm²; second growth period was 57.5x57.5 cm²; and third growth period was 100x100 cm² (Sumarwoto 2005). Whereas, Jansen et al. (1996) reported that planting distance for Amorphophallus vary with the plant material used, e.g. seeds at 10 cm, bulbils at 35-70 cm, and tubers at 35-90 cm. Normally, tubers become larger at wider spacing, but tuber growth is also influenced by the size of planting material, water availability and soil fertility. Harvesting was done when corm age minimally reach second growth period with glucomannan 41.8%. Wider canopy diameter accompanied with higher corm glucomannan (Sumarwoto 2005). Although porang corm has multifunction for human being, as an Araceae plants, there are very high calcium oxalate in all plant organs. Oxalate in food causes unavailability of calcium in human body, and toxic to animal (Nakata 2003). In high content, oxalic acid affects mechanical aberration in digestive tract and smooth tubules in kidney. Chemically, oxalic acid absorbs calcium that important for nerve and muscle fiber function. In an extreme condition, absorption of calcium affects hypocalcaemia and paralysis (Brown 2000). Although many factors affect kidney problems, it is recommended to limit consumption of food that consists of high oxalate, especially for kidney stone risk people (Noonan and Savage 1999). Plants produce oxalate 3-80% from dry weight, 90% of total calcium found in oxalate salt involved calcium oxalate. Calcium oxalate crystals found in many kind of plant tissue, but the highest content of calcium oxalate found in specialized vacuoles named crystal idioblast. Oxalate in plant found as soluble (oxalic acid) such as potassium oxalate, sodium oxalate, and ammonium oxalate and insoluble as calcium oxalate (Holloway et al. 1989). Plants produce calcium oxalate crystal in various shape and size. Based on the shape, there are five categories of crystal, e.g. sand, raphide (needle), druse, stiloid, and prismatic (Nakata 2003). The types of calcium oxalate

crystal in Araceae are raphide and druse (Prychid and Rudall 1999; Prychid et al. 2008). Hagler and Herman (1973) reported that the formation of calcium oxalate via cleavage of respiratory carbohydrate or from protein metabolism. While, Franceschi and Nakata (2005) reported that the formation of calcium oxalate via glycolate, but others stated via L-ascorbic acid precursor. Actually, climate and soil influence plant growth and development, as well as plant substance. Research in this field, usually was conducted partially or univariately. In fact, in the environment, climate and soil influence directly or indirectly to plant growth as well as plant substance. The information of climate and soil factors related to oxalate content in porang corm that are analyzed simultaneously and multivariately in a model has not been intensively studied yet. Based on this argument, research was conducted using model simulation with smartPLS software to obtain a model of relationship between climate and soil factors related to corm oxalate content in porang.

MATERIALS AND METHODS Porang exploration was conducted on March to May 2009 in five agroforestries in East Java, Indonesia involved (i) Klangon Village, Saradan Subdistrict, Madiun District; (ii) Klino Village, Sekar Subdistrict, Bojonegoro District; (iii) Bendoasri Village, Rejoso Subdistrict, Nganjuk District; (iv) Sugihwaras Village, Ngluyu Subdistrict, Nganjuk District and (v) Kalirejo Village, Kalipare Subdistrict, Malang District. The number of total samples was 107 plants as many as soil samples. Geography variable consists of altitude (g1) was measured by Global Positioning System (GPS). Climate variables consist of percentage of radiation (i1) was measured by solarimeter, temperature (i2) was measured by thermometer, and rainfall (i3) was obtained from Meteorology, Climatology, and Geophysics Agency at Karangploso Malang. Soil variables consist of electrical conductivity (s1), pH (s2), soil specific gravity (s3), soil organic matter (s4), available of calcium (s5), and cation exchange capacity / CEC (s6). Soil electrical conductivity was measured by conductivitymeter, soil pH (H2O) was measured by pHmeter, soil specific gravity was measured by cylindrical method, soil organic matter was measured by volumetry, available of calcium was measured by EDTA titration, and CEC was measured by flame photometry. Soil variables were measured at Soil Department, Faculty of Agriculture, Brawijaya University. Vegetation variables consist of species of plant tree (v1) and percentage of coverage (v2). Porang vegetative growth variables consist of plant height (t1), number of bulbil (t2), canopy diameter (t3), and petiole diameter (t4). Corm variables consist of corm diameter (u1), corm weight (u2), and corm specific gravity (u3). Oxalate variables consist of total oxalate (o1), soluble oxalate (o2), insoluble oxalate (o3), and density of calcium oxalate crystal (o4). Oxalate contents were measured based on AOAC (1990) and calcium oxalate crystal density were counted based on Cao (2003). All of variables were collected from first to fourth growth period of porang. The

INDRIYANI et al. – Relationship between climate and soil to oxalate content of porang

determination of growth period of porang was referred to Sumarwoto (2005). Oxalate measurement was done at Biology and Chemistry Department, Faculty of Mathematics and Natural Sciences, Brawijaya University, Malang, East Java, Indonesia. The relationship between climate and soil factors that influence oxalate content of porang corm was simulated by smartPLS software (Ghozali 2008; Solimun and Fernandes 2008; Sarmanu et al. 2009). Pairing data were obtained from all variables that compelled in MS Excel table. Data were analyzed multivariately to examine a designed structural equation model with smartPLS software. Sequentially stage were: (i) Designing Structural Model (inner model), (ii) Designing Measuring Model (outer model), (iii) Constructing Path Diagram, (iv) Converting Path Diagram to Equation System, (v) Estimation: Path Coefficient, Loading, and Weight, (vi) Evaluation of Goodness of Fit, and (vii) Hypothesis Examination (Resampling Bootstrapping). Statistically examination with t-test α=5%. If p-value ≤ 0.05 means a real model. Real outer model shows that indicator is valid, real inner model shows the real effect of measurable variable. The examination of Goodness of Fit of structural model in inner model was measured by predictive-relevance (Q²) value as the follow formula: Q2 = 1-( 1-R12) ( 1-R22 ) ... ( 1- Rp2 )

R12, R22, … Rp2 were R-square value of endogen variable in model. The interpretation of Q² was equal with the total determination coefficient in path analysis (resemble with R² in regression).

RESULTS AND DISCUSSION Proposed model was very useful to explain the phenomenon of the relationship between abiotic and biotic factors that influence plant growth and plant substance. Figure 1 revealed a model (structural model) of relationship between climate and soil factors related to oxalate content in porang corm based on empirical study. The result of examination of Measurement Model Measurement model (outer weight) will be examined whether the weight of each formative indicator significantly composes the latent variables. Outer weight value reveals the weight of each indicator as measurement of each latent variable. The examination of signification of outer weight can revealed in p-value, if p-value < 5% or 0.05 the indicator significantly composes latent variables. The highest value of outer weight of indicator indicates that this indicator as a strong measurement of variable (dominant).

Figure 1. A model of relationship between climate and soil factors related to oxalate content in porang corm. Note: g1: altitude, i1: percentage of radiation, i2: temperature, i3: rainfall, s1: electrical conductivity, s2: pH, s3: soil specific gravity, s4: soil organic matter, s5: available of calcium, s6: cation exchange capacity (CEC), v1: species of plant tree, v2: percentage of coverage, t1: plant height, t2: number of bulbil, t3: canopy diameter, t4: petiole diameter, u1: corm diameter, u2: corm weight, u3: corm specific gravity, o1: total oxalate, o2: soluble oxalate, o3: insoluble oxalate, and o4: density of calcium oxalate crystal.

B I O D I V E R S IT A S

12 (1): 45-51, January 2011

Table 1. The result of the examination of indicators that compose latent variables Outer weight

Indicator Geography  Altitude (g1) Climate  Percentage of radiation (i1)  Temperature (i2)  Rainfall (i3) Soil  Electrical conductivity (s1)  pH (s2)  Soil specific gravity (s3)  Soil organic matter (s4)  Available of calcium (s5)  Cation exchange capacity (s6) Vegetation  Species of plant tree (v1)  Percentage of coverage (v2) Vegetative growth  Plant height (t1)  Number of bulbil (t2)  Canopy diameter (t3)  Petiole diameter (t4) Corm size  Corm diameter (u1)  Corm weight (u2)  Corm specific gravity (u3) Corm oxalate content  Total oxalate (o1)  Soluble oxalate (o2)  Insoluble oxalate (o3)  Density of calcium oxalate crystal (o4) Note: * = significant (p-value < 0.05)

Standard deviation

TStatistic

p-value

1 0.076 0.803 0.338

0.329 0.237 0.304

0.231 3.39 1.113

0.817 0.001* 0.266

-0.092 -0.049 0.226 0.143 -0.506 1.392

0.147 0.214 0.273 0.179 0.348 0.313

0.624 0.227 0.828 0.8 1.455 4.45

0.533 0.820 0.408 0.424 0.146 0.000*

0.48 0.774

0.346 0.416

1.388 1.86

0.165 0.063*

0.019 -0.091 -0.22 1.229

0.549 0.5 0.474 0.431

0.035 0.183 0.464 2.849

0.972 0.855 0.643 0.004*

1.018 0.033 0.094

0.215 0.233 0.112

4.73 0.14 0.842

0.000* 0.889 0.400

-6.342 6.504 2.126 0.742

2.035 2.074 0.801 0.2

3.116 3.136 2.654 3.703

0.002* 0.002* 0.008* 0.000*

Table 2. The result of repeat examination of indicators that compose latent variables Indicator Geography  Altitude (g1) Climate  Temperature (i2) Soil  Cation exchange capacity (s6) Vegetation  Percentage of coverage (v2) Vegetative growth  Petiole diameter (t4) Corm size  Corm diameter (u1) Corm oxalate content  Total oxalate (o1)  Soluble oxalate (o2)  Insoluble oxalate (o3)  Density of calcium oxalate crystal (o4) Note: * = significant (p-value < 0.05)

Outer weight

Standard Tdeviation Statistic

p-value

1 1

-6.125 6.274 2.09 0.771

2.218 2.352 0.535 0.099

2.761 2.668 3.904 7.825

0.006* 0.008* 0.000* 0.000*

Based on Table 1, it was recognized that there were two climate indicators, five soil indicators, one vegetation indicator, three vegetative growth indicators, and two corm size indicators were not significantly to compose each latent variables, so it was necessary to evaluate the early PLS model. Next, Table 2 revealed the result of measurement model without no significant indicators that compose latent variables. Based on Table 2, it was revealed that all of indicators significantly to compose latent variables. The examination of Goodness of Fit Model The examination of Goodness of Fit of structural model in inner model utilizes predictive-relevance value (Q²). R² value of each endogen variables in this research as follow: The meaning of table 3 was explained as follow: first column showed latent variables that used in this model; second column showed R² value of each variable, third column showed the value of one minus R², and the fourth column showed the multiplication of each row in the third column with the value of sequence previous row in fourth column. Counting of the values were: geography = 1 because only one indicator (altitude) that used in the model; climate = 0.157x1 = 0.1570; soil = 470x0.157 = 0.07379; vegetation = 0.572x0.07379 = 0.042208; vegetative growth = 0.572x0.042208 = 0.039296; corm size = 0.141x0.039296 = 0.005541; and corm oxalate content = 0.771x0.005541 = 0.004272. Beside that, the explanation of Table 3 is as follow: (i) R2 = 0.843 for climate variable. The meaning of the value, 84.3% climate was influenced by geography; (ii) R2 = 0.530 for soil variable. The meaning of the value, 53.0% soil was influenced by climate and geography; (iii) R2 = 0.428 for vegetation variable. The meaning of the value, 42.8% vegetation was influenced by geography, climate, and soil; (iv) R2 = 0.069 for vegetative growth variable. The meaning of the value, 6.90% porang vegetative growth was

INDRIYANI et al. – Relationship between climate and soil to oxalate content of porang

influenced by geography, climate, soil, and vegetation; (v) R2 = 0.859 for corm size variable. The meaning of the value, 85.9% corm size was influenced by vegetative growth; and (vi) R2 = 0.229 for corm oxalate content variable. The meaning of the value, 22.9% corm oxalate content was influenced by vegetative growth. The predictive-relevance value was obtained with the equation as follow:

information in the data 99% could be explained by this PLS model. The residue 1% was explained by other variables that not involved in the model yet. Table 3. The relationship between R² and Q² value for the examination of Goodness of Fit

Q2 = 1-( 1-R12) ( 1-R22 ) ... ( 1- Rp2 ) Q2 = 1-(1-0,843) (1-0,530) (1-0,428) (1-0,069) (1-0,859)(1-0,229) Q2 = 99,45% or 0,99 The result revealed that the predictive-relevance value Q2 was 99% or 0.99 and above 80%, so the model reasonable to possess a relevant predictive value. The predictive relevance value 99% indicated that the

Geography Climate Soil Vegetation Vegetative growth Corm size Corm oxalate content

Table 4. The result of direct effect examination Independent variables Geography Geography Climate Geography Climate Soil Geography Climate Soil Vegetation Growth Corm oxalate content Growth

Dependent variables Climate Soil Soil Vegetation Vegetation Vegetation Vegetative growth Vegetative growth Vegetative growth Vegetative growth Corm Size Corm Size Corm oxalate content

Inner weight -0.918 0.363 1.047 1.466 1.033 0.249 0.357 0.417 -0.306 -0.063 0.892 0.069 0.478

Tstatistics 63.864 2.299 7.807 9.1 4.625 2.206 1.241 1.331 2.304 0.543 31.979 1.555 7.089

pvalue 0.000 0.022 0.000 0.000 0.000 0.027 0.215 0.183 0.021 0.587 0.000 0.120 0.000

Note Significant Significant Significant Significant Significant Significant No significant No significant Significant No significant Significant No significant Significant

Figure 2. Path diagram of the result of the examination of direct effect hypothesis. Note: Dot line indicates indirect effect, straight line indicates direct effect

Multiplication of 1R1-(R- (R-square) with the square square) value of sequence previous row 1 0.843 0.157 0.157 0.530 0.470 0.07379 0.428 0.572 0.042208 0.069 0.931 0.039296 0.859 0.141 0.005541 0.229 0.771 0.004272

The result of examination of Inner Model Basically, the examination of inner model (structural model) is to examine the research hypothesis. The hypothesis examination was done through t-test of each path that influence directly and partially. The result of analysis completely involved in PLS analysis. Table 4 revealed the result of the examination of direct effect hypothesis. The paths of hypothesis examination were revealed as follow (Figure 2). Beside that, it was obtained the examination result of indirect effect. The coefficient of indirect effect was obtained from the multiplication result of two or more direct effect. If there were two or more direct effect that composes indirect effect significantly, so indirect effect also significant. The result of direct effect examination (Table 4) was explained as follow: (i) There was significantly direct effect (p-value 0.00 < 0.05) and negative (inner weight-0.918) between altitude and temperature. The meaning was higher altitude condition affects lower temperature condition; (ii) There was significantly direct effect (p-value 0.022 < 0.05) and positive (inner weight 0.363) between altitude and CEC of soil. The meaning was higher altitude condition affects higher CEC of soil condition; (iii) There was significantly direct effect (p-value 0.000 < 0.05) and positive (inner weight 1.047) between temperature and CEC of soil. The meaning was

B I O D I V E R S IT A S

12 (1): 45-51, January 2011

higher temperature condition affects higher CEC of soil condition; (iv) There was significantly direct effect (pvalue 0.000 < 0.05) and positive (inner weight 1.466) between altitude and percentage of coverage. The meaning was higher altitude condition affects higher percentage of coverage condition; (v) There was significantly direct effect (p-value 0.000 < 0.05) and positive (inner weight 1.033) between temperature and percentage of coverage. The meaning was higher temperature condition affects higher percentage of coverage condition; (vi) There was significantly direct effect (p-value 0.027 < 0.05) and positive (inner weight 0.249) between CEC of soil and percentage of coverage. The meaning was higher CEC of soil condition affects higher percentage of coverage condition; (vii) There was not significantly direct effect (pvalue 0.215 > 0.05) or there was indirect effect between altitude and petiole diameter condition; (viii) There was not significantly direct effect (p-value 0.183 > 0.05) or there was indirect effect between temperature and petiole diameter condition; (ix) There was significantly indirect effect between temperature and petiole diameter. The coefficient of indirect effect was 1.047x-0.306 =-0.320. The meaning was higher temperature condition affects lower petiole diameter condition if the condition of CEC of soil was lower too; (x) There was significantly direct effect (p-value 0.021 < 0.05) and negative (inner weight-0.306) between CEC of soil and petiole diameter. The meaning was higher CEC of soil condition affects lower petiole diameter condition; (xi) There was not significantly direct effect (p-value 0.587 > 0.05) or there was indirect effect between percentage of coverage and petiole diameter condition; (xii) There was significantly direct effect (pvalue 0.000 < 0.05) and positive (inner weight 0.892) between petiole diameter and corm diameter. The meaning was higher petiole diameter condition affects higher corm diameter condition; (xiii) There was not significantly direct effect (p-value 0.120 > 0.05) or there was indirect effect among corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and corm diameter condition; (xiv) There was significantly direct effect (p-value 0.000 < 0.05) and positive (inner weight 0.478) among petiole diameter and corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal condition. The meaning was higher petiole diameter condition affects higher corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal condition. Many scientific information explain the correlation between environmental factors and plant growth. The interaction between environmental factors and genetic factors will influence plant production (Sugito 1999). Environmental factors also affect plant growth as well as plant substance in this case plant oxalate content. Although oxalate is not a secondary metabolite compound, plant oxalate content is affected by environmental factors. Rahman et al. (2006) reported that oxalate content in napiergrass (Pennisetum purpureum Schumach) was significantly affected by the season with the highest value (3.77%) being associated with early summer samples and the lowest value (1.76%) with late autumn samples. Cao

(2003) reported that environmental factors such as rhizospheric nutrition concentrations and light intensity were affected calcium oxalate crystals in an ornamental plant Dieffenbachia. Both of these previous research results support the results. The altitude, temperature, and percentage of coverage were indirectly affected to petiole diameter. The CEC of soil was directly affected to petiole diameter. The petiole diameter was directly affected to corm oxalate content and corm size, while corm oxalate content was not directly affected to corm size. Based on plant physiology experts, oxalate synthesis in plant presumed via some precursors for example oxidation and dismutation of glyoxylate, cleavage of oxaloacetate, and cleavage of ascorbate (Libert and Franceschi 1987; Franceschi and Nakata 2005), while Hagler and Herman (1973) reported that the formation of calcium oxalate via cleavage of respiratory carbohydrate or from protein metabolism. Based on the results, oxalate synthesis in plant was not directly influenced by temperature and CEC of soil, but it was 89.2% directly influenced by petiole diameter. Whereas, petiole diameter was 30.6% directly influenced by CEC of soil, but negative value. The meaning was higher CEC of soil affects lower petiole diameter of porang. The petiole diameter was 47.8% directly affected to corm diameter; and 89.2% directly affected to corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal. The corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal were not directly affected to corm diameter. The information of the correlation between the environment and plant oxalate content also obtained from Singh (1974) who explained that vegetable plant Chenopodium album L. and C. amaranticolor L. which treated with light (climate), fertilizers and salinity (soil mineral) revealed that oxalic acid synthesized in leaves as a metabolite from both photosynthesis and nonphotosynthesis pathway. The meaning was light directly influenced to photosynthesis and indirectly influenced to oxalate synthesis. However, in this research revealed that light was not influenced to corm oxalate content but temperature indirectly influenced to petiole diameter. Therefore, temperature also indirectly influenced to porang corm oxalate content. The difference of this results presumed due to the former design and data analysis were analyzed partially or univariately. Some researchers reported that oxalate content different for any kind of plant species depend on age, physiology, environment, and genetic (Libert and Franceschi 1987). Palaniswamy et al. (2002, 2004) explained that oxalic acid was influenced by nitrogen (soil mineral) and the age of leaves in hydroponic vegetable plant Portulaca oleraceae L. Sumarwoto (2008) explained that P and K fertilizer (soil mineral) influenced corm size (diameter, thickness, and weight of corm) of Amorphophallus muelleri, but no information about corm oxalate content. Ambarwati and Murti (2001) reported that corm diameter and weight of Amorphophallus variabilis positively and significantly correlated with glucomannan and starch, and negatively correlated with corm oxalate content. However, the increasing of corm size was not

INDRIYANI et al. â&#x20AC;&#x201C; Relationship between climate and soil to oxalate content of porang

always followed by the decreasing of corm oxalate content and vice versa. This fact was appropriate with the report of Indriyani et al. (2010a,b) that mentioned there was difference of oxalate content based on corm size, but its correlation was not linear. Soil factors were seemly more dominantly affected corm oxalate content than climate factors.

CONCLUSION The result revealed that predictive-relevance Q2 value or the Goodness of Fit model R2 was 99.45%, so the model reasonable to possess a relevant predictive value. The developing model to determine the relationship between climate and soil factors related to oxalate content in porang corm revealed that temperature and CEC of soil possessed indirect effect to corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal. In this developing model only porang petiole diameter was influenced indirectly by altitude, temperature, percentage of coverage, and it was influenced directly by CEC of soil. Porang petiole diameter was influenced positively, directly and significantly to corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and corm diameter. The correlation among corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and corm diameter oxalate content was negative, but the increasing of corm diameter was not always followed by the decreasing of corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and vice versa. There was indirect effect between corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crysta and corm diameter.

ACKNOWLEDGEMENTS This research was supported by DP2M, Directorate General of High Education, Ministry of National Education through Post-graduate Program of Airlangga University through Doctorate Program Research Grant year 2009. We would like to thank to Rendra Aji Saputra and Evit Endriyeni for helpfully assistance at the laboratory.

REFERENCES Afriyol (1993) The observation of agroclimatology aspect of iles-iles plant Amorphophallus oncophyllus. [Final Task]. Department of Geophysics and Meteorology Faculty of Mathematics and Natural Sciences Bogor Agriculture Institute Bogor. [Indonesia]. Ambarwati E, Murti RH (2001) Correlation analysis and path coefficient of agronomy character to chemical composition of iles-iles (Amorphophallus variabilis) corm. Agric Sci 8 (2): 55-61. AOAC (1990) Official methods of analysis. Association of Official Analytical Chemist. Food composition; additives, natural contaminants. 15th ed. Edited by Helrich K. AOAC, Virginia. Brown D (2000) Aroids: plants of the arum family. 2nd ed. Timber Press, Portland. OR.

Cao H (2003) The distribution of calcium oxalate crystals in genus Dieffenbachia Schott, and the relationship between environmental factors and crystal quantity and quality. [M.Sc. Thesis]. University of Florida, Miami. FL. Franceschi VR, Nakata PA (2005) Calcium oxalate in plants: formation and function. Ann Rev Plant Biol 56: 41-71. Ghozali I (2008) Structural Equation Modeling: alternative method with Partial Least Square (PLS). 2nd ed. Diponegoro University, Semarang. Hagler L, Herman RH (1973) Oxalate metabolism. Comments in biochemistry. Edited by Herman RH. Amer J Clin Nutr 26: 758-765. Holloway WD, Argall ME, Jealous WT, Lee JA, Bradburry JH (1989) Organic acids and calcium oxalate in tropical root crops. J Agric Food Chem 37 (2): 337-341. Indriyani S, Arisoesilaningsih E, Wardiyati T, Purnobasuki H (2010a). The relationship of the environmental factors of porang (Amorphophallus muelleri Blume) habitat at five agroforestry in East Java related to corm oxalate content. Proceeding Book Volume 1. 7th Basic Science National Seminar. Faculty Mathematics and Natural Sciences. Brawijaya University. [Indonesia]. Indriyani S, Mastuti R, Roosdiana A (2010b) Oxalate content in porang (Amorphophallus muelleri Blume syn. A. oncophyllus Prain) corm. J Biol Res 4A: 99-102. Jansen PCM, van der Wilk C, Hetterscheid WLA (1996) Amorphophallus Blume ex Decaisne. In: Flach M Rumawas F (eds.). Plant Resources of South-East Asia 9: Plants yielding non-seed carbohydrates. Prosea Bogor. Lase E (2007). Cultivation of the jungle corm (porang). Koran Nias 3 September 2007. Libert B, Franceschi VR (1987) Oxalate in crop plants. J Agric Food Chem 35: 926-938. Nakata PA (2003) Advances in our understanding of calcium oxalate crystal formation and function in plants. Plant Sci 164: 901-909. Noonan SC, Savage GP (1999) Oxalic acid content of foods and its effect on human. Asia Pacific J Clin Nutr 8: 64-74. Palaniswamy UR, Bible BB, McAvoy RJ (2002) Effect of nitrate:ammonium nitrogen ratio on oxalate levels of purslane. In: Janick J, Whipkey A (eds.). Trends in new crops and new uses. ASHS Press. Alexandria, VA. Palaniswamy UR, Bible BB, McAvoy RJ (2004) Oxalic acid concentrations in purslane (Portulaca oleraceae L.) is altered by the stage of harvest and the nitrate to ammonium ratios in hydroponics Scientia Horticulture 102: 267-275. Prychid CJ, Rudall PJ (1999) Calcium oxalate crystals in monocotyledons: a review of their structure and systematics. Ann Bot 84: 725-739. Prychid CJ, Jabaily RS, Rudall PJ (2008) Cellular ultrastructure and crystal development in Amorphophallus (Araceae). Ann Bot 101: 983-995. Rahman MM, Niimi M, Ishii Y, Kawamura O (2006) Effects of season, variety and botanical fractions on oxalate content of napiergrass (Pennisetum purpureum Schumach). Grassland Sci 52 (4): 161-166. Sarmanu, Kuntoro, Widjanarko B, Wibowo A, Notobroto HB (2009) Training material: Structural Equation Modeling and Partial Least Square. Faculty of Animal Medice, Airlangga University, Surabaya. Singh PP (1974) Influence of light intensity, fertilizers and salinity on oxalate and mineral concentration of two vegetables (Chenopodium album L. and Chenopodium amaranthicolor L.). Qual Plant-PIF ds Hum Nutr 24: 115-125. Solimun, Fernandes AAR (2008) Structural equation modeling approach PLS and SEM: application of smartPLS and AMOS software. Laboratory of Statistics Faculty of Mathematics and Natural Sciences Brawijaya University Malang. Sugito Y (1999) Plant ecology. Faculty of Agriculture Publisher Brawijaya University Malang. Sulaeman AR (2004) Porang, make prosperous community and conserve Klangon jungle. Kompas, 19 January 2004. Sumarwoto (2005) Iles-iles (Amorphophallus muelleri Blume): Description and another characters. Biodiversitas 6(3) : 185-190. Sumarwoto (2008) Growth and yield of elephant food yam (Amorphophallus muelleri Blume) in first growth period on various P and K fertilizer dosage. Agrivita 30 (10): 67-74. Yuzammi (2000) A taxonomic revision of the terrestrial and aquatic Aroids (Araceae) in Java. [Master Thesis]. School of Biological Science, Faculty of Life Science, University of New South Wales, Sidney.

B I O D I V E R S IT A S Volume 12, Number 1, January 2011

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Pages: 52-58

DOI: 10.13057/biodiv/d120110

Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA) NURHENI WIJAYANTO♥ Department of Silviculture, Faculty of Forestry, Bogor Agricultural University (IPB), Bogor 16680, PO BOX 168-16001, West Java, Indonesia, Tel. +62251-8626806, Fax. +62-251-8626886, ♥email: nurheniw@gmail.com Manuscript received: 25 April 2010. Revision accepted: 23 June 2010.

ABSTRACT Wijayanto N (2011) Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA). Biodiversitas 12: 52-58. In order to improve land productivity surrounding the LTCA, the existing ITTO project tries to establish agroforestry system. The system will be designed to meet consideration of both sides. on one side is to generate the people awareness of the forest and land rehabilitation, and on the other side is to support the poverty reduction. The aims of this research are: species identification and selection to develop agroforestry at LTCA. Data collecting was carried out with: interview, group discussion, field observation, divining manual study, and PRA. The diversity of the available crop kind shows the number of choices to be developed by the farmer. The farmers generally have the economic objective to develop agroforestry, including increase in net income, risk reduction, increase in environmental service, and the wealth and savings accumulation. Various types of agricultural crops, plantations and forest trees were found in LTCA. They can be the basis for building a wide variety of agroforestry systems. Key words: catchment area, agroforestry system, sequential, integrated.

INTRODUCTION Forests are cleared mainly into agricultural land as a result of population growth, high dependability of population to agriculture sector, and low awareness of forest functions on the environment. This condition together with slash-and-burn cultivation practices that use inappropriate cultivation system caused negative impact on the environment, especially reducing land productivity. Cash crops are often presented as an alternative to slashand-burn agriculture, assuming that this practice is in crisis or doomed to fail in short term. These conditions lead into a poverty increase which affects many farmers and damage the natural resources (deforestation, watershed degradation, etc.) (Ducoirtieux et al. 2006). In order to improve land productivity surrounding the LTCA, the existing International Trade Timber Organization (ITTO) project tries to establish agroforestry system which combines the techniques for reforestation and land rehabilitation with agricultural cultivation. Agroforestry is able to mitigate environmental problems through several mechanisms. In turn, practitioners have seen these ecological benefits turn into economic benefits through the increase of agricultural output (Hildreth 2008). Agroforestry serves multiple functions. It is a source of livelihood and it provides environmental service that consists of watershed functions, biodiversity and climate change (Na’iem 2007). The system will be designed with the aims to generate the people awareness to the forest and land rehabilitation, and to support the poverty reduction. Doing agroforestry means caring and adopting the

traditional knowledge, as long as the traditional knowledge is not hampering the purpose of the program, which is to reduce the poverty. Hopefully, through agroforestry, land productivity surrounding the LTCA will be improved and income of community will be increased. Pattanayak et al. (2003) has reviewed 120 studies on on-farm tree growing (agroforestry adoption). This review revealed limited empirical attempts to study on-farm tree growing related to biophysical factors. The limited number of biophysical variables such as slope, soil quality and irrigation are included in a very few studies. They found that only 27% of the studies contained biophysical variables. Notwithstanding, these variables were important predictors in a majority of studies (64%) where they were included. Thus, they emphasized a need of comprehensive empirical studies on on-farm growing to incorporate biophysical factors. In most developing countries, rural communities practice agriculture. These communities are characterized by high socioeconomic inequalities. The aims of this research are: species identification and selection to develop agroforestry at LTCA.

MATERIALS AND METHODS The study was conducted from February until May 2008. Agroforestry field survey was carried out on several studies and production demo plots. The locations were Samosir, Simalungun, and Karo District of North Sumatra Province, Indonesia. Details of demo plots in each district were presented in Table 1.

WIJAYANTO â&#x20AC;&#x201C; Agroforestry at Lake Toba Catchment Area Table 1. Location of demo plot in each district District

Sub District

Village

Samosir

Sianjur Mula-mula

Simalungun

Girsang Sipangan Bolon

Sipangan Bolon

Karo

Merek

Sibolangit

Information and data analysis that was carried out were: (i) managing data: collecting data, completing and classifying it in accordance to concept or category, (ii) displaying data: organizing the result of data reduction that organized and displaying completely, and (iii) verifying data.

RESULTS AND DISCUSSION The primary data collected were soil type, climate, slope, local, and endemic species. The secondary data were land productivity, land use change history, growth of agricultural sector surrounding the LTCA, agricultural commodities, physical aspects surrounding the LTCA (soil, climate, and water), and prospective species on agroforestry of the LTCA. Data collecting was carried out with: (i) interview (semi structured household interviews), (ii) focus group discussion (farmers and local community members, official research and development institution, non government organizations, farmer organizations, artisans and traders, and private enterprise). (iii) field observation (checking and inventorying plants that grow around the demo plot candidate, surveys such as crops variety inventorying and land condition checking), and (iv) PRA (tools are: transects, seasonal calendars, matrices, participatory diagramming); respondents: farmers and local community members (Sianjur Mula-mula 50 respondents, Sipangan Bolon 13 respondents, and Sibolangit 10 respondents). Secondary data such as commodity products were collected from Indonesian Statistic Center of North Sumatra. The object of this research is the Sub District that entered study territory, and the candidate of agroforestry demo plot. The information about those locations was gathered from data of Central Bureau of Statistics (CBS) Simalungun District (2007a, 2007b), CBS Samosir District (2007a, 2007b), and CBS Karo District (2007a, 2007b).

Species diversity The species of crop data divided into agriculture, plantation and forestry commodity are shown in Table 2. Agricultural sector plays a strategic role in Simalungun District, where the contribution from this sector amounts to 54.77%, followed by industrial sector amounted to 18.86%, services 10.4%, commerce 8.44%, as well as other sectors. From these figures and in accordance with the potential and characteristics of the region, the agricultural sector becomes the main priority scale development in this area (CBS Simalungun District 2007a). Agriculture sector is one of Samosir District leading sectors which contribute about 48.16% of Gross District Income (CBS Samosir District 2007a). Karo District is known as an agricultural center in the North Sumatran Province. Agriculture sector gives the biggest contribution for Gross District Income, which is about 59.58% (CBS Karo District 2007a). The field observation results of demo plot site candidates villages are reported in Table 3. Based on the observation (at Sianjur Mula-mula Village), the results of the agriculture (crop) made by community are Allium cepa, Capsicum annuum, Zea mays, Oryza sativa, Coffea arabica, Persea americana, Gliricidia sepium (Jacq.) Walp., and Erythrina subumbrans (Hassk.) Merr.. The wanted plantation are combined with second crops, such as C. arabica, MPTs (D. zibethinus, P speciosa, Archidendron pauciflorum (Benth.) Nielsen., A. heterophyllus, and P. americana. The forestry trees planted are Toona sureni (Bl.) Merr. and Tectona grandis L.f.

Table 2. Agriculture, plantation and forestry commodity District

Commodity Agriculture (crops)

Plantation and Forestry (trees) Coffea arabica L., Cocos nucifera L., Eugenia aromatica O.K., Cinnamomum burmanii (C.G. & Th. Nees) Bl., Aleurites moluccana (L.) Wild., Arenga pinnata (Wurmb.) Merr., Areca catechu L., Vanilla mexicana Mill., Durio zibethinus Murr., Mangifera indica L., Artocarpus heterophyllus Lam., Persea americana Mill., and Citrus aurantium L.

Simalungun

Oryza sativa L., Zea mays L., Manihot esculenta Crantz., Ipomoea batatas (L.) L., Arachis hypogaea L., Glycine max (L.) Merr., Capsicum annuum L., Pisonia grandis R.Br., Allium cepa L. forma ascalonicum, Allium sativum L., Solanum aculeatissimum Jacq., Solanum melongena L., Lycopersicon esculentum Mill., Daucus carota L., Brassica rugosa Prain., Vigna unguiculata (L.) Walp., Cucumis sativus L., Ipomoea aquatica Forsk., Phaseolus vulgaris L., Musa paradisiaca L., Carica papaya L., and Ananas comosus (L.) Merr.

Samosir

O. sativa, Z. mays, M. esculenta, I. batatas, A. hypogaea, G. max, and Curcuma longa L.

C. arabica, C. nucifera, E. aromatica, A. moluccana, Vanilla mexicana Mill., A. pinnata, A. catechu, Theobroma cacao L., Myristica fragrans Houtt., and Anacardium occidentale L.

Karo

L. esculentum, P. grandis, S. aculeatissimum, A. cepa, A. sativum, C. annuum, P. vulgaris, and D. carota

C. arabica, C. nucifera, E. aromatica, A. moluccana, C. burmanii, and Parkia speciosa Hask.

Source: CBS Simalungun District (2007b); CBS Samosir District (2007b); CBS Karo District (2007b)

B I O D I V E R S IT A S

12 (1): 52-58, January 2011

Table 3. The field observation result of demo plot site candidates villages Demo plot site candidates villages and geographic position Sianjur Mula-mula Village 98,47o-98,67o LE and 2,54o-2,55oPN

Altitude, annual rainfall, and average Current vegetation, and soil types Problem temperature  900-2,100 m asl. with  Current vegetation: A. cepa, C. annuum, Z. mays, O.  There are many bare declivity between 0sativa, C. arabica, P. americana, G. sepium, Pinus lands with hill and >40 % or the average merkusii Jungh. & De Vr., and E. subumbrans undulate topography that gradient.  hapludults, dystropepts, humitropepts, troporthents are easy to burn.  1,400-6.000 mm/year (Ultisol, Inceptisol, and Entisol)  12˚-33˚C.

Sipangan Bolon Village 2.60˚-2.67˚ PN and 98.96˚-99,04˚ LE

 900-1.800 m asl. with  Current vegetation: C. Arabica, E. aromatica,  The rate of land 8-25% of slope or Bambusoideae spp., D. zibethinus, A. moluccana, P. degradation was quite with slightly and Americana, Psidium guajava L., P. merkusii, P. high which was seen steeply area. speciosa, A. heterophyllus, Sandoricum koetjape from domination of tall  1.500-4.000 mm/year (Burm.f.) Merr., grass  18˚-32˚C.  kecapi, M. indica, Macadamia hildebrandii Steenis, A. pinnata, C. Annum, Zingiber officinale Rosc., P. grandis, L. esculentum, Z. mays, and A. hypogaea  troporthents, dystropepts, humitropepts, hapludults, haplohumults, tropopsamments, and hapludox (Inceptisol, Entisol, Ultisol, and Oxisol)

Sibolangit Village 2.87˚-2.88˚ PN and 98.54˚-98.56˚ LE

 900-1,200 m asl. with  Current vegetation: M. indica, P. americana, A.  The large number of the slope between 8moluccana, G. sepium, E. deglupta, T. sureni, Melia critical land which was 25% that was slight azedarach L., Cassia siamea Lamk., Gmelina dominated by sedgeuntil medium slope. arborea Roxb., A. muricata, A. heterophyllus, grass on that area  The rainfall in this Syzygium aqueum (Burm.f.) Alston, A. pinnata, Z.  Marketing of agriculture territory revolved mays, C. arabica, A. cepa, T. cacao, A. catechu, D. yield that is still between 1,500-5.700 zibethinus, Solanum torvum Sw., P. speciosa, A. difficult, fire disaster, mm/the year Pauciflorum. and the mango trees that  17˚-32˚C.  tropudult (Ultisol) only have a few fruits.

Table 4. The Commodities that were really liked by the farmer

Agriculture (crops) C. annum, Z. mays, O. sativa, A. cepa

Commodity Plantation C. arabica, P. americana, D. zibethinus, P. speciosa, A. pauciflorum, A. Heterophyllus

Forestry (trees) G. sepium, P. merkusii, E. lithosperma, T. sureni and T. grandis

Sipangan Bolon Village

C. annum, Z. mays, L. esculentum, Z. officinale

C. arabica, T. cacao, P. americana, D. Zibethinus

T. sureni, S. macrophylla, and Podocarpus imbricata Bl.

Sibolangit Village

C. annum, Z. mays, M. esculenta, O. sativa, A. cepa, A. hypogaea

C. arabica, T. cacao, E. aromatic, M. Indica

E. deglupta, T. sureni, C. calothyrsus, A. mangium

Demo plot site candidates villages and located Sianjur Mula-mula Village

The available crops in the community's land consist of A. cepa, C. annum, A. hypogaea, Z. mays, M. esculenta, and O. sativa as the agricultural crop. The available plantation crops in Sibolangit Village are C. arabica, T. cacao, and E. aromatica clove. The forestry crop planted by the Sibolangit Village community are M. indica, A. moluccana, P. Americana, T. sureni, D. zibethinus, Gmelina arborea Roxb., P. guajava, A. Pinnata, A. muricata, A. catechu, S. torvum, P. speciosa, A. Pauciflorum, E. deglupta, A. heterophyllus, M. azedarach, G. sepium, and Cassia siamea Lamk. The commodities really liked by farmer are reported in Table 4. Based on results of the interview with participants (Sipangan Bolon Village) in the meeting and results of

stocktaking, it is known that available crops variety in demo plot land (the Sagala-resin Village), which serve as an agricultural crops, were C. annum, Z. officinale, P. grandis, L. esculentum, and Z. mays. The available plantation crops in the community's land are C. arabica and E. Aromaticum, whereas for the forestry crops were Bambusoideae spp., D. zibethinus, A. moluccana, P. americana, P. guajava, P. merkusii, P. speciosa, A. heterophyllus, S. koetjape, M. indica, M. hildebrandii, and A. pinnata. The community often does not know about the species of crops that can be planted, nor do they know how the production technique of seedling cultivation of the forestry crops (the tree) is. However, the most wanted second crop

WIJAYANTO â&#x20AC;&#x201C; Agroforestry at Lake Toba Catchment Area

species are the legumes, which are Z. mays, L. esculentum, Z. officinale, and C. annum. The most wanted species of the plantation crop are C. arabica, and T. cacao. P. americana is the most wanted species of MPTs followed by Solanum aculeatissimum Jacq. and D. zibethinus, whereas for the community's trees, the most wanted species is T. sureni in addition to Swietenia macrophylla King., and Podocarpus imbricata Bl.. Most of the group's members do not like P. merkusii because of consideration that it will drain the land. Then, the plantation crops really liked by the farmer (at Sibolangit Village) are C. arabica, P. americana, and T. cacao. The forestry crops that they want are Eucalyptus deglupta Blume, T. sureni, Calliandra calothyrsus Meissn., D. zibethinus, A. mangium Willd., and M. indica. Actually A. mangium kind was not yet known by them, but they are interested of planting the acacia after having been given the explanation that A. mangium could be planted as the pioneer of fast growing crop before the bare land is planted by C. arabica and T. cacao. In the determination of species, there are some interesting information: (i) participants in the meeting want not only T. sureni, but also the combination of various kinds of trees/crops, (ii) P. merkusii was not liked by the most because of belief in by the community that it will absorb water quite a lot, (iii) C. calothyrsus is known by the community as the fire barrier that grows faster than M. hildebrandii. Considering the condition of the villages as mentioned above, plant varieties which were appropriate to be planted in the demo plot are: (i) For Sianjur Mula-mula Village: C. arabica, P. americana, P. merkusii, and T. sureni; (ii) For Sipangan Bolon Village: S. macrophylla, M. tinctoria Roxb, T. sureni, C. calothyrsus, Jatropha curcas L., P. americana, C. arabica, T. cacao, and S. aculeatissimum; (iii) For Sibolangit Village: T. sureni, C. calothyrsus, E. deglupta, C. arabica, T. cacao, M. indica, Caesalpinia sappan L. and P. americana. Trees play a crucial part in almost all terrestrial ecosystems and provide a range of products and services to rural and urban people. As natural vegetation is cleared for agriculture and other types of development, the benefits provided by trees are the best sustained by integrating trees into agriculturally productive landscapes (Kuswanto 2007). The selection of agriculture plant species The choice of crop species was very important, because the mistakes that might be happened will have a long impact and will be very damaging. The species being selected should not only suitable with the specific site, but also have capacity to grow and develop ideally together with other crop species being planted on the same land. Factors which determine the success of agroforestry A key to successful mixed cropping is selection of species with complementary root system behavior patterns as well as complementary shoot growth habits (Huck 1983). Multispecies agro-ecosystems, with their potential for synergy in terms of below-ground interactions, can offer improved farmer livelihoods and sustainability and

basic ecosystem functions, at levels of complexity far below those of natural ecosystems (Van Noordwijk et al. 2004). Factors which should be considered for achieving success in agroforestry are among other things (Perum Perhutani 1993): (i) Environmental factors: species of plants, topography, soil fertility, climate, pest and diseases; (ii) Supporting factors: road condition, accessibility (distance), supporting facilities, capital support, and market prospect; (iii) socio-cultural factors: planting techniques, skill level, and types of needs. Patterns of agroforestry are determined by several factors, which are among other things: (i) interaction between components within the agroforestry system, (ii) determination of planting distance (spacing) of main crops, (iii) management treatment, and (iv) efforts to seek multifunction of land and sustainability of yield. Regulation of plant components (Nair 1993) can be conducted by among other things: (i) spatial regulation (dense mixture, sparse mixture, strip and boundary); (ii) temporal regulation (coinciding, in a row, overlapping, in sequence, interpolated). Imo (2009) showed that tree survival, growth and nutrient uptake, and maize growth and yield were higher in the deep soil site than the shallow site. The planting technology which is needed to make the existing land use systems be functional in increasing land productivity and supporting soil and water conservation functions, are among other things: development of terrace and the use of compost or organic fertilizer. Therefore, development of forage crops in a land unit, for terrace reinforcement, becomes a requirement which should be prioritized. In the study area, there is a great potential for development of compost or organic fertilizer. Development of this kind of fertilizer should be emphasized, due to consideration that at present, as indicated by interview results, the dependence of farmers on chemical fertilizer is very high. In long term, chemical fertilizer will have negative impact toward Lake Toba ecosystem. Calliandra plants are appropriate to be developed. The main objectives of calliandra plant developments are for terrace reinforcement and for honey bee culture. However, there is also other purpose of the bee culture, namely assisting the process of pollination of fruit crops (mango). According to information from the farmers, the mangga udang (a kind of mango) plants, at present become rare in producing fruit or sparse in the fruit production. Sequential system and succession system which are managed properly could become the main alternative in developing forest with the agroforestry system in Toba Lake area, because the system have the following potency: (i) efficient in light utilization, (ii) maintaining the nutrient availability, (iii) increasing soil organic matter, (iv) increasing productivity, (v) having more self-maintenance features, (vi) having relatively less pest and diseases, (vii) having relatively less competition from weeds. Requirements of plant species for agroforestry In conventional intercropping in agricultural tree crop plantations, certain criteria have been suggested for choosing suitable â&#x20AC;&#x2DC;subsidiaryâ&#x20AC;&#x2122; crops. Thus, Allen (1955) stated that the second or subsidiary crop grown under or

B I O D I V E R S IT A S

12 (1): 52-58, January 2011

between a tree crops should be tolerant of partial shade, and should not: (i) grow as tall as the main crop; its root system should exploit different soil horizons; (ii) be more susceptible than main crops to diseases they have in common; (iii) demand harvesting or other operations that would damage the main crop or induce soil erosion or damage soil structure; and (iv) have an economic life longer than that of the main crop. In addition to these, Hartley (1977) adds that: (i) the soil shall be suitable for both crops; (ii) the combine yield of the two crops shall be greater in monetary terms than that of the main crop when grown without the subsidiary crops; and (iii) if and when the subsidiary crops comes to the end of its bearing life, the yield of the main crop shall continue at an economic level unaffected by previous presence of subsidiary crop. Agroforestry can help prevent land degradation while allowing continuing use of land to produced crops and livestock on sustainable basis (Cacho 2005). Research Institutes of IPB (1986) reported plant species which are used for each form of agroforestry should fulfill the following requirements: (i) Ecological requirement: The plant species should (a) be suitable with the local condition where the agroforestry will be developed; (b) not create competition with food/forage or feed crops, either in the form of root competition or crown competition (for this purpose, species being selected are trees with light crown, and deep rooting; or there should be proper regulation of spacing of planting); (c) be able to increase and maintain soil fertility/soil productivity; (d) have slow regeneration and narrow radius of seed dispersal to prevent expansion toward food crops which are combined with the tree crops; (ii) Economic requirements: The plant species should (a) produce yield rapidly (in this case, fast growing species with high increment could be chosen) (b) have multiple benefits (such as in the form of carpentry wood, raw materials for pulp and paper, firewood, and others); (c) be easily marketed (the developed plant species should be integrated with other sectors); (d) be as far as possible produce intermediate yields (the obtained yield in the form of wood is obtained not only in the end of the rotation, but also during the whole period of the rotation, and for this purpose there could be efforts in the form of establishing multistoried tree stands which are combined with plantation of estate crops, feed/forage crops or food crops). Any choice of species (Huxley 1999) is conditioned by a combination of the farmerâ&#x20AC;&#x2122;s objectives and constrains, the biology of the species concerned, and the nature of the system in which it is be grown â&#x20AC;&#x201C; we have to get all of these right. Sometimes ascertaining the farmer needs thorough a consideration of the technical alternatives as it should. Assumptions about the benefits of agroforestry may, unwisely, be taken for granted. Keeping an open mind about the whole spectrum of possibilities is crucial. Also, of course, in optimizing land use it is essential that, after the social issues have been exposed and explored, all the technical alternatives are evaluated in economic terms. Agroforestry is one possible option to enhance the stability and productivity of agro-ecosystems (Kindt et al. 2006) and alleviate environmental stresses (Leakey and Jaenicke 1995). Especially, fruit-based agroforestry has a

real promise in alleviating poverty by contributing both products and important ecological services. For the many crop components and combinations possible, this system is highly adaptable and applicable to a wide area and range of physical and social conditions (Withrow-Robinson et al. 1999; Withrow-Robinson and Hibbs 2005). Fruit-based agroforestry can potentially be developed from indigenous fruits that are now mostly found in the wild as much as from exotic fruit sources. The contribution of indigenous fruits to poverty reduction and their vital role in the livelihoods of many communities is getting good recognition (Garrity 2004; Schreckenberg et al. 2006). In addition, as they are adapted to the local environment, indigenous fruits can grow easily with few requirements for external input and be integrated into sustainable farming systems. An evaluation of farmers' experiences planting native trees in rural Panama: implications for reforestation with native species in agricultural landscapes (Garen et al. 2009) reported all participants in the program considered their experience to be positive, few had problems with their plantations, and most were interested in planting more native trees. The program's frequent and ongoing technical support was an important factor for farmers. These results indicate widespread interest in, and success with, planting native species and underscore the need to systematically examine farmers' interests and perceptions when planning, implementing, and evaluating reforestation initiatives. Ecological and socio-economic sustainability is not just related to species diversity per se, but rather to more specific features such as presence of keystone species and diversity in functional species groups. Socio-economic sustainability in terms of adjustment to socio-economic change implies dynamics in species diversity (Abebe et al. 2010). How the plants utilize sun light? If light it is the main limiting environmental resource, then leaves become organs of aggression, and the dominant crop will be that which is tallest. One of the most potent ways of resource sharing is to plant crops so that they each become tallest in turn. Five ways of doing this spring to mind (Cannel 1983): (i) by planting crops together which attain similar heights but with different life cycles, (ii) by planting crops together which attain different heights such that the sorter ones mature before the taller ones, (iii) by planting crops at different time, (iv) by planting crops which can climb up the stalks of crops that mature before them, and (v) by minimizing the shade by the tall crops, by using erect-leaved crops (for example, maize), by pruning trees or by planting deciduous trees. . The findings of spatial arrangement, interview results and literature review, revealed the following things. . The villages around lake Toba has the following characteristics (i) The farmer made efforts to maintain diversity of the crops (ii) the farmer generally knows well the species of annual crops, estate crops, and forestry crops which they cultivated (iii) the farmer generally practices the land use system of agroforestry (iv) the women had important role in the land use system, (v) there were high dependence on

WIJAYANTO â&#x20AC;&#x201C; Agroforestry at Lake Toba Catchment Area

chemical fertilizer, (vi) the farmer generally knows crop species which have high economic value (vii) generally, the farmer did not really practice the proper conservation technique for soil and water (viii) Farm land in the villages seldom received the attention of agricultural extension workers (ix) organic fertilizers were still rarely used. The diversity of the existing crop species showed the number of choices to be developed by the farmer. The farmer generally has the aims of economic gain in developing agroforestry, such as risk reduction increase in net income, increase in environmental service and increase in wealth and savings. The villagers would only receive and developed agroforestry, when they felt that it was beneficial. Therefore, agroforestry was not only an art of mixing woody plants, fruit tree, annual crops, and animal in skill full manner, but agroforestry was also in the long run, an art to make life in rural areas more productive and interesting. "Interesting" in this sense was related with the ability of agroforestry to maintain good cultural values, to control the use of land, and to increase peopleâ&#x20AC;&#x2122;s income, as well as to reduce risk in farming works and to spread the use of labors in the farm. The concepts, strategies and policies associated with agroforestry are rapidly evolving towards the creation of sustainable land uses that enhance farmers' livelihoods, provide commodities for global markets and mitigate global concerns about environmental degradation. In parallel, the techniques for the domestication of indigenous trees for the agroforestry production of NTFPs also are evolving rapidly and should produce further benefits in terms of income generation for agricultural inputs and household welfare (Leakey and Tchoundjeu 2001). Moreover, the present study open vistas for using farmersâ&#x20AC;&#x2122; experience and knowledge of adoption of agroforestry to stimulate on-farm tree growing. The wider implication of the study is that biophysical as well as social variables should be considered together in designing suitable agroforestry systems in various parts of the world (Sood and Mitchell 2009). Modern agriculture and forestry, without and agroecological perspective, has gone a long way toward satisfying the demand for food, fiber, and other products. This has been accomplished in a world with rapidly expanding population and a less stable land area (Wojtkowski 2002). Wijayanto (2001) stated that management system for community based forest could be done through maintaining and implementing dynamic equilibrium condition, with implies that occurring growth in economy and business should be accompanied by ecological sustainability and socio-cultural stability. Agroforestry is one options directly linked to the double goal of providing a good income to farmers and maintaining the environmental services that all of society expects: no landslides that destroy houses, no flooding beyond what is to the expected when there are is heavy rain, no pollution of the water sources by over use fertilizers and pesticides as we find in vegetable production. Farmers interested planting trees in their farm depending on land ownership, economic value, market access, low labor requirements and availability of good

seedlings. Farmer choice on tree species differs among ethnic background and associated resource base (Hairiah 2006).

CONCLUSION Various types of agricultural crops, plantations and forest trees were found in LTCA. They have the potential to be developed in agroforestry systems. Based on the data and information being collected, as well as the available literature references, the combination of the crops species which were potential to be developed were among other things: (i) The agricultural crop: Z. mays, O. sativa, C. annuum, B. rugosa, L. esculentum, S. tuberosum, P. grandis, Phaseolus spp., A. cepa, C. papaya, M. paradisiaca, A. comosus, P. vulgaris, and M. esculenta; (ii) The plantation/estate crop: C. arabica, T. cacao, E. aromatica, C. aurantium, S. aculeatissimum, P. americana, J. curcas, M. indica, C. burmanii, P. speciosa, S. aqueum, A. occidentale, P. guajava, and E. lithosperma; (iii) The forestry tree species: T. sureni, S. macrophylla, P. merkusii, P. falcataria, G. arborea, C. calothyrsus, E. deglupta, M. hildebrandii, T. grandis, C. siamea, G. sepium, A. moluccana, P. imbricata, M. tinctoria Roxb., A. heterophyllus, C. sappan L. Development of integrated agriculture in the form of agroforestry system (livestocks, livestock feed, agriculture, plantation, forestry) are better to be prioritized, to create sustainable forest and prosperous community. Sequential system and succession system which are managed properly, should become the basis of plant selection and combination for development of agroforestry system to make the farmers happy and the forest sustainable.

REFERENCES Abebe T, Wiersum KF, Bongers F (2010) Spatial and temporal variation in crop diversity in agroforestry homegardens of Southern Ethiopia. Agrofor Sys 78: 309 Allen EF (1955) Cultivation other crops with rubber. Planters Bulletin 16. Rubber Research Institute of Malaysia, Kuala Lumpur Cacho O (2005) An analysis of externalities in agroforestry systems in the presence of land degradation. Ecol Econom 39: 131-143 Cannel MGR (1983) Plant management in agroforestry manipulation of trees, population densities and mixtures of trees and herbaceous crops. In: Huxley PA (ed.) Plant research and agroforestry. ICRAF, Nairobi CBS Karo District (2007b) Merek Sub-District in Figures 2007. Kabanjahe [Indonesia] CBS Karo District. (2007a) Karo District in Figures 2007. Kabanjahe [Indonesia] CBS Samosir District (2007a) Samosir District in Figures 2007. Pangururan [Indonesia] CBS Samosir District (2007a) Simanindo Sub-District in Figures 2007. Pangururan [Indonesia] CBS Simalungun District (2007a) Girsang Sipangan Bolon Sub-District in Figures 2007. Pematangsiantar [Indonesia] CBS Simalungun District (2007a) Simalungun District in Figures 2007. Pematangsiantar [Indonesia] Ducoirtieux O, Visonnavong P, Rossard J (2006) Introducing cash crops in shifting cultivation regions-the experience with cardamom in Laos. Agrofor Sys 66: 65-76 Garen EJ, Saltonstall K, Slusser JL, Mathias S (2009) An evaluation of farmers' experiences planting native trees in rural Panama:

B I O D I V E R S IT A S

12 (1): 52-58, January 2011

implications for reforestation with native species in agricultural landscapes. Agrofor Sys 76: 219 Garrity DP (2004) Agroforestry and the achievement of the millennium development goals. Agrofor Syst 61-62 (1-3): 5-17 Hairiah K (2006) Can agroforestry improve the livehood of smallholder farmers and environmental services on degraded soil? In: Sabarnurdin MS (ed.) The role of agroforestry education in revitalization of agriculture, fishery and forestry program; proceeding international seminar. Gadjah Mada University, SEANAFE, Department of Forestry, and Perum Perhutani. Yogyakarta, 7-8 February 2006 Hartley CWS (1977) The oil palm. 2nd ed. Longman, London Hildreth LA (2008) The economic impacts of agroforestry in the Northern Plains of China. Agrofor Syst 72: 119-126 Huck MG (1983) Root distribution, growth and activity with reference to agroforestry. In: Huxley PA (ed.) Plant research and agroforestry. ICRAF, Nairobi Huxley P (1999) Tropical agroforestry. Blackwell Science Ltd. London. Imo M (2009) Interactions amongst trees and crops in taungya systems of western Kenya. Agrofor Sys 76: 265 Kindt R, Van Damme P, Simons AJ (2006). Tree diversity in western Kenya: using diversity profiles to characterise richness and evenness. Biodiversity and Conservation 15: 1253-1270 Kuswanto KR (2007) Restructuring education in agriculture science. In: Sabarnurdin MS (ed.) The role of agroforestry education in revitalization of agriculture, fishery and forestry program; proceeding international seminar. Gadjah Mada University, SEANAFE, Department of Forestry, and Perum Perhutani Leakey RRB, Jaenicke H (1995) The domestication of indigenous fruit trees: opportunities and challenges for agroforestry. In: Suzuki K, Sakurai S, Ishii K, Norisada M (eds) Proceedings of 4th International BIO-REFOR Workshop. BIO-REFOR, 15-26. Tokyo, 7-11 October 2001 Leakey RRB, Tchoundjeu Z (2001) Diversification of tree crops: domestication of companion crops for poverty reduction and environmental service. Expl Agric 37: 279-296 Naâ&#x20AC;&#x2122;iem M (2007) Preface. In: Sabarnurdin MS (ed.) The role of agroforestry education in revitalization of agriculture, fishery and forestry program; proceeding international seminar. Gadjah Mada

University, SEANAFE, Department of Forestry, and Perum Perhutani. Yogyakarta, 7-8 February 2006 Nair PKR (1993) An introduction to agroforestry. Kluwer Academic Publishers in cooperation with ICRAF. Netherlands Pattanayak SK, Mercer DE, Sills E, Yang J (2003) Taking stock of agroforestry adoption studies. Agrofor Syst 57:173-186 Perum Perhutani (1993) Guidelines for agroforestry in the social forestry. Perum Perhutani, Jakarta [Indonesia] Research Institutes of IPB (1986) The draft plan of transmigration settlement pattern with its main business agroforestry. Cooperation between the Secretariat General of Transmigration Department with Research Institutes of IPB, Bogor [Indonesia] Schreckenberg K, Awono A, Degrande A, A., Mbosso, C., Ndoye, O. and Tchoundjeu, Z (2006) Domesticating indigenous fruit trees as a contribution to poverty reduction. Forests Trees Livelihoods 16: 3551 Sood KK, Mitchell ECP (2009) Identifying important biophysical and social determinants of on-farm tree growing in subsistence-based traditional agroforestry system. Agrofor Syst 75:175-187 van Noordwijk M, Cadisch G, Ong CK (2004) Challenges for the next decade of research on below-ground interactions in tropical agroecosystems: client-driven solutions at landscape scale. In: van Noordwijk M, Cadisch G, Ong CK (eds) Below-ground interactions in tropical agroecosystems: concepts and models with multiple plant components. CABI, New York Wijayanto N (2001) Dominant factors on management system for community based forest (Case study at Repong Damar, Pesisir Krui, Lampung. [Dissertation]. Bogor Agricultural University, Bogor [Indonesia] Withrow-Robinson B, Hibbs D, Gypmantasiri P, Thomas D (1999) Preliminary classification of fruit-based agroforestry in a highland area of northern Thailand. Agrofor Syst 42:195-205 Withrow-Robinson B, Hibbs D (2005) Testing an ecologically based classification tool on fruit-based agroforestry in northern Thailand. Agrofor Syst 65 (2): 123-135 Wojtkowski PA (2002) Agroecological perspectives in agronomy, forestry, and agroforestry. Science Publishers, Inc. Enfield (NH) USA, Plymouth, UK

GUIDANCE FOR AUTHORS BIODIVERSITAS, the Journal of Biological Diversity publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem. Scientific feedback (short communication) is only received for manuscript, which criticize published article before. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English (U.S. English) are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emission and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can only be addressed to the managing editor; better to forward to one of the communicating editor for accelerating evaluation. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached. Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah AsingIndonesia (2006). For DNA sequence, it is better used Courier New font. Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated. Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information. Abstract should not be more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only reexpress the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos

and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement. Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference. APA style in double space is used in the journal reference as follow: Journal: Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 38: 531-545.

Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158. Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds. Elsevier, Amsterdam. Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York. Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007. Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island. Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants productivity in agroforestry system based on sengon. [Dissertation]. Brawijaya University, Malang. [Indonesian] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited. Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0” (null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark. Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in about three months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondence in a certain period. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request. NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed multiplying article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email.

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GENETIC DIVERSTY

Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences CHARIS AMARANTINI, LANGKAH SEMBIRING, HARIPURNOMO KUSHADIWIJAYA, WIDYA ASMARA Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson AGUNG KURNIAWAN, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana HADIWIYONO, JAKA WIDADA, SITI SUBANDIYAH, MARK FEGAN

1-6

7-11

12-16

ECOSYSTEM DIVERSTY

Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem SRI WIDAWATI Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java NINA DWI YULIA, SUGENG BUDIHARTA Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi DEWI AYU LESTARI, WIDJI SANTOSO Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta EKO SETYOBUDI, SOEPARNO, SENNY HELMIATI Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia AWAL RIYANTO A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm SERAFINAH INDRIYANI, ENDANG ARISOESILANINGSIH, TATIK WARDIYATI, HERY PURNOBASUKI

17-21

22-27

28-33

34-37

38-44

45-51

ETHNOBIOLOGY (CULTURAL DIVERSITY)

Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA) NURHENI WIJAYANTO

52-58

Front cover: Eria flavescens (PHOTO: NINA DWI YULIA)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X (printed)

ISSN: 2085-4722 (electronic)