African Journal of Biotechnology - 3 April, 2012 Issue by Academic Journals

African Journal of

Biotechnology Volume 11 Number 27 ISSN 1684-5315

3 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewersâ&#x20AC;&#x2122; comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: ÂŠ 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents:

Volume 11

Number 27 3 April, 2012,

International Journal of Medicine and Medical Sciences ences ARTICLES

. Research Articles GENETICS AND MOLECULAR BIOLOGY

Genetic diversity and relationship analysis of the Brassica napus germplasm using simple sequence repeat (SSR) markers Cunmin Qu, Maen Hasan, Kun Lu, Liezhao Liu, Xiaolan Liu, Jingmei Xie, Min Wang, Junxing Lu,Nidal Odat, Rui Wang, Li Chen, Zhanglin Tang and Jiana Li

Development of bacterial cell-based system for intracellular antioxidant activity screening assay using green fluorescence protein (GFP) reporter Warawan Eiamphungporn, Supaluk Prachayasittikul, Chartchalerm Isarankura-Na-Ayudhya and Virapong Prachayasittikul

6923

6934

Construction of mammary gland specific expression plasmid pIN and its expression in vitro and in vivo Jian Lin, Qinghua Yu, Qiang Zhang and Qian Yang

6946

A quick DNA extraction protocol: Without liquid nitrogen in ambient temperature Jannatul Ferdous, M M Hanafi, Rafii M Y and Kharidah Muhammad

6956

Structure modeling and mutational analysis of gap junction beta 2 (GJB2) Samina Bilal, Hamid Rashid, Jabar Zaman Khan Khattak, Shehzad Ashraf Ch, Tahira Sultana and Asif Mir

6965

PLANT AND AGRICULTURAL TECHNOLOGY Sodium nitroprusside (SNP) alleviates the oxidative stress induced by NaHCO3 and protects chloroplast from damage in cucumber Zhongxi Gao, Yan Lin, Xiufeng Wang, Min Wei, Fengjuan Yang and Qinghua Shi

6974

Table of Contents:

Volume 11

Number 27 3 April, 2012

ences ARTICLES Phosphate uptake and growth characteristics of transgenic rice with phosphate transporter 1 (OsPT1) gene overexpression under high phosphate soils Woon-Ha Hwang, Soo-Kwon Park, Tackmin Kwon, Gihwan Yi, Min-Hee Nam, Song-Yi Song, Sang-Min Kim, Hang-Won Kang, Doh-Hoon Kim, Hoejeong Wang and Dong-Soo Park

Molecular cloning, structural analysis and expression of a zinc binding protein in cotton Ying-fan Cai, Xian-ke Yue, Yi Liu, Quan Sun, Xiaohong He and Huaizhong Jiang

6983

6991

PLANT AND AGRICULTURAL TECHNOLOGY Partial purification and characterization of polygalacturonase-inhibitor proteins from pearl millet S. Ashok Prabhu, K. Ramachandra Kini and H. Shekar Shetty

7000

Improving production of laccase from novel basidiomycete with response surface methodology Yonghui Zhang, Shujing Sun, Kaihui Hu and Xiaoyong Lin

7009

7016

FOOD TECHNOLOGY Effects of biofertilizers on grain yield and protein content of two soybean (Glycine max L.) cultivars Iraj Zarei, Yousef Sohrabi, Gholam Reza Heidari, Ali Jalilian and Khosro Mohammadi

7028

Table of Contents:

Volume 11

Number 27 3 April, 2012

ences ARTICLES APPLIED BIOCHEMISTRY Antioxidant activity of longan (Dimocarpus longan) barks and leaves Yuge Liu, Liqin Liu, Yiwei Mo, Changbin Wei, Lingling Lv and Ping Luo

7038

ENVIRONMENTAL BIOTECHNOLOGY Studies on antioxidant capacity of anthocyanin extract from purple sweet potato (Ipomoea batatas L.) Yuzhi Jiao, Yanjie Jiang, Weiwei Zhai and Zhendong Yang

7046

Study on the triphenyl tetrazolium chloride–dehydrogenase activity (TTC-DHA) method in determination of bioactivity for treating tomato paste wastewater Shiyang Sun, Zhiguo Guo, Ruili Yang, Zhigang Sheng and Peng Cao

7055

Isolation and characterization of nitrogen fixing bacteria from raw coir pith Abesh Reghuvaran, Kala K. Jacob and Anita Das Ravindranath

7063

APPLIED BIOCHEMISTRY Salt-induced osmotic stress for lipid overproduction in batch culture of Chlorella vulgaris Xu Duan, Guang Yue Ren, Li Li Liu and Wen Xue Zhu

Production and partial characterization of an exopolysaccharide from Ustilago maydis in submerged culture Cornejo-Mazón Maribel, Hernández-Sánchez Humberto, Gutiérrez-López Gustavo F, Dorantes-Alvarez Lidia, Cortés Sánchez Alejandro de Jesús, Jiménez-Aparicio Antonio, Gimeno-Seco Miguel, Moreno Abel, and Jaramillo- Flores María E.

Study of the effect of PAPA NONOate on the rate of diabetic wound healing Nasrin Dashti, Nahid Einollahi, Mohammad Ansari and Mitra Zarebavani

7072

7079

7088

Table of Contents:

Volume 11

Number 27

3 April, 2012

ences ARTICLES MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY L-Monomethyl-arginine decreases apoptosis of chondrocytes by altering Bax and Bcl-2 expression in osteoarthritis of rabbit knee Zong-bao Wang, Qing-you Lu, Zeng-chun Li, Zhao-hui Chen, Wei-ming Liao, Guang-zhi Kuang and Zhuo-peng Wu

7094

BIOTECHNIQUES Characterization of diploid and triploid Heterobranchus bidorsalis using morphometric, meristic and haematological parameters Ayeloja, A. A., Agbebi, O. T. and Jimoh, W. A.

7098

PHARMACEUTICAL SCIENCE Ultramicromorphological observation of Usnea longissima Ach. Yunzhe He, Hui Tang, Zhiguo Zhang

Salt effect on physiological, biochemical and anatomical structures of two Origanum majorana varieties (Tunisian and Canadian) Olfa Baâtour, Mouhiba Ben Nasri-Ayachi, Hela Mahmoudi, Imen Tarchoun, Nawel Nassri, Maha Zaghdoudi, Wissal abidi,Rym Kaddour, Sabah M’rah, Ghaith Hamdaoui, Brahim Marzouk and Mokhtar Lachaâl

Changes in some biochemical parameters of kidney functions of Plasmodium berghei infected rats administered with some doses of artemether R. O. Akomolafe, I. O. Adeoshun, J. B. Fakunle, E. O. Iwalewa, A. O. Ayoka, O. E. Ajayi, O. M. Odeleye and B.O. Akanji

7102

7109

7119

ENTOMOLOGY Some chemical properties of oil palm decanter meal M. Afdal, Azhar Kasim, A. R. Alimon and N. Abdullah

7128

Table of Contents:

Volume 11

Number 27

3 April, 2012

ences ARTICLES BIOTECHNIQUES Immune responses of pigs inoculated with a recombinant fowlpox virus coexpressing ORF2/ORF1 of PCV2 and P1 2A of FMDV Xiaobing Qin, Huijun Lu, Kuoshi Jin, Min Zheng, Mingyao Tian, Chang Li, Jinguo Niu, Ningyi Jin, and Hu Shan

7135

Full Length Research Paper

Genetic diversity and relationship analysis of the Brassica napus germplasm using simple sequence repeat (SSR) markers Cunmin Qu1, Maen Hasan2, Kun Lu1, Liezhao Liu1, Xiaolan Liu1, Jingmei Xie1, Min Wang1, Junxing Lu1,Nidal Odat3, Rui Wang1, Li Chen1, Zhanglin Tang1 and Jiana Li1* 1

Chongqing Engineering Research Center for Rapeseed, College of Agronomy and Biotechnology, Southwest University, 216 Tiansheng Road, Beibei, Chongqing 400716, People’s Republic of China. 2 Department of Plant Production and Protection, Al-Balqa’ Applied University, Al-Salt 19117, Jordan. 3 Department of Biology, Al-Hussein Bin Talal University, P. O. BOX 20, Máan, Jordan. Accepted 3 February, 2012

Oilseed rape (Brassica napus L.) is an important oilseed crop worldwide. The objective of this research was to study the genetic diversity and relationships of B. napus accessions using simple sequence repeat (SSR). A set of 217 genotypes was characterized using 37 SSR markers of mapping on the B. napus genome. The detected alleles were 2 to 11 at each of the 37 markers, with an average of 5.29 per marker. Unweighted pair group method with arithmetic mean (UPGMA) clustering enabled the identification of two general groups with increasing genetic diversity as follows: (1) group I was further divided into three groups (A, B and C), group A included 121 accessions, and consisted of the yellowseeded and black-seeded cultivars and breeding lines. The group B included 70 accessions and consisted mainly of the yellow-seeded cultivars and breeding lines, which were mostly cultivated in China. The group C included 10 accessions and consisted of the black-seeded cultivars and breeding lines with low levels of erucic acid. (2) Group II included 16 accessions consisted mainly of breeding lines and German cultivars, which were black-seeded lines with high levels of oleic acid (>80%) and low erucic acid and seed glucosinolate. The grouping of accessions by cluster analysis was generally consistent with known pedigrees, which included the grouping of lines derived both by backcrossing or self-pollination with their parents. The molecular genetic information gained enables also help breeders and geneticists to understand the structure of B. napus germplasm and to predict which combinations would produce the best off-spring which is potentially interesting with respect to increasing heterosis in oilseed rape hybrids. Key words: Brassica napus L., genetic diversity, microsatellites, SSR markers. INTRODUCTION Oilseed rape (Brassica napus, genome AACC, 2n = 38) is the most important source of edible vegetable oil in China and the second most important oilseed crop in the world after soybean. It originated in a limited geographic region through spontaneous hybridizations between turnip rape (Brassica rapa, AA, 2n = 20) and cabbage (Brassica oleracea, CC, 2n = 18) genotypes (Kimber and

*Corresponding author. E-mail: ljn1950@swu.edu.cn. Tel: +8623-68251950. Fax: +86-23-68251950.

McGregor, 1995). Like most agricultural crops, the first step in Brassica improvement is full assessment of the local materials, including collection, evaluation and molecular characterization of germplasm lines. Usually, local varieties of oil seed crops are of excellent quality and flavor also have a good level of resistance to pests and diseases and may be superior to exotic materials. So, the enhancement of genetically diverse gene pools is an essential requirement in plant breeding. However, the challenges that face modern plant breeders are to develop higher yielding, nutritious and environmentally friendly varieties that improve our quality

6924

Afr. J. Biotechnol.

of life without harnessing additional natural habitats to agricultural production (Zamir, 2001). Without a broad base of heterogeneous plant material, it is impossible for plant breeders to produce cultivars that meet the changing needs regarding adaptation to growing conditions, resistance to biotic and abiotic stresses, produce yield or specific quality requirements (Friedt et al., 2007). Therefore, the most efficient way to further improve the performance of crop varieties is to access to large diverse pool of genetic diversity. Moreover, information on the genetic diversity of B. napus germplasm collections can provide breeders and geneticists important information on the allelic diversity present in B. napus materials and may help to identify genetically diverse pools for use in cross combinations to improve important agronomic traits or to better exploit heterosis (Diers and Osborn, 1994). Traditionally, morphological, phenological and agronomical traits have been employed as criteria for the introgression of new variation into oilseed rape breeding lines. In comparison with other molecular marker techniques, simple-sequence repeat (SSR) markers are numerous, highly polymorphic and informative, codominant, technically simple, reproducible and relatively inexpensive when primer information is available. Furthermore, SSR markers often occur in gene-rich genome regions, increasing their potential relevance for allele-trait association studies in well-characterized genome regions containing quantitative trait loci. SSR markers have been widely used in diversity studies in maize, rice and tomatoes (Reif et al., 2006; Vigouroux et al., 2005; Warburton et al., 2005; Olsen et al., 2006; Caicedo et al., 2007; Bredemeijer et al., 2002 ). It has been proven that SSR markers are useful for genetic diversity and structure studies of Brassica. Fu and Gugel (2010) studied the genetic diversity of 300 plants by employing 22 SSR primer pairs from eight linkage groups, detecting 88 polymorphic loci. The genetic diversity in Australian canola cultivars were analysed by using 18 SSR primer pairs, which produced 112 polymorphic loci (Wang et a., 2009). By using 15 SSR markers with known locations on the Brassica A, B, and C genomes, Pradhan et al. (2011) assessed genetic diversity of 180 Brassica nigra (L.) Koch genotypes from 60 different accessions. Soengas et al. (2011) also established the genetic relationship among eight populations and studied the genetic structure by analyzing the polymorphic alleles of 18 SSR markers. The objectives of this study were to use a set of SSR markers to detect DNA polymorphism among cultivated B. napus accessions and the genetic diversity B. napus accessions appropriately. This will provide useful information for Brassica breeding program in the future. MATERIALS AND METHODS The plant materials for this study comprised 217 genotypes, which

were selected and used for rapeseed breeding lines or hybrid breeding. Most of the 217 accessions were selected by the Rapeseed Engineering Research Center of Southwest University in Chongqing or provided by different breeding institutes in China. Some of these have consistent pedigrees, which were derived both by backcrossing or self-pollination with their parents. The other was widely grown in German. The accessions investigated and their origins are listed in Table 1. Although they had a little range of morphological types and geographical origins, there were many hybrid rapeseed with higher yield and quality from these accessions and widely cultivated. All genotypes were grown in Beibei, Chongqing, China, in the growing seasons of 2009 and 2010. DNA extraction The plants of all accessions were cultivated for one month in the field. Leaves from 3 to 5 seedlings for each accession were pooled together for DNA isolation. Genomic DNA was extracted according to the protocol of Doyle and Doyle (1990) with some modifications. The concentration and purity of each DNA sample were measured using a GeneSpec I spectrophotometer at wave-lengths of 260 and 280 nm quantified by visual comparison to λ DNA standards on ethidium bromide-stained agarose gels. SSR assays We used 37 SSR markers that were selected genome wide primer combinations, and then analyzed the genetic diversity which were selected from the collection available in the public domain obtained from five sources: John Innes Centre, UK (http://www. brassica.bbsrc.ac.uk/BrassicaDB/); National Institute of Vegetable and Tea Science, Japan (http://vegetea.naro.affrc.go.jp); Agriculture and Agri-Food, Canada (http://brassica.agr.gc.ca/index_e.shtml), Plant Biotechnology Centre, La Trobe University, Australia (http://www.hornbill.cspp.latrobe.edu.au) and Brassica rapa Genome Project (http://www.brassica-rapa.org/BRGP/status.jsp); These were synthesized by Shanghai Sangon Biological Engineering Service Co. Ltd. (China) and listed in Table 2. Polymerase chain reactions (PCR) were performed in 96-well plates with a volume of 10 µL. The composition of the mixture was as follows: 20 ng/µL of DNA template, 0.5 pmol of each primer, 0.2 mM dNTP mix, 2.5 µL 10×PCR reaction buffer (with 15 mM MgCl2) and 0.5 U of Taq DNA polymerase (TransGen Biotech, China). PCR was carried out in PTC-100 and PTC-200 thermo cycler with the following program: 94°C for 5 min; 35 cycles with 94°C denaturation 45 s, annealing for 45 s, 72°C elongation for 1 min, elongation for 10 min (Table 2). All PCR products were detected using nondenaturing polyacrylamide gel electrophoresis (10% polyacrylamide) using DYCZ-30 electrophoresis cell and silver staining (Zhang et al., 2002). Analysis of genetic relationship The analysis of genetic diversity was based on discrete variables of binary data matrix that consist of the presence (1) and absence (0) of an allele per SSR locus for each accession. Additionally, we estimated genetic diversity (D) for each SSR locus using the formulas: Di =n (1−ΣPij2)/n−1, where n is the number of accessions analyzed, and Pij is the frequency of the jth allele for the ith locus across all alleles at loci. Average marker diversity (D) was estimated as D = ΣDi/r, where r was the number of loci analyzed. To detect the relationship between accession studied, we estimated the genetic similarity according to Jaccard’s coefficients from the alleles across all the loci in the 217 accessions using the formula: J = Nij/ (N−N00), where Nij was the number of shared alleles in both accessions i and j, N was the number of all alleles across all

Qu et al.

6925

Table 1. A list of tested oilseed lines and their pedigree. Number of field

Pedigree/source

Origin

[(GH01/Yuanza 1)/GH01]F2/02P208(F7)

SWU of CN

Number of field

Pedigree/source

Origin

L295

SWU of CN

L296

[(GH01/99A227)F6/(GH16/Chuanyou 18)F5]F5

SWU of CN

L297

H4 H5 H6

SWU of CN SWU of CN SWU of CN

L298 L299 L300

[(GH01/851)F6/(Ⅲ-227/Zhongshuang 1)F7]F5

SWU of CN

Number of field

Pedigree/source

Origin

L567

GH01/(Pin901871/Zhongshuang 1)

SWU of CN

L568

GH06

SWU of CN

SC94005/GH01

SWU of CN

L569

Zhongshuang 10

SWU of CN

GH01/Pin93－496 -

SWU of CN SWU of CN SWU of CN

L570 L583 L585

94005 R54-4 R71-1

SWU of CN SWU of CN SWU of CN

L301

SC94005/GH16

SWU of CN

L588

05E26-2

SWU of CN

L302

SWU of CN

L589

05E105-2

SWU of CN

{(GH01/851)F6/[(7018/Brassica oleracea)/(Zhongyou 821/D2)]F7}F6

SWU of CN

L303

(GH01/3529-5)F4/(Aisipeide/74-317)

SWU of CN

L590

05E105-3

SWU of CN

H10

SWU of CN

L304

Pin93-496/[GH01/ (Pin901871/Zhongshuang 1)]

SWU of CN

L591

05E159-1

SWU of CN

H11 H12 L01 L02 L03 L04 L05 L06

[Andor/(Altex/96V44)F8]F5 Yuhuang 2 GH01//(Pin901871/Zhongshuang 1) -

SWU of CN Dianjiang of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L305 L383 L384 L385 L386 L387 L388 L389

07H40-1 07H46-1 07H89-3 07R51-2 07R52-3 07R53-4

SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L592 L593 L594 L595 L83 L85 L86 L87

SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L07

SWU of CN

L390

07R54-4

SWU of CN

L08

SWU of CN

L391

07R55-5

SWU of CN

L09

SWU of CN

L392

07R56-2

SWU of CN

L10

GH01/3529-5

SWU of CN

L393

07R58-4

SWU of CN

05E159-2 05E258-1 Zhongshuang 9/06R6 (Aisipeide/74-317)/(821/Pin93496)F8 [(821/Pin93-496)F8/(821/97V27)F8] F5 [(821/Pin93-496)F8/(Altex/96V44)F8] F5 [(Altex/96V44)F8/Wanxian158]F5

L11

SWU of CN

L394

07R60-4

SWU of CN

P10

[{Yellow Brassica oleracea/ [194/ (Aisipeide /74317)]}F6/(GH01/GH03)F6] F5

SWU of CN SWU of CN SWU of CN SWU of CN

SWU of CN

6926

Afr. J. Biotechnol.

Table 1 Contd

L12

SWU of CN

L395

07R61-1

SWU of CN

P16

[(GH01/GH03)F6/{Yellow Brassica oleracea/ [194/(Aisipeide/74317)]}F6 ] F5

SWU of CN

L13

SWU of CN

L396

07R62-2

SWU of CN

P19

[(Aisipeide/74-317)/Pin93496]F6/Zhongshuang 9 F5

SWU of CN

L14

SWU of CN

L397

07R63-2

SWU of CN

P42

[Zhongshuang 9/(Youyan 2/Pin93496)F6]F5

SWU of CN

L15

[(D57/O)/85-64]/84-24016

SWU of CN

L398

07R64-4

SWU of CN

P30

[(Aisipeide/74-317)/Pin93496]F6/Zhongshuang 9] F5

SWU of CN

L16

SWU of CN

L399

07R64-3

SWU of CN

P40

{Zhongshuang 9/[(Aisipeide 317) /Pin93-496]F6} F5

L17

Ningyou 10

SWU of CN

L400

07R65-4

SWU of CN

P46

{Zhongshuang9/[{97V38/[(Siban/Bra ssica oleracea var italica)/Primor]/2328} /97V38] F1}F5

SWU of CN

L18 L19

GH01//(Pin901871/Zhongshuang 1) GH05/GH02

SWU of CN SWU of CN

L401 L402

R66-4 R67-2

SWU of CN SWU of CN

P56 P58

[Zhongshuang 9/96V44]F5

SWU of CN SWU of CN

L20

GH16/Mixed powder

SWU of CN

L403

R68-4

SWU of CN

P60

[(Pin901871/Zhongshuang 1)F10/964222S] F5

SWU of CN

L21

(GH16/SC94005)F3/SC94005

SWU of CN

L404

R68-3

SWU of CN

P61

[{[(D57/Oro)/85-64]/8424016}F6/96V44]F1/[(821/Pin93496)F7/Zhongshuang 9]F1

SWU of CN

L22

Pin93-496/[GH01/((Pin901871/Zhongshuang 1))]

SWU of CN

L405

R69-3

SWU of CN

P65

(94005/Mixed powder) F5

SWU of CN

L23

[(Aisipeide/74-317)/Pin93-496]F6/(GH01/99A227)

SWU of CN

L406

R69-4

SWU of CN

P70

[(Pin901871/Zhongshuang 1)F11/(94005/Mixed powder)F4] F5

SWU of CN

L24

[GH01/(Pin901871/Zhongshuang 1)]F6/(GH01/851)

SWU of CN

L407

SWU of CN

P72

Pin93-496

SWU of CN

L25

(GH01/99A227)F6/(GH01/851)

SWU of CN

L408

R70-1

SWU of CN

P73

Zhongshuang 220

SWU of CN

L26

[GH01/(Pin901871/Zhongshuang 1)]F6/(GH01/851)F6

SWU of CN

L409

SWU of CN

P74

Zhongshuang 1

SWU of CN

/74-

SWU of CN

Qu et al.

6927

Table 1 Contd L27

[GH01/(Pin901871/Zhongshuang 1)]F6/(GH01/99A227)F6

SWU of CN

L410

R71-1

SWU of CN

P75

Zhongshuang 4

SWU of CN

L28 L110 L111 L112 L113

Zhongshuang 9/06E25 -

SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L411 L412 L413 L414 L426

R72-2 R73-1 R73-4 R74-1 Westar

SWU of CN SWU of CN SWU of CN SWU of CN

P76 P77 P78 P79 P80

Zhongshuang 5 Zhongshuang 6 Zhongshuang 7 Zhongshuang 9 Zhongshuang 10

SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L114

Zhongshuang 9/06E47

SWU of CN

L427

[GH01/(Pin901871/Zhongshuang1)]F6 /(GH01/99A227)

SWU of CN

P81

Huashuang 4

SWU of CN

L115 L116 L117 L118 L198 L199 L200 L201 L212 L213 L214 L215 L216 L217 L218 L219 L220 L221 L285 L286 L287 L288 L289 L290 L291 L292 L293 L294

Zhongshuang 9/06E85 Zhongshuang 9/06E98 Express Campino Aragon Viking 04SH145/04P17(06M16) 04SH254/04P35(06M58) 04SH243/04P35(06M49) 04SH32/04P17(06M121) 04SH145/04P17(06M124) 04SH32/04P17(06M120) GH01/3529-5 GH01/851 GH16/SC94005 SC94005/GH16 -

SWU of CN SWU of CN SWU of CN SWU of CN Germany Germany Germany Germany SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

L428 L429 L430 L431 L432 L433 L434 L435 L436 L437 L438 L551 L552 L553 L554 L555 L556 L557 L558 L559 L560 L561 L562 L563 L564 L565 L566

06-634-4 Holliday Zhongshuang 9 Y511-7 Y511-11 Y520-5 Y520-11 Y539-1 Y539-3 Y539-4 GH01/851 GH01/3529-5 GH16/SC94005 SC94005/GH16 [(D57/O)/85-64]/84-24016 Zhongshuang 9/06E123 GH16/SC94005//K127 06P243/Zhongshuang 9 Zhongshuang 9 GH16/SC94005 -

SWU of CN

P82 P84 P85 P86 P87 P88 P89 P91 P92 P110 P122 P145 P205 P208 P217 P222 P226 W1 W2 W3 W406 W423 W434 W488 W514 W635 W7

Huashuang 5 Huyou 18 Zhongnongyou 136 94005 Youyan 2 851 Zheyou 6001 56602 Yang 6614 (96V44/Zhongshuang 9) F7 [(GH01/851)F6/Zhongshuang 9]F7 2007R343 P214-1 P219-1 P235-2 P237-2 P243-1

SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN SWU of CN

Negative sign (-) indicated the same to the last one; SWU: indicating the Southwest University; CN: indicating the China.

6928

Afr. J. Biotechnol.

Table 2. Allelic diversity at SSR loci amplified by primer used for the genetic diversity analysis.

SSR Primer

Forward sequence

Reverse sequence

sR12387 sNRA59 sR3688 Au39

5’-GGGTCTGGGTTTTTCTGTGA-3’ 5’-CAGATTCGGATTTGGGAAGA-3’ 5’-GGAGTCCACTTCATGGAGGA-3’ Unknown

5’-GATTGGGCCGTGTAATATCG-3’ 5’-GGCGGAAGAATCAAAGGAGT-3’ 5’-CTCTTGCTCGTAGGTTTCCG-3’ Unknown

Tm (°C) 55 55 55 56

Number of alleles detected 4 6 7 5

Polymorphic Loci detected 1 1 2 4

Polymorphic rate (%)

Reported

25.00 16.67 28.57 80.00

Cheng et al. (2009) Long et al. (2007) Choi et al. (2007) Long et al. (2007)

BRAS051

5’-GAATAGCCTCGCAGAAGTAGC-3’

5’-CGACGGCGATAAAACGAA-3’

85.71

Lowe et al. (2004); Piquemal et al. (2005); Choi et al. (2007); Cheng et al. (2009)

BRMS075

5’-GTTTCACATATTTTCTCTGTTTATT-3’

5’-ACCTTAAATGTTAAGTAAGCTAAAC-3’

66.67

Suwabe et al.(2008)

BRMS093

5’-TCCAAGTAGACCGAATCAAGAGAGT-3’

5’-ATAAATCGAACCTGAAACCATGTCT-3’

60.00

Suwabe et al. (2008); Cheng et al. (2009)

BRMS098

5’-TGCTTGAGACGCTGCCACTTTGTTC-3’

5’-CATTCCTCCCCACCACCTTCACATC-3’

57.14

Choi et al. (2007); Suwabe et al. (2008)

BRMS106

5’-ACCAAACGACGCAAACAAACAAATA-3’

5’-TGACTTCGGAACGTGCAATAGAGAT-3’

100.00

Choi et al. (2007); Cheng et al. (2009)

BRMS129 BRMS175 BRMS232 BRMS240

5’-TGAGGTTAGACATGGCGCTGCTTGC-3’ 5’-GTGATACTGAAAGGGAGAGAGTGAG-3’ 5’-AAAACAATACGACTGATTGAACCAT-3’ 5’-CAAGAGTATTTGTGTGGGTTGACTC-3’

5’-TTTGATCATTGTGGTCGCGAGTTCG-3’ 5’-AATCCTCATGAGCAAATCAACTAAC-3’ 5’-CAAATCATAGTCGAAACTAGCTAAAA-3’ 5’-AAATAACGAACGGAGAGAGAGAGAG-3’

55 55 55 55

6 7 4 4

3 2 4 4

50.00 28.57 100.00 100.00

Suwabe et al. (2006) Suwabe et al. (2008) Suwabe et al. (2008) Suwabe et al. (2006)

BRMS246

5’-ACATGTGCTTTATGAGAGAGAGAGA-3’

5’-TCTTTGTCACATTAATCCTTCCACT-3’

66.67

Choi et al. (2007); Cheng et al. (2009)

BRMS324

5’-AACTTAACCGAAACCGAGATAGGTG-3’

5’-AATCTCGAAATTCATCGACTTCCTC-3’

63.64

Suwabe et al.(2008)

CB10022

5’-AACAACCAAACATAGTCCC-3’

5’-GTTGACTTTGACCTTGACTT-3’

83.33

Piquemal et al. (2005); Long et al. (2007); Cheng et al. (2009)

CB10065

5’-CGGCAATAATGGACCACTGG-3’

5’-CGGCTTTCACGCAGACTTCG-3’

50.00

Piquemal et al. (2005); Long et al. (2007); Cheng et al. (2009)

Qu et al.

6929

Table 2. Cond.

CB10278

5’-TGAAGAAGCTGGGACAAG-3’

5’-CAATGCAATACAGCACCA-3’

25.00

CB10302 CN52 EJU5 ENA19 FITO 040 MR119 niab_ssr022 niab_ssr091 niab_ssr112 SA63 sN11722 sNRD03 sORF73 sR12777 sR7223 sR9222 sR94102 sR9447

5’-CGATACTTGGAGCGTGTC-3’ 5’-CCGGCTTGGTTCGATACTTA-3’ 5’-GGCACGTACATGGAGGATTC-3’ 5’-AAGTTACCAAGGAGAGGACAG-3’ 5’-GATTGTTTGTTTCTAACTGTGG-3’ 5’-GCTGAAACGCGTAGAGACTAA-3’ 5’-CTCTCGTCTCGGAGGATCTAAA-3’ 5’-TGGTTCTGCTATTGCTGTCA-3’ 5’-TCACGAGACTACCCTTGGAG-3’ 5’-AGCCGTGTAGCACCAGAACT-3’ 5’-CGATCTGAGCGTTGTTGCTA-3’ 5’-GAAGATTCGAGCTCTTTCGG-3’ 5’-CGTGGGCCAAGCTTAGATTA-3’ 5’-CAAGCAGTTTAAGGAACCGC-3’ 5’-AGGACCCGACTTTCCTTGTT-3’ 5’-CACCGAACAAAACTGAGGGT-3’ 5’-ATCCCCAAACTACCCTCACC-3’ 5’-AAATTCGAAAATGCAAACGG-3’

5’-CTGGTGTCTTAACCACGC-3’ 5’-TTGCGAATCTTTAAGGGACG-3’ 5’-TGTTGGTCGAGCTGTTTCAG-3’ 5’-AAAGGGACGCTACAAGTCA-3’ 5’-TAGGATGTGACTTGGTCTTTC-3’ 5’-GCTGGGAAATACGTTGAAA-3’ 5’-GTGAGAGTGGTTGCTGAGTGAG-3’ 5’-GAAGTTTGTGAGCCAGGAAA-3’ 5’-GCAACAGTGCTTTTCTTGGT-3’ 5’-CGTGTAGTGTGCGCATCTTT-3’ 5’-GCGCGACTCAAAGAAGAAGT-3’ 5’-CGTTTCAGAATCATATTGTATTTTGCT-3’ 5’-CGTTCAAGAAGACACAGATCAAA-3’ 5’-ATAATTGCATTTTGCTCCGC-3’ 5’-ACCAAACTCGGCGTACAAAT-3’ 5’-CGTTTCACTGCGTTCTACCA-3’ 5’-AGGATGAGCAAAGGAAAGCA-3’ 5’-CCAATCTTGGAACAATAGAAGATG-3’

55 56 56 56 55 55 60 60 60 56 55 55 55 55 55 55 55 55

3 4 8 4 3 6 6 2 6 7 5 5 10 5 7 6 2 7

1 3 7 1 3 5 6 1 4 4 1 3 5 4 3 3 1 3

33.33 75.00 87.50 25.00 100.00 83.33 100.00 50.00 66.67 57.14 20.00 60.00 50.00 80.00 42.86 50.00 50.00 42.86

Ol10-C05

5’-GGCTACAAAATGTTTGATAAGCTCT-3’

5’-ACCTGAAAGAGAGGCTACACAT-3’

66.67

Total accessions investigated, while the N00 was the number of alleles present neither in accession i nor in accession j. In addition, to investigate the relationship between accessions, a dendrogram based on similarity coefficients, was constructed with the unweighted pair-group method with arithmetic averages (UPGMA; Sneath and Sokal, 1973). The estimation of genetic diversity and the cluster analysis were performed using NTSYS-pc software package (Rohlf, 2005).

RESULTS Assessment of polymorphism by SSR markers in B. napus accessions The markers covered each of the linkage groups

196

according to previous research done in B. napus (Lowe et al., 2004; Piquemal et al., 2005; Choi et al., 2007; Long et al., 2007; Suwabe et al., 2006, 2008; Cheng et al., 2009). Among the 37 primers used in the present study, a total of 117 scorable polymorphic loci with 196 alleles were amplified in the 217 genotypes. The polymorphic loci gave unique genetic fingerprints for all 217 accessions. Eight primers yielded on average minimum number of bands (1.00), while primers BRMS324 and EJU5 yielded maximum (7.00) number of alleles per genotype on average (Table 2). The average number of alleles per loci was 5.29. Level of polymorphism rate were calculated and

Piquemal et al. (2005); Long et al. (2007) Piquemal et al. (2005) Long et al. (2007) Choi et al. (2007) Choi et al. (2007) Long et al. (2007) Long et al. (2007) Long et al. (2007) Cheng et al. (2009) Cheng et al. (2009) Long et al. (2007) Cheng et al. (2009) Cheng et al. (2009) Long et al. (2007) Cheng et al. (2009) Long et al. (2007) Long et al. (2007) Long et al. (2007) Long et al. (2007) Lowe et al. (2004); Cheng et al. (2009)

117

observed in this study, it was in the range of 16.67 to 100.00%. Genetic relationship of B. napus accessions Genetic similarities among accessions were estimated based on Jaccard’s similarity (1908). An UPGMA phenogram was constructed for all 217 accessions and the similarity coefficient ranged from 0.00 to 0.91. Then 217 accessions were classified into two groups at the similarity coefficient 0.04 (Figure 1). Group I included 201 accessions, group II included 16 accessions

6930

Afr. J. Biotechnol.

Figure 1. Phenogram showing Jaccardâ&#x20AC;&#x2122;s genetic similarity coefficients for a diverse set of 217 oilseed rape accessions revealed by UPGMA clustering based on genetic fingerprints calculated from 37 SSR primer combinations.

Qu et al.

6931

Figure 1 Contd

consisting mainly of breeding lines and German cultivars, which were black-seeded lines with high levels of oleic acid (>80%) and low erucic acid and seed glucosinolate. The grouping of accessions by cluster analysis was generally consistent with known pedigrees. Moreover, the group I was further divided into three groups with a genetic similarity coefficient of only around 0.18 (A, B and C). The first group A included 121 accessions and consisted of the yellow-seeded, black-seeded cultivars and breeding lines. The second group (B) included 70 accessions and consisted mainly of the yellow-seeded cultivars and breeding lines, which were mostly cultivated in China. The group C included 10 accessions and consisted of the black-seeded cultivars and breeding lines with low levels of erucic acid. The group A was also further divided into three subclusters. The first group I consisted of yellow-seeded

cultivars and breeding lines with the high or low levels of erucic acid, seed glucosinolate and arachidonic acid. The second group consisted of low levels of erucic acid with the yellow-seeded or black-seeded cultivars and breeding lines. The near-isogenic lines or the derivation of offspring of Zhongshuang No.9 were located on this region between the L394 and the P78 (Figure 1). The last group included the high levels of erucic acid, seed glucosinolate and arachidonic acid. In addition, the group B was further divided into two groups including the 38 and 32 accessions, which each showed a similarity index of around 0.24 to their respective cluster. The first group consisted mainly of the local cultivars and breeding lines with low levels of erucic acid and arachidonic acid derivation from the GH01. While the second group included 32 accessions with high levels of erucic and arachidonic acid.

6932

Afr. J. Biotechnol.

DISCUSSION In our study, the 37 SSR markers showed sufficiently high sensitivity to detect DNA polymorphisms among the 217 B. napus accessions. The results obtained in this study will also demonstrate that SSR markers can be suitable and efficient tool for genetic characterization of many plant species including oilseed rape (Hasan et al., 2006, Naito et al., 2008). The SSR markers information could provide a useful starting point for structure-based association analyses of phenotypic traits in this B. napus core collection and the theoretical basis for the hybriddization and selecting parents in oilseed breeding programs. Local materials, including collections, evaluation and molecular characterization of germplasm lines were also the mainly genetical resources of parental varieties to oilseed rape breeders. Some previous reports have also deeply researched Brassicaceae, such as the differences between the spring and the winter of oilseed, the China and Europe accessions (Hu et al., 2003, Hasan et al., 2006), significant yield increases in spring oilseed rape hybrids (Butruille et al., 1999; Cruz et al., 2007; Quijada et al., 2004; Udall et al., 2006) and genetic diversity of rapeseed cultivars and germplasm (Ahmad et al., 2011; Ana et al., 2011; Moghaddam et al., 2009). Moreover, knowledge about germplasm diversity and genetic relationship among local cultivars and the main breeding lines could be an invaluable aid in crop improvement strategies. In our study, the grouping of accessions by cluster analysis was generally consistent with known pedigrees. This consistency included the grouping of lines derived both by backcrossing or self-pollination with their parents. First, the most accessions were classified into group I, including both the higher or lower levels of erucic acid, seed glucosinolate and arachidonic acid of yellow-seeded and black-seeded cultivars and breeding lines or the local cultivars and the near-isogenic lines of Zhongshuang No. 9 and GH01. They have been developed from cultivars of diverse origins. Some lines are sister inbred lines developed from the same F2 population. Secondly, group II consists mostly of black-seeded lines with high levels of oleic acid (>80%) and low erucic acid and seed glucosinolate. The few materials in cluster II originated from Germany cultivars, such as L198, L199, L200 and L201 (Figure 1). The results obtained herein therefore indicate that SSR markers are effective and useful for analyzing the genetic diversity of B. napus genetic resources. Many other authors have also reached similar conclusions on the use of SSR markers in the breeding of rapeseed (Cruz et al., 2007; Li et al., 2011; Hasan et al., 2006; Tommasini et al., 2003). In addition, the findings of this preliminary study indicate that a set of microsatellite primers could be used for several important aspects of various breeding strategies, example organizing the germplasm of oilseed genetic resources, identification of cultivars, selecting appropriate parents for B. napus hybrids and for

monitoring hybridity level, and ultimately to assist the development of molecular markers for marker-assisted breeding. Genome-wide SSR marker data described in this work provides a useful starting point for structurebased association analyses of phenotypic traits in this B. napus core collection.

ACKNOWLEDGEMENTS We are grateful to Professor Jinling Meng for offering the primer sequences. This work was supported by the National High Technology Research and Development Programs of China (863program 2011AA10A104), the Key Program of Chongqing (CSTC, 2010AA1014), and the Science and Technology Innovation Fund of Southwest University (ky2009007).

Abbreviations: SSR, Simple-sequence repeat; UPGMA, unweighted pair group method with arithmetic mean; AFLP, amplified fragment length polymorphism; RAPD, random amplification polymorphic DNA.

REFERENCES Ahmad M, Khan MW, Abbas SJ, Swati ZA (2011). Characterization of Brassica napus Germplasm Based on Molecular Markers. Afr. J. Biotechnol. 10: 3035-3039. Ana MJ, Ankica KS, Dejana SP, Radovan M, Nikola H (2011). Phenotypic and molecular evaluation of genetic diversity of rapeseed (Brassica napus L.) genotypes. Afr. J. Biotechnol. 8(19): 4835-4844. Bredemeijer GMM, Cooke RJ, Ganal MW, Peeters R, Isaac P, Noordijk Y, Rendell S, Jackson J, Rรถder M, Wendehake K, Dijcks M, Amelaine M, Wickaert V, Bertrand L, Vosman B (2002). Construction and testing of a microsatellite database containing more than 500 tomato varieties. Theor. Appl. Genet. 105: 1019-1026. Butruille DV, Guries RP, Osborn TC (1999). Increasing yield of spring oilseed rape hybrids through introgression of winter germplasm. Crop Sci. 39: 1491-1496. Caicedo AS, Williamson RD, Hernandez A, Boyko A, Fledel-Alon A, York TL, Polato NR, Olsen KM, Nielsen R, McCouch SR, Bustamante CD, Purugganan MD (2007). Genome-wide patterns of nucleotide polymorphism in domesticated rice. PLoS Genet. 3: 1745-1756. Cheng XM, Xu JS, Xia S, Gu JX, Yang Y, Fu J, Qian XJ, Zhang SC, Wu JS, Liu KD (2009). Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. Theor. Appl. Genet. 118: 1121-1131. Choi SR, Teakle GR, Plaha P, Kim JH, Allender CJ, Beynon E, Piao ZY, Soengas P, Han TH, King GJ, Barker GC, Hand P, Lydiate DJ, Batley J, Edwards D, Koo DH, Bang JW, Park BS, Lim YP (2007). The reference genetic linkage map for the multinational Brassica rapa genome sequencing project. Theor. Appl. Genet. 115: 777-792. Cruz VMV, Luhman R, Marek LF, Rife CL, Shoemaker RC, Brummer EC, Gardner CAC (2007). Characterization of flowering time and SSR marker analysis of spring and winter type Brassica napus L. germplasm. Euphytica, 153: 43-57. Diers BW, Osborn TC (1994). Genetic diversity of oilseed Brassica napus germplasm based on restriction fragment length polymorphisms. Theor. Appl. Genet. 88: 662-668. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13-15.

Qu et al.

Friedt W, Snowdon R, Ordon F, Ahlemeyer J (2007). Plant Breeding: Assessment of Genetic Diversity in Crop Plants and its Exploitation in Breeding. In Progress in Botany, K. Esser, U. Löttge, W. Beyschlag, and J. Murata, eds (Springer Berlin Heidelberg), pp. 151-178. Fu YB, Gugel RK (2010). Genetic diversity of Canadian elite summer rape (Brassica napus L.) cultivars from the pre- to post-canola quality era. Can. J. Plant Sci. 90: 23-33. Hasan M, Seyis F, Badani AG, Pons-Kuhnemann J, Friedt W, Luhsand W, Snowdon RJ (2006). Analysis of genetic diversity in the Brassica napus L. gene pool using SSR markers. Genet. Resour. Crop. Evol. 53: 793-802. Hu S, J. Ovesná L, Kučera V, Kučera M, Vyvadilová (2003). Evaluation of genetic diversity of Brassica napus germplasm from China and Europe assessed by RAPD markers. Plant Soil Environ. 49: 106-113. Jaccard P (1908). Nouvelles recherches sur la distribution florale. Bull. Soc. Vaud. Sci. Nat. 44: 223-270. Kimber DS, McGregor DI (1995). The species and their origin, cultivation and world production. In: Kimber D, McGregor DI (eds.), Brassica Oilseeds: Production and Utilization. CABI Publishing, Wallingford, UK. pp. 1-9. Li L, Wanapu C, Huang X, Huang T, Li Q, Peng Y, Huang G (2011). Comparison of AFLP and SSR for Genetic Diversity Analysis of Brassica napus Hybrids. Agric. Sci. China, 3: 101-110. Long Y, Shi J, Qiu D, Li R, Zhang C, Wang J, Hou J, Zhao J, Shi L, Park B-S, Choi SR, Lim YP, Meng J (2007). Flowering time quantitative trait loci analysis of oilseed Brassica in multiple environments and genomewide alignment with Arabidopsis. Genetics, 177: 2433-2444. Lowe AJ, Moule CL, Trick M, Edwards KJ (2004). Efficient large-scale development of microsatellites for marker and mapping applications in Brassica crop species. Theor. Appl. Genet. 108:1103-1112. Moghaddam M, Mohammmadi SA, Mohebalipour N, Toorchi M, Aharizad S, Javidfar F (2009). Assessment of genetic diversity in rapeseed cultivars as revealed by RAPD and microsatellite markers. Afr. J. Biotechnol. 8: 3160-3167. Naito Y, Suzuki S, Iwata Y Kuboyama T (2008). Genetic diversity and relationship analysis of peanut germplasm using SSR markers. Breeding Sci. 58: 293-300. Olsen KM, Caicedo AL, Polato N. McClung A, McCouch S, Purugganan MD (2006). Selection under domestication: evidence for a sweep in the rice Waxy genomic region. Genetics, 173: 975-983. Piquemal J, Cinquin E, Couton F, Rondeau C, Seignoret E, Doucet I, Perret D, Villeger MJ, Vincourt P, Blanchard P (2005). Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet. 111: 1514-1523. Pradhan A, Nelson MN, Plummer JA, Cowling WA, Yan G (2011). Characterization of Brassica nigra collections using simple sequence repeat markers reveals distinct groups associated with geographical location, and frequent mislabeling of species identity. Genome, 54: 50-63. Quijada PA, Udall JA, Lambert B, Osborn TC (2006). Quantitative trait analysis of seed yield and other complex traits in hybrid spring rapeseed (Brassica napus L.): 1. Identification of genomic regions from winter germplasm. Theor. Appl. Genet. 113: 549-561. Quijada PA, Udall JA, Polewicz H, Vogelzang RD, Osborn TC (2004). Phenotypic effects of introgressing French winter germplasm into hybrid spring canola. Crop Sci. 44: 1982-1989. Reif JC, Warburton ML, Xia XC, Hoisington DA, Crossa J, Taba S, Muminovic J, Bohn M, Frisch M, Melchinger AE (2006). Grouping of accessions of Mexican races of maize revisited with SSR markers. Theor. Appl. Genet. 113: 177-185. Rohlf FJ (2005). NTSYS-pc: numerical taxonomy and multivariate analysis system, version 2.2. Exeter Software: Setauket, New York. Sneath PHA, Sokal RR (1973). Numerical taxonomy: the principles and practice of numerical classification. W.H. Freeman and Co., San Francisco, Calif. Soengas P, Cartea ME, Francisco M, Lema M, Velasco P (2011). Genetic structure and diversity of a collection of Brassica rapa subsp. rapa L. revealed by simple sequence repeat markers. J. Agric. Sci. 1: 1-8. Suwabe K, Tsukazaki H, Iketani H, Hatakeyama K, Kondo M, Fujimura M, Nunome T, Fukuoka H, HiraiM, Matsumoto S (2006). Simple sequence repeat based comparative genomics between Brassica

6933

rapa and Arabidopsis thaliana. the genetic origin of clubroot resistance. Genetics, 173: 309-319. Suwabe K, Morgan C, Bancroft L (2008). Integration of Brassica A genome genetic linkage map between Brassica napus and B. rapa. Genome, 51: 169-176. Tommasini L, Batley J, Arnold G, Cooke R, Donini P, Lee D, Law J, Lowe C, Moule C, Trick M (2003). The development of multiplex simple sequence repeat (SSR) markers to complement distinctness, uniformity and stability testing of rape (Brassica napus L.) varieties. Theor. Appl. Genet. 106: 1091-1101. Udall JA, Quijada PA, Lambert B, Osborn TC (2006). Identification of alleles from unadapted germplasm affecting seed yield and other quantitative traits in hybrid spring oilseed Brassica napus L. Theor. Appl. Genet. 113: 597-609. Vigouroux Y, Mitchell S, Matsuoka Y, Hamblin M, Kresovich S, Smith JSC, Jaqueth J, Smith OS, Doebley J (2005). An analysis of genetic diversity across the maize genome using microsatellites. Genetics 169: 1617-1630. Wang J, Kaur S, Cogan NOI, Dobrowolski MP, Salisbury PA, Burton WA, Baillie R, Hand M, Hopkins C, Forster JW, Smith KF, Spangenberg G (2009). Assessment of genetic diversity in Australian canola (Brassica napus L.) cultivars using SSR markers. Crop Pasture Sci. 60: 1193-1201. Warburton ML, Ribaut JM, Franco J, Crossa J, Dubreuil P, Betrán FJ (2005). Genetic characterization of 218 elite CIMMYT inbred maize lines using RFLP markers. Euphytica, 142: 97-106. Zamir D (2001). Improving plant breeding with exotic genetic libraries. Nat. Rev. Genet. 2: 983-989. Zhang J, Guo W, Zhang TZ (2002). Molecular linkage map of allotetraploid (Gossypium hirsutum L. × Gossypium× Gossypium barbadense L.) with a haploid population. Theor. Appl. Genet. 105: 1166-1174.

Full Length Research Paper

Development of bacterial cell-based system for intracellular antioxidant activity screening assay using green fluorescence protein (GFP) reporter Warawan Eiamphungporn1,2, Supaluk Prachayasittikul3, Chartchalerm Isarankura-NaAyudhya2 and Virapong Prachayasittikul2* 1

Center for Innovation Development and Technology Transfer, Faculty of Medical Technology, Mahidol University, Bangkok 10700, Thailand. 2 Department of Clinical Microbiology and Applied Technology, Faculty of Medical Technology, Mahidol University, 2 Prannok Rd., Bangkok-Noi, Bangkok 10700, Thailand. 3 Department of Chemistry, Faculty of Science, Srinakharinwirot University, Bangkok 10110, Thailand. Accepted 23 February, 2012

The novel bacterial cell-based assay was developed for evaluating the intracellular antioxidant activity. The genetically engineered Escherichia coli strains harboring the fusions of sodA::gfp and fumC::gfp were constructed and applied as reporters in response to cellular superoxide stress. Using this assay, twelve pure compounds and three Thai medicinal plants were investigated for intracellular antioxidant activity in comparison with conventional chemical-based assays; 2,2-diphenyl-1-picrylhydrazyl (DPPH) and superoxide dismutase (SOD) activity assays. Both strains demonstrated that quercetin and αtocopherol exhibited the most potent and significant antioxidant activity with more than 60% reduction of intracellular superoxide. These compounds also showed high DPPH radical scavenging activity. Interestingly, gallic, caffeic and protocatechuic acids had the most significant DPPH radical scavenging and SOD-like activities but with moderate to weak intracellular antioxidant activity. Our hypothesis was that the lower intracellular antioxidant activity possibly occurs due to poor permeability of compounds into biological membrane based on their structures. Moreover, our results demonstrated that intracellular antioxidant activity of three plant extracts well correlated to results from DPPH assay. Our bacterial-based assay is simple, reproducible, very specific and applicable as an alternative screening tool for assessing the activity of compounds and plant extracts affecting cellular oxidative stress. Key words: Bacterial cell-based assay, antioxidant activity, oxidative stress, superoxide dismutase, fumarase, green fluorescence protein (GFP) reporter, plant extracts. INTRODUCTION Reactive oxygen species (ROS) including superoxide radical (O.2-), hydroxyl radical (HO.), hydrogen peroxide (H2O2) and singlet oxygen (1O2) are produced as an unavoidable consequence of the aerobic lifestyle (Imlay, 2002). They can react with and damage many cellular components, such as carbohydrates, lipids, proteins and DNA. ROS can cause oxidative stress that implicates in

*Corresponding author. E-mail: mtvpr@mahidol.ac.th. Tel: +66 2 441 4376. Fax: +66 2 441 4380.

initiating, accompanying or causing pathogenesis of many diseases and aging (Keller et al., 1998; Halliwell and Gutteridge, 1999; Prasad et al., 1999; Pratico and Delanty, 2000; Lu and Finkel, 2008). In general, living cells possess the protective systems of antioxidants which counteract and prevent the deleterious effects of ROS. These systems include enzymes, such as superoxide dismutase (SOD), glutathione peroxidase (GPx) and catalase (CAT) and intracellular antioxidants, such as glutathione (GSH) and some vitamins (Ullmann et al., 2008). Various antioxidants have been derived from foodstuffs, such as fruits and vegetables. Recently,

Eiamphungporn et al.

interest has increased considerably in finding naturally occurring antioxidants for health promotion and disease prevention with high safety and consumer acceptability. Therefore, several approaches have been established to the evaluation of antioxidant activity in vitro and in vivo (Shahidi and Ho, 2007; Wolfe and Lui, 2007; Ma et al., 2011). In vitro assays based on chemical approaches, such as DPPH radical scavenging assay (Brand-Williams et al., 1995), ferric reducing/antioxidant power (FRAP) assay (Benzie and Strain, 1999) and Trolox equivalent antioxidant capacity (TEAC) assay (van den Berg et al., 1999) are attractive for their simplicity, convenience, reproducibility and cost-effective (Moreno-Sanchez, 2002). They are widely used to determine the capacity of an antioxidant in the reduction of antioxidant, which changes color when reduced. However, they present some disadvantages, such as pre-treatment of colored samples, correction for interfering substances and no biological relevance. Moreover, though they are great methods used for antioxidant evaluation, no approved and standardized method can alone provide an adequate measure, resulting from the complexity of antioxidant action and multiple-method approach for the estimation of antioxidant activity is recommended (Liu et al., 2012). The animal models and human studies are the best approaches to assess the effects of antioxidants in vivo. Nevertheless, they are expensive, time-consuming, not affordable and not suitable for initial antioxidant screening of foods and dietary supplements (Liu and Finley, 2005). Mammalian cell models have also been developed and used to examine the antioxidant activity in response to a need for more biologically representative methods than chemical-based assays (Takamatsu et al., 2003; Wolfe and Lui, 2007). These assays are relatively fast and costeffective as compared to animal models. However, these still require well-trained personnel or specialized technician for practice. Therefore, alternative biological methods are needed. Currently, cellular biosensors based on various recombinant bacteria containing reporters which are specifically induced via selected promoters are widely used in biomedical applications (Alksne et al., 2000; Hansen et al., 2001; Mitchell and Gu, 2004). Their advantages over the mammalian cell-based assays are that they are inexpensive, very easy to perform and have much shorter generation times as they can be detected within a period of hours. Park et al. (2010) demonstrated a bacterial cell-based methodology as a tool for screening antioxidant activity of natural chemical products. They suggested that this assay is more relevant to the effect of antioxidants at a cellular level than chemical-based assays, however, no results that compared between chemical-based and bacterialbased approaches was stated. The purpose of our study was to develop the bacterial-based antioxidant activity assay used to screen antioxidant substances for potential biological activity. Herein, two Escherichia coli biosensor strains that individually carried plasmid that fused sodA and fumC promoters with gfp gene were produced and

6935

then used to evaluate antioxidant activity of twelve pure compounds in comparison with two DPPH radical scavenging and SOD activity assays. Furthermore, three Thai traditional medicinal plant extracts were assessed in the biological antioxidant activity using this assay. Hydnophytum formicarum Jack. has been used for the treatment of hepatitis, rheumatism and diarrhea (Prachayasittikul et al., 2008). Spilanthes acmella Murr. has been used for the treatment of toothache, rheumatism and fever (Prachayasittikul et al., 2009). Eclipta prostrata Linn. has been used for the treatment of diverse symptoms, example hyperlipidemia, atherosclerosis and skin diseases (Prachayasittikul et al., 2010). In this study, the green fluorescent protein (GFP) was utilized as a reporter according to its advantages, such as high stability and no need for additional substrates or other cofactors (Cha et al., 1999). Moreover, it is a noninvasive reporter which allowing realtime monitored by continuous quantitative measurement of the GFP emission (Chalfie et al., 1994; Lu et al., 2004). In this way, we were able to evaluate both the chemical and the biological antioxidant activity of compounds and extracts, as well as compare these methods. MATERIALS AND METHODS Chemicals and reagents Paraquat or methyl viologen, resorcinol, 3-hydroxypyridine, 2,2diphenyl-1-picrylhydrazyl (DPPH), nitroblue tetrazolium (NBT), NADH disodium salt, phenazine methosulfate (PMS) and bovine erythrocyte superoxide dismutase (SOD) were purchased from Sigma-Aldrich (St Louis, MO, USA), hydrogen peroxide was purchased from Merck (Germany). Quercetin, α-tocopherol, caffeic acid, p-coumaric acid, 3-hydroxycinnamic acid, gallic acid, orotic acid and dimethyl sulfoxide (DMSO) were obtained from Fluka (USA). Vanillic acid and protocatechuic acid were obtained from Acros organics (Belgium). Salicylic acid was purchased from Unilab (Philippines). Luria-Bertani (LB) medium and agar were purchased from Difco Laboratories (Detroit, MI, USA). Ampicillin was purchased from Bio basic (Canada). All restriction enzymes were obtained from Fermentas (USA). PCR master mix solution and iTaqTM DNA polymerase were purchased from Intron biotechnology (South Korea). Chemical structures of all tested compounds used in this study are shown in Figure 1. All crude ethyl acetate extracts including that of S. acmella (Linn.) Murr., H. formicarum Jack. and E. prostrata Linn. were prepared as previously described (Prachayasittikul et al., 2008, 2009, 2010). Construction of E. coli reporter strains pGlow-TOPO (Invitrogen, Carlsbad, CA, USA) was used to construct a recombinant plasmid containing a native oxidative responsive promoter and gfp fusion. A total of four oxidative stress responsive promoters, sodA (manganese superoxide dismutase), fumC (fumarase C) from SoxRS regulon and katG (bifunctional catalase), ahpC (alkyl hydroperoxide reductase) from OxyR regulon were PCR amplified using E. coli TG1 genome as a template. The PCR primers were synthesized referring to the sequence of E. coli K-12 MG1655 obtained through Genbank. The amplified PCR products include the native start codon, ribosome binding site (RBS), and –35 and –10 regions plus other regulatory regions.

6936

Afr. J. Biotechnol.

Figure 1. Chemical structures of the tested compounds used in this study.

Sequences of PCR primers and the sizes of the amplified promoters are shown in Table 1. Expected products were confirmed by gel electrophoresis. Following amplification without purification, PCR products were mixed with pGlow-TOPO vector at room temperature for 5 min. The resulting recombinant plasmids were transformed into E. coli strain Top10. The positive colonies were screened by plating on LB agar plates containing 100 µg/ml ampicillin. The positive clones were extracted the plasmids and the insertions were proved by restriction enzyme digestion. The orientation of the promoter insert was confirmed by PCR using the forward primer of each promoter and downstream GFP primer (5′ GGG TAA GCT TTC CGT ATG TAG C 3′). The sequences of the fusions were verified by DNA sequencing. Determination of optimal culture conditions and intracellular antioxidant activity testing E. coli reporter strains containing the fusions of promoters and gfp were used to monitor the intracellular oxidative stress generation. The overnight cultures were grown aerobically in 250 ml flasks containing 50 ml of LB medium and 100 µg/ml ampicillin at 37°C with vigorous shaking (150 rpm) until the optical density at 600 nm (OD600) reached approximately 0.4 as measured by a UV-Visible

spectrophotometer (UV-1601, Shimadzu, Japan). Cultures were divided into 5 ml aliquots in 50 ml tubes (Fisher Scientific, Pittsburgh, PA, USA); then paraquat or hydrogen peroxide was added at various concentrations. For antioxidant activity testing, the tested compounds or plant extracts were added immediately at the desired concentrations after addition of inducers. Cultures were further incubated at 37°C with shaking (150 rpm). The raw fluorescence intensity and OD measurements were taken every hour using FLx800 microplate fluorescence reader (Bio-Tek instruments, VT, USA) at an excitation wavelength of 395 nm and emission of 509 nm and UV-Visible spectrophotometer at a wavelength of 600 nm until 8 h. For data analysis, raw fluorescence intensity (FL) and OD measurements of triplicate experiments were averaged and the standard errors of means were calculated. Specific fluorescence intensity (SFI) was calculated from the following equation; raw fluorescence intensity/OD600. Fold induction (FI) was calculated by the equation; SFIstress/SFIcontrol or SFItest/SFIcontrol where SFIstress represents the specific fluorescence intensity of the tubes with oxidants, SFItest represents the specific fluorescence intensity of the tubes with tested compounds plus oxidants and SFIcontrol represents the specific fluorescence intensity of the tubes without any oxidants. The percent relative fold induction (RFI) was calculated by the equation; (FItest/FIstress) × 100 where FItest represents the fold induction of tubes with tested

Eiamphungporn et al.

6937

Table 1. PCR primers used in this study.

Gene katG

Primer sequences (5′′ 3′′) Forward; GTG TGG CTT TTG TGA AAA TCA Reverse; TCA TCA ATG TGC TCC CCT CT

PCR product size (bp) 329

ahpC

Forward; GAG CTT AGA TCA GGT GAT TG Reverse; ACA TCT ATA CTT CCT CCG TG

309

sodA

Forward; GTA ATC GCG TTA CTC ATC TT Reverse; TCA TAT TCA TCT CCA GTA TT

305

fumC

Forward; CAC AAT GCA CCC GCT GTG TG Reverse; TCA TGA CCT GCT CCT CAC CTG

172

compounds plus oxidants and FIstress represents the fold induction of tubes with oxidants.

DPPH radical scavenging assay DPPH radical scavenging capacity was determined by the method as previously described (Prachayasittikul et al., 2009). The 2,2diphenyl-1-picrylhydrazyl (DPPH) was dissolved in 100% methanol to prepare 0.1 mM DPPH solution. The 1 ml of this solution was added to 0.5 ml, 3 mM of sample solution which dissolved in DMSO (final concentration of sample equals to 1 mM). After 30 min of incubation at room temperature, the absorbance of the reaction mixture was measured using UV-Visible spectrophotometer at 517 nm. The percentage of radical scavenging activity was calculated according to the equation: Radical scavenging activity (%) = [(Abs.control - Abs.sample) / Abs.control] × 100 Where, Abs.control is the absorbance of the control reaction and Abs.sample is the absorbance of the tested compound. SOD activity assay Superoxide dismutase (SOD) activity was measured using the method as described previously (Grey et al., 2009) with some modifications. In principle, this assay is based on the ability of SOD to inhibit NBT reduction by an aerobic mixture of NADH and PMS, which produces superoxide at non-acidic pH. The complete reaction system (1 ml total volume) consisted of 50 mM phosphate buffer, pH 7.4, 0.1 mM EDTA, 50 µM NBT, 78 µM NADH and 3.3 µM PMS (final concentrations). For the assay, 100 µL of sample or standard at various concentrations were added into cuvettes containing 900 µL of reaction mixture. The absorbance at 560 nm was monitored during 5 min as an index of NBT reduction using a UV-Visible spectrophotometer and SOD activity was calculated from the following equation: Enzyme inhibition (%) = [(Abs.control - Abs.sample) / Abs.control] × 100 Where, Abs.control is the absorbance of the control reaction and Abs.sample is the absorbance of the tested compound. Enzyme inhibition (%) was used for graph plotting and calculated for IC50 values.

RESULTS Effects of oxidative stress to promoters in E. coli reporter strains In this study, we successfully constructed the recombinant E. coli TOP10 reporter strains. A total of four oxidative stress promoters, sodA, fumC, katG and ahpC were fused individually to gfp located on pGlow-TOPO. To investigate the appropriate concentration and time that these promoters can be maximally induced, each reporter strain was grown to reach mid log phase, then exposed to various concentrations of either paraquat (0 to 1.0 mM), or hydrogen peroxide (0 to 2.0 mM), then the raw fluorescence intensity and OD600 were measured over a period of time. Since the cell density was different according to oxidant concentration, the specific fluorescence intensity was used instead of raw fluorescence intensity to normalize the data. The fold induction over the control was also calculated to eliminate the basal level of the promoter expression in the cells. The fold induction was plotted to demonstrate the net induction directly occurred from the applied stresses (Figure 2). The induction of these promoters appeared to be dosedependent particularly after longer exposure times. However, the highest fold induction of sodA promoter was observed when cells were treated with 0.2 and 0.3 mM of paraquat at approximately 240 min after induction (Figure 2A), while fumC promoter had the highest fold induction when cells were exposed to 0.7 and 0.8 mM of paraquat at about 360 min after induction (Figure 2B). According to these conditions, the fumC promoter was higher responsive than sodA promoter in which they were induced to 13-fold and 7-fold respectively. In addition, these promoters showed the similar patterns that their induction by hydrogen peroxide (< 2-fold) was much smaller than those of the paraquat effect (data not shown). The cultures harboring fusions of katG and ahpC promoters were also tested for their activity in response to various concentrations of hydrogen peroxide and paraquat. Interestingly, the induction caused by these stresses was

6938

Afr. J. Biotechnol.

Figure 2. Fold induction profiles of sodA::gfp (A) and fumC::gfp (B) towards paraquat. Cultures were grown until mid log phase, then, induced by paraquat (0 to 1.0 mM). The raw fluorescence intensity and OD600 were measured over a period of time. The experiments were performed in triplicates. Means Âą SD were calculated but graphs were plotted using only means.

smaller than 2-fold in all tested concentrations over a time period (data not shown). From the above mentioned

observations, the strains harboring the fusions of sodA and fumC promoters were chosen for antioxidant activity

Eiamphungporn et al.

6939

Figure 3. Determination of intracellular antioxidant activity using bacterial cell-based assay. Two E. coli reporter strains harbored the fusion of sodA::gfp (black bar) or fumC::gfp (light grey bar). Cells were treated with 0.2 mM paraquat or 0.7 mM paraquat, respectively. 1 mM of each tested compound was added immediately to the culture; quercetin (Que), α-tocopherol (Toc), caffeic acid (Caf), 3hydroxycinnamic acid (3-OHcin), gallic acid (Gal), orotic acid (Oro), protocatechuic acid (Protocat), vanillic acid (Van), p-coumaric acid (p-Cou), resorcinol (Res), 3-hydroxypyridine (3-OHpyr), salicylic acid (Sal) and paraquat (PQ) as a control. The raw fluorescence intensity and OD600 were measured at 240 and 360 min, respectively. Graph represented % relative fold induction of each compound. The experiments were performed in triplicates. Means ± SD were calculated and used for plotting graph with error bars.

testing using the optimal conditions whereby these two promoters had the highest induction of these two promoters was achieved. Determination of intracellular antioxidant activity of compounds using bacterial cell-based assay To investigate whether these genetically engineered bacterial strains can be applied to determine the antioxidant activity of putative compounds at cellular level, therefore, twelve flavonoids and phenolic compounds (Figure 1) previously reported as antioxidants were tested. Each compound was added to the cultures carrying two promoter fusions immediately after paraquat treatment to make the final concentration of compound of 1 mM, then, the raw fluorescence intensity and OD600 were measured to investigate a role of compound to reduce intracellular oxidative stress. Expectedly, both promoters showed similar patterns in response to all tested compounds although there were the different relative fold induction values between these promoters (Figure 3). The results

show that quercetin and α-tocopherol exerted the most significant intracellular antioxidant activity as they could reduce the paraquat generated superoxide stress > 60%. Moreover, the other compounds; caffeic acid, 3-hydroxycinnamic acid and gallic acid displayed significantly moderate intracellular antioxidant activity by reducing superoxide stress approximately 20 to 40%, while the rest of the compounds; orotic acid, protocatechuic acid, vanillic acid, p-coumaric acid, resorcinol, 3-hydroxypyridine and salicylic acid possessed weak intracellular antioxidant activity with < 20% reducing superoxide stress when they were investigated by sodA promoter or no obvious intracellular antioxidant activity when they were determined by fumC promoter (Figure 3). By comparing the percent relative fold induction of two promoters, we could observe that after adding various compounds, the decreased induction of sodA promoter by paraquat was detected as compared to the induction of fumC promoter. As shown in Figure 3, some compounds increased the relative fold induction when evaluating by fumC promoter.

6940

Afr. J. Biotechnol.

Figure 4. Evaluation of percent radical scavenging activity using DPPH assay. 1 mM of each tested compound was added to the 0.1 mM DPPH-methanol solution to evaluate the DPPH free radical-scavenging capacity; quercetin (Que), α-tocopherol (Toc), caffeic acid (Caf), 3-hydroxycinnamic acid (3-OHcin), gallic acid (Gal), orotic acid (Oro), protocatechuic acid (Protocat), vanillic acid (Van), p-coumaric acid (p-Cou), resorcinol (Res), 3-hydroxypyridine (3-OHpyr) and salicylic acid (Sal). The assays were measured in triplicates. Means ± SD were calculated and used for plotting graph with error bars.

Comparison of antioxidant activity determined by bacterial cell-based, DPPH and SOD activity assays All compounds were also tested for their antioxidant activity using DPPH radical scavenging activity and SOD activity assays to determine whether there are correlations between our cell-based and such conventional chemical-based antioxidant assays. The DPPH radical scavenging activity (%) and IC50 values for SOD-like activity of all tested compounds are shown in Figure 4 and Table 2, respectively. A roughly similar pattern among three methods was observed with some exception. In agreement with the bacterial cell-based assay, quercetin exhibited very strong DPPH radical scavenging activity (> 85%) and high SOD like activity (IC50 < 5 µg/ml), whereas vanillic acid, resorcinol, p-coumaric acid, orotic acid, salicylic acid, 3-hydroxycinnamic acid and 3hydroxypyridine showed weak DPPH radical scavenging activity (< 25%) and low SOD -like activity. Remarkably, there were some significant differences among these methods: α-tocopherol had no SOD –like activity,

However, it showed very strong DPPH radical scavenging activity (> 85%) and high intracellular antioxidant activity (> 60%). Although, gallic acid and caffeic acid showed the strongest radical scavenging activity (~ 94%) as well as highest SOD-like activity (IC50 = 0.52 and 1.92 µg/ml), they revealed moderate intracellular antioxidant activity (20 to 40%). Moreover, protocatechuic acid demonstrated very strong DPPH radical scavenging activity (> 85%) and high SOD-like activity (IC50 < 5 µg/ml), but it showed weak intracellular antioxidant activity (< 20%). Although, the results of two chemical-based methods showed good correlations, no absolute correlation was observed among these results derived by three different methods. Determination of intracellular antioxidant activity of plant extracts using bacterial cell-based assay Recently, several biologically relevant assays using some enzymes or molecules or cells have been developed for antioxidant activity measurement to screen the potent

Eiamphungporn et al.

6941

Table 2. SOD-like activity of twelve tested compounds by NBT reduction assay.

Antioxidant

IC50* (µg/ml)

Gallic acid Quercetin Caffeic acid

0.52 1.55 1.91

Protocatechuic acid Vanillic acid 3-hydroxycinnamic acid p-coumaric acid

4.91 35.92 420 500

Salicylic acid

> 500**

Orotic acid 3-hydroxypyridine Resorcinol

> 500** > 500** > 500**

α-tocopherol

no activity***

SOD**** (Bovine erythrocytes)

0.24

*IC50 values mean the minimal concentration of tested compounds that inhibits NBT reduction of 50%. **The values in parentheses represent the measured % inhibition of NBT reduction when the final concentration of tested compounds in reactions was 500 µg/ml. *** No activity means % inhibition of NBT reduction when the final concentration of tested compounds in reactions was 500 µg/ml. ****Superoxide dismutase (SOD, 3,400 U/mg) from bovine erythrocytes was used as a standard.

antioxidants from natural products and dietary supplements (Mello et al., 2003; Cortina-Puig et al., 2009; Oktyabrsky et al., 2009; Song et al., 2010). To investigate whether our bacterial cell-based assay can be applied for antioxidant screening from natural products, we also tested our system using the extracts from different plants. Hence, the ethyl acetate extracts from H. formicarum Jack., S. acmella Murr. and E. prostrata Linn. were examined for their intracellular antioxidant activity since they had the highest radical scavenging activity by determined DPPH assay (Prachayasittikul et al., 2008, 2009, 2010; Prachayasittikul, unpublished data). These extracts were dissolved in dimethyl sulfoxide (DMSO) and added immediately to the cultures after paraquat treatment, the final concentration of extracts in cultures were 100, 300 and 500 µg/ml. The reporter strain harboring fumC::gfp fusion was used for testing since it exhibited higher fold induction in response to paraquat comparing with strain harboring sodA::gfp fusion. The relative fold induction of these plant extracts are shown in Figure 5. The intracellular antioxidative effect of extracts was inversely proportional to relative fold induction. The extract of H. formicarum Jack. had the highest intracellular antioxidant activity followed by S. acmella Murr. and E. prostrata Linn. Nevertheless, the results show no significant differences among the tested extracts of the two latter. Notably, these extracts could alleviate intracellular superoxide stress in a dose dependent fashion (Figure 5).

DISCUSSION In E. coli, there are two main transcriptional regulatory proteins for oxidative stress sensing; SoxR and OxyR which respond to various ROS (Pomposiello and Demple, 2001). In response to superoxide, SoxR can only trigger the expression of SoxS, in turn SoxS can activate the transcription of many genes, such as sodA (manganese superoxide dismutase), fumC (fumarase C), zwf (glucose-6-phosphate dehydrogenase) and nfo (exonuclease IV). While in response to peroxide, OxyR can stimulate the transcription of many genes, such as katG (hydroperoxidase I), ahpCF (hydroperoxide reductase), grxA (glutaredoxin I) and gorA (glutathione reductase). Using these oxidative stress sensing systems, we developed the bacterial assay and used for evaluation of intracellular antioxidant efficiency of pure compounds and plant extracts. In our system, we used the GFP as a reporter since it is a convenient system throughout the monitoring process which does not require cell lysate preparation and any cofactors or substrates (Kain and Kitts, 1997). Initial experiment was conducted to determine the optimal conditions for the promoter inductions in the presence of paraquat and H2O2. Interestingly, the induction of sodA and fumC promoters was appeared to be in dose-dependent manner particularly after longer exposure times. Plausible explanation could be drawn as the visible induction was delayed due to the rate-limiting step of chromophore formation which

6942

Afr. J. Biotechnol.

Figure 5. Determination of intracellular antioxidant activity of plant extracts using fumC::gfp reporter strain. All three Thai medicinal plant ethyl acetate extracts were tested for their anti-superoxide activity. Cells were treated with 0.7 mM paraquat, then, 100 (black bar), 300 (light grey bar) and 500 (dark grey bar) µg/ml of each plant extract were added immediately to the culture. The raw fluorescence intensity and OD600 were measured at 360 min. Graph represented % relative fold induction of each plant extract at various concentrations. The experiments were performed in triplicates. Means ± SD were calculated and used for plotting graph with error bars.

requires at least 95 min (Cha et al., 1999; Lu et al., 2005). Notably, the maximal peak of fumC was delayed comparing with the peak of sodA in which their highest expressions were reached at 6 and 4 h, respectively after stress. The sodA encodes manganese containing superoxide dismutase which converts O.2- to H2O2, thus it is a first line of defense in detoxifying this ROS, suggesting a possible reason that sodA had high sensitivity in response to low concentration of paraquat and its expression reached to maximum faster than fumC. Remarkably, the genes in OxyR regulon, katG and ahpC were not highly responsive to H2O2 as observed by less than 2-fold induction throughout the experiment comparing with the genes in SoxRS regulon. These results were consistent to the previous work reported by Lu et al. (2005) that they characterized the gene regulation pattern of many oxidative stress responsive genes in response to stressors using similar plasmid system. Their results show that fold inductions of katG and ahpC promoters induced by 0.01 to 10 mM H2O2 varied from 1.0 to 1.6 during 120 to 360 min comparing to uninduced condition. They discussed that both katG and ahpC had high basal levels even in the absence of H2O2, therefore their induction folds were small. They also elucidated that high

concentration of H2O2 had no deleterious effects on GFP reporter property as they excluded the low induction of these genes caused by H2O2 inhibitory effects. Our results were also supported by Gonzalez-Flecha and Demple (1997) in which the induction of katG::lacZ fusion was less than 2-fold in response to 0.002 to 1 mM H2O2. However, Belkin et al. (1996) revealed that significant induction of katG::luxCDABE could be observed at H2O2 concentrations as low as 2.9 µM since the great sensitivity of lux reporter. Based on these published studies, these discrepancies were due to different reporter systems. In general, the enzymatic-based systems, such as lux gene have higher sensitivity owing to the signal amplification effect. Despite the high sensitivity of lux gene, the damage by high concentration of H2O2 is a drawback of this system (Belkin et al., 1996). Considerably, inconsistent results could be occurred by different experimental conditions, such as growth phase of cells, time after induction, etc.). Because of their high responses to paraquat, sodA::gfp and fumC::gfp fusions were used to assess the antioxidant potential of various phenolic compounds and flavonoids for specific intracellular superoxide anion alleviation.

Eiamphungporn et al.

The results reveal that quercetin and α-tocopherol had the highest intracellular antioxidant activity for superoxide alleviation (Figure 3). Quercetin is a flavonoid compound with better antioxidant activity than others in many different assays (Rice-Evans et al., 1996; FernandezPanchon et al., 2008; Holst and Williamson, 2008). The α-tocopherol is well known as a lipid soluble antioxidant which can protect cell membranes from oxidation and it is commonly used as a standard compound for many antioxidant activity assays. This study also showed that caffeic acid, 3-hydroxycinnamic acid and gallic acid possessed significant moderate intracellular antioxidant activity. There was an earlier work performed by utilizing mammalian cell-based assay, L-929 murine fibrosarcoma cell line containing fluorescence probe 2′,7′dichlorofluorescin-diacetate (DCFH-DA), as an indicator of intracellular ROS to evaluate the antioxidant properties of compounds and mixtures (Girard-Lalancette et al., 2009). Their results were in good agreement with our results which showed that the order of antioxidant potentials of the tested compounds were as following: quercetin > caffeic acid > gallic acid > α-tocopherol. However, it was different in the order of α-tocopherol which is possible that DCFH-DA probe can be directly oxidized by several intracellular ROS intermediates (LeBel et al., 1992; Wang and Joseph, 1999). In their experiment, they challenged cells with tert-butylhydroperoxide (t-BOOH) that can produce the peroxide stress, another type of ROS, while our bacterial system mainly assessed the intracellular superoxide anions. Surprisingly, our results showed significant differences in relative fold induction and sensitivity between the sodA and fumC in response to some tested compounds (Figure 3). Apparently, sodA was less inducible by paraquat than fumC. However, sodA showed higher sensitivity as compared to fumC when testing the intracellular antioxidative effect of compounds. The sodA gene encodes manganese superoxide dismutase which converts O.2- to H2O2, whereas, fumC encodes stable fumarase C that can replace the oxidatively unstable fumarase A and B. The manganese superoxide dismutase is more important since it is the first line of defense in O.2- detoxification, suggesting a possible rationale for its high sensitivity to maintain the harmless intracellular O.2- level (Lu et al., 2005). In general, DPPH and SOD activity assays involve only in vitro chemical reactions and are performed under nonphysiological conditions that do not depend on any cellular function. In contrast, the cell-based assay is a measurement for total biological effects that supposed to represent the actually antioxidant activity inside cells that may be affected by many factors, such as bacterial cell viability, membrane permeability of compounds, indirect complexity of cellular function and other unknown factors. Obviously, our results demonstrated that the effectiveness of tested compounds in antioxidant activity was not exactly similar among these methods. Not surprisingly, two chemical-based methods revealed the

6943

results that all tested compounds, except α-tocopherol, had the similar pattern in which antioxidant activity depends on the numbers of hydroxyl groups in their structures. It was noted that α-tocopherol had no SOD-like activity even it showed high radical scavenging activity (~ 86 %). Such result could be possibly explained by inductive effect of keto group. In case of quercetin, it had a keto group on its molecule which can create an electrophillic center to react with the superoxide anions that lead to its high SOD-like activity (Table 2). This could not apply to the α-tocopherol which is perhaps due to the lack of keto group on its molecule. However, there is no advanced explanation to point out that why the SOD-like activity was not observed for αtocopherol. Apparently, there is still no evidence from the literatures to reason such result. Importantly, our experiments indicated that only quercetin and αtocopherol exerted the highest significant intracellular antioxidant activity tested by bacterial-based assay, whereas caffeic acid, gallic acid and protocatechuic acid showed the highest antioxidant activity determined by DPPH and SOD assays, but only moderate or weak intracellular antioxidant activity. We propose that these discrepancies could be due to chemical structures and ability of compounds for penetrating into biological membranes. The chemical structures of both quercetin and α-tocopherol are planar aromatic compounds that the quercetin is a flavonoid compound composing of coumarin and benzene rings with many hydroxyl groups, while α-tocopherol composes of chroman ring with hydroxyl group and long hydrophobic side chain (Figure 1). These compounds possess high antioxidant activity according to the numbers of their hydroxyl groups that can donate hydrogen radical to scavenge free radicals (Rice-Evans et al., 1996). In fact, the benzene ring and hydrophobic side chain are nonpolar or lipophillic groups, which allow them to penetrate into biological membranes. As described, it is reasonable to account for these compounds to exert the most potent intracellular antioxidant activity. On the other hand, caffeic acid, gallic acid and protocatechuic acid are polyphenolic compounds containing carboxylic acid group that they are more hydrophilic or polar than the quercetin and α-tocopherol. Taken together, although these compounds exhibit in vitro antioxidant activity, they cannot well penetrate into the membranes and scavenge the free radicals when comparing with the quercetin and αtocopherol. To elucidate this hypothesis, further experiments regarding to membrane permeability are necessary. Using our bacterial-based method, the intracellular antioxidant activity of ethyl acetate extracts from three Thai traditional medicinal plants was investigated and compared with previously reported antioxidant activity using DPPH method. Although, it was not possible to compare these methods in an absolute manner since the DPPH assay is a chemical-based

6944

Afr. J. Biotechnol.

assay for antioxidant activity that is not physiological relevance as in the case of the cell-based assay. Moreover, plant extracts may not have only affected cell function by antioxidative property but they may also affect cells through non-antioxidative effects. However, this appears to be a benefit of cell-based assays that they are more applicable for investigating the total biological effects of plant extracts to cells. The results demonstrated that the extract of H. formicarum Jack. exerted the highest intracellular antioxidant activity followed by S. acmella Murr. and E. prostrata Linn., in which the latter two plant extracts displayed comparable activity (Figure 5). These experimental findings are in good agreement with our previous study on the DPPH radical scavenging activity of these extracts (Prachayasittikul et al., 2008, 2009; Prachayasittikul, unpublished data). The ethyl acetate extract of H. formicarum Jack. exhibited the strongest radical scavenging activity with IC50 of 8.40 µg/ml, whereas the ethyl acetate extracts of S. acmella Murr. and E. prostrata Linn. displayed moderate to weak radical scavenging activity with IC50 of 216 and 101.14 µg/ml, respectively. CONCLUSION The present study is a preliminary investigation of the potential application of novel bacterial cell-based assay as an alternative screening tool for the intracellular antioxidant activity of both pure compounds and plant extracts. This assay is simple, inexpensive, reproducible and very specific for the intracellular antioxidant activity against superoxide radical that is applicable for estimating the antioxidative effects in terms of biological relevance. An additional advantage of this method is the use of very small sample volumes comparing with chemical-based assays. However, the limitation of our assay may be on the assay duration since the GFP measurement was taken within 8 h. Therefore, further experiments should be pursued in order to improve the quality of assay in case of short assay duration and broader use for development of a high throughput screening method for a large number of antioxidant compounds. ACKNOWLEDGEMENTS This work was supported by a new researcher grant from Mahidol University (B.E. 2553). This work was also supported by the Office of the Higher Education Commission and Mahidol University under the National Research Universities Initiative. REFERENCES Alksne LE, Burgio P, Hu W, Feld B, Singh MP, Tuckman M, Petersen PJ, Labthavikul P, McGlynn M, Barbieri L, McDonald L, Bradford P, Dushin RG, Rothstein D, Projan SJ (2000). Identification and analysis

of bacterial protein secretion inhibitors utilizing a SecA-LacZ reporter fusion system. Antimicrob. Agents Chemother. 44(6): 1418-1427. Belkin S, Smulski DR, Vollmer AC, Van Dyk TK, LaRossa RA (1996). Oxidative stress detection with Escherichia coli harboring a katG’::lux fusion. Appl. Environ. Microbiol. 62: 2252-2256. Benzie IF, Strain JJ (1999). Ferric reducing/antioxidant power assay: direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. Methods Enzymol. 299: 1527. Brand-Williams W, Cuvelier ME, Berset C (1995). Use of a free radical method to evaluate antioxidant activity. LWT Food Sci. Technol. 28(1): 25-30. Cha HJ, Srivastava R, Vakharia V, Rao G, Bentley WE (1999). Green fluorescent protein as a noninvasive “stress probe” in resting recombinant Escherichia coli culture. Appl. Environ. Microbiol. 65(2): 409-414. Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC (1994). Green fluorescent protein as a marker for gene expression. Science, 263(5148): 802-805. Cortina-Puig M, Mu˜noz-Berbel X, Rouillon R, Calas-Blanchard C, Marty JL (2009). Development of a cytochrome c-based screen-printed biosensor for the determination of the antioxidant capacity of orange juices. Bioelectrochemistry, 76(1-2): 76-80. Fernandez-Panchon MS, Villano D, Troncoso AM, Garcia-Parrilla MC (2008). Antioxidant activity of phenolic compounds: from in vitro results to in vivo evidence. Crit. Rev. Food Sci. Nutr. 48: 649-671. Girard-Lalancette K, Pichette A, Legault J (2009). Sensitive cell-based assay using DCFH oxidation for the determination of pro- and antioxidant properties of compounds and mixtures: Analysis of fruit and vegetable juices. Food Chem. 115(2): 720-726. Gonzalez-Flecha B, Demple B (1997). Homeostatic regulation of intracellular hydrogen peroxide concentration in aerobically growing Escherichia coli. J. Bacteriol. 179: 382-388. Grey M, Yainoy S, Prachayasittikul V, Bülow L (2009). A superoxide dismutase-human hemoglobin fusion protein showing enhanced antioxidative properties. FEBS J. 276(21): 6195-6203. Halliwell B, Gutteridge JM (1999). Free Radicals in Biology and Medicine, New York, Oxford University. Hansen LH, Ferrari B, Sorensen AH, Veal D, Sorensen SJ (2001). Detection of oxytetracycline production by Streptomyces rimosus in soil microcosms by combining whole-cell biosensors and flow cytometry. Appl. Environ. Microbiol. 67(1): 239-244. Holst B, Williamson G (2008). Nutrients and phytochemicals: from bioavailability to bioefficacy beyond antioxidants. Curr. Opin. Biotechnol. 19(2): 73-82. Imlay JA (2002). How oxygen damages microbes: oxygen tolerance and obligate anaerobiosis. Adv. Microb. Physiol. 46: 111-153. Kain SR, Kitts P (1997). Expression and detection of green fluorescent protein (GFP). Methods Mol. Biol. 63: 305-324. Keller JN, Kindy MS, Holtsberg FW, St Clair DK, Yen HC, Germeyer A, Bruce-Keller SM, Butchins AJ, Mattson MP (1998). Mitochondrial manganese superoxide dismutase prevents neural apoptosis and reduces ischemic brain injury: suppression of peroxynitrite production, lipid peroxidation, and mitochondrial dysfunction. J. Neurosci. 18(2): 687-697. LeBel CP, Ischiropoulos H, Bondy SC (1992). Evaluation of the probe 2′,7′-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem. Res. Toxicol. 5(2): 227-231. Lui Q, Liu H, Yuan Z, Wei D, Ye Y (2012). Evaluation of antioxidant activity of chrysanthemum extracts and tea beverages by gold nanoparticles-based assay. Colloids Surf B Biointerfaces. 92: 348352. Liu RH, Finley J (2005). Potential cell culture models for antioxidant research. J. Agric. Food Chem. 53(10): 4311-4314. Lu C, Albano CR, Benley WE, Rao G (2005). Quantitative and kinetic study of oxidative stress regulons using green fluorescent protein. Biotechnol. Bioeng. 89(5): 574-587. Lu C, Benley WE, Rao GA (2004). High-throughput approach to promoter study using green fluorescent protein. Biotechnol. Prog. 20(6): 1634-1640. Lu T, Finkel T (2008). Free radicals and senescence. Exp. Cell Res.

Eiamphungporn et al.

314(9): 1918-1922. Ma XY, Li H, Dong J, Qian WP (2011). Determination of hydrogen peroxide scavenging activity of phenolic acids by employing gold nanoshells precursor composites as nanoprobes. Food Chem. 126(2): 698-704. Mello LD, Sotomayor Mdel P, Kubota LT (2003). HRP-based amperometric biosensor for the polyphenols determination in vegetables extract. Sens. Actuators B. 96(3): 636-645. Mitchell RJ, Gu MB (2004). Construction and characterization of novel dual stress-responsive bacterial biosensors. Biosens. Bioelectron. 19(9): 977-985. Moreno-Sanchez C (2002). Review: Methods used to evaluate the free radical scavenging activity in foods and biological systems. Food Sci. Technol. Int. 8(3): 131-137. Oktyabrsky O, Vysochina G, Muzyka N, Samoilova Z, Kukushkina T, Smirnova G (2009). Assessment of antioxidant activity of plant extracts using microbial test systems. J. Appl. Microbiol. 106(4): 1175-1183. Park SJ, Chung HY, Lee JH (2010). Rapid in vivo screening system for anti-oxidant activity using bacterial redox sensor strains. J. Appl. Microbiol. 108(4): 1217-1225. Pomposiello PJ, Demple B (2001). Redox-operated genetic switches: the SoxR and OxyR transcription factors. Trends Biotechnol. 19(3): 109-114. Prachayasittikul S, Buraparuangsang P, Worachartcheewan A, Isarankura-Na-Ayudhya C, Ruchirawat S, Prachayasittikul V (2008). Antimicrobial and antioxidative activities of bioactive constitutents from Hydnophytum formicarum Jack. Molecules, 13(4): 904-921. Prachayasittikul S, Suphapong S, Worachartcheewan A, Lawung R, Ruchirawat S, Prachayasittikul V (2009). Bioactive metabolites from Spilanthes acmella Murr. Molecules, 14(2): 850-867. Prachayasittikul S, Wongsawatkul O, Suksrichavalit T, Ruchirawat S, Prachayasittikul V (2010). Bioactivity Evaluation of Eclipta prostrata Linn: A Potential Vasorelaxant. Eur. J. Sci. Res. 44(2): 167-176. Prasad KN, Cole WC, Kumar B (1999). Multiple antioxidants in the prevention and treatment of Parkinson’s disease. J. Am. Coll. Nutr. 18(5): 413-423. Pratico D, Delanty N (2000). Oxidative injury in diseases of the central nervous system: focus on Alzheimer’s disease. Am. J. Med. 109(7): 577-585. Rice-Evans CA, Miller NJ, Paganga G (1996). Structure-antioxidant activity relationships of flavonoids and phenolic acids. Free Radic. Biol. Med. 20(7): 933-956. Shahidi F, Ho CT (2007). Antioxidant measurement and applications, ACS Symp. Ser. 956 2-7.

6945

Song W, Derito CM, Lui MK, He X, Dong M, Lui RH (2010). Cellular antioxidant activity of common vegetables. J. Agric. Food Chem. 58(11): 6621-6629. Takamatsu S, Galal AM, Ross SA, Ferreira D, ElSohly MA, Ibrahim AR, El-Feraly FS (2003). Antioxidant effect of flavonoids on DCF production in HL-60 cells. Phytother. Res. 17(8): 963-966. Van den Berg R, Haenen GR, Van den Berg H (1999). Applicability of an improved Trolox equivalent antioxidant capacity (TEAC) assay for evaluation of antioxidant capacity measurements of mixtures. Food Chem. 66(4): 511-517. Ullmann K, Wiencierz AM, Müller C, Thierbach R, Steege A, Toyokuni S, Steinberg P (2008). A high-throughput reporter gene assay to prove the ability of natural compounds to modulate glutathione peroxidase, superoxide dismutase and catalase gene promoters in V79 cells. Free Radic. Res. 42(8): 746-753. Wang H, Joseph JA (1999). Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free Radic. Biol. Med. 27(5-6): 612-616. Wolfe KL, Lui RH (2007). Cellular antioxidant activity (CAA) assay for assessing antioxidants, foods, and dietary supplements. J. Agric. Food Chem. 55(22): 8896-8907.

Full Length Research Paper

Construction of mammary gland specific expression plasmid pIN and its expression in vitro and in vivo Jian Lin, Qinghua Yu, Qiang Zhang and Qian Yang* Key Laboratory of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Weigang 1, Nanjing, Jiangsu 210095, People’s Republic of China. Accepted 16 February, 2012

The aim of this study was to construct a mammary gland specific expression plasmid pIN and validate its function in expressing goat insulin-like growth factor 1 (IGF-1). The backbone plasmid pBC1 contained goat β-casein 5′ arm and β-casein 3′ arm, to target mammary gland-specific gene expression. First, the igf-1 gene was cloned from liver tissue harvested from a Saanen dairy goat and inserted downstream of the β-casein 5' arm. Then the neo gene was amplified from plasmid pCDNA3.1 and placed downstream of the β-casein 3' arm as a positive selection marker. In order to analyze the bioactivity of plasmid pIN, it was transfected into the Bcap-37 cell line and injected into goat mammary gland. Western-blotting and quantitative polymerase chain reaction (PCR) results confirmed the expression of IGF-1 protein and mRNA in transfected Bcap-37 cells. Further studies (RIA) demonstrated that the expression of IGF-1 protein in transfected group was much higher than that in control group (p < 0.05). In vivo results showed that the expression of IGF-1 in injected group was significantly higher than that in control group. All our results provide evidence that pIN is a mammary gland specific expression plasmids that can target expression of IGF-1 to mammary tissue, with the goal of increasing milk production. Key words: IGF-1, pIN, Bcap-37 cell line, goat mammary, milk production. INTRODUCTION Improving milk production of goat by transgenic animal technology is a promising strategy, but requires selecting an appropriate gene for increased expression. Mammary gland development and milk production are affected by many hormone genes (Plante et al., 2011), such as growth hormone, prolactin (PRL), progesterone, estrogen and insulin-like growth factor 1 (IGF-1) (Kaskous et al., 2003). IGF-1 is a hormone similar to insulin in molecular structure, which can bind to two receptors: IGF-1 receptor

*Corresponding author. E-mail: zxbyq@njau.edu.cn. +8602584395817. Fax: +8602584398669.

Tel:

Abbreviations: IGF-1, Insulin-like growth factor 1; Bcap-37, human mammary tumor cell line; RIA, radioimmunoassay; PRL, prolactin; IGF-1R, insulin-like growth factor 1 receptor; IGF-BP, insulin-like growth factor binding protein; DMEM, Dulbecco’s modified Eagle medium.

and insulin receptor. In addition to insulin-like effect, IGF1 can regulate cell growth and development. After binding to IGF-1R, it initiates intracellular signaling: activating AKT signal pathway, a stimulator of cell growth and proliferation. Also IGF-1 has growth-promoting effects on almost every cell. The deficiency of IGF-1 will directly lead to non-development of mammary gland (Ruan et al.,1999). IGF-1 plays a role in lactation mainly in two aspects: on one hand, IGF-1 increases the milk production of animals in unit time. Prosser et al. (1994) proved that arterial infusion of IGF-1 into mammary gland increased milk yield by 9% in goat. On the other hand, IGF-1 enhances sustainability of lactation in lactating animals. Hadsell et al. (2002) demonstrated that IGF-1 slowed the apoptotic loss of mammary epithelial cells during the recession phase of lactation, which implied that IGF-1 possessed a potent inhibitor of programmed cell death. The ability of modifying mammary gland function through transgenic technology provides an opportunity to enhance the

Lin et al.

production of milk. Previous research had suggested strategies for changing milk composition to reduce the energetic cost of milk production and to reduce the microbial load in milk. The perceived utility of mammary gland may, in part, account for the considerable attention that had been focused on investigating transgene expression in mammary glands. Most studies are designed to address both basic and applied aspects of expressing additional protein in mammary gland, while the bulk of research literature are focused on biomedical rather than agricultural applications. The aim of our research was to construct a mammary gland specific expression plasmid pIN and validate its function in Bcap-37 cell line and goat mammary gland. Mammary-specific promoter such as casein (Lee et al., 1996; Zinovieva et al., 1998), whey protein (Hadsell et al., 1996) and lactalbumin (Su and Cheng, 2004) were wildly used in transgene animal. We used β-casein to initiate the expression of IGF-1. Our research laid a solid foundation for producing IGF-1 genetically modified goat with increasing milk production.

6947

The construction of vector pIN As shown in Figure 2, to produce IGF-1 insert fragment, recombinant plasmid pMD19-T-IGF-1 was amplified with infusion primers. Infusion Primers were listed in Table 1. PCR amplification was performed with PrimeSTAR® HS DNA polymerase. Infusion-IGF-1 product was isolated and purified. Then we used In-Fusion™ Advantage PCR cloning Kit to insert infusion-IGF-1 into plasmid pBlue-pBC. Recombinant plasmid was named pBI. Finally, the digested plasmid pBI (Kpn I/ Cla I) was linked with plasmid DNA3. Recombinant plasmid was named pI. Then we designed a primer to check plasmid pI. Furthermore, to produce neo fragment, recombinant plasmid pMD19-T-neo was digested with restriction enzyme Not I. Plasmid pI was also digested with Not I. Then we used T4 DNA ligase to link digested plasmid pI with neo fragment. Recombinant plasmid was named pIN. PCR and restriction enzyme digestion methods were used to verify recombinant plasmid pIN.

Expression of recombinant plasmid pIN in Bcap-37 cell line Cell culture Bcap-37 cell line was grown in Dulbecco’s modified Eagle medium (DMEM) (Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen, USA) at 37°C in a humidified atmosphere of 5% CO2.

MATERIALS AND METHODS Materials and reagents Liver and mammary gland were harvested from Saanen dairy goats. Plasmid pBC1 was generously donated by Professor Cheng of Yangzhou University. Plasmid pCDNA3.1 and Bcap-37 cell line were provided by Professor Wang of Nanjing Agricultural University. Plasmid pBluescript II SK (+) was purchased from Takara (Japan). Escherichia coli JM 109 strain was kept in our laboratory. Mouse monoclonal antibody to IGF-1 was purchased from Abcam Biotechnology (USA).

Detection of the expression of IGF-1 mRNA by quantitative PCR Quantitative PCR assays were run to confirm whether the plasmid pIN could be expressed successfully in Bcap-37 cell line. Cells were divided into three groups 6 h after transfection: the blank group (normal cells), the transfection group (transfected with plasmid pIN) and the control group (liposome 2000). Assays were performed with RNA preparation from three groups. As to each group, at least three technical (quantitative PCR) replicates were needed. Genespecific primers were designed using Primer Express software. The primer sequences are listed in Table 2.

Construction of vector pIN The amplification of igf-1 and neo gene The full-length of goat igf-1 gene was 960 bp (Gene Bank ID: D11378), while the open reading frame (ORF) region was 483 bp. Total RNA was extracted from liver of Saanen dairy goat with Trizol reagent. Reverse Transcriptase M-MLV was used to synthesize cDNA. Parameters for PCR were as follows: 94°C for 5 min; 94°C, 30 s; 57°C, 30 s; 72°C, 50 s; 30 cycles; 72°C, 10 min; 10°C. After amplification, 25 µL PCR products were run on a 1.5% agarose gel with ethidium bromide staining. The PCR primers are listed in Table 1.

The amplification of neo gene The full-length of the neo gene is 1521 bp and contains promoter and poly (a) tail. Using the plasmid pcDNA3.1 as a template, PCR amplification was performed with PrimeSTAR® HS DNA polymerase. PCR primers used for this study were listed in Table 1. The PCR products of IGF-1 and neo gene were isolated and purified. Purified DNA fragments were linked to plasmid pMD19-T. Recombinant plasmid was transformed to E. coli JM 109 competent cells by heat-stress and extracted from bacterial colonies by colony PCR. The identified recombinant plasmid was then finally sequenced.

Detection of the expression of IGF-1 by Western blot and radioimmunoassay (RIA) Bcap-37 cell line was transfected with plasmid pIN by liposome2000. Cells were divided into three groups 6 h after transfection: control group (normal cells), transfection group (transfected with pIN only) and transfection with induction group (transfected with pIN and induced with insulin, PRL and Hydrocortisone). The medium of control group and transfection group were changed into DMEM containing 10% fetal bovine serum. At the same time, transfection with induction group was added with insulin (10 µg/ml), PRL (1 µg/ml) and hydrocortisone (20 µg/ml). Cells and medium were collected at 12, 24, 36 and 48 h for subsequent test. For Western-blot analysis, the cells were collected and dissolved in radioimmunoprecipitation assay (RIPA) buffer (1 mm phenylmethylsulfonyl fluoride (PMSF)). Supernatants were loaded on a 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. Then gels were wet transferred onto nitrocellulose (NC) membranes. Membranes were blocked with Tris-buffer saline Tween20 (TBST) buffer containing 5% non-fat milk at room temperature for 2 h, then incubated with mouse antihuman IGF-1 monoclonal antibody at 4°C for 18 h and subsequently incubated with secondary HRP-IgG (1:10000) antibody at room temperature for 2 h. Then IGF-1 proteins were

6948

Afr. J. Biotechnol.

Table 1. PCR primers.

Product length (bp) 501 513

Gene

Sense primer

Anti-sense primer

IGF-1 infusion IGF-1

ACAGGTACCATGGGAAAAATCAGCAGTCT ATCGCGGATCCTCGAGATGGGAAAAATCAG

CGCAAGCTTCTACATTCTGTAGTTCTTGT ATCGCGGATCCTCGAGATGGGAAAAATCAG

neo pBC1- IGF-1 pBC1354

GCGGCCGCTGTGGAATGTGTGTCAGTTA TTTGCAGGATCTTGGTTC GTGAATGAGATGAAAAAGAGT

GCGGCCGCACAGACATGATAAGATACAT

1521

TCAAAAACAAGATGTGAAATG

1354

pIN799

ACATCCTCCTCGCATCTCTTC

TTAGGTTTGTTATTCTTAGCC

799

visualized by enhanced chemiluminescence. For IGF-1 RIA, the concentration of IGF-1 in Bcap-37 cells lysate and cells culture medium were measured separately after 12, 24, 36 and 48 h by a radioimmunoassay protocol. 125I-IGF-1 kit was purchased from Beijing Sinoukbio Company. Cells lysate and cells culture medium samples 0.1 ml, mixed with acid/ethanol (95% ethanol: 2 M HCL = 87.5:12.5) 0.4 ml, set at room temperature for 30 min and then centrifuged at 3000 rpm / min for 30 min at 4°C. After centrifugation, 0.2 ml of the supernatant mixed with 0.2 ml 0.855 M Tris solution for 30 min at 4°C, then centrifuged 3000 rpm/min for 20 min at 4°C. Subsequently, 100 µL supernatant was aspired for testing. One hundred microliters each of cells lysate and cells culture medium extracts (or standards), IGF-1 anti-serum, and 125I-IGF-1 were pipetted into duplicate RIA tubes. Tubes were vortexed and incubated with rotation at 4°C for 48 h. At the end of the incubation, 500 μL of the separation reagents was added to each tube followed by 30 min incubation at room temperature. The tubes were then centrifuged at 3600 rpm, 4°C for 20 min, to separate bound 125IIGF-1 from unbound. Immediately after centrifugation, the supernatant was removed by aspiration. All RIA tubes were then placed in a Beckman Gamma 4000 counter, and the bound 125IIGF-1 fraction radioactivity was counted for 2 min per tube.

The expression of recombinant plasmid pIN in goat mammary Plasmid injection 10 healthy goats were divided into two groups: control group (lactating goat primed with saline) and experimental group (lactating goat injected with plasmid pIN). For the experimental group, 400 ng plasmid pIN was dissolved into saline and injected into right side mammary gland of each goat in day three and seven. Then mammary gland tissues of each group were collected to conduct subsequent testing in day 10.

Detecting the expression of IGF-1 protein in goat mammary The concentration of growth hormone (GH) protein in goat mammary of different groups was measured by human IGF-I Quantikine ELISA Kit (R&D, USA). ELISA assays were performed in accordance with protocol.

Transfection of the goat ear fibroblast lines and establishment of transgenic cell lines Purified goat ear fibroblast cells (donated by shanghai transgenic

research) were cultured in DMEM supplemented with 10% fetal bovine serum, penicillin (100 U/ml), and streptomycin (100 µg/ml). The whole procedure was conducted according to the description provided with liposome 2000 regent (Invitrogen). Briefly, 1×105 cells were seeded in each well of 6-well plate one day before transfection. The cells in 5 wells were transfected with 2 µg plasmid pIN, while one well served as control. After 48 h of transfection, cells were passage based on cell density at 1:3 or 1:4 into the appropriate medium and selected using 600 µg/ml G418 (Amresco, USA) for 10 to 14 days. The observed positive cell clones were marked with circles at the corresponding spot on the bottom of the culture flask or plate. Each marked circle was digested with 0.25% trypsin for 2 min and then transferred into 48 -well plate supplemented with DMEM, 10% fetal bovine serum (FBS) and 300 µg/ml G418 until each cells in 48 wells passage into six-well plate, three positive clones (1, 2 and 3) were used for following analysis. Genomic DNA was isolated from the above three positive cell lines and non-transgenic cell lines with TIANamp genomic DNA Kit (TIANgen). Two specific primers were designed to detect the positive clones. The primers used are listed in Table 1.

Statistical analysis The statistical analyses of the concentration of IGF-1 in different group were carried out with SPSS 17 software. Comparison between two groups was carried out using t-test. A one-way analysis of variance (ANOVA) with Turkey’s post hoc analysis was performed when comparing more than two groups. Significant differences (P < 0.05) are noted with symbols in the Figures. All data are expressed as mean ± standard error of the mean.

RESULTS Cloning of igf-1 gene and neo gene Result shows that igf-1 gene was amplified and cloned into plasmid pMD19-T (Figure 1A). Subsequently, plasmid pMD19-T- igf-1 was digested with restriction enzyme Xho I and there were two fragments: 501 and 2690 bp as we wished. Nucleotide sequencing showed 100% homology to goat IGF-1 gene sequences. Results also show that neo gene was amplified and cloned into plasmid pMD19-T (Figure 1B). Then plasmid pMD19-Tneo was digested with restriction enzyme Not I and two fragments, 1521 and 2690 bp, were obtained. Nucleotide sequencing showed 100% homology to neo gene.

Lin et al.

6949

Figure 1. Construction and verification of vector pIN. (A) IGF-1 electrophoresis of PCR product (1, IGF-1; -, negative clone; +, positive clone; M, DNA marker / Trans2K Plus). (B) Neo electrophoresis of PCR product (1, 2, neo; -, negative clone; +, positive clone; M, Marker DNA /Trans2K Plus). (C) Identification of vector PI digested with restriction enzymes (Kpn I/Cla I) (1, vect or pBIKpn I/Cla; 2, vector pI-Kpn I/Cla I; 3, pBC I-Kpn I/Cla I; 4, vector pI; M, marker DNA /位-Hind III digest ). (D) Identification of vector pIN digested with restriction enzyme (Not I) (1, 2, vector pIN; 3, vector pI-Not I; M, marker DNA /位-Hind III digest).

Figure 2. The map of vector pIN.

Identification of recombinant plasmid PI and pIN with restriction enzymes Recombinant plasmid pI was cleaved with restriction enzymes Kpn I and Cla I (Figure 1C). Compared with

digested plasmid pBC1 (Kpn I/ Cla I), plasmid pIN was identified. Furthermore, the recombinant plasmid pIN was cleaved with restriction enzyme Not I. Results show two fragments 1521 and 22108 bp as we supposed (Figure 1D). These results demonstrate that plasmid pIN was

6950

Afr. J. Biotechnol.

Table 2. Quantitative PCR primers.

Gene IGF-1 Bcap-37 beta-actin

Sense primer cgtctgtgaacccggagtat gatcattgctcctcctgagc

Anti-sense primer gcctcgttcaccgtcttaat tgtggacttgggagaggact

constructed successfully. Detecting of the expression of plasmid pIN in Bcap37 cell line Detection of expression quantitative PCR

IGF-1

mRNA

Plasmid pIN was transfected into Bcap-37 cell line to evaluate its biological activity. IGF-1 mRNA was evaluated by quantitative PCR after 36 h. As shown in Figure 3A, the expression of IGF-1 in transfected group was greatly increased by 3000 times than that in control group. Results certified that plasmid pIN could be successfully transcribed in Bcap-37 cell line (Figure 3A). SDS-PAGE From Figure 3B, we observed a 7.5-kDa major band appearing in only a few transfected group (A8, B2 and B4), while most of them could not spot any band in 7.5kDa place. Western-blotting Western blot analysis showed that the molecular weight of the expressed IGF-1 was 7.5-kDa, which was in agreement with the molecular weight of IGF-1 reported previously (Tokunou et al., 2008). Interestingly, we saw a 17-kDa band, which was always associated with a smaller 7.5- kDa IGF-1 band, in the colonic specimens with IGF-1 mouse antibody (Figure 3C).

Product length (bp) 193 385

730.14 ± 64.31; 776.86 ± 126.14 and 842.69 ± 89.40 µg/L, respectively), the content of total IGF-1 in transfection group (1017.40 ± 51.16; 817.90 ± 37.38; 1267.10 ± 190.51 and 1015.70 ± 61.84 µg/L) were increased significant in 12 and 36 h. However the expression of IGF-1 in transfection and induction group reached to a peak in 36 h (1209.60 ± 130.88, 887.65 ± 39.01, 1472.10 ± 56.47 and 1111.00 ± 86.15 µg/L) (Figure 4C). In cell lysate, the expression of IGF-1 in control group at 36 h (277.30 ± 56.19 µg/L) were precisely lower than that in transfection with induction group (641.13 ± 42.81 µg/L) (Figure 4A). Also in cell culture medium, the content of IGF-1 increased significant from 499.56 ± 182.28 µg/L (36 h, control group) to 837.33 ± 122.50 µg/L (36 h, transfection group) and 830.98 ± 58.32 µg/L (36 h, transfection with induction group) (Figure 4B). Statistical analysis showed that the content of IGF-1 in transfection and induction group was higher than that in control group at 24 and 48 h. The content of IGF-1 in induction group was significantly higher than that in control group (P <0.05) at 12 and 36 h. Detect the expression of plasmid pIN on goat mammary The ELISA results of goat mammary gland changed dramatically in different groups. In the right side (injection side), the IGF-1 content in injection group was 0.98 ± 0.11 ng/mg, which was greatly higher than that in control group (0.72 ± 0.03 ng/mg). As to the left sides (noninjection side), the expression of IGF-1 content dropped from 0.77 ± 0.11 ng/mg (injection group) to 0.66 ± 0.05 ng/mg (control group). In general, the total IGF-1 content (two sides) in injection group (0.87 ± 0.07 ng/mg) was higher than that in control group (0.69 ± 0.06 ng/mg) (Figure 5).

RIA To be sure whether the expression of IGF-1 was up regulated in transfected cells, cells lysate and cells culture medium of different group were collected to perform RIA analysis. Results confirm that the expression of IGF-1 in transfection group and transfection with induction group was much more than that in control group (Figure 4). In general, the content of total IGF-1(the addition of IGF-1 in cells lysate and cells culture medium) was stably grown by time from 12 to 36 h, while the content of IGF-1 had a little drop down in 48 h. Compared with control group at 12, 24, 36 and 48 h (666.11 ± 47.78;

Detection of the established transgenic cell lines by PCR To clarify whether plasmid pIN was integrated into the genomes of transgenic cell lines, two specific primers were design to detect the positive clones. An amplified fragment for pIN included 384 bp of IGF-1 and 415 bp βcasein 3′ region, a total of 799 bp. Result shows that three positive clones carried the 799 bp fragment (Figure 6). Another amplified fragments (1354 bp) for pIN contained 389 bp β-casein 5′ region, 465 bp of IGF-1

Lin et al.

Figure 3. The expression of IGF-1 in Bcap-37 cell line. (A) The relative IGF-1 mRNA expression in Bcap-37 cell line. (B) SDS-PAGE result of IGF-1 protein in Bcap-37 cell line (A: M1, PageRuler™Prestained Protein Ladder; 1, control group/12 h; 2, transfection group/12 h; 3, transfection with induction group/12 h; 4, control group/24 h; 5, transfection group/24 h; 6, transfection with induction group/24 h; 7, control group /36 h; 8, transfection group/36 h; M2, protein MW marker (low). B: M2, Protein MW marker (low); 1, transfection with induction group /48 h; 2, transfection group/48 h; 3, control group /48 h; 4, transfection with induction group/36 h; 5, transfection group/36 h; 6, control group/36 h; M1, PageRuler™Prestained Protein Ladder). (C) Western blot result of IGF-1 protein in Bcap-37 cell line (1, control group / 24 h; 2, transfection group/24 h; 3, transfection with induction group/24 h; M, PageRuler™Prestained Protein Ladder; 4, control group/36 h; 5, transfection group/36 h; 6, transfection with induction group/36 h). IGF-1, Insulin-like growth factor 1; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

6951

6952

Afr. J. Biotechnol.

Figure 4. RIA result of IGF-1 content in Bcap-37 cell line. (A) The IGF-1 content in cell lysate in different group at the same time (*significant difference P < 0.05). (B) The IGF-1 content in cell culture medium in different group at the same time. (C) The IGF-1content in cell culture medium and cell lysate of different group at the same time (*significant difference P < 0.05). RIA, Radioimmunoassay; IGF-1, insulin-like growth factor 1.

gene and 500 bp Î˛-casein 3' region. Results show that 1354 bp fragment appeared in clone lines 2 and 3, but not in clone line 1 for reason unknown (Figure 6). All these results indicate that plasmid pIN was integrated into the genomes of transgenic clone lines 2 and 3, but not clone lines 1.

DISCUSSION IGF-1 plays an important role in mammary development (Loladze et al., 2006) and lactation (Hadsell et al., 2008). The mechanism may be that IGF-1 regulates signaling molecules to promote AKT activity in mammary cells

Lin et al.

6953

Figure 5. The IGF-1 concentration in goat mammary gland. IGF-1, Insulin-like growth factor 1.

which increases the persistence of lactation (Burgos and Cant, (2010) or that IGF-1 could reduce the oxidative damage to mammary epithelial cells which in turn could maintain lactation. IGF-1 also blocks the apoptotic process of mammary epithelial cells, thus prolonging the lactation period and improving milk ability (Hadsell et al., 2002). From the important role of IGF-1 in mammary development and lactation, what would be happened if IGF-1 was overexpressed? Su demonstrated that local over expression of IGF-1 would stimulate milk yield during the first lactation in transgenic mice (Su and Cheng, 2004). However, in transgenic swine, overexpressed IGF-1 notably increased IGF-1 and IGFBP content in milk, while it had no impact on lactation performance (Monaco et al., 2005). Interestingly, Noble found an apparent discontinuity between the enhanced milk production in transgenic sows and the increased growth rate of piglets (Noble et al., 2002). Sometimes IGF-1 may not increase milk production, but it really exerted effect in another form (increasing the piglet growth speed). So the over expression of IGF-1 in goat stand a good chance for increasing milk production. Milk protein regulatory elements were wildly used in regulating lactation gene expression. Recent studies showed that β-lactoglobulin and β-casein obtained high level expression in mammary gland of rat (Lee et al., 1996), sheep (Wright et al., 1991), goats (Parker et al., 2004) and cows (van Berkel et al., 2002). Plasmid pBC1 used in this experiment contained a goat β-casein 5 ' regulatory element which could regulate the downstream gene expression (Kang et al., 1998). Research on lactating mammary of goat, sheep and cattle found that αs1- and β-casein transcripts were translated three to four fold more efficiently than αs2- and κ-casein transcripts. The percentage of αs1-Cas mRNA dramatically dropped from 30% (αs1-CasA/A) to 3% (αs1CasE/F), with an intermediate value (17%) (αs1-CasA/E)

(Bevilacqua et al., 2006). In order to verify plasmid bioactivity, plasmid pIN was transiently transfected into human breast cancer cell line Bcap-37 (Zhang et al., 2009). Quantitative PCR results showed that pIN could be transcribed successfully in Bcap-37 cell line. The high level expression of IGF-1 mRNA in transfected group not only proved that β-casein 5′ regulatory element highly initialed the transcription, but also verified that Bcap-37 cell line was suitable for detecting gene expression. In this study, Western blotting result showed that IGF-1 were expressed at different times (12, 24, 36 and 48 h) and different treatments (control group, transfect group, transfect and inducted group), while the concentration of IGF-1 had no significant difference. Taking into account the detection limit of Western blot, we further detected the content of IGF-1 by RIA. RIA results showed that the contents of IGF-1 in cell lysate and cell culture medium were increased with time lasting in control group. However, the increment of IGF-1 was slow and low, which implied that Bcap-37 cells could express IGF-1 stably at a low level. In general, the content of IGF-1 changed greatly in other two groups at different time. At the beginning (12 h), transfection group and transfection with induction group conveyed much more IGF-1 than that in control group. The significant difference (P<0.05) between control group and transfection group convinced us that plasmid pIN played its role in expressing IGF-1. The IGF-1's increment at 12 h was primarily attributed to the increment in cell lysate (Figures 4A and B), which meant that IGF-1 was produced in cells while it did not secrete into cell culture medium at 12 h. As times went on, the IGF-1 contents in transfection and transfection with induction group were only slightly higher than that in control group at 24 h. We supposed that all plasmid pIN were expressed at 12 h. A part of plasmid did not integrate into cells, so they lost the capacity to express IGF-1 which resulted in the drop down of IGF-1 content in

6954

Afr. J. Biotechnol.

Figure 6. The detection of established transgenic cell lines by PCR. Lanes 1, 2 and 3, Positive transgenic cell lines; -, negative clone; +, plasmid pIN; M, marker DNA.

24 h. The other hypothesis was that the transfection greatly harmed cells which consumed some IGF-1 to repair. Yee proved that IGF-1 was a potent survival factors for mammary epithelial cells (Yee and Wood, 2008). When the detection journey paused at 36 h, the content of IGF1 in transfection and transfection with induction group had a huge increase, which was significantly higher than that in control group at 36 h. Results in 36 h hinted us that plasmid pIN was stably enrolled into cell chromosome or cells were fully recovered from the damage caused by transfection. Interestingly, the expression of IGF-1 in 36 h reached to a peak. It was also very important to stress that based on our research, the increment of IGF-1 was primarily due to the increasing IGF-1 in cell culture medium which hinted that IGF-1 was synthesized and secreted into cell cultural medium in 36 h. The expression of total IGF-1 showed a downward trend at 48 h. Surprisingly, the content of IGF-1 in cells cultural medium did not decrease notably, especially for transfection group and transfection with induction group which kept a high level of IGF-1 expression in 48 h. However in cells lysate, the content of IGF-1 declined notably in 48 h. This result confirms that the expressed IGF-1 was continuously secreted into cells cultural medium at 48 h. As for the reason, the depletion of nutrient might have led to lack of raw materials to synthesize IGF-1, which would result in the reduction of IGF-1 in cell lysate. Meanwhile, it was important to note that based on our analysis, obvious increase in IGF-1 protein expression in injection side cannot be attributed specifically to plasmid pIN. Observations in vivo also found that the expression level of IGF-1 protein increased not only in injection sides but also in non-injection sides. This overall rising, whether direct, indirect, or both, would require a coordinated response within the mammary gland that involved in many different pathways.

All RIA statistics showed that transfected cell could express goat IGF-1 protein and had potential to stimulate the increase of IGF-1 in cell level. Results also prove that plasmid pIN had bioactivity in efficiently expressing IGF-1 in mammary gland cells. Previous studies had found that increased activity of mammary epithelial cells would lead to the intensifying of early lactation (Capuco et al., 2001). IGF-1 could not only increase the number of mammary epithelial cells, but also activate the secretion of mammary epithelial cells. Our data suggests that plasmid pIN had the potential to stimulate the expression of IGF-1 in human breast cancer cell line Bcap-37, which probably suggested that plasmid would be effective in transgenic goat. Hadsell et al. (2002) proved that the sustained expression of IGF-1 not only blocked the apoptosis of mammary epithelial cells, but also slowed the aging of mammary cells. Results also confirm that IGF-1 could prolong the time of lactation and increase the milk secretion capacity. Our research demonstrates that plasmidpIN could exhibit favorable bioactivity in efficiently expressing IGF-1, which would be a promising way in increasing the milk production. REFERENCES Bevilacqua C, Helbling JC, Miranda G, Martin P (2006). Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants. Reprod. Nutr. Dev. 46: 567-578. Burgos SA, Cant JP (2010). IGF-1 stimulates protein synthesis by enhanced signaling through mTORC1 in bovine mammary epithelial cells. Domest. Anim. Endocrinol. 38: 211-221. Capuco AV, Wood DL, Baldwin R, McLeod K, Paape MJ (2001). Mammary cell number, proliferation, and apoptosis during a bovine lactation: relation to milk production and effect of bST. J. Dairy. Sci. 84: 2177-2187. Hadsell DL, Bonnette SG, Lee AV (2002). Genetic manipulation of the IGF-I axis to regulate mammary gland development and function. J. Dairy. Sci. 85: 365-377. Hadsell DL, Greenberg NM, Fligger JM, Baumrucker CR, Rosen JM (1996). Targeted expression of des (1-3) human insulin-like growth

Lin et al.

factor I in transgenic mice influences mammary gland development and IGF-binding protein expression. Endocrinology, 137: 321-330. Hadsell DL, Parlow AF, Torres D, George J, Olea W (2008). Enhancement of maternal lactation performance during prolonged lactation in the mouse by mouse GH and long-R3-IGF-I is linked to changes in mammary signaling and gene expression. J. Endocrinol. 198: 61-70. Kang YK, Lee CS, Chung AS, Lee KK (1998). Prolactin-inducible enhancer activity of the first intron of the bovine beta-casein gene. Mol. Cells, 8: 259-265. Kaskous S, Grun E, Gottschalk J, Hippel T (2003). The behavior of lactogenic and steroid hormones in the blood of Awassi ewes in Syria during lactation. Berl. Munch. Tierarztl. Wochenschr. 116: 117-123. Lee CS, Kim K, Yu DY, Lee KK (1996). An efficient expression of human growth hormone (hGH) in the milk of transgenic mice using rat betacasein/hGH fusion genes. Appl. Biochem. Biotechnol. 56: 211-222. Loladze AV, Stull MA, Rowzee AM, Demarco J, Lantry JH, Rosen CJ, Leroith D, Wagner KU, Hennighausen L, Wood TL (2006). Epithelialspecific and stage-specific functions of insulin-like growth factor-I during postnatal mammary development. Endocrinology, 147: 54125423. Monaco MH, Gronlund DE, Bleck GT, Hurley WL, Wheeler MB, Donovan SM (2005). Mammary specific transgenic over-expression of insulin-like growth factor-I (IGF-I) increases pig milk IGF-I and IGF binding proteins, with no effect on milk composition or yield. Transgenic. Res. 14: 761-773. Noble MS, Rodriguez-Zas S, Cook JB, Bleck GT, Hurley WL, Wheeler MB (2002). Lactational performance of first-parity transgenic gilts expressing bovine alpha-lactalbumin in their milk. J. Anim. Sci. 80: 1090-1096. Parker MH, Birck-Wilson E, Allard G, Masiello N, Day M, Murphy KP, Paragas V, Silver S, Moody MD (2004). Purification and characterization of a recombinant version of human alpha-fetoprotein expressed in the milk of transgenic goats. Protein Expr. Purif. 38: 177-183. Plante I, Stewart MK, Laird DW (2011). Evaluation of mammary gland development and function in mouse models. J. Vis. Exp. 53: 28282836. Prosser CG, Davis SR, Farr VC, Moore LG, Gluckman PD (1994). Effects of close-arterial (external pudic) infusion of insulin-like growth factor-II on milk yield and mammary blood flow in lactating goats. J. Endocrinol. 142: 93-99.

6955

Ruan W, Kleinberg DL (1999). Insulin-like growth factor I is essential for terminal end bud formation and ductal morphogenesis during mammary development. Endocrinology, 140: 5075-5081. Su HY, Cheng WT (2004). Increased milk yield in transgenic mice expressing insulin-like growth f actor 1. Anim. Biotechnol. 15: 9-19. Tokunou T, Miller R, Patwari P, Davis ME, Segers VF, Grodzinsky AJ, Lee RT (2008). Engineering insulin-like growth factor-1 for local delivery. Faseb. J. 22: 1886-1893. Van Berkel PH, Welling MM, Geerts M, Van Veen HA, Ravensbergen B, Salaheddine M, Pauwels EK, Pieper F, Nuijens JH, Nibbering PH (2002). Large scale production of recombinant human lactoferrin in the milk of transgenic cows. Nat. Biotechnol. 20: 484-487. Wright G, Carver A, Cottom D, Reeves D, Scott A, Simons P, Wilmut I, Garner I, Colman A (1991). High level expression of active human alpha-1-antitrypsin in the milk of transgenic sheep. Biotechnology (N. Y.). 9: 830-834. Yee D, Wood TL (2008). The IGF system in mammary development and breast cancer. Preface. J. Mammary. Gland. Biol. Neoplasia, 13: 351352. Zhang X, Wu Y, Luo F, Su H, Bai Y, Hou Y, Yu B (2009). Construction of targeting vector for expressing human GDNF in cattle mammary gland. Appl. Biochem. Biotechnol. 159: 718-727. Zinovieva N, Lassnig C, Schams D, Besenfelder U, Wolf E, Muller S, Frenyo L, Seregi J, Muller M, Brem G (1998). Stable production of human insulin-like growth factor 1(IGF-1) in the milk of hemi- and homozygous transgenic rabbits over several generations. Transgenic Res. 7: 437-447.

African Journal of Biotechnology Vol. 11(27), pp. 6956-6964, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3283 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

A quick DNA extraction protocol: Without liquid nitrogen in ambient temperature Jannatul Ferdous1*, M M Hanafi1, Rafii M Y2 and Kharidah Muhammad3 1

Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia. Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia. 3 Department of Food Science, Faculty of Food Science and Technology, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.

Accepted 12 March, 2012

Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction protocol has been described for different tissues of color rice and other plant species which contain pigment and polyphenolic compound. This method has been modified from well known cetyltrimethylammonium bromide (CTAB) method where CTAB is used for DNA extraction. This protocol is simple and fast compared to other methods and no liquid nitrogen is required. Only inexpensive chemicals and ordinary laboratory equipments are enough for DNA extraction. The quantity of total genomic DNA from different tissues was almost similar which was extracted from 10 mg samples. The extracted DNA is stable and applicable to marker assisted selection, DNA fingerprinting, quantitative traits loci analysis, screening of transformants and enzymatic digestion. Key words: Different plant tissues, inexpensive, rice flour, rapid DNA extraction. INTRODUCTION Marker assisted selection, diversity assessment, germplasm identification, quantitative traits loci analysis and transformants screening are the important techniques in the molecular study. Hundreds to thousands samples need to be processed for the above-mentioned analysis and rapid DNA extraction with expectable quality is the prerequisite for such kind of experiments (Post et al., 2003). Several authors (Muray and Thompson,1980; Dellaporta et al., 1983; Doyle and Doyle, 1990)

*Corresponding author. E-mail: jannatulupm@gmail.com. Tel: +6-0102100738. Abbreviations: CAPs, Cleaved amplified polymorphic sequence; CIP, chloroform, isoamyl alcohol and phenol; CTAB, cetyltrimethylammonium bromide; EDTA, ethylenediaminetetraacetic acid; GAPDH, glyceraldehyde 3phosphate dehydrogenase; ITS1, internal transcribed spacer1; SDS, sodium dodecyl sulfate; SSR, simple sequence repeat.

described DNA extraction methods which are widely used in plant molecular biology, but most of the protocols are time consuming, comparatively expensive and requires liquid nitrogen for grinding (Sharma et al., 2003; Allen et al, 2006). The cetyltrimethylammonium bromide (CTAB) method is one of the most popular protocol for rice DNA isolation, including other plants, bacteria (Caccavo et al., 1994), fungi (Thuan et al., 2006) and animals (Shahjahan et al., 1995). A number of modifications have been made on CTAB method (Kang et al., 1998; Allen et al., 2006). Some methods have been reported to minimize the DNA extraction steps but they need a large amount of plant tissue and liquid nitrogen (Tussell et al., 2005). Usually, leaf tissues are frequently used for DNA extraction from different plants. Many researchers suggested using the fresh tissue, but it has some limitations such as the glass house or field required for plantation as well as liquid nitrogen is essential for collection and storage. Continuous liquid nitrogen supply is a problem in many developing countries because purchasing time is

Ferdous et al.

6957

Table 1. List of primers used in the study.

Primer name Wx

Primer sequence F: ACCATTCCTTCAGTTCTTTG R: ATGATTTAACGAGAGTTGAA

Product size (bp)

Type of marker

530

CAPs

Specific for copper/zinc-superoxide dismutase

RSODA

F: ATGGTGAAGGCTGTTGTTGT R: TCAGCCTTGAAGTCCGATGA

359

RM1

F: GCGAAAACACAATGCAAAAA R: GCGTTGGTTGGACCTGAC

82-126

SSR

RM536

F: TCTCTCCTCTTGTTTGGCTC R: ACACACCAACACGACCACAC

211-249

SSR

GTGATCGCAG

250-1170

RAPD Housekeeping

OPA-7 GAPDH ITS1

F: GAAGTAAAAGTCGTAACAAG R: CCTCCGCTTATTGATATGC

unpredictable from overseas. In addition, to store fresh tissue in -80°C fridges is another constrain. Moreover, it needs few weeks to few months from plantation to fresh tissue collection and also requires more attention for management practices. To overcome these problems Kang et al. (1998) developed a DNA extraction method using the dry half seeds of rice, and Ahmadikhah (2009) described a rapid method for DNA isolating from rice seed. But rice flour has not been used extensively for DNA extraction. Rice flour can be used any time and minimizes the step at grinding phase. This protocol is also applicable to other plant species such as oil palm, banana, Moringa and fungus. The objective of this study was to develop a simple and rapid method to isolate DNA under normal laboratory condition (room temperature) from small amount of tissue for large number of samples. MATERIALS AND METHODS Rice flour, seeds and leaves of two high yielding varieties BR16 and MR219 were used for DNA extraction and leaves of Moringa, oil palm, banana and fungus (Fusarium proliferatum) were used to evaluate the efficiency of this protocol. All leaves samples were collected in polyethylene beg on ice and stored at 4°C. Primers Extracted DNA was amplified with simple sequence repeat (SSR), cleaved amplified polymorphic sequence (CAPs), random amplified polymorphic DNA (RAPD) markers and specific primer (Table 1). Solutions and buffers The solutions used were: 1M Tris-HCl (prepared using 121.14 g Tris-HCl dissolved in 800 ml deionized water and adjudged to pH 8.0 using concentrated HCl. Then top up the total volume to 1 L

530

Species specific

with de-ionized water) and 0.5M EDTA (prepared using 186.12 g of EDTA dissolved in 800 ml de-ionized water). Ten molar (10 M) NaOH solution was used to adjust the pH to 8.0. Then top up the total volume to 1 L with de-ionized water. EDTA alone will not dissolve unless NaOH is added. Other solutions include: 3.5M NaCl (204.54 g NaCl added into 800 ml of de-ionized water and adjudged the final volume to 1 L with de-ionized water); 5% SDS: (5 g SDS dissolved into 100 ml de-ionized water); 2% CTAB (2 g CTAB dissolved into 100 ml de-ionized water); 1% PVP: (1 g PVP added into 100 ml 2X CTAB solution); and 70% ethanol (71.5 ml 95% ethanol mixed with 28.5 ml de-ionized water. The buffers used include: Extraction buffer, 2X CTAB solution, chloroform: isoamyl alcohol (24:1) with 5% phenol (CIP), 5X Trisborate-EDTA (TBE) buffer, 1X TBE buffer and 1X TE buffer. Their composition and preparation are shown in Tables 2 to 7, respectively. DNA extraction procedure Four hundred microliters (400 µL) extraction buffer and 400 µL of 2 X CTAB solution were added into 2 ml Eppendorf tube containing 0.01 g of rice flour. In case of leaf and seed, 0.01 g tissues were ground with 600 µL extraction buffer by mortar and pestle and poured into 2 ml Eppendorf tube. Then 400 µL of 2X CTAB solutions and 400 µL chloroform: isoamyl alcohol: phenol (24:1:5%) mixture were added in the same tube. The mixture was mixed well by vortex mixture and centrifuged at 8,400 × g in microcentrifuge at room temperature for 10 min. The supernatant was transferred into new tubes. Two third volume of isopropanol was added and mixed gently by inverting the Eppendorf tube. The tubes were incubated at room temperature for 10 to 15 min and centrifuged at 8,400 × g for 5 min. Supernatant was removed and the DNA pellet was washed with 70% ethanol. Afterward the pellet was air-dried and resuspended into 50 µL TE buffer. The quality and quantity of extracted DNA were measured by NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, USA). Polymerase chain reaction (PCR) amplification Polymerase chain reaction (PCR) reaction was carried out in a

6958

Afr. J. Biotechnol.

Table 2. Composition and preparation of the extraction buffer.

Reagent Tris HCl (pH 8) EDTA (pH 8) NaCl SDS De-ionized water

Stock Solution 1M 0.5 M 3.5 M 5% -

Final concentration 200 mM 25 mM 200 mM 0.5% SDS -

100 ml preparation 20 ml 5 ml 5.7 ml 10 ml 59.3 ml

Table 3. Composition and preparation of the 2X CTAB solution.

Reagent Tris HCl (pH8) EDTA (pH8) NaCl CTAB PVP De-ionized water

Stock solution 1M 0.5 M 3.5 M -

Final concentration 100 mM 20 mM 1.4 M 2% (w/v) 1% (w/v)

Table 4. Composition and preparation of the chloroform: isoamyl alcohol (24:1) with 5% phenol (CIP).

Reagent Chloroform Isoamyl alcohol Phenol

100 ml preparation 91.2 ml 3.8 ml 5 ml

Table 5. Composition and preparation of the 5X TBE buffer.

Reagent Tris HCl (pH 8) EDTA (pH 8), 0.5 M Boric acid Water

1 L preparation 54 g 20 ml 27.5 g Up to 1 L

volume of 25 µL, including 1 µL template DNA directly used after extraction. Five microliters 5X Green GoTaq® Flexi Buffer, 3 µL MgCl2 solution (25 mM), 0.5 µL PCR nucleotide mix (10 mM each), 0.2 µL primers (0.4 µmol), and 1.0 U of Taq DNA polymerase were used according to the company instruction (Promega) for both SSR and RAPD markers. The optimum annealing temperature was determined for specific primer. The following condition was performed for PCR amplification of SSR marker: initial denaturation for 5 min at 95°C, followed by 35 cycles of denaturation at 94°C for 1 min, annealing (temperature varies with primer) for 1 min, and 2 min extension at 72°C. Final extension was performed for 7 min at 72°C (Ahmadikhah, 2009). In random amplified polymorphic DNA (RAPD) analysis, the following condition was used: initial denaturation at 94°C for 1 min

100 ml preparation 10 ml 4 ml 40 ml 2g 1g 46 ml

Table 6. Composition and preparation of the 1X TBE buffer.

Reagent 5X TBE De-ionized water

1 L preparation 200 ml 800 ml

followed by 45 cycles of denaturation at 94°C for 1 min, annealing at 34°C for 1.5 min and extension at 72°C for 2 min and a final extension at 72°C for 5 min (Resmi et al., 2007). Gel electrophoresis Three microliters of genomic DNA was subjected to electrophoresis with 1% (w/v) agarose gel at 75 volt for 40 min to check the DNA quality and the amplified PCR products were further subjected to electrophoresis on 3% (w/v) MetaPhor agarose gel for 70 min. 1× TBE running buffer were used to prepare and run the gel. Finally, the gel was stained with ethidium bromide and visualized under ultraviolet (UV) light. Restriction digestion Two hundred nanograms of PCR product (amplified with Wx primer) were digested with 1 µL of FastDigest AccI (Xmil) restriction enzymes at 37°C for 1.5 h following the manufacturer’s recommendation (Fermentas). The digested DNA (10 µL) was subjected to electrophoresis on 1% agarose gel at 75 volt for 40 min and viewed under ultraviolet (UV) light.

RESULTS The quality and quantity of extracted DNA were

Ferdous et al.

6959

Table 7. Composition and preparation of the 1X TE buffer.

Reagent Tris HCl (pH 8) EDTA (pH 8), 0.5M De-ionized water

Stock solution (M) 1 0.5 -

Final concentration (mM) 10 1

100 ml preparation 1 ml 0.2 ml 97.8 ml

Table 8. Quantity and quality of genomic DNA extracted from different tissues measured by Nanodrop spectrophotometer.

Tissue BR16 leaf BR16seed BR16 flour BR16 flour (with kit) MR219 leaf MR219seed MR219 flour MR219 flour (with kit) Oil palm leaf Banana leaf Maringa sp Fusarium sp

Concentration (ng/µL) 327.22 ± 30.88 315.85 ± 28.65 262.14 ± 8.92 14.11 ± 3.79 307.70 ± 21.72 321.07 ± 18.58 313.56 ± 41.19 30.25 ± 3.43 85.98 ± 5.63 108.86 ± 12.02 624.57 ± 18.45 215.94 ± 20.21

Purity A260/280 2.09 ± 0.05 2.09 ± 0.04 2.02 ± 0.05 1.97 ± 0.05 2.04 ± 0.03 2.06 ± 0.02 2.01 ± 0.09 1.83 ± 0.02 2.03 ± 0.04 2.19 ± 0.01 1.88 ± 0.02 2.13 ± 0.03

A260/230 2.11 ± 0.03 2.17 ± 0.01 2.26 ± 0.1 1.85 ± 0.03 2.13 ± 0.04 2.14 ± 0.03 2.16 ± 0.02 1.95 ± 0.07 2.35 ± 0.07 2.45 ± 0.05 2.01 ± 0.02 2.05 ± 0.02

Values are mean (±SE) (n= 3).

measured by NanoDrop ND-1000 spectrophotometer V5.3 2 (NanoDrop Technologies, Wilmington, USA). The yields of extracted DNA ranged from 85.98 - 624.5 ng/µL. The ratio of 260/280 and 260/230 were 1.88 to 2.19 and ≤ 2, respectively (except DNA extracted by commercial kit) (Table 8). A ratio of absorbance 260/280 and 260/230 are used to assess the purity of nucleic acid and secondary measurement, respectively. The accepted range of 260/280 and 260/230 ratios are commonly in ~1.8 and 2 - 2.2, respectively (Thermo Scientific, 2011). The spectral structure of extracted DNA (Figure 1B and C) using this protocol was similar to typical spectral pattern (Figure 1A) (Thermo Scientific, 2011). The quality of extracted genomic DNA was also checked by 1% agarose gel electrophoresis (Figures 2A and B). To verify the suitability of extracted DNA for PCR amplification, simple sequence repeat (SSR), cleaved amplified polymorphism sequence (CAPs) markers and specific primers were used (Figure 3A, B and D). PCR was also performed with RAPD markers OPA-7 using DNA of Moringa and was successfully amplified (Figure 3C). The species specific primer ITS1 was used to amplify fungus (F. proliferatum) DNA. To assess the genetic diversity of rice genotypes, RM1 and RM536 were used and polymorphic products were amplified at 82 - 126 and 211 - 249 bp, respectively. A PCR-AccI

CAPs marker (Wx) was used to examine the amylose content of rice genotypes which amplified at 530 bp (Figure 4A). The PCR product was completely digested with AccI and two DNA fragments were obtained (405 and 125 bp), indicating high amylose content of BR16 (Figure 4B) (Liu et al., 2006). Furthermore, to check the suitability of the extracted DNA, one-year old DNA was amplified with RM536 (Figure 5A); the DNA was amplified same as before. PCR product was also used to test the stability. Extracted DNA was amplified with RM1 (SSR marker) just after DNA extraction (Figure 5B) and stored at 4°C. The same PCR products were also subjected to electrophoresis after 1 year and the same results were obtained as before (Figure 5C). DISCUSSION In the described protocol, no liquid nitrogen was required for the storage and grinding of the tissues. In addition, the expensive chemicals have not been used. To trim down the time, the extraction buffer was directly added to the rice flour, while rice seed and leaf tissues of different plants were ground with extraction buffer. No incubation has been required for DNA extraction in both cases, but

6960

Afr. J. Biotechnol.

B Figure 1. Comparison of Nanodrop spectrophotometry measurements of extracted DNA from rice flour to determine the quality of DNA. (A) Typical spectral pattern of nucleic acid supplied by Thermo scientific. (B) Spectral pattern of BR16 rice flour measured immediately after extraction. (C) Same DNA (BR16 rice flour) measured after two years.

quality and quantity of extracted DNA were similar with or without incubation in extraction buffer (data not shown). However, Rajendrakumar et al. (2011) reported that DNA

degradation occurred when seed was ground before incubation in the buffer which disagrees with the finding of our study. Moreover, DNA extraction buffer, CTAB

Ferdous et al.

6961

C Figure 1. Contd.

1 2

3 4

5 6 7

8 9 10 11

M 1

2 3

Figure 2. Quality test of DNA samples from different plant tissues on 1% (w/v) agarose gel. (A) Lane M, 1 kb DNA ladder; lane1, BR16 leaf; lane 2, BR16 seed; lane 3, BR16 flour; lane 4, MR219 leaf; lane 5, MR219 seed; lane 6, MR219 flour; lane 7, BR16 flour extracted with kit; lane 8, MR219 flour extracted with kit; lane 9, oil palm leaf; lane 10, banana leaf; lane 11, Fusarium proliferatum. (B) Lane M, 100 bp DNA ladder; lanes 1 to 3, Moringa from different genotypes.

solution and CIP were added in the same step to reduce the time. The DNA extraction from rice flour required approximately 50 min for 20 - 25 samples and 80 min for seed and leaf which indicates that 2.5 - 3 min is required

for each sample. In this study, very common chemicals were used for DNA extraction instead of costly chemicals. Several authors used expensive chemicals such as RNase

6962

Afr. J. Biotechnol.

M 1 2

3 4 5 6 1000 bp

1 5

100 bp 500 bp

A 1

B B

500 bp 500 bp

Figure 3. PCR amplification with extracted DNA on 3% MetaPhor agarose gel. (A) CAPs marker for Wx gene amplification with different tissues of two rice genotypes. Lane M, 100 bp DNA ladder; lane1, BR16 leaf; lane 2, BR16 seed; lane 3, BR16 flour; lane 4, MR219 leaf; lane 5, MR219 seed; lane 6, MR219 flour. (B) Lane 1, Fusarium proliferatum with specie specific marker (ITS1); lane M, 50 bp DNA ladder; lane 2, oil palm with specific primer (Wx) for waxy gene; lane 3, oil palm with housekeeping gene (GAPDH); lane 4, banana with specific primer (Wx) for rice waxy gene. (C) Lanes 1 to 3: Moringa with OPA-7 RAPD marker; lane M, 100 bp DNA ladder. (D) Lane 1, 100 bp DNA ladder; lane 2, DNA from rice flour amplifies with specific primer of RSODA gene.

(Ahmadikhah, 2009) and proteinase K (Kang et al., 1998) for rapid and simple DNA extraction. And the quality of extracted DNA was high enough to PCR amplification for marker assisted selection and genetic diversity analysis (Figures 5A to C) without RNase and proteinase K. The amplified PCR products of rice flour DNA showed similar banding patterns and intensity like seed and leaf tissues (Figure 3A). The amplification of expected bands with SSR, CAPs, RAPD and specific primer were evident of good quality genomic DNA without RNase and proteinase K. The complete digestion of PCR product with AccI

indicated that the extracted DNA is also useful for genetic manipulation. The extracted DNA samples and PCR products in the present study were stable more than 1 year, but extracted DNA was unstable in a rapid DNA extraction protocol developed by Warner et al. (2001). Commercial DNA extraction kit is not economic for marker assisted selection or diversity analysis in which large number of samples is used. DNA was extracted by â&#x2C6;&#x161; Gene Allâ&#x201E;˘ Plant SV mini DNA extraction kit and it was observed that concentration was too low to amplify (Figure 2 and Table 8). Therefore, this protocol was

Ferdous et al.

400 bp 500 bp

405 bp

530 bp

125 bp

100bp

Figure 4. Undigested and digested PCR product of waxy gene (Wx). (A) Amplified PCR product (530 bp) of Wx gene. Lane M, 100 bp DNA ladder; lane 1, PCR product .(B) Digestion with AccI from amplified PCR product of Wx gene. Lane M, 50 bp DNA ladder; lane 1, PCR product digested with AccI and after electrophoresis, two DNA fragments were obtained (405 and 125 bp).

3 4

7 8

9 10 11 12 13 14 15 16 17 18 19

20 C

150 bp

A M

150

1 2

6 7

9 10

11 12 13 14 15

16 17 18 19 20 C

11 12 13

100 bp

B M

150

100

1 2

5 6

9 10

14 15

17 18 19 20 C

C Figure 5. Amplification of extracted DNA from flour of different color rice using SSR marker. (A) Lane M, 50 bp DNA ladder; lanes 1 to 20, DNA of different rice genotypes using after one year with RM536; C, negative control. (B) Lane M, 50 bp DNA ladder; lanes 1 to 20, PCR product amplified with RM1 immediate after DNA extraction; C, negative control. (C) Lane M, 50 bp DNA ladder; lanes 1 to 20, PCR product amplified with RM1 after one year of DNA extraction; C: negative control. Lane 1= BR16; lane 2= BR29; lane 3 = MR219; lane 4 = MR220; lane 5 = Bukit Garam582; lane 6 = Bukit Garam753; lane 7 = Bukit Garam1334; lane 8 = Bukit Garam1449; lane 9 = NERICA7; lane 10= Tenom; lane 11= Karibang; lane 12= Karingam; lane 13= Padi Hijau Menis; lane 14= Padi Beleong; lane 15= Padi Durak B; lane 16= Padi Kalopak; lane 17= Bukit Merah; lane 18= Bukit Hitam; lane 19 = Bukit Kelakak; lane 20= Padi Padi.

6963

6964

Afr. J. Biotechnol.

found to be potential for DNA extraction using different tissues of rice and other plants. ACKNOWLEDGEMENTS Authors are grateful to the Organization for Women in Science for the Developing World (OWSDW) and Universiti Putra Malaysia for financial support during the study period. We are also thankful to Bangladesh Rice Research Institute (BRRI) for providing deputation to Jannatul Ferdous for PhD study. REFERENCES Ahmadikhah A (2009). A rapid mini-prep DNA extraction method in rice (Oryza sativa). Afr. J. Biotechnol. 8(2): 323-327. Allen GC, Vergara MAF, Krasnyanski S, Kumar S, Thompson WF (2006). A modified protocol for rapid DNA isolation from plant tissue using cetyltrimethylammonium bromide. Nature protocols 1: 23202325. Caccavo F, Lonergan DJ, Lovely DR, Davis M, Stolz JF, Mclnerney MJ (1994). Geobacter sulfurreducens sp-nov, a hydrogen-oxidizing and acetate-oxidizing dissimilatory metal-reducing microorganism. Appl. Environ. Microbiol. 60: 3752-3759. Dellaporta SL, Wood J, Hicks JB (1983). A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1: 19-21. Doyle JJ, Doyle JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11-15. Kang HW, Yong GC, Ung han Y, Moo YE (1998). A Rapid DNA Extraction Method for RFLP and PCR Analysis from a Single Dry Seed. Plant Mol. Biol. Rep. 16: 1-9. Liu QQ, Li QF, Cai XL, Wang HM, Tang SZ, Yu HX, Wang ZY, Gu MH (2006). Molecular marker-assisted selection for improved cooking and eating quality of two elite parents of hybrid rice. Crop Sci. 46: 2354-2360.

Murray MG, Thompson WF (1980). Rapid isolation of high molecular weight plant DNA. Nucleic acids Res. 8: 4321-4325. Post Rv, Post Lv, Dateg C, Nilssson M, Froster BP and Tuvesson S (2003). A high-throughput DNA extraction method for Barley seed. Euphytica, 130: 255-260. Rajendrakumar P, Sujatha K, Rao KS, Nataraj Kumar P, Viraktamath BC, Balachandran SM, Biswal AK, Sundaram RM (2011). A protocol for isolation of DNA suitable for rapid seed and grain purity assessments in rice. Rice Genetics Newsletter Available at www.shigen.nig.ac.jp/ rice/ oryzabase/ rgn/pdf/23_25.pdf (Accessed 12 July 2011) 23: 92-95. Resmi DS, Celine VA, Rajamony L, Sony KB (2007) Detection of genetic variability in Dramstick (moringa oleifera lam.) using RAPD markers. Recent trends in horticultural biotechnology, 2007. Eds Raghunath Keshvachandran et al., New India Publishing agency, New Delhi (India) pp. 587-592. Shahjahan RM, Hughes KJ, Leopold RA, DeVault JD (1995). Lower incubation temperature increases yield of insect genomic DNA isolated by the CTAB method. Biotechniques, 19: 332-334. Thermo Scientific. (2011). T042 Technical Bulletin. NanoDrop Spectrophotometers. Available at: http://www.nanodrop.com/default.aspx (Accessed 1July 2011). Thuan NTN, Bigirimana J, Roumen E, Straeten DVD, Hofte M (2006). Molecular and pathotype analysis of the rice blast fungus in North Vietnam. Eur. J. Plant Pathol. 114: 381-396. Tussell RT, Ramayo AQ, Herrera RR, Saavedra AL Brito DP (2005). A fast simple and reliable high yielding method for DNA extraction from different plant species. Mol. Biol. 31: 137-139.

African Journal of Biotechnology Vol. 11(27), pp. 6965-6973, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3540 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Structure modeling and mutational analysis of gap junction beta 2 (GJB2) Samina Bilal1,3, Hamid Rashid1, Jabar Zaman Khan Khattak2, Shehzad Ashraf Ch3, Tahira Sultana4 and Asif Mir2* 1

Department of Bioinformatics, Mohammad Ali Jinnah University, Islamabad, Pakistan. Department of Bioinformatics and Biotechnology, International Islamic University, Islamabad, Pakistan. 3 Department of Computer Science and Software Engineering, International Islamic University, Islamabad, Pakistan. 4 Department of Environmental Sciences, International Islamic University, Islamabad, Pakistan. 2

Accepted 22 March, 2012

The genome sequencing accomplishes complete genetic blue prints for hundreds of organisms, including humans. In the current era, we are trying to focus on analyzing, controlling and modifying functions of proteins encoded by these genomes. This task is attained by protein three dimensional structures. Three dimensional (3 D) structure is very useful for understanding biological functions. Gap junction beta 2 (GJB2), human gene encoding for gap junction beta 2 protein is involved in various hearing disorders in Pakistani families. After the first report of GJB2 involvement in Pakistani families, it was necessary to further study this protein. Therefore, a 3D structure of GJB2 was developed using comparative modeling approach. For modeling, a template was selected by blastp at NCBI and the best template selected was 2ZW3. By comparing the template-target sequence, a model was created using MODELLER, a program for homology modeling. The accuracy of the predicted structure was checked using Ramachandran plot which showed that the residue falling in the favored region was 92.4%. The predicted GJB2 model can be used to understand the defects that lead to deafness and eventually in drug designing. Domains and different properties of GJB2 were analyzed by applying online servers. Most frequent mutations of GJB2 were discussed by differentiating between damaging and benignity. Key words: GJB2, 3D structure, 2ZW3, DFNB1, MODELLER. INTRODUCTION Deafness is a state in which aptitude to perceive certain frequency of sound is completely or partially impaired. In humans, the term hearing impairment is usually reserved for people who have virtual insensitivity to sound in the speech frequencies. Research in deafness became real necessity in our common life (Karen, 2000; Sterkers et al., 1982). Indeed, this is a real and serious problem causing social disintegration of a wide percent of the active society. Hearing impairment is the result of abnormal ear development, abnormal ear function or both. It is the most common sensory disorder affecting 1 in 1000 newborns world-wide (Cohen and Gorlin, 1995). It is estimated that the prevalence of profound bilateral

*Corresponding author. E-mail: mir77uspk@gmail.com.

hearing loss is 1.6 per 1000 in Pakistani population. (http://www.jpma.org.pk/full_article_text.php?article_id=2 089). More than 100 loci have been associated with the nonsyndromic hearing loss, with majority of the cases (~80%) being autosomal recessive in inheritance (Cryns et al., 2004). DFNB1 at 13q12 is the first locus identified for hearing impairment and is subsequently focused more because of its complexity and clinical relevance. It harbors the gene GJB2 (Denoyelle et al., 1997; Green et al., 1999), a human gene encoding for Gap junction protein, beta 2, 26kDa or Connexin 26. Defects in this gene lead to the most common form of congenital deafness in developed countries, called DFNB1, also known as Connexin 26 deafness or GJB2-related deafness. The GJB2 gene is a member of the gap junction or connexin family. This family of genes produces protein

6966

Afr. J. Biotechnol.

Table 1. Percentage similarity between target and template sequence.

Model number

Tool used

Template

1 2 3 4 5 6

Modeller Modeller Swiss-Model Swiss PDB viewer Esyred3d CPH models

2ZW3 1SJ2 2ZW3E 2ZW3 2ZW3A 2ZW3A

subunits for channels (gap junctions) that connect neighboring cells. The channels (which are made from several protein subunits) permit the movement of nutrients, charged atoms (ions), and communication signals between cells. The size of the channel opening and the specific particles that move through the channel are determined by the protein subunits that make up the channel. Connexin26 is believed to play a critical role in the recycling of potassium ions at their entry into hair cells during sensory transduction from the endolymph through to the stria vascularis where other potassium channels pump potassium back into the endolymph (Scott et al., 1998). Gap junction beta 2 protein is found in cells throughout the body, particularly in the inner ear and the skin. Because of its presence in the inner ear, especially the snail-shaped structure called the cochlea, researchers have focused on the role of this protein in hearing. Some studies indicate that channels made with gap junction beta 2 protein help to maintain the correct level of potassium ions. Other research suggests that the GJB2 gene is required for the maturation of certain cells in the cochlea. Kelsell et al. (1997) identified the first nonsyndromic hearing impairment (NSHI) gene, the gap junction beta-2 gene (GJB2), which encodes for Connexin 26 (Cx26). At present, there are >100 known sequence variants for GJB2, of which 56 are reported to be associated with ARNSHI (Calvo et al., 2004) Comparative modeling is a practical procedure in bioinformatics and computational biology because this process constructs three dimensional models that are related to known protein structure (template) (Sali and Blundell, 1993; Mart-Renom et al., 2000). Thus, this approach is relevant to structural based functional annotation. As a result, it enhances impact of structure and function on biology and medicine. By using various bioinformatics tools, three dimensional structure of GJB2 was constructed in the present study through comparative homology modeling approach. Our predicted model for GJB2 reduces the need for acquiring protein structure through experimental protocols (x-ray crystallography and nuclear magnetic resonance (NMR)). Furthermore, mutations in GJB2 were analyzed through mutant models.

Similarity (%)

Number of residues modeled

100 28 93 100 100 93

226 226 216 225 216 216

MATERIALS AND METHODS The aminoacid sequence of GJB2 was retrieved from NCBI (http://www.ncbi.nlm.nih.gov/nuccore/195539329?report=genbank). It contains 226 aminoacids. It was confirmed that three dimensional structure of the protein was not available in Protein Data Bank (http://www.rcsb.org/pdb/results/results.do?outformat=). Hence, the current task of predicting 3D model of human GJB2 was performed via homology modeling. Then template of protein GJB2 was searched by BLASTP, scanning the non redundant protein sequence database at NCBI with efficient e-value cut off lesser than threshold, and retaining up templates with considerable e-value. Template 2ZW3 was found satisfactorily and was used further. Web based tools SWISS-MODEL (http://swissmodel.expasy.org/ workspace/index.php? func=modelling_simple1) and CPH models (http://www.cbs.dtu.dk/services/CPHmodels/) obtained templates automatically without any user interference. Swiss-Model is an automated knowledge-based protein modeling server. CPH models sought templates by iteratively aligning the target sequence to non redundant protein sequence database and searching the template protein data bank (PDB) in protein structure database. ESyPred3D uses PSI-Blast at NCBI. All the obtained templates are listed in Table 1. The target and template sequences were then aligned using the alighn2d command of MODELLER (http://www. salilab.org/modeller/8v1/) which uses global dynamic programming, with linear gap penalty for alignment of two profiles. ESyPred3D use neural network method for increasing the alignment performance between the query and template sequence. CPH model uses profile-profile alignment between target and template. Alignment between target and template (2ZW3) shown in Figure 1 is obtained through ClustalW web based tool. A three dimensional structure was built from sequence alignment between GJB2 and template protein using MODELLER8v1. It constructs model by satisfaction of spatial restraints. Distance and dihedral angle restraints on target sequence were derived from alignment with template. Stereochemical restraints such as bond angles and bond lengths were extracted from CHARM22 molecular mechanics force field. Statistical correlation of dihedral angles and non-bonded interatomic distance were extracted from database of family alignments that includes proteins with known 3D structures. CHARMM energy function and these spatial restraints were combined to obtain objective function. Final model was obtained by optimization of objective function using conjugate gradients and molecular dynamics with simulated annealing. 3Djigsaw, CPH models, ESyPred3D automatically build model by using their own set of modeling algorithms. CPH model uses segmod program from the GeneMine package. It further refines the model using encad program from the GeneMine package. The constructed models were subjected to energy minimization by steepest descent, using GROMOS96 force field, implementation of Swiss-pdb Viewer. The accuracy of the predicted model determines information that

Bilal et al.

6967

Figure 1. Multiple sequence alignment between target (GJB2) and template (2ZW3).

can be derived from it; therefore, all the models were evaluated via applying different model assessment web servers. Stereochemical properties were evaluated through procheck (Laskowski et al., 1993). Backbone conformation was evaluated by investigating

PSi/Phi Ramachandran plot using Procheck and RAMPAGE (Laskowski et al., 1993; http://www-cryst.bioc.cam.ac.uk/ servers.html). Packing quality and RMS of model was evaluated using Whatif packing quality control and protein analysis.

6968

Afr. J. Biotechnol.

Table 2. Ramachandran plot values obtained through Procheck, Rampage and Whatif servers.

Model number 1 2 3 4 5 6

Core (%) 87.4 78.6 83.9 83.4 89.9 86.9

Allowed (%) 9.7 15.0 14.7 15.6 8.6 10.1

Procheck Generously (%) 2.9 4.4 1.1 1.0 1.5 2.0

RESULTS AND DISCUSSION Three dimensional structure plays a chief role in studying disease related mutations and in drug designing process. Protein sequence of GJB2 was obtained through NCBI. Templates were obtained using blastp at NCBI. Web based tools obtained templates (http://www-cryst.bioc. cam. ac.uk/servers.html) automatically and are shown in Table 1. Comparative modeling builds a three dimen-sional structure of the target protein based on sequence identity to known protein structures (template) (http:// ww.cryst.bioc.cam.ac.uk/ servers.html; Sali, 1998). Therefore, sequence identity is a good determinant for the quality of the model. Sequence of at least one related structure must have more than 30% identity. Sequence identity between target and templates is shown in Table 1. Among the different alignments, the more related alignment is of models obtained through MODELLER. The template is 2ZW3. MODELLER and web-based tools were used for building the model and global energy minimization. After model building, the structures were validated through energy minimization. Refined models were checked through RAMPAGE and

Rampage Disallowed (%) 0.0 1.9 0.3 0.0 0.0 1.0

Number of residues in favored region (%)

Number of residues in allowed region (%)

92.4 88.8 84.7 85.1 92.5 90.2

6.2 8.0 13.4 13.4 5.1 7.0

PROCHECK. Values for the Ramachandran plot obtained through Procheck are shown in Table 2. The plot is subdivided in core, allowed, generously allowed and disallowed regions. The models obtained through MODELLER and Esypred3D showed better Ramachandran plot values, as core region (>80%) accounts for better structure (Moris et al., 1992). Rampage assessment is shown in Figure 3. Rampage derives Phi/Psi plots for Gly, Pro, PrePro and other residues. The plot was divided into three regions - the favored, allowed and outlier regions. The result for models obtained through MODELLER and Esypred were significant as denser number of residues in favored region (>90%) is the measure of good quality of a model (Morris et al., 1992), but Esypred3D created the model for 216 residues while MODELLER created the model for all 226 residues. The values for Ramachandran plot obtained through Whatif Server are shown in Table 2. The score expressing how well the backbone conformations of all residues are corresponding to the known allowed areas in the Ramachandran plot is within expected ranges for well-refined structures. These results demonstrate that prediction of the

Whatif Number of residues in outlier region (%) 1.3 3.1 1.9 1.6 2.3 2.8

Z-Score -1.124 -1.033 -5.909 -6.237 -0.534 -6.045

best possible target would be a difficult task because the target performing well in one case was not found good in other cases. Esypred3D model tends to have better stereochemistry, whereas it does not hold good sequence similarity and is modeled for 216 residues only. For all the targets described herein, the structure obtained through MODELLER, using 2ZW3 template was found to be satisfactory based on the above results. This model is shown in Figure 2. Ramachandran plot analysis through procheck showed that 87.4% residues are within the core region. RMS and packing quality was evaluated through Whatif and found satisfactory for this model. The predicted structure would be helpful for molecular characterization of proteins. Different regions of GJB2 were determined by web server SMART (http:// smart.emblheidelberg.de/smart/job_status.pl?jobi d =11973310764861289571183-tfEfZVzneN) which shows some important domains that include signal peptide ranging from residue no 1 to 40, Pfam connexin domain from 2 to 124 and four transmembrane regions from 21 to 40, 76 to 98, 132 to 154 and 193 to 215. The interaction network of GJB2 is shown in Figure 4. The

Bilal et al.

6969

Figure 2. Three dimensional structure of GJB2 protein in RasMol 2.7.5.

physical and chemical properties of GJB2 were analyzed utilizing web server Protoparam (http://expasy.org/cgibin/protparam). The results showed that molecular weight: 26215.0 Da, theoretical pI: 9.11, formula: C1216H1876N302O311S16, total number of atoms: 3721, extinction coefficient: 52410 (280 nm). The estimated half-life was: 30 h (mammalian reticu-locytes, in vitro). The instability index (II) was computed to be 42.80; this classifies the protein as unstable. Aliphatic index: 98.67. Grand average of hydropathicity (GRAVY): - 0.288. The GJB2 is composed of 20 kinds of Aminoacids. The most abundant components are Val, Ile, Lys and Phe but low content residues are His, Asn and Gln. Congenital hearing loss occurs in approximately 1 in 1000 live births and 50% of these cases are hereditary. Most cases of hereditary hearing loss are non-syndromic sensorineural hearing loss (Morton, 1991). Recently, significant progress has been made in identifying the genes for non-syndromic hearing loss. Since the mutation of connexin26 (Cx26) gene (GJB2) in a deaf family was identified (Kelsell et al., 1997), half of autosomal recessive non-syndromic deafness was found to be caused by GJB2 mutations (Hong-Joon et al., 2000). Gap junctions are believed to play a role in the recycling of potassium ions back to the endolymph of the cochlear duct after stimulation of the sensory hair cells. The loss of Cx26 would be expected to disrupt this potassium ion flow, thereby leading to hearing loss (Yeager at al., 1998; Steel, 1998). The mutation of the Cx26 gene is a major contributor to autosomal recessive deafness as well as a small percentage of autosomal dominant deafness. GJB2

variants 95G>A(R32H) and 269T>C(L90P) that occurred at conserved residues were deemed possibly damaging, while those at non-conserved residues, variants 341A> G(E114G), 380G>A(R127H), 457G>A(V153I), and 493C>T(R165W) were considered benign. The only exception was 79G>A(V27I), which occurred at a conserved residue based on the homology search but was predicted to be functionally benign. This can be explained by its location at a transmembrane region which for hydrophobic residues is variable in conservation according to a predicted hydrophobic and transmembrane matrix (Ng, 2000). In contrast, 95G>A(R32H) which also occur at the transmembrane region was considered conserved and damaging due to polarity of residues. The 269T>C(L90P) substitution at the transmembrane region, though with a hydrophobic residue, results in a negative PHAT matrix score and was thus considered possibly damaging. The mutations 269T>C(L90P) failed to form functional gap junction channels in cellular studies (Dâ&#x20AC;&#x2122;Andrea et al., 2002; Thonnissen et al., 2002; Bruzzone and Veronesi, 2003). On the other hand, 380G>A(R127H) and 341A>G(E114G) were not different from wild type in functional studies on transfected HeLa cells (Dâ&#x20AC;&#x2122;Andrea et al., 2002; Thonnissen et al., 2002; Bruzzone and Veronesi, 2003). The different mutant models for GJB2 are shown in Figure 5. Furthermore, 380G>A(R127H) and 457G>A(V153I) were mostly observed in the heterozygous state among the hearingimpaired, and in addition occurred with a relatively high frequency in the hearing control population (Roux et al.,

6970

Afr. J. Biotechnol.

Figure 3. Ramachandran plot values showing number of residues in favored, allowed and outlier region through RAMPAGE evaluation server.

Bilal et al.

Figure 4. Interaction Network of GJB2 by SMART web server.

341A>G (E114G)

95G>A (R32H) Figure 5. The reported mutations in different regions of GJB2.

269T>C (L90P)

380G>A (R127H)

6971

6972

Afr. J. Biotechnol.

95G>A (R32H)

380G>A (R127H)

493C>T (R165W)

79G>A (V27I)

457G>A (V153I) Figure 5. Contd.

2004; RamShankar et al., 2003). Polymorphisms 79G> A(V27I) and 341A>G(E114G) have been observed independently and as a haplotype. The 493C>T(R165W) variant has not been noted among hearing controls (Ram Shankar et al., 2003; Santos et al., 2005), nevertheless its predicted effect on the protein product point to its benignity (Santos et al., 2005). REFERENCES Brenner SE (2000). Target selection for structural genomics. Nat. Struct. Biol. 7(Suppl.): p. 967. Bruzzone R, Veronesi V (2003). Gomes Loss-of-function and residual channel activity of connexin26 mutations associated with nonsyndromic deafness. FEBS Lett. 533: 79-88. Calvo J, Rabionet R, Gasparini P, Estivill X (2004). Connexins and deafness homepage. (Retrieved on 31 August from http://www.crg.es/deafness). Choung YH, Moon SK, Park HJ (2002). Functional study of GJB2 in hereditary hearing loss. Laryngoscope, 112: 1667-1671. Cryns K, Orzan E, Murgia A, Huygen PL, Moreno F, del Castillo I, Chamberlin GP, Azaiez H, Prasad S, Cucci RA, Leonardi E, Snoeckx RL, Govaerts PJ, Van de Heyning PH, Van de Heyning CM, Smith RJ, Van Camp G (2004) A genotypephenotypecorrelation for GJB2 (connexin 26) deafness. J Med Genet 41:147â&#x20AC;&#x201C;154 Dâ&#x20AC;&#x2122;Andrea P, Veronesi V, Bicego M (2000). Hearing loss: frequency and functional studies of the most common connexin26 alleles. Biochem. Biophys. Res. Commun. 296: 685-691.

Hong-Joon P, Houn Si, Young-Myoung (2000). Connexin26 Mutations Associated With Nonsyndromic Hearing Loss Laryngoscope, 110: 1535-1538. Kelsell DP, Dunlop J, Stevens HP (1997).Connexin 26 mutations in hereditary non syndromic sensorineural deafness. Nature, 387: 8083. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. (1993). Procheck: a program to check the stereochemical quality of protein structures. J. Appl. Cryst., 26: 283-291. Server:http://www.csb.yale.edu/userguides/datamanip/procheck/)http: //www-cryst.bioc.cam.ac.uk/servers.html Marti-Renom MA, Stuart AC, Fiser A, Sanchez R, Melo F, Sali A (2000). Comparative protein structure modeling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct. 29: 291-325. http://www.ncbi.nlm.nih.gov/nuccore/195539329?report=genbank http://www.rcsb.org/pdb/results/results.do?outformat= http://swissmodel.expasy.org/workspace/index.php?func=modelling_sim ple1 http://www.cbs.dtu.dk/services/CPHmodels/http://www.salilab.org/model ler/8v1/ Morris AL, MacArthur MW, Hutchinson, EG, Thornton JM (1992). Stereochemical properties of protein structure coordinates. Proteins, 12: 345-346 http://smart.emblheidelberg.de/smart/job_status.pl?jobid=11973310764 861289571183tfEfZVzneN. http://expasy.org/cgi-bin/protparam Morton NE (1991). Genetic epidemiology of hearing impairment. Ann. N. Y. Acad. Sci. pp. 630:16-31. Ng PC, Henikoff JG, Henikoff S (2000). PHAT: a transmembranespecific substitution matrix. Bioinformatics, 16: 760766.

Bilal et al.

Sali A, Blundell TL (1993). Comparative protein modeling by satisfaction of spatial restraints. J. Mol. Biol. 234: 779-815. Sali A (1998). 100,000 protein structures for the biologist. Nat. Struct. Biol. 5: 1029-1032. Steel KP (1998). A new era in the genetics of deafness. N. Engl. J. Med. 339: 1545-1547. Thonnissen E, Rabionet R, Arbones ML, Estivill X, Willecke K, Ott T (2002). Human connexin26 (GJB2) deafness mutations affect the function of gap junction channels at different levels of protein expression. Hum. Genet. 111: 190-197. Roux AF, Pallares-Ruiz N, Vielle A (2004). Molecular epidemiology of DFNB1 deafness in France. BMC Med.Genet. 5: p. 5. RamShankar M, Girirajan S, Dagan O (2003). Contribution of connexin26 (GJB2) mutations and founder effect to non-syndromic hearing loss in India. J. Med. Genet. 40: e68.

6973

Santos RLP, Wajid M, Pham TL (2005). Low prevalence of Connexin 26 (GJB2) variants in Pakistani families with autosomal recessive nonsyndromic hearing impairment. Clin. Genet. 67: 61-68. Yeager M, Unger VM, Falk MM (1998). Synthesis, assembly and structure of gap junction intercellular channels. Curr. Opin. Struct. Biol. pp. 517-524.

Full Length Research Paper

Sodium nitroprusside (SNP) alleviates the oxidative stress induced by NaHCO3 and protects chloroplast from damage in cucumber Zhongxi Gao, Yan Lin, Xiufeng Wang, Min Wei, Fengjuan Yang and Qinghua Shi* State Key Laboratory of Crop Biology, College of Horticulture Science and Engineering, Shandong Agricultural University, Taian 271018, P.R. China. Accepted 19 December, 2011

Oxidative damage is often induced by abiotic stress, nitric oxide (NO) is considered as a functional molecule in modulating antioxidant metabolism of plants. In the present study, effects of sodium nitroprusside (SNP), a NO donor, on the phenotype, antioxidant capacity and chloroplast ultrastructure of cucumber leaves were studied under NaHCO3 stress. 30 mM NaHCO3 treatment significantly induced accumulation of H2O2 and thiobarbituric acid-reactive substances (TBARS) in cucumber leaves, and led to serious electrolyte leakage. Application of 100 µM SNP stimulated reactive oxygen species (ROS)scavenging enzymes and increased antioxidant capacity, resulting in lower lipid peroxidation and membrane damage induced by NaHCO3 stress. As a main organelle of ROS formation, chloroplast ultrastructure was seriously damaged by NaHCO3 stress and SNP treatment obviously reversed the damage. On the contrary, the above effects of SNP were not observed by application of potassium ferrocyanide which is an analog of SNP that does not release NO. Therefore, it could be concluded that the NO from SNP might account for the alleviating effect of NaHCO3 stress on cucumber plants. Key words: Cucumber, alkaline stress, nitric oxide, antioxidant, chloroplast ultra structure. INTRODUCTION Salinity and alkalinity are important environmental factors limiting crop production in semi-arid and arid regions. There are 831 million hectares of soils affected by excessive salinity and alkalinity in the world. Of this, area under sodic soils (alkaline soils) is 434 million hectares, compared to 397 million hectares of saline soils (Jin et al., 2008). It is well known that salinity soil is mainly due to the accumulation of NaCl and Na2SO4, and alkalinity soil is mainly due to the accumulation of NaHCO3 and Na2CO3 (Shi and Sheng, 2005; Yang et al., 2009). Higher plant tolerance to salinity stress has previously been extensively studied;

*Corresponding author. E-mail: qhshi@sdau.edu.cn. Tel: 86538-8242161. Abbreviations: EC, Electricity conductivity; HEPES, 4-(2Hydroxyethyl)-1-piperazineethanesulfonic acid; SNP, sodium nitroprusside; TBARS, thiobarbituric acid-reactive substances; TCA, trichloroacetic acid; TBA, 2-thiobarbituric acid.

unfortunately, the adaption mechanism to alkalinity in plants is short of deep investigation (Jin et al., 2008). Osmotic stress and ion-induced injury are generally considered to be involved in salt stress on plants, while except for the same stress with salt stress, there is the influence of high-pH on plants under alkaline conditions (Liu et al., 2010). The most conspicuous symptom of alkaline salt stress on plants is the induction of leaf chlorosis and stunted growth, which is greatly related with the precipitation of metal ions and phosphorus as well as the disruption of ionic balance and pH homeostasis in tissues caused by high-pH environment surrounded the roots (Yang et al., 2007, 2008). Like other environmental stress, alkaline stress also induces oxidative stress (Cellini et al., 2011). As the results of oxidative stress, lipid is peroxidised, protein synthesis is inhibited, enzyme is inactivated, and membrane systems are damaged (Bursal and Gülçin, 2011; Gülçin et al., 2011; Tanou et al., 2009). The balance between free radical generation and scavenging determines the survival of

Gao et al.

plants under alkaline stress. To counteract the oxidative stress, plants have evolved an antioxidant system which is composed of ROS-scavenging enzymes such as superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (GPX), ascorbate peroxidase (APX), dehydroascorbate reductase (DHAR) and glutathione reductase (GR) (Jung, et al., 2000). Many studies indicated that plant tolerance to salt stress was closely related with the expression and activities of these antioxidant enzymes (Nawaz and Ashraf, 2010; Noreen et al., 2010; Seckin et al., 2010). Therefore, increasing antioxidant capacity by exogenous substance application could be a practical measure in the detoxification of alkaline stress-induced excessive free radical production. Nitric oxide (NO) is a small, highly diffusible gas and a ubiquitous bioactive molecule. Its chemical properties make NO a versatile signal molecule that functions through interactions with cellular targets via either redox or additive chemistry (Lamattina et al., 2003). Recent studies provided increasing evidences that NO is involved in many key physiological processes of plants, such as germination (Beligni and Lamattina, 2000), growth and development of plant tissue (Durner and Klessig, 1999; Pagnussat et al., 2003), iron homeostasis (Graziano and Lamattina, 2007), regulation of plant maturation and senescence (Guo and Crawford, 2005; Leshem et al., 1998). In abiotic stress tolerance, it has been obtained that NO plays an important role in resistance to salt, drought, temperature, UV-B and heavy metal stress (Siddiqui et al., 2011). However, there are few investigations about exogenous NO modulating plants tolerance to alkaline stress. Recently, Cellini et al. (2011) observed that nitric oxide content was associated with tolerance to bicarbonate-induced chlorosis in micropropagated Prunus explants. In the experiment, Effects of SNP, a nitric oxide donor, on phenotype, antioxidant capacity and choloroplast ultrastructure of cucumber treated with NaHCO3 stress were investigated; the obtained results would provide a basis for further investigation of NO role in cucumber tolerance to alkaline stress.

MATERIALS AND METHODS Cucumber (Cucumis sativus L. cv. Jinchun 5) seeds were germinated on moisture filter paper in the dark at 28°C for 2 days, and germinated seedlings were transferred to the growth chamber filled with vermiculite and grown in greenhouse for 8 days. Then they were transplanted into 5 L black plastic containers containing aerated full nutrient solution: 4 mM Ca(NO3)2, 4 mM KNO3, 2.5 mM KH2 PO4, 2 mM MgSO4, 29.6 µM H3BO3, 10 µM MnSO4, 50 µM FeEDTA, 1.0 µM ZnSO4, 0.05 µM H2MoO4, 0.95 µM CuSO4, with three seedlings per container. After 9 days of pre-culture, the treatments were started. The experimental design consisted of a control (no added SNP and NaHCO3, indicated as CK) and three treatments (NaHCO3: 30 mM NaHCO3 treatment; Na+ SNP: 30 mM NaHCO3 treatment+100 µM SNP treatment; Na + SF, 30 mM NaHCO3 treatment+100 µM potassium ferrocyanide treatment) and was arranged in a randomized, complete block design with three replicates, giving a total of 12 containers. The plants were cultivated

6975

under natural conditions in a glass greenhouse after 12 days the leaves were taken for further assay.

Determination of H2 O2 content H2O2 content was determined according to Patterson et al. (1984). The assay was based on the absorbance change of the titaniumperoxide complex at 415 nm. Absorbance values were quantified using standard curve generated from known concentrations of H2O2. Determination of Lipid peroxidation Lipid peroxidation (LPO) was estimated by measuring the concentration of thiobarbituric acid reactive substances (TBARS) using the thiobarbituric acid method described by Heath and Packer (1968). 0.3 g of tissue homogenized in 3 ml of 0.1% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 10,000 g for 10 min and 3 ml of 20% TCA containing 0.5% (w/v) 2-thiobarbituric acid (TBA) was added to 1 ml of supernatant. The mixture was heated at 95°C for 30 min and the reaction was stopped by quickly placing in an ice-bath. The cooled mixture was centrifuged at 10,000 g for 10 min, and the absorbance of the supernatant at 532 and 600 nm was read. After substrating the non-specific absorbance at 600 nm, the TBARS concentration was determined by its extinction coefficient of 155 mM-1 cm-1. Determination of electrolyte leakage percentage Electrolyte leakage percentage (ELP) was used to assess membrane permeability. Electrolyte leakage percentage was measured using an electrical conductivity meter according to the method of Lutts et al. (1996). Leaf samples were cut into 1 cm segments and placed in individual stoppered vials containing 10 ml of distilled water after three washes with distilled water to remove surface contamination. These samples were incubated at room temperature on a shaker for 24 h. Electrical conductivity of bathing solution (EC1) was read, and then samples were placed in the thermostatic water bath at 95°C for 15 min and then the electrical conductivity (EC2) was read after cooling the bathing solutions to room temperature. ELP was calculated as EC1/EC2 and expressed as percentage. Fe2+-chelating activity For the determination of Fe2+-chelating activity, 0.3 g sample was suspended in 3 ml of serine borate buffer (100 mM Tris-HCl, 10mM borate, 5 mM serine, and 1 mM diethylenetriaminepentacetic acid, pH 7.0). The slurry was centrifuged at 5,000 g for 10 min at 4°C and the supernatants were used for the in vitro antioxidant assays. All samples were placed on ice during the experiments. Fe2+-chelating activity was measured according to the method of Gülçin (2011), Köksal et al. (2011) and Manda et al. (2010). The reaction mixture (2.0 ml) contained 100 µl of cucumber radicles extract, 100 µl FeCl2 (0.6 mM), and 1.7 ml deionised water. The mixture was shaken vigorously and left at room temperature for 5 min; 100 µl of ferrozine (5 mM in methanol) were then added, mixed, and left for another 5 min to complex and was measured at 562 nm against a blank. Disodium ethylenediamineteracetic acid (EDTA-Na2) was used as the control. The chelating activity of the extract for Fe2+ was calculated as:

Chelating effect = [1-(A1-A2)/A0] ×100%.

6976

Afr. J. Biotechnol.

Na+SNP

NaHCO3

Na+SF

Figure 1. Effects of SNP (sodium nitroprusside, a nitric oxide donor) on the phenotype of NaHCO3-stressed cucumber plants. CK, Control; NaHCO3, 30 mM NaHCO3 treatment; Na+SNP, 30 mM NaHCO3 + 100 µM SNP treatment; Na + SF, 30 mM NaHCO3 + 100 µM potassium ferrocyanide treatment (potassium ferrocyanide, an analog of SNP that does not release NO).

Where, A0 is the absorbance of the control (without extract); A1 is the absorbance in the presence of the extract and A2 is the absorbance without ferrozine. Enzyme extraction For enzyme assays, 0.3 g leaves were ground with 3 ml ice-cold 25 mM HEPES buffer (pH 7.8) containing 0.2 mM EDTA, 2 mM ascorbate and 2% PVP. The homogenates were centrifuged at 4°C for 20 min at 12,000 g and the resulting supernatants were used for determination of enzymatic activities (Zhu et al., 2000). All spectrophotometric analyses were conducted on a SHIMADZU UV-2450PC spectrophotometer. Determination of enzymatic activities SOD activity was assayed by measuring its ability to inhibit the photochemical reduction of nitroblue tetrazolium following the method of Stewart and Bewley (1980). CAT activity was measured as the decline in absorbance at 240 nm due to the decrease of extinction of H2O2 using the method of Patra et al. (1978). GPX activity was measured as the increase in absorbance at 470 nm due to guaiacol oxidation (Nickel and Cunningham, 1969). APX activity was measured by the decrease in absorbance at 290 nm as ascorbate was oxidized (Nakano and Asada, 1981). DHAR activity was assayed by measuring the increase in absorbance at 265 nm due to reduced ascorbate formation (Nakano and Asada, 1981). GR activity was measured according to Foyer and Halliwell (1976), which depended on the rate of decrease in the absorbance of NADPH at 340 nm. Determination of chloroplast ultrastructure Chloroplast ultrastructure was determined by TEM according to the

method of Xu et al. (2008). The cucumber leaves were fixed in 3.5% glutaraldehyde for 24 h, washed with 0.1 M phosphate buffer (pH 7.2) and then postfixed with 1% osmic acid at 4°C for 4 h. Cells were dehydrated with ascending concentrations (from 30 to 100%) of ethanol and embedded in spur resin at 60°C for 24 h. After thin sections have been cut with an LKB Ultratome Nova (Bromma, Sweden) and picked on 250-mesh grids, leaf cells were postained with uranyl acetate and lead citrate and then were observed using a transmission electron microscope (JEM-1200EX; JEOL Ltd., Tokyo, Japan) at 80 kV. The statistics method Values presented were means ± standard deviation (SD) of three replicates. Statistical analyses were carried out by analysis of variance (ANOVA) using SPSS10.0 software. Differences between treatments were analyzed by the Duncan’s multiple range test.

RESULTS AND DISCUSSION Effects of SNP on symptom of cucumber plants under NaHCO3 stress Figure 1 shows that NaHCO3 stress significantly induced cucumber leaf chlorosis and inhibited the plant growth, it is well known that chlorosis is often caused by deficiency of iron (Fernández et al., 2008) which easily precipitates under alkaline conditions (Riadh et al., 2006). Nitric oxide, as a gas signal molecular, can readily form complexes with transition metal ions in aqueous solutions or those present in diverse nucleophylic compounds such as metalloproteins (Stamler et al., 1992). The Fe(III)NO

Gao et al.

complex appears to undergo a charge transfer reaction to + form Fe(II)NO (Olson, 1981) and Graziano et al. (2002) observed that NO could increase the availability of iron in plants. In the present experiment, application of SNP reversed the chlorosis of cucumber leaves induced by NaHCO3 stress; the mechanism might be partly attributed to its function in modulating iron metabolism. Because the NO donor SNP contains iron in its molecule, it is important to exclude the effect of iron in SNP for the elucidation of NO function. Therefore, potassium ferrocyanide, an analog of SNP that does not release NO was chosen to treat cucumber under NaHCO3 stress, the results showed that it had no effect on reversing NaHCO3-induced cucumber leaf chlorosis, based on this phenomenon it could be concluded that the function of SNP was due to the NO from it. Effects of SNP on H2O2, lipid peroxidation accumulation and electrolyte leakage percentage of cucumber leaves under NaHCO3 stress When plants subject to environmental stresses like salinity, drought and extreme temperatures, oxidative damage is caused either directly or indirectly by triggering increased production of reactive oxygen species (ROS) (Suzuki et al., 2011). H2O2 is one important member of ROS which are produced as products of membrane linked electron transport activities as well as by a number of metabolic pathways (Blokhina and Fagerstedt, 2010). Increased H2O2 accumulation has been obtained in many plants such as cucumber (Zhu et al., 2004), and tomato (Mittova et al., 2003) under neutral salt NaCl stress, however, there is short of investigations about the effects of alkaline salt on H2O2 production. In the experiment, NaHCO3 treatment, as a simulation of alkaline environment, dramatically induced accumulation of H2O2 in cucumber leaves (Figure 1A). The results indicate that the ROS balance in cucumber leaves was destroyed under NaHCO3. Estimation of cell membrane integrity in plants based on measurements of electrolyte leakage has become a widely accepted method of estimating cell viability (Ingram and Buchanan, 1981), and enhanced electrolyte from cells can occur as a result of changes in membrane permeability caused by oxidative damage to the plasma membrane. The present experiment showed that NaHCO3 treatment significantly induced electrolyte leakage of cucumber leaves (Figure 2C); similar results have been obtained in NaCl-treated cucumber (Zhu et al., 2004). TBARS were often used to indicate lipid peroxidation, in the experiment, in accordance with the change of electrolyte leakage; their concentrations were much higher in NaHCO3 treatment than in the control (Figure 2B). TBARS formation was considered to be caused by oxidative degradation of polyunsaturated fatty acids, in particular linolenic acid, since most of the linolenic acid in leaves is localized in the thylakoid glycolipids, TBARS

6977

formation in leaves is likely a good measure for peroxidative damage to chloroplast membrane (Van-Hasselt et al., 1996). David et al. (2011) observed that NaCl treatment showed a transient positive effect on expression of NO signal in root tips and the process might be involve in the regulation of specific transporter proteins. However, the antioxidant capacity modulation by NO was still widely thought as one of important pathways in regulating abiotic stress (Hao et al., 2009; Qiao and Fan, 2008). There were a number of investigations indicating the role of NO in hydrogen peroxide-dependent induction of abiotic stress tolerance by BRs (Cui et al., 2011), SA (Zottini et al., 2007; GĂŠmes et al., 2011), and other signal molecule (Acharya et al., 2011). In the present study, SNP treatment significantly decreased H2O2 accumulation, electrolyte leakage and lipid peroxidation, however, potassium ferrocyanide did not obviously ameliorate them (Figure 2A, B, C), therefore, it could be concluded that NO from SNP should be responsible for the lower oxidative stress induced by NaHCO3 stress and exogenous NO could protect cucumber membrane system from damage. Metal chelating capacity could be used to express antioxidant capacity of plant tissues. Compared to the control, NaHCO3 stress dramatically decreased Fe2+chelating activity, and application of SNP significantly enhanced Fe2+-chelating activity in NaHCO3-treated cucumber leaves (Figure 2D). Increase of antioxidant capacity in plants usually depends on antioxidant metabolites such as ascorbic acid, glutathione, polyphenols and flavonoids (Ksouri et al., 2007), and there were reports indicating that exogenous NO could induce synthesis of these antioxidant metabolites (Ksouri et al., 2007; Ferreira et al., 2010; Wu et al., 2007). In the experiment, it was SNP rather than potassium ferrocyanide which enhanced Fe2+-chelating activity in NaHCO3treated cucumber leaves, therefore, the function of SNP increasing antioxidant capacity depended on NO from it. Effects of SNP on activities of antioxidant enzyme in cucumber leaves under NaHCO3 stress As key elements in the plant defense mechanisms, varying reactions of ROS-scavenging enzymes in plants have been observed under salt stress. For example, under neutral salt NaCl stress, it has been reported that ROSscavenging enzymes increased under saline conditions in the case of salt-tolerant cotton (Meloni et al., 2003), shoot cultures of rice (Fadzilla et al., 1997), cucumber (Lechno et al., 1997), but decreased in wheat roots (Meneguzzo et al., 1999). In the aspect of alkaline stress, Cellini et al. (2011) found that SOD activity was not affected, and CAT and GPX displayed reduced trend in Prunus explants under bicarbonate stress. In the present study, alkaline salt NaHCO3 stress inhibited activities of all antioxidant

Afr. J. Biotechnol.

1.4

TBARS concentra tions (nmol g-1 FW)

H 2 O2 concentra tions (nmol g-1 FW)

1.2 b

0.8 0.6 0.4 0.2

5 a 4 b 3

0 CK

NaHCO3

Na+SNP

Na+SF

NaHCO3

Na+SNP

Na+SF

90 45

D C

40 70

Fe 2+ chelating activity (%)

b electrolyte leaka ge (%)

6978

35 d 30

20 CK

NaHCO3

Na+SNP

Na+SF

b 60 c 50

20 CK

NaHCO 3

Na+SNP

Na+SF

Figure 2. Effects of SNP (sodium nitroprusside, a nitric oxide donor) on the concentrations of H2 O2 (A) and TBARS (B), electrolyte leakage (C) and Fe2+-chelating activity (D) of cucumber leaves under NaHCO3 stress. Data are means ± SD of three replicates. Mean values followed by different letters (a to c) are significantly different (P < 0.05). CK, Control; NaHCO3, 30 mM NaHCO3 treatment; Na+SNP, 30 mM NaHCO3 + 100 µM SNP treatment; Na + SF, 30 mM NaHCO3 + 100 µM potassium ferrocyanide treatment (potassium ferrocyanide, an analog of SNP that does not release NO).

Gao et al.

200

180

2.5

CAT activity (µmol H2O2 g-1 FW min-1)

160

SOD activity (U g-1 FW)

6979

140 120 100

b 2

80 60 40

1.5

0.5

20 0 CK 16

NaHCO3

Na+SNP

Na+SF

0 CK

Na+SNP

Na+SF

6 a

14 12 10 b 8 c

4 2

APX activity (µmol AsA g-1 FW ming-1)

GPX activity (µmol guaiacol g-1 FW min -1)

NaHCO3

3 b

c c

0 CK

NaHCO3

Na+SNP

Na+SF

NaHCO3

Na+SNP

Na+SF

16 a E

GR activity (µmol NADPH g-1 FW min-1)

DHAR activity (µmol DHA g-1 FW min -1)

8 7 6 5 4 3 2 1 0

F b

12 10 8 c

6 4 2 0

NaHCO3

Na+SNP

Na+SF

Control

NaHCO3

Na+SNP

Na+SF

Figure 3. Effects of SNP (sodium nitroprusside, a nitric oxide donor) on the activities of SOD (A), CAT (B), GPX (C) APX (D) DHAR (E) and GR (F) of cucumber leaves under NaHCO3 stress. Data are means ± SD of three replicates. Mean values followed by different letters (a to c) are significantly different (P<0.05). CK, Control; NaHCO3, 30 mM NaHCO3 treatment; Na+SNP, 30 mM NaHCO3 + 100 µM SNP treatment; Na + SF, 30 mM NaHCO3 + 100 µM potassium ferrocyanide treatment (potassium ferrocyanide, an analog of SNP that does not release NO).

enzymes including SOD, CAT, GPX, APX, DHAR and GR (Figure 3). The different reactions showed that the influence of abiotic stress on the antioxidant enzymes were very complex and related to plant treatment period, plant tissues, plant species and genotypes. However, higher activities of antioxidant enzymes were always thought to play important role in alleviating oxidative stress induced by environmental stress. In many investigations, it was observed that the

func-tion of NO alleviation of oxidative stress was due to induction of various ROS-scavenging enzyme activity (Laspina et al., 2005; Sun et al., 2007; Yi et al., 2008). Cheng et al. (2002) reported that the inhibition of polyethylene glycol (PEG)- and dehydration (DH)-enhanced senescence of rice leaves by NO was most likely modulated through increasing SOD activity which resulted in lower lipid peroxidation. In the present study, application of SNP significantly alleviated the inhibited level of

6980

Afr. J. Biotechnol.

(A)

(C)

(B)

(D)

Figure 4. Effects of SNP (sodium nitroprusside, a nitric oxide donor) on chloroplast of cucumber leaves under NaHCO3 stress. (A), Control; (B) 30 mM NaHCO3 treatment; (C) 30 mM NaHCO3 + 100 µM SNP treatment; (D) 30 mM NaHCO3 + 100 µM potassium ferrocyanide treatment (potassium ferrocyanide, an analog of SNP that does not release NO).

SOD activity by NaHCO3 stress (Figure 3A), which suggested that application of NO could promote the conversion from O2·- into H2O2 and O2. It is well known that SOD includes Mn-SOD, Cu,Zn-SOD and Fe-SOD, and previous study indicated that NO could increase the Fe utilization efficiency in higher plants (Graziano and Lamattina, 2007), based on the facts, it might be able to conclude that the increasing SOD activity by SNP might be partly attributed to higher Fe efficiency. H2O2, as the products of O2·- descomposition, can rapidly diffuse across the membrane and is toxic because it acts both as an oxidant as well as reductant (Foyer et al., 1997), under such situation, the highly efficiency of H2O2 scavenging is very vital. In the experiment, SNP significantly increased CAT and GPX activity, which can directly scavenge H2O2 and play important role in reducing oxidative stress induced by abiotic stress (Figure 3B, C), similar results were obtained in wheat seed germination treated with NaCl (Zheng et al., 2009). Besides SOD, CAT and APX, there exists another important ROSscavenging system which is ascorbate-glutathione cycle in chloroplast (Murshed et al., 2008). The cycle is mainly composed of enzymes such as APX, DHAR, GR and antioxidants such as ascorbate and glutathione. In the experiment, SNP significantly induced activities of APX,

DHAR and GR (Figure 3D, E, F), which are very important in making chloroplast avoid oxidative damage. On the contrary, the effects of SNP on antioxidant enzymes were not observed by potassium ferrocyanide treatment under NaHCO3 stress (Figure 3), which indicated that the increase of antioxidant enzymes induced by exogenous NO was greatly responsible for decreasing oxidative stress induced by NaHCO3. Effects of SNP on ultrastructure of cucumber chloroplast under NaHCO3 Chloroplast is the organelle of photosynthesis and the center ROS formation in plant leaves, especially under stress conditions. It has been demonstrated that chloroplast membrane ruptured under saline or osmotic stress (Yamane et al., 2003) and that the thylakoidal structure of the chloroplast is disrupted by salt stress (Hernández et al., 1995). In this study, compared to elliptical shape and thylakoid integrity of chloroplast in the control, NHCO3 treatment led chloroplast become completely swollen, membrane disappear and thylakoid in a disorganized form (Figure 4B). The results could account for a notable reduction of net photosynthesis rate in NaHCO3-treated

Gao et al.

cucumber plants in our earlier investigation (Lin et al., 2010). SNP treatment reversed the damage of chloroplast ultrastructure and membrane system induced by NaHCO3 stress, on the contrary, potassium ferrocyanide did not obviously inhibit the chloroplast disturbance caused by NaHCO3 (Figure 4C, D). This indicated that exogenous NO could protect the chloroplast ultrastructure of cucumber under NaHCO3 stress. The protective effect of NO on chloroplast has been observed in Fedeficiency maize (Magdalena et al., 2002). Conclusion Exogenous NO application had significant beneficial effects on NaHCO3-exposed cucumber plants, effectively revered the chlorosis and alleviating growth inhibition of cucumber induced by NaHCO3. The preliminary investigation indicated that the protective effects of exogenous NO were partly attributed to its role in modulating ROS metabolism and holding the integrity of chloroplast. The results suggest that a practical potential method in alleviating alkaline stress by NO metabolism. Because NO is also an important endogenous signal biomolecule which was verified to be effective in gene expression regulation (Besson-Bard et al., 2009), therefore, the genetic method of NO should also be considered to be a direction to increase plants tolerance to abiotic stress including alkaline stress. ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China (No. 30800751) and National Basic Research Program of China (2009CB119000). REFERENCES Acharya K, Chakraborty N, Dutta AK, Sarkar S, Acharya R (2011). Signaling role of nitric oxide in the induction of plant defense by exogenous application of abiotic induces. Arch. Phytopathol. Plant Protect. 44: 1501-1511. Beligni MV, Lamattina L (2000). Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyls elongation, three lightinducible responses in plants. Planta, 210: 215-221. Besson-Bard A, Astier J, Rasul S, Wawer I, Dubreuil-Maurizi C, Jeandroz S, Wendehenne D (2009). Current view of nitric oxideresponsive genes in plants. Plant Sci. 177: 02-309. Blokhina O, Fagerstedt KV (2010). Oxidative metabolism, ROS and NO under oxygen deprivation. Plant Physiol. Biochem. 48: 359-337. Bursal E, Gülçin I (2011). Polyphenol contents and in vitro antioxidant activities of lyophilised aqueous extract of kiwifruit (Actinidia deliciosa). Food Res. Int. 44: 1482-1489. Cellini A, Corpas FJ, Barroso JB, Masia A (2011). Nitric oxide content is associated with tolerance to bicarbonate-induced chlorosis in micropropagated Prunus explants. J. Plant Physiol. 168: 1543-1549. Cheng FY, Hsu SY, Kao CH (2002). Nitric oxide counteracts the senescence of detached rice leaves induced by dehydration and polyethylene glycol but not by sorbitol. Plant Growth Regul. 38: 265272. Cui J, Zhou Y, Ding J, Xiao X, Shi K, Chen S, Asami T, Chen Z, Yu J

6981

(2011). Role of nitric oxide in hydrogen peroxide-dependent induction of abiotic stress tolerance by brassinosteroids in cucumber. Plant Cell Environ. 34: 347-358. David A, Yadav S, Bhatla SC (2010). Sodium chloride stress induces nitric oxide accumulation in root tips and oil body surface accompanying slower oleosin degradation in sunflower seedlings. Physiol. Planta. 140: 342-354. Durner J, Klessig DF (1999). Nitric oxide as a signal in plants. Curr. Opin. Plant Biol. 2: 369-374. Fadzilla NM, Finch RP, Burdon RH (1997). Salinity, oxidative stress and antioxidant responses in shoot cultures of rice. J Exp. Bot. 48: 325331. Fernández V, Eichert T, del Río V, López-Casado G, Heredia-Guerrero JA, Abadía A, Heredia A, Abadía J (2008). Leaf structural changes associated with iron deficiency chlorosis in field-grown pear and peach: physiological implications. Plant Soil, 311: 161-172. Ferreira LC, Cataneo AC, Remaeh LMR, Corniani N, Fátima Fumis Tde, Souza YAde, Scavroni J, Soares BJA (2010). Nitric oxide reduces oxidative stress generated by lactofen in soybean plants. Pestic. Biochem. Phys. 97: 47-54. Foyer CH, Halliwell B (1976). The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta, 133: 21-25. Gémes K, Poór P, Horváth E, Kolbert Z, SzopkóD, Szepesi Á, Tari I (2011). Cross-talk between salicylic acid and NaCl-generated reactive oxygen species and nitric oxide in tomato during acclimation to high salinity. Physiol. Planta. 142:179-192. Graziano M, Beligni MV, Lamattina L (2002). Nitric oxide improves internal iron availability in plants. Plant Physiol. 130: 1852-1859. Graziano M, Lamattina L (2007). Nitric oxide accumulation is required for molecular and physiological responses to iron deficiency in tomato roots. Plant J. 52: 949-960. Guo FQ, Crawford NM (2005). Arabidopsis nitric oxide synthase 1 is targeted to mitochondria and protects against oxidative damage and dark-induced senescence. Plant Cell, 17: 3436-3450. Gülçin I (2011) Antioxidant activity of eugenol: a structure-activity relationship study. J. Med. Food 14: 975-985. Gülçin I, Topal F, Çakmakçı R, Gören AC, Bilsel M, Erdogan U (2011). Pomological features, nutritional quality, polyphenol content analysis, and antioxidant properties of domesticated and 3 wild ecotype forms of raspberries (Rubus idaeus L.). J. Food Sci. 76: 585-593. Hao G, Du X, Zho F, Shi R, Wang J (2009). Role of nitric oxide in UV-Binduced activation of PAL and stimulation of flavonoid biosynthesis in Ginkgo biloba callus. Plant Cell Tiss. Org. Cul. 97: 175-185. Heath RL, Packer L (1968). Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 125: 189-198. Hernández JA, Olmos E, Corpas FJ, Sevilla F, Del Río LA (1995). Saltinduced oxidative stress in chloroplasts of pea plants. Plant Sci. 105: 151-167. Ingram DL, Buchanan D (1981). Measurement of direct heat injury of roots of three woody plants. HortScience, 16: 769-771. Jin H, Kim HR, Plaha P, Liu SK, Park JY, Piao YZ, Yang ZH, Jiang GB, Kwark SS, An G, Son M, Jin YH, Sohn JH, Lim YP (2008). Expression profiling of the genes induced by Na2CO3 and NaCl stresses in leaves and roots of Leymus chinensis. Plant Sci. 175: 784-792. Jung S, Kim JS, Cho KY, Tae GS, Kang BG (2000). Antioxidant responses of cucumber (Cucumis sativus) to photoinhibition and oxidative stress induced by norflurazon under high and low PPFDs. Plant Sci .153: 145-154. Koksal E, Bursal E, Dikici E, Tozoğlu F, Gülçin İ (2011). Antioxidant activity of melissa officinalis leaves. J. Med. Plants Res. 5: 217-222. Ksouri R, Megdiche W, Debez A, Falleh H, Grignon C,. Abdelly C (2007). Salinity effects on polyphenol content and antioxidant activities in leaves of the halophyte Cakile maritima. Plant Physiol. Biochem. 45: 244-249. Lamattina L, García-Mata C, Graziano M, Pagnussat G (2003). Nitric oxide: the versatility of an extensive signal molecule. Annu. Rev. Plant Biol. 54: 109-136. Laspina NV, Groppa MD, Tomaro ML, Benavides MP (2005). Nitric oxide protects sunflower leaves against Cd-induced oxidative stress.

6982

Afr. J. Biotechnol.

Plant Sci. 169:323-330. Lechno S, Zamski E, Tel-Or E (1997). Salt stress-induced responses in cucumber plants. J. Plant Physiol. 150: 206-211. Leshem YY, Wills RBH, Ku VVV (1998). Evidence for the function of the free radical gas-nitric oxide (NO) â&#x20AC;&#x201C; as an endogenous maturation and senescence regulating factor in higher plants. Plant Physiol. Biochem. 36: 825-833. Lin Y, Hong YY, Shi QH, Wang XF, Wei M, Yang FJ (2010). Effects of SNP on the growth and nitrogen metabolism enzymes activities of cucumber seedlings under NaHCO3 stress. Plant Nutr. Fert. Sci. 16: 1294-1298. Liu J, Guo WQ, Shi DC (2010). Seed germination, seedling survival, and physiological response of sunflowers under saline and alkaline conditions. Photosynthetica, 48: 278-286. Lutts S, Kinet JM, Bouharmont J (1996). NaCl-induced senescence in leaves of rice (Oryza sativa L.) cultivar differing in salinity resistance. Ann. Bot. 78: 389-398. Manda K, Adams DC, and Ercal N (2010). Biologically important thiols in aqueous extracts of spices and evaluation of their in vitro antioxidant properties. Food Chem. 118:589-593. Meloni DA, Oliva MA, Martinez CA, Cambraia J (2003). Photosynthesis and ability of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 49: 69-76. Meneguzzo S, Navari-Izzo F, Izzo R (1999). Antioxidative responses of shoots and roots of wheat to increasing NaCl concentrations. J. Plant Physiol. 155: 274-280. Mittova V, Tal M, Volokita M, Guy M (2003). Up-regulation of the leaf mitochondrial and peroxisomal antioxidative system in response to salt-induced oxidative stress in the wild salt tolerant tomato species Lycopersicon pennellii. Plant Cell Environ. 26: 845-856. Murshed R, Lopez-Lauri F, Sallanon H (2008). Microplate quantification of enzymes of the plant ascorbate-glutathione cycle. Anal. Biochem. 383: 320-322. Nakano Y, Asada K (1981). Hydrogen peroxide scanvenged by ascorbate-specific peroxidase in spinach chloroplast. Plant cell Physiol. 22: 867-880. Nawaz K, Ashraf M (2010). Exogenous application of glycinebetaine modulates activities of antioxidants in maize plants subjected to salt stress. J. Agron. Crop Sci. 196: 28-37. Nickel RS, Cunningham BA (1969). Improved peroxidase assay method using Ieuco 2,3,6-trichlcroindophenol and application to comparative measurements of peroxidase catalysis. Ann. Biochem. 27: 292-299. Noreen Z, Ashraf M, Akram NA (2010). Salt-induced regulation of some key antioxidant enzymes and physio-biochemistry phenomena in five diverse cultivars of turnip(Brassica rapa L.). J. Agron. Crop Sci. 196: 23-285. Pagnussat GC, Lanteri ML, Lamattina L (2003). Nitric oxide and cyclic GMP are messengers in the indole acetic acid-induced adventitious rooting process. Plant Physiol. 132: 1241-1248. Patra HL, Kar M, Mishre D (1978). Catalase activity in leaves and cotyledons during plant development and senescence. Biochem. Physiol. 172: 385-390. Patterson BD, Macrae EA, Ferguson IB (1984). Estimation of hydrogen peroxide in plants extracts using titanium (IV). Ann. Biochem .134: 487-492. Qiao W, Fan L (2008). Nitric oxide signaling in plant responses to abiotic stresses. J. Integr. Plant Biol. 50: 1238-1246. Riadh R, Sabah M, Mohamed G, Mokhtar L (2006). Biochemical responses to true and bicarbonate-induced iron deficiency in grapevine genotypes. J. Plant Nutr. 29: 305-315. Seckin B, Turkan I, Sekmen AH, Ozfidan C (2010). The role of antioxidant defense systems at differential salt tolerance of Hordeum marinum Huds. (sea barleygrass) and Hordeum vulgare L. (cultivated barley). Environ. Exp. Bot. 69: 76-85. Shi D, Sheng Y (2005). Effect of various salt-alkaline mixed stress conditions on sunflower seedlings and analysis of their stress factors. Environ. Exp. Bot. 54: 8-21. Siddiqui MH, Al-Whaibi MH, Basalah MO (2011). Role of nitric oxide in tolerance of plants to abiotic stress. Protoplasma, 248: 447-455.

Stamler JS, Singel DJ, Loscalzo J (1992). Biochemistry of nitric oxide and its redox-activated forms. Science, 258: 1898-1902. Stewart RC, Bewley JD (1980). Lipid peroxidation associated with accelerated aging of soybean axes. Plant Physiol. 65: 245-248. Sun B, Jing Y, Chen K, Song L, Chen F, Zhang L (2007). Protective effect of nitric oxide on iron deficiency-induced oxidative stress in maize (Zea mays). J. Plant Physiol. 164: 536-543. Suzuki N, Koussevitzky S, Mittler R, Miller G (2011). ROS and redox signaling in the response of plants to abiotic stress. Plant Cell. Environ (in Press, doi:10.1111/j.1365-3040.2011.02336.x) Tanou G, Molassiotis A, Diamantidis G (2009). Induction of reactive oxygen species and necrotic death-like destruction in strawberry leaves by salinity. Environ. Exp. Bot. 65: 270-281. Van-Hasselt PR, Chow WS, Anderson JM (1996). Short-term treatment of pea leaves with supplementary UV-B at different oxygen concentrations: impacts on chloroplast and plasma membrane bound processes. Plant Sci. 120: 1-9. Wu CH, Tewari RK, Hahn EJ, Paek KY (2007). Nitric oxide elicitation induces the accumulation of secondary metabolites and antioxidant defense in adventitious roots of Echinacea purprea. J. Plant Biol. 50: 636-643. Xu PL, Guo YK, Bai JG, Shang L, Wang XJ (2008). Effects of long-term chilling on ultrastructure and antioxidant activity heaves of two cucumber cultivars under low light. Physiol. Planta. 132: 467-478. Yamane K, Kawasaki M, Taniguchi M, Miyake H (2003). Differential effect of NaCl and polyethylene glycol on the ultrastructure of chloroplasts in rice seedlings. J. Plant Physiol. 160: 573-575. Yang CW, Chong JN, Li CY, Kim CM, Shi DC, Wang DL (2007). Osmotic adjustment and ion balance traits of an alkali resistant halophyte Kochia sieversiana during adaptation to salt and alkali conditions. Plant Soil, 294: 263-276. Yang CW, Shi DC, Wang DL (2008). Comparative effects of salt and alkali stresses on growth, osmotic adjustment and ionic balance of an alkali-resistant halophyte suaeda glauca (Bge.). Plant Growth Regul. 56: 179-190. Yang CW, Xu HH, Wang LL, Liu J, Shi D, Wang DL (2009). Comparative effects of salt-stress and alkali-stress on the growth, photosynthesis, solute accumulation, and ion balance of barley plants. Photosynthetica, 47: 79-86. Yi QY, Niu HB, Wang MB, Shao HB, Deng DZ, Chen XX, Ren JP, Li YC (2008). Protective role of exogenous nitric oxide against oxidativestress induced by salt stress in barley (Hordeum vulgare). Collid Surfaces B: Biointerfaces, 65: 220-225. Zheng C, Jiang D, Liu F, Dai T, Liu W, Jing Q, Cao W (2009) Exogenous nitric oxide improves seed germination in wheat against mitochondrial oxidative damage induced by high salinity. Environ. Exp. Bot. 67: 222-227. Zhu Z, Wei G, Li J, Qian Q, Yu J (2004). Silicon alleviates salt stress and increases antioxidant enzymes activity in leaves of salt stressed cucumber (Cucumis sativus L.) Plant Sci. 167: 527-533. Zhu ZJ, Gerendas J, Bendixen R, Schinner K, Tabrizi K, Sattelmacher B, Hansen UP (2000). Different tolerance to light stress in NO3 and + NH4 grown Phaseolus vulgaris L. Plant Biol. 2: 558-570. Zottini M, Costa A, De Michele R, Ruzzene M, Carimi F, Lo Schiavo F (2007). Salicylic acid activates nitric oxide synthesis in Arabidopsis. J. Exp. Bot. 58: 1397-1405.

African Journal of Biotechnology Vol. 11(27), pp. 6983-6990, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3129 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Phosphate uptake and growth characteristics of transgenic rice with phosphate transporter 1 (OsPT1) gene overexpression under high phosphate soils Woon-Ha Hwang1, Soo-Kwon Park1, Tackmin Kwon1, Gihwan Yi1, Min-Hee Nam1, Song-Yi Song1, Sang-Min Kim1, Hang-Won Kang1, Doh-Hoon Kim2, Hoejeong Wang3 and Dong-Soo Park1* 1

National Institute of Crop Science (NICS), Rural Development Administration (RDA), Suwon 441-857, Korea. 2 Department of Genetic Engineering, Dong-A University, Busan 604-714, Korea. 3 Department of Biology Educations, Seoul National University, Seoul 151-742, Korea. Accepted 12 January

Farmers have used phosphate fertilizer to provide sufficient yields. However, overuse of phosphorus accumulate in soil and causes soil and water pollution. We evaluated the phosphate acquisition and growth characteristics of OsPT1 transgenic rice (OsPT1-OX, over-expressing the high affinity phosphate transporter 1) in high phosphate soils with different level of nitrogen fertilizer treatment to investigate its removal ability of excessive phosphate from soil. OsPT1-OX had shorter culm length but more tillers than those of wild-type plants in each soil conditions. Phosphate content per dry weight of OsPT1-OX was 1.8 times higher than that of wild-type under control fertilizer treated conditions. Although the dry weight of OsPT1-OX was not different from that of wild-type plants, whole plant phosphate content was 1.7 times higher than that of wild-type plants under control fertilizer conditions. Tiller number and phosphate content per dry weight of wild-type plants increased following high levels of phosphate application, but did not change following additional nitrogen application. Tiller number and phosphate content per dry weight of OsPT1-OX did not also change under the high phosphate condition, but increased following nitrogen application under similar conditions. Whole plant phosphate content was also highest under high nitrogen and high phosphate application conditions. These results suggest that OsPT1-OX may reduce phosphate content in soils containing excess phosphate and may be further effective under high nitrogen condition. Key words: Phosphate content, fertilizer treatment, phosphate transporter, rice, soil. INTRODUCTION Phosphate is one of the most important elements for plant growth and development, as it is incorporated with sugar phosphates, nuclear acids, nucleotides and coenzymes. Plants absorb phosphate in the form of phosphate ions, represented by (H2PO4)2- or (HPO4)2. Phosphate easily combines with other minerals such as calcium and magnesium, resulting in an available

*Corresponding author. E-mail: parkds9709@korea.kr. Tel: +82 55 350 1184. Fax: +82 55 350 1184.

phosphate of about 0.3% in the most cultivated soils of the world. To achieve higher yields under phosphate deficient condition, farmers have used surplus amounts of chemical fertilizers and animal manure especially in developed countries. Although fertilizer applications increase crop yield, they have caused several problems. The overuse of phosphate fertilizers increase algal productivity in fresh water, potentially leading to ecological problems associated with eutrophication (Gibson, 1997; Haijun and Hongzhu, 2009). Countries including the UK, USA, Canada, France, Germany and China are now paying more attention to the problems posed by lake

6984

Afr. J. Biotechnol.

eutrophication due to the continuous and increasing losses

of soil phosphorus by surface runoff (Zhou and Zhu, 2003; Edwards and Withers ., 1998; Zhang et al., 2008). Phosphates are mostly obtained from mined rock phosphate and existing reserves may be exhausted in the next 50~100 years (Steen, 1998; Smil, 2000; Smit et al., 2009; Vaccari, 2009; Cordell et al., 2011) Therefore, developing crops with improved phosphate uptake is critical to prevent environmental pollution and sustain agricultural production systems. Uptake of phosphate at the roots is regulated by membrane-spanning phosphate transporter (PT) proteins (Raghothama and Karthikeyan, 2005; Mimura, 2001). In plant, PTs are classified into two forms based on phosphate absorption kinetics and affinity to target phosphate (Furihata et al., 1992). High-affinity PTs are induced under phosphate deficient conditions particularly in the roots, whereas low-affinity PTs are expressed constitutively in the aerial parts of plants (Daram et al., 1998; Rae et al., 2003). Many high-affinity PT genes have been isolated from Arabidopsis, potato, maize and tomato (del Pozo et al., 1999; Leggewie et al., 1997; Liu et al., 1998; Miller et al., 2001; Muchhal et al., 1996), suggesting potential targets for improving phosphate uptake (Mitsukawa et al., 1997; Vance et al., 2003). In tomato, transcript levels of high-affinity PTs increase under a phosphate deficient condition and transporter protein and phosphate acquisition also increase concurrently (Muchhal and Raghothama, 1999). Similarly, overexpression of a barley high-affinity PT gene in rice increased phosphate uptake rate over 2.5-fold (Rae et al., 2003) and in transgenic tobacco, over-expressing the Arabidopsis PT gene shows increased phosphate uptake and cell growth (Mitsukawa et al., 1997). In a previous study, we identified nine kinds of high affinity PTs in rice and confirmed their expression pattern under a variety of phosphate conditions (Seo et al., 2008). Among the nine OsPTs genes, the OsPT1 gene was highly expressed under phosphate deficient conditions. To test the possibility that overexpression the OsPT1 gene would increase phosphate uptake, we generated transgenic rice (OsPT1-OX) that over-expresses the OsPT1 gene under the control of the CaMV 35S promoter. OsPT1-OX accumulates almost twice as much phosphate in the shoots compared to that in wild-type plants grown under phosphate deficient soil conditions (Seo et al., 2008). Although several studies have been conducted to generate phosphate uptake enhanced transgenic rice, they focused on phosphate deficient condition. Furthermore, the phosphate uptake ability of OsPT1-OX under sufficient phosphate conditions has not been clearly determined. However, excess phosphate in soil has emerged as an important issue of water and soil pollution as well as the phosphate deficient problem. In this study, we investigated phosphate uptake patterns and growth characteristic of OsPT1-OX under a high phosphate soil condition. We also investigated the possibility of enhancing phosphate uptake by applying

additional nitrogen fertilizer. MATERIALS AND METHODS Transgenic rice (OsPT1-OX) overexpressing the high affinity PT1 gene was generated by Agrobacterium-mediated transformation in the Japonica rice cultivar, Dongjinbyeo. The OsPT1 gene was amplified with a specific primer set that included the XbaI site (forward: tgtctagacatggcgggagggcagct, reverse: gctctagaattacttcgggtaggccgcc) to generate the transformation vector. After digestion of the polymerase chain reaction (PCR) product with XbaI, the OsPT1 gene was fused into the pBTEX binary vector. The expression construct was introduced into Agrobacterium tumefaciens (EHA105) by tri-parental mating (Seo et al., 2008). Transgenic lines were selected based on the OsPT1 gene expression level. Homozygous plants of the T9 generation were used for further studies. Nutrient-treatment for hydroponic culture and the reverse transcription-polymerase chain reaction (RT-PCR) Seeds of OsPT1-OX and wild-type plants were sterilized in 30% sodium hypochlorite for 30 min and germinated on MS medium to determine OsPT1 expression. After three days of germination, the plants were transferred and cultured in nutrient solution for two weeks in the greenhouse under a natural photoperiod. The nutrient composition and concentration for the standard solution [S] was as follows: N (1.43 mM), P (0.32 mM), K (0.51 mM), Ca (0.75 mM), Mg (1.64 mM), Fe (0.51 µM), B (18.92 µM), Mn (9.50 µM), Mo (0.10 µM), Zn (0.15 µM) (Yoshida et al., 1976). For the [high-P] solution, 1.6 mM of phosphate was added and 2.86 mM nitrogen was added in high-P solution to prepare a [high-N·P] solution. The pH of the nutrient solution was adjusted to 5.5 using NaOH and the solution was changed every three days. Total RNA of fresh shoots and roots was isolated 14 days after germination using the TRI reagent (Invitrogen, USA). Total RNA was reverse-transcribed to cDNA using a Prime ScriptTM One Shot RT-PCR kit (Takara, Japan). The following PCR conditions were employed: first strand cDNA synthesis for 30 min at 50°C OsPT1 and actin amplication, second strand cDNA synthesis for 2 min at 94°C, denaturation for 30 s at 94°C , annealing for 30 s at 58°C, and extension for 1 min at 72 °C . After 30 amplification cycles, the PCR product was examined by agarose gel electrophoresis with ethidium bromide staining. PCR primers for synthesized for OsPT1 (forward: 5′-AGGAGCAGGA-GAAGGCTGACG-3′, reverse: 5′CACATCGTCATCGTCCTCGTTC-3′) and actin (forward: 5′ATTCACCACAACGGCCGAGC-3′, reverse: 5′GGAGGGGCGACCACCTTGAT-3′). Field experiment A field experiment was conducted in the GMO field of the National Institute of Crop Science (Miryang, Republic of Korea) from June to October in 2009. Three different fertilization conditions were created in a paddy field (Table 1). Fertilizer application rates in control condition were 9 kg of nitrogen (N), 4.5 kg of phosphorus (P205), 5.7 kg of potassium (K2 0) per 10 acre. A five-time greater amount of phosphate fertilizer (22.5 kg/10 a) than control condition was added in excess phosphate condition [high-P]. To investigate effect of nitrogen on OsPT1-OX growth and phosphate uptake, two times higher amount of nitrogen fertilizer (18 kg/10 a) was applied to the excess phosphate condition [High- N·P]. After a 30-day cultivation in the greenhouse, OsPT1-OX and wild-type plants were transplanted to a paddy field. The plant culm length and tiller numbers in each plot were determined by 10 replications at maximum tillering, booting and at the ripening stage.

Hwang et al.

6985

Table 1. Design of field experiment to test the different fertilizer conditions

Fertilizer Treatmenta Control condition High-P High- N·P

N (Nitrogen) b 50 - 20 - 30 9 9 18

Fertilizer dose (kg/10 acre) P (Phosphorus,P205) K (Potassium,K20) 100 - 0 - 0 70 - 0 - 30 4.5 5.7 22.5 5.7 22.5 5.7

Fertilizer treatment: Control conditions; moderate combination of NPK fertilizer application, high-P; five-folds phosphate fertilizer compare to control condition, High-NP; two-folds nitrogen and five-folds b phosphate fertilizer to compare to control condition. A split method was used for the nitrogen and potassium application at different growth stage of rice; pre-planting (%) – beginning of tillering (%) – and the panicle differentiation stage(%).

Plant nutrient analysis Plants were cut at ground level, washed in tap water and dried at 60°C for three days. Dried plants were divided into leaves, stems and grains, and dry weight was measured. The phosphate content of each sample was measured using the Vanadate method (NIAST, 2000) and total nitrogen and protein contents of the plants were measured using the Kjeldahl method (Varley, 1996) using an Auto Kjeldahl Foss 2300 (Foss, Denmark). Statistical analysis SAS version 9.2 (SPSS Inc) was used for data analysis. Duncan’s multiple range test (DMRT) was carried out to identify significant differences (P < 0.05) between individual treatments.

RESULTS OsPT1 expression of OsPT1-OX For analysis of OsPT1 gene expression in OsPT1-OX and wild-type plants according to different nitrogen and phosphate levels, plants were cultured in nutrient solution with different phosphate and nitrogen levels: standard conditions (S), high-P, and high-N·P conditions. OsPT1 was expressed in the wild-type regardless of nitrogen and phosphate levels, and it was more highly expressed in OsPT1-OX following every treatment with the help of the CAMV 35S promoter (Supplementary Figure 1). Crop growth responses to different phosphate and nitrogen levels The plant height of OsPT1-OX was not significantly different from that of wild-type plant until maximum tillering stage in each treatment. However, culm length of OsPT1-OX was shorter than that of the wild-type plants after booting stage in each treatment (data not shown). Plant culm lengths at ripening stage were between 88.08~93.61 cm in OsPT1-OX, and 100.75~105.95 cm in wild-type plant (Table 2). OsPT1-OX culm length did not change under high-P conditions compared to that under

control conditions, whereas that of wild type increased significantly. Culm length of both varieties further increased under high-N·P conditions. The number of tillers per plant of OsPT1-OX and wild-type plant was 13.2~17.79 and 11.7~14.4, respectively, under the different fertilizer conditions. OsPT1-OX had 1.2 times more tillers than that of wild-type plants regardless of the fertilizer conditions in all stage (data not shown). The change in the tiller number was in accordance with the change in culm length under the different fertilizer conditions (Table 2). The tiller number of wild-type plants increased significantly in high-P conditions, but did increase further under high-N·P conditions. The tiller number of OsPT1-OX increased significantly under highN·P conditions, but not under high-P conditions. Meanwhile, the dry weight of the stem in OsPT1-OX did not increase under high-P conditions compared to that under control conditions (Table 2). However, the dry weight of the stem in wild-type plants increased significantly under high-P conditions. The dry weight of both cultivars significantly increased under high-N·P conditions. Change in phosphate accumulation according to different phosphate and nitrogen levels The average phosphate content of stem was 0.64% per dry weight in OsPT1-OX, and 0.32% in wild-type plants (Table 3). Phosphate content of OsPT1-OX in leaves, stems and grains was 1.56, 1.96 and 1.46 times higher than that in wild-type, respectively. Under high-P conditions, phosphate content of stems in wild-type plant increased compared to that in plant under control conditions, but did not increase in OsPT1-OX. While phosphate content of stems in OsPT1-OX plants significantly increased under the high- N·P condition, it did not increase in wild-type plants. The plant phosphate content (mg) was calculated by multiplying dry weight and phosphate contents (%) per dry weight (Figure 1). The phosphate contents of leaves, stems and grains of OsPT1-OX plants were higher than those in wild-type plants for all treatments. Phosphate contents in the

6986

Afr. J. Biotechnol.

Table 2. Change in growth characteristics and dry weight (g) by different fertilizer treatment at the ripening stage.

Cultivar

Fertilizer treatment

OsPT1-OX

Control Condition High-P High- N·P

Growth characteristics Culm length (cm) No. Tillers per plant b* b 88.08 ± 2.2 13.20 ± 2.2 b b 89.19 ± 2.6 14.90 ± 2.3 a 93.61 ± 3.0 17.79 ± 2.3a c

Leaf b 6.58 ± 0.58 ab 8.52 ± 1.43 10.39 ± 1.1a c

100.75 ± 2.7 b 102.86 ± 2.7 105.95 ± 2.9a

Dry weight (g) Stem Grain b b 20.21 ± 3.23 23.05 ± 3.70 b ab 21.69 ± 3.48 26.31 ± 4.76 25.43 ± 2.98a 30.76 ± 3.60a c

7.31 ± 0.96 b 9.04 ± 1.24 12.41 ± 1.48a

11.70 ± 1.7 a 13.10 ± 2.0 14.40 ± 1.9a

18.35 ± 1.29 b 21.69 ± 3.47 27.86 ± 2.69a

25.31 ± 3.47 b 26.84 ± 2.18 a 33.57 ± 4.14

Total b 50.26 ± 7.94 ab 57.15 ± 9.71 64.74 ± 5.82a b

50.97 ± 5.58 b 58.22 ± 6.97 74.46 ± 7.98a

All values are mean ± SD. *Different letters in a column indicate a significant different at the 5% level by Duncan’s multiple range test.

Table 3. Change in available phosphate and nitrogen content (%) per dry weight by different fertilizer treatment at the ripening stage.

Cultivar

OsPT1-OX

Fertilizer treatment

Phosphate content (%) Leaf

Stem a

Nitrogen content (%) Grain

Leaf

Stem

Grain

Control Condition High-P

0.48 ± 0.052 0.58 ± 0.063 0.73 ± 0.139 0.51 ± 0.102a 0.61 ± 0.029b 0.73 ± 0.064a

1.40 ± 0.04 1.40 ± 0.08b

0.62 ± 0.05 1.11 ± 0.03b 0.62 ± 0.05b 1.09 ± 0.04b

High- N·P

0.51 ± 0.055a 0.76 ± 0.077a 0.71 ± 0.041a

1.70 ± 0.09a

0.76 ± 0.03a 1.35 ± 0.36a

Average

0.50 ± 0.083

0.72 ± 0.863

1.50 ± 0.05

0.67 ± 0.04

Control Condition

0.28 ± 0.029b 0.25 ± 0.052b 0.50 ± 0.088a

1.11 ± 0.03b

0.47 ± 0.02b 0.99 ± 0.02c

0.64 ± 0.104

1.18 ± 0.15

High-P High- N·P

0.37 ± 0.058 0.38 ± 0.056 0.46 ± 0.079 0.31 ± 0.027ab 0.36 ± 0.043a 0.53 ± 0.084a

1.19 ± 0.08 1.43 ± 0.14a

0.50 ± 0.04b 1.04 ± 0.03b 0.60 ± 0.03a 1.15 ± 0.03a

Average

0.32 ± 0.0569 0.32 ± 0.0694 0.50 ± 0.0925

1.24 ± 0.08

0.52 ± 0.03

1.06 ± 0.02

All values are mean ± SD. Different letters in a column indicate a significant different at the 5% level by Duncan’s multiple range test.

leaves and grains of OsPT1-OX gradually increased according to high P and N fertilizer. However, stem phosphate content increased significantly under high-N·P conditions compared to that under control fertilizer conditions. The total phosphate content in both cultivars of plants was higher under high-N·P conditions compared to

that of other treatments. The nitrogen content of stems was 0.47~0.60% in wild-type, and 0.62~0.76% in OsPT1-OX plants (Table 3). Nitrogen content of OsPT1-OX plants was slightly higher than in wild-type plants. The nitrogen content in both cultivars did not increase under high-P conditions, but increased signifi-

cantly under the high-N·P condition. DISCUSSION Many phosphate transporters have been characterized to overcome phosphate-deficient

Hwang et al.

6987

Figure 1. Plant phosphate content (mg) at the ripening stage. The plant phosphate content was calculated by multiplying phosphate content (%) with dry weight. Total P content was summed with phosphate contents of leaves, stems and grains. A: Control condition, B; High-P, C; High- N路P

soil conditions. Phosphate transporters (PT) are divided into the high-affinity PTs and low-affinity PTs. The lowaffinity PTs are mainly active in vascular loading, unloading and remobilization of acquired phosphate, whereas the high-affinity PTs are active in acquisition of phosphate from soils (Smit et al., 2001). Since various high-affinity PTs were identified (Paszkowski et al., 2002; Seo et al., 2008), many researchers have investigated the expression pattern and phosphate acquisition by high-affinity PTs genes. Among the high-affinity PTs, we selected the OsPT1 gene to generate phosphate acquisition enhanced transgenic rice (OsPT1-OX), which is highly expressed in rice regardless of the phosphate condition. In a previous study, we confirmed enhanced acquisition of phosphate by overexpressing the OsPT1 gene. OsPT1-OX had 1.7~2 times more phosphate than that of wild-type plants under phosphate deficient soil condition (Seo et al., 2008; Song et al., 2011).

The morphological characteristics of rice related to phosphate uptake efficiency have been researched to develop phosphate uptake enhanced rice. Hung (1985) reported that tillering ability is the best marker of phosphate deficient tolerant rice cultivars. Additionally, Wissuwa et al. (1998) reported that phosphate uptake and phosphate-use efficiency could be monitored indirectly by dry weight and tiller number. In our study, OsPT1-OX had more tillers and 1.18 ~ 1.7 times higher phosphate content than that of wild-type plants under control phosphate conditions (Tables 2 and 3). Since the use of chemical fertilizers, excess phosphate has been regarded as a serious problem that causes soil and water pollution. Hence, we investigated the possibility of removing excess phosphate from excessive phosphate treated soil using OsPT1-OX plants. Phosphate content (%) of OsPT1-OX was 1.37~1.6 times higher than that of wild-type plants under excess

6988

Afr. J. Biotechnol.

phosphate condition. Furthermore, OsPT1-OX plant phosphate content was 1.15~1.47 times higher than that of wild-type plants despite a lower biomass (Figure 1). From these results, we confirmed that OsPT1-OX can take up more phosphate than wild-type plant under phosphate excessive and control phosphate conditions. Although the tillering ability and phosphate uptake of OsPT1-OX was more effective than those of wild-type plant, OsPT1-OX biomass was not different from that of wild-type plants due to short culm length. Moiser et al. (2004) reported that nutrient recoveries are higher in plots treated with both nitrogen and phosphate combined than with nitrogen or phosphate alone in addition to enhanced crop yield. Similarly, wheat dry matter was highest under nitrogen and phosphate combined treatment among nitrogen, phosphate, nitrogen and phosphate combined treatment (Dordas, 2009). Additionally, Juan et al., 2009) reported that rapeseed yield was higher in NPK and NPB treatments than that in PKB and NKB treatments. Similarly, the short culm length of OsPT1-OX plants was considered for nutrient imbalance from the high phosphate contents. Additional nitrogen content is needed to adjust nitrogen and phosphate balance in OsPT1-OX plants. In this study, OsPT1-OX tiller number under high-P conditions did not increase compared to that under the control condition, whereas tiller number of wild-type plants increased significantly (Table 2). Adding nitrogen to the high phosphate condition (high-N路P) significantly increased tiller number in OsPT1-OX plants, followed by an increase in plant dry weight. We expected that OsPT1-OX took up enough phosphate to increase tiller number under control phosphate conditions, but tiller number did not increase under high phosphate conditions without additional nitrogen due to imbalance of nitrogen and phosphate in the plants. From these results, we suggest that additional nitrogen treatment improved the growth of OsPT1-OX. Phosphate uptake and homeostasis are affected by the presence of several other elements and physical soil factors. The balance between nitrogen and phosphate is important for phosphate uptake and homeostasis (Jain et al., 2007; Ziadi et al., 2008). Dordas (2009) reported that wheat nitrogen content is higher under phosphate fertilizer treatment condition than a no fertilizer treatment condition. Additionally, wheat phosphate content is higher in nitrogen and phosphate combined treatment than nitrogen or phosphate treatment. Our results showed that nitrogen content of OsPT1-OX was significantly higher than that of wild-type plants under control condition (Table 3). The percentage of phosphate content in OsPT1-OX plants did not increase under the high-P conditions but increased significantly under high-N路P conditions, particularly in the stem. In addition, nitrogen content did not change in either cultivar under high phosphate conditions compared to that under the control condition, but increased significantly under high-P路N conditions (Table 3). The biomass of OsPT1-OX was the highest under

high-P路N conditions, and phosphate acquisition was also the highest under the same conditions (Table 2, Figure 1). Based on our results, OsPT1-OX was considered to be effective in the removing of phosphate from soils. Additional nitrogen is needed to improve growth and phosphate acquisition of OsPT1-OX. Meanwhile, further research on the control of nitrogen uptake genes as well as phosphate transporters is warranted to develop more effective phosphate acquisition transgenic plants. ACKNOWLEDGEMENTS This work was supported by a grant from the NextGeneration BioGreen 21 Program (Plant Molecular Breeding Center, no. PJ0080352011), Rural Development Administration, Republic of Korea. REFERENCES Cordell D, White S, Lindstrom T (2011). Peak phosphorus: the crunch time for humanity? The Sustainability Review 2011:2. Daram P, Brunner S, Persson BL, Amrhein N, Bucher M (1998). Functional analysis and cell-specific expression of a phosphate transporter from tomato. Planta, 206: 225-233. Del Pozo JC, Allona I, Rubio V, Leyva A, de la Pena A, Aragoncillo C, Paz-Ares J (1999). A type 5 acid phosphatase gene from Arabidopsis thaliana is induced by phosphate starvation and by some other types of phosphate mobilizing /oxidative stress conditions. Plant J. 19(5): 579-89. Dordas C (2009). Dry matter, nitrogen and phosphorus accumulation, partitioning and remobilization as affected by N and P fertilization and source-sink relations. Eur. J. Agron. 30: 129-139. Edwards AC, Withers PJA (1998). Soil phosphorus management and water quality: a UK perspective. Soil Use. Manage. 14: 124-130. Furihata T, Suzuki M, Sakurai H (1992). Kinetic characterization of two phosphate uptake systems with different affinities in suspensioncultured Catharanthus roseus protoplast. Plant Cell Physiol. 33: 1151-1157. Gibson WR (1997). The dynamics of phosphorus in freshwater and marine environments. In: Tunney, H. et al. (Eds.), Phosphorus Loss from Soil to Water. CAB International. Oxon, pp. 67-98. Haijun W, Hongzhu W (2009). Mitigation of lake euthrophication: Loosen nitrogen control and focus on phosphorus abatement. Progress Nat. Sci. 19: 1445-1451. Hung HH (1985). Studies on tillering ability of rice under phosphorus stress. PhD thesis. A and M University. Texas. Jain A, Poling MD, Karthikeyan AS, Blakeslee JJ, Peer WA, Titapiwatanakun B (2007). Differential effects of sucrose and auxin on localized phosphate deficiency-induced modulation of different traits of root system architecture in Arabidopsis. Plant Physiol. 144: 232-247. Juan ZU, Jian-Wei LU, Fang CHEN, Yin-Shui LI (2009). Increasing Yield and Profit of Rapeseed Under Combined Fertilization of Nitrogen, Phosphorus, Potassium and Boron in Yangtze River Basin. Acta Agron. Sinica, 35(1): 87-92. Leggewie G, Willmitzer L, Riesmeier JW (1997). Two cDNAs from potato are able to complement a phosphate uptake-deficient yeast mutant: identification of phosphate transporters from higher plants. Plant Cell. 9(3): 381-392. Liu H, Trieu AT, Blaylock LA, Harrison MJ (1998). Cloning and characterization of two phosphate transporters from Medicago truncatula roots: regulation in response to phosphate and to colonization by arbuscular mycorrhizal (AM) fungi. Mol. Plant Microbe. Interact. 11(1): 14-22. Miller SS, Liu J, Allan DL, Menzhuber CJ, Fedorova M, Vance CP

Hwang et al.

(2001). Molecular control of acid phosphatase secretion into the rhizosphere of proteoid roots from phosphorus-stressed white luPn. Plant Physiol. 127(2): 594-606. Mimura T (2001). Physiological control of phosphate uptake and phosphate homeostasis in plant cells. Aust. J. Plant Physiol. 28: 653-658. Mitsukawa N, Okamura S, Shirano Y, Sato S, Kato T, Harashima S, Shibata D (1997). Overexpression of an Arabidopsis thaliana highaffinity phosphate transporter gene in tobacco cultured cells enhances cell growth under phosphate-limited conditions. Proc. Natl. Acad. Sci. USA, 94: 7098-7102. Moiser A, Keith Syers J, Freney JR (2004). In Agriculture and the nitrogen cycle: accessing the impact of fertiliser use on food production and the environment, SCOPE publishers/Island Press France. p. 182. Muchhal US, Pardo JM, Raghothama KG (1996). Phosphate transporters from the higher plant Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA, 93: 10519-10523. Muchhal US, Raghothama KG (1999). Transcriptional regulation of plant phosphate transporters. Proc. Natl. Acad. Sci. USA, 96: 58685872. NIAST (National Institute of Agricultural Science and Technology) (2000). Methods of soil and plant analysis. RDA. Suwon, Korea. Paszkowski U, Korken S, Roux C, Briggs SP (2002). Rice phosphate transporters include and evolutionarily divergent gene specifically activated in arbuscular mycorrhizal symbiosis. Proc. Natl. Acad. Sci. USA, 99: 13324-13329. Rae AL, Cybinski DH, Jarmey JM, Smith FW (2003). Characterization of two phosphate transporters from barley; evidence for diverse function and kinetic properties among members of the Pht1 family. Plant Mol. Biol. 53: 27-36. Raghothama KG, Karthikeyan AS (2005). Phosphate acquisition. Plant Soil, 274: 37-49. Zhang RY, Wu FC, Liu CQ, Fu PQ, Li W, Wang LY, Liao HQ, Guo JY (2008). Characteristics of organic phosphorus fractions in different tropic sediments of lakes from the middle and lower reaches of Yangtze River region and Southwestern Plateau, China. Environ. Pollut. 152: 366-372. Zhou Q, Zhu Y (2003). Potential pollution and recommended critical levels of phosphorus in paddy soils of the southern Lake Tai area, China. Geoderma. 115: 45-54.

6989

Seo HM, Jung YH, Song SY, Kim YH, Kwon TM, Kim DH, Jeung SJ, Yi YB, Yi GH, Nam MH, Nam JS (2008). Increased expression of OsPT1, a high-affinity phosphate transporter, enhances phosphate acquisition in rice. Biotechnol. Lett. 30: 1833-1838. Smil V (2000). Phosphorus in the environment: natural flows an human interferences. Annu. Rev. Energy Environ. 25: 53-88. Smit AL, Bindraban PS, Schrodor JJ, Conijn JG, Van Der Neer HG (2009). Phosphorus in agriculture: global resources trends and developments. Wageningen, The Netherlands: Plant Res. Intl. B.V. p.36 Smit SE, Dickson S, Smith FA (2001). Nutrient transfer in arbuscular mycorrhizas: how are fungal and plant processed integrated? Aust. J. Plant Physiol. 28(7): 685-696. Song SY, Yi GH, Park DS, Seo JH, Son BY, Kim DH, Nam MH (2011). Expression of OsPTs-OX Transgenic Rice in Phosphate-Deficient Condition. Korean J. Crop Sci. 56(3): 264-272. Steen I (1998). Phosphorus avaliability in the 21st Century: management of a nonrenewable resource. Phosphorus and Potassium, 217: 25-31. Vaccari DA (2009). Phosphorus: a looming crisis. Sci. Am. 300: 54-59. Vance CP, Uhde-Stone C, Allan DL (2003). Phosphorus acquisition and use: critical adaptation by plants for securing a non-renewable resource. New Phytol. 157: 423-447. Varley J (1966). The determination of N, P, and K ions in plant materials. Analyst. 91: 119-126. Wissuwa M, Yano M, Ae N (1998). Mapping for phosphorus-deficiency tolerance rice (Oryza sativa L.). Theor. Appl. Genet. 97: 777-783. Yoshida S, Forno DA, Cock JH, Gomez KA (1976). Laboratory manual for physiological studies of rice. IRRI. Los Banos, Philippines. pp 6165. Ziadi N, Blanger G, Cambouris AN, Tremblay N, Nolin MC, Claessens A (2008). Relationship between phosphorus and nitrogen concentration in spring wheat. Agron. J. 100(1): 80-86.

6990

Afr. J. Biotechnol.

Supplementary Figure 1. OsPT1 expression in OsPT1-OX and wild-type plants in different nutrient solutions. S, Shoot; R, root; S, standard solution.

Full Length Research Paper

Molecular cloning, structural analysis and expression of a zinc binding protein in cotton Ying-fan Cai1#, Xian-ke Yue1,2#, Yi Liu1,2*, Quan Sun1, Xiaohong He1 and Huaizhong Jiang1 1

College of Bioinformatics, Chongqing University of Posts and Telecommunications, Chongqing 400065, China. 2 College of Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu 610041, China. Accepted 27 January, 2012

The full-length zinc-binding protein (ZnBP) gene was cloned from a normalized cDNA library constructed from a cotton mutant (Xiangmian-18) during the gland-forming stage. The clone was sequenced and analysed. BLASTP analysis showed that the deduced amino acid sequence of ZnBP in Xiangmian-18 is similar to that in Arabidopsis thaliana (GenBank accession no. EFH46337.1) with an overall similarity of 77%. The cDNA insert comprises 654 base pairs (bp) and 217 amino acid residues. Its molecular weight is 24.6 kDa, and the theoretical pI is 9.33. The cotton ZnBP gene was cloned from the gDNA from Xiangmian-18 leaves. After sequencing the two fragments, a 1731 bp cotton ZnBP gene with three introns was identified. Using pET-28a(+) as a prokaryotic expression vector, the gene was expressed in Escherichia coli BL21(DE3). The conditions for achieving optimal ZnBP expression were 37°C, IPTG 1 mmol/L, 8 h and a shaker speed of 150 rpm. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis confirmed the correct expression of the protein. pCAMBIA2300-35S-OCS was used as a eukaryotic expression vector. The recombinant plasmid pCAMBIA2300-ZnBP was used to transform competent Agrobacterium GV3101 by the freeze-thaw method. Then, A. thaliana plants were transformed by the floral dipping method. Transformed plants were grown to maturity in a growth chamber. After screening on kanamycin-resistant half-strength Murashige and Skoog plates and polymerase chain reaction (PCR) analysis, two transgenic plant strains were obtained. Northern blot analysis showed that ZnBP expression was higher in homozygous plants than in wild-type plants. The differences between the phenotypes of homozygous and wild-type plants indicate that the ZnBP gene affects the growth and development of A. thaliana. The results of prokaryotic expression of ZnBP and overexpression of the ZnBP gene in A. thaliana improve our understanding of the function of this gene. Future studies should investigate the molecular mechanisms involved in gland morphogenesis in cotton. Key words: Gossypium hirsutum, pigment gland, zinc binding protein, prokaryotic expression, overexpression. INTRODUCTION Metal ions are essential in various biochemical functions. They are incorporated into or associate with proteins in living cells, and can have purely stabilizing roles or be central to protein function (Wintz et al., 2003; Cox, 2000; Michel and Berg, 2002; Jensen et al., 2005). About 30%

*Corresponding author :E-mail: luyi@cqupt.edu.cn, caiyf3000@ yahoo.com.cn. #These authors contributed equally to this work.

contain at least one metalloenzyme that requires Mg, K, Ca, Fe and Zn to sustain life. Other elements in cluding Cu, Mo, Ni, Se and Co are required by more primitive organisms (Arya et al., 1998; Dupont et al., 2010). The bound amino acids are almost always Cys, His, Glu and Asp residues (Golovin, 2005; Auld, 2001), which ligate metal ions through polar side chain atoms (Alberts, 1998). Metal-binding proteins play fundamental roles in plant processes, acting as cofactors in enzymes, osmotic regulators and current carriers in structural functions of proteins, as well as in protein – protein interactions (Kraemer and Clemens, 2005; Passerini et al., 2006). In

6992

Afr. J. Biotechnol.

plant mitochondria, key functions of metal cofactors include metabolism, electron transport, ATP synthesis and the detoxification of reactive oxygen species (Bridgewater, 2006; Harding, 2004; Tan, 2010). Zinc is one of the most abundant and important metal ions (Dupont et al., 2010; Rachline et al., 2005; Auld, 2001). It is essential for the growth and development of not only plants (Kraemer and Clemens, 2005; Passerini et al., 2006; Bridgewater, 2006; Harding, 2004; Tan, 2010; Bixby, 1999), but also animals including humans (Frederickson, 1989; Earl et al., 1988) and microorganisms (Stempniak et al., 1997; Muhlberger et al., 1999). More than three hundred enzymes/proteins that require zinc to function have been identified (Vallee, 1999; Coleman, 1992). Zinc is required for the protein import apparatus, for both carrier protein transport to the inner membrane and pre-sequence degradation (Kuznetsova et al., 2005). Zinc readily forms complexes with amino acids, peptides, nucleotides and proteins in biological media (Vallee and Auld., 1990). Physical and chemical properties of zinc, such as its stable association with proteins and its co-ordination flexibility, make it highly adaptable to the requirements of proteins and enzymes that carry out diverse biological functions (Vallee, 1993, 1999; Coleman, 1992). The amino acids involved in zinc–protein interactions are histidine, glutamate, aspartate and cysteine (Golovin, 2005; Auld, 2001; Alberts, 1998; Golovin, 2005). For a structural zincbinding site, Cys and His are the preferred coordinating residues, and there are usually no water molecules in the primary coordination sphere (Auld, 2001; Patel et al., 2007). In numerous zinc-binding proteins (ZnBPs), zinc ions are organized into tetrahedral or distorted tetrahedral structures according to negatively charged groups (carboxylates and thiolates) by charge–charge interactions, and/or neutral dipolar groups (example, carbonyls and imidazoles) through orientation-dependent charge–dipole interactions (Vallee and Falchuk, 1993; Wooltorton et al., 1997; Rachline et al., 2005). Plant AT-rich sequence and zinc-binding protein 1 (PLATZ1) was isolated from peas (Inaba, 1999). Expression of PLATZ1 represses the expression of reporter constructs containing the coding sequence of a luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to tandem repeat A/T-rich sequences (Sandhu et al., 1998; Schwabe and Klug, 1994; Nagano, 2001). Zinc also help to modulate the properties of channels such as voltage-gated channels (Bixby, 1999; Anumonwo, 1999; Wang, 2007), NMDA receptor channels (Rachline et al., 2005), GABA channels (Wooltorton et al., 1997) and chloride channels (Chen, 1998). MTI-II was isolated as ZnBP and found to be identical to parathymosin. It functions not only in the nucleus but also in the cytoplasm, playing essential and important roles in cell differentiation, although its specific functions and precise molecular mechanisms remain unknown (Okamoto and Isohashi, 2000). To date, there

have been no reports of ZnBP in cotton. We previously isolated the complete sequence of ZnBP from a normalised cDNA library constructed from a cotton mutant (Xiangmian-18) during the gland-forming stage (Xie et al., 2007). The structure of the gene was analysed, a ZnBP prokaryotic expression vector was constructed and expressed in Escherichia coli BL21(DE3), and a ZnBP overexpression vector was constructed and transfected into Arabidopsis thaliana. In this study, the differences in the phenotypes of homozygous and wild type (WT) plants were compared to gain an initial understanding of the functions of the gene, and to provide a scientific basis for studying related biological functions such as the molecular mechanism of gland formation and the metabolism of gossypol. MATERIALS AND METHODS Seeds from Xiangmian-18 (with low gossypol seeds and glanded plants) were obtained from the National Research Center for CrossCotton of China (Hunan Changde, China), while seeds from WT A. thaliana (ecotype “Columbia”) were provided by the Crop Institute of the Chinese Academy of Agricultural Sciences. Strains and plasmid E. coli DH5a, E. coli BL21(DE3), Agrobacterium GV3101 and pET28a(+) were available in our laboratory. pMD19-T vector was obtained from TaKaRa (Japan) and pCAMBIA2300-35S-OCS was provided by the Chinese Academy of Agricultural Sciences. Enzymes and reagents Restriction endonucleases (XbaI, SalI, XhoI, BamHI, and PstI), T4 DNA ligase, DNase I (RNase-free), RNase H and TaKaRa Ex Taq™ were obtained from TaKaRa (Japan). The plant gDNA isolation mini kit and plant RNA isolation mini kit were purchased from Watson Biotech (Shanghai, China). TIAN prep mini plasmid kit, TIAN gel mini purification kit, TIAN script RT kit, anti-His antibody, Pro-light HRP chemiluminescence detection reagent, and DNA marker III were obtained from TIANGEN Biotech Co., Ltd (Beijing, China). Molecular cloning and sequence analysis of the cotton ZnBP gene Total RNA extraction and synthesis of the first-strand cDNA Cotton seeds were disinfected in 70% ethanol and 5% NaClO solution, dipped in sterilized water, and allowed to bud in plates containing sterilized filter paper and water. The pigment gland begins to develop 36 h after budding. Total RNA was extracted using the plant RNA isolation mini kit (Watson Biotech) according to the manufacturer’s instructions. RNA yield was measured using an ultraviolet spectrometer and through electrophoresis on a denaturing formaldehyde agarose gel. First-strand cDNA was synthesized using the TIAN script RT kit (TIANGEN Biotech Co., Ltd). Cloning of the ZnBP gene and sequence analysis The primary cDNA synthesised was used as a template for

Cai et al.

6993

Table 1. The amplification PCR primers in structural analysis.

Primer ZnBP-1F ZnBP-1R ZnBP-2F ZnBP-2R

Sequence of primer (5’—3’) TCCGTGAAATCAAGCCCAAA GAGAACAGAAGCGAAATGAG GACCGTAGCCTTGTCG GTAGGGTAAATATATATC

polymerase chain reaction (PCR) amplification using the ZnBP gene-specific primers ZnBPF (5’ATGGGAGCTGGTGGGCCTGATG-3’) and ZnBPR (5′TTAATATTCTATGATTAGACC-3′), which were designed based on the ZnBP gene of normal upland cotton (Gossypium hirsutum, GenBank accession no. EU372997.1). Reactions (total volume, 20 µL) contained the following: template, 25 ng; 10× Taq buffer, 2 µL; dNTP mix, 1.6 µL; MgCl2, 1.2 µL; F and R primers (20 mmol), 1 µL each; Taq DNA polymerase, 0.2 µL; and H2O, 12 µL. PCR was performed with the following thermal conditions: 94°C for 4 min followed by 30 cycles of 94°C for 45 s, 56°C for 45 s, and 72°C for 60 s, and a final extension at 72°C for 10 min. The amplified cDNA fragment was isolated by agarose gel electrophoresis and then purified. The purified fragment was cloned into the pMD19-T vector (TaKaRa) and then transfected into E. coli DH5α. The inserted fragment was sequenced by Beijing Sunbiotech Co., Ltd. Primer design and the identification of open reading frames in the novel cotton ZnBP cDNA sequence were performed using DNAman software. BLASTN and BLASTP were used to identify sequences in GenBank that are homologous to the cotton ZnBP cDNA and protein sequences (http://www.ncbi.nlm.nih.gov/blast). Structural analysis of the cotton ZnBP gene Genomic DNA extraction, PCR amplification, and sequencing Xiangmian-18 leaves were collected and total DNA was extracted using a plant gDNA isolation mini kit (Watson Biotech). The primers, ZnBP-1F/ZnBP-1R and ZnBP-2F/ZnBP-2R, were designed based on the sequence of the cotton ZnBP cDNA (Table 1). PCR amplification was performed using 2× Taq Master Mix (TIANGEN Biotech Co., Ltd). Reactions (total volume, 20 µL) contained the following: template 100 ng; 2× Taq Master Mix, 10 µL; F and R primers (ZnBP-1F/ZnBP-1R or ZnBP-2F/ZnBP-2R), 1 µL each; and H2O, 8 µL. PCR was performed with the following thermal conditions: 94°C for 5 min followed by 30 cycles of 94°C for 60 s, 56°C for 60 s and 72°C for 2 min, and a final extension at 72°C for 10 min. The amplified fragment was isolated by agarose gel electrophoresis and then purified. The purified fragment was cloned into the pMD19-T vector (TaKaRa) and then transfected into E. coli DH5α. The inserted fragment was sequenced by Beijing Sunbiotech Co. Ltd. Structural analysis of ZnBP from cotton DNAman software was used to compare the gDNA sequence to the cDNA sequence to determine the number, length and position of introns in the cotton ZnBP gene. Prokaryotic expression analysis of cotton ZnBP pET-28-ZnBP vector construction and E. coli BL21(DE3) transformation The primary cDNA synthesised was used as a template for PCR

amplification using the ZnBP gene-specific primers YHZnBPF (5′CGGATCCATGGGAGCTGGTGGGCCTGATG-3′) and YHZnBPR (5′-CCCTCGAGTTAATATTCTATGATTAGACC-3′), which were designed based on the ZnBP gene of normal upland cotton. (The underlined sequences represent BamHI and XhoI restriction sites.) The inserted fragment was isolated and ligated into BamHI- and XhoI-digested pET-28a (+) expression vector and then transfected into E. coli BL21 (DE3) cells (Novagen). The recombinant plasmid was named pET-28-ZnBP and the inserted fragment was sequenced by Beijing Sunbiotech Co. Ltd.

Expression and analysis of pET-28-ZnBP The confirmed clone was grown in kanamycin-supplemented LuriaBertani (LB) medium to an OD600 of 0.8 to 1.0 at 37°C and 150 rpm, and then induced with isopropyl-β-D-thiogalactopyranoside (IPTG). Culture samples (20 ml) for different induction times (0, 2, 4, 8 and 12 h) were processed by the ultrasonic method, and the cell pellets were collected by centrifugation at 12,000 rpm. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed with a 4% (v/v) stacking gel and a 15% (v/v) separating gel. Separated proteins were visualised by Coomassie Brilliant Blue staining and gel images were captured using a Gel Doc 2000 Gel Documentation System (Bio-Rad). For Western blot analysis, recombinant protein samples were separated by SDS-PAGE and then electrically transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with membrane-confining liquid (25°C, 300 mA, 2 h), and then incubated overnight at 4°C with anti-His antibody (dilution 1:2,000). After washing for 10 min with PBST, the membrane was incubated with horseradish peroxidaseconjugated goat anti-mouse IgG in membrane-confining liquid (dilution 1:200). The blot was washed three times with phosphatebuffered saline (PBST) (10 min per wash). Finally, the blot was incubated in the dark with Pro-Light HRP detection reagent, and images were captured using a Gel Doc 2000 gel documentation system.

Overexpression of the cotton ZnBP gene pCAMBIA2300-ZnBP vector construction and A. thaliana transformation The primary cDNA synthesised was used as a template for PCR amplification using the ZnBP gene-specific primers GBZnBPF (5′GCTCTAGAATGGGAGCTGGTGGGCCTGATG-3′) and GBZnBPR (5′-AACTGCAGTTAATATTCTATGATTAGACC-3′), which were designed based on the ZnBP gene of normal upland cotton (the underlined sequences represent XbaI and PstI restriction sites). The plant expression vector pCAMBIA2300-35S-OCS containing the CaMV 35S promoter and the nptII kanamycin-resistance gene was used to clone the cotton ZnBP gene. The amplified ZnBP fragment and pCAMBIA2300-35S-OCS vector were digested using XbaI and PstI, isolated by agarose gel electrophoresis and then purified. The purified fragment was cloned through incubation

6994

Afr. J. Biotechnol.

Figure 1. Alignment of the deduced amino acid sequences of ZnBP in cotton and A. thaliana. Amino acids are numbered on the left. Identical residues are shown with gray shading.

overnight at 16°C with T4 DNA ligase, and then transfected into E. coli DH5α. The recombinant plasmid was sequenced by Beijing Sunbiotech Co. Ltd. Subsequently, the recombinant plasmid pCAMBIA2300-ZnBP was used to transform competent Agrobacterium GV3101 by the freeze-thaw method. A recombinant Agrobacterium strain was selected and used to transform A. thaliana plants by the floral dipping method. Transformed plants were grown to maturity in a growth chamber.

Selection and analysis of transgenic A. thaliana plants Seeds (T1) were collected from the transformed plants and checked by growing them on kanamycin-resistant half-strength Murashige and Skoog (1/2MS) plates containing 50 µg/ml. Resistant plants were transferred to pots containing vermiculite, perlite, soil (3:1:1 v/v/v), and ½ MS liquid medium and grown to maturity in a growth chamber. Kanamycin-resistant plants were screened for the presence of the transgene by PCR using the pCAMBIA2300-ZnBPspecific primers 2300F (5′-GCTATGACCATGATTACGAAT-3′) and 2300R (5′-GCAAGGCGATTAAGTTGGG- TAAC-3′), which were designed based on the sequence of the pCAMBIA2300-35S-OCS vector. DNA was isolated from the leaves of transgenic and WT plants using a plant gDNA isolation mini kit (Watson Biotech). The amplified fragments were analysed on a 1% agarose gel. Furthermore, Seeds (T2) were harvested and sown on ½ MS agar to obtain homozygous plants. Homozygous plants were transferred to soil and were grown for the purpose of seed production. Seeds (T3) from these homozygous plants were used for Northern blot analysis.

Northern blot analysis of ZnBP expression Total RNA was isolated from the seedlings of homozygous and WT plants using a plant RNA isolation mini kit (Watson Biotech) and analysed on a 1% agarose gel. Next, total RNA was fractionated on a denaturing agarose gel and transferred to a positively charged nylon membrane (Maarten and Feng, 1995) according to the method described in the DIG-High Prime DNA Labelling and Detection Starter Kit (F. Hoffmann-La Roche, Ltd). Phenotype analyses of transgenic A. thaliana plants Seeds (T3) were sown on ½ MS agar after disinfection. Seven days

later, the seedlings from transgenic and WT A. thaliana plants were transferred to pots containing vermiculite, perlite, soil (3:1:1 v/v/v), and ½ MS liquid medium. Differences between the transgenic and WT A. thaliana plants were compared 21 and 30 days later.

RESULTS Molecular cloning and sequence analysis of the cotton ZnBP gene cDNA encoding the ZnBP gene from an upland cotton gland mutant (Xiangmian-18) during the pigment glandforming stage was amplified by RT-PCR. A 654 base pair (bp) open reading frame encoding a 217 aa protein with a calculated molecular mass of 26.4 kDa and an isoelectric point of 9.33 was identified. The DNA sequence of the ZnBP gene was deposited in GenBank (accession no. EU372997.1). BLASTP analysis showed that the deduced amino acid sequence of ZnBP in Xiangmian-18 is similar to that in A. thaliana (accession no. EFH46337.1), with an overall similarity of 77% (Figure 1).

Structural analysis of the cotton ZnBP gene Genomic DNA extracted from Xiangmian-18 leaves was used as the template for PCR using the primers ZnBP1F/ZnBP-1R and ZnBP-2F/ZnBP-2R. After sequencing the two fragments cloned from the cotton ZnBP gene, the cotton ZnBP gene, 1731 bp in length and containing three introns, was identified (Figure 2). Prokaryotic expression analysis of cotton ZnBP The recombinant plasmid pET-28- ZnBP was transfected into E. coli BL21(DE3) and the expression of recombinant ZnBP protein was induced through treatment with IPTG.

Cai et al.

6995

Figure 2. The sketch map of ZnBP gene. Intron I =99 bp; Intron II = 714 bp; Intron III = 264 bp; Exon I = 198 bp; Exon II = 216 bp; Exon III = 237 bp.

Figure 3. (A) SDS-PAGE analysis of the recombinant ZnBP. SDS-PAGE (15%) was loaded with E. coli extract expressing the ZNBP before (lane 2) and after 2, 4, 8 and 12 h IPTG induction (lanes 3, 4, 5, 6), and lane 1 was the protein product by vector of pET-28a(+). (B) Western blotting analyses with lane 5. Molecular weight markers in KDa are indicated on the right. The larger size of the fusion protein is due to the N-terminal leader peptide of 3.5 kDa encoded by the expression vector.

The estimated molecular mass of recombinant ZnBP was confirmed by SDS-PAGE (Figure 3A). Western blot analysis confirmed that the expressed recombinant protein was ZnBP (Figure 3B). Overexpression of the cotton ZnBP gene Using the plant expression vector pCAMBIA2300-35SOCS, we constructed the recombinant plasmid pCAMBIA2300-ZnBP. This plasmid was then transfected into competent Agrobacterium GV3101 by the freezethaw method. A recombinant Agrobacterium strain was selected and used to transform A. thaliana plants. Transformed plants were grown to maturity in a growth chamber. Seeds (T1) were collected from the transformed plants and checked by growing them on kanamycin-1 resistant ½ MS plates containing 50 µg ml . Some seeds failed to germinate and turned yellow 10 days after germinating. Two resistant plant strains were transferred to pots, and DNA was isolated from the leaves of transgenic and WT plants using a plant gDNA isolation

mini kit (Watson Biotech). Kanamycin-resistant plants were screened for the presence of the transgene by PCR using the pCAMBIA2300-ZnBP-specific primers 2300F and 2300R. The amplified fragments were analysed on a 1% agarose gel (Figure 4). Total RNA was isolated from the seedlings of two homozygous strains (ZnBP-1 and ZnBP-2) and WT plants using a plant RNA isolation mini kit (Watson Biotech), and analysed on a 1% agarose gel (Figure 5A). Then the total RNA was fractionated on denaturing agarose gels and transferred to a positively charged nylon membrane according to the method described in the DIG-High Prime DNA Labelling and Detection Starter Kit (F. Hoffmann-La Roche, Ltd) (Figure 5B). Seeds (T3) were sown on ½ MS agar after disinfection. Seven days later, transgenic and WT A. thaliana seedlings were transferred to pots containing vermiculite, perlite, soil (3:1:1 v/v/v), and ½ MS liquid medium. The transgenic and WT A. thaliana plants were compared after 21 (Figure 6A) and 30 days (Figure 6B). The differences in the phenotypes of homozygous and WT plants indicated that the ZnBP gene affects the growth

6996

Afr. J. Biotechnol.

Figure 4. PCR analysis of transgenic A. thaliana plants. M, DNA Marker; lane 1, gDNA isolate from wild type A. thaliana plants; lane 2, the pCAMBIA2300-ZnBP recombinant plasmid; lanes 3 and 4, gDNA isolate from transgenic A. thaliana plants.

Figure 5. (A) Lane 1, Total RNA isolated from the seedling of ZnBP-1 homozygous plants; lane 2, total RNA isolated from the seedling of ZnBP-2 homozygous plants; lane 3, total RNA isolated from the seedling of wild type plants. (B) Northern blotting analysis of transgenic A. thaliana plants; lane 1, total RNA samples (40 µg) isolated from the seedling of wild type plants; lane 2, total RNA samples (40 µg) isolated from the seedling of ZnBP-1 homozygous plants; lane 3, total RNA samples (40 µg) isolated from the seedling of ZnBP-2 homozygous plants. All of these were tested using the ZnBP cDNA as probe.

Cai et al.

6997

Figure 6. The phenotype comparison between ZnBP transgenic and wild-type A. thaliana. 1, 30-day-old seedlings of ZnBP-1 homozygous A. thaliana; 2, 30-day-old seedlings of ZnBP-2 homozygous A. thaliana; 3, 30day-old seedlings of wild-type A. thaliana.

and development of A. thaliana. DISCUSSION Zinc ions play important roles in structural stability and complex formation (Wintz et al., 2003; Michel and Berg, 2002), the regulation of gene expression (Wintz et al., 2003; Jensen et al., 2005; Hantke, 2001), DNA processing (Feng, 2004), transport (Hantke, 2001; Harris, 2000), metabolism and control (Wintz et al., 2003; Hantke, 2001; Vallee, 1990), as well as other processes such as cellular respiration and antioxidant defence (Lieu et al., 2001). Most of them are identified as DNA-binding or protein-binding proteins, while others function as RNAbinding proteins. Zinc-binding protein as common transcription factors are important regulators of cellular processes and the complexity of living organisms necessitates a large number of transcription factors. In

Arabidopsis, zinc-binding protein participates in a new regulatory mechanism governing seed germination and stem growth (Deng, 1992; Ballachanda, 2007). Given the preliminary study about mechanism of organogenesis genes that regulate widespread changes in gene expression, here we report the characterization of the cotton ZnBP gene and overexpression in the A. thaliana transgenic plants expressing the ZnBP cDNA under the control of the constitutive CaMV 35S promoter. The phenotype comparison between ZnBP transgenic and wild-type A. thaliana is that the growth of transgenic was slower than wild-type A. thaliana. ZAT6 is very closely related and share an identical DNA binding domain. Overexpression of ZAT6 resulted in retarded root and seedling growth during early stages of seedling development. The mechanism of overexpression of ZAT6 suppressed the expression of several Pi stressresponsive genes, suggesting its influence on multiple facets of Pi homeostasis. These results indicate that

6998

Afr. J. Biotechnol.

ZAT6 is a repressor of primary root growth that regulates Pi homeostasis by controlling the root architecture independent of the Pi status of the plant (VicenteCarbajosa et al., 1997; Ballachanda, 2007). Also transgenic plants overexpressing AZF under the control of a glucocorticoid-inducible promoter showed severe growth retardation with morphological defects. This dwarf phenotype is consistent with the results obtained from the overexpression of ZAT6 (Sakamoto et al., 2004; Mittler et al., 2006; Ciftci-Yilmaz et al., 2007). Although, the difference phenotype between ZnBP transgenic and wild-type A. thaliana is obvious, the molecular mechanisms controlling plant growth are yet unknown. In future studies, we hope to transform the ZnBP overexpression vector and construct a ZnBPspecific RNAi vector, and transfect into cotton to gain further insights into the function of the ZnBP gene. ACKNOWLEDGEMENTS This work was supported by the Natural Science Foundation of China (NSFC grant No. 31071461ďź&#x152;3077131) and Chongqing Natural Science Foundation( CSTC,2011AB1095; CSTC,2009BA1088, Chongqing Municipal Commission of Education(No. KJ110506). REFERENCES Alberts IL, Nadassy K, Wodak SJ (1998). Analysis of zinc binding sites in protein crystal structures. Protein Sci. 7: 1700-1716. Anumonwo J M, Horta J, Delmar M, Taffet S M, Jalife J (1999). Proton and zinc effects on HERG currents. Biophys. J. 77: 282-298. Arya ,David M.Mount,Nathan S.Netanyahu, Ruth Silverman, Angela Y.Wu (1998). An optimal algorithm for approximate nearest neighbor searching fixed dimensions.J. ACM (JACM). 45(6): 891-923. Auld D S( 2001). Zinc coordination sphere in biochemical zinc sites. Biometals. 14: 271-313. Ballachanda N D, Vinay K N, Kashchandra G R (2007). Phosphate Homeostasis and Root Development in Arabidopsis Are Synchronized by the Zinc Finger Transcription Factor ZAT61. Plant Physiology, 145: 147-159. Benz CC, Keniry MA, Ford JM, Townsend AJ, Cox FW, Palayoor S, Matlin SA, Hait WN, Cowan KH (1990). Biochemical correlates of the antitumor and anti mitochondrial properties of gossypol enantiomers. Mol Pharmacol. 37: 840-847. Bixby K A, Nanao M H, Shen N V, Kreusch A, Bellamy H, Pfaffinger P J, Choe S (1999). Zn21-binding and molecular determinants of tetramerization in voltage-gated K1 channels. Nat. Struct. Biol. 6: 3843. Cai YF, Mo JC, Zeng Y, Ren WW, Xu Y, Wang SH, Chen F (2003). Cloning of cDNAs of differentially expressed genes in the development of special pigment gland of cotton by suppression subtractive hybridization. J Beijing Univ For. 25: 6-10 (Chinese). Chen T Y (1998). Extracellular zinc ion inhibits ClC-0 chloride channels by facilitating slow gating. J. Gen. Physiol. 112: 715-726. Cole man JE (1992). Zinc proteins: enzymes, storage proteins, transcription factors, and replication proteins. Annu. Rev. Biochem. 61: 897-946. Cox EH, McLendon GL (2000). Zinc-dependent protein folding. Curr Opin Chem Biol. 4(2): 162-165. Cristiana Picco, Alessia Naso, Paolo Soliani, Franco Gambale (2008). The Zinc Binding Site of the Shaker Channel KDC1 from Daucus

carota. Biophy. J. pp. 424-433. Deng XW, Matsui M, Wei N, Wagner D, Chu A M, Feldmann K A, Quail PH (1992). COP1, an Arabidopsis regulatory gene, encodes a protein with both a zinc-binding motif and a Gb homologous domain. Cell 71: 791-802. Dupont, Andrew Butcher, Ruben E.Valas, Philip E.Bourne, and Gustavo. (2010). History of biological metal utilization inferred through phylogenomic analysis of protein structures. Proceedings of the National Academy of Sciences, 107 (23): 10567. Earl C, Chantry A, Mohammad N, Glynn P (1988). Zinc ions stabilize the association of basic protein with brain myelin membranes. J. Neurochem. 51: 718-724. Feng M, Patel D, Dervan JJ, Ceska T, Suck D, Haq I, Sayers JR (2004). Roles of divalent metal ions in flap endonuclease-substrate interactions. Nat Struct Mol Biol, 11(5): 450-456. Frederickson C J (1989). Neurobiology of zinc and zinc-containing neurons. Int. Rev. Neurobiol. 31: 145-238. Golovin A, Dimitropoulos D, Oldfield T, Rachedi A, Henrick K MSD (2005)site: a database search and retrieval system for the analysis and viewing of bound ligands and active sites. Proteins, 58: 190-199. Hantke K (2001). Iron and metal regulation in bacteria. Curr Opin Microbiol, 4(2): 172-177. Harding MM (2004) The architecture of metal coordination goups in proteins. Acta Crystallogr D Biol Crystallogr. 60 : 849-859. Harris ED (2000). Cellular copper transport and metabolism. Annu Rev Nutri, 20: 291-310. InabaT, NaganoY, SakakibaraT, Sasaki Y (1999). Identification of a cisregulatory element involved in phytochrome down-regulated expression of the pea small GTPase gene pra2. Plant Physiology, 120: 491-499. Jensen MR, Petersen G, Lauritzen C, Pedersen J, Led JJ (2005). Metal binding sites in proteins: identification and characterization by paramagnetic NMR relaxation. Biochemistry, 44(33): 11014-11023. Kraemer U, Clemens S (2005). Functions and homeostasis of zinc, copper, and nickel in plant. Topics Curr. Gen. 14: 216-271. Kuznetsova SS, Azarkina NV, Vygodina TV, Siletsky SA, Konstantinov AA (2005). Zinc ions as cytochrome c oxidase inhibitors: two sites of action. Biochemistry (Mosc), 70: 128-136. Lieu PT, Heiskala M, Peterson PA, Yang (2001) The roles of iron in health and disease. Mol Aspects Med. 22(1-2): 1-87. Maarten H K,Feng J(1995).Cataloging altered gene expression in young and senescent cells, using enhanced differential display. Nucleic Acids Research, 23: 3244-3251. Michel SL, Berg JM (2002). Building a metal binding domain, one half at a time. Chem Biol. 9(6): 667-668. Muhlberger E, Weik M, Volchkov VE, Klenk HD, Becker S (1999). Comparison of the transcription and replication strategies of Marburg virus and Ebola virus by using artificial replication systems. J. Virol. 73: 2333-2342. Okamoto K, Isohashi F (2000). Purification and primary structure of a macromolecular-translocation inhibitor II of glucocorticoid receptor binding to nuclei from rat liver. Inhibitor II is the 11.5-kDa Zn2+binding protein. Dept. Biochem. 267(1): 155-162. Passerini A, Punta M, Ceroni A, Rost B, Frasconi P (2006). Identifying cysteines and histidines in transition metal-binding sites using support vector machines and neural networks. Proteins, 65: 305-316. Patel K, Kumar A, Durani S (2007) Analysis of the structural consensus of the zinc coordination centers of metalloprotein structures. Biochem. Biophys Acta. 1774: 1247-1253. Rachline J, Perin-Dureau F, Goff A Le, Neyton J, Paoletti P (2005). The micromolar zinc-binding domain on the NMDA receptor subunit NR2B. J. Neurosci. 25: 308-317. Sandhu JS, Webster CI, Gray J C (1998). A/T-rich sequences act as quantitative enhancers of gene expression in transgenic tobacco and potato plants. Plant Mol. Biol. 37: 885-896. Schwabe J W, Klug A (1994) Zinc mining for protein domains. Nature Struct. Biol. 1: 345-349. Stempniak M, Hostomska Z, Nodes B R, Hostomsky Z (1997). The NS3 proteinase domain of hepatitis C virus is a zinc-containing enzyme. J. Virol. 71: 2881-2886. Vallee BL, Auld D S (1990) Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochemistry, 29: 5647-5659.

Cai et al.

Vallee, B.L. & Falchuk, K.H. (1993) The biochemical basis of zinc physiology. Physiol. Rev. 73: 79-118. Vallee BL, Auld DS (1990). Active-site zinc ligands and activated H2O of zinc enzymes. Proc Natl Acad Sci U S A. 87(1): 220-224. Vicente-Carbajosa J, Moose S, Parsons RL, Schmidt R (1997). A maize zinc finger protein binds the prolamin box in zein gene promoters and interacts with basic leucine zipper transcriptional activator Opaque2. USA Proc. Natl. Acad. Sci. 94: 7685-7690. Wintz H, Fox T, Wu YY, Feng V, Chen W, Chang HS, Zhu T, Vulpe C(2003). Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J Biol Chem, 278(48): 47644-47653.

6999

Wooltorton J R, McDonald B J, Moss S J, Smart T G (1997). 2+ Identification of a Zn binding site on the murine GABAA receptor complex: dependence on the second transmembrane domain of beta subunits. J. Physiol .505: 633-640. Xie YF, Wang BC, Li B ,Ying-Fan Cai, Lei Xie,Yu-Xian Xia,Ping-An Chang, Jiang HZ (2007). Construction of cDNA library of cotton mutant (Xiangmian-18) library during gland forming stage. Colloids and Surfaces Bďź&#x161;Biointerfaces, 60: 258-263.

Full Length Research Paper

Partial purification and characterization of polygalacturonase-inhibitor proteins from pearl millet S. Ashok Prabhu, K. Ramachandra Kini* and H. Shekar Shetty Department of Studies in Biotechnology, University of Mysore, Manasagangotri, Mysore-570006, Karnataka, India. Accepted 18 January, 2012

Polygalacturonase-inhibitor proteins (PGIPs) are plant cell wall glycoproteins, involved in the inhibition of microbial endo-polygalacturonases (EPGs). The present study involved activity guided partial purification of pearl millet [Pennisetum glaucum (L.) R.Br.] protein extract by cation exchange chromatography, which resulted in two pooled protein peaks – Peak-A and Peak-B, both of which showed inhibitory activity against the Aspergillus niger EPG. Protein separation of the two peaks by gel electrophoresis showed prominent bands between 29 and 43 kDa, consistent with the molecular weights of the known plant PGIPs. The two PGIP peaks were further studied for their inhibitory activities with respect to three parameters viz., inhibitor concentration, pH and temperature effects. Enzyme inhibition was partial and increased with inhibitor concentration. The Peak-B was found to be the more active inhibitor of the two. The results indicate the presence of at least two isoforms of PGIP in pearl millet. This is the first such study to be undertaken in understanding the presence of the PGIPs in millets. Key words: Cation-exchange chromatography, endo-polygalacturonase, inhibitor concentration, pearl millet, polygalacturonase-inhibitor protein. INTRODUCTION Plants depend on their cells walls, the mechanical barrier in warding off the constant attempts by the pathogen to access the nutrients from the host reservoir (Cuixia et al., 2006). The microbial pathogens, both bacteria and fungi, are known to employ an array of cell wall degrading enzymes targeting the various polysaccharide components constituting the wall, thus making their way into the host (Juge, 2006). Endo-polygalacturonases (EPGs) are known to be one of the first and most important

*Corresponding author. E-mail: krk@appbot.uni-mysore.ac.in. Tel: +91 821 2419882. Abbreviations: CMC, Carboxy methyl cellulose; EPGs, endopolygalacturonases; ICRISAT, The International Crops Research Institute for the Semi-Arid Tropics; PGIPs, polygalacturonase-inhibitor proteins; SDS-PAGE, sodium dodecyl sulphate - polyacrylamide gel electrophoresis.

virulence factors released by pathogens which degrade the homopolygalacturonate (α-1,4-linked chain of Dgalacturonic acid) component of pectins, a galacturonic acid rich cell wall matrix (Karr and Albersheim, 1970). Many studies have well established the role of microbial and even insect EPGs in causing serious plant diseases (Hershonhorn et al., 1990; Hugouvieux et al., 1997; Garcia-Maceira et al., 2001; Gotesson et al., 2002; Allen and Mertens, 2008). Polygalacturonase-inhibitor proteins (PGIPs) are cell wall glycoproteins, belonging to leucine rich repeat (LRR) super family of proteins involved in plant defense against the invading pathogens by inhibiting/ modulating the activity of EPGs (Janni et al., 2008). PGIPs inhibit fungal EPGs (De Lorenzo et al., 2001; Federici et al., 2006), but are shown to be ineffective against pectic enzymes of plant origin (Cervone et al., 1990). Pathogen infection and a number of stress-related signals have been reported to induce PGIPs (De Lorenzo et al., 2001). Bean

Prabhu et al.

(Phaseolus vulgaris) PGIPs, PvPGIP3 and PvPGIP4 were found to be effective against the insects (D’Ovidio et al., 2004). In addition to their role in plant defense, PGIPs have also been reported to be involved in wounding responses in bean (D’Ovidio et al., 2004) and in developmental processes such as hypocotyl elongation in bean (Devoto et al., 1997) and in regulation of floral organ development in rice (Jang et al., 2003). PGIPs can inhibit non-host EPGs, for example PvPGIP2 inhibits EPG of maize pathogen, Stenocarpella maydis. PGIP genes within a family are differentially regulated by different signal molecules through separate signal transduction pathways (Ferrari et al., 2003). PGIP is a constitutive protein and its transcript accumulation has been observed in a number of incompatible interactions involving various plant-fungal pathogen systems (Faize et al., 2003; Favaron et al., 2000; Devoto et al., 1997). Recent biotechnological approaches such as plant transformation with pgip genes leading to overexpression in both dicots such as tobacco, tomato and monocot maize (Joubert et al., 2006; Manfredini et al., 2005); and anti-sense expression of pgip genes (Ferrari et al., 2006) have confirmed the role of PGIPs as important host– resistance factors to counter the EPGs of phytopathogenic fungi. Pearl millet [Pennisetum glaucum (L.) R. Br.], a staple food for the poor parts of Asia and Africa has a history of 4000 years. It is the fifth most important cereal crop, accounting for more than 55% of global millet production. India is the largest producer of the crop at 7.3 million tonnes with an average productivity of 780 kg/ha. Poaceous crops suffer substantial yield and quality reductions due to fungal disease as is the case with most agronomic crops, and pearl millet is no exception. Downy mildew caused by Sclerospora graminicola (Sacc.) Schroet is a very important disease affecting the production of pearl millet. Under favorable environmental conditions for the pathogen, the disease can spread rapidly causing as much as 40% crop loss. Although, several resistant cultivars to downy mildew pathogen have been developed, they ultimately succumb to the disease due to break down of resistance. The exact reasons for this breakdown of resistance is not known as there is a lack of clear understanding of biochemical and molecular basis of resistance in pearl millet to downy mildew. Hence continuous efforts need to be made to fill the gaps in our knowledge in this important area, which has got implications in developing newer breeding strategies for obtaining pearl millet cultivars with durable host resistance to downy mildew. Though PGIPs have been studied in some of the monocot plants such as wheat (Kemp et al., 2003), rice (Jang et al., 2003) and more recently in oil palm (AlObaidi et al., 2010), there are no reports of their study in economically important millets. In that direction, the present study has been the first initiative in the isolation

7001

and characterization of the PGIPs from pearl millet. Since pearl millet, though drought-resistant is prone to various fungal and bacterial diseases leading to significant yield losses, the study of the role of PGIPs in its defense both at the biochemical and molecular level will be a significant step in devising strategies to counter this menace. MATERIALS AND METHODS Plant Material Pearl millet seeds (IP18296) obtained from The International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India were used in the study. Extraction of total protein from pearl millet seedlings The total proteins were extracted from one-week-old pearl millet seedlings using a modified method of Favaron et al. (1994). All the steps were carried out at 4°C. Briefly, 250 g plant tissue was homogenized in 2 volumes of cold acetone and centrifuged at 15,000 g for 30 min. The pellet was washed twice with cold acetone under the same conditions, air-dried completely and resuspended in 2 volumes of sodium acetate buffer (20 mM, pH 5 containing 1 M NaCl). The resuspended pellet was incubated at 4°C for 72 h on a shaker to facilitate leaching out of wall bound proteins. The protein resuspension was centrifuged at 15,000 g for 30 min and the resulting supernatant was dialyzed against 20 mM sodium acetate buffer, pH 4. The dialyzed protein extract was lyophilized and appropriately reconstituted in the same buffer. Partial purification of PGIPs by Ion-exchange chromatography The purification was carried out at 4°C. The cation-exchange resin, carboxy methyl cellulose (CMC) (Genei, Bangalore) was packed onto a glass column (1.5 × 30 cm) and equilibrated with 20 mM sodium acetate buffer, pH 4. One hundred milligrams of total pearl millet crude protein was loaded and the column was washed with the above mentioned buffer at a flow rate of 0.5 ml/min. The 2 ml fractions collected were monitored for protein at A280nm. The flowthrough fractions were collected and the column was washed with 5 bed volumes of buffer. Gradient elution was carried out by a stepwise increase in the salt gradient (100, 200, 300, 400, 500 and 1000 mM NaCl) in the buffer. The active protein fractions were pooled separately (9 and 5 active fractions eluted at 200 and 300 mM NaCl concentrations were pooled, respectively), dialyzed against 20 mM sodium acetate buffer, pH 4, lyophilized and appropriately reconstituted in the same buffer. Protein content of all the fractions was measured according to Lowry et al. (1951) using bovine serum albumin (Hi-Media) as standard. Gel electrophoresis Fifty micrograms each of the crude, flow-through, 25 µg each of Peak-A and Peak-B fractions were separated by sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) following the method of Laemmli (1970) in a 1-mm thick, 12% separating polyacrylamide gel under reducing conditions. The standard proteins for molecular mass determination obtained from

7002

Afr. J. Biotechnol.

Figure 1. Purification profile of the pearl millet crude protein extract by carboxy methyl cellulose (CMC) column (1.5 × 30 cm).

Genei, Bangalore were used. Protein banding pattern was visualized with Coomassie blue – R 250 staining. Polygalacturonase assay – Time course of hydrolysis Pectinase from Aspergillus niger (Sigma) served as the source of endo-polygalacturonase. A working enzyme stock of 1 mg/ml was prepared in 20 mM sodium acetate buffer, pH 4 and a suitable aliquot of the enzyme was used for the assay. EPG activity was determined as an increase in reducing end equivalents over time. Reducing ends were measured according to the method of Wang et al. (1997) using D-glucose as the standard. The reaction mixture containing 200 µL of 2.5 mg/ml polygalacturonic acid (HiMedia), 10 ng enzyme made up to 500 µL with 20 mM sodium acetate buffer, pH 4 was incubated for 15, 30, 45 and 60 min at 30°C and assayed for the reducing equivalents. A graph with incubation time versus enzyme activity was plotted. The experiment was carried out in triplicates. The data was subjected to linear regression analysis. A time point in the linear range of the plot served as the optimal time point of incubation for the enzyme inhibition studies.

Enzyme inhibition studies – Assay for PGIPs The inhibitory activity of crude, flow-through, Peak-A and Peak-B fractions was assayed as per the standard EPG assay (45 min incubation, 10 ng enzyme was used) as mentioned above. PGIP

and the enzyme were pre-incubated together at 30°C for 20 min prior to assay. The effect of various parameters such as the inhibitor concentration (– at 0.5,1 and 5 µg), pH (at 4, 4.5 and 5) and temperature (at 20, 30, 40 and 50°C) was carried out. In a separate experiment, the temperature stability was studied by preincubating the purified peaks for 1 h at temperatures ranging from 20 to 100°C upon which its inhibition potential was assayed. Three independent experiments were performed each in triplicates. The data was subjected to Tukey’s HSD test at P < 0.05.The percent inhibition displayed by different assayed fractions was determined in comparison to the uninhibited enzyme activity.

RESULTS Partial purification of PGIPs by cation-exchange chromatography The cation-exchanger employed in the present study in the purification of the pearl millet crude protein extract yielded two peak fractions. The first peak fraction, Peak-A eluted at a salt gradient of 200 mM NaCl whereas the second one, Peak-B eluted at 300 mM NaCl (Figure 1). The column was loaded with 100 mg crude protein and the two separately pooled peak fractions were estimated to be 3.5 and 1 mg respectively.

Prabhu et al.

7003

Figure 2. SDS-PAGE separation of proteins. Lane 1- Standard protein molecular weight markers; lane 2- pearl millet crude protein extract, lane 3- CMC column flowthrough fraction; lane 4- CMC column eluted Peak-B fraction; lane 5- CMC column eluted Peak-A fraction.

SDS-PAGE separation of partially purified protein fractions The analysis of peaks by SDS-PAGE, showed the presence of more number of proteins in peak B compared to peak A (Figure 2). Furthermore, silver staining of the gel did not show any additional bands. The molecular weights of the bands in Peak-A were determined to be 37 and 34 kDa, whereas Peak-B showed bands of 43, 37 and 34 kDa. In addition, few protein bands of molecular weights at and below 20 kDa and above 43 kDa were also found more predominantly in peak B. Endo-polygalacturonase assay optimization

Effect of pH and temperature

The optimal time point of incubation of the A. niger EPG for the enzyme inhibition studies was chosen to be 45 min based on the linearity of a plot between incubation time versus enzyme activity (Figure 3). The optimized enzyme conditions were further used for inhibition studies and percent inhibition of various protein fractions were evaluated in relation to un-inhibited enzyme activity. Characterization of the CMC fractions - EPG inhibition studies

column

at three different concentrations of 0.5, 1 and 5 µg showed a very low percent inhibition of 4, 8 and 11%, respectively (Figure 4). Peak-B showed the highest percent inhibition of 18, 28 and 34% at the same concentrations tested as above. The Peak-A on the other hand showed 3, 8 and 13% inhibition, respectively which is similar to the values obtained with the crude. A general trend of increase in percent inhibition with the increase in the inhibitor concentration was observed. The CMC column flow-through showed no inhibition at any of the tested concentrations. The inhibition of all the samples was lost post boiling and upon treatment of the protein with a protease, trypsin (data not shown).

purified

Effect of inhibitor concentration Inhibition studies of the crude pearl millet protein extract

Further characterization of the effect of physical parameters such as pH and temperature on enzyme inhibition was carried out for all the fractions at 5 µg concentration. The enzyme showed a pH optimum at pH 4. The crude extract showed inhibitory activity at all three pH units with values of 10, 12 and 12% inhibition at pH 4, 4.5 and 5, respectively. Peak-B showed the highest percent inhibition at all the three tested pH units with the percent inhibition being 36, 34 and 37%, respectively at the above mentioned pH values. In contrast, the Peak-A showed an inhibition of 12% at pH 5 and failed to show any inhibition at pH 4. At pH 4.5, slight enzyme activation was observed (Figure 5A). The enzyme’s highest activity was observed at 50°C at

7004

Afr. J. Biotechnol.

Figure 3. Time course of hydrolysis of polygalacturonic acid by the A. niger endo-polygalacturonase. The data was analyzed by linear regression analysis to determine the linear range. The data points are means of the experiment carried out in triplicates. Bars indicate ±SE.

Figure 4. A. niger endo-polygalacturonase inhibition assay - Effect of inhibitor concentration. The different CMC column peaks were assayed for inhibition, each at three different concentrations (0.5, 1 and 5 µg). The data are means of three independent experiments. Bars indicate ±SE. Means designated with the same letter are not significantly different according to Tukey’s HSD test at P < 0.05.

pH 4 with the activity values doubling at 10°C intervals. At 20°C, the crude, Peak-A and Peak-B showed 8, 15 and 35% inhibition, respectively (Figure 5B), with no inhibition being observed in case of flow-through fraction. The

trend remained much the same at the other tested temperatures with inhibition reading 9, 16 and 35% at 30°C; 12, 13 and 32% at 40°C and 12, 12 and 37% respectively, at 50°C. The temperature stability studies

Prabhu et al.

7005

Figure 5. A. niger endo-polygalacturonase inhibition assay. (A) Effect of pH. The different CMC column fractions (5 µg each) were assayed for inhibition, each at three different pH units; (B) Effect of temperature. The different CMC column peaks (5 µg each) were assayed for inhibition, each at four different temperatures. (C) Thermal stability of PGIP. The different CMC column fractions (5 µg each) were assayed for inhibition, each in the range of 20 to 100°C. The data are means of three independent experiments. Bars indicate ±SE. Means designated with the same letter are not significantly different according to Tukey’s HSD test at P < 0.05.

revealed that inhibition of both the peaks was retained even at 70°C (Figure 5C). DISCUSSION Recent studies in various host-pathogen systems such as ginseng (Rhizoctonia solani) and other fungal pathogens (Sathiyaraj et al., 2010) and in bean-Sclerotinia sclerotiorum (Oliveira et al., 2010), as well as the transgenic expres-sion studies in wheat and Arabidopsis

to successfully counter Fusarium graminearum (Ferrari et al., 2011) triggered our interest to explore PGIPs in pearl millet. The present study was aimed at exploring the presence of PGIPs in millets. In that direction, a partial purification of the pearl millet crude protein extract was carried out on a carboxy methyl cellulose cationexchanger matrix. The cation-exchanger was chosen as the purification matrix as many of the already characterized PGIPs from various plant species have pI values in the range of 6.6 to 9.5 (Abu-Goukh et al., 1983; Cervone et al., 1987; Favaron et al., 1994; Stotz et al.,

7006

Afr. J. Biotechnol.

1994) respectively. The proteins being positively charged 1-2 units below their pI and also the fact that PGIPs are stable and active at lower pH values prompted the use of cation-exchangers for their purification in many of the plant species. The separation of pearl millet seedling crude extract on the ion-exchanger yielded two peaks at 200 and 300 mM NaCl elution gradients which on separation by reducing gel electrophoresis, resulted in prominent protein bands distributed between the 29 and 43 kDa molecular weight protein standards. This is consistent with most of the known plant PGIPs which fall in this range with monocot wheat PGIP being 40.3 kDa (Kemp et al., 2003) and cotton PGIP is 34 kDa (James and Dubery, 2001). In addition, protein bands lower than 20 kDa and higher than 43 kDa were also observed in the 2 peak lanes which could also be putative PGIPs as occasionally some plant species have shown the presence of PGIPs with molecular weights of 15 kDa in peach (Fielding, 1981) and 91 kDa in pear (Abu-Goukh et al., 1983). Hence further purification of pearl millet PGIPs to homogeneity will be crucial in determining the actual inhibitory protein. A similar attempt to identify the presence of PGIP isoforms in Allium porrum L. active against S. sclerotiorum by partial purification resulted in soluble PGIP with two peaks of activity (P1 and P2) eluting at about 0.10 and 0.25 M NaCl, respectively and the wall-bound PGIP divided into three peaks (P3, P4 and P5), eluting at about 0.10, 0.18 M and 0.25 M NaCl (Favaron, 2001) with, multiple PGIP isoforms. The major biotic constraint in the pearl millet production is the obligate biotrophic oomycete pathogen, Sclerospora graminicola. It is practically not possible to obtain good amounts of endo-polygalacturonase from the native pathogen as its axenic culture is not possible. Since plants are also known to produce polygalacturonases, it is not possible to distinguish between plant and pathogen EPGs. Crude protein extracts from S. graminicola infected susceptible pearl millet plants showed EPG activity, but incubation with the PGIP showed no inhibition against them, thus indicating that the observed EPG activity could be of plant origin. The S. graminicola zoospore extracts upon screening for EPG activity showed no activity, as biotrophs are known to produce very low amounts of the enzyme only upon infection (Simon et al., 2005). Currently, isolation of the gene encoding EPGs from the pathogen is being undertaken, which could further be expressed in suitable expression systems to obtain fusion proteins for inhibition studies. Hence the commercially available EPG from A. niger was used as the enzyme in the inhibition studies for screening of PGIP in the present study. The enzyme has been used earlier for screening of PGIP activity in bean (Cervone et al., 1987). The pH and temperature optimum for the enzyme was found to be 4 and 50°C, which is in correlation with the literature (Kester and Visser, 1990). A suitable aliquot of enzyme was subjected to time course

of hydrolysis to determine the linear range of the enzyme activity. The enzyme activity was linear up to 1 h and for the present study 45 min was chosen as the incubation time for the inhibition experiments. The determination of this linearity of enzyme activity is crucial for the determination of the inhibition, as any time point beyond this linearity range may not be able to detect inhibition thus leading to false negative results. The effect of inhibitor concentration on enzyme activity showed that there was only a partial inhibition and a positive correlation was observed between the inhibitor concentration and the percent inhibition. The Peak-B was the more active of the two column eluents with the maximum inhibition being 34% followed by that of Peak-A and crude with 13 and 11%, respectively at 5 µg. A similar study conducted in tomato showed that the inhibition capacity increased with increasing concentrations of PGIP. The purified tomato PGIP incubated with A. niger EPG (12 ng) at 0.5 µ g showed an inhibition of just below 20%, whereas at 8 µ g it was around 90%. The same PGIP at 5 µ g concentration displayed 66% inhibition against the Stenocarpella maydis EPG (9 µg) (Berger et al., 2000). A lack of inhibition observed in the CMC flow-through fraction is an indication that all of the PGIPs are bound onto to the column and employment of cation-exchange chromatography as an initial purification step was justified. Many different EPG-PGIP combinations have been shown to demonstrate a range of enzyme inhibition. The study involving bean PGIP2 and the 5 PG isoforms (PGI, PGII, PGA, PGB and PGC) of A. niger over a pH range between 4 to 5 showed that the interaction between various EPG-PGIP combinations are pH dependent. The PGB, PGI, and PGII were inhibited by PGIP-2 over the entire tested pH range, whereas PGA and PGC isoforms were activated at pH 5.0 and inhibited at pH 4.75 and 4.2, respectively (Kemp et al., 2004). To determine if such pH dependence existed in the present system the effect of pH on the EPG-PGIP was undertaken. Interestingly, a differential inhibition pattern was observed with the PeakB being active at all the three tested pH values whereas the Peak-A showed no inhibition at pH 4, slight enzyme activation at pH 4.5 and partial inhibition at pH 5. This means that the plant produces multiple PGIP isoforms which are active at different pH values which could be advantageous to the plant as changes in pH due to biotic or abiotic factors could be taken care of by the functional redundancy. The pearl millet is a drought resistant crop grown in tropical conditions with temperature rising in excess of 40°C in summer. The thermal stability of the pearl millet PGIP was evaluated over a temperature range of 20 to 50°C. The results clearly demonstrate that the PGIPs are active at 50°C and the increase in temperature from 20 to 50°C had no effect on their potential of inhibition of A. niger EPGs. The inhibition was seen to be retained even

Prabhu et al.

at 70°C. This is consistent with other such studies conducted in different plant systems. The PGIPs from orange (Barmore and Nguyen, 1985), bean (Cervone et al., 1987) and guava (Deo and Shastri, 2003) were found be active at 60°C. The peach PGIP was stable at 80°C (Fielding, 1981), whereas PGIP of chilli stable at 50°C retained some residual inhibitory activity even at 90°C (Shivshanker et al., 2010). In conclusion, the present study was one of the first initiatives in understanding the presence of PGIPs in pearl millet. The study has been able to partially purify and characterize pearl millet PGIPs. Further purification, characterization of the pearl millet PGIPs and their encoding genes will aid in the understanding of their role in host-pathogen interaction as well as in protein-protein interaction studies. The downy mildew of pearl millet caused by S. graminicola is the most important disease of the host leading to significant economic losses. The use of advanced biotechnological approaches in understanding the interaction between pearl millet PGIP(s) - S. graminicola EPG(s) would be crucial in formulating effective crop protection strategies. Currently, the isolation and characterization of the pure protein and the gene encoding it is in progress. REFERENCES Abu-Goukh AA, Greve LC, Labavitch JM (1983). Purification and partial characterization of ‘Bartlett’ pear fruit, polygalacturonase inhibitors. Physiol. Plant Pathol. 23: 111-122. Allen ML, Mertens JA (2008). Molecular cloning and expression of three polygalacturonase cDNAs from the tarnished plant bug, Lygus lineolaris. J. Insect. Sci. 8(27): 1-14. Al-Obaidi JR, Mohd-Yusuf Y, Chin-Chong T, Mhd-Noh N, Othman RY (2010). Identification of a partial oil palm polygalacturonase-inhibiting protein (EgPGIP) gene and its expression during basal stem rot infection caused by Ganoderma boninense. Afr. J. Biotechnol. 9(46): 7788-7797. Barmore C, Nguyen TK (1985). Polygalacturonase inhibition in rind of Valencia orange infected with Diplodia natalensis. Phytopathology, 75: 446-449. Berger DK, Oelofse D, Arendse MS, Du Plessis E, Dubery IA (2000). Bean polygalacturonase-inhibiting protein-1 (PGIPs-1) inhibits polygalacturonases from Stenocarpella maydis. Physiol. Mol. Plant Pathol. 57: 5-14. Cervone F, De Lorenzo G, Degra L, Salvi G, Bergami M (1987). Purification and characterization of polygalacturonase-inhibiting protein from Phaseolus vulgaris L. Plant Physiol. 85: 631-637. Cervone F, De Lorenzo G, Pressey R, Darvill AG, Albersheim P (1990). Can Phaseolus PGIP inhibit pectic enzymes from microbes and plants? Phytochemistry, 29: 447-449. Cuixia D, Manxiao Z, Shijian X, Tuo C, Lizhe A (2006). Role of polygalacturonase-inhibiting protein in plant defense. Crit. Rev. Microbiol. 32: 91-100. D’Ovidio R, Raiola A, Capodicasa C, Devoto A, Pontiggia D, Roberti S, Galletti R, Conti E, O’Sullivan D, De Lorenzo G (2004). Characterization of the complex locus of Phaseolus vulgaris encoding polygalacturonase-inhibiting proteins (PGIPs) reveals subfunctionalization for defense against fungi and insects. Plant Physiol. 135: 2424-2435. De Lorenzo G, D‟Ovidio R, Cervone F (2001). The role of polygalacturonase-inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annu. Rev. Phytopathol. 39: 313-335.

7007

Deo A, Shastri NV (2003). Purification and characterization of polygalacturonase-inhibitory proteins from Psidium guajava Linn. (guava) fruit. Plant Sci. 164: 47-156. Devoto A, Clark AJ, Nuss L, Cervone F, De Lorenzo G (1997). Developmental and pathogen-induced accumulation of transcripts of polygalacturonase-inhibiting protein in Phaseolus vulgaris L. Planta, 202: 284-292. Faize M, Sugiyama T, Faize L, Ishii H (2003). Polygalacturonaseinhibiting protein (PGIP) from Japanese pear: possible involvement in resistance against scab. Physiol. Mol. Plant Pathol. 63: 319-327. Favaron F (2001). Gel detection of Allium porrum polygalacturonaseinhibiting protein reveals a high number of isoforms. Physiol. Mol. Plant Pathol. 58: 239-245. Favaron F, D’Ovidio R, Porceddu E, Alghisi P (1994). Purification and molecular characterization of a soybean polygalacturonase-inhibiting protein. Planta, 195: 80-87. Favaron F, Destro T, D’Ovidio R (2000). Transcript accumulation of polygalacturonase inhibiting protein (PGIP) following pathogen infections in soybean. J. Plant Pathol. 82: 103-109. Federici L, Di Matteo A, Recio FJ, Tsernoglou D, Cervone F (2006). Polygalacturonase inhibiting proteins: players in plant innate immunity? Trend Plant Sci. 11: 65-70. Ferrari S, Galletti R, Vairo D, Cervone F, De Lorenzo G (2006). Antisense expression of the Arabidopsis thaliana AtPGIP1 gene reduces polygalacturonase-inhibiting protein accumulation and enhances susceptibility to Botrytis cinerea. Mol. Plant- Microbe In. 19: 931–936. Ferrari S, Sella L, Janni M, De Lorenzo G, Favaron F, D’Ovidio R (2011). Transgenic expression of polygalacturonase-inhibiting proteins in Arabidopsis and wheat increases resistance to the flower pathogen Fusarium graminearum. Plant Biol. DOI: 10.1111/j.14388677.2011.00449.x. Ferrari S, Vairo D, Ausubel FM, Cervone F, De Lorenzo G (2003). Arabidopsis polygalacturonase-inhibiting proteins (PGIP) are regulated by different signal transduction pathways during fungal infection. Plant Cell, 15: 93–106. Fielding AH (1981). Natural inhibitors of fungal polygalacturonases in infected fruit tissues. J. Gen. Microbiol. 123: 377–381. Garcia-Maceira F, Di Pietro A, Huertas-Gonzalez MD, Ruiz-Roldan MC, Roncero MIG (2001). Molecular Characterization of an endopolygalacturonase from Fusarium oxysporum expressed during early stages of infection. Appl. Environ. Microb. 67(5): 2191-2196. Götesson A, Marshall JS, Jones DA, Hardham AR (2002). Characterization and evolutionary analysis of a large polygalacturonase gene family in the oomycete plant pathogen Phytophthora cinnamomi. Mol. Plant-Microbe. In. 15(9): 907–921. Hershonhorn J, Manulis S, Barash I (1990). Polygalacturonase associated with infection of Valencia orange by Penicillium italicum. Phytopathology, 80: 1374-1376. Hugouvieux V, Centis S, Lafitte C, Esquerre-Tugaye MT (1997). Induction by α-L-Arabinose and α-L-Rhamnose of endopolygalacturonase gene expression in Colletotrichum lindemuthianum. Appl. Environ. Microb. 63(6): 2287-2292. James TJ, Dubery IA (2001). Inhibition of Polygalacturonase from Verticillium dahliae by a polygalacturonase inhibiting protein from cotton. Phytochemistry, 57: 149-156. Jang S, Lee B, Kim C, Yim J, Han JJ, Lee S, Kim SR, An G (2003). The OsFOR1 gene encodes a polygalacturonase-inhibiting protein (PGIP) that regulates floral organ number in rice. Plant Mol. Biol. 53: 357369. Janni M, Sella L, Favaron F, Blechl AE, De Lorenzo G, D'Ovidio R (2008). The expression of a bean pgip in transgenic wheat confers increased resistance to the fungal pathogen Bipolaris sorokiniana. Mol. Plant-Microbe Int. 21: 171-177. Joubert DA, Slaughter AR, Kemp J, Becker VW, Krooshof GH, Bergmann C, Benen J, Pretorius IS, Vivier A (2006). The grapevine polygalacturonase-inhibiting protein (VvPGIP1) reduces Botrytis cinerea susceptibility in transgenic tobacco and differentially inhibits fungal polygalacturonases. Transgenic Res. 15: 687-702. Juge N (2006). Plant protein inhibitors of cell wall degrading enzymes. Trend Plant Sci. 11: 359-361.

7008

Afr. J. Biotechnol.

Karr AL, Albersheim P (1970). Polysaccharide-degrading enzymes are unable to attack plant cell walls without prior action by a â&#x20AC;&#x153;wallmodifying enzymeâ&#x20AC;?. Plant Physiol. 46: 69-80. Kemp G, Bergmann CW, Clay R, Van der Westhuizen AJ, Pretorius ZA (2003). Isolation of a polygalacturonase-inhibiting protein (PGIP) from wheat. Mol. Plant-Microbe. Int. 16: 955-961. Kemp G, Stanton L, Bergmann CW, Clay RP, Albersheim P, Darvill A (2004). Polygalacturonase-inhibiting proteins can function as activators of polygalacturonase. Mol. Plant-Microbe. Int. 17(8): 888894. Kester HCM, Visser J (1990). Purification and characterization of polygalacturonases produced by the hyphal fungus Aspergillus niger. Biotechnol. Appl. Biochem. 12: 150-160. Laemmli UK (1970). Cleavage of structural proteins during assembly of the head of the bacteriophage T4. Nature, 227: 680-685. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951). Protein measurement with the folin phenol reagent. J. Biol. Chem. 193: 265275. Manfredini C, Sicilia F, Ferrari S, Pontiggia D, Salvi G, Caprari C, Lorito M, De Lorenzo G (2005). Polygalacturonase-inhibiting protein 2 of Phaseolus vulgaris inhibits BcPG1, a polygalacturonase of Botrytis cineria important for pathogenicity, and protects transgenic plants from infection. Physiol. Mol. Plant Pathol. 67: 108-115. Oliveira MB, Nascimento LB, Junior ML, Petrofeza S (2010). Characterization of the dry bean polygalacturonase-inhibiting protein (PGIP) gene family during Sclerotinia sclerotiorum (Sclerotiniaceae) infection. Genet. Mol. Res. 9(2): 994-1004.

Sathiyaraj G, Srinivasan S, Subramaniam S, Kim YJ, Kim YJ, Kwon WS, Yang DC (2010). Polygalacturonase inhibiting protein: isolation, developmental regulation and pathogen related expression in Panax ginseng C.A. Meyer. Mol. Biol. Rep. 37: 3445-3454. Shivshanker S, Thimmareddy C, Roy TK (2010). Polygalacturonase inhibitor protein from anthracnose resistant and susceptible varieties of Chilli (Capsicum annuum L). Indian J. Biochem. Biol. 47: 243-248. Simon UK, Bauer R, Rioux D, Simard M, Oberwinkler F (2005). The intercellular biotrophic leaf pathogen Cymadothea trifolii locally degrades pectins, but not cellulose or xyloglucan in cell walls of Trifolium repens. New Phytol. 165: 243-260. Stotz HU, Contos JJ, Powell LA, Bennett AB, Labavitch JM (1994). Structure and expression of an inhibitor of fungal polygalacturonases from tomato. Plant Mol. Biol. 25: 607-617. Wang G, Michailides TJ, Bostock RM (1997). Improved Detection detection of Polygalacturonase polygalacturonase Activity activity due to Mucor piriformis with a modified Dinitrosalicylic dinitrosalicylic acid reagent. Phytopathology, 87(2): 161-163.

Full Length Research Paper

Improving production of laccase from novel basidiomycete with response surface methodology Yonghui Zhang, Shujing Sun*, Kaihui Hu and Xiaoyong Lin College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, People’s Republic of China Accepted 5 March, 2012

A Mycena purpureofusca strain screened from six basidiomycota fungi is well characterized in submerged fermentation for its high production of laccase and very low mycelium generation. Optimization of submerged fermentation medium for laccase production by M. purpureofusca was carried out with two statistical methods including Plackett-Burman (P-B) and Box-Behnken (B-B) designs. Three variables (sucrose, MgSO4 and CuSO4) were found to affect laccase production significantly by P-B screening. B-B design with three-factor at three levers was performed to explain the combined effects of the three medium constituents. The optimum medium consisted of sucrose (4.26 g/L), yeast powder (15 g/L), MgSO4 (4.83 g/L), KH2PO4 (2.7 g/L), CuSO4 (5.625 mg/L) and vitamin B1 (0.1 g/L). The laccase production was increased by 1.87 folds (277.5 U/L) using this optimized medium. Furthermore, the experimental value was closed to the prediction under the optimal condition, indicating that the chosen methods were successful to determine the optimal medium components, which is the least time consuming and most effective for laccase production. The data obtained in this study may provide new insights to large-scale laccase production by Mycena sp. Key words: Mycena purpureofusca, Laccase, Medium optimization, Plackett-Burman design, Box-Behnken design INTRODUCTION Laccases (benzenediol: oxygen oxidoreductases, EC 1.10.3.2) are blue multicopper oxidases that catalyze the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water (Giardina et al., 2010). The majority of laccases are often found in white-rot fungi and higher plants such as the varnish tree Rhus vernicifera (Morozova et al., 2007). Among these resources, glycol content of laccase from fungi is generally lower than that of laccase from plant (Liang et al., 2008). In fungi, laccases play a variety of physiological roles in their life cycle, such as lignin degradation, pathogenesis, detoxification and morphogenesis

*Corresponding author. E-mail: shjsun2004@126.com. Tel: +86591-83789492. Fax: +86-591-83789352. Abbreviations: RSM, Response surface methodology; P-B, Plackett-Burman; B-B, Box-Behnken; R2, determination coefficient.

(Baldrian, 2006; Leonowicz et al., 2001;Sun et al., 2011). The laccases from fungi have many advantages, such as substrate non-specific, directly oxidizing various phenolic compounds, using molecular oxygen as the final electron acceptor instead of hydrogen peroxide, and showing a considerable level of stability in the extracellular environment (Eggert et al., 1997). Therefore, the laccases from fungi have been widely applied in biotechnology and industry, such as delignification of lingocellulosics, paper pulping/bleaching, and degradation of different recalcitrant compounds, bioremediation, sewage treatment, dye decolorization and biosensors (Osma et al., 2010; Rodriguez Couto et al., 2005; Shervedani and Amini, 2012). Up to date, the use of laccase on a commercial scale is restrained by the low productivity in microbial fermentation. There have been a few studies on fermentation optimization of laccases by Trametes sp., Botryosphaeria sp., Panus tigrinus and Pleurotus ostreatus (Ana Flora et al., 2000; Daniele et al., 2008; Dekker et al., 2007; Galhaup and Haltrich, 2001; Liu et al., 2009; Nyanhongo

7010

Afr. J. Biotechnol.

et al., 2002; Tong et al., 2007). These strains can secret laccase abundantly, although a large amount of mycelial pellets are formed in the fermentation process, which seriously limited the utilization of laccases from these strains. It is known that culture medium is important to laccase production (Elisashvili et al., 2008). For this reason, it is useful to optimize the medium composition for the production of laccase produced by fungi. The development of an economically productive medium requires selecting carbon, nitrogen and trace element sources. There were two ways by which the problem of medium component limitations may be addressed: classical and statistical (Mao et al., 2010). Conventional optimization procedures involve altering of one variable at a time and keeping all other variables constant, which enables it to assess the impact of those particular variables on the process performance. Compared with the classical method, statistical experimental designs are useful tools for medium optimization to screen the main variables rapidly from a multivariable system. The statistical experimental designs have many advantages, including more advanced results with less process variability, closer confirmation, less development time and less overall costs. Response surface methodology (RSM) has been successfully applied in the optimization of the medium conditions of laccase product from different microorganism (Arockiasamy et al., 2008; Bhattacharya et al., 2011; Niladevi et al., 2009). In this study, Mycena purpureofusca was screened out of six fungal strains according to laccase-secreting ability. Medium optimization for production of laccase by M. purpureofusca was reported to make it clear that fermentation factors influenced the laccase yield under statistical experimental design. Until now, there have been no reports on the medium optimization for enhancing laccase production by a fungus in the genus Mycena. MATERIALS AND METHODS Fungal strains Six strains including Pleurotus spodoleucas, M. purpureofusca, Pleurotus florida, Pleurotus abalonus, Tremella aurantialba and P. ostreatus were obtained from Fujian General Station of Technology Popularization for Edible Fungus (Fuzhou, China) and maintained on potato dextrose agar (PDA; potato 200 g/L, glucose 20 g/L, agar 20 g/L) at 25°C with periodic transfer. Six strains were selected for further experiments based on the results obtained from previous research (Xu et al., 2011). Medium and culture conditions The minimal liquid medium contained (per liter) 10 g sucrose, 10 g yeast powder, 2.7 g KH2 PO4, 2 g MgSO4·7H2O, 2.5 mg CuSO4·5H2 O, and 0.1 g vitamin B1 (Sun et al., 2010). The amounts of every component, however, changes in different optimization experiments. All the experiments were carried out in triplicate and each data point is the mean of three independent scorings. First,

the strains were grown on PDA plate, then five evenly mycelium mats (ca. 50 mm2) from the plate were made by a sterile Pasteur pipette (5-mm-diameter) and transferred to the seed culture medium. The seed culture was grown in a 250-ml flask containing 100 ml of liquid medium at 24°C on a rotary shaker at 110 rpm for eight days. The broth was filtered through nylon mesh (100 mesh), the filtrate further was clarified by centrifugation at 8000×g for 15 min at 4°C, and the supernatant were retained and stored at 4°C for further experiments.

Laccase assay Laccase activity assay is conducted in 3 ml reaction mixtures consisting of 2.7 ml of 0.1 M sodium acetate buffer (pH 4.5), 0.2 ml of 1 mM 2,2-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) solution, and 0.1 ml culture supernatant. The reaction was monitored by measuring the change in A420 for 3 min at 30°C. One unit of enzyme activity is defined as the amount of enzyme that oxidized 1 µM ABTS per minute. The extinction coefficient of 3.6×104 mol-1 cm-1 was used for oxidized ABTS (Niladevi et al., 2009). Strain selection Laccase production of six strains was determined in two batch experiments. First, six strains were incubated in 250 ml Erlenmeyer flasks containing 100 ml of main medium at 24°C on a rotary shaker at 110 rpm, and then laccase activities were assayed every 24 h for 14 days and the peak time of activity was detected. The next step was to determine total laccase activity. Total laccase activity of every strain was calculated with the maximum activity of every strain per volume of fermentation broth. The strain with the highest laccase-secreting ability was selected for subsequent research.

Experimental design Screening for the significant factors As shown in Table 1, the Plackett-Burman (P-B) design was applied to screen the key nutrient factors for the production of laccase. Three virtual variables were introduced to reduce the effect of manipulative error. The signs -1 and +1 represented the lower and higher levels, respectively of the corresponding components. The higher levels of the components were equal to 1.5-folds of the lower levels (Table 2).

Box-Behnken design Based on analysis of P-B and steepest ascent experiments, BoxBehnken (B-B) design was employed to establish a response surface of laccase production for further optimization of the variables’ level. B-B design with three variables at three levels was used as listed in Table 3. The behavior of the system was explained by a regression equation (Equation 1), where Y is the predicted response, β0 is offset term, βi is linear effect, βii is squared effect, βij is interaction effect, and Xi is dimensionless coded value of independent variables under study (Murat, 2004). Data were processed to attain Equation 1, indicating the interaction between the process variables and laccase production.

Y = β 0 + ∑ β i X i + ∑ β ii X i2 + ∑ β ij X i X ji

(1)

Zhang et al.

Table 1. P-B design for screening significant variables with coded values.

Run 1 2 3 4 5 6 7 8 9 10 11 12

X1 1 1 -1 1 1 1 -1 -1 -1 1 -1 -1

X2 -1 1 1 -1 1 1 1 -1 -1 -1 1 -1

X3 1 -1 1 1 -1 1 1 1 -1 -1 -1 -1

Variables in coded level X4 X5 X6 -1 -1 -1 1 -1 -1 -1 1 -1 1 -1 1 1 1 -1 -1 1 1 1 -1 1 1 1 -1 1 1 1 -1 1 1 -1 -1 1 -1 -1 -1

X7 1 -1 -1 -1 1 -1 1 1 -1 1 1 -1

X8 1 1 -1 -1 -1 1 -1 1 1 -1 1 -1

X9 1 1 1 -1 -1 -1 1 -1 1 1 -1 -1

319.1 ± 5.3 318.9 ± 5.1 315.3 ± 9.9 330.2 ± 7.3 350.3 ± 11.4 297.8 ± 3.1 379.1 ± 4.5 344.6 ± 2.6 320.2 ± 8.6 303.6 ± 8.6 347.8 ± 9.1 315.9 ± 7.5

P-B, Plackett-Burman; Y, predicted response; X, dimensionless coded value of independent variables.

Table 2. Assigned concentration of variables at different levels in P-B design.

Factor X1 X2 X3 X4 X5 X6 X7 X8 X9

Variables with designate Sucrose (g/L) yeast powder (g/L) Virtual 1 MgSO4 (g/L) KH2PO4 (g/L) Virtual 2 CuSO4 (mg/L) Vitamin B1 (g/L) Virtual 3

Lower lever (-1) 10 10

Higher lever (+1) 15 15

2 2.7

3 4

2.5 0.1

3.75 0.15

P-B, Plackett-Burman; X, dimensionless coded value of independent variables.

Table 3. The B-B design for the values in coded and the observed values in response.

Run 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

X1 Sucrose (g/L) 2 2 9 9 5.5 5.5 5.5 5.5 2 9 2 9 5.5 5.5 5.5

X2 MgSO4 (g/L) 3.7 6.1 3.7 6.1 3.7 3.7 6.1 6.1 4.9 4.9 4.9 4.9 4.9 4.9 4.9

X3 CuSO4 (mg/L) 5.625 5.625 5.625 5.625 5 6.25 5 6.25 5 5 6.25 6.25 5.625 5.625 5.625

P-B, Plackett-Burman; X, dimensionless coded value of independent variables.

laccase activity (U/ml) 474.1 ± 9.6 511.2 ± 9.6 436.8 ± 2.9 386.1 ± 7.9 491.6 ± 15.9 477.5 ± 8.6 474.8 ± 2.8 460.5 ± 15.9 457.3 ± 11.4 447.3 ± 5.9 483.6 ± 3.5 390.2 ± 19.1 522.5 ± 3.3 517.8 ± 7.7 512.4 ± 8.1

7011

7012

Afr. J. Biotechnol.

Table 4. Screening fungal strains with laccase activity in liquid state fermentation.

Strains

Genus

P. spodoleucas M. purpureofusca P. florida P. abalonus T. aurantialba P. ostreatus

Pleurotus Mycena Pleurotus Pleurotus Tremella Pleurotus

Peak time (day) 11 10 11 12 14* 11

Maximum activity (U/ml) 378.9 ± 3.1 277.5 ± 5.7 364.7 ± 7.3 219.7 ± 2.3 187.2 ± 2.4 370.5 ± 3.7

Volume (ml) 52.5 ± 2.6 82.3 ± 2.4 59.7. ± 3.5 84.2 ± 0.8 74.5 ± 5.1 56.5 ± 4.2

Total activity (U) 19893.26 22838.25 21520.92 18458.14 13855.70 20938.06

Productivity (U/day) 1808.5 2283.8 1979.7 1541.8 996.4* 1903.5

*The peak of laccase yield did not occur after 14 days of cultivation.

Table 5. Analysis of variance for P-B factorial model.

Source Model Sucrose Yeast powder Virtual 1 MgSO4 KH2PO4 Virtual 2 CuSO4 ABTS Virtual 3 Error Total

Degrees of freedom 9 1 1 1 1 1 1 1 1 1 2 11

Sum of square 5727.305 883.589 476.9632 71.35344 1723.39 519.9227 17.83836 1781.579 175.794 76.87558 83.74682 5811.052

Mean square 636.3672 883.589 476.9632 71.35344 1723.39 519.9227 17.83836 1781.579 175.794 76.87558 41.87341

F-value 15.19741 21.10143 11.3906 1.704027 41.15715 12.41654 0.426007 42.54677 4.198225 1.835904

Pr > F 0.0632 0.0443 0.0777 0.3217 0.0234 0.072 0.581 0.0227 0.177 0.3082

P-B, Plackett-Burman.

In the regression equation, the test variable were coded according to Equation 2, where Xi is the independent variable coded value,

i is the independent is the independent variable value, variable real value on the center point and is the step change value (Murat, 2004).

Xi =

U i − U i0 ∆U i

(2)

Statistical analysis of the experimental results and generation of response surfaces were performed by SAS 9.2 (SAS institute inc., Cary, NC, USA.).

after 10-days cultivation and the highest productivity was 2283.8 U/day. The peak in T. aurantialba strain did not occur until 14th day. These results show that the strains have different laccase-secreting abilities. The strains of P. spodoleucas and P. ostreatus showed relatively higher laccase activities. Moreover P. spodoleucas and P. ostreatus generated more mycelia than other strains, which resulted in the decrease of the broth volume after centrifugation at 11th day, then further weakened laccase accumulation. M. purpureofusca had best potential of biotechnology for lacccase production in submerged fermentation based on the above research. Therefore, M. purpureofusca was used in the following research to optimize laccase fermentation medium by RSM.

RESULTS Screening for the significant factors Strain selection According to Table 4, the laccase activities in extracellular culture fluids of six strains reached the peak at different time. Laccase activity of M. purpureofusca reached its peak on the 10th day and dropped slowly. Total laccase production by M. purpureofusca reached 22838.25 U

To check the adequacy of the model, statistical analysis was carried out using the Fisher’s test for analysis of variance (ANOVA) according to the results of P-B experiment (Table 1). As shown in Table 5, sucrose, MgSO4 and CuSO4 were found to be the main variables significantly influencing laccase production according to

Zhang et al.

the regression coefficient and P > F value. CuSO4 concentration with P > F value of 0.0227 was found to be the most important variable followed by MgSO4 (P > F = 0.0234) and sucrose (P > F = 0.0443). The first-order polynomial equation for the predicted response Y of laccase yield was given by Equation 3. X1 (namely sucrose) has a regression coefficient value of -8.58, which indicated sucrose with high concentration had repression effect on laccase production by M. purpureofusca. The concentration of sucrose was gradually decreased to approach the central region in the next steepest ascent experiment. Y = 328.5602 - 8.580933*X1 + 6.304517*X2 + 2.438467*X3 + 11.98398*X4 - 6.582317*X5 + 1.219233*X6 + 12.18462*X7 - 3.827467*X8 - 2.53333*X9 (3) After the main variables were identified, a steepest ascent experiment was carried out to investigate the central point of these variables values for subsequent response surface design. The initial concentrations of sucrose, MgSO4 and CuSO4 were 12.5, 2.5 g/L and 3.125 mg/L, respectively, which were the central point of their level in P-B design. The concentration of other three insignificant variables was as follows: yeast powder 15 g/L, KH2PO4 2.7 g/L and vitamin B1 0.1 g/L, according to their positive or negative effect to laccase production which can be identified by their regression coefficient in P-B experiment. The highest laccase activity of 511.1 U/L was achieved when the concentration of sucrose, MgSO4, CuSO4 were at 5.5, 4.9 g/L and 5.63 mg/L, respectively. The corresponding concentration levels of sucrose, MgSO4 and CuSO4 were -2.8, 4.8 and 4, respectively. These results suggest that the configuration could be considered as a fine central point for experimental design of response surface in further optimization. Box-Behnken design A Box-Behnken experiment was employed to determine the second-order polynomial equation including term of interaction between the selected experimental variables obtained by previous research. The step sizes of the variables involved in the experiment were double size as the corresponding size of the steepest ascent design. The other three insignificant variables were used in the same concentration in steepest ascent experiment. The experimental conditions and results of Box-Behnken experiment are summarized in Table 3. By multiple regression analysis, the second-order polynomial equation to explain the model for laccase production is given below: Y = 517.5785 - 33.21446*X1 - 5.937975*X2 - 7.379062*X3 - 48.51201*X1*X1 - 21.9462*X1*X2 - 20.86973*X1*X3 17.01644*X2*X2 - 0.06945*X2*X3 - 24.48231*X3*X3 (4)

7013

Experimental data were processed using SAS 9.2, including ANOVA to check the statistical significance of this regression model (Table 6). The quality of the fit of this model was expressed by the coefficient of 2 determination (R ) in the same program. The results of ANOVA indicated that the model of the equation for 2 laccase yield was significant at the 1% level. The R 2 value of 97.82% and the adjusted R value of 93.90% showed that the response surface model was highly reliable. Also the lack of fit (Pr > F = 0.1415), which is not significant at 5% level proved that except for the considered factors, there was no factor influencing this prediction model significantly. The three dimensional response surface plots are given in Figure 1 by SAS 9.2 analysis. Each Figure presented the effect of two variables on the production, while other variable was held at zero level. Figure 1 shows the response surface for the variation in the production of laccase. There is a strong interaction effect of sucrose/ MgSO4 (Figure 1A) and sucrose/CuSO4 (Figure 1C), while there is no significant interaction effect between CuSO4 and MgSO4 (Figure 1B). At the same time, the values of laccase activity for different concentrations of the variables could also be predicted. The maximal laccase yield (523.3 U/L) by M. purpureofusca was modeled using response surface regression analysis at the following medium components: 4.26 g/L sucrose, 4.83 g/L MgSO4 and 5.625 mg/L CuSO4. In order to verify the reliability of this prediction model, the experiment was performed with the optimized medium and the maximal laccase production was found to be 519.3 U/L, which was in close agreement with the model prediction. DISCUSSION In recent years, laccase has received extensive attention for its industrial application such as environmental pollution control, textile industry, biosensors, food industry and organic synthesis et al (Tukayi et al., 2011). In general, it is time consuming to cultivate the fruiting bodies of fungi for obtaining laccase. Therefore, submerged cultivation of fungi for efficient laccase production is looked at as a promising alternative to fruiting body cultivation. In this study, among six fungal strains, M. purpureofusca shows the highest laccasesecreting ability and low mycelia generation, which is its advantages in submerged fermentation. Although P. spodoleucas and P. ostreatus represented better laccase activities than M. purpureofusca, the growing mycelia nearly covered the entire flask after 14 days, which resulted in the decrease oxygen transfer, and then inhibited laccase accumulation. At the same time, a large amount of mycelial pellets reduced the effective working volume of the fermentation broth containing laccase, which further limited the application laccase. Unlike these two strains, the growth of M. purpureofusca was very

7014

Afr. J. Biotechnol.

Figure 1. A, Effect of sucrose and MgSO4 concentration on the laccase production by M. purpureofusca. Another variable is maintained at zero level. B, Effect of MgSO4 and CuSO4 concentration on the laccase production by M. purpureofusca. Another variable is maintained at zero level. C, Effect of sucrose and CuSO4 concentration on the laccase production by M. purpureofusca. Another variable is maintained at zero level. X1, Sucrose; X2, MgSO4; X3, CuSO4; Y1, laccase yield.

slow, and even slower than their early stages of growth. Therefore, this advantage makes M. purpureofusca an excellent resource for largescale laccase production. At the same time, its culture period is relatively short and its culture process can be optimized to achieve a high laccase production. In fermentation process optimization, the optimization of fermentation medium is greatly important to enhance laccase production. Using statistical tools like P-B and RSM designs, the variables that played important role in enzyme production were determined and adjusted to an optimized composition. According to P-B experiment, sucrose, MgSO4 and CuSO4 were determined to be the most important variables in laccase production of M. purpureofusca. The data obtained in P-B experiment show that sucrose has negative effect and yeast powder reflect positive effect on laccase production. This means that the

fermentation medium with a low ratio of carbon to nitrogen can increase laccase yield by M. purpureofusca, which may be due to the following facts. First, laccase production of M. purpureofusca was triggered when the carbon source was depleted in short time. Second, the largest increase in activity and highest abundance of lac1Pt transcripts was observed when glucose had been almost depleted (Daniele et al., 2008), and third, the expression of the main laccase gene (lap2) was repressed when glucose concentration exceeds about 1 g/L (Ronne 1995). These results were different from the previous reports by Eggert et al. (1996) and Kaal et al. (1995). They found that a high ratio of carbon to nitrogen can stimulate laccase production. Of course, our research is also in agreement with previous results that Cu2+ was an extremely important metal ion and could induce laccase secretion (Galhaup and Haltrich, 2001; Shutova et al.,

2008). This role of Cu2+ may be due to its induction effect on transcription of the laccase gene (Galhaup et al., 2002). Another reason is that Cu2+ may be buried at the catalytic center and maintains the stability of the laccase. The 3D response surface curve (Figure 1) determines optimum condition of each component for maximum response and their interaction effect when other variable was fixed at zero level. The convex response surfaces implied that a maximum Y value was predicted by this model which could also be demonstrated by the negative quadratic coefficients in Equation 3 (Liu et al., 2010). The interactions between the variables can be inferred from the shapes of response surface plots (Yu et al., 2008). The validation experiment for the response surface model was carried out using optimized fermentation medium consisting of 4.26 g/L sucrose, 15 g/L yeast powder, 4.83 g/L MgSO4, 2.7 g/L KH2PO4, 5.625 mg/L CuSO4 and

Zhang et al.

0.1 g/L vitamin B1. The laccase yield reached 519.3 U/L, which was very close to the predicted production of 523.3 U/L with the optimized fermentation medium. This result therefore confirms the precision of statistical and theoretic effectiveness of the model. Laccase production with nonoptimized medium was 277.5 U/L under the same culture condition. The highest laccase yield was increased by 1.87 times after medium optimization. The data obtained in this study may provide new insights to large-scale laccase production by M. purpureofusca or Mycena genus. At the same time, this study also demonstrates that RSM is effective for the medium optimization in the submerged cultivation of higher fungi. ACKNOWLEDGEMENTS This work was financially supported by the Key Project of Fujian Province of China (No.2010N0004) and General Program of the Provincial Education Department of Fujian Province of China (No. JA11079). REFERENCES Ana Flora DV, Aneli MB, Robert FHD, Ieda SS, Maria InĂŞs R (2000). Optimization of laccase production by Botryosphaeria sp. in the presence of veratryl alcohol by the response-surface method. Process Biochem. 35: 1131-1138. Arockiasamy S, Krishnan IP, Anandakrishnan N, Seenivasan S, Sambath A, Venkatasubramani JP (2008). Enhanced production of laccase from Coriolus versicolor NCIM 996 by nutrient optimization using response surface methodology. Appl. Biochem. Biotechnol. 151: 371-379. Baldrian P (2006). Fungal laccases- occurrence and properties. FEMS Microbiol. Rev. 30: 215-242. Bhattacharya SS, Garlapati VK, Banerjee R (2011). Optimization of laccase production using response surface methodology coupled with differential evolution. New Biotechnol. 28: 31-39. Daniele Q, Mario C, Ermanno F, Alessandro DA (2008). Response surface methodology study of laccase production in Panus tigrinus liquid cultures. Biochem. Eng. J. 39: 236-245. Dekker RF, Barbosa AM, Giese EC, Godoy SD, Covizzi LG (2007). Influence of nutrients on enhancing laccase production by Botryosphaeria rhodina MAMB-05. Int. Microbiol. 10: 177-185. Eggert C, Temp U, Eriksson KE (1996). The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase. Appl. Environ. Microbiol. 62: 11511158. Eggert C, Temp U, Eriksson KE (1997). Laccase is essential for lignin degradation by the white-rot fungus Pycnoporus cinnabarinus. FEBS Lett. 407: 89-92. Elisashvili V, Penninckx M, Kachlishvili E, Tsiklauri N, Metreveli E, Kharziani T, Kvesitadze G (2008). Lentinus edodes and Pleurotus species lignocellulolytic enzymes activity in submerged and solidstate fermentation of lignocellulosic wastes of different composition. Bioresour. Technol. 99: 457-462. Galhaup C, Goller S, Peterbauer CK, Strauss J, Haltrich D (2002). Characterization of the major laccase isoenzyme from Trametes pubescens and regulation of its synthesis by metal ions. Microbiology, 148: 2159-2169. Galhaup C, Haltrich D (2001). Enhanced formation of laccase activity by the white-rot fungus Trametes pubescens in the presence of copper. Appl. Microbiol. Biotechnol. 56: 225-232. Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G (2010). Laccases: a never-ending story. Cell Mol. Life Sci. 67: 369385.

7015

Kaal EEJ, Field JA, Joyce TW (1995). Increasing ligninolytic enzyme activities in several white rot basidiomycetes by nitrogen sufficient media. Bioresour. Technol. 53: 133-139. Leonowicz A, Cho NS, Luterek J, Wilkolazka A, Wojtas-Wasilewska M, Matuszewska A, Hofrichter M, Wesenberg D, Rogalski J (2001). Fungal laccase: properties and activity on lignin. J. Basic Microbiol. 41: 185-227. Liang S, Zhou DM, Feng YR (2008). Research progress and application prospect of laccase from white rot fungus. J. Anhui Agric. Sci. 36: 1317-1319. Liu BB, Yang MH, Qi BK, Chen XR, Su ZG, Wan YH (2010). Optimizing L-(+)-lactic acid production by thermophile Lactobacillus plantarum As.1.3 using alternative nitrogen sources with response surface method. Biochem. Eng. J. 52: 212-219. Liu LH, Lin ZW, Zheng T, Lin L, Zheng CQ, Lin ZX, Wang SH, Wang ZH (2009). Fermentation optimization and characterization of the laccase from Pleurotus ostreatus strain 10969. Enzyme Microb. Technol. 44: 426-433. Mao XZ, Liang XT, Wang S, Dong W, Xing YL, Wang HL, Guo LZ, Wei DZ (2010). Enhanced production of intracellular dextran dextrinase from Gluconobacter oxydans using statistical experimental methods. Afr. J. Biotechnol. 9: 1180-1189. Morozova OV, Shumakovich GP, Gorbacheva MA, Shleev SV, Yaropolov AI (2007). "Blue" laccases. Biochemistry. Mosc. 72: 11361150. Murat E (2004). Optimization of medium composition for actinorhodin production by Streptomyces coelicolor A3(2) with response surface methodology. Process Biochem. 39: 1057-1062. Niladevi KN, Sukumaran RK, Jacob N, Anisha GS, Prema P (2009). Optimization of laccase production from a novel strain-Streptomyces psammoticus using response surface methodology. Res. Microbiol. 164: 105-113. Nyanhongo GS, Gomes J, Gubitz G, Zvauya R, Read JS, Steiner W (2002). Production of laccase by a newly isolated strain of Trametes modesta. Bioresour. Technol. 84: 259-263. Osma JF, Toca-Herrera JL, Rodriguez-Couto S (2010). Transformation pathway of Remazol Brilliant Blue R by immobilised laccase. Bioresour. Technol. 101: 8509-8514. Rodriguez Couto S, Sanroman M, Gubitz GM (2005). Influence of redox mediators and metal ions on synthetic acid dye decolourization by crude laccase from Trametes hirsuta. Chemosphere, 58: 417-422. Ronne H (1995). Glucose repression in fungi. Trends Genet 11: 12-17. Shervedani RK, Amini A (2012). Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: Characterization and quantitative detection. Bioelectrochemistry, 84: 25-31. Shutova VV, Revin VV, Makushina YA (2008). The effect of copper ions on the production of laccase by the fungus Lentinus (Panus) tigrinus. Prikl. Biokhim. Mikrobiol. 44: 683-687. Sun SJ, Liu JZ, Hu KH, Zhu HX (2011). The level of secreted laccase activity in the edible fungi and their growing cycles are closely related. Curr. Microbiol. 62: 871-875. Sun W, Xia CY, Cai HH, Liu XM (2010). Purification and properties of laccase produced by Coriolus hirsutus in sol id state fermentation. J. Food Sci. Biotechnol. 29: 748-754. Tong P, Hong Y, Xiao Y, Zhang M, Tu X, Cui T (2007). High production of laccase by a new basidiomycete, Trametes sp. Biotechnol. Lett. 29: 295-301. Tukayi K, Gibson SN, Georg MG, Stephanie B (2011). Potential applications of laccase-mediated coupling and grafting reactions: A review. Enzyme Microb. Technol. 48: 195-208. Xu JZ, Hu KH, J. SS, L. ZJ, Xiao YM, Lin YH (2011). The comparison and analysis of the producing ability of the ligninolytic enzyme system in different types of edible fungi. Acta. Agric. Univ. Jiangxiensis, 33: 375-380. Yu L, Lei T, Ren XD, Pei XL, Feng Y (2008). Response surface optimization of L-(+)-lactic acid production using corn steep liquor as an alternative nitrogen source by Lactobacillus rhamnosus CGMCC 1466. Biochem. Eng. J. 39: 496-502.

African Journal of Biotechnology Vol. 11(27), pp. 7016-7027, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3810 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Application of high-resolution melting for variant scanning in chloroplast gene atpB and atpB-rbcL intergenic spacer region of Crucifer species Guixin Yan, Xiaodan Lv, Peijun Lv, Kun Xu, Guizhen Gao, Biyun Chen and Xiaoming Wu* Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan, 430062, P. R. China. Accepted 26 January, 2012

High-resolution melting (HRM) analysis is a rapid and sensitive method for single nucleotide polymorphism (SNP) analysis. In this study, a novel HRM assay was carried out to detect SNPs in the chloroplast gene atpB which encodes the beta subunit of the ATP synthase and atpB upstream intergenic region. The polymorphisms of the two fragments in intertribal samples from the Cruciferae family and within the species of Brassica napus were detected. Based on this results, we found that HRM were able to determine over 90% of the variants which included single or multiple variants and insertion-deletion polymorphisms (INDELs) and rendered possible genotyping of more closely spaced polymorphisms, although there were several false positives (FPs) and misclassification. Six haplotypes were identified in the intertribal materials. The analysis of 90 B. napus found five variation types and the variations were all located in the intergenic region. In conclusion, HRM analysis is a closed tube assay that is easy to perform and is a more effective approach to identify variant of chloroplast genes. This study will facilitate further functional investigations into the role of chloroplast genes in photosynthesis, phylogeny and molecular evolution. Key words: atpB gene, chloroplast genome, crucifer, high-resolution melt curve analysis, SNP, INDEL. INTRODUCTION The chloroplast genome (cpDNA) in plants is highly conserved in size and structure, as well as gene content and linear order of genes among angiosperms (Biss et al., 2003). The lack of heteroplasmy and recombination has made it an attractive tool for phylogenetic, phylogeographic, and population genetic studies. Crucifer species exhibit a high level of genetic and phenotypic diversity (Martin et al., 2002). Therefore, a variety of molecular markers have been developed for the const-

Corresponding author. E-mail: wuxm@oilcrops.cn. Tel: +0086 27 86812906. Fax: +0086 27 86812906. Abbreviations: HRM, High-resolution melting; SNP, single nucleotide polymorphism; INDELs, insertion-deletion polymorphisms; FPs, false positives.

ruction of cpDNA linkage maps in Cruciferae, including restriction fragment length polymorphism (RFLP) (Palmer et al., 1983), polymerase chain reaction-RFLP (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) (Allender et al., 2007). However, the density of the markers that have been detected is not sufficient for analysis of lower taxonomic levels. Furthermore, these methods are labour-intensive and require sophisticated technology. The most abundant form of genetic variation, single nucleotide polymorphism (SNP), may resolve this problem (Hess et al., 2000). The use of SNPs is expected to lead to a better understanding of the genetic basis for complex characteristics, such as plant productivity, development, and adaptation to stress. Therefore, this approach could be essential for genetic improvement programmes. Recently, many methods have been developed to genotype SNPs. High-resolution melting

Yan et al.

7017

Figure 1. Regions of atpB gene investigated with HRM analysis. The first region (1) was in atpB gene at positions 588 bp to 691 bp and the second fragment (2) was mainly in the intergenic region between atpB and rbcL genes, upstream of atpB gene from -113 bp to 33 bp. The two regions are indicated by solid arrowheads, and the sequences of the primers used for PCR amplification are described in Table 1. Concerning the coding DNA reference sequence, nucleotide numbering uses the A of the ATG translation initiation start site as nucleotide +1; the GenBank accession numbers were provided when available.

curve (HRM) analysis is a new method that has been identified as a powerful, rapid, and simple way for genotyping and detection of polymorphisms and mutations (De Leeneer et al., 2008). HRM analysis measures the dissociation of double-stranded DNA from a PCR product amplified in the presence of a saturating fluorescence dye which enables differentiation of PCR products based on their dissociation behavior as they are subjected to increasing temperatures (Studer et al., 2009). It has been widely used to genotype plant and human nuclear genes (De Koeyer et al., 2010). However, there are few reports describing the scanning of chloroplast (cp) genes. Our lab has used HRM analysis to search for SNPs and insertion-deletion polymorphisms (INDELs) of the cp gene accD. We found that the detection efficiency depends on variation degree of the gene in the population detected (has been submitted to another journal). Therefore, the potential for use of HRM analysis to scan cp gene variants of intergenic region is considerable. Studies indicated that (cp) gene atpB located in the large single-copy region of the plastid genome (Hu et al., 2011) and it codes for the beta subunit of the ATP synthase (Zurawski et al., 1982). Moreover, the atpB gene and intergenic spacer region between rbcL genes have been used successfully in phylogenetic studies at higher taxonomic levels (Hoot et al., 1999). However, little attention has been given to develop plastid (chloroplast) SNP markers for Brassica and its close relatives. In our study, we used HRM analysis to detect the atpB gene variations among different taxa of Cruciferae and intraspecies of B. napus. Our results demonstrated six haplotypes within the detected fragment at intertribal level and detected five variation types within B. napus species. This study also demonstrated that HRM analysis is an effective approach to identify variants of cp gene.

METHODS AND MATERIALS Plant materials Two sets of plant specimens were sampled to detect the atpB gene variation in the cp genome at different taxonomic levels. The first set was composed of 48 representative accessions from 13 species and 7 genera of the tribe Brassiceae and Arabideae (Electronic Supplementary Material S 1). This set was used to detect the atpB variance at the intertribal, intergeneric and interspecific levels. The second set sampled 90 accessions of cultivars of B. napus (Electronic Supplementary Material S 2) to evaluate the ability of HRM analysis for detecting intraspecific variation. DNA extraction The fresh young leaves of each accession were collected for extracting total DNA using a previously reported method (Guillemaut and Maréchal-Drouard, 1992). DNA samples with absorbance ratios A260/A280 of about 2.0 were used in this experiment. Pure DNA samples were diluted to 50 ng µL-1 and stored at -20°C until needed. PCR analysis The primers were designed according to the HRM analysis protocol. The sequence of GenBank GQ861354 was the reference sequence. Concerning the coding DNA reference sequence, nucleotide numbering uses the A of the ATG translation initiation start site as nucleotide +1; the GenBank accession numbers were provided when available. Two regions were chosen for the HRM assay. The first region was within the atpB gene (588 bp to 691 bp) and the second fragment was the intergenic spacer between atpB and rbcL genes. There was at least one SNP existing in the two regions at the intraspecies level for B. napus, and more SNPs were found at a higher taxonomic level. When designing primers, we chose all the primer pairs with the annealing temperature in common. As a result, we can amplify different fragment in one plate under the same PCR conditions. The primer sequences and their description are reported in Figure 1 and Table 1. PCR was performed in a total volume of 20 µL using Biomed 2×

Table 1. Primers used for HRM analysis of the atpB gene.

Amplicon 1

Primer sequence (5'–3') F：TATCCGTATTTGGTGGAGTAGG R：GGAGTCCGCAAGGTTTAGTT

Region (bp)

Location

Expectedsize (bp)

GC%

588 – 691

atpB gene

103

-113 – 33

Intergenic region

148

F：CCAATGAAATCGAGTGCTTACT R：GCTGGATCCGAAGTAGTAGG

Oligonucleotides are oriented 5'–3', bp = base pairs.

Taq Master Mix. The reaction mixture contained 50 ng of genomic DNA, 2 µL LC Green (Idaho Technology, Inc, UT, USA) (Studer et al., 2009), and 0.5 mmol L-1 of each primer. Finally, 10 µL mineral oil (Bio-Rad) was added to avoid evaporation of the PCR mix during DNA amplification. PCRs were performed in a PTC-200 Peltier Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with a cycling program consisting of 5 min of initial denaturation at 95°C and 30 cycles of 1 min at 94°C, 1 min at 54°C and 1 min at 72°C and a final extension of 10 min at 72°C.

HRM analysis After amplification, the plates were quickly centrifuged and imaged in a 96-well LightScanner (Idaho Technology, Hi-Res Melting™ system 96-well plate format, Inc., Salt Lake City, Utah，USA). Melting curves were generated by ramping the temperature from 55°C to 95°C at 0.1°C/s using the "Scanning" mode and expert scanning analysis (Montgomery et al., 2007). The reference samples were set as a baseline. In the analysis of the 48 different samples, 5 samples including the B. napus sample Chikuzen, Eruca sample Cilezhahong, B. rapa samples Baichengbaiyoucai, Chuanlingyoucai, and Quxu, whose sequences were the same as GenBank GQ861354, were chosen as reference samples. In the 90 B. napus, the samples SavariA, Hongyou-3, and Bounty were used for reference, and their sequences were 100% identical to GenBank GQ861354. Negative PCR products were verified and eliminated before normalisation was performed. The normalised melting curves were temperature-overlaid (to eliminate slight temperature errors between runs) by selecting a fluorescence range (low fluorescence, high temperature, typically 5 to10% fluorescence) and shifting each curve along the x-axis to better overlay a standard sample within this range. Then, the derivative (–dF/dT) of the fluorescence signal was plotted against the temperature to show the melting peak, and a difference plot was generated by subtracting the curves from a reference curve to group samples with similar melting curves (Muleo et al., 2009).

Sequence analyses Genotype homogeneity within clusters was confirmed by sequencing any samples on the edge of apparent clusters. Sequencing was performed by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd (Shanghai, China). Alignment of the sequences with their DNA homologues and DNA phylogenic clustering were carried out using the Vector NTI suite 9.0 software package (Invitrogen, Carlsbad, CA, USA).

RESULTS Selection of the scanning region and primer detection The positions of the two regions detected are shown in Figure 1. The first fragment contained two SNPs at positions 619 bp and 651 bp, respectively (Figure 2a). The intergenic fragment contained one INDEL at -59 bp (Figure 2b). The GC content of the two fragments was 51 and 50%, respectively (Table 1). To verify the suitability of the primer for different tribe samples, we first detected the PCR product by agarose gel electrophoresis; all the atpB products were of the expected size, and no undesired products or dimer products were detected. However, two samples (one B. napus and one Sinapis) did not amplify any product within the intergenic fragment (data not shown). HRM analysis of the cp gene atpB and the intergenic region at different taxonomic levels of Crucifer species In order to perform a thorough analytical evaluation of various amplicons, we initially examined the two primer sets. We used HRM to detect variants among a panel of 48 materials from different taxonomic samples as listed in Electronic Supplementary Material S 1. All the accessions were plotted against temperature, and the reference samples (subtracted from themselves) were set at zero. Different melting profiles were distinguishable among the species based on the peak position and the melting temperature (Figure 3). An atpB intergenic fragment 148 bp in length (Fragment 2 in Figure 1) was scanned by HRM to identify polymorphic variants in the seven different genera. The melting curves obtained clearly differentiated the 48 samples into 5 groups and indicated the presence of SNPs in the fragment (Figure 3). The B. rapa accession Jiningtianjinlv had an adenine (A) insertion at -59 bp and an A deletion at -68 bp (MC1 group), A. thaliana Tri had multiple SNPs, and the B. rapa sample Taicai had no variants that were grouped together (MC1 group). At

Yan et al.

7019

Figure 2. Alignment of the two fragments internal to the primers. (a) Alignment of the fragment of atpB gene. (b) Alignment of the intergenic fragment.

higher taxa, the Hancai species of the genus Rorippa indica had a guanine (G) to thymine (T) substitution at -16 bp and a T Insertion at -10 bp, and the A. thaliana sample Kas had 4 SNPs clustered in one group (MC2 group). A. thaliana had the most SNPs (4), indicating that the variation was more complex at higher taxonomic levels. The B. nigra sample Henjie with C to T substitution generated an MC3 curve, and the B. napus species Zhongshuang 4 with one SNP T to G substitution produced an MC4 curve. The results indicate that the intergenic region varied between the most closely related species, such as B. napus samples Zhongshuang 4 and H47 (accessions from Russia). At the same time, the results demonstrated that single base changes can be identified by high-resolution melting. The other samples were all grouped together with the reference samples (reference type, Figure 3a), indicating that there were no variants (Table 2, Figure 3a).

A 103 bp fragment of atpB gene was analyzed, and the results showed that there were fewer variants within the gene than in the intergenic space. The variants were partitioned into 7 groups (reference type, H1, H2, H3, H4, H5, and H6 groups) and 8 accessions that potentially contained variations were selected by HRM analysis (Figure 3b). The sequencing results showed 5 groups containing SNPs except two groups containing 4 false positives (FPs) (Table 2, Figure 3b). That is to say, only four samples contained variation that is at a higher taxonomic level – R. indica Hancai, A. thaliana accessions Tri and Kas, and E. sativa Shanxiyunjie. The above results demonstrated that we obtained six haplotypes (Table 2). The two A. thaliana materials belonged to Haplotype “TH 2”; “TH 6” contained one E. sativa sample; “TH 3” included one Rorippa sample; and the 3 out of 36 Brassica samples belonged to “TH 1”, “TH4”, and “TH 5” Haplotypes, respectively (Table 2).

7020

Afr. J. Biotechnol.

Figure 3. HRM analysis of the 48 samples from different taxonomic materials. (a) Difference curves resulting from the intergenic region. The samples that have no variations compared with the reference were referred to as â&#x20AC;&#x153;Refâ&#x20AC;? (grey curves). The samples were clustered to different groups. The MC3 and MC4 groups were differentiated successfully. However, the MC1 group contains one FP. The MC2 group showed resulted in misclassification two types of variations. The percent of FPs were 2.1% in the analysis. Ins: insertion; Del: deletion. (b) The difference curves resulting from the coding region of atpB gene. The sample Piaobai was used as reference and the data were analyzed at normal sensitivity level. By comparing to the wild-type reference sequence (grey curves), HRM analysis clustered these samples into six different groups. H2 with multiple SNPs and H6 with one SNP were accurately clustered, respectively. However, HRM curve analysis resulted in four FPs. In addition, the H4 and H5 shared the same variation type. The percent of FPs was 8.7% in the analysis. *: The samples that failed to amplify any products (coloured white) were filtered before data analysis.

HRM detection of atpB gene and the intergenic region polymorphisms within B. napus To detect the intraspecific variations, the two sets of primers were applied to 90 B. napus samples from different countries. We found that five samples potentially

contained variances in the intergenic region (Variation group, Figure 4a). One sample could not be assigned to any other group (Unknown group, Figure 4a). According to the sequencing results, the intergenic fragment had more variance, similar to the results shown in Table 2. Though there were variations among the most samples

Yan et al.

7021

Table 2. Derived haplotypes for atpB gene and the intergenic amplicons based on 16 SNP positions in a set of 48 samples from different tribes.

Haplotype a

Representative

Number

TH1 TH 2 TH 3 TH 4 TH 5 TH 6

Jiningtianjinlv Kas Hancai Heijie Zhongshuang 4 Shanxiyunjie

1 2 1 1 1 1

-68 —c A A A A A

-59 A — — — — —

-31 A T T T T T

-28 C C C T C C

-26 T T C C C C

-16 T T T G G G

-11 G T T T G T

Base position -10 -3 T — — — T A — A — A — A

615 A G G A A A

657 T T G T T T

669 T T C T T T

674 T A A T T T

678 C T T C C C

687 C A C C C A

690 C C A C C C

Haplotypes that were derived using Vector NTI 9.0 software and validated using available reference sequences. Base under the two amplicons. c Deletion at this position b

selected by HRM, the analysis failed to differentiate the variant type; for example, the samples in the variation group, H51, Shengliqinggeng, Qingyou-6, 2000-5, and 05zaV2 had three variation types. The first type was an A deletion at -66 bp, the second was a T to G substitution at -11 bp, and the third was a T to G at -11bp and an A insertion at -58 bp (Table 3). The results showed that the accessions B. napus from China had more variations, and the genetic diversity was abundant. Analysis by HRM indicated that variations in the atpB gene existed in only three samples. The sequence analysis of the amplification fragments showed that the atpB gene had no variation compared with the reference, and the accessions detected were FPs (Figure 4b). DISCUSSION The cp gene atpB is 1497 bp long and is located from positions 51361 bp to 52857 bp following the numbering system for the B. napus cpDNA (GenBank accession number GQ861354) (Hu et

al., 2011). This gene is 788 bp downstream from rbcL, but it is transcribed in the opposite direction of rbcL (Hu et al., 2011). Gene atpB and the intergenic region were suitable for phylogenetic study. In addition, the speed of atpB evolution appeared to be slow, and atpB was easily amplified and sequenced with universal PCR primers. Recent investigations based on sequencing of the atpB gene have revealed relationships within families and between families in angiosperms (Hoot et al., 1999). Though the cost has decreased with the development of sequencing, sequencing large populations is still expensive. Therefore, we developed HRM analysis as a high-throughput, accurate, time-saving, and costeffective approach for polymorphism detection (Wu et al., 2008). HRM is based on high-resolution melting of DNA duplexes in the presence of saturating fluorescent dyes and appears to have an accuracy equivalent or superior to other heteroduplex scanning methods (Reed and Wittwer, 2004). Identifying common genetic variants by HRM has been used recently for gene scanning for disease-related gene mutations in humans (Kennerson et al.,

2007), as well as identification of different microorganisms (Jeffery et al., 2007; Maeta et al., 2008), fish (Dalmasso et al., 2007), and mapping plant SNP markers in almond, potato, apple, olive, and oilseed (De Koeyer et al., 2010). HRM analysis of the two hypervariable regions HVI and HVII in mtDNA has also been suggested to be used as a rapid and inexpensive pre-screening method prior to DNA sequencing (Biss et al., 2003). In the cp genome of Brassica, this approach had been used to differentiate the typical B. napus chloroplasts from those of B. oleracea and B. rapa based on single-base SNPs in the cp gene ycf2 (Allainguillaume et al., 2009). In our study, we chose a fragment of the atpB gene and its upstream region for analysis. Melting temperature (Tm)-based differentiation is possible at the genus or species level. The variation in intergenic fragment was more abundant than in the atpB gene, and we were able to perfectly distinguish between the different variations using HRM analysis, with the exception of one FP and one misclassification (Figure 2a). Although, the FPs was increased in atpB gene, the samples containing multiple sequence variants were

7022

Afr. J. Biotechnol.

Figure 4. The HRM analysis of 90 B. napus entries by the two pairs of primers*. (a) The difference curves resulting from the intergenic fragment. The variation group differentiated the variations and â&#x20AC;&#x153;Refâ&#x20AC;? except one FP. However, the analysis resulted in misclassified the variances with INDELs and SNP into one group. The percent of FPs were 1.1% in the analysis. (b) The analysis result of the fragment of the atpB gene. There were no variation in the 90 samples and the three samples selected out were all FPs. The samples SavariA, Hongyou-3 and Bounty were used for reference, and their sequences were 100% identical to GenBank GQ861354.

differentiated accurately, such as A. thaliana, Eruca, and R. indica (Figure 2b). The variation in B.napus was lower than in the higher taxon. There were only five types of variation in intergenic space and no variation in atpB gene, which indicated that atpB was more highly conserved than the intergenic region. How- ever, the variation of intergenic region also decreased within intraspecies samples (Table 3). In summary, atpB gene was suitable for HRM analysis. HRM testing for a new gene or fragment is only valuable

when the majority of the samples and amplicons generate wild-type sequences and/or harbour the repetitive detection of a common polymorphism. The fragment being detected should contain the following characteristics: (1) the sequence should be highly conserved, which is important for designing universal primers; and (2) there should be a few variations of the gene within a closely related population. Detection of multiple variations by HRM can be problematic (Tindall et al., 2009); (3) GC-rich regions have proven to be an obstacle for the

Yan et al.

7023

Table 3. Validation of the exact polymorphic loci in atpB gene and its intergenic region in B. napus by sequencing.

Name Midas Celebra Shengliqinggeng Qingyou-6 2000-5 05zaV2

Origin country Canada Canada China China China China

-66 A A — — A A

-59 b — A — — — —

Base position -58 — — — — — A

-54 — A A A A A

-11 T T T T G G

Base under the two amplicons. Deletion at this position.

screening methods. GC-rich regions should be avoided for HRM curve analysis (Tindall et al., 2009). Fragments with an average GC content ranging from 31 to 54% can be currently detected (Technology Assessment on HRM as reported by Helen White, National Genetics Reference Laboratory [NGRL], Wessex, United Kingdom; http:// www.ngrl.org.uk/Wessex/down loads_reports.htm). Gene atpB was more conservative (Figure 2), which confirmed the accuracy of HRM detection. The method at highly polymorphic cpDNA loci in particular populations is not recommended. We performed an assessment of the HRM analysis for the gene accD and found that amplicons (amplified from different tribe samples) with more INDELs demonstrate a high level of misclassification (has been submitted to another journal). The variation of the fragment within the population should be assessed based on the known sequence, which is a precondition for HRM analysis. The second factor that should be considered is the GC content. In our study, the GC content of the two fragments was 51 and 50% respectively (Table 1), which is considered an appropriate level of GC content. Hu et al. (2011) reported that most features of B. napus cpDNA are highly similar to those of B. rapa cpDNA. Alignment of the cpDNAs of B. napus and B. rapa showed that the total length of the gene coding regions and the intron region are highly similar between these species. A total of 1-3 SNPs were found in about 50% of the protein coding genes and rrn genes, and INDELs appeared in only three genes, including accD, psbB, and rrn16. Therefore, the cpDNA is conserved not only within species, but also among species. Therefore, most regions of cpDNA are suitable for HRM high-throughput detection for the rare polymorphisms among close relatives. When using HRM analysis, the sensitivity level was very important for accurate detection. Sensitivity levels can also be selected by evaluating the degree of gene variation. In this study, the normal sensitivity levels for atpB gene varied between -1.43 and -2.66 according to the conservation of the gene and the known sequence. It was best to use several samples with known sequence to evaluate the sensitivity level. When no variants are

available for evaluation, and variant curves located close to the wt curve can be detected; moreover, this circumvents the detection of frequent FP scores. We recommend re-evaluating the results again after performing the first series of diagnostic scanning tests. It should be considered that the software cannot always discriminate between different variants in the same amplicon. Therefore, common polymorphisms should never be judged only by their similarity in melt profiles; instead, they should always be confirmed by probe or sequence analysis to exclude the presence of a mutation with an identical melt profile. Also, in our study the overlap in melt profiles was not always simply explained by the similarity of the substitution and a short distance between the locations of the two variants. We do recommend taking note of the critical features mentioned in this study, which should be specifically addressed when applying HRM for mutation scanning analysis. We have summarized recommendations and guidelines that can be considered when setting up and performing HRM for other genes in the online supporting information. Finally, we supply a validated set of PCR primers for mutation scanning analysis of atpB gene on the Light Scanner using identical test conditions. The results indicated over 90% of the variations which included single or multiple variants and INDELs can be identified by HRM analysis. In conclusion, HRM analysis is an effective approach to identify variant of chloroplast genes. This study will facilitate further functional investigations into the role of chloroplast genes in photosynthesis, phylogeny, and molecular evolution. ACKNOWLEDGEMENTS We thank the Biotechnology Research Group, State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences (CAAS), Beijing, China, for providing LightScanner equipment. We thank Jie Zhang, Ph.D. in the Biotechnology Research Group for

7024

Afr. J. Biotechnol.

assistance. We would also like to thank American Journal Experts for providing language help. This study was funded by the 973 Projects (2011CB109300 and 2006CB101600) and National Science and Technology Support Project (2011BAD35B09) of China. REFERENCES Allainguillaume J, Harwood T, Ford CS, Cuccato G, Norris C, Allender CJ, Welters R, King GJ, Wilkinson MJ (2009). Rapeseed cytoplasm gives advantage in wild relatives and complicates genetically modified crop biocontainment. New Phytol. 183: 1201-1211. Allender CJ, Allainguillaume J, Lynn J, King GJ (2007). Simple sequence repeats reveal uneven distribution of genetic diversity in chloroplast genomes of Brassica oleracea L. and (n=9) wild relatives. Theor. Appl. Genet. 114: 609-618. Biss P, Freeland J, Silvertown J, McConway K, Lutman P (2003). Successful amplification of rice chloroplast microsatellites from century-old grass samples from the Park Grass Experiment. Plant Mol. Biol. Rep. 21: 249-257. Dalmasso A, Fontanella E, Piatti P, Civera T, Secchi C, Bottero MT (2007). Identification of four tuna species by means of real-time PCR and melting curve analysis. Vet. Res. Commun. 31(Suppl. 1): 355-357. De Koeyer D, Douglass K, Murphy A, Whitney S, Nolan L, Song Y, De Jong W (2010). Application of high-resolution DNA melting for genotyping and variant scanning of diploid and autotetraploid potato. Mol. Breed. 25: 67-90. De Leeneer K, Coene I, Poppe B, De Paepe A, Claes K (2008). Rapid and sensitive detection of BRCA1/2 mutations in a diagnostic setting: comparison of two high-resolution melting platforms. Clin. Chem. 54: 982-989. Guillemaut P, Maréchal-Drouard L (1992). Isolation of plant DNA: A fast, inexpensive, and reliable method. Plant Mol. Biol. Rep. 10: 60-65. Hess J, Kadereit JW, Vargas P (2000). The colonization history of Olea europaea L. in Macaronesia based on internal transcribed spacer 1 (ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD), and intersimple sequence repeats (ISSR). Mol. Ecol. 9: 857-868. Hoot SB, Magallon S, Crane PR (1999). Phylogeny of basal eudicots based on three molecular data sets: atpB, rbcL, and 18S nuclear ribosomal DNA sequences. Ann. Mom. Bot. Gard. 86: 1-32. Hu ZY, Hua W, Huang SM, Wang HZ (2011). Complete chloroplast genome sequence of rapeseed (Brassica napus L.) and its evolutionary implications. Genet. Resour. Crop Evol. 58: 875-887. Jeffery N, Gasser RB, Steer PA, Noormohammadi AH (2007). Classification of Mycoplasma synoviae strains using single-strand conformation polymorphism and high-resolution melting-curve analysis of the vlhA gene single-copy region. Microbiology, 153: 2679-2688. Kennerson ML, Warburton T, Nelis E, Brewer M, Polly P, De Jonghe P, Timmerman V, Nicholson GA (2007). Mutation scanning the GJB1 gene with high-resolution melting analysis: implications for mutation

scanning of genes for Charcot-Marie-Tooth disease. Clin. Chem. 53: 349-352. Maeta K, Ochi T, Tokimoto K, Shimomura N, Maekawa N, Kawaguchi N, Nakaya M, Kitamoto Y, Aimi T (2008). Rapid species identification of cooked poisonous mushrooms using real-time PCR. Appl. Environ. Microbiol. 74: 3306-3309. Martin W, Rujan T, Richly E, Hansen A, Cornelsen S, Lins T, Leister D, Stoebe B, Hasegawa M, Penny D (2002). Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl. Acad. Sci. USA, 99: 12246-12251. Montgomery J, Wittwer CT, Kent JO, Zhou L (2007). Scanning the cystic fibrosis transmembrane conductance regulator gene using high-resolution DNA melting analysis. Clin. Chem. 53: 1891-1898. Muleo R, Colao MC, Miano D, Cirilli M, Intrieri MC, Baldoni L, Rugini E (2009). Mutation scanning and genotyping by high-resolution DNA melting analysis in olive germplasm. Genome, 52: 252-260. Palmer JD, Shields CR, Cohen DB, Orton TJ (1983). Chloroplast DNA evolution and the origin of amphidiploid Brassica species. Theor. Appl. Genet. 65: 18l-189. Reed GH, Wittwer CT (2004). Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clin. Chem. 50: 1748-1754. Studer B, Jensen LB, Fiil A, Asp T (2009). ''Blind'' mapping of genic DNA sequence polymorphisms in Lolium perenne L. by high resolution melting curve analysis. Mol. Breed. 24: 191-199. Tindall EA, Petersen DC, Woodbridge P, Schipany K, Hayes VM (2009). Assessing high-resolution melt curve analysis for accurate detection of gene variants in complex DNA fragments. Hum. Mutat. 30: 876-883. Wu SB, Wirthensohn MG, Hunt P, Gibson JP, Sedgley M (2008). High resolution melting analysis of almond SNPs derived from ESTs. Theor. Appl. Genet. 118: 1-14. Zurawski G, Bottomley W, Whitfeld PR. (1982). Structures of the genes for the β and ε subunits of spinach chloroplast ATPase indicate a dicistronic mRNA and an overlapping translation stop/start signal. Proc. Natl. Acad. Sci. USA, 79: 6260-6264.

Yan et al.

Electronic Supplementary Material S 1. Forty-eight entries from the tribes Brassiceae and Arabideae assayed using HRM analysis

Genera Brassica carinata B. carinata B. juncea B. juncea B. juncea B. juncea B. juncea B. juncea B. napus B. napus B. napus B. napus B. napus B. napus B. oleracea B. oleracea B. oleracea B. oleracea B. oleracea B. oleracea B. oleracea B. oleracea B. oleracea B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. rapa B. nigra B. nigra Eruca sativa E. sativa Orychophragmus violaceus Raphanus sativus R. sativus Rorippa indica Sinapis alba S. alba S. arvensis S. arvensis Arabidopsis thaliana A. thaliana

Name Aijie Huangziaijie Nanfangren Bangcai 02 Banyedatoucai Donghaigaojiaofengweijie Cv. Pusa Bold CMS (Mri) Midas H47 Chikuzen Zhongshuang 4 Zhongshuang 4 NSA Luobozhicailiao Baoziganlan Ziganlan Shimianlianhuabai Baipilan Tuanyexiaohuacai Lilvqinghuacai Zhonghuajielan Yeshengganlan Yuyiganlan Changningxiaoheiyoucai Xishuibai Guangfuqing Baichengbaiyoucai Chuanlingyoucai Quxu Jiningtianjinglv Piaobai Niuyezhongshucaixin Wutacai Taicai Oiebra Heijie Shanxiyunjie Cilezhahong Eryuelan Yuewangluobozi Lanhuazi Hancai Baijie 01 Baijie 02 Xinjiangyeshengyoucai A Xinjiangyeshengyoucai B Tri Kas

Origin Ethiopia Ethiopia Russia China China China India India Canada Russia Japan China China China China China China China China China China China China China China China China China China China China China China China Sweden Spain China China China China China China China China China China

Sweden Sweden

7025

7026

Afr. J. Biotechnol.

S 2. Ninety varieties in B. napus and its ancient parents used for intraspecies HRM analysis.

Code 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

Name Mianza 03-33 Oro Major Primor Yaojin Rape Marnoo Ujfertadi Savari A Expander Ledos Huyou 21 H51 Janpol Start Mikado P20 Lingot Wipot Regent Tower Shiralee Viking Cobra Parter Falcon Nevin Samouran Roman-1 Tornado Legend Grant Celebra Triton Profit Startigh Bounty Garrison Gcsunder Disamant Mar Star Shengli Qinggen Jiuer rape Hanfeng-1 Huayou-13 Aijiazao Southeast-302 Yunyou-49 Qingyou-6

Ploidy 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x

Genome AACC (n =19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19)

Origin China Canada France France Italy Australia Hungary Hungary Germany Germany China Former Soviet Union Poland Poland United Kingdom United Kingdom United Kingdom Norway Canada Canada Australia Denmark Germany Germany Germany France France Netherlands Sweden Sweden Sweden Canada Canada Canada Sweden Sweden Sweden Germany Germany Poland Denmark Shanghai, China Zhejiang, China Shanxi, China Wuhan, China Sichuan, China Sichuan, China Yunnan, China Qinghai, China

Yan et al.

Supplementary 2. Contd.

50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

Nonglin-18 F01*J6 1-1 Ganyou-5 Zhongyou-821 Xiangyou-5 Dong-Hae 23 Ganpol Norin 16 Zheyouyou-2 Yuyou-2 Zhongyoudijie-1 Qingyou-12 Heyou 563 Zhongshuang 4 ISN-705 H0302 2000-5 H9944 01 Za-654 05 Za-V2 HY8 Youyan-10 Qianyou-20 6766 H0202 Zheyou-5002 Zhongyouza-2 Za-839 Hongyou-3 Zashuang-5 7633 Qinyou-7 Rape-23 Ganyou-4 Huayou-3 Huayou-8 Chuannong Changjiao Chuanyou-7 Luzhou-5 Nanyang-41 Hechengyoucai

4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x

AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19)

Japan Hubei, China Wuhan, China Wuhan, China Hunan, China Japan Zhejiang, China Japan Zhejiang, China Henan, China Wuhan, China Qinghai, China Japan Wuhan, China India Hubei, China Hubei, China Hubei, China Sichuan, China Chongqing, China Jiangsu, China Guizhou, China Guizhou, China Hubei, China Hubei, China Zhejiang, China Hubei, China Hunan, China Jiangsu, China Henan, China Shanxi, China Shanxi, China Shanghai, China Hubei, China Hubei, China Hubei, China

AACC (n=19)

Sichuan, China

4x 4x 4x 4x

AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19)

Sichuan, China Sichuan, China Henan, China Henan, China

7027

Full Length Research Paper

Yan et al.

7017

Table 1. Primers used for HRM analysis of the atpB gene.

Amplicon 1

Primer sequence (5'–3') F：TATCCGTATTTGGTGGAGTAGG R：GGAGTCCGCAAGGTTTAGTT

Region (bp)

Location

Expectedsize (bp)

GC%

588 – 691

atpB gene

103

-113 – 33

Intergenic region

148

F：CCAATGAAATCGAGTGCTTACT R：GCTGGATCCGAAGTAGTAGG

Oligonucleotides are oriented 5'–3', bp = base pairs.

Yan et al.

7019

Figure 2. Alignment of the two fragments internal to the primers. (a) Alignment of the fragment of atpB gene. (b) Alignment of the intergenic fragment.

7020

Afr. J. Biotechnol.

Yan et al.

7021

Table 2. Derived haplotypes for atpB gene and the intergenic amplicons based on 16 SNP positions in a set of 48 samples from different tribes.

Haplotype a

Representative

Number

TH1 TH 2 TH 3 TH 4 TH 5 TH 6

Jiningtianjinlv Kas Hancai Heijie Zhongshuang 4 Shanxiyunjie

1 2 1 1 1 1

-68 —c A A A A A

-59 A — — — — —

-31 A T T T T T

-28 C C C T C C

-26 T T C C C C

-16 T T T G G G

-11 G T T T G T

Base position -10 -3 T — — — T A — A — A — A

615 A G G A A A

657 T T G T T T

669 T T C T T T

674 T A A T T T

678 C T T C C C

687 C A C C C A

690 C C A C C C

Haplotypes that were derived using Vector NTI 9.0 software and validated using available reference sequences. Base under the two amplicons. c Deletion at this position b

7022

Afr. J. Biotechnol.

Yan et al.

7023

Table 3. Validation of the exact polymorphic loci in atpB gene and its intergenic region in B. napus by sequencing.

Name Midas Celebra Shengliqinggeng Qingyou-6 2000-5 05zaV2

Origin country Canada Canada China China China China

-66 A A — — A A

-59 b — A — — — —

Base position -58 — — — — — A

-54 — A A A A A

-11 T T T T G G

Base under the two amplicons. Deletion at this position.

7024

Afr. J. Biotechnol.

Yan et al.

Electronic Supplementary Material S 1. Forty-eight entries from the tribes Brassiceae and Arabideae assayed using HRM analysis

Sweden Sweden

7025

7026

Afr. J. Biotechnol.

S 2. Ninety varieties in B. napus and its ancient parents used for intraspecies HRM analysis.

Code 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

Ploidy 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x

Yan et al.

Supplementary 2. Contd.

50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x

AACC (n=19)

Sichuan, China

4x 4x 4x 4x

AACC (n=19) AACC (n=19) AACC (n=19) AACC (n=19)

Sichuan, China Sichuan, China Henan, China Henan, China

7027

African Journal of Biotechnology Vol. 11(27), pp. 7028-7037, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3194 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Effects of biofertilizers on grain yield and protein content of two soybean (Glycine max L.) cultivars Iraj Zarei1, Yousef Sohrabi1*, Gholam Reza Heidari1, Ali Jalilian2 and Khosro Mohammadi3 1

Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Kurdistan, Sanandaj, Iran. 2 Kermanshah Agriculture and Natural Resources Center, Kermanshah, Iran. 3 Department of Agronomy, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran. Accepted 18 January, 2012

Nutrient management is one of the most important factors in successful cultivation of plants. Biofertilizers can affect the quality and quantity of crop. In order to study the effects of biofertilizers on grain yield and protein content of two soybean (Glycine max L.) cultivars, an experiment was conducted using a factorial arrangement based on randomized complete block design with four replications, at the Mahidasht Research Station of Kermanshah in 2010. The factors were soybean cultivar (Williams and Line no. 17) and fertilizer application (b1= N + P, b2= Bradyrhizobium japonicum + P, b3= N + Bacillus and Pseudomonas + 50% of P, b4= B. japonicum + Bacillus and Pseudomonas + 50% of P, b5= B. japonicum + 50% of N + Bacillus and Pseudomonas + 50% of P). Results show that Line no. 17 with 2911.2 kg/ha had higher seed yield than Williams with 2711 kg/ha. Also, fertilizer levels of b3 with 3058.2 and b2 with 2643.8 kg/ha produced the highest and the lowest seed yield, respectively. Plants treated with fertilizer levels of b1, b2 and b5 in comparison with other fertilizer levels significantly produced lower thousand seed weight. In Line no. 17 fertilizer level of b3 with 2.88 produced the highest seed per pod. Results show that fertilizer levels had a significant effect on the number of pod per plant and treatments containing biological fertilizers in terms of the number of pods per plant were equal or superior to chemical fertilizer. It was also observed that fertilizer levels of b1, b3 and b5, produced the highest protein percentage. It therefore seems that biofertilizers can be considered as a replacement for part of chemical fertilizers in soybean production. Key words: Bacillus, Bradyrhizobium japonicum, phosphate solubilizing, protein, Pseudomonas. INTRODUCTION Nutritional management is an important factor in success of planting crops. Soybean in the case of protein and oil is known as a world's most important crop (Raei et al., 2008). Throughout history, legumes have been used for the supply of food, fodder, fuel and traditional medicine (Howieson et al., 2008). Protein of soybean seed contains amino acids required for human nutrition and livestock (Raei et al., 2008). For optimum plant growth, nutrients must be balanced and should be sufficient for plant, or in other words the soil must have nutrients that are needed for plants (Ayoola, 2010); however, most of these resources are in the unavailable form and each

*Corresponding author. E-mail: y.sohrabi@uok.ac.ir. +989141421300. Fax: +988716620553.

Tel:

year only a little part of them are released through biological activity and chemical processes (Chen, 2006). Hence, in order to increase crop yield per unit area, largely chemical fertilizers are used. The result of these activities in recent years has been the crisis of environmental pollution, especially water and soil pollution that threatens human society. Sustainable agriculture based on using biological fertilizers is an effective solution for overcoming these problems (Darzi et al., 2006; Ekin et al., 2009). Biological fertilizers can affect on yield and quality of product. Biological fertilizers containing useful enzymes and microorganisms that can increase plant growth and quality of crops, and reduce the cost of fertilizer and pesticide application (Chen, 2006). Phosphate-solubilizing microorganisms produce various organic acids such as oxalate, lactate, acetate, glycolate, gluconate, tartrate,

Zarei et al.

7029

Table 1. Some physical and chemical characteristics of soil.

Texture

O.C (%)

Ec (Ds/m)

Ntot (%)

Clay silty

0.91

0.71

7.1

0.1

citrate and succinate. Plants of the legume family establish symbiotic relationship by rhizobial bacteria and through this symbiosis can fix nitrogen by rhizobial bacteria and provide all or part of their required nitrogen in this way (Gan and Peoples, 1997). Kuntal et al. (2007) during the research on medicinal plant, Stevia rebaudiana Bert, showed that application of phosphate solubilizing bacteria, improved biological function and absorption of nutrient elements in this plant. Shaharoona et al. (2007) also reported that phosphate-solubilizing bacteria would increase wheat yield. In addition, Jat and Ahlawat (2006) by using of phosphate solubilizing bacteria and one strain of rhizobial bacteria on the pea plant, stated that biological yield, grain yield and grain protein level significantly increased compared with control treatment. Olivera et al. (2002) declared that the effect of combined inoculation of bean by phosphate solubilizing bacteria and Bradyrhizobium japonicum bacteria were positive on dry weight. Moreover, Zhang et al. (2002) reported that B. japonicum bacteria increased number of pods per plant, number of seeds per plant, hundred seed weight, grain protein, total protein and development of plant leaves in two soybean cultivars. Kazemi et al. (2005) also stated that soybean seed inoculation by rhizobial bacteria significantly increased the number of pods per plant, number of seeds per plant, thousand grain weights and finally the yield of soybean. Yadeghari et al. (2003) in research to examine the effects of inoculation of four strains of B. japonicum on yield and yield components of soybean showed that line no.11 was superior to Williams cultivar. This superiority was attributed to more vegetative period of line no. 11 and better symbiosis by B. japonicum. Asadi Rahmani et al. (2000) reported that during seed filling stage of soybean in treatments inoculated by B. japonicum bacteria, more photoassimilate transport to grain due to higher photosynthesis level and this factor can increase the seed size and seed weight. Stefan et al. (2010) stated that inoculation of soybean by Bacillus pumilus significantly increased plant height, leaf number, leaf area, grain protein and nodulation. While Rosas et al. (2002) reported that combined inoculation of soybean by symbiotic bacteria of soybean and phosphate solubilizing bacteria improved dry weight of soybean. Considering the importance of soybean in production of oil, its nutritional importance and status of biological fertilizers in sustainable agriculture, the study of yield and yield components of soybean, possible changes of oil and protein percentage affected by biological fertilizer is

410

Fe (mg/kg) 7

9.7

0.75

therefore essential to improve yield and quality of product, effort to provide food and health security and also decrease use of chemical inputs with adverse effects on environmental health. In most researches carried out, little attention has been paid to combined effect of phosphate solubilizing bacteria and B. japonicum bacteria. Moreover, doing such an experiment in a different climatic condition may have different results. MATERIALS AND METHODS The experiment was conducted at the Station of Agriculture and Natural Resources of Mahidasht, Iran with latitude 34° 16′ 12′′ N and longitude 46° 50′ 01′′ E and elevation of 1380 m above the sea level during the 2010 growing season. The experiment was conducted as a factorial arrangement based on randomized complete block design with four replications. The experimental treatments consisted of two soybean cultivars (Williams and line no. 17) and five different levels of fertilizer as follows: b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50 percent P; b4: Bradyrhizobium japonicum + Bacillus + Pseudomonas + 50 percent P; b5: Bradyrhizobium japonicum + 50 percent N + Bacillus + Pseudomonas + 50 percent P. Soil samples were collected prior to the experiment (Table 1). Considering fertilizer requirement and results of soil analysis, 150 kg/ha triple super phosphate and 300 kg/ha urea was used for fertilizer treatment. Urea fertilizer was used during the three-stage, 30 kg, simultaneously with the planting (starter) in all experimental plots and 270 kg was applied as an equal in four-leaf stage and early reproductive stage. Planting soybean was done in early June. Biological fertilizers fully were mixed with seeds in the shadow and dried for 10 min (inoculated seeds were planted before two hours). Inoculated seeds were planted in rows with 3 cm depth. To ensure the success of biological fertilizers, once again in two to four leaf stages, biological fertilizers were consumed in plots by irrigation. Measurement of growth parameters In this study, plant height, number of stem node, number of lateral branches, the height of the first fertile node of the soil, plant dry weight, number of seed per plant, number of pod per plant, number of seed per pod, seed thousand weight, biological yield, economic yield, harvest index, protein percentage and protein yield were measured. For measuring traits of plant height, number of stem node, number of lateral branches, plant dry weight, number of seed per plant, number of pod per plant, number of seed per pod and biological yield, 10 plants from each plot were harvested and studied. To measure plant dry weight, 10 plants from each plot were put in oven at 75°C for 48 h. Two lines in each plot were considered for measuring seed yield (economic yield). Harvest index was calculated by using this formula:

Economic yield Harvest index (%) = Biological yield

7030

Afr. J. Biotechnol.

Table 2. Analysis of variance of number of lateral branches, number of stem node, plant height, height of first fertile node from the soil, number of pod per plant, number of seed per pod and number of seed per plant in response to various Cultivar and fertilizer in soybean plant.

Source of variation

Df.

Number of lateral branches

Number of stem node

Plant height

Height of first fertile node from the soil

Number of pod per plant

Number of seed per pod

Number of seed per plant

0.090ns

3.698**

79.46**

0.043ns

26.58ns

0.00428ns

168.9ns

Cultivar

0.090

4.160**

Fertilizer

0.968**

1.723**

Cultivar × Fertilizer

Error

0.124

0.405

13.9

11.1

3.1

3.5

Block

0.204

0.580

0.09

162.90** ns

10.40

0.009

0.067ns ns

0.433

8.93

53.82** ns

0.00062

0.04560**

54.8

723.3** ns

8.96

0.04436*

24.7

0.225

8.5

0.00326

67.5

9.1

7.5

2.1

7.8

*Significant at P ≤ 0.05; **Significant at P ≤ 0.01; Df: Degree of freedom; CV: Coefficient of variation. ns, Non significant.

Protein was measured by Kjeldahl method (Peach and Tracey, 1956) and by multiplying seed yield in protein percentage, protein yield was determined. Statistical analysis The data were analyzed using the SAS software package. Comparisons of all means were done at the 5% probability level based on Duncan’s method. Moreover, for significant interaction, slicing was used. Graphs were generated using Excel software.

RESULTS AND DISCUSSION Number of lateral branches Results show that fertilizer levels of b2 with 3.65 and b1 with 2.80 had the highest and lowest number of lateral branches, respectively (Table 3). Increase in the number of lateral branches could be caused by increase in plant growth that was the result of improved nutrient absorption of phosphorus and nitrogen. Nitrogen as part of the protein compounds, enzymes, effective compounds in energy transfer, takes part in structure of DNA, present in the structure of chlorophyll and

has a direct impact on vegetative growth (Assiouty and Sedera, 2005). It seems that a gradual release of nitrogen by nitrogen stabilizer bacteria caused the number of lateral branches in the fertilizer levels of b2 and b4 to increase. Priority of b2 and b4 could be due to balancing the absorption of nutrients (supply of continuous and stable mineral elements especially nitrogen to plants) in the root environment and beneficial effect of bacteria in these treatments on the enzymes and hormones, which results in plant growth. However, in level of fertilizer b5, despite having nitrogen stabilizer bacteria, the number of lateral branches was less than those of b2 and b4. It seems that consuming of 50% nitrogen fertilizer in this fertilizer levels led to decrease in the activity of nitrogen fixation in nodules. Sundara et al. (2002) during their research in sugarcane plant reported that application of phosphate solubilizing bacteria (Bacillus megaterium) increased the number of stems per plant.

Williams cultivar with 20.02. Among the studied fertilizer levels, b3 with 20.74 and b2 with 19.81 had the highest and lowest stem node, respectively (Table 2). Between fertilizer levels of b2 and b4, and also b1, b3 and b5, no significant difference was observed (Table 3). Priorities of b1, b3 and b5 in terms of number of stem node can be induced from developed root system, improved water supply and adequate plant nutrients. Lower number of stem node in b2 and b4 may be due to the fact that in these two fertilizer levels, supplied nitrogen by nitrogen stabilizer bacteria has been gradually given to the plant. In fertilizer levels of b2 and b4 that had used B. japonicum bacteria, stem node was less than other fertilizer treatments. Increasing lateral branches per plant in fertilizer levels containing B. japonicum may have caused the stem node in plants under these treatments to decrease.

Number of stem node

Fertilizer levels of b3 with 112.21 and b4 with 101.6 had the highest and lowest plant height, respectively (Table 3). As shown in Table 3, in

Line no. 17 with 20.67 nodes, had more node than

Plant height

Zarei et al.

7031

Table 3. Effect of variety and fertilizer levels on soybean traits.

Number of lateral branches

Number of stem node

Plant height (cm)

The height of first fertile node from the soil (cm)

Cultivar a1 a2

3.12a a 3.21

20.02b a 20.67

107.98a a 107.88

5.17a a 5.20

Fertilizer b1 b2 b3 b4 b5

2.80b 3.65a b 2.96 a 3.40 3.02b

20.74a 19.81b a 20.59 b 19.87 20.72a

110.82a 104.84b a 112.21 b 101.60 110.19a

5.31a 5.12a a 5.07 a 5.19 5.22a

Treatment

Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). a1: Williams cultivar, a2: line no. 17; b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5 : B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

this is probably due to sufficient supply of required nutrients to the plant, which finally caused the photosynthesis and soybean growth to be improved. These results are in agreement with the results of Darzi et al. (2006) that they performed their study on the fennel plant. Dileep Kumar et al. (2001) also reported that combined inoculation of pea seeds with rhizobial and phosphate solubilizing bacteria increased plant height.

The height of first fertile node from the soil

Results show that the effects of cultivar, fertilizer treatments and their interaction were not significant on the height of first fertile node from the soil.

Number of pod per plant

45 40

Fertilizer Figure 1. Effect of fertilizer levels on number of pod per plant. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

fertilizer levels of b2 and b4 that used B. japonicum bacteria, plant height was less than other fertilizer treatments. Increasing lateral branches per plant in fertilizer levels containing B. japonicum may have caused the plant height in plants under these treatments to decrease. As can be observed in this table, fertilizer levels of b1, b3 and b5 had a similar effect on plant height,

The results obtained showed that fertilizer levels had a significant effect on number of pod per plant. Fertilizer levels of b3 with 41.6 and b2 with 36.16 had the highest and lowest number of pod per plant, respectively (Figure 1). Treatments containing biological fertilizers in terms of number of pods per plant were equal or superior to chemical fertilizer. Fertilizer levels of b3 and b4 had the higher number of pods per plant than chemical fertilizer. This result probably was because of balancing uptake of nutrients in root environment, the beneficial effects of these bacteria on enzymes and hormones and their effects on plant growth. Mahfouz and Sharaf-Eldin (2007) reported that phosphorous solvent bacteria have the ability to produce organic acids that would increase solubility of phosphorus available for plants. Continuous and stable supply of mineral elements especially P to the plants, can increase growth and flowering rate. Phosphorus along with nitrogen, improves reproductive growth

Afr. J. Biotechnol.

Number of seed per pod

7032

2.9 2.8 2.7 2.6 2.5 2.4 2.3 2.2

a a a

b a

Williams variety Line no. 17

b1 b2 b3 b4 b5 b1 b2 b3 b4 b5 Fertilizer Figure 2. Effect of fertilizer levels on number of seed per pod of two soybean cultivars. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

Table 4. Effect of fertilizer levels on number of seed per plant, seed thousand weight and plant dry weight.

Fertilizer b1 b2 b3 b4 b5

Number of seed per plant 102.49b 96.00b 117.25a 111.85a 96.19b

Seed thousand Weight (g) 134.77b 128.70b 145.98a 148.89a 133.56b

Plant dry weight (g) 33.91bc 32.16c 37.54a 36.93ab 31.71c

Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

and fruit produce in the plant. The b5 consumption of nitrogen fertilizer (up to 50 percent of plant requirement), may have led to reduction of nitrogen fixation by B. japonicum and finally the number of pod per plant, compared to chemical fertilizer. Gan and Peoples (1997) during their research on soybean, however, observed that there was no difference in the number of pods per plant and grain yield between plants inoculated by B. japonicum and plants treated by chemical fertilizer.

characteristics results in plants showing different responses to fertilizer levels. Priority of b3, in Line no. 17 may have been because of hormonal effects of phosphate solubilizing bacteria and continuous and stable supply of P to the plants during growth and flowering periods. Nabila et al. (2007) observed that application of Azospirillum on wheat had significant effect on number of grain per spikelet.

Number of seed per pod

Number of seed per plant

Results show that the studied cultivars had different responses to fertilizer levels. In line no. 17, fertilizer levels of b3 with 2.88 and b5 with 2.63 had the highest and lowest seed per pod, respectively. Also in line no. 17, only b3 showed significant differences with other fertilizer levels (Figure 2). It seems that different genetics

The highest and lowest number of seed per plant belonged to fertilizer levels of b3 with 117.25 and b2 with 96.00, respectively. The b3 and b4 in terms of number of seed per plant were significantly different from b1, b2 and b5 (Table 4). This priority of b3 and b4 may be due to the more pods per plant, which may have been provided from

Zarei et al.

adequate phosphorus and nitrogen needed for plants. P is an essential element for cell division, root development and seed formation (Gizawy and Mehasen, 2009). Similarly, Zhang et al. (2002) reported that B. japonicum bacteria application increased the number of seed per plant of two soybean cultivars. Seed thousand weight Results show that fertilizer levels of b4 with 148.89 and b2 with 148.70 g had the highest and lowest seed thousand weight, respectively. Plants treated with fertilizer levels of b1, b2 and b5 in comparison with other fertilizer levels significantly produced lower seed thousand weight (Table 4). Better developed root systems and better absorption of nutrient elements in fertilizer levels of b3 and b4, may increase seed thousand weight. On the other hand, improvement of photosynthesis by these bacteria may increase seed thousand weight moreover on increasing vegetative growth. Likely, improve of plant nutrition has led to sufficient photoassimilate being transmitted to seeds in the grain filling stage and seeds have more seed thousand weight (Saleh Rastin, 2005). Priority of seed thousand yield in b3 and b4 possibly is attributed to enzymatic and hormonal effects of phosphate solubilizing bacteria. On the other hand, the lower yield in b2 may be due to the absence of phosphate solubilizing bacteria. In b5, consumption of nitrogen fertilizer (up to 50% of plant requirement) may have led to the reduction of nitrogen fixation by B. japonicum and seed thousand weight as well. Kazemi et al. (2005) reported that soybean seed inoculation with rhizobial bacteria significantly increased seed thousand weight. Zhang (2002) reported that inoculation with B. japonicum bacteria increased 100 seed weight of two soybean cultivars. Asadi Rahmani et al. (2000) also observed that in the grain filling stage of soybean due to higher levels of photosynthesis in treatments inoculated with B. japonicum bacteria, more phosphate is transported to the grain and this factor could increase the size and weight of seed. Plant dry weight Result show that among fertilizer levels, b3 with 37.54 and b5 with 31.71 g had the highest and lowest plant dry weight, respectively. Fertilizer levels of b3 and b4 compared to other fertilizer levels had higher plant dry weight (Table 4). To justify these results, it could be suggested that phosphate solubilizing bacteria in these fertilizer levels had a positive impact on plant growth and increased plant dry weight. This can be caused by stimulating secretion of growth hormones which is produced by this bacteria and their effect on plant growth. In b5, consumption of nitrogen fertilizer (up to 50% of plant

7033

requirement), may lead to reduction of nitrogen fixation by B. japonicum and finally plant dry weight compared to chemical fertilizer. Kandil et al. (2004) reported that the use of biological fertilizers in sugar beet, significantly increased plant dry weight. Raeipour and Aliasgharzadeh, (2004) also stated that Bradyrhizobium bacteria has positive effect on shoot dry weight, and interaction of phosphate solubilizing bacteria and B. japonicum was significant on shoot dry weight. Hernandez et al. (1995) reported that effect of Pseudomonas fluorescens bacteria was positive on the increasing weight of plant maize. Seed yield Results show that Line no. 17 with 2911.2 kg/ha had higher seed yield than Williams with 2711 kg/ha. Between fertilizer levels, b3 with 3058.2 and b2 with 2643.8 kg/ha produced higher and lower seed yield respectively (Table 5). Between plants treated with fertilizer levels of b3 and b4, no significant differences were observed, but these plants significantly produced higher seed yield compared to plants under fertilizer treatment of b1, b2 and b5 (Figure 3). Fertilizer levels of b3 and b4 significantly produced higher seed yield compared to plants under fertilizer treatment of b1 (chemical fertilizer). It seems that nitrogen stabilization and phosphate solubilizing bacteria, by increasing yield component such as number of pods per plant, seeds per pod, seed number and seed thousand weight, increased seed yield. For high yield, plant should have proper balance between vegetative and reproductive growth, and developmental stages of seeds completely. This status can be created when we have balanced the necessary elements for vegetative growth (nitrogen), with the necessary elements for reproductive growth (P) (Bashan et al., 1992). Bacteria used in these treatments (b3 and b4), maybe increase seed yield by providing macro and micro nutrients for plant growth, production of stimulate material, development of root system and anti-pathogenic effects (Jat and Ahlawat, 2006). It is reported that soybean inoculated by Bradyrhizobium bacteria and phosphate solubilizing bacteria increased the seed yield (Singh, 1994; Jat and Ahlawat, 2006). Phosphate solubilizing bacteria led to increased absorption of other elements by increasing the ability to access phosphorus and thereby can increase crop yield (Mahfouz and Sharaf-Eldin, 2007). Priority of fertilizer level of b4 than fertilizer level of b2 was probably because phosphate-solubilizing bacteria had positive effect on activities of nitrogen stabilizer bacteria due to provision of phosphorus and other nutrients. In fertilizer level of b5, consumption of nitrogen fertilizer (up to 50% of plant requirement) may have led to reduction of nitrogen fixation by B. japonicum and thus, seed yield was reduced.

7034

Afr. J. Biotechnol.

Table 5. Analysis of variance of seed thousand weight, plant dry weight, seed yield, biological yield, harvest index, protein percentage and Protein yield in response to various Cultivar and fertilizer in soybean plant.

Df.

Seed thousand Weight

Plant dry weight

Block

467.1**

84.05**

Cultivar

45.3ns

Fertilizer

Cultivar Ă&#x2014; Fertilizer

165.4

Error

86.7

10.18

66232

244231

15.419

7.569

19286.3

6.7

9.3

9.2

6.1

11.3

7.7

13.7

Source of variation

Seed yield

Biological yield

62917

2310557**

4.91ns

401001*

2134408**

596.4**

57.44**

309321**

1120716**

20.11

98406

456005

Harvest index ns

24.080

Protein percentage ns

Protein yield ns

12.961

3819.1

206.025**

8.546ns

75836.2ns

17.304ns

148.475**

196601.9**

16.931

19.379

11238.4ns

*Significant at P â&#x2030;¤ 0.05; **Significant at P â&#x2030;¤ 0.01; Df: degree of freedom; CV: coefficient of variation. ns, Non significant.

Biological yield Results show that Williams cultivar with 8376.7 had higher biological yield than Line no. 17 with 7914.7 kg/ha. Soybean treated with fertilizer levels of b3 with average of 8502.8 and b5 with average of 7709.3 kg/ha had the highest and lowest biological yield, respectively. Plants treated with fertilizer levels of b2 and b5 significantly had less biological yield (Figure 4). Biological yield represents the total biomass of plant organs and effective absorption of nutrient elements. Considering that nitrogen is available in the structure of proteins, nucleic acids, chlorophyll, enzymes and vitamins, so enough nitrogen in the plant, provide plant better growth. In treatment of b1, adequate nitrogen supply increased vegetative growth and thus biological yield was increased. The b2 treatment inoculated with nitrogen stabilizers bacteria may be unable to fix nitrogen for complete need of plant. In treatment of b5, it is likely that consumption of nitrogen fertilizer (50% needed by plant) reduced nitrogen fixation by B. japonicum and consequently biological yield was reduced compared to chemical fertilizer. In

fertilizer levels containing phosphate solubilizing bacteria (b3 and b4), due to the solubility of phosphate and production of plant hormones that affect nutrient uptake and photosynthesis processes, can increase growth, development of plant root systems and biological yield (Assiouty and Sedera, 2005). Gharib et al. (2008) reported that developed root systems increase water and nutrient uptake and consequently, increased photosynthesis, and this caused the production of photosynthetic material and biological yield to increase. Harvest index As seen from Table 6, Line no. 17 with average of 36.89% had higher harvest index than Williams cultivar with 32.35%. Priority of Line no. 17 than cultivar of Williams can be attributed to the fact that cultivar of Williams had lower seed yield and higher biological yield than Line no. 17, according to the equation related to harvest index (Equation 1); thus Williams cultivar had been a lower harvest index. Shirastava et al. (2001) and Narne et al.

(2002) stated that in soybean, harvest index has highly correlated with grain yield. Protein percentage and protein yield Results reveal that fertilizer levels of b1, b3 and b5 produced the highest protein percentage (Figure 5). Priority of levels of fertilizer of b1, b3 and b5, may be that in these treatments, sufficient nitrogen for protein synthesis and the production was put at the disposal of plant. However, plants treated with fertilizer levels of b2 and b4 significantly produced lower protein percentage in grain. This may be due to the low efficiency of nitrogen stabilizer nodes in the late growth period of soybean. Priority of fertilizer level of b4 than b2, was probably because of presence of phosphate solubilizing bacteria (in fertilizer level of b4) that caused the gradual and balanced supply of phosphorus, part of the energy needed for nitrogen fixation (by stabilizer bacteria) provided. Plants treated with fertilizer levels of b1, b4 and b5, significantly produced lower seed protein yield compared with plants treated with fertilizer level of

Zarei et al.

Seed yield (kg ha-1)

2800

3000 b

a b

Variety

2600 Fertilizer

2400 2200 2000 a1

b1 b2 b3 b4 b5 Variety and fertilizer

Biological yield (kg ha-1)

Figure 3. Effect of cultivar and fertilizer level on seed yield. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). a1: Williams cultivar, a2 : line no. 17; b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

8500

a b

8000

7500

Variety Fertilizer

7000 6500 6000 a1

b1 b2 b3 b4 Variety and fertilizer

Figure 4. Effect of cultivar and fertilizer level on biological yield. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). a1: Williams cultivar, a2: line no. 17; b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

Table 6. Effect of cultivar on harvest index.

Treatment Harvest index (%)

Cultivar Williams 32.35b

Means with one common letter have no significant difference (P â&#x2030;¤ 0.05).

Line no. 17 36.89a

7035

Afr. J. Biotechnol.

40 35 30 25 20 15 10 5 0

a b

1200 Protein yield (kg ha-1)

Seed protein (%)

7036

1000 c

800 600 400

b3 b4 Fertilizer

Figure 5. Effect of different levels of fertilizer on protein percentage. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

b3 (Figure 6). Considering that seed protein yield, by multiplying the seed yield and protein percentage can be derived, hence the plants treated with fertilizer level of b3, due to having higher yield and protein percentage produced higher protein yield. On the other hand, plants treated with fertilizer level of b2, compared with other treatments, produced lower seed yield and protein percentage, therefore their protein yield was lowest. Stephen et al. (2010) stated that soybean inoculated with Bacillus pumilus had higher seed protein content. Rahmani et al. (2008) reported that nitrogen is the most important element in protein synthesis and its increase in optimum conditions increases the amount of protein. In addition, Shehata and Khawas (2003) showed that application of biological fertilizer on sunflower increased seed protein. Conclusion So far, the application of phosphate-solubilizing bacteria in most examined traits was better than chemical fertilizer. Moreover, the inoculation with B. japonicum in most examined traits did not have significant difference with chemical fertilizer. So the impact of phosphatesolubilizing on examined traits was more than inoculation with B. japonicum. Overall, the results obtained in this experiment showed that Line No. 17 had a more quantitative and qualitative performance than cultivar of Williams. Between examined fertilizer levels, treatment of b4, including B. japonicum, phosphate-solubilizing and 50% super phosphate triple, provided the best conditions

b3 Fertilizer

Figure 6. Effect of different levels of fertilizer on protein yield. Means with one common letter have no significant difference (P â&#x2030;¤ 0.05). b1: N + P; b2: Bradyrhizobium japonicum + P; b3: N + Bacillus + Pseudomonas + 50% P; b4: B. japonicum + Bacillus + Pseudomonas + 50% P; b5: B. japonicum + 50% N + Bacillus + Pseudomonas + 50% P.

for achieving maximum grain yield and oil yield in soybean. ACKNOWLEDGEMENTS We thank the employees of the Agricultural Research Center, Kermanshah, and also Mr. Yousef dezfuli and Mr. Ali Coraei for their assistance in this study. REFERENCES Asadi Rahmani H, Saleh Rastin N, Sajadi A (2000). Investigate the possibility of predicting the need of inoculation of soybeen, based on the determine number of Bradyrhizobium japonicum bacteria and index of availability of soil nitrogen. Soil Water J. 12(7): 21-32. Assiouty FM, Abo-Sedera SA (2005). Effect of bio and chemical fertilizers on seed production and quality of spinach (Spinacia oleracea L.). Int. J. Agric. Biol. 6: 947-952. Ayoola OT (2010). Yield performance of crops and soil chemical chsnges under fertilizer treatments in a mixed cropping system. Afr. J. Biotechnol. 9(26): 4018-4021. Bashan Y, Alcaraz L, Toledo G (1992). Responses of soybean and cowpea root membranes to inoculation with Azospirillum brasilense. Symbiosis, 13: 217-228. Chen J (2006). The combined use of chemical and organic fertilizer and/ or biofertilizer for crop growth and soil fertility. Taipei Food Fertilizer Technol. Bull. 17: 1-9. Darzi MT, Ghalavand A, Rejali F, Sefydkan F (2006). Study of application of biological fertilizers on the yield and yield components of fennel herbs. J. Med. Arom. Plants Res. 22(4): 276-292. Dileep Kumar SB, Berggren I, Martensson AM (2001). Potential for improving pea production by co- inoculation with fluorescent Pseudomonas and Rhizobium. Plant Soil, 229(1): 25-34. Ekin Z, Oguz F, Erman M, Ogun E (2009). The effect of Bacillus sp.

Zarei et al.

OSU-142 inoculation at various levels of nitrogen fertilization on growth, tuber distribution and yield of potato (Solanum tuberosum L.). Afr. J. Biotechnol. 8(18): 4418-4424. Gan Y, Peoples MB (1997). The effect of N fertilizer strategy on N2 fixation, growth and yield of vegetable soybean. Field Crops Res. 51: 221-229. Gharib FA, Moussa LA, Massoud ON (2008). Effect of compost and Bio-fertilizers on growth, yield and essential oil of sweet marjoram (Majorana hortensis) plant. Int. J. Agric. Biol. 10: 381-387. Gizawy NKB, Mehasen SAS (2009). Response of Faba bean to bio, mineral phosphorus fertilizers and foliar application with zinc. World Appl. Sci. J. 6(10): 1359-1365. Hernandez AN, Hernandez A, Heydrich M (1995). Selection of rhizobacteria for use in maize cultivation. Cultivos Tropicales, 6: 5- 8. Howieson JG, Yates RJ, Foster K, Real D, Besier RB (2008). Prospects for the future use of legumes. In: Dilworth, MJ, James EK, Sprent JI, Newton WE. (Eds.). Nitrogen-Fixing Leguminous Symbioses. Springer, Dordrecht, The Netherlands, pp. 363-387. Jat RS, Ahlawat IPS (2006). Direct and residual effect of vermicompost, biofertilizers and phosphorus on soil nutrient dynamics and productivity of chickpea-fodder maize sequence. J Sustain Agr. 28(1): 41-54. Kandil A, Badawi MA, El-Mursy SA, Abdou UMA (2004). Effect of planting dates, nitrogen levels and biofertilization treatments on growth attributes of suger beet (Beta vulgaris L.). Scientific Journal of King Faisal University (Basic Appl. Sci.), 5(2): 227-236. Kazemi Kazemi S, Ghaleshi S, Ghanbari A, Kianoush GE (2005). Effects of planting date and seed inoculation by the bacteria on the yield and yield components of two soybean varieties. Agri. Sci. Nat. Resour. 12(4): 20-26. Kuntal D, Dang R, Shivananda TN, Sekeroglu N (2007). Comparative efficiency of bio and chemical fertilizers on nutrient contents and biomass yield in medicinal plant Stevia rebaudiana Bert. J. Med. Plants Res. 1: 35-39. Mahfouz SA, Sharaf-Eldin MA (2007). Effect of mineral vs. biofertilizer on growth, yield, and essential oil content of fennel (Foeniculum vulgare Mill.). Int. Agrophys, 21: 361-366. Nabila M, Zaki MS, Karima M, EL-Din G (2007). Growth and yield of some wheat cultivars irrigated with saline water in newly cultivated land as affected by biofertilization. J. Appl. Sci. Res. 3:1121-1126. Narne C, Aher RP, Dahat DV, Aher AR (2002). Selection of protein rich genotypes in soybean. Crop Res. His. 24(1): 106-112. Olivera M, Iribarne C, Lluch C (2002). Effect of phosphorus on nodulation and N fixation by bean (Phaseolus vulgaris). Proceedings of the 15th International Meeting on Microbial Phosphate Solubilization. Salamanca University, 16-19 July, Salamanca, Spain. Peach K, Tracey MV (1956). Modern methods of plant analysis. Vol 1, Peach K, Tracey MV (ed), Springer-Verlag, Berlin, pp. 468-502. Raeipour L, Aliasgharzadeh N (2004). Interaction of phosphate solubilizing bacteria and Bradyrhizobium japonicum on yield and absorption of some nutrients in soybean, J. Agric. Know. 4(15): 141156. Raei E, Sedghi M, SayedSharifi R (2008). Effect of Bradyrhizobium inoculation, application of nitrogen and weeding on growth and seed filling rate in soybean. J. Agric. Tech. 12(43): 81-91. Rahmani N, Valadbighi SA, Daneshian J, Bidgholi VM (2008). Effect of different levels of drought stress and nitrogen on oil yield in evergreen herb (Calendula officinalis L.). J. Res. Arom. Plant Iran. 24(1): 101-108. Rosas S, Rovera M, Andres J, Correa N (2002). Effect of phosphorous solubilizing bacteria on the rhizobia- legume symbiosis. Proceedings of the 15th International Meeting on Microbial phosphate Solubilization. Salamanca University, 16-19 July, Salamanca, Spain. Saleh Rastin N (2005). Sustainable management from the perspective of soil biology. Proceedings of the necessity of manufacturing biofertilizers in the country, pp. 261-276.

7037

Shaharoona B, Jamro GM, Zahir ZA, Arshad M, Memon KS (2007). Effectiveness of various Pseudomonas Sp and Burkholderia improving growth and yield of wheat (Triticum aestivam L.). J. Microbiol. Biotechnol. 17(8): 1300-1307. Shehata MM, EL-Khawas SA (2003). Effect of two biofertilizers on growth parameters, yield characters, nitrogenous components, nucleic acids content, minerals, oil content, protein profiles and DNA banding pattern of sunflower yield. Pak. J. Biol. Sci. 6: 1257-1268. Shirastava MK, Shukla RS, Jain PK (2001). Path coefficient analysis in diverse genotype of soybean (Glycine max L.). Adv. Plant Sci. 4: 4751. Singh HP (1994). Response to inoculation with Bradyrhizobium, vesicular-arbuscular mycorrhiza and phosphate solubilizing microbes on soybean in a mollisol. Indian J. Microbiol. 34: 27-31. Stefan M, Dunca S, Olteanu Z, Oprica L, Ungureanu E, Hritcu L, Mihasan M, Cojocaru D (2010). Soybean (Glycine max L.) inoculation with Bacillus pumilus RS3 promotes plant growth and increases seed protein yield: Relevance for environmentally-friendly agricultural applications. Carpath J. Earth Environ. 5(1): 131-138. Sundara B, Natarajan V, Hari K (2002). Influence of phosphorus solubilizing bacteria on the changes in soil available phosphorus and sugar cane and sugar yields. Field Crop Res. 77: 43-49. Yadeghari M, Akbari GE, Daneshyan JF (2003). Effects of inoculation of four strains of bacteria (Bradyrhizobium japonicum) on yield and yield components of soybean in Karaj climate. Iran J. Field Crop. Res. 1(1): 93-107. Zhang H, Charles TC, Driscoll B, Prithiviraj T, Smith DL (2002). Low temperature-tolerant Bradyrhizobium Japonicum strains allowing improved soybean yield in short-season. Agron. J. 94: 870-875.

Full Length Research Paper

Antioxidant activity of longan (Dimocarpus longan) barks and leaves Yuge Liu*, Liqin Liu, Yiwei Mo, Changbin Wei, Lingling Lv and Ping Luo* South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, People’s Republic of China. Accepted 27 January, 2012

In this paper, the barks and leaves of longan (Dimocarpus longan Lour.) were extracted with 80% methanol. The antioxidant activity and the contents of ellagic acid (EA) in the extracts were investigated. For the evaluation of antioxidant activities, the extracts possess almost the same 2,2diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and reducing power. Besides, the antioxidant activity was concomitant with the development of the reducing power with high correlation coefficients. The contents of EA in the extracts were 0.91 and 3.723 mg/g dry samples, respectively. After hydrolysis, the EA contents increased almost three and four times. Therefore, the ellagic acid in longan barks and leaves exist mostly in the form of ellagitannins. The research showed that longan barks and leaves not only were excellent sources of free-radical inhibitors, but also had potential use in the production of ellagic acid. Key words: Antioxidant activity, ellagic acid, longan, barks, leaves. INTRODUCTION Antioxidants are the compounds that can increase the shelf-life of lipids and lipid-containing foods when added, by retarding the process of lipid peroxidation, which is one of the major reasons for the deterioration of food products during processing and storage and in the pomological features, nutritional quality, polyphenol content analysis and antioxidant properties of domesticated and three wild ecotype forms of raspberries (Rubus idaeus L.) (Gülçin et al., 2011; Koksal1 et al., 2011). In the past decades, commercial available antioxidants were most synthetic antioxidants, such as 23-tert-butyl-4-methoxyphenol (BHA), 2,6-di-ter-butyl-4methylphenol (BHT) and so on. However, those compounds had been suspected of possessing certain toxicity and may be responsible for the damage of human organs (Pan et al., 2004, 2007). Therefore, the research of isolation of natural antioxidants from natural plant,

*Corresponding author. E-mail: liuyugehb@126.com. Tel/Fax: +86 759 2859155. Abbreviations: DPPH, 2 ,2 - Diphenyl -1- picrylhydrazyl; EA, ellagic acid.

which have no such side effects, has been the focus of researchers in recent years. Polyphenols are of great importance because of their effects on sensory properties, including astringency and colour, and possible health benefits. The use of plants as spices and herbs indicates that the antioxidative and antimicrobial constituents are present in all parts of the plants, including tree barks, stalks, leaves, fruits, roots and so on (Gülçin, 2011; Gülçin et al., 2010). Since all the phenolic classes have the structural requirements of free radical scavengers and have potential as food antioxidants (Bandoniene and Murkovic, 2002), phenolic compounds have been recognized as natural antioxidants that possess beneficial effects against free radicals in biological systems (Prasad et al., 2005) and considerable interest have been focused on the field of vegetables and fruits in recent years (Hollman and Katan, 1999; Li and Jiang, 2007). Ellagic acid (EA) is one of the important polyphenols, which mainly exists in nuts and berries, such as strawberry, raspberry and blackberry (Amakura et al., 2000; Vekiari et al., 2008). This compound can exist as free form, glycoside or linked as ellagitannins esterified with glucose ( Bate-Smith, 1972 ; Haddock et al., 1982;

Liu et al.

Maas and Galletta, 1991). In the1960s, EA was mainly studied for its effects on blood clotting, whitening of the skin and its hemostatic activity. Meanwhile, there has been increasing interest in its antioxidant, antimutagenic, anti-inflammatory and cardioprotective activity and possible antimutagenic, antiviral and anticarcinogenic effects during the past few years. Most of these works have been proved in laboratory animals, while a few works are even reported in humans (Akagi et al., 1995; Hakkinen et al., 2000; Sigman et al., 1984; Priyadarsini et al., 2002). The hepatoprotective property of ellagic acid has been reported both in vitro and in vivo (Singh et al., 1999). Besides, there is a profusion of pomegranate nutraceutical products called ‘‘standardized to 40% ellagic acid” in the market (Lansky, 2006). Ellagitannins are the primary source of ellagic acid, and some of them have also been shown to possess anti-tumor-promoting activity, antibacterial and antiviral properties, as well as host-mediated antitumor effects (Okuda, 2005). Longan (Dimocarpus longan Lour.) is a member of the Sapindaceae family. It is a highly attractive fruit extensively distributed in China and South East Asia including Thailand, Vietnam and the Philippines. For the past decade, the antioxidant activity and content of EA in longan mostly concentrated on its fruits, fruit pericarp and seeds (Hsieh et al., 2008; Prasad et al., 2009, 2010; Nuchanart et al., 2007; Richard and Jutamaad, 2005). However, there have been few reports on the extracts of longan barks and leave. Agricultural by-products are quite potential and attractive sources of antioxidant components (Moure et al., 2001). The primary waste fractions, which are peels, barks, leaves and seed residues, contain high amounts of bioactive components that can be potentially exploited as antioxidant agents and nutraceutical. In this paper, the antioxidant activity and content of ellagic acid in the methanol extracts of longan barks and leaves were investigated. The results show that these wastes not only were excellent sources of free-radical inhibitors, but also had potential use in the production of ellagic acid. This investigation provides a new way for the reuse of agricultural by-products. MATERIALS AND METHODS The materials used in this paper were collected just from the longan trees planted in the institute. Mature leaves and barks were first cleared and dried at 60°C, and then were ground using a stainlesssteel grinder. They were stored in vacuum-packaged polyethylene pouches at -20°C until required for analysis.

Chemicals High performance liquid chromatography (HPLC) grade methanol was from Thermo Fisher Co. Ellagic acid (EA), Folin–Ciocalteu’s (FC) phenol reagent and gallic acid (GA) were purchased from Fluka. The 2,2’-diphenyl-2-picrylhydrazyl (DPPH) radical was received from Sigma. All the other chemicals were of analytical

7039

grade and used without further purification. Ultra-pure water was used for the preparation of solutions.

Sample preparation Approximately 200 mg of dried longan barks and leaves were separately weighed and refluxed with 30 ml of 80% methanol at 70°C for 3 h under magnetic stirring, respectively. The above extracts were passed through Whatman filter paper (no. 4) and subsequently used for various assays. Hydrolysis An amount of 8.74 ml of the extracts received above were accurately taken and 1.26 ml concentrated hydrochloric acid (HCl) was added by careful mixing (the final HCl concentration was 1.5 M). The solutions were stirred using a magnetic stirrer and refluxed at 85°C for 2 h by the method similar to that previously reported by Hertog et al., 1992). The final solutions were evaporated to dryness under vacuum below 40°C. The residue was dissolved in 5 ml of HPLC grade methanol and filtered through a 0.22 µM filter prior to injection (10 µL) into the HPLC system. Determination of total phenol content (TPC) TPC was determined using the FC assay described before (Singleton and Rossi, 1965). Typically, samples (0.2 ml) were introduced into test tubes and followed by the addition of 1.0 ml of Folin-Ciocalteu’s reagent (diluted 10 times with water in advance) and 0.8 ml of water. The solutions were allowed to stand 5 min at room temperature before the addition 0.8 ml of sodium carbonate solution (7.5% w/v). After reacting in dark for 30 min, the absorbance of the solutions were measured at 765 nm on a UV–vis spectrophotometer (Shimadzu UV-1700, Japan). The test was run in triplicate, and then a calibration curve was prepared using a standard solution of gallic acid. The results were expressed as mg gallic acid equivalents (GAE)/g dry samples. DPPH free radical-scavenging assay The free radical scavenging activity of the extracts was performed by measuring the decrease in absorbance of DPPH solution at 517 nm in the presence of the extracts by the method proposed by Şerbetçi et al. (2010) with some modification. The solution of 5 mM was prepared by dissolving DPPH in methanol. For the evaluation of free radical scavenging activity, 1 ml of DPPH was added into 1 ml of the extracts with different concentrations. The mixture was then allowed to stand at room temperature for 30 min in dark before the absorbance at 517 nm was read. The control was prepared as above without extract. The antioxidant activity could be expressed as the following equation:

Scavenging activity=

A0 − As ×100% A0

Where A0 and As are the absorbance at 517 nm of the control and sample solution, respectively. The inhibition concentration IC50 was defined as the amount of sample extracted into 1 ml solution necessary to decrease 50% of the initial DPPH concentration. The value of IC50 was derived from the percentage disappearance vs. concentration plot. Here, concentration means mg of samples extracted into 1 ml solution.

7040

Afr. J. Biotechnol.

Ferric reducing power The antioxidant capacity of the extracts was also tested by the ferric reducing power. This assay was performed according to a modified method described by Juntachote and Berghofer (2005). Sample extracts of 1 ml with different concentrations were added into 0.5 ml of 0.2 M phosphate buffer (pH 6.6) and 1.5 ml of potassium ferricyanide (0.3%). The mixtures were incubated at 50°C for 30 min, and then 1 ml of trichloroacetic acid (10%) was added. After centrifuging at 5000 rpm for 10 min, 1 ml of ferric trichloride (0.3%) was added into the mixture. The absorbance of the solution at 700 nm was measured after standing for 30 min. The assay was run in triplicate and the increase in absorbance of the reaction indicated the reducing power of the samples. HPLC analysis HPLC analysis was performed on a Shimadzu HPLC (Model LC20A) equipped with a UV-vis detector (Model SPD-20A). The separation was conducted on a Shim-Pack column (GCP-ODS, 250 × 4.6 mm i.d., GL Sciences Inc., Japan) and the data were collected on a HP personal computer with the software of LC solution. The temperature of the column was 35°C. EA was eluted at a flow rate of 1.0 ml/min, using a mobile phase consisting of 50% methanol and 50% acetic acid solution (1%). The mobile phase was vacuum filtered through a 0.22 µM membrane filter before used. The appearance of EA was tested by comparison of the peak areas obtained at wavelength 254 nm. Construction of reference standards calibration curve The stock solution (400 mg/L) was prepared by dissolving EA in HPLC-grade methanol, and the working curve was prepared by diluting the stock solution with the same solvent.

RESULTS AND DISCUSSION Total phenol content Polyphenolic compounds are quite important constitutes for fruits and their trees. Since polyphenols are sensitive to heat (Soong and Barlow, 2004), the temperature of 60°C was chosen for the treatment of materials in oven. The total phenol content (TPC) expressed as gallic acid equivalents (GAE) achieved by FC method in the leaves and barks were 132.47 and 140 mg/g dry weight, respectively. The results show that the TPC in mature longan barks and leaves were quite high and close. Moreover, it is well known that plant phenolics are highly effective free radical scavengers and antioxidants, and the activity is derived largely from the phenolic and polyphenolic compounds. Therefore, the investigation on the antioxidant activity of longan barks and leaves was of great importance. DPPH assay and reducing power Due to its operating simplicity, DPPH is one of the most popular methods employed for the evaluation of

antioxidant ability. In the radical form, the molecule of DPPH has an absorbance at 517 nm, which will disappear after the acceptance of an electron or hydrogen radical from an antioxidant in the solution to become a stable diamagnetic molecule (Matthäus, 2002). Besides, DPPH has the advantage of being unaffected by certain side reactions of polyphenols, such as metal ion chelation and enzyme inhibition. In this paper, different concentrations of extracts were used. The relationship between the scavenging activity and concentrations are shown in Figure 1. It can be clearly seen that the scavenging activity of longan barks and leaves extracts were concentration-dependent. With the increase of the amount extracted into solution, the scavenging activity of the extracts of both the leaves and the barks increased accordingly. At each concentration, the scavenging activity of the bark extract was almost the same as that of the leaf extract. IC50 was defined as the concentration of the methanol extracts to quench 50% of DPPH in the solution under the chosen experimental conditions. The values of IC50 for barks and leaves of longan extracts derived from the figure of scavenging activity and concentrations were 0.057 and 0.058 mg/ml, respectively. The data obtained here reveal that the methanol extracts are quite good free-radical inhibitors and have potential use in the termination of free radical reactions. Furthermore, since the reducing capacity of compounds may serve as a significant indicator of their potential antioxidant activity, the antioxidant activity of the methanol extracts were also investigated by reducing power. During the reducing power assay, the presence of reductants (antioxidants) in the samples would result in the reduce of Fe3+/ferricyanide complex to the ferrous form (Fe2+), which can be then monitored by measuring the formation of Prussian blue at 700 nm (Chung et al., 2002). Figure 2 shows the reducing power of methanol extracts with different concentrations. Similar to that of the DPPH assay, the reducing power of the longan methanol extracts were also concentration-dependent. At same concentration levels, the extract of longan leaves showed a little higher reducing power than that of the longan barks. It had been reported that the antioxidant activity may be concomitant with the development of the reducing power, and it can be seen from Figures 1 and 2 that both the scavenging activity and the reducing power increased with the increase of extract concentration. The correlation coefficients between antioxidant activity and reducing 2 power for the extracts were quite high (R = 0.987 for longan barks and 0.983 for longan leaves) (Figure 3), indicating that antioxidant properties were concomitant with the development of reducing power. This result is in agreement with that of Juntachote and Berghofer (2005), who reported that the reducing power of Holy basil and Galangal extracts correlated well with the extent of antioxidant activity.

Liu et al.

Figure 1. Scavenging activity of the methanol extracts of (a) longan barks and (b) longan

leaves.

Figure 2. Reducing power of the methanol extracts of (a) longan barks and (b) longan

leaves.

7041

7042

Afr. J. Biotechnol.

Figure 3. Linear correlation between reducing power and the percentage of DPPH radicalscavenging activity of the methanol extracts of (a) longan barks and (b) longan leaves. DPPH, 2,2-Diphenyl-1-picrylhydrazyl.

Figure 4. A typical HPLC chromatogram of ellagic acid. HPLC, High performance liquid chromatography.

Liu et al.

7043

Figure 5. HPLC chromatograms of (a) unhydrolyzed and (b) hydrolyzed barks. HPLC, High performance liquid chromatography.

Identification and quantification of EA by HPLC assay Reverse phase (RP)-HPLC was considered as an effective tool for the determination of ellagic acid in plants. Shown in Figure 4 is the chromatogram of authentic standard of this compound. The retention time of EA was 8.73 min under the chosen conditions. The relative standard deviation (RSD) of reproducibility in the retention time obtained with 10 successive determinations and intra-day (n=3) were 0.1 and 0.2%, respectively. The linear range for the determination of EA was from 0.1 to 200 ppm, with a regression coefficient of 0.9998. All these showed that the method used herein was quite stable and widely applicable. Determination of free EA in the barks and leaves of longan The chromatograms for the methanol extracts of longan barks and leaves were given in Figures 5a and 6a. The chromatograms showed clear peaks with a retention time of 8.76 and 8.77 min, respectively. This indicated the appearance of EA in both barks and leaves of longan trees. Furthermore, the content of free EA in the two parts of longan tree was determined by HPLC. The results

were 0.091 and 3.723 mg/g dry samples for the barks and leaves, respectively. Apparently, the contents of free EA in the barks and leaves of longan were quite high and so such waste of longan had potential use in the production of ellagic acid.

Hydrolysis of the extracts Ellagitannins are known as the primary source of ellagic acid. These precursor molecules yield ellagic acid when undergoing hydrolysis with acid or base. In the past decade, an acid solution was mostly employed for the hydrolysis of ellagitannins (Rommel and Wrolstad, 1993; Michael and Augustin, 2000). Here in this paper, an acid solution of 1.5 M HCl was used for the hydrolysis of the methanol extracts. It can be clearly seen that the hydrolyzed samples had a quite larger area as compared with those unhydrolyzed (Figures 5b and 6b). The contents of EA in longan barks and leaves after hydrolysis were 3.6 and 18.196 mg/g dry samples, respectively. The data show that the content in hydrolyzed barks and leaves were almost three and four times more than that of the unhydrolyzed ones. This indicates that most of EA exists the form of

7044

Afr. J. Biotechnol.

Figure 6. HPLC chromatograms of (a) unhydrolyzed and (b) hydrolyzed leaves. HPLC, High performance liquid chromatography.

ellagitannins in longan barks and leaves and hydrolysis by acid is an effective way of converting ellagitannins into free ellagic acid.

opened a new window for the reuse of agricultural and food by-products. ACKNOWLEDGEMENTS

Conclusion In the present research, the extracts of longan barks and leaves were achieved by refluxing the plant materials in 80% methanol solution. Furthermore, the antioxidant activities and the contents of ellagic acid in the extracts were investigated and results show that the extracts were excellent sources of free-radical inhibitors, and also possessed almost same DPPH radical scavenging activity and reducing power. Besides, the antioxidant activities were concomitant with the development of the reducing power with high correlation coefficients. The antioxidant activities were also dependent on total phenolic content in the solution. For the determination of ellagic acid, the contents in the barks and leaves were quite high. After hydrolysis, the contents were almost four and five times of the unhydrolyzed ones, respectively, which indicates that the ellagic acid in longan barks and leaves exist mostly in the form of ellagitannins. This research therefore demonstrates the potential use of longan barks and leaves not only as antioxidants, but also in the production of ellagic acid. This study has also

The work was supported by the Fund on Basic Scientific Research Project of Nonprofit Central Research Institutions (no. SSCRI200901 and 1251022011009), the National Natural Science Foundation of China (no. 31071353) and the Natural Science Foundation of Hainan province (no. 310099). REFERENCES Akagi K, Hirose M, Hoshiya T, Mizoguchi Y, Ito N, Shirai T (1995). Modulating effects of ellagic acid, vanillin and quercetin in a rat medium term multi-organ carcinogenesis model. Cancer. lett. 94: 113-121. Amakura Y, Okada M, Tsuji S, Tonogai Y (2000). High performance liquid chromatographic determination with photodiode array detection of ellagic acid in fresh and processed fruits. J. Chrom. A, 896: 87-93. Bandoniene D, Murkovic M (2002). On-line HPLCâ&#x20AC;&#x201C;DPPH screening method for evaluation of radical scavenging phenols extracted from apples (Malus domestica L.). J. Agric. Food Chem. 50: 2482-2487. Bate-Smith E C (1972). Detection and determination of ellagitannins. Phytochemistry, 11: 1153-1156. Chung Y-C, Chang C-T, Chao W-W, Lin C-F, Chou S-T (2002). Antioxidative activity and safety of the 50% ethanolic extract from red bean fermented by Bacillus subtilis IMR-NK1. J. Agric. Food Chem. 50: 2454-2458.

Liu et al.

Gülçin İ, Topal , Çakmakç R, Bilsel M,. Gören A C, Erdogan U (2011). Pomological Features, Nutritional Quality, Polyphenol Content Analysis, and Antioxidant Properties of Domesticated and 3 Wild Ecotype Forms of Raspberries (Rubus idaeus L.). J. Food Sci. 76(4): C585-C593. Gülçin İ (2011). Antioxidant Activity of Eugenol: A Structure–Activity Relationship Study. J. Med. Food. 14(9): 975-985. Gülçin I, Bursal E, Sehitoğlu M H, Bilsel M, Gören A C (2010). Polyphenol contents and antioxidant activity of lyophilized aqueous extract of propolis from Erzurum, Turkey. Food Chem. Toxicol. 48(89): 2227-2238. Haddock E A, Gupta R K, Al-Shafi S M K, Layden K, Haslam E, Magnolato D (1982). The metabolism of gallic acid and hexahydroxydiphenic acid in plants: Biogenetic and molecular taxonomic considerations. Phytochemistry, 21: 1049-1062. Hakkinen S H, Karenlampi S O, Mykkanen H M, Heinonen I M, Torronen A R (2000). Ellagic acid content in berries: Influence of domestic processing and storage. Eur. Food Res. Technol. 212: 75-80. Hertog M G L, Hollman P C H, Venema D P (1992). Optimization of a quantitative HPLC determination of potentially. anticarcinogenic flavonoids in vegetables and fruits. J. Agric. Food Chem. 40: 15911598. Hollman P C H, Katan M B (1999). Dietary flavonoids: Intake, health effects and bioavailability. Food Chem. Toxicol. 37: 937-942. Hsieh M-C, Shen Y-J, Kuo Y-H, Hwang LS (2008). Antioxidative activity and active components of longan (Dimocarpus longan Lour.) flower extracts. J. Agric. Food Chem. 56(16):7010-7016. Juntachote T, Berghofer E (2005). Antioxidative properties and stability of ethanolie extracts of Holybasil and Galangal. Food Chem. 92: 193 - 202. Koksal1 E, Bursal1 E, Dikici E, Tozoglu F, Gülçin İ (2011). Antioxidant Activity of Melissa officinalis leaves. J. Med. Plants Res. 5(2): 217222. Lansky E P (2006). Beware of pomegranates bearing 40% ellagic acid. J. Med. Food. 9:119-122. Li J, Jiang Y (2007). Litchi flavonoids: Isolation, identification and biological activity. Molecules, 12: 745-758. Maas J L, Galletta G J (1991). Ellagic acid, an anticarcinogen in fruits, especially in strawberries: A review. HortScience, 26: 10–14. Matthäus B (2002). Antioxidant activity of extracts obtained from residues of different oilseeds. J. Agric. Food Chem. 50: 3444-3452. Michael N C, Augustin S (2000). Ellagitannins-nature, occurrence and dietary burden. J. Sci. Food Agric. 80: 1118-1125. Moure A, Cruz J M, Franco D, Dominguez J M, Sineiro J, Singleton V L (1965). Natural antioxidants from residual sources. Food Chem, 2001, 72:145–171 Nuchanart R, Luksamee W, Richard N B, Jutamaad S (2005). Identification and Quantification of Polyphenolic Compounds in Longan (Euphoria longana Lam.) Fruit. J. Agric. Food Chem. 53: 1387-1392. Okuda, T. (2005). Systematics and health effects of chemically distinct tannins in medicinal plants. Phytochemistry, 66: 2012-2031. Pan Y.M., Liang, Y, Wang H S, Liang M (2004). Antioxidant activities of several Chinese medicine herbs. Food Chem. 88: 347-350.

7045

Pan Y M, Zhang X P, Wang H S, Liang Y, Zhu J C, Li H Y, Zhang Z, Wu Q (2007). Antioxidant potential of ethanolic extract of Polygonum cuspidatum and application in peanut oil. Food Chem. 105: 15181524. Prasad K N, Divakar S, Shivamurthy G R, Aradhya S M (2005). Isolation of a free radical scavenging antioxidant from water spinach (Ipomoea aquatica Forsk). J. Sci. Food Agric. 85: 1461-1468. Prasad K N, Hao J, Shi J, Liu T, Li J, Wei X, Qiu S, Xue S, Jiang Y (2009). Antioxidant and anticancer activities of high pressure-assisted extract of longan (Dimocarpus longan Lour.) fruit pericarp. Innov. Food Sci. Emerg. Technol. 10: 413-419. Prasad K N, Yang B, Shi J, Yu C, Zhao M, Xue S, Jiang Y (2010) Enhanced antioxidant and antityrosinase activities of longan fruit pericarp by ultra-high-pressure-assisted extraction. J. Pharm. Biomed. Anal. 51: 471-477. Priyadarsini I K, Khopde S M, Kumar S S, Mohan H J (2002). Free radical studies of ellagic acid, a natural phenolic antioxidant. J. Agric. Food Chem. 50: 2200-2206. Rommel A, Wrolstad R E (1993). Influence of Acid and Base Hydrolysis on the Phenolic Composition of Red Raspberry Juice. J. Agric. Food Chem. 41: 1237-1241. Şerbetçi Tohma H, Gülçin İ (2010). Antioxidant and radical scavenging activity of aerial parts and roots of Turkish liquorice (Glycyrrhiza glabra L.). Inter. J. Food Prop. 13(4): 657-671. Sigman C C, Helmes C T, Fay J R, Lundquist P L, Perry L R (1984). A study of chemicals in the wood and associated industries for the selection of candidates for carcinogen bioassay, 1. Naturally-occuring wood chemicals. J. Environ. Sci. Health Part A, 19: 533-577. Singh K, Khanna A K, Chander R (1999). Hepatoprotective effect of ellagic acid against carbon tetrachloride induced hepatotoxicity in rats. Indian J. Exp. Biology, 37: 1025-1026. Singh K, Khanna A K, Visen P K, Chander R (1999). Protective effect of ellagic acid on tert-butyl-hydropeoxide induced lipid peroxidation in isolated rat hepatocytes. Indian J. Exp. Biology, 37: 939-940. Soong Y, Barlow P J (2004). Antioxidant activity and phenolic content of selected fruit seeds. Food Chem. 88: 411-417.

Full Length Research Paper

Studies on antioxidant capacity of anthocyanin extract from purple sweet potato (Ipomoea batatas L.) Yuzhi Jiao1, Yanjie Jiang2, Weiwei Zhai1 and Zhendong Yang1* 1

Food engineering department of Jiangsu food science college, Huaian, Jiangsu 223003, China. Institute of Food Crops, Jiangsu Academy of Agricultural Sciences，Nanjing，Jiangsu 210014, China.

Accepted 27 January, 2012

The radical scavenging effects by α,α-diphenyl-β-picrylhydrazyl (DPPH) and superoxide anions of anthocyanin extract from purple sweet potato were investigated. The antioxidation experiments showed that the reducing power of the anthocyanin extract reduced 0.572 at 0.5 mg/ml, while those of Lascorbic acid (L-AA) and butylated hydroxytoluene (BHT) reduced 0.460 and 0.121, respectively. They also displayed potent antioxidant effects against the DPPH radical and superoxide anions radical, showing the IC50 values of 6.94 and 3.68 µg/ml, respectively. Moreover, this anthocyanin extract also could significantly inhibit the formation of lipid peroxidation compound. Sixteen kinds of anthocyanins in purple sweet potato were detected by high-performance liquid chromatography with diode-array detection (HPLC-DAD), and most of the anthocyanins were acylated. Key words: Antioxidant activity, anthocyanins, purple sweet potato. INTRODUCTION Reactive oxygen species (ROS), including super oxide anion (O2-), hydroxyl radical (OH) and hydrogen peroxide (H2O2), exist in living organisms (Riley, 1994). ROS formed during normal metabolism naturally can damage biological structures such as proteins, lipids and DNA and induce a variety of human diseases (Elahi and Matata, 2006; Thrasivoulou et al., 2006). Accumulation of ROS in organisms is considered to be as a reason of food deterioration through inducing lipid peroxidation (Kinsella et al., 1993). Many synthesis antioxidants have been used to retard lipid peroxidation in foods and defend the human body against diseases, but have shown toxic and /or mutagenic effects (Mizutani et al., 1987). Therefore, the natural antioxidants from foods have attracted much attention and great effort has been made to search for safe and effective therapeutic agents for oxidative stressrelated diseases. Several fruits and vegetables have

*Corresponding author: E-mail: yzdjyj@gmail.com. Tel (Fax): +86 0517 87088039. Abbreviations: DPPH, α,α-Diphenyl-β-picrylhydrazyl; L-AA, Lascorbic acid; BHT, butylated hydroxytoluene.

been demonstrated to contain antioxidants and colorants to prevent lipid peroxidation in food and help the human body to reduce oxidative damages (Prior, 2003; Wang and Lin, 2000). Purple sweet potato (Ipomoea batatas L.) contains high content of anthocyanin in the storage root, of which cyanidin and peonidin were major anthocyanidins (Goda et al., 1997; Odake et al., 1992; Teranara et al., 1999; Terahara and Konczak, 2004). Different purple sweet potato cultivars contain different anthocyanin compositions which possess many healthy benefits including antioxidative properties, antineoplastic properties, as well as anticancer properties. The anthocyanin-health properties are due to electron deficiency chemical structure, of which the peculiar chemical structure leads to the reactive nature towards with ROS (Galvano et al., 2004). Therefore, anthocyanins are utilized as high quality natural food antioxidant with potentially preventive function against life-style-related disease like antimutagnicity, anticarciongenic activity and antidiabetic action. Anthocyanins in fruits and vegetables have been extensively studied (Bao et al., 2005; Gulcin et al., 2005). Though only few studies have focused on in vitro antioxidant activity of anthocyanins in purple sweet

Jiao et al.

potato from China. The object of this paper was to study the antioxidant activity of anthocyanins from Chinese purple sweet potato, which have been determined by the four methods under study.

7047

ml) was added to the mixture to stop the reaction. The mixture was centrifuged at 2790 g for 10 min and the supernatant was mixed with distilled water and 0.1% FeCl3 at a ratio of 5:5:1 (v/v/v). After the mixture reacting for 10 min, absorbance was measured at 700 nm. The reducing powers of the tested samples increased with the increasing absorbance values.

MATERIALS AND METHODS Materials and chemicals

Measurement of antioxidant peroxidation of linoleic acid

Purple sweet potato kindly supplied by National Sweet Potato Research Institute, in Xuzhou (Xuzhou City, Jiangsu Province, China) was washed in running tap water, cut into pieces of approximately 0.5 cm, dried in a heated air drier (50°C) (ZT-3, Jiangdu City, Jiangsu Province, China), and then pulverized by the disintegrator (FSD-100A, Taizhou city, Zhejiang Province, China) and sifted through a 100 mesh sieve. Samples were kept at 4°C. α-Diphenyl-β-picrylhydrazyl (DPPH), L-ascorbic acid (L-AA), linoleic acid, butylated hydroxytoluene (BHT), standards of cyanidin and peonidin were purchased from Sigma Chemicals Co. AB-8 resin was obtained from Nankai University Chemicals Co. Ammonium thiocyanate and other reagents were of analytical grade.

The antioxidant activity of the anthocyanins from purple sweet potato on liposome acid were determined according to the ferric thiocyanate (FTC) method, as described in detail by Xu et al. (2005). Two microliters of anthocyanins, L-AA or BHT were added to 2 ml of 1.0% (w/v) linoleic acid in ethanol and then 4 ml of 0.05 M phosphate buffer (pH 7.0) and 2 ml of distilled water were mixed in a 10 ml vial with a screw cap and then incubated in a 40°C water bath in the dark. The above mixture (0.1 ml) was added to 9.7 ml of 75% (v/v) ethanol and 0.1 ml of 30% (w/v) ammonium thiocyanate. After precisely reacting for 5 min, 0.1 ml of 0.02 M ferrous chloride in 3.5% (v/v) hydrochloric acid were added to the above mixture, the absorbance of mixture was measured at 500 nm every 24 h for one week.

Preparation of anthocyanins extracts

Measurement scavenging

About 200 g (powder of purple sweet potato) were macerated with 800 ml ethanol for 24 h in the dark at 4°C. The crude extract obtained was filtered through filter paper and the remaining residues were washed with 400 ml of ethanol, and then collected the crude extract filtrate. The ethanol in the crude extract was evaporated by the rotary evaporator (0.1 MPa, 40°C). The extract solution was loaded on AB-8 resin columns (20 × 400 mm) (Lanxiao Company, China) and washed with nanopure water and eluted with 100% ethanol. The eluate was concentrated and evaporated, and then the solution was freeze-dried to obtain red powder. The red powder was dissolved with 250 ml nanopure water, which was done as the stock solution of anthocyanins. The stock solution was kept in 4°C for further analysis. Determination of total anthocyanin content of purple sweet potato extract The anthocyanins were quantified following the spectrophotometric method proposed by Francis (1989). The concentration of anthocyanin was determined using the Lambert – Beer law. The factor 98.2 is the molar absorption value for the acid-ethanol solvent and it refers to the absorption of a mixture of cranberry anthocyanin in acid-ethanol, measured in a 1 cm cell at 535 nm, at a concentration of 1% (w/v). The spectra recorded in a UV-2802 diode array spectrophotometer (UNIC, USA) were measured at 25°C and 530 nm, against the solvent. For that purpose 1 cm quartz cells were used. The anthocyanin content (mg/g) was calculated using the following equation: Total anthocyanin (TA) = A530 × dilution factor/98.2. Measurement of reducing power The reducing powers of anthocyanins from purple sweet potato, LAA and BHT were determined according to the method of Iqbal et al. (2006) with some modifications. Samples were mixed with 3.0 ml of 0.5 M phosphate buffer (pH 6.6) and 2.5 ml of 1% potassium ferricyanide amd incubated at 50°C for 20 min. 10% acetic acid (2.5

antioxidant

activity

inhibition

DPPH

radical-

DPPH radical-scavenging activity of anthocyanins, L-AA or BHT was determined using methods described by Chung et al. (2005) with some modifications. Two microliters of the anthocyanins, L-AA or BHT were mixed with 2.0 ml of 2×10-4 M DPPH in ethanol. The mixture was shaken vigorously and left in the dark at room temperature for 30 min. The absorbance of mixture was determined immediately at 517 nm. Initial and blank were measured without substrate and DPPH respectively. The ability to scavenge DPPH radical was calculated by the following equation: scavenging rate (%) = 100 (Ai-As+Ab) /Ai, in which Ai, As, and Ab were the absorbance of initial, sample and blank solutions, respectively.

Measurement of antioxidant activity by superoxide radicalscavenging Superoxide radical-scavenging rate was measured according to the method described by Giannopolites and Ries (1977), with some modifications. 195 mM methionine (0.2 ml), 0.1 ml 3 mM ethylenediaminetetraacetic acid (EDTA), the anthocyanins, L-AA or BHT, 0.2 ml 1.125 mM nitro blue tetrazolium, and 0.1 ml 60 µM riboflavin were sequentially added to 2.4 ml 0.05 M phosphate buffer (pH 7.8) in order. All solutions were prepared in 0.05 M phosphate buffer (pH 7.8). The mixtures were performed under 4000 lux fluorescent lamp for 10 min at 25°C. The mixture without sample was used as a control. The scavenging activity was calculated as follows: scavenging rate (%) ＝100 (Ac－As) /Ac, in which Ac and As were the absorbance of control and sample solutions, respectively. Acid hydrolysis of purple sweet potato anthocyanins One millilitre of concentrated purple sweet potato anthocyanins (PSPAs) solution was dissolved in 10 mL of hydrochloric acid (1.0 mol/L) in a screw-cap test tube. The solution was hydrolyzed at 98°C for 1 h, cooled in an ice bath (Luigia and Giuseppe, 2006). Samples were stored at 4°C.

7048

Afr. J. Biotechnol.

0.7

Absorbance

0.6 0.5

L-AA

0.4

Anthocyanins

0.3

BHT

0.2 0.1 0 0

0.1

0.2

0.3

0.4

0.5

Concentration(mg/ml) Figure 1. Reducing power of anthocyanins from purple sweet potato compared to BHT and L-AA. Each value represents means ± SD (n=6). L-AA, L-Ascorbic acid; BHT, butylated hydroxytoluene.

HPLC analysis of purple sweet potato anthocyanins Purple sweet potato anthocyanins were separated by reversephase high performance liquid chromatography (HPLC) using Agilent 1100 (Palo Alto, USA) with a Prodigy C18 reversed-phase column (5 mm), 4.6 × 250mm i.d. (Agilent, USA), and were detected at 520 nm using diode-array absorbance detection (DAD). The text temperature was at 30°C, the flow rate was 1 mL/min, and the injection volume was 20 µl. The mobile phase A consisted of HPLC-grade acetonitrile, whereas mobile phase B was a mixture of 10% (v/v) acetic acid in distilled water. Separation of anthocyanins was carried out for 25 min. The elution profile was a linear gradient elution with 10 to 25% solvent A from 0 to 10 min, 25 to 30% from 15 to 20 min. Separation of anthocyanidins was carried out for 25 min. The elution profile was a linear gradient elution with 10 to 40% solvent A from 0 to 25 min. Statistical analysis All data were expressed as means ± standard deviation (SD). Analysis of variance was performed by ANOVA procedures. Multiple comparisons of means were done by least significant difference (LSD) test. And P < 0.05 was considered significant. All computations were made by employing the statistical software (SPSS, version 11.0).

RESULTS AND DISCUSSION The content of anthocyanins in purple sweet potato The content of anthocyanins from purple sweet potato was calculated to be 132 mg/100g (dry weight). Fan et al. (2008) reported that the highest anthocyanin content was 158 mg/100g (dry weight) of purple sweet potato which was reached at the best extraction conditions. Compared with other fruits, such as grape (25 to 260 mg/100g, fresh

weight) (Arozarean et al., 2002), blackberry (67 to 230 mg/100g, fresh weight) (Wang and Xu, 2007) and Jaboticaba (4.4 to 16.3 mg/100g, fresh weight) (Montes et al, 2005), the content of anthocyanins was relatively high in purple sweet potato, which made this material a good source for anthocyanins. Reducing power Reducing power was measured using the potassium ferricyanide reduction method. In this assay, an antixidant donates electron to reduce the Fe3+ ferricyanide complex into its Fe2+ ferrous form (Hinneburg et al., 2006). Amount of Fe2+ compound can be monitored by detecting the absorbance of mixture at 700 nm. Therefore, the reducing power is believed to be strongly correlated with antioxidant activity, for it suggests the electron-donating capacity. As shown in Figure 1, purple sweet potato anthocyanin, BHT and L-AA showed the reducing power as dosedependent manner. In particular, anthocyanins exerted the strongest reducing power, indicating that anthocyanins had high electron-donating capacity. At a concentration of 0.5 mg/ml, the reducing power of anthocyanins, L-AA and BHT reached 0.572, 0.460 and 0.121, respectively. These results reveal that anthocyanins could donate electron easier and also had higher reducing power than BHT and L-AA at the same dosage. These results are in agreement with those reported by Duan et al. (2007) who found that the anthocyanins from litchi pericarp exhibited a higher reducing power than BHT and ascorbic acid, suggesting that the anthocyanins had strong electron-donating capacity.

Jiao et al.

7049

0.8 Control

0.7

BHT

Anthocyanins

L-AA

Absorbance at 500 nm

0.6 0.5 0.4 0.3 0.2 0.1 0 0

3 4 Time (day)

Figure 2. Antioxidant activities of anthocyanins from purple sweet potato compared to BHT and L-AA. Each value represents means ± SD (n=6). L-AA, L-Ascorbic acid; BHT, butylated hydroxytoluene.

Antioxidant activity in linoleic acid system In present study, ferric thiocyanate method in linoleic acid emulsion was used to evaluate antioxidant activity of anthocyanins. The principle of FTC is that the Fe2+ ion was oxidized to Fe3+ ion by hydroperoxide, of which the red colour of ferric thiocyanate was produced by the direct addition of a ferric salt and Fe3+ ion. The content of hydroperoxide would be measured through colorimetry. The Fe3+ ion interacted with SCN– and formed a resultant, which had a maximum absorbance at 500 nm. Thus, a high absorbance value suggests high peroxide formation during the emulsion incubation (Duan et al., 2007). Figure 2 shows that the antioxidant activity of anthocyanins from purple sweet potato, BHT and L-AA exhibited peroxidation inhibition effect as a dosedependent manner. In particular, the anthocyanins and BHT significantly retard peroxidation of linoleic acid and reduce formation of peroxide compounds. Although the absorbances of anthocyanins were slightly higher than those of BHT, a widely synthesized antioxidant, it still indicates that anthocyanins are natural antioxidants. Some authors (2007) reported that anthocyanis can significantly inhibit peroxidation of linoleic acid and reduce formation of hydroperoxide, thus implying that the anthocyains are powerful natural antioxidants.

method is based on the reaction that hydrogen-donating antioxidants reduce violet DPPH free radical to yellow DPHH-H, a non-radical form (Kumaran and karunakaran, 2005). The reduced amount of DPPH absorption at 517 nm indicated the radical-scavenging ability of antioxidants. Figure 3 displays DPPH radical-scavenging activity of the anthocyanins from purple sweet potato. The results show that the radical-scavenging activities of antioxidants increased with the increment of concentrations. Terahara et al. (2004) investigated that the purple sweet potato anthocyanins were examined with respect to radical scavenging activity against the DPPH radical. Lachman et al. (2008) reported that the purple-fleshed potatoes have significantly higher antioxidant activity than yellowfleshed cultivars. L-AA had the highest scavenging radical activity, followed by anthocyanins from purple sweet potato. Among them, the anthcyanins from purple sweet potato and L-AA exerted strong activities, showing 94.1 and 95.8% of DPPH radical scavenging activities at concentration of 50 µg/ml, respectively. On the hand, BHT showed relatively low DPPH radical scavenging activity (37.6%). The DPPH radical-scavenging effects of the anthocyanins, BHT and L-AA are shown in Table 1. The IC50 values of anthocyanins and L-AA were low, while BHT was higher.

DPPH radical-scavenging activity

Superoxide anion-scavenging activity

The DPPH radical model has been widely used to valuate the antioxidant activity of fruit and vegetable extract. The

Superoxide anion, which is a reductive form of molecular oxygen, is produced by a number of cellular reactions,

7050

Afr. J. Biotechnol.

120

Scavenging rate on DPPH (%)

100 80 BHT

Athocyanins 40

L-AA

20 0 0

0.1

0.2 Concentration (mg/ml)

0.3

0.4

Figure 3. DPPH radical-scavenging activity of anthocyanins from purple sweet potato compared to BHT and L-AA. Each value represents means ± SD (n=6). DPPH, α,α-Diphenyl-β-picrylhydrazyl; L-AA, Lascorbic acid; BHT, butylated hydroxytoluene.

Table 1. Half inhibition concentration (IC50) of anthocyanins from purple sweet potato, BHT and L-AA scavenging DPPH, superoxide radical.

Antioxidant BHT L-AA Anthocyanins

DPPH radical-scavenging activity IC50 (µg/ml ) 123.46 ± 0.14a 6.10 ± 0.05c 6.94 ± 0.02b

Superoxide onion radical-scavenging activity IC50 (µg/ml ) 50.00 ± 0.14a 10.01 ± 0.24b 3.68 ± 0.01c

Means in the same column followed by different letters are significantly different at P <0.05. HPLC characterization of purple sweet potato anthocyanins. L-AA, L-Ascorbic acid; BHT, butylated hydroxytoluene.

including a range of enzyme systems in autooxidation reaction and non-enzymatic electron transfers that reduce molecular oxygen (Gulcin et al., 2005). It was known that superoxide anion is very harmful because it could transform into more reactive oxygen species such as hydroxyl radical, which contributes to tissue damage and various diseases. In this paper, illuminating a solution containing riboflavin was used to generate superoxide radical. Superoxide scavenging activities of the anthocyanins is shown in Figure 4. Anthocyanins, L-AA and BHT exhibited superoxide anoin-scavenging activity as dose-dependent manner. They exerted strong activities, showing 86.1, 65.8 and 50.7% of superoxide anoin-scavenging activities at concentration of 50 µg/ml, respectively. The IC50 value of anthocyanins was less than those of L-AA and BHT (Table 1). Thus, anthocyanins had higher superoxide

anoin-scavenging activity than L-AA and BHT. Figure 5 shows that 16 peaks appeared in the chromatograms of purple sweet potato antho-cyanins, which were detected at 520 nm. From the chromate-graphic and UV – visible spectral features, peaks 1, 2, 3 and 4 were accounting for 7.8, 16.3, 15.6 and 33.5%, respectively, of the total amount of all the anthocyanins, and they were eluted after 9.0, 10.8, 14.4 and 16.5 min, respectively. Suda et al. (2002) reported that 15 kind of anthocyanins in purple sweet potato from Japan. Eichhorn and Winterhalter (2005) found there were four anthocyanin peaks in the chromatograms of purple sweet potato from Germnay. An absorption peak appeared at 330 nm of the UV – Vis characteristic of the four major anthocyanins (Figure 6), which indicates that these anthocyanins are acylated anthocyanins. This result agreed with the research of Suda et al. (2003). They have

Jiao et al.

7051

(%) Scavenging rate(%)

100 80 L-AA

BHT 40

Anthocyanins

20 0 0

0.01

0.02 0.03 0.04 Concentration(mg/ml)

0.05

Figure 4. Superoxide radical-scavenging activity of anthocyanins from purple sweet potato compared to BHT. Each value represents means Âą SD (n=6). BHT, Butylated hydroxytoluene.

Figure 5. HPLC chromaographs of anthocyanins from purple sweet potato. HPLC, High-performance liquid chromatography.

indicated that the anthocyanins in purple sweet potato are mono- or diacylated forms. Calculation from the

chromatograms showed that more than 84.7% of the purple sweet potato anthocyanins were acylated

7052

Afr. J. Biotechnol.

Figure 6. UV-Vis spectrum of major peaks in purple sweet potato anthocyanins recorded from 250 to 700 nm.

Jiao et al.

7053

Figure 7. HPLC frofile of purple sweet potato anthocyanins after acid hydrolysis. Cy, Cyanidin; Pn, peonidin. HPLC, Highperformance liquid chromatography.

anthocyanins. Fossen and Andersen (2000) also found that the acylated anthocyanis constitute more than 98% of the total anthocyani content in purple sweet potato. This suggests a high stability of the purple sweet potato anthocyanins and confirms the potential use of purple sweet potato anthocyanins as a source of natural colourants for the food industry (Fernando and CisnerosZevallos, 2007). Figure 7 shows the chromatograms of purple sweet potato anthocyanins after acid hydrolysis, and peaks 1 and 2 were detected compared with the standard samples.They accounted for about 46.5% of the total anthocyanidins. Cyanidin accounted for about 16.7% of the anthocyanidins and was eluted after 18.2 min. Peonidin accounted for about 29.8% and was eluted after 22.1 min. These results are in agreement with those reported by Bridle and Timberlake (1997) and Terahara et al. (1999) who found that the anthocyanins in purple sweet potato are mono- or di-acylated forms of cyanidin and peonidin. Further studies would be needed to determine other anthocyanidins in purple sweet potato anthocyanins. Conclusion This study demonstrated that anthocyanins from purple

sweet potato exerts DPPH radical and superoxide anion scavenging activities, resulting in a significant, dosedependent scavenging radical. The anthocyanins in purple sweet potato are mono- or di-acylated forms of cyanidin and peonidin. However, the further study is needed to isolate and identify the monoanthocyanins and compare their antioxidant activities in vitro and in vivo. REFERENCES Arozarena I, Ayestarรกn B, Cantalejo MJ, Navarro M, Vera M, Abril I, Casp A (2002). Anthocyanin composition of Tempranillo, Garnacha and Cabernet Sauvignon grapes from high- and low-quality vineyards over two years. Eur. Food Res. Technol. 214(4): 303-309. Bao J, Cai Y, Sun M., Wang G, Corke H (2005). Anthocyanins, flavonols, and free radical scavenging activity of Chinese bayberry (Myrica rubra) extracts and their color properties and stability. J. Agric. Food Chem. 53: 2327-2332. Bridle P, Timberlake CF (1997). Anthocyanins as natural food coloursselected aspects. Food Chem. 58: 103-109. Chung YC, Chen SJ, Hsu CK, Hsu CK (2005). Studies on the antioxidative activity of Graptopetalum paraguayense E. Walther. Food Chem. 91: 419-424. Duan XW, Jiang YM, Su XG, Zhang ZQ (2007). Antioxidant properties of anthocyanins extracted from litchi (Litchi chinenesis Somn.) fruit pericarp tissues in relation to their role in the pericarp browning. Food Chem. 101: 1365-1371. Elahi MM, Matata BM (2006). Free radicals in blood: evolving concepts in the mechanism of ischemic heart disease. Arch. Biochem. Biophys. 450: 78-88.

7054

Afr. J. Biotechnol.

Fernando RL, Cisneros-Zevallos L (2007). Degradation kinetics and colour of anthocyanins in aqueous extracts of purple- and redflesh potatoes (Solanum tuberosum L.). Food Chem. 100: 885-897. Fan GJ, Han YB, Gu ZX, Chen DM (2008). Optimizing conditions for anthocyanins extraction from purple sweet potato using response surface methodology (RSM). LWT-Food Sci. Technol 41: 155 - 160. Fossen T, Andersen ØM (2000). Anthocyanins from tubers and shoots of the purple potato, Solanum tuberosum. J. Hortic. Sci Biotech. 75: 360-363. Francis F (1989). Food colourants: Anthocyanin. Crit. Rev. Food Sci. 28: 273–314. Galvano F, Fauci LL, Lazzarino G, Fogliano V (2004). Cyanidins: metabolism and biological properties. J. Nutr. Biotechem. 15: 2-11. Giannopolites CN, Ries SK (1977). Superoxid dismutase I occurence in higher plants. Plant. Physiol. 59: 309-314. Goda Y, Shimizu T, Kato Y, Nakamura M, Maitani T, Yamada T, Terahara N, Yamaguchi M (1997). Two acylated anthocyanins from purple sweet potato. Phytochemistry, 44: 183-186. Gulcin I, Berashvili D, Gepdiremen A (2005). Antiradical and antioxidant activity of total anthocyanins from black pepper (Piper nigrum) seeds. J. Ethnopharmacol. 56: 491-499. Gulcin I, Berashvili D, Gepdiremen A (2005). Antiradical and antioxidant activity of total anthocyanins from Perilla pankinensis decne. J. Ethnopharmacol. 101: 287-293. Hinneburg I, Damien-Dorman HJ, Hiltunen R (2006). Antioxidant activities of extracts from selected culinary herbs and spices. Food Chem. 97: 122-129. Iqbal S, Bhanger MI, Akhtar M, Anwar F, Ahmed KR, Anwer T (2006). Antioxidant properties of methanolic extracts from leaves of Rhazya stricta. J. Med. Food. 9: 270-275. Kinsella JE, Frankel E, German B, Kanner JI (1993). Possible mechanism for the protective role of the antioxidant in wine and plant foods. Food Technol. 47: 85-89. Kumaran A, karunakaran, RJ (2005). Antioxidant and free radical scavenging activity of an aqueous extract of Coleus aromaticus. Food Chem. 97: 109-114. Lachman J, Hamouz K, Šulu M, Orsák M, Dvořák P (2008). Differences in phenolic content and antioxidant activity in yellow and purplefleshed potatoes grown in the Czech Republic. Plant. Soil Environ. 54: 1-6. Mizutani T, Nomura H, Nakanishi K, Fujita S (1987). Hepatotoxicity of butylated hydroxytoluene and its analogs in mice depleted of hepatic glutathione. Toxicol. Appl. Pharm. 87: 166-176. Montes C, Vicario IM, Raymundo M, Fett R, Heredia FJ (2005). Application of tristimulus colourimetry to optimize the extraction of anthocyanin from Jaboticaba (Myricia Jaboticaba Berg.). Food Res. Int. 38: 983-988. Odake K, Terahara N, Saito N, Toki K, Honda T (1992). Chemical structures of two anthocyanins from purple sweet potato, Ipomoea batatas. Phytochemistry, 31: 2127-2130. Prior RL (2003). Fruits and vegetables in the prevention of cellular oxidative damage. Am. J. Clin. Nutr. 78: 570-578. Riley PA (1994). Free radicals in biology: oxidative stress and the effects of ionizing radiation. Int. J. Radiat. Biol. 65: 27-33.

Suda I, Oki T, Masuda M, Kobayashi M, Nishiba Y, Furuta S (2003). Physiological functionality of purple-fleshed sweet potatoes containing anthocyanins and their utilization in foods. Jpn. Agr. Tes. Q. 37: 167-173. Suda I, Oki T, Masuda M, Kobayashi M, Nishiba Y, Furuta S, Matsugano K, Sugita K, Terabhara N (2002). Direct absorption of acylated anthocyanins in purple-fleshed sweet potato into rats. J. Agric. Food Chem. 50: 1672-1676. Teranara N, Kato Y, Nakamura M, Maitani T, Yamaguchi M, Goda Y (1999). Six diacylated anthocyanins from storage roots of purple sweet potato, Ipomoea batatas. Biosci. Biotechnol. Biochem. 63: 1420-1424. Terahara N, Konczak I, Ono H, Yoshimoto M, Yamakawa O (2004). Characterization of acylated anthocyanins in callus induced from storage root of purple-fleshed sweet potato, Ipomoea batatas L. J. Biomed. Biotechnol. 5: 279-286. Thrasivoulou C, Soubeyre V, Ridha H, Giuliani D, Giaroni C, Michael GJ, Saffrey MJ, Cowen T (2006). Reactive oxygen species, dietary restriction and neurotrophic factors in age-related loss of myenteric neurons. Aging Cell. 5: 247-257. Wang SY, Lin HS (2000). Antioxidant activity in fruits and leaves of blackberry, raspberry, and strawberry varies with cultivar and developmental stage. J. Agric. Food Chem. 48: 140-146. Wang WD, Xu SY (2007). Degradation kinetics of anthocyanins in blackberry juice and concentration. J. Food. Eng. 82: 271−275. Xu J, Chen SB, Hu QH (2005). Antioxidant activity of brown pigment and extracts from black sesame seed (Sesamum indicum L.) Food Chem. 91: 79-83.

Full Length Research Paper

Study on the triphenyl tetrazolium chloride– dehydrogenase activity (TTC-DHA) method in determination of bioactivity for treating tomato paste wastewater Shiyang Sun1,2, Zhiguo Guo1,2, Ruili Yang1,2, Zhigang Sheng3 and Peng Cao1,2* 1

College of Chemistry and Chemical Engineering, Shihezi University, Shihezi 832003, China. Key Laboratory for Green Processing of Chemical Engineering of Xinjiang Bingtuan, Shihezi 832003, China. 3 Shihezi Tianye Tomato Products Co., Ltd., Shihezi 832000, China.

Accepted 23 February, 2012

A quick analysis of the sludge activity method based on triphenyltetrazolium chloride-dehydrogenase activity (TTC-DHA) was developed to change the rule and status of the biological activity of the activated sludge in tomato paste wastewater treatment. The results indicate that dehydrogenase activity (DHA) can effectively facilitate the biochemical reaction of tomato paste wastewater treatment upon analysis of the influences of various DHA and kinetic factors. The biological activity of the activated sludge by TTC-DHA was changed to become applicable to aeration and wastewater treatment operation and management. Key words: Tomato paste wastewater, TTC-DHA, bioactivity, active sludge. INTRODUCTION In recent years, new technologies and methods were developed in environmental water monitoring (Bihan, 2000). Physicochemical analysis was accurate and reliable. However, one of the major problems was that the analysis could only be used for a single component of pollutant concentrations in wastewater (Bihan and Lessard, 1998). Therefore, finding a broad and indispensable biological indicator to analyze the sludge activity for tomato paste wastewater treatment was necessary. Biological oxidation of organic compounds is a

*Corresponding author. E-mail: caopengh@sohu.com. Tel: 0086-993-2055015. Fax: 0086-993-2057270. Abbreviations: TTC-DHA, Triphenyltetrazolium chloridedehydrogenase activity; DHA, dehydrogenase activity; COD, chemical oxygen demand; MLSS, mixed liquor suspended solids; DO, dissolved oxygen.

dehydrogenation process (Tabatabai, 1982) mediated by many different intracellular and specific dehydro-genases. The dehydrogenase activity (DHA) of the activated sludge supposedly reflects sludge activity (Nielsen, 1975). DHA estimation is conducted using redoxsensitive tetrazolium dye, which is reduced to insoluble formazan inside the cells as a result of respiratory activity. Tetrazolium chloride-dehydrogenase activity (TTC-DHA) method is recommended as a very sensitive and simple methodology to determine sludge activity (Lazarova and Manem, 1995). Triphenylte-trazolium chloride (TTC) is a kind of colorless soluble dye, which serves as terminal acceptor in biochemical reactions. Red triphenyl formazan (TF) salt forms in microbial cells when TTC irons react with H atoms and can be extracted from the cells using an organic solvent (Yang and Jiang, 2002; Yu et al., 1990). In previous studies, DHA assays were used to evaluate the activated sludge by counting bacterial colonies (Bihan, 1998, 2000; Zhou and Li, 1995; Zinbei and Henrietle, 1994) and measure water toxicity. Therefore, the TTC-DHA method has been widely used

7056

Afr. J. Biotechnol.

in the study of biological activity of the activated sludge. In this study, red TF is an index that reflects sludge activity. Its influence was analyzed in the wastewater treatment plant of Shihezi Tianye Tomato Products Co., Ltd. The DHA from the biochemical analyses will play an important role in tomato paste wastewater treatment and in the daily management of the tomato paste wastewater treatment plant. MATERIALS AND METHODS Reactor and operation The wastewater treatment system of Shihezi Tianye Tomato Products Co., Ltd consists of an equalization tank, seven aeration tanks and a secondary sedimentation tank as shown in Figure 1. Every tank measured 19 × 10 × 5 m (L × W × H), and the volume was 950 m3. Aeration tanks of nos. 3, 4 and 5 added fiber packing. Seven aeration tanks were divided into three regions by the filler: A region including aeration tanks 1 and 2; B region including aeration tanks 3, 4 and 5; and C region including aeration tanks 6 and 7. The aeration was 405 m3/min, which was provided by two roots blower (24 kW/h). The influent flow was 216.12 m3/h on average (ranging from 175.8 to 209.6 m3/h). The hydraulic retention time (HRT) in every reactor tank and total HRT were 4.40 and 30.77 h, respectively.

Seed sludge The flora consisted of seven aerobic strains (Wen et al., 2009). These strains were screened from acclimated sludge which originated from the tomato paste wastewater drainage pipe in Shihezi, China. The seven strains were divided into two types: degradation dominant bacteria including Bacillus subtilis (JH642), Pseudomonas putida (KT2440), Bacillus megaterium (DSM319) and Citrobacter koseri (BAA-895), and settlement dominant bacteria including Bacillus cereus (F65185), Bacillus sp. (B-14911) and Pantoea agglomerans (WAB1913). Strains were cultured separately in a shake flask and subsequently mixed in a 140 L container. The polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis showed that the major microbes of the sludge were the added strains in the treatment system.

Sample preparation Activated sludge samplings were done upwardly from aeration tanks sampling ports every day. Bioactivity measurements were immediately done after sampling. Moreover, all the materials used were sterilized.

Analytical methods The treatment continued for 50 days (from August 11, 2011 to September 29, 2011). Chemical oxygen demand (COD) and mixed liquor suspended solids (MLSS) were measured by standard methods (Wei, 2002). pH was measured using a pH electrode connected to a pH meter (Sension156, Hach Company, America). The dissolved oxygen (DO) was measured using a DO electrode connected to a DO meter (Sension156, Hach Company, America). The temperature was measured using a temperature electrode

connected to a temperature meter (Sension156, Hach Company, America). All measurements were replicated three times.

DHA analytical measurement steps The TTC-DHA analytical measurements were performed base on the method proposed by Yu et al., 1990). Briefly, the tubes with the detached active sludge samples were added with 1.5 mL of TrisHCl buffering liquid (pH 8.4), 0.5 mL Na2 SO3 solution, 1.5 mL distilled water and 1.5 mL of TTC solution. The tubes were lightly cap, and then placed in water bath at 37°C. After subjecting the tubes to centrifugation at 10000 rpm for 1 min at room temperature, 1 mL concentrated sulfuric acid was added to the tubes to stop the reaction, and 5 mL of chloroform was used to extract the TF crystal. The mixture was further centrifuged at 10000 rpm for 1 min and the supernatant was separated to measure the TF content colorimetrical at 485 nm. The amount of TF was determined from the standard TF curve drawn with Na2S2 O4 as reduction agent. All samples were analyzed at least in duplicate. DHA was expressed in terms of 10-6g TF/(ml·h). The DHA standard curve is shown in Figure 7.

RESULTS DHA in the three regions during sludge culture DHA in the three regions during sludge culture is shown in Figure 2. These samples were collected after six days of the aeration tanks operation times (from August 5 to 10, 2011). As indicated in Figure 2, DHA in the three regions were relatively low during the early stage (one to two days). As the culture continued, DHA began to increase. The main reason for this trend was the relatively low MLSS (average MLSS was 540 mg/L) of the aeration tank, which caused DHA to become relatively low. However, DHA in the B region was higher than the DHA in the other regions after two days. The high concentration of TTC irons can penetrate deeply into the cells within filler during bioactivity detection, and reacted with hydrogen atoms which were removed from organic matters catalyzed by the dehydrogenase enzyme, generating the red TF crystal. Whether the cells of the organism were fixed on the support media or kept free in the liquid, the red TF product can be extracted by organic solvent from the cells and measured quantitatively. Therefore, the TTC-DHA activity was determined for tomato paste wastewater treatment without necessarily unfixing the fibred from the support media for the B region (Tian et al, 2006). DHA in the three regions during the continuous treatment Figure 3 shows the trend in the three regions during the continuous treatment. DHA in the A region was slightly higher than the other two regions during the early stage of the treatment. Two reasons were attributed to the higher DHA in the A region. One was the lower COD

Sun et al.

70 m 3

4 5

7057

10 m

9 1 0

Figure 1. Schematic diagram of the system. 1, Influent water; 2, equalization tank; 3 and 4, aeration tank (A region); 5, aqueduct I; 6, 7 and 8, fibre tank (B region); 9, aqueduct II; 10, 11 and 12, aeration tank (C region); 12, secondary settling tank; 13, effluent water.

60 50

-6

DHA (10 DHA (10g TF/ml/day) gTF(ml/d)

40 A region B region C region

30 20

Time (day)

Time (d)

Figure 2. The dehydrogenase activity (DHA) in the three regions during the sludge culture.

loading of the influent, which was lower than 1000 mg/L, thus resulting in the increase of the sludge activity, while the other was the increase in the sludge return ratio resulting in the increase of sludge concentration. DHA in

the B region gradually increased halfway through the treatment. The sludge concentration in the B region was also increased compared with the other two regions. In the last stage of the treatment, DHA in the region became

7058

Afr. J. Biotechnol.

-6

DHA (10 g TF/ml/day)

50 40 30 20 A re g ion B re gion C re gion

10 0

Time (day) Figure 3. The dehydrogenase activity (DHA) in the three regions during the continuous treatment

7 6

DO (mg/L)

5 4 A reg ion B reg ion C reg ion

3 2 1 0

Time T im (day) e (d ) Figure 4. Dissolved oxygen (DO) concentration in the three regions during the continuous treatment.

significantly higher than the DHA in the other two regions because of the fiber added into the treatment system, which led to the increase of MLSS in the B region and also because of the higher COD removal and removal rate (Gao et al., 2009). In general, the DHA value obtained in the present study is much higher than the DHA value obtained in the previous study, especially in the last treatment, where the -6 value ranged from 12 (10 g/(mL路day)) to 56 (10-6 g/(mL路day)) (Gao et al., 2009). This difference is possibly due to the high biological activity of the activated sludge

in the treatment system of this study. DISCUSSION The relationship between concentration and DHA

dissolved

oxygen

Figure 4 shows the DO concentration in three regions during continuous treatment. The DO concentration in the A region essentially increased, whereas DO

Sun et al.

7059

34 A region B region C region

Temperature Tempperature (â&#x201E;&#x192;)

32 30 28 26 24 22 0

Time (d) Figure 5. Temperatures of the three regions during the continuous treatment.

concentration in the C region decreased. During the treatment in 2010, all aeration tanks had the same aeration rate. DO concentration in the A region was lower than 2.0 mg/L, which was lower than the lower limit of the DO concentration in the activated sludge system, thus indicating insufficient aeration. On the other hand, the DO concentration in the C region was higher than 3.4 mg/L, which denoted a slight waste of energy costs. Consequently, DO concentration in the two regions was adjusted during the treatment in 2011. However, the higher COD loading of the influent decreased the sludge activity during the early treatment, and the higher COD loading of the influent was mainly caused by a large amount of peeled tomato flesh. Most of the flesh precipitated in the A region, which caused a higher burden. As a result, the average DHA in the treatment system became lower during the early treatment, with a positive correlation coefficient of 0.5. The positive correlation coefficient of DHA and DO concentration was 0.85 when the treatment system stabilized with the adjustment of the DO concentration. DHA was evidently by DO concentration and a positive correlation. Compared with other studies, DHA in the current study was higher because of a larger positive correlation resulting in higher biological activity of the flora.

the A region was slightly higher than the DHA in the other two regions because of the increase in sludge return ratio. The main reason for this finding was that the temperature of the clean tomato wastewater was low, while the endogenous respiration of microorganisms was limited in the A region compared with the endogenous respiration of microorganisms in the B and C regions. The temperature of the B region was higher than the temperatures of the other two regions halfway through the treatment. The sludge concentration in the region was higher than the sludge concentration in the other regions, which increased along with the microbial endogenous respiration and temperature. Compared with DHA, temperature did not increase with the microbial endogenous respiration while the exothermicity of the aeration equipment continually reduced. The higher COD loading of the influent was caused by the non-achievement of the desired concentration of microorganisms Therefore, DHA and tomato paste wastewater treatment were not affected by temperature. However, in the later stage of the treatment, temperature decreased, resulting in the increase in DHA. This result was apparently influenced by the decrease of local temperature and measurement time, especially during the last stage of the treatment.

The relationship between temperature and DHA

The relationship between MLSS and DHA

Figure 5 shows the temperature of the three regions during continuous treatment. The temperature of the A region was lower than the temperatures of the B and C regions during continuous treatment. However, DHA in

Figure 6 shows the MLSS of aqueducts I and II, and aeration tanks 4 and 7. During the early treatment, MLSS experienced a transient decrease because of the dilution effect. With the large population of microorganisms,

7060

Afr. J. Biotechnol.

1400 Aqueduct I Aqueduct II Aeration tank 4 Aeration tank 7

1200

MLSS (mg/L)

1000 800 600 400 200 0

40 60 Time (0.5 d) Time (0.5 day)

100

Figure 6. MLSS of aqueducts I and II, and aeration tanks 4 and 7. MLSS, Mixed liquor suspended solids.

MLSS in the system quickly increased. At first, MLSS in the A and B regions were stable at 500 to 700 mg/L. Along with the quick growth of the influent COD, MLSS in the A and B regions increased again and eventually stabilized at 800 to 1200 mg/L. Considering the sludge adhering on the filler (0.1189 kg/1.5 m, approximately equal to 461 mg/L), sludge concentration in the B region could reach to 1250 to 1650 mg/L. Sludge concentration in the 2011 treatment was significantly higher than the sludge concentration in the 2010 treatment which was only 400 to 450 mg/L (the treatment effect radically improved). However, sludge concentration only reached the lower limit of that in the conventional activated sludge process (Tchobanoglous and Burton, 1991; Galapate et al., 1999). The flora added into the system dominated and the proportion of degrading dominant strains in the sludge became higher than the strains in the conventional activated sludge. This potentially contributed to the better effect reached under lower MLSS. On the other hand, MLSS in the C region was lower (stable at 600 to 800 mg/L) than the MLSS in the other regions. Since the filler could hold up the sludge, the amount of sludge entering into the C region was lower (MLSS of aqueduct II in Figure 6). Furthermore, the sludge growth was limited by the lower pollution loads. The load of secondary sedimentation tank could be decreased because of the lower MLSS in the C region. At the same time, the sludge recycle flow rate could also be

decreased if the sludge was intercepted more effectively in the system. Kinetic analysis of the sludge activity A linear relationship existed between DHA of the activated sludge and the substrate concentration for the biodegradation process of organic matter (Tchobanoglous and Burton, 1991). These phenomena can be described by Equation 1, which is expressed by the MichaelisT Menten equation where DHA (U ) and Max DHA (UM) of the activated sludge have a similar relationship with maximum specific growth rate (碌m) and specific growth rate (碌):

U K +S M

(1)

Where, UT is DHA of the activated sludge (TF10-6 g/(mL路day)), UM is the max DHA of the activated sludge -6 T (TF(10 g/(mL路day)), K is the Michaelis constant (mg/L) and S is the organic matter concentration (mg/L). Figure 8 shows the relationship between 1/UT and 1/S for the three regions. UM in the A region was higher than UM in the other two regions (Table 1). The main reason for this trend is the higher COD loading in the A region

Sun et al.

y=0.0061x-0.0003 2 R =0.99789

0.8

OD485(nm)

7061

0.6

0.4

0.2

100

120

140

-6

TF (10 g/mL)

day)) (TF10 g/(L路d))

y=1 5.21 37 x+ 23.4 28 1 2 R = 0.8 596 35

y=11.91 2175 x+2 6.219 28 2 R =0.9 637

-6

day)) (TF10 g/(L路d))

Figure 7. The dehydrogenase activity (DHA) standard curve.

1/U /10

-3

25 0 .2

0.4

0 .6

0 .8

1.0

0.8

1.0

-3

1 /S/1 0 (m g/L )

1.4

1.6

1.8

-3

1/S/10 (m g /L)

y = 3 .4 3 0 1 8 x + 3 6 .8 8 6 2 1 2 R = 0 .9 2 5 1 8

65 60

1/U /10

-3

-6

(TF10 g/(L路d)) day))

1.2

55 50 45 40

4 1 /S /1 0

6 -3

(m g /L )

Figure 8. The relationship between (a) 1/UT and 1/S for A region; (b) 1/UT and 1/S for B region; and (c) 1/UT and 1/S for C region.

7062

Afr. J. Biotechnol.

Table 1. The UM and KT of values for the three regions.

Parameter UM KT

A region 0.0427 0.6496

B region 0.0381 0.4543

C region 0.0271 0.0930 -6

UM, Max DHA of the activated sludge (TF (10 g/(mL路day)), while T K , Michaelis constant (mg/L). TF, Triphenyl formazan.

compared with the other regions. On the other hand, the microbial endogenous respiration increased, which led to the increase in the microorganism growth rate. The value T of U indicates the removal rate of COD over a range of influent COD concentrations and thus indicates the T stability of the process. U obtained in the present study is comparable with the results in a previous literature (Tan et al., 2005), indicating that the addition of the aerobic degrading strains was appropriate to the treatment of wastewater with different concentrations in the treatment system. The system is also suitable to high and shock loadings. Conclusion By the change of the sludge activity in the treatment system, the state of the treatment system is indicated and provides a good basis to improve the water quality of the treatment system. This experiment shows that the TTCDHA method is suitable to be used for the treatment of tomato paste wastewater, where DO and sludge concentrations are not affected by temperature. The kinetic analysis of the sludge activity shows that the TTCDHA method was reliable for the treatment of tomato paste wastewater. ACKNOWLEDGEMENTS This study is partially supported by the National Natural Science of China (grant no. 51068024). Assistances from the Laboratory for Green Processing of Chemical Engineering, Xinjiang Bingtuan and Shihezi Tianye Tomato Products Co., Ltd are also acknowledged. REFERENCES Bihan YL (2000). Monitoring biofilter clogging: biochemical characteristics of the biomass. Water Res. 34: 4284-4294. Bihan YL, Lessard P (1998). Influence of operational variables on enzymatic tests applied to monitor the microbial biomass activity of a biofilter, Water Sci. Tech. 37: 199-202.

Gao Y, Dai XC, Chen X (2009). TTC-ETS activity monitoring of A O process for combined sewage treatment. China Environ. Sci. 30: 1711-1715. Lazarova V, Manem J (1995). Biofilm characterization and activity analysis in water and wastewater treatment. Wat. Res. 29: 22272245. Nielsen RH (1975). Measurement of the inhibition of respiration in activated sludge by a modified determination of the TTCdehydrogenase activity. Water Res. 9: 1179-1185. Galapate RP, Agustiani E, Baes AU, Ito K, Okada M (1999). Effect of HRT and MLSS on THM precursor removal in the activated sludge process. Water Res. 33: 131-136. Tabatabai MA (1982). Soil enzymes. In: Page AL, Keeney DR (eds). Methods of soil analysis. Part 2: Chemical and microbiological properties. Soil Science Society of America, Madison, Wis. 42: 903948. Tan XJ, Ying J, Tang L (2005). Evaluation of TTC and INT-electron transport system activity tests for heavy metal inhibition of activated sludge. China Environ. Sci. 5: 56-62. Tchobanoglous G, Burton FL (1991). Wastewater engineering: treatment, disposal and reuse, 3rd edn. New York, McGraw-Hill, Inc Tian Q, Chen JH, Zhang H (2006). Study on the Modified triphenyl tetrazolium chloride-dehydrogenase activity (TTC-DHA) Method in Determination of bioactivity in the up-flow aerated bio-activated carbon filter. Afr. J. Biotechnol. 5: 181-188. Wei FS (2002). National environmental protection agency, monitoring, and analysis method of water and wastewater. Beijing: China Environ. Science Press. Wen SM, Li C, Lu JJ, Cao P (2009). Comparative study on the properties of aerobic strains in an aerobic-anaerobic coupled reactor. J. Chem. Ind. Eng. 60: 2067-2073. Yang H, Jiang Z, Shi S, Tang W (2002). In the dehydrogenase activity test for assessing anaerobic biodegradability of organic compounds.Ectoxicol. Environ. Saf. 53: 416-421. Yu QX, Wu GQ, Meng XT (1990). Handbook of environmental engineering microbiological study. Beijing: China Environ. Sci. Press. Zhou CS, Li YQ (1995). A Study on characteristics of the biofilm from the reactor of ceramic media column. China Environ. Sci. 15: 351355. Zinbei S, Henrietle Cl (1994). Indentification and characerization of bacterial activities involved in wastewater treatment by aerobic fixedbed reactor. Water Res. 28: 2575-2582.

African Journal of Biotechnology Vol. 11(27), pp. 7063-7071, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2205 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Isolation and characterization of nitrogen fixing bacteria from raw coir pith Abesh Reghuvaran1*, Kala K. Jacob1 and Anita Das Ravindranath2 1

Rajiv Gandhi Chair in Contemporary studies, School of Environmental Studies, Cochin University of Science and Technology, Cochin 682 022, Eranakulam, Kerala, India. 2 Coir Research Institute, Coir Board, Kalavoor P.O., Alappuzha-688 522, India. Accepted 9 November, 2011

Coir fibre is the hard fibre extracted from the coconut husk and coir pith is a lignocellulosic byproduct released during the extraction of coir fibre. The pith is not degraded under normal environmental conditions and accumulates in the fibre extraction units occupying sprawling space in the units. The inherent properties of coir pith make it useful as a plant nutrient. Nitrogen fixing bacteria could be isolated from the coir pith and four strains were amplified with nifH gene viz. NF-4 (Lysinibacillus sp.), NF-7 (Ochrobactrum sp.), NF-12 (Paenibacillus sp.) and an uncultured bacterial clone which shows only 50% similarity to NF-18 (Clostridium sp). The present study targeted the isolation and characterization of natural flora of nitrogen fixing organisms in the coir pith. Key words: Coir pith, nifH gene, nitrogen fixation, organic manure. INTRODUCTION Coir pith or coir dust is a major byproduct of coir fiber extraction industries (Reghuvaran and Ravindranath, 2010). Normally, the pith is dumped as an agricultural waste and accumulates in the form of heaps of coarse and fine dust. Coir pith thus produced decomposes very slowly in the soil as its pentosan-lignin ratio is below 0.5 (Ghosh et al., 2007), and because of the chemical and structural complexity of its lignin-cellulose complex (Ramalingam et al., 2005). Large amounts of coir pith (approximately 7.5 million tons annually in India) accumulate nearby coir processing units, causing severe disposal problems, fire hazards and ground water contamination due to the release of phenolic compounds (Namasivayam et al., 2001). Coir pith contains 87% of organic matter, 6.28% organic carbon, 0.73% nitrogen (Reghuvaran and Ravindranath, 2010) and 13% of ash content (Thampan, 1987). Lignin is generally synthesized by polymerization of coniferyl, sinapyl and p-coumaryl alcohol to produce large molecules of indefinite size in which aromatic monomers are linked by a variety of chemical bonds. The

*Corresponding author. E-mail: abesh199@gmail.com. Tel: 09946 199 199.

structural feature has important implications for effective bio-degradation by microorganisms (Crawford and Crawford, 1976; McCarthy et al., 1984). It is estimated that 15,840 million coconuts are produced annually in India. In agro-industrial wastes; lignin is a main contributor of the total carbon producing polycyclic aromatic hydrocarbon components such as benzopyrine, catechol, hydroquinone, phenanthrene and naphthalene when degraded by heat (Kjallstrand et al., 1998). Coir pith is low in nitrogen content, C: N ratio mounting to 112:1 (Nagarajan et al., 1985). Microbial degradation of this waste is generally considered to be safe, effective and an environmental friendly process and certain mushrooms have showed good potentials for degrading coir pith (Vijaya et al., 2008). Nitrogen fixation can be considered as one of the most interesting microbial activity as it makes the recycling of nitrogen on earth possible and gives a fundamental contribution to nitrogen homeostasis in the biosphere (Aquilantia et al., 2004). It is the reduction of N2 (atmospheric nitrogen) to NH3 (ammonia). Free living prokaryotes with the ability to fix atmospheric dinitrogen (diazotrophs) are ubiquitous in soil. In natural ecosystems, biological nitrogen fixation is the most important source of nitrogen. The capacity for nitrogen fixation is

7064

Afr. J. Biotechnol.

widespread among bacteria. The estimated contribution of free living N-fixing prokaryotes to the nitrogen input of soil ranges from 0 to 60 kg/ha/year (Burgmann et al., 2003). In recent years, many studies have addressed the importance and contribution of biological nitrogen fixation in ecologically unique terrestrial and aquatic habitats by focusing on the diversity of nifH sequences (Zehr et al., 2003). Such studies have provided a rapidly expanding database of nifH sequences and revealed a wide diversity of uncultured diazotrophs (Tan et al., 2003). Plant-associated nitrogen fixing bacteria have been considered as one of the possible alternatives for inorganic nitrogen fertilizer for promoting plant growth and yield (Ladha and Reddy, 2000). A variety of nitrogen fixing bacteria like Acetobacter, Arthrobacter, Azoarcus, Azospirillum, Azotobacter, Bacillus, Beijerinckia, Derxia, Enterobacter, Herbaspirillum, Klebsiella, Pseudomonas and zoogloea have been isolated from the rhizosphere of various crops (Barraquio et al., 2000). A significant reduction in the use of nitrogen-fertilizer could be achieved if biological nitrogen fixation is made available to crop plants (Dawe, 2000). Nitrogenous fertilizers are one of the most widely used chemical fertilizers, as deficiency of nitrogen in the soil often limits crop yields. Consumption of nitrogen fertilizer in Asia has increased from 1.5 to 47 million tones (mt) during the last 35 years (Dawe, 2000). Only less than 50% of the added nitrogen is available to the plants. The enzymatic reduction of nitrogen to ammonia replenishes the loss of nitrogen from soil-plant ecosystems and is achieved through biological nitrogen fixation. Diazotrophs in the soil are the main source of nitrogen input in primary production ecosystems (Cleveland, 1999). Nitrogen fixers in the environment are diverse. Bacteria of the genus Azospirillum are well-known examples of socalled associative nitrogen fixers, which are widespread in the soils of tropical, subtropical and temperate regions. These bacteria develop close relationships with the roots of various wild and agricultural plants (Tyler et al., 1979; Steenhoubt and Vanderleyden, 2000). The studies of these microorganisms carried out over the last few decades have primarily been aimed at gaining insight into the molecular nature of plant-microbial interactions in order to develop efficient modern genetic and agricultural biotechnologies (Burdman et al., 2001; Fedonenko et al., 2001). Associative nitrogen fixing bacteria such as Azospirillum brasilense, Herbaspirillum seropedicae and Acetobacter diazotrophicus may benefit their host plants as nitrogen biofertilizers and plant growth promoters. The latter two organisms were the first nitrogen-fixing bacteria suggested to be endophytes (Baldani et al., 1997; James and Oliveres, 1997). A. lipoferum and A. brasilense were for long the only known members of the genus Azospirillum (Tarrand et al., 1978). A large number of nifH primers have been designed to study the diversity of diazotrophs (Poly et al, 2001; Rosch et al., 2002; Widmer et al., 1999; Shaffer et al., 2000). All

nitrogen fixers carry a nifH gene that encodes the Fe protein of the nitrogenase. In this study, the structure of the nifH gene pool was investigated by RFLP analysis of the nifH gene, which has been amplified from DNA directly extracted from soil samples (Poly et al., 2001) and other techniques, such as PCR cloning (Zehr et al., 1995, 1998). The nifH genes are very diverse, some of them are characteristic of an ecological niche (Chelius and Lepo, 1999; Shaffer et al., 2000), which shows the habitats of soil nitrogen fixing bacteria and the structure of nifH gene pools relationships. MATERIALS AND METHODS Sampling location Samples of coir pith were collected from the accumulated heap in the Alappuzha district of Kerala in India. The samples were randomly collected in sterile plastic bags and stored at 4°C in the laboratory for the further experiments.

Isolation of nitrogen fixing bacteria General plating techniques were followed for screening and isolation. Individual colonies were picked, purified and assayed as pure cultures for nitrogenase activity using N-deficient medium. Pure cultures of nitrogen fixing isolates were readily obtained by repeated sub-culturing and confirmed through Gram staining technique.

Extraction and analysis of DNA Genomic DNA was obtained by using standard bacterial procedure (Sambrook et al., 1989). The DNA stock samples were quantified by UV spectrophotometer at 260 and 280 nm using the convention that one absorbance unit at 260 nm wavelength equals 50 µg DNA per ml. The absorbance in the UV range of 260 and 280 nm were studied for determination of DNA concentration and purity. Purity of DNA was confirmed on the basis of optical density ratio at 260:280 nm. The quality of DNA was further confirmed using agarose gel electrophoresis (Naniatis et al., 1982). 16S rDNA fragment was amplified by PCR from the bacterial genomic DNA using 16s rDNA universal primers (10 to 30 F: 5′ –GAG TTT GAT CCT GGC TCA G-3′ and 530 R: 5′-G(AT)A TTA CCG CGG CGG CTG-3′).

PCR amplification of the nifH gene fragment One hundred nanogram of DNA were used as template in PCR. Selected primers NifH for-5’ TAYGGNAARGGNGGHATYGGYATC and NifH rev -5’ ATRTTRTTNGCNGCRTAVABBGCCATCAT were used to amplify (Poly et al., 2001). PCR was carried out in a final reaction volume of 25 µL in 200 µL capacity thin wall PCR tubes. The PCR tubes with all the components were transferred to thermal cycler. The thermo cycling conditions consisted of an initial denaturation step at 94°C for 3 min, 30 amplification cycles of 45 s at 94°C, 30 s at 55°C, 60 s at 72°C and a final extension step at 72°C for 5 min with Gene Amp PCR system (Perkin-Elmer Co., Norwalk, Conn.).

Reghuvaran et al.

Analysis of DNA amplification by AGE Commercially available 100 bp ladder was used as standard molecular weight DNA. Analysis of the PCR products was carried out by electrophoresis. Electrophoresis was done by 5 µL of PCR product with 4 µL bromophenol blue (loading dye) in agarose gels (1.5%). The voltage of 100 V and current of 45 A for a period of 1 h 20 min till the bromophenol blue travelled 6 cm from the wells was applied. We viewed the gels on UV transilluminator and photographed the gel for documentation.

Purification and DNA sequencing of samples Amplified PCR product was purified using column purification as per manufacturer’s guidelines (Thermo Scientific, Fermentas Molecular Biology Tools). The isolated DNA having ratio between 1.8 to 2.0 can be considered to be of good purity and further used for sequencing reaction.

Sequencing of purified 16SrDNA gene segment The concentration of the purified DNA was determined and was subjected to automated DNA sequencing on ABI3730xl genetic analyzer (Applied Biosystems, USA).

16S rRNA sequence analysis Each nucleic acid sequence was edited manually to correct falsely identified bases and trimmed to remove unreadable sequences at the 3′ and 5′ ends (considering peak and quality values for each base) using the sequence analysis tools. The edited sequences (16S rDNA) were then used for similarity searches using Basic Local Alignment Search Tool (BLAST) programme in the NCBI GenBank (www.ncbi.nlm.nih.gov) DNA database for identifying the bacterial strains. The phylogenetic tree was constructed by the methods implemented in the TREECONW software package.

Sequence deposition The 16s rRNA, nifH gene fragments of the strain NF4, NF7, NF12 and NF18 have been deposited in the GenBank under the accession numbers JN230510, JN230511, JN230512 and JN230513, respectively.

RESULTS AND DISCUSSION Coir pith is a rigid fluffy material and in the present study, an attempt was made to isolate microorganisms in the coir pith samples drawn from accumulated heaps of coir pith on coir fiber extraction units stored for the past 3 years without any type of treatment (Figure 6). Four nitrogen fixing bacteria composed of different physiological and biochemical characters were isolated and sequenced. Out of the 19 isolated colonies, four strains were amplified with nifH gene viz. NF-4 (Lysinibacillus sp.), NF-7 (Ochrobactrum sp), NF-12 (Paenibacillus sp) and an uncultured bacterial clone was isolated which

7065

shows only 50% similarity to NF-18 (Clostridium sp.). By repeated plating on to nitrogen deficient agar media, pure cultures of the four bacterial colonies were obtained. High molecular weight DNA was observed in agarose gel evaluation.16s rDNA fragment was amplified by PCR from genomic DNA using 16S rDNA universal primer. Column purification yielded contaminant free PCR product. A large number of nifH primers were designed to study the diversity of diazotrophs (Poly et al., 2001; Rosch et al., 2002; Widmer et al., 1999; Shaffer et al., 2000). Here, the design of the appropriate primers was done with utmost priority for the novel primers, otherwise the use of highly generated primers in combination with low stringency amplification conditions could result in biased conclusions. In the present study, predesigned degenerated primers were used for the coir pith based micro flora analysis viz. NifH for-5’ TAYGGNAARGGNGGHATYGGYATC and NifH rev -5’ ATRTTRTTNGCNGCRTAVABBGCCATCAT (Edwards et al., 1989). The nifH primers were designed from the available nifH sequences of different organisms from NCBI GenBank (www.ncbi.nlm.nih.gov). After the amplification of microbial DNA from coir pith with nif H primers (Figure 1), the edited sequences (16s rDNA) were then subjected to the similarity searches using BLAST programme (Table 1). The BLAST results show that the four cultures have greater similarity with Lysinibacillus sp., Ochrobactrum sp., Paenibacillus sp. and Clostridium sp. The results have been furnished in Figures 2 to 5. Coir pith is very slow in microbial decomposition due to the presence of lignin and accumulates in coir fiber extraction units. The microflora inhabiting coir pith is therefore limited, as the lignocellulose complex resists biodegradation. Herein, an effort is made here to isolate the microorganisms in coir pith which possess the nitrogen fixing ability. The DNA isolated from the natural microflora in coir pith showed similarities with Lysinibacillus sp., Ochrobactrum sp., Paenibacillus sp. and Clostridium sp. These bacteria are important nitrogen fixing species and most of them have other applications too. It is observed that activities that have been found to be associated with P. polymyxa treatment on plants in field experiments include nitrogen fixation, soil phosphorous solubilization, production of antibiotics, auxins, cytokinins, chitinase and hydrolytic enzymes, as well as the promotion of increased soil porosity (Timmusk and Wagner, 1999; Timmusk et al., 1999). All these activities might be of importance for plant growth promotion. Timmusk et al. (2009) reported P. polymyxa B2, B5 and B6 antagonistic mechanisms against the well characterized model of oomycetic pathogens Phytophthora palmivora and Pythium aphanidermatum. P. polymyxa (previously Bacillus polymyxa; Ash et al., 1994) is a common soil bacterium belonging to plant growth promoting rhizobacteria

7066

Afr. J. Biotechnol.

Figure 1. Amplification of coir pith DNA with nifH primers. Lane 1, 100 bp molecular weight marker, lane 2, NF-4; lane 3, NF-7; lane 4, NF-12 and lane 5, NF-18.

Table 1. Blast results of top two genes showed maximum similarity.

Organisms

Accession No FJ 174660.1

Lysinibacillus sp. HM 032886.1

HM 629806.1 Ochrobactrum sp. EU 301689.1

EU 912456.1 Paenibacillus sp. FJ 468006.1

HP 259293.1 Clostridium sordellii sp. HQ 259292.1

Maximum identity (%)

Description Lysinibacillus fusiformis strain 109XG27YY6 16S ribosomal RNA gene, Partial sequence. Bacillus sonorensis strain 16S ribosomal RNA gene, Partial sequence. Ochrobactrum sp. BE3. 16S ribosomal RNA gene, Partial sequence. Ochrobactrum tritici. 16S ribosomal RNA gene, Partial sequence. Paenibacillus sp. BL18-3-2. 16S ribosomal RNA gene, Partial sequence. Paenibacillus polymyxa strain. MS 0102 16S ribosomal RNA gene, Partial sequence. Clostridium sordellii strain MA2 16S ribosomal RNA gene, Partial sequence. Clostridium sordellii MA1 16S ribosomal RNA gene, Partial sequence.

(PGPR) also present in the coir pith sample. The activities associated with P. polymyxa include nitrogen fixation (Heulin et al., 1994), soil phosphorous solubilization (Jisha and Alagawadi, 1996), as well as promotion of increased soil porosity (Gouzou et al., 1993;

97 98

96 96

98 98

85 85

Timmusk and Wagner, 1999; Timmusk et al., 1999). Besides, it produces antimicrobial substances active against fungi and bacteria (Rosado and Seldin, 1993; Picard et al., 1995; Kajimura and Kaneda, 1996). P. polymyxa also has been used for the control of plant

Reghuvaran et al.

7067

Figure 2. Blast result of Culture 4. Based on the 16s rDNA analysis, the culture 4 showed 97% similarity with Lysinibacillus sp. (accession no: HQ436428.1).

Figure 3. Blast result of Culture 7. Based on the 16s rDNA analysis, the culture 7 showed 96% similarity with Ochrobactrum sp. (accession no: HM629806.1).

disease (Mavingui and Heulin, 1994; Kim, 1995; Shishido et al., 1996; Dijksterhuis et al., 1999; Kharbanda et al., 1999). It displayed potent antimicrobial properties against both Gram negative and Gram positive pathogenic

bacteria. The antimicrobials produced by this strain were isolated from the fermentation broth and subsequently analyzed by liquid chromatography-mass spectrometry. Another important bacteria isolated from the coir pith

7068

Afr. J. Biotechnol.

Figure 4. Blast result of Culture 12. Based on the 16s rDNA analysis, the culture 12 showed 98% similarity with Paenibacillus sp. (accession no: EU912456.1).

Figure 5. Blast result of Culture 18. Based on the 16s rDNA analysis, the culture 18 showed 85% similarity with Clostridium sordellii. (Accession No: HQ259293.1)

Reghuvaran et al.

7069

Figure 6. Coir pith heaps accumulating in fiber extraction units.

sample was Ochrobactrum sp., which has several properties of importance. The genus Ochrobactrum was described first by Homes et al. (1988) and belongs to the Îą-2 subclass of the Proteobacteria (De Ley, 1992). Ochrobactrum tritici was identified as Bacterial strain 5bv11, isolated from a chromium-contaminated waste water treatment plant, which is resistant to a broad range of antibiotics and metals viz. Cr (VI), Ni (II), Co (II), Cd (II) and Zn (II) (Branco et al., 2004). Holmes et al. (1988) proposed Ochrobactrum anthropi as a sole and type species of Ochrobactrum, but they observed heterogeneities in geno- or phenotypic characters within the tested O. anthropi collection. O. anthropi strains have been isolated from samples originating from different continents. Ochrobactrum sp. contains root associated bacteria that enter bivalent interactions with plant and human hosts. Several members of these genera show plant growth promoting as well as excellent antagonistic properties against plant pathogens and were therefore utilized for the development of biopesticides (Weller, 1988; Whipps, 2001). Most available O. anthropi isolates are from human clinical specimens (Lebuhn et al., 2000). O. anthropi LMG 5140 has also been isolated from arsenical cattle dipping fluid (Holmes et al., 1988). Moreover, there are some reports on the presence of O. anthropi in soil, on wheat roots and in internal root tissues of different plants (Anguillera et al., 1993; McInroy and Kloepper, 1994; Sato and Jiang, 1996).

More also, NF-4(Lysinibacillus sp.) could be isolated from the coir pith samples. It is described by Ahmed et al. (2007) as spore forming, Gram-positive, motile, rod shaped and boron-tolerant. A large number of Bacillus strains, including B. fusiformis capable of degrading different hydrocarbons, have been isolated from oil contaminated soils (Bento et al., 2003). It is also considered as a growth promoting agent. In addition to all the useful organisms, some pathogenic microorganisms could also be observed with 50% possibility. Conclusion The results of the study indicated that coir pith is a source of nitrogen fixing bacteria and other useful microorganisms. Coir pith, which was considered as a problematic waste, has been found to harbor useful microorganisms with potential use as plant nutrient. Coir pith can be used as good organic manure after supplementing with efficient nitrogen fixing bacteria. It can therefore be concluded that the coir pith has great potential for use as a source of many useful microorganisms including nitrogen fixing bacteria. ACKNOWLEDGEMENTS First author thanks Prof N Chandramohanakumar, Rajiv

7070

Afr. J. Biotechnol.

Gandhi Chair in Contemporary Studies (RGCCS) for permission to carry out this investigation. Authors also thank Mr. Arun Augustine and K Pillai Raji, RGCCS for continuous encouragement and support.

REFERENCES Ahmed IA, Yokota A, Yamazoe A, Fugiwara T (2007). Proposal of Lysinibacillus boronitolerans gen. nov.., sp. nov., and transfer of Bacillus fusiformis to Lysinibacillus fusiformis comb. Nov. and Bacillus sphaericus to Lysinibacillus sphaericus comb. Nov. Int. J. Syst. Evol. Microbiol., 57: 1117-1125. Anguillera MM, Hodge NC, Stall RE, Smart Jr. GC (1993). Bacterial symbionts of Steinernema scapterisci. J. Invertebr. Pathol. 68: 68-72. Aquilantia L, Favilib F, Clementi F (2004). Comparison of different strategies for isolation and preliminary identification of Azotobacter from soil samples. Soil Biol. Biochem. 36: 1475-1483. Ash C, Priest FG, Collins MD (1994). Molecular identification of rRNA group 3 Bacilli using PCR probe test. Proposal for the creation of a new genus Paenibacillus. Antonie van Leeuwenhoek. 64: 253-260. Baldani JI, Caruso VLD, Baldani SR, Goi J, Dobereiner (1997). Recent advances in BNF with non-legume plants. Soil Biol. Biochem. 29: 911-922. Barraquio WL, Segubre EM, Gonzalez MS, Verma SC, James EK, Ladha JK, Tripathi AK (2000). Diazotrophic enterobacteria: what is their role in rhizosphere of rice? In: Ladha JK, Reddy PM (Eds.), The quest for nitrogen fixation in rice, Los Banos, Philippines., pp. 93-118. Bento FM, Camargo FAO, Okeke B, Frankenberger-junior WT (2003). Bioremediation of soil contaminated by diesel oil. Brazilian J. Microbiol. 34: 65-68. Branco R, Alpoim MC, Morais PV (2004). Ochrobactrum tritici strain 5bv11- characterization of a Cr(VI)- resistant and Cr(VI)- reducing strain. Can J Microbiol. 50(9): 697-703. Burdman S, Dulguerova G, Okon Y, Jurkevitch E (2001). Purification of the major outer membrane protein of Azospirillum brasilense, its affinity to plant roots and its involvement in cell aggregation., Mol. Plant. Microb. Interact. 14: 555-561. Burgmann H, Manuel P, Franco W, Josef Z (2003). Strategy for optimizing quality and quantity of DNA extracted from soil. Bacteriological Rev. 36(2): 295-341. Chelius MK, Lepo JE (1999). Restriction Fragment Length Polymorphism analysis of PCR-amplified nifH sequences from wetland plant rhizosphere communities. Environ. Technol. 20: 883889. Cleveland CC (1999). Global patterns of terrestrial biological nitrogen (N2) fixation in natural ecosystems. Global Biogeochem. Cycle, 13: 623-645. Crawford LD, Crawford RL (1976). Microbial degradation of lignocelluloses: the lignin component. Appl. Environ. Microbiol. 31: 714-717. Dawe D (2000). The potential role of biological nitrogen fixation in meeting future demand for rice and fertilizer. In: Ladha JK, Reddy PM (Eds.), The quest for nitrogen fixation in rice. Los Banos, Philippines. pp. 93-118. De Ley J (1992). The proteobacteria: ribosomal RNA cistron similarities nd and bacterial taxonomy. In The Prokaryotes, 2 edn, Edited by Balows A, Truper HG, Dworkin M, Harder W & Schleifer KH. New York: Springer. pp. 2111-2140. Dijksterhuis J, Sanders M, Gorris LG, Smid EJ (1999). Effect of inoculation with Bacillus polymyxa on soil aggregation in the wheat rhizosphere: preliminary examination. Geoderma 56:479-491. Edward U, Rogall T, Blocker H, Emde M, Bottger EC (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16s ribosomal RNA. Nucleic Acid Res. 17(19): 7843-7853. Fedonenko YP, Egorenkova IV, Konnova SA, Ignatov VV (2001). Involvement of the lipopolysaccharides of Azospirilla in the interaction with wheat seedling roots, Mikrobiologiya., 70(3): 384-390 [Microbiology (Engl. Transl.), 70(3): 329-334.

Ghosh PK, Sarma US, Ravindranath AD, Radhakrishnan S, Ghosh P (2007). A novel method for accelerating composting of coir pith. Energy Fuels, 21: 822-827. Gouzou, Burtin R, Philippy R, Bartoli F, Heulin T (1993). Effect of inoculation with Bacillus polymyxa on soil aggregation in the wheat rhizosphere: preliminary examination. Geoderma. 56: 479-491. Heulin T, Berge O, Mavingui P, Gouzou L, Hebbar KP, Balandreau J (1994). Bacillus polymyxa and Rahnella aquatilis, the dominant N-2 fixing bacteria associated with wheat rhizosphere in French soil. Eur. J. Soil Biol. 30: 35-42. Holmes B, Popoff M, Kiredgian M, Kersters K (1988). Ochrobactrum anthropi gen. nov., sp. nov. from human clinical specimens and previously known as group Vd. Int. J. Syst. Bacteriol. 38: 406-416. James EK, Oliveres FL (1997). Infection and colonization of sugarcane and other graminaceous plants by endophytic diazotrophs. Crit. Rev. Plant Sci. 17: 77-119. Jisha MS, Alagawadi AR (1996). Nutrient uptake and yield of sorghum (Sorghum bicolor L. Moench) inoculated with phosphate solubilizing bacteria and cellulolytic fungus in a cotton stalk amended vertisol. Microbiol. Res. 151: 213-217. Kajimura Y, Kaneda M (1996). Fusaricidin A, a new depsipeptide antibiotic produced by Bacillus polymyxa KT-8 taxonomy, fermentation, isolation, structure elucidation and biological activity . J. Antibiotics, 49: 129-135. Kharbanda PD, Yang J, Beatty P, Jensen S, Tewari JP (1999). Biocontrol of Leptosphaeria maculans and other pathogens of canola th with Paenibacillus polymyxa PKB1. In: Proceedings of 10 International Rapeseed congress. Canberra, Australia. Kjallstrand J, Ramna O, Peterson G (1998) Gas chromatographic and mass spectrometric analysis of 36 lignin- related methoxyphenols from uncontrolled combustion of wood. J Chromatogr. 824: 205-210. Kim YK (1995). Biological control of Phytophtora blight of red pepper by antagonistic Bacillus polymyxa â&#x20AC;&#x2DC;AC-1â&#x20AC;&#x2122;. Seoul National University. Ph.D. Thesis. p .78. Ladha JK, Reddy PM (2000). The quest for nitrogen fixation in rice. Proceedings of the third working group meeting on assessing opportunities for nitrogen fixation in rice, 9-12 Aug. 1999, IRRI, Los Banos, Laguna, Philippines, p. 354. Lebuhn M, Achouak W, Schloter,M, Berge O, Meier H, Barakat M, Hartmann A, Heulin T (2000)., Taxonomic characterization of Ochrobactrum sp. isolates from soil samples and wheat roots and description of Ochrobactrum tritici sp. nov. and Ochrobactrum grignonense sp. nov., Int. J. System. Evol. Microbiol. 50: 2207-2223. Mavingui P, Heulin T (1994). In vitro chitinase and antifungal activity of a soil, rhizosphere and rhizoplane population of Bacillus polymyxa. Soil Biol. Biochem. 26: 801-803. McCarthy AJ, Macdonald MJ, Paterson A, Paul B (1984). Degradation 14 of [ C] lignin-labelled wheat lignocelluloses by white-rot fungi. J. General Microbiol. 130: 1023-1030. McInroy JA, Kloepper JW (1994). Novel bacterial taxa inhabiting internal tissues of sweet corn and cotton. In improving plant productivity with Rhizosphere bacteria , p. 190. Edited by M.H. Ryder, P. M. Stephens & G. D. Bowen. Adelaide: CSIRO. P. 190 Nagarajan R, Manickam T S, Kothandaraman G V (1985) Manurial value of coir pith. Madras Agric J., 72:533-535. Namasivayam C, Kumar MD, Selvi K, Begum A, Vanathi T, Yamuna RT (2001). Waste coir pith- a potential biomass for the treatment of dyeing waste waters. Biomass Bioener. 21(6):477-483. Picard B, Larue JP, Thouvenot D (1995). Gavaserin and Saltavalin, new peptide antibiotics produced by Bacillus polymyxa. FEMS Microbiol. Lett. 133: 215-218. Poly F, Monrozier JL, Bally R (2001). Improvement in RFLP Procedure to study the community of nitrogen fixers in soil through the Diversity of nifH gene. Res. Microbiol. 152: 95-103. Poly F, Ranjard L, Nazared S, Gourbiere F, Monrozier LJ (2001). Comparison of nifH gene pools in soils and soil microenvironments with contrastinig properties. Appl Environ. Microbiol. 67(5): 22552262. Reghuvaran A, Ravindranath AD (2010). Efficacy of biodegraded coir pith for cultivation of medicinal plants. J. Sci. Ind. Res. 69: 554-559. Rosado AS, Seldin L (1993). Production of a potentially novel antimicrobial substance by Bacillus polymyxa. World J. Microbiol.

Reghuvaran et al.

Biotechnol. 9:521-528. Rosch C, Mergel A, Bothe H (2002). Biodiversity of denitrifying and dinitrogen fixing bacteria in acid forest soil. Appl. Environ. Microbiol. 68: 3818-3829. Sambrook J, Fritsch EF, Maniatis T, (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring harbor, New York, USA. Sato K, Jiang JY (1996). Gram-negative bacterial flora on the root surface of wheat (Triticum aestivum) grown under different soil conditions. Biol. Fertil. Soils, 23: 273-281. Shaffer BT, Widmer F, Porteous,L A , Seidler RJ (2000). Temporal and spatial distribution of the nifH gene of N2 fixing bacteria in forests and clearcuts in western Oregon. Microb. Ecol. 39: 12-21. Shishido M, Massicotte HB, Chanway CP (1996). Effect of plant growth promoting Bacillus strains on pine and spruce seedling growth and mycorrhizal infection. Ann. Bot. 77: 433-441. Steenhoubt O, Vanderleyden J (2000). Azospirillum, a free living nitrogen fixing bacteria closely associated with grasses: genetic, biochemical and ecological aspects, FEMS Microbiol. Rev., 24: 487506. Takezaki N, Rzhetsky A, Nei M (2004) Phylogenetic test of the molecular clock and linearized trees. Mol. Biol. Evol. 12: 823-833. Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Tamura K, Nei M, Kumar S (2004) Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. (USA), 101: 11030-11035. Tan Z, Hurek T, Reinhold-Hurek B (2003). Effect of N-fertilization, plant genotype and environmental conditions of nifH gene pools in roots of rice, Environ. Microbiol. 5: 1009-1015. Tarrand JJ, Kreig NR, Dobereriner J (1978). A taxonomic study of the Spirillum lipoferum group, with a description of a new genus, Azospirillum gen.nov., and Two species, Azospirillum lipoferum (Beijerinck) comb.nov., and Azospirillum brasilense sp.nov., Can. J. Microbiol., 24: 967-980. Thampan PK (1987). Handbook of coconut palm. Oxford and IBH Publishers, New Delhi. Timmusk S, Nicander, B, Granhall U, Tillberg E (1999). Cytokinin production by Paenibacillus polymyxa. Soil Biol. Biochem. 31: 18471852. Timmusk S, Van West P, Gow NAR, Paul H (2009). Paenibacillus polymyxa antagonizes oomycete plant pathogens Phytophthora palmivora and Pythium aphanidermatum. J. Appl. Microbiol. 106: 1473-1481. Timmusk S, Wagner EG (1999). The plant growth promoting Rhizobacterium Paenibacillus polymyxa induces changes in Arabidopsis thaliana gene expression: a possible connection between biotic and abiotic stress responses. Mol. Plant Microbe Interact. 12: 951-959. Tyler ME, Milan JR, Smith RL, Schank SC, Zuberer DA (1979). Isolation of Azospirillum from diverse geographical regions, Can. J. Microbiol. 25: 4673-4680.

7071

Vijaya D, Padmadevi S N, Vasandha S, Meerabhai R S, Chellapandi P (2008). Effect of vermicomposted coir pith on the growth of Andrographis paniculata, J. Org. Syst. 3: 51-56. Weller DM (1988) Biological control of soilborne plant pathogens in the rhizosphere with bacteria. Annu. Rev. Phytopathol. 26: 379-407. Whipps JM (2001). Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 52: 487-511. Widmer F, Shaffer BT, Porteous LA, Seidler RJ (1999). Analysis of nifH gene pool complexity in soil and litter at a Douglas fir forest site in the Oregon Cascade mountain range. Appl. Environ. Microbiol. 65: 374380. Zehr JP, Jenkins BD, Short MS, Steward GF (2003). Nitrogenase gene diversity and microbial community structure: a cross system comparison, Environ. Microbiol. 5: 539-554. Zehr JP, Mellon MT, Braun S, Litaker W, Steppe T, Paerl HW (1995). Diversity of heterotrophic nitrogen fixing genes in a marine cyanobacterial mat., Appl. Environ. Microbiol. 61: 2527-2532. Zehr JP, Mellon MT, Zani S (1998). New nitrogen-fixing microorganisms detected in oligotrophic oceans by amplification of nitrogenase (nifH) genes. Appl. Environ. Microbiol. 64: 3444-3450.

African Journal of Biotechnology Vol. 11(27), pp. 7072-7078, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3670 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ2012 Academic Journals

Full Length Research Paper

Salt-induced osmotic stress for lipid overproduction in batch culture of Chlorella vulgaris Xu Duan, Guang Yue Ren, Li Li Liu* and Wen Xue Zhu Food and Biology Engineering College, Henan University of Science and Technology, Luoyang 471003, China. Accepted 17 February, 2012

Effect of NaCl-induced osmotic stress on lipid production was investigated in batch culture of Chlorella vulgaris. Based on the facts that NaCl stress improved lipid production but inhibited cells growth at the same times, the novel strategies of multiple osmotic stresses with different NaCl additions (2 g/L at 80 h, 4 g/L at 100 h, and 6 g/L at 120 h) were adopted for lipid overproduction. Results show that after 180 h cultivation, lipid yield reached 3.16 g/L and intracellular lipid content was 58.6%, increased by 21.1 and 22.9%, respectively, compared to the control. Further applying the strategies to 5 L fermentor, lipid yield of 3.81 g/L was achieved at 180 h, which was 30.1% higher than the control, suggesting application of osmotic stress to lipid overproduction as being feasible. Key words: NaCl-induced osmotic stress, heterotrophic cultivation, lipid, glucose, Chlorella vulgaris. INTRODUCTION Consumption of fossil fuel has been dramatically increased since industrial revolution. The imprudent use of fossil fuel has caused many issues in environment and economics, such as global warming and oil crisis. Due to the limitation of fossil fuel and its increased consumption rate, the need to explore alternative fuels is greatly urgent. Biodiesel, as a biodegradable and renewable fuel source, is considered as an ideal candidate (Lang et al., 2001; Antolin et al., 2002). Biodiesel is mainly made from renewable biological sources such as vegetable oils, animal fats and microalgae lipids. Compared to other two sources, microalgae biodiesel have received much attention in recent years (Xu et al., 2006; Bastianoni et al., 2008). Microalgae were considered as ideal candidates for biodiesel production because of their higher biomass and intracellular lipid content (Ginzburg, 1993; Minowa et al., 1995). To make biodiesel production from microalgae sustainable, Chlorella vulgaris and Chlorella protothecoides were currently used on industrial scale (Chisti, 2007; Wu et al., 2008). It was demonstrated that both strains can be cultured photoautotrophically or heterotrophically (Chih and Wen, 2009). Compared to

*Corresponding author. E-mail: duanxu_dx@163.com. Tel/Fax: +86-379-64282342.

autotrophic way, heterotrophic cultivation of microalgae is considered an efficient alternative due to its higher biomass and productivity (Han et al., 2006). More recently, many researches have been conducted on heterotrophic growth of some microalgae for efficient production of biodiesel (Wen and Chen, 2003; Miao and Wu, 2006). As an intracellular product, the ultimate goal of biodiesel production from microalgae is to obtain maximal lipid yield by increasing biomass and intracellular lipid content. Accordingly, the concerned methods or strategies have been developed (Courchesne et al., 2009; Stephenson et al., 2010). Principal researches were focused on enhancing intracellular lipid content by biochemical engineering approaches. For instance, nitrogen deprivation (Tornabene et al., 1983), silicon deficiency (Lynn et al., 2000), and iron limitation (Liu et al., 2008) were adopted. It was reported that high salinity can stimulate microalgae to accumulate intracellular lipid (Rao et al., 2007). Although salt-induced osmotic stress can stimulate lipid accumulation, its effects on cell growth is scarcely known. Moreover, application of osmotic stress to stimulating lipid production in C. vulgaris and C. protothecoides was never reported. Accordingly, in the present study, the novel strategies of NaCl-induced osmotic stress were developed for lipid overproduction in C. vulgaris. To our knowledge, this is the first study on promoting lipid production by salt-induced osmotic stress.

Duan et al.

Initially, the effects of NaCl stress on cells growth and lipid production were studied. Then based on the results that NaCl can stimulate lipid accumulation but inhibit cells growth simultaneously, the strategies of multiple NaCl stresses were developed. MATERIALS AND METHODS Microorganism and culture medium A high-lipid microalgae strain of C. vulgaris, which was screened and collected in our laboratory, was used in this study. Both seed and batch culture mediums were consisted of bold’s basal media (BBM) supplemented with (g/L): glucose 10, yeast extract 2.0, glycine 1.0 at pH 6.0. The main components used in BBM were (g/L): NaNO3 0.25, MgSO4.7H2O 0.075, NaCl 0.025, K2 HPO4.3H2O 0.075, KH2PO4 0.175, CaCl2.2H2 O 0.025, and trace elements were (10-3 g/L): ZnSO4.7H2O 8.82, MnCl2.4H2O 1.44, MoO3 0.71, CuSO4.5H2 O 1.57, Co(NO3)2.6H2 O 0.49, H3BO3 11.42, EDTA 50.0, KOH 31.0 and FeSO4.7H2O 4.98. Batch cultivation in shake flask and fermentor Flask culture experiments were performed in 250 ml flasks, each containing 50 ml medium after inoculating with 10% (v/v) of seed culture. Culture conditions of temperature, agitation rate, and growth period were fixed at 30°C, 200 rpm and 200 h, respectively. Meanwhile, batch culture with 3 L medium containing 10% (v/v) of seed culture was carried out in 5 L fermentor. The pH was controlled automatically at 6.0 by adding 3 mol/L H2SO4 or NaOH solutions. Agitation speed and temperature were controlled at 200 rpm and 30°C respectively. NaCl-induced osmotic stress The whole batch culture process for lipid production lasted 180 h. For NaCl-induced osmotic stress, the different types of NaCl additions in flask experiments were as follows: NaCl addition at the beginning of cultivation; NaCl with concentrations (2, 4, 6, 8 and 10 g/L) added to the medium at the beginning of cultivation, separated NaCl addition: NaCl with different concentrations (2, 4, 6 and 8 g/L) which were added to the medium separately at various cultivation times (40, 60, 80, 100, 120 and 140 h) and multiple NaCl addition: based on separated NaCl addition, two, three and four points additions of NaCl with three concentrations (2, 4 and 6 g/L) carried out at different times (80,100,120 and 140 h), respectively in flasks.

7073

RESULTS Effects of NaCl added at initial cultivation stage on cells growth and lipid production Although osmotic stress can result in intracellular lipid accumulation in plant, its effect on microalgae growth is scarcely known. Accordingly, to investigate the influence of salt stress on intracellular lipid accumulation and cells growth, NaCl at various levels were added at initial stage in heterotrophic cultivation of C. vulgaris in 5 L fermentor. Initially, the status of cells growth and lipid production without salt addition was investigated. As shown in Figure 1, according to biomass increment and lipid accumulation, the whole process was separated into two phases of cells growth and lipid synthesis. It was noticed that glucose and nitrogen concentrations decreased gradually with cultivation extending. At 120 h, nitrogen source was almost exhausted and cells stopped increasing. At this time point, maximal cell concentration of 5.78 g/L was obtained and intracellular lipid yield was 2.12 g/L. Meanwhile, after nitrogen exhaustion and cell growth has stopped, the intracellular lipid increased continually from 2.12 g/L at 120 h to 2.93 g/L at 180 h, and corresponding lipid content was increased from 37 to 51%. In comparison, as indicated in Table 1, with NaCl stress, cells’ growth were strongly inhibited and in turn led to a decrease in lipid yield. Moreover, the negative impacts of NaCl stress on cells growth and lipid yield were dose-dependent. For instance, as NaCl concentration was increased from 2 to 6 g/L, maximal dry cell weight (DCW) and lipid yield decreased from 5.51 and 2.87 g/L, to 5.11 and 2.77 g/L, respectively. Moreover, as salt concentration increased from 8 to 10 g/L, lipid contents decreased from 55.1 to 52.3%, indicating that the maximal addition amounts should be 8 g/L. It was evident that intracellular lipid contents in all treatments were higher than the control, indicating positive effect of NaCl stress on improving lipid synthesis. Concisely, NaCl added at the beginning of cultivation showed positive effect on intracellular lipid accumulation, but inhibited cells growth simultaneously. As a result, total lipid yields were decreased in all treatments as compared to the control.

Analytical methods The cell concentration was determined after drying cells at 65°C to a constant weight. Culture broths were centrifuged at 8000 rpm for 15 min and cells were washed twice with distilled water and freezedried. Dried cells were then pulverized into powder in a mortar and lipid was extracted by soxhlet method using n-hexane. Intracellular lipid content was obtained by the ratio of total lipid yield to cell concentration. Total nitrogen in medium was analyzed using high temperature TOC/TNb Analyzer LiquiTOC II (Elementar Analysensysteme GmBH, Hanau, Germany). Glucose residue in medium was determined according to the methods described by Miller (1959). All experiment treatments were designed in three parallel and repeated twice and average results were used for final analysis.

Effects of NaCl addition times and amounts on lipid production Based on previous results, we safely concluded that it is unsuitable to add NaCl at the initial culture time for enhancing lipid production. So it is necessary to investigate effects of addition times and amounts on lipid production. Moreover, because it is unpractical to conduct all experiments in fermentor under the same condition at one time, the following experiments were carried out in flasks. NaCl concentrations with 2, 4, 6, and 8 g/L were added

Afr. J. Biotechnol.

Glucose concentration (g/l)

0.35

0.30

0.25 6 0.20 0.15

0.10 2

0 0

100

120

140

160

Dry cell weight (g/l)

Nitrogen concentration (g/l)

7074

0.05

0.00 180

0 0

Time(h)

100

120

140

160

180

120

140

160

180

Time (h)

3.0

54 51

2.5 48

Lipid content (%)

Lipid yield(g/l)

2.0

1.5

1.0

45 42 39 36

0.5 33 0.0

30 0

100

120

140

160

180

Tim(h) e (h) Time

100

Time(h) (h) Time

Figure 1. Effects of NaCl added at initial culture time on cells growth and lipid production. ◊, Nitrogen concentration; ◆, glucose concentration; ■, lipid yield; □, lipid content; ▲, dry cell weight.

at 40, 60, 80, 120, and 140 h, separately. As shown in Table 2, without NaCl addition, maximal DCW of 5.47 g/L was achieved at 120 h and maximal lipid yield reached 2.61 g/L at 180 h. Consequently, to better compare cells growth and lipid production in treatments with the control, cell concentration and lipid yield of all treatments were measured at 120 and 180 h, respectively, in the following works. Apparently, NaCl stress effectively induced lipid synthesis but inhibited cells growth simultaneously, especially at cell growth phase. Moreover, this inhibition was positively proportional to NaCl levels and inhibition degree accelerated with advancing of NaCl addition times. For example, with 2 g/L NaCl added at 40 and 80 h, DCW of 5.36 and 5.42 g/L were achieved at 120 h and lipid yields reached 2.66 and 2.73 g/L after 180 h cultivation. Also, 6 g/L NaCl stress addition at 120 h achieved the highest lipid yield of 2.95 g/L in all treatments.

It was fascinating that, with lower NaCl added at 40, 60, 80 and 100 h or higher added at 120 and 140 h, a comparatively higher lipid yield can be achieved. Meanwhile, the negative impact of NaCl on cells growth was insignificant with 2 g/L of NaCl added at 80 h and 4 g/L added at 100 h, indicating the inhibition degree can be minimized by adding lower NaCl at cells growth phase. Moreover, at lipid synthesis phase, lipid production was negatively proportional to NaCl addition times, which suggests that suitable times for NaCl addition perhaps were at 120 and 140 h. Briefly, based on the phenomenon that NaCl stress can greatly promote lipid production but inhibit cell growth at the same times, we speculated that NaCl added with lower level at cells growth phase and higher one at stationary phase can maximize lipid yield while minimize cells growth inhibition. Accordingly, the types of multiple NaCl additions were further conducted.

Duan et al.

7075

Table 1. Effects of NaCl added at initial culture time on cells growth and lipid production.

Parameter Dried cell weight (g/L) Lipid yield (g/L) Lipid content (%)

2 g/L NaCl 5.51 ± 0.03 2.87 ± 0.02 52.1 ± 0.2

4 g/L NaCl 5.32 ± 0.022 2.82 ± 0.02 53.0 ± 0.2

6 g/L NaCl 5.11 ± 0.02 2.77 ± 0.01 54.2 ± 0.3

8 g/L NaCl 4.86 ± 0.01 2.68 ± 0.01 55.1 ± 0.3

10 g/L NaCl 4.61 ± 0.01 2.41 ± 0.01 52.3 ± 0.2

Table 2. Effects of NaCl addition amounts and times on lipid production in flask.

Addition time (h) -

Dry cell weight (g/L) 5.47 ± 0.03

Lipid yield (g/L) 2.61.3 ± 0. 2

Lipid content (%) 47.71 ± 0.01

40 60 80 100 120 140

5.36 ± 0.02 5.38 ± 0.02 5.42 ± 0.03 5.45 ± 0.03 5.47 ± 0.03 5.47 ± 0.04

2.66 ± 0.01 2.69 ± 0.01 2.73 ± 00.2 2.76 ± 00.2 2.78 ± 00.3 2.65 ± 0.02

49.63 ± 0. 2 50.00 ± 0. 2 50.37 ± 0.3 50.64 ± 0.3 50.82 ± 0.3 48.45 ± 0.2

40 60 80 100 120 140

5.32 ± 0.01 5.34 ± 0.02 5.38 ± 0.04 5.41 ± 0.04 5.47 ± 0.03 5.47 ± 0.04

2.71 ± 0.02 2.75 ± 0.03 2.81 ± 0.02 2.85 ± 0.03 2.89 ± 0.03 2.67 ± 0.01

50.94 ± 0.2 51.15 ± 0.3 52.23 ± 0.4 52.68 ± 0.4 52.83 ± 0.3 50.64 ± 0.2

40 60 80 100 120 140

5.29 ± 0.01 5.31 ± 0.02 5.34 ± 0.05 5.38 ± 0.05 5.47 ± 0.04 5.47 ± 0.04

2.74 ± 0.02 2.78 ± 0.02 2.84 ± 0.03 2.88 ± 0.03 2.95 ± 0.04 2.79 ± 0.01

51.80 ± 0.1 52.35 ± 0.2 53.18 ± 03 53.53 ± 0.4 53.93 ± 0.3 50.01 ± 0.3

40 60 80 100 120 140

5.24 ± 0.02 5.28 ± 0.01 5.32 ± 0.04 5.35 ± 0.04 5.47 ± 0.03 5.47 ± 0.03

2.68 ± 0.03 2.720 ± 0.02 2.79 ± 0.02 2.83 ± 0.03 2.88 ± 0.03 2.75 ± 0.02

51.15 ± 0.1 51.52 ± 0.2 52.44 ± 0.3 52.90 ± 0.2 52.65 ± 0.3 50.27 ± 0.2

Concentration of NaCl (g/L) Control

DCW and lipid yield were measured at 120 and 180 h respectively. DCW, Dry cell weight.

Multiple NaCl additions with differed times and amounts Based on foregoing single addition results that lower NaCl levels of 2 and 4 g/L added at 80 h and at 100 h insignificantly affected cells growth while greatly promoted lipid production, and 6 g/L NaCl added at 120 h achieved the highest lipid yield, three NaCl concentrations of 2, 4 and 6 g/L were used to study impact of multiple NaCl additions on lipid production. Additional

ways of two, three and four points of NaCl additions with different concentrations and times were adopted. As indicated in Table 3, three spots NaCl stresses (2 g/L at 80 h, 4 g/L at 100 h and 6 g/L at 120) achieved a lipid yield of 3.16 g/L at 180 h and corresponding intracellular lipid content was 58.6%, which were 21.1 and 22.9% higher than the control. Meanwhile, we noticed that further frequent induction by NaCl stress at stationary phase cannot enhance lipid yield greatly. For example, four spots NaCl stresses (2 g/L at 80 h, 4 g/L at

7076

Afr. J. Biotechnol.

Table 3. Effects of multiple NaCl addition on cells growth and lipid production in flasks.

No.

1 2 3 4 5 6 7 8

2 2 2 0 0 2 2 2

Addition time (h) 100 120 140 Concentration of NaCl (g/L) 4 0 0 0 6 0 0 0 6 4 6 0 4 0 6 4 6 0 4 0 6 4 6 6

Experimental result DCW (g/L)

Lipid yield (g/L)

Lipid content (%)

5.39 ± 0.02 5.42 ± 0.01 5.42 ± 0.01 5.41 ± 0.02 5.41 ± 0.03 5.39 ± 0.02 5.39 ± 0.02 5.39 ± 0.02

2.96 ± 0.02 2.99 ± 0.2 2.92 ± 0.01 3.03 ± 0.03 2.95 ± 0.02 3.16 ± 0.03 3.11 ± 0.03 3.18 ± 0.03

54.9 ± 0.3 55.2 ± 0. 2 53.9 ± 0.2 56.1 ± 0.3 54.5 ± 0. 2 58.6 ± 0.3 57.7 ± 0.3 59.1 ± 0. 4

DCW and lipid yield were measured at 120 and 180 h respectively. DCW, Dry cell weight.

4.0

3.5

2.5 2.0 1.5

Lipid content(%)

Lipid content (%)

Lipid yield(g/l)

Lipid yield (g/l)

3.0

1.0 40

0.5

0.0 0

100

120

140

160

180

Time (h) Time (h)

100

120

140

160

180

Time (h)

Figure 2. Enhanced lipid production by multiple NaCl addition in 5 L fermentor. ■, Lipid yield; □, lipid content.

100 h, 6 g/L at 120 and 140 h) led to a lipid yield of 3.18 g/L, which was slightly higher than three point’s stresses. It was suggested that NaCl addition with three points is feasible for lipid overproduction. As it is known, the pH value cannot be kept constant in flask experiments. As a result, relatively lower cell concentration and lipid yield were obtained as compared to that in fermentor. For example, maximal DCW and lipid yield were 5.47 and 2.61 g/L in the control of flask experiments, while the corresponding values were 5.78 and 2.93 g/L in 5 L fermentor. Accordingly, to test the effectiveness of the strategies developed in flasks, three points NaCl additions were further applied to 5 L fermentor.

Maximized lipid production by applying multiple NaCl additions to 5 L fermentor According to foregoing results, it was known that three points NaCl additions are feasible and practical in improving lipid yield. However, since pH change was the main factor leading to a decrease in cell concentration and lipid yield in flask experiments compared to that in fermentor. Consequently, three points NaCl additions were further applied to batch culture in 5 L fermentor. As indicated in Figure 2, with three points NaCl additions (2 g/L at 80 h, 4 g/L at 100 h and 6 g/L at 120 h), maximal lipid yield and corresponding intracellular lipid content reached 3.81 g/L and 67.2% after 180 h cultivation, which

Duan et al.

were 30.1 and 31.8% higher than the control. Furthermore, with three points salt additions, we found that lipid yield was changed from 3.16 g/L in flask to 3.81g/L in 5 L fermentor, increased by 20.6%, which indicates that pH affects lipid synthesis as well as cells growth. In short, a significant increase was observed in lipid yield via salt stresses, suggesting the feasibility of the proposed strategies for lipid overproduction.

DISCUSSION Microalgae were suggested as very good candidates for biodiesel production because of their rapid growth and higher lipid yield (Minowa et al., 1995). Some microalgae, such as C. vulgaris and C. protothecoides, are exceedingly rich in lipid and used for lipid production. Lipid yield can be improved by increasing cell concentration and intracellular lipid content. However, an increase in biomass can inevitably lead to lowered intracellular lipid content. As a result, some methods or strategies, such as nitrogen deprivation (Tornabene et al., 1983), were adopted to enhance lipid accumulation. Besides nutrition supply, environmental conditions such as dissolved oxygen, temperature and pH also significantly affect cells growth and products production (Elibol, 2002). Recently, much attention has been paid to the response of plants or microorganisms to osmotic stress (Ruiz and Blumwald, 2002; Liang et al., 2009). For example, investigations showed that high salinity can stimulate lipid accumulation in microalgae (Rao et al., 2007). However, up to date, effects of salinity on cells growth and lipid production in heterotrophic cultivation of microalgae were little known. As an intracellular product, lipid production was closely related to biomass and lipid content. Salt stress significantly affects cells growth and lipid formation. Accordingly, how to maximize lipid production by optimizing salt stress is the point we tried to explore. In this study, NaCl-induced osmotic stress was adopted to stimulate lipid accumulation in C. vulgaris. As a result, an increase in lipid yield was observed, which can be explained by a protective mechanism that cells synthesized lipid excessively to avoid injuries caused by salt stress. However, we found that effects of single salt stress on cells growth and lipid production were time and concentration dependent. In particular, cell growth was strongly affected which in turn led to a significantly negative effect on lipid accumulation when salt was added at the beginning of cultivation. As expected, the multiple salt additions strategies with lower salt concentration added at cells growth phase and higher one at the stationary phase would maximize lipid yield, while minimizing its negative effect on cells growth. By adopting this novel strategy of multiple salt stresses (2 g/L at 80 h, 4 g/L at 100 h and 6 g/L at 120 h), a lipid yield of 3.81 g/L was achieved and the corresponding intracellular lipid content reached 67.2%.

7077

In conclusion, a strategy based on defensive mecha-nism of C. vulgaris to NaCl-induced osmotic stress was adopted to enhance lipid production. To maximize intracellular lipid yield but minimize inhibition of cells growth, a multiple salt addition method was developed. It can be said that the novel strategy developed is a feasible method in lipid production. Although osmotic + stress can lead to lipid accumulation in microalgae, Na perhaps also play a positive role in stimulating lipid synthesis. Therefore, we will further investigate the role of Na+ in inducing lipid accumulation in future study. ACKNOWLEDGEMENTS This project was financially supported by Natural Science Research Program of the Education Department of Henan Province under the contract of No. 2011B550003 and Doctoral Research Program of Henan University of Science and Technology under the contract of No. 09001417. REFERENCES

Antolin G, Tinaut FV, Briceno Y (2002). Optimisation of biodiesel production by sunflower oil transesterification. Bioresour. Technol. 83: 111-114. Bastianoni S, Coppola F, Tiezzi E, Colacevich A, Borghini F, Focardi S (2008). Biofuel potential production from the Orbetello lagoon macroalgae: A comparison with sunflower feedstock. Biomass Bioenergy, 32(7): 619-628. Chih HH, Wen TW(2009). A novel photobioreactor with transparent rectangular chambers for cultivation of microalgae. Biochem. Eng. J. 46: 300-305. Chisti Y (2007). Biodiesel from microalgae. Biotechnol. Adv. 25(3): 294306. Courchesne NMD, Parisien A, Wang B, Lan CQ (2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. J. Biotechnol. 141: 31-41. Elibol M (2002). Product shifting by controlling medium pH in immobilized Streptomyces coelicolor A3(2) culture. Process Biochem. 37: 1381-1386. Ginzburg BZ (1993). Liquid fuel (oil) from halophilic algae: A renewable source of non-polluting energy. Renew. Energy, 3: 249-252. Han X, Miao XL, Wu QY(2006). High quality biodiesel production from a microalgae Chlorella protothecoides by heterotrophic growth in fermenters. J. Biotechnol. 126: 499-507. Lang X, Dalai AK, Bakhshi NN (2001). Preparation and characterization of bio-diesels from various bio-oils. Bioresour. Technol. 80: 53-62. Liang GB, Du GC, Chen J (2009). Salt-induced osmotic stress for glutathione overproduction in Candida utilis. Enzym. Microb. Technol. 45: 324-329. Liu ZY, Wang GC, Zhou BC (2008). Effect of iron on growth and lipid accumulation in Chlorella vulgaris. Bioresour. Technol. 99: 47174722. Lynn SG, Kilham SS, Kreeger DA, Interlandi SJ (2000). Effect of nutrient availability on the biochemical and elemental stoichiometry in freshwater diatom Stephanodiscus minutulus acillariophyceae. J. Phycol. pp. 510-522. Miao XL, Wu QY (2006). Biodiesel production from heterotrophic microalgal oil. Bioresour. Technol. 105: 1432-1440. Miller GL(1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: 426-429. Minowa T, Yokoyama SY, Kishimoto M, Okakurat T (1995). Oil production from algal cells of Dunaliella tertiolecta by direct thermo-

7078

Afr. J. Biotechnol.

chemical liquefaction. Fuel, 74: 1735-1738. Rao AR, Dayananda C, Sarada R, Shamala TR., Ravishankar GA (2007). Effect of salinity on growth of green alga Botryococcus braunii and its constituents. Bioresour. Technol. 98: 560-564. Ruiz JM, Blumwald E (2002). Salinity-induced glutathione synthesis in Brassica napus. Planta, 214: 965-969. Stephenson AI, Dennis JS, Howe CJ, Scott SA, Smith AG (2010). Influence of nitrogen limitation regime on the production by Chlorella vulgaris of lipids for biodiesel feedstocks. Biofuels, 1: 47-58. Tornabene TG, Holzer G, Lien S, Burris N (1983). Lipid composition of the nitrogen starved green alga, Neochloris oleoabundans. Enzym. Microb. Technol. 5: 435-440.

Wen ZY, Chen F (2003). Heterotrophic production of eicosapentaenoic acid by microalgae. Biotechnol. Adv. 21: 273-294. Wu Q, Xiang J, Li X, Xiong W (2008). High-density fermentation of microalgal Chlorella protothecoides in bioreactor for microbio-diesel production. Appl. Microbiol. Biotechnol. 78: 29-36. Xu H, Miao X, Wu Q (2006). High quality biodiesel production from a microalgae, Chlorella protothecoides, by heterotrophic growth in fermenters. J. Biotechnol. 126(4): 499-507.

Full Length Research Paper

Production and partial characterization of an exopolysaccharide from Ustilago maydis in submerged culture Cornejo-Mazón Maribel1, Hernández-Sánchez Humberto1, Gutiérrez-López Gustavo F1, Dorantes-Alvarez Lidia1, Cortés Sánchez Alejandro de Jesús1, Jiménez-Aparicio Antonio2, Gimeno-Seco Miguel3, Moreno Abel4 and Jaramillo- Flores María .E1* 1

Departamento de Graduados e Investigación en Alimentos, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Carpio y Plan de Ayala, CP 11340 México, D. F. 2 Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional. Km 8.5 Carretera Yautepec-Jojutla, Col. San Isidro, C.P.62731 Yautepec, Morelos, México. 3 Departamento de Alimentos y Biotecnología, Facultad de Química. Universidad Nacional Autónoma de México. Ciudad Universitaria. Colonia Copilco Universidad, CP 04360 México, D. F. 4 Departamento de Bioquímica. Instituto de Química. Universidad Nacional Autónoma de México. Ciudad Universitaria. Colonia Copilco Universidad, CP 04510 México, D. F. Accepted 1 March, 2012

In Mexico, corn is widely cultivated and frequently parasitized by Ustilago maydis, a basidiomycete dimorphic fungus that causes the disease known as corn smut. It is widely consumed and is considered a culinary delight. From a biotechnological perspective, U. maydis offers the possibility as a producer of various metabolites, such as laccase and tyrosinase enzymes, glycolipids, and indole derivatives that can be used in pharmaceutical, cosmetic and food, due to its safety. The exopolysaccharides (EPS) are extracellular sugar compounds synthesized by a variety of microorganism and have shown various properties and applications. Among them are the improved rheology, texture, stability and mouthfeel of fermented dairy products. In addition, these compounds have shown biological activity as an antitumor agent, immune-stimulating and reducing blood cholesterol. The production of EPS by U. maydis was studied by culturing the cells in yeast extractpeptone-dextrose (YPD), YPD supplemented with CuSO4 (YPDT ), Czapek Dox-sucrose, Czapek Doxglucose, Czapeck Dox culture media with corn steep liquor and in another media containing high oil oleic sunflower as the sole carbon source. The presence of activity of glycosyltransferase by sodium dodecyl sulfate-polyacrylamide gel electrophresis (SDS-PAGE) was detected as well as the polymers formed by dinitrosaliscilic acid (DNS). The products of fermentation were characterized by enzymatic hydrolysis using carbohydrases, gel permation chromatography and atomic force microscopy. Key words: Ustilago maydis, glucans, polymerization, glycosyltransferase, exopolysaccharide. INTRODUCTION Ustilago maydis is a basidiomycete dimorphic fungus which causes the disease known as corn smut in Zea

*Corresponding author. E-mail: Jaramillo_flores@hotmail.com, mjarfl@ipn.mx. Tel: +[52] 55 57296000/62464. Fax: +[52] 55 57296000/62359.

mays and Zea diploperenis. This occurs when the fungus is in its dikaryotic fungus phase, producing infected bodies or ears. It is called huitlacoche in Mexico, where it is consumed as a culinary delicacy. When cultured in the laboratory, U. maydis grows, forming haploid cells called sporidia (Banuett and Herskowitz, 1996; Juarez et al., 2011). This fungus, as

7080

Afr. J. Biotechnol.

well as Candida bombicola, Schizonella melanogramma and Geotrichum candidum, is a producer of two extracellular glycolipid biosurfactants: 1) manosileritritol lipids or ustilipids (MEL), 4-O-β-D-mannopyranosyl-Derythritol which is esterified with short and medium size fatty acid chains (C2 to C8 and C10 to C18, respectively) as well as acetyl groups and 2) cellobiose lipids also known as ustilagic acid in which the disaccharide is attached through an o-glycosidic bond to a ω-hydroxy group of the 2,15,16-trihydroxy-o 15.16 – dihydroxihexadecanoic acid (Spoeckner et al., 1999; Hewald et al., 2005; Bolker, et al., 2008; Cortés et al., 2011). Exopolysaccharides (EPS) are formed by various types of sugars. They may also contain proteins and are synthesized by the combined action of different types of glycosyltransferases (GTFs) as in the case of β-glycans (Pacheco et al., 2006), or are produced from a single substrate such as sucrose, thus producing glycans and fructans (Van Hijum et al., 2006). Since these compounds are excreted to the culture media, bioseparation operations aimed at their purification do not necessarily include cell breakage. Biological glycans are constituted from a single carbohydrate unit to complex polysaccharides arrangements such as the chitin and β-1,3 glycans which are structural component of cell walls of fungi. In U. maydis, the chitin is the main structural component of cell walls and is synthesized by UDP-glucose β(1,3)-D-glucan and β(1,4)D-glycosyltransferase (Klutts et al., 2006). Glycosyltransferases are enzymes (EC 2.4) that catalyze the transfer of a monosaccharide from an activated nucleotide sugar to specific acceptor molecules, forming glycosidic bonds. There are descriptions on the activity of glycosyltransferases (GTFs) (ß-glucan synthetase) associated to cell membranes that are able to produce glycans constituted by 60-80 residues of glucose by using UDP-glucose as substrate Douglas (2001). However, there are no reports on the activity of glycosyltransferase by U. maydis and on the consequent production of a polysaccharide. Exopolysaccharides (EPS) are long-chain molecules produced and excreted mainly by bacteria and microalgae. EPS consist of branched units of sugars or sugar derivatives (Patel et al., 2011) which occasionally contain proteins and are synthesized by the combined action of different GTFs as in the case of β-glycans (Pacheco et al., 2006) or are produced by a single substrate by the action of sucrose, thus producing glycans and fructans (Van Hijum et al., 2006). EPS play a vital role in the protection of the microbes from adverse conditions such as water and osmotic stresses, nutrient shortage, presence of toxic compounds, bacteriophages, and to the action of antagonists (Looijesteijn et al., 2001; Patel et al., 2011; Donot et al., 2012). Microbial EPS can be classified into two groups based on their composition of monosaccharides and on the biosynthetic pathways

involved in their production (Jolly et al., 2002). The homopolysaccharides (HoPS) include, dextran, mutan, alternan, reuteran, pullulan, levan, inulin, curdlan, etc., and consist of identical monosaccharides such as Dglucose or D-fructose and can be divided into two major groups: glucans and fructans. On the other hand, the heteropolysaccharides (HePS) comprise gellan, xanthan, and kefiran (Monsan et al., 2001; Patel et al., 2011; Donot et al., 2012). The biosynthesis of EPS includes three main steps: 1) assimilation of a carbon substrate, 2) intracellular synthesis of the polysaccharides and 3) EPS excretion of the cell (Vandamme et al., 2002). Lactobacillus casei CG11 cultured using various carbon sources such as glucose, sucrose, maltose, and lactose at a concentration of 20 g/L, showed a production of 160, 50, 60, 45 mg/L of EPS, respectively showing that the carbon source had an effect on EPS production (Cerning et al.,1994). Leifa et al. (2007) reported that the fungus A. brasiliensisi produced 2.3 mg/ 50 ml of EPS using glucose as carbon source and 3.4 mg/ 50 ml using sucrose. The same microorganism, when using yeast extract as a nitrogen source produced 9.4 mg/ 50 ml of EPS and 2.2 mg/ 50 ml when using peptone. The yield of EPS by lactic acid bacteria (LAB) depends on the strain and on the culture conditions such as temperature, concentration of oxygen, pH, and time of incubation. For achieving appropriate yields, a deep understanding of biosynthetic pathways are involved, and their relation to biological structures is mandatory (Patel et al., 2011). One of the most important characteristics of EPS from basidiomycetes and other microorganism such as LAB is their action as antimutagenic, hypoglycemic, hypocholesterolemic, anti-inflammatory, antitumor, antiviral, bactericides, antiparasitic and immunomodulator agents (Selbman et al., 2002; Patel et al., 2011). In this category, it is possible to find various β-glycans such as scleroglucan (Selbman et al., 2002), botryospheran from Botryosphaeria rhodina (Miranda et al., 2007) and a glucan having anti-inflammatory action from Collybia dryophila and Lentinus edodes having β (1,3) and β(1,4) bonds (Pacheco et al., 2006). The objective of this work was to produce and carry out a partial characterization of an exopolysaccharide from U. maydis in submerged culture using different carbon sources. MATERIALS AND METHODS Biological material U. maydis FBD12 (diploid strain) used for this work was kindly donated by Ms. Flora Banuett from California State University, USA, and kept in 50% [v/v] glycerol solution at -70°C. Strain was cultured at 32°C in yeast extract-peptone-dextrose broth (YPD), using Erlenmeyer flasks and in conditions of agitation, using an orbital shaker at 200 rpm until culture reached stationary phase (48 h). Initial concentration of the inoculums was 3 g/L. Culture media YPD and YPD supplemented with CuSO4 (YPDT) as well as Czapek Dox

Maribel et al.

added with glucose, sucrose or corn steep liquor culture media were used for the detection of glycosyltransferase. Culture media containing oil was used for the detection of the polysaccharide (Spoeckner et al., 1999).

7081

Applied power was 120 volts for 90 min and gels were stained with Coomassie blue G-250 and distained by using a mixture of methanol: acetic acid: water (3:1:6 v:v:v) (Bio-Rad Laboratories, Miniprotean II Instruction Manual). All experiments were made in triplicates.

Culture media composition For yeast extract-peptone-dextrose broth (YPD), yeast extract (10 g), peptone (20 g), and dextrose (20 g) were dissolved in distilled water (1 L) and 15 g of bacteriological agar were added (Ausubel et al., 1994). For Czapek Dox medium, dextrose or sucrose (30 g) or corn steep liquor (CSL) (0.6 ml), NaNO3 (3 g), K2HPO4 (1 g), Mg SO4 (0.5 g), KCl (0.5 g), FeSO4 (0.01 g) were dissolved in 1 L of distilled water. Medium with addition of oil for the production of glycolipids (SWNL) was prepared by using the following compounds (Spoeckner et al., 1999): K2HPO4 (1 g), citric acid (0.2 g), MgSO4 (0.4 g), FeSO4 (0.03 g), corn steep liquor (CSL)(0.6 ml), CaCO3 (1.5 g), NH4SO4 (1.3 g), and sunflower oil with 75% oleic acid (20 ml) which were dissolved and dispersed in 1 L of distilled water. CSL was added to YPD and Czapek Dox culture media instead of dextrose or sucrose, to to find out possible inducing effects of this ingredient on the production of the EPS. Preparation of an extract containing glycosyltransferase and polysaccharide Cells were separated by centrifugation from media SWNL at 3, 5, 7 and 9 days of fermentation. Supernatant was subjected to fractioned precipitation with (NH4)2SO4 until reaching 90% saturation and centrifuged at 10000 ×g for 30 min and cells were resuspended in phosphate buffer (1 mM, pH 6.8) containing phenylmethylsulphonyl fluoride (PMSF). Then, the suspension was concentrated by using an Amicon ultrafilter at 4°C, using a 10 kDa cut off membrane in a nitrogen atmosphere. Obtained extract (EC) or retentate was used to measure the activity of glycosyltranferase with 3, 5 dinitrosalicylic acid (DNS) (Miller, 1959). All experiments were made in triplicates. Determination of protein Protein was evaluated following the Bradford (1976) method, using bovine serum albumin (Sigma-Aldrich) to construct the standard curve and commercial Bradford reagent (Sigma-Aldrich). All experiments were made in triplicates. Activity of glycosyltransferase Glycosyltransferase activity was determined using dinitrosalicylic acid (DNS). Each sample was transferred to a 10 ml test tube; 1.5 ml of DNS were added, mixed with 50 µl of enzymatic extract and stirred by means of a vortex. Test tubes were covered with a cap and heated in boiling water for 15 min and immediately transferred to a cold water bath. 2 ml of deionized water were added to each tube and mix stirred in a vortex. Absorbance at 550 nm was registered using as blank, the buffer solution that contained the sample. All experiments were made in triplicates. Molecular weight determination (PAGE) Electrophoresis was carried out in polyacrylamide gels (7.5%).

Detection of glycosyltransferase by PAGE using Schiff staining reaction Extract containing glycosyltransferase was separated using PAGE as previously described. Gel was incubated for 18 h at 37°C in a 0.2 M PBS buffer at pH 6 containing 1% sucrose and washed with distilled water and immersed in a 1% periodic acid for 10 min. After this, gel was washed with distilled water and stained with Schiff reagent for 25 min and washed out three times with acetic acid solution (7%) and kept for 24 h in the absence of light. Positive reaction indicating the existence of glycosyltransferase was associated to the presence of pink bands (Jung et al., 2007). All experiments were made in triplicates.

Determination of molecular weight of the polysaccharide To evaluate the possible formation of polymers by the catalytic action of glycosyltransferase, the extract was incubated with dextran blue 2000, UDP-glucose and dextran blue 2000 + UDPglucose as initiators of polymerization with and without (blank) 1% sucrose solution in 0.2 M PBS pH 6 buffer for 18 h. The final extract (500 µl) was added with 120 µl of the extract, 370 µl of sucrose solution, 10 µl of dextran blue and 10 µl of UDP-glucose; the final volume was adjusted to 1.5 ml with buffer solution. For the blank samples, buffer solution was used instead of sucrose solution. When reaction was completed, proteins were precipitated with 40% trichloroacetic acid (TCA) and resulting solution was filtered and analyzed in a Zetasizer nano (Malvern Instruments Zetasizer Nano Apllication Note MRK577-01) at 25°C to evaluate possible presence and size of extracellular materials (Dextran blue 2000 and UDPglucose were used as standards). All experiments were made in triplicates. Characterization of the polysaccharide by gel permeation chromatography (GPC) Molecular weight determination and partial characterization of the polysaccharide was carried out in an HP Polymer Laboratories PLELS 100 chromatograph, equipped with two fluid bed columns (GPC/SEC PL gel 10 µm MIXED-BLS 300 × 7.5 mm) arranged in serial mode and Cirrus software was used for data processing. The nebulization and evaporation chambers where operated at 40 and 80°C respectively. Calibration was made with polystyrene standards and the molecular weights ranged from 162 to 6,000,000 kDa. Mobile phase was tetrahydrofurane (Merck THF), flow to flow rate was 1.0 ml/min and volume of injection was 20 µl. All experiments were made in triplicates.

Enzymatic hydrolysis Characterization of polysaccharides was carried out by enzymatic hydrolysis using ß-glucanase from Trichoderma longibrachiatum (CELLUZYME from ENMEX); ß-glucosidase (G-4511 Sigma); mixture of β-glucanase and β-glucosidase; lipase (L-1754 Sigma) and bacterial alkaline protease from Bacillus licheniformis (DETERZYME® L-660 from ENMEX). The final volume of each test

7082

Afr. J. Biotechnol.

Table 1. Enzyme activity in the raw extracts from the fermentation in all the culture media.

Culture medium YPD YPD T YPD CSL Czapek Dox with glucose Czapek Dox with sucrose CZ CSL SWNL 3º SWNL 5º SWNL 7º SWNL 9º

Glycosyltransferase activity -1 -1 (µ µmol of glucose ml min ) 0.844±0.042 0.0436±0.002 0.94±0.047 0.0704±0.02 1.32±0.066 1.11±0.055 0.29±0.014 0.99±0.049 2.02±0.10 0.66±0.033

-1

Protein (mg ml-1)

EAU mg of protein

0.472±0.023 1.216±0.06 2.2±0.110 0.534±0.026 1.33±0.066 2.1±0.10 4.2±0.21 4.8±0.24 7.0±0.35 2.2±0.11

1.79±0.08 0.03±0.001 0.422±0.02 0.132±0.006 0.99±0.04 0.52±0.02 0.07±0.003 0.208±0.01 0.29±0.014 0.297±0.014

YPD= Yeast extract, peptone and dextrose broth; YPD T= YPD with copper sulfate; YPD CSL= YPD with corn steep liquor; CZ CSL = Czapek Dox with corn steep liquor; SWNL = broth used for the production of glycolipids analyzed after 3, 5, 7 and 9 days of fermentation and in triplicate each. Results are the average of three determinations ± standard error.

was 200 µl and contained 198 µl of extract and any of the following enzymes: 2 mg of ß-glucanase, 6 mg of ß-glucosidase, 2 mg of lipase and 1 mg of protease (Pacheco et al., 2006). Reactions with β-glucanase and β-glucosidase were carried out at 50°C for 1 h in 0.1 M, pH 5 citrate buffer while reactions with lipase were carried out at 37°C for 60 min in 0.1 M, pH 8 phosphate buffer. Reactions with protease were performed at 50°C for 2 h in PBS 0.1 M, pH 8 buffer. Blank samples did not contain enzymatic extract. From each experiment, 120 µl of sample were added with 1 ml of HPLC purity tetrahydrofurane prior to analysis by gel permeation chromatography (GPC). All experiments were made in triplicates. Atomic force microscopy Polymers obtained from the extract and in various solvents were observed using Atomic Force Microscopy, Nanoscope IIIa (AFM), Digital Instruments Veeco, Santa Barbara California USA. For scanning samples, silicon nitride probes were used with a force of contact of 0.3 N/m. Two microliter (2 µl) of sample were used for the observation onto plates of muscovite (KAl2(Si3 Al)O10(OH, F)2). Different observation areas were considered according to sample and magnification applied. Applied frequencies were 2 to 10 Hz per line and scanning was performed once polymer was detected. Images were captured from monitor in tagged image file (TIF) format for further analysis. Blank samples had the polymer dissolved in tetrahydrofurane (THF) which was used in GPC runs. Samples labeled “THF-water” were prepared by evaporation of THF and re-suspended in water. Samples labeled as “mixture” were treated with β-glucosidase and β-glucanase. Those samples labeled as “in acetone” are those that were treated with this solvent before GPC experiments to eliminate possible presence of proteins. Those labeled as “in chloroform” were treated with this solvent prior to GPC experiments to eliminate possible presence of proteins. All experiments were made in triplicates.

RESULTS AND DISCUSSION Activity of glycosyltransferase in different culture media The highest biomass production was observed in SWNL

medium (18.1 g/L), followed by YPDT (15.67 g/L), YPD (9.30 g/L), Czapek Dox-sucrose (4.1 g/L) and finally, Czapek Dox-glucose (3.7 g/L); this could probably be explained by a high lipase activity. Maximum glycosyltransferase activity was observed in YPD media (1.8 times activity obtained when using Czapek Dox-sucrose media), followed by that found in Czapeck Dox with corn steep liquor (CZ CSL) and, in descending order: YPD with corn steep liquor (YPD CSL) > SWNL at 5, 7 and 9 days of fermentation, and finally in Czapeck Dox media with added glucose (13.5 times less activity than YPD) (Table 1). In the case of YPD, addition of Cu++ probably decreased the total protein production or inhibited enzyme activity. When using Czapeck Dox-sucrose, 3 times more enzyme activity was found than when Czapeck Doxglucose media was used. This was possibly due to glucose acting as repressor of the synthesis of glycosyltransferase. Glucose has been reported to inhibit a number of microbial enzymes (Martins et al., 2006). Enzymes detected from all culture media by zimograms in PAGE (with the exception of SWNL media) showed molecular weights above 212 kDa while the protein detected in SWNL medium had a molecular weight of 53 kDa. Possible inducing effects of CSL in Czapek and YPD media were studied given the presence of a 53 kDa band when using SWNL culture media. No effect of CSL was found and the presence of detected enzyme can be due to the presence of high oleic acid-sunflower oil in the media.In Table 1, it is possible to observe that the extract from CZ CSL had, after extracts obtained from YPD medium (1.79 EAU mg-1 of protein), the highest value of -1 enzymatic activity (0.525 EAU mg of protein), followed by the extract from YPD CSL (0.422 EAU mg-1 of protein) and the SWNL medium at 9 days of culture, which had 0.297 EAU mg-1 protein. The glycosyltransferase was detected in the culture medium SWLN at 3, 5, and 7 days

Maribel et al.

7083

9 (Days)

High molecular weight Glycosyltransferase Low molecular weight Glycosyltransferase

Figure 1. Detection of glycosyltransferase from Ustilago maydis in 7.5% PAGE stained with Schiff reagent. SWNL = broth used for the production of glycolipids analyzed after 3, 5, 7 and 9 days of fermentation.

of incubation. This was achieved by means of the reaction of the glycosil moiety of the enzyme with Schiff reagent in the electrophoresis gel. Results are shown in Figure 1. The absence of glycosyltransferase on the 9th day of culture is noteworthy. Reducing sugars measured at 3, 5, 7 and 9 days of fermentation were 0.07, 0.2, 0.29 and 0.30 EAU (enzymatic activity units) respectively. Those detected at 9 days of culture (Table 1) could be the product of the activity of other enzymes such as invertase, since glycosyltransferase was not present on that fermentation day. The glycosidic bond of the glycoprotein (glycosyltransferase) was split using β-glucanase and β– glucosidase. Products of the reaction were subjected to PAGE and no bands were detected when using Schiff reagent, which indicated that the product was originated from a glycoprotein. Determination of particle sizes of glycosyltransferase reactions products In Table 2, results of polymer formation under the different reaction conditions after protein precipitation with TCA (15%) are shown. It is noticeable that important changes on the hydrodynamic radius were observed in B and D samples, indicating that reaction proceeds with sucrose or sucrose and UDP-glucose. Regarding reaction with blue dextran, it was possible to observe the

generation of low molecular weight compounds which may indicate the presence of fructose and glucose by the action of invertase or glycosyltransferase. All experiments were made in triplicates. Two different species were detected according to evaluated hydrodynamic radius when they differ by a factor of 2, which corresponds to a factor of 8 in molecular mass. β-Glucans are present in cell walls; their physiological role is still unknown and approximately 80% of glucans are of the β-1,3 type. These compounds are synthesized within the plasmatic membrane and for glucan production, UDP-glucose is required as substrate and GTP as activator (Sakai et al., 2007). There are, however, studies in which exopolysaccharides are produced by fermentation processes such as the pentasaccharide produced by Streptococcus thermophilus formed with D-galactose and D-glucose units (Nordmark et al., 2005). There are also reports on the production of water-soluble extracellular structures composed of α-Dglucans (α-1, 3 glucan) by a glycosyltransferase of Streptococcus sobrinus using sucrose as a substrate (Cheetham et al., 1990). Characterization of the polysaccharide permation chromatography

gel

In Figure 2a, peaks corresponding to polymers of different molecular weight obtained by fermentation in

7084

Afr. J. Biotechnol.

Table 2. Hydrodynamic diameters of the glycosyltransferase reaction products under different reaction conditions.

Peaks of the polymer

Sample

Enzyme extract (µl)

1% sucrose buffer (µl)

Buffer without sucrose (µl)

UDP-Gluc (10 mg/ml) (µl)

Dextran (1 mg/ml) (µl)

120

370

Hydrodinamic diameter (nm) 178.9 (100%)

120

370

330.6 (100%)

120

360

224.7 (100%)

120

380

169.2 (98.6%)

120

370

255.3 (100%)

120

370

208.3 (100%)

120

360

202.7 (100%)

120

380

187.2 (100%)

Hydrodinamic diameter (nm)

4996 (1.4%)

TA, TB, TC, TD: Blanks of samples A, B, C and D.

SWNL medium are shown. Four groups of polymers were classified whose molecular weights were within the range of 26862 to 65349 kDa with an average MW of 44285 for peak 1, and their average MW corresponded to the average MW´s of 983 and 439 Da for peaks 2 and 3 respectively. To carry out the characterization of the produced polysaccharides (peak 1), a series of hydrolytic procedures were applied as well as treatments with two different solvents to precipitate proteins and to be able to detect glucans. All experiments were made in triplicates. Hydrolysis was performed by using β-glucanase, β-glucosidase, a mixture of β-glucanase and β-glucosidase, lipase, and protease, and, in addition, samples were treated with chloroform and acetone. The main peak observed in Figure 2a was broken down in a series of smaller peaks. Treatment with β-glucanase provided an important extent of hydrolysis along with a 14 fold reduction of initial concentration after treatment with βglucanase. The hydrolysis by β-glucanase of T. longibrachiatum of these compounds suggested

the presence of β- 1-3 bonds in the structure of the glucan, since this enzyme specifically hydrolyzes these bonds. Hydrolisis with β-glucosidase produced a smaller number of products than after treatment with glucanase. The extent of hydrolysis was half to that attained by β-glucanase. The smaller extent of hydrolysis observed with β-glucosidase than with glucanase suggested the presence of a smaller number of homo β-1, 4 bonds and higher number of β-1, 3 bonds in the polysaccharide (Figure 2a). However, hydrolysis with a mixture of β-glucanase and β-glucosidase produced a synergic effect on the reaction and a different profile was obtained than when the single enzymes were used individually as shown in Figure 2b where 6 peaks were observed, being peaks 2, 3 and 4 of a higher intensity while peak 1 presented a better definition than when hydrolysis was carried out with a single enzyme, thus narrowing the interval of corresponding molecular weights and suggesting the breakage of the polymer by the two enzymes and the presence of a predominant polymer with a molecular weight of

40.225 kDa while the other peaks corresponded to lower molecular weight compounds. Hydrolysis with lipase was carried out to break complex high molecular weight lipidic compounds formed with proteins, the polysaccharide and glycolipids. It is possible that the peak having a retention time of 16.8 min corresponded to a glycolipid since it disappeared from the chromatographic profile after the enzyme treatment. When performing the hydrolysis with protease, there was no drastic decrement of the intensity of the peaks with respect to the crude extract. To eliminate the protein from the glucan, chloroform and acetone were used. In the solvent treated samples, different products of the reaction including glucans (high molecular weights) and glycolipids were detected and probably, at a very low concentration. Also, when the sample was subjected to proteolysis, a minimum change in the profile of glycopeptides was noticed. These results are similar to the observations of other authors (Spoeckner et al., 1999).When carrying out submerged culture of U. maydis, it was found

Maribel et al.

7085

Time (min)

Figure 2. SEC chromatogram of polysaccharide extract produced by Ustilago maydis before (a) and after (b) enzymatic hydrolysis with carbohydrases.

that formation of polymers occurred during the stationary phase of the culture. This was opposed to findings when experimenting with other suspended cultures with other microorganisms (Webster et al., 2008). Type of products as well as expressed enzymes by U. maydis is highly dependent on the media used. In YPD medium, a high molecular weight enzyme was expressed and a polysaccharide was formed which increased the viscosity of the media during the concentration by ultrafiltration.

Characterization of polysaccharide by atomic force microscopy Micro and nano characterization of the polymer was carried out by atomic force microscopy (AFM). In Figure 3a, it is possible to observe that original sample had patterns which are typical of this kind of polymeric structures with corpuscular and interlinked linear arrangements similar to those reported (Morgan et al., 1999) when observing a commercial glucan (GlucagelTM) by AFM. Coexistence of corpuscular and linear morphologies has been reported by these authors in samples of the commercial glucan subjected to dehydrationrehydration processes such as those carried out for preparation of the sample for observation in the AFM. Aggregation due to thermal denaturation of glucans (Application Note Agilent Technologies, Inc.) has been reported, and also, those changes of pH and heating

processes produced aggregation in glucans observed by AFM (Sletmoen et al., 2005). Samples treated with a mix of β-glucosidase and βglucanase (Figure 3b) when subjected to observation by AFM showed degradation, structural damage and formation of aggregates with sizes around 73 to 74 nm, which formed irregular and incomplete rings on the stage of the AFM. These findings support the idea of the existence of a main glucan having β-1,4 bonds and residues of hydrolytic action which would be formed mainly by glucans having β-1,3 bonds. It was possible to identify carbohydrate polymers of different molecular weights in the extract obtained from the fermentation of U. maydis in SWNL culture media. Glucans having β-1,4 and β-1,3 bonds were detected, having molecular weights within a range of 26,862 to 65,349 Da, as well as others having molecular weight of around 44,285 Da. By means of AFM, the presence of structures with corpuscular and interlinked arrangements were found, which, after enzymatic treatment, showed degradation, structural damage and formation of small aggregates. ACKNOWLEDGEMENT This research was funded by grant SIP 20100386, 20113514,20120489 from the National Polytechnic Institute-MEXICO, COFAA, EDI, SNI. CONACYT scholarship 184911.

7086

Afr. J. Biotechnol.

Figure 3. (a) AFM image of the β-glucan showing patterns typical of this kind of polymeric structures with corpuscular and interlinked linear arrangements; (b) AFM images of β-glucan treated with the enzymatic mix β-glucosidase and β-glucanase. Structures were disrupted and aggregates decreased size and changed pattern in respect to those shown in (a).

REFERENCES Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1994). Current Protocols in Molecular Biology, Current Protocols. Brooklyn. New York. pp. 13.0.1-13.9.1. Banuett F, Herskowitz I (1996). Discrete developmental stages during teliospore formation in the corn smut fungus, Ustilago maydis. Development, 122: 2965-2976. Bradford MM (1976). A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 203-213. Bolker M, Basse CW, Schirawski J (2008). Ustilago maydis secondary metabolism from genomics to biochemistry. Fungal Gen. Biol. 45: S88-S93. Cerning J, Renard CMGC, Thibault JF, Bouillanne C, Landon M, Desmazeaud M, Topisirovic L (1994). Carbon Source Requirements for Exopolysaccharide Production by Lactobacillus casei CG11 and Partial Structure Analysis of the Polymer. Appl. Environ. Microbiol. 60: 3914-3918. Cortés-Sánchez A, Hernández-Sánchez H, Jaramillo-Flores M (2011). Production of glycolipids with antimicrobial activity by Ustilago maydis FBD12 in submerged culture. Afri. J. Microbiol. Res. 5: 2512-2523. Cheetham NWH, Wlaker GJ, Pearce BJ, Fiala-Berr E, Taylor C (1990). Structures of water soluble α-D-glucans synthesized from sucrose by glucolsyltransferases isolated from Streptococcus sobrinus culture filtrates. Carbohydr. Polym. 14: 3-16. Donot F, Fontana A, Baccou JC, Schorr-Galindo S (2012). Microbial exopolysaccharides: Main examples of synthesis, excretion, genetics and extraction. Carbohydr. Polym. 87: 951- 962. Douglas CM (2001). Fungal ß [1,3]-D-glucan synthesis. Med. Mycol. 39:

55-66. Hewald S, Josephs K, Bölker M (2005). Genetic analysis of biosurfactant production in Ustilago maydis. Appl. Environ. Microbiol. 71: 3033-3040. Jolly L, Vincent SJ, Duboc P, Neeser JR (2002). Exploiting exopolysaccharides from lactic acid bacteria. Antonie Van Leeuwenhoek, 82: 367-374. Juárez-Montiel M, Ruiloba de León S, Chávez-Camarillo G, HernándezRodríguez C, Villa-Tanaca L (2011). Huitlacoche (corn smut) caused by the phytopathogenic fungus Ustilago maydis, as a functional food. Rev. Iberoam. Micol. 28: 69-73. Jung PT, Tzung T, Su-Chen H (2007). In vitro inhibitory effects of rosemary extracts on growth and glucosyltransferase activity of Streptococcus sobrinus. Food Chem. 105: 311-316. Klutts JS, Yoneda A, Reilly MC, Bose I, Doering TL (2006). Glycosyltransferases and their products: cryptococcal variations on fungal themes. FEMS Yeast Res. 6: 499-512. Leifa F, Andrea TS, Ashok P, Carlos RS (2007). Effect of nutritional and environmental conditions on the production of exo-polysaccharide of Agaricus brasiliensis by submerged fermentation and its antitumor activity. LWT, 40: 30-35. Looijesteijn PJ, Trapet L, De vries E, Abee T, Hugenholtz J (2001). Physiological function of exopolysaccharides produced by Lactococcus lactis. Int. J. Food Microbiol. 64: 71-80. Martins BPR; Menocci V, Goulart AJ, Teixeira de Moraes PML, Monti R (2006). Cyclodextrin glycosyltransferase from Bacillus licheniformis: optimization of production and its properties. Braz. J. Microbiol. 37: 317-323. Miller GL (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: p. 426.

Maribel et al.

Miranda CCB, Dekker RFH, Cólus I, Zaia CT, Castro I, Barbosa AM (2007). Botryosphaeran: a new fungal exopolysaccharide presenting antimutagenic, hypoglycaemic and hypocholesterolaemic activities in mice and rats. J. Biotechnol. 131: S1-S58. Morgan KR, Roberts CJ, Tendler SB, Davies MC, Williams PC (1999). A 13C CP:MAS NMR spectroscopy and AFM study of the structure of Glucagel™, a gelling b-glucan from Barley. Carbohydr. Res. 315: 169-179. Monsan P, Bozonnet S, Albenne C, Joucla G, Willemot R, RemaudSimeson M (2001). Homopolysaccharides from lactic acid bacteria. Int. Dairy J. 11: 675-685. Nordmark EL, Yang Z, Huttunen E, Widmalm G (2005). Structural studies of an exopolysaccharide produced by Streptococcus thermophilus THS. Biomacromolecules, 6: 105-108. Pacheco SM, Boutin Y, Angers P, Gosselin A, Tweddell RJ (2006). A bioactive [1→3]-, [1→4]-ß-D-glucan from Collybia dryophila and other mushrooms. Mycol. 98: 180-185. Patel S, Majumder A, Goyal A (2011). Potentials of exopolysaccharides from lactic acid bacteria. Indian J. Microbiol. DOI 10.1007/s12088011-0148-8. Sakai Y, Azuma M, Takada Y, Umeyama T, Kaneko A, Fujita T, Igarashi K, Ooshima H (2007). Saccharomyces cerevisiae mutant displaying β-glucans on cell surface. J. Biosci. Bioeng. 103: 161-166.

7087

Selbman L, Crognale S, Petruccioli M (2002). Exopolysaccharide production from Sclerotium glucanicum NRRL 3006 and Botryosphaeria rhodina DABAC-P82 on raw and hydrolysed starchy materials. Lett. Appl. Microbiol. 34: 51-55. Sletmoen M, Christensenb BE, Stokke BT (2005). Probing macromolecular architectures of nanosized cyclic structures of [1, 3]b-D-glucans by AFM and SEC-MALLS. Carbohydr. Res. 340: 971979. Spoeckner S, Wray V, Nimtz M, Lang S (1999). Glycolipids of the smut fungus Ustilago maydis from cultivation on renewable resources. Appl. Microbiol. Biotechnol. 51: 33-39. Vandamme EJ, De Baets S, Steinbuchel E (2002). Biopolymers. Polysaccharides I Polysaccharides from prokaryotes Wiley-VCH. Van Hijum SAFT, Kralj S, Ozimek LK, Dijkhuizen L, Van Geel-Schutten IGH (2006). Structure-function relationships of glucansucrase and fructansucrase enzymes from lactic acid bacteria. Microbiol. Mol. Biol. R. 70: 157-176. Webster JM, Oxley D, Pettolino FA; Bacic A (2008). Characterization of secreted polysaccharides and [glycol] proteins from suspension cultures of Pyrus communis. Phytochemistry, 69: 873-881.

Full Length Research Paper

Study of the effect of PAPA NONOate on the rate of diabetic wound healing Nasrin Dashti1, Nahid Einollahi1*, Mohammad Ansari2 and Mitra Zarebavani1 1

School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran-Iran. Biochemistry Department, School of Medicine, Tehran University of Medical Sciences, Tehran-Iran.

Accepted 24 January, 2012

To investigate the effect of exogenous nitric oxide donor (PAPA NONOate) a drug which spontaneously release nitric oxide on the rate of wound healing and collagen synthesis on impaired wound healing in experimental diabetes. 12 male Sprague – Dawley rats were transferred to separate metabolic cages. Nine days before wounding, the rats were injected intraperitoneally (IP) with streptozotocin (STZ) (55 mg/kg body weight in citrate buffer 0.1 mol/L, pH 4.5) to induce diabetes. The dorsal surface of each rat was properly shaved and given full thickness dermal wound. The test group (n = 6) was treated with 100 µmole PAPA NONOate in phosphate buffer while control wounds (n = 6) received sterile phosphate buffer on the same day and every three days. Daily urine samples were collected at every 24 h intervals. To inhibit bacterial growth, 5 ml of 3 M HCl was added to each urine collection (pH = 1) and urine -3 samples were kept frozen until analyzed (-70°C). Urinary nitrate (NO ) was quantitated daily prior to wounding, and during wound healing (21 days) following external wound closure. The rate of wound healing was determined by video image analysis. PAPA NONOate treatment increased the rate wound healing in test group as compared to the control group. The nitric oxide donor PAPA NONOate may represent a potential treatment for impaired wound healing in diabetes by increasing the rate of collagen synthesis at the wound site. Key words: Wound healing, PAPA NONOate, diabetic wound. INTRODUCTION Wound healing is an orchestrated sequence of biochemical changes which results in tissue repair Thimothy and Margret,. (2008). In diabetes all the stages of the complex wound healing process including inflammation, proliferation, angiogenesis and matrix formation, are impaired (Dashti et al., 2004). During the early phases of wound repair, chemotaxis, phagocytosis, bacterial killing and antioxidant levels are decreased in diabetes (Witte et al., 2002; Bitar et al., 1996; Beer et al., 1997). Also, growth factor depletion, increased glucocortocoids levels (Bitar et al., 1997), decreased cell proliferation (Hehenberger et al., 1998; Goldstein et al., 1979) and up regulation of apoptosis (Darby et al., 2000) characterize the later phases of healing in diabetics, resulting in poorer granulation tissue formation. The rate of collagen

*Corresponding author. einolahn@tums.ac.ir.

synthesis is decreased in diabetic wound healing (Witte et al., 2002). Based on previous findings, the role of nitric oxide as a mediator of wound healing has been determined (Witte et al., 2002, 2000). In diabetes, the level of nitric oxide is decreased in the wound environment. In diabetes, an endogenous deficiency in nitric oxide synthase (NOS) enzyme leads to decreased wound nitric oxide (NO) production and a wide range of related pathologies, such as impaired cutaneous vasodilation, decreased neurogenic vascular response, diabetic neuropathy, endothelial cell function that inhibit the processes necessary for granulation tissue formation. Accumulation of reparative collagen is also reduced. As a mediator of tissue repair, NO plays an important role in promotion of angiogenesis and cellular migration, increase wound collagen deposition and collagen cross linking, regulate vasodilation, inhibit platelet aggregation, inhibit endothelial - leukocyte cell adhesions, modulate endothelial proliferation and

Dashti et al.

7089

Figure 1. Metabolic cages.

apoptosis, increase the viability of random cutaneous flaps, and enhance cellular immunomodulation and bacterial cytotoxicity (Dashti et al., 2004). NO is critically involved in the entire continuum of events associated with collagen synthesis in fibroblasts by an unknown mechanism and accelerates wound closure when applied topically at the wound site (Witte and Thornton, 2000). Reduced nitric oxide production in diabetic wounds has been shown to be associated with impaired healing and reduced collagen deposition (Thimothy et al., 2008). Failure of wound healing is a major cause of morbidity and mortality in diabetes (Terezelain and Hanson., 2009). Collagen molecule is one of the most fundamental constituents of connective tissue with a triple helical structure (Bitar et al., 1997; Hehenberger et al., 1998; Goldstein et al., 1979; Darby et al., 2000; Burgeson and Marcel,1992). Based on previous findings that diabetes is characterized by reduced nitric oxide levels in the wound environment, this study investigated whether exogenous nitric oxide supplementation with nitric oxide donor PAPA NONOate could reverse impaired healing in diabetes. The 24 h urine samples were collected throughout the healing period (21 days). Wound closure profiles were examined by video image every three days and urinary -3 nitrate (NO ) output was measured by Griess reagent.

MATERIALS AND METHODS PAPA NONOate [1- propamine, 3- (2-hydroxy–2–nitroso–1–propyl hydrazine)] was purchased from Alexis Co. (Switzerland). Low nitrate diet (2% L-arginie) was obtained from Pasture Institute, Tehran, Iran. Blood glucose levels were measured with glucose oxidize kit (Zist Chimy Chemical Co. Tehran, Iran). Male Sprague – Dawley rats (Tehran University of Medical Sciences animal house, Tehran, Iran) were acclimatized for one week, they were given water ad libitum, and fed a low nitrate containing diet (2% Larginine). Animals were transferred to separate metabolic cages (Figure 1). Nine days before wounding, the test groups were injected intra peritoneally (IP) with streptozotocin (STZ) (55 mg/kg body weight in citrate buffer 0.1 mol/L, pH 4.5) to induce diabetes. Evidence of diabetes was confirmed by blood glucose levels greater than 250 mg/dL and excessive urination. Before wounding, the rats were anesthetized with Nembutal (40 mg/kg i.p.). The dorsal surface of each rat was properly shaved and given full thickness dermal wound approximately 1 × 1 cm. The test group (n = 6) was treated with 100 µmole PAPA NONOate in phosphate buffer while control wounds (n = 6) received sterile phosphate buffer on the same day and every three days. Daily urine samples were collected at every 24 h intervals. To inhibit bacterial growth, 5 ml of 3 M HCl was added to each urine collection (pH = 1) and urine samples were kept frozen until analyzed (-70°C). Urinary NO-3 was quantitated daily prior to wounding, and during wound healing (21 days) following external wound closure. The rate of wound healing was determined by video image analysis. 48 h following wounding and every three days,

7090

Afr. J. Biotechnol.

16 Urinary Nitrate Output (micro mol / day)

Control Test

12 10 8 6 4 2 20

-2

-4

-6

-8

-10

Days Figure 2. Urinary nitrate output profiles (µmol/day) for diabetic wounds treated with PAPA NONO ate.

Table 1. Urinary nitrate output (mmol/day) for diabetic normal wounds treated with PAPA NONOate

Urinary nitrate output Pre-wound Early-wound Post -wound

Control (mmol/day) 4.9 ± 0.21 8.80 ± 0.70 8.80 ± 0.90

Test (mmol/day) 4.9 ± 0.21 9.59 ± 0.67 9.60 ± 0.93

wounds were videotaped using Nikon Colpix 5000. The urinary nitrate levels were determined using Griess reagent. The principle of this assay is reduction of nitrate by vanadium (III) combined with detection by acidic Griess reaction. The Griess reaction entails formation of a chromophore from the diazotization of sulfanilamide by acidic nitrite followed by coupling with bicyclic amines such as N1-naphthyl ethylenediamine. SPSS computer software was used for data management and analysis.

RESULTS Interesting and promising results have been obtained from studies using non-soluble, polymeric PAPA NONOate as NO donating agent during cutaneous healing in rats. Topical application of NONOate was made on days 0, three, six, nine, 12, 15, 18 and 21. The mean pre wound urinary nitrate output for NONOate and control group was 4.9±0.21 µmol/day. The mean early wound urinary nitrate output for control and test group was 8.80±0.70 and 9.59±0.67 µmol/day, respectively. The mean post wound urinary nitrate output for control and test group was 8.80±0.90 and 9.60±0.93 µmol/day, respectively. The urinary NO-3 profiles for diabetic rats with PAPA NONOate and controls is shown in Figure 2 and Table 1. Control diabetic rats had significantly less

p-Value 0.001 0.001

Significance S S

urinary NO-3 output than the test group (P<0.001). A -3 significant peak in NO output occurred between days 12 to 13 when the external wound was approximately 65% closed. Diabetic rats whether treated with PAPA NONOate or not, exhibited a significant increase in -3 urinary NO output within 24 to 48 h post wounding period. During a three day period, all the rats were removed from their cages and video imaged. The wound closure profiles for all the rats are shown in Figure 3 and Table 2. There is a significant difference (P<0.001) in wound closure profiles between the test and the control group. Photographs of full thickness thermal wounds for the control and the test group on days 0, 12 and 21 are shown in Figures 4 and 5, respectively. Therefore, PAPA NONOate treatment can increase the rate of wound healing and collagen synthesis in diabetic test group as compared to the control group. DISCUSSION NO is important in the process wound healing and tissue repair. NO potentiates antiseptic effects, minimizing intraoperative wound contamination. It, besides, stimulates endothelial and basal cells of epidermis

Percentage wound open

Dashti et al.

7091

100 80

Control Test

60 40 20 0 3

12 15 Days

Figure 3. Wound closure profiles for diabetic wounds treated with PAPA NONOate and control rats.

Table 2. Percent wound open for diabetic normal wounds treated with PAPA NONOate.

Percent wound open (days) 3 12 21

Control (%)

Test (%)

p-Value

93 ± 0.33 55 ± 0.11 25 ± 0.27

89 ± 0.15 35 ± 0.43 0

0.001 0.001 0.001

proliferation (Larichev et al., 2011). Refractory wound is a severe complication that leads to limb amputation in diabetes, and is also a leading cause of hospitalizations in diabetic patients with limited treatment regimens. However, the underlying mechanisms remain to be fully elucidated. Various factors contribute to delayed diabetic wound healing, such as growth factor, nitric oxide (NO), reactive oxygen species (ROS), matrix metalloproteinases (MMPs), microRNA, endothelial progenitor cells (EPCs), etc (Sheng Li et al., 2010). NO and its interrelationship with essential growth factors is involved in the entire events associated with wound repair. NO is often impaired in rats with diabetes. Diabetic rats have a reduced ability to generate NO from L-arginine which is reflected by direct measurements of plasma nitrate and nitrite levels. NOS from which NO is derived is a pH dependent enzyme which is active at slightly alkaline (basic) conditions but is suppressed by acidic conditions. In diabetes, glycolysis and ketoacidosis force pH towards acidic conditions and this may account, in part, for the reduced production of NO (Jian-dong et al., 2005).

Significance S S S

Adequate oxygen is necessary for the activity of NOS and therefore NO. Circulation is notoriously impaired in diabetic patients, which limits available NOS and NO. Lastly, people with diabetes often experience elevated glucose levels. Some of this glucose becomes incorporated into hemoglobin and is measured as glycosylated hemoglobin (Hob) or HgbA1C. Glycosylated hemoglobin binds to NO as nitrosothiols very tightly so that any NO that is formed cannot be easily released from red blood cell (RBC) to help maintain blood flow through smooth muscle cell relaxation. When available NO is tightly bound to glycosylated hemoglobin its release is limited in smooth muscle cells where NO is required for essential cellular functions. Similarly, the NO donor molsidomine (N-ethoxycarbomyl-3morpholinylsidnonimine) or NO releasing poly (vinyl alcohol) hydrogel dressings are also shown to partially restore such healing impairment in STZ-induced diabetic rats. Collectively, impairment of skin NO function represents an important factor for delayed wound healing in diabetes and strategies aimed at restoring cutaneous NO bioavailability with NO donors or NOS gene therapy may serve as effective means for diabetic wound healing

7092

Afr. J. Biotechnol.

Figure 4. Photographs showing normal diabetic control wounds on day 0, 12 and 21 respectively.

Figure 5. Photographs showing normal diabetic wounds treated with PAP NONOate on day 0, 12 and 21, respectively.

(Jian-dong et al., 2005). The capacity of a nitric oxide-releasing nanoparticle (NO-np) to treat wounds infected with Acinetobacter baumannii (Ab) was examined. It was found that the NOnps were therapeutic in an experimental Ab murine wound model. Treatment with NO-nps significantly accelerated healing of infected wounds (Mihu et al., 2010). Collagen is one of the principle structural proteins which play an important role in wound healing (Bilden and Oktay,1999). Collagens are a large family of structural proteins in the extra cellular matrix of eukaryotes (Bulfield., 1990). During wound healing, the collagen molecules, after being secreted by the cells, assemble to form fibers for the functional integrity of tissues (Freeman et al., 1988). Diabetes is characterized by a nitric oxide â&#x20AC;&#x201C; deficient state accompanied by decreased collagen deposition at the wound site. The nitric oxide donor PAPA NONOate may represent a potential treatment for impaired wound healing in diabetes by increasing the rate of collagen synthesis at the wound site. It has been shown that diabetic wounds are more susceptible to nitric oxide donor treatment since the wound is deficient in nitric oxide (Witte et al., 2002). Furthermore, the previous results show that topical application of S-nitrosoglutathione (GSNO) is effective in the treatment of ischemic wounds, leading to a significant improvement in the wound healing (Georgii et al., 2010).

Also, our previous study on DETA NONOate showed, this compound can partially improve impaired healing in diabetes by increasing the rate of collagen synthesis (Dashti et al., 2010). In the previous studies, it was shown that the effect of nitric oxide donor administration may be dependent on a threshold rather than the dose. So therefore, further studies should be performed to demonstrate a correlation between levels of nitric oxide donors at the wound site and its outcome. In summary, administration of PAPA NONOate can partly restore the impaired healing in diabetes by increasing the rate of collagen synthesis. This may have therapeutic potential and needs further evaluation. REFERENCES Beer HD, Longaker MT, Werner S(1997) Reduced expression of PDGF receptors during impaired wound healing J Invest Dermatol. 109: 132-8. Bilden G, Oktay G(1999) Collagen content and electrophoretic analysis of type I collagen in breast skin of heterozygous naked neck and normally feathered commercial broi? Tr J. Veterinary Anim. Sci. 23: 483-487. Bitar MS (1997). Insulin like growth factor-I reverses diabetes- induced wound healing impairment in rats. Horm Metab Res. 29: 383-6. Bitar MS, Labbad ZN(1996).Transforming growth factor-beta and insulin like growth factor-I in relation to diabetes â&#x20AC;&#x201C; induced impairment of wound healing. J. Surg. Res. 61(14): 113-119. Bulfield G(1990). In poultry breeding and genetics . Molecular genetics, pp. 543-584.

Dashti et al.

Burgeson R, Marcel E(1992). Collagen types: Molecular structure and tissue distribution. Clinical orthopaedics related research, 282: 251272. Darby IA, Bisucci T, Hewitson TD(2000).Apoptosis is increased in a model of diabetes impaired wound healing in genetically diabetic mice. Int. J. Biochem Cell Biol . 26: 191-198. Dashti N, Ansari M, Shabani M, Vardasbi S (2004). Nitric oxide donor (DETA NONOate) enhance experimental wound healing in strepto zotocin â&#x20AC;&#x201C; induced diabetic rats. PJMS. 20(3): 211-214. 1516. Dashti N,Einollahi N, Zarebavani M, Kiani F(2010).The effect of DETA NONOate, a nitric oxide donor, on the rate of collagen synthesis in rat as an animal model of diabetes.Int. J. Veterinary Res. 4(3): 159-161. Freeman WH(1988 ).Biochemistry. 261-281; 3th (ed. Stryer) New York. Georgii JL,Amadeu TP, Seabra AB, de Oliveira MG, Monte-Alto-Costa A( 2010). Topical S-nitrosoglutathione-releasing hydrogel improves healing of rat ischemic wounds. J Tissue Eng Regen Med .Dec 29. Goldstein S, Moerman EJ, Soeldner JS(1979).Diabetes mellitus and genetic prediabetes. Decreased replicative capacity of cultured skin fibroblasts. J. Clin Invest. 63: 358-370. Hehenberger K, Heilborn JD, Brismar K, Hansson A(1998). Inhibited proliferation of fibroblasts drived from chronic diabetic wound and normal dermal fibroblasts treated with high glucose is associated with increased formation of L-lactate. Wound Rep. Reg. 6: 135-141. Jian-dong LUO, Alex F (2005). Nitric oxide: a newly discovered function on wound healing, Acta Pharmacologica Sinica Mar. 26 (3): 259-264. Larichev AB, Shishlo VK, LisovskiÄ AV, Chistiakov AL ( 2011).[The use of exogenous nitrogen monoxide for the prophylaxis of postoperative wound infection. Khirurgiia (Mosk), (7): 31-35. Mihu MR, Sandkovsky U, Han G, Friedman JM, Nosanchuk JD, Martinez LR( 2010).The use of nitric oxide releasing nanoparticles as a treatment against Acinetobacter baumannii in wound infections.Virulence. Mar-Apr.1(2): 62-67.

7093

Sheng LI , Jin Zhan(2010). Molecular mechanisms of diabetic wound healing . State Key Laboratory of Natural & Biomimetic Drugs .Dec. 41(6): 407-412. TerezeLain M, Hanson R(2009). Effect of Pravastatin on Experimental Diabetic Wound Healing. J. Surg. Res.pp. 1-5. Timothy J , Margret A(2008) .Simple biochemical markers to assess chronic wounds. Wounds Rep. Reg. 8: 264-269. Witte M.B,,Kiyama T, Barbul A(2002).Nitric oxide enhances experimental wound healing in diabetes. British J. Surg. 89: 15941601. Witte MB, Thornton FJ(2000). Enhancement of fibroblast collagen synthesis by nitric oxide. Nitric oxide, 4: 572-582.

Full Length Research Paper

L-Monomethyl-arginine decreases apoptosis of chondrocytes by altering Bax and Bcl-2 expression in osteoarthritis of rabbit knee Zong-bao Wang1,2, Qing-you Lu3*, Zeng-chun Li3, Zhao-hui Chen2, Wei-ming Liao4, Guang-zhi Kuang1 and Zhuo-peng Wu1 1

Science Research Base of Kaiping Central Hospital, Postdoctoral Mobile Station of Sun Yat-sen University, Kaiping 529300, People’s Republic of China. 2 Clinical School of Acupuncture and Orthopaedics, Anhui University of Traditional Chinese Medicine, Hefei 230038, People’s Republic of China. 3 Department of Traumatic Surgery, East Hospital Affiliated to Tongji University, Shanghai 200120, People’s Republic of China. 4 Department of Orthopedic, the First Hospital Affiliated to Sun Yat-sen University, Guangzhou 510700, People’s Republic of China. Accepted 27 January, 2012

Previous studies found that NG-monomethyl-L-arginine (L-NMMA) treatment inhibits progression of osteoarthritis. Here, we aimed to explore the effects of L-NMMA on chondrocyte apoptosis and Bax and Bcl-2 mRNA expression in rabbits with knee osteoarthritis. Knee osteoarthritis was induced in 24 healthy rabbits by Hulth method, and rabbits were randomly divided into control (n = 12) and experimental (n = 12) groups. Once weekly, knee joints of control rabbits were injected with saline solution, while knees of experimental rabbits were injected with L-NMMA. Knee joint samples were collected after 6 weeks of treatment. Apoptosis of chondrocytes was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), and Bax and Bcl-2 mRNA expression by in situ hybridization. The results show that the mean rate of chondrocyte apoptosis in knees of the experimental rabbits was significantly lower than that of the control rabbits (P<0.05). Additionally, Bax expression decreased and Bcl-2 expression increased in the experimental group (P<0.05). In brief, LNMMA can inhibit apoptosis of joint chondrocytes through changes in the expression of apoptosisrelated genes. Thus, this molecule offers the potential for treating osteoarthritis. Key words: NG-Monomethyl-L-arginine, knee osteoarthritis, chondrocyte, apoptosis-related regulatory gene. INTRODUCTION Osteoarthritis (OA) is a chronic, progressive osteoarthropathy that poses a health hazard in aging individuals. OA pathology includes articular cartilage degeneration, characterized by degradation of cartilage matrix and reduction in chondrocytes (Lories and Luyten, 2011). One report analyzing the ultrastructure of cartilage in OA (Weiss and Mirow, 1972) linked an increased

*Corresponding author. E-mail: zongbao_wang@126.com. Tel: +86-021-38804518.

number of degraded chondrocytes to disease severity. A subsequent study of a rabbit knee OA model by Hashimoto et al. (1998), reported an increase in apoptosis of chondrocytes with accompanying pannus formation; specifically, 28.7% of chondrocytes were apoptotic in OA-affected articular cartilage. Further, apoptotic cells were located in the cartilage surface and middle layer. In contrast, only 6.7% of chondrocytes were apoptotic in normal cartilage, located only in the cartilage surface. Similarly, using TUNEL and flow cytometry, Blanco et al. (1998) determined that apoptotic cells accounted for 11 to 22% of OA articular cartilage, but only

Wang et al.

2 to 4% of normal cartilage. Staining of cartilage sections confirmed the presence of apoptotic cells in both the surface and middle layer, as well as identifying proteoglycan depletion. Indeed, the number of apoptotic cells was significantly and positively correlated with OA severity. In a follow-up study, the same group induced apoptosis of rabbit articular chondrocytes using varying concentrations of sodium nitroprusside over different time periods. They found that the exogenous nitric oxide (NO) produced by sodium nitroprusside induced apoptosis of cultured chondrocytes, indicating that NO plays an important role in chondrocyte apoptosis (Blanco et al., 1995). Injecting collagenase into upper compartments of the bilateral temporomandibular joints, Gao et al. (2003) established a goat OA model. They then injected the joints with 0.5 ml of 0.5% L-monomethyl-arginine (LNMMA), an NO synthase inhibitor, in 3-day intervals. After one week OA progression was inhibited in L-NMMAtreated joints, likely by indirect inhibition of NO synthesis. However, additional studies are needed to confirm the inhibitive effect of L-NMMA on chondrocyte apoptosis. Here, we investigated the mechanisms behind the therapeutic effects of L-NMMA on OA in rabbit knees by assessing apoptosis and Bax and Bcl-2 expression in chondrocytes. MATERIALS AND METHODS Experimental animals Twenty-four healthy adult New Zealand rabbits of both sexes were obtained from the Experimental Animal Center of Wuhan University. Rabbits weighed from 2.8 to 3.5 kg, with a mean body weight of 3.2 ± 0.2 kg. These were caged for one week before experimentation to assure no obvious abnormalities were observed before inclusion. Laboratory temperature was 22 ± 2°C with relative humidity of 60%. Rabbits were fed regular diets with free access to water. Rabbit knee OA models were established as in previous studies (Hulth et al., 1970). Briefly, skin on the right knee was shaved one day before modeling. Prior to surgery, rabbits were anesthetized with 3% amyl sodium pentobarbital (30 mg/kg) via ear vein, and then incised from the patella medial site. The medial collateral ligament was cut to open the knee joint cavity, then the anterior and posterior cruciate ligaments were cut with ophthalmic scissors and the medial meniscus was resected. Surgery did not damage the articular cartilage surface. After complete hemostasis, the wound was sutured by layer. Limb fixation was not needed after surgery. Rabbits were randomized to either the control or experimental groups, with 12 in each group. One week after surgery, rabbits were treated with either 0.3 ml saline (control) or 0.3 ml 0.5% L-NMMA (experimental; Sigma Chemical Co., St. Louis, MO) via cavity puncture of the right knee joint once per week. After 6 weeks of treatment, rabbits were killed by air embolism, the right knees were opened, and the lateral tibial plateau of the right upper end was removed. Samples were fixed and paraffin embedded for serially sectioning with thickness of 4 µM. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) TUNEL reactions were performed according to the manufacturer’s

7095

instructions, with some modifications (Roche, Mannheim, Germany). Briefly, sections were dewaxed prior to digestion with 20 mg/ml trypsin for 15 min at room temperature. Following treatment with 3% H2O2 solution for 5 min, slides were placed in 50 µL balanced fluid for 1 min, to which 15 µL reaction solution containing TDT enzyme was added. Reaction proceeded at 37°C for 1.5 h before being stopped with reaction-termination solution. Slides were rinsed with buffer solution twice for 15 min each. Slides were incubated with 20 ml/L normal goat serum for 30 min and then antidigoxigenin alkaline phosphatase antibody in a humid chamber for 2 h. Following rinses with buffer 1 and buffer 3, freshly-prepared DAB color reagent was added to develop the color. After visualization, color development was halted, slides were washed and stained with hematoxylin and finally sealed with neutral gum.

In situ hybridization (ISH) Bax and Bcl-2 in situ hybridization detection kits were purchased from Invitrogen Life Technologies, Inc. (Carlsbad, CA, US). Following dewaxing and treatment with 3% H2 O2 solution for 10 min at room temperature, samples were digested for 5 min by pepsase diluted with 3% citric acid. Then 20 µL pre-hybridization solution were added and slides were placed in a humidified chamber for incubation at 37°C for 2 h. Next, 20 µL hybridization solution were then added and slides were incubated at 37°C overnight. Following incubation with blocking solution at 37°C for 30 min, slides were treated with biotinylated mouse anti-digoxigenin at 37°C for 60 min. Streptavidin--biotin complex (SABC) was incubated on slides at 37°C for 20 min, then biotinylated peroxidase was added for 20 min, and finally 3,3´-diaminobenzidine (DAB) was used to develop color for 10 min. Slides were rinsed with tap water for 10 min and then stained with hematoxylin and sealed with neutral gum. Positive staining results were interpreted as appearance of brown tinting in the cytoplasm and nucleus. Sections without probes were used as negative control. Staining was visualized under light microscope (400×) and analyzed with Image-pro Plus6.0 image processing system (Media Cybernetics, Inc. Bethesda, MD, US). Ten different fields were selected for each section. Bax and Bcl-2 mRNA expression in chondrocytes was assessed by positive area and grayscale values (maximum grayscale was set as 255 for white, and minimum grayscale was set as 0 for black; smaller grayscale indicates higher intensity of positive reaction/expression).

Statistical methods SPSS13.0 statistical software was used for statistical analysis. Results are expressed as mean± standard deviation. Independent sample χ2 test was used to compare apoptosis of chondrocytes or Bax and Bcl-2 mRNA expression between different groups. Twosided test was used, with α level of 0.05 and P <0.05 considered statistically significant.

RESULTS Reduced apoptosis of chondrocytes following LNMMA treatment In both L-NMMA-treated and untreated OA rabbit knees, apoptotic nuclei appeared brown and were mainly distributed in the cartilage proliferation zone and shallow layer of hypertrophic cells. In the control group, 12.05 ± 1.17% of chondrocytes was apoptotic, primarily

7096

Afr. J. Biotechnol.

Figure 1. Altered expression of Bax and Bcl-2 mRNA in chondrocytes following L-NMMA treatment. A, Expression area; B, expression grayscale; C, ratio of Bax/Bcl-2.

concentrated in the cartilage proliferation zone. However, in experimental rabbits treated with L-NMMA, the number of apoptotic cells was significantly reduced [5.09 ± 0.31%, t=19.851, P=0.001] and cartilage chondrocyte layers were maintained. Altered Bax and Bcl-2 expression following L-NMMA treatment We next explored the mechanism behind this decreased apoptosis following L-NMMA treatment. Using image analysis software to quantify ISH signals, we measured the mRNA expression area of apoptosis-related genes Bax (pro-apoptotic) and Bcl-2 (anti-apoptotic). Mean Bax expression area was reduced following L-NMMA treatment measured as 912.22 ± 50.99 in the controls and 728.39 ± 26.00 in the experimental rabbits (Figure 1A). Mean expression areas of Bcl-2 were 693.65 ± 32.36 and 958.23 ± 38.95 in the control and experimental groups, respectively (Figure 1B). Thus, the ratio of Bax/Bcl-2 expression area was significantly altered from (0.76 ± 0.06) in the controls to (1.32 ± 0.09) in the experimental group (Figure 1C, t = 18.182, P = 0.001). Statistical analysis showed that compared with the control

group, the expression area of Bax in experimental group was significantly reduced (t = 18.327, P = 0.001), while Bcl-2 expression area was significantly increased (t = 11.126, P = 0.001). Expression intensity of Bax and Bcl-2 in chondrocytes was measured via ISH grayscale values (higher value = less intensity). Grayscale values for Bax expression were 157.88 ± 7.79 and 184.37 ± 7.36 in the control and experimental groups, respectively reflecting a significant increase in Bax expression in the experimental group (Figure 1B; t = 8.566, P = 0.001). Grayscale values for Bcl-2 were (190.88 ± 20.17) and (149.13 ± 7.83), respectively for the control and experimental groups, reflecting a significant reduction in Bcl-2 expression in experimental rabbit knees (Figure 1B; t = 6.687, P = 0.001). The ratio of Bcl-2/Bax grayscale intensity was therefore 1.21 ± 0.15 for the controls and 0.81 ± 0.06 for the experimental rabbits, with a statistically significant difference (Figure 1C; t = 8.555, P=0.001). DISCUSSION The pathogenesis of OA is characterized by degenerative changes in articular cartilage, followed by proliferation of

Wang et al.

adjacent cartilage and ossification. Recent studies of OA pathogenesis mainly focused on apoptosis of the chondrocyte itself (Ishoguro et al., 2002; Loeser, 2006). Farrell et al. (1992) found that a large amount of the NO metabolite nitrite could be detected in synovial fluid and serum of OA patients, suggesting that NO may be involved in the pathology of OA. Meanwhile, in vitro studies (2005) found that high concentrations of NO cause apoptosis or necrosis of chondrocytes. Thus, inhibition of chondrocyte apoptosis by preventing NO production may offer a new approach in treating OA. In addition, two molecules, L-NMMA and L-arginine, may compete for NO synthase binding sites, thereby inhibiting NO synthase and indirectly preventing NO production. In a study by Amin et al. (2000) in which L-NMMA was used to treat arthritis, L-NMMA effectively reduced NO, ameliorating arthritis swelling and tissue damage. Similarly, administering L-NMMA to OA rat models by intraperitoneal injection resulted in reduced swelling and redness (McCartney-Francis et al., 2001). Here, we used a rabbit knee OA model to investigate the mechanisms behind the effects of L-NMMA treatment. TUNEL staining revealed an obvious decrease in apoptosis of chondrocytes, with a corresponding increase in expression of Bcl-2 (anti-apoptotic) and decrease in Bax (pro-apoptotic) expression. Thus, in inhibiting NO synthase, L-NMMA can inhibit apoptosis of knee chondrocytes, thus resulting in a protective effect whereby degeneration of articular cartilage is delayed. However, the repair of cartilage defects is a regulatory process involving multiple factors, and inhibition of excessive release of NO is only one aspect of this process. NO is a signal transmission molecule with broad functions in the body, and normal physiological concentrations of NO may be interrupted by L-NMMA administration, potentially producing serious side-effects (McCartney-Francis et al., 2003). Therefore, further studies on NO inhibitors are needed to develop more specific drugs before these molecules can be used as effective therapy for cartilage repair in OA. REFERENCES Amin AR, Dave M, Attur M, Abramson SB (2000).COX-2, NO, and cartilage damage and repair. Curr Rheumatol Rep. 2(6): 447-453. Blanco FJ, Guitian R, Vรกzquez-Martul E, de Toro FJ, Galdo F (1998). Osteoarthritis chondrocytes die by apoptosis: a possible pathway for osteoarthritis pathology. Arthritis Rheum. 41: 284-289. Blanco FJ, Ochs RL, Schwarz H, Lotz M (1995). Chondrocyte apoptosis induced by nitric oxide. Am. J. Pathol. 146: 75-85.

7097

Farrell AJ, Blake DR, Palmer RM, Moncada S (1992). Increased concentrations of nitrite in synovial fluid and serum samples suggest increased nitric oxide synthesis in rheumatic diseases. Ann. Rheum. Dis. 51(11): 1219-1222. Gao ZW, Hu J, Wang DZ, Li JH (2003). The effects of L-NMMA on experimental temporomandibular joint osteoarthrosis in goats. Zhonghua Kou Qiang Yi Xue Za Zhi 38(4): 295-297. Hashimoto S, Takahashi K, Amiel D, Coutts RD, Lotz M (1998). Chondrocyte apoptosis and nitric oxide production during experimentally induced osteoarthritis. Arthritis Rheum. 41(7): 12661274. Hulth A, Lindberg L, Telhag H (1970). Experimental osteoarthritis in rabbits: preliminary report. Acta Orthop Scand. 41(5): 522-530. Ishiguro N, Kojima T, Poole AR (2002). Mechanism of cartilage destruction in osteoarthritis. Nagoya J. Med Sci. 65(3-4): 73-84. Kim HA, Lee KB, Bae SC(2005). The mechanism of low-concentration sodium nitroprusside-mediated protection of chondrocyte death. Arthritis Res. Ther. 7(3): R526-535. Loeser RF (2006). Molecular mechanisms of cartilage destruction: Mechanics, inflammatory mediators, and aging collide. Arthritis Rheum. 54(5): 1357-1360. Lories RJ, Luyten FP (2011). The bone-cartilage unit in osteoarthritis. Nat. Rev. Rheumatol. 7(1): 43-49. McCartney-Francis NL, Song X, Mizel DE, Wahl SM (2001). Selective inhibition of inducible nitric oxide synthase exacerbates erosive joint disease. J Immunol .166(4): 2734-2740. McCartney-Francis NL, Chan J, Wahl SM (2003). Inflammatory joint disease: clinical, histological, and molecular parameters of acute and chronic inflammation and tissue destruction. Methods Mol. Biol. 225: 147-159. Weiss C, Mirow S (1972). An ultrastructural study of osteoarthritis changes in the articular cartilage of human knees. J. Bone. Joint. Surg. Am. 54(5): 954-972.

Full Length Research Paper

Characterization of diploid and triploid Heterobranchus bidorsalis using morphometric, meristic and haematological parameters Ayeloja, A. A.1, Agbebi, O. T.2 and Jimoh, W. A.1 1

Department of Fisheries Technology, Federal College of Animal Production and Health Technology, Ibadan, Nigeria. 2 Department of Aquaculture and Fisheries Management, University of Agriculture Abeokuta, Ogun, Nigeria. Accepted 15 December, 2011

The study investigates comparative changes in morphometric, meristic and haematological values of triploid and diploid strain of Heterobranchus bidorsalis with a view to establishing differences and comparative adaptability between the two strains. The experiment was carried out inside net hapas submerged inside 1 × 1 × 1.2 m2 concrete tank where diploid (2n) and triploid (3n) fish were reared. Each hapa net contain 45 post fingerlings of the same genetic makeup. 10 post fingerlings of diploid and triploid strains of H. bidorsalis with average total length between 11.2 and 12.8 cm and 12.2 and 14 cm respectively were collected for morphometric and meristic parameters. Blood samples were also collected and analyzed packed cell volume (PCV), haemoglobin (Hb), white blood cell count (WBC), red blood cell count (RBC), mean cell hemoglobin concentration (MCHC), platelet, and mean cell volume (MCV) values of triploid and diploid fish were analyzed. This study shows the superiority of the triploid H. bidorsalis over the diploid strain. It also indicated that morphometric and meristic indices are the best parameters to characterize post juvenile diploid and triploid H. bidorsalis while haematological indices is not a better indices for characterization of juvenile diploid and triploid H. bidorsalis. Key words: Heterobranchus bidorsalis, diploid, triploid, morphometric, meristic, heamatology, INTRODUCTION Recent trends all over the world, point to a decline in landing from capture fisheries, which is an indicator that fish stocks have approached or even exceeded the point of maximum sustainable yield; aquaculture therefore remains the only viable alternative for increasing fish production in order to meet the protein need of the people (Adewumi and Olaleye, 2011). Bakir et al. (1993) reported that Heterobranchus sp., which belong to the family Clariidae, is one of the species of freshwater fish that are mostly utilized in aquaculture, especially in the developing world like Nigeria. Tawari and Abowei (2011) reported that Heterobranchus sp. is one of the fish species that its fingerlings are available both in the wild and cultured medium in Nigeria. The use of sexually

*Corresponding author. ayelojaa@yahoo.com.

E-mail:

aye_ayo@yahoo.com,

sterile fish in fish production is advantageous for several applications, such as: controlling reproduction of exotic species; preventing potential backcross of hybrids with either parent species resulting in intermingling of genetic material; improving growth of aquaculture species because less energy is diverted for reproduction (Rottmann et al., 1991). Gain and loss of whole chromosomes leads to aneuploidy in which the chromosome number differs from the normal haploid (n) or diploid (2n) chromosome number, it changes to an exact multiple of the haploid number (e.g. 3n and 4n) which is termed polyploidy, triploidy and tetraploidy, respectively (Strunjak-Perovic et al., 2003). Although there are many similarities between triploid and diploid fish, basic differences exist and conflicting results in terms of performance have been obtained in salmonids and other species (O’Flynn et al., 1997). The use of haematological values as indices of the state of animal health is receiving a lot of research effort (Awe et al., 2011). Blood

Ayeloja et al.

examination is a good way of assessing the health status of an animal as it plays a vital role in the physiological, nutritional and pathological status of the animal (George et al., 1994). Hematological assessment in reared and wild fish is an important tool to evaluate fish health. They can be induced by the presence of pollutants and factors such as temperature, salinity, pH, dissolved oxygen concentration, carbon dioxide and inadequate management (Ranzani-Paiva and Silva-Souza, 2004). Haematological status of diploid, triploid and tetraploid fish could provide a better understanding of the comparative adaptability of these fish (Zexia et al., 2007). The aim of this work was to characterize diploid and triploid H. bidorsalis using morphometric, meristic and heamatological parameters so as to determine the changes that occurred in the normal diploid H. bidorsalis from the triploid H. bidorsalis. MATERIALS AND METHODS Experimental design The design of the experiment was a completely randomized design (CRD). Two different strains of H. bidorsalis {the diploid (2n) and the triploid (3n)} of equal age (nine weeks each) were reared in net hapa submerged inside 1 × 1 × 1.2 m2 concrete tank. Each hapa net contained 45 post fingerlings of the same genetic makeup, 10 post fingerlings each were randomly selected from the net hapa containing the diploid strain, and the net hapa containing triploid strains for morphometric, meristic and heamatological parameters examination.

Determination of morphometric, meristic and heamatological parameters In the laboratory, morphometric parameters including; head width, frontal frontanelle (long), frontal frontanelle (small) caudal peduncle length, head to dorsal fin origin, distance between the eye, gap between dorsal fin and adipose fin, sex, body depth at anus, adipose fin length and fish weight were measured while the meristic parameters observed include; number of dorsal fin rays, number of pectoral fin rays, number of pelvic fin rays, number of anal fin rays, vomerine tooth plate width, vomerine tooth plate depth, number of left gill rakers, number of vertebrae (atlas), number of vertebrae (urostyle), number of vertebrae column, premaxillary tooth width, premaxillary tooth depth, nasal barbell length, mandibular barbell length and number of right gill rakers. These parameters were recorded for both 2n and 3n H. bidorsalis; the total length of the diploid fish ranged from 11.2 to 12.8 cm while that of the triploid ranged from 12.2 to 14.0 cm. Thereafter, blood was collected from the caudal peduncle of each fish using separate heparinized syringes and oxalate anticoagulant was added to prevent the blood from coagulating. Standard haematological procedure described by Blaxhall and Daisley (1973) were employed in the assessment of the various blood parameters. Haemoglobin (Hb) was done by the cyanomethaemoglobin method, packed cell volume (PCV) by microhaematocrit method, white blood cell count (WBC) was determined with the improved neubauor counter, different count was done on blood film stained with May Grumwald Gemsa Stain, red blood cell count (RBC) was estimated using the relationship between Hb and PCV (Mirale, 1982). Mean cell hemoglobin concentration (MCHC), and mean cell volume (MCV) were

7099

calculated using the formulae mentioned by Dacie and Lewis (2001): MCHC (%) = Hb / Hct × 100 MCV (µ³) = Hct / RBC × 10 Statistical analyses Heamatological data collected from the experiment were subjected to one way analysis of variance (ANOVA) test using the Statistical Package for the Social Sciences (SPSS 13.0) for window software. Where significant differences occurred, group means were further compared with Duncan’s multiple range test (SPSS, IL, USA).

RESULTS AND DISCUSSION The mean value of the morphometric parameters (Figure 1) shows the superiority of the triploid fish over the diploid strain as the triploid have better weight, longer adipose fin length, better flesh at body depth towards the anus; triploid fish also have longer length between the head and dorsal fin origin and longer caudal peduncle length, at the head region; triploid fish have wider head width than the diploid strain while the diploid fish have longer frontal frontanelle for both small and long frontanelle. This agrees with the report of Tiwary et al. (1997) that triploid Heteropneustes fossilis showed better growth rates than normal diploid individuals under controlled laboratory conditions. The meristic parameters (Figure 2) indicate that alteration in genetic makeup does not alter the vomerine tooth plate depth (cm) of triploid H. bidorsalis. Both diploid and triploid H. bidorsalis strain also have the same number of left gill raker; the same number of vertebrae (both atlas and urostyle) and the same number of right gill. However, the two strains have different numbers of anal fin rays, vomerine tooth plate width (cm), number of vertebrae column, premaxillary tooth width (cm), premaxillary tooth dept (cm), nasal barbell length (cm) and mandibular barbell length (cm) which can be used to differentiate them. Study on the haemtological indices indicated that there is no significant difference in all the indices of diploid and triploid H. bidorsalis except MCHC (Table 1). This result disagrees with other researchers like Zexia et al. (2007) who used six month old fish for the haematological characterization of loach Misgurnus anguillicaudatus diploid, triploid and tetraploid specimens suggesting that haematological indices of diploid and triploid H. bidorsalis strain will not be significantly different at the early stage of life (at post fingerlings stage) except for MCHC. Conclusion This study shows the superiority of the triploid H. bidorsalis over the diploid strain; it also indicates that a

7100

Afr. J. Biotechnol.

Figure 1. Morphormetric parameters for diploid and triploid H. bidorsalis

Figure 2. Meristic parameters for diploid (D) and triploid (T) H. bidorsalis.

Table 1. Haematological parameters of triploid and diploid H. bidorsali.

Treatment D T

PCV 27.000a 33.600a

Hb (g/L) 8.900a 10.620a

RBC (×106 µL-1) 2.4880a 3.1680a

WBC (×103 µL-1) 19160.0a 19020.0a

Platelet (g/dL) 100000a 94600a

MCV (fL) 111.200a 106.800a

MCHC(g/dL) 33.2000a 31.6000b

Mean with different superscripts along the same row indicate significance difference at 95% confidence value. D, Diploid; T, triploid H. bidorsalis.

Ayeloja et al.

wide variation existed between morphometric and meristic indices of post juvenile diploid and triploid strains of H. bidorsalis. The haematological indices of the two strains did not show a significant difference. Since growth performance is a critical factor in aquaculture, it is therefore suggested that triploid H. bidorsalis should be cultured by farmer rather than culturing the diploid strain. REFERENCES Adewumi AA, Olaleye VF (2011). Catfish culture in Nigeria: Progress, prospects and problems. Afr. J. Agric. Res. 6(6): 1281-1285. Awe S, Sani A, Tunde OE (2011). Haematological studies of rats fed with some selected locally produced fruit wines. Bioresearch Bull. 4: 217-222. Bakir HM, Melton SL, Wilson JL (1993). Fatty acid composition, lipids and sensory characteristics of white amur (Ctenopharyngodon idella) fed different diets. J. Food Sci. 58(1): 90-95. Blaxhall PC, Daisley KW (1973). Routine haematological methods for use with fish blood. J. Fish Biol. 5: 771-781. Dacie JV, Lewis SM (2001). Practical Haematology, 9th edition. Churchill Livingstone, London. p. 633. George HB, Donald ES, Colin RP (1994). Physiol. Biochem. 16: 156258. Mirale JB (1982). Laboratory medicine haematology. 6th edition. The CV Mosby Pub. London. p. 883.

7101

O'Flynn FM, McGeachy SA, Friars GW, Benfey TJ, Bailey JK (1997). Comparisons of cultured triploid and diploid Atlantic salmon (Salmo salar L.). ICES J. Mar. Sci. 54: 1160-1165. Ranzani-Paiva MJT, Silva-Souza AT (2004). Hematology of Brazilian fish. In: Ranzani-Paiva MJT, Takemoto RM, Lizama M, de los AP (Ed.). Sanity of the aquatic organisms. S達o Paulo: Varela. pp. 89120. Rottmann RV, Shireman JV, Chapman FA (1991). Induction and verification of triploidy in fish. SRAC Publication. 427: 2. Strunjak-Perovic I, Coz-Rakovac R, Topic PN (2003). Micronucleus occurrence in diploid and triploid rainbow trout (Oncorhynchus mykiss Walbaum). Vet. Med. Czech. 48(8): 215-219. Tawari CC, Abowei JFN (2011). An exposition of the potentials and utilization of sustainable culture fisheries in Africa. J. Appl. Sci. Eng. Tech. 3(4): 304-317. Tiwary BK, Kirubagaran R, Ray AK (1997). Induction of tripliody by cold shock in Indian catfish, Heteropneustes fossilis (Bloch). Asian Fish Sci. 10: 123-129. Zexia G, Weimin W, Khalid A, Xiaoyun Z, Yi Yang, James S, Diana HW, Huanling W, Yang L, Yuhua S (2007). Haematological characterization of loach Misgurnus anguillicaudatus: Comparison among diploid, triploid and tetraploid specimens. Comparative Biochem. Physiol. 147: 1001-1008.

African Journal of Biotechnology Vol. 11(27), pp. 7102-7108, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3463 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Ultramicromorphological observation of Usnea longissima Ach. Yunzhe He1, Hui Tang2 and Zhiguo Zhang1* 1

Shandong University, Jinan, 250100, China. Hebei University, Baoding, 071002, China.

Accepted 1 March, 2012

The Usnea longissima Ach. grew as an epiphyte on Abies georgei and was collected at an altitude of 3640 m above sea level from the Pudacuo National Park in the Shangri-La County of the Diqing Tibetan Autonomous Prefecture in the Yunnan Province of China. Scanning electron microscopy revealed the ultramicro-organisation of the U. longissima. We observed that the interior of the specimen contained a large amount of cubic and needle-like secretions; images of the cross-section of the central axis show many densely distributed holes, and the longitudinal section of the central axis revealed many vessellike structures, similar to vessels in plants; some hyphae specialised into ring-shaped. These structures have not been reported even in other Usnea. This study gives us more comprehensive understanding of the structure and function of lichens. Key words: Usnea longissima Ach., ultramicromorphological observation, scanning electron microscopy. INTRODUCTION Lichens are composite organisms formed by the symbiotic association of fungi and algae. This unique mutualistic symbiotic relationship endows lichens with novel biological characteristics that are different from those of regular fungi and algae (Blasco et al., 2011). Lichens contain large amounts of usnic acid, lichesterinic acid, and other substances that possess potent antiseptic and antibacterial activities (Asahina, 1967; Cocchietto et al., 2002). Therefore, they are a biological resource with great potential for development. Usnea longissima refers to species in the genus Usnea, the family Parmeliaceae, the order Lecanorales, and the class Lecanoromycetes (Tavares, 1997; Halonen et al, 1998). It is edible and is utilized in the preparation of traditional foods and medicines in both Eastern and Western countries. It is pale green or silvery-yellowishgreen in color, fruticose, and pendulous. Its main branches are cylindrical and can reach up to 3 m or more in length. The main branches rarely divide but they have

*Corresponding author. E-mail: zgzhang@sdu.edu.cn. Tel/Fax: 03125079696.

numerous short perpendicular side branches and fibrils of approximately equal length (3 to 40 mm). Papillae are lacking but soredia or isidia occasionally form on the side branches. Apothecia are extremely rare. When present, they are disc-shaped, 1 to 3 (5) mm across, and terminate on the ends of the side branches, with numerous fibrils extending from the thalline margin (Halonen et al., 1998; Keon, 2002). In recent years, molecular biology techniques have been used to study the species diversity and thallus composition of Usnea (Ohmura, 2002; DePriest, 2004; Fabian et al., 2007; Arnold et al., 2009; Jana et al., 2010; Ana and Lumbsch., 2010); but morphological observations of the thallus have been limited to traditional optical microstructural observations of paraffin-embedded sections (Su et al., 2007), and observations of handsectioned or partially dissected dried herbs and fixed samples (Fabian et al., 2007; Suetina and Glotov., 2010; Wirtz et al., 2008). Little information is currently available on the morphological characteristics of the U. longissima at the ultra-microscopic level. In this study, we utilised scanning electron microscopy to characterise the ultramicroscopic morphological structure of the U. longissima, to discover some unknown or uncertain structure.

He et al.

7103

Figure 1. The morphology of the Usnea longissima thallus and the features of the main stems and side branches.

MATERIALS AND METHODS Specimen collection Fresh thalli of U. longissima were collected from Pudacuo National Park, Shangri-la County, Yunnan Province, China (27°49'N, 99°59'E). The mean annual temperature is 5.4°C, and the mean annual precipitation is approximately 580 mm. The lichens were located at an altitude of ca. 3640 m above sea level. The collected samples from Abies georgei were identified by their morphological characteristics. Morphological and anatomical methods Whole specimen and specimen sections were coated with platinum using a JFC-1600 auto fine coater at a current of 10 mA for 2 min. The platinum-coated samples were stored in a dryer before use. A JSM-7500F scanning electron microscope was used to observe the external morphology and the internal structure of the lichen.

RESULTS AND DISCUSSION Dissection and observation under a stereoscopic biological microscope The U. longissima is filamentous and cylindrical, with a length of approximately 50 to 130 cm and a diameter of approximately 0.6 to 1.5 mm. The main stems are long,

with branches, some parts of which have dense growths of short side branches. The surface is gray-green or yellow-green, slightly smooth with white powder in certain areas, and covered with fine white rings (Figure 1). The specimen is supple, slightly flexible, and can be easily broken by pulling. The exposed section is greenish-white, with a faint smell and weak taste. The original U. longissima thallus from which the specimen was obtained grows as an epiphyte hanging on the surface of the branches of A. georgei. The base of its attachment with the tree branch is enlarged, with a width of approximately 5 mm. Microscopic images of the cross-sections (Figure 2) demonstrated that the U. longissima thallus is composed of three concentric rings of tissue, each with a radial structure. The outermost cortex layer, which has a thickness of 20 to 30 µm, is a tissue layer composed of 4 to 5 columns of hyphae woven together and has annularpseudocyphellae which are characteristic of the subgenus Dolichousnea (Ohmura, 2001). The gonidial layer is immediately inside the cortex and is composed of 2 to 3 staggered layers of Tsengia-like algal cells. The algal cells are either oval or semi-round in shape, with a diameter of 8 to 13 µm. The chloroplasts are the source of the green colour. In the middle of the thallus is the centre axis, which has a diameter of approximately 200 to250 µm. The centre axis accounts for about one-half to

7104

Afr. J. Biotechnol.

Central axis Gonidial layer Cortex layer

Figure 2. Tissue cross-sections of the Usnea longissima thallus, 50Ă&#x2014; magnification

two-thirds of the entire cross-section

and is composed of tightly

packed specialised hyphae. Scanning electron microscopy Scanning electron microscopy was used to observe the surface and anatomical structures of the specimen (Figure 3). On the surface of the thallus, the dense cortex is formed by left-handed vertical helical arrangements of hyphae (Figure 3a). Regular square- or diamond-shaped crystals and spherical or irregular granular secretions are also located on the surface (Figure 3a). These structures are also found on the exposed surfaces of the cortex. These secretions might be deposits of secondary metabolites, including multiple lichen acids such as usnic acid and lichen polysaccharide, which are produced by the biological processes of the lichen. Ring fractures in the cortex are present on the surface of the thallus or in the branch bases. Vertical cracks are also present. We can observe pink buds growing in the branch bases, spherical spores growing on top of the buds, and scars on the surface of the buds resulting from the loss of the

spores (Figure 3b). The hyphal surface is covered with needle-like or granular secretions of varying thickness (Figure 3c), scattered with small amounts of algae in groups or as single algal cells. The connections among the hyphae are loose, with many large gaps, and some specialised hyphae are ring-shaped (Figure 3d) which may form more space and be helpful for gas exchange. The central axis is composed of tightly packed specialised mycelium, oriented longitudinally, appearing like an elastic cord or cylindric rubber band in the center of the lichen thallus, which is surrounded by gonidial layer and cortex, coincides with other Usnea species (Tavares, 1997; Clerc, 1998; Halonen et al., 1998; 2000). However, a crosssection of the central axis shows many densely distributed holes (Figure 3e), and images of the longitudinal section of the central axis reveal many vessel-like structures (Figure 3f), similar to vessels in plants. These ultramicromorphological structures have not been reported by others (Ohmura, 2001, 2002, Ohmura and Kanda, 2004; Fabian et al., 2007). We assume that the structure probably has two roles; one is that it can increase the space, so as to facilitate the

He et al.

Pink buds

7105

7106

Afr. J. Biotechnol.

He et al.

Figure 3. The surface and anatomical structures of Usnea longissima specimen observed by scanning electron microscopy; a) left-handed vertical helical arrangement of mycelium and granular secretions located on the surface, 1,300× magnification; b) pink buds formed in the base of a side branch with spherical spores on top, 950× magnification, and 2,700× magnification; c) the hyphal surface is covered with needle-like or granular secretions, 4,000× magnification; d) ring-shaped structure composed of specialised mycelia, 8,000× magnification, and 20,000× magnification; e) cross-section of the central axis; f) longitudinal section of the central axis.

7107

7108

Afr. J. Biotechnol.

exchange of gases, while the other is support, the U. longissima is longer, hollow, can improve toughness, ensure uniform stress, and is not easily broken. Conclusions The U. longissima Ach. grew as an epiphyte on A. georgei and was collected at an altitude of 3640 m above sea level from the Pudacuo National Park in the ShangriLa County of the Diqing Tibetan Autonomous Prefecture in the Yunnan Province of China. After treatment with 5% potassium hydroxide and 1% iodine solution, the Usnea specimen showed characteristics of U. longissima Ach. and the typical morphological features of a Usnea lichen symbiont. Scanning electron microscopy demonstrated that the tissue organisation of the thallus includes three basic parts: cortex layer, gonidial layer, and central axis. We observed that the central axis is a specialised structure of hyphae that resembles plant vessels. The surface is covered with an off-white powder, whereas the interior of the specimen contains a large amount of cubic and needle-like secretions. Some hyphae also specialised into ring-shaped. ACKNOWLEDGEMENTS The authors wish to express their gratitude to anonymous reviewers whose comments on an early draft greatly improved the manuscript. We thank Dr. Wang H.Y. for help in identification of the Usnea longissima. REFERENCES Ana C, Lumbsch HT (2010). Cryptic species in lichen-forming fungi. IMA Fungus, 1(2): 167-170. Arnold AE, Jolanta M, Higgins KL, Sarvate SD (2009). A phylogenetic estimation of trophic transition networks for ascomycetous fungi: are lichens cradles of symbiotrophic fungal diversification? Syst. Biol. 58(3): 283-297. Asahina Y (1967). Lichenologische Notizen. J. Jpn. Bot. 42: 289-294. Blasco M, Domeño C, López P, Nerín C (2011). Behaviour of different lichen species as biomonitors of air pollution by PAHs in natural ecosystems. J. Environ. Monit. 13(9): 2588-2596. Clerc P (1998). Species concepts in the genus Usnea (lichenized Ascomycetes). Lichenologist. 30: 321-340. Cocchietto M, Skert N, Nimis PL, Sava G (2002). A review on usnic acid, an interesting natural compound. Naturwissenschaften. 89(4): 137-46. DePriest PT (2004). Early molecular investigations of lichen-forming symbionts: 1986-2001. Annu. Rev. Microbiol. 58: 273-301.

Fabian AS, Peter DC, Nora W, Paul SD (2007). Phylogenetic and morphological analysis of Antarctic lichenforming Usnea species in the group Neuropogon. Antarctic Sci. 19(1): 71-82. Jana MU, François L, Jolanta M, Arnold AE (2010). Community analysis reveals close affinities between endophytic and endolichenic fungi in mosses and lichens. Microb. Ecol. 60: 340-353. Halonen P, Clerc P, Goward T, Brodo IM, Wulff K (1998). Synopsis of the genus Usnea (Lichenized Ascomycetes) in British Columbia, Canada. Bryologist. 101: 36-60. Halonen P (2000). Usnea pacificana sp. nov. and U. wasmuthii (Lichenized Ascomycetes) in Pacific North America. Bryologist. 103: 38-43. Keon DB (2002). Fertile Usnea longissima in the Oregon Coast Range. Lichenologist. 34: 13-17. Ohmura Y (2001). Taxonomic study of the genus Usnea (lichenized Ascomycetes) in Japan and Taiwan. J. Hattori Botanical Lab. 90: 196. Ohmura Y (2002). Phylogenetic evaluation of infrageneric groups of the genus Usnea based on ITS regions in rDNA. J. Hattori Botanical Lab. 92: 231-243. Ohmura Y, Kanda H (2004). Taxonomic status of section Neuropogon in the genus Usnea elucidated by morphological comparisons and ITS rDNA sequences. The Lichenologist. 36(3&4): 217-225. Suetina IG, Glotov NV (2010). Ontogeny and morphogenesis of the fruticose lichen Usnea florida (L.) Weber ex F.H. Wigg. Russian J. Dev. Biol. 41(1): 32-40. Su YQ, Peng F, Li B (2007). Improvement of paraffin section methods and morphological studies on Usnea betulina. Acta Botanica BorealiOccidentalia Sinica. 27(5): 859-863. Tavares II (1997). A preliminary key to Usnea in California. Bull. California Lichen Soc. 4: 19-23. Wirtz N, Printzen C, Lumbsch HT (2008). The delimitation of Antarctic and bipolar species of neuropogonoid Usnea (Ascomycota, Lecanorales): a cohesion approach of species recognition for the Usnea perpusilla complex. Mycol. Res. 112(4): 472-484.

Full Length Research Paper

Salt effect on physiological, biochemical and anatomical structures of two Origanum majorana varieties (Tunisian and Canadian) Olfa Baâtour1*#, Mouhiba Ben Nasri-Ayachi1*#, Hela Mahmoudi1, Imen Tarchoun1 , Nawel Nassri1, Maha Zaghdoudi1, Wissal abidi1, Rym Kaddour1, Sabah M’rah1, Ghaith Hamdaoui2, Brahim Marzouk2 and Mokhtar Lachaâl1 1

Unité de Physiologie et Biochimie de la Tolérance au Sel des Plantes, Département de Biologie, Faculté des Sciences de Tunis, Campus Universitaire, 1060 Tunis, Tunisie. 2 Laboratoire des Substances Bioactives, Centre de Biotechnologie de Borj-Cedria, BP 901, 2050 Hammam-lif, Tunisia. Accepted 2 March, 2012

In this study, we evaluated the salt concentration effect on plant growth, mineral composition, antioxidant responses and anatomical structure of two varieties of Origanum majorana after exposure to NaCl treatment. Our results show an inclusive behaviour of the two varieties, since the majority of sodium was exported and accumulated in their aerial parts. The Canadian variety (CV) appeared relatively more tolerant to salt than the Tunisian one (TV). Transversal section of leaves showed a thickening of dorsal and ventral cuticle, more importantly in CV than in TV, in the presence and in absence of salt. This was accompanied by an increase in the length of palisade cells, and the width of spongy collenchyma lacuna. The stem had a subquadrangular shape in TV and quadrangular in the Canadian variety. At mature stage, the stem pit was reabsorbed in the TV and replaced by a large cavity, whereas it remained unchanged in CV. The relative salt tolerance of the CV was related to: (1) a good selectivity in favour of K+: (2) a strong peroxidase activity and (3) an increase in the lengthening of palisade cell accompanied with an increase of lacunae in spongy parenchyma in CV. Key words: Origanum majorana, salinity, growth, mineral nutrition, leaves, stems, anatomical, antioxidant. INTRODUCTION In modern agriculture and trade, importance accorded to plants is not restricted to food, forage, and fibre, but to secondary metabolites having desired aromatic or therapeutic qualities, or providing source of material for the perfume and chemical industries (Banchio et al., 2008). Sweet marjoram (Origanum majorana L.), a member of the Lamiaceae family, is an aromatic plant; of great economic and industrial importance. It is known

*Corresponding author. E-mail: olfa_zouhair@yahoo.fr, baatourolfanaiimi@gmail.com; benasri@gmail.com. Abbreviations: CV, Canadian variety; TV, Tunisian variety.

#These authors contributed equally to this work.

since antiquity for its therapeutic properties (Baatour et al., 2011). Notably among all Lamiaceae species, it is used in gastronomy for its spicy herbaceous notes (Circella et al., 1995), especially in the Mediterranean culinary delights. Volatile extract of marjoram is used in pharmacology, medicine, clinical microbiology, pathology and food preservation (Dafarere et al., 2000). Currently, besides drought, there is an expansion of salt-affected soils which cover about 10% of the total area in Tunisia (Hachicha, 2007). These two environmental constraints affect the growth, nutrition, antioxidant activities and anatomy structure of medicinal, aromatic and the majority of cultivated plants. Thus, the study of plants responses to these constraints is required. In a previous study, referring to the set of the physiological and biochemical behaviour of the marjoram observed in

7110

Afr. J. Biotechnol.

responses to the variation of NaCl concentration in the culture medium, the concentration of 75 mM was kept for the continuation of the experiment (Bâatour et al., 2010). In another study, based on fatty acid and essential oil composition, Bâatour et al. (2011) observed that at this sodium chloride concentration (75 mM), Canadian variety (CV) seemed to be more tolerant than the Tunisian variety (TV). The purpose of the present work was to confirm the tolerance of CV by studying the: (i) growth, (ii) water content (iii) mineral status (iv) enzyme assays and (v) anatomical structure. MATERIALS AND METHODS Canadian and Tunisian Marjoram (O. majorana L.) were cultured individually in a hydroponic system containing a complete Hoagland’s medium (Hoagland and Arnon, 1950) diluted eightfold in a culture chamber (16 h light/8 h dark at 22/18°C). After 20 days of acclimation, 75 mM NaCl was added to nutritive solution. The aerial parts of O. majorana were harvested after 17 days of treatment. Subsequently, the dry weight (DW) of different organs (leaves, stems and roots) was measured. Ions were extracted with 0.5% HNO3; K+, Na+ and Ca2+ concentrations were assayed by flame photometry (Eppendorf apparatus). Tissue ion content and ion selectivity Major cations and chloride in dried leaf and roots materials were extracted with 0.5% HNO3 and were assayed with flame photometry as previously described by M’rah et al. (2006). The ability of the plants to maintain tissue K+ concentration in saline conditions is indicated as the K+ selectivity. It is defined as the ratio of K+ / (K+ + Na+) in the tissue divided by the ratio of K+ / (K+ + Na+) in the external medium (Ashraf and McNeilly, 1990). Determination of enzyme activity Fresh leaves were homogenised with 5 ml of extraction buffer containing 50 mM K phosphate buffer, pH 7.5, 100 mM ethylenediaminetetraacetic acid (EDTA), 5% polyvinylpyrrolidone (PVP), 5% glycerol and 1 mM dithiothreitol (DTT). The homogenate was centrifuged at 15000 g for 15 min, and the supernatant fraction was used to assay various enzymes. All steps in the preparation of enzyme extracts were performed at 4°C. Protein concentrations in the enzyme extract were determined by the method of Bradford (1976) using bovine serum albumin as a standard. Catalase activity (CAT) was determined by monitoring the disappearance of H2O2 according to the method of Cakmak and Marschner (1992). The final reaction mixture contained 50 mM sodium phosphate buffer (PH 7.0) and 2% H2O2. The activity was expressed as units (µmol H2O2 consumed per minute) per mg of protein. Guaiacol peroxidase activity (GPX) according to Srinivas et al. (1999) was assayed using guaiacol as an electron donor, with a reaction mixture containing 20 mM phosphate buffer (pH 7.0) and 30 mM H2 O2. The increase of absorbance due to tetraguaiacol formation was recorded at 470 nm. One unit of peroxidase activity catalyzes the oxidation of 1 µmol of guaiacol. Measurement of malondialdehyde (MDA) MDA was determined for aerial parts following a published procedure (Locquin and Langeron, 1978). Briefly, fresh tissue (0.2

g) was homogenized in 2 ml of a mixture containing 20% 2thiobarbituric acid and 0.5% trichloroacetic acid. Extracts were incubated at 95°C for 30 min, the reaction was stopped on ice and then centrifuged at 4000 g for 30 min at 4°C, and the absorbance of the supernatant was measured at 532 and 600 nm. The MDA concentration (µmol g-1 FW) was calculated using a molar extinction coefficient at 532 nm (155 mM cm-1). The absorption at 600 nm resulting from non specific absorption was subtracted from the optimal absorption at 532 nm.

Light microscopy Fresh control and treated leaves (level 4) were subjected to various treatments: (1) some leaves were fixed in formaldehyde-acetic-acid (FAA), cut with a freezing microtome then stained with acetocarmine (Locquin and Langeron 1978); (2) other leaves, were fixed with 4% glutaraldehyde in sodium cacodylate buffer, and then post fixed with 1% osmium tetroxide (OsO4) buffered with the same product, dehydrated in acetone and subsequently embedded in Spurr resin. Sections were made with a glass knife and stained with Boracic toluidine blue. These sections were observed with a Leitz Ortholux (LM) equipped with a camera. Statistical analysis All extractions and determinations were conducted in triplicate and data was expressed as mean ± standard deviation (SD). The means were analysed using the one-way analysis of variance (ANOVA) followed by Duncan’s multiple range tests. Means were statistically compared using the STATISTICA (v 5.1) (Statsoft, 1998) program with Student’s t-test at the p < 0.05 significance level.

RESULTS Growth and water content Both varieties of O. majorana produced the same amount -1 of dry weight (about 1200 mg. plant ) under controlled condition (Figure 1). A very important part of this biomass is allocated to the stems (about 50%) and leaves (40%). Plant biomass was significantly decreased following salt treatment for two weeks, but it was more pronounced in Tunisian variety as compared to the Canadian. Besides, the degree of sensibility decreased gradually from stems to roots. Moreover, there was a significant decrease in water content in leaves and stems of TV under salt constraint. As compared to the other organs, its roots appeared less sensitive to NaCl, whereas CV seemed insensitive to salt in all organs (Figure 2). This salt hydration insensitivity reflected a greater capacity for osmotic adjustment in plants tissues grown in the presence of salt. In addition, the effect of salt on the water content seemed more pronounced than dry biomass and can better discriminate between the two varieties in terms of their response to salt stress. Ionic concentrations O. majorana plants cultivated with NaCl 75 mM, absorbed

Baâtour et al.

DW (mg plant-1)

1600 TV

1 -

1200

Roots Stems Leaves

b 800 )

400 0 0

75 NaCl (mM)

H 2 O (m g g -1 D W )

Figure 1. Dry weights (DW) in roots, stems and leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

Roots a

Stems Leaves

1 -

O ml.g

10 a 5

0 0

75 NaCl (mM)

NaCl (mM)

Figure 2. Tissue hydration in roots, stems and leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Means of 8 replicates ± standard error at P ≤ 5%.

N a + (m eq g -1 D W )

2.4 a

a a

1.6

Roots

CV a

Stems Leaves

0.8 b b b

b b

0.0 0

75 NaCl (mM)

Figure 3. Na concentrations in roots, stems and leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

7111

Afr. J. Biotechnol.

Ka + (meq g -1 DW)

7112

1.2

a a

Roots

Stems Leaves

0.8

b 0.4

b b

0.0

DW)

Figure 4. K+ concentrations in roots, stems and leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

2.0

1.6

a TV

Roots

1.2

(m eq

0.8

C a 2+

g -1

a a

0.4

b b

Stems Leaves

0.0 0

75 NaCl (mM)

Figure 5. Ca2+ concentrations in roots, stems and leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

and accumulated sodium in their different organs (Figure 3). However, the leaves with sodium accumulation were -1 higher in Tunisian variety (about 1.8 meq.g DW) -1 against only (1.2 meq.g DW) in their roots. Conversely, + in CV, the Na accumulation reached comparable levels -1 -1 in all the three organs (about 1.5 meq . g DW). This result suggests that CV has the ability to control Na+ absorption and transport it from roots to shoots parts. Under control conditions, both marjoram varieties have the same K+ content in their different organs (leaves, stems and roots) (Figure 3). Salt treatment significantly + decreased K accumulation in the three organs of TV, but only in the roots and stems in CV. A decrease of K+ accumulation about 50% in TV leaves was correlated with a greater accumulation of Na+. Calcium plays an important role in plant tissues regulating the function of Na+ and K+ (Cachorro et al., 1994; Grattan and Grieve, 1993). In saline soils with 2+ abundant Ca , deficiency arises due to the competitive + effects of K / Na+ selectivity that were associated with

plant salt tolerance (Ashraf and Naqvi, 1991). In this experiment, the effect of salt stress on Ca2+ contents of the different organs (leaves, stems and roots) were 2+ illustrated in Figure 5. Ca accumulation in shoots (leaves and stems) were similar in the two varieties. In 2+ contrast, roots Ca accumulation were higher in Canadian variety compared with the Tunisian variety, although 2+ NaCl decreased significantly the content of Ca in different organs of both varieties. In fact, it showed a strong inhibition of absorption and transport of calcium + which would be due to Na competition. Sodium reduced 2+ Ca influx by binding it to the plasma membrane, 2+ inhibiting influx and increasing efflux of Ca by depleting 2+ the internal Ca concentration (Cramer et al., 1989). Our results also show that the Canadian variety had the best performance (better growth) in salt constraint due to a better selectivity for K+ in their leaves compared with Tunisian one (Figure 6). However, disturbances of potassium nutrition induced by salt treatment were not very remarkable. In fact, it is probable to suggest that the

3 1

2 1

Protein (mg g-1 FW)

0.012 0.008 b

0.004

150

50 100 NaCl (mM)

TV a

Membrane integrity

Membrane lipid peroxidation resulted in elevated levels of MDA, a generic biomarker for membrane damage (Elkahoui et al., 2005). The leaves MDA content was much higher in CV (about 0.92 µmol g-1 FW) than in TV (Figure 6). NaCl treatment reduced and stimulated the MDA content by 42 and 29%, respectively, in Canadian and Tunisian varieties.

Pr ot, m g g

0 0

75 NaCl (mM)

Figure 7. The total protein content in leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

15 b

5 0 0

Figure 9. Catalase activity (CAT) in leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

CV b

inhibition of O. majorana L growth was due to Ca2+limitation of provision.

NaCl (mM)

Figure 6. MDA content in leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

POD activity (mg g-1 protein)

0.016

0 0

7113

0.02

CAT activity (mg g-1 protein)

MDA (µmol g-1 FW)

Baâtour et al.

NaCl (mM)

Figure 8. Guaiacol peroxidase (POD) activity in leaves of Origanum majorana L. plants grown over 17 days in the presence of 75 mM NaCl concentrations. Data represent the means of 8 replicates ± standard error at P ≤ 5%.

Total protein and antioxidant enzyme activities Leaves protein content of both O. majorana varieties are represented in Figure 7. The results show that NaCl increased the protein content in the CV and decreased those in the Tunisian variety. GPX and CAT are the major antioxidant enzymes associated with scavenging active oxygen species (ROS) (Marschner, 1995). Therefore, to determine the response of O. majorana to salt-induced oxidative stress, GPX and CAT activities were measured in leaves treated with or without 75 mM NaCl. Our results (Figure 8) show that GPX activity was increased in the presence of salt in CV, whereas it decreased significantly in TV. This response could explain the protective leaves response in CV against the accumulation of reactive oxygen species. In the absence of salt, the highest catalase activity was observed in CV leaves (0.016 mg g1 FW) than Tunisian variety (Figure 9). NaCl treatment, tended to decrease catalase activity by three-fold in TV, but it remained constant in Canadian variety. Anatomical structure Cross sections of leaves and stems were investigated in

7114

Afr. J. Biotechnol.

Table 1. Extent of different leaf tissues in Canadian variety in the absence and presence of 75 mM NaCl in ÂľM.

NaCl (mM) CV (0) CV (75)

Cu d 0.22a 0.13b

Cu v 0.12a 0.10a

Epd 0.25a 0.15b

Epv 0.6a 0.20b

PL 0.24b 0.27a

PP 0.6a 0.7a

L (PP) 0.6b 0.83a

l (PP) 0.1b 0.15a

Co 0.11b 0.2a

Ep F 2.84a 2.73b

CV, Canadian variety; Cu d, dorsal cuticule; Cu v, ventral cuticule; Epd, dorsal epidermis; Epv, ventral epidermis; PL, spongy parenchyma; PP, palisade parenchyma; L, length ; l, widh; Co, collenchyma; Ep F, thickness of the vessel.

Table 2. Extent of different leaf tissues in Tunisian variety in the absence and presence of 75 mM NaCl in ÂľM.

NaCl (mM) TV (0) TV (75)

Cu d b 0.056 a 0.1

Cu v a 0.06 a 0.054

Epd b 0.17 a 0.18

Epv a 0.36 b 0.35

PL a 1.2 a 1.3

PP b 1.4 a 1.5

L (PP) b 0.4 a 0.6

I (PP) a 0.2 b 0.15

Co b 0.14 a 0.53

Ep F a 3.99 a 3.76

TV, Tunisian variety; Cu d, dorsal cuticule; Cu v, ventral cuticule; Epd, dorsal epidermis; Epv, ventral epidermis; PL, spongy parenchyma; PP, palisade parenchyma; L, length; l, width; Co, collenchyma; EpF, thickness of the vessel.

Table 3. Extent of different stem tissues in Canadian variety in the absence and presence of 75 mM NaCl in mM.

Variety CV (0) CV (75)

Cu 0.11a 0.04b

Ep 0.99b 1.00a

Co 1.00a 0.08b

PC 0.53a 0.17

MO 0.92a 0.30b

T 0.60b 0.83a

CV, Canadian variety; Cu, cuticule; Ep, epidermis; PC, cortical parenchyma; Co, collenchyma; T, entire stem.

detail. Our findings show that both leaves varieties were bifacial covered by a thick cuticle on the upper and lower surfaces, and followed by a single layered epidermis and three or four layered palisade. Spongy parenchyma cells are lined-up and occupy a wide area in the mesophyll. Vascular bundles were surrounded by a sheath of parenchyma cells. Upper and lower parts of central vessel were surrounded by collenchymatous cells (Figures 1 and 2). The ventral epidermal cells were larger than dorsal ones in CV (Table 1) and TV (Table 2), at the control medium. The treated leaves were characterized by a spongy parenchyma with small lacunae. In CV, salt induced an increase of lengthening of palisade cell and lacunae in spongy parenchyma as shown in Figure 1A and Table 1. However, in the Tunisian variety, leaf thickness remained substantially unchanged due to an increase in the size of the dorsal epidermal cells associated with elongation of palisade parenchyma cells. In addition, salt induced thickening of the cuticle covering epidermis (Figures 2A and B; Table 2). Stems For the control, cross sections showed that Tunisian variety (Figure 3A) had a less large diameter than the Canadian one (Figure 3E). It consisted of a unilayered epidermis (Ep) with more or less rounded cells, covered by a thick cuticle in both varieties. Under the epidermis

lied a unilayered collenchyma (Co) all around the stem, but thicker at the corners where it was formed by two to three layers. Cortical parenchyma (CP) was of meatus type, composed of three to four layers of cells with a thin pectocellulosique wall. In the vascular cylinder, vascular system showed primary structure. The phloem (Ph) was surrounded by the side, by an arc composed of fibres (F) more numerous in the Tunisia variety (Figure 3B). Between the phloem and xylem, there was a cambial zone (CZ) which extended laterally in the interfascicular regions. The development of the cambial zone was more advanced in the Tunisian variety (*). The centre of the stem was occupied by a pith (P) with large cells; larger at the Canadian variety (Table. 3). Ripe stem diameter increased in the two varieties (Figures 3D and H), by the increase of the amount of vascular tissues. It became subquadrangular in the Tunisian variety (Figure 3C) and quadrangular in the Canadian variety (Figure 3G). In both varieties (Figures 3D and H), collenchyma were layered (seven to eight cells) at the corners, and sclerenchymatic in the Canadian variety (Figures 3G and H). Conducting tissues form a continuous vascular cylinder, where the wood (W) is the dominant element. They are surrounded externally by a layer of cells (+ +, Figure 3D and H), distinguished by their large size (they are larger in the Tunisian variety and with sclerenchymatic wall). The pith in the Canadian variety, is reduced to a diamond-shaped area (P, Figures 3G and H), but in the Tunisian variety, its cells are absorbed in

Baâtour et al.

7115

Table 4. Extent of different leaf tissues in Tunisian variety in the absence and presence of 75 mM NaCl in mM.

NaCl (mM) TV (0) T V (75)

Cu 0.039 0.041

Ep 0.08 0.97

Co 0.098 0.12

PC 0.158 0.140

MO 0.29 0.24

T 0.4 0.6

TV, Tunisian variety; Cu cuticule; Ep, epidermis; PC, cortical parenchyma; Co, collenchyma; T, entire stem.

their place to form a central gap (P, Figures 3C and D). Salt induced a decrease in stem diameter (Figures 3A and C) due to a reduction in cortical parenchyma cells (Pc) in both varieties. Besides, we observed an increase and a decrease respectively, in the thickness of the Ep and the light of the Co (Figures 4B and D), In the Canadian variety, we also observed a decrease of the pit (P) (Figures 4A and B), vessels size associated and a thickening of F above the Ph (Tables 3 and 4). DISCUSSION The ability of the two varieties to maintain their hydration status at 75 mM NaCl could be due to their osmotic adjustment capacity as is the case of wheat (Bouslama et al., 2004). However, the decrease in biomass depending on the severity of stress could be an adaptive strategy. Indeed, plant reduces its exchange surface with the external environment in order to conserve a better water content. In aromatic and medicinal plants, recent studies emphasized sensitivity to salt stress; illustrated by a decrease in growth, such as in Mentha pulegium (Oueslati et al., 2010), an halophyte behavior in Sesuvium portulacastrum (Messeddi et al., 2004) or by a reduction in the biomass production by 25 and 38% as compared to control plants at 50 and 75 mM NaCl, respectively (Ben Taarit et al., 2010). Similarly, Hendawy and Khalid (2005) found a significant decrease in sage dry weight at 50 mM NaCl ranging between 34 and 48%. A growth reduction by salt constraint is considered by many authors as critical for discrimination between species or cultivars, tolerant and sensitive (Paradossi et al., 1999; Royo and Aragüés, 1999). Our findings suggest that CV was less sensitive to salt than TV at a moderate NaCl concentration. Besides, as in a Thellungiella halophila (M’rah et al., 2006), a competition in absorption and transport of + + (K /Na ) from the roots to aerial parts was found in variety CV. According to Kaddour et al. (2009), a good selectivity for K+ is necessary to maintain better plant growth on saline medium. Indeed, a law biomass production due to Na+ competition with K+ for uptake and transport causes a deficiency of potassium (Shiyab et al., 2003). Since potassium as suggested by Ashraf and Orooj, (2006) and Oueslati et al. (2010) is one of the most growth-limiting factors under saline conditions, salinity at some extend can induce ROS, which may be reduced by antioxidant

enzymes. GPX and CAT are the major antioxidant enzymes associated with scavenging ROS (Marschner 1995). In CV, NaCl constraint increased GPX and CAT activities, whereas it decreased it significantly in TV. This increase in GPX was also observed in M. pulegium (Oueslati et al., 2010) and has been previously described in cotton cultivars (Meloni et al., 2002); in this latter, peroxidase activity was stimulated by 76 and 94% of the control, at 100 and 200 mM NaCl respectively. MDA is regarded as a marker for evaluation of lipid peroxidation or damage to plasmalemma and organelle membranes that increases with environmental stresses. Our findings indicate a lower degree of membrane damage observed in CV, which is indicated by low MDA content and high peroxidase activity. According to their results, Demiral and Turkan (2005), showed that the lowest MDA content is correlated with salt tolerance in resistant cultivar of rice, compared with the susceptible cultivar IR28. Similarly, lettuce Verte variety was more tolerant than Romaine on by limiting the accumulation of MDA and enhancing the accumulation of antioxidant enzymes (Mahmoudi et al., 2010). Sreenivasulu (1999) showed that a high peroxidase activity associated to a low MDA content contribute to better salt tolerance. In order to confirm and better explain the tolerance of CV as compared to TV, we carried out a study on the anatomical structures of leaves and stems of these two varieties. The marjoram leaves structures were similar to Origanum onites (Gonuz et al., 1999), but it differed from Origanum vulgare (Romanes et al., 2008). Stem has a subquadrangular shape in TV and quadrangular in the Canadian variety. Our findings in CV was similar to O. onites L., characterized by quadrangular stem (Gonuz et al., 1999). The stem of O. vulgare L. plants presented a quadratic contour to in transverse section, with four (more or less prominent in its upper third and attenuated in the rest of its length) (Romanes et al., 2008). According to Kofidis et al. (2003), the combined effects of altitude and season on growth of oregano showed that the increasing elevation resulted in a progressive decrease of plant height, while during the growing period, plants in autumn are some how shorter than plants in summer. A comparatively histo-anatomical observations at the spontaneous O. vulgare L. testify the fact that the thickness of the aerial stem (resulting especially from the development of the pith) progressively decrease at once with the increase of the altitude where the plants grow (Romanes et al., 2008). In the same time, our comparatively study reveals

7116

Afr. J. Biotechnol.

vEp

Co SP

PP Sv

bPP

SP C

vEp

dEp

Figure 10. Anatomical structure of the control (A) and treated leaves (B) of the Canadian variety (G* 500), A, section fixed in FAA and stained with aceto-carmine. B, section fixed in 4% glutaraldehyde buffered with Na-cacodylate, post fixed with et post 1% OsO4 buffered with the same buffer and then stained with boric toluidine blue. Epd, Dorsal epidermis; Epv, ventral epidermis; Co, collenchyma; PP, palisade parenchyma; PL, spongy parenchyma; NS, small vein; G, bundlesheath; FAA, formaldehyde-acetic-acid.

dEp

dEp S

S PP

co vEp

vEp

Figure 11. Anatomical structure of the control (A) and the treated leaves (B) of Tunisian variety (G* 500). Sections were fixed in 4% glutaraldehyde buffered with Na-cacodylate, then post fixed with et post 1% OsO4 buffered with the same buffer and stained with toluidine blue boric. dEp, Dorsal epidermis; vEp, ventral epidermis; Co, collenchyma; PP, palisade parenchyma; SP, spongy parenchyma; SV, small vein; G, bundle-sheath.

some anatomical differences of the stem and leaves which discriminate between the both varieties of Origanum majorana L. (Figures 10 to 13). Conclusion Our results demonstrate that the two varieties, CV and TV, responded differentially to NaCl treatment. The CV,

however, accomplished the followings: i) maintained organs hydration under saline condition; ii) maintained its K+ status in leaves; iii) restricted the accumulation of Na+ in its aerial parts; IV) maintained a high selectivity in + favour of K , which was demonstrated by limiting the MDA accumulation and enhancing the peroxidase activity; V) had thicker ventral and dorsal cuticle in the absence or presence of salt and increase in the lengthening of palisade cell accompanied by an increase

Baâtour et al.

Ep Ep

Co Co

’C C

Pc CP

+ +

Ph Ph CzZC SPh

SPh

XyXy

Mo Ep

SPh

SPh SPh

Xy Cz

w + +

Co Co

L ZC

Figure 12. Control stem of the two varieties (A - D Tunisian variety, E - H, Canadian variety). A and E, overview of young control stems cross-section, G×38; B and F, detail of portions from Figures A - E respectively, showing their anatomical structures, G*400; C to G, overviews of ripe stems cross-sectional, G×38; D - H, detail of portions from Figures C and D respectively, showing their anatomical structures, G*270. Sections fixed in FAA and stained with aceto-carmine. Ep, Epidermis; CZ, cambial zone; Xy, xylem; Ph, phloem; SPh, secondary phloem; P, pith, w, wood; Co, collenchymas; FAA, formaldehyde-acetic-acid.

c c

Xy Zc

Co Ph

Figure 13. Transverse sections of treated stems. A and B, Canadian variety; C and D, Tunisian variety; A and C, overview of cross-sectional stems, G*20; B and D, details of a portion of the stem showing its anatomical structure, G*750. In A to D, sections were fixed in FAA and stained with acetocarmine. FAA, Formaldehyde-acetic-acid.

7117

7118

Afr. J. Biotechnol.

of lacunae in spongy parenchyma. REFERENCES Ashraf M, McNeilly T (1990). Responses of four Brassica species to sodium chloride. Environ. Exp. Bot. 30: 475- 487, Ashraf M, Naqvi M (1991). Growth and ion uptake of four Brassica species as affected by Na/Ca ratio in saline sand culture. Z. Pflanzenemiihr. Bodenkd. 155: 101-108. Ashraf M, Orooj A (2006). Salt stress effect on growth, ion accumulation, and seed oil concentration in an arid zone traditional medicinal plant ajwain (Trachyspermum ammi L). Arid. Environ. 64: 209-220. Bâatour O, Kaddour R, Aidi WW, Lachâal M, Marzouk B (2010). Salt effects on the growth, mineral nutrition, essential oil yield and composition of marjoram (Origanum majorana). Acta. Physiol. Plant. 32: 45-51. Bâatour O, Kaddour R, Mahmoudi H, Tarchoun I, Bettaieb I, Nasri N, Mrah S, Hamdaoui G, Lachaâl M, Marzouk B (2011). Salt effects on Origanum majorana fatty acids and essential oils composition. J. Sci. Food. Agr. DOI. 10: 1002-4495. Banchio E, Bogino PC, Zygadlo J, Giordano W (2008). Plant growth promoting rhizobacteria improve growth and essential oil yield in Origanum majorana L. Biochem. Syst. Ecol. 36: 766-771. Ben Taarit M, Msaada K, Hosni K, Marzouk B (2010). Changes in fatty acid and essential oil composition of sage (Salvia officinalis L,) leaves under NaCl stress. Ind. Crops Prod. 30: 333-337. Bouslama T, Snoussi H, Harbi M, Arroyo R (2004). Organization international de la vigne et du vin, Formes liées. B. O. I.V. 77: 881882. Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Cachorro P, Ortiz A, Cerda A (1994). Implications of calcium nutrition on the response Phaseolus vulgaris L to salinity. Plant Soil, 159: 205212. Cakmak I, Marschner H (1992). Magnesium deficiency and high light intensity enhance activities of superoxide dismutase ascorbate peroxidase, and glutathione reductase in bean leaves. Plant. Physiol. 98: 1222-1227. Circella G, Franz C, Novak J, Resh H (1995). Influence of day length and leaf insertion on the composition of marjoram essential oil. Flavour. Fragr. J. 10: 371-374. Cramer GR, Epstein E, Laûchli A (1989). Na-Ca interactions in barley seedlings: relationship to ion transport and growth. Plant. Cell. Environ. 12: 551-558. Dafarera DJ, Ziogas BN, Polissiou M (2000). GCMS analysis of essential oils from some greek aromatic plants and their fungotoxicity on Penicillium digitatum. J. Agric. Food. Chem. 48: 2576-2581. Demiral T, Türkan I (2005). Comparative lipid peroxidation, antioxidant defense systems and proline content in roots of two rice cultivars differing in salt tolerance. J. Environ. Exp. Bot. 53: 247-257. Elkahoui S, Hernandez JA, Abdelly C, Ghrir R, Limam F (2005). Effects of salt on lipid peroxidation and antioxidant enzyme activities of Catharanthus roseus suspension cells. Plant Sci. 168: 607-613. Gönüz A, Özörgücü A, Bilkan B (1999). An Investigation on the Morphology, Anatomy and Ecology of Origanum onites L. Trend J. Bot. 23: 19-32. Grattan SR, Grieve CM (1993). Mineral nutrient acquisition and response by plants grown in saline environments. In: Handbook of plant and crop stress Marcel Dekker, New York, pp 203–226. Hachicha M (2007). Les sols salés et leur mise en valeur en Tunisie. Sécheresse. 18: 45-50. Hendawy SF, Khalid KA (2005). Response of sage (Salvia officinalis L,) plants to zinc application under different salinity levels. J .Appl. Sci. Res. 1: 147-155.

Hoagland DR, Arnon DI (1950). The water culture method for growing plants without soil. Calif. Agric. Exp. Sta. Berkley. 32: Circ 347. Kaddour R, Nasri N, M’rah S, Berthomieu P, Lachaâl M (2009). Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress. C.R. Biologies. 332: 784-794. Kofidis G, Bosabalidis AM, Moustakas M (2003). Contemporary seasonal and altitudinal variations of leaf structural features in Oregano (Origanum vulgare L). Ann. Bot. 92: 635-64. Locquin M, Langeron M (1978). Manuel de Microscopie, edition Masson. p. 352. M’rah S, Ouerghi Z, Berthomieu C, Havaux M, Jungas C, Hajji M, Grignon C, Lachaal M (2006). Effects of NaCl on the growth, ion accumulation and photosynthetic parameters of Thellungiella halophila. J. Plant. Physiol. 163: 1022-1031. Mahmoudi H, Huang J, Gruber MY, Kaddour R, Lachaâl M, Ouerghi Z, Hannoufa A (2010). The impact of genotype and salinity on physiological function, secondary metabolite accumulation, and antioxidative responses in lettuce. J. Agric. Food. Chem. 58: 51225130. Marschner H (1995). Mineral nutrition of higher plants 2nd edn. Academic Press London. Meloni DA, Oliva MA, Martinez CA, Cambria J (2002). Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 49: 69-76. Messedi D, Labidi N, Grignon C, et Abdelly C (2004). Limits imposed by salt to the growth of the halophyte Sesuvium portulacastrum. J. Plant Nutr. Soil Sci. 167: 720-725. Oueslati S, Karray BN, Attia H, Rabhi M, Ksouri R, Lachaal M (2010). Physiological and antioxidant responses of Mentha pulegium (Pennyroyal) to salt stress. Acta. Physiol. Plant. 32: 289-296. Pardossi A, Malorgia F, Tognoni F (1999). Salt tolerance and mineral relations for celery. J. Plant Nutr. 22(1): 151-161. Ramona G, Constantin T, Ana P, Elvira G (2008). Structural peculiarities of the vegetative apparatus of spontaneous and cultivated and cultivated Origanum vulgare. Plants Univer. Din. Craiova. 13( XLIX): 273-278. Royo A, Aragüés R (1999). Salinity-yield response function of barley genotypes assessed with a triple line source sprinkler system. Plant. Soil. 209: 9-20. Shiyab SM, Shibli RA, Mohammad MM (2003). Influence of sodium chloride salt stress on growth and nutrient acquisition of sourorange in vitro. J. Plant Nutr. 26: 985-996. Sreenivasulu N, Ramanjulu S, Ramachandra-Kini K, Prakash HS, Shekar-Shekar, Savithri H, Sudhakar C (1999). Total peroxidase activity and peroxidase isoforms as modified by salt stress in two cultivars of fox-tail millet with differential salt tolerance. Plant. Sci. 141(1): 1-9. Srinivas ND, Rashmi KR, Raghavarao KSMS (1999). Extraction and purification of a plant peroxidase by aqueous two phase extraction coupled with gel filtration. Process. Biochem. 35: 43-48. Statsoft (1998). STATISTICA for Windows (Computer program electronic manual), Statsoft, Tulsa, OK. York, pp. 203-226.

African Journal of Biotechnology Vol. 11(27), pp. 7119-7127, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1505 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Changes in some biochemical parameters of kidney functions of Plasmodium berghei infected rats administered with some doses of artemether R. O. Akomolafe1*, I. O. Adeoshun1, J. B. Fakunle2, E. O. Iwalewa3, A. O. Ayoka1, O. E. Ajayi1, O. M. Odeleye4 and B.O. Akanji5 1

Department of Physiological Sciences, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria. 2 Department of Chemical Pathology, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria. 3 Department of Pharmacology, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria. 4 Department of Pharmacognosy, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria. 5 Department of Chemical Pathology, Obafemi Awolowo University Teaching Hospital Complex, Ile-Ife, Osun State, Nigeria. Accepted 12 August, 2011

This study aimed at determining changes in urine concentrations of sodium (Na+) and potassium (K+) of Plasmodium berghei infected rats during a week of intramuscular administration of artemether (12.5 to 50.0 mg/kg/day) and one week thereafter. Their concentrations and that of creatinine and urea in the plasma were also determined at the end of the study. The observed changes were related to the effects of artemether on the kidneys of the rats. The urine levels of the two electrolytes decreased significantly during treatment (P<0.05). One week post-treatment with 12.5 mg/kg of artemether, the urine concentrations of the electrolytes increased to values that were not significantly different from that of day 0. At 25 and 50 mg/kg, their urine concentrations still remained significantly lower than day 0 values (P<0.05). Plasma concentrations of the electrolytes one week post-treatment increased, but they were + only significant at 25 mg/kg for K . A significant increase in the plasma level of creatinine was observed at all the doses of the drug at one week post-treatment. A dose-dependent degeneration of the renal tissue of all the experimental rats was also observed. We concluded that high doses of artemether caused progressive degeneration of the renal tissue of P. berghei infected rats. Key words: Artemether, electrolytes in urine, plasma creatinine concentration, Plasmodium berghei. INTRODUCTION Artemether is one of the derivatives of artemisinin. Its efficacy in the treatment of malaria, including those resulting from infection by chloroquine-resistant strains of Plasmodium is well documented (Qinghaosu Antimalarial Coordinating Research Group, 1979; China Cooperative Research Group on Qinghaosu and its Derivatives as Antimalarials, 1982). It is being used worldwide in combination with other anti-malarials, as one of the first lines of treatment of cerebral malaria caused by chloroquine-resistant Plasmodium (Van Vugt et al., 1999; Nosten et al., 2000). Intramuscular administration of

*Corresponding author. E-mail: rufakom@yahoo.co.uk.

multiple doses of the drug to dogs, rats and rhesus monkeys has been reported to produce neurotoxic effects such as gait disturbances, loss of spinal and pain reflexes (Petras et al., 1997; Sumalee et al., 1997; Nontprasert et al., 1998, 2000; Xiao et al., 2002). High doses of artemether were also reported to have caused neuronal necrosis in the region of the brainstem of rats (Raymond et al., 1998; Xiao et al., 2002). Anorexia and a dosedependent reduction in body weight have also been reported at these high doses (Qigui et al., 1998). Following one week of intramuscular administration of 12.5 to 50.0 mg/kg of artemether, we reported changes in some of the visceral functions of Wistar rats (Akomolafe et al., 2006). We reported a pattern of anorexia which manifested as a significant reduction in the food and

7120

Afr. J. Biotechnol.

water intake of all the treated rats. This was accompanied by significant increases in their urine output. These effects persisted until even one week after the stoppage of drug administration in those rats that received 50.0 mg/kg of the drug, whereas those that received lower doses had only their food intake restored during this period. We concluded that the significant increase in urine output without a corresponding increase in the water intake of the rats could exacerbate dehydration and lead to a deleterious effect on the ionic balance of the body fluid of the rats. We also postulated that high doses of artemether could cause impaired renal function of the treated rats and that the significant increase in urine output could be due to other effects of the drug on thirst, anti-diuretic hormone output and the osmotic pressure of their blood (Akomolafe et al., 2006). The plasma levels of some electrolytes especially sodium (Na+) and potassium (K+), are very important for the proper function of the neuromuscular and cardiovascular systems (Guyton and Hall, 2001; Ganong, 2003). Excessive loss of these ions from the body through urine, stool or sweat could have serious deleterious effects on these two systems, likewise their excessive retention (Guyton and Hall, 2001; Ganong, 2003). Literature is scanty on the influence of artemisinin derivatives on the electrolyte balance of the body fluid of laboratory animals. Our recent study on the effects of seven days administration of some doses of artemether (12.5 to 50 mg/kg) on the plasma and urine levels of these electrolytes in uninfected rats revealed that their concentrations in urine decreased dose dependently during treatment (Akomolafe et al., 2011). The decrease was not reversed at 25 and 50 mg/kg even one week after treatment. A dose-dependent tissue degeneration was observed in the kidneys of the rats. We concluded that the doses of artemether used in the study caused impairment of renal functions in apparently healthy rats, leading to the inability of the kidneys to concentrate urine. Therefore, we carried out this study to determine changes in urine levels of Na+ and K+ during and after administration of artemether to rats that were infected with Plasmodium berghei. Plasma levels of the electrolytes, urea and creatinine were determined post-treatment with a view to shedding some light on its toxicity in the body fluid and renal tissue of rats treated for malaria. MATERIALS AND METHODS Eighty adult Wistar rats (200 to 250 g) were used for this study. The rats were obtained from the Animal Holding of the Department of Physiological Sciences, Obafemi Awolowo University, Ile-Ife, Nigeria. They were kept in the laboratory under natural light/dark cycle and were fed on normal mouse cubes (Ladokun feeds, Ibadan, Nigeria) and water ad libitum. The rats were divided into four groups labeled I, II, III and IV. Each of the groups consisted of 20 rats: ten males and ten females. Each rat was housed in a separate metabolic cage (Ohaus R Model; Ohaus, Pine Brook, NJ, USA) with free access to food and water. The rats were

acclimatized for two weeks before the commencement of the experiments. P. berghei (NK 65 strain) was used for this study. It was acquired from the Department of Pharmacology and Therapeutics, University of Ibadan, Nigeria.

Inoculum preparation Donor rat with P. berghei strain with about 20 to 32% parasitaemia was used. The red blood cell (RBC) per unit volume was calculated from the inoculum size. The number of parasitized RBC in a volume of blood was then calculated by multiplying the percentage of parasitaemia by the number of RBC. The desired volume of blood was obtained from the donor rat under chloroform anaesthesia by cardiac puncture using a heparnised sterile syringe. The blood was suitably diluted with sterile normal saline so that the final inoculum (0.2 ml) for each rat contained the required number of parasitized RBC (that is, 3.0 Ă&#x2014; 107 parasitized RBC) (a modification of the method of Shu-Hua et al., 2004).

Preparation of thin and thick films and staining technique A small drop of blood from the tail of the rat was collected on clean non-greasy slide. Thin and thick blood films were made accordingly. The films were air-dried. The thin film only was then fixed using few drops of methanol and left to air-dry. The malaria parasites in thick and thin blood films were stained with Giemsa stain. The stain was diluted with the sodium phosphate buffer at pH 7.2 in the ratio of 4:10, that is, 4 ml of the Giemsa stain to 10 ml of buffer solution. The stain was applied on the slide and allowed to stand for 10 to 12 min. The stain was poured off and the slide rinsed with buffer solution and allowed to air-dry.

Evaluation of parasitaemia Each of the blood films prepared was mounted on a microscope and a drop of immersion oil was applied to the slide using 100x objective lens to locate the best field of view for counting both parasitized RBC and unparasitized RBC. In a particular field, the total number of red blood cells (TRBC) as well as the total number of parasitized RBC (PRBC) was counted. Percentage parasitaemia in each field was calculated as follows:

Total number of PRBC Parasitaemia (%) =

100 x

Total number of RBC

Ten fields were counted on each slide and the mean percentage parasitaemia was recorded for each rat. Rats with parasitemia level of not less than 25% were used for this study. This was observed four days after inoculation. Our pilot study revealed substantial parasite clearance (<1% parasitemia) on the 3rd and 13th day of treatment in experimental and control rats, respectively. Drug administration was commenced on the 5th day of inoculation, which was taken as day 0 of the experiment.

Drug administration Injectable form of artemether (80 mg/ml) manufactured by Kunming Pharmaceutical Factory, Kunming, Peopleâ&#x20AC;&#x2122;s Republic of China was dispensed in 1 ml ampoules for intramuscular injection.

Akomolafe et al.

NS 12.5mg/Kg 25.0mg/Kg 50.0mg/Kg

120

Urinary concentration of Sodium (mmol/L)(INR)

7121

100

* *

0 0

Day Figure 1. Variation in the urine concentration of sodium due to a week of intramuscular administration of artemether to P. berghei infected rats (NS = nomal saline). Each point is mean ÂąS.E.M (n = 20); *significantly different from the day 0 value (p <0.05).

Dose regimens

Statistical analysis

Each rat in Group I that weighed 250 g was given 0.16 ml of normal saline (equivalent to the volume of the drug that was administered to each rat of the same weight that received 50.0 mg/kg/day) for 1 week. This group served as the control. Each of the rats in Groups II, III and IV received 12.5, 25.0 and 50.0 mg/kg/day of artemether, respectively via the intramuscular route for one week. Urine samples were collected into clean specimen bottles for 24 h on the day before the commencement of drug administration and this was taken as the day 0 urine for each of the rats. This procedure was repeated for days 3, 7, 11 and 14 of the study, that is, one week of drug administration and another one week later. The concentrations of Na+ and K+ in the samples were measured by Flame Photometry using Flame Photometer Model 410C Manufactured by Sherwood Instruments Cambridge UK. On day 14, the rats were sacrificed under chloroform anaesthesia. A midline incision was made with a surgical blade to expose the abdominal organs. Blood was collected from their hearts by cardiac puncture and delivered into lithium heparinized specimen bottle. A new syringe was used for the collection of blood from each rat. The blood was immediately centrifuged at 3000 revolutions per minutes for 20 min. The plasma was thereafter separated into a specimen bottle in readiness for analysis. The concentrations of Na+ and K+ in the samples were determined using the same methods that were used in the analysis of urine. The rats kidneys were dissected out and kept inside 10% formalin until their sections were cut and stained with eosin and hematoxylin for histological studies. Photomicrograph of the tissues was taken using Lect3 Dialux Microscope (Bright Field) at 400x magnification.

The results were expressed as mean Âą S.E.M and subjected to one-way ANOVA. Significant differences were further tested by the Duncanâ&#x20AC;&#x2122;s multiple range and Student Neuman Keuls tests. Student t-test was used to compare the urine concentration of the electrolytes for each day with the day 0 value for each group. Differences with probability values of p<0.05 were considered significant.

RESULTS Effect of artemether on urinary concentration/level of electrolytes +

Sodium (Na ) There was no significant alteration in the urine Na+ concentration of the control rats during and after treatment (Figure 1). During treatment, a significant reduction in the urine concentration of Na was observed at all the doses of artemether used in this study. After treatment, the concentration of this electrolyte remained significantly reduced at 25 and 50 mg/kg, while it was restored to values that were not significantly different from the pre-treatment value in rats that received 12.5 mg/kg of the drug.

7122

Afr. J. Biotechnol.

Urinary concentration of Potassium (mmol/L)(INR)

400

350

300

* *

250

* * 200

* *

150

NS 12.5mg/Kg 25.0mg/Kg 50.0mg/Kg

100

0 0

Day

Figure 2. Variation in the urine concentration of potassium due to a week of intramuscular administration of artemether to P. berghei infected rats (NS = nomal saline). Each point is mean Âą S.E.M (n = 20); * significantly different from the day 0 value (p < 0.05).

Potassium (K+) During treatment, a significant reduction in the concentration of K+ in urine was observed in the control as well as the experimental rats (Figure 2). After treatment, the urine concentration of this electrolyte remained significantly lower than the day 0 value in rats that received 25 and 50 mg/kg, while that of the control and rats that received 12.5 mg/kg of the drug rose to values that were not significantly different from the day 0 concentrations. Effects of artemether concentration

plasma

electrolyte

Plasma Na+ concentration was significantly lower than the control value only at 12.5 mg/kg (Figure 3). Plasma K+ level increased significantly at 25 mg/kg of artemether (Figure 4). DISCUSSION The periodic assay of Na+ and K+ in urine showed that, the concentrations of the electrolytes in rats treated with artemether fell during treatment (Figures 1 and 2). Their concentrations increased to the day 0 values at 12.5 mg/kg. At 25.0 and 50.0 mg/kg however, the concentrations of the electrolytes fell irreversibly and significantly. At these two doses, marked polyuria was

reported in our previous studies (Akomolafe et al., 2006). Plates 1 to 4 also show progressive renal tissue damage with increasing dose of artemether. Inability of the kidney to concentrate or dilute the urine, usually occurs in case of damage to most of the nephrons (Guyton, 2001; Dunn, 2003). There is rapid tubular flow of the glomerular filtrate in the remaining functional nephrons, making reabsorption of water and electrolytes impossible. The kidney is therefore unable to concentrate or dilute the urine. This study indicates that the doses of artemether used were dose-dependently toxic to the renal tissue of the infected rats, as evidenced by the photomicrographs of the kidneys. The changes in plasma concentration of urea of experimental rats were not dose dependent (Figure 5). At 12.5 mg/kg, it was not significantly different from the control. It was significantly higher than the control at 25 mg/kg and significantly lower at 50 mg/kg. However, the plasma creatinine levels in all the experimental rats were significantly higher than that of the control (Figure 6). Plasma urea, creatinine and electrolytes are the most sensitive biochemical markers used in the assessment of renal tissue damage, because urea and creatinine are excreted through the kidneys, while the electrolytes are reabsorbed in the tubules. So, in cellular damage, there is retention of urea and creatinine in the blood, low reabsorption and much excretion of electrolytes by the tubules. The excessive fluid loss of rats that received these doses of artemether could lead to dehydration and a severe depletion of the major electrolytes of the extracellular fluid of the rats, however, there was an associated decrease in food intake (Akomolafe et al.,

Akomolafe et al.

7123

144

142

a Sodium (mmol/L)

140

138

b 136

134

132

130

128 NS

12.5

25.0

50.0

Dose (mg/Kg) Figure 3. Effect of artemether on the sodium concentration of the plasma of P. berghei infected rats. Each bar is mean Âą S.E.M (n = 20); b Significantly different from control (p < 0.05).

Potassium (mmol/L)

0 NS

12.5

25.0

50.0

Dose (mg/Kg) Figure 4. Effect of artemether on the potassium concentration of the plasma of P. berghei infected rats. Each bar is mean Âą S.E.M (n = 20); b significantly different from control (p < 0.05).

7124

Afr. J. Biotechnol.

Urea (mmmol/L)

b 5

0 NS

12.5

25.0

50.0

Dose (mg/Kg) Figure 5. Effect of artemether on the urea concentration of the plasma of P. berghei infected rats. Each bar is mean Âą S.E.M (n = 20); bsignificantly different from control (p < 0.05).

140

Creatinine (umol/L)

b 120

100

b 80

b 60

0 NS

12.5

25.0

50.0

Dose (mg/Kg) Figure 6. Effect of artemether on the creatinine concentration of the plasma of P. berghei infected rats. Each bar is mean Âą S.E.M (n = 20); b Significantly different from control (p < 0.05).

Akomolafe et al.

7125

T Plate 1. Photomicrograph of the kidney of infected rats that received normal saline i.m. for 7 days (control 2). Magnification 400x. The Bowmanâ&#x20AC;&#x2122;s capsule (B) appears distinct, but the capsular space (S) is closed by inflamed glomerulus (G). The tubular cells (C) are densely stained and the inter-tubular spaces (P) are almost closed. The tubular architecture (T) is still fairly preserved. There is mesangial cell (M) proliferation.

C P T

Plate 2. Photomicrograph of the kidney of rats that received 12.5 mg/kg of artemether i.m. for 7 days. Magnification 400x. Bowmanâ&#x20AC;&#x2122;s capsule (B) has started degeneration. The glomerulus (G) has broken down. The tubules (T) are inflamed and have distorted shapes. Their cells (C) are densely stained and the spaces between them (P) are almost closed completely.

2006). Only the experimental rats that received 25 and 50 mg/kg of artemether had insignificantly higher plasma + concentrations of Na than the control rats. However, all the experimental rats had higher concentrations of K+ than the control, the difference being significant at 25 mg/kg only. Sodium is the major cation of the extracellular fluid, while potassium is the major cation of the intracellular fluid (Guyton, 2001; Gannong, 2003). Saroj et al. (2002) reported an increase in the plasma level of + K (hyperkalemia) in patients with acute renal failure

resulting from Plasmodium falciparum infection. This according to them was due to the rapid lysis of blood cells by the parasites. They also reported that the inflammation that is associated with malarial infection could lead to leakage of fluid from the intravenous compartment due to increased vascular permeability, thereby leading to hypovolemia and haemo-concentration. The increase + + in the plasma level of Na and K observed at 25 and 50 mg/kg in this study (Figures 4 and 5) is in conformity with the report of the researchers. A significant polyuria had been reported in these rats (Akomolafe et al., 2006).

7126

Afr. J. Biotechnol.

Plate 3. Photomicrograph of the kidney of rats that received 25.0 mg/kg of artemether i.m. for 7 days. Magnification 400x. The Bowmanâ&#x20AC;&#x2122;s capsule (B) has degenerated completely. The renal tubular architecture (T) is almost completely distorted, as most of the cell boundaries of the tubular cells are no more distinct. The inter-tubular spaces (P) are almost completely filled up by inflamed tubules.

C B T

Plate 4. Photomicrograph of the kidney of rats that received 50.0 mg/kg of artemether i.m. for 7 days. Magnification 400x; The Bowmanâ&#x20AC;&#x2122;s capsule (B) has undergone complete degeneration, neither the glomerulus nor the capsular space can be seen again. The renal tubules (T) have lost their integrity to a very large extent. All the spaces between them have been filled up and their cells (C) are densely stained.

Photomicrographs of their kidneys revealed much tissue damage (Plates 2 to 4). The excessive water loss by these rats was responsible for the high levels of Na+ and K+ in their plasma. Hyperkalemia causes bradycardia or reduced heart rate (Guyton, 2001). The elevated value of

K+ in these rats could have a severe consequence on the functioning of their hearts. The significant increase in the plasma creatinine concentration of the experimental rats as revealed by Figure 6 was an indication of renal tissue damage.

Akomolafe et al.

The necrosis observed in the renal tissues of the experimental rats could not be attributed to malarial infection, since significant parasite clearance was achieved even before the completion of treatment. The control rats that achieved parasite clearance by their own immune system much later showed evidence of less tissue damage in their kidney. Artemether induced necrosis in the renal tissue of the rats (Plates 2 to 4) led to a breakdown in the renal handling of the major electrolytes of the body fluid: Na+ and K+, and the inability of their nephrons to retain water in the body. The resulting excessive loss of water also contributed to the raised plasma levels of Na+ and K+ in this study. This study revealed that the doses of artemether used are toxic to the kidney of the infected rats. The toxicity manifested as renal tissue damage, elevated levels of plasma creatinine and urea resulting from impaired renal function, and electrolyte imbalance in their body fluid. ACKNOWLEDGMENTS We are grateful to Obafemi Awolowo University, Ile-Ife for financing part of this study and to Mr. J.A. Ibeh, of the Department of Anatomy and Cell Biology, and Messrs T. A. Ogundoyin, F. A. Abidoye, C. O. Ola, R. T. Olatoye and A. E. Adebiyi of the Department of Physiological Sciences for their technical assistance in the process of carrying out this research work. We also thank the Department of Pharmacology and Therapeutics, University of Ibadan for assisting us with the P. berghei strain. REFERENCES Akomolafe RO, Adeoshun IO, Fakunle JB, Iwalewa EO, Ayoka AO, Ajayi OE, Odeleye OM, Akanji BO (2011). Effects of artemether on the plasma and urine concentrations of some electrolytes in rats. Afr. J. Biotechnol. 10(20): 4226-4233. Akomolafe RO, Adeoshun IO, Fakunle JB, Iwalewa EO, Ayoka AO, Akanji BO (2006). Changes in the visceral functions of plasmodiuminfected and uninfected rats following administration of artemether. Clin. Exp. Pharmacol. Physiol. 33: 1180-1183 . China Cooperative Research Group on Qinghaosu and its Derivatives as Antimalarials (1982). Studies on the toxicity of qinghaosu and its derivatives. J. Trad. Chin. Med. (2): 31 - 38 Dunn MJ (2003). Kidney failure in Dogs and Cats. A publication of the pet center. The Internet Animal Hospital: 22 - 28. st Ganong WF (2003). Review of medical physiology 21 Edition. Lange Med. Books/Mc Graw Hill: 701 - 733. Guyton AC, Hall JE (2001) Textbook of Med. Physiol. Tenth Edition. Harcourt Int. Ed. Pub. by WB, Saunders Company, Philadelphia, Pennsylvania: 377-455. Nontprasert A, Norsten-Bertrand M, Pukrittayakamee S, Vanijanonta S, Angus BJ, White NJ (1998). Assessment of the neurotoxicity of parenteral artemisinin derivatives in mice. Am. J. Trop. Med. Hyg. (59):519 - 522.

7127

Nontprasert A, Sasithon P, Marika N, Sirivan V. Nicholas JW (2000). Studies of the neurotoxicity of oral artemisinin derivatives in mice. Am. J. Trop. Med. Hyg. 62 (3): 409- 412. Nosten F, Van Vugt M, Prince R, Luxemburger C, Thway K, Brockman A, McGready R. Kuile F, Looareesuwan S, White NJ (2000). Effects of artesunate-mefloquine combination on incidence of Plasmodium falciparum malaria and mefloquine resistance in western Thailand: a prospective stud. Lancet. 356: pp. 297-302. Petras JM, Kyle DE, Gettayacamin M, Young GD, Bauman RA, Webster HK, Corcoran KD, Peggins JD, Vane MA, Brewer TG (1997). Arteether; Risk of two-week administration of Macaca mulatta. Am. J. Trop. Med. Hyg. 390-396. Qigui L, Thomas GB, James OP (1998). Anorexic toxicity of dihydroartemisinin, artemether, and arteether in rats following multiple intramuscular doses. Int. J. Toxicol. (17): 663- 676. Qinghaosu Antimalarial Coordinating Research Group 1979. Antimalarial studies on qinghaosu. Chin. Med. J. (92): 811- 816 Qinghaosu Antimalarial Coordinating Research Group, Haiman Island (1979). Observations on the clinical effect of qinghaosu in the treatment of chloroquine-resistant malaria. J. Nat. Drug. 9:12-16. Raymond GG, Donald BN, Qigui Li JO, Thomas JB (1998). Dosedependent brainstem neuropathology following repeated arteether administration in rats. Brain. Res. Bull, 45 (2):199 -202. Saroj M, Shradhanand M, Sanjib M, Patel NC, Mohapatra DN (2002). Acute renal failure in Falciparum malaria. J. Ind. Acad. Clin. Med. 3 (2): 141-147. Shu-Hua Xiao, Jun-Min Yao, Jurg Utzinger, Yuel Cai, Marcel Tanner (2004). Selection and reversal of Plasmodium berghei resistance in the mouse model following repeated high doses of artemether. Parasitol. Res. 92 (3): 215-219. Sumalee K, Paul M, Paul H, Herman Z, Steven RM (1997). Artemisinin neurotoxicity: Neuropathology in rats and mechanistic studies in vitro. Am. J. Trop. Med. Hyg. 56(1): 7- 12. Van Vugt M, Wilariratana P, Gemperti B, Gathman I, Phaipum L, Brockman A, Luxemburger C, White NJ, Nosten F, Looareesuwan S (1999). Efficacy of six doses of artemether-lumefantrine (Benflumetol) in multidrug-resistant plasmodium falciparum malaria. Am. J. Trop. Med. Hyg. 60(6): 736-942. Xiao S, Yang Y, You Q, Utzinger J, Guo H, Peiying J, Mei J, Guo J, Bergquit) R, Tanner M (2002). Potential long-term toxicity of repeated orally administered doses of artemether in rats. Am. J. Trop. Med. Hyg. 66 (1): 30- 34.

African Journal of Biotechnology Vol. 11(27), pp. 7128-7134, 3 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2612 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Some chemical properties of oil palm decanter meal M. Afdal1,2, Azhar Kasim1*, A. R. Alimon1 and N. Abdullah3 1

Department of Animal Science, Faculty of Agriculture, Universiti Putra Malaysia, Selangor 43300, Malaysia. 2 Faculty of Animal Husbandry, Jambi University Kampus Mandalo Darat, 36361, Indonesia. 3 Department of Biochemistry, Faculty of Biotechnology and Biomolecular Science, Universiti Putra Malaysia, Selangor 43300, Malaysia. Accepted 15 November, 2011

The aims of this study were to investigate the rancidity and chemical properties of oil palm decanter meal (OPDM) after been kept over an extended period of time. Samples were collected daily and analyzed for some rancidity properties, including peroxide value (PV) and thiobarbituric acid (TBA), and for chemical composition, including proximate analysis, fiber, mineral and fatty acid (FA) content. The correlation coefficient between time of storage and the rancidity (PV and TBA) of OPDM were positive with R2 of 0.9792 and 0.9678, respectively. During ten days of observation, the compositions of longchain FA, including stearic, oleic, linoleic and linolenic except for palmitic were significantly (P<0.05) different. The compositions of short-chain FA, including acetic, propionic, isobutyric, butiryc, isovaleric and valeric, were also significantly (P<0.05) different. Furthermore, PV and TBA were significantly (P<0.05) different during the extended time of 10-days storage. The correlation coefficient between PV and long-chain FA (palmitic, stearic, oleic, linoleic, and linolenic) were 0.61, 0.16, -0.82, -0.3 and -0.84, respectively, and the correlation composition between TBA and the composition of long-chain FA (palmitic, stearic, oleic, linoleic and linolenic) were 0.40, 0.34, -0.91, -0.02 and 0.62, respectively. It could be summarized that physically and chemically, the fresh OPDM might be used as an alternative feed, especially for ruminant. Key word: Oil palm decanter meal, fatty acid, oxidation, rancidity, peroxide, thiobarbituric. INTRODUCTION Oil palm decanter meal (OPDM) is a pasty-type byproduct derived from mechanical extraction of crude palm oil (Afdal et al., 2011). It is slightly different from palm oil mill effluent or palm oil sludge as it is processed by a specific processing machine. The OPDM is produced after passing through a process of decanting, centrifuging and then drying within the machine system (Southworth, 1985). Utomo and Widjaja (2004) clarified that OPDM was produced by the separation of liquid from palm oil sludge so it looks like a solid by-product, like tofu. The typical characteristic color of OPDM is soft blackish brown. OPDM consists of 81.65, 12.63, 7.12, 25.79, 0.03 and 0.003%, respectively, of dry matter (DM), crude protein (CP), ether extract (EE), crude fiber, calcium and phosphorous, and 154.52 Kcal/kg energy (Southworth,

*Corresponding author. Email: bandatanang@yahoo.com.

1985). The fatty acids (FA) components of OPDM are usually palmitic, oleic, linoleic, stearic and miristic acids (Macfarlane et al., 1975). OPDM is also rich in betacarotene content and is a source of natural vitamin A with 900 IU g-1. This is slightly higher than the content of -1 natural vitamin A of fish oil (600 IU g ) (Macfarlane et al., 1975). It is a valuable and potential by-product that can be utilized as an alternative source of feed for animals (Southworth, 1985). However, OPDM usually turns rancid when kept in the open air for a few days. Normally, oxygen and other environmental factors lead to its oxidation, and this may influence the chemical composition which subsequently affects the organoleptic, chemical and physical properties. The OPDM containing polyunsaturated FA was found to be easily oxidized and quick to develop rancid-off flavor (Hamilton, 1994). Rancidity could be one of the limiting factors when it is used as feed. In fact, there is less study concerning the rancidity and chemical

Afdal et al.

properties of OPDM. The aims of these studies were to describe some properties of OPDM namely, the chemical composition, rancidity (PV and TBA) and the involvement of the deterioration of FA such as palmitic, stearic, oleic, linoleic and linolenic after been kept at 10-extended days. MATERIALS AND METHODS Sample preparation and procedure Fresh OPDM sample was collected from the palm oil plant in Kemaman Trenggano Malaysia and transported to the laboratory of Animal Nutrition, Universiti Putra Malaysia. The samples were placed in a big bucket and kept standing at a room temperature prior to the data collection. One kilogram of a composite sample was collected from the bucket at 05.00 pm everyday for 10 consecutive days. Collected samples were arranged inside the different plastic bags and subsequently transferred into a fridge at 20°C prior to the analysis.

thiosulphate titrated, N is normality of sodium thiosulphate and S the sample weight.

Thiobarbituric acid TBA number was determined according to the procedure of Tadlargis et al., (1960). 10 g of OPDM sample were mixed for 2 min with 50 ml distilled water using a blender. The mixture was then poured into a distillation flask and washed with 47.5 ml of distilled water. It was afterward treated with 2.5 ml of 4 N hydrochloric-acid together with an anti foam agent and marble. The flask was heated for about 10 min and 50 ml of distillate was collected. 5 ml of this distillate was pipeted into a 15-ml-glass stopper tube and 5 ml of 0.2883% (w/v) TBA solution in 90% glacial acetic acid was added. The tubes were capped, shaken and then heated to the boiling point in a water bath for 35 min. A blank tube preparation was made in the same way using 5 ml of distilled water and 5 ml of the reagent. Both sample and blank were cooled in tapped water for 10 min, and the absorbance (D) was recorded against the blank at 538 nm using 1.5 ml cuvette. The TBA number was calculated in mg of malondialdehyde kg-1 of samples, which was equal to 7.8 times using the formula:

Property evaluation

TBA = D × 7.8

Fresh sample was evaluated for physical properties, including appearance, color, smell and tenderness. Samples from the fridge were analyzed for the rancidity (PV and TBA), the compositions of FA, nutrients, including DM, ash, CP, EE, neutral detergent fiber (NDF), acid detergent fiber (ADF), and some minerals. The pH was measured as soon as the fresh OPDM was collected from the factory using a pH meter (Scan 1 water proof, Eutech Instrument Pte Ltd Singapore).

Where, TBA is thiobarbituric number and D is absorbance.

Chemical analysis Proximate analysis, including DM, ash, CP and EE was done according to the procedure of AOAC (1990). Analysis of fiber content, including NDF and ADF, was done following the procedure of VanSoest (1963). Mineral analysis for Cr, Fe, Mn, Ni and Cu were carried out using atomic absorption spectrometry (AAS). Rancidity analysis Peroxide value Peroxide value was determined according to the procedure of Vanhanen and Savage (2006) with few modifications. Approximately 5 g of OPDM sample were placed into a beaker glass and 30 ml of mixture of acetic acids and chloroform (ratio of 3:2) were added, shaken by hand and kept standing on a table for 1 h. The mixture was filtered using filter paper (Whatman 125 mm Ø Cat No 1001 125, Whatman International Ltd Maidstone, England) into an Erlenmeyer flask and treated with 1.5 ml of saturated potassium iodide. The solution was kept on the table for a while and shaken by hand, after which 30 ml distilled water and one or two drops of an indicator (starch solutions) were added. The solution was subsequently titrated with sodium thiosulphate (0.1 N Na2 S2 O3) until the purple color disappeared. The blank sample was also done under the same condition as PV determination itself. PV was calculated according to the formula: PV = (A × N × 1000)/S Where, PV (meq kg-1) is peroxide value, A is ml amount of sodium

7129

Fatty acids analysis Extraction of lipids The total fatty acids were extracted from OPDM sample based on the method of Folch et al. (1957) modified by Rajion et al. (1985), using chloroform/methanol (2:1 v/v) containing butylated hydroxy toluene to prevent oxidation during sample preparation. The 1 g samples were homogenized in 40 ml chloroform/methanol (2:1 v/v) using an Ultra-Turrax T5 FU homogenizer (IKA Analysentechnik GmBH, Heidolph, Viertrieb, Germany) in a 50-ml stoppered groundglass extraction tube. After filtration of the mixture, 10 ml of normal saline solution was added to ease phase separation. After complete separation, the lower phase was collected in a round-bottom flask and rotary evaporated (Laborota 4000-efficient; Heidolph, Germany) at 70°C. An internal standard, heneicosanoic acid (C21:0) (Sigma Chemical, St. Louis, MO, USA), was added to each sample before transmethylation to determine the individual fatty acid concentration within the sample. Transmethylation of the extracted fatty acids to their fatty acid methyl esters (FAME) was carried out using KOH in methanol and 14% methanolic boron trifluoride (BF3) (Sigma Chemical) according to methods by AOAC (2000). Finally, the petroleum ether containing the FAME was transferred to a 4 ml screw-capped vial (Kimble Glass Inc., USA), flushed with nitrogen, closed tightly and stored at 4°C until analysis by gas-liquid chromatography (GC). GC analysis The methyl esters were quantified by GC (Agilent 7890N) using a 30 m x 0.25 mm ID (0.20 µm film thickness) Supelco SP-2330 capillary column (Supelco, Inc., Bellefonte, PA, USA). 1 µl of the sample was injected by an auto sampler into the chromatograph, equipped with a split/splitless injector and a flame ionization detector (FID). High purity nitrogen (Malaysian Oxygen Bhd., Malaysia) was used as a carrier gas at a flow rate of 40 ml/min. High purity hydrogen (Malaysian Oxygen Bhd., Malaysia) and compressed air (Malaysian Oxygen Bhd., Malaysia) were used for the flame ionization detector in the gas-liquid chromatograph. The

7130

Afr. J. Biotechnol.

Table 1. Physical properties, rancidity and chemical composition of fresh OPDM.

Parameter Physical appearance Appearance Colour Smell Tenderness pH

Value Like tofu Blackish Brown good arouse appetite Soft 4.62 - 4.95

Rancidity PV (meq/kg) TBA (mg/kg)

1.86 - 1.98 0.60 - 2.89

Chemical analysis (%) Dry matter Ash Crude Protein Ether extract NDF ADF

26.11 - 27.19 5.70 - 6.21 11.58 - 11.87 2.10 - 3.51 73.33 - 76.84 40.47 - 48.48

Minerals (ppm) Cr Fe Mn Ni Cu

0.18 - 0.29 12.60 -13.59 0.41 - 0.45 0.94 - 0.97 4.28 - 8.80

Fatty acids (%) Palmitic Stearic Oleic Linoleic Linolenic

40.09 - 41.28 5.28 - 5.97 40.84 - 41.45 10.85 - 11.23 0.95 - 1.66

injector temperature was programmed at 250°C and the detector temperature was 300°C. The column temperature program initiated runs at 100°C, for 2 min, warmed to 170°C at 10°C/min, held for 2 min, warmed to 200°C at 7.5°C/min, and then held for 20 min to facilitate optimal separation. The peaks of samples were identified, and concentrations were calculated based on the retention time and peak area of known standards (Sigma Chemical). The fatty acid concentrations were expressed as a percentage of total identified fatty acids. Experimental design and statistical analysis The completely randomized design with four treatments of sampling time (on day 0, 3, 5, 7 and 10) and three replications were applied to these experiments. ANOVA followed by Duncan test were applied to analyze the mean of FA, PV and TBA during these studies. Analysis of correlation was done for time of sampling, rancidity and FA content using Microsoft SAS 9 (SAS, 2008).

RESULTS The properties of fresh OPDM are presented in Table 1. It included the physical appearance, rancidity, FA, chemical and mineral content, and was investigated 24 h after sample collection. The contents of palmitic and oleic were dominant; more than 40% of OPDM lipid. The CP content was moderate, and the contents of NDF and ADF were relatively high. The contents of Fe and Cu were also quite high and ranged from 12.60 to 13.59 ppm and from4.28 to 8.80 ppm, respectively. Figures 1 and 2 show the daily value of PV and TBA of OPDM during the 10 days of observation. The correlation between sampling time and rancidity (PV and TBA) was positive with the correlation coefficient (R2) of 0.9792 and 0.9678 for PV and TBA, respectively. The variation of FA composition and rancidity of OPDM during the 10 days after sample collection can be seen in Table 2. Most of the composition of long-chain FA significantly (P<0.05) decreased except palmitic and all the compositions of short-chain FA significantly (P<0.05) increased. In terms of rancidity, PV and TBA were significantly (P<0.05) increased. The correlation coefficient between rancidity (PV and TBA) and the composition of each long-chain FA as well as palmitic, stearic, oleic, linoleic and linolenic is shown in Table 3. The correlation coefficient between rancidity (PV and TBA) and the concentration of unsaturated FA namely oleic, linoleic and linolenic acid was negative. On the other hand, the correlation coefficient between rancidity (PV and TBA) and the concentration of saturated FA (palmitic and stearic) was positive. DISCUSSION The appearance of fresh OPDM physically was dark brownish pasty, like dark brownish tofu with the sour taste as its pH ranged from 4.62 to 4.95. Fresh OPDM was not categorized as rancid since PV and TBA numbers were very low; about 1.98 meq kg-1 and 2.89 mg -1 kg for PV and TBA, respectively. These numbers were still below the level of rancidity as reported by Nawar (1996), in which soybean oil and other linolenic containing oil frequently began to turn rancid at the PV of about 5 meq/kg. The compositions of palmitic and oleic within OPDM were dominant and ranged from 40.09 to 41.28% and from 40.84 to 41.45%, respectively. There were some other FA, including stearic, linoleic and linolenic existing within OPDM. The FA component in this study was slightly different from the result found by Macfarlane et al. (1975) which analyzed the mesocarp palm oil in Nigeria, and found that it ranged from 22.5 to 35.5% and from 50.2 to 55.4%, for palmitic and oleic acids, respectively whilst, the palmitic and oleic composition of OPDM were somewhat comparable to those in Colombia’s palm oil,

Afdal et al.

7131

Figure 1. Peroxide value of OPDM during the 10 days observation.

Figure 2. TBA value of OPDM during the 10 days observation.

which ranged from 22.9 to 48.6% and 34.6 to 54.8%, respectively (Macfarlane et al., 1975). All these might be due to the different breed and different geographical location. Oleic, linoleic and linolenic acids might possibly cause the rancidity of OPDM as it is an unsaturated FA. Nawar (1996) explained that hydrogen abstraction at a carbon chain on oleic, linoleic and linolenic resulted in formation of free allylic radical, causing rancidity. The composition of CP was medium and ranged from 11.58 to 11.87%, while EE content was low and ranged

from 2.10 to 3.51%. The fiber composition was somewhat high with the content of NDF, ranging from 73.33 to 76.84% and ADF, ranging from 40.47 to 48.48%. Low content of EE might be linked to lipid that was previously extracted in the factory. The composition of NDF and ADF is nearly similar to those of grass or roughage. This could possibly be because OPDM was extracted from mesocarp, consisting of high fiber. As a result of these, OPDM could be recommended for ruminant feed as it was high in NDF and ADF and moderate in CP content in

7132

Afr. J. Biotechnol.

Table 2. The composition of fatty acids, PV and TBA of OPDM over 10 days (%).

Parameter

Day 0

Long chain FA Palmitic Stearic Oleic Linoleic Linolenic

40.87±0.39 a 5.59±0.20 a 41.12±0.18 a 14.28±0.23 a 2.90±0.20

41.68±1.02 b 3.95±0.10 b 38.91±1.13 a 13.55±0.42 a 2.65±0.06

42.70±0.99 b 3.92±0.33 bc 37.29±0.48 a 13.35±0.16 a 2.50±0.57

43.31±0.31 b 3.70±0.23 c 36.91±0.53 a 13.00±0.96 b 1.38±0.22

44.36±1.32 b 3.59±0.03 c 36.56±0.06 b 11.04±0.11 b 1.30±0.12

0.1539 0.0021 0.0018 0.0092 0.0072

Short chain FA Acetic Propionic Isobutyric Butyric Isovaleric Valeric

34.56±0.46d b 11.80±0.20 b 1.52±0.18 10.68±1.16c 0.54±0.05b 1.06±0.13c

38.37±1.35cd b 12.59±0.09 b 2.55±0.07 15.55±0.31bc 0.59±0.01b 1.21±0.06bc

45.14±2.19bc a 15.09±1.11 a 5.00±0.75 19.15±2.33b 0.69±0.02a 1.27±0.01abc

48.40±5.27ab a 15.99±0.28 a 5.28±0.88 23.11±2.44b 0.75±0.02a 1.40±0.04ab

55.79±2.22a a 16.62±0.85 a 5.47±0.66 27.55±0.77a 0.75±0.01a 1.49±0.03a

0.0026 0.0012 0.0024 <0.0001 0.0005 0.0091

Rancidity PV (meq/kg) TBA (mg/kg)

1.92±0.04c 2.40±0.40b

8.16±1.73b 4.99±0.14a

11.84±0.54b 5.99±0.47a

17.05±1.32a 6.43±2.30a

18.12±0.04a 8.13±0.21a

0.0011 0.0025

Different superscript within the same row is significantly different (P<0.05).

Table 3. The correlation coefficient between TBA, PV and the composition of some FA within OPDM.

Parameter PV TBA

Palmitic 0.61 0.4

Stearic 0.16 0.34

which ruminant could tolerate (McDonald et al., 1988; Utomo et al., 2004). It might be possibly prepared as a single feed or as a mixed diet for animal feeding. The content of Fe and Cu was quite high and ranged from 12.60 to 13.59 ppm and from 4.28 to 8.80 ppm for Fe and Cu, respectively. The content of Fe might be a potential component to affect the rancidity of OPDM. Nawar (1996) reported that one of the factors influencing the rate of lipid oxidation in foods was Fe, a catalyst in lipid metabolism. Therefore, the Fe content of OPDM has to be considered in preserving OPDM and in preparing it in a diet of animal. Overall, the nutrient composition of OPDM is not so far different from those of the conventional feed. Figures 1 and 2 show PV and TBA during 10-day extended time of storage. The correlation coefficient (R2) between the extended time of storage and the rancidity was 0.9792 and 0.9678 for PV and TBA, respectively. This might probably be due to the enhancement of oxidative rancidity that forms hydroperoxide and increases attack of oxygen at allylic position of unsaturated FA (Nawar, 1996) during the period. The formation of hydroperoxide was probably as a result of the deterioration of

Oleic -0.82 -0.91

Linoleic -0.3 -0.02

Linolenic -0.84 -0.62

FA such as oleic, linoleic and linolenic acids, which are the main unsaturated FA, existing within OPDM. More specifically, the development of the hydroperoxide might have originated from the deterioration of the double bond of oleic acid since the oleic acid was the most concentrated unsaturated FA among the other three FAs within OPDM. In addition, the concentration of oleic acids significantly (P<0.05) declined over 10 days of sampling (Table 2). The increase in the concentration of hydroperoxide was followed by a decrease in the concentration of unsaturated lipid over time of oxidation (Nawar, 1996). OPDM easily becomes rancid because of its previous exposure to high temperature at the factory which obstructs the aldehyde, alkanal, hydrodcarbon and other chemicals. Peroxide value is sensitive to temperature, which plays a role in the formation of carbonyl and hydroxy compound (Kamal-Eldin et al., 2003). There appears to be a strong correlation between time and PV (R2 = 0.9792). This might possibly be the primary reason of oxidation with the formation and liberation of peroxide (H2O2) from unsaturated FA like oleic, linoleic and linolenic acids. Moreover, rancidity is normally facilitated by a mineral

Afdal et al.

as a catalyst. High content of Fe and Cu in OPDM (Table 1) might possibly oxidize unsaturated FAs and then speed up the rancidity. This might also be related to the composition of unsaturated FA namely oleic, a dominant FA in OPDM. In this circumstance, mineral Fe and Cu might also possibly play a role as a catalyst to oxidize unsaturated FA, oleic, linoleic and linolenic (Nawar, 1996). This might be interpreted as a lower rate of hydrolytic rancidity than oxidative rancidity as TBA regularly represents hydrolytic rancidity. TBA figures out the amount of aldehyde formations that previously comes from the attack of peroxide (Hamilton, 1994). Rancidity is normally initiated with the oxidative rancidity followed by hydrolytic rancidity. Therefore, the correlation between PV and TBA is usually positive. Hoyland and Taylor (1991) reviewed that malondialdehyde, a product of lipid oxidation, is the major TBA reactive substance and the chemical reaction is still uncertain (Labuza, 1971). The other oxidation products involved in TBA activity includes Îą,Î˛-unsaturated aldehyde and several other unrecognized non-volatile precursor of these substances (Kamal-Eldin et al., 2003). During 10 days of observation, it appears that the increase of rancidity was tagged along with the changes of FA composition. The increase rate of TBA and PV would be predicted faster after 10 days hence it is a challenge, which must be solved. It is necessary to incorporate any treatment into OPDM that would reduce the rancidity. Rancidity is usually caused by an oxidation process that is influenced by air, heat and light. It is a biochemical reaction that leads to an attack on the double bond within unsaturated FA, followed by the formation of free radical. This might be prevented by using a synthetic antioxidant like BHT, BHA and TBHQ which are forbidden in some developed countries or a natural antioxidant from a plant tree. Using a natural antioxidant might be a very good alternative approach to overcome the rancidity in OPDM as it is safe and natural. Moreover, the correlation between long-chain FA (oleic, linoleic and linolenic) and both PV and TBA was both negative (Table 3). It could be highlighted that the rancidity was due to the deterioration of these unsaturated FA. The oxidation process usually occurs at a doublebond unsaturated spot of the glyceride molecules (Ladikos and Lougovois, 1990). The composition of palmitic acid is also another dominant component of FA within OPDM. There was no significant difference (P>0.05) in the composition of the palmitic acid in over 10 days of sample collection. The increase of rancidity might not be linked to the degradation of palmitic acid since it is a saturated FA molecule which is relatively stable and is not susceptible to oxidation (Hamilton, 1994). Overall, the unsaturated FA component of OPDM such as oleic, linoleic and linolenic would lead to formation of rancidity when it is kept in an open air condition. The

7133

number of PV and TBA would increase within 10 days when fresh OPDM is kept standing in an open air without any treatment. The results show an initial rise in the composition of palmitic, linoleic and linolenic for the first few days before a subsequent decline. This might be due to the formation of FA by a microorganism in the initial step of the storage which was then followed by oxidation. Fulco (1977) explained that FA synthesis (FAS) could be done by a microorganism like bacteria and also by algae, fungi, protozoa and other higher plant and animals. The FAS might be in anaerobic and aerobic condition. Alberts and Greenspan (1984) reported that the action of bacterial FA synthetase enzyme might form FA from Acetil-CoA and 7 malonyl-CoA. Kaneda and Smith (1980) reported that there are bacteria producing the FA synthetase like Bacterium subtilis, Corynebacterium cyclohexanicum, Micrococcus luteus, Psedomonas maltophila (Bryan), Escherichia coli B and P flourescens. Furthermore, the decrease in the composition at the end might be due to the fact that FA has started to be oxidized. The decrease in the composition of stearic and oleic acids could be linked to the only oxidation that occurred in this circumstance without any synthesis of these FAs. Table 3 represents the correlation coefficient between the rancidity (PV and TBA) and long-chain FA compositions for 10 days. The correlation coefficient between rancidity (PV and TBA) and the concentration of oleic, linoleic and linolenic acid was negative. This portrays that the increase of both PV and TBA might be attributed mostly to the degradation of oleic, linoleic and linolenic acids. The main source of rancidity in this study may possibly be indicated by the oxidation from unsaturated oleic and linolenic acids. This is marked by a strong negative correlation between the rancidity (PV and TBA) and the composition of oleic and linolenic acids, and a very low negative correlation between rancidity (PV and TBA) and the composition of linoleic acid. Conclusion Physically and chemically, the fresh OPDM might possibly be used as an alternative feed, especially for ruminant. Conversely, it becomes rancid after few days. The rancidity might be caused by oleic acid and other unsaturated FA component within the OPDM. The rancidity might also possibly be linked to high content of Fe and Cu oxidizing FA. The use of antioxidant is an alternative way to preserve OPDM and to overcome rancidity in order for it to be used as animal feed. ACKNOWLEDGEMENT Our deep appreciation is extended to Ladang Rakyat Trenggano Sdn Bhd for providing the OPDM sample.

7134

Afr. J. Biotechnol.

REFERENCES Afdal M, Azhar K, Alimon AR, Abdullah N (2011). The peroxide value and thiobarbituric acids profiles of palm oil decanter meal kept over extended time. British Soc. Ani. Sci. Nottingham Univ. Jubilee Campus 4-6 April. p. 264. Albert AW, Greenspan MD (1984). Animal and bacterial fatty acid synthetase in Fatty acid metabolism and its regulation. In S. Numa, New Comp. Biochem. 7: 29-58. AOAC (1990). Official method of analysis. Washington DC: Association of Official Analytical Chemist. Washington, DC, USA. AOAC (2000). Official Methods of Analysis, 17th edn. Association of Official Analytical Chemists, Washington, DC, USA. Folch J, Lees M, Sloan-Stanley GH (1957). A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226(1): 497-509. Fulco AJ (1977). Fatty acid desaturation in microorganism. In Kunau WH & Holman RT, Polysaturated fatty acid, Am. Oil. Soc. pp. 19-36. Hamilton RJ (1994). The chemistry of rancidty in foods. In Allen JC, & Hamilton RJ. Rancidity in Food 3th. London: Blackie Academic and Professional. Hoylan DV, Taylor AJ (1991). A review of the methodology of the 2thiobarbituric acid test. Food Chem. 40: 271-291. Kamal-Eldin A, M채kinen M, Lampi AM (2003). The challenging contribution of hydroperoxidesto the Lipid Oxidation Mechanism In: Lipids oxidation pathways. AOCS Press. Kaneda T, Smith E (1980). Relatonship of primer specificity of fatty acid de novo synthetase to fatty acid composition in 10 species of bacteria and yeast . Can J. Microb. 26: 893-898. Labuza TP (1971). Kinetics of lipid oxidation in foods. CRC. Crit. Rev. Food. Tech. 2: 355-405. Ladikos D, Lougovois V (1990). Lipid oxidation in muscle foods: A review. Food Chem. 35: 295-314.

Macfarlane N, Swetman T, Cornelius JA (1975). Analysis of mesocarp and kernel oils from the American oil palm and F1 hybrids with the W Afric oil palm. J. Sci. Food. Agric. 26: 1293-1298. McDonald P, Edwards RA, Grennhalgh JF (1988). Animal Nutrition. Essex England: Scientific and Technical. Nawar WW (1996). Lipid. In O. R. Fenema, Food Chemistry 3rd NewYork USA: Marcel Dekkerb Inc. pp. 225-319. Rajion MA, McLean JG, Cahill RN (1985). Essential fatty acids in the fetal and newborn lamb. Aust. J. Biol. Sci. 38: 33-40. SAS. (2008). SAS 9.2 TS Level 1MO. Cary NC USA: SAS Institute Inc. Southworth A (1985). Palm oil and palm kernels. J. Am. Oil. Chem. Soc. 62(2): 250-254. Tarladgis BG, Watts BM, Younathan MT, Dugan LJ (1960). A distilation method for the quantitative determination of malonaldehyde in rancid foods. J. Am. Oil. Chem. Soc. 37 : 44-48. Utomo BN, Widjaja E, Hartono A, Sintha E, Adriansyah (2004). A final report of technology exibition: The utilisation of solid sawit by-product as broiler feed. Palangkaraya Indonesia: BPTP Central Kalimantan. Van Soest PJ (1963). Use of detergents in the analysis of fibrous feeds. II A rapid method for teh determination of fiber and lignin. J. Assoc. Off. Agric Chem. 46 : 829-835. Vanhanen LP, Savage GP (2006). The use of peroxide value as a measure of quality for walnut flour stored at five different temperatures using three different type of packaging. Food Chem. 99: 64-69.

Full Length Research Paper

Immune responses of pigs inoculated with a recombinant fowlpox virus coexpressing ORF2/ORF1 of PCV2 and P1 2A of FMDV Xiaobing Qin1, 2, Huijun Lu2, Kuoshi Jin2, Min Zheng2, Mingyao Tian2, Chang Li2, Jinguo Niu3, Ningyi Jin2* and Hu Shan1 1

Departmet of Animal Science and Technology, Qingdao Agricultural University, Qingdao,Shandong 266109, PR China. 2 Military Veterinary Institute, Academy of Military Medical Sciences, Changchun, Jilin 130062, PR China. 3 Institute of Veterinary and Husbandry, Shanxi Academy of Agricultural Sciences, Taiyuan, Shanxi 030032, PR China. Accepted 21 November, 2011

A recombinant fowlpox virus (rFPV-ORF2ORF1-P12A) containing the open reading frame ORF2)/ORF1 DNAs of the porcine circovirus 2 (PCV2) (strain, Inner Mongolia) and foot-and-mouth disease virus (FMDV) capsid polypeptide of O/NY00 was evaluated for its abilities to induce humoral and cellular responses in piglets. In addition, we examined its abilities to protect cell cultures against a homologous virus challenge. To approach the feasibility of different united ways of immunization, the recombinant fowlpox virus rFPV-ORF2ORF1-P12A and the recombinant DNA plasmid pVAX1-IL18-ORF2ORF1 were used to immunize the pigs in “prime-boost”programme. We observed that priming the pigs with DNA plasmid pVAX1-IL18-ORF2-ORF1, followed by boosting with the recombinant virus rFPV-ORF2ORF1P12A produced partially cellular immunity and humoral immunity. Control groups were inoculated with wild-type fowlpox virus (wtFPV) and phosphate buffer saline (PBS). All animals vaccinated with rFPVORF2ORF1-P12A developed specific anti-PCV2/anti-FMDV enzyme-linked immunosorbent assay (ELISA) and neutralizing antibodies and also showed T lymphocyte proliferation response. The antibody level produced by PCV2 was lower than that of O type FMDV to 1:20 and 1:200 respectively. We examined specific cytotoxic T lymphocyte (CTL) production in pigs serum and T lymphocytes (CD4, CD8, and CD4/CD8 double positive T cells) in the peripheral blood. First inoculating pVAX1-IL18ORF2ORF1 and then rFPV-ORF2ORF1-P12A, had considerably higher CD4+, CD8+ and CD4+CD8+ T lymphocytes subgroups compared with the control groups. Whether the ratio between effective cells and target cells was 50:1 or 25:1, the specific CTL of experimental groups had much more significant differences with the control (FPV), even still the group of priming nucleic acid vaccine boosting recombinant virus had the bravest cytotoxicity of specific CTL. Moreover, the E/T ratio of 50:1 was more excellent. Following infection respectively with a mixture of a pathogenic strain of PCV2 (strain, Inner Mongolia)/FMDV (O/NY00) and neutralizing antibody, PK15 cells (BHK21) inoculated with recombinant fowlpox virus (rFPV) showed less (P < 0.05) yellow-green fluorescence and cytopathogenesis, suggesting the establishment of partial protection against PCV2/FMDV infection. The results show that the immunization programme here, in which pVAX1-IL18-ORF2ORF1 DNA vaccine was inoculated firstly and rFPV-ORF2ORF1-P12A was followed, is viable and indicates the potential use of a fowlpox virusbased recombinant vaccine for the control and prevention of PCV2/FMDV infections. Key words: PCV2, rFPV, FMDV, immune response, prime-boost. INTRODUCTION The porcine circovirus 1 (PCV1) was initially isolated as a

*Corresponding author. E-mail: jinningyi2000@yahoo.com.cn. Tel: +86 431 86985921.

persistent contaminant of the porcine kidney cell line PK15 (Tischer et al., 1982). PCV1 is a ubiquitous virus that does not cause any disease in piglets (Allan et al., 1995; Tischer et al., 1986). PCV2 is associated with clinical diseases in pigs (Kennedy et al., 2000; Meehan et al.,

7136

Afr. J. Biotechnol.

2001). Post-weaning multisystemic wasting syndrome (PMWS), an emerging disease in pigs, is caused by PCV2 (Ellis et al., 1998; Kennedy et al., 2000; Ellis et al., 1999). This PMWS and other porcine circovirus associated diseases (PCVAD) have caused severe economical losses for swine farmers and the pig industry worldwide. The exact mechanisms of how PCV2 contributes to the clinical manifestation of PCVAD are poorly understood and might include host and viral genetic determinants (Opriessnig et al., 2006), the presence of other infectious agents (Dorr et al., 2007), or environmental factors. However, evidence suggests that its manifestation requires coinfection with a pathogen such as porcine parvovirus (PPV) (Ellis et al., 2000) or a similar immune stimulant (Krakowka et al., 2001), stressor, or cofactor. PMWS mainly affects 5 to 16 week-old pigs (Allan et al., 2000; Harding and Clark, 1997; Segales et al., 2004). The characteristic clinical signs of PMWS include progressive weight loss, dyspnea, enlargement of lymph nodes, diarrhea, pallor, and jaundice (Allan et al., 2000; Segales et al., 2004). PMWS, a new emerging swine disease worldwide since its first identification in Canada in 1991 (Allan et al., 2000; Chae et al., 2004), is now endemic in many pig-producing countries and causes a potential economical impact on the swine industry worldwide. PCV is an icosahedral, nonenveloped virus, and measures 17 nm in diameter. The genome of PCV is a single-stranded circular DNA of about 1.76 kb. PCV genome contains at least two potentially functional open reading frames (ORFs): ORF1 (930 bp) encodes the Rep protein involved in viral replication and ORF2 (690 bp) encodes the immunogenic capsid protein. The overall DNA sequence homology within the PCV1 or PCV2 isolates is greater than 90%, while the homology between PCV1 and PCV2 isolates is 68 to 76%. Two major open reading frames (ORFs) have been recognized for PCV; ORF1, called the rep gene, which encodes a 35.7-kDa protein involved in virus replication (Mankertz et al., 1998), and ORF2, called the cap gene, which encodes the major 27.8-kDa immunogenic capsid protein (Cheung, 2003; Nawagitgul et al., 2002; 2000). In addition to the replicase ORF1 and the capsid protein ORF2, the virus genome is predicted to contain another five potential ORFs encoding proteins larger than 5 kDa (Meehan et al., 1997). Whether these potential ORFs are expressed or not and whether the expressed proteins are essential for viral replication remain to be elucidated. The use of fowlpox virus vectors for heterologous antigen delivery has been explored in a variety of fields (Jiang et al., 2005; Tine et al., 2005; Karaca et al., 2005).Despite the fact that their replication is restricted to avian species, attenuated strains of the fowlpox virus have shown to be efficacious and extremely safe vectors for mammals. The inoculation of fowlpox virus-based

recombinants into mammalian cells has in fact resulted in the expression of the foreign gene and induction of protective immunity (Karaca et al., 2005). This observation shows that favorable immune responses could be induced in the absence of productive replication, while eliminating the potential for dissemination of the vector within the vaccinator and the spread of the vector to nonvaccinated contacts or to the general environment (Taylor and Paoletti, 1988; Pastoreta and Vanderplasschen, 2003). However, the use of the fowlpox virus as a vaccine vector for recombinant PCV2 vaccines has not been previously investigated. In this study, the immune responses of pigs inoculated with a recombinant fowlpox virus vaccine by different vaccination schemes were evaluated. We examined the ability of priming the recombinant fowlpox viruses (rFPVORF2ORF1-P12A) and/or boosting the recombinant plasmid (pVAX1-IL18-ORF2ORF1) to elicit PCV2-specific immune responses and protective efficacy in pigs. Our results indicate that the recombinant fowlpox virus, rFPVORF2ORF1-P12A, may be an effective vaccine affording protection to pigs against PCV2 challenge. MATERIALS AND METHODS Viruses cells and plasmids The wild type strain of the fowlpox virus (wtFPV) is an attenuated vaccine produced by the Animal Pharmaceutical Factory of Nanjing (Nanjing, China). The recombinant fowlpox virus rFPV-ORF2ORF1P12A containing the ORF2/ORF1 DNAs of PCV2 (strain, Inner Mongolia) and the foot-and-mouth disease virus (FMDV) capsid polypeptide of O/NY00 was previously constructed in our lab. wtFPV and rFPV were prepared in chicken embryo fibroblast (CEF) cells in MEM supplemented with 10% fetal calf serum (FCS). PCV2 (strain, Inner Mongolia) originally isolated from lymph node sample of a pig with naturally occurring PMWS (Fenaux et al., 2002) was preserved and passed to PCV-negative PK-15 cells (ATCC CCL33). FMDV O/NY00 was preserved and passed in BHK21 cells to obtain a titer of 1 Ă&#x2014; 106.4 50% tissue culture infectious dose (TCID50)/0.01 ml in our lab. We previously constructed the recombinant plasmid pUTALP12A encoding the capsid polypeptide genes of FMDV O/NY00 and another recombinant plasmid, pMD18-T-ORF2ORF1, encoding PCV2 genes. The recombinant plasmid (pVAX1-IL18-ORF2ORF1) encoding the ORF2/ORF1 genes of PCV2 and pig interleukin-18 mature protein gene was previously constructed. Selection and identification of rFPV-ORF2ORF1-P12A The fowlpox virus shuttle vector pUTALP12A, which was composed of the combined promoter TI-P7.5 (ATI promoter of cowpox virus and 20 tandemly repeated mutant P7.5 early promoters of vaccinia virus) and the P12A gene controlled by the single promoter (16 tandemly repeated mutant P7.5 early promoters of vaccinia virus) have been reported previously (Zheng et al., 2006). The plasmid pMD18-T-ORF2ORF1 was digested with SmaI to produce an ORF2ORF1 fragment that was then inserted into the SmaI site under the combined promoter ATI-P7.5 of pUTALP12A, and the shuttle vector pUTALORF2ORF1-P12A was obtained. Subsequently, the rFPV-ORF2ORF1-P12A was selected and identified as described previously (Zheng et al., Ma et al., 2006). Briefly, the

Qin et al.

7137

Table 1. Immunization in “prime-boost” programme.

Group

Inoculated times and biologic 1st i. m(1 day) 2nd i. m (28 day) PBS PBS

Code

Controls

Trials

M I J K

wtFPV rFPV-ORF2ORF1-P12A rFPV-ORF2ORF1-P12A pVAX1-IL18-ORF2ORF1

shuttle plasmid pUTALORF2ORF1-P12A and wtFPV were cotransfected to 80% confluent CEF cells via liposomes (lipofectamine, Invitrogen Corporation). The viruses were collected after a cytopathic effect (CPE) appeared. They were then screened three times under the presence of 40 µg/mL BudR (5-bromo-2′ deoxyuridine, Sigma) and cultured in MEM medium without BudR. The individual virus plaque was selected, amplified, and purified when CPE appeared, and identified by electron microscope. The purified recombinant virus was named rFPV-ORF2ORF1-P12A. Experimental animals We brought 40 segregated early weaned crossbred pigs approximately 8 to 12 week-old pigs from a PCV2- and FMDV-free farm in ChangChun, China.

wtFPV rFPV-ORF2ORF1-P12A pVAX1-IL18-ORF2ORF1 rFPV-ORF2ORF1-P12A

control serum was added to the well at the end of each row of a 24-well tissue culture plate. Samples were then serially diluted twofold across the plates. Further, 50 µl PCV2 suspension of 200 IU/150 µl (1 IU = amount of virus causing specific immunofluorescence in 1 cell/well) was added to each well and the plate was vortexed for 1 min. After incubation at 37°C for 90 min, this mixture was inoculated into 1-day PK-15 cell cultures in each well. After incubation for 1 h (37°C; 5% CO2), cultures were washed and growth medium (MEM + 5% FCS) was added. 4 h later, cultures were treated with D-glucosamine (Sigma) and thereafter incubated in growth medium. 24 h after inoculation, a period in which PCV2 antigen resulting from a secondary infection of cells by progeny virus has not yet been formed, cultures were fixed and tested for the presence of specifically fluorescent cell nuclei by the indirect fluorescent antibody (IFA) test using rabbit anti-PCV2 antiserum. The neutralizing titer was defined as the highest serum dilution which had caused a 50% reduction in the number of specifically fluorescing cells.

Inoculation of pigs with rFPV The pigs were divided into five groups (five pigs per control group and ten pigs per trial group). Pigs in the respective control groups were inoculated intramuscularly with 200 µL phosphate-buffered saline (N) and 2 × 108 plaque-forming units (PFU) of wtFPV (M). Pigs in the trial groups (I J and K) were inoculated intramuscularly with the same dose of rFPV-ORF2ORF1-P12A (2 × 108 PFU) or 200 µg pVAX1-IL18-ORF2ORF1, respectively. All groups were boosted with an equivalent dose at 28 days post-inoculation (dpi) (Table1). Blood samples were collected from each pig preinoculation and every week post-inoculation.

Evaluation of the humoral immune response to FMDV

Evaluation of the humoral immune response

Evaluation of the cellular immune response to immunization

Evaluation of the humoral immune response to PCV2

T lymphocyte proliferation assay

Indirect enzyme-linked immunosorbent assays (I-ELISAs) were performed (according to the protocol of the PCV2-Diagnosis-Assay kit provided by the Veterinary College, Huazhong Agricultural University) on pig serum to measure the amount of anti-PCV2 antibodies present in each sample. Briefly, 96-well flat-bottom plates coated with the ORF2 protein of PCV2 were incubated in duplicate with 20-fold dilutions of test sera for 30 min at 37°C. Peroxidase-conjugated anti-pig IgG conjugate was then added for 30 min at 37°C, followed by addition of the substrates (each 50 µl). After 10 min in the dark at room temperature, the color reaction was terminated with 50 µl of dense H2SO4, and the absorbance at 630 nm was determined using an ELISA plate reader within 15 min. Serum samples from all pigs were analyzed for neutralizing antibodies by using a neutralization assay (Tischer et al., 1986) with a monolayer of PK-15 cells. Sera were inactivated at 56°C for 30 min and 2-fold dilutions (in duplicate) and 50 µL of each sample or

3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium-bromide) (MTT) assay was performed to determine T lymphocyte proliferation. Peripheral blood (taken at 14 and 42 dpi, respectively) from each pig was collected into tubes containing sodium heparin as an anticoagulant. Peripheral blood mononuclear cells (PBMCs) were isolated from each blood sample by Ficoll-Hypaque density gradient centrifugation and resuspended in RPMI 1640 medium with 10% FCS. The MTT assays (Zheng et al., 2006) were carried out in triplicate cultures (200 µL 2 × 106 cells/mL) in 96-well flatbottom plates (Costar). T lymphocytes were stimulated with 2 µg/mL of recombinant VP1 protein, or 1:100 live O/NY00, or 1 µg/mL of Concanavalin A. The plate was incubated at 37°C for 45 h, followed by incubation with MTT for 3 h and addition of 150 µL DMSO to every well to dissolve the deposit. Absorbance was determined at 570 nm and results were expressed as stimulation index (SI) (cpm sample/cpm medium alone).

I-ELISAs were performed (Ma et al., 2008) on pig serum to measure the amount of anti-FMDV antibodies present in each sample. Serum samples from all pigs were analyzed for neutralizing antibodies using a neutralization assay with a monolayer of BHK21 cells (Cedillo-Barron et al., 2001; Yu and 221Cui, 1997). The operating method was the same as described (Zheng et al., 222 2006).

7138

Afr. J. Biotechnol.

Analysis of CD4+, CD8+, and CD4+CD8+ T lymphocytes subtypes At 21 and 42 dpi, peripheral blood was collected from each pig. The isolation method of PBMCs was the same as described in previously. PBMCs were adjusted to 1 × 106 cells/mL. After centrifugation, the supernatants were discarded and the remaining cell pellets were resuspended with 50 µL of monoclonal antibodies (MAb) against CD4 or CD8 (PE-labeled anti-pig CD4a and FITClabeled anti-pig CD8a, BD Biosciences Pharmingen) and incubated on ice for 30 min. After washing, the cells were analyzed with the FACScan cytometer (Becton Dickinson) at an excitation wavelength of 488 nm, 580 nm and 630 nm filters.

CTL assay At 42 dpi, peripheral blood was collected from each pig. The isolation method of PBMCs was the same as described in above. The PBMCs were resuspended in RPMI 1640 medium supplemented with 10% FCS, 2 µg/mL Concanavalin A (Sigma), and 10 U/mL of IL-2 and cultured in vitro as the effector cells. A modified PK15 cell line, which stably expressed the ORF2 protein of PCV2, was previously constructed by transfecting the cells with the mammalian expression plasmid pDisplay-ORF2 (data not shown). The stimulator cells were harvested and treated with 25 µg/mL mitomycin C at 37°C in 5% CO2 for 2 h. Subsequently, the cells were pelleted and washed four to five times with RPMI 1640 medium. The effector cells (4 × 107 cells) were incubated with stimulator cells at an effector-stimulator ratio of 50:1 or 25:1 for three days at 37°C in 5% CO2. To measure the specific lysis of these target cells, the lactate dehydrogenase (LDH) release assay was performed according to the manufacturer’s protocol. In 96-well round-bottom plates, target cells were incubated with effector cells at various effector-target ratios for 4 h in phenol red-free RPMI 1640 containing 3% FCS. The supernatant (100 µL/well) was then transferred to 96-well plates, and lysis was determined by measuring LDH release using a non-radioactive cytotoxicity assay kit (Promega Corporation, USA). The absorbance values of the supernatants were recorded at 490 nm on an ELISA microplate reader. The percentage of specific lysis of PK15 target cells for a given effector cell sample was calculated by the following formula: specific lysis = (OD of experimental LDH release - OD of effector cell spontaneous LDH release - OD of target cell spontaneous LDH release)/(OD of maximum target LDH release - OD of target spontaneous LDH release) ×100%. All determinations were performed in triplicate. Statistical analyses Serological responses, CD4+, CD8+, and CD4+CD8+ subtype T lymphocytes, and SI of inoculated pigs were compared to those of control animals using the analysis of variance and t-tests. A P value of ≤ 0.05 was considered to be statistically significant.

RESULTS Humoral immune response to inoculation with rFPV Specific anti-PCV2 antibody titers (AT) of rFPV-ORF2ORF1-P12A vaccinated pigs were not significantly different (P > 0.05) compared with M/N control groups from 7 dpi to 42 dpi. However, the AT increased gradually after the boost until day 70, while there was no notable

difference between the 3 prime-boost immunization regime groups. The amount of specific anti-FMDV antibody in the rFPV-vaccinated groups was significantly increased compared with the M and N inoculated groups. However, the antibody responses of the I, J and K vaccinated groups were not significantly different (Figure 1). The sera from inoculated pigs were tested for their ability to neutralize PCV2/FMDV in PK-15 cells and BHK21 cells. At 14 and 42 dpi, sera from rFPV-inoculated pigs showed PCV2/FMDV neutralizing activity (Table 2). The titer of neutralizing antibodies in rFPV-inoculated pigs ranged from 1:26.6 to 1:46.6 and 1:26.91 to 76.11. The sera from wtFPV-inoculated pigs showed no PCV2/FMDV-neutralizing activity. There was a higher antibody titer of PCV2 in the group primed with rFPVORF2ORF1-P12A and boosted with pVAX1-IL18ORF2ORF1, while the antibody titer of FMDV in the group primed with rFPV-ORF2ORF1-P12A and boosted with rFPV-ORF2ORF1-P12A was the highest. Cell-mediated immune response T lymphocyte proliferation response of pigs Pigs in the rFPV-ORF2ORF1-P12A-vaccinated/ inoculated groups showed a specific T lymphocyte proliferation response (stimulated with live virus or purified recombinant VP1 protein) and a relatively weak nonspecific proliferation response (stimulated with ConA). In contrast, pigs in the wtFPV/PBS-inoculated group only developed a weak non-specific T lymphocyte proliferation response. Analysis of the specific T lymphocyte proliferation response showed that the J-inoculated group had a higher SI, but no significant difference was observed between the tested groups (Table. 3). Analysis of T lymphocytes subtypes Peripheral blood lymphocytes were analyzed by flow cytometry at 21 and 42 dpi, respectively. At 21 dpi, there were no significant differences (P > 0.05) between the percentages of CD4+, CD8+, and CD4+CD8+ T lymphocytes of the rFPV-vaccinated groups and that of the wtFPV/PBS-inoculated groups. At 42 dpi, the percentage numbers of CD8+ T lymphocyte subgroups of the rFPV-vaccinated groups were higher (P < 0.05) compared with the wtFPV/PBS-inoculated groups. The Jvaccinated group was higher than the other tested groups but no significant difference was observed (Figure 2). CTL activity of immunized pigs The cytotoxic activities of the inoculated pigs were

O D (492 nm) OD(492nm)

Qin et al.

0.6 0.4 0.2 0 7

35 day

r FPV -OR F2O RF1- P12 A/r FPV -OR F2O RF1 -P12 A r FPV -OR F2O RF1- P12 A/p VAX 1-I L18 -OR F2OR F1 p VAX 1-I L18 -ORF 2OR F1/ rFP V-O RF2 ORF 1-P1 2A w tFP V P BS

OD (630 nm) OD(63Onm)

(a) 1 0.8 0.6 0.4 0.2 0 7

35 day

r FPV -ORF 2OR F1- P12 A/r FPV -OR F2OR F1- P12 A r FPV -ORF 2OR F1- P12 A/p VAX 1-I L18- ORF 2OR F1 p VAX 1-IL 18- ORF 2OR F1/ rFP V-O RF2O RF1 -P1 2A w tFP V P BS

(b) Figure 1. The antibody level of anti-FMDV (a) and anti-PCV2 (b) after immunization. Sera from all pigs were sampled regularly and tested for antibodies against FMDV (1:200 dilution) and PCV2 (1:20 dilution). The results were obtained from the average of the sera in each group.

Table 2. Maximum dilution of neutralizing antibodies in sera of pigs inoculated with rFPV

Immune group I J K M N

0 dpi FMDV 1.82 1.82 1.82 1.82 1.82

14 dpi PCV2 1.82 1.82 1.82 1.82 1.82

FMDV 76.11 38.05 53.82 <2 <2

42 dpi PCV2 30.2 46.6 26.6 <2 <2

FMDV 76.12 26.91 38.05 <2 <2

PCV2 27.0 40.7 37.2 <2 <2

Neutralizing antibody titers were analyzed at 14 and 42 days post-inoculation (dpi). Serum samples were obtained from five pigs of each group.

7139

7140

Afr. J. Biotechnol.

Table 3. Specific T lymphocyte proliferation assay.

Group I J K M N

(Vp1) protein 14 days 42 days 1.143 1.448 1.337* 1.258 1.034 1.337 0.986 1.225 0.927 1.000

Stimulate index (O FMDV) live virus ConA 14 days 42 days 14 days 42 days 1.888* 1.197 0.941 0.873 2.078* 1.205 0.988 1.653* 1.889* 1.406 1.017* 1.547* 1.222 1.167 0.914 0.873 1.011 1.000 0.901 1.000

Control 14 days 42 days 0.217 0.39 0.287 0.42 0.268 0.405 0.217 0.39 0.193 0.26

21dpi

CD4+/CD8+

CD8+

CD4+

CD4+/CD8+

CD8+

40 35 30 25 20 15 10 5 0 CD4+

% %

T lymphocyte proliferation responses of pigs stimulated by live virus, purified recombinant VP1 protein and ConA, respectively; *represents significant differences.

rFP V-O RF2 ORF 1P12 A/r FPV ORF 2OR F1- P12 A rFP V-O RF2 ORF 1P12 A/p VAX 1-I L18ORF 2OR F1 pVA X1- IL1 8ORF 2OR F1/ rFP VORF 2OR F1- P12 A wtF PV

PBS

42dpi

Figure 2. The percentages of CD4+, CD8+, CD4+CD8+ T lymphocytes of different prime-boost immunization groups. This test was performed at 21 and 42 dpi, respectively. The results were obtained from the average of five pigs sera in each group.

measured by the non-radioactive LDH release assay and the specific lysis rates are shown in Figure 3. All tested vaccines groups elicited specific CTL cytotoxic activities compared with wtFPV- and PBS-inoculated groups (P < 0.05). The specific lysis rate of the J or K group was higher than that of the I group. DISCUSSION The vaccine potential of recombinant fowlpox viruses is well established. It has been successfully employed in the development of recombinant FMD and of recombinant porcine reproductive and respiratory syndrome (PRRS) vaccines(Zheng et al., 2006; Shen et al., 2007). Recombinant fowlpox virus vaccines offer significant advantages over the traditional virus-inactivated vaccines or recombinant proteins, because the antigen is expressed intracellularly in the immunized animal. Therefore,

the processing and presentation of the viral epitope occurs in a way that is similar to a natural infection. Moreover, the fowlpox virus vector is a non-replication vector when used in mammals, so it does not carry the risk of replication associated with Vaccinia virus vaccines (Pastoreta and Vanderplasschen, 2003). Therefore, we attempted to develop a recombinant PCV2 vaccine on the basis on the fowlpox virus vector. In this work, an experimental immunization regimen was developed and tested against PCV2. Piglets coinfected with PCV2 and FMDV developed a more severe clinical disease and PCV2-associated lesions than piglets infected with PCV2 (data not shown). Thus, the gene fragment P12A of FMDV (Berinsteina et al., 2000) in addition to ORF2ORF1 of PCV2 was chosen and used to construct the recom-binant fowlpox virus. The recombinant fowlpox virus coexpressing ORF2ORF1 (PCV2) and P12A (FMDV) was inoculated in pigs and tested in a protectionchallenge experiment, showing that the combination of

Qin et al.

7141

120 80

100

1:25 1:50

1:50

cytotoxicity

1:25

Cytotoxicity

cytotoxicity

Cytotoxicity

50 40 30 20

80 60 40 20

10 0

0 N

(a)

(b)

Figure 3. Specific lysis of target cells by restimulated effector cells from the immunized pigs. Effector-to-target cell ratios are indicated in different colors. The percent specific lysis is demonstrated on the vertical axis. This test was performed at 42 dpi. (a) specific CTL activity for PCV; (b) specific CTL activity for FMDV; N=PBS group; M=wtFPV group; I=rFPV-ORF2ORF1-P12A/rFPVORF2ORF1-P12A; J = rFPV-ORF2ORF1-P12A/pVAX1-IL18-ORF2ORF1; K = pVAX1-IL18-ORF2ORF1/ rFPV-ORF2ORF1-P12A.

ORF2ORF1 (PCV2) and P12A (FMDV) can induce a partial protective immunity. This finding suggests that this experimental method of antigen presentation may be useful for future protection studies of these and other possibly protective PCV2 (FMDV) antigens, alone or in combination. A genetic engineering vaccine against PCV2 is not yet available, although an experimental vaccine based on a chimeric virus of PCV1 and PCV2 was very promising (Fenaux et al., 2004; 2003). Engineering vaccine design for manipulating antigen presentation and processing pathways is one of the most important aspect that can be easily handled in the DNA vaccine technology. If an antibody response is the goal, it is clearly desirable to direct antigen expression to the endo plasmic reticulum(ER), in which folding and secretion can occur. An appropriate leader (signal) sequence can achieve this. For induction of CTLs, addition of genes encoding molecules such as ubiquitin, aimed to enhance degradation and peptide production in the proteasome, can be effective. Similarly, targeting expression to different subcellular pathways such as the endosome or lysosome can amplify CD4+ T cell responses. Vaccination schedules based on combined prime-boost regimens using different vector systems to deliver the desired antigen (that is heterologous prime- boost immunization regimen) appear to be a successful improvement in DNA vaccine platform. Actually, prime-boost regimens have shown promise in eliciting greater immune response

in humans compared with DNA vaccination alone (Daniela et al, 2010). The heterologous prime-boost vaccination regimen exploits the ability of the immune system to generate a large number of secondary antigen-specific T cells. Following a priming immunization, a proportion of the antigen-specific T cell populationtrans forms into antigenspecific memory T cells, which have the ability to expand rapidly up on encounter with the same antigen a secondtime round. Since the priming and boosting vectors are different, and induction of effective immunity are becoming clear, this strategy allows for greater expansion of the disease antigen-specific T cell populations. To date, heterologous prime-boost regimens are among the most potent strategies to induce cellular immune responses. Compared to homologous prime-boost approach with the same DNA vaccine, boosting a primary response with a heterologous vector will result in 4 to 10-fold higher T cell responses (Daniela et al, 2010). Though prime-boost regimens was adopted in the study, the antibody levels in trail groups still had no statistics senses compared with the control ones. So, the recombinant vaccine is to further be improved. In this study, it is surprising to find that the antibody level of anti-PCV2 was not different from the control (Figure 1b). It is possible that only the four immunodominant regions of ORF2-PCV2 and one of ORF1-PCV2 were determined (Dominique et al, 2000). It

7142

Afr. J. Biotechnol.

can be thought that ORF1 protein has no immune reactivities. In addition, for the coated ORF2-PCV2 protein used by I-ELISA which was gained by prokaryotic expression, its naturally biological activity may be another factor to affect immune reactivities. Whether the antiORF2-PCV2 antiserum generated from a regional PCV2 strain could recognize the same epitopes in strain from other countries is not yet known and such experiments would provide information about epitope variability among PCV2 strains. We found that relatively high levels of neutralizing antibody and protection against PCV2/FMD were induced in all rFPV-vaccinated groups. Pigs inoculated with rFPV developed neutralizing antibodies with titers ranging from 1:26.6 to 1:46.6 (PCV2) and 1:26.9 to 76.11 (FMDV), (Table 1) which indicate that rFPV expressing ORF2ORF1 and P12A induces PCV2and FMDV-neutralizing antibodies in pigs. Because TCID50 was here used to assess the titers of neutralizing antibodies, it is necessary to further examine the result depending on the experimental piglets. Although it is generally accepted that protective immunity to FMDV is principally due to neutralizing antibodies, the cellular immune response provides an essential regulatory role in the induction and expression of the serological response. In order to evaluate the rFPV-induced PCV2 (FMDV)specific T cell response, we applied the MTT assay to measure the T lymphocyte proliferation response. Analysis of the specific T lymphocyte proliferation response showed there was a significant difference (P < 0.05) between the rFPV-ORF2ORF1-P1 groups and the control groups, and the SI of the prime-boost vaccination with rFPV-ORF2ORF1-P12A and the recombinant plasmid pVAX1-IL18-ORF2ORF1 was higher than in the other groups. Although a higher SI was achieved with the recombinant VP1 protein, the index was still relatively lower compared with the live viruses. Since wasted pigs always had a lower proportion of the CD4+ cell subsets and a + + + significant downshift of CD8 or CD4 CD8 cells was observed in PCV2-positive pigs (Darwich et al., 2002), the results of T lymphocyte subgroup analysis indicate that at 42 dpi, the percentage numbers of CD8+ T lymphocytes subgroups of the rFPV-vaccinated groups were higher (P < 0.05) compared with the wtFPV/PBS+ inoculated groups. The percentage numbers of CD8 T lymphocyte subgroups in the rFPV-ORF2ORF1-P12A/ pVAX1-IL18-ORF2ORF1-vaccinated group was higher than in the other tested groups, but no significant difference was observed (Fig. 2). In addition, at 21 and 42 dpi, the percentage numbers of the CD8+ T lympho+ cyte subgroups was always higher than that of the CD4 + + and CD4 CD8 T lymphocyte subgroups. Moreover, priming with rFPV-ORF2ORF1-P12A or boosting with the recombinant plasmid pVAX1-IL18-ORF2ORF1 led to an augmented CD8+ response. In addition, the percentage numbers of CD4+CD8+ T lymphocyte subgroups was higher at 42 dpi than at 21 dpi. This finding demonstrate

that rFPVs have the ability to increase cytotoxic responses and improve memory and/or effector cell responses, although the percentage of CD4+CD8+ T lymphocytes subgroups were positively related to the pigs' growth . The CTL assay resulted in statistically noticeable augmentation of specific-CTL activity (PCV2/FMDV) in rFPV-vaccinated groups compared to wtFPV/PBS at 25:1 and 50:1 effector-to-target ratios. This finding also elicited that rFPV-ORF2ORF1-P12A indeed promoted the Th2mediated immune response consistent with the CD8+ cell subsets being mainly responsible for cytotoxic responses. Additional evidence has been indicated because primeboost with the recombinant plasmid pVAX1-IL18ORF2ORF1 and rFPV-ORF2ORF1-P12A at a 50:1 ratio for both PCV2 and FMDV showed a statistically significant increase in the CTL-specific immunogenicity over the other two regimen. Altogether, it is clear that the cellular immune response of rFPV-ORF2ORF1-P12A were better than the antibody titers for PCV2, but rFPVORF2ORF1-P12A induces good neutralizing antibodies that is beyond what is expected. Although results of the immune response and viral challenge show that the rFPV-ORF2ORF1-P12A-inoculated group developed a stronger immune response and better protection, it would be advisable to focus future studies on how PCV2 acts on the immune systems of infected pigs. This would allow a more effective use of rFPV-ORF2ORF1-P12A by different inoculation schemes. In summary, in this study, we show that pigs immunized with rFPV-expressing ORF2/ORF1 and P12A were able to elicit a partial humoral and cellular response. Most importantly, a degree of protection was also shown against the challenge with a pathogenic strain of PCV2/FMDV. Moreover, a heterologous prime-boost (rFPVORF2ORF1-P12A/pVAX1-IL18-ORF2ORF1 or pVAX1IL18-ORF2ORF1/rFPV-ORF2ORF1-P12A) immunization strategy was more efficient in inducing a T cell response than the homologous prime-boost (rFPV-ORF2ORF1P12A/rFPV-ORF2ORF1-P12A). In the PCV2/FMDV TCID50 assay, pigs immunized with a heterologous primeboost regimen such as rFPV-ORF2ORF1-P12A/pVAX1IL18-ORF2ORF1 showed better protection. These studies demonstrate that this vaccination strategy may be useful and rFPV-ORF2ORF1-P12A could be further developed as a new genetically engineered vaccine. ACKNOWLEDGEMENTS The authors thank Dr. Min Zheng for providing live virus of FMDV O/NY00 and VP1 protein of FMDV O/NY00 and Ping Li and Jinshuang Zhang for the assistance in cell culture and reagent preparation. This work was supported by grants from the National 863 Project of China ((No. 2001AA213071) and Key Technologies R&D Program of Jilin Province (No. 20040202-1).

Qin et al.

REFERENCES 2).Vet. Pathol. 38: 31-42. Allan GM, Ellis JA (2000). Porcine circoviruses: a review. J. Vet. Diagn. Investig. 12: 3-14. Allan GM, McNeilly F, Cassidy JP, Reilly GA, Adair B, Ellis WA, McNulty MS (1995). Pathogenesis of porcine circovirus: experimental infections of colostrum deprived piglets and examination of pig foetal material. J. Vet. Microbiol. 44: 49-64. Berinsteina A, Tamia C, Tabogaa O, Smitsaart E, Carrillo E (2000). Protective immunity against foot-and-mouth disease virus induced by a recombinant vaccinia virus. Vaccine, 18: 2231-2238. Cedillo-Barron L, Foster-Cuevas M, Belsham GJ, Lefevre F, Parkhouse RM (2001). Induction of a protective response in swine vaccinated with DNA encoding foot-and-mouth disease virus empty capsid proteins and the 3D RNA polymerase. J. Gen. Virol. 82: 1713-1724. Chae C (2004). Postweaning multisystemic wasting syndrome: a review of 503 aetiology, diagnosis and pathology. J. Vet. 168: 41-49. Cheung AK (2003). Transcriptional analysis of porcine circovirus type 2. J. Virol. 305: 168-180. Daniela F, Sandra I, Vito Michele F, Vito Michele Fazio, Monica R (2010). DNA 507 Vaccines: Developing New Strategies against Cancer. Biomed. Biotechnol. Article ID174378: pp. 1-16 . Darwich L, Segales J, Mariano D, Enric M (2002). Changes in CD4+,CD8+,CD4+CD8+, and Immunoglobulin M-Positive Peripheral Blood Mononuclear Cells of Postweaning Multisystemic Wasting Syndrome-Affected Pigs and Age-Matched Uninfected Wasted and Healthy Pigs Correlate with Lesions and Porcine Circovirus Type 2 Load in Lymphoid Tissues. Clin. Diagn. Lab. Immunol. 9(2): 236-242. Dominique MahĂŠ, Philippe Blanchard, Catherine TruongLe Cann P, CarioletR, Madec F, Albina E, Jestin A (2000). Differential recognition of ORF2 protein from type 1 and type 2 porcine circoriruses and identification of immunorelevant epitopes. J. Gen. Virol. 81: 18151824. Dorr PM, Baker RB, Almond GW, Wayne SR, Gebreyes WA (2007). Epidemiologic assessment of 510 porcine circovirus type 2 coinfection with other pathogens in swine. J. Am. Vet. 511 Med. Assoc. 230: 244-250. Ellis J, Hassard L, Clark E , Harding J, Allan G, Willson P, Strokappe J, Martin K, McNeilly F, Meehan B, Todd D, Haines D (1998). Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can. Vet. J. 39: 44-51. Ellis J, Krakowka S, Lairmore M, Haines D, Bratanich, Clark E, Allan G, Konoby C, Hassard L, Meehan B, Martin K, Harding J, Kennedy S, McNeilly (1999). Reproduction of lesions of postweaning multisystemic wasting syndrome in gnotobiotic piglets. J. Vet. Diagn. Invest. 11: 3-14. Ellis JA, Bratanich A, Clark EG, Allan G, Meehan B, Haines DM, Harding J, West KH, Krakowka S, Konoby C, Hassard L, Martin K, McNeilly F (2000). Coinfection by porcine circoviruses and porcine parvovirus in pigs with naturally acquired postweaning multisystemic wasting syndrome. J. Vet. Diagn. Invest. 12: 21-27. Fenaux M, Halbur PG, Haqshenas G, Royer R, Thomas P, Nawagitgul P,` Gill M, Toth TE, Meng XJ (2002). Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease,virus distribution, and pathologic lesions. J. Virol. 76: 541-551. Fenaux M, Opriessnig T, Halbur PG, Elvinger F, Meng XJ (2004). A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs. J. Virol. 78: 6297-6303. Fenaux M, Opriessnig T, Halbur PG, Meng XJ (2003).Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs. J. Virol. 77: 11232-11243. Harding JC, Clark EG (1997). Recognizing and diagnosing postweaning multisystemic wasting syndrome (PMWS). J. Swine Health Prod. 5: 201-203. Jiang WZ, Jin NY, Cui SF, Li ZJ, Zhang LS, Zhang HY, Wang HW, Han WY (2005). Construction and characterization of recombinant fowlpox virus coexpressing HIV-1CN gp120 and IL-2. J. Virol. Method, 130:

7143

95-101. Karaca K, Bowen R, Austgen LE, Teehee M, Siger L, Grosenbaugh D, Loosemore L, Audonnet JC, Nordgren R, Minke JM (2005). Recombinant canarypox vectored West Nile virus (WNV) vaccine protects dogs and cats against a mosquito WNV challenge. Vaccine, 23: 3808-3813. Kennedy S, Moffett D, McNeilly F Meehan B, Ellis J, Krakowka S, Allan GM (2000). Reproduction of lesions of postweaning multisystemic wasting syndrome by infection of conventional pigs with porcine circovirus type 2 alone or in combination with porcine parvovirus. J. Comp. Pathol. 122: 9-24. Krakowka S, Ellis JA, McNeilly F, Ringler S, Rings DM, Allan G (2001). Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2). Vet.Pathol. 38: 31-42. MahĂŠ D, Blanchard P, Truong C, Le Cann P, Cariolet R, Madec F, Albina E, Jestin A (2000). Differential recognition of ORF2 protein from Type 1 and type 2 porcine circoriruses and identification of immunorelevant epitopes. J. Gen. Virol. 81: 1815-1824. Ma M, Jin N, Wang Z, Wang R, Fei D, Zheng M, Yin G., Li C, Jia L, Jin K, Zhang Y (2008). Construction and immunogenicity of recombinant fowlpox vaccines coexpressing HA of AIV H5N1 and chicken IL18. Vaccine, 24(20): 4304-4311. Ma M, Ningyi J, Guoshun S, Guangze Z, HuiJuan L, Min Z, Huijun L, Xiaowei H, Minglan J, Gefen Y, Haili M, Xu L, Yue J, Kuoshi J (2008). 583Immune responses of swine inoculated with a recombinant fowlpox virus co-expressing P12A and 3C of FMDV and swine IL-18. Vet. Immunol. Immunopathol. 121: 1-7. Mankertz A, Mankertz J, Wolf K, Buhk HJ (1998). Identification of aprotein essential for replication of porcine circovirus. J. Gen. Virol. 79: 381-383. Meehan BM, Creelan JL, McNulty MS, Todd D (1997). Sequence of porcine circovirus DNA: affinities with plant circoviruses. J. Gen. Virol. 78: 221-227. Meehan BM, McNeilly F, McNair I, Walker I, Ellis JA, Krakowka S, Allan GM (2001). Isolation and characterization of porcine circovirus 2 from cases of sow abortion and porcine dermatitis and nephropathy syndrome. Arch. Virol. 146: 835-842. Nawagitgul P, Harms PA, Morozov I, Thacker BJ, Sorden SD, Lekcharoensuk C, and Paul PS (2002). Modified indirect porcine circovirus(PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assay for detection of antibodies to PCV. Clin. Diagn. Lab. Immunol. 9: 33-40. Nawagitgul P, Morozov I, Bolin SR, Harms PA, and Sorden SD (2000). Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J. Gen. Virol. 81: 2281-2287. Opriessnig T, Fenaux M, Thomas P, Hoogland MJ, Rothschild MF, Meng XJ, Halbur PG (2006). Evidence of breed- dependent differences in susceptibility to porcine circovirus type-2-associated disease and lesions. Vet. Pathol. 43: 281-293. Opriessnig T, McKeown NE, Zhou EM, Meng XJ, Halbur PG (2006). Genetic and experimental comparison of porcine circovirus type 2 (PCV2) isolates from cases with and without PCV2-associated lesions provides evidence for differences in virulence. J. Gen. Virol. 87: 2923-2932. Pastoreta PP, Vanderplasschen A (2003). Poxviruses as vaccine vectors. Comp. Immunol. Microbiol. Infect Dis. 26: 343-355. Segales J, Rosell C, Domingo M (2004). Pathological findings associated with naturally acquired porcine circovirus type 2 associated disease. Vet. Microbiol. 98: 137-149. Shen G, Jin N, Ma M, Jin K, Zheng M, Zhuang T, Lu H, Zhu G, Jin H, Jin M, Huo X, Qin X, Yin R, Li C, Li H, Li Y, Han Z, Chen Y, Jin M (2007). Immune responses of pigs inoculated with a recombinant fowlpox virus coexpressing GP5/GP3 of porcine reproductive and respiratory syndrome virus and swine IL-18. Vaccine, 24(20): 4304-4311. Taylor J, Paoletti E (1988). Fowlpox virus as a vector in non-avian species. Vaccine, 6: 466-468. Tine JA, Firat H, Payne A, Russo G, Davis SW, Tartaglia J, Lemonnier FA, Demoyen PL, Moingeon P (2005). Enhanced multiepitope-based vaccines elicit CD8 + cytotoxic T cells against both immunodominant and cryptic epitopes. Vaccine, 23: 1085-1091. Tischer I, Gelderblom H, Vettermann W, Koch MA (1982). A very small

7144

Afr. J. Biotechnol.

porcine virus with circular single-stranded DNA. Nature, 295: 64-66. Tischer I, Mields W, Wolff D, Vagt M, and Griem W (1986). Studies on epidemiology and pathogenicity of porcine circovirus. Arch. Virol.91: 271-276. Tischer I, Mields W, Wolff D, VAGT M, GRIEM W (1986). Study on Epidemiology and Pathogenicity of Porcine Circovirus. Arch. Virol. 91: 271-276. Todd D, Niagro FD, Ritchie BW, Curran W, Allan G.M, Lukert PD, Latimer KS, Steffens III WL, McNulty MS (1991). Comparison of three animal viruses with circular single-stranded DNA genomes. Arch. Virol. 117: 129-135. Yu DH, Cui YL (1997). Guideline for Entry and Exit Animal Quarantine of China. Chinese Agricultural Publishing House, Beijing.

Zheng M, Jin N, Zhang H, Jin M, Lu H, Ma M, Li C, Yin G, Wang R, Liu Q (2006). Construction and immunogenicity of a recombinant fowlpox virus containing the capsid and 3C protease coding regions of footand-mouth disease virus. J. Virol. Methods, 136: 230-237.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals ■ ■ ■ ■ ■ ■

Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling African Journal of Biochemistry Research African Journal of Food Science African Journal of Plant Science