Issuu

Chapter 1: DNA Structure and Function Multiple Choice Identify the choice that best completes the statement or answers the question. ____

1. In which body or cell area are most genes in humans located? A. Nucleus B. Mitochondrion C. Cytoplasm D. Plasma membrane

____

2. Which condition or statement exemplifies the concept of genomics rather than genetics? A. The gene for insulin is located on chromosome 11 in all people. B. Expression of any single gene is dependent on inheriting two alleles. C. Sex-linked recessive disorders affect males more often than females. D. One allele for each gene is inherited from the mother, and one is inherited from the

father. ____

3. What is the purpose of phosphorous in a DNA strand? A. Linking the nucleotides into a strand B. Holding complementary strands together C. Ensuring that a purine is always paired with a pyrimidine D. Preventing the separation of double-stranded DNA into single-stranded DNA

____

4. What is the term used to define alternative forms of a gene that may result in different expression of

the trait coded for by that gene? A. Alleles B. Bases C. Centromeres D. Diploids ____

5. What percentage of bases in a stretch of double-stranded DNA that contains 30% guanine (G) bases

would be adenine (A)? A. 70% B. 60% C. 30% D. 20% ____

6. What is the term used to describe the organized picture of the paired chromosomes within a cell used

to determine whether chromosome numbers, structures, and banding patterns are normal? A. Pedigree B. Phenotype C. Karyotype D. Autotype ____

7. What would be the sequence of DNA that is complementary to a DNA section with the base

B. TTGACCGAAGGCT C. AACTGGCTTCCGA D. CCAGTTAGGAATC ____

8. Which of these complementary base pairs form the strongest or “tightest” association? A. Adenine and thymine B. Cytosine and guanine C. Guanine and thymine D. Cytosine and adenine

____

9. What activity occurs during M phase of the cell cycle? A. The cell undergoes cytokinesis. B. Activity stops, and the cell “sleeps.” C. All DNA is completely replicated. D. The cell greatly increases protein synthesis.

____ 10. Which chromosome number represents the euploid state for normal human somatic cells? A. 44 B. 46 C. 47 D. 48 ____ 11. How does the proteome differ from the genome? A. The proteome changes in response to intracellular and extracellular signals. B. The genome changes in response to intracellular and extracellular signals. C. The proteome is stable in somatic cells and unstable in germ cells, whereas the

genome is stable in both somatic cells and germ cells. D. The genome is stable in somatic cells and unstable in germ cells, whereas the proteome is stable in both somatic cells and germ cells. ____ 12. What is the most outstanding feature of a mature haploid cell? A. It is usually homozygous. B. The sex chromosomes are missing. C. Only one chromosome of each pair is present. D. DNA synthesis occurs after mitosis instead of before. ____ 13. At what phase of the cell cycle are chromosomes visible as separate structures? A. G1 B. G2 C. S D. M ____ 14. Which statement about the cell cycle phase of G0 is true? A. Hyperplastic growth in place of hypertrophic growth B. Performance of specific differentiated functions C. Initiation and completion of nucleokinesis D. Replication of DNA ____ 15. What is the result of normal DNA replication? Copyright © 2018 F. A. Davis Company

A. Formation of two new daughter cells B. Formation of two identical sets of DNA C. Disappearance of the original parent cell D. Activation and attachment of spindle fibers ____ 16. Which statement regarding chromosome structure or function is true? A. The chromatids of any single chromosome are known as “sister chromatids.” B. The genes located on the telomeres of chromosomes are identical to the genes in

the centromeres. C. Immediately before the mitosis phase of cell division, the chromosomes of all

somatic cells are haploid. D. A specific gene allele on one chromosome has a complementary allele on the other

chromosome of a pair. ____ 17. Why does a person with normal chromosomes only have two alleles for any single gene trait? A. A minimum of two alleles is required for the expression of monogenic traits. B. When a dominant allele is paired with a recessive allele, only the dominant allele is

expressed, and the recessive allele is silent. C. One allele for the monogenic trait is on the paternally derived chromosome, and

the other allele is on the maternally derived chromosome. D. Expression of more than two alleles of any single-gene trait results in enhanced

expression of recessive alleles and suppressed expression of dominant alleles. ____ 18. Under what normal condition are genotype and phenotype always the same? A. Euploidy of alleles B. Aneuploidy of alleles C. Homozygosity of alleles D. Heterozygosity of alleles ____ 19. What would be the expected result of a drug that affected a particular tissue by causing new DNA to

form with covalent bonds instead of hydrogen bonds? A. None of the cells in the affected tissue would be able to leave G0 and enter the cell cycle. B. Replication of DNA would result in identical DNA strands instead of complementary strands. C. Mitosis of cells in the tissue would result in the production of three new daughter cells instead of just two. D. The new cells that formed within this tissue would not be able to complete the next round of mitosis successfully. ____ 20. How does the DNA enzyme topoisomerase contribute to DNA replication? A. Unwinds the double helix and separates the double-stranded DNA B. Creates a “nick” in the DNA supercoils, allowing them to straighten before

replication C. Initiates DNA synthesis in multiple sites down the strand, making the process more

efficient D. Connects and links the individual pieces of newly synthesized DNA to form a

____ 21. Where is telomeric DNA located? A. At the tips of the p and q arms of chromosomes. B. In the mitochondria of all somatic cells C. Only in the germ cells (ova and sperm) D. Within the histones of the solenoid ____ 22. What is the purpose of a chromosome centromere? A. Connecting sister chromatids to form a chromosome B. Preventing the chromosome arm tips from unraveling C. Allowing chromatids to separate during DNA replication D. Ensuring that DNA replication proceeds only in the 3'-to-5' direction ____ 23. Which genetic process would be disrupted in one cell if it could not form chromosomes? A. DNA replication B. Gene-directed protein synthesis C. Delivery of genetic information to new cells D. Conversion of a nucleoside into a nucleotide ____ 24. What are the expected expressed blood types of children born to a mother who is B/O for blood type

and a father who is A/B for blood type? A. 25% A, 25% B, 25% O, 25% AB B. 25% A, 50% B, 0% O, 25% AB C. 50% A, 25% B, 25% O, 0% AB D. 50% A, 25% B, 0% O, 25% AB ____ 25. A person’s karyotype shows 44 autosomes and one X chromosome. What is the best interpretation of

this karyotype? A. The karyotype is aneuploid, and the individual has only one allele for each of the genes on the X chromosome. B. The karyotype is aneuploid, and the individual is experiencing the pathologic condition of haploidy. C. The karyotype is euploid, making the individual a genotypic female and a phenotypic male. D. The karyotype is euploid, making the individual a genotypic male and a phenotypic female.

Chapter 1: DNA Structure and Function Answer Section MULTIPLE CHOICE 1. ANS: A

Most genes are part of the DNA located in the nucleus of body cells. Only a few genes are located in a cell’s mitochondrion or mitochondria. There are no genes or DNA in either the cytoplasm or the plasma membranes of any cell. PTS: 1 2. ANS: A

Genetics is the study of the general mechanisms of heredity and the variation of inherited traits. Genomics is the study of the function of all the nucleotide sequences present within the entire genome of a species, including genes in DNA coding regions and DNA noncoding regions. Selections B, C, and D all refer to mechanisms of heredity. Only selection A refers to the function of a specific nucleotide sequence. PTS: 1 3. ANS: A

Each nucleoside becomes a complete nucleotide when a phosphate group is attached. The phosphates have multiple binding sites, and each one can link to two nucleotides. These linkages allow the nucleotides to be connected when placed into the DNA strand. The nucleotides within each strand are held in position by the linked phosphate groups, which act like the string holding a strand of beads together, forming a necklace. PTS: 1 4. ANS: A

For each single gene, two alternative forms of that gene, known as alleles, together control how that gene is expressed. The alleles may be identical in their sequence but do not have to be. When a dominant allele is paired with a recessive allele, only the dominant allele is expressed, and the recessive allele is silent. When a dominant allele is paired with another dominant allele, they are both expressed (usually equally). Recessive alleles are only expressed when they are homozygous. Bases are the essential part of a nucleotide, of which there are many within any gene region. Centromeres are the pinched-in part of a chromosome between the p arms and the q arms. The term diploid refers to the normal number of chromosome pairs within a cell. It is an adjective, not a noun. Therefore, the plural diploids does not exist. PTS: 1 5. ANS: D

Because of complementary pairing, if 30% of the bases are guanine (G), which always pairs with cytosine C, these two bases account for 60% of the total bases in this stretch. The remaining bases make up 40% of the total. This 40% is composed of equal percentages of thymine (T) and adenine (A). PTS: 1 6. ANS: C Copyright © 2018 F. A. Davis Company

A karyotype is a picture of an organized arrangement of all of the chromosomes within one cell during the metaphase section of mitosis. The chromosomes are paired and then arranged by number according to size and centromere position. The banding pattern of each pair is analyzed to determine whether areas have been deleted, expanded, or translocated. A pedigree also is a picture, but it illustrates several generations of a family history. Phenotypes are observable traits. Autotype is not a genetic term. PTS: 1 7. ANS: D

Because doubled stranded DNA (ds-DNA) is complementary in that A always pairs with T and G always pairs with C, wherever a G is located on strand 1, the complementary base in the same position on strand 2 is C; wherever a C is located on strand 1, the complementary base in the same position on strand 2 is G; wherever a T is located on strand 1, the complementary base in the same position on strand 2 is A; and wherever an A is located on strand 1, the complementary base in the same position on strand 2 is T. PTS: 1 8. ANS: B

Cytosine and guanine normally pair together, whereas adenine and thymine normally pair together. The reason for this specific and complementary pairing of bases is related to the forces that hold the two DNA strands together. The two strands are held loosely together, most of the time, by weak hydrogen bonds. Within a base pair, the hydrogen bonds form between the two nucleotides. Adenine and thymine each have a site for two hydrogen bonds to form, whereas cytosine and guanine each have three sites for hydrogen bonds to form. With three hydrogen bonds instead of just two, the cytosine–guanine pair is tighter (stronger) than an adenine–thymine pair. Note, a purine must always pair with a pyrimidine: they each can only pair with the base that can form the same number of hydrogen bonds. Adenine and cytosine do not pair, and neither do guanine and thymine. PTS: 1 9. ANS: A

The M stands for mitosis. This is the time during the cell cycle after the DNA has successfully replicated completely into two identical sets of double-stranded DNA during S phase, and then progressed through G2 phase into M phase. During M phase, the chromatids separate, each half goes into a new separate nucleus (nucleokinesis), and the cell has two nuclei. Just after nucleokinesis, the cell pulls apart into two cells (cytokinesis), each with a complete set of chromosomes in the nucleus. These two new daughter cells are identical to the parent cell that initiated cell division. There is no “sleep” stage of the cell cycle, although there is a reproductive resting state (G0) outside of the cell cycle. PTS: 1 10. ANS: B

Ploidy is the actual number of chromosomes present in a single cell nucleus at mitosis. Humans have 46 chromosomes divided into 23 pairs. When the nucleus contains both pairs of all chromosomes, the number present is the diploid chromosome number (2N). Normal human somatic cells (body cells that are not reproductive cells) with a nucleus have the diploid number of chromosomes, 23 pairs. When a cell’s nucleus contains the normal diploid number of chromosomes for the species, the cell is termed euploid. Copyright © 2018 F. A. Davis Company

PTS: 1 11. ANS: A

The proteome is the protein content of any given cell. It is dynamic, changing in response to intracellular and extracellular (environmental) signals. Therefore, the proteome is not an exact copy of the genome. The genome is stable in all cells, and the proteome expresses different proteins (both enzymes and structural proteins) at different times in different cells. PTS: 1 12. ANS: C

A haploid cell has a nucleus that contains only half of each chromosome pair, 23 chromosomes (1N). In a normal haploid cell, one sex chromosome is present. Because there is only one chromosome of each pair present, only one allele of each gene is present, and the cell is not homozygous. A mature haploid cell does not undergo cell division (mitosis) and does not replicate its DNA. PTS: 1 13. ANS: D

A chromosome is a temporary but consistent state of condensed DNA structure formed for the purpose of cell division during metaphase of mitosis (M phase). At other times in the cell cycle, the DNA is so loosely coiled as a double helix that the basic structure of a chromosome is not visible with a standard microscope. The DNA can be seen with an electron microscope as a double helix, not a chromosome, during G1, G2, and S phases. PTS: 1 14. ANS: B

G0 is a reproductive resting state of a cell outside of cell division in which the cell performs its normal differentiated functions. Therefore, nucleokinesis (a process of M phase of the cell cycle) and replication of DNA (a process of S phase of the cell cycle) do not occur. Hyperplastic growth is growth by cell division, which does not occur during the reproductive resting state of G0. PTS: 1 15. ANS: B

In S phase of the cell cycle, the DNA replicates completely into two identical sets of double-stranded DNA. This occurs in preparation for cell division, which then generates two new daughter cells. Spindle fiber formation, activation, and attachment are critical for mitosis but have no role in DNA replication. The process of DNA replication occurs inside the original parent cell that is undergoing mitosis but does not make the parent cell disappear. PTS: 1 16. ANS: A

Each longitudinal left and right half of any one chromosome is a chromatid. The two chromatids of a chromosome are homologous and termed sister chromatids. Gene alleles on separate chromosomes of a pair are not considered “complementary”; only gene sequences are complementary. PTS: 1 17. ANS: C

For each single gene at a specific chromosome location, two alleles together control how that gene is expressed even for single-gene traits that have more than two possible alleles. Regardless of how many different possible alleles are present in the entire human population, each person only has two because he or she has only two chromosomes (one inherited from his or her father and one inherited from his or her mother) per pair with one allele on each chromosome. Selection B is true but does not answer the question asked. Only two alleles for each monogenic trait should be present. Both are not required for the expression of all monogenic traits. PTS: 1 18. ANS: C

Homozygous alleles are identical on both chromosomes of a pair and result in the expression of both of these identical alleles in the phenotype, regardless of whether the alleles are both recessive or both dominant. Heterozygous alleles are different on both chromosomes of a pair. Although they may both be expressed or one may be silent, the phenotype does not always reflect the genotype. Trisomy of alleles would require an extra chromosome. This condition, unless the alleles are homozygous, does not always result in identical genotype and phenotype. Triploidy, like trisomy, would require an extra chromosome copy (actually, a whole extra set of chromosomes). This condition, unless the alleles are homozygous, does not always result in identical genotype and phenotype. PTS: 1 19. ANS: D

If, during S phase of one cell cycle, the replicated DNA had covalent bonds rather than hydrogen bonds, the cell could complete that round of cell division, resulting in two new daughter cells. When either of these two new daughter cells then reentered the cell cycle, it could not complete the cycle. The tight covalent bonds of the DNA in each of these cells would not break apart to allow each strand to separate and be used as templates for DNA replication and synthesis. Thus, the cycle would be arrested at this stage. PTS: 1 20. ANS: B

Replication of DNA is performed when double-stranded DNA is separated and each strand is used as a template to guide the correct construction of a complementary strand. Synthesis of new DNA begins at multiple sites, creating many short pieces. The enzyme DNA ligase connects or links the individual pieces of newly synthesized DNA during replication, forming a new single strand complementary to the template strand. The enzyme DNA helicase unwinds the double helix and initially separates the ds-DNA. The group of topoisomerase enzymes creates a “nick” in the supercoils of ds-DNA, allowing them to loosen so that eventually the two strands can separate. The enzyme primase is responsible for initiating DNA synthesis in multiple sites down the single strand being copied. PTS: 1 21. ANS: A

Telomeric DNA is a type of noncoding DNA located at the tips of chromosomes. Its purpose is to prevent DNA strands from unraveling. It is present in all linear DNA. The mitochondria do not contain linear DNA or true chromosomes. It is present in all somatic cells, as well as germ cells. PTS: 1 Copyright © 2018 F. A. Davis Company

22. ANS: A

A centromere is the pinched-in area of the chromosome that connects the two halves (sister chromatids) together in a metaphase chromosome. It also connects the chromosome segments above it and below it. The centromere has no role in DNA replication. The telomeres prevent chromosome unraveling. DNA replication proceeds in the 5'-to-3' direction and is determined by specific enzymes, not the centromere. PTS: 1 23. ANS: C

Chromosomes are temporary structures that have the important job of making the delivery of DNA to the two new cells precise so that one new cell does not get more or less than the correct amount of DNA and the correct distribution of the genes. This precision is critical for the new cells to be able to function normally. Chromosomes are not involved in either DNA synthesis or protein synthesis. PTS: 1 24. ANS: B

Blood type alleles A and B are codominant, and O is recessive. Thus when O is paired with either A or B, it is not expressed. When A and B are paired together, both are expressed, and the blood type is AB. In this situation both parents are heterozygous. For each pregnancy there is one chance out of four (25%) of the AB blood type being expressed, two chances out of four (50%) of the B blood type being expressed (with either a B/B genotype or a B/O genotype), one chance out of four (25%) of the A blood type being expressed (from an A/O genotype), and no chance (0%) of an O blood type (O/O genotype) being expressed. PTS: 1 25. ANS: A

A euploid karyotype for humans has a total of 46 chromosomes, 44 autosomes, and a pair (2) of sex chromosomes. The fact that this karyotype has only 45 chromosomes makes it aneuploid. Because the person is missing a sex chromosome and only one X is present, the person is female but has only one allele for each gene on the X chromosome (and none of the alleles for genes on the Y chromosome). PTS: 1

Chapter 2: Protein Synthesis Multiple Choice Identify the choice that best completes the statement or answers the question. ____

1. What is the relationship among genes, DNA, and proteins? A. DNA is composed of a series of amino acids that provide the directions for

synthesizing proteins. B. Protein is composed of DNA that is organized into specific gene sequences called

amino acids. C. A gene is a section of DNA that provides the directions for synthesizing a specific protein. D. Proteins are the nitrogenous bases that form double strands of DNA in its helical shape. ____

2. What is the best meaning for the term gene expression? A. The location of a specific gene allele on a specific autosomal chromosome B. The specific trait or protein coded for by a single gene is actually present C. The ability of a single gene to code for more than one trait or characteristic D. The loss of a trait or characteristic from one family generation to the next

generation ____

3. What is the difference between DNA transcription for DNA synthesis and DNA transcription for

protein synthesis? A. Transcription for DNA synthesis is rapidly followed by the process of translation. B. Transcription for protein synthesis has “greater fidelity” than does transcription for DNA synthesis. C. Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. D. Transcription for DNA synthesis occurs with both the “sense” and the “antisense” strands, while transcription for protein synthesis occurs with only the “antisense” strand. ____

4. Which mature messenger RNA strand correctly reflects the accurate transcription of the following

segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA A. AUGGUUAUUA B. ACGCTCGATTATTT C. CGCUCGAUUAUUU D. AACGCUUGGUCUGAAUUUUAAUUU ____

5. What is the function of ribosomes (also known as ribosomal RNA) in protein synthesis? A. Allow interpretation of the two strands of DNA to determine which is the “sense”

strand and which is the “antisense” strand B. Serve as the coordinator mechanism to allow proper reading of the mRNA and

placement of the correct amino acid in the sequence by the tRNAs C. Allow further processing of synthesized proteins (posttranslational modification)

in order to ensure that the final product is physiologically active D. Serve as transport molecules able to move a specific amino acid to the site of protein synthesis (peptide chain elongation) in the correct sequence ____

6. A strand of recently transcribed mRNA contains the following components: intron (1), intron (2),

exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA? A. 1, 2, 3, 4, 5, 6, 7, 8 B. 2, 3, 4, 5, 6, 7 C. 1, 2, 4, 8 D. 3, 5, 6, 7 ____

7. Which process occurs outside of the nucleus? A. DNA transcription B. RNA transcription C. Splicing out of introns D. Translation of mRNA

____

8. What would be the consequence for protein synthesis if only limited amounts of adenine were

available in a cell? A. Increased rate of mRNA degradation B. Increased formation of mutation “hot spots” C. Decreased production of cellular proteins D. Decreased amounts of uracil in the cytoplasm ____

9. Which process would be directly inhibited by a lack of conversion of thymine to uracil? A. Translation B. Transcription C. MicroRNA silencing D. Posttranscriptional modification

____ 10. What would be the sequence of RNA complementary to single-stranded DNA with the base

sequence of ACCTGAACGTCGCTA? A. TGGACTTGCAGCGAT B. ACCTGAACGTCGCTA C. UGGACUUGCAGCGAU D. ACCUGAACGUCGCUA ____ 11. Which events, structures, or processes are likely to trigger transcription of the beta-globin gene? A. Anemia and TATA boxes upstream from the beta-globin gene B. Anemia and polyadenylation downstream from the beta-globin gene C. Polycythemia and TATA boxes upstream from the beta-globin gene D. Polycythemia and polyadenylation downstream from the beta-globin gene ____ 12. After a protein is synthesized during translation, what further process or processes is/are needed for

it to be fully functional? A. No further processing beyond the linear arrangement of amino acids is required. B. Although minimal function can occur in the linear form, the protein is more active when it undergoes mitosis. Copyright © 2018 F. A. Davis Company

C. The protein first twists into a secondary structure and then “folds” into a specific

tertiary structure for activation and function. D. The initial protein produced is a “preprotein” that requires a series of

depolarizations by electrical impulses for conversion to an active protein. ____ 13. How does an “anticodon” participate in protein synthesis? A. Splicing out the introns to form a functional and mature messenger RNA B. Identifying which DNA strand is the “sense” strand to transcribe into RNA C. Ensuring the appropriate tRNA places the correct amino acid into the protein D. Interpreting the correct “stop” triplet or codon that signals for translation

termination ____ 14. The protein glucagon contains 29 amino acids in its active linear form. What is the minimum

number of bases present in the mature messenger RNA for this protein? A. 29 B. 58 C. 87 D. 116 ____ 15. Which feature or characteristic is most critical for protein function or activity? A. The number of amino acids B. The sequence of amino acids C. Deletion of all active exons D. Transcription occurring after translation ____ 16. How does a “codon” participate in protein synthesis? A. Carrying amino acid for peptide bond attachment B. Ensuring that ribosomal RNA is securely wrapped around the mature mRNA C. Preventing microRNA from binding to mRNA and prematurely degrading it D. Indicating which amino acid is to be placed within the growing protein chain ____ 17. How does replacement of thymine with uracil in messenger RNA help in the process of protein

synthesis? A. Allowing messenger RNA to leave the nucleus B. Ensuring only the “antisense” strand of DNA is transcribed C. Determining the placement of the “start” signal for translation D. Promoting posttranslational modification for conversion to an active protein ____ 18. How does the process of polyadenylation affect protein synthesis? A. Binding to the antisense DNA strand to prevent inappropriate transcription B. Promoting attachment of ribosomes to the correct end of messenger RNA C. Linking the exons into the mature messenger RNA D. Signaling the termination of mRNA translation ____ 19. Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis? A. These enzymes prevent overexpression of critical proteins. B. Without ribonucleases, messenger RNA could leave one cell type and lead to

protein synthesis more energy efficient. D. The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production. ____ 20. Which statement about the introns within one gene is correct? A. These small pieces of DNA form microRNAs that regulate gene expression. B. They are part of the desert DNA composing the noncoding regions. C. When expressed, they induce posttranslational modifications. D. The introns of one gene may be the exons of another gene. ____ 21. Which DNA segment deletion would cause a frameshift mutation? A. TCT B. GAGTC C. TACTAC D. GCATGACCC ____ 22. A person who is worried that he may have inherited the gene mutation for Huntington disease is told

that he has the “wild-type” form of this gene. What is the best interpretation of this finding? A. His gene for Huntington disease (HD) has more “hot spots” for mutations than the general population. B. His Huntington disease has unusual mutations of unknown significance. C. His Huntington disease gene is considered normal. D. He has no Huntington disease gene. ____ 23. What is the expected result of a “nonsense” point mutation? A. Total disruption of the gene reading frame, no production of protein B. Replacement of one amino acid with another in the final gene product C. Replacing an amino acid codon with a “stop” codon, resulting in a truncated

protein product D. No change in amino acid sequence and no change in the composition of the protein

product ____ 24. What makes a frameshift mutational event more serious than a point mutational event? A. Frameshift mutations occur primarily in germline cells, and point mutations occur

only in somatic cells. B. Frameshift mutations result in the deletion or addition of whole chromosomes

(aneuploidy), and point mutations are undetectable at the chromosome level. C. The rate of frameshift mutations increases with aging because DNA repair

mechanisms decline, whereas the rate of point mutations is unchanged with age. D. When the mutations occur in expressed genes, frameshift mutations always result

in disruption of the gene function, whereas a point mutation can be silent. ____ 25. What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of

his noncoding regions and his monozygotic twin (twin B) does not? A. DNA identification of each twin will be more specific. B. Only their somatic cells will remain identical at all loci. C. Only their germline cells will remain identical at all loci. D. They will now be dizygotic twins instead of monozygotic twins. Copyright © 2018 F. A. Davis Company

____ 26. Which statement about single-nucleotide polymorphisms (SNPs) is true? A. SNPs can change an exon sequence into an intron sequence. B. SNPs can change an intron sequence into an exon sequence. C. SNPs are generally responsible for frameshift mutations. D. SNPs are generally responsible for point mutations. ____ 27. Why are people who have poor DNA repair mechanisms at greater risk for cancer development? A. Their cancers are usually resistant to chemotherapy. B. Their somatic mutations are more likely to be permanent. C. They have greater exposure to environmental carcinogens. D. They have sustained a mutational event in all cells and tissues. ____ 28. How does an acquired mutation in a somatic cell gene leading to cancer development affect a

person’s ability to pass on a predisposition for that cancer type to his or her children? A. The predisposition can only be passed on if the person with the somatic cell mutation is female. B. There is no risk of passing on a cancer predisposition to one’s children from a somatic cell mutation. C. The risk for predisposition is dependent on which tissue type experienced the somatic mutation. D. Multiple somatic mutations are required for passing on a predisposition to cancer development. ____ 29. Which factor has the greatest influence on protein tertiary structure? A. The presence of a poly-A tail B. The specific amino acids that are in close proximity to each other C. Bond formation between amino acids that are distant from each other D. The number and position of additional proteins needed to form the complex

structure ____ 30. Jack and Jill go up a hill that has high levels of gamma radiation emission. Jack suffers 10 point

mutational events in a noncoding region, and Jill suffers only one frameshift mutation in the insulin gene–coding region of all her pancreatic beta cells. What are the possible and probable outcomes of these events for both people? A. Jack will have major deficiencies in the production of 10 proteins; Jill will have reduced insulin activity. B. Jack will have less functional proteins and an increased risk for cancer; Jill will have type 2 diabetes mellitus. C. Jack will have few, if any, effects on protein synthesis but will have more personal DNA markers; Jill will not produce any functional insulin and will have type 1 diabetes mellitus. D. Jack will not have any change in protein synthesis or function; Jill will have an increased risk for developing type 1 diabetes mellitus and can pass this risk on to her children. ____ 31. A new experimental drug has been developed that reduces the activity of microRNA in the beta cells