Issuu on Google+

SPONSORED BY

the campaign to revitalize the gateway arch grounds

e th s r n rs fo tio tie s de ec n si l s ey in a fro n e ci se spe h tor alt at he top

JUNE 26, 2013


BA

THE

IT’S THE PERFECT TIME TO IMPROVE YOUR SLEEP.

THE BACK STORE

5

years to pay

BUY NOW and TAKE UP TO

A

FREE

*

UNIQUE

* see store associate for complete details

THE-B

starting as low as... (8432) Back Store HOTLINE 314-643-

* * see store associate for complete details on financing options, free delivery and requirements for free gift with purchase.

Comfort Package

300tc luxury cotton blend

* see store associate for complete details

moisture proof & allergen resistant

MATTRESS & PILLOW

* 2 Free Pillows valued at $99 each. Elite Comfort Package is a $100 Value. Free pillows and Comfort Package are only valid with purchase of qualifying sleep set. See store associate for details.

ON SALE NOW

$

QUEEN MATTRESS

BOUTIQUE.

THE

BACK STORE

sleep well. we’ve got your back.

CHESTERFIELD MALL

SAINT LOUIS GALLERIA

636.536.1113

314.725.5222

PLAZA FRONTENAC

WEST COUNTY CENTER

314.692.2225

314.966.2225

UPPER LEVEL DILLARDS WING

UPPER LEVEL, NEIMAN MARCUS WING

stlbackstore.com

NEXT TO ST. LOUIS BREAD

LOWER LEVEL NEXT TO NORDSTROM

follow us:


JUNE 26, 2013

|

townandstyle.com

| 3


LIKE US ON FACEBOOK! TWITTER.COM/TOWN_AND_STYLE

MEET YOUR T&S TEAM

connecting our community. [ local & independently owned ]

<<PUBLISHER [ LAUREN B. RECHAN ]

EDITOR IN CHIEF>> ASSOC. PUBLISHER [ DOROTHY F. WEINER ]

CREATIVE DIRECTOR>> [ JULIE STREILER ]

<< SENIOR EDITOR [ TONY DI MARTINO ]

ASSOCIATE EDITOR>> [ REBECCA KOENIG ]

HEALTH WRITER>> [ MARY KONROY]

<<MANAGING EDITOR [CATHERINE KLENE ]

HEALTH WRITER>> [ SARA SAVAT]

CONTRIBUTOR>> [ DR. TIM JORDAN ]

<<STYLE EDITOR [ SUZY BACINO ]

<<CONTRIBUTOR [ BILL BEGGS JR. ]

CONTRIBUTOR>> [CHARLIE BRENNAN]

<<FOOD CRITIC [ JONATHAN CARLI ] (INCOGNITO)

<<CONTRIBUTOR [ PAUL DOERNER ]

CONTRIBUTOR>> [ ELLEN SOULE ]

CONTRIBUTOR>> [ JUDY GOODMAN ]

<<CONTRIBUTOR [ KENNETH BLAND ]

CONTRIBUTOR >> [ BOB WILCOX ]

<<CONTRIBUTOR [JOAN BERKMAN ]

PHOTOGRAPHER>> [ COLIN MILLER ]

<<PHOTOGRAPHER

PHOTOGRAPHER>> [ SUZY GORMAN ]

[ BILL BARRETT]

SOCIETY>> PHOTOGRAPHER [ CARLA FALASCO ] <<SOCIETY PHOTOGRAPHER [ MARGARET RAMBO ]

SR ADVERTISING EXEC.>> [ WENDY KREMS ]

<<SALES EXEC. [ PAULA RUSSELL ]

<<SALES EXEC. [VIVIAN FORTUNATO]

GRAPHIC DESIGNER>> [ JON FOGEL ]

4|

TOWN&style

|

JUNE 26, 2013

SOCIETY >> PHOTOGRAPHER

[CHARLES BARNES]

SR ADVERTISING EXEC.>> [ WENDY JABLONOW ]

SALES EXEC.>> [JEFF MELNICK]

CLASSIFIEDS MANAGER>> [ JANIE SUMNER ]

<<CONTRIBUTOR [ MICHAEL PECHLOF]

<<CONTRIBUTOR [ PATTY HANNUM ]

CONTRIBUTOR>> [ RASCHELLE BURTON ]

<<GRAPHIC DESIGNER [ SARAH GIBSON ]

OFFICE MANAGER >> [ KATHY COWHEY ]

<<SALES EXEC. [JENNIFER LYONS]

<<GRAPHIC DESIGNER [GAYLE VAN DYKE]

<<SALES &SPECIAL PROJECTS COORDINATOR [ MEREDITH BUSH]


JUNE 26, 2013

|

townandstyle.com

| 5


PHOTO BY COLIN MILLER OF STRAUSS PEYTON | CLOTHES BY NEIMAN MARCUS

TABLE OF

CONTENTS

june 26, 2013 // look for our next issue july 10

24

32

42 60

[ LETTER FROM THE EDITOR ] My trips to San Francisco are remarkable. Literally, there is always something to remark on. Visiting as a tourist is, no doubt, a lot more fun than staying there for a week with your children, trying to navigate this city of notoriously big costs and little parking space. But even if I had never encountered a naked Klezmer band in the Castro, San Francisco would leave me with a case of culture shock. This time the trouble started at the grocery store. I probably should have avoided the new Whole Foods on Haight Street (that Haight Street). Like many City by the Bay businesses, the store locks its bathrooms. (The code is 4-0-3-1, should you be there anytime soon.) In this case, I understand why they do it: Golden Gate Park and its various itinerant communities live across the street. Yet, inexplicably, there was still plenty of graffiti in the restroom; you’d think at those prices, the clientele would not be drawing on the walls. I also visited another store, Rainbow Grocery. It was kind of like a grungy, non-gentrified Whole Foods: warehouse setting, dim lighting, lots of bulk items and a panhandler perched at the exit (apparently it’s his regular turf). The only problem here was the complete absence of meat, chicken and fish. Hey, it’s a co-op, so if members have a conscientious objection to meat, so be it. But considering how hard it is to park (we had to wait for the lot attendant to wave us in when a parking spot opened), I was not inclined to negotiate yet another parking lot. One trip to the grocery store is enough. —Dorothy F. Weiner Editor in Chief

[ on the cover ]

se sp e in ec

he topalth ialsisede fo att fronctiornsthe orn tie eys rs

JUNE 26, 2013

A FUNDRAISING CAMPAIGN FOR CITYARCHRIVER 2015, A PARTNERSHIP DEDICATED TO REVITALIZING THE AREAS SURROUNDING THE GATEWAY ARCH, LAUNCHES PUBLICLY LATER THIS YEAR. PICTURED ON THE COVER: CAMPAIGN CO-CHAIRS DAVID PEACOCK, CHAIRMAN OF ST. LOUIS SPORTS COMMISSION, AND DANNY LUDEMAN, PRESIDENT AND CEO OF WELLS FARGO ADVISORS. TO LEARN MORE OR TO CONTRIBUTE, CALL 314.881.3535 OR VISIT CITYARCHRIVER.ORG.

the campaigen to revitaliz the gateway s arch ground

6|

TOWN&style

SPONSORED BY

|

JUNE 26, 2013

COVER DESIGN BY JON FOGEL COVER PHOTO BY COLIN MILLER OF STRAUSS PEYTON

[ town talk ]

[ style ]

7 8 10 15 16

COVER STORY – Wells Fargo Advisors TALK OF THE TOWNS THE INSIDER BOOKSHELF – SLUHMO CHARLIE’S TOWN

31 STOREFRONT 32 WHAT TO WEAR WHERE

18 18 19 20 22

FOR KIDS’ SAKE NONPROFIT DATEBOOK COVER STORY – Friends of Kids with Cancer HEARD IN THE HALLS SPRING SPORTS WRAP-UP BABIES

36 38 42 43

TOP ATTORNEYS 24 SPECIAL FEATURE – Off The Docket 25 COVER STORY – Hais, Hais, Goldberger & Lambson 26 VELVET HAMMER

[ photo album ] 27 SHE SAID YES! 28 SNAPPED! The Foundation for Barnes-Jewish Hospital 29 Nurses For Newborns 30 St. Louis Psychoanalytic Institute 30 Foster & Adoptive Care Coalition

[ health&beauty ]

HEALTH FRONTIERS COVER STORY – Washington University HEALTH – From Local Labs TREND REPORT – Ombre Manicures BEFORE & AFTER

[ leisure ] 45 46 47 49 49 50

HOPING FOR A HOME ON THE TABLE – PRASINO QUICK BITES FRONT & CENTER UNCORKED ARTS & ENTERTAINMENT

[ t&s homes ] 52 56 56 60 62 66

T&S HOME – 51 Westmoreland Place OPEN HOUSE NEIGHBORHOOD GEMS – Compton Heights TRENDING – The Great Outdoors HOMEWORK SOLD!

WE’RE SORRY | In our June 5 issue on p. 10, we omitted a credit for the photo of Philip Durham, which was taken by Dilip Vishwanat. CONTACT US

TOWN & STYLE, LLC 121 HUNTER AVE., STE 201 | ST. LOUIS, MO 63124 314.657.2100 | TOWNANDSTYLE.COM

EDITORIAL COMMENTS

TELLUS@TOWNANDSTYLE.COM IF YOU HAVE A PRESS RELEASE PLEASE SEND TO PRESSRELEASES@TOWNANDSTYLE.COM

DISTRIBUTION

PLEASE GO TO OUR WEBSITE AND LET US KNOW IF YOU WOULD LIKE TO BE REMOVED FROM OUR MAILING LIST OR EMAIL US AT DISTRIBUTION@TOWNANDSTYLE.COM

ADVERTISING INQUIRIES

SALES@TOWNANDSTYLE.COM

ALL CONTENTS ARE COPYRIGHT 2013 BY TOWN & STYLE LLC. ALL RIGHTS RESERVED. REPRODUCTION OR USE IN WHOLE OR IN PART OF THE CONTENTS, WITHOUT THE PRIOR WRITTEN PERMISSION OF THE PUBLISHER, IS STRICTLY PROHIBITED.

ALL REAL ESTATE ADVERTISED HEREIN IS SUBJECT TO THE FEDERAL FAIR HOUSING ACT, WHICH MAKES IT ILLEGAL TO ADVERTISE “ANY PREFERENCE, LIMITATION OR DISCRIMINATION BECAUSE OF RACE, COLOR, RELIGION, SEX, HANDICAP, FAMILIAL STATUS, OR NATIONAL ORIGIN, OR INTENTION TO MAKE ANY SUCH PREFERENCE, LIMITATION OR DISCRIMINATION.” WE WILL NOT KNOWINGLY ACCEPT ANY ADVERTISING FOR REAL ESTATE WHICH IS IN VIOLATION OF THE LAW. ALL PERSONS ARE HEREBY INFORMED THAT ALL DWELLINGS ADVERTISED ARE AVAILABLE ON AN EQUAL OPPORTUNITY BASIS.


TOWN TALK

St. Louis’ Premier Fine Art Gallery Nest Oil on Canvas 40 x 50 inches

COVER STORY

WELLS FARGO ADVISORS

by tony di martino

Join us for a series of educational open houses featuring Missouri’s top artists

July 20

Benjamin Guffee

Benefits Foundation Fighting Blindness A Trusted Family Tradition in Fine Art Services. AlwAyS Buying And ConSigning Free VerBAl eVAluATionS dAily

9650 Clayton Road in Ladue 63124 | 314-993-4477 | www.kodnergallery.com

IMAGE COURTESY OF CAR 2015

THE GATEWAY ARCH SOARS TRIUMPHANTLY ABOVE the Mississippi River, 630 feet and 886 tons of glittering steel. This monument to westward expansion symbolizes humanity’s determination to explore, discover and grow, despite all obstacles. The structure, designed by famed architect Eero Saarinen and completed in 1965, attracts more than 4 million visitors a year from around the world. But after 50 years, our most famous landmark could use some sprucing up. Enter CityArchRiver 2015, a partnership dedicated to revitalizing the Arch grounds and surrounding areas. “Our goal is to make the Arch easier for residents and tourists to enjoy,” says Sharon Mertzlufft, director of development for CAR 2015 Foundation. “This project will link the river, Arch and city through a series of improvements and additions that reinvigorate the area and make it accessible to all.” The multi-faceted project includes Park Over the Highway, which will extend over I-70 between Chestnut and Market streets, joining the riverfront, Arch grounds and Old Courthouse with one continuous greenway. In another component, the riverfront area from Biddle Street to Chouteau Avenue will be raised an average of two-and-a-half feet out of the flood zone, keeping area businesses and attractions open even when the river rises. Other improvements include extensive renovations to the Arch museum, Old Courthouse and Kiener Plaza, as well as interconnected gardens and pathways throughout the Arch grounds and a park that links the area to Eads Bridge. “The revitalized area will give locals and tourists new incentives to spend time at the Arch and surrounding attractions,” Mertzlufft says. CAR 2015, established in 2009, consists of the foundation and other agencies and organizations, including the National Park Service, Missouri PARK OVER THE HIGHWAY Department of Transportation, Great Rivers Greenway District, City of St. Louis and Bi-State Development Agency. A portion of the project is now funded, thanks to a sales tax initiative approved by City and County voters in April, and local, state and federal funding. Other projects are on track for completion by October 2015, the 50th anniversary of the Gateway Arch. A $250 million fundraising campaign, spearheaded by business leaders Danny Ludeman and David Peacock, will launch publicly later this year. The communitywide campaign will reach out to corporations, organizations and individuals for support. “Although the Arch is in St. Louis’ front yard, it’s really a symbol of America,” says Ludeman, president and CEO of Wells Fargo Advisors. “So we expect our campaign to garner nationwide and worldwide attention. I’m so proud to be part of this once-in-a-lifetime project. Once it’s complete, it will be a source of immense pride and economic impact for our region.” “CityArchRiver 2015 serves as a catalyst for progress downtown,” says Peacock, chairman of St. Louis Sports Commission and former president of Anheuser-Busch. “The Arch defines our city. That the community is coming together to enhance this great symbol serves as inspiration for further development as we transform downtown into the vibrant showplace we all envision.”

Missouri Masters Series 2013

grandma’s beautiful brooch not your cup of tea? before you tuck it in the back of your jewelry box, let our custom design team transform it into a go-to piece that’s suited to your style. or, if you’re not too attached, we are always interested in buying estate jewelry, so let us make you an offer even grandma couldn't refuse.

314 863 8820 heffern.com clayton 101 s hanley bldg lobby suite 110

100 years of redefining fine jewelry JUNE 26, 2013

|

townandstyle.com

| 7


TALK [TOWNS] by bill beggs jr.

Art fairs abound in our region, from Belleville to Ballwin, all season long. Although the deadline to apply has expired, if you’re an art-lover who missed the last show at Queeny Park produced by the Greater St. Louis Art Association, now is the time to squeeze this next event into your Labor Day weekend calendar. But what if it’s hotter than a pre-heated oven, it rains, or both? Abandon the barbecue and other outside plans to escape inside the (ahhh!) climate-controlled Greensfelder Recreation Center in Queeny Park. More than 130 artists from 20 states are expected to exhibit and/or demonstrate their work. The show opens at 6 p.m. on Friday, Aug. 31. Two such juried arts fairs are staged by GSLAA at Queeny each year; the next comes up in the spring.

COURTESY OF H&M

Jennie Runk of Chesterfield recently made a splash as the face and body of H&M swimwear (yes, that H&M, of Swedish fame). She wears a size 10 shoe, but no one is obsessing about her feet. Her 180-pound weight is another thing in the notorious world of Twiggy-ness. Runk thinks it’s time for the discussion of body size to disappear. She told Vogue Italia the concept of “plus-size is old fashioned.”

CHESTERFIELD

OF THE

We’ll try to act our age, not our shoe size, in our discussion of the buzz that surrounds our other wunderkind in the modeling industry. Several months ago there was a brouhaha, at least in fashion circles, about Karlie Kloss. A magazine in Japan airbrushed her image, significantly smoothing her torso so her ribcage didn’t seem … so prominent. (The photos are artfully done; that is, NSFW.) Women who wish they could airbrush out some thigh, midsection or bottom often choose a one-piece suit for the pool or shore. Many add a cover that stays on. Although many of the suits Runk shows off for H&M are one-piece, the hubbub is apparently about her in a two-piece. (We doubt airbrushing was involved, and although we cannot say so with any certainty, we looked very, very carefully.) She looks fabulous just the way she is. If you don’t think so, choose from one of our two responses: A. What’s your BMI? B. Who cares? Eric Hinson is a name many in Ladue hope never to hear again. He was chief of the Ladue fire department when the feds indicted him for embezzling nearly $600,000 from the fire district in St. Clair, Mo., where he served between 2006 and 2011. Hinson got his comeuppance a couple of weeks ago when he was sentenced in federal court to financial restitution, plus 35 months in prison. In the position of treasurer in St. Clair, he apparently had been a bear too close to the honey pot. The feds say he took expensive trips, as well as cash advances for the dayto-day maintenance of his ridiculously upscale lifestyle. Reportedly, he paid back what he took, and the feds publicly acknowledged St. Clair’s efforts in proving his guilt. (Begs the question: Where did Hinson come up with a halfmillion bucks?) Following a thorough

investigation, Ladue officials say there had been no malfeasance during Hinson’s year there, before he abruptly resigned last September. While he’s in the pokey, Hinson will have plenty of time to worry about cheating on his income taxes, as well as coming up with the $20,000 or so he’ll need to cover St. Clair’s investigative expenses. Cops and other regular citizens who were hoping to grab a maple doughnut with bacon on National Doughnut Day are still waiting for Strange Donuts in Maplewood to fling open its doors. And, for Homer Simpson and his ilk, the wait has been excruciating. (Seriously, though, what’s another Krispy Kreme or sugardusted, jelly-filled doughnut to a true believer?) National Doughnut Day was June 7—nearly three weeks ago. No one answered the phone when we called last week. The website is incomplete. They do encourage us to ‘Stay Strange.’ But, for how much longer? Those in the know say the store is hoping to open sometime in July. Let’s all cross those greasy, sugar-coated fingers. We won’t tempt you with any of the other proposed menu offerings until we’ve had a chance to see, smell, touch and taste them. A gazebo is going up in Richmond Heights. But the structure, for which ground was broken last month at The Heights, isn’t just any outdoor pavilion. It is the city’s veterans memorial. The memorial committee, comprised of veterans and citizens from several mid-county communities, emphasizes that the spot will be a place where anyone may reflect “on the sacrifices of all veterans, past and present.” Plans are to formally dedicate the Veterans Memorial Gazebo this Nov. 11—Veterans Day. Brick ‘pavers’

are available for purchase, and a fundraising trivia night is slated for July 20 at The Heights, 8001 Dale Ave. From the road, it wasn’t easy to identify the installation at Lindbergh High School. But as other drivers slowed to crane their necks at the back of the long structure, a low arc rising from both ends to the middle, it was impossible not to investigate. The Traveling Wall, 60 percent the size of the permanent black granite Vietnam War memorial in Washington, stopped here a few weeks ago. Billed as the ‘Show-Me Hero Salute,’ the exhibit was open 24 hours a day, and chaplains were on hand for comfort where needed. The exhibit provided an opportunity for Vietnam vets, families, friends and others to grieve those lost … and provided a stark contrast to the reception servicemen received 40 years ago, when protesters jeered them at airports. The wall, which includes the names of 58,195 men and women who died between 1959 and 1975, will appear over Independence Day weekend (July 3-7) in Pikeville, Ky. Citygarden is billed by the powers that be as an ‘urban oasis’ downtown. That is not hype. It is a draw for workers at lunch, visitors and wanderers (not all of whom are lost). It celebrates its fourth anniversary July 1. (Really—was it only that long ago?) Kids can play in the fountains and waterfall—and do they. In the midst of the Gateway City’s heat and humidity, many people in business attire are tempted to play hooky from their next meeting and take a splash themselves. It occupies two formerly vacant city blocks immediately west of the Serra sculpture (bordered by Eighth and 10th streets, between Chestnut and Market), which were transformed into the inviting landscape. Citygarden features

[ TT TRIVIA ] SAY YOU’RE DRESSING KARLIE KLOSS FOR HER NEXT STROLL DOWN THE RUNWAY. WHAT SIZE SLINGS WOULD YOU GRAB FOR HER? THE FIRST CORRECT EMAIL ANSWER WE RECEIVE AT TOWNTALK@TOWNANDSTYLE.COM WILL WIN AN EXCLUSIVE TOWN & STYLE TOTE BAG! LAST ISSUE’S ANSWER | A LIME RICKEY IS A FIZZY BEVERAGE, ALCOHOL OPTIONAL, IDEAL FOR SUMMER DAYS.

8|

TOWN&style

|

JUNE 26, 2013


TOWN TALK

two dozen sculptures and is highlighted by a halfdozen rain gardens. It was designed by the same firm that created the Flight 93 Memorial in 9/11 Shanksville, Pa., site of an airliner brought down on 9/11. The garden’s sculptures range from the whimsical to the pseudo-classical. There’s a fire-engine-red Keith Haring piece. Jim Dine’s metal sculpture of the wooden Pinocchio “explores the relationship between truth and lies.” The bronze by Igor Mitoraj is perhaps the most prominent installation. Reminiscent of a fallen Grecian classic, the hollow bronze head lies on its side, inviting exploration. It’s not only kids who venture inside to peer through an eye of Eros Bendato for photos. There are no gates or fences, and no admission charge, year-round. If you’re fond of the public display of flora throughout U. City, U. City in Bloom is looking for you. Three women planting tulips along Pershing Avenue started the group in 1985, and it since has blossomed into a hardy band of volunteers who maintain 350 gardens city-wide. More than 150 volunteers plant and keep up the flower gardens at Centennial Commons, Heman Park pool, the U. City Public Library, and the Centennial Gardens at City Hall. They take care of the 100-plus planters in the Delmar Loop. They also work the flower gardens at each of the U. City elementary schools (including the Butterfly Memorial Garden at Flynn Park), the middle school and the high school. If you’d like to help out, green thumbs not required. Visit ucityinbloom.org.

ST. LOUIS

Kinky Boots. Kind of fun to say, isn’t it? But that’s not important right now, because we’re talking about Tony Award-winning musicals here. Jerry Mitchell, an alumnus of Webster University, has won his second Tony, for choreography. (He was also up for directing.) His first was for choreographing another little play with a funny

name, La Cage Aux Folles, in 2005. Webster awarded him an honorary doctorate that year. When he was honing his Terpsichore 30 years ago, Mitchell studied at what was then known as Webster University Conservatory. Kinky Boots won this year’s Best Play at the awards ceremony in May, plus five other Tonys (including the second for our hometown boy).

Leasing on Pre-oWNeD vehicles available

2009 Mercedes e63 | $638.99/month*

2007 Porsche cayMan | $628.91/month*

2009 Mercedes cL63 | $1,298.49/month*

amG, Black/Black, 45k miles, sunroof, navigation, premium wheels.

rWD, Black/tan, 5-speed coupe, leather interior, 36k miles.

amG coupe, White/tan, 27k miles, leather interior, navigation, sunroof, premium wheels.

2008 InfInItI M35x | $24,999

2008 BMW 335i | $24,999

2001 Porsche 911 carrera | $28,900

aWD, White/Gray, 5-speed automatic, sunroof, leather interior, 34k miles.

Gray/Black, sports package coupe, NeW tires, sunroof, remote keyless entry, 37k miles.

silver/Gray convertible, excellent condition, low miles, tiptronic transmission, leather interior.

C

We are a highline luxury store that concentrates on Mercedes, BMW, Audi, Range Rover, Jaguar, Infiniti and Lexus. Our No Haggle/No Hassle pricing makes luxury car buying the way it should be, effortless.

oncierge

automotive

services

636 trade center Boulevard chesterfield 63005 636-536-2966 | chesterfieldcars.com

*Leases with approved credit. Leases on 2009 mercedes cL63 and 2009 mercedes e63 are closed end for 48 months, lease on 2007 Porsche cayman is closed end for 42 months. For all leases: $0 down, $0 security deposit, first payment is due at lease signing. taxes, title and license fees are not included in above payments. 12,000 miles per year allowed however additional mileage usage into lease. JUNE 26,can 2013be| built townandstyle.com

| 9


THE[IN]SIDER #TS smalltalk

A glimpse at what’s going on around St. Louis and beyond

St. Louisans say a lot in 140 characters. Check out the tweets of the town and join the conversation on Twitter using #TSsmalltalk.

DAN AND CONNIE BURKHARDT of Frontenac recently won the

6/19 SPACEarchitects @SPACEarchitects Chain restaurant saturated Chesterfield residents are in for a treat. #local #restaurants Town & Style @Town_and_Style @SPACEarchitects Do tell! SPACEarchitects @SPACEarchitects @Town_and_Style A bit too early, but suffice to say it’s a big time local chef opening a whole new concept restaurant 6/19 Luke @LukeOldham1 Tasting some Oud Bruin barrels that are the next sour beer from @Schlafly to go on tap at the Tap Room. 6/19 Gail Pennington @GailPennington Love it that people are being told not to swim in the Mississippi, River des Peres today. Shouldn’t that go without saying? 6/19 Kira Whitaker @seenondascene Got an email from @BarLouie that said today is national martini day! I planned on going today anyway #HappyHumpDayFolks 6/17 Jayson Reising @Jay_Reising There is noting like the feeing of buying #cardscubs tickets. @sarah3lynn @Cardinals TWITTER.COM/TOWN_AND_STYLE

10 |

TOWN&style

|

JUNE 26, 2013

2013 State Trail Advocacy Award from American Trails,

a national online trails resource. The award is given to individuals who demonstrate successful efforts to influence public policy on trail development and protection. The Burkhardts co-founded the Katy Trail Land Trust.

Academy Award-winning actress (and Webster University alum) MARSHA MASON was guest of honor at a recent luncheon hosted by Insight Theatre Company in Webster Groves. While in town, Mason attended Insight’s production of Neil Simon’s Chapter Two.

Disney’s CINDERELLA has kids dancing in the aisles at Stages St. Louis. But the Fairy Godmother isn’t the only one contributing to the show’s magical moments. Sources say it took four seamstresses 60 hours to sew Cinderella’s costume, and six seamstresses 80 hours to create costumes for the mice. The musical, sponsored by Town&Style, runs through June 30, with kid-friendly pre-show activities throughout the entire run.

ST. LOUIS ROWING CLUB made a strong showing at the recent Youth Nationals Championships in Oak Ridge, Tenn. Bringing home the team’s firstever gold medal in the Men’s Youth 4+ event were BJ Francis (Ladue ‘13), Tom Kendrick (Ladue ‘13), Andrew Grant (Parkway Central ‘15), Jimmy Francis (Ladue ‘14) and Charlie Lebens (Whitfield ‘14). BJ FRANCIS, TOM KENDRICK, ANDREW GRANT, The club also placed JIMMY FRANCIS, CHARLIE LEBENS among the top 10 in the country in the pair, men’s lightweight youth 4+ and women’s youth 8+. The championships drew teams from 30 states and 119 cities.

CHESS, ART AND FASHION recently convered when St. Louis-based World Chess Hall of Fame previewed its upcoming exhibition, A Queen Within, at Christie’s in New York City. St. Louisans attending the Big Apple event included Susan Barrett of WCHOF, exhibition project manager Susan Sherman, and exhibition co-chairs Jan Goldstein and Jimmy Jamieson of Jamieson Interior Design. Celeb guests included St. Louis native Derek Blassberg of Harper’s Bazaar, Simon Doonan of Barney’s New York, and Deborah Roberts of ABC-TV. The exhibition, which focuses on how various queen archetypes have captured the imagination of fashion designers over the years, opens here Oct. 19.

PH

OT

O

BY

PE

TE

R

W

OC

HN

IA

K

KEVIN WHITEHEAD, formerly of Wells Fargo Advisors, has joined the financial investment and management firm Smith Moore. Whitehead serves as senior vice president and director of sales and recruiting at the Clayton firm.

DEREK BLASSBERG, SIMON DOONAN, SUSAN SHERMAN, DEBORAH ROBERTS


TOWN TALK

When you want the very best care At McKnight Place we provide quality care you can trust and peace of mind you can depend on. We build close relationships with our Residents and their families to assure that their needs and wishes are fulfilled. Our beautiful, intimate environment is the perfect place for Residents to socialize with other Residents, friends and family. And we are conveniently located on The Gatesworth campus at Delmar and I-170. At McKnight Place we offer: - Great staff to Resident ratios delivered by specially trained, compassionate caregivers - A wide range of entertainment and activities that provide many opportunities for intellectual and social interaction - A fully equipped Therapy gym staffed by licensed therapists offering Physical, Occupational, Speech & Restorative Therapy - All-inclusive rates that are simple, predictable and worry-free Experience the difference for yourself! For Assisted Living please call 314-997-5333. For Skilled Nursing please call 314-993-2221.

We are committed to equal housing opportunity that does not discriminate in housing and services because of race, color, religion, sex, handicap, familial status or national origin. JUNE 26, 2013

|

townandstyle.com

| 11


advertise in >>

services>> style with

FRIENDSHIP VILLAGE

POYNTER

THE BUZZ]

reach our exclusive readership + ad appears online and in print for one low cost + great results! +

<< call JANIE SUMNER at 314.749.7078 or place your ad today ONLINE at townandstyle.com/classifieds

[ summer buzzin’ ]

314.657.2100 | townandstyle.com

PDI

Summer Elegance!

Providing therapy, residents and staff at FRIENDSHIP VILLAGE Chesterfield set up a FEEDING STATION to accommodate nine ducklings and their mother, who nested in one of the courtyards (friendshipvillagestl.com)... STACEY BROCHTRUP recently joined the staff at POYNTER LANDSCAPE ARCHITECTS to assist in creating beautiful, functional and sustainable landscapes (poynterlandscape.com)... COMPUTER FORENSIC INVESTIGATION, developed by PDI INVESTIGATIONS, is used by individuals, corporations and the legal profession to discover what was deleted from a computer and recovered for litigation purposes (pdi-web.com)...

DIELMANN INTERNATIONAL

DIELMANN

SOTHEBY’S REALTY’S

sales volume is UP 34 PERCENT for the first half of 2013. The company credits multiple contracts, low inventory, increasing home-sale prices, and a shift to a seller’s market (dielmannsothebysrealty.com)... CONCIERGE AUTO

T ISI

TREATS UNLEASHED

US O N

V

McKNIGHT PLACE

CONCIERGE AUTOMOTIVESERVICES

Model Kayla Luckey at Missouri botanical garden.

“Melany” handbag in light pink by Francesca Evangelista.

RObeRT L. bROwN phOTOgRaphy

Pace Farias COLLECTIONS

Monarch silk scarf by Pineda Covalin.

314~983~0781

Gold cuff & earrings by Mary Samoli for Pace Farias Collections, s/s 2013 .

266 Plaza Frontenac ~ Saint Louis ~ 63131 open: m-f 10-8 | sat 10-7 | sun 12-6

now specializes in LEASE PACKAGES for high-end, pre-owned vehicles, offering lowratesand haggle-free pricing (chesterfieldcars.com)... McKNIGHT PLACE on The Gatesworth campus now offers an art therapy program led by RACHEL TROKEY that promotes relaxation, positive mood, cognitive stimulation, self-esteem building and memory recall (mcknight.com)... THE THUNDERSHIRT, now sold at TREATS UNLEASHED, provides gentle, constant pressure that helps your dog make it through Fourth of July fireworks with less stress and anxiety, no medication required (treats-unleashed.com)...

[ save the date ] UNIVERSITY COLLEGE – WASHINGTON UNIVERSITY offers a new MASTERS OF SCIENCE

IN STATISTICS to prepare employees for an information-rich, data-driven career. For more information, attend preview night Aug. 8 on the Danforth Campus (ucollege.wustl.edu)... W.U.

12 |

TOWN&style

|

JUNE 26, 2013


TOWN TALK

TellThem

CENTRAL TABLE

“I saw it in

PRINTS CHARMING

PRINTS CHARMING GALLERY

GARDEN VILLAS

features whimsical pet portraits by local artist PEGGY WILLIAMSON from June 24 to July 6. All sales support her journey to bring crayons and creativity to Kenyan children (pcgstl. com)...CENTRAL TABLE in the CWE now offers a SUNDAY BRUNCH of savory dishes in addition to the lunch and dinner services popular with St. Louisans (centraltablestl. wcom)... ASSISTED LIVING is coming soon to GARDEN VILLAS RETIREMENT COMMUNITY to help residents live the

style e pages of town& th on e se u yo t ha and... << if you like w cal businesses

support our lo

[ IT’S THE TALK OF OUR TOWN ]

314.657.2100 | townandstyle.com

The wait is over. Assisted Living at Garden Villas is coming!

The Delmar Gardens family has done it again… after almost five decades of innovative and passionate care for the senior community, we are pleased to announce the newest addition to our West campus:

FREINDS OF KIDS WITH CANCER

Assisted Living at Garden Villas. Tailored to your needs, Assisted Living Services include: • Bathing and personal grooming • Management of medications • Menu and special diet planning • Specially trained and qualified Assisted Living Staff • Complimentary breakfast and lunch prepared by our Executive Chef • Weekly personal laundry and flat linen service • Personalized activities • Scheduled transportation to Doctor appointments, special events and shopping • In-house escort service to activities and dining room • 24-hour oversight of care

SOLANA WEST

retirement they want and receive the extra help they need. Visit or call Gayle Messmann (314.434.2520)... Join the YOUNG FRIENDS OF KIDS WITH CANCER at its annual HAPPY HOUR MEMBERSHIP DRIVE, a networking event from 5:30 to 7:30 p.m., July 11 at The Wood (friendsofkids.org)... The SOLANA WEST COUNTY, open since June 2012, hosts COOKOUT FOR A CAUSE from 11:30 a.m. to 1:30 p.m. July 10. Donations benefit Alzheimer’s Association. Call Ray for reservations (636.527.5700)...

[ agents reporting for duty ]

JANET McAFEE REAL ESTATE welcomes agent PATTI GREENEMAY, who specializes in homes in the St. Charles area (janetmcafee.com/pattig)... JANET MCAFEE REAL ESTATE welcomes sales associate PAMELA BERRA, who has 28 years of real estate experience (janetmcafee.com/ pamelaberra)...Executive sales consultant KATHRYN BADER has joined DIELMANN SOTHEBY’S INTERNATIONAL REALTY as part of the Warner Hall group. Bader specializes in high-end properties in Clayton and Ladue, as well as commercial real estate (dielmannsothebysrealty.com)... PATTI GREENEMAY

PAMELA BERRA

You will also enjoy our luxurious amenities such as billiards, complimentary dinner, putting green, and much, much more! Call or visit Assisted Living at Garden Villas Retirement Community today! Start living a carefree and safe lifestyle with the Delmar Gardens family!

KATHRYN BADER

Luxury Retirement & Licensed Assisted Living

(314) 434-2520 www.delmargardens.com | gmessmann@delmargardens.com

SPECIAL ASVERTISING FEATURE

JUNE 26, 2013

|

townandstyle.com

| 13


Serving the finest homes in St. Louis for over 30 years

314.965.9377

PLUMBING COMPANY INC

TonyLaMartinaPlumbing.com Angie’s List 2012 Super Service Award Recipient Better Business Bureau A+ Rating

$20 off

LAURA McCARTHY

LAURA MCCARTHY welcomes these new agents who have joined its Clayton and Town & Country locations: MORGAN CLARK, BETH PERCY NELSON, DOREE WREN, ELLEN MARTIN, JOAN WOLKEN, MICHELLE KILE MOSHIRI, ALISON SCHNEIDER, JIM KERLEY AND LAUREN HASAK GILLENTINE (lauramccarthy.com)...

any service call

HAIS

Not valid with other offers or discounts. Expires 9/20/13.

COULTER

[ legal buzz ] HAIS, HAIS, GOLDBERGER & LAMBSON announces its

NEW NAME AND PARTNERS. It remains dedicated to the practice of family law in the greater St. Louis metropolitan area (hhgl-law.com)... CURRAN COULTER of THE

COULTER LAW FIRM

has received his Guardian ad Litem certification. Both he and Joan are now certified to work with children as families move through the divorce process. (314.721.1116)... MR. GUY

Taking a vacation? Need foreign currency? Commerce Bank can help you with foreign currency needs. The Clayton Banking Center has select types of foreign currency available in limited quantities – including Euros, British pounds, and Mexican pesos. For Commerce Bank customers, we can order prepackaged currency from around the world.

Visit our Clayton Banking Center, 8000 Forsyth, with easy access and plenty of parking.

A MISTER GUY WOMEN’S exclusive: a three-day ALGO TRUNK SHOW, June 27 to 29. Choose your colors, fabrics and styles for an elegant piece that clients design (misterguyclothiers. com)... Now trending at IBELLA BEADS: NEON. Custom pieces created daily to complement outfits and keep up with the latest trends (ibellabeads.com)... another MISTER

GUY

PACE FARIAS

LILYPAD

14 |

TOWN&style

|

JUNE 26, 2013 6/3/2013 3:35:56 PM

WOMEN’S

exclusive: BESSI will IBELLA BEADS beshowcased in a threeday TRUNK SHOW June 27 to 29, featuring the Italian GINGER & MARY ANN brand’s characteristic rich prints and colors (misterguyclothiers. com)... Elegant extravagance is featured at PACE FARIAS COLLECTIONS with a new SMALL FRA HANDBAG in red by Italian designer Francesca Evangelista (314.983.0781)... New this summer at ELLEARD HEFFERN: A whimsical enamel and diamond STARFISH BROOCH in the colors of the sea. Handmade in Italy of 18 kt. gold (heffern.com)... LILYPAD PINK MAGNOLIA APPAREL, a boutique within a boutique, is a collection of clothing lines from designers in NYC, L.A. and Europe. Now available in two locations: Codi, The Boutique and Sei Bella Salon and Boutique (314.283.4675)... PINK MAGNOLIA offers the latest styles in LILLY PULITZER MAXI DRESSES (314.997.6161)...GINGER & MARY ANN BOUTIQUE is now open until 8 p.m. Thursdays for its THIRSTY THURSDAY event, serving cold beverages and offering a daily special announced on its Facebook page that morning (gingerandmaryannboutique.com)...

commercebank.com / 314.746.7463

J14725 Town & Style Foreign Currency Ad_3.95x9.7.indd 1

[ fashion buzz ]

MR. GUY

ELLEARD HEFFERN


TOWN TALK

When you graduate from University

College, you earn a Washington

University degree!

Professional & Continuing Education

BACK FROM LEFT | GINNIE WESTMORELAND, KATHLEEN SCHUMACKER, KAREN EASLEY, PEGGY CONROY, MARY DICKINSON, COLLEEN MEHAN, JO-ANN DIGMAN. FRONT | SABRINA INDELICATO, LISA TRYNIECKI, LYNN MORRIS, MARY ANN SCHULTE, PEGGY MAGEE, JANE FRICK PHOTO BY BILL BARRETT

BOOKSHELF SLUHMO]

by rebecca koenig

ABOUT THE CLUB Every month while school is in session, a group of women who met through their sons at Saint Louis University High School gather to discuss a book. SLUHMO Book Club, which stands for SLUH Mothers & Others, has read more than 60 selections since forming in 2006. “Everyone brings something different to the mix: people from different parts of the country, people of different disciplines and professional environments,” member Colleen Mehan says. “The different perspectives we bring to the table make it a great conversation.” And varied tastes make for an interesting reading list, since each hostess gets to choose a book. “It gives us exposure to something we wouldn’t have chosen off the bookshelf in the first place,” Mehan says. For fun, the food served at meetings usually has a literary tie-in; Mehan says she found Swedish treats at Global Foods Market when the group read Girl with the Dragon Tattoo. ABOUT THE BOOK

Poor Japanese villager Chiyo Sakamoto learns the subtle art of power negotiation and feminine entertaining in Memoirs of a Geisha, a historical fiction novel by Arthur Golden.

[ opinions ]

>>The words flow with a casual rhythm, giving the reader a fascinating look into the life of a geisha

in 1930s Japan. Vivid descriptions and an emotional storyline make Memoirs of a Geisha a great read. - PEGGY MAGEE >>I have loved reading and learning about the history and culture of Asian women. I was engaged from the start getting to know Sayuri’s determination through all her tragedies and challenges she faced in the life of a geisha, which she did not choose for herself. At times I could imagine sitting at the tea houses and observing the interactions between the geishas and the men of Gion. - PEGGY CONROY >>We can receive strength in our own lives as we witness the resilience of Sayuri overcoming seemingly insurmountable obstacles throughout her life—being cruelly sold into enslavement after the death of her mother, the tragic separation from her sister, the emotional abuse inflicted upon her by Hatsumomo, and other misfortunes. - MARY DICKINSON

FAVORITE |

POPE JOAN by Donna Woolfolk Cross

UP NEXT |

THE UNLIKELY PILGRIMAGE OF HAROLD FRY by Rachel Joyce

Earn your degree at a University ranked among the best in the Nation with one of the lowest tuition rates in St. Louis!

Preview Night Thursday • August 8th, 2013 7pm in Holmes Lounge Doors open at 6pm

Meet faculty, advisors & other students.

Ask your questions!

Why Choose University College? • Evening and online classes • Nationally ranked university • Affordable tuition • Distinguished faculty & first rate teaching • Centrally located with two Metrolink stops • Inviting academic community • When you graduate from University College, you earn a Washington University degree!

To RSVP for Preview Night & for more information:

ucollege.wustl.edu/preview or call 314.935.6700 JUNE 26, 2013

|

townandstyle.com

| 15


PHOTO BY COLIN MILLER OF STRAUSS PEYTON

by charlie brennan

CHARLIE’S TOWN

[ I enjoyed dinner earlier this month with classical guitarist Christopher Parkening, in town for the St. Louis Classical Guitar Society’s 50th Anniversary Gala. Parkening, whom Andres Segovia called “one of the most brilliant guitarists in the world,” wanted to see JOHANN SEBASTIAN BACH’S bibles at Concordia Seminary. I had no idea the school had any of Bach’s books. The Guitar Society’s Bill Ash escorted him the next day to Concordia, where the virtuoso viewed the bibles, including the composer’s scribbled notes and underlined verses. The volumes are the only known books from Bach’s library. Wow! ] [ Speaking of classical music, St. Louis Symphony Orchestra conductor DAVID ROBERTSON’S SUMMER SCHEDULE includes visits to the following cities: Hong Kong, Sydney, New York, Aspen, Sun Valley, Lausanne, Lucerne and Tel Aviv. Whew! ] [ Congressman LACY CLAY IS WORKING ON TWO BOOKS: a history of his career in Jefferson City and Washington, D.C., and an account of the divisive 2012 election, when he squared off against former Congressman Russ Carnahan in a heated primary contest. ]

[ JOHN DOERR, THE CHAMINADE ALUM

with an estimated net worth of $2.7 billion, has fallen from 12th to 26th place in Forbes’ annual ranking of the world’s top venture capitalists. “Still a towering figure in the Valley, and the most wellconnected venture capitalist, he’s trying to put (his firm) Kleiner (Perkins Caufield & Byers) back on top,” the magazine states. Forbes notes Doerr’s dad “pushed all his kids to study hard.” ] [ LOCAL AUTHORS are getting national and international attention. Kingdom Keepers by Ridley Pearson of Town and Country has spent the last 10 weeks on the The New York Times Best Sellers list. Meanwhile Curtis Sittenfeld, author of Sisterland, has enjoyed ink in USA Today, The New York Times, Britain’s The Guardian, and beyond. ] [ The June edition of Hemispheres Magazine, United Airlines’ inflight publication, showcases “the St. Louis barbecue snoot, a cut of meat from the nose and cheeks of a pig that’s grilled until crispy.” Where does one go for snoots? Hemispheres recommends Smoki O’s on North Broadway and Roper’s Ribs on West Florissant. ] 16 |

TOWN&style

|

JUNE 26, 2013


FOR KIDS’ SAKE] [ SPECIAL SECTION

Helping Kids with Cancer…Be Kids!


datebook SOCIAL | CHARITY EVENTS

2

>>AIM HIGH FRIENDS DAY

3

>>AIM HIGH FRIENDS DAY

[ JULY ]

AIM HIGH ST. LOUIS 9 – 10 A.M. | ST. LOUIS PRIORY SCHOOL AIMHIGHSTL.ORG | 314.432.9500

AIM HIGH ST. LOUIS 11 A.M. – NOON | JOHN BURROUGHS SCHOOL AIMHIGHSTL.ORG | 314.432.9500

6

>>FOREST PARK FOREVER FESTIVITIES

8

>>NINTH ANNUAL GOLF TOURNAMENT

11

>>HAPPY HOUR MEMBERSHIP DRIVE

20

FOREST PARK FOREVER 10 A.M. | FOREST PARK FORESTPARKFOREVER.ORG | 314.367.7275

RANKEN JORDAN – A PEDIATRIC SPECIALTY HOSPITAL 11 A.M. | NORWOOD HILLS COUNTRY CLUB RANKENJORDAN.ORG | 314.872.6414

YOUNG FRIENDS OF KIDS WITH CANCER 5:30-7:30 P.M. | THE WOOD FRIENDSOFKIDS.COM | 314.275.7440

>>CARD CARE CONNECTION’S BEAUTY BASH

SSM CARDINAL GLENNON CHILDRENS MEDICAL CENTER 1–4 P.M. | ST. LOUIS GALLERIA CARDCARECONNECTION.COM | 314.477.0084

22

>>BENEVOLENT CARE GOLF TOURNAMENT

23

>>HOWARD PARK GOLF CLASSIC

27

>>FIFTH THIRD BANK PRESENTS SCOOPS OF FUN

LUTHERAN SENIOR SERVICES NOON | NORWOOD HILLS COUNTRY CLUB LSSLIVING.ORG/TEEOFF | 314.262.8217

ACTION FOR AUTISM, HOWARD PARK CENTER, THE AMERICAN SCHOOL 11:30 A.M. | NORWOOD HILLS COUNTRY CLUB SHAPIER@AOL.COM | 314.443.4653

SSM CARDINAL GLENNON CHILDREN’S MEDICAL CENTER 6 P.M. | THE MAGIC HOUSE GLENNON.ORG | 314.577.5605

>>WITS’S 10TH BEE GREEN ANNIVERSARY THANKQUET AND RECYCLED E-SCRAP ART COMPETITION WEB INNOVATIONS & TECHNOLOGY SERVICES NOON | 6500 CHIPPEWA ST. WITSTHANKQUET.EVENTBRITE.COM

28

>>PAR-TEE DINNER AUCTION

29

>>BENEFIT FOR THE KIDS GOLF TOURNAMENT

LIFE SKILLS 5 P.M. | MEADOWBROOK COUNTRY CLUB LIFESKILLS-MO.ORG | 314.567.7705

MERCY HEALTH FOUNDATION ST. LOUIS 10:30 A.M. | WHITMOOR COUNTRY CLUB MERCY.NET/BENEFITFORTHEKIDS | 314.251.1800

>>TEE IT UP GOLF TOURNAMENT

LIFE SKILLS 6:30 A.M. | MEADOWBROOK COUNTRY CLUB LIFESKILLS-MO.ORG | 314.567.7705

YOUNG FRIENDS BOARD PRESIDENT KATY BREEN WITH MACKENZIE WOELBLING, KATIE LAWLESS, DOMINIC CAPUTA PHOTO BY BILL BARRETT

COVER STORY FRIENDS OF

KIDS WITH] CANCER

by rebecca koenig

FRIENDSHIPS ARE FORMED WHILE RUNNING AROUND THE PLAYGROUND, passing the ball in soccer practice and sharing secrets at sleepovers. But these opportunities are rare for kids who spend hours each day cooped up in hospital rooms. To facilitate social interaction, the Friends of Kids with Cancer young professionals group brings children together each June at its annual party at The Magic House, where they slurp snow cones, get their faces painted and, best of all, meet new buddies. At events such as these, the nonprofit’s associate director, Brandy Lucero, says, “They build lifelong friendships. It’s something the entire family can do. It gives them an opportunity to be together and enjoy themselves.” More than two dozen area residents sit on the board of Young Friends of Kids with Cancer. “It’s a very dynamic group that is active in looking to build a future for the organization,” Lucero says. Health professionals at Mercy Children’s Hospital St. Louis, SSM Cardinal Glennon Children’s Hospital and St. Louis Children’s Hospital refer patients diagnosed with pediatric forms of cancer to work with the group and its parent nonprofit. “We have a very close relationship with the social workers, nurses and doctors,” Lucero says. Friends of Kids with Cancer provides emotional, educational and recreational services not only to patients, but to their families as well. “We try to focus on the siblings and keeping the family unit together,” Lucero explains. “We want them to feel included as much as possible.” The organization addresses needs on multiple levels. A tutor helps kids keep up with their schoolwork, while certified art and play therapists offer children outlets for their emotions. “It’s so expressive for the kids to explain what they’re going through when it’s hard to find words,” Lucero says. “They’re scared and in a lot of pain, but it helps them to express what they’re feeling.” Young Friends of Kids with Cancer provides recreational support through events such as Family Night at The Magic House in June and a back-to-school party in August. The group also helps Friends of Kids with Cancer keep hospital toy and snack closets well stocked, for when kids spend hours there during treatment. And members even custom-shop for individual children undergoing radiation. “They get so much hospital food, so we provide snacks, treats and juice boxes,” Lucero says. “We send dinners down for special occasions by request from the treatment centers. In the bone marrow treatment centers, the family is isolated in the unit for a while, so we try to keep it stocked with things they like.” They also host several fundraisers each year, ranging from mouse races to mini golf to toy drives. In January, they’ll unveil a new event: Voodoo in the Lou, a Mardi Gras-themed masquerade ball. The organization’s influence is evident among the Young Friends members themselves. “What’s really been cool to see is that we have a lot of survivors on the board this year,” Lucero says. “There’s seven who had been a part of the program as kids, and now that they’re older, they’re giving back.” FRIENDS OF KIDS WITH CANCER IS LOCATED AT 530 MARYVILLE CENTRE DRIVE, STE. LL5. FOR MORE INFORMATION, CALL 314.275.7440 OR VISIT FRIENDSOFKIDS.COM. ON THE COVER, IN FRONT FROM LEFT: MACKENZIE WOELBLING, KATIE LAWLESS, DOMINIC CAPUTA. IN BACK: JOHN SKAE, KATY BREEN, BRANDY LUCERO, JOHN HENRY COVER DESIGN BY GAYLE VANDYKE | COVER PHOTO BY BILL BARRETT

18 |

TOWN&style

|

JUNE 26, 2013


Fabulous family friendly patio dining

TOWN TALK

HEARD IN THE [ HALLS ]

CLAYTON

by rebecca koenig WESTRIDGE ELEMENTARY SCHOOL

Second-grader Richie Tienter, who placed first in the Regional Braille Challenge in February, will compete in the National Braille Challenge June 21 to 22 in Los Angeles. The competition tests students in braille reading, speed, accuracy, comprehension, spelling and reading graphs.

Live music on saturdays with Brian cLark

314 878 8180 | 333 Westport Plaza | Saint Louis 63146 | PaulMineos.com

LIKE T&S ON FACEBOOK

CHESTERFIELD

KIRKWOOD HIGH SCHOOL

JACKSON PARK

Head boys basketball coach Bill Gunn was named Missouri Coach of the Year by the National High School Basketball Coaches Association at an April 29 banquet at Drury University in Springfield. Gunn, who has worked at several high schools, earned his 200th win as head coach while at Kirkwood.

FOLLOW US ON TWITTER See exclusive photos, find out the happenings around town—and tell us what you are up to!

And keep an eye out for T&S contests and giveaways only on Facebook!

CHESTERFIELD DAY SCHOOL

121 Hunter Ave Suite 201 | 314.657.2100 townandstyle.com

The Continental Mathematics League, which offers a series of word problem challenges for elementary school students, named fifth-grader Aanjaneyaa Venkataraman a national winner for earning a perfect score. Sixth-grader Jason Zhou, who missed only one problem, was named a regional winner.

CLAYTON HIGH SCHOOL All the world’s a stage for sophomore Katie Warnusz-Steckel, who was a semi-finalist in the 30th English-Speaking Union’s National Shakespeare Competition. Held April 22, the contest brought 58 regional winners to Lincoln Center in New York City to perform monologues and sonnets. Competitors attended an acting workshop at New York University’s Tisch School of the Arts and saw the Royal Shakespeare Company perform Julius Caesar.

kids

KIRKWOOD

Party ing Connect

eativity

Kids&Cr

Feeding Children’s Imaginations...

JACKSON PARK ELEMENTARY Out of the 18,700 submissions to the Major League Baseball and Scholastic Inc. 2013 essay contest, ‘Breaking Barriers in Sports, In Life,’ first place went to a piece written by fourth-grader Xavier Morgan-Gillard. Morgan-Gillard suffered from social anxiety and selective mutism when he was in kindergarten, a challenge he wrote about in his essay, “What Jackie Robinson and I Have in Common.” To honor the accomplishment, Jackie Robinson’s daughter, Sharon Robinson, visited Jackson Park Elementary April 30 and gave the school an autographed set of her book, Promises to Keep. Morgan-Gillard’s accomplishment was announced on the field at the Cardinals baseball game that night, and he and his teacher were awarded laptop computers.

®

ONE PARTY AT A TIME!

Your child will feel like royalty when their friends see them in our very special birthday throne!!! 90 minute instructor led parties that are fun and teach a skill that will last a lifetime. Don’t stress. Packages include invites, cake & pizza. Each child takes home their own unique creation (no need for a goodie bag)

CALL 314-567-1928 TO RESERVE YOUR PREMIUM TIME SLOT TODAY!

®

®

SHARE YOUR SCHOOL NEWS BY EMAILING US AT TELLUS@TOWNANDSTYLE.COM OR GO TO OUR FACEBOOK PAGE AND POST YOUR PHOTOS, STORIES AND MORE! ®

770 N. New Ballas Rd | Creve Coeur, MO 63141 314.567.1928 | Mon — Sat 9am to 7pm

LIKE US ON FACEBOOK! TWITTER.COM/TOWN_AND_STYLE WESTRIDGE

JUNE 26, 2013

|

townandstyle.com

| 19


SPRING WRAP-UP

by bill hester

A three-peat by the Westminster Christian Academy baseball team and an amazing final performance by John Burroughs standout Ezekiel Elliott highlighted another special spring season for local athletes.

[ baseball ] Westminster did it again, winning its third consecutive state championship. The Wildcats defeated Oak Grove 2-1 in a thrilling Class 4 title game, as Shane Benes provided a two-run homer in the fourth inning, his 11th home run of the season, and enough for Westminster pitchers Davis Vanderslice and Ben Lovell to finish the job. Westminster finished the season with a 33-3 record and 22 consecutive victories. The three losses totaled only four runs. CBC also made it to the state championship game, but the Cadets fell to Francis Howell 7-3 in Class 5. The Cadets, who beat Parkway North 11-6 in the district championship game, finished the season with a 24-9 record. The Metro Catholic WESTMINSTER Conference was very strong again this spring as Vianney and Saint Louis University High also won district and sectional titles. Vianney defeated Oakville 17-2 in the Class 5 District 2 championship and then beat Seckman 6-1 in the sectionals before losing to CBC 10-5. SLUH edged Ladue 2-1 in the Class 5, District 5 championship game and then won by the same score against Hazelwood West in sectionals before falling to eventual state champion Francis Howell in the quarterfinals, 4-2. SLUH, CBC and DeSmet Jesuit all shared the conference championship with 5-3 league marks. Vianney was 4-4. Clayton and Brentwood also won district titles. Clayton won in Class 4, District 6. The Greyhounds defeated John Burroughs 3-2 in the title game and then fell to St. Mary’s 2-1 in the sectional round. Brentwood won the Class 3, District 4 title, defeating Maplewood 14-4 in the title game. The Eagles were eliminated in the sectional round by St. Pius, 14-2. Other area conference champions were: Valley Park (South Central Athletic Association); Ladue (Suburban East); Parkway North (Suburban South); and Marquette (Suburban West). DeSmet Jesuit’s Brandon Gutzler led area hitters with a .489 average. Justin Paulsen of CBC was tops in RBI with 45. Westminster’s Lovell had another outstanding season on the mound with a 9-0 record. He had four shutouts and eight complete games. Ladue’s Rob Ewald and Westminster’s Vanderslice also were perfect on the mound with 8-0 records, while SLUH’s Brian Howard had the area best ERA of 0.54 in 52 innings.

[ soccer ] St. Joseph’s Academy made it to the final four but fell just short of capturing the Class 3 championship. The Angels lost to St. Teresa’s Academy 1-0 in the semifinals and then came back to defeat Nixa 4-1 and capture third place. The Angels, who won the Metro White Conference, finished the season with a 19-3 record and outscored their opponents 85-13 for the season. St. Joe was the only area school to win a district title, but others won two district championships in classes 1 and 2, and one made it to the final four. Rosati-Kain did not allow a postseason goal en route to state in Class 2. The Kougars beat Jennings 10-0 in the Class 2, District 4 title game and followed with a 7-0 win over Bishop DuBourg in the sectionals and a 2-0 triumph over Cape Notre Dame in the quarterfinals. Their dreams of a state title were halted with a 2-1 loss to Helias in the semifinals. Visitation won a Class 2 district title, defeating Westminster 2-1, but the Vivettes lost in the sectional round to Incarnate Word 3-2. Kennedy and John Burroughs each won Class 1 district championships. Kennedy won in District 2 as the Celts beat Whitfield 1-0 in the finals. They then defeated Burroughs 5-2 before falling to St. Pius 5-0 in the quarterfinals. Burroughs won in District 4 with a 4-0 20 |

TOWN&style

|

JUNE 26, 2013

victory over Crossroads. The Bombers then were eliminated by Kennedy. MICDS had a tremendous regular season. The Rams were undefeated in six matches in the Metro Conference and were 17-3-1 overall. Crossroads and Brentwood shared the championship in the SCAA with 9-1 marks, while Ladue was undefeated in five games in the Suburban East. Webster Groves was one of the elite teams in the area. The Stateswomen won the Suburban South Conference and were 22-3-1 overall. Webster outscored its opponents 78-20. Webster’s Maddie Pokorny was the top area scorer with 26 goals and led all players in the St. Louis area with 14 game-winning goals. Webster’s Charlotte Kennedy had 15 solo shutouts, while MICDS’ Elizabeth Lewis had 14 shutouts, 12 of which were solo.

[ girls lacrosse ] MICDS won the state championship, defeating Ursuline 12-7 in the finals. “Last season we made it to the championship game and were defeated,” says Rams coach Traci Nelson. “We knew all season that we wanted to make it back to the title game. When we met Ursuline earlier in the season and beat them by one goal, we had tons of turnovers. I knew that taking care of the ball by making smart decisions and not turning it over were going to be keys in the championship game.” The Rams cut down on the errors and were rewarded with the state title. Top players for MICDS throughout the season were goalie Ellis Chalfant, Olivia Polk, Claire Rush and Rebecca Welford. The Rams finished the season URSULINE AND MICDS with a 16-3 record. Three players led the St. Louis area in key categories. Parkway West’s Annie Spewak led all scorers with 116 goals. Katie Karl of St. Joseph’s Academy led the area with 47 assists, while Abby Frerotte of John Burroughs led the area with a 17-2 record in goal.

[ water polo ] For the second consecutive year, the most exciting high school game of this season may have been a water polo match. And both times, it involved Saint Louis University High. The Junior Bills lost last year’s Missouri District Tournament championship game by one goal in sudden victory. This year, SLUH defeated MICDS by the same score on a goal by Victor Castro, almost at the buzzer. “We anticipated making it to the final four,” says SLUH coach Paul Baudendistel. “After that, the remaining teams are all good enough to beat each other on a given day.” SLUH got great effort from its second unit in a 17-8 win over DeSmet Jesuit in one semifinal, while MICDS beat defending champion Parkway West 10-9 in the other semifinal, setting up the dramatic finale. “The key was team defense and balanced scoring,” Baudendistel says. “Five different players (Kevin Brennan, Darrian Castro, Victor Castro, Tom Critchfield and Chris Favier) scored two goals apiece, and five other players recorded at least one assist.” SLUH extended its record number of Missouri Championships to 16. The Junior Bills have won six of the last eight titles. SLUH


TOWN TALK

[ tennis ]

[ golf ] MICDS won a team title, while Vianney’s Matt Mueller captured an individual state championship this spring. The Rams used a mix of experience (seniors Sohil Dessai and George Hurley and junior Blake Adamson) and youth (freshmen Drew Lilly and Mike O’Keefe) to capture the Missouri Class 3 state title. “We thought we would be a strong, eight-man team with the talented freshmen we added to the mix from last year,” says Rams coach Ron Holtman. “It was difficult to select five players for state, as our top seven were strong contributors all season.” Lilly led the way with a second place finish individually to help the Rams to the Class 3 crown. For the second straight season, the Rams led after the first day of the two-day tournament at the Sedalia Country Club. This year the Rams finished with a score of 617, three strokes ahead of second place Cape Notre Dame. Vianney junior Mueller had an interesting state tournament MICDS in Springfield, culminating in a tied Class 4 state championship with Patrick Byrne of Rockhurst. Mueller becomes the first Griffin individual golf champion. Mueller was in the last grouping following round one after an even par 72 on the first day. But things did not start well for Mueller on day two with two double bogeys on the first three holes. “All I told him was to keep grinding,” Vianney coach Don Owens says. “There was a lot of golf to be played, and it is where you finish, not where you start, that counts.” And what a finish it was for Mueller. He just missed a birdie on the 16th hole, birdied the 17th and just narrowly missed an eagle putt on the 18th, which would have secured the outright championship.

[ volleyball ] Lafayette and Vianney won state championships this spring. The title was the first for the Lafayette Lancer boys, who defeated CBC in the Class 4 championship

[ boys track ] John Burroughs’ senior Ezekiel Elliott made a lasting impression during his sensational high school athletic career, winning four gold medals and leading the Bombers to a second place finish in Class 3. Elliott won the 110-meter hurdles (13.87 seconds), the 100 dash (11.03), the 300 hurdles (39.01) and the 200 JBS SENIOR EZEKIEL ELLIOTT dash (22.25). “Ezekiel’s final high school track meet is one I will never forget,” Bomber coach Daniel Harris says. “He maintains a unique blend of athleticism, character, dedication, focus, leadership, power, speed and a contagious smile that shines through his confident yet humble demeanor. Ezekiel’s generosity of spirit and commitment to excellence will remain a lasting legacy.” Three area teams finished in the top 10 in Class 4. CBC led the way with a third place finish. The Cadets had an individual champion (senior Jamal Robinson in the 200-meter dash) and a 4x400-meter relay champion (seniors Bertrand Birdsall and Jonathon Parker, 11th grader Stephan Hickman and sophomore Jerrick Powell). Junior Bills 11th grader Raymond Wingo won the 100-meter dash. Marquette junior Noah Kauppila was the other Class 4 state champion, winning the 800-meter run.

PHOTO BY MARGARET BAHE

The area had a team champion, an individual singles and a doubles champion in the Class 1 tournament. MICDS captured the team title with a win over rival John Burroughs in the championship. The title was the first for the Rams since 2008 and was accomplished without one of its top players, senior Matt Wolfe, who missed the entire postseason. “It is really tough to lose a player who finished fifth in state last year,” MICDS coach Patrick Huewe says of Wolfe. “We knew it was going to be a monumental task to win without him, and the guys responded to the challenge. It was 100 times more rewarding to win the way we did.” The Rams were led by a pair of freshmen, Joey McAllister and Tyler Raclin, who played the top two singles spots. It also was a successful season for John Burroughs, which lost only twice during the season, both times to MICDS. The Bombers ended Pembroke Hill’s four-year reign in the team semifinals. “Beating the defending champions was awesome,” says Bomber coach Matt Waite. “We had a lot of tough wins across the board.” It was an all-Clayton final in the Class 1 singles championship match with junior Mac Rechan defeating Joey Dulle, 6-1, 6-3 in the finals. Rechan finished second in singles last season at state, while Dulle was a defending state doubles champion. “Mac does not like to lose a single point,” says Clayton coach Susie Luten. “He fights for each one and is the fiercest competitor I have ever coached— the complete package.” It was a complete Class 1 sweep for Town & Style area teams after a doubles championship by Westminster’s Bailey Merkel and Derek Bell. They defeated Michael Peters and Matthew Wong of John Burroughs in the title match.

match 25-15, 26-24. “This season was a dream,” says Lafayette coach Doug Ell. “We started the season with a simple, realistic goal: get better every day. We didn’t talk about anything beyond that. We had some senior leadership who had lasting memories of our final loss the year before and didn’t want to end their high school career the same way.” Ryan Gettinger, Alex Moll and Adam Kerr were some key Lancer players. “While I may have had better individual talent in past years, this may have been the most well-rounded team,” Ell says. “Those 10 boys all made significant contributions during the season.” The Lancers finished the season with a 31-5-1 record. The title was the first for Lafayette but the 17th for Vianney, a new state record. The Griffins won their final 12 matches of the season, including a 27-25, 25-20 win over Westminster in the Class 3 championship. The Griffins actually were under .500 in the Metro Catholic Conference (3-5) but the experience of playing teams such as league champion SLUH (31-4-0 overall) and CBC (28-6-1 overall) helped prepare Vianney for the postseason. The Griffins finished 26-7-1 overall.

[ girls track ] It was quite a state debut for Brentwood’s Sophia Rivera. The freshman won both the discus and shotput at the Class 2 championship. Rivera broke the school records in both events in her first high school meet and reset those records six times during the season. She medaled at the prestigious Kansas Relays and capped off her amazing season with the two championships at the state meet. Maplewood junior Essence Brewer also was a state champion in Class 2 as she won the 400-meter dash and helped the Blue Devils to a fifth-place finish as a team. Parkway North senior Amber Alexander was the lone area champion in Class 4. She won the high jump, clearing 5-6. MICDS closed out the Class 3 meet in style, capturing the 4x400-meter relay with seniors Julia Olson, Pam Ekpelu and CeCe Moore, MICDS and freshman Geneva Lee. JUNE 26, 2013

|

townandstyle.com

| 21


BAB ES] [ COCO MAE ASHLEY FOUCH ] DEC. 15, 2012 | 7 LBS. 11 OZ. PARENTS | Rob & Ashley Fouch of Saint Louis Hills

GRANDPARENTS |

Corey & René Dittamore of Tulsa, Okla., Bob & Karen Fouch of Tulsa, Okla.

Artist:

Megan Rieke St. Louis

[GRANT ALAN WILLER JR. ] MARCH 28 | 7 LBS. 1 OZ. PARENTS | Grant &

Art provided by Art Saint Louis www.artstlouis.org - (314) 241-4810

Michelle Willer of Frontenac GRANDPARENTS | Patricia Willer of St. Louis, Gene & Carol Hoffmann of St. Louis

Furniture & Accessories Provided By Niche www.nichestl.com - (314) 621-8131

LEARN ABOUT NEW, EFFECTIVE SOLUTIONS TO

ADHD

[ HENDRIX JAYNE WALL ] JAN. 24 | 6 LBS. 7 OZ. PARENTS | Stephen Edward

Wall & Holly Crispin Martin of Nantucket, Mass.

GRANDPARENTS |

Don & Gretchen Gerber of Frontenac, Rick & Kathy Wall of Des Peres, John & Elaine Martin of Nantucket, Mass. and Charlestown, Mass.

Meet the Team from St. Louis Neurotherapy Institute and learn more about our comprehensive approach to addressing symptoms associated with ADHD. You will learn about our perspective on the interplay between the neurological, metabolic and psychosocial realms and how this multi-pronged approach is unique and effective. Dr. Rhodes will share case studies that illustrate the power of neurofeedback. FREE PaREnt SEminaR:

thursday, July 11 7:00 to 8:30pm at our facility. Reservations are required.

314-983-9355 || DR. JASON RhODES || DR. JENNIFER RhODES || 11710 Old Ballas Road – Suite 205 – Saint Louis 63141 – STLneurotherapy.com 22 |

TOWN&style

|

JUNE 26, 2013

GREAT-GRANDPARENTS |

Lorraine Cronin of Andover, Mass.

[ JACK CHARLES GETCHMAN ] MARCH 6 | 8 LBS. 4 OZ. PARENTS | Rob and

Lauren Getchman of Sunset Hills

GRANDPARENTS | Ann Getchman of Crestwood, Mike & Joan Taylor of Webster Groves

TO SHARE YOUR BLESSED EVENT WITH TOWN & STYLE, CONTACT BABIES@TOWNANDSTYLE.COM OR CONNECT WITH US ON FACEBOOK


TOWN TALK

TOP ATTORNEYS] [ SPECIAL SECTION

Hais, Hais, GoldberGer & lambson

pc

Fighting injustice and winning – that’s how we measure success. JUNE 26, 2013

|

townandstyle.com

| 23


F OF the docket BYTONYDIMARTINO

PHOTOSBYBILL BARRETT

They excel in front of and behind the bench, but what motivated these three very different personalities to pursue a career in law?

HON. ELLEN LEVY SIWAK, ADMINISTRATIVE JUDGE, ST. LOUIS COUNTY FAMILY COURT; CIRCUIT COURT JUDGE, DIVISION 11 Ellen Levy always loved to read, talk and argue, which was a plus on the debate team at Ladue High. But it wasn’t until she was an undergrad at Washington University that everything came together. As president of the student congress and a student rep to the board of trustees, she met Whitney Harris, who had served as a prosecutor at the Nuremberg trials. “I got to go over parts of the trial transcripts with the man who helped prosecute Nazi war criminals, including Hermann Goring and Rudolph Hoess,” Siwak recalls, still awestruck by the memory. “He made history and the law come alive. The more we worked together, the more I thought, What a great job! This is for me!” Siwak was a trial attorney before taking the bench, but knew she wanted to be a judge. “There’s no better way to make sure people get access to justice,” she says. After being appointed a family court commissioner in 1999 by the ELLEN LEVY SIWAK 33 sitting St. Louis County judges, she was named associate circuit court judge by Gov. Bob Holden in 2002, and Circuit Court Judge by Gov. Matt Blunt in 2008. Siwak presides over cases in the family, civil, criminal and equity divisions. Married 23 years to marketing exec Jeff Siwak, she seldom talks about cases at home. Despite her packed schedule, she still finds time to be her 18-year-old daughter’s Girl Scout troop leader and her 11-year-old son’s room mother. To unwind, she makes jewelry. The only biological child of five siblings, she credits her now-divorced parents, Dr. Jerome Levy, a retired surgeon, and Marilyn Schlitter, a teacher and social worker, with her strong desire to make a difference “They urged me to follow my passion, and that’s what I wish for my kids—and for every troubled young person who comes before me in juvenile court.”

SCOTT ROSENBLUM

24 |

TOWN&style

|

JUNE 26, 2013

N. SCOTT ROSENBLUM, ROSENBLUM, SCHWARTZ, ROGERS & GLASS The defense eventually rests, but Scott Rosenblum doesn’t. “I have no hobbies,” he says. “I don’t play golf. I don’t travel. Other than being with my kids whenever I can, I have no downtime. I’m obsessed with what I do. I love being in front of a jury.” It shows. Rosenblum, among the area’s top criminal defense attorneys, exudes confidence—some might say arrogance—in the courtroom. He’s been praised and damned for blistering cross-examinations that leave witnesses wishing they’d worn Depends. In 30 years of practicing law he’s made his share of headlines, defending famous athletes and prominent business leaders. “The high-profile cases get all the publicity, but every case is equally important to me— because it’s important to my client.” His competitive nature shines in even the most casual conversation. As a kid, he wanted to be a great baseball player. He quit the game when he realized he’d never be the best. Luckily, an attorney uncle steered him toward law. He worked his way through school as a bartender, and scorns the trend toward ‘mixologists’ and their sugary concoctions. “Give me a scotch and water any day.” Rosenblum is divorced, but he and his ex still spend time as a family with their kids: a set of triplets (two boys and a girl), 22, and a 17-year-old son. “I love going to a ballgame or dinner with them, or just hanging out,” he says. Any future lawyers in the clan? “Yeah, a couple—heaven help ‘em.”

DUDLEY MCCARTER

W. DUDLEY McCARTER, BEHR, McCARTER & POTTER Growing up in Glasgow Village, Dudley McCarter daydreamed about joining the FBI. “I never missed The Untouchables—Eliot Ness was my hero,” he recalls. “Somewhere along the line, I heard you had to be a lawyer or accountant to join the FBI. So the idea of going to law school stuck with me.” Despite a conspicuous lack of crime-busting shootouts, McCarter’s legal career has its satisfactions. He is a founding partner at Behr, McCarter & Potter, a Clayton-based civil litigation firm that routinely makes U.S. News and World Report’s ‘best firms’ and ‘best lawyers’ lists. He has gathered an armload of awards over the years, as have his partners and associates. But BM&P also is known for its commitment to community service. “If you have any ability at all to help people, you owe it to them, and to yourself, to do so,” he says. “My parents instilled that in me.” McCarter and his wife, Elizabeth, also an attorney, have three daughters. A graduate of University of Missouri School of Law, he’s an officer in the alumni association and actively recruits prospective students. He doesn’t sugarcoat his advice: “The days of graduating and having a good job immediately drop into your lap are long gone, and might never come back,” he says. “But if you work hard and are open to taking a job in a related field where you won’t actually be practicing law, such as human resources, you can still earn a good living.” Like Eliot Ness in The Untouchables, McCarter believes in justice. “I love fighting for my clients in the courtroom,” he says. “The most satisfying moment is when the jury agrees to the verdict you’ve asked for—and your client cries tears of joy. There’s nothing like presenting a good case on behalf of someone who’s counting on you.”


TOWN TALK

PDI InvestIgatIons, Inc. National & International Investigative Agency

» » » » »

Domestic / civil / criminal Investigations computer Forensic Investigations Background Investigations corporate Investigations Insurance Investigations

COVER STORY

HAIS, HAIS, GOLDBERGER & LAMBSON]

by tony di martino

AT MANY LAW FIRMS, success is measured by the number of billable hours racked up by partners and associates. Sam and Susan Hais, of Hais, Hais, Goldberger & Lambson, have a slightly different perspective. “Fortunately, the firm has enjoyed its share of material success over the last 30-plus years, but we tend to rate our achievements based on the gratitude of our clients,” Sam says. Not long ago, a client called the Hais home on a Friday night. “I’d represented her in a divorce years ago and hadn’t seen her in a long time,” Susan recalls. “She said, ‘You helped me through one of the worst ordeals in my life. You told me things were going to get better—and thanks to you, they did.’ The next day, she sent me a huge fruit basket.” Other times, plaudits come in the form of an invitation. “Last month, a client asked me to her son’s high school graduation,” Susan says. “She told me the custody and child support agreements we worked out for her gave her the best possible foundation as a single mother and enabled her son to get a good start in life, academically and socially.” Another grateful client sends a picture of his daughter every year on the girl’s birthday, with a note: If not for you, I wouldn’t have so much time with her. “I fought hard to make sure he got a good custody deal,” Susan recalls. For the Haises, nothing is more satisfying than contributing to a family’s well-being. “What matters most is the opportunity to make a meaningful impact on people’s lives,” says Sam, who was a family court judge before joining his spouse’s law firm in 2002. Success is not accidental and doesn’t come easily, he adds. “Domestic law is specific and complex. It takes preparation, hard work and dedication to make sure your client gets the best SAM HAIS PHOTO BY CHARLES BARNES deal. Knowledge and experience count, and our firm has both.” It’s all about relationships, Susan says. “When I talk to a client, I don’t look at my watch. I’m here to solve their problems, and I don’t give up until I do. We make sure they get what they need, including more time with their children and enough money to take care of them and start a new life.” She even gets referrals from the opposition. “There’s no greater compliment than to hear, I wish you had been my lawyer, from someone you fought against in court.” Recently, a client came to her in tears. “His wife is trying to limit his custody,” Susan explains. “I told him, ‘Don’t worry. I’ll deal with this. We’ll fight it together.’ He looked at me and said, ‘Bless you.’ Fighting injustice and winning—there’s no better yardstick for success.”

FRee consultatIon 24 hour live operators standing by

314-957-9157

clayton corporate Headquarters

314-863-9225

pdi-web.com | emaIl: pdi1@pdi-web.com mo. state agency lIcense #201 000 9142

MIX IT UP! This summer we’re hosting

7on 7

M ik k i’s Ma t c he s

private singles mixers with drinks & appetizers.

Events arranged & based on registrations received.

Designed to match singles with similar interests and goals, you are sure to make new friends or maybe even meet that Special Someone!

at

Get more info & register:

bistro1130.com event dates to be announced

as heard on

1380AM the Woman will follow Mikki’s Matches on a date live on air! CAll for dEtAils

636-394-1130 ~ 1130 Town & Country Crossing Drive 63017

WE ARE...

the only law firm

your family will ever need.

Joan A. Coulter

|

C. Curran Coulter II

Our expanded firm now practices in the areas of: Dissolution of Marriage Paternity Actions u Motions to Modify u Child Support u u

Estate Planning and Wills u Bankruptcy u Traffic Violations u

THE

Coulter Law Firm Legal Expertise. Personalized Results.

LLC

314-721-1116 HAIS, HAIS, GOLDBERGER & LAMBSON IS LOCATED AT 222 S. CENTRAL AVE., STE. 600. PICTURED ON THE COVER: SAM AND SUSAN HAIS. FOR MORE INFORMATION, CALL 314.862.1300, OR VISIT HHGC-LAW.COM. COVER DESIGN BY GAYLE VANDYKE | COVER PHOTO COURTESY OF HHG&L

8000 Maryland Avenue | Suite 1060 | St. Louis 63105 The choice of a lawyer is an important decision and should not be based solely upon advertisements.

JUNE 26, 2013

|

townandstyle.com

| 25


“I can start in the fitness room, spend some time at the pool and end the day at game night.” – Shirley A., Sunset Hills resident

Dance, work out, laugh, learn, reflect, play cards, volunteer, garden, do whatever you want to do. And, do it at Friendship Village with the knowledge that your costs are known and predictable, even for health care. LifeCare,™ exclusive to Friendship Village, assures unlimited days of assisted living and skilled nursing on site—if needed. That means quality care at a known cost and at a substantial savings over other health care options. Adding new apartments, villas and underground parking this year, the notfor-profit Friendship Villages benefit from management by a local board of directors. Come visit a more brilliant, affordable alternative in senior living.

Call or visit today! www.FriendshipVillageSTL.com CHESTERFIELD

15201 Olive Boulevard Chesterfield, MO 63017

www.FriendshipVillageSTL.com/Chesterfield

(636) 525-1455

SUNSET HILLS

12503 Village Circle Drive Sunset Hills, MO 63127

www.FriendshipVillageSTL.com/SunsetHills

(314) 499-2059

TS6263

26 |

TOWN&style

|

JUNE 26, 2013

PHOTO BY COLIN MILLER OF STRAUSS PEYTON

Life with certainty— that’s life more brilliant!

THE VELVET

HAMMER by joan berkman

Q: RECENTLY, I’VE INTERVIEWED WITH A NUMBER OF PROSPECTIVE EMPLOYERS WHO ALL TELL ME I AM WELL- QUALIFIED AND HAVE EXCELLENT CREDENTIALS; HOWEVER, JUST WHEN I THINK I’M GOING TO GET AN OFFER, SOMEONE ELSE GETS IT INSTEAD. I’M SENSING SOME SORT OF DISCONNECT. WHAT MIGHT I BE DOING WRONG? ——Can’t seem to make the final cut in Florissant A: Could it be you’re overplaying your hand or not adhering to the fundamentals of good interview technique and etiquette? Each interview is certainly a unique encounter, where the venue, the recruiter or the substance of the discussion may differ, but it’s important to consistently employ proper interview techniques to create a favorable and lasting impression. Executing consistently in this regard ensures you are not ‘striking out’ strictly on that score alone. The following is a list of questions you might ask yourself after each interview to help gauge the subtler aspects: Were you self-confident without being arrogant? Were you appropriately dressed for the interview? Did you project a positive, can-do attitude? If you were asked to address any shortcomings in your background, education or work history, did your explanation make sense? Keep in mind that many interviewers listen carefully not only to what you say, but how you say it. Finally, did you send the interviewer a personal ‘Thank You’ note afterward? Such follow-up demonstrates thoughtfulness and sincerity in wanting the job. Nonetheless, you can do everything right and still not get the job. But, try to remember the old saying: “There’s a lid for every pot.” So, don’t give up. Keep interviewing; you should only get better at it. Q: I’M SINGLE AND WAS LOOKING FORWARD TO SPENDING THE FOURTH OF JULY HOLIDAY WITH FAMILY AND FRIENDS. BUT, LIKE LAST YEAR, I HAVE BEEN ASKED TO MANAGE THE OFFICE TO HELP OUT MARRIED COLLEAGUES. I FEEL I DESERVE TO ENJOY TIME WITH MY FAMILY AND FRIENDS TOO. YOUR ADVICE, PLEASE. ——Being singled out for the wrong reasons A: It’s unfair that singles should yield to married co-workers when it comes to holiday time off. A more equitable way to avoid disputes— assuming the boss is agreeable—would be to establish a ‘Holiday Work Rotation Schedule.’ Whether by seniority or by drawing lots—each co-worker would select a holiday, subject to availability and their place in line. After everyone’s initial choice is made, colleagues could then freely and fairly swap holidays with others willing to do the same. The boss should be kept informed of all changes to the holiday schedule to ensure everyone is on the same page and the office is appropriately staffed. This is one way you might keep your independence and avoid any fireworks this coming holiday. Happy Fourth of July! IF YOU HAVE A QUESTION FOR JOAN, SEND IT TO BUSINESS@TOWNANDSTYLE.COM. JOAN LEE BERKMAN IS A MARKETING AND PUBLIC RELATIONS CONSULTANT.


PHOTO ALBUM

SHE SAID

[ wedding party ] MAID OF HONOR | Jill Texier BEST MAN | Jeff Orbin USHERS | Matthew Texier, Cory Texier, Christopher Texier BRIDE’S PARENTS | Tom & Sue Texier GROOM’S PARENTS | Steven & Marilyn Teitelbaum RING BEARERS | Leo and Sam Wallace

[ resources ] CATERER | Herbie’s Vintage 72 PHOTOGRAPHER | Olga Gow

by rebecca koenig

[YES!

AFTER FALLING IN LOVE with longtime friend Marci Texier last year, Aaron Teitelbaum, the chef at Herbie’s Vintage 72, is preparing their wedding for Sept. 14. Having studied at the Culinary Institute of America in New York and worked for chefs Bobby Flay and Daniel Boulud, Aaron returned to his native St. Louis 10 years ago to help open Monarch and Herbie’s. He struck up a friendship with Marci, a St. Louis County occupational therapist, in 2005. “About nine months ago, we were finally at the point where we were both single and interested in each other,” Aaron says. “We went out on our first date, and within two weeks I knew she was the woman for me.” Their friends were surprised they had taken so long to get together. “The greatest thing in the world is that everyone is so excited,” he says. “They believed we were perfect for each other.” Although they had discussed marriage, Aaron caught Marci off-guard with his proposal on March 27. “Little surprises are what I love to do,” he says. He planned a spa day for her at the Four Seasons, then hid the ring in her hotel room. They celebrated her acceptance with a dinner at Cielo. Six months is not very long to plan a wedding, but the couple didn’t want to wait. “We wanted to not have a long engagement because we’re ready to start our lives together, and start a family,” Aaron explains. “I’m 39, and we both waited until we found the person who was right for us. When that happens, it moves a little bit quicker.”

PHOTO BY GEORGE EICHELBERGER

Knowing who to use for catering helped speed the planning process: Herbie’s will provide the food for the reception, which will be at Monarch event space. “The meal will be a marriage between the food here at Herbie’s and some of our favorite dishes,” Aaron says. “It is exciting for me to be able to do it. Monarch is what brought me back to St. Louis, and I never would have met Marci if I hadn’t moved back. Herbie’s is our second home.” Marci’s childhood priest, Father Carl J. Scheble of Our Lady of Lourdes Parish, and Aaron’s family friend Mike Wolff, dean of Saint Louis University Law School, will officiate the ceremony in the Bank of America pavilion at The Muny.

Stay cool

Hot Deal!

with hot dealS

Made In

America TM

All-American

Sale 1499 $

2013 7’ Tarzan

With Rocket Slide

Hot Deal!

Reg: $2299

2012 6’ Tarzan

< Shown w/Optional Custom Pole Pad (not included)

With Alpine Slide

WoW!

< limited Supply >

2012 5’ Tarzan With Wave Slide

Sale $3999 Sale 2699 $

SuppoSinreStS

Small Bu

Buy local!

Sale 3199 $

Reg: $4799

Do your research, read the reviews, shop the big box stores, shop the corporate super store,

Reg: 5999 $

Reg: $7699

SWing by today

Sale ends Sunday, June 30, 2013

then come to dream Play recreation!

Unmatched QUality • dUrability • Safety • long-term ValUe • SerVice

17373 Edison AvE. • ChEstErfiEld, Mo • 636.530.0055 • 800.962.0055 • drEAMPlAyrEC.CoM | townandstyle.com | 27 JUNE 26, 2013


2|

4|

1|

5|

[SNAPPED!] THE FOUNDATION FOR

3|

BARNES-JEWISH HOSPITAL by margaret rambo

WHAT | Illumination Gala WHERE | Ritz-Carlton WHEN | April 20 WHY | To benefit the Alvin J. Siteman Cancer Center in its lifesaving

6|

7|

8|

work on cancer cures WHO | Co-chairs Ron Kruszewski and Craig Schnuck, president Rich and Stacey Liekweg, Dr. Tim and Kim Eberlein, Melissa and George Paz, Stacey and Jim Weddle, Keith and Nancy Alper, Goldfarb School of Nursing dean Dr. Michael Bleich, ACW Alliance, Stifel and other sponsors, 630 guests HIGHLIGHTS | Performances by special guest Steve Martin & The Steep Canyon Rangers, luxury auction, Fund-A-Cure, and an elegant dinner

9|

10 |

11 |

14 |

15 |

12 |

13 |

16 |

17 |

18 |

1| STACEY AND RICH LIEKWEG 2| RON KRUSZEWSKI, TIFFANY BUCHHOLZ 3| DR. TIM AND KIM EBERLEIN 4| HARVEY AND JUDY HARRIS 5| NANCY AND KEITH ALPER 6| WARNER AND CINDY BAXTER 7| SUSAN WELC, JOYCE ROMINE, JULIA RUVELSON 8| GENE DWIGGINS, DR. MICHAEL BLEICH 9| SUZIE AND ASHLEY NICHOLS 10| HENRY AND SUSAN WARSHAW 11| MOLLY AND SCOTT BOHANNON 12| TRACY AND TIM ZALESKI 13| KEN AND SHAWN SUELTHAUS; SUSAN AND RICK SULLIVAN 14| JIM AND STACEY WEDDLE 15| DENNY AND SARAH SCHOEMEHL 16| KEVIN AND ANNE MCCORMACK 17| CRAIG AND NANCY SCHNUCK 18| MARY AND HANK SLAY <<< GO TO TOWNANDSTYLE.COM TO SEE MORE [ SNAPPED! ] >>> 28 |

TOWN&style

|

JUNE 26, 2013


PHOTO ALBUM

cookout for a cause at the solana

West county.

All proceeds benefit the Alzheimer’s Association

1|

Join us on July 10 as we “Cookout for a Cause” at The Solana West County. Enjoy traditional cookout fare and we’ll forward your donation to the Alzheimer’s Association. It promises to be a lot of fun and a great way to experience the service and hospitality that make The Solana West County such an exceptional place to live.

2|

[SNAPPED!] NURSES FOR NEWBORNS

Wednesday, July 10 11:30 a.m. to 1:30 p.m.

by margaret rambo

donations to the

WHAT | A Night for Newborns Dinner Auction WHERE | Hilton St. Louis Frontenac WHEN | April 21 WHY | To support NFNF in its multiple services, including parenting skills training and home visits that serve as a safety net for families with newborns. The ultimate goal is to help babies receive a healthy, secure start in life. WHO | CEO Melinda Ohlemiller; auction chairs Barbara Druhe, Fran Marks and Gloria Wind; Claire and John Devoto; Sherry Moschner, Alex Fees, Erin Roesemeier, Eileen Hamburg, Jen and David Meyer HIGHLIGHTS | Presentation of the McGraw Milhaven Award to Tom and Suzanne Hough; an elegant raffle and loyal supporters for precious infants.

alzheimer’s association accepted.

RESERVATIONS: CALL RAY AT (636) 527-5700

3| Assisted Living • Alzheimer’s & Dementia Care 785 Henry Avenue, Ballwin, MO 63011 • (636) 527-5700 • brookdale.com ALL THE PLACES LIFE CAN GO is a Trade Mark of Brookdale Senior Living Inc., Nashville, TN, USA. ® Reg. U.S. Patent and TM Office. 18760-ROP01-0713 LMM

Exciting Summer Pops Concerts by the Compton Heights Band!

Purser Center Auditorium

4|

6|

5|

Logan Chiropractic College The Compton Heights Concert Band’s NEW Indoor concert series every Sunday in July!

Guest Artists #1—Sunday, July 7, 2013 7:30 PM

The Canadian Brass Returns!

#2— Sunday, July 14 7:30 PM

Sigrun Hjalmtysdottir (Diddú), Soprano

7|

9|

8|

The Icelandic Storm! Fan Favorite!

#3 — Sunday, July 21, 2013 7:30 PM Buckwheat Zydeco, Creole Dance Music 6 Piece Band!

#4 — Sunday, July 28, 2013 7:30 PM St. Louis’ Lindsay Garritson, Pianist Van Cliburn International Piano

Competition Final 30, Ft. Worth 2013!

10 |

11 |

1| FRAN MARKS, ROBERT HUGHES, SHARON ROHRBACH 2| SUZANNE AND TOM HOUGH 3| JENNIFER LYONS 4| MIKE MARKS, MELINDA OHLEMILLER, JOHN DRUHE 5| CLAIRE AND JOHN DEVOTO 6| ZOEY AND JENNIFER DURHAM 7| MCGRAW MILHAVEN, PEGGY RASP 8| DAVID AND JEN MEYER 9| JENNY MARKS, DANIEL AND BARBARA MARKS 10| AARON AND JENNIFER CROWELL, CATHY AND JOE FEDERER 11| PAUL AND KORA FELSCH, STEPHANIE AND KYLE ATTARIAN

<<< GO TO TOWNANDSTYLE.COM TO SEE MORE [ SNAPPED! ] >>>

Tickets: $25 $35 $45 and Gold Patron $75

Gold Patrons — Best Seats, Box Lunch, and Drink Group & Season Subscription Discounts Available!

(314) 776-2263 (314) PRO-BAND www.chband.org JUNE 26, 2013

|

townandstyle.com

| 29


1| 1|

2|

2|

3|

[SNAPPED!] FOSTER & ADOPTIVE 3|

CARE COALITION

4|

ST. LOUIS PSYCHOANALYTIC INSTITUTE by margaret rambo

by margaret rambo

4|

WHAT | Seventh Annual Old Bags Party WHERE | Frontenac Hilton Hotel WHEN | April 30 WHY | To help support adoption programs that provide forever families for thousands of children waiting in the foster care system, including crisis intervention, educational services and support groups WHO | Executive director Melanie Scheetz, board president Jane Dueker, Melody Noel, Barbara Bell, Rhonda Hamm-Niebruegge, Holly Demerath, Lisa Foehner, The Lueken Group, and committee members HIGHLIGHTS | Guests enjoyed a special evening of girlfriends, designer handbag shopping, delectable bites, Lake Forest chocolates and signature drinks. Prada raffle winner was Mary Lambert. Jordan Williams won her $3,000 bid for the Louis Vuitton hobo bag. Julie Tristan and Coreen Savitski of Show Me St. Louis served as emcees.

WHAT | Fifth Annual Spring Fling: Uncorked! WHERE | Busch Family Mansion at Grant’s Farm WHEN | April 24 WHY | To enjoy great friends, exquisite wines and support the Institute’s child programs WHO | Dr. Lynne Moritz, Curt and Robin Engler, Bill DeWolf of Edward Jones, Jay Thomeczak of Macy’s, Dr. Robin Turner, Paul Wentzien, Janine Lawler, Earl and Becky Weaver, staff, sponsors and distinguished guests. HIGHLIGHTS | Children, representing various schools, performed violin music directed by Ed Sprunger, and Dr. Moritz explained the Institute’s work with childen

5|

5|

6|

6|

9|

7|

8|

10 |

11 |

1| PAUL AND K WENTZIEN 2| NANCY HAWES, DON ALTVATER 3| DR. MOISY SHOPPER 4| FRONT: LYNN KAUFMAN, BOBBIE LAND, BECKY DAVID; BACK: CATHY KRANE, JANINE LAWLER, CECILIA MCGLONE, BRENNA MEDLIN 5| DR. ANDY CHIRCHIRILLO 6| MICHAEL AND SUSAN KIME 7| DR. STEVE AND JULIE PLAX 8| CURT ENGLER, NANCY GULICK 9| DR. TRISH AND JOHN SALEEBY 10| CHUCK AND BOO COOK 11| BILL DEWOLF, JAY THOMECZAK 30 |

TOWN&style

|

JUNE 26, 2013

9|

12 |

7|

10 |

8|

11 |

13 |

14 |

1|KATIE SHETH,JENNY REID 2|MELODY NOEL,MELANIE SCHEETZ 3|ALDERWOMAN DONNA BARINGER,JENNIFER LUEKEN DELF, KATHY BENOIST 4| JORDAN WILLIAMS 5| MARY LAMBERT, PRADA RAFFLE WINNER 6| JULIE TRISTAN, COREEN SAVITSKI 7| BARBARA BELL, LAURA LUEKEN 8| CONNIE LOHR 9| HOLLY DEMERATH, SHERRIE DUNAWAY 10| MARY PEEK, MARCIA AMBROSE 11| DIANE JOHNSON, ANN GRANQUIST, STACEY CROWDER 12| HEATHER HAGLER, CHRISTINE RONKEN 13| KELLY RADER, KAREN TUCKER, MEG RADER, JENNIFER PHILLIPS 14| RHONDA HAMM-NIEBRUEGGE, SANDY SALLY <<< GO TO TOWNANDSTYLE.COM TO SEE MORE [ SNAPPED! ] >>>


STYLE

STORE FRONT

[ADVERTISE] TO LEARN MORE ABOUT HOW TO PROMOTE YOUR BUSINESS IN ST. LOUIS’ HOTTEST NEW PUBLICATION

>> a peek into the windows of the st. louis retail world

GO ONLINE TOWNANDSTYLE.COM AND CLICK [ADVERTISE] | IT’S THE TALK OF OUR TOWN |

by rebecca koenig CWE COMINGS AND GOINGS

Upscale athletic clothes purveyor Lululemon is opening a location on Euclid Avenue at Maryland Plaza in retail spaces formerly occupied by K. Hall Studio (28 N. Euclid Ave.) and Moris Fashions (26 N. Euclid Ave.). K. Hall Studio has opened a pop-up shop in Plaza Frontenac, where its locally made scented bath, body and home products will be available for at least three months. Moris plans to close June 14 and reopen two days later up the street at 226 N. Euclid Ave.

BREAK A SWEAT

FitShop, a new activewear clothing boutique, has opened at 14430 Clayton Road in Ballwin Grove Shopping Plaza. It specializes in workout wear for men and women.

HIP HYBRIDS

Chocolate beverages, haircuts and acoustic concerts in the same space? Why not! Sip Salon at 7818 Forsyth Blvd. in Clayton offers all three, plus a lunch menu. The salon is enclosed by a cafe area serving coffee, beer, wine, vegetarian pizzas and baked goods. Local art is on display, and Friday and Saturday nights bring singer-songwriters to play unplugged in the corridor.

Art Saint Louis and Mississippi Mud Coffee Roasters are joining forces to open a new gallerycafe in the Park Pacific building at 1223 Pine St. The space will feature comfortable seating, free Wi-Fi and changing exhibits. Renovation is projected to be finished in July.

BUILDING BLOCKS

The new Lego store in West County Center in Des Peres celebrated its grand opening in May with the construction of an 8-foot-tall model of the Hulk. The shop features an interactive play area, display models and a pick-a-brick wall, which allows customers to select specific Lego pieces.

I’M A PC

Microsoft celebrated the grand opening of its store in the Saint Louis Galleria June 7 with a concert featuring R&B artist Ne-Yo.

121 Hunter Ave | Suite 201

314.657.2100

townandstyle.com

Mister Guy Women’s announces JUNE 27TH, 28TH AND 29TH. Our most stunning trunk show pairing ever: The sculptural elegance of Algo... Detailed jackets, shirts, and cardigans presented in your design. Choose your colors, fabrics and styles from a collection of never-beforeseen opulence. A St. Louis exclusive.

ZOOMING INTO TOWN

Tri-Star Imports, the Ellisville Mercedes-Benz dealer, broke ground on a new facility May 21 at the corner of Hwy. 40 and Hampton Avenue, the previous location of KTVI Fox 2. Mayor Francis Slay attended the ceremony.

9817 Clayton Road St. Louis 63124 | 314 991 5262 MisterGuyClothiers.com

JUNE 26, 2013

|

townandstyle.com

| 31


SUMMER!

WHERE]

WHAT TO WEAR… by ellen nisenson soule

9810 Clayton Road St. Louis 63124 314 -997- 6161

[ WHAT ARE YOU WEARING TO OUTDOOR EVENTS?

Monday –Saturday 10 am – 5 pm PinkMagnoliaShop.com HaSSle-free lillyPulitzer.com returnS

❝She’s like a porcelain doll. She sets me on fire.❞

Lieutenant Benjamin Franklin Pinkerton

St. Louis offers The Muny, evening concerts at the History Museum and Missouri Botanical Garden, Opera Theatre picnics and much more under the stars. For what to wear there, designers are showing a variety of looks, from short to long, sleeveless little tops to blousy tunics. And make sure you have a go-to pair of white jeans or pants in your closet. WHAT GOES AROUND

Experience the fire and passion of

Vintage looks, a la Zooey Deschanel and the Olsen twins, can be flirty in long or short lengths and in colors reminiscent of decades past, such as lemon zest, emerald and turquoise. They look fresh and individual at festivals, concerts or a backyard barbecue. The hottest colors this season are emerald green, yellow and blue. When in doubt, reach for your black-and-white color combination and just accent with a brightly colored accessory.

MADAMA BUTTERFLY July 12, 13, 19, 20 — 8 p.m.

Tickets: unionavenueopera.org (314) 361-2881

THE LONG AND SHORT OF IT

The Maxi Dress is a one-piece wonder, very versatile and ‘casually glamorous.’ You can find a style, color, pattern, neckline and waistline right for you. And it’s an ideal silhouette for any summer occasion—but you have to be OK with fabric down to the floor during our hot, humid summers. Shorts can be a great alternative to pants, jeans and skirts. They are now accepted in ‘dressy’ versions, and for women with great legs, these can look quite au courante with a blazer, tunic or even a shear dress.

Inspired Style

1164 Town & Country Crossing 636.227.2634

14444 Clayton Road 636.220.7200

Salon & Boutique

SAKS FIFTH AVENUE

SEI BELLA

SAKS FIFTH AVENUE

CODI

the boutique

SAKS FIFTH AVENUE

now available at two locations

ELLEN SOULE IS A PUBLIC RELATIONS EXPERT. SHE FORMERLY WORKED AS THE NEIMAN MARCUS PUBLIC RELATIONS MANAGER IN ST. LOUIS AND AS THE DANA BUCHMAN REGIONAL CONSULTANT.

32 |

TOWN&style

|

JUNE 26, 2013

PHOTO COURTESY OF KAYOSSDESIGNS.COM

PRINTS, FLORALS AND OTHER PATTERNS

These are everywhere this summer in apparel and accessories. The brave will mix patterns in both the top and bottom of an outfit. If you’re not sure how to mix, go the safe route and incorporate a solid item with your statement piece. Patterned pants are still a trend and can easily be worn with a monochromatic top. Graphic prints should definitely be on your list. Try them in a tunic silhouette with shorts or a skinny pant. And florals this time of year are classic. The variety is endless! Another good classic is the nautical look, especially horizontal stripes worn with continental accessories, like a large straw hat and rattan evening bag and a pretty, open-toe sandal or wedge.


STYLE

Oh say, can you see how cute you’ll be? vA •A

Show your patriotic spirit with this Nally and Millie flag top, $70

ilABle A t

151 West Jefferson Avenue | Kirkwood 63122 | 821-4646 GingerAndMaryAnnBoutique.com Like us

on Facebook and see what fun is on tap each week!

Mister Guy Women’s announces

RUNGOLEE

JUNE 27TH, 28TH AND 29TH. Our most stunning trunk show pairing ever: The European euphoria of Bessi...

PHOTO COURTESY OF RUNGOLEE.COM

Prints and patterns which inspire and allure. KAYOSS

[ tricks of the trade ] Q: Q: AFTER WEARING HEELS ALL DAY, WHAT DO YOU RECOMMEND FOR A COMFORTABLE, CASUAL LOOK? A: Flip-flops have made a fashion statement of their own, from high-end designers to low cost. Check out Kate Spade, Cole Haan, or your local discount store like Target, J.C. Penney or T.J. Maxx for a wide variety of styles and colors. Remember to paint your toes with a primary or pastel color—or even white!

Q: SINCE JULY IS TRADITIONALLY A BIG SALE MONTH WITH DEEP DISCOUNTS, WHAT ARE SOME GOOD SHOPPING TIPS TO KEEP IN MIND? A: Make a list in advance of what would be smart choices to buy. This way you are not just buying because it’s on sale. For instance, this is a great time to purchase white shirts (cotton and knit) that can be worn year-round. Plus, white shirts don’t last forever (spots, pilling, graying). Other items to consider are white or colored jeans, a great top to wear with jeans, and a current spring/summer trend that you didn’t already buy that would update your wardrobe.

A palette of color that only Bessi could evoke. A St. Louis exclusive.

9817 Clayton Road St. Louis 63124 | 314 991 5262 MisterGuyClothiers.com

JUNE 26, 2013

|

townandstyle.com

| 33


se sp e

lux beaeciainlside ury u sectfoior th po ty & ns e rtfo lio

AUGUST 22, 2012

PRESENTED BY

BENEFITING

OCTOBER 6 & 7, 2012

SITEMAN CANCER CENTER & ST. LOUIS CHILDREN’S HOSPITAL

&

� � AS SEEN IN

&

� � AS SEEN IN

august 22, 2012

h a r t] & C i t e CoSrm UCtiVe SUrGery CoVer Story

reConSt

ood, rn, mph by mary jo blackw Sm et iC G y U Se D b y Co n eW te Ch n o lo lU ti o n iZ in G the ability to o SU r G eo n S iS r eV clients. “BodyTite, a

e and body to many restore a youthful fac rs in Israel, uses m developed by docto or atf pl t en um str in iam Hart of multiuefy fat,” says Dr. Will liq to gy er en cy en qu te. The fat radiofre ctive Surgery Institu tru ns co Re d an ic et erized to Hart Cosm blood vessels are caut e th d an t, ou ed on e tissue is then sucti htens both connectiv tig s es oc pr he “T g. reduce bruisin en those who have that many people, ev and skin to the degree ss skin removed,” he fat, don’t need exce lost a great deal of move fat from the that don’t actually re ts uc od pr r he Ot . ys sa fat circulates in because the liquefied ll, we as rk wo n’t do ds. body get redeposited, he ad ay m d an m n ea str rio od ma but still have the blo ph ot o by jo el ar their best weight ne or at ed liz bi sta o are ter thigh pads, te are individuals wh familial inner or ou , Ti dy les nd Bo r ha fo e s lov ate y, id nc egna s, can yield “The best cand ly on the upper arm the abdomen after pr lar in s cu sit rti po pa de s, es fat oc as pr tening n garments problem areas, such rt says. The skin-tigh leaves in compressio nt Ha ,” tie es pa ttl e th wa ic; ck et ne th anes n of nonheavy upper arms or the office under local e the next generatio in tit ne dy do Bo is e er ur id ed ns oc co pr “I e in 24 to 48 hours. dramatic results. Th n-strenuous activity no al, rm no lutionary. e m su re to the Erbium Yag and can olutionary than revo ev e or m es effects are comparable vic he de “T ng e. ni te fac e gh th -ti at in sk tre e or redness with used to excisional there is little downtim ure, Fractora Firm, is is, ed rm oc de pr te ep Ti de dy e th Bo r ore on Anothe s and capillaries. cy energy focuses m t delicate facial vein en os qu m e re of th di en ra ev e at us ca tre the face, giving can laser, but be different instrument place atrophied fat in re A . y ys he sa “T rt h. Ha ut yo g,” in of rs rm a month or two. contou comparable fi ould be approved in y to restore the firm sh wa r ich he wh ot a, an e m ar lu rs Vo lle is on Dark circles Injectable fi t up to three years.” ains. New on the horiz las pl ex ld rt ou sh Ha , ,” es ift ey e-l e th fac y. “A special d around the client a liquid ed for eyelid surger r that, when injecte ne e lle fi th c ni ng ro ati in alu m hy eli g ing or e,” he adds. “It’s a longer-lastin , reducing downtim tifully, often postpon in au sk be ate d lic on de sp e re th lly to under the eyes usua trauma and bruising t the filler prevents jec in to e always ing lost cheek mass. us we e ur proced terventions. “We’re in filling, such as rebuild l er ica ep rg de su r nfo no ed e us or is ll, surgeries, no down d look can expect m Another filler, Artefi sive manner no risky s seeking a revitalize va nt in tie st pa lea e, e m th co in to ts s en In year enation for cli ovide effective rejuv looking for ways to pr rt says. time and no pain,” Ha

Hart Cosmetic & Reconstructive Surgery Institute 314.251.6250 | hartmd.com 34 |

TOWN&style

|

JUNE 26, 2013


HEALTH FRONTIERS] [ SPECIAL SECTION

GCACGTGACGCACCGGTAATATCGCCGGTCTAATACAC GAGGTATACGCAATAGCACTGATGCCGGTAATTCGCCG GTGCACCGTGAATAATAGCACTGAACCTGACGCCGGCA CGTGACGCCGGTCTAGCACTAGTAGGTGCGTAAT TC GCCGGTCTACCGTGAATATTCGATCTGAATACTGAACC GCGGCACCGTGTACGGGTCTCGGCATTCGGTAATTAC GCCGGTCTAACGCCGGTCTAGCAGTAATTCTTCGCCATC CACCGGTAATATCGCCGGTCTAATACACGCCGGTCTAGC AGTAATTCTTCGCCATCGTCTACCGTGAATATTCGCATAT CACCGGTAATATCGCCGGTCTAATACAC

Now, for the first time, cancer treatment can be selected based on an individual tumor’s genetic fingerprint.

Taking personalized medicine to the next level.

JUNE 26, 2013

|

townandstyle.com

| 35


Ce! s i r P esetregion loW in tH

for skin-revealing

summer! Virtually painless hair removal that offers results 5 times faster than any other device. You’ll gain ongoing results after each treatment that work for ALL skin tones or hair colors. S readers: Exclusive for T& *

e Half PrtiC 24 monitehds u n l im y laser hair full-bod tments removal trea

l Hair removal l IPL photo facial l Tattoo removal l Facials l Chemical peels l Body wraps l Waxing Call or stop in for your

Free consultation! 314.450.8361 511 south Hanley road Clayton 63105 Hairremoval-stlouis.com

*must mention offer when calling or at time of purchase. some restrictions may apply.

COVER STORY

WASHINGTON UNIVERSITY

by tony di martino TOMORROW’S MEDICINE IS HERE TODAY. New gene-sequencing technology developed by local researchers is helping physicians choose the most effective treatments for cancer patients. Genomics and Pathology Services at Washington University (GPS@WUSTL) now offers a test, the comprehensive cancer gene set, which identifies key mutations in cancerous tumors. “Thanks to this test, we can determine which drugs work best for each patient based on genetic profiles of their tumors,” says Dr. John Pfeifer, a clinical genomicist at GPS and professor of pathology and immunology at Washington University School of Medicine. “We can also rule out therapies that could be ineffective, thus reducing needless side effects and stress on patients and families.” The test, among the first of its kind in the United States, profiles mutations in 40plus genes commonly altered in cancers, including those of the blood, lung, brain, pancreas, skin and breast. “These mutations can reveal changes in a tumor’s cellular machinery that oncologists can exploit to fight the disease,” Pfeifer says. “For example, patients with a particular mutation can be treated with a chemotherapy drug that suppresses the mutation’s effects, improving chances for recovery.” GPS, established in 2011, is a collaboration between the genetics and pathology/ immunology departments at Washington University. The partnership has led to rapid technological advances. “The new test is an expansion of the 25-gene test we launched just last year,” Pfeifer says. Prior to these tests, most genes could be examined individually for mutations. But cancer is characterized by abnormalities in sets of genes, not single genes. “With the comprehensive cancer gene set, physicians can simultaneously examine the several dozen genes most likely to influence treatment of a patient’s tumor,” he says. “Multiple sequencing technology DR. JOHN PFEIFER substantially increases our chances of detecting critical mutations.” Sequencing multiple genes at once also saves precious time and is less expensive than sequencing them separately, he adds. Available to patients here and throughout the country, GPS is a reference lab, meaning that patients can’t order a test directly. “If you’re interested, have your oncologist contact us,” Pfeifer advises. The testing process, including rigorous interpretation of results and treatment recommendations, takes just a few weeks. The test is affordable, covered by most insurance plans, and GPS handles insurance preauthorization. Technology that once seemed like the stuff of science fiction is now saving lives. “GPS brings the promise of human genomics research directly to patient care,” Pfeifer says. “Scientists have discovered the range of mutations characteristic of many cancers, and the pharmaceutical industry is developing drugs targeted to specific mutations. This kind of personalized, effective treatment has always been the goal of genomic medicine.” The comprehensive cancer gene set, a true breakthrough for patients and doctors alike, puts GPS at the very forefront of personalized medicine. “And we’re just getting started,” he adds. “Down the road, this technology will continue to have a huge impact on how we treat and prevent disease.” PHOTO COURTESY OF WASHINGTON UNIVERSITY

get ready

FOR MORE INFORMATION, VISIT GPS.WUSTL.EDU. COVER DESIGN PROVIDED BY WASHINGTON UNIVERSITY

36 |

TOWN&style

|

JUNE 26, 2013


LoSe WeigHT and Make LifeSTyLe CHangeS to SuSTain youR ReSuLTS after dieting.

like mother...like daughter! Mother JANE | age 53 | lost 60lbs in 4 months†

Daughter MEGAN | age 32 | lost 40lbs in 3 months†

I started my weight loss program on November 7, 2012 after many attempts at other methods. This was the easiest I’ve tried with the greatest success. I lost 60 pounds in less than 4 months and have maintained that for more than three months. I have lots of energy to play with my grandchildren now. My daughters have also had wonderful success with this program.

I have always exercised and been a runner, but had trouble losing weight. I started this diet on December 5, 2012 at 171 lbs. after watching my sister and mom’s success. By March 2013 I had reached my goal weight. My best half marathon time prior to the diet had been 2 hours and 20 minutes. I did the Go! St. Louis race in April 2013 and ran it in 1 hour and 59 minutes, my best time ever!

Visit our website to read more about Jane & Megan’s stories.

our four phase, medically developed weight loss program is a structured plan that can put an end to constant dieting. MORE: LEARN

our FREE* Semin atend ar JuLy 10th *RESERVATIONS REQUIRED. CALL TO RESERVE YOUR PLACE TODAY!

Theriac Health LLC

314-692-8013

16216 Baxter Road | Suite 325 | Chesterfield 63017 TheriacWeightLoss.com †Individual results may vary.

JUNE 26, 2013

|

townandstyle.com

| 37


CHECK OUT OUR UPCOMING HEALTH&BEAUTY SPECIAL SECTION:

HEALTH FOR WOMEN, BY WOMEN

JULY 17

[ FROM LOCAL LABS by mary konroy

Home to two major medical schools and a slew of top physicians and researchers, St. Louis is at the forefront of many medical innovations. Here’s news about advancements occurring right here that can improve your health and life.

[ testing tb vaccines ] Tuberculosis is not on most Americans’ radar, but it should be: 10 million Americans and one-third of the world’s population are infected. While there is a vaccine—Bacillus Calmette-Guérin, or BCG, created more than 90 years ago—drugresistant strains of TB are cropping up globally. “We have a lot of immigration from areas with high rates of TB infection,” says Dr. Daniel Hoft, director of the division of infectious diseases, allergy and immunology at Saint Louis University. Hoft is leading a SLU pilot study to expedite the testing of vaccines that target TB. Present efficacy trials are cumbersome, expensive and lengthy. “We’re trying to do something simpler and faster, with groups of 10 to 20 patients instead of thousands at a time,” Hoft says. Hoft hopes to develop a screening process to identify early vaccine performers. But he’s not testing a vaccine. He’s testing the testing process by conducting a challenge protocol to see if the body’s immune system will elicit a fighting response. The 20 participants in the trial will receive the BCG vaccine — “Not tuberculosis,” says Hoft. An open sore that drains or ‘sheds’ the BCG bacterium may result. “Any drainage coming from the sore means there is live BCG,” he says. Researchers will then use a number of tests to monitor BCG shedding and determine which one works best in measuring the body’s immune response.

[ new lens implant ] A new intraocular lens implant just approved by the FDA corrects astigmatism and dramatically improves vision across the board in patients undergoing cataract surgery. Patients have significantly improved near, intermediate and distance vision—often without having to resort to glasses. “And if glasses are worn, they are low-power readers, worn more for comfort than for need,” says Dr. Jay Pepose of Pepose Vision Institute. Pepose served as medical monitor for a clinical study of the recently approved Trulign Toric intraocular lens implant (IOL). Trulign is the first toric IOL that corrects astigmatism and improves vision across the natural range of focus. (Toric lenses have two different curves to correct astigmatism.) Crystalens, a popular non-toric IOL, also improves vision but doesn’t correct astigmatism. Both lenses were compared in the clinical trial, and patients with astigmatism who received the Trulign lens did better. “It’s revolutionary,” Pepose says. “It’s only been a few years since we’ve had any lens implant that corrects astigmatism. Now we have an IOL that corrects astigmatism and deals with age-related presbyopia (farsightedness), which occurs in every person over the age of 45.”

38 |

TOWN&style

|

JUNE 26, 2013


HEALTH&BEAUTY

[ cholesterol drugs & macular degeneration ] Cholesterol-lowering drugs used to treat atherosclerosis may be effective in treating macular degeneration, suggests a study conducted by Washington University researchers. “That’s because atherosclerosis, sometimes called hardening of the arteries, and macular degeneration, the leading cause of blindness in people 50-plus, share a common underlying condition: high cholesterol,” says the study’s senior investigator, Dr. Rajendra Apte. However, there’s no conclusive evidence that people already on cholesterol drugs derive protection against macular degeneration, says the professor of ophthalmology. “Based on our research, we think what’s going on throughout the body may be more important in atherosclerosis, and what’s really important in macular degeneration is what’s going on inside the eye itself.” In macular degeneration, cholesterol deposits are found in tissues deep below the retina. Apte and his associates zeroed in on macrophages, white blood cells that transport cholesterol and fat from tissues into the liver. Macrophages malfunction in macular degeneration. They have inadequate levels of a protein called ABCA1 to move cholesterol out of cells. But when researchers used an atherosclerotic drug that restored levels of the protein, they reversed macular degeneration in a mouse. “If we can take some existing drugs that modify or move cholesterol, and repurpose them for localized treatment of macular degeneration, such as through eye drops, doses would be much smaller and side effects fewer,” Apte says. Research is progressing rapidly, he adds.

[ severe depression & nerve stimulation ] Of the 15 million people suffering from depression in the United States, about 8 percent have treatment-resistant depression that doesn’t respond to antidepressants or psychotherapy. But many of those who receive an implanted electronic stimulator experience long-lasting relief. The device stimulates the part of the vagus nerve that runs from the neck to the brainstem. Brain imaging trials conducted by Washington University researchers have revealed what occurs during vagus nerve stimulation. “The brain undergoes significant metabolic changes months before the patient feels better,” says Dr. Charles Conway, associate professor of psychiatry. Consequently, Conway and his team of researchers were able to identify regions of the brain associated with this form of depression. They also found that structures deep in the brain with high concentrations of dopamine, the ‘feel-good’ neurotransmitter, changed as well. The stimulator is the size of a wafer cookie. It’s implanted in the chest, underneath the collarbone with the lead snaked into the neck, where the wire is attached to the vagus nerve. Once activated, the device delivers a 30-second electronic jolt every five minutes. “The device alone appears to combat depression by bringing about an antidepressant response,” says Conway. “We feel very confident it works in a significant number of individuals with depression.” But the FDA-approved stimulator is underutilized. That’s because, even with almost a decade of use, it’s still considered experimental by Medicare and insurance. Conway, however, is guardedly optimistic that will change.

JUNE 26, 2013

|

townandstyle.com

| 39


40 |

[ arthritis, aging & obesity ]

[ music & chemotherapy ]

[ alzheimer’s disease & ritalin ]

Washington University researchers, who studied the torn meniscus in 68 people post-surgery, identified abnormal gene activity that may explain how the cartilage tear contributes to the development of arthritis in the same knee years later. Researchers identified 28 genes in the meniscus. Five behaved abnormally; they weren’t as active as they should have been. “Each gene is sort of a blueprint for making a certain type of protein,” says Dr. Rob Brophy, a sports medicine specialist and principal investigator of the study. “We were basically looking at something called RNA, which is the message from the gene to the cell to make a certain level of the protein. The cells were telling themselves to make less of a protein. The genes were ‘under-expressing.’” Of the five genes behaving abnormally, four were aging-related and one was obesity-related. “We know there’s a mechanical relationship between aging, obesity and osteoarthritis, Brophy says. As people age, they tend to pack on more pounds, which puts more stress on joints. “We now know that both aging and obesity have an impact on the biology within the patient’s knee. We just don’t know to what extent. It’s too early to tell how they contribute overall.”

With help from St. Louis Symphony orchestra members and other musicians, researchers at Saint Louis University will investigate whether music can reduce the stress and anxiety of adult cancer patients. Participants in SLU’s cancermusic therapy pilot study will have their pulse, blood pressure and respiration rates measured before and after receiving chemotherapy. “The study will focus on 100 patients, separated into three groups,” says Crystal Weaver, co-investigator of the study and SLU Cancer Center’s music therapist. The first is the control group, which will not hear music. The second will listen to live music collectively at the university’s infusion center, and the third will hear songs selected individually, in private sessions. “We want to know which group does best,” Weaver says. Music for study is performed at 66 beats per minute— close to a normal pulse. “That tempo has been used in other music therapy research studies with different populations, and seems to have a calming effect,” Weaver says. If the serenades prove beneficial, additional studies will occur.

Ritalin, a drug used to suppress hyperactivity in children and adolescents, will be used in a pilot study by Saint Louis University to see if it can diminish apathy in patients with Alzheimer’s disease. Researchers hope the drug can lessen the incidence of falls experienced by individuals with Alzheimer’s. “We’re looking at a transdermal patch that slowly releases Ritalin,” says Dr. George Grossberg, a professor and director of geriatric psychiatry at the school of medicine. “It’s been long known that Ritalin can have mood-elevating and energizing affects and improve appetite in the elderly.” But the drug also helps hyperactive kids concentrate. Grossberg wants to know if a continuous release of low-dose Ritalin will enable seniors to focus better and avoid the hazards that cause falls, which can lead to hip fractures and death. He’s also investigating whether the psycho-stimulant can motivate Alzheimer’s patients with apathy. “One of the cardinal manifestations of this devastating brain disease is that it robs the individual of any and all motivation,” he says. “We are the first study to look at these two conditions together,” Grossberg says. “And we are the first to look at them in a fairly large population of Alzheimer’s patients, particularly in a nursing home environment where falls are a big issue.”

TOWN&style

|

JUNE 26, 2013


HEALTH&BEAUTY

Bare your toes.

[ physical therapy vs. knee surgery ] Washington University researchers participated in a multi-site study that found physical therapy at the one-year mark yields results similar to arthroscopic surgery in people with a torn meniscus and arthritis in the knee. However, 30 percent of participants believed physical therapy was not working and asked for surgery within weeks. “That’s a high crossover rate,” says Dr. Rick Wright, one of four Washington University sports medicine specialists who contributed to the study. “It means you don’t have to jump into surgery as a first step. Try physical therapy. If it doesn’t work, have surgery.” The study was difficult and challenging because of patient bias, Wright adds. “We encouraged them to try physical therapy for three months, but some people wouldn’t agree,” he says. “They felt that they hadn’t gotten anywhere after six weeks and wanted surgery.” Researchers are now analyzing data from each group to identify the predictors for success and failure in surgery and physical therapy, respectively. “Hopefully, we’ll eventually be able to tell people whether they are better candidates for one or the other,” Wright says.

Introducing

HyperBlue Simple. Fast. Virtually painless! FDA cleared*

[ hepatitis b research advances ] After almost 20 years, a Saint Louis University researcher has successfully measured and blocked a key enzyme that allows the Hepatitis B (HBV) virus to reproduce. It’s the first time anyone has been able to study the elusive enzyme, and the event is being heralded as a major advance—but not a cure—for the virus that is the leading cause of liver failure and liver cancer. Dr. John Tavis, a professor of microbiology at SLU, led the research involving the enzyme, ribonuclease H or RNAseH. “RNAseH is one of two enzymes that the virus makes, and both are absolutely essential for viral replication,” Tavis says. “Five different drugs that target the other enzyme (a DNA polymerase) control the virus, but can’t cure it. They remove the virus from people’s bloodstreams, but aren’t strong enough to block the cellular activities that maintain the virus in the patient’s liver.” Now researchers have a new target, and pharmaceutical companies are taking note. Because HBV and HIV viruses reproduce similarly, Tavis and colleagues thought there might be chemical similarities they could exploit. They were right: inhibitors of HIV RNAseH also inhibited the HBV RNAseH enzyme. SLU researchers conceptually proved that HBV replication could be stopped in cells with drugs that targeted the enzyme. “There’s a long way between proving something is theoretically possible and having a drug patients can use,” Tavis notes. “But we’re getting closer.”

Visit us today to ‘heal the toe’ (no more fungus!) Seth M. Anderson, DPM, FACFAS John J. Holtzman, DPM, FACFAS Timothy Oldani, DPM, AACFAS

[ cancer, collagen and dense breasts ] Women with dense breasts are more likely to develop breast cancer and have aggressive and metastatic (spreading) disease. A study conducted by Washington University researchers at Siteman Cancer Center helps explains how metastasis occurs, and explores the role of collagen in the process. “Density in breasts is caused by excess collagen, a fibrous protein that connects tissue and supports most organs,” explains Dr. Greg Longmore, a professor of medicine, cell biology and physiology. “Collagen is also the body’s response to inflammation, and rims most breast cancer tumors.” Longmore and his colleagues found that a protein called DDR2, which sits on the surface of tumor cells, binds with collagen. This results in a signal that encourages cancer cells to spread. DDR2 also plays a crucial role in how collagen fibers assemble next to the tumor. “If collagen fibers are more perpendicular than parallel, there’s a higher risk of metastatic disease,” Longmore says. “Cells love to run in straight lines. So tumor cells grab collagen fibers and run along them. That’s how they spread.” The more linear and straight the fibers are, the better for cancer cells to spread, he adds. “It’s like you’re creating little highways for them to leave the primary tumor.” If you know you have dense breasts, be vigilant, Longmore advises. “Most women don’t die of tumors in their breasts. They die from the tumor spreading.”

621 S. New Ballas Road, Ste. 7005B St. Louis, MO 63141

314-991-FOOT (3668) mofoot.com

[ bacteria may cause preterm birth ] *For temporary increase of clear nail in patients with onychomycosis

According to the March of Dimes, 1 out of 9 babies in the United States is born prematurely. Washington University researchers may have found one possible cause. New research conducted at the medical school has identified a common bacterium as an important contributor to bacterial vaginosis (BV), a condition linked to pregnancy complications such as infections of the placenta, premature births, and an increased risk of sexually transmitted diseases. BV occurs when the mix of good and bad bacteria in the vagina becomes imbalanced, although scientists disagree about which of the potentially bad bacteria are actually causing the problem. “One of the features of BV, from a gynecologist’s perspective, is the presence of what they call clue cells, detected in vaginal fluids under a microscope,” says Dr. Amanda Lewis, assistant professor of molecular microbiology. “Clue cells are thought to be the outermost cells of the vaginal lining that shed in response to BV. Our studies show that a bacterium called Gardnerella vaginalis damages the layers of mucus that protect the vaginal lining. It also stimulates shedding of this outermost layer of cells.” Lewis and her colleagues believe the damage caused to maternal mucus barriers by this bacterium may allow infections in the uterus that cause preterm birth. They also speculate that increased shedding exposes sensitive, underlying vaginal tissue and may explain the vulnerability of some women with BV to sexually transmitted diseases.

JUNE 26, 2013

|

townandstyle.com

| 41


TREND [REPORT OMBRE MANICURES

FROM THE RED CARPET TO THE RUNWAY, ombre hair has become synonymous with Hollywood “It” girls and fashionistas. But who says ombre has to be limited to long locks? Ombre manicures are a fun, simple and less committed approach to rocking one of this year’s top beauty trends and it doesn’t require a trip to the salon.

by marylyn simpson photo by charles barnes

[ based in bare ] >> ESSIE TOPLESS AND BAREFOOT BASE COAT

The Ombre Gradient Manicure is the perfect way to give your summertime manicure a boost of color without overwhelming it. First, base each nail with a neutral nail polish. This will give your manicure a sophisticated edge and allow your color of choice to pop. Essie’s Topless and Barefoot is neutral, yet thick enough to contrast for our ombre effect. ULTA, $8

[ pick three ] >> DEBORAH LIPPMANN I KISSED A GIRL; ESSIE GUCHI, MUCHI, PUCHI; SEPHORA SUGAR COATED

Pick your three favorite shades of any color. Remember, they should be in descending order from brightest to lightest. I like Deborah Lippmann’s I Kissed a Girl for the brightest shade, Essie’s Guchi, Muchi, Puchi for the medium and Sephora’s Sugar Coated for the lightest. DEBORAH LIPPMANN SET, NEIMAN MARCUS, $45

[ easy does it ] >> FACE SECRETS PROFESSIONAL COSMETIC WEDGES

Wet a makeup sponge with water. Starting at the top of the makeup sponge, apply each of your three colors in a narrow line, descending from brightest to lightest. Make sure the colors overlap on the sponge, not only to achieve a blended effect but to ensure each nail has even amount of polish. With the darkest color hitting the base of your nail, lightly dab the sponge on your nail until each color is on your nail. For a brighter, more dramatic ombre, you can reapply each shade of polish onto the sponge and apply to your nail again.

[ sealed & delivered ] >> SALLY HANSEN XTREME WEAR TOPCOAT

Finish off your Gradient Ombre Manicure with a layer of clear topcoat. It will help seal and blend each hue for a smooth ombre manicure.

[ less is more ] >> ESSIE TOPLESS AND BAREFOOT, OPI MY VAMPIRE IS BUFF, CHANEL DJANGO, DEBORAH LIPPMANN CARELESS WHISPER

Nothing says chic like a nude manicure. Simple and sophisticated, a nude ombre manicure requires nothing more than five descending shades of nude, using a different color on each finger. I chose Essie’s Topless and Barefoot for my ring finger, OPI’s My Vampire Is Buff for my middle finger, Chanel’s Django for my index finger and Deborah Lippmann’s Careless Whisper for my thumb. CHANEL, FINE DEPARTMENT STORES, $27 CARELESS WHISPER, NEIMAN MARCUS, $17 OPI, ULTA, $9

[ gilding the lily ] >> NARS EASY WALKING

For my pinky finger, I chose Nars’ Easy Walking to throw in a hint of metallic. This, or a crisp white hue, adds a little extra depth to an otherwise subtly sexy manicure. SEPHORA, $19

42 |

TOWN&style

|

JUNE 26, 2013


HEALTH&BEAUTY

[BEFORE &AFTER

by marylyn simpson | photos by bill barrett

MEET AMANDA | Our contest winner Amanda Budd is a Lindenwood University student by day and bartender by night. Her busy schedule doesn’t leave much time for primping, so Budd keeps her beauty routine simple and easy. SHE WANTS | Volume, volume, volume! “My hair tends to flatten out and frizz as the day goes on,” says Budd. Accentuating her ombre highlights with big curls and ample product were key in getting Budd a more voluminous look. HER STYLE | Budd’s day-to-day look is understated, with just a swipe of mascara and a touch of eyeliner to define her nighttime look. She regularly air-dries and occasionally straightens her naturally fine, curly hair, but sometimes a girl needs a little glam in her life. So we visited blow dry bar Breeze, in Ladue, for Budd’s hair and makeup transformation, focusing on a variety of blowouts and simple updos, Stylist and makeup artist Alexandra London was responsible for giving Budd the ‘Easy Breezy’ blow out and applying her sultry yet soft makeup. For maximum hold and volume, London used a bevy of L’Oreal products that included thickening primer, weight-lifting mousse and smoothing creams. London applied them to Budd’s freshly washed hair and combed for even distribution. Using a roll brush and blow dryer, London worked from bottom to top layers, motioning hair upward to create more height. London brushed Budd’s blunt bangs to the side and finished her look with L’Oreal Extreme Hold Finishing Spray. Channeling actress Olivia Wilde, London focused on making Budd’s blue-green eyes pop and her skin radiate. With Glo Minerals products, London used a base primer and concealer before adding a foundation to tone down any redness in the cheeks. The eyes got a smokey color palette with earth tones Cappuccino, Enigma and Tuxedo. “Apply Tuxedo to the corner of the eyes for a smokey look and blend until you reach the middle of the eyelid,” says London. After finishing Budd’s lids and lashes with black pencil liner and mascara, London topped off her look with a splash of color on the lips. “I applied the ‘Beloved’ gloss with a smudge brush for a fuller lip,” London explained.

THE REACTION | Budd’s transformation took her by surprise, but it was a welcome change for this understated student. “At first I hardly recognized myself,” she says. “It was a surprise to see how much body my hair had, as well as how blue my eyes looked. After this makeover, I definitely give my hair a lot more attention, so it doesn’t just lie flat and lose shape throughout the day—I’ve bought a couple of the products she used to aid in that department. I also use a little more eyeshadow to make my eyes open up.”

WANT TO APPEAR IN TOWN & STYLE AND GET A FREE MAKEOVER? CHECK OUR FACEBOOK PAGE FOR FUTURE CHANCES TO GET THE MOVIE STAR TREATMENT JUST LIKE AMANDA!

No One Will Know. Everyone Will Notice. Face, Breast & Body Surgical Procedures BOTOX Cosmetic, Facial Fillers, Fat Injections ®

Facial Lasers & Laser Hair Removal Board Certified Plastic Surgeon

14825 N. Outer 40 Road, Suite 350 Chesterfield, Missouri 63017 JUNE 26, 2013 |judithgurley.com townandstyle.com | 43 636.812.4300


[FOR YOUR HEALTH MENâ&#x20AC;&#x2122;S MEDICAL INSTITUTE

THERIAC HEALTH, LLC

MMI is dedicated exclusively to Testosterone Replacement Therapy, which can prevent heart disease, hypertension, osteoporosis and diabetes in men. 1062 Old Des Peres Road 314.394.1660 mensmedicalinstitute.com WINORA HELDMANN, R.N., BSN

DR. TED MIMLITZ, DR. STEPHEN BENZ

WEST COUNTY PLASTIC SURGEONS OF WASHINGTON UNIVERSITY

ESTETICAL LASER & SKINCARE STUDIO

Sculpt your body and eliminate stubborn fat with no needles, no anesthesia and no downtime. CoolSculpting is a FDA-approved treatment that uses a targeted cooling process to kill fat cells underneath the skin without disturbing healthy skin cells. 1040 N. Mason Road, Ste. 124 | 314.996.8800 westcountyplasticsurgeons.wustl.edu

With state-of-the-art IPL technology, Estetical offers remarkable change in the health and beauty of your skin. Clients can expect superior results from treatments that are faster, painless and attractively priced. 511 S. Hanley Road 314.450.8361 hairremoval-stlouis.com

KRISTIN GREEN, DR. TERRY MYCKATYN, EMILY WEINHAUS, DR. MARISSA TENENBAUM

MISSOURI CENTER FOR REPRODUCTIVE MEDICINE Join Dr. Ahlering for a free informative seminar on fertility treatments. Dinner will be provided and registered attendees will receive discounted future fertility treatments. The seminars are scheduled from 6 to 8 p.m., July 10 and 11. 303 Keene St., Ste. 202, Columbia, Mo. 573.442.1886 missourifertilityexperts.com

EYE CARE ASSOCIATES OF ST. LOUIS Eye Care Associates has options for glaucoma patients who have difficulty using eye drops. Our ophthalmologists can perform Selective Laser Trabeculoplasty, a laser procedure that can help lower pressure and may reduce the need for eye drops. #15 The Boulevard | 11611 Gravois Road eyecarestl.com

DR. PETER AHLERING

DR. STEPHEN WEXLER, DR. SEAN BREIT

MISSOURI FOOT & ANKLE Missouri Foot & Ankle now provides the FDA-cleared HyperBlue 1530 Laser/Blueshine Gold Series, a fast, powerful and effective treatment. 621 S. New Ballas Road, Ste. 7005B 314.991.3668 | mofoot.com

ETERNITY MED SPA Eternity Med Spa has introduced vitamin B12 shots for wellness and energy. Eternity Med Spa also offers full laser service for skin tightening, brown spots, hair removal and vein treatments, and incorporates a complete hydrating facial to add a youthful glow. 12401 Olive Blvd., Ste. 103 | 314.469.2946 eternitymedspastl.com

JOANNE KNIGHT HEALTH CENTER

CLEANSPA Problem nails, cracked heels and calluses can be painful and unsightly. Take time to care for your feet and keep them healthy and beautiful with pedicures. Experience more than beauty at CleanSpa. 17201 Chesterfield Airport Road 314.880.0777 | cleanspa.com DR. CATHERINE APPLETON

SPECIAL ADVERTISING FEATURE

44 |

TOWN&style

|

JUNE 26, 2013

Attend our free seminar on July 10 to learn more about our medically developed and supervised weight loss program. The four-phase program can help you put an end to constant dieting. 16216 Baxter Road, Ste. 325 314.692.8013 theriacweightloss.com

BREAST

Your health is in capable hands with radiology specialists. From screening mammograms to comprehensive diagnoses, Washington University radiologists provide access to coordinated, complete care in a comfortable environment. 4921 Parkview Place, Ste. D, Fifth Floor 314.454.7500 wuphysicians.wustl.edu


LEISURE

[HOPING FOR A H ME by catherine klene

Town & Style is partnering with St. Louis animal adoption organizations to introduce you to local furry friends in need of adoption. We’ll feature new animals each month, and you can meet others on our Facebook page! I’M SPIKE, a 3-year-old mixed terrier, and my idea of a great day is relaxing with you. I’m a smart boy who is great at following instructions and just wants to snuggle on your lap for awhile.

[SNAPPED!]

TO ADOPT ME // Karen Schenks, C.A.R.E. | 636.208.6267 | carole@boxxarchitect.com

<< go to townandstyle.com to see more [SNAPPED!] >>

MY NAME IS BUBBLES, and my favorite hobby is to sit in a sunny window and watch the world pass by. I’m a 2-yearold orange tabby, easygoing and affectionate. TO ADOPT ME // Bethany, Tenth Life Cat Rescue | 314.808.2454 adoptions@tenthlifecats.org

314.657.2100 | townandstyle.com

I’M GIA, an obedient, friendly, pointer/greyhound mix. I’m a smart 3-year-old girl, too. Before my owners moved away, they taught me to sit, speak, shake and lie down—and they house-trained me! TO ADOPT ME // Natalie Partenheimer, APA of Missouri | 314.645.4610, ext. 124 natalie@apamo.org

I’M PENELOPE, a 9-month-old pointer/pit bull terrier mix, and I’m always ready to play. I’m a curious, friendly lady, and I love to take walks and sit for treats from you and your family. TO ADOPT ME // Humane Society of Missouri | 314.647.8800 customer.service@hsmo.org

SEE SOMEONE YOU LOVE? If you adopt a featured pet, share your

story on our Facebook page or at pets@townandstyle.com and Riley’s Organics and Treats Unleashed will provide gifts for your new addition. ALL PETS LISTED ARE AVAILABLE FOR ADOPTION AT PRESS TIME. THE ADOPTION ORGANIZATIONS ARE SOLELY RESPONSIBLE FOR ASSESSING THE HEALTH AND TEMPERAMENT OF THE ANIMALS LISTED.

Tim Gamma, B.S. Horticulture Board Certified Master Arborist Knowledge and quality are hallmarks of our reputation

Your trees deserve the best care

314-725-6159

SPONSORED BY

InSured

healthy foods | fresh treats | pets welcome 5 locations: Chesterfield, Des Peres, Ladue,

TM

GammaTree.com

St. Peters/Mid Rivers, Oakville

blog, calendar & more @ treats-unleashed.com

JUNE 26, 2013

|

townandstyle.com

| 45


[ ON THE TABLE ] by jonathan carli | photos by bill barrett

[ PRASINO ]

1520 w. 5th st. | st. charles | 636.277.0202

[ amuse bouche ] THE SCENE |

Lively contemporary restaurant focused on clean food and sustainability

THE CHEF |

Tony Marchetto

THE PRICES |

$7 to $16 starters; $12 to $18 sushi rolls; $15 to $29 entrees

THE FAVORITES |

Lobster Avocado, Lava Roll, Chocolate Molten Cake, Black Cod, Lamb Shank Tagine, Green Tea Crème Brulee

THIS RESTAURANT, STARTED IN CHICAGO, has a unique formula that emphasizes natural, farm-to-table ingredients at affordable prices. You won’t find Coke here. You will find house-made cocktail mixers, jams and lots of gluten-free and vegan dishes (all identified as such in an effort to make life easier for the dining-challenged). But this is no granola cafe; it’s a mainstream restaurant—and a slick one, at that. Located in the old Noah’s Ark grounds, it is one of the businesses anchoring a Main Street-style development that eventually will include residences and businesses in an attractive planned community. I’d call the menu comfort food with a twist. Our Lobster Avocado starter ($16) was a treat of lobster meat piled high on top of an avocado half and dotted with bits of mango and creamy chili beurre blanc. It was memorable in the quantity of its flavorful seafood and the rich sauce with a bite.

Another winner was the Lava Roll ($16), one of about a half-dozen specialty sushi rolls. The fish was fresh, the sauce on top (called Firecracker sauce) was creamy. Especially good was the crispy ‘tempura panko’ crumbled on top, adding some crunch to what is normally a smooth and creamy food. A starter of Tuna Tartare ($15) featured a good presentation of chunked tuna piled into fried wonton shells. The fish had been glazed with sesame oil and possibly a little soy, and it was sprinkled with black and white sesame seeds—all to great effect. Less successful was the Mexican Roll ($16): south of the border ingredients like cilantro, raw red onion and tortilla strips simply don’t pair well with yellowtail and shrimp sashimi. Two outstanding entrees were the Black Cod ($28) and the Lamb Tagine ($26). The cod was sweet and mouthwatering in its Asian sauce of dashi and shiitake. Served in a shallow bowl on top of soba

noodles and bok choy, it’s the kind of dish you go back for. The lamb shank was tender and pungent with Moroccan spices. Covered with harissa, it tasted of clove, cinnamon and other flavors somewhat exotic for meat. It came with creamy tzatziki to temper the aromatic flavors, and couscous mixed with arugula, roasted carrots and celery. An order of Short Ribs ($26) was well-cooked, with the beef as lean as can be expected of this cut sitting on top of Swiss chard. Nearby was a mold of cauliflower gratin and a pool of Cabernet truffle mushroom sauce. It was a good dish, but rather heavy for the season. Desserts of Chocolate Molten Cake and Good Orange Tart (each $7) were very good. The former oozed chocolate and had a drizzle of caramel. The tart, with a tasty crust, was piled high with berries. Also stellar was our Green Tea Crème Brulee, delicately flavored with tea and rich with cream and the standard sugary crust.

[ food • ŏ • lō • gy ]

[ chef chat ]

meats and vegetables. HARISSA | A North African sauce of chilis, coriander, cumin, garlic paste, salt, spices and caraway. BLACK COD | Also called Sablefish or Butterfish, it comes from Alaska and British Columbia and has a rich, buttery flavor.

16 years in the business, including time at Cardwell’s at the Plaza, Tony’s and BC’s Kitchen

TAGINE | A dish named for the clay/ceramic cooking vessel used in Morocco to slow-cook

>>We loved the food here! The lobster in avocado was to-die-for, and the wait staff was really nice —SANDY B OF CHESTERFIELD

>> I was hesitant about ‘crossing the river,’ but this place is hip and the portions are really big and worth the price.

FAVORITE INGREDIENT

Right now, fresh celery hearts, arugula, parsley, lola rosa lettuce

[ aftertaste ] and enthusiastic.

>> tony marchetto PEDIGREE

—MICHAEL S. OF CREVE COEUR

UP NEXT | THE LIBERTINE WRITE TO FOOD@TOWNANDSTYLE.COM TO SHARE YOUR OPINION.

FAVORITE STL RESTAURANT

Sydney Street Cafe or Mai Lee

BEST DINING EXPERIENCE

Maude’s Liquor Bar in Chicago. They focus on grass-fed, farm-to-table food, and the chef is always there. The ambience is amazing.

GUILTY PLEASURE

Dark chocolate and red wine

46 |

TOWN&style

|

JUNE 26, 2013


LEISURE

QUICK BITES by rebecca koenig

Your Home Town Team Our Care Staff $2,000 Off

DORIS COOK Executive Director COMMUNITY FEE

TONIA MOORE Director of Wellness JULIA SCOTT Director of Assisted Living

[ leafy green ]

Diners with special diets won’t have trouble finding something to eat at TREE HOUSE VEGETARIAN RESTAURANT, which opened earlier this month at 3177 S. Grand Blvd. Executive chef JOHN INTRIERI, formerly of Oceano Bistro, and VICTORIA LOPEZ, formerly of Black Bear Bakery, developed the menu’s vegetarian, raw, vegan and gluten-free options.

Actual Spectrum Residents

HOPE GOODIN Transitional Memory Care Life Enrichment Specialist

We are here to be At Your Service SM

[ a fond farewell ]

After more than 40 years in business, DUFF’S, that Central West End classic owned by KAREN DUFFY and TIM KIRBY, closed June 23 after one last Sunday brunch. The space at 392 N. Euclid Ave. will be filled by CUCINA PAZZO, a new Italian venture by the team that owns The Shack Pubgrub, The Corner Pub & Grill and The Tavern Kitchen & Bar.

[ brewing something new ]

With organic beans and siphon brewing, CAFE DI ORGANO caters to coffee purists. The cafe, located at 1221 Locust St., also serves bagels, panini sandwiches, empanadas and salads to give customers something to munch while they sip.

314-288-0633

27 Reinke Road, Ellisville, MO 63021 WestviewAssistedLiving.com Off of Manchester Road at Reinke Road, next to IHOP

A SPECTRUM RETIREMENT COMMUNITY

• Combined, our directors have lived in St. Louis for more than 250 years • More than 100 years of healthcare experience

Services Available • Assisted Living • Transitional Memory Care • Memory Care

WV Town & Style 6 12 26 13

[ hasta la vista ]

VIDA MEXICAN KITCHEN Y CANTINA

in the Galleria has closed after less than a year in business.

[ on the docket ]

Lawyers-in-training at Saint Louis University will soon be able to sink their teeth into something tastier than amicus briefs. The new downtown law school announced plans to open a restaurant, called THE DOCKET, at 100 N. Tucker Blvd. The big establishment, run by Bon Appetit Management Company, will have more than 100 seats inside and 70 outside, and will serve quick breakfasts and lunches Monday through Friday, and dinner Monday through Saturday. Menu items will include small plates, pizzas, pastas and wood-fired entrees.

Sundays at Central Table Now serviNg BruNch aNd diNNer A perfect neighborhood spot for breakfast, lunch, dinner and takeaway from our market

23 south euclid aveNue st. louis, missouri 63108 p: 314 932 5595 w: ceNtraltaBlestl.com JUNE 26, 2013

|

townandstyle.com

| 47


ENJOYING SUMMER compiled by anna kaczkowski

Our best-selling basketball goal, the Goalsetter AllAmerican, is now on sale for $1,499. It features a 60-inch, tempered-glass backboard with a 3-inch offset, and is adjustable from 6 feet to 10 feet. 17373 Edison Ave. 636.530.0055 dreamplayrec.com

KODNER GALLERY

Kodner Gallery Missouri Masters Series 2013: Join us for a series of educational open houses featuring Missouri’s top artists—Benjamin Guffee (July 20, benefiting The Foundation Fighting Blindness),Yingxue Zuo (Aug. 17, benefiting American Parkinson Disease Association), and Irek Szelag (Sept. 14, benefiting Love U 2 Pieces). Light refreshments will be served while guests browse and enjoy a painting demonstration and discussion by the featured artist. 9650 Clayton Road | 314.993.4477 | kodnergallery.com

MONOLITH BY BENJAMIN GUFFEE

LINDENWOOD’S J. SCHEIDEGGER CENTER FOR THE ARTS

COMPTON HEIGHTS CONCERT BAND

Treat your family to ‘Sousa Sundays,’ delightful pops concerts at Logan College’s Purser Center, featuring the Compton Heights Concert Band and guest artists such as the Canadian Brass, appearing in Concert No. 1 at 7:30 p.m., Sunday, July 7. Purser Center 1851 Schoettler Road 314.776.2227 | chband.org

The 2013-14 season will be our best yet, if legendary entertainer Martin Short (opening the season on Sept. 14) is any indication! 2300 W. Clay St. 636.949.4433 LindenwoodCenter.com PICTURED: MARTIN SHORT

SAMMY HAGAR

RANKEN JORDAN— A PEDIATRIC SPECIALTY HOSPITAL

STAGES ST. LOUIS

Ann Hoyt Wazelle returns to the UAO stage as Cio-Cio-San in one of the world’s most beloved operas, Puccini’s Madama Butterfly, July 12, 13, 19 and 20 in this tragic tale of love and heartbreak. 733 N. Union Blvd. | 314.361.2881 unionavenueopera.org

Sammy Hagar and LiveNation have launched a new fundraiser for Ranken Jordan – A Pediatric Specialty Hospital by offering free concert tickets in return for donations to the hospital. Hagar will be in concert at the St. Louis Verizon Wireless Amphitheater on Aug. 31. 11365 Dorsett Road 314.872.6400 rankenjordan.org

CANADIAN BRASS

EDGEWILD RESTAURANT & WINERY

Wine Down Wednesdays continues to be a roaring success. Every Wednesday this summer, enjoy half- price bottles of wine all day, up to $100 list price) and Ladies' Night drink and appetizer specials in the bar and patio. 550 Chesterfield Center 636.532.0550 edgewildwinery.com

PHOTO BY STRAUSS PEYTON

STAGES will turn St. Louis pink this summer as it continues its 27th season with Broadway’s dance- filled hit, Legally Blonde, The Musical. Join in all the fun with Elle Woods, July 19 to Aug. 18! 314.821.2407 | stagesstlouis.org

UNION AVENUE OPERA

PAUL MINEO’S TRATTORIA

Owner Brigitte Mineo welcomes diners to experience the restaurant’s classic Italian specialties on its spacious and family-friendly outdoor patio. Live music is offered Saturday evenings. 333 Westport Plaza | 314.878.8180 paulmineos.com PICTURED: GIOVANNI MINEO WITH KRISTIN, MIKE AND JILLIAN CLARK

PICTURED: ANN HOYT WAZELLE

METRO LIGHTING

Take your summer entertaining to the next level with dramatic outdoor and landscape lighting. Provide ambience, safety and security to outdoor spaces while adding beauty and usability. 17485 N. Outer Road metrolightingcenters.com

48 |

TOWN&style

|

JUNE 26, 2013

DREAM PLAY RECREATION

AMINI’S HOME, RUGS & GAME ROOM

Make your home the destination for all the summer parties with a new outdoor kitchen and grill center from Amini’s. The Chesterfield showroom features outdoor kitchen displays, modular islands and top-shelf stainless steel models. 17377 Chesterfield Airport Parkway 636.537.9200 | aminis.com

SPECIAL ADVERTISING FEATURE


by bob wilcox

FRONT] &CENTER PHOTO BY OF KEN HOWARD

THEATER WITH MUSIC—LOTS OF MUSIC: Opera Theatre of St. Louis has blessed us this year with an even wider variety of offerings than usual. The highlight has been the world premiere of Champion, about the welterweight boxer Emile Griffith. It received a sustained and loud ovation on opening night. Some have referred to it as a jazz opera because the composer of Champion is the highly regarded jazz musician Terence Blanchard. I liked the jazz-influenced parts of the score best. But in the opera’s score I heard more of the Blanchard who has written music for several films. That part serves the story well enough, though, without memorable melodies and without grabbing me the way the jazz did. The libretto by Pulitzer—and Tony-winner Michael Cristofer intelligently condenses the boxer’s rise and fall and makes the smart choice of telling that story through the memory of the old and mentally failing Griffith—a powerful and moving performance at Opera Theatre by Arthur Woodley. If Cristofer gets a chance to work further on the libretto, I hope he’ll develop more clearly and fully Griffith’s growing realization of his identity as a gay man. At the other extreme is the silliness of Bedrich Smetana’s rarely-seen comedy of strong-willed, battling lovers, The Kiss. It is given a proto-feminist twist by librettist Eliska Krasnohorska and provides a showcase for two impressive THE CHAMPION AT OTSL young sopranos in a cast that is strong throughout. And while the artificiality of a piece like The Kiss almost seems to require artificiality in the playing of it, I found the level of the acting at OTSL this year pretty much equal to what I see at the better non-operatic theaters. (That’s not always the case with opera.) For lovers of the standard repertoire, there are the two one-acts, Il Tabarro by Puccini and Pagliacci by Leoncavallo. They bring us the usual operatic fare of adultery, jealousy and murder. And for sheer unadulterated pleasure, nothing beats Gilbert and Sullivan’s The Pirates of Penzance. (Shakespeare Festival St. Louis’ Twelfth Night came close.) But it has now turned Forest Park over to its senior resident, The Muny, which opened its season with the demented Monty Python’s Spamalot and is now playing one of the most successful translations of animated film to live musical theater, Shrek. The ogre’s story got a boost from having its adaptation of the film script and its lyrics written by another Pulitzer winner, David Lindsay-Abaire. St. Louis Actors’ Studio has come up with one of the more intriguing offerings of the summer in its collaboration with playwright, screenwriter and movie director Neil LaBute. For the second year, they’ll be producing a new play by LaBute at their Gaslight Theatre on Boyle. This year, his new one-act, The Possible, will be part of the LaBute New Theater Festival, July 5 through 28. LaBute’s new play will be joined by eight plays selected in a competition held last fall. Four of them are on the bill July 5 though 14, and four of them from July 18 to 28. The playwrights hail from across the country but include St. Louisans Nancy Bell, Rachel Fenton and Joshua Thomas, and former St. Louisan Tyler Vickers. In addition, five high school students will have their plays read on the morning of July 6 at the Gaslight.

by michael pechlof

UNC RKED]

LEISURE

WINE DECANTING: CONFUSION & DISAGREEMENT Wine lovers debate the purpose of wine decanting on a regular basis. That’s the process of uncorking the bottle and pouring the contents into another vessel to let it breathe for awhile before drinking. The objective of decanting is little understood, and even the opinions of experts conflict. So what is the benefit of decanting wine? Is it worth waiting to drink your open bottle? Does the wine taste different after decanting? The vast majority of consumers believe decanting definitely benefits the wine. However, the practice of decanting should depend on its age, quality and style.

WHAT ARE THE BENEFITS? Overall, there are two main reasons to decant your wine: removing sediment and aeration. The separation of sediment before serving results in a clearer and smoother wine; aeration allows the wine to breathe and develop taste and aroma. For most of history, decanting was a standard procedure to separate the sediment from the wine. Filtering and refining techniques were barely developed, and a strong presence of sediment in wine was common. However, advanced wine-making techniques have definitely reduced the amount of particles present in wines today. I recommend decanting red wines that are 10 years or older. The maturation process in the bottle causes sediment development of dead yeast cells, grape skins and tannins. But be aware that some wines with a mature life span can eventually reach a point where even careful decanting is too violent. Fragile aromas and flavors can collapse when exposed to air. In this case, keep the wine in the bottle and pour directly in the glass without stirring up the sediments. Aeration is the second and more common reason to decant wine. This process is called ‘breathing’ and describes the contact of wine and oxygen. Young red wines can taste bitter and have an obvious alcohol component. In these cases, oxygen can break up the tannins and alcohol to develop flavors and aromas. This phenomenon usually takes place in the bottle during the maturation process over years. Young whites benefit from aeration, too, especially those with high acidity like white Burgundies, rieslings and chenin blancs.

MICHAEL PECHLOF IS A SOMMELIER AT THE FOUR SEASONS HOTEL ST. LOUIS AND A CERTIFIED MEMBER OF THE INTERNATIONAL SOMMELIER GUILD AND THE COURT OF MASTER SOMMELIERS. HAVE A QUESTION? EMAIL US AT WINE@TOWNANDSTYLE.COM OR CONNECT WITH US ON FACEBOOK.

sponsored by

Wine Down Wednesdays Enjoy these specials every Wednesday this summer

p

Half price bottles of wine up to $100 list price

p

Ladies Night ~ drink & appetizer specials patio aNd bar oNLy

11am-11pm Mon-Thu 11am-12am Fri & Sat | 12-9pm Sun Mon-SaT ~ KiTchen cloSeS aT 10pM

550 chesterfield center | chesterfield 636.532.0550 | edgewildWinery.com JUNE 26, 2013

|

townandstyle.com

| 49


[ARTS&ENTERTAINMENT] [JUNE-JULY]

by amber peterson

5

[ ART ]

[ MOVIES ] t&s saw it!

wartime escape, margret and h.a. rey’s journey from france

MAN OF STEEL >> I’m a sucker for a good superhero story, and Superman

Chesterfield Arts | Free | chesterfieldarts.org >> This exhibition chronicles the journey of Margret and H.A. Rey as they fled Paris in 1940, traveling by bike, boat and train, with only a few belongings. Through Aug. 2.

fans will love this take from producer Christopher Nolan (The Dark Knight trilogy) and director Zack Snyder (300, Watchman). The top-notch cast does a great job retelling the Superman legend, especially his struggles as a child. The special effects, particularly the scenes on Krypton, are downright beautiful; I wish baby Kal-El had a little more time on his home planet just so I could marvel at its technology. One minor qualm: I’m partial to morally ambiguous superheros, so compared to Iron Man’s snark and Batman’s angst, Superman is just too darn saintly. At one point, Clark Kent ponders his duty to mankind in a church, and nearly every camera angle manages to work a stained-glass Jesus in the frame. I’m all for symbolism, but that’s hitting the point a bit too hard. SHOULD YOU SEE IT? Fans of the genre will not be disappointed. Definitely one of the blockbusters this summer —C.K.

6/7–8/4 sarah bernstein: the heart’s epic schlep

St. Louis Artists’ Guild | Free | stlouisartistsguild.org

6/28–9/27 beneath the covers

Foundry Art Centre | Free | foundryartcentre.org

7/10–8/11 josh fraught: snacks, supports and something to rally around

Contemporary Art Museum | $5 | camstl.org

[ ETC. ]

VIEWED AT WEHERENBERG RONNIE’S 20 CINE

THE INTERNSHIP >> This is a predictable but highly enjoyable movie. Vince

6/26 coffee tour

5:30 p.m. | The Frank Lloyd Wright House in Ebsworth Park $30 | ebsworthpark.org

Vaughn and Owen Wilson are a couple of salesmen whose jobs become obsolete thanks to the Internet. So what do they do? They join Google. The two tech illiterates apply for, and get, an internship with the famously brilliant and pubescent Silicon Valley company. It’s a setup for hilarity as the 40-somethings join the other beanie-topped interns in a series of competitions, from Quidditch to online troubleshooting (or as Vaughn calls it ‘on the line’) to see which team gets permanent jobs there. Predictably, the young people at Google learn some life lessons from Vaughn and Wilson, while those two become pretty adept at navigating their way around the web (not to mention Google’s free dining rooms, nap pods, spiral slide and more). Sounds silly, but it is handled well and great fun. SHOULD YOU SEE IT? Absolutely! —D.W.

6/29–6/30 pridefest st. louis

4

11 a.m. | Solider’s Memorial | Free | pridestl.org

136th annual veiled prophet parade

9:30 a.m. | Downtown St. Louis Free | veiledprophet.org >> Enjoy the imaginative and colorful floats when the Veiled Prophet Parade continues its legacy as one of St. Louis’ favorite family traditions.

jr. >>>7/9 SHOOTING STARZ CAMP

10:30 – 11:30 a.m. | Foundry Art Centre $38.50–$45 | foundryartcentre.org Your child will take center stage in this beginning acting and art camp. Through July 12. FIRST FRIDAY: THE SCIENCE OF DOCTOR WHO 6–10 p.m. | Saint Louis Science Center Free | slsc.org

TOWN&style

now

[ THEATER ]

[ MUSIC ]

shrek: the musical

6/22 sonny rollins

8:15 p.m. | The Muny | Free - $75 | muny.org >> Everyone’s favorite ogre, Shrek, takes the stage. Through June 30.

Now–6/28 the kiss

Opera Theatre of St. Louis | Loretto-Hilton Center $25–$128 | opera-stl.org

6/28–7/14 soy yo! (i am me!) an

7/5

50 |

VIEWED AT RONNIE’S 20 CINEMA

|

JUNE 26, 2013

afro-latina suite

Kranzberg Arts Center | $25 | gitana-inc.org

6/30 ms. bridget’s conservatoire of dance

3 p.m. | Edison Theatre | $20 | edison.wustl.edu

8 p.m. | Jazz St. Louis | Touhill | $35 - $125 | touhill.org

6/28 delta rae

8 p.m. | Old Rock House | $12 | oldrockhouse.com

7/1 matt pond

7:30 p.m. | Firebird | $12 | firebirdstl.com

sgt. pepper’s lonely hearts club band

8 p.m. | Powell Symphony Hall | $35 - $95 | stlsymphony.org >> Classical Mystery Tour joins the STL Symphony for its 45th anniversary celebration, performing Beatles favorites like Lucy in the Sky with Diamonds, When I’m 64 and Strawberry Fields Forever.

28


[HOME]

51 WESTMORELAND PLACE

JUNE 26, 2013

|

townandstyle.com

| 51


200 South Brentwood Boulevard, #12D ~ Clayton 63105

Gracious heart-of-Clayton living with breathtaking views; walk to restaurants and boutiques. Spacious 2 bedroom, 2 full and one half-bath, open plan, hardwood floors, sleek baths, updates throughout. Numerous building amenities include doorman, secure parking, fitness center and roof-top pool. $549,000 314

304-3117

Dorcas Dunlop dorcas@prustl.com

we’re

homegrown,

[

a completely independent st. louis publication

connecting our community.

121 Hunter Ave. Suite 201 | 314.657.2100 | townandstyle.com

52 |

TOWN&style

|

JUNE 26, 2013

T&S HOME 51 WESTMORELAND PLACE ] by catherine klene listing price | $2,295,000 listing agent | holly bry & ann wroth with gladys manion VISITORS TO 51 WESTMORELAND PLACE IN THE CENTRAL WEST END may find their necks a bit stiff after a few minutes. A massive stone staircase in the entry greets guests, whose eyes follow as it spirals up to a soaring rotunda. Owners John and Robin Porta were equally awestruck when they purchased the home 11 years ago. “We just fell in love with it when we walked in: the moldings, the rotunda, the ceilings,” Robin Porta says. The eight-bedroom, seven-bathroom house is steeped in history and luxury. St. Louis architect James P. Jamieson designed the concrete and marble structure for Daniel Catlin, president of American Tobacco Co. Construction began in 1917, though Catlin died before the home was complete. His widow, however, lived there the rest of her life, and no expense was spared to bring the extravagance and elegance of an Italian Renaissance villa to St. Louis. “The story goes that they brought in 40 Italians, and it took four years to build it,” Porta says. “I don’t know how much truth there is to that, but the marble and detail work are fabulous. There is a Tiffany glass wall above the staircase that has Catlin and his wife’s initials in it.” The Portas continued to find hidden details long after they were settled. They had passed that Tiffany glass hundreds of times before a guest noticed something tucked into the pattern. “At the top, you see a picture of Catlin and his wife,” she says. “You could visit this house 10 times and still not see some things.” The Portas began a massive renovation project upon moving, completely gutting the kitchen and butler’s pantry. Today, the modern kitchen boasts a Viking range, a Sub-Zero refrigerator, hidden cabinets, granite counters and more. Chandeliers and drapery throughout the home were replaced, and a separate guest apartment also was given the full remodel. The backyard has been transformed into an outdoor oasis, adding a canopied patio, pool and outdoor fireplace. “Maintaining the home’s design is important,” Porta says. “You don’t want it to look like it was renovated. We wanted to stick with old Italian.” PHOTOS BY ALISE O’BRIEN The home’s 12,500 square feet have provided plenty of space for charity events, holiday gatherings and special moments, including their daughter’s wedding. “She wanted to get married at home, and we had 150 guests and everyone fit comfortably,” Porta says. “You have to want to entertain if you have this house.” The three Porta children have since moved out of the home, and the couple plans to relocate to San Diego, Calif., to be nearer to them. But memories of their years at this historic manse will remain. “We have books and books of pictures. There are a lot of great memories,” she says. “It’s a sad thing to see it go, but we’re moving forward.”


10040 LitzSinger road ~ LadUe ~ $1,699,000

Gorgeous home on 3 manicured acres in the heart of Ladue. 5476 square feet, 4+ bedrooms, 5 baths with a pool, patio, terrace and gardens. A must see! NEW LISTINGS 33 DROMARA ROAD

$2,295,000 5 acre Ladue estate. 4BR/7BA/7,000SF. Pool and pool house.

1000 WEIDMAN ROAD

$1,640,000 8.2 acres with main house, service house, 6 stall stable & expansive pastures.

24 MUIRFIELD ~ OPEN SUN 2:30-4:30

$799,000 With breathtaking views of the 12th hole at Bellerive CC, 4BR/2BA home has unlimited potential.

Featured Properties

For Quick Access to Search St. Louis Listings or To view our Featured Properties Scan Using Your Smartphone

408 SOUTH WARSON ROAD ~ OPEN SUN 1-3

11218 TUREEN DRIvE

$2,499,000 8,700SF Ladue mansion, almost 3 acres. 5BR/6.5BA, pool, reflecting pond, 5-car garage.

5 NASSAU DRIvE

$2,399,000 Johnson built home in Ladue. 6BD/7BA, 1+ acre with pool and hillside waterfall.

18 DARYL LANE ~ UNDER CONTRACT

$2,395,000 Totally renovated 7,000+ square foot home on 1.8 acres, brand new pool and pool house.

15507 JOST CIRCLE

$1,825,000 3-year old Rehnquist-built home on a private cul-de-sac off Ladue’s Gold Coast, Litzsinger Road.

$725,000 5BR. Ladue Schools. 3,400SF. Pool, pool house. $449,500 Wonderful condo alternative in Ladue with lovely pool. Close to Clayton and airport. $397,000 Level, park-like 3/4 acre in heart of Ladue. 3BR/2.5BA, walk to Ladue schools, dining & shopping. $259,000 2 story 4BR/2.5BA, 3-car garage on cul-de-sac.

4191 DOMENICO COURT

$99,000 Charming 2BR/1BA ranch w/open floor plan, eat-in kitchen. New roof, lots of storage, great location.

CLAYTON / RICHMOND HEIGHTS 9 CARRSWOLD DRIvE ~ UNDER CONTRACT

$3,349,900 Functional & luxurious.10,000SF, 4-car garage.

135 NORTH FORSYTH BOULEvARD

$1,999,000 Not your typical Clayton Gardens home! Old-world charm, 4BR/6BA, finished lower level.

150 CARONDELET PLAzA, UNIT 402

$799,000 2BR/2.5BA Spacious, light filled 2,421 square feet, corner unit with east/north exposure.

7420 WYDOWN BOULEvARD

11223 HUNTERS POND LANE

26 CLERMONT LANE ~ OPEN SUN 1-3 30 DEERFIELD TERRACE

9710 & 9714 LITzSINGER ROAD

$1,750,000 2 lots totaling 4.74 acres in heart of Ladue, backing to Old Warson Country Club.

#2 EDGEWOOD ROAD

$1,749,000 Ladue home, completely renovated, 4BR/6BA on 1.76 acres with pool and pool house.

$1,265,000 Harris Armstrong treasure, this masterpiece is on three rolling acres in the heart of Ladue.

9810 OLD WARSON ROAD

$2,599,900 Across from Old Warson CC, 8,500SF+. 2009 Higginbotham rehab. Gourmet kit. Pool & poolhouse.

REALTOR®

l

2069 SOUTH MASON ROAD

12318 BOOTHBAY COURT

$799,000 Prestigious residential 4.5+ acre building site in Town and Country, could be subdivided to 2 lots.

805 FAIRFIELD LAKE ~ OPEN SUN 12-2

21 OvERBROOK DRIvE

$625,000 Build your dream home on this lovely 1.8-acre lot in terrific neighborhood.

$369,900 3 bedroom, 3 bath atrium ranch condo. Walk out lower level, steps from the pool.

121 LADUEMONT DRIvE ~ OPEN SUN 1-3

FRANKLIN COUNTY 2271 TALON COURT

$475,000 Renovated ranch, 2,818SF, 4BR3.5BA, updated kitchen & master bath, finished LL.

7 WESTFIELD LANE ~ UNDER CONTRACT

$5,750,000 Exceptional estate w/ exceptional views atop the Bluffs of St. Albans. 10,000+SF of living space.

1000 DAUTEL LANE ~ UNDER CONTRACT

KIRKWOOD / DES PERES / WEBSTER 106 OAKWOOD AvENUE

$449,000 TEARDOWN – Picturesque private setting on almost one acre level lot, end of cul-de-sac, Ladue schools.

4 TALL TIMBERS DRIvE

36 CLERMONT LANE ~ UNDER CONTRACT

$879,000 Updated Colonial on 1+ acre lot in Wheatfield Farms, backs to park.

$699,000 Spacious two-story on quiet cul-de-sac. 5BR/7BA, in-ground pool, sunroom, sauna, 3-car garage.

HUNTLEIGH / FRONTENAC 12 DUNLORA LANE

$1,499,000 Equestrian property on 3+ acres in Ladue. Miles of bridle trails. 2 stall barn, 4BR, 4 full/2 half BA.

13039 STARBUCK ROAD ~ UNDER CONTRACT

31 RIO vISTA DRIvE ~ UNDER CONTRACT

$208,000 Spacious split-level, 4 beds/5 baths, features unique addition with endless possibilities.

$1,595,000 Newer Ladue home, 10,284SF, finished LL, 5BR, main floor master suite, 3-car garage, 1+ acre.

9 FORDYCE MANOR

$1,049,000 Functional and updated. Expanded Town and Country home. 5BR, 6,500SF.

$699,000 Fabulous family home in La Hacienda! Movein condition, neutral decor, spacious, 4BR/4BA, pool.

1 PILLSBURY PLACE

$1,650,000 Cape Cod Colonial is elegant, yet warm and inviting. 1.69 acres, 4+BR/6+BA.

LADUE / CREvE COEUR/ OLIvETTE 3 SAINT ANDREWS DRIvE ~ UNDER CONTRACT #8 MAYFAIR ROAD ~ OPEN SUN 1-3

Home Search

$369,000 Ladue Schools, 4BR/2.5BA, 2,634 SF. Newer Kitchen, finished LL, fenced in backyard.

$1,375,000 5BR/5.5BA, two story brick home in soughtafter area. Newer updates thruout. Saltwater pool.

$2,900,000 A state-of-the-art smart home, 7BR/8BA. Updated and distinctively decorated for luxury living.

12817 DUBON LANE ~ UNDER CONTRACT

$1,295,000 Unparalleled ranch w/ 8,500SF. Custom wine cellar, home theater, gourmet kitchen. 1.45 Acres.

18 CLERMONT LANE ~ UNDER CONTRACT

$795,000 Charming 4BR/3.5BA Colonial. Walking distance to Wydown Boulevard hotspots.

$3,699,000 Maritz & Young masterpiece. 10,000+SF on 2 manicured acres in St. Louis Country Club grounds.

12116 CARBERRY PLACE $1,289,000 Refined executive home in Barrington Place. 5BR/6BA. 4,740SF, pool. Walkout fin. LL. In-law suite.

$164,900 Webster cottage, 2BR/1BA, maple cabinets and hardwood floors.

CENTRAL WEST END / DEMUN 51 WESTMORELAND PLACE

12088 LAKE PLACID ~ UNDER CONTRACT

$2,295,000 Historic manse restored to its original splendor! Beautiful entry 8BR/7BA, pool.

5215 LINDELL BOULEvARD

$1,399,900 Elegant Lindell mansion. All new systems. CatV/voice data/dual coax. 4BR/5BA 7,000SF total.

$3,249,500 Huntleigh Estate. 11,000SF. 3.5 acres. Pool. Majestic, expansive views.

6370 ALAMO AvENUE ~ OPEN SUN 1-3

3 BRIDLE LANE

9999 LITzSINGER ROAD

$2,275,000 Custom 8-year-old Frontenac 1.5 story. 5BR/8BA/8,500SF including fin. LL. Ladue Schools.

$419,000 Charming 4BR, 1800+SF cottage-style home in popular DeMun area.

719 DOMINION DRIvE ~ UNDER CONTRACT

1316 LITzSINGER WOODS LANE ~ UNDER CONTRACT

$1,699,900 7 years new in Frontenac. 4BR/7BA/8,500SF including finished LL. Pool. Home theater. Luxurious.

SAINT LOUIS COUNTY 7250 CHRISTOPHER DRIvE ~ UNDER CONTRACT

$865,000 4BR/4.5BA with main-floor master. All bedrooms are suites. Condo alternative.

34 BURROUGHS LANE

$825,000 5 Bedrooms / 7 Baths. Finished walk-out lower level. Unique floor plan with 2 main level bedrooms.

108 NORTH MOSLEY ROAD

TOWN & COUNTRY/ CHESTERFIELD 527 WINDY HILL ACRES LANE

$829,900 Central Ladue location with 4 bedrooms, 4,300SF and a finished living area. $799,000 Traditional 2 story home in Ladue schools. 5BR/4BA on almost an acre with pool and pool house.

Since 1936

l

$550,000 Spectacular river views from this bluff home on 1.9 acres. One of only 6 owning right up to the river.

1126 BELLA vISTA DRIvE

7729 BOARDWALK TOWER CIRCLE

$124,900 Beautiful end unit in Winghaven. 2BR/2.5BA, Loft, new carpet, many upgrades! Walk to Boardwalk!

1366 HAMPTON ROAD

$114,900 3BR/2.5BA move-in ready condo with recent updates. Low-maintenance & conveniently located!

$1,499,000 4BR Colonial on 6+ secluded acres, manicured lawn, pool and guest cottage.

www.gladysmanion.com

l

| 314.721.4755 JUNE 26, 2013

townandstyle.com

| 53


314.725.0009 We would like to welcome the following Sales Associates who recently joined our company.

new listing! kay hoffman

lynda nicholson

4 soMerset downs | ladue 1091 wings | st. albans 5 bedrooMs, 9 baths $3,250,000 15.7 acres $8,900,000 la charrette is one Missouri’s most important estates stunning contemporary estate on 3 park-like acres with in the area. 12,000+ sq. ft. of living space. Pool/hot tub. 10,000+ sq. ft. of total living space. guest house. 16 years old.

new Price!

new Price!

41 clerMont lane | ladue 5 bedrooMs, 6½ baths $1,335,000 More than 6,000 sq. ft. of refreshed, open & stunning comfort in this white colonial brick manse. Pool.

228 lancaster drive | clayton 5 bedrooMs, 3½ baths $1,300,000 luxurious contemporary home. stunning foyer, vaulted great rm. excellent for entertaining. oversized 3-c gar.

10 Fielding road | ladue 4 bedrooMs, 4 baths $950,000 california-style house on an acre in ladue. custom redesigned & new kitchen. Master wing w/ private deck.

21 kingsbury Place | central west end 6 bedrooMs, 3½ baths $699,000 outstanding architectural details highlight this gracious home. French doors open to rear garden & pool.

4976 Pershing Place | central west end 6 bedrooMs, 4½ baths $899,000 enjoy the charm & elegance of the world’s Fair era w/ timeless updates in every room of this beautiful manse.

#3 sunnyMeade | ladue 4 bedrooMs, 3 baths $519,000 exemplary bright cottage sits on nearly a half-acre lot. updated & maintained. Finished lower level. 2-c garage.

54 |

new listing! 9701 ladue road | ladue 23 lenox Place | central west end 6 bedrooMs, 4½ baths $1,195,000 6 bedrooMs, 3½ baths $1,285,000 gracious colonial on 1.13-acre lot in a park-like setting. glamorous & stunning residence with historical 5600+ sqft of comfortable living space. 3-c gar. Pool. significance on a double lot. 1st floor sunroom addition.

new Price!

new listing!

16512 kingsPointe lake ln. | clarkson valley 4 bedrooMs, 3½ baths $825,000 stunning 1½-story home with kitchen/hearth room, great room, library, 3 fireplaces & walkout lower level.

4909 laclede ave. #2103 | central west end 2 bedrooMs, 2½ baths $825,000 Park east tower executive penthouse with unmatched views of the city. Elegant living & free flowing floor plan.

1 saPPington sPur | oakland 14 leMP road | kirkwood 3 bedrooMs, 3½ baths $699,000 4 bedrooMs, 5 baths $675,000 stunning contemporary on a lushly landscaped lot w/pool. incredible home with many additions & updates since it sophisticated kitchen, screened porch & guest house. was first built. Well-appointed & spacious! 1-acre lot.

new Price! 226 south Forest ave. | webster groves 4 bedrooMs, 3½ baths $509,900 spacious home on private half-acre lot. Finished lower level with wet bar, bath & office. Large deck.

oPen sunday 1-3 8025 Maryland avenue #17a | clayton Maryland walk $2,795,000 Penthouse residence offers sweeping views to the north, south & west. stunning architectural details.

30 kingsbury Place | central west end 6 bedrooMs, 3½ baths $650,000 Magnificent Georgian Colonial in sought-after kingsbury Place. stunning home w/updated kitchen.

oPen sunday 1-3

new Price!

523 north and south rd. | university city 3 bedrooMs, 2½ baths $489,000 beautiful 2-story townhome with 2,600+ sq. ft. Fresh & move-in ready! Open floor plan. Attached 2-car garage.

22 ladue ridge | ladue 3 bedrooMs, 2 baths $439,900 wonderfully well-built, 1950’s brick ranch on almost one acre backing to a lush, sloped & private yard.

See style |all of our listings at www.dielmannsothebysrealty.com TOWN&

JUNE 26, 2013


PHOTO LEISURE ALBUM

314.725.0009

oPen sunday 1-3

new Price!

oPen sunday 1-3

155 carondeLet PLaza #905 | cLayton the crescent $2,725,000 one-of-a-kind penthouse represents the highest standards in luxury. the 1st of 4 extraordinary custom penthouses.

10 terry hiLL Lane | westwood 3 bedrooMs, 3½ baths $1,498,000 Architecturally significant mid-century modern gem renovated using the finest luxury materials.

10822 KennerLy road | sunset hiLLs 4 bedrooMs, 4½ baths $1,490,000 this truly unique home offers many extras, including an indoor pool, 2 wine cellars, catering kitchen, plus more!

16441 waLnut raiL road | cLarKson vaLLey 5 bedrooMs, 5½ baths $1,390,000 exceptional home set on picturesque 3+ wooded acres backing to lake. Perfectly appointed throughout. Pool.

new Price!

new Price! oPen sunday 1-3

29 rio vista drive | Ladue 5 bedrooMs, 4½ baths $995,000 once-in-a-lifetime home in premier location. Professionally gut-rehabbed & enlarged english manor home.

1809 bach avenue | KirKwood 6 bedrooMs, 5½ baths $975,000 Picturesque 9-year-new custom home on 3 levels with top quality finishes. In-law suite. Beautiful 1-acre lot.

8331 university drive | cLayton 44 overhiLLs drive | Ladue 4 bedrooMs, 4 fuLL & 2 haLf baths $1,145,000 6 bedrooMs, 4½ baths $999,000 one-of-a-kind contemporary located in clayton gardens, unique opportunity on a tranquil 3.2-acre property. one of clayton’s most sought-after neighborhoods. classic center hall colonial. Large kitchen & walkout LL.

new Price!

new Listing!

2365 MaybrooK | KirKwood 4 bedrooMs, 4½ baths $815,000 beautiful 4,087 sq. ft. home on large lot offers updated kitchen/hearth room & 2-story great room.

13204 cLayton road | town and country 4 bedrooMs, 4½ baths $799,000 beautiful & private 1½ story with sun room, lower level media room & walkout to salt water pool.

12583 durrow ct. | town and country 5 bedrooMs, 4 fuLL & 2 haLf baths $769,000 warm & inviting home with updates throughout. 2-story great room overlooks patio & pool. finished LL.

230 s. gore avenue | webster groves 5 bedrooMs, 3 baths $649,000 renovated Queen ann century home. walk to everything. Premier street. new 2-car garage.

14 McKnight Lane | Ladue 3 bedrooMs, 3½ baths $599,000 Quiet cul-de-sac, walking distance to local elementary school & shopping. updated kitchen, living spaces & systems.

6339 waterMan | university city 4+ bedrooMs, 3½ baths $595,000 a gem in the crown of sought-after Parkview; this home is exceptional. spacious yet cozy living spaces. Pool.

6843 waterMan avenue | university city 5 bedrooMs, 3½ baths $549,900 exceptional ames Place home! beautifully built with light-filled rooms & custom millwork. 3-car garage.

new Listing!

new Listing! oPen sunday 1:30-3:30

new Listing!

oPen sunday 1-3

2026 ann avenue | south city 4 bedrooMs, 3½ baths $284,500 Fabulous rehab wood floors, granite countertops & stainless appliances. Master bedrooms suite.

4928 bucKinghaM #2e | centraL west end 3 bedrooMs, 1½ baths $259,000 Lovely, sophisticated, & spacious condo tucked away on private street right-in-the-heart of cwe.

709 s. sKinKer bLvd. #201 | forest ParK area 3 bedrooMs, 2 baths $219,000 Light-filled unit in the elegant Versailles Condominium centrally located on skinker across from forest Park!

new Listing!

7645 carswoLd | cLayton 3 bedrooMs, 3½ baths $357,900 charming 2-story home with updated kitchen & baths, open floor plan & finished lower level.

new Listing! 20 coLoniaL hiLLs drive | Ladue schooLs 4 bedrooMs, 2½ baths $715,000 beautifully maintained 2 story with large great room overlooking private one-acre lot.

new Listing!

See all of our listings at www.dielmannsothebysrealty.com | | 55 JUNE 26, 2013

townandstyle.com


NEIGHBORHOOD [OPEN] [GEMS HOUSES

>> sunday 6/30 <<

COMPTON HEIGHTS

[ 63017 ]

805 FAIRFIELD LAKE DRIVE | $369,900 | NOON-2 P.M. | 314.721.4755 GLADYSMANION.COM 14429 PEMBURY DRIVE | $314,900 | 2-4 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63040 ]

17119 CAMBURY LANE | $249,900 | NOON-2 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63104 ]

2026 ANN AVE. | $284,500 | 1:30-3:30 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM 2903 ACCOMAC ST. | $159,900 | 2-4 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63105 ]

NO. 1N, 30 BRIGHTON WAY | $549,000 | 1-3 P.M. | 314.997.4800 | JANETMCAFEE.COM 46 CRESTWOOD DRIVE | $815,000 | 1-3 P.M. | 314.997.4800 | JANETMCAFEE.COM 733 MIDDLE POLO DRIVE | $1,269,000 | NOON-2 P.M. | 314.997.4800 JANETMCAFEE.COM NO. 905, 155 CARONDELET PLAZA | $2,725,000 | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM NO. 17C, 8025 MARYLAND AVE. | $2,795,000 | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM NO. 201, 709 S. SKINKER BLVD. | $219,000 | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63117 ]

7363 GOFF AVE. | $329,900 | 2-4 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63122 ]

750 HAVENWOOD CIRCLE COURT | $675,000 | NOON-2 P.M. | 314.721.4755 GLADYSMANION.COM 1809 BACH AVE. | $975,000 | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63124 ]

8 MAYFAIR ROAD | $2.9 MILLION | 1-3 P.M. | 314.721.4755 | GLADYSMANION.COM 408 S. WARSON ROAD | $2,499,000 | 1-3 P.M. | 314.721.4755 | GLADYSMANION.COM 26 CLERMONT LANE | $2,399,000 | 1-3 P.M. | 314.721.4755 | GLADYSMANION.COM

[ 63128 ]

10822 KENNERLY ROAD | $1.49 MILLION | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63130 ]

523 NORTH AND SOUTH ROAD | $489,000 | 1-3 P.M. | 314.725.0009 DIELMANNSOTHEBYSREALTY.COM

[ 63131 ]

8 LONG MEADOWS LANE | $2.22 MILLION | 1-4 P.M. | 314.997.4800 JANETMCAFEE.COM 2158 EAST DRIVE | $487,500 | 1-2 P.M. | 314.997.4800 | JANETMCAFEE.COM 51 FRONTENAC ESTATES | $570,000 | 1-3 P.M. | 314.997.4800 | JANETMCAFEE.COM

[ 63141 ]

301 CHASSELLE AVE. | $649,000 | 1-3 P.M. | 314.997.4800 | JANETMCAFEE.COM 24 MUIRFIELD LANE | $799,000 | 2:30-4:30 P.M. | 314.721.4755 | GLADYSMANION.COM 121 LADUEMONT DRIVE | $475,000 | 1-3 P.M. | 314.721.4755 | GLADYSMANION.COM

COMPTON HILL WATER TOWER >>

The glow of the full moon falls softly through the open window of the Compton Hill Water Tower. Visitors who climb the 198 stairs to the pinnacle find a panoramic view of the city, quiet in the darkness but unmistakably St. Louis, with the Arch’s limbs falling to earth like moonbeams. Of the seven standpipe water towers still extant in the U.S., two are in St. Louis. This one, built in 1898 to equalize water pressure and prevent powerful surges, looks down from Reservoir Park, the city’s highest point. Built of rusticated limestone, brick and terra cotta in the French Romanesque style, the exterior suited the Victorian decorative demands of the day by concealing the unattractive piping. A bare woman cast in bronze stands guard at the tower’s flank. She is The Naked Truth, a tribute to three German-American editors of the St. Louis Westliche Post, which gave Joseph Pulitzer his first byline. Adolphus Busch was the major donor of the statue, which was to be a gift to the city from the German-American Alliance. Busch balked when he saw sculptor Wilhelm Wandschneider’s nude figure design, but the artist refused to drape her. As a compromise, the commissioning jury asked that she not be carved from white marble to minimize the appearance of bare skin. The statue was unveiled in 1914, two months before the outbreak of World War I. Improved technology rendered the water tower obsolete in 1929. It fell into disrepair, despite being named to the National Registry of Historic Places, and was threatened with demolition until a preservation society organized its renovation in 1999. Now, passersby intrigued by the minaret may climb its iron stairs the first Saturday of the month and on evenings when the moon is full.

COMPTON HEIGHTS CONCERT BAND >>

The giant rose windows aren’t the first features newcomers to Immaculate Conception Catholic Church notice. Neither is the grand altar, nor the vaulted ceiling. It’s the reverberating sounds of Sousa that really draw attention. The 1908 church at 3120 Lafayette Ave. now serves as the rehearsal hall for the Compton Heights Concert Band, a community ensemble that spends its summers playing American standards. Formed in 1976 by neighborhood resident and bassoonist Harry Swanger, the band is composed of players of all ages and professions, from high school students to retirees—and even includes T&S staffer/clarinetist Rebecca Koenig. Picnickers gather in Francis Park on Sundays and Tower Grove Park on Mondays for evening concerts of marches, show tunes and classical repertoire, supplemented by performances by guest artists. Recent December holiday concerts at Powell Symphony Hall and Peabody Opera House featured internationally known musicians, such as organist rock star Cameron Carpenter and The Mariachi Los Camperos de Nati Cano band. The ensemble has an unlikely source of income: It runs weekend bingo games at Bandwagon Hall.

THE FLEUR-DE-LYS MANSION >>

26 CLERMONT LANE

8 MAYFAIR ROAD

56 |

TOWN&style

|

JUNE 26, 2013

408 S. WARSON ROAD

805 FAIRFIELD LAKE DRIVE

by rebecca koenig | photos by bill barrett

A red-brick residence on Russell Boulevard has seen the comings and goings of Compton Heights for exactly 100 years. Now a bed-and-breakfast, the Fleur-de-Lys Mansion was not unique in its day its exterior symmetry, but for its mirror-image interior. William Beckman of the W.E. Beckman Bakers and Confectioners Supply Company had the 17-room home built in 1913 for him and his wife to live on one side and his grown daughter’s family to occupy the other. Forecasting the modern duplex, each wing had a complete parlor, dining room, kitchen, butler’s pantry, bathroom and two bedrooms. Servants lived on the top floor beside a ballroom. The house was abandoned and vandalized in the ’70s, but a young couple bought and repaired it in 1989. The B&B, operating since 1996, takes its name from the unconventional fleur-de-lys endcap on one of the chimney supports (and, of course, from the city’s French heritage).


12386 Creekhaven - Des Peres - $589,000 Built-ins, surround sound, and large windows admonish the family room of this lovingly maintained and updated Berkley Manor listing. Many professional design elements throughout.

1751 North Woodlawn Avenue - Ladue - $4,700,000 Presiding over 20 plus sub-dividable acres with tiered brick terrace, swimming pool, pool house, tennis courts, and gazebo, this substantial home has been orchestrated with amazing architectural details. Includes enormous, elegant spaces and fabulous “Gone With the Wind” staircase.

155 Carondelet Plaza, #309 - Clayton - $1,125,000 One-of-a-kind, like-new condo has expansive outdoor living space with large terrace. Gourmet kitchen and spacious master suite with luxurious bathroom are part of the huge, open floor plan.

ble, d ors, the

9014 Stonebridge - Richmond Hgts. - $475,000 Lovely three-bedroom ranch in a central location with great curb appeal includes a very petty pool area, circular driveway, and attached two-car garage.

14341 Manderleigh Woods Dr. - T & C - $799,000 Stately, executive-style home with first-floor master bedroom, two-story great room with wall of windows that looks out to the woods, and cherry island kitchen with double ovens and butler’s pantry. Beautiful, private lot!

Clayton - 314.725.5100

616 Garland Place - Warson Woods - $700,000 This builder/owner whole-house renovation was recently featured in Country Living magazine. Nearly 1,800 square feet were added to the original home including a gorgeous kitchen with everything a wish list could possibly contain: over-sized center island complemented by custom designer palette, custom cabinets, top-of-the-line appliances, beautiful off-white granite, and walk-in pantry.

www.lauramccarthy.com

Town & Country - 314.569.1177


TOWN & COUNTRY $899,000 1865 South Mason Road 4 Bedroom, 3 Baths NEW LISTING

SAINT LOUIS, 63105 $529,000 801 South Skinker, Unit 12A 3 Bedrooms, 3 Baths NEW LISTING

LADUE I $2,095,000 712 South Price Road 4 Bedrooms, 5.5 Baths NEW LISTING

CREVE COEUR $1,099,000 177 Plantation Drive 7 Bedrooms, 6.5 Baths NEW LISTING

LADUE $449,500 33 Magnolia Drive 3 Bedrooms, 3 Baths NEW LISTING

LADUE I $845,000 51 Briarcliff 4 Bedrooms, 3.5+ Baths NEW LISTING

8800 Brookview Drive, Crestwood NEW LISTING. Offered at $169,900.

1009 S. Mcknight Road, Richmond Heights NEW LISTING. Offered at $299,000.

30 Berkshire Drive, Richmond Heights NEW PRICE. Offered at $705,000.

51 Berkshire Drive, Richmond Heights Offered at $780,000.

3 Bobolink, Oâ&#x20AC;&#x2122;Fallon NEW LISTING. Offered at $360,000.

1521 Dietrich Place Court, Unincorporated Offered at $385,000.

43 Kingsbury Place, CWE Offered at $599,000.

680 Henry Avenue, Ballwin Offered at $449,000.

9889 clayton road I saint louis, missouri 63124

www.janetmcafee.com I 314.997.4800


Barbara Wulfing 314.277.3285

New Listings by Barbara Wulfing

Lifetime Sales Over $550 Million Five Star Agent Past 5 Years

712 S. Price Road, Ladue Offered at $2,095,000. 8 year old French Country home on secluded 1.8 acres. Co-listed with James L. Manion

40 Auburndale Drive, Creve Coeur Offered at $1,350,000. 10 year old home, main floor master, complete attached guest quarters, six bedrooms, five-and-a-half baths and pool.

925 N. Sappington Road, Glendale Offered at $659,000. Charming 100 year old home that has been stunningly updated and renovated.

1837 Stenton Path, Chesterfield Offered at $529,000. Fantastic kitchen/breakfast room addition. Finished walkout lower level plus bonus room. Co-listed with James L. Manion

49 Fair Oaks, Ladue Offered at $1,295,000. 2-story home in perfect condition with 4BR/5.5BA,pool and garage space for 4 cars.

10 Country Life Acres, Town & Country Offered at $1,175,000. Seclusion and privacy. Stunning 2 acre lot. Modern additions and amenities, 5,831 square feet. Pool.

33 Magnolia, Ladue Offered at $449,500. Charm Galore! Fabulous master bedroom suite, huge deck overlooking private and fenced landscaped yard. Co-listed with James L. Manion

17929 Greyabbey Court, Chesterfield Offered at $855,000. Stunning custom country French home. Located In convenient and desirable Greystone Subdivision. Co-listed with Larry Levy

14608 Summer Blossom Lane, Chesterfield Offered at $569,000. Delightful two-story with three finished levels and a pool. Huge master suite and with newer luxury bath.

Other Great

Listings

8 Long Meadows Lane, Town & Country xxxxx Orrville Road, Wildwood 1 Little Lane, Ladue 168 N. Central Avenue, Clayotn 10588 Frontenac Woods, Frontenac 1 Little Lane, Ladue (LOT) 816 S. Hanley Road, Unit 1C

$2,200,000 OPEN 6/30 1-4 PM $1,850,000 $1,700,000 $1,195,000 COMING SOON $879,900 Co-listed with Larry Levy $595,000 $119,900 NEW PRICE

janet mcafee real estate | 9889 clayton road | saint louis, missouri 63124 | 314.997.4800 | www.janetmcafee.com


Natural-looking water features such as waterfalls and smaller splash pools or fountains provide an element that is both functional and beautiful. A free-form pool by Liquid Assets features a 20-foot waterfall made of Missouri fieldstone boulders to complement the natural surroundings.

the great outdoors

NATURAL WATER FEATURES

trending

EDIBLE LANDSCAPES

Don’t relegate fruit and vegetable gardens to a boring square box. Try ‘edible landscaping’ and incorporate them into your overall landscape design. “I encourage clients to incorporate herbs, fruit trees and berry plants into their ornamental container plantings,” says landscape architect Mary Deweese of Acorn Landscapes. In this planter, she’s combined a super dwarf nectarine and herbs with inedible coleus.

Summer has arrived! Time to live outdoors, enjoying fun in the sun with family and friends. In 2013, the backyard has reinvented itself. Why have a plain old patio when you can have a stylish outdoor room? These trends take leisure time to a new level.

BY AMY BURGER

Retaining walls seem like a boring necessity but they can be attractive and eco-friendly at the same time, like plant-filled walls by The Living Wall Company. “The structures we depend on can no longer just accomplish one goal. They must embrace living systems wherever possible and deliver maximum environmental service along with the expected structure,” says owner Mark Woolbright.

60 |

TOWN&style

|

JUNE 26, 2013

PHOTO COURTESY OF MISSOURI BOTANICAL GARDEN

CREATIVE RETAINING WALLS

RAIN GARDENS

With St. Louis’ average annual rainfall around 39 inches, a rain garden provides a natural solution to yards that flood. “It uses the deep roots of native plants to help absorb the water,” says landscape architect Meg Bergen of Horstmann Brothers Landscape Services. The rain garden should be at least 10 feet from your house so it doesn’t cause problems with water in your basement.


OUTDOOR LIVING ROOMS

Traditional patios and decks are giving way to more complete ‘outdoor living rooms’ defined by partial walls, ceilings, flowing curtains and pergolas filled with quality furniture upholstered in weather-resistant fabrics. “Raising the level of finish and detail on the exterior space provides a smoother transition from the adjacent interior space and becomes an extension of it,” says Michael Rechan of Michael Lauren Development.

PHOTO BY SUZY GORMAN

OUTDOOR TECHNOLOGY

Enhance your outdoor room with the latest technology. “People are increasingly installing outdoor entertainment products such as TVs, architectural speakers, wireless control systems, and more,” says Tony Vieira, VP of sales for The Sound Room. Just remember, there are differences between outdoor and indoor tech products so select accordingly. PHOTO COURTSY OF ETC, HOME AUTOMATION TECHNOLOGY

PHOTO BY BILL BARRETT

OUTDOOR KITCHENS

With outdoor entertaining a major focus of family life, “People are taking the outdoor culinary experience to the next level with custom built-in outdoor kitchens and islands, including grills, refrigerators, sinks and storage,” says Bob Holman, general manager of Amini’s Home, Rugs and Game Rooms. Attached dining or bar seating areas are popular as well.

FIREPLACES AND HEARTHS:

Many are upgrading from small, portable fire pits to full outdoor fireplaces with chimneys built into patios. Some even include a wood-burning oven for the chef. “Outdoor hearths create a gathering place where people like to hang out. Building a fire becomes a family event,” says Richard Poynter, owner of Poynter Landscape Architecture and Construction. JUNE 26, 2013

|

townandstyle.com

| 61


HOMEWORK] DEAR HOMEWORK,

We are about to paint, rather than restain our 26-year-old cedar and stone house, in an attempt to give it a long overdue face-lift. We would welcome other suggestions as far as landscaping, hardscaping, new columns/doors, etc., to try to ‘charm up’ our rather bland-looking domicile. Most of our front landscaping did not survive last summer’s heat wave, so it seems a full makeover is warranted. Help! ——— DESPERATELY SEEKING CURB APPEAL

DEAR DESPERATELY SEEKING CURB APPEAL, I think your house has a lot going for it and I commend your use of upgraded doors on your front-facing garage. A lighter color on the dark cedar siding will have a huge impact, and I think a khaki green would blend well with the existing stone walls and blue shutters. AFTER Next, I would add some new stone features, such as an arched portal at the entry porch and a longer, taller retaining wall to give the house a more completely detailed feel. Some new details such as brackets to support the box-bay window, a new corner-supported coach lamp and flower boxes would also contribute to a more upmarket feel. For the landscape, I would trim back the tree to the right of the entry porch and get rid of everything else close to the house. I would plant a low, informally clipped hedge on top of the new retaining wall, which will form an effective backdrop for hundreds of red tulips. Finally, I would remove three panels of concrete from the driveway to allow for planting between the ‘tire tracks’ to soften the effect of a double-width driveway on the smallish front yard. These changes impart a happier, more European feel to the property and upgrade the curb appeal considerably. Hope this helps. ——— HOMEWORK

BEFORE

HOMEWORK IS PENNED BY PAUL DOERNER, PRESIDENT, THE LAWRENCE GROUP. IF YOU WOULD LIKE YOUR HOME CRITIQUED, CONTACT US AT HOMEWORK@TOWNANDSTYLE.COM

UNDER CONTRACT

8 MAYFAIR ROAD ~ $2,900,000

A state of the art smart home, 7BD/8BA. Updated and distinctively decorated for luxury living.

18 DARYL LANE ~ $397,000

Level, park-like 3/4 acre in heart of Ladue. 3BR/2.5BA, walk to a trio of Ladue schools, dining & shopping.

UNDER CONTRACT

SUZIE WELLS

JERRI BRYANT

k 540.6804

973.8761

13039 STARBUCK ROAD ~ $879,000

Updated Colonial on 1+ acre lot in Wheatfield Farms. Backs to park. 62 |

TOWN&style

|

JUNE 26, 2013

REALTOR®

l

Since 1936

l

www.gladysmanion.com

l

314.721.4755


Spectacular

LIFESTYLE

Follow the winding road to this secluded estate on the shores of Lake Richard just north of Alton, Illinois... step across the threshold and into pure elegance and discover one of the most unique homes in the entire St. Louis region.

• 9,000 sf main house with 5 bedrooms, 7 baths 2 • gourmet kitchens with Wolf and Sub-Zero appliances • 2 luxurious master suites with walk-in closets • State-of-the-art home theatre • Extensive millwork, custom interior doors, built-ins abound • High-end fixtures and finishes • Magnificent east-facing sunroom • Four-car garage with roomy home office located above • 45 minutes from St. Louis on 80 acres at the shore of a fullystocked 22-acre private lake

Call for a private tour:

618-406-0461

Materials used: Granite and limestone countertops in the kitchens Travertine, slate and ceramic tile floors in the kitchens and baths Brushed cyprus, cedar beams, oak, cherry, walnut and hickory

• • •

Other property features: 2 bedroom 1,200 sf guest house Three-slip, fully-enclosed boat house with gas dock Separate electrical building houses industrial-sized generator 2,000 sf dock constructed of eco-friendly Trex® deck material with sandy beach and outside shower

• • • •

$2,100,000

privatelakeestate.net

paradiS e

JUNE 26, 2013

|

townandstyle.com

| 63


beauty...more than skin deep

your spectacular dream home built by Michael Lauren: itâ&#x20AC;&#x2122;s not just another pretty face. it exudes Quality, Integrity and Impeccable Design. We make the custom home experience satisfying with our end-to-end service, which encompasses lot acquisition, architectural design, zoning approval, construction management and post-construction design finishes. Ultimately, your home is a reflection of you. itâ&#x20AC;&#x2122;s our passion to bring that vision to life.

Call Mike Rechan at 314.374.3846 for a free custom home consultation. View our portfolio at MichaelLauren.com 8301 MaRyLand aVenue

~ Suite 100 ~ CLayton MiSSouRi 63105


TO ADVERTISE

CALL + JANIE SUMNER = 314.749.7078 ONLINE + TOWNANDSTYLE.COM EMAIL + JSUMNERTOWNANDSTYLE.COM

ACCOUNTING/TAXES

CLEANING SERVICES

GUTTERS/ROOFING

CPA FIRM FOR SMALL AND MEDIUM

IRONING PICK UP & DELIVERY

THE GUTTER GUY

SIZED BUSINESSES Affordable Accounting, Tax, Payroll & Guidance Solutions. Call Tom at 314-448-4264 www.tomdunncpa.com

ANTIQUES/ COLLECTIBLES

Reasonable Rates Excellent References 314-862-4138

CONCRETE/MASONRY

HANDYMAN SERVICES

WANT TO BUY

Old postcards, old photographs, stereo views, posters, WW2 and before military items, old toys and trains, glass lantern slides, advertising items, worlds fair, medals, documents, letterheads, billheads, most any vintage paper items & ephemera, collections & accumulations OK...If it is unusual & old I am interested in looking at it... Please call MIKE FINLEY 314-524-9400 OR 314-341-2389 EMAIL paper-boy@charter.net

CAMPS LANCE VODICKA TENNIS CAMP

Held in Forest Park.

“Inspiring and developing junior tennis players from grade school to college!!!”

We have weeks available from: (July 1- August 8) (AM/PM/Full Day) We also offer year-round Private & Group Lessons (all ages). Stringing, Clinics, and More... EMAIL: lancevodicka@aol.com

CLEANING SERVICES SCRUBBY DUTCH CLEANING

stamped Concrete | exposed aggregate Concrete Countertops | acid staining Decorative Walls | seat Walls

MIKE’S HOME SERVICES

314-324-4173

Free estimates

EDUCATION/TUTORS **SEWING LESSONS** All Ages 9 Years & Up 314.757.3763

Family Owned & Operated Since 1983

314-849-4666 or 636-926-0555 www.scrubbydutch.com

Bright Cleaning Specialist

We Specialize in Chandelier Cleaning

Drapery Cleaning On-Site Pressure Washing And Much More Years of Service 314-484-0128 BrightClean.net

A/C - New, Repair, Maintenance. Storm, Roof & Gutter Repair. Haul. Sewer/Drain, Basement Waterproofing. Plumbing • Electrical • Painting Decks • Hardwood, Tile & Carpet Repair & Installation. Ref’s Available. Mike 314-265-4568 mikec4333@gmail.com Fully Insured • All Work Guaranteed

HAULING

CERTIFIED EDUCATION TUTOR

MO Certified - Special Ed. Certified K-8 ALL Subjects. Math - 7th Grade Through College Linda 314-313-3536 CERTIFIED DYSLEXIA TUTOR & SCREENING SPECIALIST Get your child to grade level or above in reading, spelling & math. 25+yrs experience. M.A., Brown University International Dyslexia Association Member. Excellent References. Free consultation call: Heidi at 207-522-0248 E-Mail heidiodrake@me.com

GOT TRASH?

Call Rod; For Entire House Cleanout, Yard Waste Removal, Appliances, Hoarding Situations & More. Same Day Service. 314-713-HAUL (4285) Thank You!

HEALTH & FITNESS PURE PILATES PLUS

Pilates is great for the core! Pilates transforms the way your body looks, feels and performs.... Call Kim at 314-753-3600 purepilatesplus.com stl.com

ELECTRICAL

stl.com

Bonded • Insured • Supervised $10 Off For 1st Time Customers Free Estimates by Phone Satisfaction Guaranteed

Cleaning, Repairs, Drainage Solutions, Screen Installation & Window Cleaning Professional, Reliable & Insured No Mess Left Behind • Free Estimates Contact Tony 314-413-2888 thegutterguy-stl@hotmail.com

Want new lighting? Need a Panel upgrade? Want to know about the safety and code compliance of your stl.com electrical system? Your Electric is our business. 20 Yrs. Experience. Free Estimates! 314-814-3897 www.yourelectricstl.com

HEALTHCARE SERVICES ADULT DAY CARE

yourELECTRIC

ESTATE BUYING JSD ESTATE BUYERS

Moving or Downsizing? We eliminate your headaches. We buy entire or partial estates. Immediate payment since 1976. Call Jamie at 314-997-1707 A division of Albarre’ Jewelry

Mom or Dad would love to get out! My home is accessible, loving & active. Social worker, therapist & Certified Home Healthcare Specialist, on staff. This is a loving, caring environment. meals, entertainment, games, arts & crafts, exercise, all inclusive care. Call now for information and to discuss possibilities for your loved one! Near Ross/Olive/Page extension. 314.560.5567

HELP WANTED EMPLOYMENT OPPORTUNITY We are looking for an experienced full-time sales representative to join our rapidly growing publication. Candidate should have a minumum of three years sales experience preferably in media-related environment. Great opportunity and fantastic work environment. Please send resume and references to jobs@townandstyle.com or mail to: Sales Rep,

LAWN & GARDEN

YEAR ROUND MAINTENANCE • Mulching • Edging all Garden Beds • Cutting Back Perennials • New Plantings • Seasonal Pots Specializing in Landscape Design & Year Round Maintenance Call 314-498-0877

Town & Style 121 Hunter Ave., Ste. 201, St. Louis, Mo 63124.

Town & Style is an equal opportunity employer.

HOME IMPROVEMENT PATRICK INTERIOR FINISH, LLC

Specializing in Interior Home Remodeling. Carpentry, Dry Wall, Taping, Painting, Tiling, & Hardwood Flooring. Over 25 Years Exp. NO PAY UNTIL JOB COMPLETE Honest Day’s Work for Honest Day’s Pay. Ref’s Avail. Licensed & Bonded. Call Patrick 314-415-0377

DBL GROUND OAK MULCH

All Natural 12 Cubic Yards $465 20 Cubic Yards $750 Delivered & Spread 314-808-3330

PAINTING

LAWN & GARDEN

Complete Lawn Maintenance for Commercial & Residential Spring Cleanup, Mulching, Mowing, Edging, Turf Maintenance, Planting, Sodding, Seeding, Weeding, Pruning, Trimming, Bed Maintenance, Dethatching, Leaf & Gumball Cleanup, Brush Removal, Retaining Walls, Paver Patios & Drainage Solutions Liscensed Landscape Architect/Designer

Member of BBB For a Free Estimate Call 314-426-8833 www.mplandscapingstl.com

LAWN CARE

Dethatching Aeration Spring Clean Up Overgrowth Removal & More! Call Rod 314-713-4285 Thanks

Commercial/Residential, Interior/Exterior Painting. Drywall, Plaster & Stucco Repair. Power Washing, Deck Staining. 314-489-9279 Fully Licensed & Insured. www.diversified-painting.com

DECK STAINING BY BRUSH ONLY No Spraying No Rolling • No Mess Specializing in Hardwood Decks Work Guaranteed • Insured • Ref’s NO MONEY DOWN Cedar Beautiful 314-852-5467 314-846-6499 www.cedarbeautiful.com

M & M CUSTOM PAINTING Interior & Exterior Painting, Staining, Powerwashing, Wallpaper Removal. Insured and Free Estimates. Dependable. Owner & Operator Matt 314-401-9211

JUNE 26, 2013

|

townandstyle.com

| 65


PLUMBING

TREE SERVICES

TUCKPOINTING

TONY LAMARTINA PLUMBING

A+ rated from BBB Serving St. Louis for over 30 years 314.965.9377 www.TonyLaMartinaPlumbing.com $20 off any service call Please present ad - Expires 7/30/13

REAL ESTATE- FOR SALE 94.5 ACRE FARM IN WARRENTON, MO

45 minutes West of St. Louis All blacktop roads, pole barn, small pond, deep well, electric, fruit trees, grapevines , old homesite, very private. $3,800 per acre. 314-954-2223

SERVICES WE BUY DIAMONDS, JEWLERY, GOLD, SILVER, COINS, WATCHES! Family Operated Immediate Payment 636-391-6622

Diamond & Jewelry Brokers, Inc.

www.thediamondfam.com 35 years of service

FRANK THEUS COUNSELING confidential, singles & couples, veterans, professionals, clergy f.theus746@gmail.com 573-880-4518 verified by Psychology Today

TRAVEL

Complete Tree Service for Residential & Commercial Tree Removal, Brush Removal, Pruning, Plant Healthcare, Deadwooding, Stump Grinding, Deep Root Fertilization, Cabling & Storm Cleanup Over 40 Years Experience For a free estimate call 314-426-2911 or email us at info@buntonmeyerstl.com

Stump Removal • Trimming • Shaping • Removals Cabling • Landscaping • Spraying • Residential Commercial • Plant Healthcare

636-391-9944

www.omnitreeservice.com Free Estimates • Certified Arborist Member Local & National Arborists Associations

AFFORDABLE TREE SERVICE

Professional Service at a Reasonable Price. Call Michael Baumann’s Affordable Outdoor Services for a free property inspection at 636-375-2812 You’ll be glad you called!

COLE TREE SERVICE

For travelers with a discerning taste for luxury and truly extraordinary experiences, TopFlight Travels creates fully customized itineraries, giving you access to VIP treatment throughout your travels.

• Trimming & Pruning • Tree & Stump Removal • Lot Clearing • Deadwooding • Storm damage clean up We Accept Credit Cards Insured/FREE Estimates www.cole-tree-service.biz 636-475-3661

314-608-4553 julie@topflighttravels.com www.topflighttravels.com Tim Gamma – B.S. Horticulture Board Certified Master Arborist PRUNING ■ FERTILIZATION ■ PLANTING SPRAYING ■ TRIMMING ■ REMOVAL

314-725-6159

Insured gammatree.com

TUCKPOINTING & MASONRY 20+ Years Experience ALL WORK GUARANTEED Complete Home Tuckpointing Spot Tuckpointing with Color Match Chimney Repair & Rebuilding Brick or Stone Patio & Walkway Repair Insured tuckpointingandmasonry.com 314-352-4222 All Major Credit Cards Accepted

VACATION PROPERTIES GULF COAST CONDO

Carillon Beach, FL, Destin Area 3BR, 3BA, 3 pools, tennis courts and so much more! Great Rates. Available NOW! Call Dave at 314-922-8344 For Pictures Please Visit www.vrbo.com/148365

CHALET AT INNSBROOK

Sleeps 11 on 3 private wooded acres. Finished lower level/game room. Private Hot tub & fire pit. Available year-round for stays of 2 nights or more. Full details & calendar at www.vrbo.com/424270 or call Janet at 314-750-2553 THE TOWERS AT PARKVIEW BAY OSAGE BEACH, MO This newer complex is designed with a huge Indoor/Outdoor pool, Workout room, Hot Tub, Sauna. 3Bdrm/2full Bth, beautifully decorated. Overlooks the lake, lg. w/o patio with spectacular view. Sleeps 8, 14x40 boat slip. Next to outlet mall. Vrbo#441553 or call 314-603-2463

WINDOW CLEANING

Our newly opened, family owned and operated, Residential Window Cleaning Company is insured, fast, and trusted by many. We offer FREE estimates, and get the job done right the first time. Call today. 314-322-0655 navarrowindowcleaning.com

+YOURCLASS IFIED COULD BEHERE+

DEADLINE WED. AT 5 P.M.

66 |

TOWN&style

|

JUNE 26, 2013

[SOLD] [ 63005 ]

$485,000 1420 Highland Valley Circle Agent: Gloria Gantner Laura McCarthy-Clayton Price per square foot: $137.04

[ 63017 ]

$620,000 324 White House Farm Drive Agent: Mary Beth Benes Coldwell Banker Gundaker-T & C Price per square foot: $178.88

[ 63105 ]

$700,000 No. 3F, 800 S. Hanley Road #3F Agent: Victoria Holton Keller Williams Realty St. Louis Price per square foot: $282.60

[ 63122 ]

$440,900 611 N. Clay Ave. Agent: Carole Fitzgerald Red Key Realty Leaders St. Louis Price per square foot: $209.55

[ 63124 ]

$675,000 15 Berkshire Drive Agent: Grace Lowell Janet McAfee Price per square foot: $254.14

[ 63124 ]

$725,000 9 Black Creek Lane Agent: Connie O’Keefe Janet McAfee Price per square foot: $188.80

[ 63130 ]

$582,000 533 Purdue Ave. Agent: Betsy Kerner Prudential Select Properties Price per square foot: $218.22

[ 63131 ]

$1.2 million 509 Hickory Lane Agent: Carole Bernsen Coldwell Banker GundakerKirkwood/Webster Groves Price per square foot: $252.9

[ 63141 ]

$854,000 832 Masonridge Road Agent: Mary Beth Benes Coldwell Banker Gundaker-T & C Price per square foot: $245.05


Lindenwood University’s

J. Scheidegger Center for the Arts 2013 – 2014 Season Performances An Evening with Martin Short

Sept. 14, 2013 | 8:00 PM

Swing This starring Debbie Boone & The Tommy Dorsey Orchestra

Oct. 12, 2013 | 8:00 PM

Lynn Anderson in Concert

Oct. 18, 2013 | 8:00 PM

An Evening with Frankie Avalon

Oct. 19, 2013 | 8:00 PM

Christmas with The Lettermen

Dec. 13, 2013 | 8:00 PM Dec. 14, 2013 | 2:00 & 8:00 PM

Christmas Traditions with The Lennon Sisters

Dec. 15, 2013 | 5:00 PM

Christmas with Marilyn McCoo & Billy Davis, Jr. of the 5th Dimension

Dec. 20, 2013 | 8:00 PM Dec. 21, 2013 | 2:00 PM

The Moscow Festival Ballet presents Giselle

Jan. 25, 2014 | 8:00 PM

The Haifa Symphony Orchestra of Israel

Feb. 25, 2014 | 8:00 PM

Celtic Nights -- Journey of Hope: A Night of Music, Song & Dance

Mar. 2, 2014 | 2:00 PM

The Gershwin Project starring Peter Nero

Mar. 8, 2014 | 8:00 PM

Reflections of Dean Martin & Frank Sinatra starring Deana Martin

Mar. 22, 2014 | 8:00 PM

The Addams Family -- A Musical: The National Tour

Apr. 6, 2014 | 8:00 PM

Memphis -- The Musical: The National Tour

Apr. 21, 2014 | 7:00 PM

Wayne Newton in Concert

May 17, 2014 | 8:00 PM

…and more, including dance concerts, free music series, fashion shows, and free speaker events.

July 1: Renewal of Season Tickets July 15: New Season Ticket Sales July 29: Special Online Presale August 5: Single Ticket Sales Join our mailing list by calling the Box Office or visiting www.LindenwoodCenter.com to stay up to date on all performances offered at Lindenwood’s J. Scheidegger Center for the Arts. “Performing at Lindenwood’s J. Scheidegger Center in St. Charles was wonderful! It was so easy to get to and everyone was extremely friendly. I can’t wait to come back!”

- Bobby Vinton -

2300 West Clay Street - Saint Charles, MO 63301 | www.lindenwoodcenter.com | (636) 949-4433 JUNE 26, 2013

|

townandstyle.com

| 67


13980 Manchester Road

636-227-5000 GalleryMotorCo.com

LEAnSowING available!

2011 Infiniti M37

2011 Audi A4 Quattro | $29,990 Manual, 27k miles, premium plus package, navigation, rear park aid, heated seats, HID headlights, blutooth, rain sensing wipers, back-up camera, universal garage door, MP3, satellite radio, local one owner.

wheels, pwr mirrors, keyless, rear camera.

2012 Volvo XC60

Nav, rear parking aid, back-up camera, DVD, chrome 22” wheels, luggage rack, sunroof, 3rd row seating, remote start.

$23,990 2009 BMW 328i

One owner, tan interior, alloy wheels, Bluetooth, satellite radio, roof rails, keyless entry, power seat.

Local one owner, low miles, manual, terracotta leather, 19” sport aluminum wheels, heated seats, 6 CD, LED lights.

Local one owner, DVD, sunroof, leather, heated seats & steering wheel, park assist, back-up camera, SmartKey, power liftgate.

$21,990 2009 BMW 328xi

Low miles, gray leather, sunroof, heated seats, cold weather package, prem. pkg., memory seats and fog lights (blue).

One owner, gray leather, 7 passenger, 2nd row captains, 17” alloys, spoiler, heat seats, running boards, luggage rack.

$22,990

AWD, automatic, tan leather, sunroof,

cold weather package, heated seats, power seats with memory.

Two To choose from

2007 Mazda 3

$9,290 2011 Ford Fiesta

Automatic, sunroof tan interior, alloy wheels, steering wheel controls, power windows and power locks. |

N

2009 Porsche 911 Carrera S $59,990

eek ~ w e h t f o ~ Deals

TOWN&style

MANCHESTER ROAD

$34,990 2007 Cadillac Escalade AWD $27,990 2008 Mercedes GL550 $27,990 2009 GMC Acadia SLT $23,990

AWD, 24k miles, nav, sunroof, leather heat/ cool seats, sat. radio, Bluetooth,USB,18” alloy

68 |

I-270

BARRETT STATION ROAD

e

MASON ROAD

13980 Manchester Road

WEIDMAN ROAD

141

Automatic, gray interior, low miles, 28 mpg, keyless entry, power windows and locks.

$12,750

Come visit us in West County at 13980 Manchester Road in Manchester 63011

JUNE 26, 2013


Town&Style St. Louis 06.26.13