Campbell Essential Biology Plus Mastering Biology with Pearson eText -- Access Card Package, 7E Eric

Type:

Test Bank

Resource:

Campbell Essential Biology Plus Mastering Biology

Edition:

7th Edition

Author(s):

Eric J. Simon Jean L. Dickey Jane B. Reece

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 1 Learning About Life 1.1 Multiple Choice Questions 1) In what way(s) is the science of biology related to our society?

A) by helping us understand the genetics of our pets B) by examining the importance of biodiversity C) through the study of green energy D) all of the answers are correct Answer: D Topic: Biology and Society Skill: Remember/Understand Learning Outcome: 1.1 Global LO: 5, 7 2) What is biology?

A) the scientific study of life B) the scientific study of the environment C) the scientific study of DNA D) the scientific study of ecosystems Answer: A Topic: Biology and Society Skill: Remember/Understand Learning Outcome: 1.2 3) Which function is NOT a property of life?

A) Populations of organisms rarely change over time.

B) Living things exhibit complex but ordered organization.

C) Organisms take in energy and use it to perform all of life's activities.

D) Organisms reproduce their own kind.

Answer: A Topic: 1.2 The Properties of Life Skill: Remember/Understand Learning Outcome: 1.5 Global LO: 7 4) What are the two main processes upon which ecosystems depend?

A) speciation and evolution B) nutrient recycling and energy flow C) decomposition and nutrient recycling D) sunlight and photosynthesis Answer: B Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.12 1 .

5) Which substance is NOT recycled but rather is lost from ecosystems?

A) nitrogen B) energy C) magnesium D) carbon Answer: B Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.12 6) Which structure can perform all the activities required for life?

A) DNA molecules B) cells C) organelles D) nuclei Answer: B Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.13 7) What name is given to the functional compartments of a cell?

A) genomes B) nuclei C) genes D) organelles Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.13 8) What are genes composed of?

A) insulin B) organelles C) tissues D) DNA Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.11

2 .

9) What is a gene?

A) a type of cell B) an organelle that houses DNA C) a type of hormone D) a unit of inheritance Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.11 10) Which concept was proposed by Darwin?

A) energy flow B) ecosystem structure C) ocean warming D) natural selection Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.8 11) Which of these is required for natural selection to occur?

A) inheritance B) unequal reproductive success C) individual variation D) all of the answers are correct Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.9 12) What does "adaptation" mean in an evolutionary context?

A) the way an individual's body adjusts to its environment B) the accumulation of favorable variations in a population over time C) the ability of organisms to alter their appearance under changing environmental conditions D) all of the answers are correct Answer: B Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.8 Global LO: 7

3 .

13) What process accounts for the different breeds of domesticated dogs?

A) overproduction B) natural selection C) competition D) artificial selection Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.9 Global LO: 5 14) Over a span of two decades in the 1900s, scientists measured changes in the beak size of a population of Galápagos ground finches. These data could provide ________.

A) evidence of natural selection in action.

B) an example of artificial selection.

C) an example of overproduction.

D) evidence used by Darwin for his theory of evolution Answer: A Topic: 1.3 Major Themes in Biology Skill: Evaluate/Create Learning Outcome: 1.9 15) Science is ________.

A) the inquiry-based effort to describe and explain nature B) the search for truth C) an organized set of principles for how to behave ethically and morally D) all of the answers are correct Answer: A Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.2 Global LO: 1 16) Which of these statements is CORRECT? A) Scientific ideas are subjected to repeated testing.

B) Science can be used to prove or disprove the idea that deities or spirits cause earthquakes and other natural disasters.

C) Science does not require observations that other people can confirm.

D) Only exploratory science can lead to important conclusions about nature.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.2 Global LO: 1

4 .

17) Which statement is a valid scientific hypothesis?

A) Human history is determined by a series of supernatural events.

B) Humans should help in the conservation of other animal species.

C) Humans are controlled by forces beyond our understanding.

D) Humans and bacteria share a common genetic code.

Answer: D Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.3 Global LO: 1, 2 18) A hypothesis is a(n) ________.

A) a proposed explanation for a set of observations B) guess made in order to determine what observations and explorations are necessary C) observation made in order to determine a theory D) theory determined after data collection Answer: A Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.3 Global LO: 1 19) You try to start your car, but it does not start. Which of these is a prediction?

A) My car's battery is dead.

B) If I recharge the battery, then my car will start.

C) My car is too old to function properly.

D) What is wrong with my car?

Answer: B Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.2 Global LO: 1, 2 20) Which sequence shows the steps of the process of science in an order in which they might occur?

A) experiment, conclusion, exploration, application B) question, observation, experiment, analysis, prediction C) exploration, hypothesis, prediction, experiment D) exploration, question, opinion, conclusion, hypothesis Answer: C Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.2

5 .

21) How do hypotheses differ from theories?

A) Theories are more comprehensive than hypotheses.

B) Theories must be testable; hypotheses do not need to be testable.

C) Hypotheses are educated guesses, and theories are tentative explanations.

D) Hypotheses are derived from experimentation, whereas theories are derived from observation.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.3 Global LO: 1 22) Antibiotic resistance evolves in bacteria when ________.

A) the presence of antibiotics favors bacteria that already have genes for resistance B) farmers do not use enough antibiotics in animal feed C) the antibiotics create resistance genes in bacteria D) the bacteria realize that they need to avoid the antibiotic Answer: A Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.9 Global LO: 5 23) Which information flow is disrupted when diabetes destroys insulin-producing cells?

A) The body is unable to respond to signals that indicate the amount of glucose in the blood.

B) Cells in the bladder are no longer able to send signals when the bladder fills.

C) The pancreas is unable to produce enzymes to break down proteins.

D) Appetite signals no longer regulate feeding.

Answer: A Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.11 24) Information flow in biological systems is necessary for negative (regulative) feedback to operate. Which of these examples does NOT involve flow of information providing feedback?

A) Heat receptors send signals to promote sweating.

B) Low blood sugar causes the liver to convert starch to sugar to be released in the blood.

C) Drought kills many trees.

D) Bacterial genes for breaking down lactose are activated in the presence of lactose.

Answer: C Topic: 1.3 Major Themes in Biology Skill: Evaluate/Create Learning Outcome: 1.11 Global LO: 2, 7

6 .

25) Which results should occur if climate change leads to increased warming global temperatures?

A) Species competition will result in slower evolution in the tropics.

B) The tree line (at which it is too cold for trees to grow) moves toward the north and south poles.

C) Winters will be longer toward the poles.

D) Land animals will suffer fewer consequences than marine animals.

Answer: B Topic: 1.3 Major Themes in Biology Skill: Evaluate/Create Learning Outcome: 1.13 Global LO: 2, 5, 7

7 .

1.2 Art Questions 1) This figure shows the branching tree of life for bears. Which bear species is most distantly related to the sun bear?

A) brown bear B) sloth bear C) spectacled bear D) giant panda Answer: D Topic: Evolution Connection: Swimming with the Turtles Skill: Evaluate/Create Learning Outcome: 1.4 Global LO: 2, 3

8 .

2) In the process of evolution by natural selection illustrated in this figure, what is the mechanism or agent of natural selection?

A) artificial selection B) selective breeding C) selective predation D) genetic drift Answer: C Topic: 1.3 Major Themes in Biology Skill: Apply/Analyze Learning Outcome: 1.9 Global LO: 2 9 .

1.3 Scenario Questions Please use this information to answer the following question(s).

The collared lizard is a species found in the Desert Southwest. Male collared lizards show considerable color variation, ranging from brightly colored to a very dull pattern. Your goal is to determine the function, if any, of male color patterns in collared lizards, using the scientific method. Your tentative explanation is that male color plays a role in attracting females for mating purposes. You predict that females will preferentially choose brightly colored males over dull-colored ones. To test your prediction, you observed the interactions of female collared lizards with their male counterparts. You selected males that were the same age and size, and that differed only in their coloration pattern. You placed equal numbers of the two types of male lizards, bright and dull, in aquariums, along with one female lizard per aquarium. Out of 350 aquariums observed, the female chose to mate with the brightly colored male 277 times, and the dull-colored male 70 times. In three instances, the females did not mate with either type.

Create a bar graph of your data, plotting the type of male (dull-or brightly colored) on the x-axis.

On the y-axis, plot the frequency with which each type of male was chosen by females. Using this graph, answer the following questions.

1) Do the data support the conclusion that female collared lizards prefer more brightly colored male lizards over dull-colored males?

A) Yes, this conclusion is supported by the data.

B) No, this conclusion is not supported by the data.

C) The data does not clearly indicate a preference one way or the other.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.3 Global LO: 2, 3, 4, 9 2) Dull-colored males were used in this experiment to ________.

A) serve as a comparison (control) group to the brightly colored males.

B) be sure that females could recognize the gender of the other lizards.

C) give the experiment more trials so that the data would be more persuasive.

D) be sure all females had a male with which they could mate.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.2 Global LO: 1, 2, 9

10 .

3) What is the hypothesis of this case study?

A) Male collared lizards exhibit color variation.

B) Dull-colored males are less likely to be eaten by predators.

C) A function of male coloration is to attract females.

D) Males prefer brightly colored females.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.3 Global LO: 1, 2 4) "Male collared lizards show considerable color variation" This is a(n) ________.

A) hypothesis B) conclusion C) observation D) result Answer: C Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.2 Global LO: 1, 2 5) What conclusion can be drawn from the data?

A) Dull-colored females are more likely to choose dull-colored males.

B) Dull-colored males are likely to choose dull-colored females.

C) Brightly colored males are stronger and more fertile than dull-colored males D) Females do not always choose brightly colored males.

Answer: D Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.4 Global LO: 1, 2, 3, 4 6) If the proportion of brightly colored male lizards increased steadily in future generations, this would ________.

A) reject the original hypothesis B) be an example of evolution due to natural selection C) illustrate the relationship between structure and function D) demonstrate the flow of energy through a system Answer: B Topic: 1.1 The Scientific Study of Life, 1.3 Major Themes in Biology Skill: Evaluate/Create Learning Outcome: 1.3, 1.4, 1.9, 1.10, 1.12 Global LO: 2, 7

11 .

Scenario: Kenneth and Catherine Lohmann of the University of North Carolina explored the orientation or direction-finding abilities of loggerhead sea turtle hatchlings under varying magnetic conditions.

Hatchlings were placed in a tank of water in a laboratory either in the natural magnetic field of the earth OR in a reversed magnetic field in which north and south were flipped. The researchers then measured the direction that the hatchlings swam. The experiments were carried out in the dark and at night since that is when most newly hatched turtles migrate from their sandy nests into the ocean.

7) What is the variable being tested in this experiment?

A) time of day B) amount of light C) magnetic field D) time of hatching Answer: C Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.3 Global LO: 1, 2 8) What can be tested with this experimental design?

A) Turtles only hatch at night.

B) Hatchlings prefer sandy beaches to rocky beaches.

C) Hatchlings have the ability to orient using magnetic fields while swimming.

D) While crawling across the beach, hatchlings use the earth's magnetic field to find the sea.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.3 Global LO: 1, 2, 3, 9 9) In the experiment, hatchlings swam in one direction when exposed to the natural magnetic field of the earth, but in a different direction when exposed to the reversed magnetic field? What conclusion can be drawn from this?

A) The orientation of turtle migration is unrelated to the magnetic field.

B) It is now proven that all turtles use an inborn magnetic compass to orient their migration.

C) Turtle hatchlings can detect magnetic fields.

D) Hatchlings orient differently according to the direction of a light source.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.4 Global LO: 1, 2

12 .

10) After concluding their experiments, the biologists probably A) announced that they had proven a new theory of animal migration.

B) shared their data with colleagues to obtain feedback on the work.

C) filed away the data in case anyone should ever ask about these experiments and then went on to other types of experiments.

Answer: B Topic: 1.1 The Scientific Study of Life Skill: Evaluate/Create Learning Outcome: 1.3 Global LO: 1, 2, 9 11) The results of the Lohmanns' experiments are most likely to be considered credible if A) the Lohmanns are famous scientists.

B) the experiments were funded by a government grant.

C) the results were published in a peer-reviewed journal.

D) a great deal of time had been spent collecting hatchlings and running experiments.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.3, 1.4 Global LO: 1, 2 12) In determining factors that influence sea turtle migration, the exploration phase might include A) testing the influence of light and ocean current on migration.

B) publishing experimental results in a journal where studies are reviewed by other experts in the field.

C) using tracking devices to follow migration patterns.

D) performing statistical analyses of experimental results.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.3 Global LO: 1, 2 13) A study may be pseudoscience if A) the evidence is anecdotal.

B) the results are published in a journal where studies are reviewed by other experts in the field.

C) the experimenters used controlled experiments.

D) statistical analyses are performed on experimental results.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Apply/Analyze Learning Outcome: 1.3 Global LO: 1, 2

13 .

14) A reliable source about the usefulness of an herbal supplement is likely to be recognizable by all but one of these characteristics. Choose the exception.

A) The information is in a primary source.

B) The information is published in a peer-reviewed journal.

C) Many references are cited.

D) The authors are employed by the manufacturer of the supplement.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Remember/Understand Learning Outcome: 1.3 Global LO: 1, 9 15) In the figure shown, which animals are most closely related?

A) pigs and Hippopotamuses B) deer and Hippopotamuses C) whale and Hippopotamuses.

D) pigs and Whales.

Answer: C Topic: Evolution Connection: Swimming with the Turtles Skill: Apply/Analyze Learning Outcome: 1.4 Global LO: 1, 2, 3 16) The phrase "Most ecosystems are solar powered" refers to the fact that A) the sun shines on most ecosystems on earth B) energy in sunlight is turned into (becomes) sugars C) most organisms seek sunlight.

D) solar energy is converted to chemical energy by photosynthesis.

Answer: D Topic: 1.3 Major Themes in Biology Skill: Remember/Understand Learning Outcome: 1.12

14 .

17) Suppose a scientist wanted to determine if a substance retrieved from outer space alive.

Which of these properties of the substance would NOT help her make that determination?

A) having a clear orderly arrangement.

B) maintaining a constant temperature in an environment in which the temperature is variable C) being multicolored.

D) being made of cells.

Answer: C Topic: 1.2 The Properties of Life Skill: Apply/Analyze Learning Outcome: 1.6 18) Which properties of life are possessed by viruses and green turtles?

A) a clear orderly arrangement and ability to reproduce.

B) being made of cells and able to process energy C) being able to reproduce and able to process energy.

D) being made of cells and having an orderly structure.

Answer: A Topic: 1.2 The Properties of Life Skill: Apply/Analyze Learning Outcome: 1.7

15 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 2 Essential Chemistry for Biology 2.1 Multiple Choice Questions 1) How can radiation be controlled and safely used in medicine?

A) Apply radiation throughout the body at uncontrolled doses.

B) Apply radiation throughout the body at controlled doses.

C) Apply radiation to specific parts of the body at uncontrolled doses.

D) Apply radiation to specific parts of the body at controlled doses.

Answer: D Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.1 2) ________ is an example of an element.

A) Water B) Nitrogen C) Glucose D) Salt Answer: B Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.2 3) What are the four most common elements found in living organisms?

A) nitrogen, oxygen, phosphorus, and carbon B) carbon, oxygen, nitrogen, and hydrogen C) carbon, oxygen, potassium, and calcium D) oxygen, calcium, hydrogen, and carbon Answer: B Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.2 4) Which of the following elements is a trace element that is essential to life?

A) phosphorus B) carbon C) iron D) calcium Answer: C Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.3

1 .

5) In order to have a positive charge, an atom must have ________.

A) more protons than electrons B) more electrons than protons C) more neutrons than protons D) more protons than neutrons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.4 6) All atoms of an element have the same number of ________.

A) protons plus neutrons B) protons C) electrons D) neutrons Answer: B Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.4 7) An atom's ________ are found in its nucleus.

A) neutrons and protons B) protons only C) neutrons and electrons D) electrons, protons, and neutrons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.4 8) Beryllium's atomic mass is 9, and its atomic number is 4. How many protons are found in a beryllium atom?

A) 9 B) 13 C) 4 D) 5 Answer: A Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.4 Global LO: 2, 4

2 .

9) An uncharged atom of mercury has an atomic number of 80 and an atomic mass of 200. This atom has ________ protons, ________ neutrons, and ________ electrons.

A) 80; 120; 80 B) 120; 80; 120 C) 120; 280; 120 D) 80; 40; 80 Answer: A Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.4 Global LO: 2, 4 10) The way Earth moves about the sun is most like ________.

A) a neutron and electron moving around a proton B) an electron moving around the nucleus of an atom C) a proton moving about an electron D) a neutron moving about a proton Answer: B Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.4 Global LO: 2 11) Isotopes of an element have the same number of ________ and different numbers of ________.

A) protons; neutrons B) protons; electrons C) neutrons; protons D) electrons; protons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.5 12) How do radioactive isotopes differ from isotopes?

A) Radioactive isotopes have more neutrons than do isotopes.

B) Radioactive isotopes are stable; isotopes are unstable.

C) Radioactive isotopes have fewer neutrons than do isotopes.

D) Radioactive isotopes are unstable; isotopes are stable.

Answer: D Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.5

3 .

13) An atom with an electrical charge is a(n) ________.

A) isotope B) molecule C) ion D) compound Answer: C Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6 14) The bond between oppositely charged ions is a(n) ________ bond.

A) ionic B) polar C) hydrogen D) covalent Answer: A Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6 15) Consider the following reaction. What type of bond is holding the two atoms together?

K + Br → K+ + Br− → KBr A) covalent B) ionic C) hydrogen Answer: B Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.6 Global LO: 2 16) What name is given to bonds that involve the sharing of electrons?

A) covalent B) hydrogen C) ionic D) polar Answer: A Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6

4 .

17) Sulfur has an atomic number of 16. How many covalent bonds can sulfur form?

A) 1 B) 2 C) 4 D) 0 Answer: B Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.6 Global LO: 2, 4 18) The hydrogen and oxygen atoms of a water molecule are held together by ________ bonds.

A) ionic B) hydrogen C) covalent D) polar Answer: C Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6, 2.7 19) Why is water considered a polar molecule?

A) The oxygen atom is found between the two hydrogen atoms.

B) The oxygen atom attracts the hydrogen atoms.

C) The oxygen end of the molecule has a slight negative charge, and the hydrogen end has a slight positive charge.

D) Both hydrogen atoms are at one end of the molecule, and the oxygen atom is at the other end.

Answer: C Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.7 20) Adjacent water molecules interact with one another via ________ bonds.

A) covalent only B) ionic C) polar and covalent D) hydrogen Answer: D Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6, 2.7

5 .

21) Adjacent water molecules interact through the ________.

A) sharing of electrons between the hydrogen of one water molecule and the oxygen of another water molecule B) electrical attraction between the hydrogen of one water molecule and the oxygen of another water molecule C) sharing of electrons between adjacent oxygen molecules D) electrical attraction between the hydrogen atoms of adjacent water molecules Answer: B Topic: 2.1 Some Basic Chemistry Skill: Remember/Understand Learning Outcome: 2.6, 2.7 22) How many oxygen atoms are in the products of the following reaction?

C6H12O6 + 6 H2O + 6 O2 → 6 CO2 + 12 H2O A) 18 B) 6 C) 12 D) 24 Answer: D Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.8 Global LO: 2, 4 23) What are the reactant(s) in the following chemical reaction?

C6H12O6 + 6 H2O + 6 O2 → 6 CO2 + 12 H2O A) CO2 and H2O B) C6H12O6, H2O, and O2 C) O2 only D) C6H12O6, H2O, O2, CO2, and H2O Answer: B Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.8 Global LO: 2

6 .

24) Human body cells are approximately ________ water.

A) 95-99% B) 25-35% C) 50-55% D) 70-95% Answer: D Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9 25) The tendency of molecules of the same kind to stick together is called ________.

A) bonding B) cohesion C) polarity D) adhesion Answer: B Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9 26) Some tiny insects are able to walk on water. Why? A) Water has adhesive properties.

B) The surface tension that is a result of water's cohesive properties makes this possible.

C) The covalent bonds that hold a water molecule together make this possible.

D) A single insect is less dense than water.

Answer: B Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9 27) As water freezes, ________.

A) its molecules move farther apart B) it cools the surrounding environment C) its hydrogen bonds break apart D) the water molecules become less polar Answer: A Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9

7 .

28) Sugar dissolves when stirred into coffee. The coffee is the ________, the sugar is the ________, and the sweetened coffee is the ________.

A) solution; solvent; solute B) solute; solvent; solution C) solvent; solute; solution D) solution; solute; solvent Answer: C Topic: 2.2 Water and Life Skill: Apply/Analyze Learning Outcome: 2.9 Global LO: 2 29) Which of the following is an acid?

A) NaOH B) NaCl C) HCl D) CH4 Answer: C Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.10 30) A base ________.

A) removes H2O molecules from a solution B) decreases the pH of a solution C) removes OH− from a solution D) removes H+ from a solution Answer: D Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.10 31) The lower the pH of a solution, the ________.

A) the more basic the solution B) more acidic the solution Answer: B Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.10

8 .

32) Relative to a pH of 7, a pH of 4 has a ________.

A) 3,000 times higher H+ concentration B) 1,000 times higher H+ concentration C) 300 times higher H+ concentration D) 100 times lower H+ concentration Answer: B Topic: 2.2 Water and Life Skill: Apply/Analyze Learning Outcome: 2.10 Global LO: 2, 4 33) What name is given to substances that resist changes in pH? A) buffers B) solutions C) acids D) bases Answer: A Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.10 34) When a base is added to a buffered solution, the buffer will ________.

A) donate OH− B) accept water molecules C) donate H+ ions D) form covalent bonds with the base Answer: C Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.10 35) All of the following are potential negative impacts of ocean acidification except one. Choose the exception.

A) decreasing H+ concentrations B) coral bleaching C) changes in metabolism of marine animals D) increasing carbonic acid concentrations Answer: A Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9

9 .

36) A fossil was found and determined by radiometric dating to be 11,400 years old. What is the ratio of carbon-14 to carbon-12 in this fossil compared to its environment?

A) 12.5% B) 25% C) 37.5% D) 50% Answer: B Topic: Evolution Connection: Radioactivity as an Evolutionary Clock Skill: Apply/Analyze Learning Outcome: 2.12 Global LO: 2, 4 37) What is the outcome of evaporative cooling in the form of sweating?

A) a decrease in blood pH B) a decrease in air temperature C) a decrease in body temperature Answer: C Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9 38) Radiometric dating is based on ________.

A) the number of electrons in atoms B) the decay of radioactive isotopes C) the strength of bonds holding together atoms D) the rates of chemical reactions Answer: B Topic: Evolution Connection: Radioactivity as an Evolutionary Clock Skill: Remember/Understand Learning Outcome: 2.12 39) An atom has 20 protons, 20 neutrons, and 20 electrons. What atom is being described?

A) neon (atomic number 10) B) calcium (atomic number 20) C) zirconium (atomic number 40) D) neodymium (atomic number 60) Answer: B Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.4 Global LO: 2, 4

10 .

40) What type of cancer is treated with radioactive iodine seeds?

A) breast B) lung C) prostate D) skin Answer: C Topic: 2 The Process of Science Skill: Remember/Understand Learning Outcome: 2.5 Global LO: 5

11 .

2.2 Art Questions 1) In the following figure, all of the representations EXCEPT one clearly show double bonds for the oxygen molecule. Choose the exception.

A) electron configuration B) structural formula C) space-filling model D) ball-and-stick model Answer: C Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.6 Global LO: 2

12 .

2) Examine the pH scale below. How does grapefruit juice compare to lemon juice?

A) Grapefruit juice has 100 times higher H+ concentration than lemon juice.

B) Lemon juice has 10 times higher H+ concentration than grapefruit juice.

C) Lemon juice has 100 times higher H+ concentration than grapefruit juice.

D) Grapefruit juice has 10 times higher H+ concentration than lemon juice.

Answer: B Topic: 2.2 Water and Life Skill: Apply/Analyze Learning Outcome: 2.10 Global LO: 2, 4

13 .

3) The graph below shows data regarding radioactive decay of carbon-14. If decay continues to occur normally, how much C-14 will remain after 22,800 years?

A) 25% B) 12.5% C) 6.25% D) 3.125% Answer: C Topic: 2.1 Some Basic Chemistry Skill: Apply/Analyze Learning Outcome: 2.12 Global LO: 2, 3, 4

14 .

4) The data below are from three separate studies that tested different treatment options for prostate cancer. What can you conclude from these data?

A) The men who were treated with surgery were the healthiest group after 10 years.

B) Cancer progressed the least after 10 years for the men who received external radiation.

C) After 5 years all three treatment options had similar outcomes.

D) After 15 years it is expected that approximately 90% of men who received radiation seeds would have cancer that did not progress.

Answer: C Topic: The Process of Science: How Effective Is Radiation in Treating Prostate Cancer?

Skill: Apply/Analyze Learning Outcome: 2.5 Global LO: 2, 3, 5

15 .

5) The data below are from three separate studies that tested different treatment options for prostate cancer. Based on these data you might conclude that after 10 years, radioactive seeds are a more effective treatment option than external radiation for prostate cancer. What is a possible confounding factor that could lead to the results below?

A) The men who received external radiation were healthier at the start of the treatment than the men who received radioactive seeds.

B) The men who received external radiation had larger tumors than the men who received radioactive seeds.

C) The men who received radioactive seeds had additional types of cancers whereas the men who received external radiation only had prostate cancer.

D) The men who received radioactive seeds had poor diets compared to the men who received external radiation.

Answer: B Topic: The Process of Science: How Effective Is Radiation in Treating Prostate Cancer?

Skill: Evaluate/Create Learning Outcome: 2.5 Global LO: 2, 3, 5

16 .

2.3 Scenario Questions Please read the following scenario to answer the following questions.

The last few miles of the marathon are the most difficult for Heather. Her hair is plastered to her head, sweat clings to her arms, and her legs feel as if they had nothing left. Heather grabs a cup of ice water. The ice cubes smash against her nose as she gulps some cool refreshment and keeps on running. Then a breeze kicks up and she finally feels some coolness against her skin. Drops of sweat, once clinging to her forehead, now spill down, and Heather feels a stinging as the sweat flows into her eyes.

1) Why did the sweat on Heather's forehead and arms form drops?

A) because of the high salt content of sweat B) because of the cohesive nature of water C) because of the ability of water to moderate heat D) because of the high evaporative cooling effect of water Answer: B Topic: 2.2 Water and Life Skill: Apply/Analyze Learning Outcome: 2.9 2) When Heather grabbed the glass of ice water, the ice cubes were floating at the top. Why were the ice cubes floating in the water?

A) Water can store large amounts of heat.

B) Water can moderate temperatures through evaporative cooling.

C) The density of water decreases when it freezes.

D) Water has a cohesive nature.

Answer: C Topic: 2.2 Water and Life Skill: Remember/Understand Learning Outcome: 2.9

17 .

Please read the following scenario to answer the following questions.

While radioactive isotopes are used in medicine to identify tumors and other diseases, they can also be used to treat diseases such as cancer. One method to treat cancerous tumors is to expose them to radiation which can kill the cancerous cells and the tumor. In 2013, the U.S. Food and Drug Administration approved a new cancer treatment based on the radioactive isotope radium223; this isotope has a half-life of 11.4 days. The radioactive drug, known as Xofigo®, is injected into the patient's bloodstream and travels to certain regions of the body. Because it emits high-energy radiation over short distances, it can kill cancerous cells in the sites where it localizes.

After the drug was injected into a person, the following data were collected regarding the amount of radiation measured in different organs in the person's body.

Organ Brain Liver Bones Lungs Urinary bladder

Measured radiation 0.37 11.01 4262.60 0.27 14.90

3) Which of the following would be the best experiment to determine whether this drug is an effective treatment option for cancer patients?

A) Give the drug to a single cancer patient and ask him how he feels several months later.

B) Give the drug to a group of mice that have artificially induced tumors and measure whether their tumors are destroyed.

C) Give the drug to a group of cancer patients and measure whether their tumors are destroyed.

D) Give the drug to a single cancer patient and measure whether his tumor is destroyed.

Answer: C Topic: The Process of Science: How Effective Is Radiation in Treating Prostate Cancer?

Skill: Evaluate/Create Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 3, 5, 9 4) A cancer patient receives an injection of the drug on March 1. Suppose that the patient must receive a second injection once the amount of the drug decreases to less than 6% in his or her body. On approximately what day should the cancer patient schedule an appointment to receive another injection?

A) March 13 B) March 23 C) April 3 D) April 25 Answer: D Topic: 2.1 Some Basic Chemistry, 2 The Process of Science Skill: Evaluate/Create Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 4, 5, 9

18 .

5) Using the above table, what kind of cancer do you think Xofigo® is used to treat?

A) liver cancer B) bone cancer C) brain cancer D) lung cancer Answer: B Topic: 2.1 Some Basic Chemistry, 2 The Process of Science Skill: Evaluate/Create Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 3, 5, 9

19 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 3 The Molecules of Life 3.1 Multiple Choice Questions 1) People with lactose intolerance do not have enough ________.

A) lactose B) lactase C) glucose D) fructose Answer: B Topic: Biology and Society: Got Lactose?

Skill: Remember/Understand Learning Outcome: 3.1 Global LO: 5 2) A single carbon atom can form a maximum of ________ covalent bond(s).

A) 0 B) 1 C) 2 D) 4 Answer: D Topic: 3.1 Organic Compounds Skill: Remember/Understand Learning Outcome: 3.2 3) The molecule CH3–CH2–CH2–CH2–CH2–CH2–CH3 is best described as a(n) ________.

A) protein B) carbohydrate C) organic compound D) inorganic compound Answer: C Topic: 3.1 Organic Compounds Skill: Apply/Analyze Learning Outcome: 3.2 Global LO: 2 4) ________ is a hydroxyl group.

A) –NH2 B) –OH C) –COOH D) –H Answer: B Topic: 3.1 Organic Compounds Skill: Remember/Understand Learning Outcome: 3.2 1 .

5) In the following reaction, galactose is a ________. galactose + glucose → lactose + water A) polysaccharide B) monomer C) polymer D) protein Answer: B Topic: 3.1 Organic Compounds Skill: Remember/Understand Learning Outcome: 3.3 6) What name is given to this reaction: galactose + glucose → lactose + water?

A) hydrolysis B) dehydration Answer: B Topic: 3.1 Organic Compounds Skill: Remember/Understand Learning Outcome: 3.3 7) What name is given to the following reaction? sucrose + water → glucose + fructose A) hydrolysis B) dehydration Answer: A Topic: 3.1 Organic Compounds Skill: Apply/Analyze Learning Outcome: 3.3 Global LO: 2 8) Carbohydrates typically include ________.

A) an NH2 group B) C, H, and O atoms C) N and S atoms D) a PO4 group Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4

2 .

9) Which molecules listed below are isomers?

A) glucose and fructose B) glucose and sucrose C) sucrose and glucose D) lactose and maltose Answer: A Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 10) Complete the equation: monosaccharide + monosaccharide → ________ + water A) disaccharide B) polypeptide C) polysaccharide D) fat Answer: A Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 11) What can you conclude about the following reaction? galactose + glucose → lactose + water A) Glucose and lactose are both disaccharides.

B) This is an example of a hydrolysis reaction.

C) Lactose is a disaccharide and glucose is a monosaccharide.

D) Galactose and glucose are both polysaccharides.

Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 12) Table sugar is ________.

A) glucose, a monosaccharide B) glucose, a disaccharide C) sucrose, a monosaccharide D) sucrose, a disaccharide Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4

3 .

13) For good health, it is important to include ________ in our diets.

A) fructose B) monosaccharides C) disaccharides D) polysaccharides Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 Global LO: 5 14) Which molecule is an example of a polysaccharide?

A) glucose B) starch C) maltose D) sucrose Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 15) Plants use which molecule as an energy-storing carbohydrate?

A) cellulose B) glycogen C) starch D) maltose Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4 16) Cellulose is an example of a ________.

A) polypeptide B) steroid C) polysaccharide D) monosaccharide Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4

4 .

17) Which substance is hydrophilic?

A) cellulose B) testosterone C) butter D) cholesterol Answer: A Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.4 Global LO: 2 18) Sometimes when I have my morning coffee, which I drink black with no cream or sugar, I notice a thin film floating on top of the coffee. Since I have just read Chapter 3 of the text, I now realize the nature of this substance, and so I run to my friend screaming, "Look at this ________ in my coffee!"

A) hydrophilic substance B) hydrophobic substance C) disaccharide D) polysaccharide Answer: B Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.4 Global LO: 2, 5 19) A fat contains which molecular components?

A) three fatty acids only B) two fatty acids and one glycerol molecule C) three fatty acids and one steroid1 molecule D) three fatty acids and one glycerol molecule Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.5 20) What name is given to the following reaction? glycerol + 3 fatty acids → triglyceride + 3 water molecules A) hydrolysis B) dehydration Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.3, 3.5

5 .

21) Saturated fats are saturated with ________.

A) carbon B) nitrogen C) hydrogen D) oxygen Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.6 22) By definition, what type of fatty acid has double bonds?

A) unsaturated B) saturated Answer: A Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.6 23) Which substance is lowest in unsaturated fats?

A) beef B) salmon C) corn oil D) canola oil Answer: A Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.6 Global LO: 2, 5 24) A fat that is completed hydrogenated would be ________.

A) unsaturated and liquid at room temperature B) unsaturated and solid at room temperature C) saturated and solid at room temperature D) saturated and liquid at room temperature Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.6

6 .

25) Which outcome is a health effect of a diet high in saturated fats?

A) increased risk of infectious disease B) decreased risk of atherosclerosis C) increased risk of heart attack D) decreased risk of stroke Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.6 Global LO: 5 26) ________ is a steroid.

A) Butter B) Sucrose C) Amino acid D) Estrogen Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.7 27) A friend of yours appears to have put on a lot of muscle very quickly. At the same time, you notice that your friend seems to have a lot of mood swings and appears depressed. It is reasonable for you to suspect that your friend has begun to take ________.

A) amino acid supplements B) fish oils C) protein powder D) anabolic steroids Answer: D Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.7 Global LO: 2, 5, 7 28) Enzymes are ________.

A) amino acids B) monosaccharides C) lipids D) proteins Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.8

7 .

29) Proteins are polymers constructed from ________ monomers.

A) monosaccharide B) amino acid C) nucleotide D) fatty acid Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.8 30) Amino acids include a side group as well as ________.

A) a central carbon, a hydrogen atom, an amino group, and a carboxyl group B) a central carbon, a hydrogen atom, a hydroxyl group, and a carbonyl group C) a central nitrogen, a carbon atom, a hydroxyl group, and a carbonyl group D) a central nitrogen, a carbon atom, an amino group, and a carbonyl group Answer: A Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.8 31) What is the name given to the reaction that breaks peptide bonds?

A) dehydration B) hydrolysis Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.3, 3.8 32) A protein's function is dependent on environmental factors such as pH and temperature.

What property of the protein itself dictates a protein's function?

A) length B) shape C) size D) weight Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.8

8 .

33) Extremophilic bacteria are able to survive in hostile environments, including scalding hot water found in springs and vents that reach temperatures over 100°C. Researchers studying these bacteria measured the function of a protein from an extremophile bacterium at 100°C, and they also measured the function of a similar protein from a human cell at 100°C. Which results do you think the researchers obtained?

A) The bacterial protein functioned normally, whereas the human protein did not.

B) The human protein functioned normally, whereas the bacterial protein did not.

C) The bacterial protein and the human protein both functioned normally.

D) Neither the human protein nor the bacterial protein functioned normally.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Evaluate/Create Learning Outcome: 3.8 Global LO: 1, 2 34) Nucleic acids are polymers of ________ monomers.

A) monosaccharide B) fatty acid C) DNA D) nucleotide Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9 35) A specific stretch of DNA that contains information for the amino acid sequence of a polypeptide is a(n) ________.

A) gene B) protein C) nucleic acid D) enzyme Answer: A Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9 36) DNA nucleotides include ________.

A) uracil, guanine, adenine, and cytosine B) thymine, guanine, adenine, and cytosine C) thymine, uracil, adenine, and cytosine D) thymine, guanine, adenine, and uracil Answer: B Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9

9 .

37) Which statement is TRUE with regard to a DNA molecule?

A) The amount of adenine is equal to the amount of guanine, and the amount of thymine is equal to the amount of cytosine.

B) The amount of adenine is equal to the amount of cytosine, and the amount of guanine is equal to the amount of thymine.

C) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of uracil.

D) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9 Global LO: 4 38) If one strand of a DNA double helix has the sequence GACGTCA, what will be the sequence of the other strand?

A) GACGTCA B) ACTGCAG C) TGACGTC D) CTGCAGT Answer: D Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.9 Global LO: 2 39) How does RNA differ from DNA? A) RNA is double-stranded; DNA is single-stranded.

B) RNA is a polymer of amino acids; DNA is a polymer of nucleotides.

C) RNA contains uracil; DNA contains thymine.

D) In RNA G pairs with T; in DNA G pairs with C. Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9

10 .

40) A DNA molecule has the sequence TCAACTTGA. The equivalent RNA molecule would have the sequence ________.

A) TCAACTTGA B) UCAACUUGA C) UGTTCUUCT D) AGUUGAACU Answer: B Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.9 Global LO: 2 41) The ability to tolerate lactose throughout life most likely arose in ________.

A) populations that live in cold climates B) populations that live in wet climates C) cultures that keep dairy herds D) Native Americans Answer: C Topic: Evolution Connection: The Evolution of Lactose Intolerance in Humans Skill: Remember/Understand Learning Outcome: 3.11 Global LO: 5 42) What is the main sugar found in milk?

A) lactose B) sucrose C) glucose D) fructose Answer: A Topic: Biology and Society: Got Lactose?

Skill: Remember/Understand Learning Outcome: 3.1 Global LO: 5 43) Glucose is to starch as ________ are to proteins.

A) fatty acids B) polypeptides C) amino acids D) monosaccharides Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.4, 3.8

11 .

44) What is the genetic basis for lactose intolerance in humans?

A) a change in nucleotide sequence of the lactase gene B) a change in nucleotide sequence outside of the lactase gene C) a change in nucleotide sequence of the lactase RNA D) a change in the amino acid sequence of the lactase enzyme Answer: B Topic: The Process of Science: Does Lactose Intolerance Have a Genetic Basis?

Skill: Remember/Understand Learning Outcome: 3.10 45) People that are lactose intolerant have a functional copy of the lactase gene but are unable to digest lactose. Which statement must be TRUE about lactose-intolerant people?

A) They have the same lactase gene as lactose-tolerant people.

B) They produce a lactase enzyme but it does not fold properly.

C) They have a lactase gene made of RNA instead of DNA. D) They produce a lactase enzyme that digests glucose instead of lactose.

Answer: A Topic: The Process of Science: Does Lactose Intolerance Have a Genetic Basis?

Skill: Apply/Analyze Learning Outcome: 3.8, 3.9, 3.10 Global LO: 2

12 .

3.2 Art Questions 1) Examine the two sugars in the figure. How do these two sugars compare?

A) Glucose has more hydrogen atoms.

B) Glucose has more double bonds.

C) They have the same formula but different structures.

D) They are structurally identical in every way.

Answer: C Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.4 Global LO: 2

13 .

2) The figure below shows ________.

A) a single strand of RNA B) double-stranded RNA C) a single strand of DNA D) double-stranded DNA Answer: C Topic: 3.2 Large Biological Molecules Skill: Remember/Understand Learning Outcome: 3.9

14 .

3) Oleic acid is a fatty acid that occurs naturally in many animal and vegetable fats and oils.

What can you tell about oleic acid just by looking at its structure?

A) Oleic acid is an unsaturated fatty acid.

B) Oleic acid is a saturated fatty acid.

C) Oleic acid is a trans fatty acid.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.6 Global LO: 2, 3 4) The data below show the distributions of types of fats found in three different food products.

What can you conclude from these data?

A) Corn oil has a similar proportion of saturated fats as butter.

B) There is more total fat in a serving of palm oil than in a serving of corn oil.

C) Butter is a liquid at room temperature.

D) The majority of the fats in corn oil have double bonds.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.6 Global LO: 2, 3, 4 15 .

5) The female hormone progesterone (shown below) is involved in the menstrual cycle and pregnancy. Based on its structure, what type of macromolecule is progesterone?

A) fat B) steroid C) protein D) polysaccharide Answer: B Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.6 Global LO: 2, 3

16 .

3.3 Scenario Questions Please read the following scenario to answer the following questions.

While shopping at the grocery store, you take a look at three types of cookies. Summaries of the nutrition facts labels for the cookies are shown in the table below.

Amount per serving Saturated fat (g) Trans fat (g) Carbohydrates (g) Protein (g)

Chocolate mint cookies Peanut butter cookies 5 0 0 5 22 26 11 4

Chocolate caramel cookies 1 4 21 11

1) Compare the chocolate mint cookies and the peanut butter cookies. Which cookies are less healthy? Why? A) The chocolate mint cookies because they contain more saturated fat.

B) The chocolate mint cookies because they contain more total grams of protein and carbohydrates.

C) The peanut butter cookies because they contain more trans fat.

D) The peanut butter cookies because they contain more grams of carbohydrates.

Answer: C Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5 2) Compare the chocolate mint cookies and the chocolate caramel cookies. Are the chocolate caramel cookies healthier than the chocolate mint cookies? Why or why not?

A) No, because they have less saturated fat.

B) Yes, because they have less saturated fat.

C) Yes, because they have fewer grams of carbohydrates.

D) No, because they have more grams of trans fat.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Apply/Analyze Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5

17 .

3) The amount of carbohydrates in a food product is usually separated into two groups: 1) sugars, which refers only to mono- and disaccharides, and 2) fiber. Out of the 22 grams of total carbohydrates in the chocolate mint cookies, there are 12 grams of sugars and 2 grams of fiber.

All of the following statements EXCEPT for one are true about these cookies. Choose the exception.

A) There are more mono- and disaccharides than cellulose in the chocolate mint cookies.

B) There are 8 grams of carbohydrates in the chocolate mint cookies that are not monosaccharides, disaccharides, or fiber.

C) The majority of the carbohydrates in the chocolate mint cookies will be able to be broken down via hydrolysis reactions when eaten.

D) There are 6 grams of monosaccharides and 6 grams of disaccharides in the chocolate mint cookies.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Evaluate/Create Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5

18 .

Please read the scenario to answer the following questions.

Cooking oils, such as olive oil, are largely made up of unsaturated fats. If you have ever heated cooking oil in a pan, you might have noticed that eventually the oil begins to smoke. The temperature when this occurs is called the "smoke point." At the smoke point, the fatty acids and glycerol molecules that make up the unsaturated fats in the oil begin to break down and form smoke. Different oils have different smoke points, and these smoke points depend on the molecular composition of the oils. Below is a table with data for four different types of cooking oils, including their smoke points (values are for 1 tablespoon each [15 ml]).

Type of cooking oil Olive Avocado Canola Peanut

Calories 119 124 120 119

Saturated fat (g) Unsaturated fat (g) 1.9 11.4 1.6 11.9 1.0 12.0 2.3 10.3

Smoke Point (∘F) 375 520 400 450

4) Suppose that you wanted to conduct an experiment to determine the smoke points of the oils listed in the table. What would be the experiment that would give you the best information to determine which oil has the highest smoke point?

A) Add some olive oil to a pan, heat it over a flame, and measure the temperature of the oil when it begins to smoke. Repeat for the other three oils.

B) Mix all four oils in a pan, heat them over a flame, and measure the temperature of the oil mixture when it begins to smoke.

C) Add some olive oil to a pan, heat it over a flame, and measure how long it takes for the oil to begin to smoke. Repeat for the other three oils.

D) Mix all four oils in a pan, heat them over a flame, and measure how long it takes for the oil mixture to begin to smoke.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Evaluate/Create Learning Outcome: 3.5 Global LO: 1, 2, 5 5) Which statement about the data in the table is TRUE? A) Saturated fat content and smoke point are positively correlated (as saturated fat content increases so does smoke point).

B) There is a negative (inverse) correlation between unsaturated fat content and smoke point (as unsaturated fat content increases, smoke point decreases).

C) You can use the saturated fat content of an oil to reliably predict the smoke point of an oil.

D) Unsaturated fat content and smoke point are not correlated.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Evaluate/Create Learning Outcome: 3.5 Global LO: 1, 2, 3, 5

19 .

6) Corn oil has 1.8 g saturated fat and 7.0 g unsaturated fat per tablespoon. Based on the data in the table, what can you reliably conclude about the smoke point of corn oil?

A) The smoke point of corn oil is likely identical to that of olive oil.

B) The smoke point of corn oil is likely between 350 oF and 400 oF. C) The smoke point of corn oil is likely greater than 500 oF. D) The smoke point of corn oil cannot be reliably determined from the data in the table.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Evaluate/Create Learning Outcome: 3.5 Global LO: 1, 2, 3, 5

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 4 A Tour of the Cell 4.1 Multiple Choice Questions 1) Plants are susceptible to bacterial infections, which can damage their structure or even kill them. Which would be the best antibiotic to treat a plant that is infected with bacteria?

A) a drug that interferes with mitochondria function B) a drug that disrupts cell wall structure and function C) a drug that destroys the central vacuole D) a drug that blocks gene expression in circular chromosomes Answer: D Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells Skill: Evaluate/Create Learning Outcome: 4.1 Global LO: 2, 5 2) Which is a feature of prokaryotic cells but NOT eukaryotic cells?

A) fimbriae B) cell wall C) flagella D) ribosomes Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Remember/Understand Learning Outcome: 4.2 3) When using a microscope to view cells you obtained from scraping under your fingernails, you notice that the cells lack nuclei; therefore, you conclude that the cells must be a type of ________ cell.

A) plant B) eukaryotic C) fungal D) prokaryotic Answer: D Topic: 4.1 The Microscopic World of Cells Skill: Apply/Analyze Learning Outcome: 4.2 Global LO: 2

1 .

4) One difference between eukaryotic and prokaryotic cells is that eukaryotic cells ________ prokaryotic cells.

A) have DNA, which is lacking in B) have membrane-enclosed structures called organelles, which are lacking in C) have a plasma membrane, which is lacking in D) have a nucleoid region, which is lacking in Answer: B Topic: 4.1 The Microscopic World of Cells Skill: Remember/Understand Learning Outcome: 4.2 5) In eukaryotic cells, what name is given to the region that surrounds organelles but is not found inside the nucleus?

A) cytoplasm B) phospholipid bilayer C) nucleoid D) chloroplast Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Remember/Understand Learning Outcome: 4.2 6) You find a cell of a type you have never seen before. The cell has both a nucleus and a cell wall. Therefore, you conclude that it is likely to be a(n) ________ cell.

A) prokaryotic B) animal C) bacterial D) plant Answer: D Topic: 4.1 The Microscopic World of Cells Skill: Apply/Analyze Learning Outcome: 4.2 Global LO: 2 7) Which is a function of the plasma membrane?

A) regulate traffic of chemicals in and out of the cell B) regulate production of lipids in the cell C) regulate transport of DNA in and out of the nucleus D) regulate production of proteins in the cell Answer: A Topic: 4.2 Membrane Structure Skill: Remember/Understand Learning Outcome: 4.3

2 .

8) ________ are the major lipids of plasma membranes.

A) Steroids B) Fats C) Phospholipids Answer: C Topic: 4.2 Membrane Structure Skill: Remember/Understand Learning Outcome: 4.3 9) When mixed with water, phospholipids spontaneously form membranes because they ________.

A) have hydrophilic phosphate groups that are attracted to water and hydrophobic fatty acid tails that avoid water B) have hydrophilic fatty acid tails that are attracted to water and hydrophobic phosphate groups that avoid water C) have hydrophilic heads that are attracted to their hydrophobic tails Answer: A Topic: 4.2 Membrane Structure Skill: Remember/Understand Learning Outcome: 4.3 10) The concept of a membrane as a fluid mosaic reflects the ability of ________.

A) phospholipids and most proteins to drift about in the plane of the membrane B) phospholipids but not proteins to drift about in the plane of the membrane C) most proteins but not phospholipids to drift about in the plane of the membrane D) carbohydrates to drift into and out of the membrane Answer: A Topic: 4.2 Membrane Structure Skill: Remember/Understand Learning Outcome: 4.3 11) The extracellular matrix of animal cells ________.

A) protects and supports cells B) provides avenues for the exchange of DNA C) is a warehouse for the storage of extra lipids and carbohydrates D) is primarily a site of dead matter and waste materials Answer: A Topic: 4.2 Membrane Structure Skill: Remember/Understand Learning Outcome: 4.4

3 .

12) What is a gene?

A) A portion of a protein that contains information to produce DNA. B) A portion of DNA that contains information to produce a protein.

C) A portion of RNA that contains information to produce a protein.

D) A portion of DNA that contains information to produce additional DNA. Answer: B Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 13) The nuclear envelope is composed of ________.

A) chromatin B) DNA C) a double membrane D) carbohydrates Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 14) The structural combination of DNA and protein forms ________.

A) nucleoli B) RNA C) chromatin D) ribosomes Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 15) Most human cells contain ________ chromosomes.

A) 36 B) 46 C) 2 D) 23 Answer: B Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6

4 .

16) Which structure manufactures the components of ribosomes?

A) nucleus B) cytoplasm C) endoplasmic reticulum D) nucleolus Answer: D Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 17) All of the following options (except one) are locations where ribosomes are found inside the cell. Choose the exception.

A) inside the nucleus B) in the cytosol C) attached to the rough endoplasmic reticulum D) attached to the outside of the nucleus Answer: A Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 18) Where does protein synthesis take place?

A) in the nucleolus B) on smooth endoplasmic reticulum C) on ribosomes D) in the nucleus Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6 19) Information is transferred from the nucleus to ribosomes via ________.

A) mRNA B) rough endoplasmic reticulum C) DNA D) smooth endoplasmic reticulum Answer: A Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Remember/Understand Learning Outcome: 4.6

5 .

20) The endomembrane system includes ________.

A) ribosomes, lysosomes, vacuoles, and the endoplasmic reticulum B) Golgi apparatus, nucleolus, vacuoles, and the endoplasmic reticulum C) Golgi apparatus, lysosomes, ribosomes, and the endoplasmic reticulum D) Golgi apparatus, lysosomes, vacuoles, and the endoplasmic reticulum Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 21) A hormone that is secreted from a cell is manufactured by ribosomes ________.

A) attached to the rough endoplasmic reticulum B) attached to the Golgi apparatus C) attached to the plasma membrane D) inside the nucleus Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 22) Based on its function in detoxifying drugs, one would expect to find a large amount of smooth endoplasmic reticulum in ________ cells.

A) brain B) liver C) intestinal D) muscle Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 Global LO: 5 23) Functions of the smooth endoplasmic reticulum include ________.

A) steroid synthesis, protein synthesis, and drug detoxification B) lipid synthesis, protein synthesis, and drug detoxification C) lipid synthesis and drug detoxification D) lipid synthesis and storage of genetic information Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7

6 .

24) Transport vesicles move proteins from the endoplasmic reticulum to what other organelle?

A) mitochondria B) nucleus C) Golgi apparatus D) smooth endoplasmic reticulum Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 25) Which is a function of the Golgi apparatus?

A) digestion of organic matter inside the cell B) protein modification C) drug detoxification D) cell respiration Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 26) Which part(s) of a cell is (are) most like the shipping center of a company?

A) the Golgi apparatus B) mitochondria C) chloroplasts D) the nucleolus Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 27) Digestion of organic matter inside the cell takes place in what organelle?

A) Golgi apparatus B) mitochondrion C) lysosome D) rough endoplasmic reticulum Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7

7 .

28) If a cell's lysosomes burst, the cell would ________.

A) shrivel B) divide into two cells C) digest itself D) need to manufacture more lysosomes Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Apply/Analyze Learning Outcome: 4.7 Global LO: 2 29) Tay-Sachs disease results from ________ lacking a specific type of lipid-digesting enzyme.

A) the Golgi apparatus B) lysosomes C) mitochondria D) the endoplasmic reticulum Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 Global LO: 5 30) Vacuoles are ________.

A) membranous sacs B) manufactured by ribosomes C) composed of microtubules D) found only in plant cells Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 31) A protist that contains contractile vacuoles most likely lives ________.

A) in a marine environment B) within the cells of another organism C) in fresh water Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7

8 .

32) In plant cells, ________ may contain organic nutrients, pigments, and poisons.

A) mitochondria B) chloroplasts C) lysosomes D) central vacuoles Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 33) Plant cells, unlike animal cells, are characterized by the presence of a ________.

A) cell wall and a contractile vacuole B) cell wall and a central vacuole C) nucleus and a cell wall D) nucleus and a contractile vacuole Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.7 34) Cells in the thyroid gland produce and secrete thyroid hormone (a polymer of amino acids) that helps to regulate metabolism. What organelle is most likely abundant in cells of the thyroid gland?

A) mitochondria B) rough endoplasmic reticulum C) free ribosomes D) lysosomes Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Apply/Analyze Learning Outcome: 4.7 Global LO: 2 35) During a race such as a marathon, the skeletal muscle cells in your legs use a lot of energy to continually contract and power your muscles. What organelle is most likely abundant in skeletal muscle cells?

A) mitochondria B) Golgi apparatus C) smooth endoplasmic reticulum D) rough endoplasmic reticulum Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Apply/Analyze Learning Outcome: 4.7, 4.8 Global LO: 2, 5

9 .

36) Similar to the nucleus, chloroplasts and mitochondria are ________.

A) surrounded by two membranes B) able to synthesize carbohydrates C) manufactured by the nucleolus D) able to synthesize lipids Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Remember/Understand Learning Outcome: 4.8 37) What is the major function of chloroplasts?

A) to store water B) to degrade cellular waste products C) to manufacture proteins D) to allow for photosynthesis to occur Answer: D Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Remember/Understand Learning Outcome: 4.8 38) Cellular respiration can be described as the conversion of the energy ________.

A) of sunlight to energy stored in organic compounds B) stored in food molecules to energy stored in ATP C) stored in ATP to energy stored in food molecules D) stored in ATP to energy used to do work Answer: B Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Remember/Understand Learning Outcome: 4.8 39) Which adaptation increases the surface area of a part of a cell that is involved in cellular respiration?

A) cristae of a mitochondrion B) outer membrane of a chloroplast C) grana of a chloroplast D) outer membrane of a mitochondrion Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Remember/Understand Learning Outcome: 4.8

10 .

40) Which makes up portions of the cytoskeleton?

A) cilia B) flagella C) microtubules Answer: C Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Remember/Understand Learning Outcome: 4.10 41) Tobacco smokers (and those exposed to tobacco smoke) are at greater risk of an ectopic (tubal) pregnancy. Based on your understanding of the structures of the cytoskeleton, what is the BEST explanation for this phenomenon?

A) Tobacco interferes with the microtubule network of eggs, thus weakening their structure.

B) Tobacco interferes with the functioning of microtubules in sperm cells.

C) Tobacco interferes with microfilament formation in sperm, thereby forcing the zygote to implant in the tubes of the oviduct D) Tobacco interferes with sweeping motion of cilia that aids in the movement of the egg toward the uterus.

Answer: D Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Evaluate/Create Learning Outcome: 4.10 Global LO: 2, 5 42) The microscope best for viewing living cells at low levels of magnification is the ________.

A) light microscope B) scanning electron microscope C) transmission electron microscope Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Remember/Understand Learning Outcome: 4.2 43) You are working in the lab and want to use a microscope to examine the fimbriae of a bacterium at the highest magnification possible. What type of microscope should you use?

A) light microscope B) scanning electron microscope C) transmission electron microscope Answer: B Topic: 4.1 The Microscopic World of Cells Skill: Apply/Analyze Learning Outcome: 4.2 Global LO: 1, 2

11 .

44) What cellular structure do antibiotics typically target?

A) cell walls B) cell membranes C) mitochondria D) vacuoles Answer: A Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells Skill: Remember/Understand Learning Outcome: 4.1 Global LO: 5 45) Scientists are always on the hunt for new and more effective antibiotics. Suppose that a new antibiotic (antibiotic X) is discovered that may be able to kill MRSA (methicillin-resistant S. aureus), a particularly dangerous and resistant strain of bacteria. Which experiment would be best to conduct to determine if antibiotic X is more effective at killing MRSA than the antibiotic penicillin?

A) Treat a sample of MRSA with both antibiotic X and penicillin, and count how many MRSA cells are alive after three days.

B) Treat a sample of MRSA with only antibiotic X and a second sample of MRSA with only penicillin, and count how many MRSA cells are alive in each sample after three days.

C) Treat a sample of MRSA with only antibiotic X, and count how many MRSA cells are alive after three days.

D) Treat a sample of MRSA with only penicillin, and count how many MRSA cells are alive after three days.

Answer: B Topic: The Process of Science: How Was the First 21st-Century Antibiotic Discovered?

Skill: Evaluate/Create Learning Outcome: 4.5 Global LO: 1, 2, 5

12 .

4.2 Art Questions 1) Using the figure for a reference, approximately how many times larger is the smallest bacteria compared to an atom?

A) 10 times larger B) 100 times larger C) 1,000 times larger D) 10,000 times larger 13 .

Answer: C Topic: 4.1 The Microscopic World of Cells Skill: Apply/Analyze Learning Outcome: 4.2 Global LO: 2, 3, 4 2) Examine the structure of the plant cell in the figure. Which organelles connect(s) to the endoplasmic reticulum?

A) the Golgi apparatus B) lysosomes C) mitochondria D) nuclear envelope Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Remember/Understand Learning Outcome: 4.6, 4.7 Global LO: 3

14 .

3) The figure shows a Paramecium, a single-celled freshwater protist. The hairlike structures visible on the Paramecium allow it to move. These structures are ________.

A) microfilaments B) intermediate filaments C) flagella D) cilia Answer: D Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Apply/Analyze Learning Outcome: 4.10 Global LO: 2, 3

15 .

4) The child shown in the figure below is not feeling well. Why does the poster say "No Antibiotics Please?"

A) His illness may be caused by an allergy to penicillin.

B) His illness is caused by bacteria.

C) His illness is caused by a virus.

Answer: C Topic: Evolution Connection: The Evolution of Antibiotic Resistance in Humans Skill: Apply/Analyze Learning Outcome: 4.11 Global LO: 2, 5 5) Where is this molecule normally found in a eukaryotic cell?

A) cytosol B) Golgi apparatus C) nucleus D) rough endoplasmic reticulum Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Apply/Analyze Learning Outcome: 4.6 16 .

6) Suppose you are designing an antibiotic that specifically targets prokaryotic cells. Which labeled structure in the figure below should you target such that the antibiotic only affects prokaryotic cells?

A) structure A B) structure B C) structure C Answer: A Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells Skill: Apply/Analyze Learning Outcome: 4.1 Global LO: 2, 3, 5

17 .

4.3 Scenario Questions Read the following scenario to answer the following questions.

The first prokaryotic cells gave rise to eukaryotic cells approximately 1.7 billion years ago. The structure of eukaryotic cells today suggests how they might have evolved from their prokaryotic ancestors. Scientists examining mitochondria and chloroplasts now think that these organelles were probably free-living prokaryotes before becoming a part of eukaryotic cells long ago.

1) What evidence suggests that mitochondria might have evolved before chloroplasts?

A) Mitochondria can sometimes divide to produce chloroplasts.

B) Only mitochondria have their own DNA. C) Some mitochondria have chloroplasts inside of them.

D) Almost all eukaryotes have mitochondria but only some cells have chloroplasts.

Answer: D Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Apply/Analyze Learning Outcome: 4.8, 4.9 Global LO: 2, 7 2) Which characteristic of chloroplasts suggests that they might have evolved from free-living bacteria?

A) Chloroplasts have cell walls.

B) Chloroplasts contain pigments.

C) Chloroplasts have their own DNA. D) A single, highly folded plasma membrane surrounds chloroplasts.

Answer: C Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Apply/Analyze Learning Outcome: 4.8, 4.9 Global LO: 2, 7 3) Which characteristic of mitochondria suggests they might have evolved from free-living bacteria?

A) Mitochondria have cell walls.

B) The plasma membrane of a mitochondrion is the site of many important steps of cellular respiration.

C) Mitochondria have their own DNA. D) Mitochondria rely upon proteins as their source of energy.

Answer: C Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Apply/Analyze Learning Outcome: 4.8, 4.9 Global LO: 2, 7

18 .

Read the following scenario to answer the following questions.

Different species of bacteria are resistant to different types of antibiotics. For example, one species of bacteria may be resistant to an antibiotic that targets bacterial ribosomes but may not be resistant to a different antibiotic that targets bacterial cell walls. In order to figure out what type of antibiotic(s) a species of bacteria was resistant to, a researcher treated the bacteria with four different antibiotics (A, B, C, and D) and measured how many bacteria were alive over the course of a few weeks. The data that she collected are summarized below.

4) The bacteria show the greatest resistance to which antibiotic?

A) Antibiotic A B) Antibiotic B C) Antibiotic C D) Antibiotic D Answer: A Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells, The Process of Science: How Was the First 21st-Century Antibiotic Discovered?, Evolution Connection: The Evolution of Antibiotic Resistance in Humans Skill: Evaluate/Create Learning Outcome: 4.1, 4.5, 4.11 Global LO: 2, 3, 5 5) Why do bacteria numbers start to decline when treated with antibiotic C but then begin to increase as time goes on?

A) Some bacteria with resistance to antibiotic C were selected for over time.

B) Additional bacteria were added to the experimental group.

C) Antibiotic C degraded and thus was no longer effective.

D) This is the normal course of bacterial growth no matter which antibiotic is applied.

Answer: A Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells, The Process of Science: How Was the First 21st-Century Antibiotic Discovered?, Evolution Connection: The Evolution of Antibiotic Resistance in Humans Skill: Evaluate/Create Learning Outcome: 4.1, 4.5, 4.11 Global LO: 2, 3, 5

19 .

6) If you were treating a patient infected with this species of bacteria, which antibiotic would you prescribe to kill the bacteria most effectively?

A) Antibiotic A B) Antibiotic B C) Antibiotic C D) Antibiotic D Answer: D Topic: Biology and Society: Antibiotics: Drugs That Target Bacterial Cells, The Process of Science: How Was the First 21st-Century Antibiotic Discovered?, Evolution Connection: The Evolution of Antibiotic Resistance in Humans Skill: Evaluate/Create Learning Outcome: 4.1, 4.5, 4.10 Global LO: 2, 3, 5

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 5 The Working Cell 5.1 Multiple Choice Questions 1) What molecules are scientists currently trying to use to generate power for nanotechnology devices, such as microscopic robots?

A) DNA B) enzymes C) lipids D) cell membranes Answer: B Topic: Biology and Society: Harnessing Cellular Structures Skill: Remember/Understand Learning Outcome: 5.1 Global LO: 5 2) Energy can be defined as ________.

A) the capacity to cause movement B) the capacity to cause change C) a measure of calories D) a measure of disorder Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.2 3) An object at rest has no ________ energy, but it may have ________ energy resulting from its location or structure.

A) kinetic; potential B) kinetic; heat C) potential; kinetic D) chemical; potential Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.2 4) The principle that energy cannot be created or destroyed is known as ________.

A) cellular respiration B) conservation of energy C) conservation of heat D) entropy Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.2 1 .

5) A boulder at the top of a hill contains ________ energy.

A) potential B) no C) kinetic D) conserved Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.2 Global LO: 2 6) You are riding on your bike and stop pedaling, coasting along the road. Eventually, your bike slows down and stops. What happened to the energy of your motion when your bike stopped?

A) It was returned to the bicycle.

B) It was converted back to chemical energy.

C) It was released as heat.

D) It was used to chemically break down the tires.

Answer: C Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.2 Global LO: 2 7) Which of the following is a measure of randomness in a system?

A) entropy B) calorie C) potential energy D) chemical energy Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.3 8) Glucose molecules provide energy to power the swimming motion of sperm. In this example, the sperm are changing ________.

A) chemical energy into kinetic energy B) chemical energy into potential energy C) kinetic energy into potential energy D) kinetic energy into chemical energy Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.4 Global LO: 2

2 .

9) Humans convert approximately ________ of the energy stored in food to useful work.

A) 22% B) 34% C) 55% D) 99.9% Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.4 10) Ten kilocalories are equivalent to ________ calories.

A) 1,000 B) 10,000 C) 0.1 D) 100 Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.5 Global LO: 2, 4 11) You have a 2-kg bottle of liquid water at 0°C. About how many Calories are needed to heat up the water to 100°C? A) 100 Calories B) 200 Calories C) 2,000 Calories D) 10,000 Calories Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.5 Global LO: 2, 4 12) What compound directly provides energy for cellular work?

A) sugar B) ATP C) DNA D) fat Answer: B Topic: 5.2 Energy Transformation: ATP and Cellular Work Skill: Remember/Understand Learning Outcome: 5.6

3 .

13) ATP energizes other molecules in cells by transferring a(n) ________ to those molecules.

A) adenosine B) heat unit C) ADP D) phosphate group Answer: D Topic: 5.2 Energy Transformation: ATP and Cellular Work Skill: Remember/Understand Learning Outcome: 5.6 14) Anything that prevents ATP formation will most likely ________.

A) result in cell death B) force the cell to rely on lipids for energy C) force the cell to rely on ADP for energy D) have no effect on the cell Answer: A Topic: 5.2 Energy Transformation: ATP and Cellular Work Skill: Remember/Understand Learning Outcome: 5.6 15) Usually, enzymes are ________.

A) fats B) steroids C) chemical reactions D) proteins Answer: D Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 16) The sum total of all the chemical reactions that occur in organisms is called ________.

A) kinetic energy B) cellular synthesis C) conservation of energy D) metabolism Answer: D Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7

4 .

17) Enzymes increase the rate of a reaction by ________.

A) increasing the temperature of the substrates B) taking energy from reactants and transferring it to products C) decreasing activation energy D) binding to a substrate imposter Answer: C Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 18) Which statement about enzymes is TRUE? A) Enzymes are the products in a chemical reaction.

B) Enzymes are the reactants in a chemical reaction.

C) Enzymes catalyze specific reactions.

D) Enzymes' functions require inhibitors.

Answer: C Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 19) An enzyme's function is most dependent on its ________.

A) activation energy B) temperature C) shape D) size Answer: C Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 20) The combination of sucrose, sucrase, and water produces sucrase, glucose, and fructose.

Which component of the reaction is the enzyme?

A) sucrose B) sucrase C) glucose D) fructose Answer: B Topic: 5.3 Enzymes Skill: Apply/Analyze Learning Outcome: 5.7 Global LO: 2

5 .

21) The region of an enzyme to which a substrate binds is called the ________ site.

A) active B) substrate C) inhibition D) lactase Answer: A Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 22) The combination of sucrose, sucrase, and water produces sucrase, glucose, and fructose.

Which component of the reaction is the substrate?

A) sucrose B) sucrase C) glucose D) fructose Answer: A Topic: 5.3 Enzymes Skill: Apply/Analyze Learning Outcome: 5.7 Global LO: 2 23) Which statement about an enzyme is TRUE? A) An enzyme's function depends on its three-dimensional shape.

B) An enzyme works on a broad range of substrates.

C) An enzyme is used up in chemical reactions.

D) An enzyme becomes another enzyme after a reaction.

Answer: A Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7 24) Substances that plug up an enzyme's active site are enzyme ________.

A) substrates B) inhibitors C) catalysts D) products Answer: B Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.7, 5.8

6 .

25) Diffusion is an example of ________.

A) phagocytosis B) active transport C) endocytosis D) passive transport Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 26) Diffusion ________.

A) is the result of an energy transformation B) requires an input of cellular energy C) occurs when particles spread from areas where they are less concentrated to areas where they are more concentrated D) proceeds until a dynamic equilibrium is reached Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 27) Facilitated diffusion across a biological membrane requires ________ and moves a substance ________ its concentration gradient.

A) energy; down B) transport proteins; down C) energy and transport proteins; against D) transport proteins; against Answer: B Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 28) Osmosis can be defined as ________.

A) the diffusion of water across a selectively permeable membrane B) the diffusion of any small molecule across a selectively permeable membrane C) active transport across a selectively permeable membrane D) the diffusion of a solute across a selectively permeable membrane Answer: A Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9

7 .

29) A balloon that is permeable to water but not to glucose contains a 10% glucose solution. A beaker contains a 5% glucose solution. Which statement correctly classifies the solutions?

A) The solution in the beaker is hypertonic relative to the solution in the balloon.

B) The solutions in the balloon and the beaker are isotonic to each other.

C) The solution in the balloon is hypotonic relative to the solution in the beaker.

D) The solution in the balloon is hypertonic relative to the solution in the beaker.

Answer: D Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2 30) When two solutions that differ in solute concentration are placed on either side of a selectively permeable membrane, and osmosis is allowed to take place, the water will ________.

A) exhibit a net movement to the side with lower water concentration B) exhibit a net movement to the side with higher water concentration C) exhibit a net movement to the side with lower solute concentration D) exhibit an equal movement in both directions across the membrane Answer: A Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 31) A cell that neither gains nor loses a net amount of water at equilibrium when it is immersed in a solution is ________.

A) isotonic to its environment B) hypertonic to its environment C) hypotonic to its environment D) metabolically inactive Answer: A Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 32) Some protozoans have special organelles called contractile vacuoles that continually eliminate excess water from the cell. The presence of these organelles tells you that the environment ________.

A) is isotonic to the protozoan B) is hypotonic to the protozoan C) is hypertonic to the protozoan D) contains a higher concentration of solutes than the protozoan Answer: B Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2 8 .

33) If placed in tap water, an animal cell will undergo lysis, whereas a plant cell will not. What accounts for this difference?

A) expulsion of water by the plant cell's central vacuole B) inability of water to cross a plant cell membrane C) impermeability of the plant cell wall to water D) relative inelasticity and strength of the plant cell wall Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 34) In a hypotonic solution, a plant cell will ________.

A) undergo plasmolysis B) become flaccid C) burst D) become turgid Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 35) Which process could result in the net movement of a substance into a cell, if the substance is more concentrated in the cell than in the surroundings?

A) active transport B) facilitated diffusion C) diffusion D) osmosis Answer: A Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 36) Active transport ________.

A) does not use ATP as an energy source B) moves solutes with their concentration gradient C) can involve the transport of ions D) is a type of facilitated diffusion Answer: C Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9

9 .

37) When a person cries, tears are exported from cells. Which category of transport most precisely matches this process?

A) facilitated diffusion B) active transport C) endocytosis D) exocytosis Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 38) Specialized cells that line the stomach synthesize a digestive enzyme and secrete it into the stomach. Which process could be responsible for its secretion?

A) endocytosis B) exocytosis C) phagocytosis D) passive transport Answer: B Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2 39) ________ occurs when a white blood cell engulfs a bacterium.

A) Osmosis B) Diffusion C) Exocytosis D) Phagocytosis Answer: D Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 40) A balloon contains a 10% glucose solution. The balloon is permeable to water but not to glucose. A beaker contains a 5% glucose solution. What will happen when the balloon is submerged in the beaker?

A) The volume of water in the beaker will decrease.

B) The volume of water in the beaker will increase.

C) The amount of glucose in the beaker will increase.

D) The amount of glucose in the beaker will decrease.

Answer: A Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2

10 .

41) On a lab bench, there are four balloons filled with identical volumes of different salt solutions: 0% (balloon A), 5% (balloon B), 10% (balloon C), and 15% (balloon D). There are also four beakers each filled with identical volumes of a 10% salt solution. The balloons are semi-permeable; that is, only water can enter and exit the balloon. All four balloons are placed in separate beakers at the same time and are allowed to come to equilibrium. At equilibrium, which is the correct order of balloon volumes from largest to smallest?

A) A, B, C, D B) D, C, B, A C) D, B, A, C D) All balloons will be of equal volume at equilibrium.

Answer: A Topic: 5.4 Membrane Function Skill: Evaluate/Create Learning Outcome: 5.9 Global LO: 2, 4 42) Which of these molecules spontaneously form membranes when mixed in water and most likely were one of the first organic compounds formed on Earth?

A) DNA B) enzymes C) phospholipids D) RNA Answer: C Topic: Evolution Connection: The Origin of Membranes Skill: Remember/Understand Learning Outcome: 5.10 43) Which environments would be best for the functioning of animal and plant cells?

A) A hypotonic environment for plant cells and an isotonic environment for animal cells.

B) A hypotonic environment for animal cells and an isotonic environment for plant cells.

C) An isotonic environment for both plant and animal cells.

Answer: A Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 44) How are membrane transport proteins like enzymes?

A) Both are specialized to the materials they act upon.

B) Both are made from RNA molecules.

C) Both require energy to function properly.

D) Neither can change as a result of gene mutations.

Answer: A Topic: 5.3 Enzymes, 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.7, 5.9 Global LO: 2 11 .

45) What biological process did scientists use as an inspiration for engineering enzymes to remove molecular tags from red blood cells?

A) natural selection B) enzyme activation C) endocytosis D) phosphate transfer from ATP Answer: A Topic: The Process of Science: Nanotechnology Skill: Remember/Understand Learning Outcome: 5.11 Global LO: 5, 7 46) Directed evolution is a relatively new way to engineer enzymes. Previously, scientists tried to design proteins by using computer models to try to predict how specific changes in genetic sequences might result in altered enzyme structure and function. Why is one of these approaches more efficient than the other?

A) Generating high numbers of random mutations and subsequently screening for desired function means that directed evolution requires little prior knowledge of enzyme structure.

B) Computer models can produce many possible changes in genetic sequences in a short period of time, and then researchers can study each real enzyme one at a time.

C) Although the computer modeling method is slower and requires more information about the enzyme's genetic sequence, the function of enzymes produced by directed evolution is unknown.

D) Because directed evolution produces many genetic sequences that do not lead to improved activity, researchers have found that this procedure results in few successful results.

Answer: A Topic: The Process of Science: Nanotechnology Skill: Evaluate/Create Learning Outcome: 5.11 Global LO: 2, 5, 7, 9

12 .

5.2 Art Questions 1) How does the figure below represent the relationship between energy and ATP?

A) The addition of energy releases a phosphate group from ATP. B) ATP can perform cellular work when it releases a phosphate group.

C) ATP can be converted to ADP by adding a phosphate group.

D) Energy is released from ATP during the process of cellular respiration.

Answer: B Topic: 5.2 Energy Transformation: ATP and Cellular Work Skill: Remember/Understand Learning Outcome: 5.6 Global LO: 3

13 .

2) Examine the cells below. Cells with a higher concentration of ions than the surrounding medium tend to ________.

A) stay about the same size and shape B) expand C) shrink D) divide Answer: B Topic: 5.4 Membrane Function Skill: Remember/Understand Learning Outcome: 5.9 Global LO: 2, 3

14 .

3) In7 the figure below, how does the molecule labeled A affect enzyme function?

A) It is an inhibitor that changes the enzyme's active site.

B) It is a substrate imposter that keeps the regular substrate from binding.

C) It is a second substrate for an enzyme that works on two substrates.

D) It lowers the activation energy for the chemical reaction.

Answer: A Topic: 5.3 Enzymes Skill: Remember/Understand Learning Outcome: 5.8 Global LO: 3 4) The photos below show a plant before watering (left) and after it was watered (right). What causes the change in plant appearance?

A) Cells that were in an isotonic environment are restored to a hypotonic environment.

B) The plant wilted because its cells lysed; watering creates an isotonic environment.

C) A hypertonic solution makes the plant wilt and watering makes its cells turgid again.

D) Watering shifts a hypotonic environment to a hypertonic environment.

Answer: A Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2, 3

15 .

5) What cell transport is modeled by the diagram below?

A) A liver cell uses endocytosis to take up cholesterol from the blood.

B) A tear gland cell secretes a salty solution by exocytosis.

C) A neuron uses passive transport to export dopamine.

D) An immune cell engulfs virus particles using facilitated diffusion.

Answer: A Topic: 5.4 Membrane Function Skill: Apply/Analyze Learning Outcome: 5.9 Global LO: 2, 3

16 .

5.3 Scenario Questions Read the following scenario to answer the following question(s).

Cellular respiration converts the energy of fuel molecules to a form of energy that a cell can use to perform work. In an average day, most adult humans need to consume about 2,000 Calories to maintain their health. However, the exact amount of dietary Calories a person needs depends upon many factors, including the person's age, physical activity, size, and health. Foods that we consume vary greatly in their nutritional content and quality. A large hard-boiled egg, for example, has about 75 dietary Calories and contains about 70% of our recommended daily intake of cholesterol.

1) Molecules that come from the food we eat provide energy for the amazing work that goes on inside of our cells. This energy, stored inside of our food, is a form of ________.

A) potential energy called chemical energy B) potential energy called entropy C) kinetic energy called heat D) electrical energy called heat Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Remember/Understand Learning Outcome: 5.2 2) A person eats one hard-boiled egg and digests the egg fully. During cellular respiration MOST of the Calories in the egg is converted to ________.

A) ATP B) heat C) carbon dioxide D) sugars Answer: B Topic: 5.1 Some Basic Energy Concepts, 5.2 Energy Transformation: ATP and Cellular Work Skill: Remember/Understand Learning Outcome: 5.4, 5.6 3) The amount of dietary Calories in one hard-boiled egg could raise the temperature of ________.

A) 75 grams of water by 1 degree Celsius B) 750 grams of water by 1 degree Celsius C) 1,000 grams of water by 75 degrees Celsius D) 7,500 grams of water by 50 degrees Celsius Answer: C Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.5 Global LO: 2, 4

17 .

4) Running burns approximately 600 Calories per hour. If you ate four hard-boiled eggs, how long would you have to run to burn them off?

A) 10 minutes B) 30 minutes C) 60 minutes D) 120 minutes Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Apply/Analyze Learning Outcome: 5.5 Global LO: 2, 4

18 .

Read the following scenario to answer the following question(s).

Biomedical scientists have recently developed an anticancer drug delivery system that sneaks the anticancer drug into cancer cells before releasing it. They were able to do this by using two sets of liposomes. An anticancer drug (Doxorubicin (Dox)) bound to DNA molecules was added into one set of liposomes, and a high concentration of ATP molecules were added to the other set of liposomes. The drug is inactive when bound to DNA molecules. Researchers inject both types of liposomes into cancer cells, and upon doing so their contents are released. The ATP molecules from one set of liposomes bind to the DNA molecules from the other set of liposomes) and activate the drug, thus inducing cell death and decreasing tumor size.

Mice with breast cancer tumors were treated with this liposome system to test the effectiveness of the drug. The scientists performed three trials–one with both types of liposomes (Dox + ATP), one with just the drug (Dox only), and one with a salt solution (control). Examine the figure below and answer the following questions.

5) Which statement regarding these data is TRUE? A) The weight of the tumors did not change if treated with just the drug (Dox only) or both types of liposomes (Dox + ATP).

B) Tumor weight decreases when you add just the drug (Dox only) to cancer cells.

C) Adding just the drug (Dox only) or both types of liposomes (Dox + ATP) results in similar decreases in tumor weight.

D) Dox must be entering the cancer cells via endocytosis to induce cell death.

Answer: B Topic: 5.4 Membrane Function, Evolution Connection: The Origin of Membranes Skill: Evaluate/Create Learning Outcome: 5.1, 5.9 Global LO: 1, 2, 3, 5

19 .

6) What is the best explanation for the intermediate tumor size that results from treatment with just the drug (Dox only) compared to the control and treatment with both liposomes (Dox + ATP)?

A) Without ATP, Dox becomes an energy source for cancer cells.

B) Dox actually does not require ATP to be activated.

C) When ATP is lacking, not as much Dox can enter the cell via facilitated diffusion.

D) There is likely to be some ATP in the cancer cells normally, which acts to activate Dox. Answer: D Topic: 5.4 Membrane Function, Evolution Connection: The Origin of Membranes Skill: Evaluate/Create Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5 7) What would be the best experiment to test the effectiveness of this anticancer drug system?

A) Inject both sets of liposomes into a single healthy mouse and measure what happens to its blood ATP levels.

B) Inject both sets of liposomes into a single mouse that has tumors and measure what happens to the size of the tumors.

C) Inject both sets of liposomes into multiple healthy mice and measure what happens to their blood ATP levels.

D) Inject both sets of liposomes into multiple mice that have tumors and measure what happens to the size of the tumors.

Answer: D Topic: 5.4 Membrane Function, Evolution Connection: The Origin of Membranes Skill: Evaluate/Create Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5 8) A student in your class examines the graph and hypothesizes that ATP is what kills cancer cells, and not Dox. What follow-up experiment would allow you to test this student's hypothesis?

A) Add a fourth trial, in which mice with breast cancer tumors are treated with liposomes containing just ATP (ATP only).

B) Repeat the three trials described in the scenario until the tumor weights are the same from treatments with just Dox (Dox only) and both types of liposomes (Dox + ATP).

C) Treat mice with breast cancer tumors with liposomes containing both Dox and ATP together (not in separate liposomes).

D) Observe what happens to mice when ATP and Dox are combined in the absence of tumors.

Answer: A Topic: 5.4 Membrane Function, Evolution Connection: The Origin of Membranes Skill: Evaluate/Create Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 6 Cellular Respiration: Obtaining Energy from Food 6.1 Multiple Choice Questions 1) Lactic acid buildup in muscles is a sign that ________.

A) aerobic respiration capacity has not been reached B) respiration is operating effectively C) insufficient oxygen is reaching the muscles D) the muscles will be able to operate continuously for a long time Answer: C Topic: Biology and Society: Getting the Most Out of Your Muscles Skill: Remember/Understand Learning Outcome: 6.1 Global LO: 5 2) A process is referred to as aerobic if it requires ________.

A) oxygen B) carbon dioxide C) ATP D) carbohydrates Answer: A Topic: Biology and Society: Getting the Most Out of Your Muscles Skill: Remember/Understand Learning Outcome: 6.1 3) Humans are both ________.

A) heterotrophs and consumers B) heterotrophs and producers C) producers and decomposers D) autotrophs and producers Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Apply/Analyze Learning Outcome: 6.3 Global LO: 2 4) Photosynthetic organisms are ________.

A) producers that make all of their organic matter from organic molecules that they take in B) consumers that obtain organic molecules from other living organisms C) producers that make their own organic matter from inorganic molecules D) decomposers that obtain nutrients from the soil Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.3 1 .

5) Photosynthetic organisms like grass are able to ________.

A) make all of their organic matter from organic molecules in the soil B) use water they take in through their leaves as a final electron acceptor C) turn light energy from sunlight into sugars D) use molecules in the air as a major source of carbon Answer: D Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Apply/Analyze Learning Outcome: 6.3 Global LO: 2 6) A horse eating some hay is an example of ________.

A) an autotroph eating a producer B) an autotroph eating a consumer C) a consumer eating a producer D) a consumer eating a heterotroph Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Apply/Analyze Learning Outcome: 6.3 Global LO: 2 7) Plants use photosynthesis to ________.

A) store chemical energy, and they use cellular respiration to harvest energy from organic molecules B) change light energy into chemical energy as well as to harvest chemical energy C) harvest energy from organic molecules, and they use cellular respiration to store chemical energy D) turn light energy into sugars Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.2 8) The waste products of cellular respiration include ________.

A) water only B) carbon dioxide only C) water and carbon dioxide D) water and glucose Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.4

2 .

9) Plant cells ________.

A) do not need chloroplasts because their mitochondria meet their energy needs B) have chloroplasts and mitochondria C) use carbon dioxide but do not use oxygen D) do not need mitochondria because their chloroplasts meet their energy needs Answer: B Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.4 10) The ultimate source of energy in food is ________.

A) the sun B) producers C) ATP D) consumers Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.2 11) What compound directly provides energy for cellular work?

A) C6H12O6 B) glucose C) ATP D) fat Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Remember/Understand Learning Outcome: 6.4 12) Respiration describes the exchange of gases between your blood and the air. Cellular respiration ________.

A) produces ATP B) produces oxygen C) produces glucose Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7

3 .

13) Choose the equation that describes aerobic cellular respiration most accurately.

A) glucose → lactic acid + energy B) energy + carbon dioxide + water → glucose + oxygen + water C) glucose + oxygen → carbon dioxide + water + energy D) energy + glucose → water + carbon dioxide Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 14) Which are products of cellular respiration?

A) ATP and water B) carbon dioxide and ATP C) carbon dioxide, water, and ATP D) oxygen and glucose Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 15) When electrons move through a series of electron acceptor molecules in cellular respiration ________.

A) the electrons gain energy as they move from one electron acceptor to another B) oxygen is eventually reduced by the electrons in the formation of water C) the electrons release large amounts of energy each time they are transferred from one electron acceptor to another D) glucose is eventually reduced by the electrons in the formation of water Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.6 16) Which statement is an accurate comparison of energy-yielding processes?

A) Oxygen is a product of cellular respiration; carbon dioxide is a product of photosynthesis.

B) Lactic acid is a product of aerobic respiration; ethyl alcohol is a product of fermentation.

C) Oxidation is the gain of electrons; reduction is the loss of electrons.

D) Carbon dioxide is a product of aerobic respiration; lactic acid is a product of anaerobic respiration.

Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.4, 6.8

4 .

17) The first electron acceptor of cellular respiration is ________.

A) CO2 B) O2 C) NAD+ D) H2O Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.6 18) The final electron acceptor of aerobic respiration is ________.

A) ATP B) oxygen C) lactic acid D) NAD+ Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.6 19) Where in the cell does glycolysis occur?

A) cytoplasm B) endoplasmic reticulum C) within the fluid just inside the inner mitochondrial membrane D) between the inner and outer mitochondrial membrane Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 20) A product of glycolysis is ________.

A) lactic acid B) ethyl alcohol C) O2 D) pyruvic acid Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7

5 .

21) Glycolysis results in ________.

A) the production of CO2 B) the conversion of glucose to pyruvic acid C) a net loss of two ATPs per glucose molecule D) conversion of NADH to NAD+ Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 22) What must pyruvic acid be converted to before it can enter the citric acid cycle?

A) acetyl CoA B) lactic acid C) ethyl alcohol D) citric acid Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 23) Which part of cellular respiration produces the most NADH? A) electron transport chain B) citric acid cycle C) glycolysis D) fermentation Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7, 6.8 24) Electron transport takes place in the ________.

A) mitochondria B) chloroplasts C) cytoplasm D) ribosomes Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.6

6 .

25) ATP synthase plays a role in ________.

A) pulling electrons down the electron transport chain B) glycolysis C) pumping hydrogen ions across the inner mitochondrial membrane D) generating ATP Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7 26) In an active muscle cell, aerobic cellular respiration generates about ________ ATP from one glucose.

A) 2 B) hundreds C) fewer than 50 D) The number generated depends on whether the end product of aerobic respiration is lactic acid or ethyl alcohol.

Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.7 Global LO: 2, 4 27) In cellular respiration, most ATP is DIRECTLY produced as a result of ________.

A) the movement of hydrogen ions across the inner mitochondrial membrane B) the citric acid cycle C) fermentation D) the electron transport chain Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.7, 6.8 28) Human muscle cells use lactic acid fermentation to ________.

A) produce more ATP than is possible through complete aerobic respiration B) produce ATP using the electron transport chain C) regenerate NADH D) produce ATP without O2 Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.8

7 .

29) Which metabolic pathway is common to both aerobic and anaerobic processes of sugar breakdown?

A) the citric acid cycle B) the electron transport chain C) conversion of pyruvic acid to lactic acid D) glycolysis Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.11 30) A physician is examining a patient who fatigues easily after walking only a short distance.

Tissue examination reveals that certain skeletal muscle cells are missing mitochondria.

Laboratory tests are likely also to find ________.

A) the muscles contain large amounts of lactic acid following even mild physical exercise B) the muscles contain large amounts of carbon dioxide following even mild physical exercise C) the muscles require extremely high levels of oxygen to function D) the muscle cells cannot split glucose to pyruvic acid Answer: A Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.8 Global LO: 2, 5 31) Some friends are trying to make wine in their basement. They've added yeast to a sweet grape juice mixture and have allowed the yeast to grow. After several days, they find that sugar levels in the grape juice have dropped, but there's no alcohol in the mixture. The most likely explanation is that ________.

A) the mixture needs more sugar; yeast need a lot of energy before they can begin to produce alcohol B) the mixture needs less oxygen; yeast only produce alcohol in the absence of oxygen C) the mixture needs more oxygen; yeast need oxygen to break down sugar to produce alcohol D) the mixture needs less sugar; high sugar concentrations stimulate cellular respiration, and alcohol is not a by-product of cellular respiration Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.10 Global LO: 2, 5

8 .

32) What waste product do yeast produce under anaerobic conditions?

A) ethyl alcohol B) pyruvic acid C) lactic acid D) creatine Answer: A Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.10 Global LO: 5 33) Large amounts of oxygen gas first appeared in Earth's atmosphere about ________ of years ago.

A) thousands B) millions C) billions D) hundreds Answer: C Topic: Evolution Connection: The Importance of Oxygen Skill: Remember/Understand Learning Outcome: 6.11 Global LO: 4 34) The only stage of cell respiration that is not dependent on the other stages of cell respiration is ________.

A) the electron transport chain B) the citric acid cycle C) lactic acid fermentation D) glycolysis Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.8, 6.11 Global LO: 2

9 .

35) In Texas, a man showed up at a medical facility claiming that he felt drunk when he had not ingested any alcohol. Indeed his blood alcohol measured 0.37, many times the legal limit.

Although he was a home brewer, he claimed that this intoxication had been happening often without his drinking any alcohol. Which of these hypotheses and actions might be most useful in diagnosing this problem?

A) His home brew concoctions have created a type of alcohol that lasts a long time. Have him refrain from home brewing for a week and recheck his blood alcohol.

B) He might have recently had a round of antibiotics that killed the bacteria that usually live in his gut and allowed a yeast species to overgrow. Put him on probiotics and a low carb diet for a week and recheck his blood alcohol.

C) The fumes from the alcohol that he is using as a cleaning solution might be getting into his bloodstream. Ask him if he is using alcohol externally.

D) Maybe he feels drunk because he has been eating mushrooms that have sprouted during this very wet weather. Check him for fungal toxins.

Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.10 Global LO: 2, 5, 7 36) Which claim about the history of the Earth has the most scientific support?

A) Photosynthetic producers must have come first to provide food for other organisms.

B) Anaerobic bacteria must have come first because there was no carbon dioxide in the atmosphere.

C) Photosynthetic producers must have come first to provide oxygen for other organisms.

D) Anaerobic organisms must have come first because there was no oxygen in the atmosphere.

Answer: D Topic: Evolution Connection: The Importance of Oxygen Skill: Remember/Understand Learning Outcome: 6.11 Global LO: 7

10 .

6.2 Art Questions

1) Examine the figure above. Which reactant(s) primarily come(s) from the air?

A) water B) glucose C) carbon dioxide D) oxygen and carbon dioxide Answer: D Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Apply/Analyze Learning Outcome: 6.4 Global LO: 2, 3 11 .

2) Examine the figure above. Most of the organic matter in the tree shown in the figure comes from ________.

A) water B) glucose C) the air D) the soil Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Apply/Analyze Learning Outcome: 6.4 Global LO: 2

12 .

3) Examine the figure above. Which of these stages occur(s) in the cytoplasm?

A) glycolysis B) citric acid cycle C) glycolysis and citric acid cycle D) citric acid cycle and electron transport Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.7 Global LO: 2, 3 4) Examine the figure. Which of these stages receive input from more than one other stage?

A) glycolysis B) citric acid cycle C) electron transport Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.7 Global LO: 2, 3 13 .

5) The figure above shows that ________.

A) amino acids can move directly into the electron transport chain B) cells can use sugars, fatty acids, and amino acids to produce ATP C) cells can produce ATP only from glucose D) cells can produce ATP from sugars and glycerol, but not fatty acids Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.7 Global LO: 2, 3, 7 6) This figure is a model of cell respiration and like all models it has limitations. A serious limitation of this model is A) glycolysis does not generally release products that go into the Acetyl CoA reactions B) there are no sugars that can go directly into glycolysis C) fatty acids must be broken down into smaller molecules to enter the Acetyl CoA reactions D) there are ATPs produced directly from the Acetyl CoA reactions Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.7 Global LO: 2, 3, 7

14 .

7) Which molecule shown in the figure below does NOT begin cellular respiration in the cytoplasm?

A) amino acids B) fatty acids C) glucose D) glycerol Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.7 Global LO: 2, 3

15 .

6.3 Scenario Questions Read the following scenario to answer the following questions.

An abundant and continual supply of ATP is necessary for all living cells. Toxins, reduced blood flow, and a compromised respiratory system can interfere with the transport of oxygen to active cells. A runner in a marathon faces multiple obstacles to continue to produce sufficient ATP to remain competitive.

1) Exchanges across respiratory membranes are increased when we breathe faster as we exercise.

What exchanges are increased, and why?

A) carbon dioxide out and oxygen in to support aerobic metabolism B) oxygen out and carbon dioxide in to support aerobic metabolism C) carbon dioxide in and lactic acid out to support anaerobic metabolism D) oxygen in and carbon dioxide in to support anaerobic metabolism Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.4 2) When the circulatory system cannot deliver oxygen fast enough to support a runner's aerobic metabolism, cells switch to an emergency mode in which ________.

A) ATP is generated less efficiently by harvesting the heat energy in a cell B) ATP is inefficiently produced and lactic acid is generated as a by-product C) lactic acid is broken down to produce smaller amounts of ATP D) carbon dioxide is joined with water to generate much smaller amounts of ATP Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Remember/Understand Learning Outcome: 6.8

16 .

Scenario: Poultry scientists recorded data to help maximize farmers' yields. They collected data about when in the life of eggs were laid by hens, how many eggs were laid by each hen in a particular age range, the weight of those eggs and the weight of the chicks that eventually hatched from those eggs. Examine the data table to answer the following questions Egg and Chick Weight from Hens of Different Ages

Hens' Egg laying age time (h) Young Early Middle Late Total

N 168 168 168 504

Egg weight (g) 59.3±0.2 58.2±0.3 58.7±0.1 58.9±0.1

Ratio of chick Chick hatch hatch weight/ weight (g) egg weight (%) 38.8±0.2 65.4 37.8±0.3 65.0 38.1±0.2 64.9 38.3±0.1 65.0

Older Early Middle Late Total

252 252 252 756

66.8±0.2 65.5±0.2 66.0±0.2 66.1±0.1

45.8±0.2 44.0±0.3 43.2±0.2 44.1±0.1

68.6 67.2 65.5 66.7

3) Which hypothesis can be addressed with these data?

A) The time of egg laying has an impact on egg weight.

B) Bigger eggs result in larger mature chickens.

C) Young hens have fewer offspring (chicks) alive at 3 months than do older hens.

D) Egg weight is related to the amount of yolk in an egg.

Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.5 Global LO: 1, 2, 3, 4, 6, 7 4) What is(are) the main factor(s) causing differences between the chick hatch weight and the weight of the egg when it is laid?

A) The only factor that causes the chick to weigh less than the egg when it is laid is the removal of the shell.

B) Not only does the chick have no shell, but it has lost some of its mass (weight) to the air during development.

C) During development in the egg, the chick embryo grows more cells so the weight increases.

D) Egg weight immediately after laying includes a lot of organic matter that evaporates during development.

Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.5 Global LO: 1, 2, 3, 4, 7

17 .

5) If an egg were weighed halfway between being laid and hatching, how would you expect that weight to compare to the weight of the newly laid egg?

A) The egg would weigh more at this midpoint than when laid because, during development, the chick makes new cells.

B) The egg would weigh more at this midpoint than when laid because it is taking in oxygen.

C) The egg would weigh less at this midpoint than when laid because the shell wears away over time.

D) The egg would weigh less at this midpoint than when laid because some of the mass of the egg would be released through cell respiration.

Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.5 Global LO: 2, 3, 4, 7 6) What processes, if any, provide energy for the developing chick?

A) alcohol producing fermentation B) aerobic respiration C) anaerobic respiration producing lactic acid D) none of these processes begin until after the chick hatches Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Evaluate/Create Learning Outcome: 6.5 Global LO: 2, 3, 4, 7 7) Which transition describes a possible order of cell respirations activities?

A) a product of the citric acid cycle enters glycolysis B) a product of glycolysis enters the electron transport chain C) a product of fermentation enters the citric acid cycle D) ATP enters the electron transport chain and ADP results Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.7, 6.8 Global LO: 2 8) Conclusions drawn from muscle contraction experiments conducted by A.V. Hill A) demonstrated that human muscles work the same as frog muscles.

B) have been shown to be faulty according to more recent evidence.

C) demonstrate a flaw in the process of science because the conclusions were wrong.

D) were based on poorly designed experiments without a control.

Answer: B Topic: The Process of Science: Exercise Science Skill: Apply/Analyze Learning Outcome: 6.9 Global LO: 1, 2, 9 18 .

9) The metabolic processes that produce acid in your muscles are similar to the processes that produce soy sauce, pepperoni, and bread. What is the similarity?

A) All involve anaerobic respiration.

B) All are food producing processes.

C) Oxygen is necessary for each process.

D) The electron transport chain is essential to each process.

Answer: A Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Apply/Analyze Learning Outcome: 6.10 Global LO: 2, 7 10) Conclusions drawn from muscle contraction experiments conducted by A.V. Hill demonstrated what about the process of science?

A) Scientific conclusions are tentative and always subject to revision.

B) Some experiments can prove hypotheses and some cannot.

C) All truly scientific conclusions are correct and should be accepted as being so.

D) Studying nonhuman animals is not useful for understanding human physiology.

Answer: A Topic: 6 The Process of Science: Exercise Science Skill: Evaluate/Create Learning Outcome: 6.9 Global LO: 1, 2, 9

19 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 7 Photosynthesis: Using Light to Make Food 7.1 Multiple Choice Questions 1) All but one of these is an advantage of biofuels from food crops. Choose the EXCEPTION. A) reduced carbon emissions from biofuels B) biofuels are a renewable resource C) car manufacturers are producing cars that can use biofuels efficiently D) biofuels are cheaper to produce Answer: D Topic: Biology and Society: A Greasy Crime Wave Skill: Remember/Understand Learning Outcome: 7.1 Global LO: 5 2) A ________ is an autotroph A) human B) mushroom C) pine tree D) fish Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.2 Global LO: 2 3) Photosynthesis contributes to plant growth by ________.

A) taking in oxygen and making wood B) taking in carbon dioxide and making sugars (carbohydrates) C) synthesizing carbon dioxide and making cellulose D) converting sugar to oxygen and water Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 4) Interconnected sacs of membranes inside the chloroplasts called ________ are suspended in a thick fluid called the ________.

A) chlorophyll; thylakoid B) thylakoids; grana C) thylakoids; stroma D) grana; thylakoid Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 1 .

5) What is the function of stomata?

A) water absorption B) Calvin cycle C) surrounding photosystems D) gas exchange Answer: D Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 6) Plants obtain most of their water through their ________.

A) roots B) stem cells C) stomata D) leaves Answer: A Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 7) What are the membranous sacs found within a chloroplast?

A) stroma B) mitochondria C) thylakoids D) vesicles Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 8) What are grana?

A) thick fluids inside chloroplasts B) convolutions of the inner chloroplast membrane C) stacks of membranous sacs in chloroplasts D) pigments found in chloroplasts Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2

2 .

9) A shade-tolerant plant that is provided its preferred wavelength of light, but only minimal amounts of water, would likely experience ________.

A) increased plant growth B) increased amounts of oxygen released by the plants C) decreased amounts of ATP being produced by the plants D) increased growth of the plants' leaves Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.4 Global LO: 2 10) Which equation best summarizes photosynthesis?

A) 6 CO2 + 6 H2O + 6 O2 → C6H12O6 B) 6 CO2 + 6 H2O → C6H12O6 + 6 O2 C) 6 CO2 + 6 O2 → C6H12O6 + 6 H2O D) C6H12O6 + 6 O2 → 6 CO2 + 6 H2O Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.4 11) In photosynthesis, redox reactions ultimately transfer electrons from ________ to ________.

A) O2; CO2 B) C6H12O6; O2 C) H2O; C6H12O6 D) H2O; CO2 Answer: D Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.4 Global LO: 2 12) Which molecule is produced during the light reactions of photosynthesis?

A) O2 B) CO2 C) C6H12O6 D) ADP Answer: A Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.7

3 .

13) The Calvin cycle requires ________ and ________ from the light reactions in order to operate.

A) glucose; carbon dioxide B) electrons; NADH C) ATP; NADPH D) RuBP; NADP+ Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.9 14) The products of the light reactions of photosynthesis are ________.

A) ATP and NADH B) BTP and NADPH C) RuBP and O2 D) ATP and NADP+ Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.6 15) When looking at a pigmented object, the color we see is the wavelengths that ________.

A) are absorbed by the pigmented object B) are reflected or transmitted by the pigmented object C) have been raised to an excited state by the pigmented object D) the pigmented object created after interacting with sunlight Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.5 16) What wavelength of light is reflected by a plant that appears blue to us?

A) blue B) green C) red D) yellow Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Apply/Analyze Learning Outcome: 7.5 Global LO: 2

4 .

17) The energy of wavelengths that appear ________ is LEAST useful to photosynthesis.

A) red B) green C) blue D) orange Answer: B Topic: The Process of Science: What Colors of Light Drive Photosynthesis?

Skill: Remember/Understand Learning Outcome: 7.8 18) What is responsible for the yellow-orange coloration of leaves in the fall?

A) RuBP B) chlorophyll a C) carotenoids D) chlorophyll b Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 19) One reason plants have accessory pigment molecules, like chlorophyll b and carotenoids, is ________.

A) to reflect more energy B) to absorb energy in parts of the electromagnetic spectrum that chlorophyll a cannot C) to give them different colors D) because plants cannot make enough chlorophyll a for all of their energy needs Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 20) A discrete packet of light is called a ________.

A) proton B) wavelength C) photon D) prism Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6

5 .

21) The shorter the wavelength of visible light, the ________.

A) less energy that is absorbed by photosynthetic pigments B) redder the color C) more photons it contains D) greater the energy Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.5 22) When a molecule absorbs a photon, one of its electrons is raised to the ________ state.

A) energetic B) quantum C) positive D) excited Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 23) When a molecule releases energy gained by absorption of a photon, in what form may that energy be released?

A) heat B) fluorescence C) light D) all of the above Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 24) Plant photosystems are located in ________.

A) chlorophyll molecules B) thylakoid membranes C) mitochondria D) stroma Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6

6 .

25) What compound is found at the reaction center of a photosystem?

A) chlorophyll b B) carotenoids C) phycobilins D) chlorophyll a Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 26) The light reactions of photosynthesis take place ________.

A) in the stroma B) in the mitochondria C) in the thylakoid membrane D) in the cytosol Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7 27) ________ is the source of the oxygen gas released by a photosystem.

A) H2O B) Chlorophyll a C) CO2 D) C6H12O6 Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7 28) Which molecule is the source of electrons for the light reactions?

A) C6H12O6 B) CO2 C) NADPH D) H2O Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7

7 .

29) Which process is found in both cellular respiration and in the light reactions of photosynthesis?

A) citric acid cycle B) glycolysis C) Calvin cycle D) electron transport chain Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7 30) In photosynthesis, an H+ ion gradient forms across the ________.

A) thylakoid membrane B) outer chloroplast membrane C) endomembrane D) inner chloroplast membrane Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.6 31) The Calvin cycle makes direct use of ________ to make ________.

A) light energy and CO2; sugar B) CO2, ATP, and NADPH; sugar and O2 C) light energy, CO2, and water; sugar and O2 D) CO2, ATP, and NADPH; sugar Answer: D Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Remember/Understand Learning Outcome: 7.9 32) Scientists are working to create a better biofuel factory through which processes?

A) increasing the rate at which certain algae reproduce B) developing strains of algae that can clean up oil spills C) increasing the genetic variation in groups of algae D) restricting hydrocarbon production Answer: C Topic: Evolution Connection: Creating A Better Biofuel Factory Skill: Remember/Understand Learning Outcome: 7.10 Global LO: 1, 2, 5

8 .

7.2 Art Questions

1) Refer to the accompanying figure. Plant cells that contain the organelle responsible for photosynthesis are concentrated in cells of the ________.

A) roots B) leaves C) stomata D) grana Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Remember/Understand Learning Outcome: 7.2 Global LO: 3

9 .

2) In the accompanying figure, the molecule that makes up the bulk of the mass of the plant comes in mostly ________.

A) through the veins, which bring materials from the roots B) through the transparent covering of the leaf into the photosynthetic cells C) through the stomata D) from the roots where they are stored during the night Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.2 Global LO: 2, 3

3) Refer to the accompanying figure. What is TRUE regarding the behavior of a chlorophyll molecule as it absorbs a photon?

A) An electron goes from the excited state to the ground state.

B) Light is released.

C) The energy of a photon raises an electron to the excited state.

D) ATP is broken down.

Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7 Global LO: 3

10 .

4) The light reactions are generally presented in zig-zag patterns, as shown in the accompanying figure which has an implied amount of energy on the vertical axis. What is the significance of the primary electron receptor shown at position 2 being slightly higher than the primary electron receptor shown at position 3?

A) The electron that has been accepted gains energy as it leaves the primary electron receptor at 2 and heads to the primary electron receptor at position 3.

B) The primary electron receptor at 2 has slightly less energy than the primary electron receptor at position 3.

C) The primary electron receptor at position 2 comes before the primary electron receptor at position 3.

D) Since electrons have given off energy in the electron transport chain, they can be boosted higher by the second photosystem.

Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Evaluate/Create Learning Outcome: 7.7 Global LO: 2, 3

11 .

Please refer to the following art to answer the following questions.

5) Which statement BEST describes the direct mechanism of ATP production during photosynthesis?

A) uses energy generated as hydrogen ions (H+) move to an area where there are more hydrogen ions this energy is directly used to make ATP B) uses energy released as excited electrons are passed from one molecule to another in the electron transport system; the energy is converted to the chemical bond energy of ATP C) uses energy stored in excited electrons; as the electrons move from the excited state to the ground state, the energy released is directly converted to the energy stored in the third phosphate bond in ATP D) uses energy stored in hydrogen ion (H+) gradients; the potential energy of the proton gradient is released as the protons move down their gradient through special membrane protein channels; this energy is directly converted to chemical bond energy in the ATP molecule Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Remember/Understand Learning Outcome: 7.7 Global LO: 3 6) If the interior of the thylakoid were not a sealed compartment, ________.

A) there would be no location for the electron transport chain B) light would not be able to reach the photosystems C) water could not be split D) the proton gradient could not be maintained Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Evaluate/Create Learning Outcome: 7.7 Global LO: 2, 3, 7 12 .

Please refer to the following art to answer the following questions.

7) How many times must the Calvin cycle turn for the plant cell to be able to produce one molecule of glucose?

A) one B) two C) three D) six Answer: D Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Apply/Analyze Learning Outcome: 7.9 Global LO: 2, 3, 4 13 .

8) Which compound is a direct output of the Calvin cycle?

A) C6H12O6 B) NADPH C) G3P D) ATP Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Remember/Understand Learning Outcome: 7.9 Global LO: 3 9) The first step of the Calvin cycle is the incorporation of ________ into ________.

A) O2; G3P B) RuBP; O2 C) CO2; RuBP D) G3P; RuBP Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Remember/Understand Learning Outcome: 7.9 Global LO: 3 10) The last stage of one complete turn of the Calvin cycle involves regeneration of ________.

A) G3P B) CO2 C) RuBP D) sugar Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Remember/Understand Learning Outcome: 7.9 Global LO: 3 11) If an herbicide blocked the Calvin cycle before the generation of G3P, what would happen?

A) The plant would still be able to make sugar, just a lot less.

B) No oxygen would be released by the plant.

C) No sugar would be made by the plant.

D) Only RuBP would be recycled.

Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Evaluate/Create Learning Outcome: 7.9 Global LO: 2, 3

14 .

12) A plant that was grown in the dark continuously would ________.

A) not be able to take in CO2 without sunlight B) not be able to split water to provide NADH C) continue to photosynthesize because to in carbon dioxide, the only outside input to the Calvin cycle, does not require sunlight D) remain healthy because plants have stored materials in their roots that can provide what the Calvin cycle needs Answer: B Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Apply/Analyze Learning Outcome: 7.9 Global LO: 2, 3

15 .

7.3 Scenario Questions Please use the following information to answer the following questions.

You work for a company selling tropical rain forest plants commonly found in the understory of the forest. These plants are shade tolerant and can be grown indoors because they require low light. Your employer wants you to find out what is the best type of light to maximize growth of these understory plants. Using a full spectrum of natural light would cause these plants to die because they are a shade-tolerant plant species.

From your biology class, you recall that the light-dependent reactions of photosynthesis involve pigment molecules that absorb light of specific wavelengths. You also remember the experiments done by the German biologist Theodor Engelmann, in which he separated light using a prism into different wavelengths and then determined which wavelengths were best for promoting photosynthesis in the algae species he was examining. Your goal is to determine which wavelengths (colors) of light are best for promoting photosynthesis to enhance growth in your species of plant. To achieve this, you grew your plants under different wavelengths of light and measured their growth rates. The wavelengths were measured in nanometers (nm), and the growth rate was measured in millimeters per day (mm/day). The data you collected are as follows: Wavelengths 400 nm 450 nm 500 nm 550 nm 600 nm 650 nm 700 nm 750 nm

Growth 0.33 mm/day 0.46 mm/day 0.88 mm/day 0.12 mm/day 0.54 mm/day 0.28 mm/day 0.08 mm/day 0.00 mm/day

Make a bar graph plotting growth rates on the y-axis and wavelengths of light on the x-axis.

Referring to your graph, answer the following questions: 1) Which wavelength is best for your plants' growth?

A) 650 nm B) 550 nm C) 500 nm D) 400 nm Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Apply/Analyze Learning Outcome: 7.5 Global LO: 2, 3, 4

16 .

2) Which of these wavelengths is LEAST useful to your plants?

A) 650 nm B) 450 nm C) 550 nm D) 400 nm Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Apply/Analyze Learning Outcome: 7.5 Global LO: 2, 3, 4 3) Which wavelength of light is the LEAST useful to your plants' growth?

A) 750 nm B) 650 nm C) 550 nm D) 500 nm Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Apply/Analyze Learning Outcome: 7.5 Global LO: 2, 3, 4 4) Some plant species require shaded conditions while other plant species require bright sunlight.

Shade tolerance is best related to which of these characteristics?

A) Different species of plants have different ratios of pigment molecules that utilize different wavelengths of light.

B) Plant leaves without a protective coating are subject to sunburn.

C) Some species of plants are able to produce sugar without ever having been exposed to sunlight.

D) Some species of plants are consumers and do not need sunlight.

Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Evaluate/Create Learning Outcome: 7.5 Global LO: 2 5) The rate of photosynthesis in an aquatic plant can be determined by the number of bubbles released from the plant. These bubbles ________.

A) are hydrogen released when water is split B) are oxygen released when water is split C) are mostly carbon dioxide released when sugars are metabolized D) are water released when sugars are metabolized Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Apply/Analyze Learning Outcome: 7.5 Global LO: 2, 3, 4 17 .

6) The rate of photosynthesis in an aquatic plant can be determined by the number of bubbles released from the plant. The number of bubbles ________.

A) will increase in the presence of predominately green light B) is most numerous in the dark C) is less numerous at greater depths than at shallower depths D) will stay the same throughout a 24-hour period Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Evaluate/Create Learning Outcome: 7.5 Global LO: 2, 3, 4 7) Plants need carbon, hydrogen, and oxygen atoms to synthesize organic molecules to make new leaves, roots, or stems. Which statement about where they get these atoms is correct?

A) The carbon atoms come from the air.

B) The carbon atoms come from the soil.

C) The oxygen atoms come from water through the roots.

D) The oxygen is breathed in by the plants.

Answer: A Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.2 Global LO: 2 8) A student saw a bumper sticker with "Have you thanked a green plant today." This likely referred to ________.

A) without plants to cool the earth, life would have boiled away B) without plants to produce oxygen, most organisms could not survive C) without plants to produce firewood, humans would freeze to death D) without plants to feed decomposers, the soil would be sterile Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Apply/Analyze Learning Outcome: 7.2 Global LO: 2, 5

18 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 8 Cellular Reproduction: Cells from Cells 8.1 Multiple Choice Questions 1) A(n) ________ is an example of an organism that can sometimes reproduce asexually by parthenogenesis.

A) cat B) human C) zebra shark D) mouse Answer: C Topic: Biology and Society: Virgin Birth of a Shark Skill: Remember/Understand Learning Outcome: 8.1 2) The type of cell division that produces two genetically identical daughter cells is important for all of the following functions EXCEPT ________.

A) growth of a multicellular organism B) cell replacement C) production of sperm and eggs D) asexual reproduction Answer: C Topic: 8.1 What Cell Reproduction Accomplishes Skill: Remember/Understand Learning Outcome: 8.2 3) Eukaryotic cells have their chromosomes packaged in the ________.

A) nucleus B) centriole C) Golgi apparatus D) nucleolus Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.3

1 .

4) Chromatin consists of ________.

A) DNA and protein B) RNA and protein C) membrane wrapped around RNA D) membrane wrapped around DNA Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.3 5) A duplicated chromosome consists of two ________.

A) centromeres B) centrosomes C) genomes D) sister chromatids Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.3 6) The structure where sister chromatids are joined is called the ________.

A) centromere B) spindle C) centrosome D) centriole Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.3 7) What happens during interphase?

A) Chromatin becomes tightly coiled.

B) Chromosome duplication occurs.

C) Sister chromatids separate.

D) The mitotic spindle forms.

Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.4

2 .

8) The cells that result from the mitotic cell cycle can be described as ________.

A) four cells, each with the same amount of genetic material and the same genetic information B) two cells, each with the same amount of genetic material but with different genetic information C) two cells, each with the same amount of genetic material and the same genetic information D) four cells, each with the same amount of genetic material but with different genetic information Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.4 9) What happens during prophase?

A) Chromosomes line up on the midline of the cell.

B) The nuclear envelope forms.

C) Sister chromatids separate.

D) The mitotic spindle begins to form.

Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 10) ________ is a stage of mitosis.

A) Cytokinesis B) Telophase C) Interphase D) DNA synthesis Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 11) The CORRECT sequence of stages of mitosis is ________.

A) prophase, metaphase, anaphase, telophase B) telophase, prophase, anaphase, metaphase C) anaphase, interphase, prophase, metaphase, telophase Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5

3 .

12) During metaphase, ________.

A) the nuclear envelope breaks up B) sister chromatids move near the poles C) centrosomes divide D) chromosomes line up in the middle of the cell Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 13) Which event occurs during anaphase?

A) Sister chromatids become separate chromosomes.

B) Chromosomes line up in the middle of the cell.

C) The nuclear envelope breaks up.

Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 14) During telophase, ________.

A) the events of prophase are reversed B) chromosomes line up in the middle of the cell C) sister chromatids become separate chromosomes D) the nuclear envelope breaks up Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 15) A cell that completed the cell cycle without undergoing cytokinesis would ________.

A) have less genetic material than it started with B) not have completed anaphase C) have its chromosomes lined up in the middle of the cell D) have two nuclei Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Apply/Analyze Learning Outcome: 8.5 Global LO: 2

4 .

16) Cytokinesis typically begins during the ________ stage of mitosis.

A) telophase B) prophase C) metaphase D) anaphase Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.5 17) A correct comparison between a benign and a malignant tumor is that ________.

A) benign tumors are composed of cancer cells; malignant tumors are not B) benign tumors are not the result of a failure of a cell cycle control system; malignant tumors are C) benign tumors do not metastasize; malignant tumors do D) benign tumors do not form lumps; malignant tumors do form lumps Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.6 Global LO: 5 18) Which activity will help prevent cancer and increase survival?

A) Eat a low-fiber, low-fat diet.

B) Limit exercise.

C) Seek early detection of tumors.

D) Smoke cigarettes.

Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.7 Global LO: 5 19) Homologous chromosomes ________.

A) carry genes controlling the same inherited characteristics B) are a set of chromosomes received from one parent during sexual reproduction C) carry the same versions of all genes Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.8

5 .

20) What is the chromosome composition of a normal human male?

A) 22 autosomes and 2 Y chromosomes B) 44 autosomes and 2 Y chromosomes C) 44 autosomes, 1 X chromosome, and 1 Y chromosome D) 46 autosomes, 1 X chromosome, and 1 Y chromosome Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.8 21) What is the chromosome composition of a normal human female?

A) 22 autosomes and 2 X chromosomes B) 44 autosomes and 2 X chromosomes C) 44 autosomes, 1 X chromosome, and 1 Y chromosome D) 46 autosomes and 2 X chromosomes Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.8 22) Chromosomes that do NOT determine the sex of an individual are called ________.

A) homologous chromosomes B) nonhomologous chromosomes C) sex chromosomes D) autosomes Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.8 23) In sexual reproduction in humans ________.

A) haploid sperm fertilizes a haploid egg cell B) a haploid individual is produced C) an individual with 44 chromosomes is produced D) two diploid gametes are combined to produce a zygote Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9

6 .

24) In meiosis, how does prophase I differ from prophase II? A) During prophase I there is one diploid cell; during prophase II there are two haploid cells.

B) During prophase I chromosomes line up single file in the middle of the cell; during prophase II the chromosomes line up double file in the middle of the cell.

C) During prophase I the chromosomes coil up; the chromosomes are not coiled up during prophase II. D) In prophase I the sister chromatids are attached; in prophase II the sister chromatids are separated.

Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2 25) How much genetic material is present in a cell during prophase I compared to a cell that has completed meiosis II? A) one-quarter as much B) four times as much C) one-half as much D) twice as much Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2, 4 26) During metaphase I, ________.

A) crossing over occurs B) homologous chromosomes line up in the middle of the cell C) the nuclear envelope breaks up D) sister chromatids migrate to opposite poles Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9 27) Upon completion of telophase I and cytokinesis in meiosis, there is(are) ________ cell(s).

A) four haploid B) two diploid C) two haploid D) one diploid Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9

7 .

28) Which characteristic seen in prophase I does NOT occur in prophase II? A) Chromosomes move to the middle of the cell.

B) Spindle formation occurs.

C) The number of chromosomes doubles.

D) Crossing over occurs.

Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9 Global LO: 7 29) Anaphase II is essentially the same as mitotic anaphase except that in anaphase II ________ and in mitotic anaphase ________.

A) the cells are diploid; the cells are haploid B) chromosomes line up double file in the middle of the cell; chromosomes line up single file in the middle of the cell C) crossing over occurs; crossing over does not occur D) the cells are haploid and sister chromatids separate; the cells have the same number of chromosomes as the original cell and sister chromatids separate Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9 Global LO: 7 30) One difference between mitosis and meiosis is that mitosis ________.

A) produces cells genetically identical to the parent cell, but meiosis does not B) produces more daughter cells for each division than meiosis C) produces haploid cells, but meiosis produces diploid cells D) requires only one parent cell, but meiosis requires two parent cells Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9 Global LO: 7 31) Genetic variation is accomplished by all but one of the following. Choose the EXCEPTION. A) the events of meiosis I B) crossing over C) independent assortment D) the events of meiosis II Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2 8 .

32) During anaphase I ________.

A) half of the chromosomes inherited from the mother go to one pole along with half of the chromosomes inherited from the father B) sister chromatids separate and the daughter chromosomes migrate to opposite poles C) homologous chromosomes randomly separate and migrate to opposite poles D) all of the chromosomes inherited from the mother go to one pole of the cell, and all of the chromosomes inherited from the father go to the other pole Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.9 33) For a species with four pairs of chromosomes, ________ chromosome combinations are possible.

A) 4 B) 8 C) 16 D) 20 Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2, 4 34) Crossing over during prophase I results in ________.

A) nondisjunction B) reciprocal translocation C) duplication D) genetic recombination Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2 35) A karyotype (a display of the chromosomes in a cell) is often used to look for genetic disorders. Karyotype results would not be useful to determine ________.

A) sex B) Down syndrome C) Turner syndrome D) eye color Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 5 9 .

36) Nondisjunction might result in gametes with the chromosome numbers ________.

A) n + 1 or n − 1 B) 2n + 1 or 2n − 1 C) 2n + 1 or n − 1 Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 5, 7 37) How many chromosomes does an individual with Turner syndrome have?

A) 2n + 1 B) n + 1 C) 2n − 1 D) n − 1 Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 5, 7 38) Bdelloid rotifers appear to reproduce only asexually. Which outcome, if found in this group, would demonstrate that sexual reproduction may occur?

A) female rotifers with eggs B) significant differences of two different alleles among different populations (one population having mostly allele A and one having mostly a) C) cells in which meiosis occurs D) related groups (not bdelloid rotifers) which reproduce both sexually and asexually Answer: C Topic: The Process of Science: Do All Animals Have Sex? Skill: Evaluate/Create Learning Outcome: 8.11 Global LO: 1, 2, 6

10 .

39) Which type of reproduction is most adaptive in a rapidly changing environment with many different parasitic diseases present?

A) asexual reproduction, because the currently successful genotypes can reproduce quickly B) asexual reproduction, because asexual reproduction uses less energy, which leaves more for each individual to adapt to the changing environment C) sexual reproduction, because the diversity of genotypes increases the likelihood that there is one which can survive in a new environment D) sexual reproduction, because this type of reproduction allows the production of a greater number of offspring, thus providing more individuals to take advantage of any environmental challenges presented Answer: C Topic: Evolution Connection: The Advantages of Sex Skill: Evaluate/Create Learning Outcome: 8.12 Global LO: 2, 7

11 .

8.2 Art Questions 1) Examine the figure below. Nucleosomes are made of ________.

A) RNA and protein B) DNA and no protein C) DNA and histone proteins

12 .

Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Apply/Analyze Learning Outcome: 8.3 Global LO: 2, 3 2) As shown in the accompanying figure, plant cell cytokinesis differs from animal cell cytokinesis because ________.

A) plant cells produce more daughter cells B) plant cells form a cell plate and animal cells do not C) animal cells produce more daughter cells D) animal cells form a cell plate and plant cells do not Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Apply/Analyze Learning Outcome: 8.5 Global LO: 2, 3

13 .

3) If the cleavage furrow or cell plate shown in the figure formed nearer one pole of the dividing cell rather than at the midline, what would be the predicted result?

A) cytokinesis would never be completed B) the resulting cells would be much smaller than usual C) the resulting cells would be very different in size D) chromosomes could not separate properly Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Evaluate/Create Learning Outcome: 8.5 Global LO: 2, 3, 9 4)

This diagram of the human life cycle shows that ________.

A) meiosis produces a diploid zygote B) meiosis produces haploid sperm and egg cells C) fertilization produces a haploid zygote D) a diploid zygote undergoes meiosis to produce an adult human Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2, 3

14 .

5) What is the chromosome number found in humans cells if meiosis I is completed normally?

A) 46 autosomes B) 43 autosomes and 2 sex chromosomes C) 22 autosomes and a sex chromosome D) 44 autosomes and 2 sex chromosomes Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.9 Global LO: 2, 3, 4

6) The above figure shows that ________.

A) meiosis results in the formation of four haploid daughter cells B) fertilization results in four haploid daughter cells C) the human 2n number is 4 D) meiosis forms diploid gametes Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2, 3 7) The 2n number for the cell depicted here is ________.

A) one B) two C) four D) eight Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.9 Global LO: 2, 3, 4, 7 15 .

8) The karyotype above shows ________.

A) abnormal sex chromosomes B) trisomy 21, a cause of Klinefelter syndrome C) Turner syndrome D) trisomy 21, a cause of Down syndrome Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 9) Which of these mistakes would be evident in the karyotype shown?

A) a failure of cytokinesis after meiosis I in gamete formation B) a nondisjunction in meiosis II in gamete formation C) crossing over in meiosis I in gamete formation D) fertilization by two sperm in zygote formation Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 3, 5, 7

16 .

8.3 Scenario Questions Please read this paragraph and answer the following questions.

Amanda's parents realized that her body was not developing properly about the time she was 12 years old. She was shorter than most of her friends and was not going through changes normally associated with female puberty. They took her to a doctor who initially diagnosed Amanda with Turner Syndrome because of her physical features. The doctor ordered a karyotype that confirmed his diagnosis. Amanda was born with only one X chromosome. Although there is no specific cure, the doctor was able to treat her and correct some of the problems associated with the condition. For example, she received growth hormone to improve her growth and estrogen to help her develop the physical changes of puberty.

1) Amanda's abnormal number of sex chromosomes resulted from ________.

A) independent assortment of chromosomes B) crossing over C) nondisjunction D) random fertilization Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 2) With respect to her sex chromosomes, Amanda would be designated as ________.

A) XYY B) XO C) XOY D) XX Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Apply/Analyze Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 3) What percentage of Amanda's gametes would likely have the normal number of chromosomes?

A) zero B) 100 percent C) 50 percent D) 25 percent Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 3, 4, 5, 7

17 .

4) If the diagnosis had discovered that some, but not all, of Amanda's somatic (body, not gamete) cells had only one X chromosome, this could indicate that an error occurred ________.

A) during mitosis, leading to the sperm or egg that came together to form Amanda B) during meiosis in the first cell division of the original cell that was Amanda (the zygote) C) during meiosis, which occurred in Amanda's ovaries D) during mitosis, which occurred at a multicellular stage of Amanda's development Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.10 Global LO: 2, 3, 4, 5, 7 5) When in mitosis are there twice as many chromatids compared to the original cell's chromosomes?

A) prophase B) anaphase C) telophase D) G1 phase Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Apply/Analyze Learning Outcome: 8.4 Global LO: 2, 4 6) Consider an organism that usually reproduces sexually. If it produces haploid offspring through the development of unfertilized eggs, what would be the genetic similarity of those offspring to one another?

A) Since the offspring were produced without fertilization, they would all be genetically just alike.

B) If the eggs were products of meiosis, the offspring would NOT be genetically just alike.

C) If the offspring were produced asexually by mitosis, they would not be genetically just alike.

D) Genetic differences can only occur in organisms that are produced through meiosis and fertilization, so they would be genetically just alike Answer: B Topic: Biology and Society: Virgin Birth of a Shark Skill: Evaluate/Create Learning Outcome: 8.1 Global LO: 2, 7

18 .

7) What best explains the chromosome number of the resulting cell if a cell that had completed only meiosis I were fertilized by a normal sperm?

A) Both cells would be haploid, so the chromosome number of the resulting cell would be diploid.

B) This would be a diploid cell being fertilized by a haploid cell, so the chromosome number would be triploid.

C) At fertilization the sister chromatids in the sperm would separate, so the number would be triploid.

D) Both cells would be haploid, so the resulting cell would also be haploid.

Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Evaluate/Create Learning Outcome: 8.9 Global LO: 2, 4, 7 8) There is evidence of a phenomenon called quorum sensing in rotifers. Under certain conditions, a chemical released by females who usually reproduce asexually results in males being produced. The presence of these males allows sexual reproduction. What conditions would most likely lead to a switch to sexual reproduction?

A) not enough individuals in the population B) too many individuals in the population C) a change in the environment D) too many males Answer: C Topic: Biology and Society: Virgin Birth of a Shark Skill: Apply/Analyze Learning Outcome: 8.1 Global LO: 2, 4, 7 9) A promising new type of cancer treatment, immunotherapy, may involve all but one of these treatments. Choose the EXCEPTION. A) increasing the effectiveness of the body's own immune response to cancer cells B) creating proteins that kill cancer cells and giving them to the cancer patient C) injecting molecules harvested from other cured cancer patients into the patient with cancer Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Remember/Understand Learning Outcome: 8.7 Global LO: 5

19 .

10) If organisms reproduced sexually but without meiosis, what would result?

A) The resulting organisms would be haploid.

B) The gametes would be haploid.

C) The chromosome number would double each generation.

D) The zygote would be unable to divide.

Answer: C Topic: Evolution Connection: The Advantages of Sex Skill: Apply/Analyze Learning Outcome: 8.12 Global LO: 2, 4 11) Homologous chromosomes ________.

A) differ in shape B) have different genes C) pair-up during mitosis D) separate at meiosis I Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Remember/Understand Learning Outcome: 8.8

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 9 Patterns of Inheritance 9.1 Multiple Choice Questions 1) The best definition of a purebred plant is one that ________.

A) cannot be cross-fertilized B) passes on the next generation only those traits identical to the parent C) produces sterile offspring when cross-fertilized D) self-fertilizes to produce hybrid offspring Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 2) A mating between a purebred purple-flowered pea plant and a purebred white-flowered pea plant would produce a(n) ________.

A) purebred variety B) hybrid C) P generation D) F2 generation Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 Global LO: 3 3) Alleles are described as ________.

A) homologous chromosomes B) environmental factors that affect gene expression C) alternate versions of a gene D) alternate phenotypes Answer: C Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2

1 .

4) A purebred plant that produces yellow seeds is crossed with a purebred plant that produces green seeds. The seeds of all of the offspring are yellow. Why? A) The yellow allele is recessive to the green allele.

B) All of the offspring are homozygous yellow.

C) The yellow allele is dominant to the green allele.

D) The alleles are codominant.

Answer: C Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2 5) A purebred plant that produces yellow seeds is crossed with a purebred plant that produces green seeds. The F1 plants have yellow seeds. What is the expected phenotypic ratio of seed color of the offspring of an F1 × F1 cross?

A) 1:2:1 B) 2:1 C) 3:1 D) 9:3:3:1 Answer: C Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4 6) Mendel's law of segregation indicates that A) two alleles segregate into each gamete.

B) more gametes carrying the dominant allele are produced than gametes carrying the recessive allele.

C) gametes have one allele copy for each gene.

D) gametes are diploid.

Answer: C Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 7) Attached earlobes are recessive to free earlobes. What genotypic ratio is expected when an individual with attached earlobes mates with an individual heterozygous for free earlobes?

A) 2:1 B) 1:1 C) 1:2:1 D) 3:1 Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4 2 .

8) Mendel crossed purebred purple-flowered plants with purebred white-flowered plants, and all of the resulting offspring produced purple flowers. The offspring are all ________, and the allele for purple flowers is ________.

A) heterozygotes; recessive B) heterozygotes; dominant C) homozygotes; recessive D) homozygotes; dominant Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2 9) Attached earlobes are recessive to free earlobes. What is the probability of having a child with attached earlobes when an individual with attached earlobes mates with an individual heterozygous for free earlobes?

A) 0% B) 25% C) 50% D) 75% Answer: C Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4 10) In humans, the presence or absence of dimples is a trait controlled by a single gene. What is the genotype of an individual who is heterozygous for dimples?

A) DD B) Dd C) dd D) DI Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2 11) An individual who is homozygous ________.

A) expresses the dominant trait B) carries two different alleles for a gene C) carries two copies of the same allele for a gene D) expresses the recessive trait Answer: C Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 3 .

12) Which cross will produce only heterozygous offspring?

A) AA × aa B) AA × Aa C) Aa × Aa D) Aa × aa Answer: A Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2 13) What is the specific location of a gene on a chromosome?

A) locus B) phenotype C) genotype D) allele Answer: A Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 14) Round seeds (R) are dominant to wrinkled seeds (r), and yellow seeds (Y) are dominant to green seeds (y). What is the expected phenotypic ratio of a cross between an RrYy and an rryy individual?

A) 1:2:1 B) 9:3:3:1 C) 3:1 D) 1:1:1:1 Answer: D Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4 15) An individual with the genotype AaBb produces four different gametes in equal proportions.

This is a demonstration of ________.

A) the chromosomal theory of inheritance B) Mendel's law of independent assortment C) linkage D) Mendel's principle of segregation Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4

4 .

16) To determine the phenotype of an individual who expresses a dominant trait, you would cross that individual with an individual who ________.

A) expresses the dominant trait B) is homozygous recessive for that trait C) is homozygous dominant for that trait D) is heterozygous for that trait Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.3 17) A couple has two female children. What is the probability that their next child will be male?

A) 25% B) 50% C) 33% D) 67% Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.3 Global LO: 2, 3, 4 18) In humans, free earlobes (E) are dominant to attached earlobes (e) and the presence of freckles (F) is dominant to the absence of freckles (f). If an individual heterozygous for both of these traits were to mate with an individual with attached earlobes and no freckles, what is the probability of having a child with attached earlobes and freckles?

A) 0% B) 25% C) 50% D) 100% Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.3 Global LO: 2, 3, 4 19) What would you examine to determine whether a trait is sex linked?

A) karyotype B) pedigree C) DNA sequence D) blood test Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.3 Global LO: 2, 3, 4 5 .

20) The ________ is most commonly found in nature.

A) recessive trait B) wild-type trait C) parental type D) dominant trait Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.4 21) An individual who is heterozygous for cystic fibrosis ________.

A) cannot have children with cystic fibrosis B) is a carrier C) will have children who are all carriers of cystic fibrosis D) has cystic fibrosis Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2 22) Achondroplasia is a form of dwarfism caused by a dominant allele. The homozygous dominant genotype causes death, so individuals who have this condition are all heterozygotes. If a person with achondroplasia mates with a person who does not have achondroplasia, what percentage of their children would be expected to have achondroplasia?

A) 0% B) 50% C) 75% D) 100% Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.2 Global LO: 2, 3, 4 23) Which technique is used to collect fetal cells during pregnancy for genetic testing?

A) testcross B) dihybrid cross C) amniocentesis D) pedigree analysis Answer: C Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.5

6 .

24) What is the key to the recognition of incomplete dominance?

A) The phenotype of the heterozygote falls between the phenotypes of the homozygotes.

B) The trait exhibits a continuous distribution.

C) The alleles affect more than one trait.

D) The heterozygote expresses the phenotype of both homozygotes.

Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Apply/Analyze Learning Outcome: 9.7 Global LO: 2 25) An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. What is the relationship between the alleles for hair texture?

A) pleiotropy B) incomplete dominance C) wavy hair dominant to both straight and curly hair D) codominance Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Remember/Understand Learning Outcome: 9.7 Global LO: 2 26) An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. If an individual with wavy hair mates with an individual with straight hair, what is the probability that their child will have curly hair?

A) 0% B) 25% C) 50% D) 75% Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Apply/Analyze Learning Outcome: 9.7 Global LO: 2, 3, 4 27) What is the key to the recognition of codominance?

A) The phenotype of the heterozygote is intermediate between the phenotypes of the homozygotes.

B) The trait exhibits a continuous distribution.

C) The alleles affect more than one trait.

D) The heterozygote expresses the phenotype of both homozygotes.

Answer: D Topic: 9.2 Variations on Mendel's Laws Skill: Remember/Understand Learning Outcome: 9.7 7 .

28) An individual with the blood group genotype LMLN has the phenotype MN. What is the relationship between the LM and LN alleles?

A) codominance B) pleiotropy C) LN is dominant D) incomplete dominance Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Apply/Analyze Learning Outcome: 9.7 Global LO: 2 29) Marfan syndrome is the result of inheriting a single allele. Individuals with Marfan syndrome are tall and long-limbed, and have both cardiovascular and eye defects. Marfan syndrome is an example of ________.

A) codominance B) homozygous recessive C) pleiotropy D) incomplete dominance Answer: C Topic: 9.2 Variations on Mendel's Laws Skill: Apply/Analyze Learning Outcome: 9.7 Global LO: 2, 5 30) Which outcome could help you identify a trait whose expression is determined by the effects of two or more genes (polygenic inheritance)?

A) A mating between a homozygous and a heterozygous individual produces more than the expected number of offspring expressing the dominant trait.

B) All of the alleles of the gene for that trait are equally expressed.

C) Pleiotropy occurs.

D) The trait varies along a continuum in the population.

Answer: D Topic: 9.2 Variations on Mendel's Laws Skill: Remember/Understand Learning Outcome: 9.7 31) Which trait is polygenic in humans?

A) cystic fibrosis B) height C) blood type D) sickle-cell disease Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Remember/Understand Learning Outcome: 9.7 Global LO: 5 8 .

32) Many human traits, such as our performance on intelligence tests or our susceptibility to heart disease, are ________.

A) determined only by our genes B) influenced by both genes and the environment C) determined by genes in some people and by the environment in other people D) determined solely by environmental factors Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Remember/Understand Learning Outcome: 9.7 Global LO: 2 33) Mendel's laws are based on the behavior of chromosomes during ________.

A) prophase I of meiosis only B) mitotic anaphase C) prophase I and prophase II of meiosis D) metaphase I and anaphase I of meiosis Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Remember/Understand Learning Outcome: 9.8 34) Genes that violate Mendel's principle of independent assortment are ________.

A) codominant B) linked C) recessive D) pleiotropic Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Remember/Understand Learning Outcome: 9.8 35) A BbCc × bbcc cross that produces offspring in a 5:5:1:1 phenotypic ratio is evidence of ________.

A) linked genes B) polygenic inheritance C) incomplete dominance D) codominance Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.8 Global LO: 2, 3, 4

9 .

36) A dihybrid cross produces 30 recombinant offspring out of a total of 1,000 offspring. What is the recombination frequency of the two gene pairs?

A) 6% B) 3% C) 30% D) 1.5% Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.8 Global LO: 2, 3, 4 37) Linked genes are usually ________.

A) found on the X chromosome B) found on the Y chromosome C) codominant D) located close together on a chromosome Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Remember/Understand Learning Outcome: 9.8 38) Assume that having three nostrils is inherited as a sex-linked trait on the Y chromosome. A man with three nostrils has a daughter who has a son with a man who has only two nostrils. What is the probability that the three-nostril man's grandson has three nostrils?

A) 0% B) 25% C) 50% D) 100% Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.9 Global LO: 2, 3, 4 39) Red-green colorblindness is inherited as a sex-linked recessive trait. The gene is found on the X chromosome. Can a man with normal color vision father a daughter who is red-green colorblind?

A) Yes, if the woman with whom he mates is red-green colorblind.

B) Yes, if the man is heterozygous for red-green colorblindness.

C) No, he can't (unless there is a mutation).

D) No, the expression of the trait skips a generation.

Answer: C Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.9 Global LO: 2, 5 10 .

40) Hypophosphatemia (vitamin D–resistant rickets) is inherited as a sex-linked dominant trait.

The relevant gene is found on the X chromosome. What is the expected outcome of a cross between a homozygous recessive woman and a man with hypophosphatemia?

A) All of their daughters and none of their sons exhibit hypophosphatemia.

B) Fifty percent of their daughters and fifty percent of their sons exhibit hypophosphatemia.

C) All of their sons and none of their daughters exhibit hypophosphatemia.

D) Twenty-five percent of their offspring exhibit hypophosphatemia.

Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.9 Global LO: 2, 3, 4, 5 41) Experience with dog breeding has taught geneticists that ________.

A) given enough time, any desired trait can be bred into dogs B) purebred dogs are often sterile due to inbreeding C) while physical traits can be molded through artificial selection, behavioral traits cannot D) geographically isolated groups of dogs may be selected for quite different traits, resulting in a different dog breed Answer: D Topic: Biology and Society: Our Longest-Running Genetic Experiment: Dogs and Evolution Skill: Remember/Understand Learning Outcome: 9.1, 9.10 Global LO: 5

11 .

9.2 Art Questions Please refer to the following art to answer the following questions.

1) In the accompanying art, you see a table with the actual number of offspring that resulted from a dihybrid cross. The numbers do not show the 9:3:3:1 ratio predicted. One phenotype occurred more than predicted; another occurred less. The reason could be because ________.

A) of errors in mitosis B) some of the alleles were linked C) of polygenic inheritance Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Evaluate/Create Learning Outcome: 9.8 Global LO: 2, 3, 4 2) Recombinant offspring were produced by the mating shown in the accompanying art. What is the recombination frequency of purple-round and red-long offspring?

A) 21% B) 381 C) 21 + 21 D) 11% Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Apply/Analyze Learning Outcome: 9.8 Global LO: 2, 3, 4

12 .

3) This hypothetical pedigree for a disease in humans illustrates inheritance that is ________.

A) autosomal recessive B) autosomal dominant C) sex-linked dominant D) carried on the Y chromosome Answer: A Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.9 Global LO: 2, 3, 5

13 .

9.3 Scenario Questions Please read the following scenario to answer the following questions.

Widow's peak, a pointed hairline on the forehead, is a genetic trait caused by a dominant allele. It can be traced back through a family's history using pedigree analysis.

The pedigree shown here is of three generations of a family. Notice that some individuals (shown in gray) have a widow's peak (W = dominant allele and w = recessive allele).

1) Mary has the genotype ________.

A) WW B) ww C) Ww Answer: C Topic: 9.1 Genetics and Heredity Skill: Evaluate/Create Learning Outcome: 9.3 Global LO: 2, 3, 4 2) Janice's genotype is ________.

A) Ww B) WW C) ww D) WW or Ww Answer: D Topic: 9.1 Genetics and Heredity Skill: Evaluate/Create Learning Outcome: 9.3 Global LO: 2, 3, 4

14 .

3) This pedigree supports the fact that widow's peak is due to a dominant allele, because if it were due to a recessive allele and both parents show the recessive phenotype, then ________.

A) half of the sons would have a widow's peak B) all of the offspring would have a widow's peak C) none of the daughters would have a widow's peak D) all of the daughters and none of the sons would have a widow's peak Answer: B Topic: 9.1 Genetics and Heredity Skill: Evaluate/Create Learning Outcome: 9.3 Global LO: 2, 3, 4 Please read the following scenario to answer the following question.

The parents of a child with unusual disease symptoms take the child to a doctor for help. The doctor suspects that the condition might have a genetic basis. She recommends that the child be taken to a specialty clinic where physicians and staff members are trained to diagnose genetic diseases and counsel parents. Ultimately, the child is diagnosed with a rare recessively inherited disease. The parents are tested for the gene, and both are found to be heterozygous. The parents want to have another child but are afraid this child will also be affected.

4) What would genetic counselors say is the probability that the second child will have the disease?

A) 1/2 B) 1/4 C) 1/8 D) 1/16 Answer: B Topic: 9.1 Genetics and Heredity Skill: Apply/Analyze Learning Outcome: 9.3 Global LO: 2, 3, 4, 5

15 .

5) The parents of a child with unusual disease symptoms take the child to a doctor for help. The doctor suspects that the condition might have a genetic basis. She recommends that the child be taken to a specialty clinic where physicians and staff members are trained to diagnose genetic diseases and counsel parents. Ultimately, the child is diagnosed with a rare recessively inherited disease. The parents are tested for the gene, and both are found to be heterozygous. The parents are expecting another child and ask about a test to determine if this child may carry the disease.

All but one of these tests may detect genetic disorders in the unborn child. Choose the EXCEPTION. A) chorionic villus sampling B) pedigree analysis C) blood tests to measure levels of alpha-fetoprotein D) amniocentesis Answer: B Topic: The Process of Science Skill: Apply/Analyze Learning Outcome: 9.5 Global LO: 2, 5 6) To determine the phenotype of an individual who expresses a dominant trait, you would cross that individual with an individual who is homozygous recessive for that trait. This technique is referred to as a(n) ________.

A) dihybrid cross B) test cross C) amniocentesis D) pedigree analysis Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.3 7) A mating between a purebred purple-flowered pea plant and a purebred white-flowered pea plant would be called a ________.

A) pedigree analysis B) monohybrid cross C) test cross D) dihybrid cross Answer: B Topic: 9.1 Genetics and Heredity Skill: Remember/Understand Learning Outcome: 9.2

16 .

8) Scientists have long been interested in differences between dogs and wolves in their social behavior toward humans. Dogs and wolves share a common ancestor. In trying to understand the differences, a researcher analyzed data collected from 18 domesticated dogs and 10 wolves that had been raised by humans. Which data would be most useful to this study?

A) The degree of DNA similarities between dogs and humans.

B) The extent to which the dogs and the wolves sought assistance from humans when presented with a challenge.

C) The extent to which the dogs and the wolves licked and vocalized to their pups.

D) A measurement of the number of times the dogs and the wolves communicated with one another when threatened.

Answer: B Topic: The Process of Science Skill: Evaluate/Create Learning Outcome: 9.6 Global LO: 1, 2, 3, 4, 5, 9 9) Scientists have long been interested in differences between dogs and wolves in their social behavior toward humans. Dogs and wolves share a common ancestor. In trying to understand the differences, a researcher analyzed data collected from 18 domesticated dogs and 10 wolves that had been raised by humans. Which data would be most useful to understand the genetic basis of this behavior?

A) The pedigree for the dogs and the geographic location from which the wolves came.

B) The number of chromosomes in wolves and dogs.

C) Differences in DNA sequences between the dogs and the wolves.

D) Examination of DNA from the ancient ancestor of dogs and wolves.

Answer: C Topic: The Process of Science Skill: Apply/Analyze Learning Outcome: 9.6 Global LO: 1, 2, 3, 4, 5, 9 10) Scientists have long been interested in differences between dogs and wolves in their social behavior toward humans. Dogs and wolves share a common ancestor. In trying to understand the differences, a researcher analyzed data collected from 18 domesticated dogs and 10 wolves that had been raised by humans. If she discovered that the degree of social relationship a dog exhibited toward humans was positively correlated with a chemical modification of a part of a chromosome rather than what alleles a dog had, this would be an example of ________.

A) pleiotropy B) incomplete dominance C) epigenetics D) polygenic inheritance Answer: C Topic: 9.2 Variations on Mendel's Laws Skill: Apply/Analyze Learning Outcome: 9.7 Global LO: 1, 2 17 .

11) Humans have been applying the principles of genetics for many years without actually knowing about genes. Evidence for this is that humans ________.

A) have rerouted waterways in order to trade with people in distant regions B) clear forests to plant crops C) choose to save seeds from plants with the best yield to plant for the next generation D) and other species are subject to many of the same diseases Answer: C Topic: Biology and Society: Dog Breeding Skill: Apply/Analyze Learning Outcome: 9.1 Global LO: 2, 5

18 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 11 How Genes Are Controlled 11.1 Multiple Choice Questions 1) The process by which genotype becomes expressed as phenotype is ________.

A) gene regulation B) transcription C) gene expression D) translation Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.2 2) In bacteria, what name is given to a cluster of genes with related functions, along with their DNA control sequences?

A) operon B) operator C) promoter D) repressor Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 3) Bacterial RNA polymerase binds to the ________.

A) operator B) repressor C) enhancer D) promoter Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 4) In prokaryotes, the production of a single RNA transcript for a group of related genes is under the control of ________.

A) an operon B) enhancers C) a signal transduction pathway D) transcription factors Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 1 .

5) In an operon, the ________ acts as an on/off switch.

A) operator B) promoter C) activator D) repressor Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 6) What is the function of a repressor protein?

A) To turn off transcription by binding to the operator.

B) To turn off transcription by binding to the activator.

C) To turn on transcription by binding to the operator.

D) To turn on transcription by binding to the activator.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 7) Repressors act by blocking the binding of ________ to the operator.

A) promoters B) DNA polymerase C) the operon D) RNA polymerase Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 8) What would you assume if you found RNA transcripts of lactose-utilizing genes within E. coli?

A) Lactose has bound to the lac operon activator.

B) Lactose is present in the cell.

C) The lac operon activator protein is present in the cell.

D) The lac operon repressor protein is absent in the cell.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.3 Global LO: 2

2 .

9) While examining a human cell that functions normally, you determine that it has 45 functional chromosomes and one chromosome that is almost completely inactive. You immediately decide that it is very likely that this cell ________.

A) came from a normal human female B) is lacking a chromosome C) is a gamete D) will become cancerous if one or two more genes are mutated Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.4 Global LO: 2 10) What is the first level of control of eukaryotic gene transcription?

A) RNA splicing B) attachment of RNA polymerase to the promoter C) DNA packing and unpacking D) the binding and unbinding of transcription factors to enhancer sequences Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 11) Male tortoiseshell cats ________.

A) do not have an X chromosome B) have orange and black patches of fur that reflect the pattern of X chromosome inactivation C) are usually XYY individuals D) are likely to be exceedingly rare and very likely to be sterile since normal male cats are XY Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.4 Global LO: 2 12) Which of these plays a role in the regulation of transcription in both prokaryotic and eukaryotic cells?

A) RNA splicing B) attachment of RNA polymerase to the promoter C) transcription factors D) gene operons Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4

3 .

13) What type of protein binds to silencers to prevent gene expression from occurring?

A) enhancers B) repressors C) promoters D) RNA polymerase Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 14) Non-coding DNA sequences are referred to as ________.

A) exons B) introns C) genes Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 15) Which is a type of post-transcriptional regulation of gene expression?

A) inactivation of tRNA B) alteration of DNA nucleotide sequences C) breakdown of proteins D) binding of transcription factors to enhancers Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 16) What would enable a single RNA transcript to be translated into different polypeptides?

A) The RNA transcript can be spliced more than one way.

B) The coded polypeptide may be modified in more than one way.

C) The length of the RNA transcript tail can vary.

D) Two different genes can produce the same RNA transcript, which will then be translated differently.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4

4 .

17) In a eukaryotic cell an abnormal protein is binding to the promoter for a gene. Which process will likely occur in this scenario?

A) Transcription factors will bind to enhancers.

B) Transcription factors will bind to the promoter.

C) The gene will be expressed normally.

D) RNA polymerase will bind to the promoter.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.4 Global LO: 2 18) Cells communicate with one another via ________.

A) cascades of gene activation B) the diffusion of RNA transcripts through adhesion junctions C) signal transduction pathways D) RNA splicing Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.5 19) Homeotic genes are important for ________.

A) the development of an organism's body plan B) gene expression in prokaryotes C) signal transduction pathways D) gene regulation in eukaryotic cells Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.5 20) Which is most likely to cause the development of a six-legged frog?

A) mutation of homeotic genes B) binding of repressors to operons C) a mutation in DNA polymerase that affects all cells D) conversion of a proto-oncogene to an oncogene Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.5 Global LO: 2

5 .

21) Homeotic genes ________.

A) have very different sequences in plant cells as compared to animal cells B) are an example of convergent evolution C) are evidence of the common ancestry of eukaryotic organisms D) regulate gene expression in both prokaryotic and eukaryotic cells Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.5 Global LO: 7 22) Which technique could tell you how gene expression differs between individuals with and without cystic fibrosis?

A) therapeutic cloning B) DNA microarray C) reproductive cloning Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.6 Global LO: 2 23) How are the cells in different body tissues able to perform different functions?

A) The cells exhibit different patterns of gene expression.

B) Different chromosomes have been inactivated in different cells.

C) The cells contain different genes.

D) Mutations have accumulated in the cells over time.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.2 24) How can mature plants be cloned to produce genetically identical copies?

A) Mature plant cells contain only a fraction of the genes found in an adult plant.

B) Plants have evolved over time to suit the need of human agriculture.

C) Mature plant cells can develop into all the specialized cells of an adult plant.

Answer: C Topic: 11.2 Cloning Plants and Animals Skill: Remember/Understand Learning Outcome: 11.7

6 .

25) Reproductive cloning has many applications. Choose the exception.

A) the production of genetically identical mice and rats for scientific use B) the production of organs in pigs for transplant into humans C) creating stem cells to treat human diseases D) restoring populations of extinct animals such as the saber-toothed tiger Answer: C Topic: 11.2 Cloning Plants and Animals Skill: Apply/Analyze Learning Outcome: 11.8 Global LO: 2, 5 26) Identify a difference between embryonic and adult stem cells from the following list.

A) The use of embryonic stem cells raises fewer ethical issues than the use of adult stem cells.

B) Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.

C) It is easier to obtain embryonic stem cells.

D) Adult stem cells are easier to grow in culture.

Answer: B Topic: 11.2 Cloning Plants and Animals Skill: Remember/Understand Learning Outcome: 11.9 Global LO: 5 27) What name is given to a gene that causes cancer?

A) repressor B) promoter C) homeotic gene D) oncogene Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10 Global LO: 5 28) Many proto-oncogenes regulate ________.

A) cell growth B) cell cloning C) cell division D) cell repair Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10

7 .

29) Inheritance of certain genes increases the risk of getting certain cancers; thus, it can be said that ________.

A) these cancers are inherited as a dominant trait B) mutations that occur in somatic cells can be passed from parent to offspring C) predisposition to these cancers is inherited D) lifestyle will have little impact on cancer risk for these individuals Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10, 11.12 Global LO: 5 30) Data suggest that the normal version of BRCA1 functions as a(n) ________.

A) oncogene B) tumor-suppressor gene C) proto-oncogene D) silencer Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10 Global LO: 5 31) When referring to cell division, oncogenes are most like ________ while tumor suppressor genes are most like ________.

A) the brakes on a car; the gas pedal on a car B) the gas pedal on a car; the brakes on a car C) the steering wheel on a car; the gas pedal on a car D) the brakes on a car; the steering wheel on a car Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Apply/Analyze Learning Outcome: 11.10 Global LO: 2 32) If you were working for a pharmaceutical company trying to develop anticancer drugs, what biological process would be the best target to investigate?

A) meiosis B) mitosis C) cellular respiration D) glycolysis Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Apply/Analyze Learning Outcome: 11.10 Global LO: 2, 5, 7 8 .

33) Which risk factor is associated with cancer of the colon and rectum?

A) tobacco B) viruses C) UV radiation D) dietary fat Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.12 Global LO: 5 34) ________ is(are) responsible for more cancers than any other carcinogen.

A) asbestos B) UV radiation C) tobacco D) X-rays Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.12 Global LO: 5 35) More people die of ________ cancer than of any other cancer.

A) lung B) skin C) pancreatic D) breast Answer: A Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.12 Global LO: 5 36) Which of these lifestyle choices will increase cancer risk?

A) jogging B) spending less time in the sun C) changing to a diet low in plant fiber D) quitting smoking Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.12 Global LO: 5

9 .

37) Tumor cells can change over time in a variety of ways. The following options are all ways that tumors change over time except for one. Choose the exception.

A) Tumor cells show genetic variability.

B) Tumor cells grow uncontrollably.

C) Tumor cells pass on mutations when they divide.

D) Tumor cells can spread throughout the body.

Answer: D Topic: Evolution Connection: The Evolution of Cancer in the Body Skill: Remember/Understand Learning Outcome: 11.13 Global LO: 5, 7 38) About one out of how many women will develop breast cancer?

A) 2 B) 4 C) 8 D) 10 Answer: C Topic: Biology and Society: Breast Cancer and Chemotherapy Skill: Remember/Understand Learning Outcome: 11.1 Global LO: 5 39) Suppose a cDNA has the sequence CTTAGGA. What is the corresponding mRNA sequence?

A) AGGATTC B) GAATCCT C) GAAUCCU D) UCCUAAG Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.6 Global LO: 1, 2, 7 40) What is the benefit of using avatars in cancer treatments?

A) Avatars result in the cure for cancer.

B) Avatars allow clinicians to identify more effective drugs to use.

C) Avatars can be used to prevent the onset of cancer in young people.

D) Avatars are used to develop new drugs to treat cancer.

Answer: B Topic: The Process of Science: Can Avatars Improve Cancer Treatment?

Skill: Remember/Understand Learning Outcome: 11.11 Global LO: 5

10 .

41) Which is a possible result of a miRNA molecule binding to an mRNA molecule?

A) degradation of the mRNA B) transcription of the mRNA C) protection of the mRNA D) addition of a cap and tail to the mRNA Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 42) What can scientists achieve by injecting siRNAs into a cell via the process of RNA interference?

A) Scientists can turn genes on.

B) Scientists can prevent genes from being expressed.

C) Scientists can increase the rate of translation.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 43) A researcher is attempting to use RNAi to investigate the function of citrate synthase, an enzyme that is involved in the Kreb's cycle. If the researcher injected siRNAs complementary to citrate synthase mRNA into cells, what is the most likely outcome that she would observe?

A) Less citrate synthase RNA would be produced.

B) Less citrate synthase protein would be produced.

C) More citrate synthase protein would be produced.

D) More citrate synthase RNA would be produced.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.4 Global LO: 1, 2, 7

11 .

11.2 Art Questions 1) Use the accompanying figure to answer this question. The initiation of transcription requires that enhancers bind to ________.

A) DNA B) the promoter C) transcription factors D) RNA polymerase Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.4 Global LO: 3

12 .

2) What can you conclude from this figure?

A) The mRNA with exon 3 is longer than the mRNA with exon 4.

B) Exon 1 contains the stop codon for the production of a protein.

C) Exon 3 and exon 4 are being alternatively spliced.

D) This process is occurring in the cytoplasm of a eukaryotic cell.

Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Apply/Analyze Learning Outcome: 11.4 Global LO: 2, 3, 7

13 .

3) The lac operon is shown in the accompanying figure. The lac operon is usually in the ________ position and is activated by ________.

A) on; the repressor B) off; lactose C) off; the repressor D) on; the promoter Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Remember/Understand Learning Outcome: 11.3 Global LO: 3

14 .

4) Consider the accompanying figure, which outlines cloning by nuclear transplantation. Why does the clone NOT resemble the surrogate mother?

A) The sperm came from a male donor, who would also pass some of his traits to the clone.

B) The embryonic cells are adversely influenced by the surrogate.

C) The DNA for the clone comes from the genetic donor, not the surrogate.

D) The nuclear material from the egg would influence the appearance of the clone.

Answer: C Topic: 11.2 Cloning Plants and Animals Skill: Remember/Understand Learning Outcome: 11.8 Global LO: 3

15 .

5) In a typical colon cancer, the first step is ________.

A) the inactivation of a tumor-suppressor gene B) the mutation of a tumor-suppressor gene, producing an oncogene C) the mutation of a proto-oncogene, producing an oncogene D) the conversion of an oncogene to a tumor-suppressor gene Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10 Global LO: 3, 5

16 .

6) A variety of risk factors contribute to cancers. Additionally, some cancers are more deadly than others. What can you conclude from the accompanying figure regarding cancer?

A) Pancreatic cancer resulted in more deaths in 2017 than lymphoma.

B) Alcohol only contributes to the development of liver cancer.

C) Prostate cancer only occurs in females.

D) There were over 130 million new diagnoses of colorectal cancer in 2017.

Answer: A Topic: 11.3 The Genetic Basis of Cancer Skill: Apply/Analyze Learning Outcome: 11.12 Global LO: 2, 3, 5

17 .

11.3 Scenario Questions Please read the paragraph below to answer the following questions.

Jim has become particularly interested in the genetic basis of cancer and has spent considerable time reading published papers about oncogenes. He learned that as early as 1972 researchers suggested that mutations in proto-oncogenes caused by carcinogens can convert the protooncogenes to oncogenes. He asked you to answer a couple of questions about this because he did not have a sufficient biology background.

1) Jim learned that some cancer cells produce more growth factors than others. Which explanation most likely explains this observation?

A) Tumor suppressor genes may have been activated in the cells with more growth factors.

B) Mutations in homeotic genes may have occurred in the cells with fewer growth factors.

C) Vitamin C and Vitamin E may have been deficient in the cells with more growth factors.

D) Proto-oncogenes may have mutated to become oncogenes in the cells with more growth factors.

Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Evaluate/Create Learning Outcome: 11.10 Global LO: 2, 5 2) Jim learned that viruses can sometimes cause cancer and wants to know why. You tell him that ________.

A) a human cell can acquire a tumor-suppressor gene from a virus B) a human cell can acquire a proto-oncogene from a virus C) a human cell can acquire an oncogene from a virus D) some viruses are passed from mother to child and cause "inherited" cancers Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Remember/Understand Learning Outcome: 11.10 Global LO: 2, 5 3) Jim came across an advertisement for an herbal supplement that claimed to cure lung cancer by targeting precancerous cells in the lungs. If this claim were true, which of the following is a possible mechanism by which it may act?

A) The supplement would increase mutation rates in proto-oncogenes.

B) The supplement would inhibit the production of tumor suppressor proteins.

C) The supplement would stimulate translation of growth factors.

D) The supplement would restrict the transcription of oncogenes.

Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Apply/Analyze Learning Outcome: 11.10 Global LO: 2, 5, 6 18 .

Please read the paragraph below to answer the following questions.

You conducted a series of experiments to test whether the expression of hexokinase, an important enzyme involved in glycolysis, varies under different conditions. In the first experiment, you measured the production of hexokinase mRNA in cells at three different temperatures: 37°C, 25°C, and 10°C. Your results showed that the mRNA levels for hexokinase were 5× and 20× lower at 25°C and 10°C than at 37°C, respectively. Based on these results, you are going to conduct further experiments to attempt to answer your research question.

4) What can you conclude from these results?

A) Unpacking of the hexokinase gene occurs only at 37°C. B) Transcription of the hexokinase gene occurs less frequently at lower temperatures.

C) The levels of hexokinase protein are not affected by temperature.

D) Translation of the hexokinase gene occurs more frequently at higher temperatures.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Evaluate/Create Learning Outcome: 11.4 Global LO: 1, 2, 7 5) What would be the best experiment to do next to determine if cellular hexokinase protein concentration is temperature dependent?

A) Measure the amount of hexokinase mRNA in cells at different temperatures.

B) Measure the rate of transcription of the hexokinase gene in cells at different temperatures.

C) Measure the amount of mRNA that is broken down in cells at different temperatures.

D) Measure the rate of translation of the hexokinase mRNA in cells at different temperatures.

Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Evaluate/Create Learning Outcome: 11.4 Global LO: 1, 2, 7

19 .

6) DNA microarrays can be used to determine relative levels of gene expression between samples. DNA microarrays are usually interpreted by color: green means higher mRNA levels, yellow means equal levels, and red means lower levels. If you ran the samples from the temperature experiment on a DNA microarray using the 25°C experiment as a baseline, what results do you predict you would obtain?

A) The samples from the 37°C experiment would be green and the samples from the 10°C would be red.

B) The samples from the 37°C experiment would be red and the samples from the 10°C would be green.

C) The samples from the 37°C experiment would be green and the samples from the 10°C would be yellow.

D) The samples from the 37°C experiment would be yellow and the samples from the 10°C would be red.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Evaluate/Create Learning Outcome: 11.4, 11.6 Global LO: 1, 2

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 12 DNA Technology 12.1 Multiple Choice Questions 1) What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?

A) an analysis of blood types from the crime scene B) an analysis of fingerprints from the crime scene C) an analysis of DNA from the crime scene D) an analysis of witness testimony from the crime scene Answer: C Topic: Biology and Society: Using DNA to Establish Guilt and Innocence Skill: Remember/Understand Learning Outcome: 12.1 Global LO: 5 2) What is the best definition for recombinant DNA? A) a type of nucleic acid that includes both RNA and DNA strands B) DNA that includes nucleotides from two different sources C) an alternate form of DNA that is the product of a mutation Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2 3) What is the definition of a genetically modified organism?

A) an organism carrying a gene that was acquired by artificial means B) an organism in which a particular mutation has appeared for the first time C) a cloned organism carrying two different alleles Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2 4) What is the definition of a "transgenic organism?"

A) an organism that is the first of its kind to show a particular phenotype B) an organism in which a genetic defect has been corrected using gene therapy C) an organism containing a gene from another species Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2

1 .

5) The world's first genetically engineered pharmaceutical product was ________.

A) humulin B) human growth hormone C) a vaccine against hepatitis B D) erythropoietin Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2 Global LO: 5 6) A vaccine works by ________.

A) inhibiting bacterial reproduction B) stimulating the immune system to develop lasting defenses C) killing cells infected with a virus D) preventing translation of mRNA molecules that code for disease-causing proteins Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2 7) Transgenic animals are currently produced for many different reasons. Choose an example of a transgenic animal that currently does not exist.

A) pigs that carry a roundworm gene to produce omega-3 fatty acids B) dairy cows that carry an Angus cattle gene so that they do not grow horns C) Atlantic salmon that have been modified to grow twice as fast as normal D) chickens that have been modified to be able to lay eggs in very hot temperatures Answer: D Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.2, 12.4 Global LO: 5 8) What can act as a vector to introduce new genes into a cell?

A) primers B) ligase C) restriction enzymes D) plasmids Answer: D Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3

2 .

9) Of these steps, which occurs first in the production of a recombinant plasmid?

A) cloning B) cutting DNA into fragments C) isolation of a plasmid from a bacterium D) reproduction of the engineered plasmid in bacteria Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 10) Of these steps, which one occurs earliest in the process of producing recombinant DNA? A) Human DNA fragments are mixed with the cut plasmids.

B) Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA. C) Recombinant plasmids are mixed with bacteria.

D) Bacteria carrying recombinant plasmids are cloned.

Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 11) When plasmids are used to produce a desired protein, the ________.

A) plasmids multiply and produce the protein outside of the bacterium B) bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate C) desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 12) The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

A) gene cloning B) PCR C) STR analysis D) whole-genome shotgun method Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3

3 .

13) Restriction enzymes are obtained from ________.

A) archaea B) eukaryotes C) viruses D) bacteria Answer: D Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 14) "Sticky ends" are ________ that are produced by the action of ________.

A) double-stranded DNA molecules with double-stranded ends; DNA ligase B) double-stranded DNA molecules with single-stranded ends; DNA ligase C) double-stranded DNA molecules with double-stranded ends; restriction enzymes D) double-stranded DNA molecules with single-stranded ends; restriction enzymes Answer: D Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 15) "Sticky ends" are ________.

A) single-stranded ends of fragments of double-stranded DNA B) regions of double-stranded DNA that can be cut by a restriction enzyme C) portions of DNA used as markers for STR analysis Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 16) A DNA fragment with the sticky end sequence TGGCA will bind with another DNA fragment with the sticky end sequence ________.

A) TGCCA B) ACCGT C) TGGCA D) ACGGT Answer: B Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.3 Global LO: 2

4 .

17) Which enzyme is used to bind DNA fragments together?

A) restriction enzyme B) lysozyme C) DNA ligase D) DNA polymerase Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 18) Which is the last step in the production of a recombinant DNA plasmid?

A) cloning B) using DNA ligase to join DNA fragments C) cutting the gene of interest into fragments D) allowing the reproduction of the bacterium bearing the recombinant plasmid Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 19) HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?

GTAAGCTTCGACAAGCTTGCTGA A) 0 times B) 1 time C) 2 times D) 3 times Answer: C Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.3 Global LO: 2 20) You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?

A) You can use the sample to determine the individual's blood type.

B) You can use gel electrophoresis to determine the length of the DNA found in the sample.

C) You can use PCR to increase the amount of DNA available for STR analysis.

Answer: C Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6 Global LO: 2, 5

5 .

21) Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

A) gel electrophoresis B) enzymes C) recombinant DNA D) plasmids Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6 22) To make restriction fragments, a DNA sample is treated with ________.

A) DNA ligase B) restriction enzymes C) DNA polymerase D) lysozyme Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 23) Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

A) A:C ratio B) length C) G:T ratio D) electrical charge Answer: B Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6 24) STR analysis is a DNA profiling technique that makes use of the fact that different people have ________.

A) different numbers of repeats of short DNA sequences at certain sites in the genome B) different alleles for many genes in the genome C) different restriction fragments D) different CODIS DNA sequences Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6

6 .

25) FGA is one of the STRs that are used to compare DNA between different people. Why is FGA useful for comparing DNA between different people?

A) FGA varies in the number of repeats between different people.

B) FGA varies in sequence between different people.

C) FGA is only present in some people's genomes.

D) FGA is present in different places in different people's genomes.

Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6 Global LO: 5 26) The scientific field that studies complete sets of genes is called ________.

A) genomics B) metagenomics C) proteomics D) genetic engineering Answer: A Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.7 27) The human genome contains approximately ________ genes.

A) 1,000 B) 5,000 C) 21,000 D) 30,000 Answer: C Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.7 28) Approximately what percentage of the human genome consists of noncoding DNA? A) 98.5% B) 87.0% C) 77.5% D) 67.0% Answer: A Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.7

7 .

29) What was the goal of the Human Genome Project?

A) to determine the functions of all of the proteins in a human cell B) to determine the nucleotide sequence of all of the DNA in the human genome C) to determine the function of all noncoding DNA in the human genome D) to determine the amino acid sequence of all of the proteins in a human cell Answer: B Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.9 Global LO: 5 30) Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A) Humans and chimpanzees share a relatively recent common ancestor.

B) Humans evolved from chimpanzees.

C) Humans are unique and different from all other life forms.

D) Humans are a more complex life form than chimpanzees.

Answer: A Topic: 12.3 Bioinformatics Skill: Apply/Analyze Learning Outcome: 12.9 Global LO: 2, 7 31) To find the nucleotide sequence of human chromosomes, chromosomes had to be digested into small fragments and then ________.

A) separated using gel electrophoresis B) pasted together with DNA ligase C) cloned and sequenced D) cut into smaller fragments with restriction enzymes Answer: C Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.8 Global LO: 5 32) The study of the full protein sets that genomes encode is ________.

A) proteomics B) genomics C) metagenomics D) systems biology Answer: A Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.7

8 .

33) In human gene therapy ________.

A) normal versions of human genes are transferred to patients who carry a mutated allele B) harmless bacteria make important proteins for humans that cannot produce these proteins on their own C) bacterial plasmids are used to transfer genes to human patients D) genetically engineered alleles, usually from other species, replace mutated alleles Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.5 Global LO: 5 34) The state of human gene therapy today is that ________.

A) the work that has been completed so far is purely theoretical, but some treatments are in development B) there have been a small number of successes, including with the disease SCID C) human gene therapy is used routinely in the treatment of certain rare cancers D) human gene therapy is used to treat a wide variety of conditions, including diabetes, cancer, and bone marrow diseases Answer: B Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.5 Global LO: 5 35) Genetically modifying human ________ may directly affect future generations.

A) skin cells B) eggs and sperm C) brain cells D) muscles Answer: B Topic: 12.4 Safety and Ethical Issues Skill: Remember/Understand Learning Outcome: 12.12 Global LO: 5 36) There are many ethical dilemmas raised by DNA technology and knowledge of the human genome. Choose the exception.

A) the potential for interfering in evolution B) the safety of genetically modified foods C) the potential discrimination against people predisposed to certain diseases D) the possible negative effects on climate Answer: D Topic: 12.4 Safety and Ethical Issues Skill: Remember/Understand Learning Outcome: 12.12 Global LO: 5 9 .

37) The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________.

A) proteomics B) systems biology C) the X chromosome D) the Y chromosome Answer: D Topic: Evolution Connection: The Y Chromosome as a Window on History Skill: Remember/Understand Learning Outcome: 12.13 38) What is the main function of the CRISPR-Cas9 system?

A) to alter the nucleotide sequences of specific genes in a living cell B) to make copies of a gene in a PCR reaction C) to produce proteins from RNA outside of a living cell D) to prevent bacterial infections in humans Answer: A Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 39) In what type of organism was the CRISPR-Cas9 system discovered?

A) plant B) human C) bacteria D) fungi Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 40) Golden rice 2 is a genetically modified form of rice that was developed to treat what nutritional deficiency?

A) calcium B) vitamin B12 C) iron D) vitamin A Answer: D Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.4 Global LO: 5

10 .

41) Which is an example of a genetically modified organism that is not a transgenic organism?

(Note that none of these organisms currently exist!)

A) a pig that has had cow growth hormone genes inserted into its cells so that it will produce more meat B) an orange that had its own genes altered so that it will produce extra juice C) an oat plant that is sprayed with only with natural pesticides so that it grows larger D) a radish that has genes from a jalapeno pepper added to it to make it spicier Answer: B Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.2, 12.4 Global LO: 2 42) Cystic fibrosis is a serious respiratory disease that is caused by the expression of a mutant form of the cystic fibrosis transmembrane regulator (CFTR) protein. Suppose that gene therapy was being used to attempt to treat cystic fibrosis. What biological component would be required for this treatment?

A) a bacterium that contains the mutant form of the CFTR gene in its genome B) a bacterium that contains the healthy form of the CFTR gene in its genome C) a virus that contains the mutant form of the CFTR gene in its genome D) a virus that contains the healthy form of the CFTR gene in its genome Answer: D Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.5 Global LO: 2 43) What was wrong with Nic Volker's XIAP gene which caused his immune system to attack his digestive system?

A) the XIAP gene was missing a single nucleotide B) the XIAP gene had a nucleotide substitution C) the XIAP gene was missing completely D) the XIAP gene was duplicated Answer: B Topic: The Process of Science: Did Nic Have a Deadly Gene?

Skill: Remember/Understand Learning Outcome: 12.10 Global LO: 5

11 .

12.2 Art Questions 1) Recombinant DNA technology produces transgenic bacteria with a human gene that codes for a human protein. What problem could be associated with this process?

A) formation of a bacterium that cannot synthesize the product B) production of a human protein that does not function normally C) a bacterium with DNA that is resistant to restriction enzymes D) production of the mouse form of the protein instead of the human form Answer: B 12 .

Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.3 Global LO: 2, 3 2) Gel electrophoresis separates DNA fragments because ________.

A) double-stranded DNA moves slower than single-stranded DNA B) of ratios of guanine to cytosine C) DNA fragments have different lengths D) of the salt concentration in the gel Answer: C Topic: 12.2 DNA Profiling and Forensic Science Skill: Remember/Understand Learning Outcome: 12.6 Global LO: 3

13 .

3) The diagram below summarizes ________.

A) gene cloning B) how a human could be cloned C) human gene therapy D) how a vaccine is made

14 .

Answer: C Topic: 12.1 Genetic Engineering Skill: Remember/Understand Learning Outcome: 12.5 Global LO: 3 4)

The figure shows an electrophoresis gel which includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). Which DNA molecule is the largest?

A) DNA molecule A B) DNA molecule B C) DNA molecule C D) DNA molecule D Answer: B Topic: 12.2 DNA Profiling and Forensic Science Skill: Apply/Analyze Learning Outcome: 12.3 Global LO: 2, 3

15 .

5)

The figure shows an electrophoresis gel which includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). What is the approximate size of DNA molecule C? A) 520 nucleotides B) 480 nucleotides C) 400 nucleotides D) 340 nucleotides Answer: B Topic: 12.2 DNA Profiling and Forensic Science Skill: Apply/Analyze Learning Outcome: 12.3 Global LO: 2, 3

16 .

6) What method is illustrated by this figure?

A) DNA gel electrophoresis B) whole-genome shotgun method C) STR analysis D) recombinant DNA technology Answer: B Topic: 12.3 Bioinformatics Skill: Remember/Understand Learning Outcome: 12.8 Global LO: 3

17 .

12.3 Scenario Questions Please read the following scenario and then answer the following questions.

Corn crops are susceptible to damage by different species of corn borer, an insect (a type of arthropod) that feeds and lives on corn plants. It is estimated that corn borers may cause up to $1 billion of damage a year to corn crops. Because of pests like the corn borer, researchers have created genetically modified pest-resistant crops. One type of pest-resistant crop, Bt corn, expresses a bacterial toxin that kills corn borers if they consume the toxin. While Bt corn has been planted and used in the United States since 1996, some researchers and members of the public continue to worry about negative effects of the Bt toxin on other animals, including arthropods and humans. In order to investigate the effects of Bt toxins on other animals, researchers conducted experiments where they fed arthropods Bt corn or non-Bt corn. A summary of the effects of eating Bt corn on single species of corn borer, mite, and beetle are shown in the figure below.

1) What can you conclude from the data in the graph?

A) Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.

B) Mites have the highest percent mortality of the arthropods studied.

C) Beetles are more likely to survive than mites when fed Bt corn.

D) Bt corn affects the mortality of all three arthropods equally.

Answer: A Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.4 Global LO: 2, 3, 5

18 .

2) Based on the data in the graph, do you think Bt corn is having its intended effect?

A) Yes, because Bt corn affected the mortality of all three arthropods equally.

B) Yes, because Bt corn selectively killed corn borers that ate it while similar percentages of beetles and mites died after eating the Bt corn as compared to the non-Bt corn.

C) No, because Bt corn was designed to kill all arthropods that ate it, and only the corn borers were killed after eating the Bt corn.

D) No, because corn borer percent mortality increased when corn borers ate Bt corn; if Bt corn was effective, then percent mortality should have decreased.

Answer: B Topic: 12.1 Genetic Engineering Skill: Evaluate/Create Learning Outcome: 12.4 Global LO: 2, 3, 5 3) One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

A) Yes, because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer.

B) Yes, because only the corn borer was affected when eating the Bt corn.

C) No, because more mites and beetles died after eating Bt corn than after eating non-Bt corn.

D) No, because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt. Answer: D Topic: 12.1 Genetic Engineering Skill: Evaluate/Create Learning Outcome: 12.4 Global LO: 2, 3, 5, 6

19 .

Please read the following scenario and then answer the following questions.

Patients with organ failure or severe diseases may need organ transplants. However, there is often a long waitlist for certain organs, and patients may not be able to acquire a human organ transplant in time. To address this issue, pigs have been studied as a potential source of organs to use for transplants because pig organs are similar in size to human organs and are easy to obtain.

However, a major health concern that needs to be addressed before pig organ transplantation becomes viable is the prevention of bacterial or viral transmission from pig organs to the human patient.

One pig virus that is particularly difficult to prevent from being transmitted is porcine endogenous retrovirus (PERV). At some point in time, PERV infected pig eggs or sperm and thus incorporated its own genome into the pig genome, and all species of pigs carry the PERV genome to some extent. Therefore, if a pig kidney is used for a human transplant, all of the pig kidney cells will have the DNA for PERV, and these could possibly infect the human host.

To prevent transmission of PERV, researchers have recently used CRISPR-Cas9 gene editing to introduce mutations in the pol gene. The pol gene codes for the enzyme reverse transcriptase that functions to produce PERV from the pig genome, thus preventing PERV from being produced.

As of late 2017, 37 CRISPR-edited piglets were born and 15 were still alive. However, their organs have yet to be transplanted into humans.

4) For researchers to edit piglets' genomes with CRISPR-Cas9 successfully, the guide RNA sequence must be complementary to ________.

A) the PERV genome B) the pol gene C) the RNA polymerase gene D) a gene for an antibody against PERV Answer: B Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.3, 12.4 Global LO: 2, 5 5) What would have been the function of Cas9 when using CRISPR-Cas9 to edit piglets' genomes?

A) to repair mutations in the pol gene B) to remove the pol gene from the pig genome C) to insert nucleotides into the pol gene D) to cut the pol gene Answer: D Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.3, 12.4

20 .

6) What type of cell would the researchers have needed to use to produce the CRISPR-Cas9 edited piglets?

A) a bacterium cell B) a pig oocyte C) a pig neuron D) a human kidney cell Answer: B Topic: 12.1 Genetic Engineering Skill: Apply/Analyze Learning Outcome: 12.3, 12.4 Global LO: 2, 5 7) Suppose that the researchers targeted the DNA polymerase gene instead of the pol gene. What do you think the most likely outcome would have been?

A) They would have achieved the same outcome as described in this experiment.

B) All of the piglets would have likely been born and lived healthy lives since DNA polymerase is important for cell division.

C) It is likely that the technique would not have worked at all since cells would not be able to replicate their DNA without DNA polymerase.

D) They would not have been able to do the experiment since pig cells do not have the DNA polymerase gene.

Answer: C Topic: 12.1 Genetic Engineering Skill: Evaluate/Create Learning Outcome: 12.3, 12.4 Global LO: 2, 5, 7

21 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 13 How Populations Evolve 13.1 Multiple Choice Questions 1) Which is NOT a benefit of the understanding of evolution to understanding the field of biology?

A) Understanding evolution helps us to understand molecules.

B) Understanding evolution helps us to analyze ecosystems.

C) Understanding evolution helps advance biotechnology and medicine.

D) Understanding evolution helps us to understand why stars and galaxies change over time.

Answer: D Topic: Biology and Society: Mosquitos and Evolution Skill: Remember/Understand Learning Outcome: 13.1 2) The common house mouse species, Mus musculus, has the following taxonomic classification: Mus, Muridae, Rodentia, Mammalia, Chordata, Animalia, Eukarya. Which part of the name is the Family?

A) Rodentia B) Chordata C) Muridae D) Animalia Answer: C Topic: 13.1 The Diversity of Life Skill: Apply/Analyze Learning Outcome: 13.2 Global LO: 2 3) ________ believed that species are fixed forms that do not change over time while ________ believed that evolution is the refinement of traits that equip organisms to perform successfully in their environments.

A) Aristotle; Lamarck B) Lamarck; Aristotle C) Darwin; Aristotle D) Lamarck; Darwin Answer: A Topic: 13.1 The Diversity of Life Skill: Remember/Understand Learning Outcome: 13.3

1 .

4) Natural selection can be defined as ________.

A) the evolution of a population of organisms B) a process in which changes in gene frequencies result from evolution C) the production of more offspring than can survive in a given environment D) a process in which organisms with certain inherited traits are more likely to survive and reproduce than individuals with other traits Answer: D Topic: 13.2 Charles Darwin and The Origin of Species Skill: Remember/Understand Learning Outcome: 13.4 5) Natural selection ________.

A) results in evolutionary adaptation B) is a very rare phenomenon C) does not affect allelic frequencies D) prepares organisms for future changes in the environment Answer: A Topic: 13.2 Charles Darwin and The Origin of Species Skill: Remember/Understand Learning Outcome: 13.4 6) The first basic idea of evolutionary adaptation can be traced back to ________.

A) ancient Greeks about 2,500 years ago B) Aristotle C) Lamarck D) Darwin Answer: C Topic: 13.1 The Diversity of Life Skill: Remember/Understand Learning Outcome: 13.3 7) Which statement about the voyage of the Beagle is TRUE? A) Its purpose was to identify the fastest route from the Atlantic to the Pacific Ocean.

B) It lasted almost 2 years.

C) It turned into a tremendous opportunity for Darwin to collect fossils, plants, and animals.

D) It ended with the sinking of the ship off of the coast of Australia, almost 4 years into its journey.

Answer: C Topic: 13.2 Charles Darwin and The Origin of Species Skill: Remember/Understand Learning Outcome: 13.4

2 .

8) During his trip on the Beagle, Darwin found that ________.

A) plants and animals living in temperate regions were most similar to each other, regardless of the continent on which they were found B) plants and animals living on a continent seemed more closely related to each other than to plants and animals living in similar regions on other continents C) fossils found on a particular continent were clearly not related to the plants and animals living on that continent today D) plants and animals were similar on every continent and in every type of region Answer: B Topic: 13.2 Charles Darwin and The Origin of Species Skill: Remember/Understand Learning Outcome: 13.4 9) While on the Beagle, Darwin's observations suggested that ________ is (are) a better predictor of relationships among organisms than ________.

A) geographic proximity; similarity of environment B) evolutionary adaptations; similarity of environment C) geological formations; geographic proximity D) fossils; homologies Answer: A Topic: 13.2 Charles Darwin and The Origin of Species Skill: Remember/Understand Learning Outcome: 13.4 10) In The Origin of Species, Darwin argued that the mechanism of descent with modification was ________.

A) artificial selection B) natural selection C) bionomial nomenclature Answer: B Topic: 13.3 Evidence of Evolution Skill: Remember/Understand Learning Outcome: 13.4, 13.7 11) Which is a component of the fossil record?

A) the distribution of murid rodents in Australia and Asia B) information about geological formations C) bones of dinosaurs Answer: C Topic: 13.3 Evidence of Evolution Skill: Remember/Understand Learning Outcome: 13.5

3 .

12) Homology is evidence of ________.

A) binomial classification B) artificial selection C) natural selection D) common ancestry Answer: D Topic: 13.3 Evidence of Evolution Skill: Remember/Understand Learning Outcome: 13.5 13) Which anatomical features are homologous?

A) the forelimb of a dog and the hindlimb of a cat B) the forelimb of a dog and the forelimb of a cat C) wings of a butterfly and wings of a sparrow D) the mouth of a mosquito and the beak of a hummingbird Answer: B Topic: 13.3 Evidence of Evolution Skill: Apply/Analyze Learning Outcome: 13.5 Global LO: 2 14) The similarity of the embryos of chickens and humans is evidence of ________.

A) artificial selection B) common ancestry C) genetic drift D) decreased genetic variation Answer: B Topic: 13.3 Evidence of Evolution Skill: Remember/Understand Learning Outcome: 13.5 15) Natural selection generally results in ________.

A) increased genetic variation B) a population that is better adapted to a future environment C) a population that is adapted to its current environment D) an increase in the size of a population Answer: C Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Remember/Understand Learning Outcome: 13.7

4 .

16) Which is NOT a requirement of natural selection?

A) differential reproductive success B) overproduction of offspring C) genetic variation D) gene flow Answer: D Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Remember/Understand Learning Outcome: 13.7 17) Which statement is TRUE? A) Natural selection works on variation already present in a population.

B) Natural selection works on non-heritable traits.

C) Individuals evolve through natural selection.

D) Individual organisms evolve structures that they need.

Answer: A Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Remember/Understand Learning Outcome: 13.7 18) Which group of organisms is a population?

A) the termites infesting your house along with the microorganisms living in their guts B) all of the termites that have ever lived C) all organisms living in your house D) the termites infesting your house (not including the microorganisms living in their guts) Answer: D Topic: 13.5 The Evolution of Populations Skill: Apply/Analyze Learning Outcome: 13.10 Global LO: 2 19) Which process can create new alleles?

A) natural selection B) sexual reproduction C) mutation D) genetic drift Answer: C Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.9

5 .

20) The total collection of alleles in a population at any one time makes up that population's ________.

A) gene pool B) genotype C) heterozygote frequency D) allele frequency Answer: A Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.9 21) If the frequency of one allele in a population is 0.7 in a population with two alleles at a particular locus, what is the frequency of the alternate allele?

A) 0.09 B) 0.21 C) 0.30 D) 0.42 Answer: C Topic: 13.5 The Evolution of Populations Skill: Apply/Analyze Learning Outcome: 13.9 Global LO: 2, 4 22) In the Hardy-Weinberg formula, what does p2 represent?

A) frequency of heterozygotes B) frequency of the recessive allele C) frequency of the homozygotes for one allele Answer: C Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.11 Global LO: 4 23) In the Hardy-Weinberg formula, what does 2pq represent?

A) frequency of the dominant allele B) frequency of heterozygotes C) frequency of the recessive allele D) frequency of the homozygous dominants Answer: B Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.11 Global LO: 4

6 .

24) The presence of freckles is due to a dominant allele. Four percent of the individuals in a particular population lack freckles. Use the Hardy-Weinberg formula to calculate the percentage of individuals in this population who are homozygous dominant for freckles.

A) 32% B) 4% C) 64% D) 80% Answer: C Topic: 13.5 The Evolution of Populations Skill: Apply/Analyze Learning Outcome: 13.11 Global LO: 2, 4 25) The original source of genetic variation that serves as the raw material for evolution is ________.

A) mutation B) gene flow C) geographic isolation D) random fertilization Answer: A Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.9 26) Which is a characteristic of a population at Hardy-Weinberg equilibrium?

A) The population is subject to natural selection.

B) The population is not evolving.

C) Genetic drift is occurring.

D) Gene flow in and out of the population occurs.

Answer: B Topic: 13.5 The Evolution of Populations Skill: Remember/Understand Learning Outcome: 13.11 27) A change in the gene pool due to chance results in ________.

A) natural selection B) genetic drift C) a large gene pool D) environmental variation Answer: B Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12

7 .

28) Which phenomenon (or lack of) will prevent significant genetic drift?

A) Gene flow is absent.

B) There is genetic variation.

C) There is mutation.

D) The population size is large.

Answer: D Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12 29) After surviving a bottleneck, a population recovers to the point where it consists of as many individuals as it did prior to the bottleneck. Which statement is most likely to apply to this population?

A) The post-bottleneck population exhibits less genetic variation than the pre-bottleneck population.

B) The bottleneck subjected the pre-population to stabilizing selection.

C) The post-bottleneck population has less of a chance of going extinct than did the prebottleneck population.

D) The post-bottleneck population exhibits more genetic variation than the pre-bottleneck population.

Answer: A Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12 30) The founder effect differs from a population bottleneck in that the founder effect ________.

A) requires a small population B) is a type of natural selection C) can occur only on an oceanic island colony D) involves the isolation of a small colony of individuals from a larger population Answer: D Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12 Global LO: 2 31) Which explanation is most likely for a particular human population with a higher incidence of polydactyly (extra fingers/toes) than the human population as a whole?

A) directional selection B) disruptive selection C) founder effect D) bottleneck effect Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2, 5 8 .

32) What does evolutionary fitness measure?

A) physical health B) longevity C) relative reproductive success D) population size Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12 33) Which is a phenomenon that can result from directional selection?

A) There is an increase in the number of giraffes with long necks in areas of Africa where lowgrowing trees have died.

B) There is an increase in the number of different breeds of dog.

C) There is an increase in garter snakes with different coloration patterns found in backyard gardens.

Answer: A Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2 34) Disruptive selection can lead to ________.

A) a decrease in antibiotic-resistant strains of bacteria B) an increase in the number of different breeds of dog C) an increase in both large and small lobsters in comparison to medium-sized lobsters Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2 35) Which situation is most likely to decrease genetic variation?

A) directional selection B) mutation C) stabilizing selection D) diversifying selection Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12

9 .

36) Which result might be a consequence of stabilizing selection?

A) Infants born with weights between 3 and 4 kg have a higher survival than infants much lighter or heavier at birth.

B) There is an increase in antibiotic-resistant strains of bacteria.

C) There is a decrease in the number of different breeds of dog.

Answer: A Topic: 13.6 Mechanisms of Evolution Skill: Remember/Understand Learning Outcome: 13.12 37) Which situation is an example of sexual selection?

A) Bacteria evolve resistance to antibiotics.

B) Cheetahs experience a population bottleneck.

C) Peahens choose to mate with peacocks that have the brightest tails.

D) Female butterflies have a higher survival rate than male butterflies.

Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2 38) ________ introduced a system for grouping species into a hierarchy of categories.

A) Lamarck B) Aristotle C) Linnaeus D) Darwin Answer: C Topic: 13.1 The Diversity of Life Skill: Remember/Understand Learning Outcome: 13.2 39) Years ago, farmers determined that suppressing flower development in the wild mustard plant gave rise to the plant we know as broccoli. This is an example of ________.

A) the bottleneck effect B) artificial section C) migration D) disruptive selection Answer: B Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Apply/Analyze Learning Outcome: 13.7 Global LO: 2, 5

10 .

40) Guayule (Parthenium argentatum) is a plant originating in Mexico that is used to produce rubber. Scientists used artificial selection to breed guayule with a relative plant from Utah, Parthenium ligulatum, and produced a hybrid plant that transferred cold tolerance to guayule. In this example, plant growth habits and leaf shape are components of ________ that enabled cold tolerance, and the transferability of these traits is an example of ________.

A) sexual reproduction; variation B) variation; heritability C) heritability; overproduction of offspring D) genetic drift; taxonomy Answer: B Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Apply/Analyze Learning Outcome: 13.7 Global LO: 2, 5, 7

11 .

13.2 Art Questions 1) Examine the relationships between the elephants in the accompanying figure. Which pair is most closely related?

A) Deinotherium and Platybelodon B) Barytherium and Stegodon C) Loxodonta africana and Loxodonta cyclotis D) Mammut and Stegodon Answer: C Topic: 13.3 Evidence of Evolution Skill: Apply/Analyze Learning Outcome: 13.6 Global LO: 2, 3

12 .

2) Examine the evolutionary tree below. This tree tells us that the amnion is found in ________.

A) lungfishes and amphibians B) amphibians only C) mammals, lizards, and snakes only D) mammals, lizards, snakes, crocodiles, and birds Answer: D Topic: 13.3 Evidence of Evolution Skill: Apply/Analyze Learning Outcome: 13.6 Global LO: 2, 3

13 .

3) The accompanying figure shows the percent of selected DNA sequences that match between a chimpanzee and other primates. These data support the hypothesis that ________.

A) the chimpanzee's closest surviving relative is humans B) chimpanzees and gibbons are the most closely related C) orangutans are the primates least closely related to chimpanzees D) Old World monkeys and gibbons are the most closely related Answer: A Topic: 13.3 Evidence of Evolution Skill: Apply/Analyze Learning Outcome: 13.6 Global LO: 2, 3, 4

14 .

4) The accompanying figure shows what happens in insect populations when crops are sprayed with insecticides. This is an example of ________.

A) natural selection B) genetic drift C) founder effect D) gene flow Answer: A Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Remember/Understand Learning Outcome: 13.8 Global LO: 3

15 .

13.3 Scenario Questions Read the following scenario to answer the following questions.

Over the past 60 years, many amphibian species have experienced significant population declines, and some species have become extinct. Scientists suspected that local human activities such as the destruction of wetlands, regional pollution, and deforestation were the main reasons for these losses. However, research over the past 20 years reveals significant amphibian population declines in protected areas of the world, such as nature preserves and parks. These global declines suggest widespread problems, including increased ultraviolet radiation, acid rain, and disease. In Switzerland, for example, 14 of the 20 native amphibian species are threatened with extinction.

1) Some biologists urge the collection of the few remaining individuals of some of the most threatened amphibian species in order to preserve them if they become extinct in the wild. If such captive-breeding programs could produce thousands of individuals from just a few of the remaining survivors, the species will still be threatened because of ________.

A) a bottleneck effect B) directional selection C) mutations D) artificial selection Answer: A Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2 2) When most populations of a wide-ranging amphibian species are lost and the few remaining populations are widely separated, we expect to see that ________.

A) artificial selection becomes a greater factor in microevolution B) the founder effect becomes increasingly important C) gene flow between populations is reduced D) microevolution no longer occurs Answer: C Topic: 13.6 Mechanisms of Evolution Skill: Apply/Analyze Learning Outcome: 13.12 Global LO: 2

16 .

3) Chytridiomycosis is a fungal disease first identified in 1998 as a cause of massive amphibian deaths. In some severely impacted populations, a few individuals have survived, perhaps because of some natural resistance. If these resistant individuals continue to survive and prosper, new resistant populations might emerge. This would be an example of ________.

A) genetic drift B) natural selection C) the founder effect D) sexual selection Answer: B Topic: 13.5 The Evolution of Populations Skill: Apply/Analyze Learning Outcome: 13.9 Global LO: 2

17 .

Read the following scenario to answer the questions that follow.

In order to test the susceptibility of bacteria (if the bacteria are susceptible to being killed) to an antibiotic, a common laboratory test called the Bauer-Kirby Disk Diffusion test is used. First, a petri dish (a shallow, circular, transparent dish with a flat lid) is partially filled with nutrientenriched agar (a gelatinous material). The nutrients encourage growth of specific bacterial species. The agar is poured as liquid but then typically solidifies to a soft consistency. Once the agar is set, a "lawn" of bacteria is spread such that a thin layer covers the top of the agar.

Antibiotics are then applied to the lawn in a small dose, often through small, saturated paper disks. The dish is typically incubated for 24-48 hours and then observed for susceptibility. If the antibiotic is effective, it will kill the bacteria and leave a clear area called the "zone of inhibition" due to inhibited bacterial growth. The area starts at the source of the antibiotic and radiates outward. Scientists measure the diameter of the zone and then compare it to an established "cutoff value" for a zone specific to antibiotic/organism combinations. A large zone of inhibition in comparison to the standard indicates susceptibility while a small or no zone indicates resistance. Consider the following image, and answer the questions that follow:

4) What can you conclude about the susceptibility of the bacteria to the antibiotics?

A) The bacteria are more susceptible to antibiotic A than antibiotic C. B) The bacteria are more susceptible to antibiotic D than antibiotic B. C) The bacteria are more susceptible to antibiotic C than antibiotic E. D) The bacteria are more susceptible to antibiotic D than antibiotic A. Answer: C Topic: Evolution Connection: The Rising Threat of Antibiotic Resistance Skill: Evaluate/Create Learning Outcome: 13.13 Global LO: 2

18 .

5) The Federal Drug Administration (FDA) must decide which antibiotic to approve to fight a bacterial infection that results in high fevers and localized rashes. Which antibiotic do you predict that the FDA scientists will likely approve?

A) A because it has the smallest zone of inhibition.

B) C because it has the largest zone of inhibition C) E because it has a zone of inhibition similar to A D) F because it does not have a zone of inhibition Answer: B Topic: Evolution Connection: The Rising Threat of Antibiotic Resistance Skill: Evaluate/Create Learning Outcome: 13.13 Global LO: 2 6) After 1 year of widely prescribed use, reports surface that bacterial infections disappear for up to 2 weeks after taking the FDA-approved antibiotic but then reappear, sometimes worse than the first time. Which explanation might the FDA use to defend their choice of antibiotic to treat the infection?

A) Patients are not taking the antibiotic for the length of time prescribed, and so selection for resistant bacteria that can survive a limited course of the antibiotic is occurring.

B) Stabilizing selection over the year has allowed for the bacteria to remain at a high level in patients' bodies.

C) Patients' bodies are evolving over the year to create environments that are friendly to the growth of the bacteria.

D) Sexual dimorphism allowed for larger bacteria cells to outcompete smaller ones, therefore enabling larger bacteria cells to continue to multiply.

Answer: A Topic: Evolution Connection: The Rising Threat of Antibiotic Resistance Skill: Evaluate/Create Learning Outcome: 13.13 Global LO: 2, 3, 5

19 .

Read the following scenario to answer the questions that follow.

Drs. Peter and Rosemary Grant have been conducting observational research studies on finch species on Galápagos Island Daphne Major for over 40 years. The medium ground finch has a relatively small beak and a diet that consists primarily of small seeds. Large-beaked finches are able to eat larger seeds in addition to small ones. These two species successfully co-existed on the island for over 20 years, but two years of severe drought in 2003 and 2004 lead to intense competition between them because food supplies were destroyed in the drought. Numerous birds in both populations died from starvation. Interestingly, the Grants noticed that the smallerbeaked finches did not face the same degree of competitive pressure, because they could more easily eat the smaller seeds that were not being eaten by the larger finches. Only a short time later (2004-2005), the Grants observed that new populations of finches had more birds with smaller beaks than larger ones. As well, finches tended to seek out larger seeds half as often as in preceding years.

7) The Grants' data suggest that ________.

A) Directional selection is occurring in ground finch populations on Daphne Major.

B) Large-beaked finches are displaying relative fitness in ground finch populations on Daphne Major.

C) Stabilizing selection is occurring in ground finch populations on Daphne Major Answer: A Topic: 13.7 The Process of Science: Did Evolution Shape the Beaks of Darwin's Finches Skill: Apply/Analyze Learning Outcome: 13.7, 13.8, 13.14 Global LO: 1, 2 8) In these observational studies, what would have served as a control experiment?

A) A population of finches with large beaks that faced excessive rainfall and high winds and were not able to feed normally.

B) A population of finches with small beaks that faced natural fires on the island and were not able to feed normally.

C) Populations of finches with small and large beaks that did not face drought and were able to feed normally.

D) Populations of a bird species genetically unrelated to finches that did not face drought and were able to feed normally.

Answer: C Topic: 13.7 The Process of Science: Did Evolution Shape the Beaks of Darwin's Finches Skill: Evaluate/Create Learning Outcome: 13.7, 13.8, 13.14 Global LO: 1, 2

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 14 How Biological Diversity Evolves 14.1 Multiple Choice Questions 1) The actions of humans are having negative impacts on the environment at a global scale. Of the options listed, which impact is an EXCEPTION to this trend?

A) decrease in biodiversity B) decrease in human cardiovascular disease C) increase in radioactivity from testing nuclear weapons D) increase in climate-altering emissions from fossil fuels Answer: B Topic: 14 Biology and Society: Humanity's Footprint Skill: Remember/Understand Learning Outcome: 14.1 2) Biological species consist of groups of ________.

A) populations B) domains C) families D) genera Answer: A Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.2 3) Under the biological species concept, what criterion is used to assign populations of organisms to the same biological species?

A) a very similar appearance B) ability to interbreed and produce fertile offspring C) similar responses to the environment D) 99% of their genes are in common Answer: B Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.2 4) The biological species concept cannot be applied to ________.

A) fossils B) bacteria that reproduce sexually C) complex plants that have flowers Answer: A Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.2

1 .

5) The biological species concept cannot be applied to fossils. Which alternate approach to identifying species would be most useful for classifying fossil organisms?

A) an approach based on use of reproductive barriers B) an approach based on genetic history C) an approach based on measurable physical traits Answer: C Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.2 6) A reproductive barrier that prevents individuals from closely related species from interbreeding is an example of ________.

A) a prezygotic barrier B) allopatric speciation C) sympatric speciation D) geographic isolation of populations Answer: A Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.3 7) What type of reproductive isolating mechanism is described by a situation in which female fireflies mate only with males who emit light in a particular pattern?

A) habitat isolation B) temporal isolation C) mechanical isolation D) behavioral isolation Answer: D Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2 8) The type of reproductive barrier that occurs when reproductive structures of different species are physically incompatible is referred to as ________.

A) mechanical isolation B) temporal isolation C) a postzygotic barrier Answer: A Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.3

2 .

9) When two frog species, Rana pipiens and Rana sylvatica, mate, the offspring die early in embryonic development. This is an example of ________.

A) hybrid sterility B) mechanical isolation C) reduced hybrid viability D) reduced hybrid fertility Answer: C Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2 10) Which scenario describes allopatric speciation?

A) A population of squirrels is separated by the Grand Canyon. The two subpopulations evolve into two distinct species.

B) A tetraploid plant species evolves from a diploid ancestor. Both the tetraploid and diploid species are found in the same habitat.

C) One population breeds in the fall; another population breeds in the spring.

D) A male horse and a female donkey mate, producing a sterile hinny.

Answer: A Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.3 11) Sympatric speciation specifically EXCLUDES ________.

A) behavioral isolation B) postzygotic barriers C) geographic isolation D) temporal isolation Answer: C Topic: 14.1 The Origin of Species Skill: Remember/Understand Learning Outcome: 14.3 12) Some fish have bony fins. If the body of water they are in dries out, these fins can be used to help the fish "walk" to another body of water. In this context, bony fins are an example of ________.

A) an exaptation B) an adaptation C) a homologous structure Answer: A Topic: 14.3 Mechanisms of Macroevolution Skill: Apply/Analyze Learning Outcome: 14.8 Global LO: 2

3 .

13) Feathers in birds appear to have first been selected for as insulation but later conveyed a new advantage in helping create light aerodynamic surfaces. This switch in function is an example of ________.

A) allopatric speciation B) a prezygotic barrier C) an exaptation Answer: C Topic: 14.3 Mechanisms of Macroevolution Skill: Remember/Understand Learning Outcome: 14.8 14) The current geological era is the ________.

A) Paleozoic B) Cenozoic C) Mesozoic D) Cambrian Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Remember/Understand Learning Outcome: 14.4 15) Uranium-235, with a half-life of 713,000,000 years, decays to lead-207. If a rock sample is determined to have one-quarter of the uranium-235 content it had when it formed, the age of the rock sample can be estimated to be approximately ________ years old.

A) 178 million B) 713 million C) 28.5 billion D) 1.4 billion Answer: D Topic: 14.2 Earth History and Macroevolution Skill: Apply/Analyze Learning Outcome: 14.5 Global LO: 2, 4 16) Plate tectonics has been responsible for instances of all of the following EXCEPT ________.

A) volcanic explosions B) sympatric speciation C) allopatric speciation D) mass extinction Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Remember/Understand Learning Outcome: 14.5

4 .

17) The Permian mass extinction is associated with ________.

A) an asteroid impact B) global warming C) the formation of Pangaea D) the diversification of mammals Answer: C Topic: 14.2 Earth History and Macroevolution Skill: Remember/Understand Learning Outcome: 14.4 Global LO: 2 18) Characid fishes are found naturally only in South America and Africa. Fossils of these fish are not found on any other continents. What is the most likely explanation of this distribution pattern?

A) These fishes arose in either Africa or South America and migrated across the South Atlantic Ocean to the other continent.

B) Characid fishes arose prior to the separation of the African and South American continents.

C) Characid fishes arose in the South Atlantic Ocean and migrated to Africa and South America.

D) Convergent evolution is responsible for the distribution of characid fishes.

Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Apply/Analyze Learning Outcome: 14.4 Global LO: 2 19) Dinosaurs (aside from the lineage that produced birds) were extinct by the end of the ________.

A) cretaceous B) silurian C) eocene D) permian Answer: A Topic: 14.2 Earth History and Macroevolution Skill: Remember/Understand Learning Outcome: 14.4 20) A period of mass extinction is often followed by ________.

A) explosive diversification B) global warming C) continental drift Answer: A Topic: 14.2 Earth History and Macroevolution Skill: Remember/Understand Learning Outcome: 14.6

5 .

21) ________ is the discipline of biology that focuses on classifying organisms and determining their evolutionary relationships.

A) Evo-devo B) Systematics C) Cladistics Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.9 22) The science of naming, identifying, and classifying organisms is called ________.

A) cladistics B) phylogeny C) taxonomy Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.9 23) Which taxonomic level is most inclusive?

A) order B) genus C) family Answer: A Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.9 24) Of the following taxonomic levels, species found within the same ________ are the most closely related.

A) family B) phylum C) order D) domain Answer: A Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.3

6 .

25) The tailbone of a human ________ to the tail of a monkey.

A) evolved from B) is homologous to C) is analogous to Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Apply/Analyze Learning Outcome: 14.9 Global LO: 2 26) The wing of a penguin is ________ the wing of a butterfly.

A) structurally identical to B) homologous to C) analogous to Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Apply/Analyze Learning Outcome: 14.3 27) Homology is evidence of ________.

A) convergent evolution B) polyploidy C) common ancestry Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.3 28) Analogous structures are evidence of ________.

A) common ancestry B) divergent evolution C) stabilizing selection D) convergent evolution Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.3

7 .

29) Molecular systematics might examine all of the following types of data EXCEPT ________.

A) proteins B) DNA sequences C) amino acid sequences D) anatomical features Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2 30) An ancestral species and all its evolutionary descendants define a(n) ________.

A) outgroup B) clade C) genus D) ingroup Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.3 31) Why is it INCORRECT to assume that mass extinctions carry only negative impact on the evolution of life on Earth?

A) Mass extinctions are sometimes followed by periods of evolutionary change when other organism groups can flourish and expand in diversity and size.

B) Mass extinctions enable scientists to study embryonic development in two species of organisms and therefore identify possible homology.

C) Mass extinctions disprove Darwin's theory of evolution.

Answer: A Topic: Evolution Connection: Evolution in the Anthropocene Skill: Remember/Understand Learning Outcome: 14.6 32) One means of reproduction called budding occurs when a new organism develops as an outgrowth of its parent (singular). Could organisms that develop by budding be defined by the biological species concept?

A) Yes, because wild populations of the organisms have different geographic distributions.

B) Yes, because this form of reproduction occurs in natural environments.

C) No, because this form of reproduction does not allow examination of interbreeding.

D) No, because the offspring may look very different than the parent.

Answer: C Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.2 Global LO: 2

8 .

33) Human migration and global trade are two factors that have altered geographic distribution of parasites. One result of this phenomenon is that humans are introduced to new infections more often, and they can be co-infected by several parasites from different species or lineages. These co-infections can result in matings between individual parasites of the different species and lineages. What biological diversity concept does this phenomenon provide evidence for?

A) hybridization of species, specifically parasites B) ecological niches C) reproductive barriers D) three-domain system of classification Answer: A Topic: Process of Science: Do Human Activities Facilitate Speciation Skill: Evaluate/Create Learning Outcome: 14.7 Global LO: 2, 5 34) Scientists who study evo-devo engage in research in the fields of ________.

A) taxonomy and cladistics B) evolutionary biology and developmental biology C) homology and analogy D) plate tectonics and biogeography Answer: B Topic: 14.3 Mechanisms of Macroevolution Skill: Remember/Understand Learning Outcome: 14.8 35) Scientists in the field of evo-devo have determined that evolutionary changes can be a result of changes in ________.

A) radiometric dating B) the formation of Pangaea C) homeotic genes D) analogous structures Answer: C Topic: 14.3 Mechanisms of Macroevolution Skill: Remember/Understand Learning Outcome: 14.8 36) What is the currently recognized classification scheme?

A) two-kingdom system B) five-kingdom system C) biogeography D) three-domain system Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.9

9 .

37) If a method of classification is used that compares similarity in shared ancestry, this method is using ________ as the basis of classification.

A) homology B) analogy C) allopatric speciation D) sympatric speciation Answer: A Topic: 14.4 Classifying the Diversity of Life Skill: Remember/Understand Learning Outcome: 14.10 38) Human impacts on natural environments have enabled scientists to use these habitats as natural laboratories for studying evolutionary adaptation. Which is an EXCEPTION to these natural laboratories currently being used by scientists?

A) Hudson River in New York where there are high levels of industrial waste B) urban areas in Puerto Rico with expanding buildings C) backyard ponds where fish and frogs live D) areas in eastern North America where temperatures are cool Answer: C Topic: 14.5 Evolution Connects Skill: Remember/Understand Learning Outcome: 14.11

10 .

14.2 Art Questions 1) Examine the two squirrel populations in the accompanying figure. The populations are separated by a geographic barrier. If after a long period of time the two species are no longer separated, what evidence is needed to determine if speciation has occurred?

A) Hybrid offspring of the two populations begin to appear.

B) The two populations are not interbreeding freely.

C) One species will increase into a population size twice as large as the other species.

D) Polyploidy is creating new species.

Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2, 3

11 .

2) Examine the evolutionary relationships represented in the accompanying figure. Based upon this model, which of the following pairs of organisms are most closely related?

A) leopards and striped skunks B) leopards and European otters C) European otters and coyotes D) coyotes and wolves Answer: D Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.9 Global LO: 2, 3

12 .

3) Examine the accompanying figure. According to the figure, cladistic analysis indicates that crocodiles are more closely related to ________ than to ________.

A) bird;. pterosaurs B) snakes; birds C) Ornithischian dinosaur; pterosaurs D) birds; lizards Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Apply/Analyze Learning Outcome: 14.9 Global LO: 2, 3

13 .

14.3 Scenario Questions Read the following scenario to answer the following questions.

In some zoos, rare crosses between a male lion and a female tiger have produced hybrid offspring called "ligers." Male ligers are sterile but some female ligers are fertile. In the wild, lion and tiger ranges do not naturally overlap, making such a cross unlikely. Furthermore, the solitary behavior of tigers and the social organizations of lions create behavioral differences.

1) Applying the biological species concept, the sterility of ligers reveals that ________.

A) a new species called "ligers" is forming B) tigers and lions are the same species C) tigers and lions are separate species D) lions are probably a subspecies of tigers Answer: C Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.2 Global LO: 2 2) The natural differences in the ranges of wild tigers and lions is an example of ________.

A) a prezygotic barrier B) a postzygotic barrier C) the impact of mutations D) sympatric speciation Answer: A Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2 3) The production of sterile male ligers is an example of ________.

A) sympatric speciation B) the founder effect C) a postzygotic barrier D) a prezygotic barrier Answer: C Topic: 14.1 The Origin of Species Skill: Apply/Analyze Learning Outcome: 14.3 Global LO: 2

14 .

Read the following scenario to answer the following questions.

As part of a semester-long biology field research course, you are studying reproductive barriers among four different frog species. Your goal is to determine what type of reproductive barrier likely causes the gene pools of the four different frog species to be isolated. These four species share common geographic habitats and are both anatomically and gametically compatible. Your research professor gives you the following figure to consider. After studying the figure, answer the questions that follow.

4) If the researchers of this study wanted to collect reliable data about natural behavior, which methodology should they choose?

A) The researchers should collect multiple male and female frogs from each species and study them in a lab environment to determine their normal breeding seasons.

B) The researchers should study multiple male and female frogs from each species in their natural environments to determine their normal breeding seasons.

C) The researchers should collect multiple male and female frogs from each species, mix males and females from each species, and study the mixed pairs in a lab environment to determine their normal breeding seasons.

D) The researchers should study one male and female frog from each species in their natural environments to determine their normal breeding seasons.

Answer: B Topic: 14.1 The Origin of Species Skill: Evaluate/Create Learning Outcome: 14.3 Global LO: 1, 2, 3

15 .

5) Based on the independent and dependent variables represented in the figure and the information you have about common geographic habitats as well as anatomical and gametic compatibility of the four frog species, you initially conclude that reproductive barriers may be due to ________.

A) habitat isolation B) mechanical isolation C) temporal isolation D) gametic isolation Answer: C Topic: 14.1 The Origin of Species Skill: Evaluate/Create Learning Outcome: 14.3 Global LO: 2, 3, 9 6) What can you conclude about the breeding characteristics of these four frog species?

A) The maximum mating activity of the four frog species at different times reduces and/or removes interbreeding.

B) Each frog species must find a different place in the pond to breed.

C) The individual mating activity of the bull frog species reduces and/or removes interbreeding in the other three frog species.

D) An increase in maximum mating activity of the wood frog species reduces and/or removes interbreeding in the bull frog species.

Answer: A Topic: 14.1 The Origin of Species Skill: Evaluate/Create Learning Outcome: 14.3 Global LO: 2, 3, 9

16 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 15 The Evolution of Microbial Life 15.1 Multiple Choice Questions 1) Scientists hypothesize that disrupting our ________ communities may increase our susceptibility to infectious diseases, predispose us to certain cancers, and contribute to conditions such as asthma and other allergies, irritable bowel syndrome, Crohn's disease, and autism.

A) microbial B) plant C) protist D) pathogen Answer: A Topic: Biology and Society: Our Invisible Inhabitants Skill: Remember/Understand Learning Outcome: 15.1 Global LO: 5 2) Eukaryotes arose about ________ years after the first prokaryotes.

A) 3.0 million B) 1.7 billion C) 3.5 billion D) 4.0 billion Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 3) Which gas began to increase in the atmosphere as a result of photosynthesis by autotrophic prokaryotes approximately 2.7 billion years ago?

A) methane B) carbon dioxide C) oxygen D) hydrogen Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2

1 .

4) Large, diverse, multicellular organisms first appeared in the fossil record approximately ________ million years ago during the ________.

A) 290; Paleozoic era B) 600; Paleozoic era C) 363; Mesozoic era D) 50; Mesozoic era Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 5) Which groups of organisms colonized land during the Paleozoic era approximately 500 million years ago?

A) plants, protists, and insects B) plants, fungi, and insects C) bacteria, plants, and fungi D) protists, bacteria, and fungi Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 6) Land was first colonized about ________ years ago.

A) 100 million B) 500 million C) 1.7 billion D) 2.5 billion Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 7) Based on fossil evidence, eukaryotes evolved about ________ years ago.

A) 500,000 B) 1 billion C) 1.8 billion D) 3.5 billion Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2

2 .

8) Which statement is FALSE? A) The great diversification of animals occurred during the Cambrian explosion.

B) For most of biological history, life was confined to aquatic habitats.

C) The evolution of multicellularity took place after the origin of the eukaryotes.

D) The first organisms to colonize land were animals.

Answer: D Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 9) The absence of ________ in the primitive atmosphere was essential to the origin of life on Earth.

A) N2 B) CO2 C) CH4 D) O2 Answer: D Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3 10) What was the third stage of the process that led to the abiotic origin of life?

A) synthesis of small organic molecules, such as amino acids and nucleotide monomers B) origin of self-replicating molecules C) synthesis of polymers, such as proteins and nucleic acids D) formation of pre-cells Answer: D Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3 11) From what can pre-cells spontaneously form?

A) ribozymes B) RNA C) fatty acids D) DNA Answer: C Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3

3 .

12) Why is RNA thought to have been the first genetic material?

A) RNA is structurally simpler than DNA. B) RNA has been found on meteorites.

C) RNA is capable of self-replication.

Answer: C Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3 13) Ribosomes can perform some of the functions of both ________ and ________.

A) cocci; bacilli B) DNA; protein C) lysosomes; ATP molecules D) algae; amoebas Answer: B Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3 14) Variation among pre-cells was due to ________.

A) genetic drift B) natural selection C) the bottleneck effect D) mutation Answer: D Topic: 15.2 The Origin of Life Skill: Remember/Understand Learning Outcome: 15.3 15) Which prokaryotic group is most closely related to eukaryotes?

A) Bacteria B) Protista C) Archaea Answer: C Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.3 16) The prokaryotic group that tends to inhabit extreme environments belongs to ________.

A) Protista B) Archaea C) Euglena D) Bacteria Answer: B Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.8 4 .

17) Which group of prokaryotes aids digestion in cattle, deer, and other animals that obtain nutrition from cellulose?

A) halophiles B) dinoflagellates C) methanogens D) cocci Answer: C Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.8 Global LO: 5 18) Spherical bacteria that occur in clusters are ________.

A) streptococci B) bacilli C) spirochetes D) staphylococci Answer: D Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5 19) Bacilli are ________ prokaryotes.

A) spherical B) comma-shaped C) rod-shaped D) spiral Answer: C Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5 20) Which organisms would likely be the most difficult to kill if you were you to can your own food?

A) streptococci B) endospores C) biofilms D) staphylococci Answer: B Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5

5 .

21) Prokaryotes reproduce by means of ________.

A) mitosis B) binary fission C) budding D) meiosis Answer: B Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5 22) Under ideal conditions, prokaryotes are capable of reproducing at a(n) ________ rate.

A) negative B) exponential C) variable Answer: B Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5 Global LO: 4 23) Trichomonas vaginalis is a protozoan that feeds on white blood cells and bacteria living on the cells lining the female human vagina, thereby creating a common sexually transmitted disease often known as "trich." The feeding mechanism of this protozoan makes it a ________.

A) parasite B) autotroph C) producer D) mixotroph Answer: A Topic: 15.4 Protists Skill: Apply/Analyze Learning Outcome: 15.10 Global LO: 2 24) All organisms that photosynthesize fit into which nutritional category?

A) mixotroph B) heterotrophs C) autotrophs D) parasites Answer: C Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10

6 .

25) What are the two classes of poisons produced by pathogenic bacteria?

A) exotoxins and endotoxins B) chemoautotrophs and chemoheterotrophs C) protozoans and fungi D) bacilli and cocci Answer: A Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.8 26) Food poisoning from Salmonella occurs because of ________.

A) an exotoxin secreted by Salmonella bacteria B) an endotoxin produced by Salmonella bacteria C) transmission between people living in close contact D) extremophile conditions Answer: B Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.8 Global LO: 5 27) In the soil, some ________ help to decompose dead organisms and other waste materials, returning vital chemical elements such as nitrogen to the environment.

A) pre-cells B) protozoans C) prokaryotes Answer: C Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.4 28) ________ is an example of bioremediation.

A) Cyanobacteria converting atmospheric nitrogen to a form that plants can use B) The use of an autoclave to kill endospores C) The use of prokaryotes to treat sewage D) A dinoflagellate bloom causing massive fish kills Answer: C Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.6 Global LO: 5

7 .

29) In Yellowstone National Park, hot springs can reach temperatures of 205°F (96°C). Despite these high temperatures, Aquifex bacteria flourish. How might one best classify Aquifex bacteria?

A) slime molds B) extremophiles C) amoebas D) algae Answer: B Topic: 15.3 Prokaryotes Skill: Apply/Analyze Learning Outcome: 15.8 Global LO: 2 30) Recent scientific studies of the impact of microbiota on the amount of fat versus lean body mass (i.e., body composition) are described in your text. How do those studies illustrate the importance of microbiota communities in our bodies?

A) If transferred to lean humans, intestinal microbiota of obese humans will cause obesity.

B) If transferred to obese humans, intestinal microbiota in lean humans will cause exaggerated obesity.

C) The studies suggest that mice are an unreliable model organism to use for studies of human intestinal microbiota and obesity.

D) The studies suggest that intestinal microbiota may be involved in regulating our digestive processes.

Answer: D Topic: The Process of Science: Are Intestinal Microbiota to Blame for Obesity?

Skill: Remember/Understand Learning Outcome: 15.9 Global LO: 2, 9 31) Eukaryotes that are not fungi, animals, or plants are classified in a "catch-all" category called ________.

A) archaea B) bacteria C) seaweeds D) protists Answer: D Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10

8 .

32) Flagellates, amoebas, apicomplexans, and ciliates are all what type of protist?

A) slime molds B) protozoans C) dinoflagellates D) seaweeds Answer: B Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 33) You discover a unicellular organism that moves by what appear to be pseudopodia. You conclude that this organism could be ________.

A) a type of amoeba, foram, or slime mold B) a type of bacterium C) a type of alga D) a type of ciliate or a type of apicomplexan Answer: A Topic: 15.4 Protists Skill: Apply/Analyze Learning Outcome: 15.10 Global LO: 2 34) Which protozoan group has primarily been identified through fossils?

A) forams B) ciliates C) flagellates D) amoebas Answer: A Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 35) ________ include cells that can function either independently or as a single unit.

A) dinoflagellates B) forams C) seaweeds D) cellular slime molds Answer: D Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10

9 .

36) Which group of organisms is most closely related to plants?

A) brown algae B) red algae C) slime molds D) green algae Answer: D Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 37) ________ are responsible for toxic red tides.

A) Plasmodial slime molds B) Dinoflagellates C) Red algae D) Diatoms Answer: B Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 Global LO: 5 38) A protist with a shell made of silica is most likely a(n) ________.

A) apicomplexan B) foram C) dinoflagellate D) diatom Answer: D Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 39) Which organism is a colonial form of green algae?

A) Volvox B) Giardia C) Paramecium D) Plasmodium Answer: A Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10

10 .

40) What accounts for the similarity between seaweeds and plants?

A) symbiosis B) convergent evolution C) evolutionary fitness Answer: B Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 41) Which reasoning is a plausible explanation for why it may be difficult to treat infections that arise from tooth decay?

A) Biofilm bacteria that cause tooth decay begin to produce endospores as a means to deter effects of antibiotics.

B) Binary fission in biofilm bacteria that cause tooth decay begins to decrease as the biofilm community becomes more complex, thereby producing fewer bacterial cells for antibiotics to penetrate.

C) As the biofilm that causes tooth decay becomes larger, its structure makes it difficult for antibiotics to break through bacterial cell walls.

D) Bacteria of the biofilm that cause tooth decay form a symbiotic relationship with the antibiotics and therefore diminish antibiotic effectiveness.

Answer: C Topic: Evolution Connection Skill: Evaluate/Create Learning Outcome: 15.1, 15.5, 15.11 Global LO: 2, 5, 7 42) Some aquatic invertebrates such as insects and snails feed on biofilms. Scientists that study metal-contaminated streams have documented that some biofilms in stream environments absorb zinc from stream water during daylight hours and release the zinc into the stream during the night. If the scientists were to test exposure of the invertebrates to zinc, what might they hypothesize?

A) The greatest exposure to aquatic invertebrates that feed on biofilms might only occur during daylight hours.

B) The greatest exposure to aquatic invertebrates that feed on biofilms might only occur during night hours.

C) Aquatic invertebrates that prefer to feed at night will encounter little exposure to zinc.

Answer: A Topic: 15.3 Prokaryotes Skill: Apply/Analyze Learning Outcome: 15.5 Global LO: 2, 5

11 .

43) Some aquatic invertebrates such as insects and snails feed on biofilms. Scientists that study metal-contaminated streams have documented that some biofilms in stream environments absorb zinc from stream water during daylight hours and release the zinc into the stream during the night. What might the scientists hypothesize about zinc concentration in the stream?

A) The highest zinc concentrations in stream water might occur only during the day.

B) The highest zinc concentrations in stream water might occur only at night.

C) Zinc concentrations in stream water are likely to be similar during the day and at night.

Answer: B Topic: 15.3 Prokaryotes Skill: Apply/Analyze Learning Outcome: 15.5 Global LO: 2, 5 44) Yersinia pestis is a strain of bacteria that caused the "black death" plague that killed more than 50 million people in the 14th century. The bacteria spread quickly and easily through the air and from person to person. Yersinia pestis might be studied by scientists interested in ________.

A) biofilms B) parasites C) biological weapons D) apicomplexans Answer: C Topic: 15.3 Prokaryotes Skill: Apply/Analyze Learning Outcome: 15.8 Global LO: 2, 5 45) By the end of the ________, all major body plans and major groups of organisms had evolved.

A) Mesozoic era B) Paleozoic era C) Cambrian explosion Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Remember/Understand Learning Outcome: 15.2 46) The plasmodium of a plasmodial slime mold can grow in order to enlarge the organism's surface area and therefore potentially obtain more nutrients. This is an example of ________.

A) the relationship between structure and function B) convergent evolution C) autotrophy D) parasitism Answer: A Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 12 .

47) All of the species in the list below are seaweeds. Which is the EXCEPTION? A) red algae B) green algae C) brown algae D) diatoms Answer: D Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 15.2 Art Questions 1) According to this evolutionary tree, the archaea and eukaryotes last shared a common ancestor ________.

A) 1.0 billion years ago B) 1.75 billion years ago C) 2.5 billion years ago D) 3.5 billion years ago Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Apply/Analyze Learning Outcome: 15.2 Global LO: 2, 3

13 .

2) What kind of prokaryotes are shown in the figure?

A) bacilli B) spirochetes C) cocci D) ciliates Answer: A Topic: 15.3 Prokaryotes Skill: Remember/Understand Learning Outcome: 15.5 Global LO: 3 3) What kind of protist is shown in the figure?

A) ciliate B) plasmodial slime mold C) flagellate D) foram Answer: B Topic: 15.4 Protists Skill: Apply/Analyze Learning Outcome: 15.10 Global LO: 2, 3

14 .

4)

In the associated image, the aquatic organism moves using flagella. It is parasitic and can colonize and reproduce in the human intestine. What type of organism could this be?

A) a protozoan B) a slime mold C) phytoplankton D) seaweed Answer: A Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10 Global LO: 3

15 .

15.3 Scenario Questions Read the following scenario to answer the following question(s).

Malaria is a disease caused by parasitic protists in the genus Plasmodium. The parasite is transmitted to humans by female Anopheles mosquitoes. The Plasmodium parasite feeds on human red blood cells, eventually destroying them. Humans infected with malaria can exhibit many symptoms. Depending on the severity of the infection, these can range from fever, chills, sweating, and headaches to anemia and kidney failure. Ultimately, malaria can result in death.

However, if time and money permit, once a person is infected, they can be treated with different antimalarial drugs. Two commonly used drugs are artemisinin and quinine. In addition, one way to prevent the spread of malaria is to apply pesticides to treat areas with Anopheles mosquitoes.

The National Malaria Eradication Program began work in 1947 with the goal of eliminating malaria from the southern United States. In 1947, 15,000 cases of malaria were reported nationwide. By 1950, only 2,000 cases were reported, and by 1951, malaria was considered eradicated from the United States. Today, the disease is most common in Africa and South America, two continents that are highly impoverished. About one million people die from malaria every year, many of them children. In Africa, it is estimated that one in every five childhood deaths is due to malaria.

1) If an area infested with female Anopheles mosquitoes is treated with pesticides, and these mosquitos live, continue to breed, and continue to spread malaria, what can we conclude?

A) Alleles that are resistant to the pesticides are being selected for, so female Anopheles mosquitoes may continue to infect humans.

B) Malaria is not actually caused by the Plasmodium parasite.

C) Male Anopheles mosquitoes are also carriers of the Plasmodium parasite.

D) The people are becoming resistant to the pesticide.

Answer: A Topic: 15.4 Protists Skill: Evaluate/Create Learning Outcome: 15.10 Global LO: 2, 5, 7 2) Plasmodium illustrate feeding characteristics of a(n) ________.

A) slime mold B) ciliate C) apicomplexan D) algae Answer: C Topic: 15.4 Protists Skill: Remember/Understand Learning Outcome: 15.10

16 .

3) Suppose production of the pesticides used to treat malaria is halted because the Environmental Protection Agency (EPA) has found that they are causing too much environmental damage to warrant continued use. In turn, this drives up the prices of artemisinin and quinine since they are now in higher demand. How might this affect those that live in South America and Africa?

A) They will likely experience a decrease in the number of male Anopheles mosquitoes.

B) They will likely experience an increase in the number of male Anopheles mosquitoes.

C) They will likely experience a decrease in the number of malaria cases D) They will likely experience an increase in the number of malaria cases.

Answer: D Topic: 15.4 Protists Skill: Evaluate/Create Learning Outcome: 15.10 Global LO: 2, 5, 7 4) A vector is an organism that transfers a pathogen to a host. In the case of malaria, the vector(s) is (are) ________.

A) humans only B) humans and Anopheles mosquitoes C) Anopheles mosquitoes only D) humans, Plasmodium, and Anopheles mosquitoes Answer: C Topic: 15.4 Protists Skill: Apply/Analyze Learning Outcome: 15.10 Global LO: 2, 5

17 .

Read the following scenario to answer the following question(s).

Endotoxins are commonly found in the air, both inside and outside our homes. These "air endotoxins" can come from sources that include house dust mites, agricultural and industrial dust, and dust from indoor pets. Air endotoxins are typically found in low amounts, but production of them can increase dramatically under specific environmental conditions such as dampness, mold, and sewage. Many scientific studies have been conducted investigating possible links between indoor endotoxin levels and asthma, chronic bronchitis, and other upper respiratory diseases. Interestingly, some studies have found positive correlations between indoor endotoxin exposure and severity of some of these diseases while other studies have suggested that some air endotoxin exposure can actually decrease the risk of developing asthma in children.

Additionally, data suggest that industrial workers who are exposed to endotoxins in the air can develop irreversible lung damage.

In 2005, Hurricane Katrina devastated the eastern coastline of the United States. The state of Louisiana, and in particular the city of New Orleans, experienced tragic loss of human life and homes due to the failure of the levee system. Intense flooding destroyed homes and created severe exposure to wet, moldy surfaces. At that time there were no regulations in existence on the amount of exposure that individuals should have to air endotoxins. Scientists from the Natural Resources Defense Council who wanted to determine if endotoxin levels had risen in New Orleans conducted tests across 12 outdoor areas, 9 of which had been significantly flooded while the other 3 were less affected. Two indoor areas were also sampled for endotoxin levels.

No significant differences were found in endotoxin levels between the flooded and non-flooded areas or between the indoor and outdoor areas. However, a limited number of samples were collected, and they were taken after a recent dry spell. Endotoxin levels at all sites were found to be higher than national average levels but were lower than levels typically associated with longterm changes in lung function.

5) What is a potential benefit of testing indoor and outdoor sites as well as sites with heavy flooding and light flooding?

A) There is no benefit associated with testing in multiple sites.

B) Testing multiple sites takes less time and requires less equipment.

C) Testing multiple sites allows for fewer scientists to be exposed to the air endotoxins.

D) The data collected would allow scientists to compare endotoxin levels under multiple conditions.

Answer: D Topic: 15.3 Prokaryotes Skill: Evaluate/Create Learning Outcome: 15.7 Global LO: 2, 5, 9

18 .

6) What is an implication of the fact that tests were conducted after a period of dry weather?

A) Dry weather creates harsher sampling conditions for scientists.

B) If more periods of rainfall occur after the testing, bacteria that secrete endotoxins may increase, thereby increasing endotoxin levels.

C) Dry weather increases the amount of carbon available for the endotoxin bacteria to use for organic compound production.

D) Endotoxin bacteria provide greater bioremediation effects in dry weather than in wet weather.

Answer: B Topic: 15.3 Prokaryotes Skill: Evaluate/Create Learning Outcome: 15.7 Global LO: 2, 5, 9 7) What addition to methodology would be most beneficial to the study?

A) pre-flood data to compare to post-flood data in order to better compare endotoxin levels B) a greater number of scientists conducting tests so that different testing methods can be used at each site C) tests conducted on soil endotoxins to compare to air endotoxin levels D) tests conducted on bacterial exotoxins in New York City Answer: A Topic: 15.3 Prokaryotes Skill: Evaluate/Create Learning Outcome: 15.7 Global LO: 2, 5, 9 8) What is a logical conclusion to draw from this study?

A) Workers that come to these areas to help rebuild do not need to be concerned with indoor air endotoxin levels.

B) Workers that come to these areas where there was flooding damage should be advised to wear protective respiratory gear.

C) Workers that come to these areas to help rebuild do not need to be concerned with outdoor air endotoxin levels.

D) Workers that come to these areas to help rebuild buildings can assume that they will develop an irreversible lung infection.

Answer: B Topic: 15.3 Prokaryotes Skill: Evaluate/Create Learning Outcome: 15.7 Global LO: 2, 5, 9

19 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 16 The Evolution of Plants and Fungi 16.1 Multiple Choice Questions 1) Truffle mushrooms are an example of ________.

A) a parasitic fungi B) a commercially important fungus C) a photosynthetic autotroph D) seed producing organisms Answer: B Topic: 16 Biology and Society: The Diamond of the Kitchen Skill: Remember/Understand Learning Outcome: 16.1 Global LO: 5 2) Why is the symbiotic relationship of truffle mushrooms and tree roots considered to be crucial to the colonization of land?

A) This relationship is found in some of the oldest plant fossils.

B) Truffles have seeds.

C) Truffles provide trees with sugars.

Answer: A Topic: 16 Biology and Society: The Diamond of the Kitchen Skill: Remember/Understand Learning Outcome: 16.1 3) Mutualistic associations of plant roots and fungi are called ________.

A) mycorrhizae B) mycelia C) shoots D) hyphae Answer: A Topic: 16.1 Colonizing Land Skill: Remember/Understand Learning Outcome: 16.2 4) The ________ help(s) plants retain water.

A) hypha B) cuticle C) mycorrhiza D) lignin Answer: B Topic: 16.1 Colonizing Land Skill: Remember/Understand Learning Outcome: 16.2

1 .

5) ________, a chemical that hardens cell walls and supports terrestrial plants, is found in all plants EXCEPT ________.

A) Lignin; bryophytes B) Cellulose; bryophytes C) Cellulose; ferns D) Lignin; ferns and bryophytes Answer: A Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.4 6) Would you expect desert plants to have a thin or thick cuticle?

A) thin because desert plants do not have stomata B) thin because desert plants have a short root system C) thick because desert plants have an extensive shoot system D) thick because desert plants need to retain water in this dry environment Answer: D Topic: 16.1 Colonizing Land Skill: Apply/Analyze Learning Outcome: 16.2 Global LO: 2 7) Some companies that produce paper will also produce a by-product that is sold as a binder (something that binds, or holds, things together). From which part of trees does this by-product come?

A) leaves B) mycorrhizae C) lignin D) stomata Answer: C Topic: 16.1 Colonizing Land Skill: Apply/Analyze Learning Outcome: 16.2 Global LO: 2 8) Which lineage of green algae is believed to most resemble early plant ancestors?

A) charophytes B) ulva C) volvox D) dinoflagellates Answer: A Topic: 16.1 Colonizing Land Skill: Remember/Understand Learning Outcome: 16.3

2 .

9) The origin of seeds occurred approximately ________ years ago.

A) 65 million B) 360 million C) 140 billion D) 3.5 billion Answer: B Topic: 16.1 Colonizing Land Skill: Remember/Understand Learning Outcome: 16.2 10) Which series of terms correctly illustrates the sequence of the origin of modern groups of plants?

A) gymnosperms, ferns, bryophytes, angiosperms B) bryophytes, ferns, gymnosperms, angiosperms C) bryophytes, ferns, angiosperms, gymnosperms D) ferns, gymnosperms, angiosperms, bryophytes Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.4 11) Which group of plants lacks vascular tissue?

A) cone-bearing plants B) grasses C) ferns D) mosses Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 12) Why are bryophytes considered incompletely liberated from their ancestral aquatic habitat?

A) They lack lignin.

B) Their sperm are flagellated.

C) The gametophyte generation is dominant.

D) They lack a cuticle.

Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5

3 .

13) In ________ the gametophyte is more obvious than the sporophyte.

A) conifers B) mosses C) grasses D) ferns Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 14) Gametophytes are ________; sporophytes are ________.

A) male; female B) an adaptation to an aquatic existence; an adaptation to a terrestrial existence C) haploid; diploid D) the dominant stage of the conifer life cycle; the less obvious stage of the conifer life cycle Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 15) Gametophytes produce ________.

A) sperm and eggs B) spores and stomata C) lignin and vascular tissue D) stomata and cuticle Answer: A Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 16) ________ are seedless vascular plants.

A) Ferns B) Angiosperms C) Bryophytes D) Gymnosperms Answer: A Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.6

4 .

17) Why are ferns considered incompletely adapted to the terrestrial environment, when compared with other plants?

A) They lack vascular tissue.

B) Their sperm are flagellated.

C) The gametophyte generation is dominant.

D) They lack cuticle.

Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.6 18) Much of the coal we use today came from ________ that lived during the Carboniferous.

A) gymnosperms B) mosses C) angiosperms D) ferns Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.6 Global LO: 5 19) Which step is the last in the formation of fossil fuels?

A) subjecting organic matter to extreme pressure B) flooding swamps with seawater C) incomplete decomposition of organic matter D) subjecting organic matter to extreme heat and pressure Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.6 20) If you wanted to propagate (grow) ferns, what do you need to collect from existing ferns?

A) diploid zygote cells B) haploid spores C) fossil fuels D) seeds Answer: B Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.6 Global LO: 2

5 .

21) Producing millions of spores is an important evolutionary adaptation of fungi because ________.

A) having many spores increases the chances that they will produce fossil fuels B) having many spores increases the chances that they can produce seeds C) spores can germinate only in the right environmental conditions (moist, where there is food), so producing many spores increases the chances that at least one will end up in an area of those conditions D) spores can disperse only short distances, so producing many spores increases the chances that at least one will travel far enough to germinate Answer: C Topic: 16.2 Plant Diversity Skill: Evaluate/Create Learning Outcome: 16.10 Global LO: 2, 7 22) What global climatic change gave gymnosperms an advantage over ferns?

A) the climate becoming hotter and wetter B) increased fluctuations in global climate temperatures C) the climate becoming cooler and drier D) the climate becoming hotter and drier Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.7 23) What adaptation accounts for the unparalleled success of the angiosperms?

A) vascular tissue B) flowers C) lignin D) cuticle Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.7 24) A pollen grain is a ________.

A) seed B) sporophyte C) male gametophyte Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.7

6 .

25) ________ were the first plants that did not require water for transferring sperm to eggs.

A) Bryophytes B) Gymnosperms C) Ferns D) Angiosperms Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.7 26) Seeds develop from ________.

A) carpels B) anthers C) ovules D) ovaries Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.7 27) Why are gymnosperms considered to be "naked seed" plants?

A) Their seeds have a thin layer of endosperm.

B) They do not produce seeds; they produce only spores.

C) Their seeds are not enclosed within ovaries.

D) Their seeds develop on the surface of sporophytes.

Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.4, 16.7 28) In angiosperms, the ________ is a nutrient-storing tissue that nourishes a developing embryo.

A) fruit B) seed C) carpels D) endosperm Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8

7 .

29) In angiosperms, the male gametophyte develops within ________.

A) male cones B) filaments C) anthers D) stigma Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8 30) Which component of a flowering plant is a female structure?

A) petal B) filament C) anther D) stigma Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8 31) Which structure of a flower traps pollen?

A) style B) stigma C) ovary D) filament Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8 32) Gymnosperms and angiosperms share multiple similarities. All of these are similarities except one. Choose the exception.

A) Both produce flowers.

B) Both have pollen grains that are male gametophytes.

C) Both have a dominant sporophyte generation.

D) Both have seeds.

Answer: A Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.8 Global LO: 2

8 .

33) In angiosperms, what structures house female gametophytes?

A) petals B) ovules C) sepals Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8 34) The edible portion of a(n) ________ is a ripened ovary.

A) cucumber B) broccoli stalk C) radish D) onion Answer: A Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.8 Global LO: 2 35) In angiosperms, what is the function of fruit?

A) It is where the male gametophyte develops.

B) It is a mechanism for the dispersal of seeds.

C) It provides nutrients to germinating seeds.

D) It attracts pollinators.

Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.8 36) Which statement about pollination and fertilization is CORRECT? A) Pollination is identical to fertilization.

B) Pollination is not the same as fertilization, but pollination guarantees fertilization will occur.

C) Pollination and fertilization are unrelated.

D) Pollination is not the same as fertilization, and pollination does not guarantee fertilization will occur.

Answer: D Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.7, 16.8 Global LO: 2

9 .

37) Nearly all food plants are ________.

A) bryophytes B) gymnosperms C) ferns D) angiosperms Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.9 38) Exploring in the tropics, you discover a nonvascular plant that produces pollen. What type of plant have you discovered?

A) an angiosperm B) a fern C) a bryophyte D) an entirely new type that you will get to name Answer: D Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.6, 16.8, 16.9 Global LO: 2 39) All of these but one are practical reasons to be concerned with preserving plant diversity.

Which is the exception?

A) Over 100 prescription drugs are made from substances derived from plants.

B) Humans depend on plants for lumber and jobs.

C) Loss of plant biodiversity, in turn, negatively affects animal biodiversity.

D) Local knowledge of rainforest plant communities has no impact on the production of new medicines.

Answer: D Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.9 Global LO: 5 40) Nutritionally, all fungi are ________.

A) heterotrophs that acquire their nutrients by absorption B) autotrophs that acquire their nutrients from solar energy C) autotrophs that acquire their nutrients from chemicals D) parasites that acquire their nutrients from other organisms Answer: A Topic: 16.3 Fungi Skill: Remember/Understand Learning Outcome: 16.10

10 .

41) What are hyphae?

A) symbiotic associations between plant roots and fungi B) threadlike filaments that make up fungal bodies C) fungal digestive enzymes D) fungal spores Answer: B Topic: 16.3 Fungi Skill: Remember/Understand Learning Outcome: 16.10 42) Like plants, fungi have ________; however, in plants they are composed of ________, whereas in fungi they are composed of ________.

A) cell walls; cellulose; chitin B) cell walls; cellulose; peptidoglycan C) cell membranes; phospholipids; chitin D) cell walls; phospholipids; cellulose Answer: A Topic: 16.3 Fungi Skill: Remember/Understand Learning Outcome: 16.10 43) A major function of a mushroom is to ________.

A) produce seeds B) store nutrients C) produce spores D) photosynthesize Answer: C Topic: 16.3 Fungi Skill: Remember/Understand Learning Outcome: 16.10 44) What important role do fungi play in many ecosystems?

A) They decompose organic material.

B) They pollinate plants.

C) They disperse the fruits of angiosperms.

D) They perform photosynthesis.

Answer: A Topic: 16.3 Fungi Skill: Remember/Understand Learning Outcome: 16.10

11 .

45) Suppose that, while on a forest hike, you notice a blue fungus and a pink plant growing along the hiking trail. As you continue walking, you observe that if a blue fungus and a pink plant are growing side by side, they are both much larger than if the fungus and the plant are farther apart.

What can you hypothesize about the relationship between the fungus and the plant?

A) The fungus and the plant have a symbiotic relationship that allows them to have more significant growth when they are near each other than when farther apart.

B) The fungus and the plant have a parasitic relationship that allows them to have more significant growth when they are near each other than when farther apart.

C) The roots of the plant are choking off nutrient flow to the fungal hyphae.

D) The plant is helping the fungus decompose leaf litter on the forest floor.

Answer: A Topic: 16 The Process of Science: Who Killed the Pines?

Skill: Evaluate/Create Learning Outcome: 16.11, 16.12 Global LO: 2 46) Corn smut is a fungus that grows in the ears of corn and changes corn kernels into black, powdery balls of fungus tissue. What would you hypothesize is the significance of the relationship between corn smut and corn?

A) Corn smut has a parasitic relationship with corn so that it can use the corn as a way to spread spores.

B) Corn smut has a symbiotic relationship with corn so that it can use the corn as a way to spread spores.

C) Corn smut helps to decompose corn more quickly and therefore replenishes nutrients in the soil at a faster rate.

D) Corn smut slows decomposition of corn and therefore reduces the rate at which nutrients are returned to the soil.

Answer: A Topic: 16 The Process of Science: Who Killed the Pines?

Skill: Evaluate/Create Learning Outcome: 16.10, 16.11 Global LO: 2, 5 47) How is artificial selection related to diversity of plant foods we eat today?

A) Breeding practices enable people to select cattle that disperse high volumes of seeds through their feces.

B) Agricultural practices enable people to select plants for improved yield and quantity.

C) Artificial selection of favored pollinator species allows for high pollination rates of plants.

D) Artificial selection of tall grasses provides enables cattle that fertilize plants to reserve energy it takes to consume smaller, scrubbier plants.

Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.9

12 .

48) In a laboratory experiment, researchers treated pine seedlings from Puerto Rico with mycorrhizae collected from pine forests in the southeastern United States. Results were favorable for increased seedling growth in the trees treated with mycorrhizae. Suppose when the researchers then tried this same experiment in the field, pine tree seedlings treated with mycorrhizae showed minimal growth differences from the control group. All but one of the listed factors could have contributed to these results. Choose the exception.

A) Researchers in the lab provided greater nutrient concentrations to the two groups of trees.

B) Weather conditions in the field were not favorable for tree growth whereas the laboratory environment provided ideal growing conditions.

C) Mycorrhizae in the laboratory functioned separately from the plant roots.

D) Researchers planted a large number of seedlings in the laboratory but only a minimal number in the field, so their sample size in the field was not large enough to show a possible effect.

Answer: C Topic: 16 The Process of Science: Who Killed the Pines?

Skill: Evaluate/Create Learning Outcome: 16.11, 16.12 Global LO: 2, 4 49) Evolutionary evidence suggests fungi evolved from ________ that also gave rise to the fourth and most diverse group of eukaryotes: the animals.

A) protists B) plants C) bacteria Answer: A Topic: 16.5 Evolution Connection: A Pioneering Partnership Skill: Remember/Understand Learning Outcome: 16.12

13 .

50)

The figure shows results of a study where pine trees were treated with fungal mycorrhize to determine if the fungal mycorrhize would affect the growth of the pine trees. What time range showed the greatest change in mean height in feet?

A) Oct 1955 — Oct 1956 B) Oct 1956 — Oct 1957 C) Oct 1957 — Oct 1958 D) Oct 1958 — Oct 1959 Answer: D Topic: 16 The Process of Science: Who Killed the Pines?

Skill: Apply/Analyze Learning Outcome: 16.11, 16.12 Global LO: 2, 3, 4

14 .

51)

The figure shows results of a study where pine trees were treated with fungal mycorrhize to determine if the mycorrhize would affect the growth of the trees. Over the four-year study, only 36% of the control trees survived, while 85% of the pines treated with mycorrhizae survived. If the study was extended for another two years to the year 1961, what would you predict would occur with the control data and mean height of the pine trees?

A) The control data would show a steep drop in mean height.

B) The control data would continue to show a slight increase in height.

C) The control data would show a steep increase in mean height.

Answer: B Topic: 16 The Process of Science: Who Killed the Pines?

Skill: Apply/Analyze Learning Outcome: 16.11, 16.12 Global LO: 2, 3, 4

15 .

16.2 Art Questions 1) What is this organism?

A) fern B) fungus C) bryophyte D) gymnosperm Answer: C Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 Global LO: 3

16 .

2) This diagram shows what process?

A) origin of plants from green algae B) alternation of generations C) angiosperm life cycle D) gymnosperm life cycle Answer: B Topic: 16.2 Plant Diversity Skill: Remember/Understand Learning Outcome: 16.5 Global LO: 3

17 .

3) If seed production had never evolved, which organisms would be missing in today's landscape?

A) bryophytes and ferns only B) ferns and gymnosperms only C) gymnosperms and angiosperms only D) angiosperms and bryophytes only Answer: C Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.4 Global LO: 2, 3

18 .

16.3 Scenario Questions Read the following scenario to answer the following questions.

People utilize plants to meet many everyday needs, including food, fiber, and building materials.

However, not many of the over 300,000 known species of plants are used by people. One species with a lot of future promise is the jatropha tree. This species is native to Central America and is now found throughout the tropics. Many people believe the jatropha could help alleviate poverty in many areas of the world, as the seeds produce an oil that can be used for cooking, lighting, or generating electricity. This oil can also be mixed with diesel fuel or petrol to produce a biofuel.

Mature trees produce between 5 and 15 kg of seeds per year and can live more than 30 years.

1) What is a possible disadvantage of using jatropha seeds to produce oil?

A) Seeds from the jatropha tree would become infected with fungus from Central American rainforests.

B) Production of jatropha trees will increase parasitic relationships with native plants.

C) Biofuel produced from the jatrohpa tree oil will become contaminated with fungal spores.

D) Growing jatropha trees to produce oil may lower food production if a lot of land is needed for food production.

Answer: D Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 16.9 Global LO: 5 2) Suppose a weather catastrophe occurred such that the bird pollinators of the jatropha tree were significantly diminished. Which form of dispersal might jatropha trees need for a chance to continue producing flowers and seeds?

A) transportation of seeds from cattle B) wind dispersal C) water dipersal Answer: B Topic: 16.2 Plant Diversity Skill: Apply/Analyze Learning Outcome: 6.8, 6.9 Global LO: 5

19 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 17 The Evolution of Animals 17.1 Multiple Choice Questions 1) Which mode of nutrition characteristic distinguishes animals from other eukaryotes?

A) Animals obtain nutrients by absorption.

B) Animals obtain nutrients by eating.

C) Animals use photosynthesis to produce their own food.

Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Remember/Understand Learning Outcome: 17.2 2) The common ancestor of all animals is likely to have been a ________.

A) colonial, flagellated protist B) colonial, ciliated protist C) colonial, flagellated bacterium D) colonial, ciliated bacterium Answer: A Topic: 17.1 The Origins of Animal Diversity Skill: Remember/Understand Learning Outcome: 17.3 3) Radial symmetry is seen in a ________.

A) butterfly B) spoon C) snowflake D) shoe box Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2 4) Sponges are examples of ________.

A) animals that exhibit bilateral symmetry B) photoautotrophs C) animals that lack a true body cavity D) suspension feeders Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5

1 .

5) What name is given to the food-trapping cells of sponges?

A) cnidocytes B) amoebocytes C) skeletal fibers D) choanocytes Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 6) The stationary stage of the cnidarian life cycle is the ________ stage.

A) bilateral B) polyp C) tadpole D) medusa Answer: B Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 7) ________ are characterized body tissues, radial symmetry, and tentacles with stinging cells.

A) Annelids B) Sponges C) Cnidarians D) Roundworms Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 8) On a hike in the mountains, you find a stream with a rocky bottom. Many of the rocks are covered in algae. Which type of mollusc is most likely to be found living in this environment?

A) A cephalopod because it can move quickly through the stream to avoid predators.

B) A gastropod because it can use its radula to scrape the rocks for algae on which to feed.

C) A bivalve because its sedentary life style allows it to remain still when currents flow over the rocks.

Answer: B Topic: 17.2 Major Invertebrate Phyla Skill: Apply/Analyze Learning Outcome: 17.5 Global LO: 2

2 .

9) Which animals have a cylindrical body that is tapered at both ends?

A) platyhelminthes B) cnidarians C) annelids D) roundworms Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 10) There are more species of ________ than of any other type of animal.

A) nematodes B) molluscs C) arthropods D) chordates Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 11) A characteristic of arthropods that has allowed for their great success is the presence of ________.

A) bilateral symmetry B) an endoskeleton C) a brain D) specialized segments Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 12) The arthropod skeleton is composed of ________.

A) mucus B) suckers C) chitin D) amoebocytes Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5

3 .

13) All ________ exhibit the arthropod characteristic of multiple pairs of specialized appendages.

A) crustaceans B) arachnids C) flatworms D) roundworms Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 14) ________ are the most diverse group of arthropods.

A) Insects B) Millipedes C) Arachnids D) Crustaceans Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 15) You are given the task of confirming the categorization of a newly discovered marine animal that has been tagged as a species of echinoderm. What evidence would convince you that it is an echinoderm and not different marine animal such as a sponge or sea anemone?

A) a lack of segmentation B) presence of a water vascular system C) presence of radial symmetry D) larvae with bilateral symmetry Answer: B Topic: 17.2 Major Invertebrate Phyla Skill: Apply/Analyze Learning Outcome: 17.5 Global LO: 2 16) You are given the task of confirming the categorization of a newly discovered animal that has been tagged as a species of annelid. What evidence would convince you that it is an annelid and not a roundworm or flatworm?

A) an incomplete digestive tract B) presence of a highly branched gastrovascular cavity C) parasitic feeding habits D) body segmentation Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Apply/Analyze Learning Outcome: 17.5 Global LO: 2 4 .

17) You discover an organism that has scaly skin and is aquatic but returns to the land to reproduce. What else would you expect to find in this organism?

A) asexual reproduction B) amniotic egg C) a water vascular system D) radial symmetry Answer: B Topic: 17.2 Major Invertebrate Phyla, 17.3 Vertebrate Evolution and Diversity Skill: Evaluate/Create Learning Outcome: 17.5, 17.6 Global LO: 2 18) Unique features of vertebrates include the presence of a(n) ________.

A) endoskeleton and suckers B) notochord and feathery tentacles C) skull and a backbone D) pharyngeal slit and a mantle Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 19) Which characteristic is common to all chordates?

A) They all have vertebral columns.

B) They all exhibit radial symmetry.

C) They all have a notochord sometime during their life cycle.

D) They all have an exoskeleton sometime during their life cycle.

Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 20) A(n) ________ is an example of a chordate that is not a vertebrate.

A) lancelet B) echinoderm C) bird D) fish Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6

5 .

21) Among vertebrates, the unique feature of lampreys and hagfish is the ________.

A) presence of a cartilaginous skeleton B) absence of a backbone C) absence of jaws D) absence of a post-anal tail Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 22) Rays are a type of ________.

A) tunicate B) cartilaginous fish C) jawless fish D) bony fish Answer: B Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 23) Swim bladders ________.

A) contain gills B) are required for fish to exchange gases with surrounding water C) are present in both bony and cartilaginous fishes D) help bony fish to maintain buoyancy Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 24) Which group of fishes includes a lineage that migrated out of fresh water and adapted to life on land?

A) ray-finned fishes B) jawless fishes C) lobe-finned fishes D) cartilaginous fishes Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6, 17.7

6 .

25) What does the term "tetrapod" mean?

A) egg-laying B) living on land C) living a double life D) having four feet Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.7 26) A feature that freed reptiles from dependence on water for reproduction is ________.

A) parental care of eggs B) ectothermy C) metamorphosis D) the amniotic egg Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.7 27) A characteristic that is shared by snakes and birds is ________.

A) ectothermy B) the presence of only a single ovary in females C) the amniotic egg D) endothermy Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.7 28) Almost every element of bird anatomy is modified for what?

A) laying eggs B) eating seeds C) flying D) development of unique songs Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.7

7 .

29) A feature unique to mammals includes ________.

A) the presence of hair B) extended parental care of young C) endothermy D) laying amniotic eggs Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.8 30) ________ are the mammalian group that lays eggs.

A) Eutherians B) Tunicates C) Monotremes D) Marsupials Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.8 31) All chordates have ________.

A) a dorsal, hollow nerve cord and a notochord B) a post-anal tail and a single opening for the mouth and anus C) a cranium and vertebrae D) pharyngeal slits and a cranium Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6 32) Tunicates are examples of ________.

A) annelids B) flatworms C) chordates D) tunicates Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.6

8 .

33) Placental mammals are called ________.

A) birds B) marsupials C) eutherians D) monotremes Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Remember/Understand Learning Outcome: 17.8 34) While on an archaeology expedition, you unearth a skeleton with the following characteristics: four long, slender finger bones and a smaller opposable thumb bone, long arm bones, fingernails, and eye sockets close together on a skull. What type of organism do you suspect you may have found?

A) an anthropoid B) an anthropod C) a crustacean D) a marsupial Answer: A Topic: 17.4 The Human Ancestry Skill: Apply/Analyze Learning Outcome: 17.9 Global LO: 2 35) At a natural history museum, you see a skeleton with the following characteristics: four long, slender finger bones and a smaller opposable thumb bone, and larger feet with long toes. In what type of environment would you expect this organism to have lived?

A) one that lacks vegetation B) one that is very cold C) one that is very dry D) one that is heavily forested Answer: D Topic: 17.4 The Human Ancestry Skill: Evaluate/Create Learning Outcome: 17.9 Global LO: 2 36) How do New World monkeys differ from Old World monkeys?

A) New World monkeys have a prehensile tail.

B) New World monkeys have enhanced depth perception.

C) Old World monkeys are arboreal.

D) Old World monkeys have claws.

Answer: A Topic: 17.4 The Human Ancestry Skill: Remember/Understand Learning Outcome: 17.9 9 .

37) Which human characteristic was hypothesized to have evolved first but was later found NOT to have evolved first?

A) enlarged brain B) erect posture C) language D) loss of body hair Answer: B Topic: 17.4 The Human Ancestry Skill: Remember/Understand Learning Outcome: 17.11 38) The first hominid species to spread beyond Africa was ________.

A) Paranthropus robustus B) Australopithecus afarensis C) Homo erectus D) Homo neanderthalensis Answer: C Topic: 17.4 The Human Ancestry Skill: Remember/Understand Learning Outcome: 17.12 39) Where did humans first appear?

A) South America B) Africa C) Asia D) Europe Answer: B Topic: 17.4 The Human Ancestry Skill: Remember/Understand Learning Outcome: 17.12 40) What is a way in which scientists can test hypotheses about events that occurred in the distant past?

A) by dissecting current animal specimens B) by analyzing fossils recovered from the Earth C) by visiting local libraries to research the events D) by interviewing current scientists and researchers Answer: B Topic: 17.4 The Human Ancestry Skill: Remember/Understand Learning Outcome: 17.12

10 .

41) The process of biological evolution often allows humans to survive consistent environmental stresses that occur across multiple generations. As humans colonized Earth's diverse environments, they encountered hot, dry areas and decided to settle. What trait likely offered an advantage in this environment?

A) the ability to produce sweat to cool their bodies B) the ability to shiver to create body heat C) the ability to squint eyes to block out bright light D) the ability to dig deep holes to find groundwater Answer: A Topic: 17 Evolution Connection: Are We Still Evolving?

Skill: Apply/Analyze Learning Outcome: 17.12 Global LO: 2 42) All but one of these reasons indicate why humans have successfully colonized almost every major habitat on Earth. Choose the EXCEPTION. A) Large amount of connections between cells in the brain.

B) Low ratio of brain volume to body mass.

C) Humans' abilities to learn and change behavior.

D) As the environment became less predictable, increase in brain size enabled humans to plan and change behavior rather than relying only on instinct.

Answer: B Topic: 17 Biology and Society: Evolving Adaptability Skill: Remember/Understand Learning Outcome: 17.1 43) Most animals are ________ and reproduce ________.

A) haploid; sexually B) diploid; sexually C) haploid; asexually D) diploid; asexually Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Remember/Understand Learning Outcome: 17.2 44) When the crown of thorns starfish hatches, it has a semitransparent, jellylike appearance with a non-defined shape. As it ages, it grows arms and then spikes, giving rise to its name. This dramatic change in its body features describes the starfish's ________.

A) metamorphosis B) medusa body plan C) water vascular system D) molting Answer: A Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.2 11 .

45) What would be an appropriate method to use if scientists wanted to determine how mutations of Human Immunodeficiency Viruses (HIVs) have changed over time from a common ancestor?

A) animal life cycle analysis B) application of the molecular clock C) fossil evidence analysis Answer: B Topic: 17 The Process of Science: What Can Lice Tell Us About Ancient Humans Skill: Apply/Analyze Learning Outcome: 17.13 46) If researchers are able to determine when HIVs emerged and therefore how transmission of these viruses to humans occurred, how will this help modern medical care?

A) This information will allow new medical instruments to be produced.

B) This information will allow those infected with HIVs to be cured.

C) This information will enable construction of new medical facilities.

D) This information will enable scientists to find ways to prevent future transmissions.

Answer: D Topic: 17 The Process of Science: What Can Lice Tell Us About Ancient Humans Skill: Evaluate/Create Learning Outcome: 17.13 47) All but one of these traits result from evolutionary responses of ancient ancestors to their physical and cultural environment. Choose the EXCEPTION. A) high frequency of sickle hemoglobin B) inherited blood disorders called thalassemia C) increased hair loss with age D) ability to digest lactose as adults Answer: C Topic: 17 Evolution Connection: Are We Still Evolving?

Skill: Remember/Understand Learning Outcome: 17.14

12 .

17.2 Art Questions

1) The phylogenetic tree indicates that annelids are most closely related to ________.

A) chordates B) arthropods C) molluscs D) echinoderms Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2, 3 2) The phylogenetic tree indicates that ________ demonstrate the most advanced body plan in reference to the presence of tissues and bilateral symmetry.

A) sponges B) cnidarians C) ancestral protists D) arthropods Answer: D Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2, 3 13 .

3) The phylogenetic tree indicates that flatworms are similar to cnidarians in that both ________.

A) are chordates B) have true tissues C) exhibit radial symmetry D) exhibit bilateral symmetry Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2, 3 4) What type of symmetry does this organism exhibit?

A) asymmetrical B) radial C) bilateral Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2, 3

14 .

5) The figure shows a simple worm. Bilateral symmetry and a highly branched gastrovascular cavity all suggest that the worm is a(n) ________.

A) annelid B) mollusk C) chordate D) flatworm Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.4, 17.5 Global LO: 3

15 .

6) In the image, the segmented body of the worm suggests that it is a(n) ________.

A) annelid B) arthropod C) snake D) roundworm Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 Global LO: 3

16 .

7) Insects, such as the grasshopper in the image, have ________.

A) eight legs B) a two-part body: head and abdomen C) a three-part body: head, thorax, and abdomen D) no wings Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Remember/Understand Learning Outcome: 17.5 Global LO: 3

17 .

8) The evolutionary tree indicates that humans and orangutans shared a common ancestor approximately ________.

A) 1 million years ago B) 7 million years ago C) 12 million years ago D) 20 million years ago Answer: C Topic: 17.4 The Human Ancestry Skill: Apply/Analyze Learning Outcome: 17.9 Global LO: 2, 3 9) The evolutionary indicates that if a new anthropoid specimen was discovered and estimated to be approximately 42 million years old, it would be characterized as ________.

A) a species of New World monkey or a species of Old World monkey B) a species of lemur C) a species of tarsier D) a species that evolved from a new ancestral primate Answer: A Topic: 17.4 The Human Ancestry Skill: Apply/Analyze Learning Outcome: 17.9 Global LO: 2, 3 18 .

10) The phylogenetic tree indicates that ________ are most closely related to chordates?

A) molluscs B) echinoderms C) annelids D) arthropods Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Apply/Analyze Learning Outcome: 17.4 Global LO: 2, 3 11) The evolutionary tree indicates that ________ anthropoids are most closely related to humans?

A) orangutans B) chimpanzees C) gorillas D) gibbons Answer: B Topic: 17.4 The Human Ancestry Skill: Apply/Analyze Learning Outcome: 17.10 Global LO: 2, 3

19 .

17.3 Scenario Questions Several studies involving molecular analyses of Comb jellies, also known as sea gooseberries, cast doubt on the theory that sponges are the oldest animal phylum. Reported results of the studies suggested that Comb jellies, more complex animals having muscles and a nervous system, may actually be the true, first phylum of animals that diverged from a metazoan common ancestor. However, in 2015, a team of scientists re-analyzed the genetic data in the Comb jellies research with more specialized methods, and they determined that sponges were indeed the oldest animal phylum.

1) If Comb jellies were actually found to be the oldest animal phylum, how would this information impact our current understanding of the evolution of organisms?

A) We would have to rethink our understanding of aspects of early evolution of multicellular animals such as the origins of nervous systems, tissues, and organs.

B) We would have to re-classify numerous invertebrate species as vertebrate species.

C) We would have to re-classify sponges into groups of organisms that exhibit bilateral symmetry.

D) We would have to throw out all fossil evidence of animal diversification thought to occur during the Cambrian period.

Answer: A Topic: 17.1 The Origins of Animal Diversity Skill: Evaluate/Create Learning Outcome: 17.4 Global LO: 2 2) Suppose that the re-analysis of the genetic data confirmed that Combjellies are the oldest animal phylum. It is therefore likely that their complex traits, such as organ systems, would probably have been present in the common ancestor as well. Therefore, any organisms that would have diverged from the common ancestor after the comb jellies, such as sponges, should likely have similar organ systems. What is the best hypothesis for why sponges do not have a nervous system?

A) As sponges evolved over time, they lost the nervous system.

B) The amoebocytes that make the fibers of a sponge skeleton were not strong enough to support a nervous system.

C) As suspension feeders, sponges could not take in enough nutrients to support the development of a nervous system.

D) As stationary animals, sponges could not move to avoid predators, so they don't live long enough to develop a nervous system.

Answer: A Topic: 17.1 The Origins of Animal Diversity Skill: Evaluate/Create Learning Outcome: 17.4 Global LO: 2

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 18 An Introduction to Ecology and the Biosphere 18.1 Multiple Choice Questions 1) Suppose that a group of climate scientists claims that they can predict future impacts of global climate change with 98% accuracy. Why should you be skeptical of this claim?

A) They do not have reliable methods to measure this change.

B) Their predictions are based on incomplete information about species diversity and interactions of living organisms with each other and with their environments.

C) They should be focusing their predictions based only on climate change in the polar regions where the greatest effects of climate change are experienced.

D) They have not accounted for abiotic factors that affect global climate change in their predictions.

Answer: B Topic: 18 Biology and Society: Penguins, Polar Bears, and People in Peril Skill: Remember/Understand Learning Outcome: 18.1 Global LO: 5 2) Ecology is the study of ________.

A) life B) human effects on the environment C) interactions between humans and other species D) interactions between organisms and their environments Answer: D Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2 3) Which environmental factor is abiotic?

A) a protist B) a plant C) a fungus D) a rock Answer: D Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2

1 .

4) If you study how two species of finches compete for food, you are trying to answer a question about ________.

A) community ecology B) population ecology C) organismal ecology D) ecosystems ecology Answer: A Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2 5) What level of ecology is concerned with the adaptations of individuals?

A) community B) organismal C) ecosystem D) population Answer: B Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2 6) What level of ecology is concerned with groups of individuals of the same species?

A) community B) organism C) ecosystem D) population Answer: D Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2 7) What level of ecology is concerned with groups of individuals of different species?

A) community B) organism C) ecosystem D) population Answer: A Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2

2 .

8) What is a population?

A) a group of organisms living in a particular geographic area B) a group of organisms of the same species living in a particular geographic area C) a community as well as all the abiotic factors in a particular geographic area D) all of the organisms of a species existing at a particular time Answer: B Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2 9) Which of these is a community?

A) all of the garden snails (Helix aspersa) living in your garden B) all of abiotic factors that determine the health of your garden C) all of the organisms living in your garden as well as the soil and rocks D) all of the organisms living in your garden Answer: D Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2 10) What level of ecology is concerned with energy flow and the cycling of chemicals among various biotic and abiotic factors?

A) community B) organism C) ecosystem D) population Answer: C Topic: 18.1 An Overview of Ecology Skill: Remember/Understand Learning Outcome: 18.2 11) Which ecosystems support life in the absence of sunlight?

A) hydrothermal vent habitats B) tundra habitats C) photic zone habitats D) forested habitats Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Remember/Understand Learning Outcome: 18.3

3 .

12) If their own solute concentration does not match that of their surroundings, aquatic organisms ________.

A) grow a waxy coating to prevent water loss B) may experience problems with water balance C) cannot metabolize nutrients D) seek out areas of high sunlight Answer: B Topic: 18.2 Living in Earth's Diverse Environments Skill: Remember/Understand Learning Outcome: 18.3 13) Which nutrients often limit the distribution and abundance of photosynthetic organisms?

A) water and oxygen B) nitrogen and phosphorus C) carbon dioxide and nitrogen D) water and carbon dioxide Answer: B Topic: 18.2 Living in Earth's Diverse Environments Skill: Remember/Understand Learning Outcome: 18.3 14) What term applies to the physical and physiological changes experienced by astronauts who spend months in space?

A) acclimation B) camouflaging C) "flagging" Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Apply/Analyze Learning Outcome: 18.3 Global LO: 2 15) Which is a behavioral response to environmental variability?

A) migrating to a different location B) acclimation C) "flagging" Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Remember/Understand Learning Outcome: 18.3

4 .

16) In an aquatic ecosystem, what name is given to the region where photosynthesis can occur?

A) pelagic zone B) aphotic zone C) benthic realm D) photic zone Answer: D Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 17) What are estuaries?

A) types of freshwater biomes B) areas near the start of a river C) regions where ocean meets land D) transition areas between a river and the ocean Answer: D Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 18) Which biome is one of the most biologically productive of all biomes?

A) open oceans B) estuaries C) temperate grasslands D) coniferous forests Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 19) What name is given to the region where ocean meets land?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4

5 .

20) What name is given to the open ocean?

A) pelagic realm B) intertidal zone C) benthic realm D) photic zone Answer: A Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 21) In what part of the ocean are phytoplankton found?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: A Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 22) What name is given to the seafloor?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 23) What can moderate climate by absorbing heat when the air is warm and releasing heat when the air is cold?

A) clouds and tropic forests B) glaciers and deserts C) mountains and grasslands D) oceans and lakes Answer: D Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.5

6 .

24) Water-storing plants and deeply rooted shrubs are plants that characterize ________.

A) tropical forests B) chaparral C) deserts D) savanna Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 25) Long, snowy winters as well as evergreen trees such as pine and fir are found in ________.

A) chaparral B) temperate broadleaf forests C) coniferous forests D) temperate grasslands Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 26) ________ is a critical abiotic factor that contributes to plant growth in savanna ecosystems.

A) Drought B) Rain C) Wind D) Fire Answer: D Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 27) What is one important difference between savannas and temperate grasslands?

A) Savannas only rarely experience fires.

B) Temperate grasslands are mostly treeless.

C) Savannas are inhabited by grazing mammals.

D) Temperate grasslands have nutrient-poor soil.

Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6

7 .

28) Which of these biomes are maintained by fire?

A) temperate broadleaf forests and chaparral B) chaparral and savannas C) deserts and chaparral D) savanna and temperate grasslands Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 29) Which biome is characterized by permafrost?

A) temperate broadleaf forest B) chaparral C) tundra D) coniferous forest Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 30) Most of the temperate grassland in North America has been converted to ________.

A) cities B) farmland C) national parks D) small neighborhoods Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.6 Global LO: 5 31) Water moves from land to the atmosphere through ________.

A) precipitation only B) transpiration only C) transpiration and evaporation D) evaporation and precipitation Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.7

8 .

32) With regard to the environment as a whole, when is the worst time to apply pesticide to your lawn?

A) when it is raining, or is about to rain B) when it is cold, or is about to get cold C) at the same time you apply fertilizer Answer: A Topic: 18.3 Biomes Skill: Apply/Analyze Learning Outcome: 18.7 Global LO: 2, 5 33) What fraction of Earth's surface has been altered by human use?

A) 25% B) 50% C) 75% D) 95% Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.8 Global LO: 4, 5 34) The greenhouse effect causes an increase in global temperatures. This increase is due primarily to ________.

A) carbon dioxide and other greenhouse gases allowing more solar radiation to penetrate Earth's surface B) carbon dioxide and other greenhouse gases slowing the escape of UV radiation from Earth C) the loss of ozone that trapped cooling UV radiation in the atmosphere D) carbon dioxide and other greenhouse gases slowing the escape of heat from Earth Answer: D Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5 35) Temperature increases due to global warming have been greatest ________.

A) close to the poles B) in the sea C) in the tropics D) in deserts Answer: A Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5

9 .

36) An effect of deforestation has been to ________.

A) decrease the amount of carbon dioxide in the atmosphere B) increase the amount of carbon dioxide in the atmosphere C) increase the rate at which carbon dioxide is incorporated into organic material D) decrease the rate of carbon dioxide production through cellular respiration Answer: B Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5 37) In the oceans, global warming has ________.

A) decreased the amount of oxygen available B) benefited corals C) made the water more basic D) made the water more acidic Answer: D Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5 38) Global warming may trigger all but one of these results to occur. Choose the EXCEPTION. A) changes in the breeding seasons of some species B) increased forest clearing for agricultural purposes C) melting permafrost D) catastrophic wildfire seasons Answer: B Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.10 Global LO: 5 39) Malaria is an infectious disease transmitted to humans from a parasite that infects mosquitoes that feed on humans. World health officials have concerns that climate change may impact the transmission of malaria into tropical highland areas in Africa. If these concerns turn out to be valid, they would imply that global climate change ________.

A) affects the distribution of species B) will negatively impact the transmission of malaria only in Africa C) affects freshwater and marine biomes D) will enable scientists to more easily control the spread of malaria Answer: A Topic: 18 The Process of Science: How Does Climate Change Affect Species Distribution?, 18.4 Global Climate Change Skill: Evaluate/Create Learning Outcome: 18.10 Global LO: 2, 5 10 .

40) Which action would increase your carbon footprint?

A) reusing or recycling items B) eating more vegetables and less meat C) eating more beef and less chicken D) walking instead of driving Answer: C Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5 41) All but one of these are causes for increasing carbon dioxide levels. Choose the EXCEPTION. A) transportation B) home energy use C) production of manufactured goods D) creating compost piles from vegetable waste Answer: D Topic: 18.4 Global Climate Change Skill: Remember/Understand Learning Outcome: 18.9 Global LO: 5 42) Scientists have documented that spring seasons starting earlier due to climate change have resulted in some caterpillar species beginning their maturation stage earlier than normal. There are bird species that need the caterpillars to feed their chicks. However, since the caterpillars are maturing before the chicks hatch (and therefore cannot be used for chick food), the birds are experiencing a drop in their lifetime reproductive success. Interestingly, scientists have also documented that the individual birds that are successful in altering their egg-laying patterns to align with earlier spring seasons have the greatest lifetime reproductive success. These phenomena are examples of ________.

A) an evolutionary response to climate change B) an increase in global greenhouse gas emissions due to climate change C) a change in species distribution due to climate change D) the effects of terrestrial biome distribution due to climate change Answer: A Topic: 18 Evolution Connection: Climate Change as an Agent of Natural Selection, 18 The Process of Science: How Does Climate Change Affect Species Distribution?, 18.4 Global Climate Change Skill: Apply/Analyze Learning Outcome: 18.10, 18.11 Global LO: 2, 5

11 .

43) In suburban areas with a high density of humans, it is necessary to have a well-functioning wastewater treatment system. If engineers wanted to create a wastewater treatment system that takes advantage of natural resources, they should consider incorporating ________ into their plan.

A) wetlands B) oceans C) rivers Answer: A Topic: 18.3 Biomes Skill: Apply/Analyze Learning Outcome: 18.4 Global LO: 2, 5 44) Latitudes between the tropics and the Arctic Circle and the Antarctic Circle are called ________.

A) tropical zones B) temperate zones C) polar regions D) savanna ecosystems Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.5 45) Which question would be investigated by someone who studies population ecology?

A) How do phosphoruscycling and solar energy affect water temperature and phytoplankton growth in aquatic ecosystems?

B) How does a change in vocal signals helpurban great tits (Parus major)survive in urbanized areas?

C) How does habitat destruction affect growth and density of multiple amphibian species?

D) How does the structure of a cactus plant enable it to avoid desiccation in hot, arid environments?

Answer: C Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2

12 .

46) What question would be investigated by someone who studies organismal ecology?

A) How do phosphoruscycling and solar energy affect water temperature and phytoplankton growth in aquatic ecosystems?

B) How does a change in vocal signals helpurban great tits (Parus major)survive in urbanized areas?

C) How does habitat destruction affect growth and density of multiple amphibian species?

D) How does the structure of a cactus plant enable it to avoid desiccation in hot, arid environments?

Answer: B Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2 47) What question would be investigated by someone who studies ecosystem ecology?

A) How do phosphoruscycling and solar energy affect water temperature and phytoplankton growth in aquatic ecosystems?

B) How does a change in vocal signals helpurban great tits (Parus major)survive in urbanized areas?

C) How does habitat destruction affect growth and density of multiple amphibian species?

D) How does the structure of a cactus plant enable it to avoid desiccation in hot, arid environments?

Answer: A Topic: 18.1 An Overview of Ecology Skill: Apply/Analyze Learning Outcome: 18.2 Global LO: 2

13 .

18.2 Art Questions 1) From the figure, which part of Earth receives the greatest intensity of solar radiation?

A) Tropic of Cancer and Tropic of Capricorn B) Equator C) North and South Poles Answer: B Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.5 Global LO: 3

14 .

2) The figure shows regions of an ocean. In what region do phytoplankton live?

A) aphotic zone B) benthic realm C) photic zone Answer: C Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.4 Global LO: 3

15 .

3) The figure indicates that ________.

A) mountains can block the flow of moist air from a coast, causing radically different climates on opposite sides of a mountain range B) the direction of wind affects how much moisture evaporates in the photic zone of the Pacific Ocean C) rainfall creates freezing temperatures in mountain ranges D) groundwater runoff causes massive erosion at the base of mountain ranges Answer: A Topic: 18.3 Biomes Skill: Remember/Understand Learning Outcome: 18.5 Global LO: 2, 3

16 .

4)

The data in this table describe the average global temperature anomalies measured in August 2017 for Land, Ocean, and Land/Ocean combined. NOAA (the National Oceanic and Atmospheric Administration) defines a temperature anomaly as: "a departure from a reference value or long-term average. A positive anomaly indicates that the observed temperature was warmer than the reference value, while a negative anomaly indicates that the observed temperature was cooler than the reference value." (https://www.ncdc.noaa.gov/monitoringreferences/faq/anomalies.php) What can you conclude from these data?

A) Land, Ocean, and Land/Ocean combined all showed negative anomalies.

B) Land, Ocean, and Land/Ocean combined all showed positive anomalies.

C) Land temperature anomalies for 2017 are the highest recorded in 138 years.

D) Land/Ocean combined anomalies for 2017 are the coldest recorded in 138 years.

Answer: B Topic: 18.4 Global Climate Change Skill: Apply/Analyze Learning Outcome: 18.10 Global LO: 2, 3, 5

17 .

18.3 Scenario Questions Please read the following scenario to answer the following questions.

Salmon eggs hatch in freshwater streams and, during their first year of life, the young salmon migrate distances up to 1,000 km in order to reach the ocean. Here they spend up to 5 years where they feed and grow, acquiring more than 95% of their biomass. During the summer of their maturing year, they begin the long journey back to their home streams to spawn. Although it is still uncertain how salmon navigate back to their spawning grounds, current hypotheses suggest that they have a highly developed sense of smell that allows them to remember odors they encountered on their migration to the ocean. They then use these odors to help them navigate back to the streams where they were born. At the spawning grounds, females use their tails to form a hollow cavity in the stream gravel where they lay up to 8,000 eggs. The males fertilize the eggs, and both adults typically die soon thereafter.

1) The physiological response that allows salmon to survive in fresh water, then in salt water, and then fresh water again is an example of ________.

A) a behavioral response B) evolution C) acclimation D) an anatomical response Answer: C Topic: 18.2 Living in Earth's Diverse Environments Skill: Apply/Analyze Learning Outcome: 18.3 Global LO: 2 2) At different times in their lives, salmon can be found in all but one of these biomes. Choose the EXCEPTION. A) a freshwater biome B) a wetland biome C) the pelagic realm of an ocean D) an estuary Answer: B Topic: 18.3 Biomes Skill: Apply/Analyze Learning Outcome: 18.4 Global LO: 2

18 .

Please read the following scenario to answer the following questions.

CO2 is not the only greenhouse gas (GHG) that impacts global climate change. Other GHGs may be equally or more effective than CO2 at trapping heat on Earth. Climate scientists determine how much a GHG may impact global warming based on two factors: the efficiency with which a GHG absorbs energy (i.e., traps heat on Earth) and the length of time (in years) that the gas remains in the atmosphere. A unit of measurement called the Global Warming Potential (GWP) is used to describe how much energy a GHG absorbs over a specific period of time (100 years is a standard time frame). All GWP values of GHGs are compared to the GWP of CO2, which is given a value of 1.

3) In this scenario, how would you best describe CO2?

A) It is a baseline comparison for the GWP values of all other GHGs. B) It is a greenhouse gas whose GWP value is dependent upon the GWP values of all other GHGs. C) It is the greenhouse gas that is the most efficient at trapping heat on Earth.

D) It is the greenhouse gas that is the least efficient at trapping heat on Earth.

Answer: A Topic: 18.4 Global Climate Change Skill: Evaluate/Create Learning Outcome: 18.9 Global LO: 1, 2, 5 4) CH4 has a GWP over 20 times higher than CO2. However, CH4 emitted today lasts for only about a decade in the atmosphere, while the GWP of CO2 can last for thousands of years. What is a possible reason that CH4 can have such a high GWP as compared to CO2?

A) The 100-year time frame is too short of a time frame to compare CH4 and CO2.

B) CH4 absorbs more energy than CO2.

C) CH4 is less efficient at trapping heat on Earth.

D) CH4 is not a proven greenhouse gas.

Answer: B Topic: 18.4 Global Climate Change Skill: Evaluate/Create Learning Outcome: 18.9 Global LO: 2, 4, 5, 7 5) Chlorofluorocarbons (CFCs) are greenhouse gases that, for a specific amount of mass, trap significantly more heat than CO2. How can you classify CFCs? A) gases with lower GWP values than CO2 B) gases with equal GWP values to CO2 C) gases with greater GWP values than CO2 Answer: C Topic: 18.4 Global Climate Change Skill: Evaluate/Create Learning Outcome: 18.10 Global LO: 2, 4, 5 19 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 19 Population Ecology 19.1 Multiple Choice Questions 1) Chinese privet is a plant that is native to China. Over 150 years ago, Chinese privet was introduced to the United States as a fast-growing shrub that serves as an excellent privacy hedge.

With no natural herbivore, Chinese privet quickly established itself and spread in natural areas throughout the southeast and eastern seaboard of the United States. Its dominance in these areas has jeopardized the survival of native plant species. Chinese privet provides evidence that ________.

A) introducing non-native organisms can cause environmental damage B) American gardeners can easily control the spread of Chinese privet C) integrated pest management strategies will not decrease Chinese privet populations D) non-native plant species have Type I survivorship curves Answer: A Topic: 19 Biology and Society Skill: Apply/Analyze Learning Outcome: 19.1 Global LO: 2, 5 2) Which is an example of a population?

A) a group of three species of lions that live in the same general area of a prairie at the same time B) a group of lions of a single species that live in the same general area of a prairie at the same time C) a group of three species of lions that live in the same general area of a prairie at different times D) a group of lions of a single species that live in the same general area of a prairie at different times Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.2 Global LO: 2 3) What is a characteristic of Type I survivorship curves?

A) There is low survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is high for the few individuals that survive to a certain age.

Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Remember/Understand Learning Outcome: 19.3

1 .

4) Type I survivorship curves are typical of species that exhibit ________.

A) an intermediate number of offspring and an intermediate level of parental care B) few offspring and good parental care C) many offspring and good parental care D) many offspring and poor parental care Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Remember/Understand Learning Outcome: 19.3 5) Which option best describes Type II survivorship curves?

A) There is high survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is high for the few individuals that survive to a certain age.

Answer: C Topic: 19.1 An Overview of Population Ecology Skill: Remember/Understand Learning Outcome: 19.3 6) Which option best describes Type III survivorship curves?

A) There is low survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is low for the few individuals that survive to a certain age.

Answer: A Topic: 19.1 An Overview of Population Ecology Skill: Remember/Understand Learning Outcome: 19.3 7) When forest areas are clear-cut for timber, spaces previously filled with trees become open areas that have full access to sunlight. Which plant populations would be best suited for this newly generated environment?

A) Those with low death rates.

B) Those that produce many offspring.

C) Those that have seeds with long maturation periods.

D) Those that reproduce once per lifetime.

Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.4 Global LO: 2

2 .

8) Species that exhibit an equilibrial life history typically ________.

A) have long lives B) exhibit a Type III survivorship curve C) exhibit a Type II survivorship curve D) have a large number of offspring Answer: A Topic: 19.1 An Overview of Population Ecology Skill: Remember/Understand Learning Outcome: 19.4 9) If there are 500 oak trees in a forest covering 50 square kilometers (km2), then the population density is ________.

A) 5 trees per km2 B) 10 trees per km2 C) 50 trees per km2 D) 100 trees per km2 Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.2 Global LO: 2, 4 10) In an ideal, unlimited environment, a population's growth follows a(n) ________ model.

A) exponential B) density-dependent C) logistic D) boom-and-bust Answer: A Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 11) In an ideal, unlimited environment, what shape does a population's growth curve most closely resemble?

A) S B) J C) ∧ D) ∪ Answer: B Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5

3 .

12) If a population's growth rate decreases as the population size approaches carrying capacity, the population's growth follows a(n) ________ model.

A) exponential B) boom-and-bust C) logistic D) density-independent Answer: C Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 13) In a population that is following a logistic growth pattern, what shape does the population's growth curve most closely resemble?

A) S B) J C) ∧ D) ∪ Answer: A Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 14) Suppose a plane is forced to make an emergency landing on a desert island. The passengers must use the resources in their new environment to survive. The number of people who can survive depends on the availability of these resources. This is an example of ________.

A) population cycle B) carrying capacity C) life history pattern D) survivorship curve Answer: B Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2 15) According to the logistic growth model, what happens to a population when the size of the population reaches carrying capacity?

A) The growth rate increases.

B) The growth rate decreases.

C) The growth rate cannot be determined.

D) The growth rate is zero.

Answer: D Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5

4 .

16) Competition among individuals of the same species for the same limited resources is ________ competition.

A) density-independent B) intraspecific C) Type II D) Type III Answer: B Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 17) Which of these factors operates on populations in a density-dependent manner?

A) blizzard B) volcanic eruption C) food supply D) flood Answer: C Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 18) Over time, the populations of most species ________.

A) fluctuate B) increase rapidly, crash, and never recover C) continuously increase D) exhibit boom-and-bust cycles Answer: A Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 19) An unexpected freeze that kills a population of chipmunks is an example of ________.

A) a density-independent factor B) a biological control C) a density-dependent factor D) a population momentum Answer: A Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2

5 .

20) The Endangered Species Act aims to help protect species that ________.

A) are in danger of extinction B) dominate suitable habitats C) compete with invasive species Answer: A Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 Global LO: 5 21) The red-cockaded woodpecker, an endangered species, is dependent upon ________ for maintenance of its source habitat.

A) tall grasses B) fire C) floods D) corn snakes Answer: B Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 22) You arrive back in the United States after having visited a foreign country located on another continent. The customs agent stops the person in front of you and confiscates the fruit basket this person is bringing home. Being the knowledgeable person you are, you calmly explain to your enraged fellow traveler that the reason for the detainment is that the fruit basket may be ________.

A) carrying endangered fruit B) carrying a non-native species that could damage North American ecosystems C) contaminated with insecticides that will damage the ozone layer above North America D) contaminated with sufficient DDT to cause serious harm to anyone who eats the fruit Answer: B Topic: 19.3 Applications of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.6 Global LO: 2, 5 23) Non-native species can have important effects on biological communities by ________.

A) providing nutrients for growth to native species B) competing with native species for resources C) increasing biodiversity Answer: C Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 Global LO: 5

6 .

24) ________ are an example of an invasive species.

A) red-cockaded woodpeckers B) cod C) snowshoe hares D) Burmese pythons Answer: D Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 Global LO: 5 25) The intentional release of a natural enemy to attack a pest population is called ________.

A) biological control B) sustainable resource management C) integrated pest management Answer: A Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 Global LO: 5 26) The use of the Indian mongoose to control rat populations ________.

A) shows the effectiveness of biological control B) shows why integrated pest management often fails C) became a disaster when the mongoose turned out to be as invasive as its target D) is an example of coevolution Answer: C Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.6 Global LO: 5 27) Kudzu, an Asian vine introduced to the United States in the 1930s as a means to control erosion, is referred to as "the plant that ate the South" because it grows alarmingly fast and overtakes most plant species in its path. A recent and unusual way that some people are using to control kudzu growth is to allow goats to graze their land and eat the kudzu, roots and all. This is considered by some to be the most environment-friendly way to eliminate this invasive vine.

How can we best describe the goats in this situation?

A) a threatened species B) an invasive species C) a biological control agent D) an integrated pest management agent Answer: C Topic: 19.3 Applications of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.6 Global LO: 2, 5 7 .

28) Most crop pests ________.

A) have an opportunistic life history B) have an equilibrial life history C) exhibit type I survivorship D) consist of long-lived individuals Answer: A Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.7 29) Integrated pest management ________.

A) favors overwhelming a pest with chemical pesticides B) advocates total eradication of pest species C) aims to keep pest populations on an exponential growth curve D) advocates mixed-species plantings and rotating crops Answer: D Topic: 19.3 Applications of Population Ecology Skill: Remember/Understand Learning Outcome: 19.7 Global LO: 5 30) Throughout most of human history, human population size ________.

A) was at carrying capacity B) grew very slowly C) showed boom-and-bust cycles D) grew exponentially Answer: B Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.8 Global LO: 5 31) In most developed countries, overall population growth rates ________.

A) are high, so the population size is growing rapidly B) are high, so the population size is fairly stable C) are near zero, so the population size is fairly stable D) are low, so the population size is declining Answer: C Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.8 Global LO: 5

8 .

32) In most developing countries, ________.

A) birth rates equal death rates, so the population is fairly stable B) birth rates are lower than death rates, so the population is declining C) birth rates are lower than death rates, so the population is growing rapidly D) birth rates are much higher than death rates, so the population is growing rapidly Answer: D Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.8 Global LO: 5 33) What will be the approximate shape of the age-structure diagram of a rapidly increasing population?

A) a rectangle B) a pyramid C) an inverted pyramid D) an hourglass Answer: B Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.9 34) In 2012, the Global Footprint Network reported that ________.

A) the average ecological footprint for the world's population had already exceeded the planet's biocapacity per person B) the average ecological footprint for the world's population was far below the planet's biocapacity per person C) Earth can sustain a population about double the current population Answer: A Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.10 Global LO: 5 35) The ecological footprint of the United States ________.

A) is about the same as the world average B) is about two times lower than the world average C) is almost three times higher than the world average Answer: C Topic: 19.4 Human Population Growth Skill: Remember/Understand Learning Outcome: 19.10 Global LO: 5

9 .

36) During the Pleistocene era, many large mammal species went extinct. Their permanent disappearance occurred in a short period of time when humans were expanding across North America. In this situation, how do many scientists view humans?

A) as a threatened species B) as a density-independent factor C) as an invasive species D) as a biological control agent Answer: C Topic: 19 Evolution Connection Skill: Remember/Understand Learning Outcome: 19.11 Global LO: 5 37) Population growth is affected differently in dense versus sparse populations. When female bats raise their offspring, they form "maternity colonies" that are densely populated. In these populations, the female bats are so tightly packed together in one area that their bodies touch one another. Mites, a common parasite of bats, thrive in this type of environment because they can easily move from host to host. What might you predict would happen to the mite infection rate once the maternity colonies naturally break apart? The parasite population will ________.

A) demonstrate declined growth because greater distance between bats makes transmission of parasites more difficult B) demonstrate exponential growth because greater distance between bats makes transmission of parasites more difficult C) fluctuate between times of high growth rate and then low growth rate because individual parasites evolve to have an equilibrial life history D) maintain a slow but steady growth rate because individual parasites will evolve feeding strategies that allow them to feed longer on individual bats Answer: A Topic: 19.2 Population Growth Models Skill: Evaluate/Create Learning Outcome: 19.5 Global LO: 2 38) Weasels are a natural predator of bats. Since bats sleep during the day, weasels can climb to where they roost and feed on them. Suppose you want to design a study to see if weasels and bats demonstrate a boom and bust relationship in population size. What is the best first step to take?

A) Estimate the current population density of only the weasel species you plan to observe that live in one grassland area.

B) Estimate the number of weasels born each year in as many habitat areas as possible.

C) Estimate the current population densities of both the bat species and the weasel species you plan to observe in as many habitat areas as possible.

D) Estimate the number of bats eaten each day by weasels in one habitat area.

Answer: C Topic: 19.2 Population Growth Models Skill: Evaluate/Create Learning Outcome: 19.5 Global LO: 1, 2, 7 10 .

19.2 Art Questions 1) The figure shows population cycles of snowshoe hare and lynx. Recent field studies suggest that the most likely explanation for these cycles is ________.

A) periodic winter storms B) excessive predation of snowshoe hares C) environmental disturbances including fire D) usually hot and dry summers Answer: B Topic: 19.2 Population Growth Models Skill: Remember/Understand Learning Outcome: 19.5 Global LO: 3

11 .

2) The line in between the data points on the curve is a trend line; a trend line shows the general pattern of the data points. In the curve, the trend line indicates that male fur seals reached carrying capacity in the year ________.

A) 1915 B) 1930 C) 1940 D) 1950 Answer: C Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2, 3 3) Suppose a density-dependent factor acted on the fur seal population in 1940 such that it caused the population to crash. How would this be reflected in the trend line?

A) The trend line would stay as a flat line for at least another 50 years.

B) The trend line would display a sharp incline.

C) The trend line would display a sharp decline.

Answer: C Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2, 3

12 .

This figure depicts population growth for three different populations.

4) Which population is growing at the fastest rate?

A) Population A B) Population B C) Population C D) They are all growing at the same rate.

Answer: A Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2, 3, 4 5) If all 3 populations occupy different areas that are approximately the same size, which population has the lowest density in year 5?

A) Population A B) Population B C) Population C D) All three populations will have the same density.

Answer: C Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2, 3, 4

13 .

6) Assume the three populations represent three populations of the same species of bird that all live in the same geographic area. All population sizes are equal, and data collected on the populations' growth rates all started on the same day. There are several plausible reasons why population C has the slowest growth rate. Choose the exception.

A) Population C started with the greatest number of birds in their reproductive prime.

B) Birds in Population C laid fewer eggs per clutch than in the other two populations.

C) Population C had greater numbers of natural predators in their niche than the other two populations.

Answer: A Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2, 3 7) Which possible description best matches this figure?

A) Dolphins produce only single offspring at a time and provide parental care for many months.

B) During "mating frenzies," male and female squid aggregate and release hundreds of eggs and sperm into the water column. The fertilized eggs are often quickly preyed on by fish.

C) The century plant grows for many years and reproduces and releases hundreds of seeds just once before it withers and dies. Because of the dry desert environment in which it lives, many of the seeds do not survive or are eaten.

D) In some species of lizards and rodents, survivorship is constant over the life span.

Answer: A Topic: 19.1 An Overview of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.2 Global LO: 2, 3

14 .

8)

The figure shows three different ponds used by scientists to study if blocking access to the ponds would limit can toad invasion. Which pond was the control for the experiment?

A) Pond A B) Pond B C) Pond C Answer: A Topic: 19 The Process of Science Skill: Remember/Understand Learning Outcome: 19.12 Global LO: 3

15 .

19.3 Scenario Questions Please read the following scenario to answer the following questions.

Michigan's Isle Royale is an island located in Lake Superior that is 45 miles long and 9 miles wide. Ecologists estimate that the moose population on the island has been there since approximately the year 1900. The wolf population on the island, on the other hand, has been there only since the winter of 1949. Weather conditions had to be calm and cold enough for the lake to freeze so that the first wolves could make the passage over to the island. When the wolves arrived, they were greeted with a large moose population that had no predators. The moose population was at a dangerously high level but was kept in check by the arrival of the wolves. This "harmonious" pattern continued for at least 20 years.

In 1982, the wolf population suddenly crashed because of a new canine virus believed to have been carried to the island carried on the shoe of a human traveler. While the wolf population size decreased from 50 to 14 individuals in a year, the moose population increased. However, the winter of 1996 was extremely harsh and the moose population experienced a major crash. More than 500 moose died during the winter months, reducing the population to less than 800 animals.

1) What most likely happened after the wolves first arrived on the island?

A) The wolf population increased exponentially.

B) The wolf population was at its carrying capacity.

C) The moose population crashed because of the introduction of a predator.

D) The moose population increased exponentially.

Answer: A Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2 2) The virus introduced to the island in 1982 that reduced the wolf population is an example of ________.

A) a density-independent factor B) a density-dependent factor C) biological control D) intraspecific competition Answer: B Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2

16 .

3) The harsh winter that led to the death of many moose in 1996 is an example of ________.

A) a density-dependent factor B) biological control C) a density-independent factor D) a trigger for logistic growth Answer: C Topic: 19.2 Population Growth Models Skill: Apply/Analyze Learning Outcome: 19.5 Global LO: 2 4) During a 1-year study, a graduate student attempted to count the wolves and moose on the island. She estimated that there were 950 moose and 120 wolves. How many organisms, populations, and species were included in this study?

A) organisms = 2; populations = 1; species = 2 B) organisms = 1,070; populations = 1; species = 2 C) organisms = 2; populations = 2; species = 1,070 D) organisms = 1,070; populations = 2; species = 2 Answer: D Topic: 19.1 An Overview of Population Ecology Skill: Apply/Analyze Learning Outcome: 19.2 Global LO: 2, 4 Please read the following scenario to answer the following questions.

In May 2014, the European Union (EU) published a report of population structure and aging data that described growing trends of low birth rates and longer life expectancies in the EU. In their report, the EU described that due to these trends, some EU member states were beginning to demonstrate a population structure with many much-older individuals.

5) If this trend continues, what do you predict that the populations will look like as time progresses for 50 more years?

A) There will be more older individuals than working-age individuals.

B) There will be more children than older individuals.

C) There will be more older individuals than children.

D) There will be more working-age individuals than older ones.

Answer: A Topic: 19.4 Human Population Growth Skill: Evaluate/Create Learning Outcome: 19.9 Global LO: 2, 5

17 .

6) Why might this changing population structure be a concern for EU leaders?

A) Eventually greater resources will be needed to support a much larger and older generation, and this burden will fall on an increasingly smaller workforce.

B) Eventually the EU population will exhibit a Type III survivorship curve.

C) Eventually intraspecific competition for resources amongst the older members of the population will lead to a decrease in food and water availability.

D) Eventually individuals of reproductive age will face a boom-and-bust population cycle.

Answer: A Topic: 19.4 Human Population Growth Skill: Evaluate/Create Learning Outcome: 19.10 Global LO: 2, 5, 7

18 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 20 Communities and Ecosystems 20.1 Multiple Choice Questions 1) The present rate of species loss ________.

A) suggests that about 25% of all plant and animal species may be extinct by the end of the century B) is about the same as it has been during the last 100,000 years C) is as much as 100 times higher than at any time in the last 100,000 years D) is slower than in recent years because of conservation efforts Answer: C Topic: 20.1 Biodiversity Skill: Remember/Understand Learning Outcome: 20.2 Global LO: 5 2) The single greatest threat to biodiversity comes from ________.

A) habitat destruction and fragmentation B) invasive species C) overexploitation D) pollution Answer: A Topic: 20.1 Biodiversity Skill: Remember/Understand Learning Outcome: 20.2 Global LO: 5 3) A traveler was crossing the border from Canada to the United States and with a bag of Washington State apples. The customs officer at the border would not let the traveler take the apples into the United States, despite the apples originating from the United States. Why did the customs officer refuse to allow the traveler to cross the border with the apples?

A) Washington State apples are considered an endangered fruit.

B) There may have been a species that was not native to the United States hitching a ride on the apples.

C) Forcing the traveler to buy more apples from a store in the United States is better for the US economy.

Answer: B Topic: 20.1 Biodiversity Skill: Apply/Analyze Learning Outcome: 20.2 Global LO: 2, 5

1 .

4) An example of a mutualism, or +/+ relationship, is ________.

A) between corals and unicellular algae B) cryptic coloration in frogs C) between snails and the plants that they eat D) between birds that use some of the same resources Answer: A Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.4 Global LO: 2 5) Populations of two coexisting species are both tertiary consumers in a community. What relationship may exist between these two organisms?

A) predation B) mutualism C) competition D) succession Answer: C Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.3, 20.4, 20.5 Global LO: 2 6) As a result of a severe disturbance, a community will ________.

A) not be repopulated B) be replaced by organisms in random order C) not change D) undergo succession Answer: D Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.7 7) Organisms that consume producers are ________.

A) tertiary consumers B) decomposers C) primary consumers D) secondary consumers Answer: C Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.5

2 .

8) In the food chain grass → antelope → human → lion, the antelope is ________.

A) both an herbivore and a secondary consumer B) both a producer and a primary consumer C) both an herbivore and a primary consumer D) a secondary consumer only Answer: C Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.5 Global LO: 2 9) In the food chain grass → antelope → human → lion, the human is a ________.

A) tertiary consumer B) secondary consumer C) primary consumer D) producer Answer: B Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.5 Global LO: 2 10) In an aquatic food chain, small fishes that eat zooplankton are ________.

A) primary consumers B) producers C) tertiary consumers D) secondary consumers Answer: D Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.5 11) Which of these organisms convert organic matter to inorganic matter by breaking down dead organisms?

A) producers B) carnivores C) decomposers D) primary consumers Answer: C Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.5

3 .

12) Most decomposers are ________.

A) plants and fungi B) bacteria and plants C) fungi and prokaryotes D) animals Answer: C Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.5 13) Bears eat berries, humans, and large fish; large fish eat smaller fish and insects; humans eat bears, large fish, and berries. The scenario described here is an example of ________.

A) an ecosystem B) parasitism C) a food web D) a food chain Answer: C Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.5 Global LO: 2 14) Herbivory is an example of a ________ interaction.

A) +/+ B) -/C) 0/+ D) +/Answer: D Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.4 15) In order to assess the species diversity of a community, you would need to know the number of different species present as well as ________.

A) the number of trophic levels in the community B) the intensity of interspecific competition in the community C) the fraction of these species that are plants D) the relative abundance of the different species Answer: D Topic: 20.2 Community Ecology Skill: Remember/Understand Learning Outcome: 20.6

4 .

16) In Yellowstone National Park, wolves were hunted to extinction in the 1920s. A current restoration project has reintroduced wolves to Yellowstone National Park. Predict the response of the Yellowstone ecological community if wolves are a keystone species.

A) Species richness should decrease.

B) The relative abundances of each species should become more unequal.

C) Species diversity should decrease.

D) Species richness should increase, and the relative abundances of each species should be about equal.

Answer: D Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.6, 20.10 Global LO: 2 17) Two lakes have the same number of species. Most of the fish in Lake 1 are of a single species, with a few individuals each for the remaining species. Lake 2, on the other hand, has about equal numbers of each species. Which lake has higher species diversity?

A) Lake 1 B) Lake 2 C) They are equally diverse.

D) The number and relative abundance of species are not related to diversity.

Answer: B Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.6 Global LO: 2 18) What is one way in which the movement of energy and chemicals differ in an ecosystem?

A) Energy flow is unidirectional; chemical elements can be recycled.

B) Energy can enter but cannot leave an ecosystem; chemical elements can leave but cannot enter an ecosystem.

C) Energy flows from lower to higher trophic levels; chemicals cycle from higher to lower trophic levels.

D) Both energy and chemical elements always remain within a single ecosystem.

Answer: A Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8

5 .

19) Approximately what percentage of the visible light that reaches Earth's producers is converted to chemical energy?

A) 10% B) 0.1% C) 1% D) 0.01% Answer: C Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 Global LO: 4 20) Biomass is the total amount of ________ an ecosystem.

A) organic matter contained in the consumers of B) organic matter contained in the producers of C) chemical elements recycled by the detritivores of D) organic material in Answer: D Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 21) The rate at which an ecosystem's producers convert solar energy to chemical energy stored in biomass is called ________.

A) energy flow B) chemical cycle C) primary productivity D) trophic structure Answer: C Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 22) What is the range of actual efficiencies of energy transfer from one trophic level to the next?

A) 5-20% B) 20-30% C) 10-25% D) 90-100% Answer: A Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 Global LO: 4

6 .

23) The ecosystem that has low primary production but contributes a large proportion of Earth's total net primary production is ________.

A) tropical rain forest B) coral reef C) open ocean D) desert Answer: C Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 24) Why are most food chains limited to three to five trophic levels?

A) The higher the trophic level, the larger the organism; the larger the organism, the less likely it will be prey.

B) The nutritional quality of existing biomass decreases with increasing trophic level.

C) Most ecosystems have insufficient space to support the increased number of organisms that more trophic levels would require.

D) There is insufficient energy to support more trophic levels.

Answer: D Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.8 25) Besides the atmosphere, abiotic reservoirs of carbon dioxide include ________.

A) fossil fuels and dissolved carbon compounds in the oceans B) rocks and dissolved carbon compounds in the oceans C) fossil fuels, but not dissolved carbon compounds in the oceans or rocks D) rocks, but not fossil fuels or dissolved carbon compounds in the oceans Answer: A Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9 26) The atmosphere is approximately 80% ________ gas.

A) CO2 B) H2O C) NH3 D) N2 Answer: D Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9

7 .

27) Plants can most readily utilize the ________ form of nitrogen.

A) nitrous oxide B) N2 C) amino D) nitrate Answer: D Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9 28) The organisms that can convert atmospheric nitrogen gas to a form that can be utilized by plants are ________.

A) bacteria B) protists C) animals D) fungi Answer: A Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9 29) ________ convert nitrogen from nitrates to N2.

A) Nitrifying bacteria B) Nitrogen-fixing bacteria living in the soil C) Denitrifying bacteria D) Nitrogen-fixing bacteria living in the root nodules of legumes Answer: C Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9 30) The major abiotic reservoir for phosphorus is ________.

A) the oceans B) the atmosphere C) rock D) dead organic matter Answer: C Topic: 20.3 Ecosystem Ecology Skill: Remember/Understand Learning Outcome: 20.9

8 .

31) With regard to nutrient pollution in aquatic ecosystems, when is the worst time to apply fertilizer to your lawn?

A) when it is raining, or is about to rain B) when it is cold, or is about to get cold C) at the same time you apply pesticides D) at night Answer: A Topic: 20.3 Ecosystem Ecology Skill: Apply/Analyze Learning Outcome: 20.9 Global LO: 5 32) The primary goal of conservation biology is to ________.

A) catalog species B) maximize the land set aside for wildlife C) integrate human culture back into nature D) counter the loss of biodiversity Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.10 Global LO: 5 33) Modern conservation science increasingly aims at ________.

A) protecting federally listed endangered species B) countering pollution C) sustaining entire ecosystems D) maintaining genetic diversity within species Answer: C Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.10 Global LO: 5 34) Species found in only one place on Earth are called ________ species.

A) hot spot B) invasive C) keystone D) endemic Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.10

9 .

35) Small areas that have a large number of endangered and threatened species are referred to as ________.

A) biologically magnified B) endemic environments C) biodiverse environments D) biodiversity hot spots Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.10 Global LO: 5 36) A regional assemblage of interacting ecosystems is a ________.

A) community B) landscape C) movement corridor D) hot spot Answer: B Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.11 37) Landscape ecology ________.

A) is the application of ecological principles to the study of land-use patterns B) focuses primarily on how to restore human-altered ecological systems C) deals primarily with ecosystems in urban settings D) deals with the study of the ranges of different species Answer: A Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.11 Global LO: 5 38) A movement corridor ________.

A) is a path used by migratory animals when they move to their winter habitats B) is the path most commonly used by an animal within its home range C) connects otherwise isolated patches of quality habitat for a species D) is a natural component of the environment Answer: C Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.11

10 .

39) Movement corridors ________.

A) always created by humans B) found only along stream sides C) never harmful because they allow for dispersal D) both harmful and beneficial, depending on the organisms that are dispersed Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.11 40) Sustainable development ________.

A) will require making difficult decisions regarding the environment and lifestyle, but is not necessary for the survival of the human species nor will it require global, multinational cooperation B) is necessary for the survival of the human species, but will not require making difficult decisions regarding the environment and lifestyle nor global, multinational cooperation C) will require global, multinational cooperation, but not involve making difficult decisions regarding the environment and lifestyle, nor is it necessary for the survival of the human species D) will require making difficult decisions regarding the environment and lifestyle, is necessary for the survival of the human species, and will require global, multinational cooperation Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Remember/Understand Learning Outcome: 20.10 Global LO: 5 41) One problem with eradicating invasive species is that sometimes the disturbed area is unable to be colonized by native species. For example, in forests where the invasive plant garlic mustard has been removed, native plants and animals do not recolonize because they are extinct in that patch of forest. How should restoration ecologists increase species diversity and recover ecosystem function?

A) Introduce tertiary consumers.

B) Develop movement corridors for primary producers.

C) Develop movement corridors for species with similar niches.

D) Eliminate keystone species.

Answer: B Topic: 20.2 Community Ecology, 20.4 Conservation and Restoration Biology Skill: Evaluate/Create Learning Outcome: 20.3, 20.5, 20.6, 20.11 Global LO: 2, 5

11 .

42) What is the estimated annual value of ecosystem services?

A) $1 billion B) $30 trillion C) $30 billion D) $1 trillion Answer: B Topic: 20 Biology and Society Skill: Remember/Understand Learning Outcome: 20.1 Global LO: 5 43) Why is it important to reverse the decline of endangered species such as the Tasmanian devil?

A) They provide ecosystem services that benefit humans and the ecological community.

B) They may evolve to compete with humans for resources.

C) They do not have economic value, but do have cultural value.

Answer: A Topic: 20 Biology and Society Skill: Remember/Understand Learning Outcome: 20.1 Global LO: 5 44) Why does the invasive brown treesnake have a negative effect on the biodiversity of Guam?

A) It disrupts mutualistic interactions that are necessary for the reproduction of primary producers.

B) It eats poultry and causes frequent power outages by shorting out high-voltage wires.

C) It competes with native snakes for nesting sites and prey.

D) It is venomous and kills forest scientists who study Guam's biodiversity.

Answer: A Topic: 20 Evolution Connection Skill: Apply/Analyze Learning Outcome: 20.13 Global LO: 5

12 .

45) Species that require large areas to survive are disappearing as their habitat is destroyed.

Researchers have found that increased forest fragmentation is associated with a higher risk of Lyme disease, which is carried by white-footed mice and transmitted from mice to humans by black-legged ticks. The researchers hypothesized that communities with higher biodiversity contain hosts for the Lyme disease bacteria that do not spread the bacteria to humans. Propose an alternative hypothesis that uses energy flows in ecosystems to explain their findings.

A) Smaller forest fragments support fewer trophic levels, and thus are less likely to have predators like coyotes to reduce mouse population size.

B) A greater percentage of energy is lost during each transfer of energy in larger forest fragments than in smaller ones, and decreases the amount of food sources for mouse hosts.

C) Larger forest fragments have faster energy flow, which makes it more difficult for small organisms like bacteria to survive.

Answer: A Topic: 20 The Process of Science Skill: Evaluate/Create Learning Outcome: 20.12 Global LO: 2, 5 46) Why might one savanna ecosystem have 4 trophic levels, while a second one has 5?

A) The second ecosystem has less biomass of primary producers compared to the first.

B) The second ecosystem is a large savanna, while the first ecosystem is small.

C) The second ecosystem exhibits a greater loss of energy between trophic levels.

D) The second ecosystem has a higher rate of denitrification.

Answer: B Topic: 20.3 Ecosystem Ecology Skill: Apply/Analyze Learning Outcome: 20.8 Global LO: 2

13 .

20.2 Art Questions

1) Refer to the accompanying figure. Together, all of the living components of the coral reef represent a(n) ________.

A) population B) species C) community D) ecosystem Answer: C Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.3 2) In the ecosystem shown, a toxin that accumulates in body tissues would have the largest effect on ________.

A) corals that obtain their food from photosynthesizing dinoflagellates B) herbivorous shrimp C) fish that eat shrimp and other invertebrates D) The toxin would affect all of these equally.

Answer: C Topic: 20.2 Community Ecology Skill: Evaluate/Create Learning Outcome: 20.5 Global LO: 2, 4 14 .

3) The figure below shows the growth curves of two populations of Paramecium, P. aurelia and P. caudatum. From the data, we can conclude that ________.

A) the ecological niches of the two species are very different B) P. aurelia is a predator of P. caudatum C) P. aurelia and P. caudatum have a mutualistic relationship D) P. aurelia is the superior competitor in this habitat Answer: D Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.3 Global LO: 2, 3

15 .

4) If there were an additional trophic level in this figure that consisted of organisms that prey on snakes, about how much energy would be available to organisms at that trophic level?

A) 100 kcal B) 90% C) 1 kcal D) 10 kcal Answer: C Topic: 20.3 Ecosystem Ecology Skill: Apply/Analyze Learning Outcome: 20.8 Global LO: 2, 3, 4

16 .

5) Examine the figure. What is the interaction between Chthalamus and Balanus?

A) interspecific competition B) commensalism C) mutualism D) herbivory Answer: A Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.4 Global LO: 2, 3

17 .

6) Examine the figure. If both barnacle species (Chthalamus and Balanus) had identical niches, but Balanus is a superior competitor, how would the figure need to be changed? Assume the captions would be edited appropriately.

A) Chthalamus would not be present in in (a) and Balanus would be distributed to the high tide line.

B) Chthalamus would not be distributed below the low tide line in (b).

C) Balanus would be between the low and high tide lines, and Chthalamus below the low tide line in (a).

Answer: A Topic: 20.2 Community Ecology Skill: Evaluate/Create Learning Outcome: 20.4 Global LO: 2, 3

18 .

7) Examine the figure. Zooplankton feed on phytoplankton that are contaminated by PCBs in the water. Which comparison correctly describes the concentration of PCBs in different trophic levels?

A) Primary consumers have higher PCB concentration than secondary consumers.

B) Quaternary consumers have the highest PCB concentration.

C) Tertiary consumers have the highest PCB concentration.

D) Cod has a higher PCB concentration than the secondary consumers.

Answer: B Topic: 20 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.5 Global LO: 2, 3, 5 8) Examine the figure. Which statement correctly compares the biomass of different trophic levels to the concentrations of PCB contained in each level.

A) Only some of the biomass from one level moves to the consumer, whereas PCBs become more concentrated with each trophic transfer.

B) Higher trophic levels have more total biomass and higher concentrations of PCBs than lower trophic levels.

C) Biomass increases with each trophic transfer, while PCBs become less concentrated.

Answer: A Topic: 20 Community Ecology, 20 Ecosystem Ecology Skill: Evaluate/Create Learning Outcome: 20.5, 20.8 Global LO: 2, 3, 5, 7 19 .

9) The figure shows the results of an experiment where sea stars were removed from communities. What is the effect of sea stars on barnacle A? A) When sea stars are present, the relative abundance of barnacle A is lower compared to when sea stars are absent.

B) When sea stars are present, the relative abundance of barnacle A is higher compared to when sea stars are absent.

C) When sea stars are present, the species richness of barnacle A is lower compared to when sea stars are absent.

D) When sea stars are present, the species richness of barnacle A is higher compared to when sea stars are absent.

Answer: A Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.6 Global LO: 2, 3, 4 10) The figure shows the results of an experiment where sea stars were removed from communities. What is the sea star's role in the community?

A) The sea star is a keystone species, because its presence maintains diversity.

B) The sea star is an invasive species, because its absence reduces diversity.

C) The sea star competitively excludes other species from the community.

Answer: A Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.6 Global LO: 2, 3

20 .

This graph shows the results of a study on black-legged tick nymphs that are infected with the Lyme disease bacterium. The density of infected nymphs was calculated for forest fragments of different sizes (area in hectares). Answer the following questions using this graph.

11) Humans can be infected with the Lyme disease bacterium. According to the graph, a hiker has the highest risk of encountering an infected black-legged tick nymph in forests that are ________ in area.

A) 1 hectare B) 3 hectares C) 5 hectares D) 10 hectares Answer: A Topic: 20 The Process of Science Skill: Apply/Analyze Learning Outcome: 20.12 Global LO: 2, 3, 5 12) If a small forest fragment (less than 2.5 hectares in size) was found to have 0.01 infected nymph ticks per square meter, what characteristic would you expect this fragment to have?

A) a corridor to a larger forest fragment B) edges that are good habitat for tick hosts C) vegetation that required bioremediation D) endemic species that increase tick population size Answer: A Topic: 20 The Process of Science Skill: Evaluate/Create Learning Outcome: 20.12 Global LO: 2, 3

21 .

20.3 Scenario Questions Use the following information to answer the following questions.

Malaria is an infectious disease caused by a unicellular eukaryotic organism belonging to the genus Plasmodium. These eukaryotic organisms are transmitted from one person to another by the female Anopheles mosquito when it feeds on human blood. Within humans, the Plasmodium species destroy red blood cells and, without effective treatment, serious infections can lead to death. Currently, more than 400 million people are afflicted with malaria and between 1 and 3 million people die from it each year. Historically, a chemical compound called quinine has been used in developing effective drugs against malaria. In its natural environment, quinine is produced by certain trees native to South America. This chemical is synthesized in the outer layer of tree trunks and acts as an herbivore deterrent.

1) Based on the relationship between Plasmodium spp. and humans, Plasmodium would be considered ________.

A) parasites B) hosts C) producers D) carnivores Answer: A Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.4 Global LO: 2, 5 2) Humans, mosquitoes, and Plasmodium together would be considered a(n) ________.

A) population B) community C) ecosystem Answer: B Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.3 Global LO: 2, 5 3) Despite being used for many years, quinine-based drugs have not led to the eradication of malaria and currently there are parasites that are resistant to the compound. What process was likely important in the development of this resistance to quinine?

A) natural selection B) mutualism C) interspecific competition D) biological magnification Answer: A Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.4 22 .

Use the following information to answer the following questions.

In East Java, Indonesia, a mud volcano has been erupting since 2006. One controversial hypothesis is that the mud volcano in East Java is erupting because a gas mining company was drilling a deep hole nearby. When a mud volcano erupts, hot water deep below the earth's surface mixes with various minerals, and this mud spews out over the surface of the earth. The hot mud flow destroys organismal habitats, including the homes and livelihoods of people.

4) When the mud volcano stops erupting, the disturbed area will be colonized by a variety of species. This process of colonization is called ________.

A) biological magnification B) species diversity C) ecological succession D) disturbance Answer: C Topic: 20.2 Community Ecology Skill: Apply/Analyze Learning Outcome: 20.7 Global LO: 2 5) When the mud volcano stops erupting, colonization of the disturbed area would be ________.

A) primary succession if there is no biomass inside the area B) primary succession if primary production relies on plants that survived the disturbance C) secondary succession if there are no biotic components of the carbon cycle D) secondary succession if there is no organic matter in the area Answer: A Topic: 20.2 Community Ecology, 20.3 Ecosystem Ecology Skill: Evaluate/Create Learning Outcome: 20.7, 20.9 Global LO: 2

23 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 21 Unifying Concepts of Animal Structure and Function 21.1 Multiple Choice Questions 1) In a person suffering from heat stroke, body temperature disrupts the ________.

A) organization of tissues into organs B) processes of the liver C) control center of the brain D) cells of the digestive tract Answer: C Topic: Biology and Society: An Avoidable Tragedy, 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.1, 21.7 Global LO: 5 2) In animals, individual cells are grouped into ________.

A) organs B) tissues C) organisms D) organ systems Answer: B Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.3 3) A physiologist is a biologist who studies the ________.

A) structure of living things B) structure of body parts C) evolution of animals D) function of body parts Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.2 4) Bone is a type of ________.

A) connective tissue B) epithelial tissue C) extracellular matrix D) adipose tissue Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4

1 .

5) A main function of most types of epithelial tissue is ________.

A) sensation B) support C) covering surfaces D) absorption Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 6) Connective tissue is different from the other major tissue types in that ________.

A) it is made up of cells B) its cells are sparsely scattered through an extracellular matrix C) its cells line organs and cover the surface of the body D) it is found only in humans Answer: B Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 7) Which type of tissue stores fat in the body?

A) cartilage B) bone C) adipose tissue D) fibrous connective tissue Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 8) What kind of connective tissue has a matrix that is strong and flexible?

A) bone B) adipose tissue C) loose connective tissue D) cartilage Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4

2 .

9) Which type of connective tissue is the most common in the typical human body?

A) fibrous connective tissue B) adipose tissue C) loose connective tissue D) bone Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 10) Which is the most abundant kind of tissue in the bodies of vertebrates?

A) connective B) epithelial C) blood D) muscle Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 11) A typical skeletal muscle ________.

A) is found in the walls of organs such as the digestive tract B) has fibers that do not have a striped appearance under the microscope C) can be enlarged by exercise D) is only found in heart tissue Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 12) Skeletal muscle is different from both smooth and cardiac muscle because skeletal muscles ________.

A) are made of cells called "fibers" B) cannot be contracted voluntarily C) can be contracted voluntarily D) cells have nuclei Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4

3 .

13) Involuntary muscle includes ________.

A) skeletal muscle only B) smooth muscle only C) smooth muscle and cardiac muscle D) smooth muscle, cardiac muscle, and some skeletal muscle Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 14) Which type of tissue forms an electrical communication system within the body?

A) nervous B) blood C) connective D) muscle Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 15) The basic unit of nervous tissue is the ________.

A) dendrite B) axon C) neuron D) brain Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.4 16) Which statement about organs is correct?

A) An organ represents a lower level of structure than the tissues composing it.

B) An organ consists of only one kind of tissue.

C) An organ performs functions that none of its components can carry out alone.

D) An organ consists of many cells, all of the same type.

Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.3

4 .

17) The fact that every organism continuously exchanges chemicals and energy with its surroundings indicates that organisms ________.

A) are open systems B) are closed systems C) have tightly controlled thermoregulation D) osmoregulate Answer: A Topic: 21.2 Exchanges with the External Environment Skill: Remember/Understand Learning Outcome: 21.5 18) Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides.

If this animal practices homeostasis with respect to the salt concentration of its body fluids, its salt concentration will show ________.

A) no fluctuations B) slight, continuous fluctuations C) a more concentrated state than the surrounding water at all times D) a more diluted state than the surrounding water at all times Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.6, 21.8 19) Homeostasis is ________.

A) the maintenance of an unchanging internal state B) a pathological condition C) the maintenance of a relatively stable internal environment D) the way the internal environment influences the external environment Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.6 20) The vertebrate kidney helps to keep the acidity of the body fluids constant by varying the amount of hydrogen ions (H+) it secretes into the urine. This aspect of kidney function, like other mechanisms of homeostasis, is most likely controlled by ________.

A) a negative feedback mechanism B) nerve impulses from the brain C) a hormone produced in the brain D) a hormone produced in the kidney itself Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.6 Global LO: 2

5 .

21) For most people, blood sugar levels rise to over 7 mmol/L after ingesting a meal. What is most likely responsible for the return of blood sugar levels to 5 mmol/L? A) the use of the sugar as an energy source by your cells B) a homeostatic mechanism based on negative feedback C) type 2 diabetes D) a homeostatic mechanism based on positive feedback Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.6 22) Most homeostatic mechanisms depend on ________.

A) positive and negative feedback B) negative feedback C) predictable environmental conditions D) predictable internal conditions Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.6 23) Which animal is an ectotherm?

A) human B) parrot (bird) C) spiny lobster D) field mouse Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.7 24) Which animal generates (produces) body heat to warm itself?

A) a beetle that absorbs solar radiation B) a moth that shivers its wings before flight C) a lizard that lies on a warm rock D) a turtle that moves to a warm, shallow part of a pond Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.7 Global LO: 2

6 .

25) When body temperature is too low, what occurs?

A) Blood vessels in the skin constrict.

B) Muscles relax.

C) Sweat glands are activated.

D) Blood vessels at the body surface dilate and fill with blood.

Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.7 26) A physiological response that takes place in many animals when they get too hot is ________.

A) slowing of the heart rate B) constriction of blood vessels in the skin C) contraction of muscles D) increased blood flow to the skin Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.7 27) Which statement applies to freshwater fish?

A) They lose water by osmosis.

B) The concentration of solutes in their internal fluids is lower than in the surrounding water.

C) They pump out ions via the gills.

D) They produce dilute urine.

Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.8 Global LO: 2 28) Humans urinate, defecate, and breathe. Which process is accompanied by water loss?

A) only urination B) only defecation C) only breathing D) all three are accompanied by water loss Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8

7 .

29) The urinary system is responsible for the elimination of urea, the reabsorption of valuable solutes, and reabsorbing water. Which of those processes occur in the kidney?

A) elimination of urea B) reabsorption of valuable solutes C) reabsorbing water D) all three processes occur in the kidney Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8 30) Reabsorption is the movement of substances from the ________ to the ________.

A) blood; nephron B) filtrate; blood C) kidney; urinary bladder D) blood; filtrate Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8 31) Secretion is the movement of substances from the ________ to the ________.

A) nephron; blood B) filtrate; blood C) kidney; urinary bladder D) blood; filtrate Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8 32) Excretion is the movement of substances from the ________ to the ________.

A) filtrate; blood B) kidney; urinary bladder C) blood; filtrate D) kidneys; outside Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8

8 .

33) Which process describes the forcing of water and other small molecules from the blood into a kidney tubule?

A) absorption B) filtration C) secretion D) excretion Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8 34) A diuretic is a substance that ________.

A) promotes sweating B) regulates the contraction of cardiac muscle C) inhibits dehydration D) promotes urinary water loss Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Remember/Understand Learning Outcome: 21.8 35) In humans, goosebumps are a vestige of a mammalian adaptation related to ________.

A) thermoregulation B) water conservation C) osmoregulation D) positive feedback Answer: A Topic: 21.3 Regulating the Internal Environment, Evolution Connection: Adaptations for Thermoregulation Skill: Remember/Understand Learning Outcome: 21.10 36) Oxytocin controls the involuntary contractions of the uterus. The uterus is composed of ________.

A) nervous tissue B) skeletal muscle C) smooth muscle D) epithelium Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Apply/Analyze Learning Outcome: 21.4 Global LO: 2

9 .

37) During heat stroke, what mechanism is being disrupted?

A) negative feedback control of body temperature B) increased dilation of vessels as air temperature increases C) immune system response to invading microbes D) muscle contractions to generate body heat Answer: A Topic: Biology and Society: An Avoidable Tragedy Skill: Apply/Analyze Learning Outcome: 21.1, 21.6, 21.7 Global LO: 2, 5 38) In a multicellular organism, cellular exchange with the environment can only occur if ________.

A) cells have access to a suitable watery environment B) the body is a closed system C) homeostasis requires energy expenditure D) temperatures are variable Answer: A Topic: 21.2 Exchanges with the External Environment Skill: Remember/Understand Learning Outcome: 21.5 39) Heat exchange with the environment will be most efficient in a structure that has large ________.

A) surface area B) volume C) number of cells D) cell size Answer: A Topic: 21.2 Exchanges with the External Environment, 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.5, 21.7 Global LO: 2 40) Why does measuring oxygen consumption estimate how a Burmese python generates body heat?

A) Oxygen is consumed during cellular respiration, which generates heat.

B) Oxygen is produced during cellular respiration, which generates heat.

C) Oxygen is consumed during cellular respiration, which absorbs heat.

D) Oxygen is produced during cellular respiration, which absorbs heat.

Answer: A Topic: The Process of Science: How Does a Python Warm Her Eggs Skill: Remember/Understand Learning Outcome: 21.9

10 .

41) What hypothesis was Hutchison et al. testing by examining the relationship between muscle contractions and oxygen consumption in Burmese pythons?

A) Burmese pythons contract muscles to warm eggs during incubation.

B) More muscle contractions occur when the temperature is cooler.

C) The Burmese python is native to southeastern Asia.

D) Oxygen consumption generates heat through cellular respiration.

Answer: A Topic: The Process of Science: How Does a Python Warm Her Eggs Skill: Apply/Analyze Learning Outcome: 21.9 Global LO: 1, 2 42) What is true of a water molecule that is excreted by the urinary system?

A) It is filtered and becomes part of the filtrate.

B) It is filtered then reabsorbed.

C) It is filtered then secreted.

D) It is filtered, secreted, then reabsorbed.

Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.8 Global LO: 2

11 .

21.2 Art Questions 1) One function of this organ system is ________.

A) thermoregulation B) excretion C) exchange of gases between the blood and air D) transport of substances throughout the body Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Remember/Understand Learning Outcome: 21.3 Global LO: 2

12 .

2) One function of this organ system is ________.

A) excretion of urea B) production of gametes C) protection of the body D) thermoregulation Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Apply/Analyze Learning Outcome: 21.3 Global LO: 3

13 .

3) The figure below shows that ________.

A) homeostatic mechanisms allow cats to sense their external environments B) homeostatic mechanisms allow cats to use their internal conditions to affect their external environments C) cats experience no variations in their internal conditions D) homeostatic mechanisms allow cats to maintain relatively constant internal conditions even when the external environment changes Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.6 Global LO: 3

14 .

4) Examine the figure above that shows negative feedback in a thermostat. If the room becomes too warm, the next thing that will occur is ________.

A) heating stops B) the set point decreases C) the room cools D) the heater is turned off Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.6 Global LO: 2, 3 5) Compare how temperature is regulated in a room with a thermostat with how thermoregulation works in the human body. What is most analogous to "Heating starts" (that is, heat is produced) for the human body?

A) Blood vessels constrict near the surface.

B) The person puts on more clothes.

C) Metabolic rate increases.

D) Sweat is produced.

Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Evaluate/Create Learning Outcome: 21.7 Global LO: 2, 3 15 .

6) How did the solutes of urine, shown in this schematic, become part of urine?

A) filtration and secretion B) reabsorption C) excretion D) osmosis Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.8 Global LO: 2, 3 7) How will the composition of urine, as shown in this diagram, change when ADH is released by the pituitary gland?

A) The total percentage of solutes will be greater than 6%.

B) The total percentage of solutes will be less than 6%.

C) The percentage of water will be greater than 94%.

D) The percentage of water will stay the same while total percentage of solutes will increase.

Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Evaluate/Create Learning Outcome: 21.8 Global LO: 2, 3, 4

16 .

8) The graph shown is from a female Burmese python who is incubating her eggs in a chamber with variable temperatures. Interpret the graph.

A) The Burmese python consumes less oxygen at warmer temperatures than at cooler temperatures.

B) The Burmese python consumes more oxygen at warmer temperatures than at cooler temperatures.

C) The Burmese python contracts muscles more frequently at warmer temperatures.

D) The Burmese python contracts muscles less frequently at cooler temperatures.

Answer: A Topic: The Process of Science: How Does a Python Warm Her Eggs Skill: Apply/Analyze Learning Outcome: 21.9 Global LO: 2, 3

17 .

21.3 Scenario Questions Use the following information to answer the following questions.

The dune-burrowing spider Seothyra species lives in the Namib Desert on the southwestern coast of Africa. These spiders build silk-lined burrows with a sticky silk mat at the entrance to trap insect prey. While foraging during the day, the spider remains concealed in its burrow and shielded from direct sunlight when prey are not present. When insect prey become entangled in the sticky silk mat, the spider will run out of its burrow and capture the prey insects.

During the day, environmental temperatures vary from 17 to 73°C (63-164°F). If a spider is forced to remain outside of its burrow, it shows signs of thermal stress at 49°C. When spiders are unrestrained, they spend more time waiting inside their burrows to keep their internal temperatures below 49°C, even when surface temperatures are above 65°C. In addition, spiders respond more quickly to prey stimuli during the hottest times of the day and capture prey in significantly less time when surface temperatures are above 49°C. The captured arthropods (prey) tend to succumb more quickly to hot surface temperatures; they are more lethargic and struggle less when captured at the high temperature ranges.

1) Based on the information in the paragraphs, spiders are ________.

A) ectotherms B) endotherms C) sometimes ectotherms and sometimes endotherms D) neither ectotherms nor endotherms Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.7 Global LO: 2 2) When foraging spiders are too hot, they retreat into their burrows. What type of feedback system does this indicate?

A) hormonal feedback B) positive feedback C) negative feedback D) positive and negative feedback Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.7 Global LO: 2

18 .

3) When spiders show signs of thermal stress, this is an indication that they are unable to ________.

A) move B) function C) osmoregulate D) thermoregulate Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.7 Global LO: 2 Use the following information to answer the following questions To study the effect of ambient (environmental) temperature on the metabolic rate of animals, a scientist takes a small animal and puts it in a sealed chamber with oxygen. The scientist measures the amount of oxygen used by the animal at different temperatures, as oxygen is consumed during the process of cellular respiration. The temperatures selected are those that the animal normally encounters in nature. The data from this experiment are in the table below.

Day 1 2 3 4 5 6 7 8

Temperature (°C) 10 15 20 25 30 35 40 45

Oxygen consumption (mL O2/(min × g0.75)) 43 30 22 16 16 16 25 32

4) The animal studied by the scientist is most likely to be ________.

A) an ectotherm B) an endotherm C) a saltwater fish D) a freshwater fish Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Evaluate/Create Learning Outcome: 21.7 Global LO: 2, 3, 4, 7

19 .

5) To communicate the results of the experiment best, how should the scientist graph the data?

A) Use a bar graph with oxygen consumption on the x-axis and temperature on the y-axis.

B) Use a line graph with day on the x-axis and temperature on the y-axis.

C) Use a line graph with temperature on the x-axis and oxygen consumption on the y-axis.

D) Use a bar graph with temperature on the x-axis and oxygen consumption on the y-axis.

Answer: C Topic: 21.3 Regulating the Internal Environment, The Process of Science: How Does a Python Warm Her Eggs Skill: Evaluate/Create Learning Outcome: 21.7, 21.9 Global LO: 2, 3, 4, 7 6) At high temperatures this animal loses water rapidly. To prevent dehydration, this animal's nephrons should ________.

A) increase reabsorption B) decrease reabsorption C) increase secretion D) decrease secretion Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Apply/Analyze Learning Outcome: 21.8 Global LO: 2 7) The scientist studies a second animal whose oxygen consumption rises as temperature increases. The second animal is most likely to be ________.

A) an ectotherm B) an endotherm C) one that cannot osmoregulate D) one that primarily uses metabolism to regulate temperature Answer: A Topic: 21.3 Regulating the Internal Environment, The Process of Science: How Does a Python Warm Her Eggs Skill: Evaluate/Create Learning Outcome: 21.7, 21.9 Global LO: 2, 3, 4, 7

20 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 22 Nutrition and Digestion 22.1 Multiple Choice Questions 1) Spiders are ________.

A) herbivores B) filter feeders C) carnivores D) omnivores Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.2 2) Digestion is ________.

A) the absorption of nutrients B) the breakdown of food into small nutrient molecules that the body can absorb C) eating Answer: B Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.3 3) What is the order of the four stages of food processing?

A) ingestion, absorption, elimination, digestion B) ingestion, elimination, digestion, absorption C) ingestion, digestion, absorption, elimination D) digestion, absorption, ingestion, elimination Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.3 4) Which process is an example of mechanical digestion?

A) the breakdown of proteins into amino acids B) peristalsis C) the digestion of fats by lipases D) chewing Answer: D Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.3

1 .

5) The digestive compartment of a cnidarian (such as a jellyfish) has ________ opening(s).

A) one B) two C) three D) four Answer: A Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.4 6) A digestive tube is best defined as ________.

A) the compartment in which an animal digests its food B) a tube-shaped digestive compartment with either one or two openings C) a tube-shaped digestive compartment that has two openings and through which food moves in one direction D) a digestive compartment that conducts both chemical and mechanical digestion Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Remember/Understand Learning Outcome: 22.4 7) The main function of salivary amylase is to ________.

A) moisten food B) break down proteins C) absorb nutrients D) break down starch Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 8) The normal flow of contents in the human alimentary canal is ________.

A) pharynx, oral cavity, esophagus, stomach, large intestine B) oral cavity, pharynx, esophagus, stomach, small intestine, large intestine C) esophagus, pharynx, stomach, large intestine, small intestine D) oral cavity, esophagus, stomach, large intestine, small intestine Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5

2 .

9) Digestion begins in the ________.

A) oral cavity B) esophagus C) pharynx D) stomach Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 10) The tongue has all of these functions EXCEPT ________.

A) taste food B) shape food into a ball C) secrete saliva D) push food into the pharynx Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 11) Muscular contraction moves food through the alimentary canal by a process called ________.

A) propulsion B) active transport C) peristalsis D) swallowing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 12) What is the epiglottis?

A) a muscle that moves the esophagus into line with the pharynx during swallowing B) a muscle that sends food into the esophagus during swallowing C) a flap that flips down to cover the entry to the trachea during swallowing D) a muscular sphincter that closes off the entry to the trachea during swallowing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5

3 .

13) Both the esophagus and trachea open to the ________.

A) pharynx B) posterior oral cavity C) posterior nasal cavity D) larynx Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 14) A food ball moves through the esophagus by ________.

A) peristalsis B) gastric juice C) ingestion D) absorption Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 15) The stomach's gastric juice consists of ________.

A) digestive enzymes only B) hydrochloric acid only C) digestive enzymes and hydrochloric acid only D) mucus, digestive enzymes, and hydrochloric acid Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 16) When contracted, ________ prevents movement of chyme from the stomach to the small intestine.

A) peristalsis B) pharynx C) the epiglottis D) a sphincter Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5

4 .

17) What is the usual cause of heartburn?

A) backflow of chyme from the stomach into the esophagus B) retention of food at the bottom of the esophagus by a sphincter that is reluctant to open C) irritation of the lower esophagus by substances in spicy food D) compression of the lower esophagus by an overfilled stomach Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 Global LO: 5 18) Which mechanism helps prevent gastric juice from digesting the stomach lining?

A) mucus coating the inside surface of the stomach B) contractions of the stomach constantly moving chyme into the small intestine C) the continuous secretion of gastric juice D) the inactivation of pepsin by hydrochloric acid Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 19) The stomach mixes food with the secretions of the stomach wall to form ________.

A) gastric juice B) a food ball C) chyme D) acid gastrin Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 20) When the wall of the stomach fails to protect itself from erosion by gastric juice, the result is ________.

A) heartburn B) obesity C) gastroesophageal reflux disease (GERD) D) a gastric ulcer Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5

5 .

21) How does the activity of Helicobacter pylori lead to gastric ulcers in humans?

A) It neutralizes the acids of the stomach.

B) It causes the production of excess acid in the stomach.

C) It damages the stomach's mucus coat.

D) It causes the stomach to produce stronger acids.

Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5 22) Most nutrient absorption occurs in the ________.

A) stomach B) duodenum C) several meters of the small intestine that come after the duodenum D) large intestine Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 23) Bile from the liver is stored in the ________ before entering the intestine.

A) pancreas B) gallbladder C) large intestine D) bile duct Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 24) What is(are) the main digestive function(s) of the pancreas?

A) It produces digestive enzymes and bile.

B) It produces pepsin.

C) It produces digestive enzymes and neutralizes stomach acids.

D) It secretes mucus into the small intestine.

Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5

6 .

25) Someone with liver failure will, in particular, have problems with the digestion and absorption of ________.

A) minerals B) fats C) carbohydrates D) proteins Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.5, 22.6 Global LO: 2, 5 26) Which nutrient begins undergoing chemical digestion in the mouth?

A) amino acids B) protein C) starch D) glucose Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 27) The epithelial cells lining the intestine have surface projections that increase the area for absorption. These projections are called ________.

A) villi B) mucus C) microvilli D) bile Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 28) Together with the small intestine, the ________ absorbs water.

A) stomach B) colon C) rectum D) appendix Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5

7 .

29) Altogether, the body secretes about 7 liters of water into the alimentary canal each day.

About what percentage of this water gets reabsorbed?

A) 30% B) 50% C) 60% D) 90% Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 30) Which structure stores feces until they can be eliminated?

A) rectum B) appendix C) anus D) colon Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 31) Which molecules are the direct source of energy for cells?

A) fats are B) glucose is C) ATP is D) amino acids are Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.7 Global LO: 5, 7 32) Most humans need about ________ kcal per day.

A) 500-700 B) 1,300-1,800 C) 2,500-3,000 D) 20,000-30,000 Answer: B Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.7 Global LO: 5

8 .

33) What does your metabolic rate depend on?

A) only your age B) your age and your activity levels, but not your genes C) only your activity levels D) your age, activity levels, and genes Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.7 Global LO: 5 34) To be considered food, a substance must ________.

A) supplement the essential nutrients that the body makes B) provide oxygen for cellular respiration C) provide ATP from the mitochondria in food D) fuel the body's activities and provide raw materials to make other molecules Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.8 Global LO: 5 35) Vitamins are ________.

A) organic molecules that are required in the diet in very small amounts B) carbohydrates that we can synthesize from simpler molecules C) important supplements for children, but not adults Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.8 Global LO: 5 36) Certain amino acids are called essential because they ________.

A) are required for making protein B) cannot be made by the body from other compounds C) store energy D) are required for making nucleic acids Answer: B Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.8 Global LO: 5

9 .

37) Which mineral is needed for the proper functioning of nerves, muscles, and bones?

A) calcium B) linoleic acid C) sodium Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.8 Global LO: 5 38) Both vitamins biotin and Vitamin K are ________.

A) water-soluble vitamins B) made in human skin in the presence of sunlight C) produced by intestinal bacteria D) common deficiencies in the human diet Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Evaluate/Create Learning Outcome: 22.8 Global LO: 2 39) On a global scale, the most significant type of malnutrition is ________.

A) vitamin A deficiency B) calcium deficiency C) iron deficiency D) protein deficiency Answer: D Topic: 22.4 Nutritional Disorders Skill: Remember/Understand Learning Outcome: 22.10 Global LO: 5 40) Anorexia and bulimia occur ________.

A) when the body does not receive enough vitamin C B) when there is a protein-deficient diet C) mainly in affluent countries where thinness is idealized D) when a person does not obtain all the essential amino acids Answer: C Topic: 22.4 Nutritional Disorders Skill: Remember/Understand Learning Outcome: 22.10 Global LO: 5

10 .

41) Modern humans possess the same craving for ________ and ________ as our ancestors, despite the obesity these cravings can cause today.

A) fat; sugar B) sugar; salt C) protein; vitamin C D) iron; iodine Answer: A Topic: Evolution Connection: Controlling Your Weight Skill: Remember/Understand Learning Outcome: 22.12 Global LO: 5 42) GERD can be treated with lifestyle changes such as ________.

A) losing weight B) eating larger meals C) lying down soon after eating D) gastric bypass surgery Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5 43) What disorder of the human digestive system can be treated with antibiotics?

A) gastric ulcers B) GERD C) anorexia D) bulimia Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5 44) What is the microbiome?

A) the bacterial community that lives in the human digestive system B) microscopic projections on cells of the small intestine C) viral infections that cause diarrhea D) the nutrients that are absorbed into the bloodstream after digestion Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5

11 .

45) What accessory organ of the digestive system converts alcohol into inactive substances that are secreted in the urine?

A) liver B) pancreas C) gallbladder D) salivary glands Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.6 Global LO: 5 46) How does a plate of red beans and rice compare to a steak, nutritionally?

A) The same essential amino acids are provided in both.

B) For both, chemical digestion of the nutrients begins in the oral cavity.

C) Only red beans and rice contain niacin.

D) The steak contains a complete protein but the red beans and rice do not.

Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Remember/Understand Learning Outcome: 22.8 Global LO: 5 47) Why do modern humans crave food that is high in fat and sugar?

A) These preferences may have been advantageous in our evolutionary history, when food was less reliably available.

B) Fat and sugar are the only essential nutrients needed by humans.

C) A calorie-rich diet, when accompanied by low caloric expenditure, prevents 15 kinds of cancer.

D) Craving fat and sugar ensures that genes for obesity passes on to future generations.

Answer: A Topic: 22 Evolution Connection: Controlling Your Weight Skill: Remember/Understand Learning Outcome: 22.12

12 .

22.2 Art Questions 1) The figure below shows ________.

A) the chemical digestion of a protein B) the building of a protein by the enzyme pepsin C) the mechanical digestion of a protein D) the addition of a water molecule to add an amino acid to a protein Answer: A Topic: 22.1 An Overview of Animal Nutrition Skill: Apply/Analyze Learning Outcome: 22.3 Global LO: 2, 3 2) The figure below shows that ________.

A) peristalsis moves food down the esophagus B) air cannot get into the trachea when the epiglottis closes the trachea C) the trachea is open when you are not swallowing D) the esophagus is open when you are breathing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 Global LO: 3 13 .

3) The function of the structure shown below is ________.

A) to digest proteins B) to absorb nutrients into the body C) to aid in mechanical digestion of food D) to break fats into smaller droplets Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Remember/Understand Learning Outcome: 22.5 Global LO: 3

14 .

Please refer to the following art to answer the following questions.

4) A person with a BMI of 27 would be described as ________.

A) overweight B) normal weight C) underweight D) It depends on the person's height.

Answer: A Topic: 22.4 Nutritional Disorders Skill: Apply/Analyze Learning Outcome: 22.10 Global LO: 2, 3, 5 5) Which person is shifting from an unhealthy category to a healthy category?

A) A 120 lb, 5'5" male loses 15 lbs.

B) A 160 lb, 5'10" female loses 5 lbs.

C) A 180 lb, 5'10" male loses 20 lbs.

D) A 130 lb, 5'0" female gains 10 lbs.

Answer: C Topic: 22.4 Nutritional Disorders Skill: Apply/Analyze Learning Outcome: 22.7, 22.10 Global LO: 2, 3, 5

15 .

6) Regarding the amount of energy consumed versus used, what would you recommend to a person who has a BMI of 27 to change to a normal BMI? A) Take in more calories by eating than are burned by physical activity.

B) Burn more calories by physical activity than are taken in by eating.

C) Take in the same amount of calories by eating compared to that which is burned by physical activity.

D) Weight gain is not related to the amount of calories taken in compared to that burned by physical activity.

Answer: B Topic: Biology and Society: The "Secret" to Shedding Pounds, 22.4 Nutritional Disorders Skill: Apply/Analyze Learning Outcome: 22.1, 22.7, 22.10 Global LO: 2, 3, 4, 5

16 .

Examine the FDA label for the loaf of Baker Organic Bread and answer the following questions.

7) A person who is trying to lose weight eats four servings of bread. Which activity would burn more total Calories than is consumed in those four servings?

A) an hour of leisurely biking (<10 mph), 292 Calories B) an hour of canoeing, 256 Calories C) an hour of resistance (weight) training, 365 Calories D) an hour of hiking, 438 Calories Answer: D Topic: Biology and Society: The "Secret" to Shedding Pounds, 22.3 Human Nutritional Requirements Skill: Apply/Analyze Learning Outcome: 22.1, 22.7, 22.9 Global LO: 2, 3, 4, 5 8) How many servings of bread would an average person have to eat in order to get the FDA Daily Value of the water-soluble vitamin needed for reducing the risk of birth defects?

A) 50 B) 25 C) 17 D) Bread does not contain this vitamin.

Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Evaluate/Create Learning Outcome: 22.8, 22.9 Global LO: 2, 3, 4, 5 17 .

9) How many loaves of bread would an average person need to eat in order to get the FDA Daily Value of the vitamin needed to prevent photophobia?

A) 0.9 B) 1.4 C) 2.8 D) Bread does not contain this vitamin Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Evaluate/Create Learning Outcome: 22.8, 22.9 Global LO: 2, 3, 4, 5 10) Which ingredient of the bread pictured would prevent beriberi?

A) ascorbic acid B) sea salt C) sunflower oil D) whole wheat (whole grain) flour Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Evaluate/Create Learning Outcome: 22.9, 22.10 Global LO: 2, 3, 5

18 .

The data below are from an experiment that tested the effect of leptin on mice with a normal obese gene and mice with a defective obese gene. Assume that the experiment began with a group of mutant mice that were all the same mass, and a group of normal mice of the same mass.

11) What role does the saline injection have in this experiment?

A) It is the control treatment.

B) It is the experimental treatment.

C) It is the independent variable.

D) It is the dependent variable.

Answer: A Topic: The Process of Science: Controlling Your Weight Skill: Apply/Analyze Learning Outcome: 22.11 Global LO: 1, 2, 3 12) What conclusion is supported by the data?

A) Obesity can be caused by a defective obese gene.

B) Saline causes mice to lose weight.

C) A normal obese gene does not produce leptin.

D) Leptin does not affect a mouse's weight.

Answer: A Topic: Process of Science: Controlling Your Weight Skill: Apply/Analyze Learning Outcome: 22.11 Global LO: 1, 2, 3

19 .

13) A mouse escapes its cage, and researchers cannot tell if it is a mutant mouse or a normal mouse. What procedure and result would confirm that this mouse is a mutant mouse?

A) The mouse is fed a high calorie diet. The mouse does not produce leptin and is overweight.

B) The mouse is fed a high calorie diet. The mouse can produce leptin and is a healthy weight.

C) The mouse is fed a low calorie diet. The mouse does not produce leptin and is overweight.

D) The mouse is fed a low calorie diet. The mouse can produce leptin and it is a healthy weight.

Answer: A Topic: The Process of Science: Controlling Your Weight Skill: Evaluate/Create Learning Outcome: 22.1 Global LO: 1, 2, 3 The figure below shows the energy (kcal) burned per hour by a 150-pound person performing various activities. Use this figure to answer these questions.

14) A fellow student comments on some recent weight gain, and attributes this weight gain to a daily habit of a slice of pizza for a midnight snack. Given that there are 280 kcal in a slice of thick crust pepperoni pizza, make a recommendation for an additional activity that would result in the MOST weight loss.

A) 5 hours of biking a week B) 2 hours of dancing fast every Saturday night C) 1 hour of running every Sunday, plus 1 hour of walking every Monday and Thursday.

D) 1 hour of swimming, three times a week Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Apply/Analyze Learning Outcome: 22.7 Global LO: 3, 4, 5

20 .

15) Four students start to meet up every night to eat a slice of thick crust pepperoni pizza for a study break at 1 A.M. These students have very similar class schedules and sleeping habits, but differ in exercise habits. Which student will gain the LEAST weight from this pizza study break?

A) The student who swims for one hour, every other day.

B) The student who walks a dog for 30 minutes every day.

C) The student who dances fast for two hours every Friday night.

D) The student who commutes by bike, 15 minutes per weekday.

Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Apply/Analyze Learning Outcome: 22.7 Global LO: 3, 4, 5

21 .

22.3 Scenario Questions Use the following information to answer the following questions.

Several years ago, scientists discovered a mutation in zebrafish larvae that prevented the absorption of lipids from dietary fat. Larvae carrying this mutation died shortly after they hatched because all cells need fat to carry out their normal functions. More recent studies have determined that the mutation leading to this disorder occurs in a single gene on chromosome 10.

When a normal gene is inserted into embryos carrying the mutation, these fish are able to process fats normally when they hatch. To discover more about the gene's function, researchers examined and compared cells from normal and mutant fish larvae under a microscope. A major difference was noticed in the intestinal cells. The Golgi apparatus in the intestinal cells of mutant larvae is much larger than those of normal larvae. As the Golgi apparatus processes fats and proteins, the lipids become trapped, resulting in the abnormally large size of the organelle.

1) Assuming that the digestive system of zebrafish works like that of a human, what substance do zebrafish need to make fats more easily digested by enzymes?

A) chyme B) bile C) lipase D) pepsin Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.5 Global LO: 2 2) Assuming that the digestive system of zebrafish works like that of a human, which portion of the digestive tract is specialized for absorption of the nutrients?

A) stomach B) small intestine C) large intestine D) pharynx Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.5 Global LO: 2

22 .

Use the following information to answer the following questions.

There are many diseases of the digestive system. Sjögren's syndrome is an autoimmune disease that destroys tear ducts and salivary glands. In megaesophagus, peristalsis fails to occur properly and the esophagus is enlarged. In achlorhydria (also called "hypochlorhydria") production of gastric acid is absent or low. When a person has diverticulitis, feces are trapped in small pouches of the large intestine, and cause infection. Infected portions of the large intestine can swell and block the large intestine. In exocrine pancreatic insufficiency, there is a progressive loss of pancreatic cells that make digestive enzymes. In gallstone cholestasis, bile cannot flow from the liver to the duodenum.

3) Difficulty swallowing could indicate ________.

A) Sjögren's syndrome B) megaesophagus C) diverticulitis D) gallstone cholestasis Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.6 Global LO: 2, 5 4) A protein deficiency in the blood could indicate ________.

A) megaesophagus B) achlorhydria C) Sjögren's syndrome D) diverticulitis Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.6 Global LO: 2, 5 5) Regurgitation of food could indicate ________.

A) Sjögren's syndrome B) achlorhydria C) megaesophagus D) celiac disease Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.6 Global LO: 2, 5

23 .

6) Exocrine pancreatic insufficiency would show symptoms most similar to ________.

A) Sjögren's syndrome B) megaesophagus C) diverticulitis D) celiac disease Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Apply/Analyze Learning Outcome: 22.6 Global LO: 2, 5

24 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 23 Circulation and Respiration 23.1 Multiple Choice Questions 1) Animals such as hydras and jellies can exchange gases directly with the environment by ________.

A) diffusion B) active transport C) osmosis D) bulk transport Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 2) In humans, oxygen is delivered from the environment to the cells of the body by ________.

A) a closed circulatory system B) an open circulatory system C) diffusion D) diffusion and facilitated diffusion Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 3) Which is a characteristic of open circulatory systems but NOT closed circulatory systems?

A) a heart B) a vascular system C) blood D) open-ended vessels Answer: D Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 4) In animals with a closed circulatory system, gas exchange occurs across the thin walls of ________.

A) arteries B) arterioles C) capillaries D) venules Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 1 .

5) Veins carry ________.

A) blood away from the heart B) oxygen-rich blood C) oxygen-poor blood D) blood toward the heart Answer: D Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 6) How does a shark's cardiovascular system differ from that of a mammal?

A) The shark's heart does not directly pump oxygenated blood to the systemic tissues.

B) The shark's heart receives both oxygenated and deoxygenated blood.

C) The shark's circulatory system has a pulmonary and a systemic circuit.

D) The shark's blood is pumped through open-ended tubes.

Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Apply/Analyze Learning Outcome: 23.2 Global LO: 2 7) What is one way in which the cardiovascular system of a mammal is different than that of an arthropod such as an insect?

A) The heart of the mammal pumps blood into arteries, while the insect heart does not.

B) Veins send blood to a mammal's lungs, while insect veins send blood to the heart.

C) A mammal's blood is always contained inside vessels, while an insect's blood sometimes leaves the vessels.

D) A mammal has a heart to pump blood, while an insect does not have a heart.

Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Apply/Analyze Learning Outcome: 23.2 Global LO: 2

2 .

8) Trace the path of a red blood cell in a circuit that takes it from the capillary bed of the right kidney to the capillary bed of the left kidney. Assume that you are doing this for an animal with a double circulation system.

A) capillary bed of right kidney → venules → veins → right atrium → right ventricle → pulmonary arteries →? capillaries of lungs → pulmonary veins → left atrium → left ventricle → aorta → arteries → arterioles → capillary bed of left kidney B) capillary bed of right kidney → venules → veins → right atrium → right ventricle → pulmonary veins → capillaries of lungs → pulmonary arteries → left atrium → left ventricle → aorta → arteries → arterioles → capillary bed of left kidney C) capillary bed of right kidney → venules → veins → left atrium → left ventricle → pulmonary arteries → capillaries of lungs → pulmonary veins → right atrium → right ventricle → aorta → arteries → arterioles → capillary bed of left kidney D) capillary bed of right kidney → arterioles → arteries → aorta → right atrium → right ventricle → pulmonary arteries → capillaries of lungs → pulmonary veins → left atrium → left ventricle → veins → venules → capillary bed of left kidney Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.3 Global LO: 2 9) Which of these animals has a double circulatory system?

A) fish B) grasshopper C) dog D) hydra Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Remember/Understand Learning Outcome: 23.2 10) Which of these carry(ies) oxygen-poor blood?

A) pulmonary arteries B) pulmonary veins C) aorta D) left ventricle Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3

3 .

11) A heart murmur occurs when there is a defect in ________.

A) a heart valve B) the sinoatrial node C) arterioles D) the timing of the cardiac cycle Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 Global LO: 5 12) Why is blood pressure higher during systole than during diastole?

A) The contraction of the heart during systole increases the blood pressure against arterial walls.

B) The relaxation of the heart during systole increases the blood pressure against arterial walls.

C) The contraction of the heart during diastole decreases the blood pressure against arterial walls.

D) More blood flows into the heart during systole than during diastole.

Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 Global LO: 5 13) The basic rhythm of the heartbeat is set by the ________.

A) systolic pressure B) EKG C) sinoatrial node D) "fight-or-flight" hormone Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 14) If your blood pressure were 120/70, it would mean that ________.

A) your blood pressure during systole is 120 and your blood pressure during diastole is 70 B) you have high blood pressure C) you have low blood pressure D) your blood pressure during systole is 120 and your heart rate is 70 Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 Global LO: 5

4 .

15) Blood pressure that is consistently ________ or higher would indicate that you have hypertension.

A) 120/80 B) 140/90 C) 110/85 D) 100/75 Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 Global LO: 5 16) Which blood vessels have thin, leaky walls?

A) capillaries B) venules C) arteries D) veins Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3 17) Blood pressure is lowest in ________.

A) veins B) capillaries C) arterioles D) venules Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4 18) One type of electrical defect in the heart is a delay in the electrical signal from the sinoatrial node to the relay point. Predict the effect of this defect on the cardiac cycle.

A) The atria relax for a shorter period of time.

B) The atria relax for a longer period of time.

C) The ventricles relax for a shorter period of time.

D) The ventricles relax for a longer period of time.

Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Evaluate/Create Learning Outcome: 23.3, 23.4 Global LO: 2

5 .

19) Plasma is where we could find ________ in the blood.

A) white blood cells B) red blood cells C) hormones D) platelets Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.5 20) Red blood cells lack nuclei and other organelles which allows them to ________.

A) have more room to carry hemoglobin B) have a small surface area C) contain less hemoglobin than they might otherwise be able to carry D) carry more calcium Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.5 21) What can cause anemia?

A) bone marrow disease, but not iron deficiency or low numbers of white blood cells B) iron deficiency, but not bone marrow disease or low numbers of white blood cells C) low numbers of white blood cells, but not bone marrow disease or iron deficiency D) bone marrow disease and iron deficiency Answer: D Topic: 23.2 The Human Cardiovascular System, 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.7, 23.11 Global LO: 2, 5 22) When tissue lining a blood vessel is damaged, the first thing that happens is ________.

A) erythrocytes release fibrin B) leukocytes multiply C) platelets convert fibrinogen to fibrin D) platelets adhere to the damaged tissue Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.5

6 .

23) White blood cells play a particularly important role in ________.

A) fighting infections B) supporting the activity of red blood cells C) carrying carbon dioxide D) blood clotting Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.5 24) Leukemia ________.

A) decreases the production of white blood cells B) increases the production of red blood cells C) is a cancer of the white blood cells D) is a cancer that arises in the lungs Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.7 Global LO: 5 25) Reduced consumption of ________ is associated with increased risk of cardiovascular disease.

A) fruits and vegetables B) red meats C) products containing trans fats D) tobacco products Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.7 Global LO: 2, 5 26) The buildup of plaque in the walls of arteries results in ________.

A) leukemia B) atherosclerosis C) anemia D) low blood pressure Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.7 Global LO: 5

7 .

27) To allow rapid diffusion between the body and the environment, gas exchange requires a surface that is both ________.

A) durable and stiff B) protected within the body and connected to the circulatory system C) thin and moist D) permeable to oxygen and impermeable to carbon dioxide Answer: C Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Remember/Understand Learning Outcome: 23.9 28) Earthworms use ________ as their respiratory organ.

A) lungs B) gills C) their skin D) tracheae Answer: C Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Remember/Understand Learning Outcome: 23.9 29) What structure do lobsters use for gas exchange?

A) gills B) lungs C) skin D) tracheae Answer: A Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Remember/Understand Learning Outcome: 23.9 30) What structure do insects use for gas exchange?

A) lungs B) tracheae C) skin D) gills Answer: B Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Remember/Understand Learning Outcome: 23.9

8 .

31) Animals need O2 because it ________.

A) plays a role in obtaining energy from food B) helps animals synthesize proteins C) is necessary to make CO2 D) is needed to deliver hemoglobin to the cells of an animal's body Answer: A Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Remember/Understand Learning Outcome: 23.9 Global LO: 7 32) In a human, the ________ provide(s) a common passageway for both food and air.

A) bronchioles B) trachea C) pharynx D) alveoli Answer: C Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10 33) What path does a molecule of O2 take from the nose to the respiratory surface?

A) pharynx → larynx → trachea → bronchus → bronchiole → alveolus B) larynx → pharynx → trachea → bronchus → bronchiole → alveolus C) pharynx → larynx → bronchus → bronchiole → alveolus → trachea D) pharynx → larynx → trachea → bronchiole → bronchus → alveolus Answer: A Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10 34) In the human respiratory system, gas exchange occurs across the cells of the ________.

A) diaphragm B) trachea C) bronchi D) alveoli Answer: D Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10

9 .

35) Together, inhalation and exhalation are referred to as ________.

A) diffusion B) breathing C) active transport D) positive pressure Answer: B Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10 36) Most of the time, breathing is controlled by ________.

A) hormones in blood plasma B) the spinal cord C) the circulatory system D) control centers in the brain stem Answer: D Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10 37) When you hold your breath, which changes in one or more blood gases leads initially to the urge to breathe again?

A) rising carbon monoxide level B) rising carbon dioxide level C) falling carbon monoxide level D) rising carbon dioxide level and falling carbon monoxide level Answer: B Topic: 23.4 The Human Respiratory System Skill: Apply/Analyze Learning Outcome: 23.10 Global LO: 2 38) Most oxygen is transported through the body ________.

A) dissolved in the blood B) dissolved in red blood cells C) bound to hemoglobin D) bound to dissolved iron Answer: C Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10

10 .

39) Cigarette smoking has many health consequences. Choose the exception.

A) It is responsible for about one in five deaths of Americans every year.

B) It accounts for 80–90% of all cases of lung cancer.

C) Secondhand smoke can affect the health of nonsmokers.

D) A former smoker will never attain the health status of a nonsmoker.

Answer: D Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.12 Global LO: 5 40) Why do cigarette smokers cough more than most people do?

A) The tar in cigarette smoke tends to make alveoli become sticky and close. Coughing opens them.

B) Coughing is the respiratory system's attempt to clear itself of the thick mucus that is produced in response to smoke exposure.

C) Cigarette smoking partially paralyzes the lungs; coughing exchanges the resultant "dead air."

D) Coughing stimulates blood flow to the lungs.

Answer: B Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.12 Global LO: 5 41) What is the pathway an oxygen molecule would take through the human circulatory system?

A) systemic tissues → alveoli → pulmonary vein → pulmonary capillaries → systemic capillaries → left ventricle → left atrium → aorta → systemic arteries B) alveoli → pulmonary capillaries → pulmonary vein → left atrium → left ventricle → aorta → systemic arteries → systemic capillaries → systemic tissues C) alveoli → pulmonary capillaries → pulmonary artery → right atrium → right ventricle → pulmonary vein → systemic arteries → systemic capillaries → systemic tissues D) alveoli → pulmonary vein → pulmonary capillaries → systemic capillaries → left atrium → left ventricle → aorta → systemic arteries → systemic tissues Answer: B Topic: 23.2 The Human Cardiovascular System, 23.4 The Human Respiratory System Skill: Apply/Analyze Learning Outcome: 23.3, 23.11 Global LO: 2

11 .

42) The cardiovascular system of a mouse works like that of a human. A mouse is moved from sea level (low altitude) to the top of a mountain (high altitude). How could this mouse's cardiovascular system maintain a similar rate of oxygen delivery to its tissues now that the mouse is at the top of the mountain?

A) Decrease breathing rate.

B) Decrease heart rate.

C) Increase the depth of ventilation.

Answer: C Topic: 23.2 The Human Cardiovascular System, 23.4 The Human Respiratory System, 23 The Process of Science Skill: Apply/Analyze Learning Outcome: 23.1, 23.3, 23.6, 23.10 Global LO: 2 43) The Antarctic icefishes are the only known vertebrates to lack hemoglobin. What would be LEAST likely to alter gas transport from the environment to an icefish's cells?

A) higher oceanic temperatures from global warming B) higher concentrations of carbon monoxide in the water from pollution C) higher concentrations of carbon dioxide in the water from pollution D) an injury that reduces the surface area of gills Answer: B Topic: 23.3 Unifying Concepts of Animal Respiration, 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.11 Global LO: 2, 5, 7 44) An unknown liquid toxin in the environment appears to diffuse easily across respiratory surfaces. Which animal's respiratory surfaces would most likely come in contact with this toxin?

A) leech B) stinkbug C) opossum D) spider Answer: A Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Apply/Analyze Learning Outcome: 23.9 Global LO: 2 45) Which group of people is most likely to have an iron deficiency?

A) pregnant women B) smokers C) high altitude residents D) endurance athletes Answer: A Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.11 Global LO: 5 12 .

23.2 Art Questions 1) The following figure illustrates ________.

A) diastolic blood pressure B) systolic blood pressure C) the pulmonary circuit D) the systemic circuit Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3 Global LO: 3

13 .

Please refer to the following art to answer the following questions.

2) The one-way flow of blood in veins is maintained by ________.

A) blood pressure B) muscles pressing against the veins C) their thick walls D) valves Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3 Global LO: 3 3) In varicose veins, veins are enlarged and blood flows backwards from the normal flow. What might help return the blood flow in these veins to normal?

A) Reduce physical activity.

B) Raise legs above the level of the heart when resting.

C) Remove valves from varicose veins.

D) Stand or sit still for long periods of time.

Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.3 Global LO: 2, 3

14 .

4) Examine the structure of blood vessels in the figure. Which vessel has the structure best suited to chemical exchange between the blood and tissues?

A) venule B) capillary C) arteriole D) artery Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3 Global LO: 3

15 .

5) Examine the figure shown. During breathing in humans, ________.

A) the diaphragm moves downward and the rib muscles contract, increasing the size of the chest cavity and decreasing the air pressure within the chest cavity B) the nasal cavities expand and the diaphragm relaxes C) the diaphragm and rib muscles contract, decreasing the size of the chest cavity and increasing the pressure within the chest cavity D) the diaphragm moves downward and the rib muscles relax, increasing the size of the chest cavity and decreasing the air pressure within the chest cavity Answer: A Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.10 Global LO: 3

16 .

6) The figure below is of an important molecule for oxygen transport. This figure shows that ________.

A) hemoglobin can bind to either oxygen or carbon dioxide B) a hemoglobin molecule can bind up to four molecules of oxygen C) a red blood cell contains four hemoglobin molecules D) each iron atom can bind four oxygen molecules Answer: B Topic: 23.4 The Human Respiratory System Skill: Remember/Understand Learning Outcome: 23.11 Global LO: 3

17 .

7) In this figure, what do the dissolved substances and water represent?

A) plasma B) erythrocytes C) leukocytes D) fibrinogen Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.5 Global LO: 2, 3 8) In this figure, what could one of the dissolved substances be?

A) protein B) erythrocytes C) leukocytes Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.5 Global LO: 2, 3

18 .

The figure below is from an experiment on athletes. The "live high, train low" group lived for 18 days in rooms with a simulated altitude of 3,000 m, while training (exercising) at 1,200 m. Use this information and this figure to answer the following questions.

9) The scientists who conducted this experiment were testing the hypothesis that living at high altitudes will boost red blood cell production, which can then affect stamina when training and competing at lower altitudes. Why did they measure the athletes' aerobic capacity, which is the maximum amount of oxygen used in one minute per kilogram of body weight?

A) Red blood cells carry oxygen, which is needed for muscle function. An increased ability to take in oxygen should correspond to more red blood cells.

B) Oxygen is needed for muscle function. More oxygen is needed to do the same amount of work at high altitude compared to low altitude.

C) Athletes with high production of red blood cells need less oxygen than those with a low production of red blood cells.

Answer: A Topic: 23 Process of Science Skill: Evaluate/Create Learning Outcome: 23.8 Global LO: 2, 5, 9

19 .

10) The scientists who conducted this experiment were testing the hypothesis that living at high altitudes will boost red blood cell production, which can then affect stamina when training and competing at lower altitudes. What group of athletes is an appropriate control treatment for this experiment?

A) Athletes who lived and trained at 1,200 m.

B) Athletes who lived at 1,200 m and trained at 3,000 m.

C) Athletes who lived at 3,000 m and trained at 1,200 m.

D) Athletes who lived and trained at 3,000 m.

Answer: A Topic: 23 Process of Science Skill: Apply/Analyze Learning Outcome: 23.8 Global LO: 2, 5, 9 11) What does the graph show about the experiment?

A) The increase in red blood cell production from living at a high altitude diminishes after returning to low altitude.

B) Living at high altitude does not have an effect on red blood cell production.

C) The increase in red blood cell production from living at a high altitude occurs from day 0.

Answer: A Topic: 23 Process of Science Skill: Apply/Analyze Learning Outcome: 23.8 Global LO: 2, 3, 5, 9 12) The scientists studied 11 elite runners in this experiment. How does their sample size affect the validity of their study?

A) The small sample size limits how broadly their conclusions apply to athletes in general.

B) The sample size is sufficient to make conclusions about all endurance athletes, because there are very few endurance athletes.

C) Although the sample size was small, scientists should still consider these results as reliable as results from larger sample sizes because it is very hard to study humans.

Answer: A Topic: 23 Process of Science Skill: Apply/Analyze Learning Outcome: 23.8 Global LO: 2, 5, 9

20 .

23.3 Scenario Questions Read the following scenario to answer the following questions.

Blood flowing away from the heart is under tremendous pressure, able to travel to just about any portion of the body. However, blood pressure drops considerably as it moves away from the heart. When blood finally reaches capillaries, the blood pressure drops to nearly zero. Therefore, when a person is standing, blood returning from the feet is not moved back towards the heart by contractions of the heart.

1) Blood is propelled back to the heart by ________.

A) rhythmic contractions of muscles in the walls of veins and the action of one-way valves B) skeletal muscle contractions around veins and the action of one-way valves C) suction force of the heart pulling blood into the empty chambers D) the natural flow of blood into ever-larger blood vessels leading to the heart Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.3 2) A scientist claimed that students might get better scores on written exams if they wiggle their legs frequently while taking an exam. This could work (but it is not better than studying) because wiggling legs might ________.

A) propel more blood from the legs back to the heart, increasing oxygen flow to the brain B) add more oxygen to the blood that is returning to the heart C) shake out more of the carbon dioxide that lingers in the blood returning to the heart D) break up blood clots in the legs, which slow the movement of blood back to the heart Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.3 Global LO: 2 3) Because of the changes in blood pressure through the circulatory system, the best way to feel a pulse is by pressing a finger against ________.

A) a vein B) a capillary C) an artery D) either an artery or a vein Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Remember/Understand Learning Outcome: 23.4

21 .

Read the scenario to answer the following questions.

In sickle cell disease (SCD), a mutation in hemoglobin causes deoxygenated hemoglobin to stick together in long chains, which in turn distorts red blood cells into an elongated, sickle (crescent) shape.

4) In a person with SCD, where would red blood cells with a sickle shape be LEAST likely to be found?

A) pulmonary arteries B) pulmonary veins C) right atrium D) right ventricle Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Evaluate/Create Learning Outcome: 23.3, 23.7 Global LO: 2, 5 5) Red blood cells with a sickle shape can block circulation in small blood vessels. Which blood vessels are most likely to become blocked by sickle cells?

A) veins B) arteries C) arterioles D) capillaries Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Apply/Analyze Learning Outcome: 23.3 Global LO: 2, 5

22 .

Read the scenario to answer the following questions.

Yawning is a reflexive action that is often associated with sleepiness. When a person yawns, the mouth opens, and a longer than normal breath of air is inhaled, followed by a longer than normal exhalation. Hypothesizing that yawning has a regulatory mechanism similar to breathing, scientists conducted an experiment on college students to test the effect of existing carbon dioxide levels on yawning.

6) The structure where the respiratory and digestive systems meet expands during a yawn. What is the name of this structure?

A) bronchus B) larynx C) pharynx D) trachea Answer: C Topic: 23.4 The Human Respiratory System Skill: Apply/Analyze Learning Outcome: 23.10 Global LO: 2 7) Yawning uses the same muscles as regular breathing. When a person exhales to complete a yawn, what happens?

A) The rib muscles contract.

B) The diaphragm contracts.

C) The rib muscles act in the same way that they do in an inhalation.

D) The diaphragm relaxes.

Answer: D Topic: 23.4 The Human Respiratory System Skill: Apply/Analyze Learning Outcome: 23.10 Global LO: 2 8) What must be TRUE if yawning has a regulatory mechanism similar to breathing?

A) Athletes should yawn more when exercising compared to when they are not exercising.

B) Tibetan mountaineers yawn less when they are walking compared to when they are standing still.

C) People adapted to lower altitudes should yawn the same amount when they are at high altitudes.

D) Athletes who have trained at high altitudes should inhale a greater volume of air when yawning compared to those who have trained only at low altitudes.

Answer: A Topic: 23.4 The Human Respiratory System, 23 Evolution Connection Skill: Apply/Analyze Learning Outcome: 23.1, 23.6, 23.10, 23.13 Global LO: 2, 5

23 .

9) The scientists investigated carbon dioxide levels in their experiment because high carbon dioxide levels in the ________ signal control centers in the brain to increase rate and depth of inhalations and exhalations.

A) alveoli B) blood C) heart muscle D) pharynx Answer: B Topic: 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.10 Global LO: 1, 2, 7, 9 10) Draw a graph that shows a relationship between carbon dioxide and yawning that supports the hypothesis of the scientists. To graph their results, the scientists would plot the ________.

A) number of yawns on the x-axis B) dependent variable on the x-axis C) level of carbon dioxide on the x-axis D) age of college students on the x-axis Answer: C Topic: 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.10 Global LO: 1, 2, 3, 4, 9 11) What finding would be considered support for the hypothesis tested by the scientists?

A) College students produce more carbon dioxide when they yawn more frequently.

B) College students yawn with the same frequency regardless of carbon dioxide levels.

C) College students yawn more when they are in lecture, compared to when they are in lab.

D) College students yawn more when they are exposed to higher levels of carbon dioxide.

Answer: D Topic: 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.10 Global LO: 1, 2, 9 12) The scientists found that the level of carbon dioxide in the air did not cause college students to yawn more frequently. What other experiment could they conduct to confirm that they should reject the hypothesis that yawning is regulated in the same way as breathing?

A) Test the effect of hemoglobin amounts on the frequency of yawning.

B) Test the effect of exercise levels on the frequency of yawning.

C) Test the effect of carbon monoxide (CO) levels on the frequency of yawning.

Answer: B Topic: 23.4 The Human Respiratory System Skill: Evaluate/Create Learning Outcome: 23.10 Global LO: 1, 2, 7, 9 24 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 24 The Body's Defenses 24.1 Multiple Choice Questions 1) What percentage of a population needs to be vaccinated for herd immunity to occur?

A) 100% B) 99% C) 95% D) 90% Answer: C Topic: 24 Biology and Society Skill: Remember/Understand Learning Outcome: 24.1 Global LO: 5 2) Which is one of the body's first lines of defense against infection?

A) antibodies B) skin and mucous membranes C) increased production of certain hormones Answer: B Topic: 24.1 An Overview of the Immune System Skill: Remember/Understand Learning Outcome: 24.2 3) Slugs produce mucus that helps keep them moist, helps them move, and protects them from pathogens. A slug's mucus is a component of which part of the immune system?

A) internal innate immunity B) external innate immunity C) adaptive immunity D) lymphatic system Answer: B Topic: 24.1 An Overview of the Immune System Skill: Apply/Analyze Learning Outcome: 24.2 Global LO: 2 4) What kinds of cells engulf the foreign cells and molecules they encounter and recognize?

A) natural killer cells B) red blood cells C) phagocytic cells D) B cells Answer: C Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.3 1 .

5) What type of molecule is part of the innate immune system and may prevent viral reproduction or destroy pathogens?

A) antibody B) histamine C) antigen D) defensive Answer: D Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.3 6) A primary function of natural killer cells is to ________.

A) attack and kill pathogenic microorganisms B) attack virus-infected cells C) tag pathogenic microorganisms with antibodies D) phagocytize microorganisms that have been tagged with antibodies Answer: B Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.3 7) Defensive proteins can assist the immune response by ________.

A) helping viruses reproduce B) directly destroying pathogens C) reducing inflammation D) increasing lymph production Answer: B Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.3 8) A researcher detects an increase in the amount of natural killer cells in a laboratory rat and concludes that ________.

A) the rat has, or recently had, a viral infection B) the rat does not have any cancerous tumors C) the rat's lymphatic system is not functioning properly D) the rat's internal innate defenses are weakened Answer: A Topic: 24.2 Innate Immunity Skill: Apply/Analyze Learning Outcome: 24.3 Global LO: 2

2 .

9) Which is a response of our innate defense system?

A) adaptive immunity B) inflammation C) cytotoxic T cell response D) helper T cell response Answer: B Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.3 10) If you suffer an injury such as cutting your foot when you step on a nail, what type of molecule is immediately released by the damaged cells?

A) histamines B) antibodies C) defensive proteins D) antihistamines Answer: A Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.4 11) Suppose you accidentally cut your finger with a piece of glass. What is the function of histamine in the ensuing inflammatory response?

A) To attract natural killer cells to the injury site.

B) To stimulate the release of defensive proteins near the injury.

C) To repel phagocytic cells away from the injury.

D) To dilate local blood vessels near the injury.

Answer: D Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.4 12) The major result of the inflammatory response is to ________.

A) initiate the production of antibodies B) disinfect and clean damaged tissues C) initiate the release of defensive proteins D) initiate the production of natural killer cells Answer: B Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.4

3 .

13) Why do diseases involving widespread infection often result in a fever?

A) The inflammatory and immune responses result in extra heat production.

B) The infection-causing microorganisms trick the brain's temperature control center into creating a hot environment that favors their growth.

C) The brain's temperature control center responds to inflammation by creating a hot environment that is unfavorable to the growth of microorganisms.

Answer: C Topic: 24.2 Innate Immunity Skill: Remember/Understand Learning Outcome: 24.4 14) A role of the lymphatic system is to ________.

A) transport histamine B) produce hormones related to fighting infections C) produce white blood cells D) return tissue fluid to the circulatory system Answer: D Topic: 24.3 The Lymphatic System Skill: Remember/Understand Learning Outcome: 24.5 15) A person's spleen may be removed (splenectomy) if it becomes enlarged due to certain types of cancer, traumatic injury, or damage. What part of the immune system will be most affected by a splenectomy?

A) internal innate immunity B) external innate immunity C) adaptive immunity D) lymphatic system Answer: D Topic: 24.3 The Lymphatic System Skill: Remember/Understand Learning Outcome: 24.5 Global LO: 5 16) Antibodies are ________.

A) composed of four fatty acid chains B) a type of lymphocyte C) proteins with short carbohydrates attached D) proteins consisting of four polypeptide chains Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7

4 .

17) A substance that can elicit an immune response from a lymphocyte is called a(n) ________.

A) defensive protein B) pathogen C) antibody D) antigen Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.6 18) If a person had the thymus gland removed, which process would be most affected in his or her body?

A) production of B cells B) production of T cells C) maturation of B cells D) maturation of T cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.6 Global LO: 2, 5 19) Which statement about antigen recognition is TRUE? A) B cell antigen receptors can bind to intact, freely circulating antigens that are bound to self proteins.

B) T cell antigen receptors can bind to intact antigens that are bound to self proteins.

C) B cell antigen receptors can bind to intact antigens that are on pathogen surfaces.

D) T cell antigen receptors can bind to intact freely circulating antigens.

Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.6 20) A typical vaccine consists of a solution containing ________.

A) antibodies B) horse serum C) B cells D) a harmless variant of a disease-causing microbe Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.10

5 .

21) The immune system is capable of mounting specific responses to particular microorganisms because ________.

A) lymphocytes are able to change their antigen specificity as required to fight infection B) the body is able to determine which type of B and T cells to make C) the body contains an enormous diversity of B and T cells, each with a specific kind of antigen receptor D) the body is able to make different antigen receptors depending on the invading microorganism Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.6 22) Antibodies ________.

A) are a type of lipid B) are generalists in that any antibody can bind to any antigen C) are a type of molecule that assists in destroying particular antigens D) are produced by T cells Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 23) Antibodies ________.

A) deactivate defensive proteins B) bind to antigens on pathogens C) stimulate the production of antigens D) phagocytose invading bacteria Answer: B Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 24) When a B or T cell is primed by an interaction with its particular antigen, the cell ________.

A) dies, killing the antigen B) engulfs the antigen and destroys it C) grows, divides, and develops further D) sticks to other cells with attached antigens to form a large clot Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7

6 .

25) A primary immune response is the ________.

A) immune response elicited by the second exposure of lymphocytes to a particular antigen B) immune response elicited by the first exposure of lymphocytes to a particular antigen C) immune response elicited by the first exposure of memory cells to a particular antigen Answer: B Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 26) The primary immune response ________.

A) results in the production of short-lived effector cells via clonal selection B) results in the production of short-lived memory cells via clonal selection C) peaks about 2 days after first exposure D) triggers the secondary immune response Answer: A Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 27) Which cell type initiates a secondary immune response?

A) natural killer cell B) memory cell C) effector cell D) cytotoxic T cell Answer: B Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 28) The secondary response in the B cell response occurs when memory cells bind to ________.

A) antibodies B) antigens C) histamine D) defensive proteins Answer: B Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7

7 .

29) A primary immune response differs from a secondary immune response in that the primary response ________.

A) produces helper T cells B) produces cytotoxic T cells C) produces effector cells D) produces memory cells Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 30) What do cytotoxic T cells identify and destroy?

A) cells that have been infected by pathogens B) blood or lymph that has been infected by pathogens C) interstitial fluid that has been infected by pathogens Answer: A Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.8 31) Strep throat can develop from an infection by the bacterium Streptococcus pyogenes. After infection by this bacterium, cells in the body will respond by producing antibodies against the bacterium and the toxins it produces. What type of immune response is being described in this situation?

A) cytotoxic T cell response B) helper T cell response C) B cell response D) inflammation Answer: C Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.8 Global LO: 2, 5 32) ________ may destroy infected body cells.

A) Phagocytic cells B) Helper T cells C) Natural killer cells D) Cytotoxic T cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.8

8 .

33) Which compounds do mast cells produce?

A) defensive proteins B) antihistamines C) histamine D) antibodies Answer: C Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.12 34) Anaphylactic shock ________.

A) occurs when blood vessels constrict abruptly B) is a symptom of an immunodeficiency disease C) causes blood pressure to drop dangerously Answer: C Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.12 35) It is best to receive an organ transplant from a donor who ________.

A) looks like you B) rarely consumes alcohol C) does not have any allergies D) best matches your self proteins Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.8 36) When the immune system improperly turns against the body's own molecules, the result is ________.

A) an allergy B) AIDS C) an autoimmune disease D) an immunodeficiency disease Answer: C Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.13

9 .

37) Which statement best explains why people with Hodgkin's disease often show signs of immunodeficiency?

A) The Hodgkin's disease virus infects and destroys B cells.

B) Hodgkin's disease involves the deposition of immune complexes in the kidneys.

C) Hodgkin's disease is a type of cancer that affects lymphocytes.

D) Hodgkin's disease occurs when an immune response elicited by streptococcal bacteria kills normal heart cells.

Answer: C Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.13 38) Which type of cells does HIV preferentially infect?

A) cytotoxic T cells B) natural killer cells C) helper T cells D) phagocytic cells Answer: C Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.13 39) Suppose that you encounter an antigen for the first time. What types of cells stored in your lymph nodes can be activated in case you encounter the antigen again?

A) memory cells B) effector cells C) phagocytic cells D) helper T cells Answer: A Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.9 40) What did Jonas Salk's polio vaccine experiment find?

A) Vaccines could be developed from bacteria.

B) Vaccines were safe only for the elderly.

C) Inactivated viruses can be used as vaccines.

D) Polio could not be prevented with a vaccine.

Answer: C Topic: 24 The Process of Science Skill: Remember/Understand Learning Outcome: 24.11 Global LO: 5

10 .

41) Jonas Salk's polio vaccine trials of 1954 involved giving placebos to 201,229 children and the polio vaccine to 200,745 children. Out of those in the placebo group, 142 children developed polio, whereas 57 children from the vaccine group developed polio. Approximately how many less times likely was a child to develop polio if he or she were vaccinated?

A) two B) ten C) three D) six Answer: C Topic: 24 The Process of Science Skill: Apply/Analyze Learning Outcome: 24.11 Global LO: 2, 4, 5 42) Why do some viruses mutate faster than others?

A) They are usually smaller.

B) They are usually larger.

C) They usually have RNA genomes.

D) They usually have DNA genomes.

Answer: C Topic: 24 Evolution Connection Skill: Remember/Understand Learning Outcome: 24.14 Global LO: 7 43) Diego was walking to class when he was stung by a bee. Students around him rushed to call for medical assistance as he collapsed to the ground. When the paramedics arrived, they found that Diego had very low blood pressure. What diagnosis is most likely?

A) AIDS B) Hodgkin's disease C) anaphylactic shock D) lupus Answer: C Topic: 24.5 Immune Disorders Skill: Apply/Analyze Learning Outcome: 24.12 Global LO: 2, 5

11 .

44) What part of the immune response do vaccines help build?

A) primary immune response B) secondary immune response C) external innate defenses D) allergic reactions Answer: B Topic: 24.5 Immune Disorders Skill: Remember/Understand Learning Outcome: 24.13 Global LO: 5 45) Edema (swelling of body tissues with fluid) may occur if fluid is unable to enter the circulatory system. What might contribute to the development of edema?

A) decreased release of histamine B) blocked lymphatic vessels C) increased memory cell production Answer: B Topic: 24.3 The Lymphatic System Skill: Apply/Analyze Learning Outcome: 24.5 Global LO: 2, 5 46) Maria has a nut allergy and accidentally ate some pine nuts in her salad while eating at a restaurant. Almost immediately after eating them, Maria went into anaphylactic shock, but fortunately she was quickly treated and completely recovered. What treatment option was the best for Maria and why?

A) a treatment that would have decreased the amount of histamine in her blood so that her blood vessels could constrict and raise her blood pressure B) a treatment that would have increased the number of cytotoxic T cells in her blood so that they could kill infected cells at a higher rate C) a treatment that would stimulate antibody production by B cells so that the antibodies could bind to antigens on pathogens more readily Answer: A Topic: 24.5 Immune Disorders Skill: Evaluate/Create Learning Outcome: 24.12 Global LO: 2, 5

12 .

24.2 Art Questions 1) Examine the numerous long structures extending from the surface of some of the cells in the figure. Cells with these long structures could be found lining ________.

A) the digestive tract B) arteries C) veins D) the trachea Answer: D Topic: 24.1 An Overview of the Immune System Skill: Apply/Analyze Learning Outcome: 24.2 Global LO: 2, 3

13 .

2) The figure shows a Y-shaped antibody molecule. How many protein chains are found in an antibody?

A) one B) two C) three D) four Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.7 Global LO: 3

14 .

3) Three B cells are shown in the figure. Which B cells will begin to grow, divide, and differentiate further?

A) only the B cell on the left B) only the B cell in the middle C) only the B cell on the right Answer: B Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.8 Global LO: 2, 3

15 .

4) The figure shows the concentration of antibodies for an antigen produced by Clostridium tetani, a bacterium that causes tetanus. What could trigger the increase in antibody production marked by the arrow?

A) a decrease in antigen concentration B) an increase in histamine production C) an initial exposure to Pseudomonas aeruginosa, a bacterium that causes pneumonia D) a second exposure to Clostridium tetani Answer: D Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.8 Global LO: 2, 3

16 .

5) The figure shows the incidences and infection rates of HIV around the world. What can you conclude from this figure?

A) There were approximately 1.5 million people living with HIV in Eastern Europe/Central Asia in 2015.

B) Southern Asia/Pacific has the most people living with HIV in 2015 C) There were approximately 2 million new infections of HIV in Latin America /Caribbean in 2015.

D) The numbers of new infections of HIV in Southern Africa will continue to rise in the future.

Answer: A Topic: 24.5 Immune Disorders Skill: Apply/Analyze Learning Outcome: 24.13 Global LO: 2, 3, 4

17 .

6) Examine the figure. Which process is this figure modeling? [Art: from Figure 24.10 — please remove all text labels and arrows (except for the large blue ones]

A) a mast cell releasing histamine after a person burned their finger B) a cytotoxic T cell killing an infected skin cell C) a B cell producing antibodies against the cold virus D) an allergic response after exposure to peanut dust Answer: B Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.8 Global LO: 2, 3

18 .

24.3 Scenario Questions Read the following scenario to answer the following questions.

Avian influenza is a viral infection with few damaging effects that naturally occurs in wild birds.

However, avian influenza is highly contagious and can quickly kill domesticated birds. Some human influenza viruses are similar to the avian influenza. People infected with avian influenza develop typical flu symptoms (fever, cough, muscle aches). However, symptoms may become more severe and life-threatening. If avian influenza evolves into a form that is easily transmissible from person to person, a global pandemic of widespread human death might occur.

1) One way to prevent a global pandemic of avian influenza would be to ________.

A) keep large doses of histamine available to treat anyone who shows signs of infection B) treat any infected birds with large doses of antibiotics C) develop a vaccine against the avian influenza virus D) develop drugs that could effectively block anaphylactic shock Answer: C Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.8 Global LO: 5 2) Which cells would be active during an immune response to a viral infection?

A) natural killer cells, only B) phagocytic cells, only C) T cells, only D) all of these cell types Answer: D Topic: 24.4 Adaptive Immunity Skill: Remember/Understand Learning Outcome: 24.8 3) Humans who are infected with avian influenza are likely to have elevated levels of ________.

A) defensive proteins B) histamine C) antihistamines D) bacterial cells Answer: A Topic: 24.2 Innate Immunity Skill: Apply/Analyze Learning Outcome: 24.2

19 .

4) Which method do you think would be best to test effectiveness of a vaccine intended for human use against avian influenza?

A) Give the vaccine to a single mouse that has the virus, and assess whether influenza symptoms develop.

B) Give the vaccine to a group of mice that have the virus, and give a placebo to another group of mice that have the virus. Assess whether influenza symptoms develop in either group.

C) Give the vaccine to a single human who has the virus, and assess whether influenza symptoms develop.

D) Give the vaccine to a group of humans who have the virus, and give a placebo to another group of humans who have the virus. Assess whether influenza symptoms develop in either group.

Answer: D Topic: 24 The Process of Science, 24 Evolution Connection Skill: Evaluate/Create Learning Outcome: 24.10, 24.11, 24.14 Global LO: 1, 2, 9

20 .

Read the following scenario to answer the following questions.

In order for cytotoxic T cells to kill infected cells, they must bind to the self proteins on the surface of the infected cells. Other proteins on the surface of the cytotoxic T cells assist with this binding process. One of these accessory proteins, CD8, has been implicated in many immunodeficiency disorders, including AIDS. CD8 is required for cytotoxic T cells to function normally.

Chronic alcohol use is associated with increased rates of pulmonary bacterial and viral infections. A recent study examined this association by investigating the effects of alcohol on the immune system in mice. Mice were given either water or alcohol (ethanol) to drink and then were infected with the influenza virus. The number of cytotoxic T cells that have the CD8 accessory protein was measured in both groups of mice. The data collected are shown in the figure below.

5) Which group of mice has more functional cytotoxic T cells?

A) The mice that drank water.

B) The mice that drank alcohol.

C) Both groups of mice have similar amounts of functional cytotoxic T cells.

Answer: A Topic: 24.4 Adaptive Immunity Skill: Apply/Analyze Learning Outcome: 24.8 Global LO: 1, 2, 3, 9 6) Which group of mice would have a stronger cytotoxic C cell response?

A) The mice that drank water.

B) The mice that drank alcohol.

C) Both groups of mice would have the same responses.

Answer: A Topic: 24.4 Adaptive Immunity Skill: Evaluate/Create Learning Outcome: 24.8 Global LO: 1, 2, 3, 9

21 .

7) What other observation would suggest that alcohol consumption contributes to increased bacterial and viral infections?

A) decreased histamine concentration in the mice that drank alcohol B) increased histamine concentration in the mice that drank alcohol C) increased numbers of B cells in the mice that drank alcohol D) decreased numbers of B cells in the mice that drank alcohol Answer: D Topic: 24.4 Adaptive Immunity Skill: Evaluate/Create Learning Outcome: 24.8 Global LO: 1, 2, 9

22 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 25 Hormones 25.1 Multiple Choice Questions 1) Hormones are usually transported through ________ and affect only cells with ________.

A) ducts; specific receptors B) intercellular junctions; cell junctions C) blood vessels; specific receptors D) blood vessels; cell junctions Answer: C Topic: 25.1 Hormones: An Overview Skill: Remember/Understand Learning Outcome: 25.3 2) Hormones regulate ________.

A) growth, but not reproduction or metabolism B) reproduction, but not growth or metabolism C) metabolism, but not growth or reproduction D) Growth, reproduction, and metabolism are all regulated by hormones.

Answer: D Topic: 25.1 Hormones: An Overview Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2 3) In general, hormones that bind to plasma membrane receptors ________.

A) are steroid hormones B) bind to DNA and cause changes in transcription C) cannot pass through cell membranes D) are produced in the interstitial fluid Answer: C Topic: 25.1 Hormones: An Overview Skill: Remember/Understand Learning Outcome: 25.2 4) When a cell responds to a particular steroid hormone it would be expected to have ________.

A) DNA sites that interact with the hormone B) a receptor inside the cell that binds the hormone C) a cell-surface receptor that binds the hormone Answer: B Topic: 25.1 Hormones: An Overview Skill: Apply/Analyze Learning Outcome: 25.2 Global LO: 2

1 .

5) Steroid hormones ________.

A) begin their action outside the membrane B) usually diffuse through the plasma membrane into target cells C) bind to receptors in the plasma membrane D) are water soluble Answer: B Topic: 25.1 Hormones: An Overview Skill: Remember/Understand Learning Outcome: 25.2 6) Steroid hormones usually ________.

A) trigger a signal transduction pathway when they bind to a membrane receptor B) bind to mRNA in the cytoplasm to initiate transcription C) bind to receptors in the cytoplasm or nucleus D) bind to rRNA to prevent translation Answer: C Topic: 25.1 Hormones: An Overview Skill: Remember/Understand Learning Outcome: 25.2 7) Water-soluble hormones can cause different effects in different cells depending on the type of cell and ________.

A) its signal transduction pathway B) the particular organelle that is targeted C) the binding of the hormone to either DNA or RNA D) the type of ribosomes in the cell Answer: A Topic: 25.1 Hormones: An Overview Skill: Remember/Understand Learning Outcome: 25.2 8) Which organ has both endocrine and nonendocrine functions?

A) pancreas B) salivary gland C) anterior pituitary gland D) skeletal muscle Answer: A Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3

2 .

9) Which molecule is a not a steroid hormone?

A) glucagon B) progesterone C) androgen Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.2 Global LO: 2 10) Which structure is part of the brain?

A) thyroid B) hypothalamus C) adrenal cortex Answer: B Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 11) Which statement is TRUE? A) The anterior pituitary is composed of nervous tissue.

B) The anterior pituitary and posterior pituitary work together to secrete the same hormones.

C) Inhibiting hormones make the anterior pituitary secrete hormones.

D) The pituitary secretes hormones that influence numerous body functions.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.4 12) Which hormone is made by the hypothalamus and released by the posterior pituitary?

A) estrogen B) growth hormone C) ADH D) insulin Answer: C Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.4

3 .

13) Alcohol acts as a diuretic by opposing the action of ________.

A) ADH B) glucagon C) HGH D) adrenalin Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2, 5 14) Which choice INCORRECTLY pairs an endocrine gland or hormone with an aspect of metabolism that it regulates?

A) TSH—thyroid hormone B) pancreas—blood glucose levels C) adrenalin—blood calcium levels Answer: C Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 15) Which hormone affects the greatest variety of cell types?

A) thyroid stimulating hormone B) insulin C) growth hormone D) antidiuretic hormone Answer: C Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 16) Which gland would be most likely impacted by a lack of the element iodine in your diet?

A) thyroid B) adrenal C) anterior pituitary D) ovary Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 5

4 .

17) Hypothyroidism can result in ________.

A) goiter B) a low sperm count C) too little iodine D) hyperactivity Answer: A Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 Global LO: 5 18) The relationship of insulin to glucagon can be described as ________.

A) working together to prepare the body to deal with stress B) insulin stimulates the pancreas to secrete glucagon C) high levels of insulin inhibit pancreatic secretion of glucagon D) They are antagonistic hormones.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6 19) Which structure exerts primary regulation of the concentration of sugar in the blood?

A) liver B) pituitary C) thyroid D) pancreas Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6 20) What happens when the concentration of glucose in the blood rises after a meal is digested?

A) Increased amounts of both glucagon and insulin are released.

B) An increased amount of glucagon is released.

C) An increased amount of insulin is released.

D) Glucagon and insulin levels in the blood stay the same.

Answer: C Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6

5 .

21) Which of the following hormones causes a rise in the concentration of glucose in the blood?

A) insulin B) glucagon C) oxytocin D) ADH Answer: B Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6 22) What is the metabolic abnormality that underlies the characteristic symptoms of diabetes mellitus, such as frequent urination?

A) a failure of the kidney tubules to reabsorb enough glucose from the urine B) a failure of the gastrointestinal epithelium to absorb enough glucose from food C) an inability of the body's cells to retain glucose they have absorbed from the blood D) an inability of the body's cells to absorb enough glucose from the blood Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6 Global LO: 2, 5 23) Which disorder can sometimes be managed with diet and exercise?

A) type 1 diabetes B) type 2 diabetes C) type 3 diabetes D) hypoglycemia Answer: B Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.6 Global LO: 5 24) Which gland is located nearest the kidneys?

A) ovaries B) pineal gland C) thyroid gland D) adrenal glands Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3

6 .

25) In the presence of stress, which gland is most likely to be active?

A) pancreas B) adrenal C) posterior pituitary Answer: B Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 26) Epinephrine ________.

A) decreases metabolic rate B) decreases heart rate C) increases absorption of glucose by the digestive tract D) increases breathing rate Answer: D Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 27) Which hormone can make a person susceptible to infection when administered for too long as a drug?

A) glucagon B) growth hormone C) corticosteroids D) antidiuretic hormone Answer: C Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 28) If your body does not secrete enough ________, your response to stress may be decreased.

A) ACTH B) insulin C) HGH D) prolactin Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2

7 .

29) The development of ________ may be stimulated by estrogen.

A) breasts B) a low-pitched voice C) sperm production D) facial hair Answer: A Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 30) Which hormone is secreted by a sexually mature woman?

A) testosterone, but not estrogen or progesterone B) estrogen, but not testosterone or progesterone C) progesterone, but not estrogen or testosterone D) All of these are secreted by a sexually mature woman.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2 31) If body cells have too few receptors for insulin, ________.

A) the insulin level is likely to decrease B) the blood glucose level may rise to abnormal levels C) the liver will need to break down more glycogen D) more glucagon will be needed Answer: B Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.6 Global LO: 2, 5, 7 32) Nate is gaining weight, is often tired, and feels cold. His thyroid hormone level is high as is the level of TSH. Nate also has a goiter. Which of these diagnoses is the most likely for Nate's condition?

A) defective thyroid hormone receptors in his body cells B) insufficient iodine in his diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: A Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3 Global LO: 2, 5, 7

8 .

33) Natalie is lethargic, has poor tolerance to cold, and the amount of thyroid hormone in her body is low even though the level of TSH is high. Natalie has a goiter. Which of these diagnoses is the most likely for Natalie's condition?

A) defective thyroid hormone receptors in the body cells B) insufficient iodine in the diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: B Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3 Global LO: 2, 5, 7 34) Jenny is losing weight, has poor tolerance to heat, and has mood swings, high blood pressure, and a rapid heart rate. She has very high levels of thyroid hormone, high levels of TSH, and a goiter. Which of these diagnoses is the most likely for Jenny's condition?

A) defective thyroid hormone receptors in the body cells B) insufficient iodine in the diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: C Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3 Global LO: 2, 5, 7 35) Which of these is generally considered a benefit of synthetic hormones?

A) effects on kidney and liver B) cardiovascular effects C) increased hostility D) mimicking estrogen Answer: D Topic: 25 Biology and Society, 25.2 The Human Endocrine System, 25 The Process of Science Skill: Remember/Understand Learning Outcome: 25.1 Global LO: 5 36) An example of the action of an endocrine disruptor is ________.

A) BPA in bottles affects particular glands B) feedback from estrogen inhibits FSH C) lack of iodine prevents synthesis of adequate thyroid hormone Answer: A Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.8 Global LO: 5 9 .

37) Many cases of pediatric thyroid cancer occurred after the 1986 Chernobyl nuclear accident in Ukraine and the cause was traced to milk containing iodine-131. What would be an effective method to prevent thyroid cancer increase following exposure to excessive radiation?

A) Do not allow anyone to drink any milk.

B) Give dairy cows large doses of iodine.

C) Give humans large doses of iodine before exposure.

D) Give people large doses of iodine a few days following exposure.

Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.5 Global LO: 2, 5 38) Which of these behaviors is NOT associated with androgens?

A) body-slamming in elephant seals B) mating songs in frogs C) territorial battles in fish D) maturation of ovaries in bears Answer: D Topic: 25 Evolution Connection Skill: Remember/Understand Learning Outcome: 25.10

10 .

25.2 Art Questions Please refer to the following art to answer the following questions.

1) What is special about the target cells that allows them to respond to the hormone? Only the target cells ________.

A) are close enough to the blood vessels to respond B) touch the blood vessels C) have specific receptors to the hormone D) located in organs next to the kidneys can respond Answer: C Topic: 25.1 Hormones: An Overview Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2

11 .

2) As this boxer is finishing his fight, which of these hormone is NOT likely to be elevated?

A) adrenalin B) ADH C) insulin D) androgens Answer: C Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3, 25.10 Global LO: 2, 3, 7 3) The hormone being released from the organs shown in the figure is likely to be ________.

A) adrenalin B) growth C) testosterone Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 2, 3 4) If the boxer wanted to be more confident and less stressed as he entered the fight, a good strategy would be to ________.

A) eat a large amount of carbohydrates to be sure glucose is properly regulated B) assume a power pose for a period of time before the fight C) drink milk to increase the amount of calcium in his blood D) take iodide tablets to insure that sufficient thyroxin is produced Answer: B Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.7 Global LO: 2, 5

12 .

5) Examine the figure. If blood glucose levels decline, ________.

A) the pancreas releases more glucagon, which causes glucose to be released into the blood B) the pancreas releases more insulin, which causes glucose to be released into the blood C) body cells take up more glucose D) liver cells convert glucose to glycogen Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.6 Global LO: 2, 3

13 .

6) Examine the figure. The process shown is an example of ________.

A) information flow from the pancreas to the liver B) regulation by the hypothalamus C) regulation of thyroxin by the liver D) the production of dwarfism Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.6 Global LO: 2, 3 7) Examine the figure below. The behavior exhibited by these elephant seals is promoted by ________.

A) growth hormone, which has brought about full body size B) testosterone, which has brought about sexual maturity C) antagonistic hormones, which cause aggression Answer: B Topic: 25.2 The Human Endocrine System Skill: Remember/Understand Learning Outcome: 25.3 14 .

25.3 Scenario Questions Please read the scenario to answer the questions.

Osteoporosis is a disease characterized by loss of bone mass and an increased susceptibility to bone fractures. It threatens more than half of all Americans over the age of 50. Women are about four times more likely to suffer from the disease than men. Osteoporosis may progress undetected until bones become so weak that they break during common activities. Prevention of osteoporosis includes regular weight-bearing exercise, recommended intake of calcium and vitamin D, and avoidance of smoking and excessive alcohol.

1) Astronauts returning from long periods in space often have very fragile bones. This is likely related to ________.

A) overproduction of thyroid hormone B) lack of gravity C) diet lacking in calcium D) excessive production of ADH Answer: B Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.2 Global LO: 2, 5 2) Calcium levels are regulated by antagonistic hormones. This is likely because ________.

A) calcium has to be produced by the body and that production must be regulated B) bone formation occurs only during puberty when many other hormones are present, thus careful regulation is necessary C) both too much and too little calcium can have disastrous effects on the body, thus the levels need tight regulation D) calcium is needed to repair bone fractures, so antagonistic hormones make sure some are released at all times Answer: C Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3 Global LO: 2, 5 3) In testing the mood-altering effects of anabolic steroids, 20 volunteers were given a placebo on day 1, a low dose of steroids on day 3, a higher dose of steroids on day 6 and a placebo again on day 9. What is the control in this experiment?

A) The experiment has no control since all of the subjects were test subjects.

B) The volunteers given the high dose of steroids were the control.

C) Each volunteer became part of the experimental control when they were given a placebo.

Answer: C Topic: 25 The Process of Science: Do 'Roids Cause Rage?

Skill: Evaluate/Create Learning Outcome: 25.9 Global LO: 1, 2, 5 15 .

4) Researchers observed a number of behavioral problems among women who used anabolic steroids including abuse of other substances, rigid dietary practices, as well as dissatisfaction and preoccupation with their appearance. Why would women who are dissatisfied with their appearance use anabolic steroids?

A) Anabolic steroid use is known to increase fertility and sexual attractiveness of the user.

B) Some women consider extra muscle mass to be an attractive trait.

C) Increase in reproductive hormones that result from anabolic steroid use enhance female characteristics such as breast size.

D) Anabolic steroids are known to help reduce weight and many women consider thinness an attractive trait.

Answer: B Topic: 25 The Process of Science: Do 'Roids Cause Rage?

Skill: Evaluate/Create Learning Outcome: 25.9 Global LO: 1, 2, 5 5) Seawater is rich in iodine and is found in coastal soils and in seafood. This might explain why scientists observer that ________.

A) goiters rarely appear in people living near the coast B) fish have body fluids that are isotonic to seawater C) hormones generally travel through the blood circulatory system D) many sea creatures have shells composed of calcium Answer: A Topic: 25.2 The Human Endocrine System Skill: Apply/Analyze Learning Outcome: 25.3 Global LO: 1, 2, 5 6) Which list includes only those factors necessary for a hormone to be effective?

A) hormone producing gland, a duct through which hormones can flow, proper receptors at target organ B) hormone producing cells with membrane channels through which the hormone can be released, proper receptors in the bloodstream and a target organ C) hormone producing cells with membrane channels through which the hormone can be released, access to the bloodstream and receptors on a target organ D) hormone producing gland that is controlled by another hormone producing gland, a duct through which hormones can flow, a clear connection to the target organ Answer: C Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.3 Global LO: 1, 2, 5

16 .

7) In the study shown in the figure, male African clawed frogs were treated with atrazine, which is the most commonly applied herbicide (weed-killer) in the world. These frogs were compared to untreated frogs. Treated and untreated frogs were presented with a female and the number of successful matings of each was recorded. What can you conclude from the data shown?

A) Atrazine causes feminization of male frogs.

B) The level of testosterone is lower in frogs treated with atrazine than in those of the untreated group.

C) Frogs cannot mate successfully if their testosterone is too high.

D) Atrazine prevents successful mating in all African clawed frogs.

Answer: B Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.8 Global LO: 1, 2, 3, 4, 9 8) In the study shown in the figure, male African clawed frogs were treated with atrazine, which is the most commonly applied herbicide (weed-killer) in the world.. These frogs were compared to other untreated frogs. Treated and untreated frogs were presented with a female and the number of successful matings of each was recorded. What questions can be answered by these data?

A) Does atrazine have a greater effect on male frogs than on female frogs?

B) Does the level of testosterone relate to mating success?

C) Do individual frogs mate fewer times if they have been exposed to atrazine?

D) Can atrazine be used to control frog population size?

Answer: B Topic: 25.2 The Human Endocrine System Skill: Evaluate/Create Learning Outcome: 25.8 Global LO: 1, 2, 3, 4, 9

17 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 26 Reproduction and Development 26.1 Multiple Choice Questions 1) Which aspect of asexual reproduction is sometimes disadvantageous?

A) Allowing animals that do not move around to produce offspring without finding mates.

B) Allowing an animal to produce many offspring quickly.

C) Saving the time and energy of gamete production.

D) Producing genetically uniform populations.

Answer: D Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Remember/Understand Learning Outcome: 26.1 2) Asexual reproduction ________.

A) creates individuals with unique combinations of genes B) generates enormous genetic variation C) is an effective way for animals to expand their population quickly and exploit an available environment D) provides greater adaptability to changing environments Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Remember/Understand Learning Outcome: 26.1 3) Which reproduction method is associated with sexual reproduction?

A) fission B) fragmentation C) gamete production Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Remember/Understand Learning Outcome: 26.1 4) Hermaphrodites ________.

A) possess both male and female functioning reproductive systems B) have the gonads of one sex but the external appearance of the other C) usually fertilize themselves Answer: A Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Remember/Understand Learning Outcome: 26.1

1 .

5) Reproductive systems with external fertilization are most common in ________.

A) animals that reproduce asexually B) animals that are widely dispersed C) aquatic animals D) populations with many more females than males Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Remember/Understand Learning Outcome: 26.1 6) What advantage is associated with human testes located in an external sac rather than in the abdominal cavity?

A) semen can travel a shorter distance during ejaculation B) testes can be kept at a constant temperature C) testes can be kept cooler than the body's interior D) testes can enlarge at sexual maturity Answer: C Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2 7) Where in humans does fertilization most often take place?

A) ovary B) oviduct C) vagina D) uterus Answer: B Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2 Global LO: 5 8) What moves a human egg through the oviduct?

A) the beating of the egg's cilia B) rhythmic contractions of the oviduct C) rhythmic contractions of the uterus D) the beating of cilia in the oviduct Answer: D Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2

2 .

9) Embryo implantation normally occurs in the ________.

A) oviduct B) corpus luteum C) follicle of the ovary D) endometrium of the uterus Answer: D Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2 Global LO: 5 10) In a human female reproductive system, the ________.

A) hymen partly covers the cervical opening B) vagina secretes hormones that help maintain the uterine lining C) labia minora are a pair of thick, fatty ridges that protect the entire genital region D) outer features are collectively called the vulva Answer: D Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2 11) Which statement is TRUE? A) Meiosis in oogenesis produces four mature eggs from one primary oocyte.

B) Oogenesis begins during puberty.

C) Spermatogenesis in an individual begins before that individual is born.

D) Oogenesis in humans is completed after stimulation by sperm.

Answer: D Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.2 12) All of these are similarities between the male and female system EXCEPT one. Choose the exception.

A) Both have erectile tissue that becomes engorged with blood during sexual excitement.

B) Both have paired gamete-producing organs.

C) Both have a urethra that carries both urine and gametes.

D) Both have a pair of tubes that can carry gametes.

Answer: C Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2

3 .

13) Researchers have found a general relationship between testicular cancer and exercise.

Increased exercise is associated with a decrease in incidence of testicular cancer. However, a positive relationship (increased incidence of testicular cancer) was found between testicular cancer and riding bikes or horses. Several factors might be hypothesized to bring about this result. All but one of the following statements are reasonable hypotheses that researchers might follow to seek the cause for this relationship. Choose the exception.

A) Riding bikes or horses causes trauma to the testes.

B) The seat on bikes and the saddle on horses are made of material containing chemicals that damage testicular cells.

C) Riding bikes or horses increases scrotal temperature, which damages testicular cells.

D) Mutations that lead to testicular cancer make men more likely to ride bikes or horses.

Answer: D Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 5, 9 14) Researchers have found a general relationship between testicular cancer and exercise.

Increased exercise is associated with a decrease in incidence of testicular cancer. However, a positive relationship (increased incidence of testicular cancer) was found between testicular cancer and riding bikes or horses. Several factors might be hypothesized to bring about this result. Which hypothesis is properly related to a prediction that arises from it?

A) Hypothesis: Riding bikes or horses causes trauma to the testes. Prediction: Bike or horse riding will cause testes to shrink.

B) Hypothesis: The seat on bikes and the saddle on horses are made of material containing chemicals that damage testicular cells. Prediction: Chemicals found in bike seats or horse saddles damage testicular cells.

C) Hypothesis: Riding bikes or horses increases scrotal temperature, which damages testicular cells. Prediction: Bike riders are more likely to wear briefs than boxers as their underwear of choice.

D) Hypothesis: Mutations that lead to testicular cancer make men more likely to ride bikes or horses. Prediction: Men who ride bikes or horses exercise less.

Answer: B Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9 15) Menstruation ________.

A) involves the release of the endometrium B) is stimulated by HCG C) occurs after ovulation but prior to production of the corpus luteum D) is triggered by an LH surge Answer: A Topic: 26.2 Human Reproduction Skill: Remember/Understand Learning Outcome: 26.3 4 .

16) If an embryo failed to secrete HCG ________.

A) maternal elements of the placenta would fail to develop B) fetal elements of the placenta would fail to develop C) neural tube formation would not occur, and the embryo would not have a brain D) spontaneous abortion of the embryo would occur Answer: D Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.3 Global LO: 2, 5 17) Which statement about a birth control method is TRUE? A) Natural family planning is one of the most reliable forms of birth control.

B) Morning-after pills are about 25% effective at preventing pregnancy.

C) Tubal ligation prevents ovulation.

D) A vasectomy involves removing a section of each vas deferens.

Answer: D Topic: 26.3 Reproductive Health Skill: Remember/Understand Learning Outcome: 26.4 Global LO: 5 18) Which types of pathogens cause sexually transmitted diseases that are generally NOT curable?

A) bacteria B) viruses C) fungi D) insects Answer: B Topic: 26.3 Reproductive Health Skill: Remember/Understand Learning Outcome: 26.5 Global LO: 5 19) Which STD is NOT caused by a virus?

A) AIDS B) chlamydia C) genital warts D) genital herpes Answer: B Topic: 26.3 Reproductive Health Skill: Remember/Understand Learning Outcome: 26.5 Global LO: 5

5 .

20) A sperm cell's acrosome ________.

A) contains the sperm's nucleus and is the part of the sperm that enters the egg during fertilization B) fuses with the plasma membrane of the egg cell C) contains enzymes that are released when the sperm encounters an egg and dissolves a hole in the jellylike matrix that surrounds the egg D) contains the sperm's mitochondria Answer: C Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.6 21) Which one of the following is the earliest event in the process of fertilization?

A) Sperm contact the jelly coat around the egg.

B) The sperm head plasma membrane fuses with the egg plasma membrane.

C) Enzymes from the acrosome are released.

D) The sperm nucleus enters the cytoplasm of the egg.

Answer: A Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.6 22) Which of these events occurs first?

A) gastrulation B) cleavage C) implantation D) formation of the placenta Answer: B Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7 23) Cleavage results in ________.

A) formation of the nervous system B) formation of the notochord C) formation of more cells D) segmentation Answer: C Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7

6 .

24) The liver, pancreas, and lining of the digestive tract come from ________.

A) ectoderm B) endoderm C) mesoderm D) endometrium Answer: B Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7 25) Gastrulation ________.

A) produces a solid ball of cells B) changes the blastocyst into an embryo that has three tissue layers C) changes the fertilized egg into a blastocyst D) changes a gastrula into a blastocyst Answer: B Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7 26) Mesoderm gives rise to the ________.

A) heart and kidneys B) brain and skin C) nervous system and thyroid D) liver and pancreas Answer: A Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7 27) Which outcome is a result of programmed cell death?

A) formation of fingers in humans B) gastrulation C) formation of the notochord D) formation of the brain Answer: A Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.7

7 .

28) What is gestation?

A) conception B) fertilization C) development D) pregnancy Answer: D Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5 29) The lifeline between the embryo and the placenta is ________.

A) derived from the yolk sac B) derived from the amnion C) called the "chorion" D) called the "umbilical cord" Answer: D Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.8 30) When does the human embryo implant in the wall of the uterus?

A) within a few hours of fertilization B) about a day after conception C) about a week after conception D) just after gastrulation Answer: C Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5 31) At about what point in gestation can an ultrasound exam determine the sex of the fetus?

A) about 4 weeks after fertilization B) at the end of the first trimester C) about 20 weeks after fertilization D) at the end of the second trimester Answer: B Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5

8 .

32) At about what point in gestation does the fetal heartbeat become audible by stethoscope and the fetus's movements easily felt by the mother?

A) 15 weeks B) 20 weeks C) 25 weeks D) 30 weeks Answer: B Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5 33) What process dominates the third trimester of human development?

A) formation of internal organs B) formation of external features such as arms and legs C) growth D) organ formation Answer: C Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5 34) Which substance stimulates contractions in uterine smooth muscle during labor?

A) progesterone B) estrogen C) oxytocin D) prolactin Answer: C Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 35) The three stages of labor, in the proper order are ________.

A) dilation, expulsion, delivery of the placenta B) dilation, crowning, expulsion C) contractions, dilation, expulsion D) contractions, dilation, crowning Answer: A Topic: 26.4 Human Development Skill: Remember/Understand Learning Outcome: 26.9 Global LO: 5

9 .

36) Which situation is NOT a legal or physical disadvantage of current reproductive technologies?

A) Babies born as a result of In Vitro Fertilization have significantly higher rates of autism.

B) Surgery is necessary to remove eggs for In Vitro Fertilization.

C) Hormone injections to promote ovulation may cause the birth of multiples.

D) It is sometimes unclear how current law applies to babies born through current reproductive technologies.

Answer: A Topic: 26.5 Reproductive Technologies, 26 The Process of Science Skill: Remember/Understand Learning Outcome: 26.10, 26.11 Global LO: 5 37) The "grandmother hypothesis" suggests that natural selection may have favored a woman ________.

A) moving away from her children and grandchildren B) focusing her energy on caring for her grandchildren, instead of producing more children C) focusing her energy on the production of as many children as possible before reaching menopause D) helping her sisters produce more children Answer: B Topic: 26 Evolution Connection Skill: Remember/Understand Learning Outcome: 26.12 38) Male fertility could be severely decreased by ________.

A) a defect in cilia production B) the presence of FSH in a male's body C) lack of production of polar bodies D) a defect in flagella production Answer: D Topic: 26 Evolution Connection Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 5 39) Female fertility could be severely decreased by ________.

A) a defect in cilia production B) the presence of FSH in a male's body C) lack of production of polar bodies D) a defect in flagella production Answer: A Topic: 26 Evolution Connection Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 5 10 .

40) What action might increase the number of eggs which mature if female infertility is caused by the absence of ovulation?

A) increase the level of progesterone B) increase the level of follicle stimulating hormone C) decrease the amount of progesterone D) increase the length of time the corpus luteum remains present Answer: B Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.10 Global LO: 2, 5

11 .

26.2 Art Questions 1) The animal in the accompanying figure illustrates ________.

A) fission B) regeneration C) asexual reproduction D) growth of male reproductive structures Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Apply/Analyze Learning Outcome: 26.1 Global LO: 2, 3

12 .

2) The figure shows male reproductive anatomy. In a human male reproductive system, ________.

A) sperm mature in the urethra B) the vas deferens conducts sperm between the testis and epididymis C) the sperm travel through the sperm duct before reaching the urethra during ejaculation D) sperm mature in the prostate gland Answer: C Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 3 3) According to the diagram, after a vasectomy (within the scrotal sac), ________.

A) secretions from the prostate can no longer reach the urethra B) secretions from the seminal vesicles can no longer reach the urethra C) secretions from the sperm duct can no longer reach the urethra D) sperm from the epididymis can no longer reach the urethra Answer: D Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 3, 5

13 .

4) According to the diagram, after a vasectomy (within the scrotal sac), ________.

A) secretions from the prostate and seminal vesicle can no longer reach the urethra B) secretions from the seminal vesicles can no longer reach the urethra C) sperm can no longer reach the epididymis D) sperm from the testes can no longer reach the urethra Answer: D Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 3, 5 5) According to the diagram ________.

A) secretions from the prostate and seminal vesicle do not exit through the urethra B) the urethra carries seminal fluid and the prostate stores urine C) the vas deferens connects directly to the penis without entering the body cavity D) an enlarged prostate could press against the urinary bladder causing increased frequency of urination Answer: D Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.2 Global LO: 2, 3, 5

14 .

6) The figure shows oogenesis. What is the function of the polar bodies that are produced during oogenesis? They are a mechanism that allows for ________.

A) the shedding of excess cytoplasm during the production of a haploid ovum B) the shedding of excess genetic material during the production of a haploid ovum C) the shedding of excess mitochondria during the production of a haploid ovum D) streamlining of the ovum so as to facilitate the penetration of an ovum by a sperm Answer: B Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 2

15 .

7) Why are polar bodies small?

A) because the oocyte cytoplasm is divided into 4 cells B) because polar bodies have less genetic material than other cells C) because they are produced at the poles of the dividing cell rather than at the equator D) because the fertilizable egg needs enough cytoplasm to support the embryo for days Answer: D Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 2, 7 8) The figure shows a human embryo 31 days after conception. Which structure is part of the placenta?

A) embryo B) chorion C) amnion D) yolk sac Answer: B Topic: 26.4 Human Development Skill: Apply/Analyze Learning Outcome: 26.8 Global LO: 2, 3

16 .

9) Examine the embryo in the figure. The hands and feet of this embryo appear paddle-like, with no distinct toes or fingers. What process is needed to define each of the toes and fingers?

A) programmed cell death B) neurulation C) gastrulation D) induction Answer: A Topic: 26.4 Human Development Skill: Apply/Analyze Learning Outcome: 26.7 Global LO: 2, 3

17 .

10) What does the ovarian cycle image illustrate?

A) A rise in the level of luteinizing hormone brings about ovulation.

B) A rise in the level of estrogen brings about ovulation.

C) The endometrium is thinner during the first half of the cycle than during the latter half.

D) A corpus luteum is necessary for ovulation.

Answer: A Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.3 Global LO: 2, 3, 5 11) What does the ovarian cycle image illustrate?

A) The peak of luteinizing hormone occurs slightly before mid-cycle.

B) Ovulation occurs well before mid-cycle.

C) The level of luteinizing hormone does not change much during the cycle.

D) The level of progesterone spikes just before mid-cycle.

Answer: A Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.3 Global LO: 2, 3, 5

18 .

12) The puffy circular structure represents the transformation of a structure previously called the ________.

A) corpus luteum B) follicle C) primary oocyte D) ovum Answer: B Topic: 26.2 Human Reproduction Skill: Apply/Analyze Learning Outcome: 26.3 Global LO: 2, 3 26.3 Scenario Questions Please read the following paragraph and then answer the questions.

Birth control methods act at many points in the reproductive cycle. Some options, such as birth control pills, are highly effective at preventing pregnancy. However, only a few commonly available methods are effective at preventing the transmission of sexually transmitted disease (STD). The Center for Disease Control estimates that each year about 10 million new STD infections strike people ages 15 to 24.

1) Which birth control method provides the most effective protection against pregnancy and sexually transmitted disease for sexually active people?

A) the pill B) male latex condoms C) a diaphragm D) the rhythm method Answer: B Topic: 26.3 Reproductive Health Skill: Apply/Analyze Learning Outcome: 26.4 Global LO: 2, 3, 5 2) A diaphragm functions as a birth control device by ________.

A) preventing ovulation B) preventing implantation of an embryo C) stimulating the production of sperm-killing antibodies D) preventing the movement of sperm into the uterus Answer: D Topic: 26.3 Reproductive Health Skill: Apply/Analyze Learning Outcome: 26.4 Global LO: 2, 3, 5

19 .

3) A vasectomy ________.

A) prevents the production of sperm in the testes B) prevents the production of semen C) prevents the movement of sperm out of the testes D) is an effective method to prevent the transmission of sexually transmitted disease Answer: C Topic: 26.3 Reproductive Health Skill: Apply/Analyze Learning Outcome: 26.4 Global LO: 2, 3 Please read the following paragraph and then answer the following questions.

Two researchers addressed the generally accepted idea that boxer shorts are better for male fertility than briefs because they lower testicular temperature. They begin by saying, "Although this idea is regarded as dogma by many in the lay community and the changing of underwear type is a therapy frequently recommended by medical practitioners, there is a paucity of data measuring scrotal temperature as a function of underwear type. ("Munkelwitz, Robert, and Gilbert, Bruce R. "Are boxer shorts really better? A critical analysis of the role of underwear type in male subfertility." The Journal of Urology, 160.4 (1998): 1329-1333.)

4) What hypothesis are these authors testing?

A) Boxer shorts allow the scrotal sac to be more exposed to outside temperature than briefs do.

B) Boxer shorts fit more loosely than briefs.

C) Boxer shorts allow the scrotal sac to have a lower temperature than briefs do.

D) Men with impaired fertility are more likely to wear briefs than boxers.

Answer: C Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9 5) Which experimental design is best to test the idea that scrotal temperature is less with boxers than with briefs?

A) Take an equal number of men wearing boxers and men wearing briefs and have them go into a clinic and have their scrotal temperatures measured.

B) Recruit a number of men of approximately the same age and have some put on boxers and some put on briefs and then measure their scrotal temperatures.

C) Recruit a number of men of approximately the same age with half wearing boxers and half wearing briefs. Have them spend time in a room of the same constant temperature and then measure their scrotal temperatures.

D) Take the first 100 men who come into a fertility clinic, record who are wearing boxers and who are wearing briefs, and then measure their scrotal temperatures.

Answer: C Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9 20 .

6) The data below are average temperatures from an experiment with more than 100 men in boxers and in briefs.

Core Body temp Surface skin temp Scrotal skin temp

Boxers 36.6 30.8 33.8

Briefs 36.5 30.9 33.6

What conclusion can be drawn from these data?

A) Men who wore briefs were cooler overall than men who wore boxers.

B) The type of underwear men wear has no impact on fertility.

C) The generally held idea is confirmed that men who wear boxers have cooler scrotal temperatures than those who wear briefs.

D) Scrotal temperature is not significantly decreased by wearing boxers rather than briefs.

Answer: D Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 4, 5, 7, 9 7) What data besides core, skin, and scrotal temperatures would be good to gather to support or reject the hypothesis that underwear type affects fertility?

A) the size and position of participants' testes B) the number and quality of sperm in wearers of each type of underwear C) the ability of participants to maintain temperature in very cold or very warm conditions D) the fertility of each man's partner Answer: B Topic: 26.2 Human Reproduction Skill: Evaluate/Create Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9

21 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 27 Nervous, Sensory, and Locomotor Systems 27.1 Multiple Choice Questions 1) The ________ is the control center of the nervous system.

A) sympathetic nervous system B) central nervous system C) peripheral nervous system D) parasympathetic nervous system Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 2) The cells that carry electric signals from one part of the body to another in the nervous system are ________.

A) dendrites B) neurons C) effectors D) synapses Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 3) What happens during integration in the nervous system?

A) action potentials are blocked B) multiple threshold potentials are reached at the same time C) sensory signals are interpreted and appropriate responses are planned D) digestive organs are stimulated Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 4) Which neurons are part of the peripheral nervous system?

A) sensory neuron and motor neuron B) interneuron neuron and motor neuron C) interneuron neuron and sensory neuron Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2

1 .

5) Multiple sclerosis involves primarily ________.

A) destruction of the medulla oblongata B) deterioration of the corpus callosum C) destruction of the myelin sheath D) deterioration of parts of the spinal cord Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 Global LO: 5 6) Which structure(s) carry incoming messages toward the cell body of a neuron?

A) axons B) dendrites C) thin filaments D) supporting cells Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 7) Which cells protect, insulate, and reinforce neurons?

A) sensory cells B) motor cells C) supporting cells Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.2 8) The voltage level that triggers an action potential is called the ________.

A) threshold B) membrane potential C) resting potential Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 9) What causes action potentials to be generated?

A) Ions channels are opened and positive ions diffuse out of the cell.

B) Ions channels are opened and positive ions diffuse into the cell.

C) Ions channels are opened and negative ions diffuse into the cell.

Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 2 .

10) The movement of an action potential along a neuron is most like ________.

A) the ripples created by dropping a pebble into a pond, gradually decreasing in size as the waves spread apart B) a crowd at a sporting event doing the wave around a stadium C) a radio tower emitting a signal that reaches only a small region D) the sound of your voice spreading out as you yell loudly to your friend while at a park Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Apply/Analyze Learning Outcome: 27.3 Global LO: 2 11) A neuron can relay a more intense signal by ________.

A) sending a stronger action potential B) sending more action potentials in a given amount of time C) sending an action potential that travels more quickly D) sending a longer action potential Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 12) Complete the analogy: A blanket is to a person as ________.

A) a dendrite is to actin filament B) an action potential is to a neuron C) a synaptic cleft is to a synaptic terminal D) a myelin sheath is to a nerve Answer: D Topic: 27.1 An Overview of Animal Nervous Systems Skill: Apply/Analyze Learning Outcome: 27.3 Global LO: 2 13) Which neurotransmitter is associated with pleasure, attention, memory, sleep, movement and learning?

A) acetylcholine B) epinephrine C) dopamine D) endorphins Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3

3 .

14) Which statement about opiates is TRUE? A) Morphine, codeine, and heroin bind to the receptors for the neurotransmitter endorphin, reducing pain and producing euphoria.

B) Morphine, codeine, and heroin are stimulants and therefore increase pain.

C) Morphine, codeine, and heroin are natural depressants.

Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 Global LO: 5 15) Where would we expect to find electrical synapses?

A) within the brain B) within the heart C) within the spinal cord D) between interneurons and motor neurons Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Apply/Analyze Learning Outcome: 27.3 Global LO: 2 16) Which parts of the body comprise the central nervous system (CNS)?

A) brain but not spinal cord B) spinal cord but not brain C) both brain and spinal cord Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.2, 27.4 17) What cushions structures of the central nervous system, helps supply them with nutrients and hormones, and carries away wastes?

A) cerebrospinal fluid B) spinal cord C) interneurons D) the bones of the skull Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.4

4 .

18) Which effect could result from activation of the sympathetic nervous system?

A) decreased heart rate B) stimulated digestive organs C) secretion of epinephrine D) narrowing of the bronchi Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.4 19) You start an exam and realize that you did not study enough for it. You find it difficult to concentrate because your heart is racing, your stomach seems tied in a knot, you are breathing too quickly, and your mouth is dry. Most likely, you are experiencing the effects of the ________.

A) sensory nervous system B) sympathetic division C) parasympathetic division D) central nervous system Answer: B Topic: 27.2 The Human Nervous System: A Closer Look Skill: Apply/Analyze Learning Outcome: 27.4 Global LO: 2 20) You are out for a walk and start to trip, but you keep your balance and don't fall. Which brain region is responsible for the rapid coordination of muscle activity that kept you from falling?

A) cerebral cortex B) thalamus C) cerebellum D) cerebrum Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.5 21) Which human traits are based in the cerebral cortex?

A) balance and hand-eye coordination B) hunger and thirst C) sex-drive and fight-or-flight response D) imagination and language skills Answer: D Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.5

5 .

22) Which one of the following correctly pairs the structure with its major function(s)?

A) hypothalamus - regulates body temperature, blood pressure, and hunger B) cerebellum - regulates memory, learning, and speech C) brainstem - the input center for sensory data going to the cerebrum D) thalamus - coordinates balance and personality traits Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.5 23) The cerebral cortex is highly folded. Why might this be an advantage for the functions of the cerebrum?

A) The increased surface area increases the area for higher-level thinking.

B) The increased surface area permits greater contact between the cerebrum and the cerebellum.

C) The folds form grooves that let the bones of the skull reach down deeply between brain regions.

D) The folds increase the areas where sensory receptors can reach the brain's surface.

Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Evaluate/Create Learning Outcome: 27.5 Global LO: 2 24) Which scientific finding was supported by the terrible accident that happened to Phineas Gage?

A) The cerebrum plays a major role in the sense of balance.

B) The hypothalamus is essential for life.

C) The frontal lobes are associated with personality.

D) The pons plays a crucial role in hearing.

Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.6 Global LO: 2 25) Alzheimer's disease is characterized by ________.

A) confusion and memory loss B) extreme mood swings and low blood pressure C) loss of energy and suicidal thoughts D) increased energy and extreme talkativeness Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Remember/Understand Learning Outcome: 27.6 Global LO: 5

6 .

26) The receptor potential is the ________.

A) membrane potential produced when a neurotransmitter molecule binds to its receptor B) membrane potential produced in the receptor cell by sensory transduction C) membrane potential produced as an all-or-none phenomenon D) membrane potential produced at a muscle cell Answer: B Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.7 27) ________ is a(n) example of sensory adaptation.

A) Going into deep sleep B) Distinguishing between different colors C) Ignoring the feeling of shoes on your feet D) Detecting sound and light simultaneously Answer: C Topic: 27.3 The Senses Skill: Apply/Analyze Learning Outcome: 27.7 Global LO: 2 28) In contrast to action potentials, receptor potentials ________.

A) are all-or-none phenomena B) vary in intensity C) do not require a stimulus D) do not rely on changes in the membrane potential Answer: B Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.7 29) In all types of chemoreceptors, receptor cells develop receptor potentials in response to ________.

A) changes in the movement of the surrounding molecules B) the electrical properties of the surrounding cells C) chemicals dissolved in a fluid such as blood or saliva D) the addition of positively charged proteins Answer: C Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8

7 .

30) Standing out in center field, a baseball player watches a hitter's bat strike the ball and then, slightly later, hears the sound of the impact. What types of sensory receptors did the player just use?

A) thermoreceptors and chemoreceptors B) photoreceptors and mechanoreceptors C) chemoreceptors and pain receptors D) pain receptors and thermoreceptors Answer: B Topic: 27.3 The Senses Skill: Apply/Analyze Learning Outcome: 27.8 Global LO: 2 31) Thermoreceptors detect ________.

A) motion B) sound C) pressure D) temperature Answer: D Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 32) Which one of the following statements is TRUE? A) Cones are more sensitive to light than rods.

B) Rods can distinguish color.

C) There are three different types of cones in the human eye.

D) The human retina is completely covered with photoreceptors.

Answer: C Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 33) A person who cannot focus well on distant objects has ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: B Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 5

8 .

34) A person who has blurred vision caused by a misshapen lens or cornea has ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: C Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 5 35) A person whose eyeball is shorter than normal suffers from ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: A Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 5 36) Sensory receptors are located in and sound is detected in the ________.

A) outer ear B) hammer C) stirrup D) cochlea Answer: D Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 37) How can drugs that have been shown to increase alertness and a sense of well-being as well as reduce physical and emotional pain also be dangerous?

A) They can disrupt the brain's neural pathways, thereby altering the chemical balances to produce dangerous behaviors or hallucinatory effects.

B) They can reduce the production of cerebrospinal fluid such that the CNS does not receive enough nutrients and hormones.

C) They can interrupt normal functioning of the optic nerve such that action potentials cannot reach the brain.

D) They can weaken the endoskeleton of the human body such that internal organs are not fully protected.

Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 Global LO: 5 9 .

38) I The joint that allows you to rotate your forearm so that your hand changes from a palm up position to a palm down position must be a ________ joint.

A) ball-and-socket B) hinge C) pivot D) twist Answer: C Topic: 27.4 Locomotor Systems Skill: Apply/Analyze Learning Outcome: 27.9 39) Which one of the following is used to combat osteoporosis?

A) calcium and vitamin supplements B) anti-inflammatory medicines C) opiates D) splints or casts Answer: A Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.9 Global LO: 5 40) What best helps a broken bone heal?

A) grafting new bone to the region B) exercising the area with the broken bone C) taking calcium supplements D) returning the broken bone parts back to their natural shape and then immobilizing the bone Answer: D Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.9 Global LO: 5 41) Arthritis is a common result of aging, affecting a person's ability to ________.

A) catch their breath after exercise B) move their joints C) heal broken bones D) produce red blood cells Answer: B Topic: 27.4 Locomotor Systems Skill: Apply/Analyze Learning Outcome: 27.9 Global LO: 2, 5

10 .

42) Muscles are connected to bones by ________.

A) thick filaments B) ligaments C) tendons D) myofibrils Answer: C Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.8 43) Functionally, what is the muscle fiber's fundamental unit of contraction?

A) thick filament B) thin filament C) myofibril D) sarcomere Answer: D Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.10 44) A thick filament is made up of ________.

A) actin B) myosin C) sarcomeres D) myofibrils Answer: B Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.10 45) According to the sliding-filament model of muscle contraction, a sarcomere contracts when its ________.

A) thick filaments slide across the ends of the sarcomere B) thin filaments slide across the ends of the sarcomere C) thin and thick filaments slide further away from each other D) thin and thick filaments slide past each other Answer: D Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.11

11 .

46) Which structure would probably have the largest motor units?

A) a motor unit in the foot that controls toe movements B) a motor unit in the thigh to control leg movements C) a motor unit that controls eye movements D) a motor unit that controls hand movements Answer: B Topic: 27.4 Locomotor Systems Skill: Apply/Analyze Learning Outcome: 27.11 Global LO: 2 47) In a species, what is required for a new sensory adaptation to evolve by natural selection?

A) Individuals that needed this trait mutated a sensory receptor to create the new adaptation.

B) Individuals that possessed this trait produced more offspring than those that did not possess the trait.

C) Individuals that possessed this trait survived by chance, and passed on the trait to their offspring.

D) Individuals immigrated to a new area, and brought the trait with them.

Answer: B Topic: 27 Evolution Connection Skill: Apply/Analyze Learning Outcome: 27.12 Global LO: 2, 7 48) How do neurotoxins benefit humans?

A) When given in large doses, neurotoxins improve dendrite functioning.

B) Researchers use them to enable different steps in signal transmission within the nervous system to better understand how it works.

C) When medicinally administered in low doses, neurotoxins can help treat medical conditions including drug addiction and pain associated with cancer.

D) Neurotoxins amplify the brain's neurotoxicity capacity.

Answer: C Topic: 27 Science and Society Skill: Remember/Understand Learning Outcome: 27.1 Global LO: 5

12 .

49) What evidence exists in the predator-prey relationship of rough-skinned newts (predator) and garter snakes (prey) for the evolution of variation in toxicity in rough-skinned newts and resistance to toxicity in garter snakes? Scientists have observed that ________.

A) After unusually cold winter temperatures five years in a row, rough-skinned newts needed a mutation to increase levels of neurotoxicity, so they evolved it, while garter snakes needed a mutation to increase levels of resistance to that neurotoxin, so they evolved it.

B) Over many generations of random mutation and nonrandom natural selection, rough-skinned newts needed a mutation to increase levels of neurotoxicity, so they evolved it, while garter snakes needed a mutation to increase levels of resistance to that neurotoxin, so they evolved it.

C) After one generation of random mutation, rough-skinned newts with greater and greater neurotoxicity were selected for, while garter snakes with greater and greater resistance to that neurotoxin were selected for.

D) Over many generations of random mutation and nonrandom natural selection, rough-skinned newts with increasing levels of neurotoxicity were selected for, while garter snakes with increasing levels of resistance to that neurotoxin were selected for.

Answer: D Topic: 27 Evolution Connection Skill: Remember/Understand Learning Outcome: 27.12 Global LO: 7

13 .

27.2 Art Questions 1) In the figure, in which step is threshold reached if the stimulus is strong enough and a sufficient number of channels open?

A) Step 1 B) Step 2 C) Step 3 D) Step 4 Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 Global LO: 2, 3 14 .

2) Examine the synaptic cleft presented in the figure. What occurs after step 4?

A) Ion channels open and triggers or inhibits a new action potential on the receiving neuron.

B) The membrane returns to resting potential.

C) The vesicle detaches from the plasma membrane.

Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Remember/Understand Learning Outcome: 27.3 Global LO: 3

15 .

3) The figure shows the human eye. Which part of the eye gives the eye its color?

A) sclera B) iris C) pupil D) retina Answer: B Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 3

16 .

4) The figure shows the structure of the humerus, a bone found in your upper arm. Which part of a bone contains stores fat?

A) red bone marrow B) cartilage C) spongy bone D) yellow bone marrow Answer: D Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.9 Global LO: 3

17 .

5) Examine the structure of a muscle cell in the figure. Which statement about muscle structure is TRUE?

A) Each muscle cell has one nucleus.

B) Each myofibril consists of many muscle cells.

C) Each muscle cell has one sarcomere.

D) A sarcomere contains thick and thin filaments.

18 .

Answer: D Topic: 27.4 Locomotor Systems Skill: Remember/Understand Learning Outcome: 27.10 Global LO: 3 27.3 Scenario Questions Please read the following paragraph and then answer the following questions.

The human eye is an incredible organ capable of gathering light to focus on images near and far, in bright light or dim, and with quick adjustments between these extremes. However, eyes can develop problems, such as floaters, which are small particles that interfere with the transmission of light between the lens and the retina, and bloodshot eyes, which occur when irritants such as dust or smoke get in the eye.

1) Eyes can become bloodshot when irritants in the eye trigger an increased blood flow to the connective tissue covering the eye. These swollen blood vessels are located on the ________.

A) cornea B) sclera C) iris D) lens Answer: B Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 2 2) If floaters are small particles that interfere with the transmission of light between the lens and the retina, they must be located in the ________.

A) pupil B) cornea C) jellylike fluid D) blind spot Answer: C Topic: 27.3 The Senses Skill: Remember/Understand Learning Outcome: 27.8 Global LO: 2

19 .

3) When light levels suddenly increase, our eyes adjust quickly by reducing the size of the ________.

A) pupil B) retina C) iris D) cornea Answer: A Topic: 27.3 The Senses Skill: Apply/Analyze Learning Outcome: 27.8 Global LO: 2 Please read the following paragraph and then answer the following questions.

Huntington's disease is a genetic disorder in which a gene mutation causes the production of an abnormal protein that damages cells in the brain. Symptoms typically begin with changes in personality, and reasoning. Uncoordinated and uncontrolled movements develop, such that physical abilities become limited.

4) Given the symptoms of Huntington's disease, multiple brain structures may be damaged by the abnormal protein. Choose the exception.

A) cerebellum B) cerebral cortex C) hypothalamus Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Apply/Analyze Learning Outcome: 27.4 Global LO: 2, 5, 7 5) Scientists hypothesize that the abnormal protein stops vesicles from moving through the cytoskeleton. Predict the effect of this protein on the nervous system.

A) Neurotransmitters cannot reach the axon terminals to be released.

B) Receptor potentials cannot occur.

C) Cerebrospinal fluid leaks out of the brain.

D) Action potentials become smaller.

Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Evaluate/Create Learning Outcome: 27.4 Global LO: 2, 5, 7

20 .

Please read the following paragraph and then answer the following questions.

Amyotrophic lateral sclerosis (ALS), or Lou Gehrig's disease, is a fatal disorder characterized by muscle weakness. Stumbling when walking or difficulty with using a hand is a typical early symptom. Individuals with ALS lose the ability to consciously control movement, though cognitive and sensory functions generally remain unimpaired. There is currently no cure for ALS. 6) Given the symptoms of ALS, what part of the nervous system is functioning abnormally?

A) parasympathetic nervous system B) motor nervous system C) sympathetic nervous system Answer: B Topic: 27.2 The Human Nervous System: A Closer Look Skill: Evaluate/Create Learning Outcome: 27.4 Global LO: 2, 5 7) In ALS, sensory input and integration are unaffected, and muscle cells still respond to neurotransmitters when they are present. Which structure would you recommend scientists to study to find a cure for ALS? A) sensory neurons B) interneurons C) motor neurons D) mechanoreceptors Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Evaluate/Create Learning Outcome: 27.4 Global LO: 2, 5

21 .

8) In October 2017, scientists presented data at the American Society of Anesthesiologists meeting in Boston, MA which suggested that Botox, a drug derived from the neurotoxin produced by the bacterium Clostridium botulium, can reduce the number of migraines and their duration as well as the amount of pain experienced during migraine episodes in children and teenagers. The study was completed with nine children between the ages of 8 and 17. Before the study began, the study participants reported having migraines anywhere from 8 and 29.5 days each month, and these episodes lasted 30 minutes-24 hours each.

During the study, all participants received Botox injections every 12 weeks for five years; injections were given in both the front and back of the participants' heads and necks. At the end of the five-year study, participants reported suffering from migraines between 2 and 10 days per month, and these episodes lasted 15 minutes-7 hours. Intensity of migraine pain also decreased from pre-study scores between 4 and 8 on a scale of 1-10 (1 being no pain and 10 being terrible pain) to scores of 1.75 to 5 post-study.

As described, what experimental design factor is missing in the Botox study?

A) an experimental group B) a control group C) independent variable D) dependent variable Answer: B Topic: 27 The Process of Science Skill: Apply/Analyze Learning Outcome: 27.11 Global LO: 1, 2, 5

22 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 28 The Life of a Flowering Plant 28.1 Multiple Choice Questions 1) What product(s) used by humans sometimes comes from plants?

A) fuel, but not clothing or food B) clothing, but not fuel or food C) food, but not fuel or clothing D) fuel, clothing, and food Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant, 28 Biology and Society Skill: Remember/Understand Learning Outcome: 28.1 Global LO: 5 2) Most domesticated food crops are ________.

A) mosses B) gymnosperms C) ferns D) angiosperms Answer: D Topic: 28 Biology and Society Skill: Remember/Understand Learning Outcome: 28.1 Global LO: 5 3) What list best characterizes the monocots?

A) embryo with one seed leaf, leaves with parallel veins, stems with vascular bundles scattered, and flower parts in threes B) embryo with one seed leaf, leaves with parallel veins, stems with a ring of vascular tissue, and flower parts in fives C) embryo with two seed leaves, leaf veins not parallel, stems with ring of vascular tissue, and flower parts in fives D) embryo with two seed leaves, leaf veins not parallel, stems with vascular bundles scattered, and flower parts in threes Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.2

1 .

4) The eudicots are characterized by ________.

A) flower parts in threes B) leaves with parallel veins C) an embryo with two seed leaves D) stems with scattered vascular bundles Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.2 5) What is a function of roots?

A) absorbing water, but not food storage or absorbing nutrients from the soil B) absorbing nutrients from the soil, but not food storage or absorbing water C) storing food, but not absorbing water or nutrients from the soil D) storing food and absorbs water and nutrients from the soil Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3 6) What are the tiny projections found on roots that increase the surface area?

A) root hairs B) cotyledons C) nodes D) mesophyll Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3 7) What constitutes the shoot system of a plant?

A) leaves, but not stems or roots B) leaves and stems, but not roots C) stems and roots, but not leaves D) stems, leaves, and roots Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3

2 .

8) Where are leaves attached to a stem?

A) joints B) nodes C) internodes D) cotyledons Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3 9) What structure is a stem modification for storage?

A) tuber B) petiole C) internode D) runner Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3 10) What is the primary function of typical leaves?

A) anchoring B) photosynthesis C) shade D) storage of the sugars produced Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3 11) The condition in which a plant's terminal bud of produces hormones that inhibit growth of axillary buds is ________.

A) biennial B) secondary growth C) apical dominance D) germination Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.3

3 .

12) You trim two different houseplants. The first houseplant becomes bushier, but the pruning does not affect the growth of the second plant. A possible explanation is ________.

A) you removed the axillary bud on the first plant but not the second B) the second plant forms tubers, but the first plant does not C) the first plant has compound leaves and the second plant has simple leaves D) you removed the terminal bud on the first plant but not the second Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.3 Global LO: 2, 5 13) What is the single layer of tightly packed cells that cover the entire root?

A) xylem B) root hairs C) epidermis D) endodermis Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 14) Describe the vascular system of a typical plant.

A) It is made up of xylem and phloem, but does not provide support nor transport nutrients throughout the plant.

B) It is made up of xylem and phloem and provides support, but does not transport nutrients throughout the plant.

C) It is made up of xylem and phloem and transports nutrients throughout the plant, but does not provide support.

D) It is made up of xylem and phloem, transports nutrients throughout the plant, and provides support.

Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 15) What is the waxy coating secreted on leaves and most stems?

A) cuticle B) lignin C) endodermis D) epidermis Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4

4 .

16) The ________ is the selective barrier of a root that determines which substances pass between the cortex and vascular tissue.

A) epidermis B) endodermis C) cuticle D) xylem Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 17) What do guard cells act to regulate?

A) stomata B) cuticle C) epidermis D) root hairs Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 18) What is the main site of photosynthesis in a typical leaf?

A) epidermis B) endodermis C) mesophyll D) xylem Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 19) What is the major component of most plant cell walls?

A) chloroplasts B) lignin C) starch D) cellulose Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4

5 .

20) What cell type provides support in growing parts of a plant?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) water-conducting cells Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 21) What has thick secondary cell walls usually strengthened with lignin?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) water-conducting cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 22) What is the most abundant cell type found in most plants?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) tracheid cells Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 23) What cells form chains with overlapping ends to form a system of water-carrying tubes, and are dead when mature?

A) collenchyma cells B) sclerenchyma cells C) tracheids and vessel elements D) food-conducting cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4

6 .

24) Which cells form tubes and are alive when mature?

A) parenchyma cells B) collenchyma cells C) tracheids and vessel elements D) food-conducting cells Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 25) What is a function of parenchyma cells?

A) food storage, conducting water, and photosynthesis B) photosynthesis, conducting food, and food storage C) dividing and developing to become other types of cells, providing support for active growth, and food storage D) food storage, photosynthesis, and dividing and developing to become other types of cells Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.4 26) A tree grows wider each year because of ________.

A) apical meristem, but not vascular cambium nor cork cambium B) vascular cambium, but not apical meristem nor cork cambium C) vascular cambium and cork cambium, but not apical meristem D) apical meristem, vascular cambium, and cork cambium Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.3, 28.4 Global LO: 2 27) A plant grows taller through ________, which involves cell division in the ________.

A) primary growth; vascular cambium B) secondary growth; vascular cambium C) primary growth; apical meristem D) secondary growth; cork cambium Answer: C Topic: 28.2 Plant Growth Skill: Remember/Understand Learning Outcome: 28.6

7 .

28) What is responsible for the increase in girth (width) of trees?

A) primary growth B) secondary growth C) growth in apical meristems D) an increase in the width of vessel elements Answer: B Topic: 28.2 Plant Growth Skill: Remember/Understand Learning Outcome: 28.6 29) Which plant type(s) complete(s) their life cycle in 2 years?

A) annuals, but not perennials nor biennials B) annuals and perennials, but not biennials C) biennials, but not annuals nor perennials D) perennials, but not annuals nor perennials Answer: C Topic: 28.2 Plant Growth Skill: Remember/Understand Learning Outcome: 28.5 30) A homeowner uses a nail to hang a "Home Sweet Home" sign on the trunk of an oak tree.

The sign is 2 meters above the ground. The tree grows in height at a rate of 10 cm per year. How high above the ground will the sign be in 15 years?

A) 1.5 meters B) 2 meters C) 3.5 meters D) 152 meters Answer: B Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.6 Global LO: 2, 4 31) Flowering plants reproduce through ________.

A) asexual reproduction, but not sexual reproduction B) sexual reproduction, but not asexual reproduction C) asexual reproduction and sexual reproduction D) budding Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8

8 .

32) What is the part of a flower that contains the female reproductive structures?

A) carpel B) stamen C) sepal D) petal Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 33) In which structure do pollen grains develop?

A) stamen B) sepal C) filament D) anther Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 34) The ________ enclose and protect the flower bud, while the ________ advertise the flower to insects and other pollinators.

A) anthers; petals B) carpels; stigmata C) sepals; stamens D) sepals; petals Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 35) The main parts of a flower are modified versions of ________.

A) stems B) rhizomes C) internodes D) leaves Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8

9 .

36) What contains the developing egg and cells that support it?

A) endosperm B) ovule C) anther D) stigma Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 37) A plant's diploid form is called the ________; the haploid form is called the ________.

A) sporophyte; pollen B) sporophyte; gametophyte C) gametophyte; sporophyte D) gametophyte; fruit Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 38) ________ is the delivery of pollen to the stigma.

A) Fertilization B) Double fertilization C) Germination D) Pollination Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 39) The formation of a zygote and a cell with a triploid nucleus is unique to flowering plants and a few gymnosperms. What is this process called?

A) fertilization B) double fertilization C) germination D) pollination Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8

10 .

40) The multicellular mass that nourishes the embryo until it becomes a self-supporting seedling is the ________.

A) endosperm B) seed coat C) fruit D) cotyledon Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 41) What typically has to happen before a fruit develops?

A) flowering, but not pollination or double fertilization B) flowering and pollination, but not double fertilization C) pollination and double fertilization, but not flowering D) flowering, pollination, and double fertilization Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8 42) While on a hike, you notice that several burrs have become attached to your socks. You quickly pull them off. Inside the burr are several seeds. Burrs are produced by certain plants and frequently catch on animal fur (or people's clothing). After thinking about it, you decide that the burr is a type of ________ that is an adaptation for ________.

A) leaf; protecting plants from herbivores B) fruit; seed dispersal C) cambium; seed protection D) pollen grain; successful pollination Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.8, 28.9 Global LO: 2 43) What initiates seed germination?

A) water is taken up by the seed B) warm temperatures are sensed by the seed C) oxygen is present D) sunlight is sufficient Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Remember/Understand Learning Outcome: 28.8

11 .

44) The diploid number for the tomato, a eudicot, is 24. One of its pollen grains has ________ chromosomes, and the nutritive tissue of the seed has ________ chromosomes.

A) 12; 12 B) 12; 24 C) 24; 24 D) 24; 36 Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.8 Global LO: 2, 4, 5, 7 45) Unlike angiosperms, gymnosperms like pines have single instead of double fertilization, but otherwise have an identical life cycle. What structure should show the greatest difference between angiosperms and gymnosperms?

A) egg cell B) seedling C) seed D) leaf cell Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.8 Global LO: 2 46) What describes the interdependence between flowering plants and animals?

A) Most angiosperms depend on insects, birds, or mammals for pollination, but not seed dispersal. Most land animals do not depend on angiosperms for food.

B) Most angiosperms depend on insects, birds, or mammals for pollination, and most land animals depend on angiosperms for food. Most angiosperms do not depend on animals for seed dispersal.

C) Most land animals depend on angiosperms for food, but angiosperms do not depend on any animals for pollination or seed dispersal.

D) Most angiosperms depend on insects, birds, or mammals for pollination and seed dispersal.

Most land animals depend on angiosperms for food.

Answer: D Topic: 28 Evolution Connection Skill: Remember/Understand Learning Outcome: 28.9

12 .

47) Bermudagrass is a plant that is commonly used on golf courses. It has a fibrous root system, and its leaf veins are parallel. As a result of being mowed on a regular basis in golf courses, it spreads via horizontal stems that root at the nodes, rather than by seed. It can live for many years. What is the best classification for bermudagrass on a golf course?

A) It is a perennial monocot that reproduces asexually.

B) It is an annual eudicot that reproduces asexually.

C) It is a perennial eudicot that reproduces sexually.

D) It is an annual monocot that reproduces sexually.

Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant, 28.2 Plant Growth, 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.2, 28.5, 28.8 Global LO: 2, 5 48) Humans domesticated the rose from a wild ancestor with large, scented flowers. Why might fragrant chemicals in flowers be adaptive for wild roses?

A) They attract herbivores.

B) They repel seed dispersal agents.

C) They attract pollinators.

D) They prevent seed germination.

Answer: C Topic: 28 Biology and Society, 28 Evolution Connection Skill: Apply/Analyze Learning Outcome: 28.1, 28.9 Global LO: 2, 5 49) In a sporophyte of an angiosperm, growth occurs at ________ via ________.

A) meristems; mitosis B) meristems; meiosis C) flowers; fertilization D) seeds; dispersal Answer: A Topic: 28.2 Plant Growth, 28.3 The Life Cycle of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.6, 28.8 Global LO: 2, 7

13 .

28.2 Art Questions 1) What is the likely effect of pruning a plant at the dotted line?

A) The plant will grow taller.

B) The plant will increase branching.

C) The plant will produce flowers.

D) The plant will grow more roots.

Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.3 Global LO: 2, 3

14 .

Use this figure to answer the following questions.

2) The arrows in the figure above illustrate ________.

A) germination B) secondary growth C) meiosis D) primary growth Answer: D Topic: 28.2 Plant Growth Skill: Remember/Understand Learning Outcome: 28.6 3) The terminal bud in the figure above eventually differentiates into a flower, which is pollinated and forms a fruit. Which structure has cells with the fewest copies of the plant's genetic material?

A) egg B) endosperm C) petal D) leaf Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.7 Global LO: 2 15 .

Use this figure to answer the questions.

4) Examine the figure. Secondary growth involves cell division in the ________.

A) cork cambium and apical meristem B) vascular cambium and apical meristem C) vascular cambium and cork cambium D) secondary xylem and secondary phloem Answer: C Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.6 Global LO: 2, 3 5) Examine the figure. What process occurs in the cork cambium?

A) mitosis B) meiosis C) pollination D) germination Answer: A Topic: 28.2 Plant Growth, 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 7

16 .

Use this figure to answer the questions.

6) Examine the figure. What process has to occur to produce a haploid embryo sac?

A) meiosis B) meiosis followed by mitosis C) mitosis followed by meiosis D) mitosis Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.8 Global LO: 2, 3 7) Examine the figure. Which structure has the same number of copies of chromosomes as the egg cell?

A) a nucleus in the pollen grain B) endosperm C) flower petal D) leaf Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.8 Global LO: 2, 3

17 .

Please refer to the art of the cross-sections of two trees to answer the following questions.

8) How old are these trees?

A) 3.5 years old B) 7 years old C) 14 years old D) 28 years old Answer: B Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.6 Global LO: 2, 3 9) These trees most likely grew in an environment with ________.

A) constant cold temperatures B) constant warm temperatures C) alternating warm and cold seasons D) It is not possible to predict the temperatures of the trees' environment.

Answer: C Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 3, 7 10) Which statement CORRECTLY compares the growth of these two trees?

A) The two trees grew at the same rate.

B) The tree on the left grew at a slower rate than the tree on the right.

C) The tree on the left grew at a faster rate than the tree on the right.

D) The growth of the two trees cannot be compared with the images shown.

Answer: C Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Evaluate/Create Learning Outcome: 28.6, 28.7 Global LO: 2, 3, 4

18 .

11) What represents one year of growth in the figure?

A) one white ring, plus an adjacent dark ring B) one dark ring C) one white ring D) one dark ring, plus one adjacent white ring plus one more adjacent dark ring Answer: A Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 3 12) What type of plant growth can be observed with these cross-sections?

A) secondary growth B) primary growth C) biennial growth Answer: A Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 3 The width of tree rings provides insights into the environmental conditions experienced by a tree in the past. A way of sampling tree rings without cutting down a tree involves drilling out a narrow cylinder of wood from just beneath the bark to the center of a tree. The image below shows two samples of Picea abies (Norway spruce). The bark of the trees is on the left side, and the center of the trees is on the right, but off the photo. Examine this image to answer the questions.

13) The amount of growth in a season depends on climate conditions. Examine the image, and interpret the pattern of tree growth to estimate the conditions recorded in these trees.

A) It may have been wetter and warmer when the trees were young compared to more recent times.

B) It may have been drier and colder when the trees were young compared to more recent times.

C) Conditions in the past were identical to recent times.

Answer: A Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 3

19 .

14) Describe the pattern of growth for the trees in the image.

A) Rapid growth initially was followed by slower growth.

B) Slow growth initially was followed by rapid growth.

C) Growth was slow and steady.

D) Growth was rapid and steady.

Answer: A Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Apply/Analyze Learning Outcome: 28.6, 28.7 Global LO: 2, 3 15) What type of cells are most likely composing the dark ring of annual growth in the image?

A) tracheids B) food conducting cells C) collenchyma D) apical meristem Answer: A Topic: 28.2 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.4 Global LO: 2, 3 16) What type of meristem produces the annual growth rings?

A) vascular cambium B) cork cambium C) apical meristem Answer: A Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.6 Global LO: 2, 3 17) What is the best category of growth for the plants sampled by these two wood samples?

A) perennial B) biennial C) annual Answer: A Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.5 Global LO: 2, 3

20 .

28.3 Scenario Questions Read the following scenario to answer the following questions.

In late 2006, bee workers in the United States started to notice a disturbing phenomenon: the sudden disappearance of honeybees from commercial hives. This mysterious condition was called "colony collapse disorder," and it has caused a drastic reduction in commercial honeybee populations all over the country. It is estimated that one-third of our food supply relies on bees and is in danger. Crops that rely most heavily on honeybees include apples, almonds, blueberries, and pumpkins. If colony collapse disorder cannot be cured or treated effectively, farmers may have to turn to other insects, perhaps other bee species or even moths.

1) Without honeybees, which process in the life cycle of plants such as apples, almonds, blueberries, and pumpkins is most affected?

A) seed dispersal B) secondary growth C) pollination D) seed germination Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant, 28 Evolution Connection Skill: Remember/Understand Learning Outcome: 28.8, 28.9 Global LO: 5 2) Which plant structure is adapted for attracting beneficial insects such as honeybees?

A) axillary bud B) terminal bud C) flower D) petiole Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant, 28 Evolution Connection Skill: Remember/Understand Learning Outcome: 28.9

21 .

Read the following scenario to answer the following questions.

The North American beaver is a large rodent that builds dams to convert freshwater streams into ponds. Beavers build their dams out of trees, which they cut down using their front teeth.

Beavers also eat the leaves and bark of trees, as well as the starchy roots of water lilies.

3) As a beaver chews from the outside to the inside of a tree, in what order does it encounter plant tissues?

A) secondary xylem ⇒ secondary phloem ⇒ cork ⇒ cork cambium ⇒ vascular cambium B) cork cambium ⇒ cork ⇒ secondary xylem ⇒ vascular cambium ⇒ secondary phloem C) cork ⇒ cork cambium ⇒ vascular cambium ⇒ secondary xylem ⇒ secondary phloem D) cork ⇒ cork cambium ⇒ secondary phloem ⇒ vascular cambium ⇒ secondary xylem Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.4 Global LO: 2 4) When a beaver is eating bark, what plant structures is it ingesting?

A) secondary phloem, cork cambium, and cork B) secondary xylem, secondary phloem, and cork cambium C) primary phloem, cortex, and endodermis D) primary xylem, vascular cambium, and primary phloem Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.4, 28.6 Global LO: 2 5) When a beaver is eating leaves, what plant structure(s) is it ingesting?

A) mesophyll, but not parenchyma nor cork B) parenchyma, but not mesophyll nor cork C) cork, but not mesophyll nor parenchyma D) mesophyll and parenchyma, but not cork Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.4 Global LO: 2

22 .

6) Water lilies store carbohydrates in their roots, which is why beavers like to eat water lily roots. What type of plant cells store these carbohydrates?

A) guard cells B) sclerenchyma cells C) parenchyma cells D) collenchyma cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.4 Global LO: 2 7) Beavers dams are sturdy, because the part of a tree that provides structural support when the tree is alive lends its strength to the dam, even after the tree is dead. What part of a tree provides this structural support?

A) heartwood B) bark C) collenchyma D) parenchyma Answer: A Topic: 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.6 Global LO: 2 8) Water lily shoots and roots have very little structural support. This support is not needed in aquatic habitats. What structures would you be LEAST likely to see in a water lily stem?

A) epidermis B) parenchyma C) sclerenchyma D) tracheids Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.4 Global LO: 2

23 .

Read the following scenario to answer the questions.

The pineapple, grown for its sweet fruit, is a tropical monocot with a diploid number of 50. It can live for many years. The plant starts as one short stem with tough leaves. The flowers of the pineapple are located as a cluster at the very top of the stem. After pollination, the single fruit forms from the fusion of the ovaries of the flowers in the cluster. The seeds are located just underneath the surface of the fruit. The pineapple fruit is harvested by cutting at the base of the fruit. After the first fruit is produced, side shoots grow from the main stem, which can go on to produce additional fruits.

9) The first pineapple on a plant develops from ________, whereas the pineapples from the second harvest of the same plant develop from ________.

A) the terminal bud; the axillary buds B) the terminal bud; the root caps C) the axillary bud; the terminal buds D) primary growth; secondary growth Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant, 28.2 Plant Growth Skill: Apply/Analyze Learning Outcome: 28.3, 28.6 Global LO: 2 10) What evidence best supports the pineapple's classification as a monocot, and not a eudicot?

A) Its pollen grains have one opening.

B) It produces a fruit.

C) Its flowers have three petals each.

D) It has double fertilization.

Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Apply/Analyze Learning Outcome: 28.2 Global LO: 2

24 .

11) Where would we expect to find cells with 25 unpaired chromosomes in a pineapple plant?

A) in the leaves B) in the ovaries prior to pollination C) in the fruit D) in the fused ovaries Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.8 Global LO: 2 Use this scenario to answer the questions.

A renewable alternative to fossil fuels are biofuels. Scientists are searching for the best plants to use as a source of biofuels. Plant sugars can be fermented into ethanol, and then used as an additive to gasoline. Although it is relatively easy to obtain ethanol in this way, this type of ethanol production competes with the need to produce food. Alternatively, biofuels can be fermented from other plant carbohydrates, such as the cellulose in plant cell walls. This is called cellulosic ethanol production.

12) Energy input is required to process plant matter in a way that prepares plant cells for cellulosic ethanol production. Lignin needs to be removed to make cellulose accessible. What plant tissue would require the MOST energy input during this preparation step?

A) secondary xylem B) perennial dermal tissue C) eudicot ground tissue D) monocot mesophyll Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant, 28.2 Plant Growth Skill: Evaluate/Create Learning Outcome: 28.2, 28.4, 28.6 Global LO: 2, 5, 7 13) Cellulases are enzymes that are used to break down cellulose. What type of cell would have cell walls that take the LONGEST for cellulases to break down?

A) sclerenchyma B) parenchyma C) collenchyma Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.3 Global LO: 2

25 .

14) Cellulases are enzymes that are used to break down cellulose. Per unit of mass, which type of cell requires the LEAST amount of cellulase to decompose cell walls?

A) parenchyma B) collenchyma C) sclerenchyma Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.3 Global LO: 2 15) Energy input is required to process plant matter in a way that prepares plant cells for cellulosic ethanol production. Lignin needs to be removed to make cellulose accessible. Why is there a greater efficiency in obtaining biofuels from grassy monocots rather than woody eudicots?

A) Lignin is the main chemical component of wood.

B) Grassy monocots grow with both primary and secondary growth, while woody eudicots only have primary growth.

C) The cell walls of woody eudicots do not contain cellulose.

D) Only grassy monocot cells have central vacuoles, which can store cellulase.

Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Evaluate/Create Learning Outcome: 28.3 Global LO: 2, 5

26 .

Campbell Essential Biology (w/ Physiology chapters), 7e (Simon) Chapter 29 The Working Plant 29.1 Multiple Choice Questions 1) In phytoremediation after a nuclear power plant accident, plants are used to remove ________ and ________ from the soil.

A) carbon; heavy metals B) radioactive isotopes; heavy metals C) nitrogen; phosphorus D) water; sulfur Answer: B Topic: 29 Biology and Society Skill: Remember/Understand Learning Outcome: 29.1 Global LO: 5 2) What aspect of plant nutrition is not found in animal nutrition?

A) Plants use inorganic substances and energy from the sun to produce their own food.

B) Plants use organic substances to produce their own food.

C) Plants absorb food through their roots.

D) Plant and animal nutrition are essentially the same.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Evaluate/Create Learning Outcome: 29.2 Global LO: 7 3) For a plant, carbon and nitrogen are ________.

A) macronutrients B) micronutrients C) minerals D) compost Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.3

1 .

4) A ________ is a chemical element that a plant can only obtain from its environment and is needed to complete its life cycle.

A) macronutrient B) micronutrient C) essential element D) mineral Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 5) What is an example of a plant micronutrient?

A) iron B) oxygen C) sulfur D) phosphorus Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.3 6) The three most important nutrients contained in fertilizers are ________.

A) nitrogen, iron, and phosphorus B) zinc, sulfur, and phosphorus C) nitrogen, phosphorus, and potassium D) zinc, iron, and potassium Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.3 Global LO: 5 7) Substances that enter a plant through the root system are ________.

A) dissolved in water B) obtained from the air C) organic molecules D) brought in through stomata Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2

2 .

8) A typical plant obtains both water and minerals from ________.

A) the air B) bacteria C) sunlight D) the soil Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 9) For plants, mycorrhizae are ________.

A) parasitic B) mutualistic C) an adaptation for photosynthesis D) agricultural pests Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 10) What does a plant gain from a mycorrhizal relationship?

A) It allows roots to absorb water and solutes more rapidly.

B) It increases the surface area for photosynthesis.

C) It helps to break down complex molecules in the soil to release micronutrients.

D) It helps to break down decaying organic matter into essential plant nutrients.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 11) What converts atmospheric nitrogen to ammonium?

A) nitrifying bacteria B) nitrogen-fixing bacteria C) mycorrhizae D) ammonifying bacteria Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2

3 .

12) What converts soil ammonium to nitrate?

A) nitrifying bacteria B) ammonifying bacteria C) mycorrhizae D) nitrogen-fixing bacteria Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 13) Root nodules in plants such as peas and beans are advantageous because they ________.

A) house nitrogen-fixing bacteria B) help absorb nutrients from the soil C) house mycorrhizae D) store nutrients Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 14) Most plants rely on bacteria to supply them with a usable form of ________.

A) nitrogen B) carbon dioxide C) water D) amino acids Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 15) What is the conversion that occurs during nitrogen fixation?

A) ammonium to nitrate B) nitrate to ammonium C) nitrogen to ammonium D) nitrogen to ammonium or nitrate Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2

4 .

16) Transpiration is ________.

A) the loss of oxygen from a plant B) evaporation from a plant's roots C) the bulk flow movement of water in a plant D) the loss of water from plant leaves through evaporation Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 17) What mechanism best explains how xylem sap moves up against the downward pull of gravity?

A) cohesion-tension hypothesis B) gravitropism C) phototropism D) expenditure of ATP Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 18) What weather conditions would cause transpiration to be most rapid?

A) hot, humid weather B) cold, humid weather C) hot, dry weather D) windy, wet weather Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 19) What best describes the opening and closing of the stomata in most plants?

A) They are open during the day and closed at night.

B) They are open at night and closed during the day.

C) They are open almost all of the time.

D) They are closed except for brief periods of time during the day.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5

5 .

20) What best describes the mechanism that causes stomata to open?

A) Water accumulates below the opening and eventually causes the stoma to open.

B) A large bubble of oxygen accumulates below the stoma and eventually causes it to open.

C) Two guard cells flanking each stoma change shape to open or close the stoma.

D) The internal pressure of xylem sap expands the leaf, stretching the stoma open.

Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 21) Transpiration pulls water up a plant because of two mechanisms: ________ describes water molecules sticking together and ________ describes water molecules sticking to the walls of the xylem.

A) cohesion; adhesion B) adhesion; cohesion C) adhesion; gravity D) gravity; cohesion Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 22) What moves phloem sap within a plant?

A) cohesion-tension mechanism B) gravity pulls the phloem sap down C) pressure-flow mechanism D) transpiration Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.6 23) A location in a plant where sugar is being received for storage or consumption is ________.

A) a sugar sink B) a sugar source C) phloem sap D) phloem tube Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.6

6 .

24) A farmer decides she wants to grow certified organic corn and sets out to meet all USDA standards to do so. Her crop grows well for the first 3 years; however, she notices during the 4th and 5th years that plants are getting smaller and producing much less corn. She has not altered farming practices and begins to wonder what is happening. She remembers someone mentioning planting peanuts every 3rd year in place of a corn crop, which leads to much healthier corn. Why would a farmer want to change to a different crop, especially something like peanuts?

A) Planting a legume like peanuts increases water retention in the soil, allowing the following year's corn crop to thrive.

B) Crop rotation with a legume like peanuts will increase nitrogen in the soil, reducing the need for chemical fertilizer.

C) Planting a legume like peanuts increases the available carbon in the soil.

D) Changing from corn to peanuts, a legume, allows the soil to "rest" for a year.

Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.2, 29.4 Global LO: 2, 5 25) In a strawberry plant in the summer, the leaves are ________ and the strawberry fruits are ________.

A) sugar sources; sugar sources B) sugar sources; sugar sinks C) sugar sinks; sugar sources D) sugar sinks; sugar sinks Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.6 Global LO: 2 26) Early in the spring, cherry trees produce flowers, even before their leaves develop, by using sugars that were stored in their roots the previous year. While cherry flowers are developing, we would expect the phloem pressure near flowers to be ________, and ________ near root storage cells.

A) high; high B) high; low C) low; low D) low; high Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.6 Global LO: 2

7 .

27) Trace the flow of a water molecule that is used during photosynthesis, from the environment to the site of photosynthesis.

A) stoma → xylem → root hair → mycorrhiza B) soil → root hair → xylem → stoma → atmosphere C) soil → root hair → xylem → leaf cell D) soil → xylem → leaf cell → atmosphere Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.5 Global LO: 2, 7 28) Which statement is TRUE? A) A given hormone has the same effect on all parts of a plant.

B) A single hormone may have different effects depending on concentration and presence of other hormones.

C) Plants and animals use hormones in very different ways.

D) Large amounts of hormones are required to affect plant growth and development.

Answer: B Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8 29) What plant hormone(s) affect(s) development in the plant body?

A) auxin, cytokinin, and ethylene B) auxin, abscisic acid, and cytokinin C) gibberellin, but not auxin or cytokinin D) auxin, cytokinin, and gibberellin Answer: D Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8 30) What hormone promotes cell elongation in stems?

A) auxin B) cytokinin C) ethylene D) absiscic acid Answer: A Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8

8 .

31) What happens in a twig if the auxin produced by its apical meristem is conveyed equally down all sides?

A) It will elongate.

B) It will branch near its tip.

C) It will produce a flower.

D) It will bend to one side.

Answer: A Topic: 29.2 Plant Hormones Skill: Apply/Analyze Learning Outcome: 29.8 32) Which hormone promotes fruit ripening and dropping of leaves?

A) auxin B) ethylene C) gibberellin D) abscisic acid Answer: B Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8 33) What hormone promotes cell division?

A) auxin B) cytokinin C) gibberellin D) abscisic acid Answer: B Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8 34) What hormone promotes seed germination?

A) auxin B) ethylene C) gibberellin D) abscisic acid Answer: C Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8

9 .

35) Which hormone promotes seed dormancy?

A) cytokinin B) ethylene C) gibberellin D) abscisic acid Answer: D Topic: 29.2 Plant Hormones Skill: Remember/Understand Learning Outcome: 29.8 36) A pea tendril contacts a string or wire and coils around it for support. What does this pea tendril demonstrate?

A) gravitropism B) photoperiod C) thigmotropism D) phototropism Answer: C Topic: 29.3 Response to Stimuli Skill: Remember/Understand Learning Outcome: 29.9 37) Experimental plants that were sent up in space shuttle missions did not exhibit all of their normal tropisms. Which response would you most expect to be lacking from these plants?

A) gravitropism B) photoperiod C) thigmotropism D) phototropism Answer: A Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.9 Global LO: 2 38) What best describes night-neutral plants?

A) The plants flower at night.

B) Plants tend to flower when nights become longer.

C) Plants tend to flower when nights become shorter.

D) The flowering in these plants is not affected by photoperiod.

Answer: D Topic: 29.3 Response to Stimuli Skill: Remember/Understand Learning Outcome: 29.10

10 .

39) What triggers flowering for plants sensitive to photoperiod?

A) temperature B) night length C) day length D) intensity of sunlight Answer: B Topic: 29.3 Response to Stimuli Skill: Remember/Understand Learning Outcome: 29.10 40) What best describe(s) the dependencies of most flowering plants?

A) Many depend on insects or other animals for pollination, but not for seed dispersal.

B) Many depend on insects or other animals for seed dispersal, but not for pollination.

C) Many depend on insects or other animals for pollination and fungi to help them acquire nutrients, but none rely on other organisms for seed dispersal.

D) Many depend on insects or other animals for pollination and seed dispersal, and on fungi to help acquire nutrients.

Answer: D Topic: 29 Evolution Connection Skill: Remember/Understand Learning Outcome: 29.11 41) Across the globe, billions of people eat rice. In order to make rice grains (the seed), a rice plant must flower and be pollinated. Rice plants flower only after days become shorter (i.e., summer to autumn). What is the best classification for rice?

A) long night B) short night C) night neutral D) long day Answer: A Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.10 Global LO: 2, 5

11 .

42) Oats are eaten by humans as oatmeal or rolled oats, and as feed for livestock such as cattle.

In order for an oat plant to make the part we eat (the seed), it must flower and be pollinated.

Typically, oat plants flower when days are lengthening (i.e., late spring to early summer). What is the best classification for oat plants?

A) long night B) short night C) night neutral D) short day Answer: B Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.10 Global LO: 2, 5 43) Three very popular strawberry cultivars grown by farmers in the United States are Earliglow, Ozark Beauty, and Tristar. Earliglow produces all of its fruit in the early summer, before days become very long (June-bearing). Ozark Beauty produces fruit from mid to late summer (everbearing). Tristar produces fruit all summer long, starting when conditions become favorable for flowering and fruit production. What is the best classification for these three strawberry cultivars?

A) Earliglow: long night; Ozark Beauty: short night; Tristar: night neutral B) Earliglow: short night; Ozark Beauty: short night; Tristar: night neutral C) Earliglow: night neutral; Ozark Beauty: short night; Tristar: long night D) Earliglow: short night; Ozark Beauty: long night; Tristar: long neutral Answer: A Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.10 Global LO: 2, 5 44) A farmer applies an organic fertilizer to her apple trees. Does this practice allow her to sell her apples as certified organic?

A) No, because she would also need to protect biodiversity, maintain soil quality, conserve water, and other sustainable agricultural practices.

B) No, because organic fertilizers contain simple minerals that might not be present in the soil.

C) Yes, because the contents of organic fertilizer are biologically-derived.

D) Yes, because the only practices required to be certified organic is the use of organic fertilizers and organic pesticides.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.4 Global LO: 2, 5

12 .

45) What processes contribute directly to soil nitrate concentrations?

A) Nitrification by bacteria and weathering of rock.

B) Nitrification by bacteria, but not weathering of rock.

C) Ammonification, but not nitrification by bacteria.

D) Ammonification and nitrogen fixation by bacteria.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 46) Michael Knoblauch and colleagues have developed methods to measure the pressure flow mechanism directly. Where would they measure high pressure vs. low pressure in a tree if the pressure flow mechanism is transporting sugar from leaves to roots?

A) High pressure near the leaves, and low pressure near the roots.

B) Low pressure near the leaves, and high pressure near the roots.

C) High pressure near both the leaves and roots.

D) Low pressure near both the leaves and roots.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients, 29 The Process of Science Skill: Apply/Analyze Learning Outcome: 29.6, 29.7 Global LO: 2 47) Plant transport products have many economic uses. A product that is correctly paired to its plant structure is ________.

A) maple syrup - xylem sap B) carrots - tubers C) latex - phloem sap Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.5 Global LO: 5 48) Plant transport products have many economic uses. A product that is correctly paired to its structure in a plant is ________.

A) potatoes - tubers B) maple syrup - phloem sap C) latex - phloem sap Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.6 Global LO: 5

13 .

49) A typical plant obtains most of the inorganic matter that forms its dry weight from ________.

A) the air B) bacteria C) sunlight D) the soil Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 29.2 Art Questions 1) Examine the figure. Where is the site of carbon dioxide uptake by a plant?

A) root hairs B) stomata C) rhizomes D) internodes Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.2 Global LO: 2, 3 14 .

2) Examine the figure. What adds ammonium to the soil by decomposing organic matter?

A) nitrifying bacteria, but not ammonifying bacteria or nitrogen fixing bacteria B) ammonifying bacteria, but not nitrifying or nitrogen fixing bacteria C) nitrogen-fixing bacteria, but not nitrifying or ammonifying bacteria D) nitrifying bacteria and nitrogen fixing bacteria, but not ammonifying bacteria Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.2 Global LO: 2, 3 3) In the figure, what produces nitrogen in a form that can be used directly by the plant, without need for conversion?

A) nitrifying bacteria only B) ammonifying bacteria only C) nitrogen-fixing bacteria only D) ammonifying bacteria and nitrogen fixing bacteria Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.2 Global LO: 2, 3

15 .

4) Examine the figure. Why does the shoot bend toward the light?

A) Reduction in auxin levels allows gibberellins to promote cell elongation.

B) Reduction in gibberellin levels allows auxin to promote cell elongation.

C) Increase in auxin levels promotes cell elongation.

D) Increase in auxin levels promotes cell proliferation.

Answer: C Topic: 29.2 Plant Hormones Skill: Apply/Analyze Learning Outcome: 29.8 Global LO: 2, 3 5) What kind of plant response is represented by the bending of the shoot in this figure?

A) phototropism B) gravitropism C) thigmotropism D) photoperiodism Answer: A Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.9 Global LO: 2, 3

16 .

6) The figure shows plants grown in the dark, and illustrates ________ in plants.

A) photoperiod B) gravitropism C) thigmotropism D) phototropism Answer: B Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.10 Global LO: 2, 3 7) The figure shows plants originally grown in the dark, and then a light is added on one side only (arrow). Predict the response of the plants to the addition of the light source.

A) Auxin becomes concentrated on the lighted side of the plants, and the plants begin to grow toward the light.

B) Auxin becomes concentrated on the darker side of the plants, and the plants begin to grow toward the light.

C) Auxin becomes concentrated on the lighted side of the plants, and the plants begin to grow away from the light.

D) Auxin becomes concentrated on the darker side of the plants, and the plants begin to grow away from the light.

Answer: B Topic: 29.3 Response to Stimuli Skill: Apply/Analyze Learning Outcome: 29.10 Global LO: 2, 3 17 .

8) A scientist finds seeds of an unknown plant on top of the soil in a desert. She measures the concentration of two hormones in these seeds. After it rains, she collects more of these seeds, and finds that the concentration of the two hormones has changed. A graph of her results is shown. Identify the most likely hormones measured by the scientist.

A) hormone 1: gibberellin; hormone 2: cytokinin B) hormone 1: auxin; hormone 2: ethylene C) hormone 1: abscisic acid; hormone 2: gibberellin D) hormone 1: ethylene; hormone 2: auxin Answer: C Topic: 29.2 Plant Hormones Skill: Evaluate/Create Learning Outcome: 29.8 Global LO: 2, 3 9) A scientist finds seeds of an unknown plant on top of the soil in a desert. She measures the concentration of two hormones in these seeds. After it rains, she collects more of these seeds, and finds that the concentration of the two hormones has changed. A graph of her results is shown. If the scientist returns to the desert to collect more seeds, a few days later, what should she observe?

A) The seeds that are still in the desert will be dormant.

B) The seeds that are still in the desert will be germinating.

C) The seeds that are still in the desert will be dead.

D) The seeds that are still in the desert will have increased levels of hormones 1 and 2.

Answer: B Topic: 29.2 Plant Hormones Skill: Evaluate/Create Learning Outcome: 29.8 Global LO: 2, 3

18 .

10) What correctly describes the plant nutrients shown in the figure?

A) The list on the left shows macronutrients, and the one on the right shows micronutrients.

B) The list on the left shows micronutrients, and the one on the right shows macronutrients.

C) The list on the left shows micro- and macronutrients, and the one on the right shows micronutrients.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.3 Global LO: 2, 3 11) What plant nutrients are shown in the figure?

A) These are all nutrients that must be obtained from the environment in order to complete the life cycle.

B) These are all nutrients that are required in relatively large amounts.

C) These are all nutrients that are required in extremely small quantities.

D) These are all nutrients that are most often deficient in depleted soils.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.3 Global LO: 2, 3

19 .

12)

This figure shows a typical label for fertilizer. What fertilizer is contained in this bag?

A) An all-purpose fertilizer with 5% nitrogen, 5% phosphorus, and 5% potassium.

B) An organic fertilizer with 5% compost, 5% yard waste, and 5% kitchen scraps.

C) An inorganic fertilizer that will make a plant grow 5% taller, 5% wider, and produce 5% more fruit.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.4 Global LO: 2, 3

20 .

13) What is the difference between the two properties of water shown at label 2 and label 3?

A) Label 2 shows how water molecules adhere to other molecules, while label 3 shows how water molecules hydrogen bond together.

B) Label 2 shows how water molecules hydrogen bond together, while label 3 shows how water molecules adhere to other molecules.

C) Label 2 shows how water transforms from liquid to gaseous form, while label 3 shows how water transforms from gaseous to liquid form.

D) Label 2 shows how water transforms from gaseous to liquid form, while label 3 shows how water transforms from liquid to gaseous form.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.5 Global LO: 2, 3

21 .

14) The force that creates the upward pulling of a string of water molecules is found at ________.

A) Label 1 B) Label 2 C) Label 3 D) Label 4 Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.5 Global LO: 2, 3 15) What can regulate the rate of water movement upward as shown in the figure?

A) the number of leaf stomata B) the amount of sap in the phloem C) the concentration of solutes in the xylem D) the amount of pressure exerted on cell walls Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.5 Global LO: 2, 3

22 .

16) In the figure, for water to flow from Site B to the adjacent xylem ________.

A) Site B must have a lower water pressure than the adjacent xylem B) Site B must have a lower solute concentration than the adjacent xylem C) transpiration must be occurring out of the plant root D) Site A must have a lower water pressure than Site B Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.6 Global LO: 2, 3

23 .

17) In the figure, for sugar to move from the source cell (Label 1) into the phloem (Label 2) ________.

A) active transport is needed to load the phloem tube with sugar B) water must flow to Label 2 from the adjacent xylem C) active transport is needed to drive phloem from Label 2 to Site B D) a sink cell at Label 3 must be removing sugar from the phloem Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.6 Global LO: 2, 3 18) Scientists can now measure phloem pressure directly. Which measurements from a plant, as represented by the figure, would support the pressure flow mechanism of plant transport?

A) Pressure at Site B is lower than pressure at Site A. B) Pressure at Site B is equal to pressure at Site A. C) Pressure at Site B is higher than pressure at Site A. Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients, 29 The Process of Science Skill: Apply/Analyze Learning Outcome: 29.6, 29.7 Global LO: 2, 3, 9

24 .

29.3 Scenario Questions Read the following scenario to answer the following questions.

Nitrogen shortage is a common nutritional problem for plants. In crops, a nitrogen deficiency can result in stunted growth as well as lower nutritional content. Farmers sometimes apply fertilizers containing nitrogen as well as other essential nutrients, such as phosphorus and potassium.

Compost can also be used to fertilize soils. Compost consists of vegetable matter that adds nutrients to soil as it is decomposed by microorganisms, fungi, and animals. Certain plants, including legumes such as peas and beans, house nitrogen-fixing bacteria in swellings called "root nodules." The bacteria have enzymes that help convert atmospheric N2 to ammonium ions that can be readily used by the plants. The plant, in turn, provides the bacteria with other nutrients. When conditions are favorable, root nodule bacteria fix so much nitrogen that the nodules secrete excess ammonia.

1) Some farmers practice crop rotation, alternating between planting nonlegumes such as corn or wheat one year and legumes the next year. What is the advantage of crop rotation?

A) The legumes in the rotation will transfer nitrogen, phosphorus, and potassium to the other crop plants.

B) Planting legumes enriches the soil for the next year when root nodule bacteria fix so much nitrogen that excess ammonia is secreted into the soil.

C) The nitrogen-fixing bacteria in legumes can migrate to nonlegume crop plants and provide them with nitrogen.

D) Any nitrogen fertilizer that is applied to the soil will be converted into ammonium ions by the nitrogen-fixing bacteria.

Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Remember/Understand Learning Outcome: 29.2 Global LO: 5 2) Which approach could an organic farmer use to deal with nitrogen deficiency?

A) plant legumes in alternate years and fertilize the soil with compost B) apply synthetic fertilizers that provide nitrogen C) plant legumes in alternate years and use synthetic fertilizers D) use genetically modified plants that require less nitrogen Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Apply/Analyze Learning Outcome: 29.4 Global LO: 2, 5

25 .

Read the following scenario to answer the following questions.

In the late 1800s, Charles Darwin and his son Francis conducted the first experiments on phototropism. Several years later, their work was furthered by Peter Boysen-Jensen, Arpad Paal, and Frits Went. Peter Boysen-Jensen separated the tip of grass shoots from the rest of the plant using either tiny blocks of agar (a gelatin) or a mica wafer (an impervious rock). Like the Darwins, Boysen-Jensen noticed that the grass did not grow toward a light without its tips.

However, when he separated the tip from the rest of the plant using agar, the grass would grow toward a light. The grass would not grow toward a light if the tip of the shoot was separated using a mica wafer. Arpad Paal cut off the tips of grass shoots that were growing in the dark. He placed these cut tips back on the shoots, but with only part of the tip covering the cut surface, and found that the plants grew, in the dark, in the opposite direction from the side with the tip covering it. Lastly, Frits Went removed the tips of many grass shoots and placed them on a large block of agar for a few hours. Then, he cut up the agar block, and was able to make grass shoots without any tips at all grow toward a light by putting these agar blocks on the cut surfaces of the shoots (i.e., no tips were placed back on the shoots, only the agar).

3) Boysen-Jensen also used the mica to separate a tip of a grass shoot only partially, by cutting the tip halfway and inserting a wafer of mica into the cut. If this experiment supported the Darwins' hypothesis, what would Boysen-Jensen have observed?

A) The grass shoot would not grow toward a light.

B) The grass shoot would grow toward a light when the mica wafer was on the side of the grass that was facing the light.

C) The grass shoot would grow toward a light when the mica wafer was on the side of the grass that was shaded from the light.

D) The grass shoot would grow toward a light no matter which direction the light was coming from.

Answer: B Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Evaluate/Create Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9 4) If Paal grew his plants using a light source that was directly overhead, what should he have observed?

A) The grass shoot would not grow.

B) The grass shoot would grow upward and straight.

C) The grass shoot would grow in the opposite direction from the side with the tip covering the cut surface.

D) The grass shoot would grow in the same direction as the side with the tip covering the cut surface.

Answer: C Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Evaluate/Create Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9

26 .

5) If Wents placed his agar blocks only halfway on the cut surfaces of grass shoots with their tips removed, what should he have observed?

A) The grass shoot would not grow toward a light.

B) The grass shoot would grow toward a light when the agar block was on the side of the grass that was facing the light.

C) The grass shoot would grow toward a light when the agar block was on the side of the grass that was shaded from the light.

D) The grass shoot would grow toward a light no matter which direction the light was coming from.

Answer: C Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Evaluate/Create Learning Outcome: 29.9, 29.10 Global LO: 1, 2, 9 6) Considering the experiments of the Darwins, Boysen-Jensen, Paal, and Went, what do you conclude about phototropism?

A) We still do not know the mechanism for phototropism.

B) The substance that regulates phototropism is produced in the tips of plants, and causes the same response even when it comes from an external source (not from the same individual).

C) For a plant to bend toward a light source, the substance that regulates phototropism must be able to move into cells on the same side as the light source.

D) The substance that regulates phototropism is distributed throughout a plant equally, but cells on the side away from the light source are the only ones that respond to the substance.

Answer: B Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Evaluate/Create Learning Outcome: 29.9, 29.10 Global LO: 1, 2, 9

27 .