Campbell Essential Biology with Physiology, 5th Edition Eric J Simo Test Bank

Campbell Essential Biology with Physiology, 5th Edition BY Eric J. Simon

Email: richard@qwconsultancy.com

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 1 Introduction: Biology Today Chapter 1 Learning Outcomes 1 Biology and Society

1.1.

1.1 1.2.

1.3.

1.4.

1.2 1.5.

1.6.

1.7.

1.3 1.8.

1.9.

1.10 1.11 1.12 1.13 1.14

Describe three examples of how biology is woven into the fabric of society.

The Scientific Study of Life Compare discovery science and hypothesis-driven science. Provide examples of each.

Distinguish science from other styles of inquiry.

Distinguish between a hypothesis and a theory. Explain why natural selection is a scientific theory.

The Nature of Life Describe seven properties or processes we associate with life.

Define a species and describe the goals of taxonomy.

Distinguish between the three domains and four eukaryotic kingdoms of life.

Major Themes in Biology Describe the two main points that Darwin made in his book On the Origin of Species by Means of Natural Selection.

Compare and contrast artificial and natural selection.

Predict how structure and function are correlated using examples.

Identify and explain information flow and how it functions to regulate processes within biological systems.

Contrast the movements of energy and matter through ecosystems.

List and give an example of each level of biological organization, starting with an ecosystem and ending with atoms.

Define emergent properties and predict where they occur.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

1.1 Multiple Choice Questions 1) In what way(s) is the science of biology influencing and changing our culture?

A) by helping us understand the relevance of evolution to human health B) by revealing how mutations in genes can lead to disease C) by providing new tools for forensic investigations D) all of the above Answer: D Topic: 1 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 1.1 Global LO: 5, 7 2) What is biology?

A) the scientific study of life B) the scientific study of the environment C) the scientific study of DNA D) the scientific study of ecosystems Answer: A Topic: 1 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 1.1 3) Which of the following is NOT a property of life?

A) Populations of organisms rarely change over time.

B) Living things exhibit complex but ordered organization.

C) Organisms take in energy and use it to perform all of life's activities.

D) Organisms reproduce their own kind.

Answer: A Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.5 Global LO: 7 4) What are the two main processes upon which ecosystems depend?

A) speciation and evolution B) nutrient recycling and energy flow C) decomposition and nutrient recycling D) sunlight and photosynthesis Answer: B Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.12 5) Which of the following is NOT recycled but is lost from ecosystems?

A) nitrogen B) energy 2 .

C) magnesium D) carbon Answer: B Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.12 6) Which of the following is a producer?

A) oak tree B) earthworm C) sun D) cat Answer: A Topic: 1.3 Major Themes in Biology Skill: Application/Analysis Learning Outcome: 1.12 Global LO: 2 7) Humans are ________.

A) producers B) producers and consumers C) consumers D) producers and decomposers Answer: C Topic: 1.3 Major Themes in Biology Skill: Application/Analysis Learning Outcome: 1.12 Global LO: 2 8) Which of the following structures can perform all the activities required for life?

A) DNA molecules B) cells C) organelles D) nuclei Answer: B Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.5

3 .

9) Relative to prokaryotic cells, eukaryotic cells are usually ________.

A) larger and more complex B) smaller and simpler C) larger and equally complex D) smaller and more complex Answer: A Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7 10) Humans are composed of ________ cells.

A) bacterial B) eukaryotic C) plant D) prokaryotic Answer: B Topic: 1.2 The Nature of Life Skill: Application/Analysis Learning Outcome: 1.1 Global LO: 2, 7 11) What name is given to the functional compartments of a cell?

A) genomes B) nuclei C) genes D) organelles Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.13 12) The DNA of a eukaryotic cell is found within the ________.

A) archaea B) nucleus C) prokaryotic cell D) insulin Answer: B Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7

4 .

13) What are eukaryotic genes composed of?

A) RNA B) organelles C) RNA and DNA D) DNA Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.11 14) What is a gene?

A) a type of eukaryotic cell B) an organelle that houses DNA C) a type of prokaryotic cell D) a unit of inheritance Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.11 15) The human genome consists of about ________ chemical letters.

A) 300,000 B) 1 million C) 3 billion D) 300 billion Answer: C Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.11 16) More than half of all known species are ________.

A) plants B) insects C) bacteria D) vertebrates Answer: B Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7

5 .

17) Taxonomy is the ________.

A) study of cells B) naming and classifying of species C) study of organisms and their interaction with the environment D) study of genes Answer: B Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.6 18) How does taxonomy assist biologists?

A) by providing easily remembered scientific names for organisms B) by categorizing diverse items into smaller and smaller numbers of groups C) by reducing life to its smallest common denominator, the cell D) all of the above Answer: B Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.6 19) Which domain(s) consist(s) of prokaryotic cells?

A) Bacteria only B) Eukarya only C) Archaea and Eukarya D) Bacteria and Archaea Answer: D Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7 20) Which kingdom of Eukarya consists primarily of unicellular organisms?

A) Plantae B) Bacteria C) Fungi D) Protista Answer: D Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7

6 .

21) A newly discovered multicellular organism obtains food by digesting dead organisms. Such an organism is most likely a member of the kingdom ________.

A) Plantae B) Fungi C) Protista D) Animalia Answer: B Topic: 1.2 The Nature of Life Skill: Application/Analysis Learning Outcome: 1.7 Global LO: 2 22) Members of the kingdom Plantae differ from members of the other kingdoms of Eukarya in that most members of the kingdom Plantae ________.

A) are decomposers B) are unicellular C) are consumers D) produce their own food Answer: D Topic: 1.2 The Nature of Life Skill: Knowledge/Comprehension Learning Outcome: 1.7 23) The branch of biology that explains both the diversity and the unity of life is ________.

A) evolution B) microbiology C) taxonomy D) genetics Answer: A Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.8 Global LO: 7 24) Which of these is most closely associated with Darwin?

A) energy flow B) ecosystem structure C) the three domains of life D) natural selection Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.8

7 .

25) Which of these is required for natural selection to occur?

A) inheritance B) unequal reproductive success C) individual variation D) all of the above Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.9 26) What does "adaptation" mean in an evolutionary context?

A) the way an individual's body adjusts to its environment B) the accumulation of favorable variations in a population over time C) the ability of organisms to alter their appearance under changing environmental conditions D) all of the above Answer: B Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.8 Global LO: 7 27) What accounts for the different breeds of domesticated dogs?

A) overproduction B) natural selection C) competition D) artificial selection Answer: D Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.9 28) Over a span of two decades, scientists measured changes in the beak size of a population of Galápagos ground finches. This ________.

A) provided evidence of natural selection in action B) is an example of artificial selection C) is an example of overproduction D) led Darwin to his theory of evolution through natural selection Answer: A Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.9

8 .

29) Science is ________.

A) the inquiry-based effort to describe and explain nature B) the search for truth C) an organized set of principles for how to behave ethically and morally D) all of the above Answer: A Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.3 Global LO: 1 30) What is the difference between discovery science and hypothesis-driven science?

A) Discovery science "discovers" new knowledge, whereas hypothesis-driven science does not.

B) Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.

C) Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.

D) Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Application/Analysis Learning Outcome: 1.2 Global LO: 2 31) Which of these statements is CORRECT? A) Scientific ideas are subjected to repeated testing.

B) Science can be used to prove or disprove the idea that deities or spirits cause earthquakes and other natural disasters.

C) Science does not require observations that other people can confirm.

D) Only discovery science can lead to important conclusions about nature.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.2 Global LO: 1 32) Discovery science is primarily based on ________.

A) hypothesis testing B) deduction C) experimentation D) observation Answer: D Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.2 Global LO: 1 9 .

33) Which of these would be a valid scientific hypothesis?

A) Human history is determined by a series of supernatural events.

B) Humans should help in the conservation of other animal species.

C) Humans are controlled by forces beyond our understanding.

D) Humans and bacteria share a common genetic code.

Answer: D Topic: 1.1 The Scientific Study of Life Skill: Application/Analysis Learning Outcome: 1.4 Global LO: 1, 2 34) A hypothesis is a(n) ________.

A) tentative answer to a question B) guess C) observation D) theory Answer: A Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.4 Global LO: 1 35) You try to start your car, but it does not start. Which of these is a hypothesis?

A) My car's battery is dead.

B) If I recharge the battery, then my car will start.

C) My car is too old to function properly.

D) What is wrong with my car?

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Application/Analysis Learning Outcome: 1.4 Global LO: 1, 2 36) You try to start your car, but it does not start. Which of these is a prediction?

A) My car's battery is dead.

B) If I recharge the battery, then my car will start.

C) My car is too old to function properly.

D) What is wrong with my car?

Answer: B Topic: 1.1 The Scientific Study of Life Skill: Application/Analysis Learning Outcome: 1.4 Global LO: 1, 2

10 .

37) Which of the following are the proper components of the scientific method?

A) experiment, conclusion, application B) question, observation, experiment, analysis, prediction C) observation, question, hypothesis, prediction, experiment, results, conclusion D) observation, question, opinion, conclusion, hypothesis Answer: C Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.2 38) How do hypotheses differ from theories?

A) Theories are more comprehensive than hypotheses.

B) Theories must be testable; hypotheses do not need to be testable.

C) Hypotheses are educated guesses, and theories are tentative explanations.

D) Hypotheses are derived from experimentation, whereas theories are derived from observation.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Knowledge/Comprehension Learning Outcome: 1.4 Global LO: 1 39) Antibiotic resistance evolves in bacteria when ________.

A) the presence of antibiotics favors bacteria that already have genes for resistance B) farmers do not use enough antibiotics in animal feed C) the antibiotics create resistance genes in bacteria D) none of the above Answer: A Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.9 40) Regulation in biological systems depends on feedback, which is an example of information flow. When diabetes destroys insulin-producing cells, what information flow is disrupted?

A) The body is unable to send signals that indicate the amount of sugar in the blood.

B) Cells in the bladder are no longer able to send signals when the bladder fills.

C) The pancreas is unable to produce enzymes to break down proteins.

D) Appetite signals no longer regulate feeding.

Answer: A Topic: 1.3 Major Themes in Biology Skill: Knowledge/Comprehension Learning Outcome: 1.11 Global LO: 2, 7

11 .

41) Information flow in biological systems is necessary for negative or regulative feedback to operate. Which of these examples does NOT involve flow of information providing feedback?

A) Heat receptors send signals to promote sweating.

B) Low blood sugar causes the liver to convert starch to sugar to be released in the blood.

C) Drought kills many trees.

D) Bacterial genes for breaking down lactose are activated in the presence of lactose.

Answer: C Topic: 1.3 Major Themes in Biology Skill: Synthesis/Evaluation Learning Outcome: 1.11 Global LO: 2, 7 42) Which of these results would you predict to occur if climate change results in increased warming global temperatures?

A) Species competition will result in slower evolution in the tropics.

B) The tree line (at which it is too cold for trees to grow) moves toward the north and south poles.

C) Winters will be longer toward the poles.

D) Land animals will suffer fewer consequences than marine animals.

Answer: B Topic: 1.3 Major Themes in Biology Skill: Synthesis/Evaluation Learning Outcome: 1.14 Global LO: 2, 5, 7

12 .

1.2 Art Questions 1) Using the branching tree of life for bears depicted in the accompanying figure, choose from among the following bear species the one that is most distantly related to the sun bear.

A) brown bear B) sloth bear C) spectacled bear D) giant panda Answer: D Topic: 1.3 Major Themes in Biology Skill: Synthesis/Evaluation Learning Outcome: 1.9 Global LO: 2, 3

13 .

2) In the process of evolution by natural selection illustrated in the accompanying figure, which of the following is the mechanism or agent of natural selection?

A) artificial selection B) selective breeding C) selective predation D) genetic drift Answer: C Topic: 1.3 Major Themes in Biology Skill: Application/Analysis Learning Outcome: 1.9 Global LO: 2 14 .

1.3 Scenario Questions Please use the following information to answer the following question(s).

The collared lizard is a species found in the Desert Southwest. Male collared lizards show considerable color variation, ranging from brightly colored to a very dull pattern. Your goal is to determine the function, if any, of male color patterns in collared lizards, using the scientific method. Your tentative explanation is that male color plays a role in attracting females for mating purposes. You predict that females will preferentially choose brightly colored males over dull-colored ones. To test your prediction, you observed the interactions of female collared lizards with their male counterparts. You selected males that were the same age and size, and that differed only in their coloration pattern. You placed equal numbers of the two types of male lizards, bright and dull, in aquariums, along with one female lizard per aquarium. Out of 350 aquariums observed, the female chose to mate with the brightly colored male 277 times, and the dull-colored male 70 times. In three instances, the females did not mate with either type.

Create a bar graph of your data, plotting the type of male (dull or brightly colored) on the x-axis.

On the y-axis, plot the frequency with which each type of male was chosen by females. Using this graph, answer the following questions.

1) Is it reasonable to conclude (i.e., is it supported by the data) that female collared lizards prefer more brightly colored male lizards over dull-colored males?

A) Yes, this conclusion is supported by the data.

B) No, this conclusion is not supported by the data.

C) The data do not clearly indicate a preference one way or the other.

D) None of the above choices are correct.

Answer: A Topic: 1.1 The Scientific Study of Life Skill: Synthesis/Evaluation Learning Outcome: 1.2 Global LO: 2, 3, 4, 9 2) Dull-colored males were used in this experiment to ________.

A) serve as a comparison (control) group to the brightly colored males B) be sure that females could recognize the gender of the other lizards C) give the experiment more trials so that the data would be more persuasive D) be sure all females had a male with which they could mate Answer: A Topic: 1.1 The Scientific Study of Life Skill: Synthesis/Evaluation Learning Outcome: 1.2 Global LO: 1, 2, 9

15 .

3) Which of the following is the hypothesis of this case study?

A) Male collared lizards exhibit color variation.

B) Dull-colored males are less likely to be eaten by predators.

C) A function of male coloration is to attract females.

D) Males prefer brightly colored females.

Answer: C Topic: 1.1 The Scientific Study of Life Skill: Synthesis/Evaluation Learning Outcome: 1.2 Global LO: 1, 2 4) "Male collared lizards show considerable color variation." This is a(n) ________.

A) hypothesis B) conclusion C) observation D) result Answer: C Topic: 1.1 The Scientific Study of Life Skill: Application/Analysis Learning Outcome: 1.2 Global LO: 1, 2 5) Which of the following conclusions can be drawn from the data?

A) Dull-colored females are more likely to choose dull-colored males.

B) Dull-colored males are likely to choose dull-colored females.

C) Brightly colored males are stronger and more fertile than dull-colored males D) Females do not always choose brightly colored males.

Answer: D Topic: 1.1 The Scientific Study of Life Skill: Synthesis/Evaluation Learning Outcome: 1.2 Global LO: 1, 2, 3, 4 6) If the proportion of brightly colored male lizards increased steadily in future generations, this would ________.

A) reject the original hypothesis B) be an example of evolution due to natural selection C) illustrate the relationship between structure and function D) demonstrate the flow of energy through a system Answer: B Topic: 1.1 The Scientific Study of Life and Topic 1.3 Major Themes in Biology Skill: Synthesis/Evaluation Learning Outcome: 1.4, 1.9, 1.10, 1.12 Global LO: 2, 7

16 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 2 Essential Chemistry for Biology Chapter 2 Learning Outcomes 2 Biology and Society: Radioactivity and Health 2.1. Define radiation and explain how it can be dangerous. Explain how radiation can be used in medicine.

2.1 Some Basic Chemistry 2.2. Distinguish between matter, mass, elements, and compounds. Give examples of each.

2.3. Explain why trace elements are important for human health.

2.4. Describe the relative size, location, and electrical charge of protons, neutrons, and electrons within an atom. Explain how the atomic number, mass number, and atomic mass are determined.

2.5. Define an isotope and explain how radioactive isotopes are used in biological research and medicine.

2.6. Distinguish between ionic, covalent, and hydrogen chemical bonds.

2.7. Describe the structure of water and explain how its shape makes water a polar molecule.

2.8. Distinguish between the reactants and products of chemical reactions.

2.2 Water and Life 2.9. Describe the four life-supporting properties of water. Describe an example of how each property affects some form of life.

2.10. Distinguish between the chemical properties of acids, bases, and neutral solutions.

Explain how buffers stabilize the pH of acidic and basic solutions.

2.11. Describe the potential impact of rising levels of carbon dioxide on the pH of the ocean.

2 Evolution Connection: Radioactivity as an Evolutionary Clock 2.12. Explain how radioactive isotopes are used in radiometric dating.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

2.1 Multiple Choice Questions 1) How can radiation be controlled and safely used in medicine?

A) Apply radiation throughout the body at uncontrolled doses.

B) Apply radiation throughout the body at controlled doses.

C) Apply radiation to specific parts of the body at uncontrolled doses.

D) Apply radiation to specific parts of the body at controlled doses.

Answer: D Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.1 2) ________ is an example of an element.

A) Water B) Carbon C) Glucose D) Salt Answer: B Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.2 3) The four most common elements found in living organisms are ________.

A) nitrogen, oxygen, phosphorus, and carbon B) carbon, oxygen, nitrogen, and hydrogen C) carbon, oxygen, potassium, and calcium D) oxygen, calcium, hydrogen, and carbon Answer: B Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.2 4) Which of the following elements, essential to life, is a trace element?

A) phosphorus B) carbon C) iodine D) calcium Answer: C Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.3

2 .

5) In order to have a positive charge, an atom must have ________.

A) more protons than electrons B) more electrons than protons C) more neutrons than protons D) more protons than neutrons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.4 6) All atoms of an element have the same number of ________.

A) protons plus neutrons B) protons C) electrons D) neutrons Answer: B Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.4 7) An atom's ________ are found in its nucleus.

A) neutrons and protons B) protons only C) neutrons and electrons D) electrons, protons, and neutrons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.4 8) Beryllium's atomic mass is 9, and its atomic number is 4. How many neutrons are found in a beryllium atom?

A) 9 B) 13 C) 4 D) 5 Answer: D Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.4 Global LO: 2, 4

3 .

9) An uncharged atom of gold has an atomic number of 79 and an atomic mass of 197. This atom has ________ protons, ________ neutrons, and ________ electrons.

A) 79... 118... 79 B) 118... 79... 118 C) 118... 276... 118 D) 79... 34... 79 Answer: A Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.4 Global LO: 2, 4 10) The way Earth moves about the sun is most like ________.

A) a neutron and electron moving around a proton B) an electron moving around the nucleus of an atom C) a proton moving about an electron D) a neutron moving about a proton Answer: B Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.4 Global LO: 2 11) Isotopes of an element have the same number of ________ and different numbers of ________.

A) protons... neutrons B) protons... electrons C) neutrons... protons D) electrons... protons Answer: A Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.5 12) How do radioactive isotopes differ from isotopes?

A) Radioactive isotopes have more neutrons than do isotopes.

B) Radioactive isotopes are stable; isotopes are unstable.

C) Radioactive isotopes have fewer neutrons than do isotopes.

D) Radioactive isotopes are unstable; isotopes are stable.

Answer: D Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.5

4 .

13) An atom with an electrical charge is a(n) ________.

A) isotope B) molecule C) ion D) compound Answer: C Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6 14) The bond between oppositely charged ions is a(n) ________ bond.

A) ionic B) polar C) hydrogen D) covalent Answer: A Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6 15) In the following reaction, what type of bond is holding the two atoms together?

K+Cl → K+ + Cl− → KCl A) hydrophilic B) ionic C) hydrophobic D) covalent Answer: B Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.6 Global LO: 2 16) What name is given to bonds that involve the sharing of electrons?

A) covalent B) hydrogen C) ionic D) polar Answer: A Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6

5 .

17) Sulfur has an atomic number of 16. How many covalent bonds can sulfur form?

A) 1 B) 2 C) 4 D) 0 Answer: B Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.6 Global LO: 2, 4 18) The hydrogen and oxygen atoms of a water molecule are held together by ________ bonds.

A) ionic B) hydrogen C) covalent D) polar Answer: C Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6, 2.7 19) Why is water considered a polar molecule?

A) The oxygen atom is found between the two hydrogen atoms.

B) The oxygen atom attracts the hydrogen atoms.

C) The oxygen end of the molecule has a slight negative charge, and the hydrogen end has a slight positive charge.

D) Both hydrogen atoms are at one end of the molecule, and the oxygen atom is at the other end.

Answer: C Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.7 20) Adjacent water molecules are joined by ________ bonds.

A) covalent only B) ionic C) polar and covalent D) hydrogen Answer: D Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6, 2.7

6 .

21) Adjacent water molecules are connected by the ________.

A) sharing of electrons between the hydrogen of one water molecule and the oxygen of another water molecule B) electrical attraction between the hydrogen of one water molecule and the oxygen of another water molecule C) sharing of electrons between adjacent oxygen molecules D) electrical attraction between the hydrogen atoms of adjacent water molecules Answer: B Topic: 2.1 Some Basic Chemistry Skill: Knowledge/Comprehension Learning Outcome: 2.6, 2.7 22) How many oxygen atoms are in the products of the following reaction?

C6H12O6 + 6 H2O + 6 O2 → 6 CO2 + 12 H2O A) 18 B) 6 C) 12 D) 24 Answer: D Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.8 Global LO: 2, 4 23) What are the reactant(s) in the following chemical reaction?

C6H12O6 + 6 H2O + 6 O2 → 6 CO2 + 12 H2O A) CO2 and H2O B) C6H12O6, H2O, and O2 C) O2 only D) C6H12O6, H2O, O2, CO2, and H2O Answer: B Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.8 Global LO: 2 24) Human body cells are approximately ________ water.

A) 95–99% B) 25–35% C) 50–55% D) 70–95% Answer: D Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9

7 .

25) The tendency of molecules of the same kind to stick together is called ________.

A) bonding B) cohesion C) polarity D) adhesion Answer: B Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9 26) Why (if you are careful) are you able to float a needle on the surface of water?

A) Water has adhesive properties.

B) The surface tension that is a result of water's cohesive properties makes this possible.

C) The covalent bonds that hold a water molecule together make this possible.

D) A single needle is less dense than water.

Answer: B Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9 27) Sweating cools your body by ________.

A) cohesion B) radiation C) evaporative cooling D) hydrogen bonding Answer: C Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9 28) As water freezes, ________.

A) its molecules move farther apart B) it cools the surrounding environment C) its hydrogen bonds break apart D) it loses its polarity Answer: A Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9

8 .

29) Sugar dissolves when stirred into water. The sugar is the ________, the water is the ________, and the sweetened water is the ________.

A) solution... solvent... solute B) solute... solvent... solution C) solvent... solute... solution D) solution... solute... solvent Answer: B Topic: 2.2 Water and Life Skill: Application/Analysis Learning Outcome: 2.9 Global LO: 2 30) Which of the following is an acid?

A) NaOH B) NaCl C) HCl D) CH4 Answer: C Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.10 31) A base ________.

A) removes H2O molecules from a solution B) decreases the pH of a solution C) removes OH— ions from a solution D) removes H+ ions from a solution Answer: D Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.10 32) The lower the pH of a solution, the ________.

A) greater the number of oxygen atoms B) more acidic the solution C) less toxic the solution D) higher the OH— concentration Answer: B Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.10

9 .

33) Relative to a pH of 6, a pH of 4 has a ________.

A) 200 times higher H+ concentration B) 100 times higher H+ concentration C) 20 times higher H+ concentration D) 100 times lower H+ concentration Answer: B Topic: 2.2 Water and Life Skill: Application/Analysis Learning Outcome: 2.10 Global LO: 2, 4 34) What name is given to substances that resist changes in pH? A) buffers B) solutions C) acids D) bases Answer: A Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.10 35) When a base is added to a buffered solution, the buffer will ________.

A) donate OH− ions B) accept water molecules C) donate H+ ions D) form covalent bonds with the base Answer: C Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.10 36) Which of the following is NOT a potential impact of ocean acidification?

A) Decreasing H+ concentrations B) Coral bleaching C) Changes in metabolism of marine animals D) Increasing carbonic acid concentrations Answer: A Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.11

10 .

37) A fossil was found and determined by radiometric dating to be 11,400 years old. What is the ratio of carbon-14 to carbon-12 in this fossil compared to its environment?

A) 12.5% B) 25% C) 37.5% D) 50% Answer: B Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.12 Global LO: 2, 4 2.2 Art Questions 1) Examine the drawing of an atom below. The art is technically INCORRECT in that ________.

A) neutrons are not located in the nucleus B) the electrons should be much farther away from the nucleus C) electrons do not orbit the nucleus D) electrons do not have a negative charge Answer: B Topic: 2.1 Some Basic Chemistry Skill: Synthesis/Evaluation Learning Outcome: 2.4 Global LO: 2

11 .

2) All of the representations in the following figure EXCEPT one clearly show double bonds.

Choose the exception.

A) electron configuration B) structural formula C) space-filling model D) ball-and-stick model Answer: C Topic: 2.1 Some Basic Chemistry Skill: Application/Analysis Learning Outcome: 2.6 Global LO: 2

12 .

3) Examine the pH scale below. How does household bleach compare to household ammonia?

A) Household ammonia has 100 times higher H+ concentration than household bleach.

B) Household bleach has 10 times higher H+ concentration than household ammonia.

C) Household bleach has 100 times higher H+ concentration than household ammonia.

D) Household ammonia has 10 times higher H+ concentration than household bleach.

Answer: D Topic: 2.2 Water and Life Skill: Application/Analysis Learning Outcome: 2.10 Global LO: 2, 4 13 .

4) The graph below shows data regarding radioactive decay of carbon-14. If decay continues to occur normally, how much C-14 will remain after 22,800 years?

A) 25% B) 12.5% C) 6.25% D) 3.125% Answer: C Topic: 2.1 Some Basic Chemistry Skill: Synthesis/Evaluation Learning Outcome: 2.12 Global LO: 2, 3, 4 2.3 Scenario Questions Please read the following scenario to answer the following questions.

The last few miles of the marathon are the most difficult for Heather. Her hair is plastered to her head, sweat clings to her arms, and her legs feel as if they had nothing left. Heather grabs a cup of ice water. The ice cubes smash against her nose as she gulps some cool refreshment and keeps on running. Then a breeze kicks up and she finally feels some coolness against her skin. Drops of sweat, once clinging to her forehead, now spill down, and Heather feels a stinging as the sweat flows into her eyes.

1) Why did the sweat on Heather's forehead and arms form drops?

A) because of the high salt content of sweat B) because of the cohesive nature of water C) because of the ability of water to moderate heat D) because of the high evaporative cooling effect of water Answer: B Topic: 2.2 Water and Life Skill: Application/Analysis Learning Outcome: 2.9 14 .

2) When Heather grabbed the glass of ice water, the ice cubes were floating at the top. Why were the ice cubes floating in the water?

A) Water can store large amounts of heat.

B) Water can moderate temperatures through evaporative cooling.

C) The density of water decreases when it freezes.

D) Water has a cohesive nature.

Answer: C Topic: 2.2 Water and Life Skill: Knowledge/Comprehension Learning Outcome: 2.9 Please read the following scenario to answer the following questions.

While radioactive isotopes are used in medicine to identify tumors and other diseases, they can also be used to treat diseases such as cancer. One method to treat cancerous tumors is to expose them to radiation, which can kill the cancerous cells and the tumor. In 2013, the U.S. Food and Drug Administration approved a new cancer treatment based on the radioactive isotope radium223; this isotope has a half-life of 11.4 days. The radioactive drug, known as Xofigo®, is injected into the patient's bloodstream and travels to certain regions of the body. Because it emits high-energy radiation over short distances, it can kill cancerous cells in the sites where it localizes.

After the drug was injected into a person, the following data were collected regarding the amount of radiation measured in different organs in the person's body.

Organ Measured radiation Brain 0.37 Liver 11.01 Bones 4262.60 Lungs 0.27 Urinary bladder 14.90 3) Which of the following would be the best experiment to determine whether this drug is an effective treatment option for cancer patients?

A) Give the drug to a single cancer patient and ask him how he feels several months later.

B) Give the drug to a group of mice that have artificially induced tumors and measure whether their tumors are destroyed.

C) Give the drug to a group of cancer patients and measure whether their tumors are destroyed.

D) Give the drug to a single cancer patient and measure whether her tumor is destroyed.

Answer: C Topic: 2.1 Some Basic Chemistry Skill: Synthesis/Evaluation Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 3, 5, 9

15 .

4) A cancer patient receives an injection of the drug on March 1. Suppose that the patient must receive a second injection once the amount of the drug decreases to less than 6% in his or her body. On approximately what day should the cancer patient schedule an appointment to receive another injection?

A) March 13 B) March 23 C) April 3 D) April 25 Answer: D Topic: 2.1 Some Basic Chemistry Skill: Synthesis/Evaluation Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 4, 5, 9 5) Using the table above, what kind of cancer do you think Xofigo® is used to treat?

A) liver cancer B) bone cancer C) brain cancer D) lung cancer Answer: B Topic: 2.1 Some Basic Chemistry Skill: Synthesis/Evaluation Learning Outcome: 2.1, 2.5 Global LO: 1, 2, 3, 5, 9

16 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 3 The Molecules of Life Chapter 3 Learning Outcomes 3 Biology and Society: Got Lactose?

3.1.

Describe the causes and consequences of lactose intolerance.

3.1

Organic Compound

3.2.

3.3.

Describe the special bonding properties of carbon that allow it to form an endless variety of organic molecules.

Compare a dehydration reaction to a hydrolysis reaction.

3.2

Large Biological Molecules

3.4.

3.9.

Compare the structures and roles of monosaccharides, disaccharides, and polysaccharides in living organisms. Give examples of each.

Describe the unique properties of lipids.

Compare the structure and properties of saturated and unsaturated fatty acids.

Distinguish between steroids and anabolic steroids, and explain how the use of anabolic steroids can be dangerous to a person’s health.

Describe the structure of proteins, and explain how the structure of a protein relates to its function.

Describe and compare the structures of DNA and RNA.

3

Evolution Connection: The Evolution of Lactose Intolerance in Humans

3.5.

3.6.

3.7.

3.8.

3.10. Explain why we think that lactose intolerance has a genetic basis and why it has evolved differently in humans spread throughout the world.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

3.1 Multiple Choice Questions 1) People with lactose intolerance do not have enough ________.

A) lactose B) lactase C) glucose D) fructose Answer: B Topic: 3 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 3.1 2) A single carbon atom can form a maximum of ________ covalent bond(s).

A) 0 B) 1 C) 2 D) 4 Answer: D Topic: 3.1 Organic Compounds Skill: Knowledge/Comprehension Learning Outcome: 3.2 3) The following molecule is best described as a(n) ________.

CH3–CH2–CH2–CH2 A) protein B) carbohydrate C) organic compound D) inorganic compound Answer: C Topic: 3.1 Organic Compounds Skill: Application/Analysis Learning Outcome: 3.2 Global LO: 2 4) ________ is a hydroxyl group.

A) –NH2 B) –OH C) –COOH D) –H Answer: B Topic: 3.1 Organic Compounds Skill: Knowledge/Comprehension Learning Outcome: 3.2 5) In the following reaction, galactose is a ________. galactose + glucose → lactose + water A) polysaccharide 2 .

B) monomer C) polymer D) protein Answer: B Topic: 3.1 Organic Compounds Skill: Knowledge/Comprehension Learning Outcome: 3.3 6) What name is given to the following reaction? galactose + glucose → lactose + water A) hydrolysis B) hydrogenation C) glycolysis D) dehydration Answer: D Topic: 3.1 Organic Compounds Skill: Knowledge/Comprehension Learning Outcome: 3.3 7) What name is given to the following reaction? sucrose + water → glucose + fructose A) hydrogenation B) hydrolysis C) glycolysis D) dehydration Answer: B Topic: 3.1 Organic Compounds Skill: Application/Analysis Learning Outcome: 3.3 Global LO: 2 8) Carbohydrates typically include ________.

A) an NH2 group B) C, H, and O atoms C) N and S atoms D) a PO4 group Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4

3 .

9) Which of the following are isomers?

A) glucose and fructose B) glucose and sucrose C) sucrose and glucose D) lactose and maltose Answer: A Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 10) Complete the equation: monosaccharide + monosaccharide → ________ + water A) disaccharide B) polypeptide C) polysaccharide D) fat Answer: A Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 11) In the following equation, lactose is a ________. galactose + glucose → lactose + water A) nucleic acid B) fatty acid C) disaccharide D) dipeptide Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 12) Table sugar is ________.

A) glucose, a monosaccharide B) glucose, a disaccharide C) sucrose, a monosaccharide D) sucrose, a disaccharide Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4

4 .

13) For good health, it is important to include ________ in our diets.

A) fructose B) monosaccharides C) disaccharides D) polysaccharides Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 Global LO: 5 14) Which of the following is an example of a polysaccharide?

A) glucose B) starch C) maltose D) sucrose Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 15) Animals store carbohydrates as ________.

A) cellulose B) glycogen C) starch D) maltose Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4 16) Cellulose is an example of ________.

A) a polypeptide B) a steroid C) fiber D) fat Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.4

5 .

17) Which of the following is hydrophilic?

A) cellulose B) testosterone C) butter D) cholesterol Answer: A Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.4 Global LO: 2 18) Sometimes when I have my morning coffee, which I drink black with no cream or sugar, I notice a thin film floating on top of the coffee. Since I have just read Chapter 3 of the text, I now realize the nature of this substance and so I run to my friend screaming, "Look at this ________ in my coffee!"

A) hydrophilic substance B) hydrophobic substance C) disaccharide D) polysaccharide Answer: B Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.4 Global LO: 2, 5 19) A glycerol with three fatty acids attached is referred to as a ________.

A) prostaglandin B) nucleic acid C) steroid D) fat Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.5 20) What name is given to the following reaction? glycerol + 3 fatty acids → triglyceride + 3 water molecules A) glycolysis B) hydrolysis C) hydrogenation D) dehydration Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.3, 3.5

6 .

21) Saturated fats are saturated with ________.

A) carbon B) nitrogen C) hydrogen D) oxygen Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.6 22) By definition, what type of fatty acid has double bonds?

A) steroid B) triglyceride C) unsaturated D) saturated Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.6 23) Which of the following is lowest in unsaturated fats?

A) beef B) salmon C) corn oil D) canola oil Answer: A Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.6 Global LO: 2, 5 24) A fat that is hydrogenated is ________.

A) more unsaturated B) easier to digest C) more solid D) less likely to cause strokes Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.6

7 .

25) Which of the following is a health effect of a diet high in saturated fats?

A) increased risk of infectious disease B) decreased risk of atherosclerosis C) increased risk of heart attack D) decreased risk of stroke Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.6 Global LO: 5 26) ________ is a steroid.

A) Butter B) Sucrose C) Amino acid D) Estrogen Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.7 27) A friend of yours appears to have put on a lot of muscle very quickly. At the same time, you notice that your friend seems to have a lot of mood swings and appears depressed. It is reasonable for you to suspect that your friend has begun to take ________.

A) amino acid supplements B) creatine C) protein powder D) an anabolic steroid Answer: D Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.7 Global LO: 2, 5, 7 28) Enzymes are ________.

A) amino acids B) monosaccharides C) phospholipids D) proteins Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.8

8 .

29) Proteins are polymers constructed from ________ monomers.

A) hydrocarbon B) amino acid C) nucleotide D) fatty acid Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.8 30) Amino acids include a side group as well as ________.

A) a central carbon, a hydrogen atom, an amino group, and a carboxyl group B) a central carbon, a hydrogen atom, a hydroxyl group, and a carbonyl group C) a central nitrogen, a carbon atom, a hydroxyl group, and a carbonyl group D) a central nitrogen, a carbon atom, an amino group, and a carbonyl group Answer: A Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.8 31) What is the name given to the reaction that breaks peptide bonds?

A) dehydration B) hydrogenation C) hydrolysis D) glycolysis Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.3, 3.8 32) A protein's function is most dependent on its ________.

A) pH B) shape C) size D) weight Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.8

9 .

33) Extremophilic bacteria are able to survive in hostile environments, including scalding hot water as well as springs and vents that reach temperatures over 100°C. Researchers studying these bacteria measured the function of a protein from an extremophile bacterium at 100°C, and they also measured the function of a similar protein from a human cell at 100°C. Which of the following results do you think the researchers obtained?

A) The bacterial protein functioned normally, whereas the human protein did not.

B) The human protein functioned normally, whereas the bacterial protein did not.

C) The bacterial protein and the human protein both functioned normally.

D) Neither the human protein nor the bacterial protein functioned normally.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Synthesis/Evaluation Learning Outcome: 3.8 Global LO: 1, 2 34) Nucleic acids are polymers of ________ monomers.

A) monosaccharide B) fatty acid C) DNA D) nucleotide Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9 35) A specific stretch of DNA that programs the amino acid sequence of a polypeptide is a ________.

A) gene B) protein C) nucleic acid D) enzyme Answer: A Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9 36) DNA nucleotides include ________.

A) uracil, guanine, adenine, and cytosine B) thymine, guanine, adenine, and cytosine C) thymine, uracil, adenine, and cytosine D) thymine, guanine, adenine, and uracil Answer: B Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9

10 .

37) Which of the following is TRUE with regard to a DNA molecule?

A) The amount of adenine is equal to the amount of guanine, and the amount of thymine is equal to the amount of cytosine.

B) The amount of adenine is equal to the amount of cytosine, and the amount of guanine is equal to the amount of thymine.

C) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of uracil.

D) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9 38) If one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand?

A) GACGTCA B) AGTACTG C) GTCATGA D) TCATGAC Answer: D Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.9 Global LO: 2 39) How does RNA differ from DNA? A) RNA is double-stranded; DNA is single-stranded.

B) RNA is a polymer of amino acids; DNA is a polymer of nucleotides.

C) RNA contains uracil; DNA contains thymine.

D) In RNA G pairs with T; in DNA G pairs with C. Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9 40) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence ________.

A) AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU Answer: B Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.9 Global LO: 2 11 .

41) The ability to tolerate lactose throughout life most likely arose in ________.

A) populations that live in cold climates B) populations that live in wet climates C) cultures that keep dairy herds D) Native Americans Answer: C Topic: 3 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 3.10 3.2 Art Questions 1) Examine the two sugars in the following figure. How do these two sugars compare?

A) Glucose has more hydrogen.

B) Glucose has more double bonds.

C) They have the same formula but different structures.

D) They are structurally identical in every way.

Answer: C Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.4 Global LO: 2

12 .

2) The figure below shows ________.

A) a single strand of RNA B) double-stranded RNA C) a single strand of DNA D) double-stranded DNA Answer: C Topic: 3.2 Large Biological Molecules Skill: Knowledge/Comprehension Learning Outcome: 3.9 3) Oleic acid is a fatty acid that occurs naturally in many animal and vegetable fats and oils.

What can you tell about oleic acid just by looking at its structure?

A) Oleic acid is an unsaturated fatty acid.

B) Oleic acid is a saturated fatty acid.

C) Oleic acid is a trans fatty acid.

D) Oleic acid is a hydrophilic fatty acid.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.6 Global LO: 2, 3

13 .

3.3 Scenario Questions Please read the following scenario to answer the following questions.

While shopping, you settle on two types of cookies. The nutritional label for the chocolate mint cookies lists 5 grams of saturated fat, 0 grams of trans fat, 22 grams of carbohydrates, and 11 grams of protein per serving. The nutritional label for the peanut butter cookies lists 0 grams of saturated fat, 5 grams of trans fat, 26 grams of carbohydrates, and 4 grams of protein per serving.

1) Which cookies are less healthy?

A) The chocolate mint cookies because they contain more saturated fat.

B) The chocolate mint cookies because they contain more total grams of protein and carbohydrates.

C) The peanut butter cookies because they contain more trans fat.

D) The peanut butter cookies because they contain more grams of carbohydrates.

Answer: C Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5 2) The manufacturer of the chocolate mint cookies changed the ingredients of its cookies. Each serving now has 1 gram of saturated fat (4 fewer grams), 4 grams of trans fat (4 more grams), 21 grams of carbohydrates (1 fewer gram), and 11 grams of protein (no change). Do you think that the manufacturer made these cookies healthier?

A) No, because they now have less saturated fat.

B) Yes, because they now have less saturated fat.

C) Yes, because they now have fewer grams of carbohydrates.

D) No, because they now have more grams of trans fat.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Application/Analysis Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5

14 .

3) The amount of carbohydrates in a food product is usually separated into two groups: 1) sugars, which refers only to mono- and disaccharides, and 2) fiber. Out of the 22 grams of total carbohydrates, there are 12 grams of sugars and 2 grams of fiber in the chocolate mint cookies.

All of the following statements EXCEPT for one are true. Choose the exception.

A) There are more mono- and disaccharides than cellulose in the cookies.

B) There are 8 grams of carbohydrates in the cookies that are not monosaccharides, disaccharides, or fiber.

C) The majority of the carbohydrates in the cookies will be able to be broken down via hydrolysis reactions when eaten.

D) There are 6 grams of monosaccharides and 6 grams of disaccharides in the cookies.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Synthesis/Evaluation Learning Outcome: 3.4, 3.6, 3.8 Global LO: 2, 4, 5

15 .

Please read the following scenario to answer the following questions.

Cooking oils, such as olive oil, are largely made up of unsaturated fats. If you have ever heated cooking oil in a pan, you might have noticed that eventually the oil begins to smoke. The temperature when this occurs is called the "smoke point." At the smoke point, the fatty acids and glycerol molecules that make up the unsaturated fats in the oil begin to break down and form smoke. Different oils have different smoke points, and these smoke points depend on the molecular composition of the oils. Below is a table with data for four different types of cooking oils, including their smoke points (values are for 1 tablespoon each [15 ml]).

Type of cooking oil Olive Avocado Canola Peanut

Smoke Point Calories Saturated fat (g) Unsaturated fat (g) (∘F) 119 1.9 11.4 375 124 1.6 11.9 520 120 1.0 12.0 400 119 2.3 10.3 450

4) Suppose that you wanted to conduct an experiment to determine the smoke points of the oils listed in the table. What would be the experiment that would give you the best information to determine which oil has the highest smoke point?

A) Add some olive oil to a pan, heat it over a flame, and measure the temperature of the oil when it begins to smoke. Repeat for the other three oils.

B) Mix all four oils in a pan, heat them over a flame, and measure the temperature of the oil mixture when it begins to smoke.

C) Add some olive oil to a pan, heat it over a flame, and measure how long it takes for the oil to begin to smoke. Repeat for the other three oils.

D) Mix all four oils in a pan, heat them over a flame, and measure how long it takes for the oil mixture to begin to smoke.

Answer: A Topic: 3.2 Large Biological Molecules Skill: Synthesis/Evaluation Learning Outcome: 3.5 Global LO: 1, 2, 5 5) Which of the following statements about the data in the table is TRUE? A) Saturated fat content and smoke point are positively correlated (related to one another).

B) There is a negative (inverse) correlation between unsaturated fat content and smoke point.

C) You can use the saturated fat content of an oil to reliably predict the smoke point of an oil.

D) Unsaturated fat content and smoke point are not correlated.

Answer: D Topic: 3.2 Large Biological Molecules Skill: Synthesis/Evaluation Learning Outcome: 3.5 Global LO: 1, 2, 3, 5

16 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 4 A Tour of the Cell Chapter 4 Learning Outcomes 4 Biology and Society: Antibiotics: Drugs that Target Bacterial Cells

4.1.

Explain how antibiotics specifically target bacteria while minimally harming the human host.

4.1

The Microscopic World of Cells

4.2.

Compare the following pairs of terms, noting similarities and differences: 1) prokaryotic cells versus eukaryotic cells and 2) plant cells versus animal cells.

4.2

Membrane Structure

4.3.

Describe the structure of cell membranes, and explain why the plasma membrane is called a “fluid mosaic.”

Compare the structures and functions of a plant cell wall with the extracellular matrix of an animal cell.

4.4.

4.3

The Nucleus and Ribosomes: Genetic Control of the Cell

4.5.

Explain how the genetic information in the nucleus is used to direct the production of proteins in the cytoplasm.

4.4

The Endomembrane System: Manufacturing and Distributing Cellular Products

4.6.

Compare the structures and functions of the following components of the endomembrane system: nuclear envelope, rough endoplasmic reticulum, smooth endoplasmic reticulum, Golgi apparatus, lysosomes, and vacuoles.

4.5

Energy Transformation: Chloroplasts and Mitochondria

4.7.

Compare the structure and function of chloroplasts and mitochondria, and explain what structures in chloroplasts and mitochondria result in adaptive advantages.

Describe the evidence that suggests that mitochondria and chloroplasts evolved by endosymbiosis.

4.8.

4.6

The Cytoskeleton: Cell Shape and Movement

4.9.

Describe the functions of the cytoskeleton and compare the structures and functions of cilia and flagella.

4

Evolution Connection: The Evolution of Antibiotic Resistance in Humans

4.10. Explain how and why antibiotic-resistant bacteria have evolved.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

4.1 Multiple Choice Questions 1) Plants are susceptible to bacterial infections, which can damage their structure or even kill them. Which of the following would be the best antibiotic to treat a plant that is infected with bacteria?

A) a drug that interferes with mitochondria function B) a drug that disrupts cell wall structure and function C) a drug that destroys the central vacuole D) a drug that blocks gene expression in circular chromosomes Answer: D Topic: 4 Biology and Society Skill: Synthesis/Evaluation Learning Outcome: 4.1 Global LO: 2, 5 2) Which theory states that all living things are composed of cells?

A) cell theory B) Hooke's rule C) evolutionary theory D) Mendel's law Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Knowledge/Comprehension Learning Outcome: 4.2 3) Which of the following is a feature of prokaryotic cells but NOT eukaryotic cells?

A) pili B) cell wall C) flagella D) DNA Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Knowledge/Comprehension Learning Outcome: 4.2

2 .

4) When using a microscope to view cells you obtained from scraping under your fingernails, you notice that the cells lack nuclei; therefore, you conclude that the cells must be a type of ________ cell.

A) plant B) eukaryotic C) fungal D) prokaryotic Answer: D Topic: 4.1 The Microscopic World of Cells Skill: Application/Analysis Learning Outcome: 4.2 Global LO: 2 5) One difference between eukaryotic and prokaryotic cells is that eukaryotic cells ________ prokaryotic cells.

A) have DNA, which is lacking in B) have membrane-enclosed structures called organelles, which are lacking in C) have a plasma membrane, which is lacking in D) have a nucleoid region, which is lacking in Answer: B Topic: 4.1 The Microscopic World of Cells Skill: Knowledge/Comprehension Learning Outcome: 4.2 6) In eukaryotic cells, what name is given to the region between the nucleus and the plasma membrane?

A) cytoplasm B) phospholipid bilayer C) nucleoid D) chloroplast Answer: A Topic: 4.1 The Microscopic World of Cells Skill: Knowledge/Comprehension Learning Outcome: 4.2 7) You find a cell of a type you have never seen before. The cell has both a nucleus and a cell wall. Therefore, you conclude that it is likely to be a(n) ________ cell.

A) prokaryotic B) animal C) bacterial D) plant Answer: D Topic: 4.1 The Microscopic World of Cells Skill: Application/Analysis Learning Outcome: 4.2 Global LO: 2 3 .

8) Which of the following is a function of the plasma membrane?

A) regulate the traffic of chemicals in and out of the cell B) regulate the production of lipids in the cell C) regulate the production of DNA in and out of the nucleus D) regulate the production of proteins in the cell Answer: A Topic: 4.2 Membrane Structure Skill: Knowledge/Comprehension Learning Outcome: 4.3 9) ________ are the major lipids of plasma membranes.

A) Steroids B) Fatty acids C) Starches D) Phospholipids Answer: D Topic: 4.2 Membrane Structure Skill: Knowledge/Comprehension Learning Outcome: 4.3 10) When mixed with water, phospholipids spontaneously form membranes because they ________.

A) have hydrophilic phosphate groups that are attracted to water and hydrophobic fatty acid tails that avoid water B) have hydrophilic fatty acid tails that are attracted to water and hydrophobic phosphate groups that avoid water C) have hydrophilic heads that are attracted to their hydrophobic tails D) are both fluid and mosaic Answer: A Topic: 4.2 Membrane Structure Skill: Knowledge/Comprehension Learning Outcome: 4.3 11) The concept of a membrane as a fluid mosaic reflects the ability of ________.

A) phospholipids and most proteins to drift about in the plane of the membrane B) phospholipids but not proteins to drift about in the plane of the membrane C) most proteins but not phospholipids to drift about in the plane of the membrane D) carbohydrates to drift into and out of the membrane structure Answer: A Topic: 4.2 Membrane Structure Skill: Knowledge/Comprehension Learning Outcome: 4.3

4 .

12) The extracellular matrix of animal cells ________.

A) protects and support cells B) provides avenues for the exchange of DNA C) is a warehouse for the storage of extra lipids and carbohydrates D) is primarily a site of dead matter and waste materials Answer: A Topic: 4.2 Membrane Structure Skill: Knowledge/Comprehension Learning Outcome: 4.4 13) ________ store the information necessary to produce proteins.

A) Lysosomes B) Genes C) Ribosomes D) Carbohydrates Answer: B Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 14) The nuclear envelope is composed of ________.

A) chromatin B) DNA C) a double membrane D) carbohydrates Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 15) The structural combination of DNA and protein forms ________.

A) nucleoli B) RNA C) chromatin D) ribosomes Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5

5 .

16) Most human cells contain ________ chromosomes.

A) 36 B) 46 C) 2 D) 23 Answer: B Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 17) Which of the following structures manufactures the components of ribosomes?

A) nucleus B) cytoplasm C) endoplasmic reticulum D) nucleolus Answer: D Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 18) Some ribosomes are suspended in the cytosol of a cell, whereas other ribosomes ________.

A) make proteins inside the nucleus B) are found on the plasma membrane C) are attached to the smooth endoplasmic reticulum D) are attached to the outside of the nucleus Answer: D Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 19) Where does protein synthesis take place?

A) in the nucleolus B) on smooth endoplasmic reticulum C) on ribosomes D) in the nucleus Answer: C Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5

6 .

20) Information is transferred from the nucleus to ribosomes via ________.

A) mRNA B) rough endoplasmic reticulum C) DNA D) smooth endoplasmic reticulum Answer: A Topic: 4.3 The Nucleus and Ribosomes: Genetic Control of the Cell Skill: Knowledge/Comprehension Learning Outcome: 4.5 21) The endomembrane system includes ________.

A) ribosomes, lysosomes, vacuoles, and the endoplasmic reticulum B) Golgi apparatus, nucleolus, vacuoles, and the endoplasmic reticulum C) Golgi apparatus, lysosomes, ribosomes, and the endoplasmic reticulum D) Golgi apparatus, lysosomes, vacuoles, and the endoplasmic reticulum Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 22) A hormone that will be secreted from a cell is manufactured by ribosomes ________.

A) attached to the endoplasmic reticulum B) attached to the Golgi apparatus C) attached to the plasma membrane D) inside the nucleus Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 23) Based on its function in detoxifying drugs, you would expect to find a large amount of smooth ER in ________ cells.

A) brain B) liver C) intestinal D) muscle Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 Global LO: 5

7 .

24) Functions of the smooth endoplasmic reticulum include ________.

A) steroid synthesis, protein synthesis, and drug detoxification B) lipid synthesis, protein synthesis, and drug detoxification C) lipid synthesis, steroid synthesis, and drug detoxification D) lipid synthesis, steroid synthesis, and storage of genetic information Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 25) What structures move proteins from the ER to the Golgi apparatus?

A) transport proteins B) central vacuole C) transport vesicles D) nucleolus Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 26) Which of the following is a function of the Golgi apparatus?

A) digestion of organic matter inside the cell B) protein modification C) drug detoxification D) cell respiration Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 27) Which of the following parts of a cell is (are) most like the shipping center of a company?

A) the Golgi apparatus B) mitochondria C) chloroplasts D) the nucleolus Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Application/Analysis Learning Outcome: 4.6 Global LO: 2

8 .

28) Lysosomes are responsible for ________.

A) lipid synthesis B) cellular respiration C) digestion of organic matter inside the cell D) protein synthesis Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 29) If a cell's lysosomes burst, the cell would ________.

A) shrivel B) divide into two cells C) digest itself D) need to manufacture more lysosomes Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Application/Analysis Learning Outcome: 4.6 Global LO: 2 30) Tay-Sachs disease results from ________ lacking a specific type of lipid-digesting enzyme.

A) the Golgi apparatus B) lysosomes C) mitochondria D) the endoplasmic reticulum Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 Global LO: 5 31) Vacuoles are ________.

A) membranous sacs B) manufactured by ribosomes C) composed of microtubules D) found only in plant cells Answer: A Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6

9 .

32) A protist that contains contractile vacuoles most likely lives ________.

A) in a marine environment B) within the cells of another organism C) in fresh water D) in ice Answer: C Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 33) In plant cells, ________ may contain organic nutrients, pigments, and poisons.

A) mitochondria B) chloroplasts C) lysosomes D) central vacuoles Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 34) Plant cells, unlike animal cells, are characterized by the presence of a ________.

A) cell wall and a contractile vacuole B) cell wall and a central vacuole C) nucleus and a cell wall D) nucleus and a contractile vacuole Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.6 35) Cells in the thyroid gland produce and secrete thyroid hormone (a polymer of amino acids) that helps to regulate metabolism. What organelle is most likely abundant in cells of the thyroid gland?

A) mitochondria B) rough endoplasmic reticulum C) free ribosomes D) lysosomes Answer: B Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Application/Analysis Learning Outcome: 4.6 Global LO: 2

10 .

36) During a race such as a marathon, the skeletal muscle cells in your legs use a lot of energy to continually contract and power your muscles. What organelle is most likely abundant in skeletal muscle cells?

A) mitochondria B) Golgi apparatus C) smooth endoplasmic reticulum D) rough endoplasmic reticulum Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Application/Analysis Learning Outcome: 4.6, 4.7 Global LO: 2, 5 37) Similar to the nucleus, chloroplasts and mitochondria are ________.

A) surrounded by two membranes B) able to synthesize carbohydrates C) manufactured by the nucleolus D) able to synthesize lipids Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Knowledge/Comprehension Learning Outcome: 4.7 38) Which plant organelle is responsible for photosynthesis?

A) smooth endoplasmic reticulum B) mitochondrion C) ribosome D) chloroplast Answer: D Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Knowledge/Comprehension Learning Outcome: 4.7 39) Cellular respiration can be described as the conversion of the energy ________.

A) of sunlight to energy stored in organic compounds B) stored in food molecules to energy stored in ATP C) stored in ATP to energy stored in food molecules D) stored in ATP to energy used to do work Answer: B Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Knowledge/Comprehension Learning Outcome: 4.7

11 .

40) Which of the following is an adaptation to increase the surface area of a part of a cell that is involved in cellular respiration?

A) the cristae of a mitochondrion B) the outer membrane of a chloroplast C) the grana of a chloroplast D) the endoplasmic reticulum Answer: A Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Knowledge/Comprehension Learning Outcome: 4.7 41) Microtubules are associated with ________.

A) cilia B) flagella C) cell shape D) all of the answer choices Answer: D Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Knowledge/Comprehension Learning Outcome: 4.9 42) Tobacco smokers (and those exposed to tobacco smoke) are at greater risk of an ectopic (tubal) pregnancy. Based on your understanding of the structures of the cytoskeleton, what is the BEST explanation?

A) Tobacco interferes with the microtubule network of eggs thus weakening their structure.

B) Tobacco interferes with the functioning of the flagella propelling sperm.

C) Tobacco interferes with microfilament formation in sperm, thereby forcing the zygote to implant in a fallopian tube.

D) Tobacco interferes with the sweeping motion of cilia that aids in the movement of the egg toward the uterus.

Answer: D Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Application/Analysis Learning Outcome: 4.9 Global LO: 2, 5

12 .

4.2 Art Questions 1) Using the figure below for a reference, approximately how many times larger is a nucleus compared to a protein?

A) 10 times larger B) 100 times larger C) 1,000 times larger D) 10,000 times larger Answer: C Topic: 4.1 The Microscopic World of Cells Skill: Application/Analysis Learning Outcome: 4.2 Global LO: 2, 3, 4 13 .

2) Examine the structures of the plant and animal cells below. Which of the following organelles connect(s) to the nuclear envelope?

14 .

A) the Golgi apparatus B) lysosomes C) mitochondria D) the endoplasmic reticulum Answer: D Topic: 4.4 The Endomembrane System: Manufacturing and Distributing Cellular Products Skill: Knowledge/Comprehension Learning Outcome: 4.5, 4.6 Global LO: 3 3) The figure below shows a Paramecium, a single-celled freshwater protist. The hairlike structures visible on the Paramecium allow it to move. These structures are ________.

A) microfilaments B) intermediate filaments C) flagella D) cilia Answer: D Topic: 4.6 The Cytoskeleton: Cell Shape and Movement Skill: Application/Analysis Learning Outcome: 4.9 Global LO: 2, 3

15 .

4) The child shown in the figure below is not feeling well. Why does the poster say "No Antibiotics Please"?

A) His illness may be caused by an allergy to penicillin.

B) Antibiotics should be taken only to promote growth.

C) His illness is caused by bacteria.

D) His illness is caused by a virus.

Answer: D Topic: 4 Evolution Connection Skill: Application/Analysis Learning Outcome: 4.10 Global LO: 2, 5

16 .

4.3 Scenario Questions Read the following scenario to answer the following questions.

The earliest cells detectable in fossils were different from the cells in animals, plants, fungi, and protists living today. These first prokaryotic cells gave rise to eukaryotic cells approximately 1.7 billion years ago. The structure of eukaryotic cells today suggests how they might have evolved from their prokaryotic ancestors. Scientists examining mitochondria and chloroplasts now think that these organelles were probably free-living prokaryotes before becoming a part of eukaryotic cells long ago.

1) What evidence suggests that mitochondria might have evolved before chloroplasts?

A) Mitochondria can sometimes divide to produce chloroplasts.

B) Only mitochondria have their own DNA. C) Some mitochondria have chloroplasts inside of them.

D) Almost all eukaryotes have mitochondria but only some cells have chloroplasts.

Answer: D Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Application/Analysis Learning Outcome: 4.7, 4.8 Global LO: 2, 7 2) Which of the following is a characteristic of chloroplasts that suggests that they might have evolved from free-living bacteria?

A) Chloroplasts have cell walls.

B) Chloroplasts contain pigments.

C) Chloroplasts have their own DNA. D) A single, highly folded plasma membrane surrounds chloroplasts.

Answer: C Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Application/Analysis Learning Outcome: 4.7, 4.8 Global LO: 2, 7 3) Which of the following is a characteristic of mitochondria that suggests that they might have evolved from free-living bacteria?

A) Mitochondria have cell walls.

B) The plasma membrane of a mitochondrion, forming the surface of this organelle, is the site of many important steps of cellular respiration.

C) Mitochondria have their own DNA. D) Mitochondria rely upon proteins as their source of energy.

Answer: C Topic: 4.5 Energy Transformations: Chloroplasts and Mitochondria Skill: Application/Analysis Learning Outcome: 4.7, 4.8 Global LO: 2, 7 17 .

Read the following scenario to answer the following questions.

Different species of bacteria are resistant to different types of antibiotics. For example, one species of bacteria may be resistant to an antibiotic that targets bacterial ribosomes but may not be resistant to a different antibiotic that targets bacterial cell walls. In order to figure out what type of antibiotic(s) to which a species of bacteria was resistant, a researcher treated the bacteria with four different antibiotics (A, B, C, and D) and measured how many bacteria were alive over the course of a few weeks. The data that she collected are summarized below.

4) The bacteria show the greatest resistance to which antibiotic?

A) Antibiotic A B) Antibiotic B C) Antibiotic C D) Antibiotic D Answer: A Topic: 4 Biology and Society, 4 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 4.1, 4.10 Global LO: 2, 3, 5 5) Why do you think the bacteria start to decline when treated with antibiotic C but then begin to grow as time goes on?

A) Some bacteria with resistance to antibiotic C were selected for over time.

B) Additional bacteria were added to the experimental group.

C) Antibiotic C degraded and thus was no longer effective.

D) This is the normal course of bacterial growth no matter which antibiotic is applied.

Answer: A Topic: 4 Biology and Society, 4 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 4.1, 4.10 Global LO: 2, 3, 5

18 .

6) If you were treating a patient infected with this species of bacteria, which antibiotic would you prescribe the person such that the bacteria were killed most effectively?

A) Antibiotic A B) Antibiotic B C) Antibiotic C D) Antibiotic D Answer: D Topic: 4 Biology and Society, 4 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 4.1, 4.10 Global LO: 2, 3, 5

19 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 5 The Working Cell Chapter 5 Learning Outcomes 5 5.1.

5.1 5.2.

Biology and Society: Harnessing Cellular Structures Explain how nanotechnology might be used to power microscopic robots.

Some Basic Energy Concepts Define the terms energy, kinetic energy, potential energy, and the principle of conservation of energy.

5.3. Explain the relationship between heat and entropy.

5.4. Compare the processes by which a car and a human use “fuel” to perform work.

5.5. Compare the amount of energy in a calorie, kilocalorie, and Calorie.

5.2 Energy Transformation: ATP and Cellular Work 5.6. Explain how ATP powers cellular work and how ATP is recycled.

5.3 Enzymes 5.7. Explain why enzymes are needed in living organisms and how they speed up specific chemical reactions.

5.8. Explain how inhibitors and poisons can affect enzyme activity.

5.4. Membrane Function 5.9. Define and distinguish between the following pairs of terms: diffusion versus osmosis, passive transport versus active transport, hypertonic versus hypotonic, and endocytosis versus exocytosis.

5 Evolution Connection: The Origin of Membranes 5.10. Explain why phospholipids were probably some of the first organic compounds to form as life emerged on Earth.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

5.1 Multiple Choice Questions 1) What molecules are scientists currently trying to use to power nanotechnology devices, such as microscopic robots?

A) DNA B) Enzymes C) Lipids D) Cell membranes Answer: B Topic: 5 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 5.1 Global LO: 5 2) What is energy?

A) the capacity to cause movement B) the capacity to cause change C) a measure of calories D) a measure of disorder Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.2 3) An object at rest has no ________ energy, but it may have ________ energy resulting from its location or structure.

A) kinetic... potential B) kinetic... conserved C) potential... kinetic D) stored... potential Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.2 4) The principle that energy cannot be created or destroyed is known as ________.

A) cellular respiration B) conservation of energy C) conservation of heat D) entropy Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.2 5) A rock on the top of a mountain contains ________ energy.

A) potential 2 .

B) no C) kinetic D) conserved Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.2 Global LO: 2 6) You are riding on your bike and stop pedaling, coasting along the road. Eventually, your bike slows down and stops. What happened to the energy of your motion when your bike stopped?

A) It was returned to the bicycle.

B) It was converted back to chemical energy.

C) It was released as heat.

D) It was used to chemically break down the tires.

Answer: C Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.2 Global LO: 2 7) Which of the following is a measure of randomness in a system?

A) entropy B) kinetic energy C) potential energy D) chemical energy Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.3 8) Glucose molecules provide energy to power the swimming motion of sperm. In this example, the sperm are changing ________.

A) chemical energy into kinetic energy B) chemical energy into potential energy C) kinetic energy into potential energy D) kinetic energy into chemical energy Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.4 Global LO: 2

3 .

9) Humans convert approximately ________ of the energy stored in food to useful work.

A) 22% B) 34% C) 55% D) 99.9% Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.4 10) Ten kilocalories are equivalent to ________ calories.

A) 1,000 B) 10,000 C) 0.1 D) 100 Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.5 Global LO: 2, 4 11) You have a 2-kg bottle of liquid water at 0°C. About how many Calories are needed to heat up the water to 100°C? A) 100 Calories B) 200 Calories C) 2,000 Calories D) 10,000 Calories Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.5 Global LO: 2, 4 12) What compound directly provides energy for cellular work?

A) sugar B) ATP C) DNA D) fat Answer: B Topic: 5.2 ATP and Cellular Work Skill: Knowledge/Comprehension Learning Outcome: 5.6

4 .

13) Energy is transferred from ATP to other molecules by transferring a(n) ________.

A) adenosine B) heat unit C) ADP D) phosphate group Answer: D Topic: 5.2 ATP and Cellular Work Skill: Knowledge/Comprehension Learning Outcome: 5.6 14) Anything that prevents ATP formation will most likely ________.

A) result in cell death B) force the cell to rely on lipids for energy C) force the cell to rely on ADP for energy D) have no effect on the cell Answer: A Topic: 5.2 ATP and Cellular Work Skill: Knowledge/Comprehension Learning Outcome: 5.6 15) Usually, enzymes are ________.

A) fats B) steroids C) chemical reactions D) proteins Answer: D Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 16) The sum total of all the chemical reactions that occur in organisms is called ________.

A) hydrolysis B) cellular synthesis C) conservation of energy D) metabolism Answer: D Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7

5 .

17) Enzymes increase the rate of a reaction by ________.

A) increasing the temperature of the substrates B) contributing electrons to the reaction C) decreasing activation energy D) changing the pH of the environment Answer: C Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 18) Which one of the following is TRUE? A) Enzymes are the products in a chemical reaction.

B) Enzymes are the reactants in a chemical reaction.

C) Enzymes catalyze specific reactions.

D) Enzymes' functions require inhibitors.

Answer: C Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 19) An enzyme's function is most dependent on its ________.

A) pH B) temperature C) shape D) size Answer: C Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 20) Which component of the following reaction is the enzyme? sucrose + sucrase + water → sucrase + glucose + fructose A) sucrose B) sucrase C) glucose D) fructose Answer: B Topic: 5.3 Enzymes Skill: Application/Analysis Learning Outcome: 5.7 Global LO: 2

6 .

21) The region of an enzyme to which a substrate binds is called the ________ site.

A) active B) substrate C) enzymatic D) inactive Answer: A Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 22) Which component of the following reaction is the substrate? sucrose + sucrase + water → sucrase + glucose + fructose A) sucrose B) sucrase C) glucose D) fructose Answer: A Topic: 5.3 Enzymes Skill: Application/Analysis Learning Outcome: 5.7 Global LO: 2 23) Which one of the following is TRUE? A) An enzyme's function depends on its three-dimensional shape.

B) Enzymes work generally on a broad range of substrates.

C) Enzymes are used up in chemical reactions.

D) Enzymes emerge changed from the reactions they catalyze.

Answer: A Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7 24) Substances that plug up an enzyme's active site are ________.

A) enzyme substrates B) enzyme inhibitors C) enzyme catalysts D) enzyme products Answer: B Topic: 5.3 Enzymes Skill: Knowledge/Comprehension Learning Outcome: 5.7, 5.8

7 .

25) Which one of the following is most similar to the mechanism of an enzyme inhibitor?

A) keeping someone from parking by parking in their designated spot B) driving the wrong way on a one-way street C) forgetting to put a cap back on a pen D) changing the tires on a car Answer: A Topic: 5.3 Enzymes Skill: Application/Analysis Learning Outcome: 5.7, 5.8 Global LO: 2 26) Diffusion is an example of ________.

A) phagocytosis B) active transport C) endocytosis D) passive transport Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 27) Diffusion ________.

A) is the result of the potential energy of atoms B) requires an input of cellular energy C) occurs when particles spread from areas where they are less concentrated to areas where they are more concentrated D) proceeds until equilibrium is reached Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 28) Facilitated diffusion across a biological membrane requires ________ and moves a substance ________ its concentration gradient.

A) energy... down B) transport proteins... down C) energy and transport proteins... against D) transport proteins... against Answer: B Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9

8 .

29) Osmosis can be defined as ________.

A) the diffusion of water across a selectively permeable membrane B) the diffusion of nonpolar molecules across a selectively permeable membrane C) active transport across a selectively permeable membrane D) the diffusion of a solute across a selectively permeable membrane Answer: A Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 30) A balloon permeable to water but not to glucose contains a 10% glucose solution. A beaker contains a 5% glucose solution. Which of the following is TRUE? A) The solution in the beaker is hypertonic relative to the solution in the balloon.

B) The solution in the balloon is isotonic; the solution in the beaker is hypertonic.

C) The solution in the balloon is hypotonic relative to the solution in the beaker.

D) The solution in the balloon is hypertonic relative to the solution in the beaker.

Answer: D Topic: 5.4 Membrane Function Skill: Application/Analysis Learning Outcome: 5.9 Global LO: 2 31) When two solutions that differ in solute concentration are placed on either side of a selectively permeable membrane, and osmosis is allowed to take place, the water will ________.

A) exhibit a net movement to the side with lower water concentration B) exhibit a net movement to the side with higher water concentration C) exhibit a net movement to the side with lower solute concentration D) exhibit an equal movement in both directions across the membrane Answer: A Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 32) A cell that neither gains nor loses a net amount of water at equilibrium when it is immersed in a solution is ________.

A) isotonic to its environment B) hypertonic to its environment C) hypotonic to its environment D) metabolically inactive Answer: A Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9

9 .

33) Some protozoans have special organelles called contractile vacuoles that continually eliminate excess water from the cell. The presence of these organelles tells you that the environment ________.

A) is isotonic to the protozoan B) is hypotonic to the protozoan C) is hypertonic to the protozoan D) contains a higher concentration of solutes than the protozoan Answer: B Topic: 5.4 Membrane Function Skill: Application/Analysis Learning Outcome: 5.9 Global LO: 2 34) If placed in tap water, an animal cell will undergo lysis, whereas a plant cell will not. What accounts for this difference?

A) expulsion of water by the plant cell's central vacuole B) the relative impermeability of the plant cell membrane to water C) the relative impermeability of the plant cell wall to water D) the relative inelasticity and strength of the plant cell wall Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 35) In a hypotonic solution, a plant cell will ________.

A) undergo plasmolysis B) become flaccid C) burst D) become turgid Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 36) Which of the following processes could result in the net movement of a substance into a cell, if the substance is more concentrated in the cell than in the surroundings?

A) active transport B) facilitated diffusion C) diffusion D) osmosis Answer: A Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9

10 .

37) Active transport ________.

A) uses ATP as an energy source B) can move solutes against their concentration gradient C) can involve the transport of ions D) all of the answer options Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 38) When a person cries, tears are exported from cells through the process of ________.

A) facilitated diffusion B) active transport C) endocytosis D) exocytosis Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 39) Certain cells that line the stomach synthesize a digestive enzyme and secrete it into the stomach. Which of the following processes could be responsible for its secretion?

A) endocytosis B) exocytosis C) phagocytosis D) passive transport Answer: B Topic: 5.4 Membrane Function Skill: Application/Analysis Learning Outcome: 5.9 Global LO: 2 40) The act of a white blood cell engulfing a bacterium is ________.

A) osmosis B) diffusion C) exocytosis D) phagocytosis Answer: D Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9

11 .

41) A balloon permeable to water but not to glucose contains a 10% glucose solution. A beaker contains a 5% glucose solution. What will happen when the balloon is submerged in the beaker?

A) The volume of water in the beaker will decrease.

B) The volume of water in the beaker will increase.

C) The amount of glucose in the beaker will increase.

D) The amount of glucose in the beaker will decrease.

Answer: A Topic: 5.4 Membrane Function Skill: Application/Analysis Learning Outcome: 5.9 Global LO: 2 42) On a lab bench, there are four balloons filled with identical volumes of different salt solutions: 0% (balloon A), 5% (balloon B), 10% (balloon C), and 15% (balloon D). There are also four beakers each filled with identical volumes of a 10% salt solution. The balloons are semi-permeable; that is, only water can enter and exit the balloon. All four balloons are placed in separate beakers at the same time and are allowed to come to equilibrium. Which is the correct order of balloon volumes at equilibrium, from largest to smallest?

A) A < B < C < D B) D < C < B < A C) D < B < A < C D) All balloons will be of equal volume at equilibrium.

Answer: A Topic: 5.4 Membrane Function Skill: Synthesis/Evaluation Learning Outcome: 5.9 Global LO: 2, 4 43) Which of the following molecules spontaneously form membranes when mixed in water and most likely were one of the first organic compounds formed on Earth?

A) DNA B) Enzymes C) Phospholipids D) RNA Answer: C Topic: 5 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 5.10

12 .

5.2 Art Questions 1) The figure below shows that ________.

A) ADP can perform cellular work when it binds to an additional phosphate group B) ATP can perform cellular work when it releases a phosphate group C) ATP can be converted to ADP by adding a phosphate group D) energy is released from ATP during the process of cellular respiration Answer: B Topic: 5.2 ATP and Cellular Work Skill: Knowledge/Comprehension Learning Outcome: 5.6 Global LO: 3

13 .

2) Examine the cells below. Cells with a higher concentration of ions than the surrounding medium tend to ________.

A) stay about the same size and shape B) expand C) shrink D) divide Answer: B Topic: 5.4 Membrane Function Skill: Knowledge/Comprehension Learning Outcome: 5.9 Global LO: 2, 3

14 .

5.3 Scenario Questions Read the following scenario to answer the following question(s).

Cellular respiration converts the energy of fuel molecules to a form of energy that a cell can use to perform work. In an average day, most adult humans need to consume about 2,000 Calories to maintain their health. However, the exact amount of dietary Calories a person needs depends upon many factors, including the person's age, physical activity, size, and health. Foods that we consume vary greatly in their nutritional content and quality. A large hard-boiled egg, for example, has about 75 dietary Calories and contains about 70% of our recommended daily intake of cholesterol.

1) Molecules that come from the food we eat provide energy for the amazing work that goes on inside of our cells. This energy, stored inside of our food, is a form of ________.

A) potential energy called chemical energy B) potential energy called entropy C) kinetic energy called heat D) electrical energy called heat Answer: A Topic: 5.1 Some Basic Energy Concepts Skill: Knowledge/Comprehension Learning Outcome: 5.2 2) If a person eats one hard-boiled egg and digests the egg fully, cellular respiration will convert most of this energy into ________.

A) ATP B) heat C) carbon dioxide D) sugars Answer: B Topic: 5.1 Some Basic Energy Concepts; 5.2 ATP and Cellular Work Skill: Knowledge/Comprehension Learning Outcome: 5.4, 5.6 3) The amount of dietary Calories in one hard-boiled egg could raise the temperature of ________.

A) 75 grams of water by 1 degree Celsius B) 750 grams of water by 1 degree Celsius C) 1,000 grams of water by 75 degrees Celsius D) 7,500 grams of water by 50 degrees Celsius Answer: C Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.5 Global LO: 2, 4

15 .

4) Running burns approximately 600 Calories per hour. If you ate four hard-boiled eggs, how long would you have to run to burn them off?

A) 10 minutes B) 30 minutes C) 60 minutes D) 120 minutes Answer: B Topic: 5.1 Some Basic Energy Concepts Skill: Application/Analysis Learning Outcome: 5.5 Global LO: 2, 4 Read the following scenario to answer the following question(s).

Biomedical scientists have recently developed an anticancer drug delivery system that sneaks the anticancer drug into cancer cells before releasing it. They were able to do this by using two sets of liposomes. An anticancer drug (Doxorubicin (Dox)) bound to DNA molecules was added into one set of liposomes (type A), and a high concentration of ATP molecules were added to the other set of liposomes (type B). The drug is inactive when bound to DNA molecules.

Researchers inject both types of liposomes (A and B) into cancer cells, and upon doing so their contents are released. The ATP molecules (from liposome type A) bind to the DNA molecules (from liposome type B) and activate the drug, thus inducing cell death and decreasing tumor size.

Mice with breast cancer tumors were treated with this liposome system to test the effectiveness of the drug. The scientists performed three trials one with both types of liposomes (Dox + ATP), one with just the drug (Dox only), and one with a salt solution (control). Examine the figure below and answer the following questions.

5) What statement regarding this data is TRUE? A) The weight of the tumors will not change if not treated with Dox or Dox + ATP. B) Tumor weight decreases when you add Dox only to cancer cells.

C) Adding Dox only or Dox + ATP result in similar decreases in tumor weight.

D) Dox is entering the cancer cells via endocytosis to induce cell death.

Answer: B Topic: 5.4 Membrane Function, 5 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5 16 .

6) Why did tumor size decrease in the Dox only experiment to a lesser extent than the Dox + ATP experiment?

A) ATP is actually the drug that is killing the cancer cells, not Dox. B) Dox is always active in cancer cells, so it should be able to kill some cells without ATP. C) When ATP is lacking, not as much Dox can enter the cell via facilitated diffusion.

D) There is some ATP in the cancer cells normally, which acts to activate Dox. Answer: D Topic: 5.4 Membrane Function, 5 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5 7) What would be the best experiment to test the effectiveness of this anticancer drug system?

A) Inject both sets of liposomes into a single healthy mouse and measure what happens to its blood ATP levels.

B) Inject both sets of liposomes into a single mouse that has tumors and measure what happens to the size of the tumors.

C) Inject both sets of liposomes into multiple healthy mice and measure what happens to their blood ATP levels.

D) Inject both sets of liposomes into multiple mice that have tumors and measure what happens to the size of the tumors.

Answer: D Topic: 5.4 Membrane Function, 5 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 5.9, 5.10 Global LO: 1, 2, 3, 5

17 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 6 Cellular Respiration: Obtaining Energy from Food Chapter 6 Learning Outcomes 6 6.1.

Biology and Society: Getting the Most Out of Your Muscles Define the aerobic capacity of an athlete and explain what happens when the intake of oxygen is no longer sufficient.

6.1 Energy Flow and Chemical Cycling in the Biosphere 6.2. Explain why photosynthesis is important to most ecosystems.

6.3. Define and compare autotrophs and heterotrophs, producers and consumers.

6.4. Explain how the processes of photosynthesis and cellular respiration are complementary to each other.

6.2 Cellular Respiration: Aerobic Harvest of Food Energy 6.5. Write and explain the overall equation for cellular respiration.

6.6. Explain how electrons are transferred from glucose to NADH to an electron transport chain to oxygen.

6.7. Compare the reactants, products, location in the cell, and energy yield of the three stages of cellular respiration (glycolysis, citric acid cycle, and electron transport chain).

6.3. Fermentation: Anaerobic Harvest of Food Energy AND the Process of Science: Exercise Science 6.8. Compare the reactants, products, and energy yield of aerobic metabolism versus fermentation in human cells including where each occurs in a cell and what the consequences are of lactic acid buildup.

6 Evolution Connection: The Importance of Oxygen 6.9. Describe the lines of evidence that suggest that glycolysis is a primitive form of metabolism.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

6.1 Multiple Choice Questions 1) Lactic acid build up in muscles is a sign that ________.

A) aerobic respiration capacity has not been reached B) respiration is operating effectively C) insufficient oxygen is reaching the muscles D) the muscles will be able to operate continuously for a long time Answer: C Topic: 6 Biology and Society: Getting the Most Out of Your Muscles Skill: Knowledge/Comprehension Learning Outcome: 6.1 Global LO: 5 2) A process is referred to as aerobic if it requires ________.

A) oxygen B) carbon dioxide C) ATP D) carbohydrates Answer: A Topic: 6 Biology and Society: Getting the Most Out of Your Muscles Skill: Knowledge/Comprehension Learning Outcome: 6.1 3) Humans are both ________.

A) heterotrophs and consumers B) heterotrophs and producers C) producers and decomposers D) autotrophs and producers Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Application/Analysis Learning Outcome: 6.3 Global LO: 2 4) Photosynthetic organisms are ________.

A) producers that make all of their organic matter from organic molecules that they take in B) consumers that obtain organic molecules from other living organisms C) producers that make all their own organic matter from inorganic molecules D) decomposers that obtain nutrients from the soil Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.3 5) Photosynthetic organisms like grass are able to ________.

A) make all of their organic matter from organic molecules in the soil.

B) use water they take in through their leaves as a final electron acceptor.

2 .

C) change the light energy from sunlight into sugars D) use substances in the air as a major source of carbon.

Answer: D Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Application/Analysis Learning Outcome: 6.3 Global LO: 2 6) A horse eating some hay is an example of ________.

A) an autotroph eating a producer B) an autotroph eating a consumer C) a consumer eating a producer D) a consumer eating a heterotroph Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Application/Analysis Learning Outcome: 6.3 Global LO: 2 7) Plants use photosynthesis to A) store chemical energy, and they use cellular respiration to harvest energy.

B) change light energy into chemical energy as well as to harvest chemical energy.

C) harvest energy, and they use cellular respiration to store chemical energy.

D) change light energy into sugars.

Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.2 8) The waste products of cellular respiration include ________.

A) water only B) carbon dioxide only C) water and carbon dioxide D) water and glucose Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.4

3 .

9) Plant cells ________.

A) do not need chloroplasts because their mitochondria meet their energy needs B) have chloroplasts and mitochondria C) use carbon dioxide but do not use oxygen D) do not need mitochondria because their chloroplasts meet their energy needs Answer: B Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.4 10) The ultimate source of the energy in food is ________.

A) the sun B) producers C) ATP D) consumers Answer: A Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.2 11) What compound directly provides energy for cellular work?

A) C6H12O6 B) glucose C) ATP D) fat Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Knowledge/Comprehension Learning Outcome: 6.4 12) Respiration describes the exchange of gases between your blood and the air. Cellular respiration ________.

A) produces ATP B) produces oxygen C) produces glucose D) uses carbon dioxide Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7

4 .

13) Which of these equations describes aerobic cellular respiration?

A) glucose → lactic acid + energy B) energy + carbon dioxide + water → glucose + oxygen + water C) glucose + oxygen → carbon dioxide + water + energy D) none of the above Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 14) Which of the following are produced as a result of cellular respiration?

A) ATP and water B) carbon dioxide and ATP C) carbon dioxide, water, and ATP D) oxygen and glucose Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 15) During cellular respiration, electrons move through a series of electron acceptor molecules.

Which of the following is a TRUE statement about this process?

A) The electrons gain energy as they move from one electron acceptor to another.

B) Oxygen is eventually reduced by the electrons to form water.

C) The electrons release large amounts of energy each time they are transferred from one electron acceptor to another.

D) Glucose is eventually reduced by the electrons to form water.

Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.6 16) Which of the following statements is TRUE? A) Oxygen is a product of cellular respiration; carbon dioxide is a product of photosynthesis.

B) Lactic acid is a product of aerobic respiration; ethyl alcohol is a product of fermentation.

C) Oxidation is the loss of electrons; reduction is the gain of electrons.

D) Glucose is a product of aerobic respiration; lactic acid is a product of anaerobic respiration.

Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.4

5 .

17) The first electron acceptor of cellular respiration is ________.

A) CO2 B) O2 C) NAD+ D) H2O Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.6 18) The final electron acceptor of aerobic respiration is ________.

A) ATP B) oxygen C) lactic acid D) NAD+ Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.6 19) Where in the cell does glycolysis occur?

A) cytoplasm B) endoplasmic reticulum (ER) C) within the fluid just inside the inner mitochondrial membrane D) between the inner and outer mitochondrial membrane Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 20) Which of the following is the CORRECT sequence of stages in cellular respiration?

A) glycolysis, citric acid cycle, electron transport B) citric acid cycle, glycolysis, electron transport C) citric acid cycle, electron transport, glycolysis D) electron transport, glycolysis, citric acid cycle Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7

6 .

21) A product of glycolysis is ________.

A) lactic acid B) ethyl alcohol C) O2 D) pyruvic acid Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 22) Which of the following is a result of glycolysis?

A) production of CO2 B) conversion of glucose to pyruvic acid C) a net loss of two ATPs per glucose molecule D) conversion of NADH to NAD+ Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 23) The second stage of aerobic respiration is ________.

A) ATP production B) the citric acid cycle C) lactic acid fermentation D) glycolysis Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 24) What must pyruvic acid be converted to before it can enter the citric acid cycle?

A) acetyl CoA B) lactic acid C) ethyl alcohol D) citric acid Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7

7 .

25) In aerobic respiration, how many molecules of acetic acid are produced from six molecules of glucose?

A) 1 B) 38 C) 6 D) 12 Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Application/Analysis Learning Outcome: 6.8 Global LO: 2, 4 26) Which part of cellular respiration produces the most NADH? A) electron transport chain B) citric acid cycle C) glycolysis D) fermentation Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 27) Electron transport takes place in the ________.

A) mitochondria B) chloroplasts C) cytoplasm D) ribosomes Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.6 28) ATP synthase plays a role in ________.

A) pulling electrons down the electron transport chain B) glycolysis C) pumping hydrogen ions across the inner mitochondrial membrane D) generating ATP Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7

8 .

29) Aerobic cellular respiration generates about ________ ATP from one glucose.

A) 2 B) 6 C) 38 D) The number generated depends on whether the end product of aerobic respiration is lactic acid or ethyl alcohol.

Answer: C Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 30) In cellular respiration, most ATP is produced DIRECTLY as a result of ________.

A) the movement of hydrogen ions across the inner mitochondrial membrane B) the citric acid cycle C) fermentation D) the electron transport chain Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 31) Human muscle cells use lactic acid fermentation to ________.

A) produce more ATP than is possible through complete aerobic respiration B) produce ATP using the electron transport chain C) regenerate NADH D) produce ATP without O2 Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.8 32) Anaerobic respiration produces a maximum of ________ ATP per glucose.

A) 0 B) 2 C) 10 D) 38 Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.8

9 .

33) Which of the following metabolic pathways is common to both aerobic and anaerobic processes of sugar breakdown?

A) the citric acid cycle B) the electron transport chain C) conversion of pyruvic acid to lactic acid D) glycolysis Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.9 34) A child is born with a rare disease in which mitochondria are missing from certain skeletal muscle cells. Physicians find that the muscle cells function. Not surprisingly, they also find that ________.

A) the muscles contain large amounts of lactic acid following even mild physical exercise B) the muscles contain large amounts of carbon dioxide following even mild physical exercise C) the muscles require extremely high levels of oxygen to function D) the muscle cells cannot split glucose to pyruvic acid Answer: A Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Application/Analysis Learning Outcome: 6.7 Global LO: 2, 5 35) Some friends are trying to make wine in their basement. They've added yeast to a sweet grape juice mixture and have allowed the yeast to grow. After several days, they find that sugar levels in the grape juice have dropped, but there's no alcohol in the mixture. The most likely explanation is that ________.

A) the mixture needs more sugar; yeast need a lot of energy before they can begin to produce alcohol B) the mixture needs less oxygen; yeast only produce alcohol in the absence of oxygen C) the mixture needs more oxygen; yeast need oxygen to break down sugar to produce alcohol D) the mixture needs less sugar; high sugar concentrations stimulate cellular respiration, and alcohol is not a by-product of cellular respiration Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Application/Analysis Learning Outcome: 6.8 Global LO: 2, 5

10 .

36) What waste product do yeast produce under anaerobic conditions?

A) ethyl alcohol B) pyruvic acid C) lactic acid D) creatine Answer: A Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.8 Global LO: 5 37) Large amounts of oxygen gas first appeared in Earth's atmosphere about ________ years ago.

A) 500,000 B) 10 million C) 2.7 billion D) 3.5 billion Answer: C Topic: 6 Evolution Connection: The Importance of Oxygen Skill: Knowledge/Comprehension Learning Outcome: 6.9 38) Which of these stages of cell respiration can occur without the others?

A) the electron transport chain B) the citric acid cycle C) lactic acid fermentation D) glycolysis Answer: D Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.9 Global LO: 2

11 .

39) In Texas, a man showed up at a medical facility claiming that he felt drunk when he had not ingested any alcohol. Indeed his blood alcohol measured 0.37, many times the legal limit.

Although he was a home brewer, he claimed that this intoxication had been happening often without his drinking any alcohol. Which of these hypotheses and actions might be most useful in diagnosing this problem?

A) His home brew concoctions have created a type of alcohol that lasts a long time. Have him refrain from home brewing for a week and recheck his blood alcohol.

B) He might have recently had a round of antibiotics that killed the bacteria that usually live in his gut and allowed a yeast species to overgrow. Put him on probiotics and a low carb diet for a week and recheck his blood alcohol.

C) The fumes from the alcohol that he is using as a cleaning solution might be getting into his bloodstream. Ask him if he is using alcohol externally.

D) Maybe he feels drunk because he has been eating mushrooms that have sprouted during this very wet weather. Check him for fungal toxins.

Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.8 Global LO: 2, 5, 7 40) Several students were talking about which came first in the history of the Earth. Which student has the best understanding of what happened?

A) Photosynthetic producers must have come first to provide food for other organisms.

B) Anaerobic bacteria must have come first because there was no carbon dioxide in the atmosphere.

C) Photosynthetic producers must have come first to provide oxygen for other organisms.

D) Anaerobic organisms must have come first because there was no oxygen in the atmosphere.

Answer: D Topic: 6 Evolution Connection: The Importance of Oxygen Skill: Knowledge/Comprehension Learning Outcome: 6.9 Global LO: 7

12 .

6.2 Art Questions

1) Examine the figure above. Which of the following reactant(s) primarily come(s) from the air?

A) water B) glucose C) carbon dioxide D) oxygen and carbon dioxide Answer: D Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Application/Analysis Learning Outcome: 6.4 Global LO: 2, 3 13 .

2) Examine the figure above. Most of the mass of the tree shown in the figure comes from ________.

A) water B) glucose C) the air D) the soil Answer: C Topic: 6.1 Energy Flow and Chemical Cycling in the Biosphere Skill: Application/Analysis Learning Outcome: 6.4 Global LO: 2

14 .

3) Examine the following figure. Which of these stages occur(s) in the cytoplasm?

A) glycolysis B) citric acid cycle C) glycolysis and citric acid cycle D) citric acid cycle and electron transport Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Application/Analysis Learning Outcome: 6.7 Global LO: 2, 3

15 .

4) What does the figure below show?

A) the synthesis of ADP B) the breakdown of ATP to perform cellular work C) the removal of a phosphate group from ADP D) the synthesis of ATP through the addition of a phosphate group Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.7 Global LO: 3

16 .

5) The figure below shows that ________.

A) amino acids can move directly into the electron transport chain B) our cells can use sugars, fatty acids, and amino acids to produce ATP C) our cells can produce ATP only from glucose D) our cells can produce ATP from sugars and glycerol, but not fatty acids Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.7 Global LO: 2, 3, 7

17 .

6) Which of these shown in the figure below does NOT begin cellular respiration in the cytoplasm?

A) amino acids B) fatty acids C) glucose D) glycerol Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.7 Global LO: 2, 3

18 .

6.3 Scenario Questions Read the following scenario to answer the following questions.

An abundant and continual supply of ATP is necessary for all living cells. Active muscle cells require an extraordinary amount of ATP to permit strenuous exercise for prolonged periods.

Toxins, reduced blood flow, and a compromised respiratory system can interfere with the transport of oxygen to active cells. A runner in a marathon faces multiple obstacles to continue to produce sufficient ATP to remain competitive.

1) Breathing faster when we exercise is necessary to expel ________.

A) carbon dioxide and bring in more oxygen to support aerobic metabolism B) oxygen and bring in more carbon dioxide to support aerobic metabolism C) carbon dioxide and bring in more oxygen to support anaerobic metabolism D) oxygen and bring in more carbon dioxide to support anaerobic metabolism Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.4 2) When oxygen delivery becomes insufficient to support a runner's aerobic metabolism, cells switch to an emergency mode in which ________.

A) ATP is generated less efficiently by harvesting the heat energy in a cell B) ATP is inefficiently produced and lactic acid is generated as a by-product C) lactic acid is broken down to produce smaller amounts of ATP D) carbon dioxide is joined with water to generate much smaller amounts of ATP Answer: B Topic: 6.3 Fermentation: Anaerobic Harvest of Food Energy Skill: Knowledge/Comprehension Learning Outcome: 6.8

19 .

The table below shows experimental data from poultry scientists. Examine the table to answer the following questions.

Oviposition time, egg weight, chicken hatch weight and hatch weight/egg weight from young and mid-age broiler breeder flocks.

Flock Oviposition age time (h) Young Early Middle Late Total Mid

Early Middle Late Total

n 168 168 168 504

Egg weight (g) 59.3±0.2a 58.2±0.3b 58.7±0.1b 58.9±0.1

Chicken hatch weight (g) 38.8±0.2a 37.8±0.3b 38.1±0.2b 38.3±0.1

Chicken hatch weight/ egg weight (%) 65.4 65.0 64.9 65.0

252 252 252 756

66.8±0.2a 65.5±0.2b 66.0±0.2b 66.1±0.1

45.8±0.2a 44.0±0.3b 43.2±0.2c 44.1±0.1

68.6 67.2 65.5 66.7

3) Which hypothesis were the poultry scientists likely testing?

A) The time of egg laying (oviposition) has an impact on egg weight.

B) Bigger eggs result in larger mature chickens.

C) Young hens have a harder time laying eggs than do older hens.

D) Egg weight is related to the weight of the hatchling (newly hatched chick).

Answer: A Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.5 Global LO: 1, 2, 3, 4, 6, 7 4) What are (is) the main factor(s) causing differences between the chick hatch weight and the weight of the egg when it is laid?

A) The only factor that causes the chick to weigh less than the egg when it is laid is the removal of the shell.

B) Not only does the hatchling have no shell, but it has lost some of its mass (weight) to the air during development.

C) During development, the chick gains new parts so the weight increases.

D) Egg weight at oviposition includes a lot of water that evaporates during development.

Answer: B Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.5 Global LO: 1, 2, 3, 4, 7

20 .

5) If the egg was weighed halfway between being laid and hatching, how would you expect that weight to compare to the weight of the newly hatched chick?

A) The egg would weigh more at this midpoint than when newly hatched because, during development, the chick gains new parts.

B) The egg would weigh more at this midpoint than when newly hatched because it is taking in oxygen.

C) The egg would weigh less at this midpoint than when newly hatched because the shell wears away over time.

D) The egg would weigh less at this midpoint than when newly hatched because some of the mass of the egg would be released through cell respiration.

Answer: D Topic: 6.2 Cellular Respiration: Aerobic Harvest of Food Energy Skill: Synthesis/Evaluation Learning Outcome: 6.5 Global LO: 2, 4, 7

21 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 7 Photosynthesis: Using Light to Make Food Chapter 7 Learning Outcomes 7 7.1.

7.1 7.2.

Biology and Society: A Greasy Crime Wave Explain how biofuels are produced and used.

The Basics of Photosynthesis Relate the structure of leaves and chloroplasts within them to the functions of bringing in light, water, oxygen, and carbon dioxide and releasing carbon dioxide and oxygen.

7.3. Explain how the process of photosynthesis is complementary to cellular respiration.

7.4. Compare the reactants and products of the light reactions and the Calvin cycle.

7.2 The Light Reactions: Converting Solar Energy to Chemical Energy 7.5. Identify the wavelengths that are absorbed by and reflected from an object that appears green and describe green in terms of its wavelength and its place on the electromagnetic spectrum.

7.6. Describe the properties of chlorophyll a, chlorophyll b, and carotenoids including how they assist in transferring the energy of photons within a photosystem driving reactions that generate ATP and NADPH. 7.7. Describe the light reactions and compare the process of ATP production in the thylakoid membrane of chloroplasts to that in the inner mitochondrial membrane.

7 The Process of Science: What Colors of Light Drive Photosynthesis?

7.8. Explain how Theodor Engelmann was able to determine that only certain wavelengths of light are used in photosynthesis.

7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide 7.9. Describe the reactants and products of the Calvin cycle, explaining where each reactant comes from and where each product goes.

7 Evolution Connection: Creating a Better Biofuel Factory 7.10. Explain how directed evolution can help to produce algae that efficiently produce biofuels.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

7.1 Multiple Choice Questions 1) Which of these is NOT considered an advantage of biofuels from food crops?

A) reduced carbon emissions B) a renewable resource C) increased fuel efficiency D) increased crop prices Answer: D Topic: 7 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 7.1 Global LO: 5 2) Which of the following is an autotroph?

A) human B) mushroom C) pine tree D) fish Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Application/Analysis Learning Outcome: 7.2 Global LO: 2 3) Photosynthesis contributes to plant growth by ________.

A) taking in oxygen and making wood B) taking in carbon dioxide and making sugars (carbohydrates) C) synthesizing carbon dioxide and making cellulose D) converting sugar to oxygen and water Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 4) Within the inner membrane of a chloroplast, interconnected sacs of membrane called ________ are suspended in a thick fluid called the ________.

A) chlorophyll... thylakoid B) thylakoids... grana C) thylakoids... stroma D) grana... thylakoid Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 5) What is the function of stomata?

A) water absorption 2 .

B) Calvin cycle C) location of photosystems D) gas exchange Answer: D Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 6) Through what structure(s) do plants obtain most of their water?

A) roots B) interior cells C) stomata D) leaves Answer: A Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 7) What name is given to the membranous sacs found within a chloroplast?

A) stroma B) mitochondria C) thylakoids D) vesicles Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 8) What are grana?

A) thick fluids inside chloroplasts B) convolutions of the inner chloroplast membrane C) stacks of membranous sacs D) pigments found in chloroplasts Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2

3 .

9) If you provided your shade-tolerant plants with their preferred wavelength of light, but only minimal amounts of water, which of the following would you expect to occur?

A) increased plant growth B) increased amounts of oxygen released by the plants C) decreased amounts of ATP being produced by the plants D) increased growth of the plants' leaves Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Application/Analysis Learning Outcome: 7.4 Global LO: 2 10) Which of the following equations best summarizes photosynthesis?

A) 6 CO2 + 6 H2O + 6 O2 → C6H12O6 B) 6 CO2 + 6 H2O → C6H12O6 + 6 O2 C) 6 CO2 + 6 O2 → C6H12O6 + 6 H2O D) C6H12O6 + 6 O2 → 6 CO2 + 6 H2O Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.4 11) In photosynthesis, redox reactions ultimately transfer electrons from ________ to ________.

A) O2... CO2 B) C6H12O6... O2 C) H2O... C6H12O6 D) H2O... CO2 Answer: D Topic: 7.1 The Basics of Photosynthesis Skill: Application/Analysis Learning Outcome: 7.4 Global LO: 2 12) Which of the following is produced during the light reactions of photosynthesis?

A) O2 B) CO2 C) C6H12O6 D) ADP Answer: A Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.7

4 .

13) The Calvin cycle requires ________ and ________ from the light reactions in order to operate.

A) glucose... carbon dioxide B) electrons... NADH C) ATP... NADPH D) RuBP... NADP+ Answer: C Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.9 14) The products of the light reactions of photosynthesis are ________.

A) ATP and NADH B) ATP and NADPH C) RuBP and O2 D) ATP and NADP+ Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.6 15) The color that we see when looking at a pigmented object is ________.

A) the wavelengths that are absorbed by the pigmented object B) the wavelengths that are reflected or transmitted by the pigmented object C) the wavelengths that have been raised to an excited state by the pigmented object D) the wavelengths that the pigmented object created after interacting with sunlight Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.5 16) If a plant appears blue to us, what wavelength of light is being reflected?

A) blue B) green C) red D) yellow Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Application/Analysis Learning Outcome: 7.5 Global LO: 2

5 .

17) The energy of wavelengths that appear ________ is LEAST useful to photosynthesis.

A) red B) green C) blue D) orange Answer: B Topic: 7 The Process of Science: What Colors of Light Drive Photosynthesis?

Skill: Knowledge/Comprehension Learning Outcome: 7.8 18) What is responsible for the yellow-orange coloration of leaves in the fall?

A) RuBP B) chlorophyll a C) carotenoids D) chlorophyll b Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 19) What is one reason why plants have accessory pigment molecules, like chlorophyll b and carotenoids?

A) to reflect more energy B) to absorb energy in parts of the electromagnetic spectrum that chlorophyll a cannot C) to give them different colors D) because plants cannot make enough chlorophyll a for all of their energy needs Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 20) What name is given to a discrete packet of light?

A) phaser B) wavelength C) photon D) quantum Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6

6 .

21) The shorter the wavelength of visible light, the ________.

A) less energy absorbed by photosynthetic pigments B) redder the color C) more photons it contains D) greater the energy Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.5 22) When a molecule absorbs a photon, one of its electrons is raised to the ________ state.

A) energetic B) quantum C) positive D) excited Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 23) Which of the following is a way that a molecule releases energy gained by absorption of a photon?

A) heat B) fluorescence C) light D) all of the above Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 24) Where are photosystems located?

A) chlorophyll B) thylakoid membrane C) mitochondria D) stroma Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6

7 .

25) What compound is found at the reaction center of a photosystem?

A) chlorophyll b B) carotenoids C) phycobilins D) chlorophyll a Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 26) The light reactions of photosynthesis take place ________.

A) in the stroma B) in the mitochondria C) in the thylakoid membrane D) in the cytosol Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7 27) ________ is the source of the oxygen gas released by a photosystem.

A) H2O B) Chlorophyll a C) CO2 D) C6H12O6 Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7 28) Which of the following is the source of electrons for the light reactions?

A) C6H12O6 B) CO2 C) NADPH D) H2O Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7

8 .

29) Which of the following is found in both cellular respiration and in the light reactions of photosynthesis?

A) citric acid cycle B) glycolysis C) Calvin cycle D) electron transport chain Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7 30) In photosynthesis, an H+ ion gradient forms across the ________.

A) thylakoid membrane B) outer chloroplast membrane C) endomembrane D) inner chloroplast membrane Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.6 31) The Calvin cycle makes direct use of ________ to make ________.

A) light energy and CO2... sugar B) CO2, ATP, and NADPH... sugar and O2 C) light energy, CO2, and water... sugar and O2 D) CO2, ATP, and NADPH... sugar Answer: D Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9 32) C4 plants conserve water by ________.

A) shuttling CO2 from the Calvin cycle to the water-splitting photosystem B) keeping their stomata closed when the weather is hot and dry C) growing very deep roots D) running the Calvin cycle at night Answer: B Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9

9 .

33) CAM plants conserve water by ________.

A) opening their stomata only at night B) incorporating CO2 into RuBP C) keeping their stomata closed at night D) running the Calvin cycle at night Answer: A Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9 34) Scientists are working to create a better biofuel factory through which of the following processes?

A) increasing the rate at which certain algae reproduce B) developing strains of algae that can clean up oil spills C) increasing the genetic diversity of groups of algae D) restricting hydrocarbon production Answer: C Topic: 7 Evolution Connection Skill: Application/Analysis Learning Outcome: 7.10 Global LO: 1, 2, 5

10 .

7.2 Art Questions

1) Refer to the accompanying figure. Plant cells that contain the organelle responsible for photosynthesis are concentrated in cells of the ________.

A) roots B) leaves C) stomata D) grana Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Knowledge/Comprehension Learning Outcome: 7.2 Global LO: 3

11 .

2) In the accompanying figure, the molecule that makes up the bulk of the mass of the plant comes in mostly ________.

A) through the veins, which bring materials from the roots B) through the transparent covering of the leaf into the photosynthetic cells C) through the stomata D) from the roots where they are stored during the night Answer: B Topic: 7.1 The Basics of Photosynthesis Skill: Application/Analysis Learning Outcome: 7.2 Global LO: 2, 3

3) Refer to the accompanying figure. Which of the following is TRUE regarding the behavior of a chlorophyll molecule as it absorbs a photon?

A) An electron goes from the excited state to the ground state.

B) Light is released.

C) The energy of a photon raises an electron to the excited state.

D) ATP is broken down.

Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7 Global LO: 3

12 .

4) The light reactions are generally presented in zig-zag patterns, as shown in the accompanying figure. What is the significance of the primary electron receptor shown at position 2 being slightly higher than the primary electron receptor shown at position 3?

A) The electron that has been accepted gains energy as it leaves the primary electron receptor at 2 and heads to the primary electron receptor at position 3.

B) The primary electron receptor at 2 has slightly less energy than the primary electron receptor at position 3.

C) The primary electron receptor at position 2 comes before the primary electron receptor at position 3.

D) Since electrons have given off energy in the electron transport chain, they can be boosted higher by the second photosystem.

Answer B Answer: B Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.7 Global LO: 2, 3

13 .

Please refer to the following art to answer the following questions.

5) Which of the following BEST describes the direct mechanism of ATP production during photosynthesis?

A) use of the energy generated as hydrogen ions (H+) move up a proton gradient; this energy is used to make ATP B) use of the energy released as excited electrons are passed from one molecule to another in the electron transport system; the energy is converted to the chemical bond energy of ATP C) use of the energy stored in excited electrons; as the electrons move from the excited state to the ground state, the energy released is converted to the energy stored in the third phosphate bond in ATP D) use of the energy stored in hydrogen ion (H+) gradients; the potential energy of the proton gradient is released as the protons move down their gradient through special membrane protein channels; this energy is converted to chemical bond energy in the ATP molecule Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Knowledge/Comprehension Learning Outcome: 7.7 Global LO: 3 6) The energy in the proton gradient above is ________.

A) potential energy B) sunlight light energy C) sugar energy D) heat energy Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.7 Global LO: 2, 3, 7 14 .

7) If the interior of the thylakoid were not a sealed compartment ________.

A) There would be no location for the electron transport chain B) Light would not be able to reach the photosystems C) Water could not be split D) The proton gradient could not be maintained Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.7 Global LO: 2, 3, 7

15 .

Please refer to the following art to answer the following questions.

8) How many times must the Calvin cycle turn for the plant cell to be able to produce one molecule of glucose?

A) one B) two C) three D) six Answer: D Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Application/Analysis Learning Outcome: 7.9 Global LO: 2, 3, 4

16 .

9) One of the compounds that is a direct output of the Calvin cycle is ________.

A) C6H12O6 B) NADPH C) G3P D) ATP Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9 Global LO: 3 10) The first step of the Calvin cycle is the incorporation of ________ into ________.

A) O2... G3P B) RuBP... O2 C) CO2... RuBP D) G3P... RuBP Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9 Global LO: 3 11) The last stage of one complete turn of the Calvin cycle involves ________.

A) G3P production B) oxidation of CO2 C) regeneration of RuBP D) sugar production Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Knowledge/Comprehension Learning Outcome: 7.9 Global LO: 3 12) If an herbicide blocked the Calvin cycle before the generation of glyceraldehyde 3-phosphate (G3P), which of the following statements would be TRUE? A) The plant would still be able to make sugar, just a lot less.

B) No oxygen would be released by the plant.

C) No sugar would be made by the plant.

D) Only RuBP would be recycled.

Answer: C Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Application/Analysis Learning Outcome: 7.9 Global LO: 2, 3

17 .

13) The Calvin cycle is sometimes called the "dark reactions." Could it take place if a plant were grown in the dark continuously?

A) No, because plants cannot take in CO2 without sunlight.

B) No, because sunlight is needed to split water to provide NADH. C) Yes, because taking in carbon dioxide, the only outside input to the Calvin cycle, does not need sunlight.

D) Yes, because plants have stored materials in their roots which can provide what the Calvin cycle needs.

Answer: B Topic: 7.3 The Calvin Cycle: Making Sugar from Carbon Dioxide Skill: Application/Analysis Learning Outcome: 7.9 Global LO: 2, 3

18 .

7.3 Scenario Questions Please use the following information to answer the following questions.

You work for a company selling tropical rain forest plants commonly found in the understory of the forest. These plants are shade tolerant and can be grown indoors because they require low light. Your employer wants you to find out what is the best type of light to maximize growth of these understory plants. Using a full spectrum of natural light would cause these plants to die because they are a shade-tolerant plant species.

From your biology class, you recall that the light-dependent reactions of photosynthesis involve pigment molecules that absorb light of specific wavelengths. You also remember the experiments done by the German biologist Theodor Engelmann, in which he separated light using a prism into different wavelengths and then determined which wavelengths were best for promoting photosynthesis in the algae species he was examining. Your goal is to determine which wavelengths (colors) of light are best for promoting photosynthesis to enhance growth in your species of plant. To achieve this, you grew your plants under different wavelengths of light and measured their growth rates. The wavelengths were measured in nanometers (nm), and the growth rate was measured in millimeters per day (mm/day). The data you collected are as follows: Wavelengths Growth 400 nm 0.33 mm/day 450 nm 0.46 mm/day 500 nm 0.88 mm/day 550 nm 0.12 mm/day 600 nm 0.54 mm/day 650 nm 0.28 mm/day 700 nm 0.08 mm/day 750 nm 0.00 mm/day Make a bar graph plotting growth rates on the y-axis and wavelengths of light on the x-axis.

Referring to your graph, answer the following questions: 1) Which wavelength is best for your plants' growth?

A) 650 nm B) 550 nm C) 500 nm D) 400 nm Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Application/Analysis Learning Outcome: 7.5 Global LO: 2, 3, 4

19 .

2) Of the following, which wavelength is LEAST useful to your plants?

A) 650 nm B) 450 nm C) 550 nm D) 400 nm Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Application/Analysis Learning Outcome: 7.5 Global LO: 2, 3, 4 3) Which wavelength of light is the LEAST useful to your plant's growth?

A) 750 nm B) 650 nm C) 550 nm D) 500 nm Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Application/Analysis Learning Outcome: 7.5 Global LO: 2, 3, 4 4) Some plant species require shaded conditions while other plant species require bright sunlight.

Shade tolerance is best related to which of these characteristics?

A) Different species of plants have different ratios of pigment molecules that utilize different wavelengths of light.

B) Plant leaves without a protective coating are subject to sunburn.

C) Some species of plants are able to produce sugar without ever having been exposed to sunlight.

D) Some species of plants are consumers and do not need sunlight.

Answer: A Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.5 Global LO: 2

20 .

5) Shade-tolerant plants have many adaptations for living in areas of low light. Predict whether each of the following processes would be high or low in comparison with other plants and choose the answer that is most CORRECT. Net photosynthetic rate Chlorophyll per area of the leaf Electron transport chain rate A) high, high, high B) high, high low C) low, high, high D) low, high, low Answer: D Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.2 Global LO: 2, 7 6) Shade-tolerant plants have many adaptations for living in areas of low light. Predict whether each of the following processes would be high or low in comparison with other plants and choose the answer that is most CORRECT. Density of stomata on leaves Leaf size Carbohydrate storage A) High, high, high B) High, high, low C) Low, high, high D) Low, high, low Answer: C Topic: 7.2 The Light Reactions: Converting Solar Energy to Chemical Energy Skill: Synthesis/Evaluation Learning Outcome: 7.2 Global LO: 2, 7

21 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 8 Cellular Reproduction: Cells from Cells Chapter 8 Learning Outcomes 8 8.1.

8.1 8.2.

Biology and Society: Virgin Birth of a Dragon Define parthenogenesis and explain how it occurs in the Komodo dragon.

What Cell Reproduction Accomplishes Compare the functions, cellular processes, and cellular products of asexual and sexual reproduction.

8.2 The Cell Cycle and Mitosis 8.3. Describe the basic structure of a chromosome including how it is packaged into an elaborate, multilevel system of coiling and folding.

8.4. Describe key events of each phase of the cell cycle including when chromosomes are duplicated.

8.5. Describe key events of each phase of mitosis, explaining how cytokinesis differs in animal and plant cells.

8.6. Predict consequences of errors in the cell cycle control system including how such errors cause cancer cells to be different from healthy cells, how benign and malignant tumors differ, and what is meant by the “slash, burn, and poison” approach to cancer treatment.

8.7. Explain how you can reduce your risks of developing cancer or increase your chances of surviving it.

8.3 Meiosis, the Basis of Sexual Reproduction 8.8. Distinguish between the following pairs of terms including structure and function of each: sex chromosomes versus autosomes, somatic cells versus gametes, and diploid versus haploid cells.

8.9. Compare the processes and products of meiosis I, meiosis II, and mitosis, explaining how the independent assortment of chromosomes during meiosis, random fertilization, and crossing over contribute to genetic diversity in offspring.

8.10. Describe the consequences of nondisjunction in autosomes and sex chromosomes.

8 The Process of Science: Do All animals Have Sex? 8.11. Describe evidence that might be used to determine whether a species has historically reproduced sexually or asexually.

8 Evolution Connection: The Advantages of Sex 8.12. Explain why asexual and sexual reproduction are adaptive.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

8.1 Multiple Choice Questions 1) A(n) ________ is an example of an organism that can sometimes reproduce asexually by parthenogenesis.

A) cat B) human C) Komodo dragon D) mouse Answer: C Topic: 8 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 8.1 2) Ordinary cell division produces two daughter cells that are genetically identical. This type of cell division is important for all of the following functions EXCEPT ________.

A) growth of a multicellular organism B) cell replacement C) production of sperm and eggs D) asexual reproduction Answer: C Topic: 8.1 What Cell Reproduction Accomplishes Skill: Knowledge/Comprehension Learning Outcome: 8.2 3) The chromosomes of eukaryotic cells are found in the ________.

A) nucleus B) centriole C) Golgi apparatus D) nucleolus Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.3 4) Chromatin consists of ________.

A) DNA and protein B) RNA and protein C) protein only D) DNA only Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.3 5) A duplicated chromosome consists of two ________.

A) centromeres B) centrosomes 2 .

C) genomes D) sister chromatids Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.3 6) Sister chromatids are joined at the ________.

A) centromere B) spindle C) centrosome D) centriole Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.3 7) Which of the following occurs during interphase?

A) Chromatin becomes tightly coiled.

B) Chromosome duplication occurs.

C) Sister chromatids separate.

D) The mitotic spindle forms.

Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.4 8) The mitotic cell cycle results in the production of ________.

A) four cells, each with the same amount of genetic material and the same genetic information B) two cells, each with the same amount of genetic material but with different genetic information C) two cells, each with the same amount of genetic material and the same genetic information D) four cells, each with the same amount of genetic material but with different genetic information Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.4

3 .

9) Which of the following occurs during prophase?

A) Chromosomes line up on the midline of the cell.

B) The nuclear envelope forms.

C) Sister chromatids separate.

D) The mitotic spindle begins to form.

Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5 10) Which of the following is a stage of mitosis?

A) cytokinesis B) telophase C) interphase D) DNA synthesis Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5 11) The CORRECT sequence of stages of mitosis is ________.

A) prophase, metaphase, anaphase, telophase B) telophase, prophase, anaphase, metaphase C) anaphase, interphase, prophase, metaphase, telophase D) interphase, prophase, metaphase, anaphase, telophase Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5 12) During metaphase, ________.

A) the nuclear envelope breaks up B) sister chromatids separate C) centromeres divide D) chromosomes line up in the middle of the cell Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5

4 .

13) Which of these events occurs during anaphase?

A) Sister chromatids become separate chromosomes.

B) Chromosomes line up in the middle of the cell.

C) The nuclear envelope reappears.

D) The nuclear envelope breaks up.

Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5 14) During telophase, ________.

A) the events of prophase are reversed B) chromosomes line up in the middle of the cell C) sister chromatids become separate chromosomes D) the nuclear envelope breaks up Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5 15) A cell that completed the cell cycle without undergoing cytokinesis would ________.

A) have less genetic material than it started with B) not have completed anaphase C) have its chromosomes lined up in the middle of the cell D) have two nuclei Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Application/Analysis Learning Outcome: 8.5 Global LO: 2 16) Cytokinesis typically begins during the ________ stage of mitosis.

A) telophase B) prophase C) metaphase D) anaphase Answer: A Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.5

5 .

17) What is the difference between a benign and a malignant tumor?

A) Benign tumors are composed of cancer cells; malignant tumors are not.

B) Benign tumors are not the result of a failure of a cell cycle control system; malignant tumors are.

C) Benign tumors do not metastasize; malignant tumors do.

D) Benign tumors do not form lumps; malignant tumors do form lumps.

Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Knowledge/Comprehension Learning Outcome: 8.6 Global LO: 5 18) Which of the following will help prevent cancer and increase survival?

A) Eat a low-fiber, low-fat diet.

B) Limit exercise.

C) Seek early detection of tumors.

D) Smoke only cigarettes.

Answer: C Topic: 8.2 The Cell Cycle and Mitosis Skill: Application/Analysis Learning Outcome: 8.7 Global LO: 2, 5 19) Homologous chromosomes ________.

A) carry genes controlling the same inherited characteristics B) include only the autosomes C) are a set of chromosomes that the cell received from one parent D) carry the same versions of all genes Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8. 8 20) What chromosomes belong to a normal human male?

A) 22 autosomes and two Y chromosomes B) 44 autosomes and two Y chromosomes C) 44 autosomes, one X chromosome, and one Y chromosome D) 46 autosomes, one X chromosome, and one Y chromosome Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.8

6 .

21) What chromosomes belong to a normal human female?

A) 22 autosomes and 2 X chromosomes B) 44 autosomes and 2 X chromosomes C) 44 autosomes, one X chromosome, and one Y chromosome D) 46 autosomes and two X chromosomes Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.8 22) Chromosomes that do NOT determine the sex of an individual are called ________.

A) homologous chromosomes B) nonhomologous chromosomes C) sex chromosomes D) autosomes Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.8 23) Sexual reproduction in humans ________.

A) allows a haploid sperm cell to fertilize a haploid egg cell B) produces a haploid individual C) produces an individual with 23 chromosomes D) combines two diploid gametes, producing a zygote Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 24) In meiosis, how does prophase I differ from prophase II? A) During prophase I there is one diploid cell; during prophase II there are two haploid cells.

B) During prophase I chromosomes line up single file in the middle of the cell; during prophase II the chromosomes line up in double file in the middle of the cell.

C) During prophase I the chromosomes coil up; the chromosomes are not coiled up during prophase II. D) In prophase I the sister chromatids are attached; in prophase II the sister chromatids are separated.

Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2

7 .

25) How much genetic material is present in a cell during prophase I compared to a cell that has completed meiosis II? A) one-quarter as much B) four times as much C) one-half as much D) twice as much Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2, 4 26) During metaphase I, ________.

A) crossing over occurs B) homologous chromosomes line up in the middle of the cell C) the nuclear envelope breaks up D) sister chromatids separate and migrate to opposite poles Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 27) Upon completion of telophase I and cytokinesis, there is(are) ________ cell(s).

A) four haploid B) two diploid C) two haploid D) one diploid Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 28) Which of the following is a characteristic seen in prophase I that does NOT occur in prophase II? A) Chromosomes move to the middle of the cell.

B) Spindle formation occurs.

C) The number of chromosomes doubles.

D) Crossing over occurs.

Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 Global LO: 7

8 .

29) Anaphase II is essentially the same as mitotic anaphase except that in anaphase II ________ and in mitotic anaphase ________.

A) the cells are diploid... the cells are haploid B) chromosomes line up double file in the middle of the cell... chromosomes line up single file in the middle of the cell C) crossing over occurs... crossing over does not occur D) the cells are haploid and sister chromatids separate... the cells have the same number of chromosomes as the original cell and sister chromatids separate Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 Global LO: 7 30) One difference between mitosis and meiosis is ________.

A) mitosis produces cells genetically identical to the parent cell, but meiosis does not B) mitosis produces more daughter cells for each division than meiosis C) mitosis produces haploid cells, but meiosis produces diploid cells D) mitosis requires only one parent cell, but meiosis requires two parent cells Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 Global LO: 7 31) Genetic variation is accomplished by all but one of the following. Choose the exception.

A) the events of meiosis I B) crossing over C) independent assortment D) the events of meiosis II Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2 32) Which of the following is the best description of the events of anaphase I? A) Half of the chromosomes inherited from the mother go to one pole along with half of the chromosomes inherited from the father.

B) Sister chromatids separate and the daughter chromosomes migrate to opposite poles.

C) Homologous chromosomes randomly separate and migrate to opposite poles.

D) All of the chromosomes inherited from the mother go to one pole of the cell, and all of the chromosomes inherited from the father go to the other pole.

Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Knowledge/Comprehension Learning Outcome: 8.9 9 .

33) For a species with four pairs of chromosomes, ________ chromosome combinations are possible.

A) 4 B) 8 C) 16 D) 20 Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2, 4 34) Crossing over during prophase I results in ________.

A) nondisjunction B) reciprocal translocation C) duplication D) genetic recombination Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2 35) A karyotype (a chromosome display) would be unable to determine ________.

A) sex B) Down syndrome C) Turner syndrome D) eye color Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 1, 2, 3, 5, 6, 7 36) How many chromosomes can a gamete possess as a result of nondisjunction?

A) n + 1 or n - 1 B) 2n + 1 or 2n - 1 C) 2n - 1 only D) 2n + 1 or n - 1 Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 1, 2, 4, 5, 6, 7

10 .

37) How many chromosomes does an individual with Turner syndrome have?

A) 2n + 1 B) n + 1 C) 2n − 1 D) n − 1 Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 1, 2, 4, 5, 6, 7 38) Sexual reproduction appears to be absent in bdelloid rotifers. Which of these, if found in this group, would bring into question the idea that they reproduce ONLY asexually?

A) female rotifers with eggs B) significant differences of two different alleles among different populations (one population having mostly allele A and one having mostly a).

C) cells in which meiosis occurs D) related groups (not bdelloid rotifers) which reproduce both sexually and asexually.

Answer: C Topic: 8 The Process of Science Skill: Synthesis/Evaluation Learning Outcome: 8.11 Global LO: 1, 2, 6 39) Which of these describes the type of reproduction that is most adaptive in a rapidly changing environment with many different parasitic diseases present?

A) asexual reproduction because the currently successful genotypes can reproduce quickly B) asexual reproduction, because asexual reproduction uses less energy, which leaves more for each individual to adapt to the changing environment C) sexual reproduction because the diversity of genotypes increases the likelihood that there is one which can survive in a new environment D) sexual reproduction because this type of reproduction allows the production of a greater number of offspring thus providing more individuals to take advantage of any environmental challenges presented Answer: C Topic: 8 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 8.12 Global LO: 2

11 .

8.2 Art Questions 1) Examine the figure below. Nucleosomes are made of ________.

12 .

A) RNA and protein B) DNA C) proteins D) DNA and histone proteins Answer: D Topic: 8.2 The Cell Cycle and Mitosis Skill: Application/Analysis Learning Outcome: 8.3 Global LO: 2, 3 2) As shown in the following figure, plant cell cytokinesis differs from animal cell cytokinesis because ________.

A) plant cells produce more daughter cells B) plant cells form a cell plate and animal cells do not C) animal cells produce more daughter cells D) animal cells form a cell plate and plant cells do not Answer: B Topic: 8.2 The Cell Cycle and Mitosis Skill: Application/Analysis Learning Outcome: 8.5 Global LO: 2, 3

13 .

3) This diagram of the human life cycle shows that ________.

A) meiosis produces a diploid zygote B) meiosis produces haploid sperm and egg cells C) fertilization produces a haploid zygote D) a diploid zygote undergoes meiosis to produce an adult human Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2, 3 4) What is the chromosome number found in humans cells after meiosis I is completed?

A) 46 autosomes B) 43 autosomes and 2 sex chromosomes C) 22 autosomes and a sex chromosome D) 44 autosomes and 2 sex chromosomes Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.9 Global LO: 2, 3, 4

14 .

5) The above figure shows that ________.

A) meiosis results in the formation of four haploid daughter cells B) fertilization results in four haploid daughter cells C) the human 2n number is 4 D) meiosis forms diploid gametes Answer: A Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2, 3 6) The 2n number for the cell depicted here is ________.

A) one B) two C) four D) eight Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.9 Global LO: 2, 3, 7

15 .

7) The karyotype above shows ________.

A) abnormal sex chromosomes B) trisomy 21, a cause of Klinefelter syndrome C) Turner syndrome D) trisomy 21, a cause of Down syndrome Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 8) Which of these could lead to the mistake evident in the karyotype?

A) a failure of cytokinesis after meiosis I in gamete formation B) a nondisjunction in meiosis II in gamete formation C) crossing over in meiosis I in gamete formation D) fertilization by two sperm in zygote formation Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 2, 3, 5, 7

16 .

8.3 Scenario Questions Please read the following paragraph and answer the following questions.

Amanda's parents realized that her body was not developing properly about the time she was 12 years old. She was shorter than most of her friends and was not going through changes normally associated with female puberty. They took her to a doctor who initially diagnosed Amanda with Turner Syndrome because of her physical features. He ordered a karyotype that confirmed his diagnosis. Amanda was born with only one X chromosome. Although there is no specific cure, the doctor was able to treat her and correct some of the problems associated with the condition.

For example, she received growth hormone to improve her growth and estrogen to help her develop the physical changes of puberty.

1) Amanda's abnormal number of sex chromosomes resulted from ________.

A) independent assortment of chromosomes B) crossing over C) nondisjunction D) random fertilization Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 2) With respect to her sex chromosomes, Amanda would be designated as ________.

A) XYY B) XO C) XOY D) XX Answer: B Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Application/Analysis Learning Outcome: 8.10 Global LO: 2, 3, 5, 7 3) What percentage of Amanda's gametes would likely have the normal number of chromosomes?

A) zero B) 100 percent C) 50 percent D) 25 percent Answer: C Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 2, 3, 4, 5, 7 17 .

4) If only some, but not all, of Amanda's somatic (body) cells had only one X chromosome, this could indicate that an error occurred ________.

A) during mitosis leading to the sperm or egg that came together to form Amanda B) during meiosis in the first cell division of the original cell that was Amanda (the zygote) C) during meiosis which occurred in Amanda's ovaries D) during mitosis which occurred at a multicellular stage of Amanda's development Answer: D Topic: 8.3 Meiosis, the Basis of Sexual Reproduction Skill: Synthesis/Evaluation Learning Outcome: 8.10 Global LO: 2, 3, 4, 5, 7

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 9 Patterns of Inheritance Chapter 9 Learning Outcomes 9 9.1.

Biology and Society: Our Longest-Running Genetic Experiment Explain how human experiences of breeding dogs and food crops can provide insights into principles of genetics.

9.1 Genetics and Heredity 9.2. Apply through examples and working problems, genetics terms and concepts including: 1) genetics and heredity; 2) characters and traits; 3) self-fertilization and crossfertilization; 4) purebred organisms and hybrids; 5) the P, the F1, and the F2 generations; 6) heterozygous and homozygous conditions; 7) dominant and recessive alleles; 8) a genotype and a phenotype; 9) phenotypic and genotypic ratios; and 10) Mendel’s law of segregation and law of independent assortment.

9.3. Set up and complete genetic analysis (problems) involving a testcross to determine an organism’s genotype, the use of the rule of multiplication to determine probable outcomes, and the use of pedigrees to determine how a particular human trait is inherited.

9.4. Compare the frequency and method of inheritance of recessive and dominant disorders.

9.5. Describe and compare methods that can be used to detect the presence of disease-causing alleles in a baby before birth.

9.2 Variations on Mendel’s Laws 9.6. Identify situations involving variations on Mendel’s laws including incomplete dominance, codominance, pleiotropy, and polygenic inheritance.

9.7. Describe the process of epigenetics and the environment in inheritance.

9.3 The Chromosomal Basis of Inheritance 9.8. Describe how the chromosome theory of inheritance explains linked genes.

9.9. Explain and describe examples of sex-linked inheritance.

9 Evolution Connection: Barking Up the Evolutionary Tree 9.10. Describe the relationships between the many breeds of dogs.

Global Learning Outcomes: 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

9.1 Multiple Choice Questions 1) The best definition of a purebred plant is one that ________.

A) cannot be cross-fertilized B) self-fertilizes to produce offspring identical to the parent C) produces sterile offspring when cross-fertilized D) self-fertilizes to produce hybrid offspring Answer: B Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 2) A mating between a purebred purple-flowered pea plant and a purebred white-flowered pea plant would produce a(n) ________.

A) purebred variety B) hybrid C) P generation D) F2 generation Answer: B Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 Global LO: 3 3) Alleles are described as ________.

A) homologous chromosomes B) environmental factors that affect gene expression C) alternate versions of a gene D) alternate phenotypes Answer: C Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2

2 .

4) A purebred plant that produces yellow seeds is crossed with a purebred plant that produces green seeds. The seeds of all of the offspring are yellow. Why? A) The yellow allele is recessive to the green allele.

B) All of the offspring are homozygous yellow.

C) The yellow allele is dominant to the green allele.

D) The alleles are codominant.

Answer: C Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2 5) A purebred plant that produces yellow seeds is crossed with a purebred plant that produces green seeds. The F1 plants have yellow seeds. What is the expected phenotypic ratio of seed color of the offspring of an F1 × F1 cross?

A) 1:2:1 B) 2:1 C) 3:1 D) 9:3:3:1 Answer: C Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4 6) According to Mendel's law of segregation, ________.

A) two alleles segregate into each gamete B) more gametes carrying the dominant allele are produced than gametes carrying the recessive allele C) gametes have one allele copy for each gene D) gametes are diploid Answer: C Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 7) Attached earlobes are recessive to free earlobes. What genotypic ratio is expected when an individual with attached earlobes mates with an individual heterozygous for free earlobes?

A) 2:1 B) 1:1 C) 1:2:1 D) 3:1 Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4 3 .

8) Mendel crossed purebred purple-flowered plants with purebred white-flowered plants, and all of the resulting offspring produced purple flowers. The offspring are all ________, and the allele for purple flowers is ________.

A) heterozygotes... recessive B) heterozygotes... dominant C) homozygotes... recessive D) homozygotes... dominant Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2 9) Attached earlobes are recessive to free earlobes. What is the probability of having a child with attached earlobes when an individual with attached earlobes mates with an individual heterozygous for free earlobes?

A) 0% B) 25% C) 50% D) 75% Answer: C Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4 10) In humans, the presence or absence of dimples is a trait controlled by a single gene. What is the genotype of an individual who is heterozygous for dimples?

A) DD B) Dd C) dd D) DI Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2

4 .

11) An individual who is homozygous ________.

A) expresses the dominant trait B) carries two different alleles for a gene C) carries two copies of the same allele for a gene D) expresses the recessive trait Answer: C Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 12) Which of these crosses will produce only heterozygous offspring?

A) AA × aa B) AA × Aa C) Aa × Aa D) Aa × aa Answer: A Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2 13) What name is given to the specific location of a gene on a chromosome?

A) locus B) phenotype C) genotype D) allele Answer: A Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 14) Round seeds (R) are dominant to wrinkled seeds (r), and yellow seeds (Y) are dominant to green seeds (y). What is the expected phenotypic ratio of a cross between an RrYy and an rryy individual?

A) 1:2:1 B) 9:3:3:1 C) 3:1 D) 1:1:1:1 Answer: D Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4

5 .

15) An individual with the genotype AaBb produces four different gametes in equal proportions.

This is a demonstration of ________.

A) the chromosomal theory of inheritance B) Mendel's law of independent assortment C) linkage D) Mendel's principle of segregation Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4 16) To determine the phenotype of an individual who expresses a dominant trait, you would cross that individual with an individual who ________.

A) expresses the dominant trait B) is homozygous recessive for that trait C) is homozygous dominant for that trait D) is heterozygous for that trait Answer: B Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.3 17) A couple has two female children. What is the probability that their next child will be male?

A) 25% B) 50% C) 33% D) 67% Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.3 Global LO: 2, 3, 4 18) In humans, free earlobes (E) are dominant to attached earlobes (e) and the presence of freckles (F) is dominant to the absence of freckles (f). If an individual heterozygous for both of these traits were to mate with an individual with attached earlobes and no freckles, what is the probability of having a child with attached earlobes and freckles?

A) 0% B) 25% C) 50% D) 100% Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.3 Global LO: 2, 3, 4 6 .

19) What data or test would you seek to determine whether or not a trait is sex linked?

A) karyotype B) pedigree C) DNA sequence D) blood test Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.3 Global LO: 2, 3, 5 20) The ________ is most commonly found in nature.

A) recessive trait B) wild-type trait C) parental type D) dominant trait Answer: B Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.4 21) An individual heterozygous for cystic fibrosis ________.

A) cannot have children with cystic fibrosis B) is a carrier C) will have children who are all carriers of cystic fibrosis D) has cystic fibrosis Answer: B Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.2 22) Achondroplasia is a form of dwarfism caused by a dominant allele. The homozygous dominant genotype causes death, so individuals who have this condition are all heterozygotes. If a person with achondroplasia mates with a person who does not have achondroplasia, what percentage of their children would be expected to have achondroplasia?

A) 0% B) 50% C) 75% D) 100% Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.2 Global LO: 2, 3, 4

7 .

23) Which of the following techniques is used to collect fetal cells during pregnancy for genetic testing?

A) testcross B) dihybrid cross C) amniocentesis D) pedigree analysis Answer: C Topic: 9.1 Genetics and Heredity Skill: Knowledge/Comprehension Learning Outcome: 9.5 24) What is the key to the recognition of incomplete dominance?

A) The phenotype of the heterozygote falls between the phenotypes of the homozygotes.

B) The trait exhibits a continuous distribution.

C) The alleles affect more than one trait.

D) The heterozygote expresses the phenotype of both homozygotes.

Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Application/Analysis Learning Outcome: 9.6 Global LO: 2 25) An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. What is the relationship between the alleles for hair texture?

A) pleiotropy B) incomplete dominance C) wavy hair dominant to both straight and curly hair D) codominance Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Knowledge/Comprehension Learning Outcome: 9.6 26) An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. If an individual with wavy hair mates with an individual with straight hair, what is the probability that their child will have curly hair?

A) 0% B) 25% C) 50% D) 75% Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Application/Analysis Learning Outcome: 9.6 Global LO: 2, 3, 4 8 .

27) What is the key to the recognition of codominance?

A) The phenotype of the heterozygote is intermediate between the phenotypes of the homozygotes.

B) The trait exhibits a continuous distribution.

C) The alleles affect more than one trait.

D) The heterozygote expresses the phenotype of both homozygotes.

Answer: D Topic: 9.2 Variations on Mendel's Laws Skill: Knowledge/Comprehension Learning Outcome: 9.6 28) An individual with the blood group genotype LMLN has the phenotype MN. What is the relationship between the LM and LN alleles?

A) codominance B) pleiotropy C) LN is dominant D) incomplete dominance Answer: A Topic: 9.2 Variations on Mendel's Laws Skill: Application/Analysis Learning Outcome: 9.6 Global LO: 2 29) Marfan syndrome is the result of inheriting a single allele. Individuals with Marfan syndrome are tall and long-limbed, and have both cardiovascular and eye defects. Of what type of inheritance is the phenotype of Marfan syndrome an example?

A) codominance B) homozygous recessive C) pleiotropy D) incomplete dominance Answer: C Topic: 9.2 Variations on Mendel's Laws Skill: Application/Analysis Learning Outcome: 9.6 Global LO: 2, 5 30) What is key to recognition of a trait whose expression is determined by the effects of two or more genes (polygenic inheritance)?

A) A mating between a homozygous and a heterozygous individual produces more than the expected number of offspring expressing the dominant trait.

B) All of the alleles of the gene for that trait are equally expressed.

C) Pleiotropy occurs.

D) The trait varies along a continuum in the population.

Answer: D Topic: 9.2 Variations on Mendel's Laws Skill: Knowledge/Comprehension Learning Outcome: 9.6 9 .

31) In humans, the inheritance of ________ is best explained as being polygenic.

A) cystic fibrosis B) height C) blood type D) sickle-cell disease Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Knowledge/Comprehension Learning Outcome: 9.6 Global LO: 5 32) Many human traits, such as our performance on intelligence tests or our susceptibility to heart disease, are ________.

A) determined only by our genes B) influenced by both genes and the environment C) determined by genes in some people and by the environment in other people D) not affected by our genes Answer: B Topic: 9.2 Variations on Mendel's Laws Skill: Knowledge/Comprehension Learning Outcome: 9.7 Global LO: 2 33) What is the basis of Mendel's laws?

A) the behavior of chromosomes during prophase I of meiosis only B) the behavior of chromosomes during mitotic anaphase C) the behavior of chromosomes during prophase I and prophase II of meiosis D) the behavior of chromosomes during metaphase I and anaphase I of meiosis Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Knowledge/Comprehension Learning Outcome: 9.8 34) ________ genes violate Mendel's principle of independent assortment.

A) Codominant B) Linked C) Recessive D) Pleiotropic Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Knowledge/Comprehension Learning Outcome: 9.8

10 .

35) What is the best explanation for a BbCc × bbcc cross producing offspring in a 5:5:1:1 phenotypic ratio?

A) linked genes B) polygenic inheritance C) incomplete dominance D) codominance Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.8 Global LO: 2, 3, 4 36) A dihybrid cross produces 30 recombinant offspring out of a total of 1,000 offspring. What is the recombination frequency of the two gene pairs?

A) 6% B) 3% C) 30% D) 1.5% Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.8 Global LO: 2, 3, 4 37) The recombination frequency between gene B and gene C is 11%. The recombination frequency between gene B and gene D is 5%. The recombination frequency between gene C and gene D is 15%. What would be the arrangement of these genes on a linkage map?

A) CDB B) DBC C) BCD D) More information is needed.

Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.8 Global LO: 2, 3, 4 38) Linked genes are usually ________.

A) found on the X chromosome B) found on the Y chromosome C) codominant D) located close together on a chromosome Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Knowledge/Comprehension Learning Outcome: 9.8 11 .

39) Assume that having three nostrils is inherited as a sex-linked trait on the Y chromosome. A man with three nostrils has a daughter who has a son with a man who has only two nostrils. What is the probability that the three-nostriled man's grandson has three nostrils?

A) 0% B) 25% C) 50% D) 100% Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.9 Global LO: 2, 3, 4 40) Red-green color blindness is inherited as a sex-linked recessive trait. The gene is found on the X chromosome. Can a man with normal color vision father a daughter who is red-green color-blind?

A) Yes, if the woman with whom he mates is red-green color-blind.

B) Yes, if the man is heterozygous for red-green color blindness.

C) No, he can't (unless there is a mutation).

D) No, the expression of the trait skips a generation.

Answer: C Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.9 Global LO: 2, 5 41) Hypophosphatemia (vitamin D—resistant rickets) is inherited as a sex-linked dominant trait.

The relevant gene is found on the X chromosome. What is the expected outcome of a cross between a homozygous recessive woman and a man with hypophosphatemia?

A) All of their daughters and none of their sons exhibit hypophosphatemia.

B) Fifty percent of their daughters and fifty percent of their sons exhibit hypophosphatemia.

C) All of their sons and none of their daughters exhibit hypophosphatemia.

D) Twenty-five percent of their offspring exhibit hypophosphatemia.

Answer: A Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.9 Global LO: 2, 3, 4, 5

12 .

42) Experience with dog breeding has taught geneticists ________.

A) that, given enough time, any desired trait can be bred into dogs B) that purebred dogs have offspring with qualities identical to the parents, because all purebred dogs are alike genetically C) that, while physical traits can be molded through artificial selection, behavioral traits cannot D) that geographically isolated groups of dogs may be selected for quite different traits, resulting in a different dog breed Answer: D Topic: 9 Biology and Society: Our Longest-Running Genetic Experiment: Dogs and Evolution Skill: Knowledge/Comprehension Learning Outcome: 9.1 and 9.10 9.2 Art Questions Please refer to the following art to answer the following questions.

1) In the accompanying art, you see a table with the actual number of offspring that resulted from a dihybrid cross. The numbers do not show the 9:3:3:1 ratio predicted. One phenotype occurred more than predicted; another occurred less. The reason could be because ________.

A) of errors in mitosis B) some of the alleles were linked C) some of the alleles were sex-linked D) of polygenic inheritance Answer: B Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Synthesis/Evaluation Learning Outcome: 9.8 Global LO: 2, 3, 4

13 .

2) Recombinant offspring were produced by the mating shown in the accompanying art. What is the recombination frequency of purple round and red long offspring?

A) 21% B) 381 C) 21 + 21 D) 11% Answer: D Topic: 9.3 The Chromosomal Basis of Inheritance Skill: Application/Analysis Learning Outcome: 9.8 Global LO: 2, 3, 4 3) This hypothetical pedigree for a disease in humans illustrated inheritance that is

A) autosomal recessive.

B) autosomal dominant.

C) sex-linked dominant.

D) carried on the Y chromosome.

Answer: A Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.9 Global LO: 2, 3, 5

14 .

9.3 Scenario Questions Please read the following scenario to answer the following questions.

Widow's peak, a pointed hairline on the forehead, is a genetic trait caused by a dominant allele. It can be traced back through a family's history using pedigree analysis.

The pedigree shown here is of three generations of a family. Notice that some individuals (shown in gray) have a widow's peak (W = dominant allele and w = recessive allele).

1) Mary has the genotype ________.

A) WW B) ww C) Ww D) More information is needed.

Answer: C Topic: 9.1 Genetics and Heredity Skill: Synthesis/Evaluation Learning Outcome: 9.3 Global LO: 2, 3, 4 2) Janice's genotype is ________.

A) Ww B) WW C) ww D) WW or Ww Answer: D Topic: 9.1 Genetics and Heredity Skill: Synthesis/Evaluation Learning Outcome: 9.3 Global LO: 2, 3, 4

15 .

3) This pedigree supports the fact that widow's peak is due to a dominant allele, because if it were due to a recessive allele and both parents show the recessive phenotype, then ________.

A) half of the sons would have a widow's peak B) all of the offspring would have a widow's peak C) none of the daughters would have a widow's peak D) all of the daughters and none of the sons would have a widow's peak Answer: B Topic: 9.1 Genetics and Heredity Skill: Synthesis/Evaluation Learning Outcome: 9.3 Global LO: 2, 3, 4 Please read the following scenario to answer the following question.

The parents of a child with unusual disease symptoms take the child to a doctor for help. The doctor suspects that the condition might have a genetic basis. She recommends that the child be taken to a specialty clinic where physicians and staff members are trained to diagnose genetic diseases and counsel parents. Ultimately, the child is diagnosed with a rare recessively inherited disease. The parents are tested for the gene, and both are found to be heterozygous. The parents want to have another child but are afraid this child will also be affected.

4) What would genetic counselors say is the probability that the second child will have the disease?

A) 1/2 B) 1/4 C) 1/8 D) 1/16 Answer: B Topic: 9.1 Genetics and Heredity Skill: Application/Analysis Learning Outcome: 9.3 Global LO: 2, 3, 4, 5

16 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 10 The Structure and Function of DNA Chapter 10 Learning Outcomes 10 Biology and Society: The First 21st-Century Pandemic 10.1. Explain how the H1N1 virus evolved, the global response, and the dangers of influenza viruses over the past 100 years.

10.1 DNA: Structure and Replication 10.2. Describe and compare the chemical compositions and structures of DNA and RNA. 10.3. Explain the process of DNA replication.

10.2 Information Flow: From DNA to RNA to Protein 10.4. Explain how the language of DNA directs the production of polypeptides.

10.5. Describe the steps of transcription and the processing of RNA before it leaves the nucleus.

10.6. Describe the steps of translation.

10.7. Distinguish between insertion, deletion, and substitution mutations, and explain how mutations can be harmful or beneficial to organisms.

10.3 Viruses and Other Noncellular Infectious Agents 10.8. Compare the lytic and lysogenic cycles of bacteriophages.

10.9. Compare the life cycles of RNA and DNA viruses, and describe the spread, symptoms, and prevention of viral diseases in plants and animals.

10.10. Describe the reproductive cycle of retroviruses such as HIV and the mechanisms by which AZT and protease inhibitors limit AIDS. 10.11. Distinguish between viroids and prions, and explain how they cause disease.

10 Evolution Connection: Emerging Viruses 10.12. Describe the processes that contribute to the emergence of viral disease.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

10.1 Multiple Choice Questions 1) What was a surprising feature about the deadly nature of the 2009 H1N1 influenza virus?

A) H1N1 affected the elderly.

B) H1N1 affected healthy young people.

C) H1N1 affected birds.

D) H1N1 affected pigs.

Answer: B Topic: 10 Biology and Society: The First 21st-Century Pandemic Skill: Knowledge/Comprehension Learning Outcome: 10.1 Global LO: 5 2) DNA and RNA are polymers composed of ________ monomers.

A) nucleotide B) carbohydrate C) fatty acid D) amino acid Answer: A Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2 3) The backbone of DNA consists of ________.

A) nitrogenous bases B) a repeating sugar-nucleotide-sugar-nucleotide pattern C) a repeating sugar-phosphate-sugar-phosphate pattern D) paired nucleotides Answer: C Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2

2 .

4) Thymine and cytosine differ from adenine and guanine in that ________.

A) thymine and cytosine are single-ring structures, whereas adenine and guanine are double-ring structures B) thymine and cytosine are only found in DNA, whereas adenine and guanine are found in both DNA and RNA C) thymine and cytosine are only found in DNA, whereas adenine and guanine are only found in RNA D) thymine and cytosine are larger nitrogenous bases Answer: A Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2 5) RNA contains the nitrogenous base ________ instead of ________, which is found only in DNA. A) a deoxyribose sugar... a ribose sugar B) uracil... thymine C) uracil... guanine D) thymine... uracil Answer: B Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2 6) If adenine makes up 20% of the bases in a DNA double helix, what percent of the bases is guanine?

A) 60% B) 40% C) 20% D) 30% Answer: D Topic: 10.1 DNA: Structure and Replication Skill: Application/Analysis Learning Outcome: 10.2 Global LO: 2, 5 7) In a DNA double helix, adenine pairs with ________ and guanine pairs with ________.

A) cytosine... thymine B) guanine... adenine C) thymine... cytosine D) uracil... cytosine Answer: C Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2

3 .

8) If one strand of a DNA double helix has the sequence GTCCAT, what is the sequence of the other strand?

A) ACTTGC B) TGAACG C) CAGGTA D) CAGGUA Answer: C Topic: 10.1 DNA: Structure and Replication Skill: Application/Analysis Learning Outcome: 10.2 Global LO: 2 9) Evidence for the spiral nature of DNA came from ________.

A) X-ray crystallography studies B) studies of disease-causing bacteria C) base rule studies D) bacteriophage studies Answer: A Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2 10) What type of chemical bond joins the bases of complementary DNA strands?

A) ionic B) covalent C) hydrophilic D) hydrogen Answer: D Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.2 11) After replication, ________.

A) each new DNA double helix consists of two old strands B) each new DNA double helix consists of one old strand and one new strand C) each new DNA double helix consists of two new strands D) one new DNA double helix consists of two old strands and the other new DNA double helix consists of two new strands Answer: B Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.3

4 .

12) DNA replication ________.

A) is a slow process that results in virtually no errors B) requires DNA polymerase and RNA polymerase C) is a very fast process that results in numerous errors D) requires the cooperation of over a dozen enzymes and other proteins Answer: D Topic: 10.1 DNA: Structure and Replication Skill: Knowledge/Comprehension Learning Outcome: 10.3 13) What name is given to the collection of traits exhibited by an organism?

A) genome B) genotype C) phenotype D) genetic code Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.4 14) How many amino acids are common to all living systems?

A) 10 B) 20 C) 30 D) 100 Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.4 15) How many nucleotides make up a codon?

A) two B) three C) four D) five Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.4

5 .

16) The shared genetic code of all life on Earth is evidence that ________.

A) the genetic code arose relatively late in the history of life on Earth B) DNA replication is error-free C) all life shares a common ancestry D) bacterial cells arose earlier than eukaryotic cells Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.4 Global LO: 7 17) Transcription is the ________.

A) manufacture of a strand of RNA complementary to a strand of DNA B) manufacture of two new DNA double helices that are identical to an old DNA double helix C) modification of a strand of RNA prior to the manufacture of a protein D) manufacture of a protein based on information carried by RNA Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5 18) If a strand of DNA has the sequence AAGCTC, transcription will result in a(n) ________.

A) single RNA strand with the sequence TTCGAG B) DNA double helix with the sequence AAGCTC for one strand and TTCGAG for the complementary strand C) single RNA strand with the sequence UUCGAG D) RNA double helix with the sequence UUCGAG for one strand and AAGCUC for the complimentary strand Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.5 Global LO: 2 19) Which of the following enzymes is responsible for RNA synthesis?

A) DNA polymerase B) ribosome C) reverse transcriptase D) RNA polymerase Answer: D Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5

6 .

20) The region of DNA where RNA synthesis begins is the ________.

A) start codon B) promoter C) stop codon D) terminator Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5 21) The CORRECT sequence of events occurring during transcription is ________.

A) splicing, capping, tailing B) initiation, elongation, termination C) tailing, capping, splicing D) elongation, initiation, termination Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5 22) The absence of a terminator in transcription will result in ________.

A) the creation of a virus B) a strand of mRNA that lacks its cap and tail C) the production of a longer RNA molecule D) the production of a shorter RNA molecule Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.5 Global LO: 2 23) What protects mRNA from attack by cellular enzymes?

A) RNA splicing B) the removal of exons C) the lack of RNA-digesting enzymes in the cytoplasm D) a cap and tail Answer: D Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5

7 .

24) The expressed (coding) regions of eukaryotic genes are called ________.

A) caps B) promoters C) exons D) introns Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.5 25) Translation converts the information stored in ________ to ________.

A) DNA... RNA B) RNA... a polypeptide C) DNA... a polypeptide D) RNA... DNA Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.6 26) The RNA that is translated into a polypeptide is ________ RNA. A) viral B) ribosomal C) transfer D) messenger Answer: D Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.6 27) The DNA codon AGT codes for an amino acid carried by a tRNA with the anticodon ________.

A) TCU B) AGU C) TCA D) AGT Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.6 Global LO: 2

8 .

28) Where is translation accomplished?

A) lysosomes B) smooth endoplasmic reticulum C) ribosomes D) nucleoli Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.6 29) During translation, what is the CORRECT order of events that occur as an amino acid is added?

A) codon recognition, peptide bond formation, translocation B) translocation, codon recognition, termination C) initiation, codon recognition, termination D) peptide bond formation, translocation, codon recognition Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.6 30) Peptide bonds form between ________.

A) amino acids B) an mRNA codon and a tRNA anticodon C) a tRNA and the amino acid it is carrying D) an mRNA transcript and the small ribosomal subunit Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.6 31) Scientific research companies sell kits that allow researchers to produce proteins in test tubes via a process known as "in vitro translation." Which one of following components is NOT needed in these kits?

A) amino acids B) transfer RNA C) DNA D) ribosomes Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.6 Global LO: 2

9 .

32) A mutation within a gene that will insert a premature stop codon in mRNA would ________.

A) result in a longer polypeptide chain B) result in a shortened polypeptide chain C) change the location at which transcription of the next gene begins D) have the same effect as deleting a single nucleotide in the gene Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.7 33) What is the smallest number of nucleotides that must be added or subtracted to change the triplet grouping of the genetic message?

A) one B) two C) three D) four Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.7 34) What is the ultimate source of all diversity?

A) natural selection B) sexual recombination C) meiosis D) mutation Answer: D Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.7 Global LO: 7 35) Mad cow disease is caused by A) a retrovirus similar to HIV. B) an enveloped virus.

C) small circular RNA molecules called viroids.

D) infectious proteins called prions.

Answer: D Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.11 Global LO: 5

10 .

36) How can bacteriophage DNA be spread from cell to cell without causing cell death?

A) by altering the way a cell splices its RNA B) via a lytic cycle C) via a lysogenic cycle D) by changing the length of its DNA molecules Answer: C Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.8 37) As an experiment, you infect bacteria with an unknown virus to see how the bacteriophage affects the bacteria. After a few days, you notice that the bacterial population is growing normally and that the cells appear healthy. Assuming that the infection occurred, what can you conclude from your observations?

A) The virus is a bacteriophage that is reproducing the lytic cycle.

B) The virus is a retrovirus that is reproducing the lytic cycle.

C) The virus is a bacteriophage that is reproducing the lysogenic cycle.

D) The virus is a retrovirus that is reproducing the lysogenic cycle.

Answer: C Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Synthesis/Evaluation Learning Outcome: 10.8 Global LO: 2 38) Plant viruses ________.

A) often use RNA, rather than DNA, as their genetic material B) benefit plants, rather than causing disease C) cause diseases that can be easily cured D) do not exist, as viruses attack only animals Answer: A Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.9 39) A(n) ________ is to bacteria as a ________ is to animal cells.

A) retrovirus... virus B) phage... prophage C) prophage... provirus D) RNA virus... DNA virus Answer: C Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Application/Analysis Learning Outcome: 10.9 Global LO: 2

11 .

40) HIV (human immunodeficiency virus) must use its own ________ to reproduce.

A) DNA polymerase B) reverse transcriptase C) RNA polymerase D) tRNA Answer: B Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.10 Global LO: 5 41) Which of the following would NOT likely develop as an emerging virus?

A) a virus harmful to humans that changes very slowly over time B) A virus that is normally harmless to humans undergoes rapid mutations.

C) a virus that begins to infect people in New York City, a popular tourist destination D) a virus that affects primarily rabbits mutates and infects humans Answer: A Topic: 10 Evolution Connection Skill: Application/Analysis Learning Outcome: 10.12 Global LO: 2, 5

12 .

10.2 Art Questions 1) The figure below shows the flow of genetic information in a eukaryotic cell. The transfer of information from DNA into an RNA molecule is known as ________.

A) DNA replication B) transcription C) polypeptide D) translation Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.4 Global LO: 3

13 .

2) Examine the genetic code table shown below. The codon AGC codes for the amino acid ________.

A) serine B) arginine C) threonine D) alanine Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.4, 10.6 Global LO: 2, 3

14 .

3) Consider the following figure. It illustrates that a single amino acid substitution in the hemoglobin gene ________.

A) always involves adenine and uracil B) may alter a protein so that it no longer functions properly C) is a silent mutation D) causes a nonsense mutation Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Knowledge/Comprehension Learning Outcome: 10.7 Global LO: 3

15 .

4) Flu vaccines have been demonstrated to protect the elderly, as shown in the figure below.

Assume there is a sample of 100 elderly people that normally would be hospitalized in winter.

How many of them would you predict would still be hospitalized in the winter if all 100 of them received the flu vaccine?

A) 27 B) 48 C) 52 D) 73 Answer: D Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Synthesis/Evaluation Learning Outcome: 10.1 Global LO: 2, 3, 4

16 .

5) An mRNA is expressed that begins with the sequence AUGCCAGGCGUC. Using the genetic code below, determine what peptide will be translated from this mRNA.

A) Met — Pro — Gly — Val B) Met — Gly — Pro — Val C) Pro — Met — Val — Gly D) Val — Gly — Pro — Met Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.4, 10.6 Global LO: 2, 3

17 .

10.3 Scenario Questions Please read the following scenario to answer the following questions If you were asked to study the pattern of bacterial growth (increase in numbers over time) during an infection, you would find that numbers of bacteria increase exponentially up to a certain point. Assume that you have been asked to interpret the growth of bacteriophages. You infect the host bacteria and measure the increase of phages over a defined period of time. You plot the results and get the graph shown here.

1) The first thing you notice is that there is no immediate increase in viruses following infection.

This is because ________.

A) it takes the virus time to adapt to the host B) although the virus has infected the host, it takes time to complete the lytic cycle C) the host is immune to the virus D) the virus is in a lysogenic cycle throughout the experiment Answer: B Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.8 Global LO: 3

18 .

2) Once viruses are detected, the number of viruses increases rapidly. This is because ________.

A) lysogeny produces large numbers of bacteriophages B) DNA viruses reproduce more rapidly than RNA viruses C) the host cell speeds the release process D) the viruses lyse the hosts to release mature viruses quickly in a short amount of time Answer: D Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Knowledge/Comprehension Learning Outcome: 10.8 Global LO: 3 3) At what point on the graph are the viruses increasing in number the fastest?

A) A B) B C) C D) D Answer: C Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Application/Analysis Learning Outcome: 10.8 Global LO: 2, 3 4) Assume that you want to take a sample of viruses so that you could use them to infect the most bacteria. At what point on the graph should you take your sample from if you want to achieve this goal?

A) A B) B C) C D) D Answer: D Topic: 10.3 Viruses and Other Noncellular Infectious Agents Skill: Synthesis/Evaluation Learning Outcome: 10.8 Global LO: 2, 3

19 .

Please read the following scenario to answer the following questions.

While working with cultured mouse cells, a researcher unknowingly treated the cells with a mutagen that causes the deletion or insertion of individual nucleotides in DNA. Subsequently, the researcher isolated and cultured a single cell from this group and noticed that the progeny of this cell were not producing a certain protein and that this affected their survival.

5) The mutation that resulted from the accident was probably ________.

A) an amino acid substitution B) one that changed the triplet grouping of the genetic message C) an error in translation D) a loss in regulation of gene expression Answer: B Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.7 Global LO: 2 6) The mutation would be most harmful to the cells if it resulted in ________.

A) a single nucleotide insertion near the start of the coding sequence B) a single nucleotide deletion near the end of the coding sequence C) a single nucleotide in the middle of an intron D) deletion of a triplet near the middle of the gene Answer: A Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Synthesis/Evaluation Learning Outcome: 10.7 Global LO: 2 7) The researcher isolated a different single cell and determined that it was producing a certain protein. However, the protein was much shorter than it should have been. What kind of mutation likely occurred in this protein?

A) one that introduced a silent mutation B) one that substituted amino acids C) one that introduced a premature stop codon D) one that deleted an entire amino acid Answer: C Topic: 10.2 Information Flow: From DNA to RNA to Protein Skill: Application/Analysis Learning Outcome: 10.7 Global LO: 2

20 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 11 How Genes Are Controlled Chapter 11 Objectives 11 Biology and Society: Tobacco’s Smoking Gun 11.1. Describe the evidence that strongly suggests that cigarette smoking causes lung cancer.

11.1 How and Why Genes Are Regulated 11.2. Explain how gene regulation leads to cells with many different properties.

11.3. Explain how the lac operon works, and compare it to the mechanism of operons that control amino acid synthesis in bacteria.

11.4. Explain how transcription is regulated in eukaryotes, and compare transcriptional regulation in eukaryotes and prokaryotes.

11.5. Describe the significance of cell signaling and homeotic genes in multicellular organisms.

11.6. Explain how DNA microarrays help scientists visualize gene expression.

11.2 Cloning Plants and Animals 11.7. Explain how and why plants are cloned.

11.8. Explain how nuclear transplantation can be used to clone animals, and describe advantages and challenges of reproductive cloning of animals.

11.9. Compare the advantages and disadvantages of embryonic stem cells and adult stem cells in the replacement of tissues in adults.

11.3 The Genetic Basis of Cancer 11.10. Explain how mutations in proto-oncogenes and tumor suppressor genes can lead to cancer.

11.11. Evaluate how personal habits and individual choices can affect a person’s risk of developing cancers.

11 Evolution Connection: The Evolution of Cancer in the Body 11.12. Explain how populations of cancer cells evolve.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

11.1 Multiple Choice Questions 1) What happened when researchers added BPDE, a component of tobacco smoke, to human lung cells in a laboratory experiment?

A) The cells behaved normally.

B) The cells shrank in size.

C) The cells developed mutations in their p53 genes.

D) The cells required less energy to grow.

Answer: C Topic: 11 Biology and Society: Tobacco's Smoking Gun Skill: Knowledge/Comprehension Learning Outcome: 11.1 Global LO: 5 2) The process by which genotype becomes expressed as phenotype is ________.

A) gene regulation B) transcription C) gene expression D) translation Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.2 3) In bacteria, what name is given to a cluster of genes with related functions, along with their DNA control sequences?

A) operon B) operator C) promoter D) exon Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3 4) Bacterial RNA polymerase binds to the ________.

A) operator B) proto-oncogene C) regulatory gene D) promoter Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3

2 .

5) In prokaryotes, the production of a single RNA transcript for a group of related genes is under the control of ________.

A) an operon B) enhancers C) a signal transduction pathway D) transcription factors Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3 6) In an operon, the ________ acts as an on/off switch.

A) operator B) promoter C) activator D) repressor Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3 7) Which of the following turns off transcription by binding to the operator?

A) RNA polymerase B) repressor C) promoter D) lactose Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3 8) Repressors act by blocking the binding of ________ to the operator.

A) promoters B) DNA polymerase C) the operon D) RNA polymerase Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3

3 .

9) What would you assume if you found RNA transcripts of lactose-utilizing genes within E. coli?

A) Lactose has bound to the lac operon activator.

B) Lactose is present in the cell.

C) The lac operon activator protein is present in the cell.

D) The lac operon repressor protein is absent in the cell.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.3 Global LO: 2 10) While examining a human cell that functions normally, you determine that it has 45 functional chromosomes and one chromosome that is almost completely inactive. You immediately decide that it is very likely that this cell ________.

A) came from a normal human female B) is lacking a chromosome C) is a gamete D) will become cancerous if one or two more genes are mutated Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.4 Global LO: 2 11) What is the first level of control of eukaryotic gene transcription?

A) RNA splicing B) attachment of RNA polymerase to the promoter C) DNA packing and unpacking D) the binding and unbinding of transcription factors to enhancer sequences Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 12) Male tortoiseshell cats ________.

A) do not have an X chromosome B) have orange and black patches of fur that reflect the pattern of X chromosome inactivation C) are usually XYY individuals D) are likely to be exceedingly rare and very likely to be sterile since normal male cats are XY Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.4 Global LO: 2

4 .

13) Which of these plays a role in the regulation of transcription in both prokaryotic and eukaryotic cells?

A) RNA splicing B) attachment of RNA polymerase to the promoter C) transcription factors D) gene operons Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 14) In eukaryotic cells, repressor proteins inhibit transcription by binding to ________.

A) silencers B) enhancers C) promoters D) operons Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 15) Introns are ________.

A) noncoding DNA sequences B) DNA sequences to which activators bind C) expressed DNA sequences D) the product of RNA splicing Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 16) Which of these is a type of posttranscriptional regulation of gene expression?

A) inactivation of tRNA B) alteration of DNA nucleotide sequences C) breakdown of proteins D) binding of transcription factors to enhancers Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4

5 .

17) What would enable a single RNA transcript to be translated into different polypeptides?

A) The RNA transcript can be spliced more than one way.

B) The coded polypeptide may be modified in more than one way.

C) The length of the RNA transcript tail can vary.

D) Two different genes can produce the same RNA transcript, which will then be translated differently.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 18) In a eukaryotic cell an abnormal protein is binding to the promoter for a gene. Which of the following processes will likely occur in this scenario?

A) Transcription factors will bind to enhancers.

B) Transcription factors will bind to the promoter.

C) The gene will be expressed normally.

D) RNA polymerase will bind to the promoter.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.4 Global LO: 2 19) Cells communicate with one another via ________.

A) cascades of gene activation B) the diffusion of RNA transcripts through adhesion junctions C) signal transduction pathways D) RNA splicing Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.5 20) The "master control genes" that regulate other genes and determine what body parts will develop in which locations are called ________.

A) enhancers B) homeotic genes C) oncogenes D) operons Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.5

6 .

21) Which of these is most likely to cause the development of a six-legged frog?

A) mutation of homeotic genes B) binding of repressors to operons C) a mutation in DNA polymerase that affects all cells D) conversion of a proto-oncogene to an oncogene Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.5 Global LO: 2 22) Homeotic genes ________.

A) have very different sequences in plant cells as compared to animal cells B) are an example of convergent evolution C) are evidence of the common ancestry of eukaryotic organisms D) regulate gene expression in both prokaryotic and eukaryotic cells Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.5 Global LO: 7 23) Which of these techniques could tell you how gene expression differs between individuals with and without cystic fibrosis?

A) therapeutic cloning B) DNA microarray C) reproductive cloning D) karyotyping Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Application/Analysis Learning Outcome: 11.6 Global LO: 2 24) How is it that the cells in different body tissues are able to perform different functions?

A) The cells exhibit different patterns of gene expression.

B) Different chromosomes have been inactivated in different cells.

C) The cells contain different genes.

D) The mutations that have accumulated in the cells of the different tissues control functions.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.2

7 .

25) Why can mature plants be cloned to produce genetically identical copies?

A) Mature plant cells contain only a fraction of the genes found in an adult plant.

B) Plants have evolved over time to suit the need of human agriculture.

C) Mature plant cells can develop into all the specialized cells of an adult plant.

D) Scientists have engineered all plants to have this ability.

Answer: C Topic: 11.2 Cloning Plants and Animals Skill: Knowledge/Comprehension Learning Outcome: 11.7 26) Which of the following is NOT a possible use of reproductive cloning?

A) the production of genetically identical mice and rats for experimentation B) the production of organs in large farm animals for transplant into humans C) restocking populations of extinct animals such as the wooly mammoth D) creating stocks of stem cells for human therapeutic use Answer: D Topic: 11.2 Cloning Plants and Animals Skill: Application/Analysis Learning Outcome: 11.8 Global LO: 2, 5 27) What is a difference between embryonic and adult stem cells?

A) The use of embryonic stem cells raises fewer ethical issues than the use of adult stem cells.

B) Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.

C) It is easier to obtain embryonic stem cells.

D) Adult stem cells are easier to grow in culture.

Answer: B Topic: 11.2 Cloning Plants and Animals Skill: Knowledge/Comprehension Learning Outcome: 11.9 Global LO: 5 28) What name is given to a gene that causes cancer?

A) repressor B) promoter C) homeotic gene D) oncogene Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.10

8 .

29) Many proto-oncogenes regulate ________.

A) cell growth B) cell cloning C) cell division D) cell repair Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.10 30) Inheritance of certain genes increases the risk of getting certain cancers; thus, it can be said that ________.

A) these cancers are inherited as a dominant trait B) mutations that occur in somatic cells can be passed from parent to offspring C) predisposition to these cancers is inherited D) lifestyle will have little impact on cancer risk for these individuals Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.10, 11.11 Global LO: 5 31) Data suggest that the normal version of BRCA1 functions as a(n) ________.

A) oncogene B) tumor-suppressor gene C) proto-oncogene D) silencer Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.10 32) When referring to cell division, oncogenes are most like ________ while tumor suppressor genes are most like ________.

A) the brakes on a car… the gas pedal on a car B) the gas pedal on a car… the brakes on a car C) the steering wheel on a car… the gas pedal on a car D) the brakes on a car… the steering wheel on a car Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Application/Analysis Learning Outcome: 11.10 Global LO: 2

9 .

33) If you were working for a pharmaceutical company trying to develop anticancer drugs, what biological process would be the best target to investigate?

A) meiosis B) mitosis C) cellular respiration D) glycolysis Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Synthesis/Evaluation Learning Outcome: 11.10 Global LO: 2, 5, 7 34) Which risk factor is associated with cancer of the colon and rectum?

A) tobacco B) viruses C) UV radiation D) dietary fat Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.11 Global LO: 5 35) ________ is(are) responsible for more cancers than any other carcinogen.

A) Asbestos B) UV radiation C) Tobacco D) X-rays Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.11 Global LO: 5 36) More people die of ________ cancer than of any other cancer.

A) lung B) skin C) pancreatic D) breast Answer: A Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.11 Global LO: 5

10 .

37) Which of these lifestyle choices will increase cancer risk?

A) jogging B) spending less time in the sun C) a diet low in plant fiber D) quitting smoking Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.11 Global LO: 5 38) Which of the following is NOT an example of how tumors evolve?

A) Tumor cells can spread throughout the body.

B) Tumor cells show genetic variability.

C) Tumor cells grow uncontrollably.

D) Tumor cells pass on mutations when they divide.

Answer: A Topic: 11 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 11.12 Global LO: 5, 7

11 .

11.2 Art Questions 1) Examine the figure below. The initiation of transcription requires that enhancers bind to ________.

A) DNA B) the promoter C) transcription factors D) RNA polymerase Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 Global LO: 3

12 .

2) The figure below illustrates ________.

A) transcription factors B) activators C) alternative RNA splicing D) protein activation Answer: C Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.4 Global LO: 3

13 .

3) The lac operon is shown in the accompanying figure. Answer the following question after reviewing the figure. The lac operon is usually in the ________ position and is activated by ________.

A) on... the repressor B) off... lactose C) off... the repressor D) on... the promoter Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Knowledge/Comprehension Learning Outcome: 11.3 Global LO: 3

14 .

4) Consider the following figure, which outlines cloning by nuclear transplantation. Why does the clone NOT resemble the surrogate mother?

A) The sperm came from a male donor, who would also pass some of his traits to the clone.

B) The embryonic cells are adversely influenced by the surrogate.

C) The DNA for the clone comes from the genetic donor, not the surrogate.

D) The nuclear material from the egg would influence the appearance of the clone.

Answer: C Topic: 11.2 Cloning Plants and Animals Skill: Knowledge/Comprehension Learning Outcome: 11.8 Global LO: 3

15 .

5) Examine the figure below. In a typical colon cancer, the first step is ________.

A) the inactivation of a tumor-suppressor gene B) the mutation of a tumor-suppressor gene, producing an oncogene C) the mutation of a proto-oncogene, producing an oncogene D) the conversion of an oncogene to a tumor-suppressor gene Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Knowledge/Comprehension Learning Outcome: 11.10 Global LO: 3

16 .

11.3 Scenario Questions Please read the paragraph below to answer the following questions.

Jim has become particularly interested in the genetic basis of cancer and has spent considerable time reading published papers about oncogenes. He learned that as early as 1972 researchers suggested that mutations in proto-oncogenes caused by carcinogens can convert the protooncogenes to oncogenes. He asked you to answer a couple of questions about this because he did not have a sufficient biology background.

1) Jim learned that some cancer cells produce more growth-stimulating proteins than others.

What would you give him as a plausible explanation?

A) Tumor suppressor genes may have been activated in these cells.

B) Proto-oncogenes may have mutated to become oncogenes in these cells.

C) Mutations in homeotic genes may be responsible.

D) This may result from vitamin C and vitamin E deficiencies.

Answer: B Topic: 11.3 The Genetic Basis of Cancer Skill: Application/Analysis Learning Outcome: 11.10 Global LO: 2, 5 2) Jim learned that viruses can sometimes cause cancer and wants to know why. You tell him that ________.

A) a human cell can acquire a tumor-suppressor gene from a virus B) a human cell can acquire a proto-oncogene from a virus C) a human cell can acquire an oncogene from a virus D) some viruses are passed from mother to child and cause "inherited" cancers Answer: C Topic: 11.3 The Genetic Basis of Cancer Skill: Application/Analysis Learning Outcome: 11.10 Global LO: 2, 5 3) Jim came across an advertisement for an herbal supplement that claimed to cure lung cancer by targeting precancerous cells in the lungs. If this claim were true, which of the following is a possible mechanism by which it may act?

A) The supplement would increase mutation rates in proto-oncogenes.

B) The supplement would inhibit the production of tumor suppressor proteins.

C) The supplement would stimulate translation of growth factors D) The supplement would restrict the transcription of oncogenes.

Answer: D Topic: 11.3 The Genetic Basis of Cancer Skill: Application/Analysis Learning Outcome: 11.10 Global LO: 2, 5, 6 17 .

Please read the paragraph below to answer the following questions.

You conducted a series of experiments to test whether the expression of hexokinase, an important enzyme involved in glycolysis, varies under different conditions. In the first experiment, you measured the production of hexokinase mRNA in cells at three different temperatures: 37°C, 25°C, and 10°C. Your results showed that the mRNA levels for hexokinase were 5× and 20× lower at 25°C and 10°C than at 37°C, respectively. Based on these results, you are going to conduct further experiments to attempt to answer your research question.

4) What can you conclude from these results?

A) Unpacking of the hexokinase gene occurs only at 37°C. B) Transcription of the hexokinase gene occurs less frequently at lower temperatures.

C) The levels of hexokinase protein are not affected by temperature.

D) Translation of the hexokinase gene occurs more frequently at higher temperatures.

Answer: B Topic: 11.1 How and Why Genes Are Regulated Skill: Synthesis/Evaluation Learning Outcome: 11.4 Global LO: 1, 2, 7 5) What would be the best experiment to do next to determine if complete hexokinase gene expression is temperature dependent?

A) Measure the amount of hexokinase mRNA in cells at different temperatures.

B) Measure the rate of transcription of the hexokinase gene in cells at different temperatures.

C) Measure the amount of mRNA that is broken down in cells at different temperatures.

D) Measure the amount of hexokinase protein in cells at different temperatures.

Answer: D Topic: 11.1 How and Why Genes Are Regulated Skill: Synthesis/Evaluation Learning Outcome: 11.4 Global LO: 1, 2, 7

18 .

6) DNA microarrays can be used to determine relative levels of gene expression between samples. DNA microarrays are usually interpreted by color: green means higher mRNA levels, yellow means equal levels, and red means lower levels. If you ran the samples from the temperature experiment on a DNA microarray using the 25°C experiment as a baseline, what results do you predict you would obtain?

A) The samples from the 37°C experiment would be green and the samples from the 10°C would be red.

B) The samples from the 37°C experiment would be red and the samples from the 10°C would be green.

C) The samples from the 37°C experiment would be green and the samples from the 10°C would be yellow.

D) The samples from the 37°C experiment would be yellow and the samples from the 10°C would be red.

Answer: A Topic: 11.1 How and Why Genes Are Regulated Skill: Synthesis/Evaluation Learning Outcome: 11.4 Global LO: 1, 2

19 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 12 DNA Technology Chapter 12 Learning Outcomes 12 Biology and Society: Using DNA to Establish Guilt and Innocence 12.1. Explain how DNA profiling is used in criminal trials to establish guilt and innocence.

12.1 Genetic Engineering 12.2. Relate useful biological products to the genetic engineering techniques used to produce them.

12.3. Explain how recombinant DNA is produced using plasmids, restriction enzymes, ligase, and gel electrophoresis.

12.4. Compare and contrast how genetically modified organisms are used in agriculture.

12.5. Evaluate the pros and cons of human gene therapy and how it can be used to treat disease.

12.2 DNA Profiling and Forensic Science 12.6. Explain how the polymerase chain reaction (PCR), short tandem repeat (STR) analysis, and gel electrophoresis are used in DNA profiling, the treatment and diagnosis of disease, and the investigations of crime, paternity, and ancient DNA. 12.3 Bioinformatics 12.7. Compare and contrast what is learned in the fields of genomics, metagenomics, proteomics, and systems biology.

12.8. Explain how the “whole-genome shotgun” method is used to study genomes.

12.9. Describe how the Human Genome Project and the field of bioinformatics can provide insights into evolutionary relationships.

12.4 Safety and Ethical Issues 12.10. Evaluate the potential benefits, risks, and concerns of producing genetically modified foods.

Evolution Connection: The Y Chromosome as a Window on History 12.11. Describe the results of DNA profiling of the human Y chromosome.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

12.1 Multiple Choice Questions 1) What evidence led to Kirk Odom's freedom after being wrongly imprisoned for 30 years?

A) an analysis of blood types from the crime scene B) an analysis of fingerprints from the crime scene C) accounts from witnesses D) an analysis of DNA from the crime scene Answer: D Topic: 12 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 12.1 Global LO: 5 2) Which of the following is the best definition for recombinant DNA? A) DNA that results from bacterial conjugation B) DNA that includes pieces from two different sources C) an alternate form of DNA that is the product of a mutation D) DNA that carries a translocation Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2 3) Which of the following is a genetically modified organism?

A) an organism carrying a gene that was acquired by artificial means B) the first organism in which a particular mutation has appeared C) a cloned organism carrying two different alleles D) an organism that gestated in an artificial womb Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2 4) Which of the following best defines the term "transgenic organism"?

A) an organism that is the first of its kind to bear a particular allele B) an organism in which a genetic defect has been corrected using recombinant DNA therapy C) an organism containing a gene from another species D) an organism containing genes from three or more species Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2

2 .

5) The world's first genetically engineered pharmaceutical product was ________.

A) humulin B) HGH C) tPA D) EPO Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2 Global LO: 5 6) A vaccine works by ________.

A) inhibiting bacterial reproduction B) stimulating the immune system to develop lasting defenses C) killing cells infected with a virus D) preventing translation of mRNA molecules that code for disease-causing proteins Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2 7) Transgenic animals are currently used ________.

A) to produce potentially useful proteins B) as food C) as vectors for use in cloning human DNA D) all of the answer options are correct Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.2 Global LO: 5 8) Which of the following can act as a vector to introduce new genes into a cell?

A) primers B) ligase C) restriction enzymes D) plasmids Answer: D Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3

3 .

9) Of these steps, which occurs first in the production of a recombinant plasmid?

A) cloning B) cutting DNA into fragments C) isolation of a plasmid from a bacterium D) reproduction of the engineered plasmid in bacteria Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 10) Of these steps, which one occurs earliest in the process of producing recombinant DNA? A) Human DNA fragments are mixed with the cut plasmids.

B) The same restriction enzyme is used to isolate the gene of interest and to cut the plasmid DNA. C) The recombinant plasmids are mixed with bacteria.

D) Bacteria carrying recombinant plasmids are cloned.

Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 Global LO: 2 11) When plasmids are used to produce a desired protein, the ________.

A) plasmids multiply and produce the protein outside of the bacterium B) bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate C) desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 12) The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

A) gene cloning B) PCR C) STR analysis D) whole-genome shotgun method Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3

4 .

13) Restriction enzymes are obtained from ________.

A) archaea B) eukaryotes C) viruses D) bacteria Answer: D Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 14) "Sticky ends" are produced as a result of the action of ________.

A) PCR B) DNA ligase C) restriction enzymes D) bacterial plasmids Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 15) "Sticky ends" are ________.

A) single-stranded ends of fragments of double-stranded DNA B) regions of double-stranded DNA that can be cut by a restriction enzyme C) portions of DNA used as markers for STR analysis D) regions of DNA amplified in PCR Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 16) A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________.

A) TAAGCB) CGGATC) GCCTAD) ATTGCAnswer: A Topic: 12.1 Genetic Engineering Skill: Application/Analysis Learning Outcome: 12.3 Global LO: 2

5 .

17) Which enzyme is used to bind DNA fragments together?

A) restriction enzyme B) lysozyme C) DNA ligase D) DNA polymerase Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 18) Of the following, which is the last step in the production of a recombinant DNA plasmid?

A) cloning B) using DNA ligase to join DNA fragments C) cutting the gene of interest into fragments D) allowing the reproduction of the bacterium bearing the recombinant plasmid Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 19) HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?

GTAAGCTTCGACAAGCTTGCTGA A) 0 times B) 1 time C) 2 times D) 3 times Answer: C Topic: 12.1 Genetic Engineering Skill: Application/Analysis Learning Outcome: 12.3 Global LO: 2 20) You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?

A) You can use the sample to determine the individual's blood type.

B) You can use gel electrophoresis to determine the length of the DNA found in the sample.

C) You can use PCR to increase the amount of DNA available for STR analysis.

D) You can use the sample to check for the presence of the Rhesus factor.

Answer: C Topic: 12.2 DNA Profiling and Forensic Science Skill: Application/Analysis Learning Outcome: 12.6 Global LO: 2, 5

6 .

21) What name is given to a region of DNA that varies from person to person?

A) genetic marker B) short tandem repeat C) sticky end D) restriction fragment Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Knowledge/Comprehension Learning Outcome: 12.6 22) Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

A) gel electrophoresis B) enzymes C) recombinant DNA D) plasmids Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 23) To make restriction fragments, a DNA sample is treated with ________.

A) DNA ligase B) restriction enzymes C) DNA polymerase D) lysozyme Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 24) Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

A) A:C ratio B) length C) G:T ratio D) pH Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3

7 .

25) STR analysis is a DNA profiling technique that makes use of the fact that different people have ________.

A) different numbers of repeats of short DNA sequences at certain sites in the genome B) different alleles for many genes in the genome C) different restriction fragments D) different CODIS DNA sequences Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Knowledge/Comprehension Learning Outcome: 12.6 26) FGA is one of the STRs that are used to compare DNA between different people. Why is FGA useful for comparing DNA between different people?

A) FGA varies in the number of repeats between different people.

B) FGA varies in sequence between different people.

C) FGA is only present in some peoples' genomes.

D) FGA is present in different places in different peoples' genomes.

Answer: A Topic: 12.2 DNA Profiling and Forensic Science Skill: Application/Analysis Learning Outcome: 12.6 Global LO: 2, 5 27) The scientific field that studies complete sets of genes is called ________.

A) genomics B) metagenomics C) proteomics D) genetic engineering Answer: A Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.7 28) The human genome contains approximately ________ genes.

A) 1,000 B) 5,000 C) 21,000 D) 30,000 Answer: C Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.7

8 .

29) Approximately what percentage of the human genome consists of noncoding DNA? A) 98% B) 87% C) 77% D) 67% Answer: A Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.7 30) The Human Genome Project has the potential to ________.

A) lead to treatments for inherited diseases B) lead to treatments for contagious diseases C) increase our understanding of the historical relationships among species D) play a role in all of the choices listed here Answer: D Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.9 Global LO: 5 31) Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A) Humans and chimpanzees share a relatively recent common ancestor.

B) Humans evolved from chimpanzees.

C) Humans are unique and different from all other life forms.

D) Humans are a more complex life form than chimpanzees.

Answer: A Topic: 12.3 Bioinformatics Skill: Application/Analysis Learning Outcome: 12.9 Global LO: 2, 7 32) To find the nucleotide sequence of human chromosomes, chromosomes had to be digested into small fragments and then ________.

A) centrifuged and electrophoresed B) fingerprinted C) cloned and sequenced D) restricted Answer: C Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.8 Global LO: 5

9 .

33) The study of the full protein sets that genomes encode is ________.

A) proteomics B) genomics C) metagenomics D) systems biology Answer: A Topic: 12.3 Bioinformatics Skill: Knowledge/Comprehension Learning Outcome: 12.7 34) In human gene therapy ________.

A) normal versions of genes are transferred to patients who carry a mutated allele B) harmless bacteria make important proteins for humans that cannot produce these proteins on their own C) bacterial plasmids are used to transfer genes to human patients D) genetically engineered alleles, usually from other species, replace mutated alleles Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.5 Global LO: 5 35) The state of human gene therapy today is that ________.

A) the work that has been completed so far is purely theoretical, but some treatments are in development B) there have been a small number of successes, including with the disease SCID C) human gene therapy is used routinely in the treatment of certain rare cancers D) human gene therapy is used to treat a wide variety of conditions, including diabetes, cancer, and bone marrow diseases Answer: B Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.5 Global LO: 5 36) Genetically modifying human ________ cells may directly affect future generations.

A) intestinal B) immune C) gametic D) somatic Answer: C Topic: 12.4 Safety and Ethical Issues Skill: Knowledge/Comprehension Learning Outcome: 12.10 Global LO: 5

10 .

37) Ethical dilemmas raised by DNA technology and knowledge of the human genome include ________.

A) the potential for interfering in evolution, only B) the safety of GM foods, only C) the potential discrimination against people predisposed to certain diseases, only D) all of the answer choices are correct Answer: D Topic: 12.4 Safety and Ethical Issues Skill: Knowledge/Comprehension Learning Outcome: 12.10 Global LO: 5 38) The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________.

A) proteomics B) plasmids C) the X chromosome D) the Y chromosome Answer: D Topic: 12 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 12.11

11 .

12.2 Art Questions 1) The following figure provides you with an overview of recombinant technology. The end result is a transgenic bacterium with a human gene that codes for marketable quantities of a human gene product. However, molecular biologists frequently have problems with the product.

One problem might be ________.

12 .

A) production of a human protein that is unable to function properly B) formation of a bacterium that cannot synthesize the product C) a bacterium with DNA that is resistant to restriction enzymes D) formation of mutants Answer: A Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 Global LO: 2, 3 2) The following figure shows that gel electrophoresis can be used to separate repetitive DNA sequences. Gel electrophoresis separates DNA fragments because ________.

A) double-stranded moves slower than single-stranded DNA B) of ratios of guanine to cytosine C) the DNA fragments have different lengths D) of the salt concentration in the gel matrix Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.3 Global LO: 3

13 .

3) The diagram below summarizes ________.

14 .

A) gene cloning B) how a human could be cloned C) human gene therapy D) how a vaccine is made Answer: C Topic: 12.1 Genetic Engineering Skill: Knowledge/Comprehension Learning Outcome: 12.5 Global LO: 3

4) The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). Which DNA molecule is the largest?

A) DNA molecule A B) DNA molecule B C) DNA molecule C D) DNA molecule D Answer: B Topic: 12.1 Genetic Engineering Skill: Application/Analysis Learning Outcome: 12.3 Global LO: 2, 3

15 .

5) The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). What is the approximate size of DNA molecule A? A) 250 nucleotides B) 300 nucleotides C) 350 nucleotides D) 400 nucleotides Answer: C Topic: 12.1 Genetic Engineering Skill: Application/Analysis Learning Outcome: 12.3 Global LO: 2, 3

16 .

12.3 Scenario Questions Please read the following scenario and then answer the following questions.

Molecular biologists have perfected DNA fingerprinting so that it is possible to use the technique to provide evidence to solve crimes and even identify a child's parents. Recently, a U.S. immigrant asked the U.S. Citizenship and Immigration Services for permission to have her young daughter who was living with grandparents in their homeland join her in the United States. Her request was denied because there was an apparent mix-up with the child's birth certificate and it could not be used as proof of maternity. Other forms of proof are required in cases such as this. The mother requested DNA fingerprinting to show that she was the mother of the daughter. Samples of DNA were taken from the mother (Mom) and the daughter (D) as well as from her son (S) living in the United States with her. STR analysis was run on the three samples, and the results are shown below.

1) The results indicate that ________.

A) she is not the mother of the son B) she is the mother of daughter D C) she is not the mother of daughter D D) the mother could not be the mother of both the daughter and the son Answer: B Topic: 12.2 DNA Profiling and Forensic Science Skill: Application/Analysis Learning Outcome: 12.6 Global LO: 2, 3, 5

17 .

2) You can use this DNA fingerprinting information to make a judgment about maternity because ________.

A) the shade of DNA bands will differ B) both mother and daughter contain only X chromosomes C) of the position of the bands in the gel D) of the size of the bands Answer: C Topic: 12.2 DNA Profiling and Forensic Science Skill: Knowledge/Comprehension Learning Outcome: 12.6 3) The short tandem repeat analysis ________.

A) compares markers on the sex chromosomes B) compares repetitive DNA sequences from different individuals C) does not require DNA amplification D) checks for purine and pyrimidine ratios Answer: B Topic: 12.2 DNA Profiling and Forensic Science Skill: Knowledge/Comprehension Learning Outcome: 12.6 4) STR analysis can also be used for crime scene investigations in addition to maternity testing.

Suppose that the results for the Mom were found at a crime scene, that the daughter's and the son's results were from possible suspects, and that each of the DNA markers in the gel was an STR marker. Would these results be enough to convince a jury that the results from the daughter matched the crime scene DNA (Mom)?

A) Yes, because the two STR markers match in size.

B) Yes, because you need only one STR marker to match to definitely make a connection between two people's DNA. C) No, because even though two STR markers matched, there still could be mismatches in the other 11 markers.

D) No, because blood-typing data analysis was not performed.

Answer: C Topic: 12.2 DNA Profiling and Forensic Science Skill: Synthesis/Evaluation Learning Outcome: 12.6 Global LO: 2, 5

18 .

Please read the following scenario and then answer the following questions.

Corn crops are susceptible to damage by different species of corn borer, an insect (a type of arthropod) that feeds and lives on corn plants. It is estimated that corn borers may cause up to $1 billion of damage a year to corn crops. Because of pests like the corn borer, researchers have created genetically modified pest-resistant crops. One type of pest-resistant crop, Bt corn, expresses a bacterial toxin that kills corn borers if they consume the toxin. While Bt corn has been planted and used in the United States since 1996, some researchers and members of the public continue to worry about negative effects of the Bt toxin on other animals, including arthropods and humans. In order to investigate the effects of Bt toxins on other animals, researchers conducted experiments where they fed arthropods Bt corn or non-Bt corn. A summary of the effects of eating Bt corn on single species of corn borer, mite, and beetle are shown in the figure below.

5) What can you conclude from the data in the graph?

A) Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.

B) Mites have the highest percent mortality of the arthropods studied.

C) Beetles are more likely to survive than mites when fed Bt corn.

D) Bt corn affects the mortality of all three arthropods equally.

Answer: A Topic: 12.1 Genetic Engineering Skill: Application/Analysis Learning Outcome: 12.4 Global LO: 2, 3, 5 6) Based on the data in the graph, do you think Bt corn is having its intended effect?

A) Yes, because Bt corn affected the mortality of all three arthropods equally.

B) Yes, because Bt corn selectively killed corn borers that ate it while the beetles and mites were unaffected when eating the Bt corn as compared to the non-Bt corn.

C) No, because Bt corn was designed to kill all arthropods that ate it, and only the corn borers were killed after eating the Bt corn.

D) No, because corn borer percent mortality increased when corn borers ate Bt corn; if Bt corn was effective, then percent mortality should have decreased.

Answer: B Topic: 12.1 Genetic Engineering Skill: Synthesis/Evaluation Learning Outcome: 12.4 Global LO: 2, 3, 5 19 .

7) One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

A) Yes, because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer.

B) Yes, because only the corn borer was affected when eating the Bt corn.

C) No, because more mites and beetles died after eating Bt corn than after eating non-Bt corn.

D) No, because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt. Answer: D Topic: 12.1 Genetic Engineering Skill: Synthesis/Evaluation Learning Outcome: 12.4 Global LO: 2, 3, 5, 6

20 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 13 How Populations Evolve Chapter 13 Learning Outcomes 13 Biology and Society: Evolution Today 13.1. Explain why an understanding of evolution is essential to the study of biology.

13.1 The Diversity of Life 13.2. Describe the hierarchical system of grouping species and how the binomial name of a species is created.

13.3. Compare the ways that Aristotle and Lamarck viewed the properties of living species and why simple observations today provide evidence against Lamarck’s evolutionary mechanism.

13.2 Charles Darwin and The Origin of Species 13.4. Explain how Darwin’s voyages on the Beagle influenced the development of his thoughts on evolution (natural selection), including how Lyell’s ideas impacted Darwin’s thinking, and the publication of Darwin’s work, On the Origin of Species.

13.3 Evidence of Evolution 13.5. Explain how the fossil record and homologies are evidence for evolution and why fossils represented a problem for the idea of fixed, permanent species.

13.6. Explain how evolutionary trees are constructed and what they represent.

13.4 Natural Selection as the Mechanism for Evolution 13.7. Compare the processes of artificial selection and natural selection.

13.8. Explain how natural selection is more a process of editing than a creative mechanism.

13.5 The Evolution of Populations 13.9. Explain the role of mutation and sexual reproduction in the evolution of life.

13.10. Explain why a population is considered the smallest unit of evolution.

13.11. Use the Hardy-Weinberg formula to determine the frequency of genotypes in a gene pool including determining if the situation meets conditions of equilibrium.

13.6 Mechanisms That Alter Allele Frequencies in a Population 13.12. Distinguish between the following concepts: genetic drift and gene flow; the bottleneck effect and the founder effect; directional selection, disruptive selection, and stabilizing selection; sexual selection and natural selection.

Evolution Connection: The Rising Threat of Antibiotic Resistance 13.13. Explain how humans are contributing to the increase in antibiotic-resistant bacteria.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

13.1 Multiple Choice Questions 1) Which is NOT a benefit of the understanding of evolution to understanding the field of biology?

A) Understanding evolution helps us to understand molecules.

B) Understanding evolution helps us to analyze ecosystems.

C) Understanding evolution helps advance biotechnology and medicine.

D) Understanding evolution helps us to understand why stars and galaxies change over time.

Answer: D Topic: 13 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 13.1 2) The common house mouse species, Mus musculus, has the following taxonomic classification: Mus, Muridae, Rodentia, Mammalia, Chordata, Animalia, Eukarya. Which part of the name is the Family?

A) Rodentia B) Chordata C) Muridae D) Animalia Answer: C Topic: 13.1 The Diversity of Life Skill: Application/Analysis Learning Outcome: 13.2 Global LO: 2 3) ________ believed that use (or lack of use) of body parts enables individual to develop certain traits that it passes on to its offspring while ________ believed that species are fixed forms that do not change over time.

A) Aristotle… Lamarck B) Lamarck… Aristotle C) Darwin… Aristotle D) Lamarck… Darwin Answer: B Topic: 13.1 The Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 13.3

2 .

4) Natural selection can be defined as ________.

A) the evolution of a population of organisms B) a process in which changes in gene frequencies result from evolution C) the production of more offspring than can survive in a given environment D) a process in which organisms with certain inherited traits are more likely to survive and reproduce than individuals with other traits Answer: D Topic: 13.2 Charles Darwin and The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 13.4 5) Natural selection ________.

A) results in evolutionary adaptation B) is a very rare phenomenon C) does not affect allelic frequencies D) prepares organisms for future changes in the environment Answer: A Topic: 13.2 Charles Darwin and The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 13.4 6) The first basic idea of evolutionary adaptation can be traced back to ________.

A) ancient Greeks about 2,500 years ago B) Aristotle C) Lamarck D) Darwin Answer: C Topic: 13.1 The Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 13.3 7) Which of the following statements about the voyage of the Beagle is TRUE? A) Its purpose was to identify the fastest route from the Atlantic to the Pacific Ocean.

B) It lasted almost 2 years.

C) It turned into a tremendous opportunity for Darwin to collect fossils, plants, and animals.

D) It ended with the sinking of the ship off of the coast of Australia, almost 4 years into its journey.

Answer: C Topic: 13.2 Charles Darwin and The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 13.4

3 .

8) During his trip on the Beagle, Darwin found that ________.

A) plants and animals living in temperate regions were most similar to each other, regardless of the continent on which they were found B) plants and animals living on a continent seemed more closely related to each other than to plants and animals living in similar regions on other continents C) fossils found on a particular continent were clearly not related to the plants and animals living on that continent today D) plants and animals were similar on every continent and in every type of region Answer: B Topic: 13.2 Charles Darwin and The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 13.4 9) While on the Beagle, Darwin was influenced by a book by Charles Lyell that suggested that Earth was ________ and sculpted by geologic processes that ________ today.

A) old... continue B) old... no longer occur C) young... continue D) young... no longer occur Answer: A Topic: 13.2 Charles Darwin and The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 13.4 10) In The Origin of Species, Darwin argued that the mechanism of descent with modification was ________.

A) artificial selection B) natural selection C) inheritance of acquired characteristics D) uniformitarianism Answer: B Topic: 13.3 Evidence of Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.4, 13.7 11) Which of the following is a component of the fossil record?

A) the distribution of murid rodents in Australia and Asia B) the similarity of the forelimbs of cats and bats C) molecular sequences D) bones of extinct whales Answer: D Topic: 13.3 Evidence of Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.5

4 .

12) The fossil record suggests that whales ________.

A) are descended from one branch of marine reptiles B) are closely related to land mammals such as pigs, hippos, and cows C) are not closely related to dolphins and porpoises, despite a superficial similarity D) once had well-developed hind flippers Answer: B Topic: 13.3 Evidence of Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.5 13) Homology is evidence of ________.

A) binomial classification B) artificial selection C) natural selection D) common ancestry Answer: D Topic: 13.3 Evidence of Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.5 14) Which of the following are homologous?

A) the forelimb of a dog and the hindlimb of a cat B) the forelimb of a dog and the forelimb of a cat C) wings of a butterfly and wings of a sparrow D) the mouth of a mosquito and the beak of a hummingbird Answer: B Topic: 13.3 Evidence of Evolution Skill: Application/Analysis Learning Outcome: 13.5 Global LO: 2 15) The similarity of the embryos of fish, frogs, birds, and humans is evidence of ________.

A) analogy B) common ancestry C) genetic drift D) decreased genetic variation Answer: B Topic: 13.3 Evidence of Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.5

5 .

16) Natural selection generally results in ________.

A) increased genetic variation B) a population that is better adapted to a future environment C) a population that is adapted to its current environment D) an increase in the size of a population Answer: C Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.7 17) Which of the following is NOT a requirement of natural selection?

A) differential reproductive success B) overproduction of offspring C) genetic variation D) gene flow Answer: D Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.7 18) Which one of the following statements is TRUE? A) Natural selection works on variation already present in a population.

B) Natural selection works on nonheritable traits.

C) Individuals evolve through natural selection.

D) Individual organisms evolve structures that they need.

Answer: A Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.7 19) Which of the following is a population?

A) the termites infesting your house along with the microorganisms living in their guts B) all of the termites that have ever lived C) all organisms living in your house D) the termites infesting your house Answer: D Topic: 13.5 The Evolution of Populations Skill: Application/Analysis Learning Outcome: 13.10 Global LO: 2

6 .

20) Which one of the following can create new alleles?

A) natural selection B) sexual reproduction C) mutation D) genetic drift Answer: C Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.9 21) The total collection of alleles in a population at any one time makes up that population's ________.

A) gene pool B) genotype C) heterozygote frequency D) allele frequency Answer: A Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.9 22) If the frequency of one allele in a population is 0.7 in a population with two alleles at a particular locus, what is the frequency of the alternate allele?

A) 0.09 B) 0.21 C) 0.30 D) 0.42 Answer: C Topic: 13.5 The Evolution of Populations Skill: Application/Analysis Learning Outcome: 13.9 Global LO: 2, 4 23) In the Hardy-Weinberg formula, what does p2 represent?

A) frequency of the dominant allele B) frequency of heterozygotes C) frequency of the recessive allele D) frequency of the homozygotes for one allele Answer: D Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.11 Global LO: 4

7 .

24) In the Hardy-Weinberg formula, what does 2pq represent?

A) frequency of the dominant allele B) frequency of heterozygotes C) frequency of the recessive allele D) frequency of the homozygous dominants Answer: B Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.11 Global LO: 4 25) The presence of freckles is due to a dominant allele. Four percent of the individuals in a particular population lack freckles. Use the Hardy-Weinberg formula to calculate the percentage of individuals in this population who are homozygous dominant for freckles.

A) 32% B) 4% C) 64% D) 80% Answer: C Topic: 13.5 The Evolution of Populations Skill: Application/Analysis Learning Outcome: 13.11 Global LO: 2, 4 26) The original source of genetic variation that serves as the raw material for natural selection is ________.

A) mutation B) gene flow C) geographic isolation D) random fertilization Answer: A Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.9 27) Which of the following is a characteristic of a population at Hardy-Weinberg equilibrium?

A) The population is subject to natural selection.

B) The population is not evolving.

C) Genetic drift is occurring.

D) Gene flow in and out of the population occurs.

Answer: B Topic: 13.5 The Evolution of Populations Skill: Knowledge/Comprehension Learning Outcome: 13.11

8 .

28) Genetic drift is the result of ________.

A) natural selection B) chance C) a large gene pool D) environmental variation Answer: B Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 29) Which one of the following will prevent significant genetic drift?

A) Gene flow is absent.

B) There is genetic variation.

C) There is mutation.

D) The population size is large.

Answer: D Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 30) After surviving a bottleneck, a population recovers to the point where it consists of as many individuals as it did prior to the bottleneck. Which of the following statements is most likely to apply to this population?

A) The postbottleneck population exhibits less genetic variation than the prebottleneck population.

B) The bottleneck subjected the population to stabilizing selection.

C) The postbottleneck population has less of a chance of going extinct than did the prebottleneck population.

D) The postbottleneck population exhibits more genetic variation than the prebottleneck population.

Answer: A Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 31) The founder effect differs from a population bottleneck in that the founder effect ________.

A) requires a small population B) is a type of natural selection C) can occur only on an oceanic island colony D) involves the isolation of a small colony of individuals from a larger population Answer: D Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.12 Global LO: 2

9 .

32) Which of the following is the most likely explanation for a particular human population with a higher incidence of polydactyly (extra fingers/toes) than the human population as a whole?

A) directional selection B) disruptive selection C) founder effect D) bottleneck effect Answer: C Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 Global LO: 5 33) Gene flow is accomplished by ________.

A) migration B) sexual recombination C) mutation D) natural selection Answer: A Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 34) What does evolutionary fitness measure?

A) physical health B) longevity C) relative reproductive success D) population size Answer: C Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 35) Which of the following is an example that results from directional selection?

A) The birth weight at which newborn humans are most likely to survive and the average weight of newborn humans are about the same.

B) There is an increase in antibiotic-resistant strains of bacteria.

C) There is an increase in the number of different breeds of dog.

D) Garter snakes with different coloration patterns behave differently when threatened.

Answer: B Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.12 Global LO: 2

10 .

36) Which of the following examples results from disruptive selection?

A) The birth weight at which newborn humans are most likely to survive and the average weight of newborn humans are about the same.

B) There is an increase in antibiotic-resistant strains of bacteria.

C) There is an increase in the number of different breeds of dog.

D) Garter snakes with different coloration patterns behave differently when threatened.

Answer: D Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.12 Global LO: 2 37) Which of the following is most likely to decrease genetic variation?

A) directional selection B) mutation C) stabilizing selection D) diversifying selection Answer: C Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 38) Which of the following examples results from stabilizing selection?

A) The birth weight at which newborn humans are most likely to survive and the average weight of newborn humans are about the same.

B) There is an increase in antibiotic-resistant strains of bacteria.

C) There is an increase in the number of different breeds of dog.

D) Garter snakes with different coloration patterns behave differently when threatened.

Answer: A Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Knowledge/Comprehension Learning Outcome: 13.12 39) Which of the following is an example of sexual selection?

A) Bacteria evolve resistance to antibiotics.

B) Cheetahs experienced a population bottleneck.

C) Peahens choose to mate with peacocks that have the most beautiful tails.

D) Female butterflies have a higher survival rate than male butterflies.

Answer: C Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.9 Global LO: 2

11 .

40) What leads paleontologists to hypothesize that whales evolved from wolf-like carnivores?

A) molecular analysis of whale DNA B) observations of fossil teeth C) the presence of vestigial structures in both species D) mathematical analysis using the Hardy-Weinberg formula Answer: B Topic: 13 Process of Science Skill: Knowledge/Comprehension Learning Outcome: 13.5 13.2 Art Questions 1) Examine the relationships between the elephants in the figure below. Which one of the following pairs is most closely related?

A) Deinotherium and Platybelodon B) Barytherium and Stegodon C) Loxodonta africana and Loxodonta cyclotis D) Mammut and Stegodon Answer: C Topic: 13.3 Evidence of Evolution Skill: Application/Analysis Learning Outcome: 13.6 Global LO: 2, 3

12 .

2) Examine the evolutionary tree below. This tree tells us that the amnion is found in ________.

A) lungfishes and amphibians B) amphibians only C) mammals, lizards, and snakes only D) mammals, lizards, snakes, crocodiles, and birds Answer: D Topic: 13.3 Evidence of Evolution Skill: Application/Analysis Learning Outcome: 13.6 Global LO: 2, 3

13 .

3) The figure below shows the percent of selected DNA sequences that match between a chimpanzee and other primates. These data support the hypothesis that ________.

A) the chimpanzee's closest surviving relative is humans B) chimpanzees and gibbons are the most closely related C) orangutans are the primates least closely related to chimpanzees D) Old World monkeys and gibbons are the most closely related Answer: A Topic: 13.3 Evidence of Evolution Skill: Application/Analysis Learning Outcome: 13.6 Global LO: 2, 3, 4

14 .

4) The figure below shows what happens in insect populations when crops are sprayed with insecticides. This is an example of ________.

A) natural selection B) genetic drift C) founder effect D) gene flow Answer: A Topic: 13.4 Natural Selection as the Mechanism for Evolution Skill: Knowledge/Comprehension Learning Outcome: 13.8 Global LO: 3

15 .

13.3 Scenario Questions Read the following scenario to answer the following questions.

Over the past 60 years, many amphibian species have experienced significant population declines, and some species have become extinct. Scientists suspected that local human activities such as the destruction of wetlands, regional pollution, and deforestation were the main reasons for these losses. However, research over the past 20 years reveals significant amphibian population declines in protected areas of the world, such as nature preserves and parks. These global declines suggest widespread problems including increased ultraviolet radiation, acid rain, and disease. In Switzerland, for example, 14 of the 20 native amphibian species are threatened with extinction.

1) Some biologists urge the collection of the few remaining individuals of some of the most threatened amphibian species in order to preserve them if they become extinct in the wild. If such captive-breeding programs could produce thousands of individuals from just a few of the remaining survivors, the species will still be threatened because of ________.

A) a bottleneck effect B) directional selection C) mutations D) artificial selection Answer: A Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.12 Global LO: 2 2) When most populations of a wide-ranging amphibian species are lost and the few remaining populations are widely separated, we expect to see that ________.

A) artificial selection becomes a greater factor in microevolution B) the founder effect becomes increasingly important C) gene flow between populations is reduced D) microevolution no longer occurs Answer: C Topic: 13.6 Mechanisms That Alter Allele Frequencies in a Population Skill: Application/Analysis Learning Outcome: 13.12 Global LO: 2

16 .

3) Chytridiomycosis is a fungal disease first identified in 1998 as a cause of massive amphibian deaths. In some severely impacted populations, a few individuals have survived, perhaps because of some natural resistance. If these resistant individuals continue to survive and prosper, new resistant populations might emerge. This would be an example of ________.

A) genetic drift B) natural selection C) the founder effect D) sexual selection Answer: B Topic: 13.5 The Evolution of Populations Skill: Application/Analysis Learning Outcome: 13.9 Global LO: 2

17 .

Read the following scenario to answer the questions that follow.

In order to test the susceptibility of bacteria to an antibiotic, a common laboratory test called the Bauer-Kirby Disk Diffusion test is used. First, a petri dish (a shallow, circular, transparent dish with a flat lid) is partially filled with nutrient-enriched agar (a gelatinous material). The nutrients encourage growth of specific bacterial species. The agar is poured as liquid but then typically solidifies to a soft consistency. Once the agar is set, a "lawn" of bacteria is spread such that a thin layer covers the top of the agar. Antibiotics are then applied to the lawn in a small dose, often through small saturated paper disks. The dish is typically incubated for 24—48 hours and then observed for susceptibility. If the antibiotic is effective, it will kill the bacteria and leave a clear area called the "zone of inhibition" due to inhibited bacterial growth. The area starts at the source of the antibiotic and radiates outward. Scientists measure the diameter of the zone and then compare it to an established "cutoff value" for a zone specific to antibiotic/organism combinations. A large zone of inhibition in comparison to the standard indicates susceptibility while a small or no zone indicates resistance. Consider the following image, and answer the questions that follow:

4) What can you conclude about the susceptibility of the bacteria to the antibiotics?

A) The bacteria are more susceptible to antibiotic A than antibiotic C. B) The bacteria are more susceptible to antibiotic D than antibiotic B. C) The bacteria are more susceptible to antibiotic C than antibiotic E. D) The bacteria are more susceptible to antibiotic D than antibiotic A. Answer: C Topic: 13 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 13.13

18 .

5) After rigorous testing, the Federal Drug Administration (FDA) must decide which of the four antibiotics to approve to fight a bacterial infection that results in high fevers and localized rashes.

Which antibiotic do you predict that the FDA scientists will likely approve?

A) A B) C C) E D) F Answer: B Topic: 13 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 13.13 6) After 1 year of widely prescribed use, reports surface that bacterial infections disappear for up to 2 weeks after taking the prescribed antibiotic but then reappear, sometimes worse than the first time. Which of the following explanations might the FDA use to defend their choice of antibiotic to treat the infection?

A) Patients are not taking the antibiotic for the length of time prescribed and so selection for resistant bacteria that can survive a limited course of antibiotic is occurring.

B) Stabilizing selection over the year has allowed for the bacteria to remain at a high level in patients' bodies.

C) Patients' bodies are evolving over the year to create environments that are friendly to the growth of the bacteria.

D) Sexual dimorphism allowed for larger bacteria cells to outcompete smaller ones, therefore enabling larger bacteria cells to continue to multiply.

Answer: A Topic: 13 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 13.13 Global LO: 2, 3, 5

19 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 14 How Biological Diversity Evolves Chapter 14 Learning Outcomes 14 Biology and Society: The Sixth Mass Extinction 14.1. Explain why scientists think we may be at the start of the sixth mass extinction.

14.1 The Origin of Species 14.2 Explain the biological species concept and speciation, providing past and present examples as well as limitations when applied to all types of living organisms.

14.3 Compare the following, noting examples of each: prezygotic and postzygotic reproductive barriers; allopatric and sympatric speciation; taxonomy, cladistics, and systematics; the two-kingdom, five-kingdom, and three-domain systems of classification; homologous and analogous structures.

14.2 Earth History and Macroevolution 14.4 List, in order, the four broad divisions in the history of Earth and its life and explain how the boundaries of each division are defined.

14.5 Explain how the age of fossils is determined and how the formation and breakup of the supercontinent Pangaea affected the evolution of life on Earth.

14 The Process of Science: Did a Meteor Kill the Dinosaurs?

14.6 Explain how an extraterrestrial object could have caused the mass extinction around 65 million years ago, how mass extinctions can be seen as times of great opportunity, and how the extinction of most of the dinosaurs affected mammalian evolution.

14.3 Mechanisms of Macroevolution 14.7 Explain what is studied in the field of evo-devo, including the role of homeotic genes in diversity of body forms and exaptations (i.e., the gradual evolution of eyes).

14.8 Describe how paedomorphosis may lead to speciation using human traits as an example.

14.9 Describe the practical applications of phylogenetic trees and how homologies are used to create classification systems.

14.4 Classifying the Diversity of Life 14.10 Explain how convergent evolution can make interpreting homologies difficult.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method in lab experiences to interpret information and draw conclusions.

1 .

14.1 Multiple Choice Questions 1) Which of the following is the strongest piece of evidence for why some scientists believe that we are at the start of a sixth mass extinction?

A) decrease in biodiversity B) decrease in fossil discoveries C) decrease in allopatric species D) decrease in hybrid fertility Answer: A Topic: 14 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 14.1 2) Biological species consist of groups of ________.

A) populations B) domains C) families D) genera Answer: A Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.2 3) Under the biological species concept, what criterion is used to assign populations of organisms to the same biological species?

A) a very similar appearance B) being able to interbreed and produce fertile offspring C) responding to the environment in the same way D) having 99% of their genes in common Answer: B Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.2

2 .

4) When brought together in a zoo, two species are capable of mating and producing fertile offspring. Why may they still be considered two distinct species?

A) Wild populations of the two species have different geographic distributions.

B) In the wild, members of one species prey upon members of the other species.

C) Zoos are not natural environments.

D) The two species look very different.

Answer: C Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.2 Global LO: 2 5) The biological species concept cannot be applied to ________.

A) fungi that live on land B) bacteria that reproduce only asexually C) complex plants that have flowers D) animals that use asexual and sexual reproduction Answer: B Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.2 6) The biological species concept cannot be applied to fossils. Which alternate approach to identifying species would be most useful for classifying fossil organisms?

A) an approach based on use of reproductive barriers B) an approach based on genetic history C) an approach based on measurable physical traits D) an approach based on molecular biology Answer: C Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.2 7) A reproductive barrier that prevents individuals from closely related species from interbreeding is an example of ________.

A) a prezygotic barrier B) allopatric speciation C) sympatric speciation D) geographic isolation of populations Answer: A Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.3

3 .

8) What type of reproductive isolating mechanism is described by a situation in which female fireflies mate only with males who emit light in a particular pattern?

A) habitat isolation B) temporal isolation C) mechanical isolation D) behavioral isolation Answer: D Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2 9) The type of reproductive barrier that occurs when two species mate but produce sterile hybrids is referred to as ________.

A) mechanical isolation B) temporal isolation C) a postzygotic barrier D) a prezygotic barrier Answer: C Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.3 10) When two frog species, Rana pipiens and Rana sylvatica, mate, the offspring die early in embryonic development. This is an example of ________.

A) hybrid sterility B) mechanical isolation C) reduced hybrid viability D) reduced hybrid fertility Answer: C Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2 11) Speciation requires ________.

A) periods of rapid evolutionary change B) geographic isolation C) long periods of time D) genetic isolation Answer: D Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.2

4 .

12) Which of the following describes allopatric speciation?

A) A population of squirrels is separated by the Grand Canyon. The two subpopulations evolve into two distinct species.

B) A tetraploid plant species evolves from a diploid ancestor. Both the tetraploid and diploid species are found in the same habitat.

C) One population breeds in the fall; another population breeds in the spring.

D) A male horse and a female donkey mate, producing a sterile hinny.

Answer: A Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.3 13) Sympatric speciation specifically EXCLUDES ________.

A) behavioral isolation B) postzygotic barriers C) geographic isolation D) temporal isolation Answer: C Topic: 14.1 The Origin of Species Skill: Knowledge/Comprehension Learning Outcome: 14.3 14) Some fish have bony fins. If the body of water they are in dries out, these fins can be used to help the fish "walk" to another body of water. In this context, bony fins are an example of ________.

A) an exaptation B) an adaptation C) a macroevolutionary event D) paedomorphosis Answer: A Topic: 14.3 Mechanisms of Macroevolution Skill: Application/Analysis Learning Outcome: 14.7 Global LO: 2 15) Feathers in birds appear to have first evolved for insulation but later conveyed a new advantage in helping create light aerodynamic surfaces. This switch in function is an example of a(n) ________.

A) paedomorphosis B) an analogy C) an adaptation D) exaptation Answer: D Topic: 14.3 Mechanisms of Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.7 5 .

16) Which of the following would be an example of paedomorphosis?

A) starfish regenerating severed limbs B) rapid evolution in a small, isolated population C) two species evolving a similar appearance D) insects that can reproduce in larval stages without reaching mature development stages Answer: D Topic: 14.3 Mechanisms of Macroevolution Skill: Application/Analysis Learning Outcome: 14.8 Global LO: 2 17) The current geological era is the ________.

A) Paleozoic B) Cenozoic C) Mesozoic D) Cambrian Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.4 18) Uranium-235, with a half-life of 713,000,000 years, decays to lead-207. If a rock sample is determined to have one-quarter of the uranium-235 content it had when it formed, the age of the rock sample can be estimated to be approximately ________ years old.

A) 178 million B) 713 million C) 28.5 billion D) 1.4 billion Answer: D Topic: 14.2 Earth History and Macroevolution Skill: Application/Analysis Learning Outcome: 14.5 Global LO: 2, 4 19) Plate tectonics has been responsible for instances of all of the following EXCEPT ________.

A) volcanic explosions B) sympatric speciation C) allopatric speciation D) mass extinction Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.4

6 .

20) The Permian mass extinction is associated with ________.

A) an asteroid impact B) global warming C) the formation of Pangaea D) the diversification of mammals Answer: C Topic: 14.2 Earth History and Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.4 21) Characid fishes are found naturally only in South America and Africa. Fossils of these fish are not found on any other continents. What is the most likely explanation of this distribution pattern?

A) These fishes arose in either Africa or South America and migrated across the South Atlantic Ocean to the other continent.

B) Characid fishes arose prior to the separation of the African and South American continents.

C) Characid fishes arose in the South Atlantic Ocean and migrated to Africa and South America.

D) Convergent evolution is responsible for the distribution of characid fishes.

Answer: B Topic: 14.2 Earth History and Macroevolution Skill: Application/Analysis Learning Outcome: 14.4 Global LO: 2 22) Dinosaurs (aside from the lineage that produced birds) were extinct by the end of the ________.

A) Cretaceous B) Silurian C) Eocene D) Permian Answer: A Topic: 14.2 Earth History and Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.4 23) A period of mass extinction is often followed by ________.

A) explosive diversification B) paedomorphosis C) global warming D) continental drift Answer: A Topic: 14.2 Earth History and Macroevolution Skill: Knowledge/Comprehension Learning Outcome: 14.6

7 .

24) ________ is the discipline of biology that focuses on classifying organisms and determining their evolutionary relationships.

A) Taxonomy B) Evo-devo C) Systematics D) Biogeography Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 25) The science of naming, identifying, and classifying organisms is called ________.

A) biogeography B) systematics C) phylogeny D) taxonomy Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 26) Which of the following taxonomic levels is most inclusive?

A) order B) genus C) family D) class Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 27) Of the following taxonomic levels, species found within the same ________ are the most closely related.

A) family B) phylum C) order D) domain Answer: A Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3

8 .

28) The wing of a bald eagle is ________ the wing of a penguin.

A) convergent with B) homologous to C) unrelated to D) analogous to Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2 29) The wing of a penguin is ________ the wing of a butterfly.

A) structurally identical to B) superior to C) homologous to D) analogous to Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 30) Homology is evidence of ________.

A) convergent evolution B) polyploidy C) common ancestry D) paedomorphosis Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 31) Analogous structures are evidence of ________.

A) common ancestry B) divergent evolution C) stabilizing selection D) convergent evolution Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3

9 .

32) Molecular systematics might examine all of the following types of data EXCEPT ________.

A) proteins B) DNA sequences C) amino acid sequences D) anatomical features Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 33) An ancestral species and all its evolutionary descendants define a(n) ________.

A) outgroup B) clade C) genus D) ingroup Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 34) Which one of the following is the only domain that contains eukaryotes?

A) Animalia B) Plantae C) Archaea D) Eukarya Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Knowledge/Comprehension Learning Outcome: 14.3 35) When you go outside, it is common to hear a variety of bird songs. These songs vary among bird species as well as bird flocks. Interestingly, some bird species that are highly unrelated have very similar song qualities. What can you conclude from this phenomenon?

A) The bird songs are homologous traits.

B) The bird songs have achieved speciation after coming from allopatric species.

C) The bird songs are analogous traits.

D) The bird songs have different molecular DNA. Answer: C Topic: 14.4 Classifying the Diversity of Life Skill: Synthesis/Evaluation Learning Outcome: 14.10 Global LO: 2

10 .

36) What hypothesis did Luis and Walter Alvarez test in relation to the mass extinction of dinosaurs 65 million years ago (MYA)?

A) The mass extinction 65 MYA was caused by a surge of catastrophic cyclones.

B) The mass extinction 65 MYA was caused by a slow but steady increase in climate temperatures.

C) The mass extinction 65 MYA was caused by an impact of an extraterrestrial object.

D) The mass extinction 65 MYA was caused by the loss of preferred plants for food.

Answer: C Topic: 14 The Process of Science Skill: Knowledge/Comprehension Learning Outcome: 14.6 37) Why is it INCORRECT to assume that mass extinctions carry only negative impact on the evolution of life on Earth?

A) Mass extinctions are sometimes followed by periods of evolutionary change when other organism groups can flourish and expand in diversity and size.

B) Mass extinctions enable scientists to better study embryonic development in two species of organisms and therefore identify possible homology.

C) Mass extinctions enable scientists to better study paedomorphosis.

D) Mass extinctions disprove Darwin's theory of evolution.

Answer: A Topic: 14 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 14.6

11 .

14.2 Art Questions 1) Examine the two squirrel populations in the following figure. The populations are separated by a geographic barrier. If after a long period of time the two species are no longer separated, what evidence is needed to determine if speciation has occurred?

A) Hybrid offspring of the two populations begin to appear.

B) The two populations are not interbreeding freely.

C) One species will increase into a population size twice as large as the other species.

D) Polyploidy is creating new species.

Answer: B Topic: 14.4 Classifying the Diversity of Life Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2, 3

12 .

2) Examine the evolutionary relationships represented in the following figure. Based upon this diagram, the two most closely related species are ________.

A) leopards and striped skunks B) leopards and European otters C) European otters and coyotes D) coyotes and wolves Answer: D Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.4, 14.9 Global LO: 2, 3

13 .

3) Examine the figure below. According to the figure, cladistic analysis indicates that crocodiles are more closely related to ________ than to ________.

A) birds... pterosaurs B) snakes... birds C) Ornithischian dinosaurs… pterosaurs D) birds... lizards Answer: D Topic: 14.4 Classifying the Diversity of Life Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2, 3 14.3 Scenario Questions Read the following scenario to answer the following questions.

In some zoos, rare crosses between a male lion and a female tiger have produced hybrid offspring called "ligers." Male ligers are sterile but some female ligers are fertile. In the wild, lion and tiger ranges do not naturally overlap, making such a cross unlikely. Furthermore, the solitary behavior of tigers and the social organizations of lions create behavioral differences.

1) Applying the biological species concept, the sterility of ligers reveals that ________.

A) a new species called "ligers" is forming B) tigers and lions are actually the same species C) tigers and lions are separate species D) lions are probably a subspecies of tigers Answer: C Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.2 Global LO: 2

14 .

2) The natural differences in the ranges of wild tigers and lions is an example of ________.

A) a prezygotic barrier B) a postzygotic barrier C) the impact of mutations D) sympatric speciation Answer: A Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2 3) The production of sterile male ligers is an example of ________.

A) sympatric speciation B) the founder effect C) a postzygotic barrier D) a prezygotic barrier Answer: C Topic: 14.1 The Origin of Species Skill: Application/Analysis Learning Outcome: 14.3 Global LO: 2

15 .

Read the following scenario to answer the following questions.

As part of a semester-long biology field research course, you are studying reproductive barriers among four different frog species. Your goal is to determine what type of reproductive barrier likely causes the gene pools of the four different frog species to be isolated. These four species share common geographic habitats and are both anatomically and gametically compatible. Your research professor gives you the following figure to consider. After studying the figure, answer the questions that follow.

4) If the researchers of this study wanted to collect reliable data about natural behavior, which methodology should they choose?

A) The researchers collected multiple male and female frogs from each species and studied them in a lab environment to determine their normal breeding seasons.

B) The researchers studied multiple male and female frogs from each species in their natural environments to determine their normal breeding seasons.

C) The researchers collected multiple male and female frogs from each species, mixed males and females from each species, and studied the mixed pairs in a lab environment to determine their normal breeding seasons.

D) The researchers studied one male and female frog from each species in their natural environments to determine their normal breeding seasons.

Answer: B Topic: 14.1 The Origin of Species Skill: Synthesis/Evaluation Learning Outcome: 14.3 Global LO: 1, 2, 3

16 .

5) Based on the independent and dependent variables represented in the figure and the information you have about common geographic habitats as well as anatomical and gametic compatibility of the four frog species, you initially conclude that reproductive barriers may be due to ________.

A) habitat isolation B) mechanical isolation C) temporal isolation D) gametic isolation Answer: C Topic: 14.1 The Origin of Species Skill: Synthesis/Evaluation Learning Outcome: 14.3 Global LO: 2, 3, 9 6) What can you conclude about the breeding characteristics of these four frog species?

A) The maximum mating activity of the four frog species at different times reduces and/or removes interbreeding.

B) The minimum mating activity of the four frog species at different times reduces and/or removes interbreeding.

C) The average mating activity of the four frog species at different times reduces and/or removes interbreeding.

D) The individual mating activity of each of the four frog species at the beginning of their mating periods reduces and/or removes interbreeding.

Answer: A Topic: 14.1 The Origin of Species Skill: Synthesis/Evaluation Learning Outcome: 14.3 Global LO: 2, 3, 9

17 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 15 The Evolution of Microbial Life Learning Outcomes 15.1 15.2

Describe how microbial communities affect health.

Identify the sequence and timing of the major events in the evolution of early life, ending with the evolution of humans.

15.3 Distinguish between the four stages of the hypothesis for the origin of life on Earth, and explain how natural selection would have affected the first pre-cells.

15.4 Describe the relative abundance of prokaryotes on Earth and how they can affect humans and ecosystems.

15.5 Describe the structure, function, and reproduction of prokaryotes.

15.6 Compare the types of nutritional diversity used by prokaryotes.

15.7 Explain how prokaryotes promote chemical recycling.

15.8 Compare bacteria and archaea including the various environments in which they are found.

15.9 Describe the ways that bacteria cause disease and have been used as biological weapons.

15.10 Describe how scientists investigated the impact of microbiota on body composition.

15. 11 Compare the four main categories of protists, grouped by lifestyle, including how the different groups impact our lives.

15.12 Explain how Streptococcus mutans contributes to tooth decay and the adaptations that gave S. mutans an advantage over other species.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

15.1 Multiple Choice Questions 1) Scientists hypothesize that disrupting our ________ communities may increase our susceptibility to infectious diseases, predispose us to certain cancers, and contribute to conditions such as asthma and other allergies, irritable bowel syndrome, Crohn's disease, and autism.

A) microbial B) exotoxin C) protist D) pathogen Answer: A Topic: 15 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 15.1 2) Eukaryotes arose about ________ years after the first prokaryotes.

A) 3.0 million B) 1.7 billion C) 3.5 billion D) 4.0 billion Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2 3) Large amounts of oxygen gas appeared in Earth's atmosphere about ________ years ago.

A) 200 million B) 1.7 billion C) 2.7 billion D) 4.5 billion Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2 4) Animal life underwent its greatest diversification during the ________, which began about ________ million years ago.

A) Paleozoic era... 290 B) Paleozoic era... 540 C) Mesozoic era... 363 D) Mesozoic era... 245 Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2

2 .

5) The first organisms to colonize land were A) plants, protists, and insects B) plants, fungi, and insects C) bacteria, plants, and fungi D) protists, bacteria, and fungi Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2 6) Land was first colonized about ________ years ago.

A) 100 million B) 500 million C) 1.7 billion D) 2.5 billion Answer: B Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2 7) Based on fossil evidence, eukaryotes evolved about ________ years ago.

A) 500,000 B) 1 billion C) 1.8 billion D) 3.5 billion Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2 8) All of the following are true EXCEPT one. Choose the exception.

A) The great diversification of animals occurred during the Cambrian explosion.

B) For most of biological history, life was confined to aquatic habitats.

C) The evolution of multicellularity took place after the origin of the eukaryotes.

D) The first organisms to colonize land were animals.

Answer: D Topic: 15.1 Major Episodes in the History of Life Skill: Knowledge/Comprehension Learning Outcome: 15.2

3 .

9) The absence of ________ in the primitive atmosphere was essential to the origin of life on Earth.

A) N2 B) CO2 C) CH4 D) O2 Answer: D Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 10) What was the first stage of the process that led to the abiotic origin of life?

A) synthesis of monomers, such as amino acids and nucleotides B) origin of self-replicating molecules C) synthesis of polymers, such as proteins and nucleic acids D) formation of pre-cells Answer: A Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 11) Whose experiments demonstrated that, given the conditions on the primitive Earth, biological monomers could arise spontaneously?

A) Miller and Urey B) Darwin and Linnaeus C) Watson and Crick D) Wallace and Darwin Answer: A Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 12) Under what abiotic conditions can monomers spontaneously form polymers?

A) in the presence of oxygen gas B) when ribozymes are present to catalyze the reaction C) when a collection of organic molecules with a cell membrane are isolated D) when water evaporates from a hot surface Answer: D Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3

4 .

13) Why is RNA thought to have been the first genetic material?

A) RNA is structurally simpler than DNA. B) RNA has been found on meteorites.

C) RNA is capable of self-replication D) Primitive organisms, such as some viruses, have RNA as their genetic material.

Answer: C Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 14) RNAs that can act as enzymes are called ________.

A) ribozymes B) ATPs C) lysosomes D) prokaryotes Answer: A Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 15) Variation among pre-cells was due to ________.

A) genetic drift B) natural selection C) the bottleneck effect D) mutation Answer: D Topic: 15.2 The Origin of Life Skill: Knowledge/Comprehension Learning Outcome: 15.3 16) Which prokaryotic group is most closely related to eukaryotes?

A) Bacteria B) Protista C) Archaea D) Bacteria and Archaea are equally closely related.

Answer: C Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.4

5 .

17) The prokaryotic group that tends to inhabit extreme environments belongs to ________.

A) Protista B) Archaea C) Euglena D) Bacteria Answer: B Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.8 18) Which of the following prokaryotes aid digestion in cattle, deer, and other animals that obtain nutrition from cellulose?

A) halophiles B) dinoflagellates C) methanogens D) cocci Answer: C Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5, 15.8 19) Spherical bacteria that occur in clusters are ________.

A) streptococci B) bacilli C) spirochetes D) staphylococci Answer: D Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5 20) Bacilli are ________ prokaryotes.

A) spherical B) comma-shaped C) rod-shaped D) spiral Answer: C Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5

6 .

21) Which of the following would likely be the most difficult to kill if you were you to can your own food?

A) streptococci B) endospores C) biofilms D) staphylococci Answer: B Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.9 22) Prokaryotes reproduce by means of ________.

A) mitosis B) binary fission C) budding D) meiosis Answer: B Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5 23) Under ideal conditions, prokaryotes are capable of reproducing at a(n) ________ rate.

A) negative B) exponential C) infinite D) variable Answer: B Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5 Global LO: 4 24) Trichomonas vaginalis is a protozoan that feeds on white blood cells and bacteria living on the cells lining the female human vagina, thereby creating a common sexually transmitted disease often known as "trich." The feeding mechanism of this protozoan makes it a ________.

A) parasite B) autotroph C) producer D) mixotroph Answer: A Topic: 15.4 Protists Skill: Application/Analysis Learning Outcome: 15.6 Global LO: 2

7 .

25) All organisms that photosynthesize fit into which nutritional category?

A) mixotroph B) heterotrophs C) autotrophs D) parasites Answer: C Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.6 26) Which of the following include the two classes of poisons produced by pathogenic bacteria?

A) exotoxins and endotoxins B) chemoautotrophs and chemoheterotrophs C) protozoans and fungi D) bacilli and cocci Answer: A Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.9 27) Food poisoning from Salmonella occurs because of ________.

A) an exotoxin secreted by Salmonella bacteria B) an endotoxin produced by Salmonella bacteria C) easy transmission between people living in close contact D) extremophile conditions Answer: B Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.9 28) In the soil, some ________ help to decompose dead organisms and other waste materials, returning vital chemical elements such as nitrogen to the environment.

A) slime molds B) animals C) protozoans D) prokaryotes Answer: D Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.7

8 .

29) ________ is an example of bioremediation.

A) Cyanobacteria converting atmospheric nitrogen to a form that plants can use B) The use of an autoclave to kill endospores C) The use of prokaryotes to treat sewage D) A dinoflagellate bloom causing massive fish kills Answer: C Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.7 30) In Yellowstone National Park, hot springs can reach temperatures of 205°F (96°C). Despite these high temperatures, Aquifex bacteria flourish. How might you classify Aquifex bacteria?

A) slime molds B) extremophiles C) amoebas D) algae Answer: B Topic: 15.3 Prokaryotes Skill: Application/Analysis Learning Outcome: 15.8 Global LO: 2 31) Approximately 10—15% of insect species harbor bacteria that make needed nutrients available to the insects. How might you classify these bacteria?

A) phytoplankton B) extremophiles C) exotoxins D) endosymbionts Answer: D Topic: 15.3 Prokaryotes Skill: Application/Analysis Learning Outcome: 15.8, 15.11 Global LO: 2

9 .

32) Recent scientific studies of the impact of microbiota on the amount of fat versus lean body mass (i.e., body composition) are described in your text. How do those studies illustrate the importance of microbiota communities in our bodies?

A) If transferred to lean humans, intestinal microbiota of obese humans will cause obesity.

B) If transferred to obese humans, intestinal microbiota in lean humans will cause exaggerated obesity.

C) The studies suggest that mice are an unreliable model organism to use for studies of human intestinal microbiota and obesity.

D) The studies suggest that intestinal microbiota may be involved in regulating our digestive processes.

Answer: D Topic: 15 The Process of Science Skill: Application/Analysis Learning Outcome: 15.10 Global LO: 2, 9 33) Eukaryotes that are not fungi, animals, or plants are classified in a "catch-all" category called ________.

A) archaea B) bacteria C) seaweeds D) protists Answer: D Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 34) According to the theory of endosymbiosis, which organelles evolved from small prokaryotes that established residence within other, larger prokaryotes?

A) vacuoles and lysosomes B) Golgi apparatus and endoplasmic reticulum C) centrioles and ribosomes D) mitochondria and chloroplasts Answer: D Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 35) Flagellates, amoebas, apicomplexans, and ciliates are all what type of protist?

A) slime molds B) protozoans C) dinoflagellates D) seaweeds Answer: B Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 10 .

36) You discover a unicellular organism that moves by what appear to be pseudopodia. You conclude that this organism is ________.

A) either a type of amoeba or a type of slime mold B) a type of bacterium C) a type of alga D) either a type of ciliate or a type of apicomplexan Answer: A Topic: 15.4 Protists Skill: Application/Analysis Learning Outcome: 15.11 Global LO: 2 37) Which protozoan group consists solely of parasitic forms?

A) apicomplexans B) ciliates C) flagellates D) amoebas Answer: A Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 38) ________ include cells that can function either independently or as a single unit.

A) Dinoflagellates B) Forams C) Seaweeds D) Cellular slime molds Answer: D Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 39) Which of the following are most closely related to plants?

A) brown algae B) red algae C) slime molds D) green algae Answer: D Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11

11 .

40) ________ are responsible for toxic red tides.

A) Plasmodial slime molds B) Dinoflagellates C) Red algae D) Diatoms Answer: B Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 41) A photoautotrophic unicellular organism with a shell made of silica is most likely a(n) ________.

A) apicomplexan B) foram C) dinoflagellate D) diatom Answer: D Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 42) Which of the following is a colonial form of green algae?

A) Volvox B) Giardia C) Paramecium D) Plasmodium Answer: A Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 43) What accounts for the similarity between seaweeds and plants?

A) Plants are the ancestors of seaweeds.

B) convergent evolution C) evolutionary fitness D) Seaweeds are aquatic plants.

Answer: B Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11

12 .

44) Endosymbiosis explains the origin of the ________ of eukaryotes.

A) chloroplasts and mitochondria B) endomembrane system C) nuclear envelope D) membrane-bound organelles Answer: A Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 45) Which of the following is a plausible reason for why it may be difficult to treat infections that arise from tooth decay?

A) Biofilm bacteria that cause tooth decay begin to produce endospores as a means to deter effects of antibiotics.

B) Binary fission in biofilm bacteria that cause tooth decay begins to decrease as the biofilm community becomes more complex, thereby producing fewer bacterial cells for antibiotics to penetrate.

C) As the biofilm that causes tooth decay becomes larger, its structure makes it difficult for antibiotics to break through bacterial cell walls.

D) Bacteria of the biofilm that cause tooth decay form a symbiotic relationship with the antibiotics and therefore diminish antibiotic effectiveness.

Answer: C Topic: 15 Evolution Connection Skill: Application/Analysis Learning Outcome: 15.1, 15.12 Global LO: 2, 7

13 .

15.2 Art Questions 1) According to this evolutionary tree, the archaea and eukaryotes last shared a common ancestor ________.

A) 1.0 billion years ago B) 1.75 billion years ago C) 2.5 billion years ago D) 3.5 billion years ago Answer: C Topic: 15.1 Major Episodes in the History of Life Skill: Application/Analysis Learning Outcome: 15.2 Global LO: 2, 3

14 .

2) What kind of prokaryotes are these?

A) bacilli B) spirochetes C) cocci D) ciliates Answer: A Topic: 15.3 Prokaryotes Skill: Knowledge/Comprehension Learning Outcome: 15.5 Global LO: 3 3) What kind of protist is this?

A) ciliate B) plasmodial slime mold C) flagellate D) foram Answer: B Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11 Global LO: 3

15 .

4) In the image above, the aquatic organism moves using flagella. It is parasitic and can colonate and reproduce in the human intestine. What type of organism could this be?

A) a protozoan B) a slime mold C) phytoplankton D) seaweed Answer: A Topic: 15.4 Protists Skill: Application/Analysis Learning Outcome: 15.11 Global LO: 2, 3 5) If you were to view this organism with the right microscope you could see that the entire stalk is covered with smaller hairs than the ones on the opening. What might be the function of these smaller hairs on the stalk?

A) camouflage B) movement C) aerobic respiration D) spore production Answer: B Topic: 15.4 Protists Skill: Application/Analysis Learning Outcome: 15.11 Global LO: 2, 3

16 .

15.3 Scenario Questions Read the following scenario to answer the following question(s).

Malaria is a disease caused by parasitic protists in the genus Plasmodium. The parasite is transmitted to humans by female Anopheles mosquitoes. The Plasmodium parasite feeds on human red blood cells, eventually destroying them. Humans infected with malaria can exhibit many symptoms. Depending on the severity of the infection, these can range from fever, chills, sweating, and headaches to anemia and kidney failure. Ultimately, malaria can result in death.

However, if time and money permit, once a person is infected, they can be treated with different antimalarial drugs. Two commonly used drugs are artemisinin and quinine. In addition, one way to prevent the spread of malaria is to apply pesticides to treat areas with Anopheles mosquitoes.

The National Malaria Eradication Program began work in 1947 with the goal of eliminating malaria from the southern United States. In 1947, 15,000 cases of malaria were reported nationwide. By 1950, only 2,000 cases were reported, and by 1951, malaria was considered eradicated from the United States. Today, the disease is most common in Africa and South America, two continents that are highly impoverished. About one million people die from malaria every year, many of them children. In Africa, it is estimated that one in every five childhood deaths is due to malaria.

1) If an area infested with female Anopheles mosquitoes is treated with pesticides, and these mosquitos live, continue to breed, and continue to spread malaria, what can we conclude?

A) Alleles that are resistant to the pesticides are being selected for, so female Anopheles mosquitoes may continue to infect humans.

B) Malaria is not actually caused by the Plasmodium parasite.

C) Male Anopheles mosquitoes are also carriers of the Plasmodium parasite.

D) The people are becoming resistant to the pesticide.

Answer: A Topic: 15.4 Protists Skill: Synthesis/Evaluation Learning Outcome: 15.11 Global LO: 2, 5, 7 2) Plasmodium illustrate feeding characteristics of a(n) ________.

A) slime mold B) ciliate C) apicomplexan D) algae Answer: C Topic: 15.4 Protists Skill: Knowledge/Comprehension Learning Outcome: 15.11

17 .

3) Suppose production of the pesticides used to treat malaria is halted because the Environmental Protection Agency (EPA) has found that they are causing too much environmental damage to warrant its continued use. In turn, this drives up the prices of artemisinin and quinine since they are now in higher demand. How might this affect those that live in South America and Africa?

A) They will likely experience a decrease in the number of male Anopheles mosquitoes.

B) They will likely experience an increase in the number of male Anopheles mosquitoes.

C) They will likely experience a decrease in the number of malaria cases D) They will likely experience an increase in the number of malaria cases.

Answer: D Topic: 15.4 Protists Skill: Synthesis/Evaluation Learning Outcome: 15.11 Global LO: 2, 5, 9 4) A vector is an organism that transfers a pathogen to a host. In the case of malaria, the vector(s) is (are) ________.

A) humans only B) humans and Anopheles mosquitoes C) Anopheles mosquitoes only D) humans, Plasmodium, and Anopheles mosquitoes Answer: C Topic: 15.4 Protists Skill: Application/Analysis Learning Outcome: 15.11 Global LO: 2, 5

18 .

Read the following scenario to answer the following question(s).

Endotoxins are commonly found in the air, both inside and outside our homes. These "air endotoxins" can come from sources that include house dust mites, agricultural and industrial dust, and dust from indoor pets. Air endotoxins are typically found in low amounts, but production of them can increase dramatically under specific environmental conditions such as dampness, mold, and sewage. Many scientific studies have been conducted investigating possible links between indoor endotoxin levels and asthma, chronic bronchitis, and other upper respiratory diseases. Interestingly, some studies have found positive correlations between indoor endotoxin exposure and severity of some of these diseases while other studies have suggested that some air endotoxin exposure can actually decrease the risk of developing asthma in children.

Additionally, data suggests that industrial workers who are exposed to endotoxins in the air can develop irreversible lung damage.

In 2005, Hurricane Katrina devastated the eastern coastline of the United States. The state of Louisiana, and in particular the city of New Orleans, experienced tragic loss of human life and homes due to the failure of the levee system. Intense flooding destroyed homes and created severe exposure to wet, moldy surfaces. At that time there were no regulations in existence on the amount of exposure that individuals should have to air endotoxins. Scientists from the Natural Resources Defense Council who wanted to determine if endotoxin levels had risen in New Orleans, conducted tests across 12 outdoor areas, 9 of which had been significantly flooded while the other 3 were less affected. Two indoor areas were also sampled for endotoxin levels.

No significant differences were found in endotoxin levels between the flooded and non-flooded areas or between the indoor and outdoor areas. However, a limited number of samples were collected, and they were taken after a recent dry spell. Endotoxin levels at all sites were found to be higher than national average levels but were lower than levels typically associated with longterm changes in lung function.

5) What is a potential benefit of testing indoor and outdoor sites as well as sites with heavy flooding and light flooding?

A) There is no benefit associated with testing in multiple sites.

B) Testing multiple sites takes less time and requires less equipment.

C) Testing multiple sites allows for fewer scientists to be exposed to the air endotoxins.

D) The data collected would allow scientists to compare endotoxin levels under multiple conditions.

Answer: D Topic: 15.3 Prokaryotes Skill: Synthesis/Evaluation Learning Outcome: 15.9 Global LO: 2, 5, 9

19 .

6) What is an implication of the fact that tests were conducted after a period of dry weather?

A) Dry weather creates harsher sampling conditions for scientists.

B) If more periods of rainfall occur after the testing, bacteria that secrete endotoxins may increase, thereby increasing endotoxin levels.

C) Dry weather increases the amount of carbon available for the endotoxin bacteria to use for organic compound production.

D) The endotoxin bacteria are better able to be used for bioremediation efforts in dry weather than in wet weather.

Answer: B Topic: 15.3 Prokaryotes Skill: Synthesis/Evaluation Learning Outcome: 15.9 Global LO: 2, 5, 9 7) What addition to methodology would be most beneficial to the study?

A) pre-flood data to compare to post-flood data in order to better compare endotoxin levels B) a greater number of scientists conducting tests so that different testing methods can be used at each site C) tests conducted on soil endotoxins to compare to air endotoxin levels D) tests conducted on bacterial exotoxins in New York City Answer: A Topic: 15.3 Prokaryotes Skill: Synthesis/Evaluation Learning Outcome: 15.9 Global LO: 2, 5, 9 8) What is a logical conclusion to draw from this study?

A) Workers that come to these areas to help rebuild do not need to be concerned with indoor air endotoxin levels.

B) Workers that come to these areas where there was flooding damage should be advised to wear protective respiratory gear.

C) Workers that come to these areas to help rebuild do not need to be concerned with outdoor air endotoxin levels.

D) Workers that come to these areas to help rebuild buildings can assume that they will develop an irreversible lung infection.

Answer: B Topic: 15.3 Prokaryotes Skill: Synthesis/Evaluation Learning Outcome: 15.9 Global LO: 2, 5, 9

20 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 16 The Evolution of Plants and Fungi Chapter 16 Learning Outcomes 16 Biology and Society: The Diamond of the Kitchen 16.1. Describe the commercial importance of truffles and their symbiotic relationship with trees.

16.1 Colonizing Land 16.2. Compare the structural, physiological, and reproductive adaptations that allowed plants to successfully survive a transition from water to land.

16.3. Relate the origin of plants to green algae.

16.2 Plant Diversity 16.4. Compare the four major periods of plant evolution and the major adaptations associated with each stage.

16.5. Describe the life cycle and two key terrestrial adaptations of mosses.

16.6. Compare ferns and mosses, noting the relationship between ancient ferns and modern fossil fuels.

16.7. Describe the environmental conditions that favored the evolution of gymnosperms as well as three adaptations to life on land that first appeared in gymnosperms.

16.8. Describe the structures and functions of a flower including the adaptive significance of pollinator attraction.

16.9. Describe the significance of angiosperms to humans and natural ecosystems.

16.3 Fungi 16.10. Describe the feeding mechanisms, structure, reproduction, ecological roles, and commercial uses of fungi.

16 The Process of Science: Did a Fungus Lead to the Salem Witch Hunt?

16.11. Explain the importance of the interaction of plants and fungi.

16 Evolution Connection: A Mutually Beneficial Symbiosis 16.12. Distinguish parasitic and mutually beneficial symbiotic relationships between fungi and plants (mycorrhizae) and algae and bacteria (lichens).

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

16.1 Multiple Choice Questions 1) Which aspect of truffle mushrooms drives their commercial importance?

A) size B) smell C) taste D) texture Answer: B Topic: 16 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 16.1 Global LO: 5 2) Why is the symbiotic relationship of truffle mushrooms and tree roots considered to be crucial to the colonization of land?

A) This relationship is found in some of the oldest plant fossils.

B) Truffles have the terrestrial adaptation of seeds.

C) Tree roots can be found only in terrestrial environments.

D) Truffles provide trees with sugars.

Answer: A Topic: 16 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 16.1 3) Mutualistic associations of plant roots and fungi are called ________.

A) mycorrhizae B) mycelia C) shoots D) hyphae Answer: A Topic: 16.1 Colonizing Land Skill: Knowledge/Comprehension Learning Outcome: 16.2 4) The ________ help(s) plants retain water.

A) hypha B) cuticle C) mycorrhiza D) lignin Answer: B Topic: 16.1 Colonizing Land Skill: Knowledge/Comprehension Learning Outcome: 16.2

2 .

5) ________, a chemical that hardens cell walls and supports terrestrial plants, is found in all plants EXCEPT ________.

A) Lignin... bryophytes B) Cellulose... bryophytes C) Cellulose... ferns D) Lignin... ferns and bryophytes Answer: A Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.2 6) Would you expect desert plants to have a thin or thick cuticle?

A) thin because desert plants do not have stomata B) thin because desert plants have a short root system C) thick because desert plants have an extensive shoot system D) thick because desert plants need to retain water in this dry environment Answer: D Topic: 16.1 Colonizing Land Skill: Synthesis/Evaluation Learning Outcome: 16.2 Global LO: 2 7) Some companies that produce paper will also produce a by-product that is sold as a binder (something that binds, or holds, things together). From which part of trees does this by-product come?

A) leaves B) mycorrhizae C) lignin D) stomata Answer: C Topic: 16.1 Colonizing Land Skill: Application/Analysis Learning Outcome: 16.2 Global LO: 2 8) Which of the following is the lineage of green algae believed to most resemble early plant ancestors?

A) charophytes B) ulva C) volvox D) dinoflagellates Answer: A Topic: 16.1 Colonizing Land Skill: Knowledge/Comprehension Learning Outcome: 16.3

3 .

9) Plants first moved onto land at least ________ years ago.

A) 65 million B) 475 million C) 1.2 billion D) 3.5 billion Answer: B Topic: 16.1 Colonizing Land Skill: Knowledge/Comprehension Learning Outcome: 16.2 10) Which of the following correctly illustrates the sequence of the origin of modern groups of plants?

A) gymnosperms, ferns, bryophytes, angiosperms B) bryophytes, ferns, gymnosperms, angiosperms C) bryophytes, ferns, angiosperms, gymnosperms D) ferns, gymnosperms, angiosperms, bryophytes Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.4 11) Which of the following lack vascular tissue?

A) cone-bearing plants B) grasses C) ferns D) mosses Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 12) Why are bryophytes considered incompletely liberated from their ancestral aquatic habitat?

A) They lack lignin.

B) Their sperm are flagellated.

C) The gametophyte generation is dominant.

D) They lack a cuticle.

Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5

4 .

13) In ________ the gametophyte is more obvious than the sporophyte.

A) conifers B) mosses C) grasses D) ferns Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 14) Gametophytes are ________; sporophytes are ________.

A) male... female B) an adaptation to an aquatic existence... an adaptation to a terrestrial existence C) haploid... diploid D) the dominant stage of the conifer life cycle... the less obvious stage of the conifer life cycle Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 15) Gametophytes reproduce ________.

A) by producing sperm and eggs B) by fission C) by meiosis of special cells in the gametophyte D) by budding Answer: A Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 16) ________ are seedless vascular plants.

A) Ferns B) Angiosperms C) Bryophytes D) Gymnosperms Answer: A Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.6

5 .

17) Why are ferns considered incompletely adapted to the terrestrial environment, when compared with other plants?

A) They lack vascular tissue.

B) Their sperm are flagellated.

C) The gametophyte generation is dominant.

D) They lack cuticle.

Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.6 18) Much of the coal we use today came from ________ that lived during the Carboniferous.

A) gymnosperms B) mosses C) angiosperms D) ferns Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.6 19) Of the following, which is the earliest step in the formation of fossil fuels?

A) subjecting organic matter to extreme pressure B) flooding swamps with seawater C) incomplete decomposition of organic matter D) subjecting organic matter to extreme heat Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.6 20) If you wanted to propagate (grow) ferns, what do you need to collect from existing ferns?

A) diploid zygote cells B) haploid spores C) fossil fuels D) seeds Answer: B Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.6 Global LO: 2

6 .

21) What is an evolutionary reason why individual ferns may produce millions of spores?

A) Having many spores increases the chances that they will produce fossil fuels.

B) Having many spores increases the chances that they can produce seeds.

C) Spores can germinate only in the right environmental conditions, so producing many spores increases the chances that at least one will end up in an area of those conditions.

D) Spores can disperse only short distances, so producing many spores increases the chances that at least one will travel far enough to germinate.

Answer: C Topic: 16.2 Plant Diversity Skill: Synthesis/Evaluation Learning Outcome: 16.6 Global LO: 2 22) What global climatic change gave gymnosperms an advantage over ferns?

A) the climate becoming hotter and wetter B) increased fluctuations in global climate temperatures C) the climate becoming cooler and drier D) the climate becoming hotter and drier Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7 23) Which of these adaptations to a terrestrial existence evolved most recently?

A) vascular tissue B) seeds C) lignin D) cuticle Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7 24) A pollen grain is a(n) ________.

A) female gametophyte B) sporophyte C) male gametophyte D) integument Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7

7 .

25) ________ were the first plants that did not require water for transferring sperm to eggs.

A) Bryophytes B) Gymnosperms C) Ferns D) Angiosperms Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7 26) Seeds develop from ________.

A) carpels B) anthers C) ovules D) ovaries Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7 27) Why are gymnosperms considered to be "naked seed" plants?

A) Their seeds have a thin layer of endosperm.

B) They do not produce seeds; they produce only spores.

C) Their seeds are not enclosed within ovaries.

D) Their seeds develop on the surface of sporophytes.

Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.7 28) In angiosperms, the ________ is a nutrient-storing tissue that nourishes a developing embryo.

A) fruit B) seed C) carpels D) endosperm Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8

8 .

29) In angiosperms, the male gametophyte develops within ________.

A) male cones B) filaments C) anthers D) stigma Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8 30) Which of the following is a component of the female structure of a flowering plant?

A) petal B) filament C) anther D) stigma Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8 31) Which structure of a flower traps pollen?

A) style B) stigma C) ovary D) filament Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8 32) Gymnosperms and angiosperms share multiple similarities. Which of the following is NOT a shared feature of angiosperms and gymnosperms?

A) Both produce flowers.

B) Both have pollen grains that are male gametophytes.

C) Both have a dominant sporophyte generation.

D) Both have seeds.

Answer: A Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.8 Global LO: 2

9 .

33) In angiosperms, what structures house female gametophytes?

A) stigmas B) petals C) ovules D) sepals Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8 34) The edible portion of a(n) ________ is a ripened ovary.

A) cucumber B) broccoli stalk C) radish D) onion Answer: A Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.8 Global LO: 2 35) From the point of view of an angiosperm, what is the function of fruit?

A) It is where the male gametophyte develops.

B) It is a mechanism for the dispersal of seeds.

C) It provides nutrients to germinating seeds.

D) It attracts pollinators.

Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.8 36) Which of the following statements about pollination and fertilization is CORRECT? A) Pollination is identical to fertilization.

B) Pollination is not the same as fertilization, but pollination guarantees fertilization will occur.

C) Pollination and fertilization are unrelated.

D) Pollination is not the same as fertilization, and pollination does not guarantee fertilization will occur.

Answer: D Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.8 Global LO: 2

10 .

37) Nearly all food plants are ________.

A) bryophytes B) gymnosperms C) ferns D) angiosperms Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.9 38) Exploring in the tropics, you discover a nonvascular plant that produces pollen. What type of plant have you discovered?

A) an angiosperm B) a fern C) a bryophyte D) an entirely new type that you will get to name Answer: D Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.6, 16.8, 16.9 Global LO: 2 39) Which of the following statements is NOT true?

A) Rainforests regenerate slowly and cannot sustain slash-and-burn clearing.

B) Humans depend on plants for food, wood, and medicines.

C) Only a fraction of plant species have been tested as potential medicine sources.

D) Local knowledge of rainforest plant communities has no impact on the production of new medicines.

Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.9 Global LO: 5 40) Nutritionally, all fungi are ________.

A) heterotrophs that acquire their nutrients by absorption B) autotrophs that acquire their nutrients from solar energy C) autotrophs that acquire their nutrients from chemicals D) parasites that acquire their nutrients from other organisms Answer: A Topic: 16.3 Fungi Skill: Knowledge/Comprehension Learning Outcome: 16.10

11 .

41) What are hyphae?

A) symbiotic associations between plant roots and fungi B) threadlike filaments that make up fungal bodies C) fungal digestive enzymes D) fungal spores Answer: B Topic: 16.3 Fungi Skill: Knowledge/Comprehension Learning Outcome: 16.10 42) Like plants, fungi have ________; however, in plants they are composed of ________, whereas in fungi they are composed of ________.

A) cell walls... cellulose... chitin B) cell walls... cellulose... peptidoglycan C) cell membranes... phospholipids... chitin D) cell walls... phospholipids... cellulose Answer: A Topic: 16.3 Fungi Skill: Knowledge/Comprehension Learning Outcome: 16.10 43) The function of a mushroom is to ________.

A) produce seeds B) store nutrients C) produce spores D) photosynthesize Answer: C Topic: 16.3 Fungi Skill: Knowledge/Comprehension Learning Outcome: 16.10 44) What important role do fungi play in many ecosystems?

A) They decompose organic material.

B) They pollinate plants.

C) They disperse the fruits of angiosperms.

D) They perform photosynthesis.

Answer: A Topic: 16.3 Fungi Skill: Knowledge/Comprehension Learning Outcome: 16.10

12 .

45) Biocontrol, short for biological control, is a means to control pest populations (e.g., insects, plants) by intentionally introducing natural enemies of those pests. Biocontrol methods have benefits of typically being less expensive and less environmentally damaging than chemical pesticides. Which of the following should NOT be considered an example of biocontrol?

A) the spores of the Chinese caterpillar fungus that are sprayed on crop pests to parasitize and kill them B) the application of herbicides that kill weeds harboring pest populations C) the introduction of mites that prey upon citrus rust mites that infest and destroy citrus crops D) the introduction of insect herbivores that eat weeds but do not feed on native plant species Answer: B Topic: 16.3 Fungi Skill: Application/Analysis Learning Outcome: 16.10, 16.11 46) Suppose that, while on a forest hike, you notice a blue fungus and a pink plant growing along the hiking trail. As you continue walking, you observe that if a blue fungus and a pink plant are growing side by side, they are both much larger than if the fungus and the plant are farther apart.

What can you hypothesize about the relationship between the fungus and the plant?

A) The fungus and the plant have a symbiotic relationship that allows them to have more significant growth when they are near each other than when farther apart.

B) The fungus and the plant have a parasitic relationship that allows them to have more significant growth when they are near each other than when farther apart.

C) The roots of the plant are choking off nutrient flow to the fungal hyphae.

D) The plant is helping the fungus decompose leaf litter on the forest floor.

Answer: A Topic: 16 The Process of Science, 16 Evolution Connection, 16.10 Skill: Synthesis/Evaluation Learning Outcome: 16.11, 16.12 Global LO: 2 47) Corn smut is a fungus that grows in the ears of corn and changes corn kernels into black, powdery balls of fungus tissue. What would you hypothesize is the significance of the relationship between corn smut and corn?

A) Corn smut has a parasitic relationship with corn so that it can use the corn as a way to spread spores.

B) Corn smut has a symbiotic relationship with corn so that it can use the corn as a way to spread spores.

C) Corn smut helps to decompose corn more quickly and therefore replenishes nutrients in the soil at a faster rate.

D) Corn smut slows decomposition of corn and therefore reduces the rate at which nutrients are returned to the soil.

Answer: A Topic: 16 The Process of Science, 16.10 Skill: Synthesis/Evaluation Learning Outcome: 16.11, 16.12 Global LO: 2, 5 13 .

16.2 Art Questions 1) What is this organism?

A) fern B) fungus C) bryophyte D) gymnosperm Answer: C Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 Global LO: 3

14 .

2) This diagram shows what process?

A) origin of plants from green algae B) alternation of generations C) angiosperm life cycle D) gymnosperm life cycle Answer: B Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.5 Global LO: 3

15 .

3) If seed production had never evolved, which organisms would be missing in today's landscape?

A) bryophytes and ferns B) ferns and gymnosperms C) gymnosperms and angiosperms D) angiosperms and bryophytes Answer: C Topic: 16.2 Plant Diversity Skill: Application/Analysis Learning Outcome: 16.4 4) The photo below shows ________.

A) a cluster of fern spore capsules B) a fairy ring C) an algal cell with extensive thread-like cilia D) a lichen, a mutually beneficial symbiosis Answer: D Topic: 16.3 Fungi, 16 Evolution Connection Skill: Application/Analysis Learning Outcome: 16.12 Global LO: 2, 3 16 .

16.3 Scenario Questions Read the following scenario to answer the following questions.

People utilize plants to meet many everyday needs, including food, fiber, and building materials.

However, not many of the over 300,000 known species of plants are used by people. One species with a lot of future promise is the jatropha tree. This species is native to Central America and is now found throughout the tropics. Many people believe the jatropha could help alleviate poverty in many areas of the world, as the seeds produce an oil that can be used for cooking, lighting, or generating electricity. This oil can also be mixed with diesel fuel or petrol to produce a biofuel.

Mature trees produce between 5 and 15 kg of seeds per year and can live more than 30 years.

However, critics argue that planting the jatropha tree will take land needed for food production, which will in turn harm the poor.

1) What would NOT be an advantage of using oil from jatropha seeds?

A) The oil is considered a renewable resource.

B) The oil can be used for generating electricity.

C) The oil can be used as a biofuel.

D) Growing jatropha tress to produce oil may lower food production.

Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.9 Global LO: 5 2) Which of the following statements concerning the jatropha tree is TRUE? A) Jatropha trees are found all over the world.

B) Everyone believes planting jatropha trees will be beneficial.

C) Humans use over half of the known species of plants for everyday uses.

D) Currently, the most valuable part of the jatropha tree is the seed.

Answer: D Topic: 16.2 Plant Diversity Skill: Knowledge/Comprehension Learning Outcome: 16.9 Global LO: 5

17 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 17 The Evolution of Animals Chapter 17 Learning Outcomes 17 Biology and Society: The Discovery of the Hobbit People 17.1. Describe the fossil discoveries on the Indonesian island of Flores and relate the findings to modern humans.

17.1 The Origins of Animal Diversity 17.2. Define what it means to be an animal, including structure and function of a body cavity, and describe common aspects of animal development.

17.3. Summarize the likely causes and significance of the Cambrian explosion.

17.4. Within the context of animal phylogeny, compare the presence of true tissues and the type of body symmetry found in each of the nine major animal phyla.

17.2 Major Invertebrate Phyla 17.5. Compare the body structure, lifestyles, and feeding strategies of the nine major animal phyla, distinguishing between distinct subgroups of these phyla.

17.3 Vertebrate Evolution and Diversity 17.6. Describe four defining characteristics of the phylum Chordata and compare body structure, lifestyles, and feeding strategies of four subgroups of Chordata.

17.7. Compare aquatic and terrestrial adaptations of amphibians, adaptations of reptiles to life on land, and adaptations for flight found in birds.

17.8. Describe the characteristics common to all mammals, distinguishing between monotremes, marsupials, and eutherian mammals.

17.4 The Human Ancestry 17.9. Compare the three main groups of primates, including adaptations for arboreal living.

17.10. Explain the misconceptions that (a) chimpanzees are our ancestors, (b) human evolution is a ladder, and (c) human traits evolved together.

17.11. Compare the traits of the major hominin species and the relationships between them.

17.12. Describe the evolution and impact of our species as we spread across the world.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

17.1 Multiple Choice Questions 1) J. R. R. Tolkien is a famous author who wrote, among others, several books about the adventures of a community of a humanoid (meaning resembling a human) race. The individuals of this race are described by Tolkien as being "…between 2 and 4 feet (0.61-1.22 m) tall, the average height being 3 feet 6 inches (1.07 m) … a fairly human figure." This general description characterizes the humanoids mostly closely resembling ________.

A) Homo sapiens B) Homo floresiensis C) mandrills D) lemurs Answer: B Topic: 17 Biology and Society Skill: Application/Analysis Learning Outcome: 17.1 Global LO: 2 2) Which of these is a defining characteristic of animals that distinguishes them from other eukaryotes?

A) Animals are multicellular.

B) Animals ingest food.

C) Animals are heterotrophs.

D) Animals use photosynthesis.

Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.2 3) The common ancestor of all animals is likely to have been a ________.

A) colonial, flagellated protist B) colonial, ciliated protist C) colonial, flagellated bacterium D) sponge Answer: A Topic: 17.1 The Origins of Animal Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.3

2 .

4) Which of these exhibits radial symmetry?

A) butterfly B) spoon C) snowflake D) shoe box Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 Global LO: 2 5) Humans are chordates. Which animal group is most closely related to chordates?

A) molluscs B) echinoderms C) annelids D) arthropods Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.4 6) How do sponges differ from all other animals?

A) Sponges exhibit radial symmetry.

B) Sponges are autotrophs.

C) Sponges lack a true body cavity.

D) Sponges lack true tissues.

Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 7) What name is given to the food-trapping cells of sponges?

A) cnidocytes B) amoebocytes C) skeletal fibers D) choanocytes Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5

3 .

8) The mobile stage of the cnidarian life cycle is the ________ stage.

A) bilateral B) polyp C) tadpole D) medusa Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 9) ________ are characterized by stinging cells used for defense and for capturing prey.

A) Annelids B) Sponges C) Cnidarians D) Roundworms Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 10) A(n) ________ is an example of a mollusc that does not have a shell.

A) octopus B) snail C) spider D) oyster Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 11) Which animals have a cylindrical body that is tapered at both ends?

A) platyhelminthes B) cnidarians C) annelids D) roundworms Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5

4 .

12) There are more species of ________ than of any other type of animal.

A) nematodes B) molluscs C) arthropods D) chordates Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 13) A characteristic of arthropods that has allowed for their great success is the presence of ________.

A) bilateral symmetry B) an endoskeleton C) a brain D) specialized segments Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 14) The arthropod skeleton is composed of ________.

A) cellulose B) peptidoglycan C) chitin D) glycogen Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 15) Nearly all ________ are aquatic.

A) crustaceans B) arachnids C) flatworms D) roundworms Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5

5 .

16) ________ are the most diverse group of arthropods.

A) Insects B) Millipedes C) Arachnids D) Crustaceans Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 17) What characteristic is unique to echinoderms?

A) a lack of segmentation B) a water vascular system C) radial symmetry D) larvae with bilateral symmetry Answer: B Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 18) You are given the task of confirming the categorization of a newly discovered animal that has been tagged as a species of annelid. What evidence would convince you that it is indeed an annelid and not a roundworm or flatworm?

A) an incomplete digestive tract B) a highly branched gastrovascular cavity C) parasitic feeding habits D) body segmentation Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Application/Analysis Learning Outcome: 17.5 Global LO: 2 19) You encounter an insect with small eyes, long sensory antennae, and a long mouthpart shaped like a sword. What can you conclude about the environment in which it lives?

A) The environment is dark and has many plants.

B) The environment is wet and has many other insects.

C) The environment is hot and has many primates.

D) The environment is cool and has many reptiles.

Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Synthesis/Evaluation Learning Outcome: 17.5 Global LO: 2

6 .

20) You discover an organism that has scaly skin and is aquatic but returns to the land to reproduce. What else would you expect to find in this organism?

A) asexual reproduction B) amniotic egg C) a water vascular system D) radial symmetry Answer: B Topic: 17.2 Major Invertebrate Phyla Skill: Synthesis/Evaluation Learning Outcome: 17.5, 17.6 Global LO: 2 21) Unique features of vertebrates include the presence of a(n) ________.

A) endoskeleton B) notochord C) skull and a backbone D) pharyngeal slit Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 22) Which of the following is a characteristic of all chordates?

A) They all have vertebral columns.

B) They all exhibit radial symmetry.

C) They all have a notochord sometime during their life cycle.

D) They all have an exoskeleton sometime during their life cycle.

Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 23) A(n) ________ is an example of a chordate that is not a vertebrate.

A) lancelet B) echinoderm C) bird D) fish Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6

7 .

24) Among vertebrates, the unique feature of lampreys and hagfish is the ________.

A) presence of a cartilaginous skeleton B) absence of a backbone C) absence of jaws D) absence of a postanal tail Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 25) Rays are a type of ________.

A) tunicate B) cartilaginous fish C) jawless fish D) bony fish Answer: B Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 26) Swim bladders ________.

A) contain the gills B) are required for fish to exchange gases with the surrounding water C) are present in both bony and cartilaginous fishes D) help bony fish maintain buoyancy Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 27) Which group of fishes includes a lineage that migrated out of fresh water and adapted to life on land?

A) ray-finned fishes B) jawless fishes C) lobe-finned fishes D) cartilaginous fishes Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6, 17.7

8 .

28) What does the term "tetrapod" mean?

A) egg-laying B) living on land C) living a double life D) having four feet Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7 29) A feature that freed reptiles from dependence on water for reproduction is ________.

A) parental care of eggs B) ectothermy C) metamorphosis D) the amniotic egg Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7 30) A characteristic that is shared by snakes and birds is ________.

A) being ectothermic B) the presence of only a single ovary in females C) the amniotic egg D) being endothermic Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7 31) Almost every element of bird anatomy is modified for what?

A) laying eggs B) eating seeds C) enhancement of flight D) singing unique songs Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7

9 .

32) A feature unique to mammals includes ________.

A) the presence of hair B) extended parental care of the young C) being endotherms D) having no egg-laying members Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.8 33) ________ are the mammalian group that lays eggs.

A) Eutherians B) Tunicates C) Monotremes D) Marsupials Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.8 34) All chordates have ________.

A) a dorsal, hollow nerve cord and a notochord B) a postanal tail and a single opening for the mouth and anus C) a cranium and vertebrae D) pharyngeal slits and a cranium Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6 35) The lancelet is a(n) ________.

A) annelid B) flatworm C) chordate D) tunicate Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.6

10 .

36) The platypus is a ________.

A) bird B) marsupial C) eutherian D) monotreme Answer: D Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.8 37) While on an archaeology expedition, you unearth a skeleton with the following characteristics: four long, slender finger bones and a smaller opposable thumb bone, long arm bones, fingernails, and eye sockets close together on a skull. What type of organism do you suspect you may have found?

A) an anthropoid B) a tarsier C) a crustacean D) a marsupial Answer: A Topic: 17.4 The Human Ancestry Skill: Application/Analysis Learning Outcome: 17.9 Global LO: 2 38) At a natural history museum, you see a skeleton with the following characteristics: four long, slender finger bones and a smaller opposable thumb bone, and larger feet with long toes. In what type of environment would you expect this organism to have lived?

A) one that lacks vegetation B) one that is very cold C) one that is very dry D) one that is heavily forested Answer: D Topic: 17.4 The Human Ancestry Skill: Synthesis/Evaluation Learning Outcome: 17.9 Global LO: 2 39) How do New World monkeys differ from Old World monkeys?

A) New World monkeys have a prehensile tail.

B) New World monkeys have enhanced depth perception.

C) Old World monkeys are arboreal.

D) Old World monkeys have claws.

Answer: A Topic: 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.9 11 .

40) Which anthropoids are most closely related to humans?

A) orangutans B) chimpanzees C) gorillas D) gibbons Answer: B Topic: 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.10 41) Which of these human characteristics is hypothesized to have evolved first?

A) enlarged brain B) erect posture C) language D) loss of body hair Answer: B Topic: 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.11 42) The first hominid to spread beyond Africa was ________.

A) "Lucy" B) Australopithecus afarensis C) Homo erectus D) Homo neanderthalensis Answer: C Topic: 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.12 43) Where did humans first appear?

A) South America B) Africa C) Asia D) Europe Answer: B Topic: 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.12

12 .

44) Which of the following is one way in which scientists can test hypotheses about events that occurred in the distant past?

A) by dissecting current animal specimens B) by analyzing fossils recovered from the Earth C) by visiting local libraries to research the events D) by interviewing current scientists and researchers Answer: B Topic: 17 Process of Science, 17.4 The Human Ancestry Skill: Knowledge/Comprehension Learning Outcome: 17.11 45) The process of biological evolution often allows humans to survive consistent environmental stresses that occur across multiple generations. As humans colonized Earth's diverse environments, they encountered hot, dry areas and decided to settle. What trait likely offered an advantage in this environment?

A) the ability to produce sweat to cool their bodies B) the ability to shiver to create body heat C) the ability to squint eyes to block out bright light D) the ability to dig deep holes to find groundwater Answer: A Topic: 17 Evolution Connection Skill: Application/Analysis Learning Outcome: 17.12 Global LO: 2

13 .

17.2 Art Questions

1) Annelids are most closely related to ________.

A) chordates B) arthropods C) molluscs D) echinoderms Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 Global LO: 2, 3 2) According to the figure, which organism group demonstrates the most advanced body plan in reference to presence of tissue and symmetry?

A) sponges B) cnidarians C) ancestral protists D) arthropods Answer: D Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 14 .

3) All organisms with bilateral symmetry also have ________.

A) hard skeletons B) bilateral adults C) sense organs D) an anterior head Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 4) Flatworms are similar to cnidarians in that both ________.

A) are chordates B) have true tissues C) lack a gastrovascular cavity D) exhibit bilateral symmetry Answer: B Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 Global LO: 2, 3 5) What type of symmetry does this organism exhibit?

A) asymmetrical B) binomial C) radial D) bilateral Answer: C Topic: 17.1 The Origins of Animal Diversity Skill: Application/Analysis Learning Outcome: 17.4 Global LO: 2, 3

15 .

6) The figure below shows a simple worm. Bilateral symmetry and a highly branched gastrovascular cavity all suggest that the worm is a(n) ________.

A) annelid B) mollusk C) chordate D) flatworm Answer: D Topic: 17.2 Major Invertebrate Phyla Skill: Application/Analysis Learning Outcome: 17.4, 17.5 Global LO: 2, 3

16 .

7) The segmented body of the worm below suggests that it is a(n) ________.

A) annelid B) arthropod C) snake D) roundworm Answer: A Topic: 17.2 Major Invertebrate Phyla Skill: Application/Analysis Learning Outcome: 17.5 Global LO: 2, 3

17 .

8) Insects, such as the grasshopper shown below, have ________.

A) eight legs B) a two-part body: head and abdomen C) a three-part body: head, thorax, and abdomen D) no wings Answer: C Topic: 17.2 Major Invertebrate Phyla Skill: Knowledge/Comprehension Learning Outcome: 17.5 Global LO: 3

18 .

9) According to this evolutionary tree, approximately how many years ago did humans and orangutans share a common ancestor?

A) 1 million years ago B) 7 million years ago C) 12 million years ago D) 20 million years ago Answer: C Topic: 17.4 The Human Ancestry Skill: Application/Analysis Learning Outcome: 17.9 Global LO: 2, 3

19 .

10) According to this evolutionary tree, how would you characterize a new anthropoid specimen discovered and estimated to be approximately 42 million years old?

A) one that could be a New World monkey or an Old World monkey B) one that is likely a species of lemur C) one that is likely a species of tarsier D) one that evolved from a new ancestral primate Answer: A Topic: 17.4 The Human Ancestry Skill: Application/Analysis Learning Outcome: 17.9 Global LO: 2, 3 17.3 Scenario Questions Read the following scenario to answer the following questions.

Birds are a widespread group of animals with approximately 10,000 different species found throughout the world today. Because they are relatively easy to find and so visually appealing, they have been studied more thoroughly than many other groups of animals. They are also valuable biological indicators because many species live in different habitats during different times of the year and cover long migration routes. According to the World Conservation Union, extinction threatens over 1,200 bird species today, and at least 179 are critically endangered.

Some of the most endangered species include the Tahiti monarch, with only 10 pairs remaining, and the Bali starling, with only 12 wild individuals left. In Hawaii, the last captive po'ouli died in 2005, and the last two known to be alive in the wild have not been seen since 2003—2004.

Common birds are also disappearing. In North America, red-winged blackbird populations declined by at least 1 percent each year between 1980 and 1999. These examples can serve as a warning. Habitat loss through destruction, degradation, and fragmentation are serious problems that affect 86 percent of threatened birds and are exacerbated by unsustainable forestry practices and intensifying agriculture. All of this shows that conservation of habitats is critical if many of the world's bird species are going to be saved from extinction in the near future.

1) What is a feature of birds that makes them valuable as biological indicators?

A) Many migrate long distances.

B) Many are brightly colored.

C) There are over 10,000 different species of birds.

D) Birdwatching is a popular hobby.

Answer: A Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7, 17.12

20 .

2) What is the greatest threat to birds today?

A) pollution B) poaching C) habitat loss D) the illegal pet trade Answer: C Topic: 17.3 Vertebrate Evolution and Diversity Skill: Knowledge/Comprehension Learning Outcome: 17.7, 17.12 3) Approximately what percent of bird species are threatened with extinction today?

A) 5% B) 12% C) 25% D) 45% Answer: B Topic: 17.3 Vertebrate Evolution and Diversity Skill: Application/Analysis Learning Outcome: 17.7, 17.12

21 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 18 An Introduction to Ecology and the Biosphere Chapter 18 Learning Outcomes 18 Biology and Society: Penguins, Polar Bears, and People in Peril 18.1 Describe the causes and impacts of global climate changes over the past century.

18.1 An Overview of Ecology 18.2 Compare the biosphere’s four levels of ecology within the context of abiotic and biotic factors, and explain how ecologists learn about the structure and processes of our natural world.

18.2 Living in Earth’s Diverse Environments 18.3 Describe the major abiotic factors that affect the distribution of life in the biosphere and the three main types of responses that enable plants or animals to adjust to changes in their environments.

18.3 Biomes 18.4 Distinguish major characteristics of freshwater and marine biomes.

18.5 Compare the properties of a stream or river at its source and at the place where it empties into a lake or the sea.

18.6 Distinguish major characteristics of the types of terrestrial biomes: tropical forest, savanna, desert, chaparral, temperate grassland, temperate broadleaf forest, coniferous forest, tundra, and polar ice.

18.7 Describe the values of aquatic and terrestrial biomes to natural ecosystems and humans.

18.8 Explain how the biosphere is linked by the global water cycle.

18.9 Explain how climate change and humans have impacted the world’s biomes within the context of goals of sustainability.

18.4 Global Climate Change 18.10 Describe how greenhouse gases affect global climates and how global climate change affects the distribution and interactions of species.

18.11 Describe the causes of increasing greenhouse gas levels in the global atmosphere and how you can decrease your carbon footprint.

18 Evolution Connection: Climate Change as an Agent of Natural Selection 18.12 Explain why organisms with low genetic diversity and long life spans might suffer the most in a rapidly changing climate.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

18.1 Multiple Choice Questions 1) Suppose that a group of climate scientists claims that they can predict future impacts of global climate change with 98% accuracy. Why should you be skeptical of this claim?

A) They do not have reliable methods to measure this change.

B) Their predictions are based on incomplete information about species diversity and interactions of living organisms with each other and with their environments.

C) They should be focusing their predictions based only on climate change in the polar regions where the greatest effects of climate change are experienced.

D) They have not accounted for abiotic factors that affect global climate change in their predictions.

Answer: B Topic: 18 Biology and Society, 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.1 Global LO: 2, 5 2) Ecology is the study of ________.

A) life B) human effects on the environment C) interactions between humans and other species D) interactions between organisms and their environments Answer: D Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2 3) Which of the following is abiotic?

A) a protist B) a plant C) a fungus D) a rock Answer: D Topic: 18.1 An Overview of Ecology Skill: Application/Analysis Learning Outcome: 18.2 Global LO: 2

2 .

4) If you study how two species of finches compete for food, you are trying to answer a question about ________.

A) community ecology B) population ecology C) organismal ecology D) ecosystems ecology Answer: A Topic: 18.1 An Overview of Ecology Skill: Application/Analysis Learning Outcome: 18.2 Global LO: 2 5) What level of ecology is concerned with the adaptations of individuals?

A) community B) organismal C) ecosystem D) population Answer: B Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2 6) What level of ecology is concerned with groups of individuals of the same species?

A) community B) organism C) ecosystem D) population Answer: D Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2 7) What level of ecology is concerned with groups of individuals of different species?

A) community B) organism C) ecosystem D) population Answer: A Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2

3 .

8) What is a population?

A) a group of organisms living in a particular geographic area B) a group of organisms of the same species living in a particular geographic area C) a community as well as all the abiotic factors in a particular geographic area D) all of the organisms of a species existing at a particular time Answer: B Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2 9) Which of these is a community?

A) all of the Staphylococcus aureus (a species of bacteria living on your skin B) all of the organisms living in your home C) all of the people living in your neighborhood D) all of the nut grass (considered a weed) in your backyard Answer: B Topic: 18.1 An Overview of Ecology Skill: Application/Analysis Learning Outcome: 18.2 Global LO: 2 10) What level of ecology is concerned with both the biotic and abiotic aspects of an environment?

A) community B) organism C) ecosystem D) population Answer: C Topic: 18.1 An Overview of Ecology Skill: Knowledge/Comprehension Learning Outcome: 18.2 11) Which of the following organisms are NOT ultimately dependent on sunlight for energy?

A) species that live in hydrothermal vent habitats B) migratory bird species C) marine species that live in the aphotic zone D) trees that have experienced "flagging" Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Knowledge/Comprehension Learning Outcome: 18.3

4 .

12) Aquatic organisms ________.

A) have a waxy coating to prevent water loss B) may experience problems with water balance C) typically have a plentiful supply of nitrogen D) never find light to be in short supply Answer: B Topic: 18.2 Living in Earth's Diverse Environments Skill: Knowledge/Comprehension Learning Outcome: 18.3 13) Which nutrients often limit the distribution and abundance of photosynthetic organisms?

A) water and oxygen B) nitrogen and phosphorus C) carbon dioxide and nitrogen D) water and carbon dioxide Answer: B Topic: 18.2 Living in Earth's Diverse Environments Skill: Knowledge/Comprehension Learning Outcome: 18.3 14) What term applies to the physical and physiological changes experienced by astronauts who spend months in space?

A) acclimation B) adaptation C) camouflaging D) flagging Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Application/Analysis Learning Outcome: 18.3 Global LO: 2 15) Which of the following is a behavioral response to environmental variability?

A) migrating to a different location B) acclimation C) endothermy D) "flagging" by trees Answer: A Topic: 18.2 Living in Earth's Diverse Environments Skill: Knowledge/Comprehension Learning Outcome: 18.3

5 .

16) In an aquatic ecosystem, what name is given to the region where photosynthesis can occur?

A) pelagic zone B) aphotic zone C) benthic realm D) photic zone Answer: D Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 17) Wetlands ________.

A) are important in improving water quality B) include rivers, streams, ponds, and lakes C) are bodies of swiftly flowing water D) are found in the intertidal zone Answer: A Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 18) What are estuaries?

A) types of freshwater biomes B) areas near the start of a river C) regions where ocean meets land D) transition areas between a river and the ocean Answer: D Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 19) Which of these biomes is one of the most biologically productive of all biomes?

A) open oceans B) estuaries C) temperate grasslands D) coniferous forests Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4

6 .

20) What name is given to the region where sea meets land?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4, 18.5 21) What name is given to the open ocean?

A) pelagic realm B) intertidal zone C) benthic realm D) photic zone Answer: A Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 22) In what part of the ocean are phytoplankton found?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: A Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 23) What name is given to the seafloor?

A) pelagic realm B) intertidal zone C) benthic realm D) aphotic zone Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4

7 .

24) Temperate zones ________.

A) have the coolest climates on Earth B) have milder climates than the tropics C) are relatively dry D) are concentrated in the polar regions Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.9 25) Which of the following can moderate climate by absorbing heat when the air is warm and releasing heat when the air is cold?

A) clouds B) glaciers C) mountains D) oceans Answer: D Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.9 26) Water-storing plants and deeply rooted shrubs are plants that characterize ________.

A) tropical forests B) chaparral C) deserts D) savanna Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 27) The Sahara Desert and the Negev Desert belong to the same ________.

A) community B) savanna ecosystem C) biome D) temperate grassland Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6

8 .

28) Long, snowy winters as well as evergreen trees such as pine and fir are found in ________.

A) chaparral B) temperate broadleaf forests C) coniferous forests D) temperate grasslands Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 29) ________ are the dominant herbivores of savanna ecosystems.

A) Antelopes B) Zebras C) Buffalo D) Insects Answer: D Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 30) What is one important difference between savannas and temperate grasslands?

A) Savannas only rarely experience fires.

B) Temperate grasslands are mostly treeless.

C) Savannas are inhabited by grazing mammals.

D) Temperate grasslands have nutrient-poor soil.

Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 31) Which of these biomes are maintained by fire?

A) temperate broadleaf forests and chaparral B) chaparral and savannas C) deserts and chaparral D) savanna and temperate grasslands Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6

9 .

32) Permafrost, or permanently frozen subsoil, characterizes ________.

A) temperate broadleaf forest B) chaparral C) tundra D) coniferous forest Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 33) Most of the temperate grassland in North America has been converted to ________.

A) cities B) farmland C) national parks D) small neighborhoods Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6, 18.7 Global LO: 5 34) Water moves from land to the atmosphere through ________.

A) precipitation only B) transpiration only C) transpiration and evaporation D) evaporation and precipitation Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.6 35) With regard to the environment as a whole, when is the worst time to apply pesticide to your lawn?

A) when it is raining, or is about to rain B) when it is cold, or is about to get cold C) at the same time you apply fertilizer D) at night Answer: A Topic: 18.3 Biomes Skill: Application/Analysis Learning Outcome: 18.8 Global LO: 2, 5

10 .

36) What fraction of Earth's surface has been altered by human use?

A) 25% B) 50% C) 75% D) 95% Answer: C Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.9 Global LO: 4, 5 37) The greenhouse effect causes an increase in global temperatures. This increase is due primarily to ________.

A) CO2 and other greenhouse gases allowing more solar radiation to penetrate Earth's surface B) CO2 and other greenhouse gases slowing the escape of UV radiation from Earth C) the loss of ozone that trapped cooling UV radiation in the atmosphere D) CO2 and other greenhouse gases slowing the escape of heat from Earth Answer: D Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.10 Global LO: 5 38) Temperature increases due to global warming have been greatest ________.

A) close to the poles B) in the sea C) in the tropics D) in deserts Answer: A Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.10 Global LO: 5 39) An effect of deforestation has been to ________.

A) decrease the amount of carbon dioxide in the atmosphere B) increase the amount of carbon dioxide in the atmosphere C) increase the rate at which carbon dioxide is incorporated into organic material D) decrease the rate of carbon dioxide production through cellular respiration Answer: B Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.10 Global LO: 5

11 .

40) In the oceans, global warming has ________.

A) decreased the amount of oxygen available B) benefited corals C) made the water more basic D) made the water more acidic Answer: D Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.10 Global LO: 5 41) Which of the following is NOT a result of global warming?

A) changes in the breeding seasons of some species B) increased forest clearing for agricultural purposes C) melting permafrost D) shifts in the ranges of some species Answer: B Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.10 Global LO: 5 42) Malaria is an infectious disease transmitted to humans from a parasite that infects mosquitoes that feed on humans. World health officials have concerns that climate change may impact the transmission of malaria into tropical highland areas in Africa. If these concerns turn out to be valid, they would be evidence for which of the following?

A) Global climate change affects the distribution of species.

B) Global climate change will negatively impact the transmission of malaria only in Africa.

C) Global climate change affects freshwater and marine biomes.

D) Global climate change will enable scientists to more easily control the spread of malaria.

Answer: A Topic: 18 Process of Science, 18.4 Global Climate Change Skill: Synthesis/Evaluation Learning Outcome: 18.10 Global LO: 2, 5 43) Which of the following actions would increase your carbon footprint?

A) reusing or recycling items B) eating more vegetables and less meat C) eating more beef and less chicken D) walking instead of driving Answer: C Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.11 Global LO: 5 12 .

44) Which of the following is NOT a cause of increasing CO2 levels?

A) burning of fossil fuels B) home energy use C) production of manufactured goods D) creating compost piles from vegetable waste Answer: D Topic: 18.4 Global Climate Change Skill: Knowledge/Comprehension Learning Outcome: 18.11 Global LO: 5 45) Scientists have documented that spring seasons starting earlier due to climate change have resulted in some caterpillar species beginning their maturation stage earlier than normal. There are bird species that need the caterpillars to feed their chicks. However, since the caterpillars are maturing before the chicks hatch (and therefore cannot be used for chick food), the birds are experiencing a drop in their lifetime reproductive success. Interestingly, scientists have also documented that the individual birds that are best able to change when they lay their eggs to align with earlier spring seasons have the greatest lifetime reproductive success. These phenomena are examples of ________.

A) an evolutionary response to climate change B) an increase in global greenhouse gas emissions due to climate change C) a change in species distribution due to climate change D) the effects of terrestrial biome distribution due to climate change Answer: A Topic: 18 Evolution Connection, 18.4 Global Climate Change Skill: Application/Analysis Learning Outcome: 18.12 Global LO: 2

13 .

18.2 Art Questions 1) Examine the figure below. Which part of Earth receives the greatest intensity of solar radiation?

A) Tropic of Cancer and Tropic of Capricorn B) equator C) North and South Poles D) All parts of Earth receive the same intensity of solar radiation.

Answer: B Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.9 Global LO: 3

14 .

2) Examine the figure below. Phytoplankton live in the ________.

A) photic zone and aphotic zone B) aphotic zone C) benthic realm D) photic zone Answer: D Topic: 18.3 Biomes Skill: Knowledge/Comprehension Learning Outcome: 18.4 Global LO: 3 3) Examine the figure below. Globally, the largest amount of water moves from ________.

A) the oceans to the atmosphere by evaporation B) land to the atmosphere by evaporation and transpiration C) the atmosphere to land by precipitation D) land to the oceans by surface and groundwater runoff Answer: A Topic: 18.3 Biomes Skill: Application/Analysis Learning Outcome: 18.9 Global LO: 2, 3 15 .

18.3 Scenario Questions Please read the following scenario to answer the following questions.

Salmon eggs hatch in freshwater streams and, during their first year of life, the young salmon migrate distances up to 1,000 km in order to reach the ocean. Here they spend up to 5 years where they feed and grow, acquiring more than 95% of their biomass. During the summer of their maturing year, they begin the long journey back to their home streams to spawn. Although it is still uncertain how salmon navigate back to their spawning grounds, current hypotheses suggest that they have a highly developed sense of smell that allows them to remember odors they encountered on their migration to the ocean. They then use these odors to help them navigate back to the streams where they were born. At the spawning grounds, females use their tails to form a hollow cavity in the stream gravel where they lay up to 8,000 eggs. The males fertilize the eggs, and both adults typically die soon thereafter.

1) The physiological response that allows salmon to survive in fresh water, then in salt water, and then fresh water again is an example of ________.

A) a behavioral response B) evolution C) acclimation D) an anatomical response Answer: C Topic: 18.2 Living in Earth's Diverse Environments Skill: Application/Analysis Learning Outcome: 18.3 Global LO: 2 2) At different times in their lives, salmon can be found in all of the following EXCEPT ________.

A) a freshwater biome B) a chaparral C) the pelagic realm D) an estuary Answer: B Topic: 18.3 Biomes Skill: Application/Analysis Learning Outcome: 18.4 Global LO: 2

16 .

Please read the following scenario to answer the following questions.

CO2 is not the only greenhouse gas that impacts global climate change. Other greenhouse gases (GHGs) may be equally or more effective than CO2 at trapping heat on Earth. Climate scientists determine how much a GHG may impact global warming based on two factors: the efficiency with which a GHG absorbs energy (i.e. traps heat on Earth) and the length of time (in years) that the gas remains in the atmosphere. A unit of measurement called the Global Warming Potential (GWP) is used to describe how much energy a GHG absorbs over a specific period of time (100 years is a standard time frame). All GWP values of GHGs are compared to the GWP of CO2, which is given a value of 1.

3) In this scenario, how would you best describe CO2?

A) It is a baseline comparison for the GWP values of all other GHGs. B) It is a GHG whose GWP value is dependent upon the GWP values of all other GHGs. C) It is the GHG that is the most efficient at trapping heat on Earth.

D) It is the GHG that is the least efficient at trapping heat on Earth.

Answer: A Topic: 18.4 Global Climate Change Skill: Synthesis/Evaluation Learning Outcome: 18.10 Global LO: 2, 4, 5 4) has a GWP over 20 times higher than CO2. However, CH4 emitted today lasts for only about a decade in the atmosphere, while the GWP of CO2 can last for thousands of years. What is a possible reason that CH4 can have such a high GWP as compared to CO2?

A) The 100-year time frame is too short of a time frame to compare CH4 and CO2.

B) CH4 absorbs more energy than CO2.

C) CH4 is less efficient at trapping heat on Earth.

D) CH4 is not a proven greenhouse gas.

Answer: B Topic: 18.4 Global Climate Change Skill: Synthesis/Evaluation Learning Outcome: 18.10 Global LO: 2, 4, 5

17 .

5) Chlorofluorocarbons (CFCs) are greenhouse gases that, for a specific amount of mass, trap significantly more heat than CO2. How can you classify CFCs? A) gases with lower GWP values than CO2 B) gas with equal GWP values to CO2 C) gases with greater GWP values than CO2 D) gases that do not have GWP values Answer: C Topic: 18.4 Global Climate Change Skill: Synthesis/Evaluation Learning Outcome: 18.10 Global LO: 2, 4, 5

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 19 Population Ecology Chapter 19 Learning Outcomes 19 Biology and Society: Invasion of the Lionfish 19.1 Explain why people should not introduce pets into the wild, using the introduced lionfish in the Atlantic region as an example.

19.1 An Overview of Population Ecology 19.2 Relate a population to population ecology and population density.

19.3 Compare Type I, Type II, and Type III survivorship curves.

19.4 Compare the characteristics of species that show opportunistic or equilibrial life histories.

19.2 Population Growth Models 19.5 Compare the exponential growth model to the logistic growth model and the effects of density-dependent and density-independent factors on various population cycles.

19.3 Applications of Population Ecology 19.6 Compare the benefits and risks of population ecology strategies used to help reach human resource management goals including species protection, maximizing harvests, and control of biological pests.

19.7 Describe the goals of integrated pest management and its advantages over the widespread use of pesticides.

19.4 Human Population Growth 19.8 Describe the growth of the human population over the last 2,000 years.

19.9 Explain how age structure diagrams can help to predict changes in a population and in social conditions.

19.10 Compare ecological footprints for an individual versus nations and for countries versus the world’s average footprint and Earth’s biocapacity.

19 Evolution Connection: Humans as an Invasive Species 19.11 Explain how and why the North American population of mammals has changed in the last 10,000 years.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

19.1 Multiple Choice Questions 1) Chinese privet is a plant that is native to China. Over 150 years ago, Chinese privet was introduced to the United States as a fast-growing shrub that serves as an excellent privacy hedge.

With no natural predators, Chinese privet quickly established itself and spread in natural areas throughout the southeast and eastern seaboard of the United States. Its dominance in these areas has jeopardized the survival of native plant species. Chinese privet provides evidence that ________.

A) introducing non-native organisms can cause environmental damage B) American gardeners can easily control the spread of Chinese privet C) integrated pest management strategies will not decrease Chinese privet populations D) non-native plant species have Type I survivorship curves Answer: A Topic: 19 Biology and Society Skill: Application/Analysis Learning Outcome: 19.1 Global LO: 2, 5 2) What is a population?

A) a group of organisms that occupy the same general area at different times B) a group of individuals of a single species that occupy the same general area at the same time C) the growth rate of individuals of a single species that occupy the same general area at the same time D) the growth rate of individuals of a single species that occupy the same general area at different times Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.2 3) Which of these is a characteristic of Type I survivorship?

A) There is low survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is high for the few individuals that survive to a certain age.

Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Application/Analysis Learning Outcome: 19.3 Global LO: 2

2 .

4) Type I survivorship curves are typical of species that exhibit ________.

A) an intermediate number of offspring and an intermediate level of parental care B) few offspring and good parental care C) many offspring and good parental care D) many offspring and poor parental care Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.3 5) Which of these best describes Type II survivorship?

A) There is high survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is high for the few individuals that survive to a certain age.

Answer: C Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.3 6) Which of these best describes Type III survivorship?

A) There is high survivorship for the very young.

B) Most individuals survive to older age intervals.

C) Survivorship is constant over the lifespan.

D) Survivorship is high for the few individuals that survive to a certain age.

Answer: D Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.3 7) Opportunistic species typically ________.

A) are very long-living B) have a large number of offspring C) reach sexual maturity slowly D) exhibit a Type I survivorship curve Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.4

3 .

8) Species that exhibit an equilibrial life history typically ________.

A) have long lives B) exhibit a Type III survivorship curve C) exhibit a Type II survivorship curve D) have a large number of offspring Answer: A Topic: 19.1 An Overview of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.4 9) If there are 500 oak trees in a forest covering 50 square kilometers, then the population density is ________.

A) 5 trees per square kilometer B) 10 trees per square kilometer C) 50 trees per square kilometer D) 100 trees per square kilometer Answer: B Topic: 19.1 An Overview of Population Ecology Skill: Application/Analysis Learning Outcome: 19.2 Global LO: 2, 4 10) In an ideal, unlimited environment, a population's growth follows a(n) ________ model.

A) exponential B) density-dependent C) logistic D) boom-and-bust Answer: A Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 11) In an ideal, unlimited environment, what shape does a population's growth curve most closely resemble?

A) S B) J C) ∧ D) ∪ Answer: B Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 Global LO: 3

4 .

12) If a population's growth rate decreases as the population size approaches carrying capacity, the population's growth follows a(n) ________ model.

A) exponential B) boom-and-bust C) logistic D) density-independent Answer: C Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 13) In a population that is following a logistic growth pattern, what shape does the population's growth curve most closely resemble?

A) S B) J C) ∧ D) ∪ Answer: A Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 Global LO: 3 14) ________ is the maximum population size that a particular habitat can support.

A) Population cycle B) Carrying capacity C) Life history pattern D) Survivorship curve Answer: B Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 15) According to the logistic growth model, what happens to a population when the size of the population reaches carrying capacity?

A) The growth rate increases.

B) The growth rate decreases.

C) The growth rate cannot be determined.

D) The growth rate is zero.

Answer: D Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5

5 .

16) Competition among individuals of the same species is ________ competition.

A) density-independent B) intraspecific C) Type II D) Type III Answer: B Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 17) Which of these factors operates on populations in a density-dependent manner?

A) blizzard B) volcanic eruption C) food supply D) flood Answer: C Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 18) Over time, the populations of most species ________.

A) fluctuate B) increase rapidly, crash, and never recover C) continuously increase D) exhibit boom-and-bust cycles Answer: A Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 19) An unexpected freeze that kills a population of chipmunks is an example of ________.

A) a density-independent factor B) a biological control C) a density-dependent factor D) a population momentum Answer: A Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2

6 .

20) The Endangered Species Act aims to help protect species that ________.

A) are in danger of extinction B) dominate suitable habitats C) compete with invasive species D) are economically valuable Answer: A Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 Global LO: 5 21) The red-cockaded woodpecker, an endangered species, is dependent upon ________ for maintenance of its source habitat.

A) thick vegetation at least 15 feet in height B) fire C) floods D) corn snakes Answer: B Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 22) You arrive back in the United States after having visited a foreign country located on another continent. The customs agent stops the person in front of you and confiscates the fruit basket this person is bringing home. Being the knowledgeable person you are, you calmly explain to your enraged fellow traveler that the reason for the detainment is that the fruit basket may be ________.

A) carrying endangered fruit B) carrying a non-native species that could damage North American ecosystems C) contaminated with CFCs that will damage the ozone layer above North America D) contaminated with sufficient DDT to cause serious harm to anyone who eats the fruit Answer: B Topic: 19.3 Applications of Population Ecology Skill: Application/Analysis Learning Outcome: 19.6 Global LO: 2, 5 23) Non-native species can have important effects on biological communities by ________.

A) preying upon native species only B) competing with native species for resources only C) reducing biodiversity only D) All of these are effects that non-native species can have on biological communities.

Answer: D Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 Global LO: 5 7 .

24) Examples of invasive species include ________.

A) kudzu and red-cockaded woodpeckers B) cod and Chilean sea bass C) snowshoe hares and kudzu D) cheatgrass and Burmese pythons Answer: D Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 Global LO: 5 25) The intentional release of a natural enemy to attack a pest population is called ________.

A) biological control B) coevolution C) sustainable resource management D) integrated pest management Answer: A Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 Global LO: 5 26) The use of the Indian mongoose to control rat populations ________.

A) shows the effectiveness of biological control B) shows why integrated pest management usually fails C) became a disaster when the mongoose turned out to be as invasive as its target D) is an example of how coevolution makes biological control difficult Answer: C Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.6 Global LO: 5

8 .

27) Kudzu, an Asian vine introduced to the United States in the 1930s as a means to control erosion, is referred to as "the plant that ate the South" because it grows so fast and overtakes most plant species in its path. A recent and unusual way that some people are using to control kudzu growth is to allow goats to graze their land and eat the kudzu, roots and all. This is considered by some to be the most environment-friendly way to eliminate this invasive vine.

How can we best describe the goats in this situation?

A) a threatened species B) an invasive species C) a biological control agent D) an integrated pest management agent Answer: C Topic: 19.3 Applications of Population Ecology Skill: Application/Analysis Learning Outcome: 19.6 Global LO: 5 28) Most crop pests ________.

A) have an opportunistic life history B) have an equilibrial life history C) exhibit type I survivorship D) consist of long-lived individuals Answer: A Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.7 29) Integrated pest management ________.

A) favors overwhelming a pest with chemical pesticides B) advocates total eradication of pest species C) aims to keep pest populations on an exponential growth curve D) advocates mixed-species plantings and rotating crops Answer: D Topic: 19.3 Applications of Population Ecology Skill: Knowledge/Comprehension Learning Outcome: 19.7 Global LO: 5 30) Throughout most of human history, human population size ________.

A) was at carrying capacity B) grew very slowly C) showed boom-and-bust cycles D) skyrocketed Answer: B Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.8 Global LO: 5 9 .

31) In most developed countries, overall population growth rates ________.

A) are high, so the population size is growing rapidly B) are high, so the population size is fairly stable C) are near zero, so the population size is fairly stable D) are low, so the population size is declining Answer: C Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.8 Global LO: 5 32) In most developing countries, ________.

A) birth rates equal death rates, so the population is fairly stable B) birth rates are lower than death rates, so the population is declining C) birth rates are lower than death rates, so the population is growing rapidly D) birth rates are much higher than death rates, so the population is growing rapidly Answer: D Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.8 Global LO: 5 33) What will be the approximate shape of the age-structure diagram of a rapidly increasing population?

A) a rectangle B) a pyramid C) an inverted pyramid D) an hourglass Answer: B Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.9 Global LO: 3 34) A study of the human ecological footprint conducted by the World Wildlife Fund in 2008 shows that ________.

A) we have already exceeded the planet's biocapacity per person B) we are far below the planet's biocapacity per person C) Earth can sustain a population about double the current population D) the human population will soon crash Answer: A Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.10 Global LO: 5

10 .

35) The ecological footprint of the United States ________.

A) is about the same as the global average B) is lower than the global average C) shows that Americans consume a disproportionate amount of food and fuel D) shows that its population size is increasing slowly Answer: C Topic: 19.4 Human Population Growth Skill: Knowledge/Comprehension Learning Outcome: 19.10 Global LO: 5 36) During the Pleistocene era, many large mammal species went extinct. Their permanent disappearance occurred in a short period of time when humans were expanding across North America. In this situation, how do many scientists view humans?

A) as a threatened species B) as a density-independent factor C) as an invasive species D) as a biological control agent Answer: C Topic: 19.4 Human Population Growth, 19 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 19.11 Global LO: 5

11 .

19.2 Art Questions 1) The figure below shows population cycles of snowshoe hare and lynx. Recent field studies suggest that the most likely explanation for these cycles is ________.

A) periodic winter storms B) excessive predation of snowshoe hares C) nearly unlimited food for hares during the summers D) boom-and-bust cycles in lemming populations Answer: B Topic: 19.2 Population Growth Models Skill: Knowledge/Comprehension Learning Outcome: 19.5 Global LO: 3

12 .

2) When did male fur seals reach carrying capacity?

A) 1915 B) 1930 C) 1940 D) 1950 Answer: C Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2, 3

13 .

This graph represents three different populations. Use it to answer the following questions.

3) Which population is growing at the fastest rate?

A) Population A B) Population B C) Population C D) They are all growing at the same rate.

Answer: A Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2, 3, 4 4) If all populations occupy different areas that are approximately the same size, which population will have the lowest density after 3 years?

A) Population A B) Population B C) Population C D) After 3 years, all three populations will have the same density.

Answer: B Topic: 19.2 Population Growth Models Skill: Synthesis/Evaluation Learning Outcome: 19.5 Global LO: 2, 3

14 .

5) Which of the following choices matches this figure?

A) Dolphins produce only single offspring at a time and provide parental care for many months.

B) During "mating frenzies," male and female squid aggregate and release hundreds of eggs and sperm into the water column. The fertilized eggs are often quickly preyed on by fish.

C) The century plant grows for many years and reproduces and releases hundreds of seeds just once before it withers and dies. Because of the dry desert environment in which it lives, many of the seeds do not survive or are eaten.

D) In some species of lizards and rodents, survivorship is constant over the life span.

Answer: A Topic: 19.1 An Overview of Population Ecology Skill: Synthesis/Evaluation Learning Outcome: 19.2 Global LO: 2, 3

15 .

19.3 Scenario Questions Please read the following scenario to answer the following questions.

Michigan's Isle Royale is an island located in Lake Superior that is 45 miles long and 9 miles wide. Ecologists estimate that the moose population on the island has been there since around 1900. The wolf population on the island, on the other hand, has been there only since the winter of 1949. Weather conditions had to be calm and cold enough for the lake to freeze and the first wolves to make the passage over to the island. When the wolves arrived, they were greeted with a large moose population that had no predators. The moose population was at a dangerously high level, but was kept in check by the arrival of the wolves. This "harmonious" pattern continued for at least 20 years.

In 1982, the wolf population suddenly crashed. The problem was a new canine virus. This virus surfaced around the world in 1978 and spread rapidly in about 6 months. Infected animals can survive, but they have to be treated immediately. Ecologists hypothesized that the virus arrived on the island carried on the shoe of a human traveler. The wolf population decreased from 50 to 14 individuals in a year. While the wolf population dropped, the moose population increased.

However, the winter of 1996 was extremely harsh and the moose population experienced a major crash. More than 500 animals died during the winter months, reducing the population to less than 800 animals.

1) What most likely happened when the wolves first arrived on the island?

A) The wolf population increased exponentially.

B) The wolf population was at its carrying capacity.

C) The moose population crashed because of the introduction of a predator.

D) The moose population increased exponentially.

Answer: A Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2 2) The virus introduced to the island in 1982 that reduced the wolf population is an example of ________.

A) a density-independent factor B) a density-dependent factor C) biological control D) intraspecific competition Answer: B Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2

16 .

3) The harsh winter that led to the death of many moose in 1996 is an example of ________.

A) a density-dependent factor B) biological control C) a density-independent factor D) a trigger for logistic growth Answer: C Topic: 19.2 Population Growth Models Skill: Application/Analysis Learning Outcome: 19.5 Global LO: 2 4) During a 1-year study, a graduate student attempted to count the wolves and moose on the island. He estimated that there were 950 moose and 120 wolves. How many organisms, populations, and species were included in this study?

A) organisms = 2; populations = 1; species = 2 B) organisms = 1,070; populations = 1; species = 2 C) organisms = 2; populations = 2; species = 1,070 D) organisms = 1,070; populations = 2; species = 2 Answer: D Topic: 19.1 An Overview of Population Ecology Skill: Application/Analysis Learning Outcome: 19.2 Global LO: 2, 4 Please read the following scenario to answer the following questions.

In May 2014, the European Union (EU) published a report of population structure and aging data that described growing trends of low birth rates and longer life expectancies in the EU. In their report, the EU described that, due to these trends, some EU member states are beginning to demonstrate a population structure with many much-older individuals.

5) If this trend continues, what do you predict that the populations will look like decades from 2014?

A) There will be more older individuals than working-age individuals.

B) There will be more children than older individuals.

C) There will be more older individuals than children.

D) There will be more working-age individuals than older ones.

Answer: A Topic: 19.3 Applications of Population Ecology, 19.4 Human Population Growth, 19 Process of Science Skill: Synthesis/Evaluation Learning Outcome: 19.9 Global LO: 2, 5

17 .

6) Why might this changing population structure be a concern for EU leaders?

A) Eventually greater resources will be needed to support a much larger and older generation, and this burden will fall on an increasingly smaller workforce.

B) Eventually the EU population will exhibit a Type III survivorship curve.

C) Eventually intraspecific competition for resources amongst the older members of the population will lead to a decrease in food and water availability.

D) Eventually individuals of reproductive age will face a boom-and-bust population cycle.

Answer: A Topic: 19.4 Human Population Growth Skill: Synthesis/Evaluation Learning Outcome: 19.10 Global LO: 2, 4, 5, 7

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 20 Communities and Ecosystems Chapter 20 Learning Outcomes 20 Biology and Society: Why Biodiversity Matters 20.1. Define biodiversity and explain why it matters. Describe the important economic roles of natural or near-natural ecosystems.

20.1 The Loss of Biodiversity 20.2. Describe the three levels of biological diversity, and describe the four main factors responsible for the loss of biodiversity.

20.2 Community Ecology 20.3. Define and give an example of a community, an ecological niche, and the competitive exclusion principle.

20.4. Define the types of helpful (+/+) and harmful (+/-) (-/-) interspecific interactions; describe examples of each; and describe the adaptations derived from these relationships.

20.5. Define and list examples roles of organisms in a food chain or a food web, explaining how their position influences biological magnification.

20.6. Describe the components of species diversity, and how the interactions between species can maintain species diversity.

20.7. Describe the types and effects of disturbances in communities, and define and distinguish between the processes of primary and secondary succession that follow a disturbance.

20.3 Ecosystem Ecology 20.8. Compare the processes of energy flow and chemical cycling as they relate to ecosystem dynamics, and explain how the input of energy is related to the structure and function of the pyramid of production.

20.9. Describe the biogeochemical cycles; distinguish between the biotic and abiotic components of them; and describe how humans have altered them.

20.4 Conservation and Restoration Biology 20.10. Define conservation biology and restoration ecology, and describe the approaches that they use to accomplish their goals.

20.11. Define landscape ecology, and explain how landscapes influence biodiversity.

20 Evolution Connection: Can Biophilia Save Biodiversity?

20.12 Describe the concept and significance of biophilia.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

20.1 Multiple Choice Questions 1) The present rate of species loss ________.

A) suggests that about 25% of all plant and animal species may be extinct by the end of the century B) is about the same as it has been during the last 100,000 years C) is as much as 100 times higher than at any time in the last 100,000 years D) is slower than in recent years because of conservation efforts Answer: C Topic: 20.1 The Loss of Biodiversity Skill: Knowledge/Comprehension Learning Outcome: 20.2 Global LO: 5 2) The single greatest threat to biodiversity comes from ________.

A) habitat destruction and fragmentation B) invasive species C) overexploitation D) pollution Answer: A Topic: 20.1 The Loss of Biodiversity Skill: Knowledge/Comprehension Learning Outcome: 20.2 Global LO: 5 3) Several years ago, I was crossing the border from Canada to the United States and I had a bag of Washington State apples with me. The customs officer at the border would not let me take the apples with me into the United States (and I really hated the idea of getting rid of a bag of perfectly good apples). Why did the customs officer refuse to allow me to cross the border with my apples?

A) Washington State apples are considered an endangered fruit.

B) Apples grown in the United States for export may be contaminated with DDT. C) There may have been a species that was not native to the United States hitching a ride on my apples.

D) Economics: If I couldn't bring the apples in with me, I would have to buy my apples from a store in the United States.

Answer: C Topic: 20.1 The Loss of Biodiversity Skill: Application/Analysis Learning Outcome: 20.2 Global LO: 2, 5

2 .

4) An example of a mutualism, or +/+ relationship, is ________.

A) the relationship between corals and unicellular algae B) cryptic coloration in frogs C) herbivory D) the relationship between Virginia's warblers and orange-crowned warblers, which use some of the same resources Answer: A Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.4 Global LO: 2 5) Populations of two coexisting species are both tertiary consumers in a community. What relationship may exist between these two organisms?

A) predation B) mutualism C) competition D) succession Answer: C Topic: 20.2 Community Ecology Skill: Synthesis/Evaluation Learning Outcome: 20.3, 20.4, 20.5 Global LO: 2 6) As a result of a severe disturbance, a community will ________.

A) not be repopulated B) be replaced by organisms in random order C) not change D) undergo succession Answer: D Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.7 7) Organisms that consume producers are ________.

A) detritivores B) decomposers C) primary consumers D) producers Answer: C Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.5

3 .

8) In the food chain grass → antelope → human → lion, the antelope is ________.

A) both an herbivore and a secondary consumer B) both a producer and a primary consumer C) both an herbivore and a primary consumer D) a secondary consumer only Answer: C Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.5 Global LO: 2 9) In the food chain grass → antelope → human → lion, the human is a ________.

A) tertiary consumer B) secondary consumer C) primary consumer D) producer Answer: B Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.5 Global LO: 2 10) Small fishes that eat zooplankton are ________.

A) primary consumers B) producers C) tertiary consumers D) secondary consumers Answer: D Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.5 11) Which of these convert organic matter to inorganic matter by breaking down dead organisms?

A) producers B) detritivores C) decomposers D) primary consumers Answer: C Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.5

4 .

12) Most decomposers are ________.

A) plants and fungi B) bacteria and plants C) fungi and prokaryotes D) animals Answer: C Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.5 13) Bears eat berries, humans, and large fish; large fish eat smaller fish and insects; humans eat bears, large fish, and berries; Venus flytraps eat insects. The scenario described here is an example of ________.

A) an ecosystem B) parasitism C) a food web D) a food chain Answer: C Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.5 Global LO: 2 14) Herbivory is an example of a ________ interaction.

A) +/+ B) -/C) 0/+ D) +/Answer: D Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.4 15) In order to assess the species diversity of a community, you would need to know the number of different species present as well as ________.

A) the number of trophic levels in the community B) the intensity of interspecific competition in the community C) the fraction of these species that are plants D) the relative abundance of the different species Answer: D Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.6

5 .

16) In Yellowstone National Park, wolves were hunted to extinction in the 1920s. A current restoration project has reintroduced wolves to Yellowstone National Park. Predict the response of the Yellowstone ecological community if wolves are a keystone species.

A) Species richness should decrease.

B) The relative abundances of each species should become more unequal.

C) Species diversity should decrease.

D) Species richness should increase, and the relative abundances of each species should be about equal.

Answer: D Topic: 20.2 Community Ecology Skill: Synthesis/Evaluation Learning Outcome: 20.6, 20.10 Global LO: 2 17) Two lakes have the same number of species. Most of the fish in Lake 1 are of a single species, with a few individuals each for the remaining species. Lake 2, on the other hand, has about equal numbers of each species. Which lake has higher species diversity?

A) Lake 1 B) Lake 2 C) They are equally diverse.

D) The number and relative abundance of species are not related to diversity.

Answer: B Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.6 Global LO: 2 18) What is one way in which energy flow differs from chemical cycling?

A) Energy flow is unidirectional; chemical elements can be recycled.

B) Energy can enter but cannot leave an ecosystem; chemical elements can leave but cannot enter an ecosystem.

C) Energy flows from lower to higher trophic levels; chemicals cycle from higher to lower trophic levels.

D) Energy can both enter and leave an ecosystem; chemical elements always remain within a single ecosystem.

Answer: A Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8

6 .

19) Approximately what percentage of the visible light that reaches Earth's producers is converted to chemical energy?

A) 10% B) 0.1% C) 1% D) 0.01% Answer: C Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8 20) Biomass is the total amount of ________ an ecosystem.

A) organic matter tied up in the consumers of B) organic matter tied up in the producers of C) chemical elements recycled by the detritivores of D) living organic material in Answer: D Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8 21) The rate at which an ecosystem's producers convert solar energy to chemical energy stored in biomass is called ________.

A) energy flow B) chemical cycle C) primary productivity D) trophic structure Answer: C Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8 22) On average, what percentage of the energy in one trophic level becomes incorporated into the next higher trophic level?

A) 10% B) 30% C) 50% D) 90% Answer: A Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8

7 .

23) Which type of ecosystem has low primary production but nonetheless contributes a large proportion of Earth's total net primary production?

A) tropical rain forest B) coral reef C) open ocean D) desert Answer: C Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8 24) Why are most food chains limited to three to five trophic levels?

A) The higher the trophic level, the larger the organism; the larger the organism, the less likely it will be prey.

B) The nutritional quality of existing biomass decreases with increasing trophic level.

C) Most ecosystems have insufficient space to support the increased number of organisms that more trophic levels would require.

D) There is insufficient energy to support more trophic levels.

Answer: D Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.8 25) Besides the atmosphere, abiotic reservoirs of carbon dioxide include ________.

A) fossil fuels and dissolved carbon compounds in the oceans B) rocks and dissolved carbon compounds in the oceans C) fossil fuels only D) rocks only Answer: A Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9 26) The atmosphere is approximately 80% ________ gas.

A) CO2 B) H2O C) CH4 D) N2 Answer: D Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9

8 .

27) Plants can most readily utilize the ________ form of nitrogen.

A) nitrous oxide B) N2 C) amino D) nitrate Answer: D Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9 28) Which of these organisms convert atmospheric nitrogen gas to a form that can be utilized by plants?

A) bacteria B) protists C) animals D) fungi Answer: A Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9 29) ________ convert nitrogen from nitrates to N2.

A) Nitrifying bacteria B) Nitrogen-fixing bacteria living in the soil C) Denitrifying bacteria D) Nitrogen-fixing bacteria living in the root nodules of legumes Answer: C Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9 30) The major abiotic reservoir for phosphorus is ________.

A) the oceans B) the atmosphere C) rock D) dead organic matter Answer: C Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9

9 .

31) With regard to nutrient pollution in aquatic ecosystems, when is the worst time to apply fertilizer to your lawn?

A) when it is raining, or is about to rain B) when it is cold, or is about to get cold C) at the same time you apply pesticides D) at night Answer: A Topic: 20.3 Ecosystem Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.9 Global LO: 5 32) The primary goal of conservation biology is to ________.

A) catalog species B) maximize the land set aside for wildlife C) integrate human culture back into nature D) counter the loss of biodiversity Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.10 Global LO: 5 33) Modern conservation science increasingly aims at ________.

A) protecting federally listed endangered species B) countering pollution C) sustaining entire ecosystems D) maintaining genetic diversity within species Answer: C Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.10 Global LO: 5 34) Species found in only one place on Earth are called ________ species.

A) hot spot B) exotic C) keystone D) endemic Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.10

10 .

35) Small areas that have a large number of endangered and threatened species are referred to as ________.

A) biologically magnified B) endemic environments C) biodiverse environments D) biodiversity hot spots Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.10 Global LO: 5 36) A regional assemblage of interacting ecosystems is a ________.

A) community B) landscape C) movement corridor D) hot spot Answer: B Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.11 Global LO: 5 37) Landscape ecology ________.

A) is the application of ecological principles to the study of land-use patterns B) focuses primarily on how to restore human-altered ecological systems C) deals primarily with ecosystems in urban settings D) deals with the study of the ranges of different species Answer: A Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.11 Global LO: 5 38) A movement corridor ________.

A) is a path used by migratory animals when they move to their winter habitats B) is the path most commonly used by an animal within its home range C) connects otherwise isolated patches of quality habitat for a species D) is a natural component of the environment Answer: C Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.11

11 .

39) Movement corridors are ________.

A) always created by humans B) found only along stream sides C) not harmful, but are beneficial because they allow for dispersal D) harmful because they allow for the spread of disease and beneficial because they allow for dispersal Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.11 40) Sustainable development ________.

I) will require making difficult decisions regarding the environment and lifestyle II) must be achieved if the human species is to survive III) will require global, multinational cooperation A) I only B) II only C) III only D) I, II, and III Answer: D Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.10 Global LO: 5 41) E. O. Wilson coined the term ________ for our innate appreciation of wild environments and living organisms.

A) bioremediation B) bioethics C) biophilia D) biophobia Answer: C Topic: 20.4 Conservation and Restoration Biology Skill: Knowledge/Comprehension Learning Outcome: 20.12 Global LO: 5

12 .

42) One problem with eradicating invasive species is that sometimes the disturbed area is unable to be colonized by native species. For example, in forests where the invasive plant garlic mustard has been removed, native plants and animals do not recolonize because they are extinct in that patch of forest. How should restoration ecologists increase species diversity and recover ecosystem function?

A) Introduce tertiary consumers.

B) Develop movement corridors for primary producers.

C) Develop movement corridors for species with similar niches.

D) Eliminate keystone species.

Answer: B Topic: 20.2 Community Ecology, 20.4 Conservation and Restoration Biology Skill: Synthesis/Evaluation Learning Outcome: 20.3, 20.5, 20.6, 20.11 Global LO: 2, 5 43) What is the estimated annual value of ecosystem services?

A) $1 billion B) $33 trillion C) $33 billion D) $1 trillion Answer: B Topic: 20 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 20.1 Global LO: 5

13 .

20.2 Art Questions Please refer to the following art to answer the following questions.

1) Refer to the accompanying figure. All of the living components of the coral reef represent a(n) ________.

A) population B) species C) community D) ecosystem Answer: C Topic: 20.2 Community Ecology Skill: Knowledge/Comprehension Learning Outcome: 20.3

14 .

2) In the ecosystem shown above, a toxin that accumulates in body tissues would have the largest effect on ________.

A) corals that obtain their food from photosynthesizing dinoflagellates B) herbivorous shrimp C) fish that eat shrimp and other invertebrates D) The toxin would affect all of these equally.

Answer: C Topic: 20.2 Community Ecology Skill: Synthesis/Evaluation Learning Outcome: 20.5 Global LO: 2, 4 3) The figure below shows the growth curves of two populations of Paramecium, P. aurelia and P. caudatum. From the data, we can conclude that ________.

A) the ecological niches of the two species are very different B) P. aurelia is a predator of P. caudatum C) P. aurelia and P. caudatum have a mutualistic relationship D) P. aurelia is the superior competitor in this habitat Answer: D Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.3 Global LO: 2, 3

15 .

4) Refer to the following figure. If there were an additional trophic level that consisted of organisms that prey on snakes, about how much energy would be available to organisms at that trophic level?

A) 100 kcal B) 90% C) 1 kcal D) 10 kcal Answer: C Topic: 20.3 Ecosystem Ecology Skill: Application/Analysis Learning Outcome: 20.8 Global LO: 2, 3, 4

16 .

20.3 Scenario Questions Use the following information to answer the following questions.

Malaria is an infectious disease caused by a unicellular eukaryotic organism belonging to the genus Plasmodium. These eukaryotic organisms are transmitted from one person to another by the female Anopheles mosquito when it feeds on human blood. Within humans, the Plasmodium species destroy red blood cells and, without effective treatment, serious infections can lead to death. Currently, more than 400 million people are afflicted with malaria and between 1 and 3 million people die from it each year. Historically, a chemical compound called quinine has been used in developing effective drugs against malaria. In its natural environment, quinine is produced by certain trees native to South America. This chemical is synthesized in the outer layer of tree trunks and acts as an herbivore deterrent.

1) Based on the relationship between Plasmodium spp. and humans, Plasmodium would be considered ________.

A) parasites B) hosts C) producers D) carnivores Answer: A Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.4 Global LO: 2 2) Humans, mosquitoes, and Plasmodium together would be considered a(n) ________.

A) population B) community C) ecosystem D) population and community Answer: B Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.3 Global LO: 2

17 .

3) Despite being used for many years, quinine-based drugs have not led to the eradication of malaria and currently there are parasites that are resistant to the compound. Which of the following were likely important in the development of this resistance to quinine?

A) natural selection B) mutualism C) interspecific competition D) biological magnification Answer: A Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.4 Use the following information to answer the following questions.

In East Java, Indonesia, a mud volcano has been erupting since 2006. One controversial hypothesis is that the mud volcano in East Java is erupting because a gas mining company was drilling a deep hole nearby. When a mud volcano erupts, hot water deep below the earth's surface mixes with various minerals, and this mud spews out over the surface of the earth. The hot mud flow destroys organismal habitats, including the homes and livelihoods of people.

4) When the mud volcano stops erupting, the disturbed area will be colonized by a variety of species. This process of colonization is called ________.

A) biological magnification B) species diversity C) ecological succession D) disturbance Answer: C Topic: 20.2 Community Ecology Skill: Application/Analysis Learning Outcome: 20.7 Global LO: 2 5) When the mud volcano stops erupting, colonization of the disturbed area would be ________.

A) primary succession if there is no biomass inside the area B) primary succession if primary production relies on plants that survived the disturbance C) secondary succession if there are no biotic components of the carbon cycle D) secondary succession if there is no organic matter in the area Answer: A Topic: 20.2 Community Ecology, 20.3 Ecosystem Ecology Skill: Synthesis/Evaluation Learning Outcome: 20.7, 20.9 Global LO: 2

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 21 Unifying Concepts of Animal Structure and Function Chapter 21 Learning Outcomes 21 Biology and Society: An Avoidable Tragedy 21.1. Explain how a person keeps from overheating when exercising strenuously, and how these functions fail when heat exhaustion occurs.

21.1 The Structural Organization of Animals 21.2. Define and compare anatomy and physiology and explain why the two are usually studied together.

21.3. Define tissues, organs, and organ systems and describe the relationships among them.

21.4. Describe the four main categories of animal tissues, noting examples of each, and distinguishing between their structures and functions.

21.2 Exchanges with the External Environment 21.5. Explain why every organism is an open system, and how an animal’s size and shape affect how it exchanges energy and materials with its surrounding environment.

21.3 Regulating the Internal Environment 21.6. Define “homeostasis” and how it is regulated, and illustrate with examples of homeostasis and its regulation within the human body.

21.7. Define “thermoregulation” and describe adaptations in humans and other animals that aid in thermoregulation.

21.8. Define “osmoregulation” and describe adaptations for osmoregulation in different environments.

21 Evolution Connection: Adaptations for Thermoregulation 21.9. Define “thermoregulation” and describe adaptations in humans and other animals that aid in thermoregulation.

Global learning outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

21.1 Multiple Choice Questions 1) If a person is suffering from heat stroke, which organ system is failing?

A) skeletal system B) digestive system C) nervous system D) circulatory system Answer: C Topic: 21 Biology and Society, 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.1, 21.3, 21.7 Global LO: 2, 5 2) In animals, individual cells are grouped into ________.

A) organs B) tissues C) organisms D) organ systems Answer: B Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.3 3) A physiologist is a biologist who studies the ________.

A) structure of living things B) structure of body parts C) evolution of animals D) function of body parts Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.2 4) Bone is a type of ________.

A) connective tissue B) epithelial tissue C) extracellular matrix D) adipose tissue Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4

2 .

5) A main function of most types of epithelial tissue is ________.

A) sensation B) support C) covering surfaces D) absorption Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 6) Connective tissue is different from the other major tissue types in that ________.

A) it is made up of cells B) the cells are sparsely scattered through an extracellular matrix C) it is not made up of cells D) it is found only in humans Answer: B Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 7) Which one of the following types of tissue stores fat in the body?

A) cartilage B) bone C) adipose tissue D) fibrous connective tissue Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 8) What kind of connective tissue has a matrix that is strong and flexible?

A) bone B) adipose tissue C) loose connective tissue D) cartilage Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4

3 .

9) Which of the following is the most common type of connective tissue in the typical human body?

A) fibrous connective tissue B) adipose tissue C) loose connective tissue D) bone Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 10) Which is the most abundant kind of tissue in most animals?

A) connective B) epithelial C) blood D) muscle Answer: D Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 11) Which of the following is TRUE of a typical skeletal muscle?

A) It is found in the walls of organs such as the digestive tract.

B) Its fibers do not have a striped appearance under the microscope.

C) It can be enlarged by exercise.

D) It is only found in heart tissue.

Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 12) Which of the following generally makes skeletal muscle different from both smooth and cardiac muscle?

A) Skeletal muscles are made of cells called "fibers."

B) Skeletal muscle cannot be contracted voluntarily.

C) Skeletal muscle can be contracted voluntarily.

D) Skeletal muscle cells have nuclei.

Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4

4 .

13) Involuntary muscle includes ________.

A) skeletal muscle only B) smooth muscle only C) smooth muscle and cardiac muscle D) smooth muscle, cardiac muscle, and some skeletal muscle Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 14) Which type of tissue forms an electrical communication system within the body?

A) nervous B) blood C) connective D) muscle Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 15) The basic unit of nervous tissue is the ________.

A) dendrite B) axon C) neuron D) brain Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.4 16) Which of the following is NOT a true statement about organs?

A) An organ represents a higher level of structure than the tissues composing it.

B) An organ consists of several tissues.

C) An organ can carry out only the functions of its component tissues.

D) An organ consists of many cells.

Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.3

5 .

17) The fact that every organism continuously exchanges chemicals and energy with its surroundings indicates that organisms ________.

A) are open systems B) are closed systems C) have tightly controlled thermoregulation D) osmoregulate Answer: A Topic: 21.2 Exchanges with the External Environment Skill: Knowledge/Comprehension Learning Outcome: 21.5 18) Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides.

If this animal practices homeostasis with respect to the salt concentration of its body fluids, its salt concentration will show ________.

A) no fluctuations B) slight, continuous fluctuations C) a more concentrated state than the surrounding water at all times D a more diluted state than the surrounding water at all times Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.6, 21.8 19) Homeostasis ________.

A) is the maintenance of an unchanging internal state B) is a pathological condition C) is the maintenance of a relatively stable internal environment D) is the way the internal environment influences the external environment Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.6 20) The vertebrate kidney helps to keep the acidity of the body fluids constant by varying the amount of hydrogen ions (H+) it secretes into the urine. You can confidently predict that this aspect of kidney function, like other mechanisms of homeostasis, will be controlled by ________.

A) a negative feedback mechanism B) nerve impulses from the brain C) a hormone produced in the brain D) a hormone produced in the kidney itself Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.6 Global LO: 2 6 .

21) Which of the following is most likely to be responsible if, when your blood sugar level rose, the level went back down?

A) the use of the sugar for energy by your cells B) a homeostatic mechanism based on negative feedback C) type 2 diabetes D) a homeostatic mechanism based on positive feedback Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.6 22) Most homeostatic mechanisms depend on ________.

A) positive and negative feedback B) negative feedback C) predictable environmental conditions D) predictable internal conditions Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.6 23) Which of the following animals is an ectotherm?

A) human B) parrot C) spiny lobster D) field mouse Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.7 24) Which of the following animals is generating (producing) body heat to warm itself?

A) a beetle that absorbs solar radiation B) a moth that shivers its wings before flight C) a lizard that lies on a warm rock D) a turtle that moves to a warm, shallow part of a pond Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.7 Global LO: 2

7 .

25) When body temperature is too low, which of the following occurs?

A) Blood vessels in the skin constrict.

B) Muscles relax.

C) Sweat glands are activated.

D) Blood vessels at the body surface dilate and fill with blood.

Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.7 26) Which of the following is a physiological response that takes place in many animals when they get too hot?

A) slowing of the heart rate B) constriction of blood vessels in the skin C) contraction of muscles D) increased blood flow to the skin Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.7 27) Which of the following statements apply to freshwater fish?

A) They lose water by osmosis.

B) The concentration of solutes in their internal fluids is lower than in the surrounding water.

C) They pump out ions via the gills.

D) They produce dilute urine.

Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.8 Global LO: 2 28) Which of the following is a source of water loss in humans?

I) urination II) defecation III) breathing A) I B) II C) III D) I, II, and III Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8

8 .

29) Which of the following is a function of the kidneys?

I) elimination of urea II) reabsorption of valuable solutes III) reabsorbing water A) I B) II C) III D) all of the above Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8 30) Reabsorption is the movement of substances from the ________ to the ________.

A) blood... nephron B) filtrate... blood C) kidney... urinary bladder D) blood... filtrate Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8 31) Secretion is the movement of substances from the ________ to the ________.

A) nephron... blood B) filtrate... blood C) kidney... urinary bladder D) blood... filtrate Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8 32) Excretion is the movement of substances from the ________ to the ________.

A) filtrate... blood B) kidney... urinary bladder C) blood... filtrate D) kidneys... outside Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8

9 .

33) Which process describes the forcing of water and other small molecules from the blood into a kidney tubule?

A) absorption B) filtration C) secretion D) excretion Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8 34) A diuretic is a substance that ________.

A) promotes sweating B) regulates the contraction of cardiac muscle C) inhibits urinary water loss D) promotes urinary water loss Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Knowledge/Comprehension Learning Outcome: 21.8 35) In humans, goosebumps are a vestige of a mammalian adaptation related to ________.

A) thermoregulation B) water conservation C) osmoregulation D) positive feedback Answer: A Topic: 21.3 Regulating the Internal Environment, 21 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 21.9

10 .

21.2 Art Questions 1) One function of this organ system is ________.

A) thermoregulation B) excretion C) exchange of gases between the blood and air D) transport of substances throughout the body Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Knowledge/Comprehension Learning Outcome: 21.3 Global LO: 3

11 .

2) One function of this organ system is ________.

A) excretion of urea B) production of gametes C) protection of the body D) thermoregulation Answer: A Topic: 21.1 The Structural Organization of Animals Skill: Application/Analysis Learning Outcome: 21.3 Global LO: 2, 3

12 .

3) The figure below shows that ________.

A) homeostatic mechanisms allow cats to sense their external environments B) homeostatic mechanisms allow cats to use their internal conditions to affect their external environments C) cats experience no variations in their internal conditions D) homeostatic mechanisms allow cats to maintain relatively constant internal conditions even when the external environment changes Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.6 Global LO: 2, 3

13 .

4) Examine the figure above that shows negative feedback in a thermostat. If the room becomes too warm, the next thing that will occur is ________.

A) heating stops B) the set point decreases C) the room cools D) the heater is turned off Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.6 Global LO: 2, 3 5) Compare how temperature is regulated in a room with a thermostat with how thermoregulation works in the human body. What is most analogous to "Heating starts" (i.e., heat is produced) for the human body?

A) Blood vessels constrict near the surface.

B) The person puts on more clothes.

C) Metabolic rate increases.

D) Sweat is produced.

Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Synthesis/Evaluation Learning Outcome: 21.7 Global LO: 2, 3 14 .

21.3 Scenario Questions Use the following information to answer the following questions.

The dune-burrowing spider Seothyra species lives in the Namib Desert on the southwestern coast of Africa. These spiders build silk-lined burrows with a sticky silk mat at the entrance to trap insect prey. While foraging during the day, the spider remains concealed in its burrow and shielded from direct sunlight when prey are not present. When insect prey become entangled in the sticky silk mat, the spider will run out of its burrow and capture the prey insects.

During the day, environmental temperatures vary from 17 to 73°C (63-164°F). If a spider is forced to remain outside of its burrow, it shows signs of thermal stress at 49°C. When spiders are unrestrained, they spend more time waiting inside their burrows to keep their internal temperatures below 49°C, even when surface temperatures are above 65°C. In addition, spiders respond more quickly to prey stimuli during the hottest times of the day and capture prey in significantly less time when surface temperatures are above 49°C. The captured arthropods (prey) tend to succumb more quickly to hot surface temperatures; they are more lethargic and struggle less when captured at the high temperature ranges.

1) Based on the information in the paragraphs, spiders are ________.

A) ectotherms B) endotherms C) sometimes ectotherms and sometimes endotherms D) neither ectotherms nor endotherms Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.7 Global LO: 2 2) When foraging spiders are too hot, they retreat into their burrows. What type of feedback system does this indicate?

A) hormonal feedback B) positive feedback C) negative feedback D) positive and negative feedback Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.7 Global LO: 2

15 .

3) When spiders show signs of thermal stress, this is an indication that they are unable to ________.

A) move B) function C) osmoregulate D) thermoregulate Answer: D Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.7 Global LO: 2 To study the effect of ambient (environmental) temperature on the metabolic rate of animals, a scientist takes a small animal and puts it in a sealed chamber with oxygen. The scientist measures the amount of oxygen used by the animal at different temperatures. The temperatures selected are those that the animal normally encounters in nature. The data from this experiment are in the table below.

Day 1 2 3 4 5 6 7 8

Temperature (°C) 10 15 20 25 30 35 40 45

Oxygen consumption [mL O2/(min × g0.75)] 43 30 22 16 16 16 25 32

4) The thermoregulatory strategy of the animal studied by the scientist is most likely to be ________.

A) an ectotherm B) an endotherm C) one that cannot thermoregulate D) one that primarily uses behavior to regulate temperature Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Synthesis/Evaluation Learning Outcome: 21.7 Global LO: 2, 3, 4, 7

16 .

5) To communicate the results of the experiment best, how should the scientist graph the data?

A) Use a bar graph with oxygen consumption on the x-axis and temperature on the y-axis.

B) Use a line graph with day on the x-axis and temperature on the y-axis.

C) Use a line graph with temperature on the x-axis and oxygen consumption on the y-axis.

D) Use a bar graph with temperature on the x-axis and oxygen consumption on the y-axis.

Answer: C Topic: 21.3 Regulating the Internal Environment Skill: Synthesis/Evaluation Learning Outcome: 21.7 Global LO: 2, 3, 4, 7 6) At high temperatures this animal loses water rapidly. To prevent dehydration, this animal's nephrons should ________.

A) increase reabsorption B) decrease reabsorption C) increase secretion D) decrease secretion Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.8 Global LO: 2 7) The scientist studies a second animal whose oxygen consumption rises as temperature increases. The thermoregulatory strategy of the second animal is most likely to be ________.

A) an ectotherm B) an endotherm C) one that cannot osmoregulate D) one that primarily uses metabolism to regulate temperature Answer: A Topic: 21.3 Regulating the Internal Environment Skill: Synthesis/Evaluation Learning Outcome: 21.7 Global LO: 2, 3, 4, 7 8) What best describes the regulatory mechanism described in the scenario?

A) negative feedback B) positive feedback C) thermoregulation D) natural selection Answer: B Topic: 21.3 Regulating the Internal Environment Skill: Application/Analysis Learning Outcome: 21.6 Global LO: 2

17 .

9) Oxytocin controls the contractions of the uterus. Of which type of tissue is the uterus composed?

A) nervous tissue B) skeletal muscle C) smooth muscle D) epithelium Answer: C Topic: 21.1 The Structural Organization of Animals Skill: Application/Analysis Learning Outcome: 21.4 Global LO: 2

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 22 Nutrition and Digestion Chapter 22 Learning Outcomes 22 Biology and Society: The “Secret” to Shedding Pounds 22.1. Explain why there are really no tricks to losing weight.

22.1 An Overview of Animal Nutrition 22.2. Define and distinguish between different types of animal diets.

22.3. List and describe the general steps involved in digestion, and explain how and why mechanical and chemical digestion dismantles large food molecules.

22.4. Describe the structure and functions of different types of digestive compartments.

22.2 A Tour of the Human Digestive System 22.5. Describe the structure and function of the main components of the human digestive tract and the associated digestive glands.

22.6. Describe the causes and treatments of disorders of the human digestive system.

22.3 Human Nutritional Requirements 22.7. Explain how energy in food is measured, and how metabolic activity results in weight loss or gain.

22.8. List and define essential components of the human diet, and describe how deficiencies in these components can lead to health problems.

22.9. Describe the types of information found on food labels.

22.4 Nutritional Disorders 22.10. Describe the causes and treatments of different nutritional disorders.

22 Evolution Connection: Fat and Sugar Cravings 22.11. Explain how cravings for fat might have evolved in humans.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

22.1 Multiple Choice Questions 1) Spiders are ________.

A) herbivores B) filter feeders C) carnivores D) omnivores Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.2 2) Digestion is ________.

A) the absorption of nutrients B) the breakdown of food into small nutrient molecules that the body can absorb C) the churning of food in the stomach and intestine D) eating Answer: B Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.3 3) The four stages of food processing are, in order ________.

A) ingestion, absorption, elimination, digestion B) ingestion, elimination, digestion, absorption C) ingestion, digestion, absorption, elimination D) digestion, absorption, ingestion, elimination Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.3 4) Which of the following is an example of mechanical digestion?

A) the breakdown of proteins into amino acids B) peristalsis C) the digestion of fats by lipases D) chewing Answer: D Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.3

2 .

5) The digestive sac of a jellyfish has ________ opening(s).

A) one B) two C) three D) four Answer: A Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.4 6) A digestive tube is best defined as ________.

A) the compartment in which an animal digests its food B) a tube-shaped digestive compartment with either one or two openings C) a tube-shaped digestive compartment that has two openings and through which food moves in one direction D) a digestive compartment that conducts both chemical and mechanical digestion Answer: C Topic: 22.1 An Overview of Animal Nutrition Skill: Knowledge/Comprehension Learning Outcome: 22.4 7) The main function of salivary amylase is to ________.

A) moisten food B) break down proteins C) absorb nutrients D) break down starch Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 8) Which of the following choices lists the organs of the human alimentary canal in the CORRECT order?

A) pharynx, oral cavity, esophagus, stomach, large intestine B) oral cavity, pharynx, esophagus, stomach, small intestine, large intestine C) esophagus, pharynx, stomach, large intestine, small intestine D) oral cavity, esophagus, stomach, large intestine, small intestine Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5

3 .

9) Digestion begins in the ________.

A) oral cavity B) esophagus C) pharynx D) stomach Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 10) The tongue does all of the following EXCEPT ________.

A) taste food B) shape food into a ball C) secrete saliva D) push food into the pharynx Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 11) Muscular contraction moves food through the alimentary canal by a process called ________.

A) propulsion B) active transport C) peristalsis D) swallowing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 12) What is the epiglottis?

A) a muscle that moves the esophagus into line with the pharynx during swallowing B) a muscle that moves the trachea out of line with the pharynx during swallowing C) a flap that flips down to cover the entry to the trachea during swallowing D) a muscular sphincter that closes off the entry to the trachea during swallowing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5

4 .

13) The esophagus and trachea are both open to the ________.

A) pharynx B) posterior oral cavity C) posterior nasal cavity D) larynx Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 14) A food ball moves through the esophagus by ________.

A) peristalsis B) gastric juice C) mastication D) regurgitation Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 15) The stomach's gastric juice consists of ________.

A) digestive enzymes only B) hydrochloric acid only C) digestive enzymes and hydrochloric acid only D) mucus, digestive enzymes, and hydrochloric acid Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 16) When contracted, ________ prevents movement of chyme from the stomach to the small intestine.

A) peristalsis B) reverse peristalsis C) the epiglottis D) a sphincter Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5

5 .

17) Which of the following is the usual cause of heartburn?

A) backflow of chyme from the stomach into the esophagus B) retention of food at the bottom of the esophagus by a sphincter that is reluctant to open C) irritation of the lower esophagus by substances in spicy food D) compression of the lower esophagus by an overfilled stomach Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 18) Which of the following mechanisms helps prevent gastric juice from digesting the stomach lining?

A) mucus coating the inside surface of the stomach B) contractions of the stomach constantly moving chyme into the small intestine C) the continuous secretion of gastric juice D) the inactivation of pepsin by hydrochloric acid Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 19) The stomach mixes food with the secretions of the stomach wall to form ________.

A) gastric juice B) a food ball C) chyme D) acid gastrin Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 20) When the wall of the stomach fails to protect itself from erosion by gastric juice, the result is ________.

A) heartburn B) obesity C) GERD D) a gastric ulcer Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.6 Global LO: 5

6 .

21) How does Helicobacter pylori cause gastric ulcers in humans?

A) It neutralizes the acids of the stomach.

B) It causes the production of excess acid in the stomach.

C) It damages the stomach's mucus coat.

D) It causes the stomach to produce stronger acids.

Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.6 Global LO: 5 22) Most nutrient absorption occurs in which part of the digestive system?

A) stomach B) duodenum C) the several meters of the small intestine that come after the duodenum D) large intestine Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 23) Bile from the liver is stored in the ________ before entering the intestine.

A) pancreas B) gallbladder C) large intestine D) bile duct Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 24) What is the main digestive function of the pancreas?

A) It produces digestive enzymes and bile.

B) It produces bile.

C) It produces digestive enzymes and neutralizes stomach acids.

D) It secretes mucus into the small intestine.

Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5

7 .

25) Someone with liver failure will, in particular, have problems with the digestion and absorption of ________.

A) minerals B) fats C) carbohydrates D) proteins Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.5, 22.6 Global LO: 2, 5 26) Which of the following nutrients begins undergoing chemical digestion in the mouth?

A) amino acids B) protein C) starch D) glucose Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 27) The epithelial cells lining the intestine have surface projections that increase the area for absorption. These projections are called ________.

A) villi B) mucus C) microvilli D) bile Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 28) Together with the small intestine, the ________ absorbs water.

A) stomach B) colon C) rectum D) appendix Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5

8 .

29) Altogether, the body secretes about 7 liters of water into the alimentary canal each day.

About what percentage of this water gets reabsorbed?

A) 30% B) 50% C) 60% D) 90% Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 30) Which structure stores feces until they can be eliminated?

A) rectum B) appendix C) anus D) colon Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 31) ________ the direct source of energy for cells.

A) Fats are B) Glucose is C) ATP is D) Amino acids are Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.7 Global LO: 5 32) Most humans need about ________ kcal per day.

A) 500-700 B) 1,300-1,800 C) 2,500-3,000 D) 20,000-30,000 Answer: B Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.7 Global LO: 5

9 .

33) Your metabolic rate depends on ________.

I) your age II) your activity levels III) genetics A) I only B) I and II, but not III C) II only D) I, II, and III Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.7 Global LO: 5 34) Humans need food in order to obtain ________.

I) essential nutrients II) fuel to power all body activities III) organic raw materials to make their own molecules A) I only B) I and II, but not III C) II only D) I, II, and III Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.8 Global LO: 5 35) Vitamins are ________.

A) organic molecules that are required in the diet in very small amounts B) nutrients that we can synthesize from simpler molecules C) important supplements for children, but not adults D) required to synthesize most amino acids Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.8 Global LO: 5

10 .

36) Certain amino acids are called essential because they ________.

A) are required for making protein B) cannot be made by the body from other compounds C) store energy D) are required for making nucleic acids Answer: B Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.8 Global LO: 5 37) Which mineral is needed for the proper functioning of nerves, muscles, and bones?

A) calcium B) linoleic acid C) sodium D) salt Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Knowledge/Comprehension Learning Outcome: 22.8 Global LO: 5 38) What do the vitamins biotin and Vitamin K have in common?

A) They are both water-soluble vitamins.

B) They are both obtained from meat.

C) They are both produced by intestinal bacteria.

D) They are both common deficiencies in the human diet.

Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Synthesis/Evaluation Learning Outcome: 22.8 Global LO: 2 39) On a global scale, the most significant type of malnutrition is ________.

A) vitamin A deficiency B) calcium deficiency C) iron deficiency D) protein deficiency Answer: D Topic: 22.4 Nutritional Disorders Skill: Knowledge/Comprehension Learning Outcome: 22.10 Global LO: 5

11 .

40) Anorexia and bulimia ________.

A) occur when the body does not receive enough vitamin C B) occur when there is a protein-deficient diet C) occur mainly in affluent countries where thinness is idealized D) occur when a person does not obtain all the essential amino acids Answer: C Topic: 22.4 Nutritional Disorders Skill: Knowledge/Comprehension Learning Outcome: 22.10 Global LO: 5 41) Modern humans possess the same craving for ________ and ________ as our ancestors, despite the obesity these cravings can cause today.

A) fat … sugar B) sugar … salt C) protein … vitamin C D) iron; iodine Answer: A Topic: 22 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 22.11 22.2 Art Questions 1) The figure below shows ________.

A) the chemical digestion of a protein B) the building of a protein by the enzyme pepsin C) the mechanical digestion of a protein D) the addition of a water molecule to add an amino acid to a protein Answer: A Topic: 22.1 Overview of Animal Nutrition Skill: Application/Analysis Learning Outcome: 22.3 Global LO: 2, 3

12 .

2) The figure below shows that ________.

A) peristalsis moves food down the esophagus B) air cannot get into the trachea when the epiglottis closes the trachea C) the trachea is open when you are not swallowing D) the trachea is closed when you are not swallowing Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 Global LO: 3

13 .

3) The function of the structure shown below is ________.

A) to digest proteins B) to absorb nutrients into the body C) to aid in mechanical digestion of food D) to break fats into smaller droplets Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Knowledge/Comprehension Learning Outcome: 22.5 Global LO: 3

14 .

Please refer to the following art to answer the following questions.

4) A person with a BMI of 27 would be described as ________.

A) overweight B) normal weight C) underweight D) It depends on the person's height.

Answer: A Topic: 22.4 Nutritional Disorders Skill: Application/Analysis Learning Outcome: 22.10 Global LO: 2, 3, 5 5) Which of the following people is shifting from an unhealthy category to a healthy category?

A) A 120 lb, 5'5" male loses 15 lbs.

B) A 160 lb, 5'10" female loses 5 lbs.

C) A 180 lb, 5'10" male loses 20 lbs.

D) A 130 lb, 5'0" female gains 10 lbs.

Answer: C Topic: 22.4 Nutritional Disorders Skill: Application/Analysis Learning Outcome: 22.7, 22.10 Global LO: 2, 3, 5

15 .

6) Regarding the amount of energy consumed versus used, what would you recommend to a person who has a BMI of 27 to change to a normal BMI? A) Take in more calories by eating than are burned by physical activity.

B) Burn more calories by physical activity than are taken in by eating.

C) Take in the same amount of calories by eating compared to that which is burned by physical activity.

D) Weight gain is not related to the amount of calories taken in compared to that burned by physical activity.

Answer: B Topic: 22 Biology and Society: The "Secret" to Shedding Pounds, 22.4 Nutritional Disorders Skill: Application/Analysis Learning Outcome: 22.1, 22.7, 22.10 Global LO: 2, 3, 4, 5

16 .

Examine the FDA label for the loaf of Baker Organic Bread and answer the following questions.

7) A person who is trying to lose weight eats four servings of bread. Which of the following activities would burn more total Calories than is consumed in those four servings?

A) an hour of leisurely biking (<10 mph), 292 Calories B) an hour of canoeing, 256 Calories C) an hour of resistance (weight) training, 365 Calories D) an hour of hiking, 438 Calories Answer: D Topic: 22 Biology and Society: The "Secret" to Shedding Pounds, 22.3 Human Nutritional Requirements Skill: Application/Analysis Learning Outcome: 22.1, 22.7, 22.9 Global LO: 2, 3, 4, 5 8) How many servings of bread would an average person have to eat in order to get the FDA Daily Value of the water-soluble vitamin needed for reducing the risk of birth defects?

A) 50 B) 25 C) 17 D) Bread does not contain this vitamin.

Answer: A Topic: 22.3 Human Nutritional Requirements Skill: Synthesis/Evaluation Learning Outcome: 22.8, 22.9 Global LO: 2, 3, 4, 5 17 .

9) How many loaves of bread would an average person need to eat in order to get the FDA Daily Value of the vitamin needed to prevent photophobia?

A) 0.9 B) 1.4 C) 2.8 D) Bread does not contain this vitamin Answer: C Topic: 22.3 Human Nutritional Requirements Skill: Synthesis/Evaluation Learning Outcome: 22.8, 22.9 Global LO: 2, 3, 4, 5 10) Which of the following ingredients of the bread pictured would prevent beriberi?

A) ascorbic acid B) sea salt C) sunflower oil D) whole wheat (whole grain) flour Answer: D Topic: 22.3 Human Nutritional Requirements Skill: Synthesis/Evaluation Learning Outcome: 22.9, 22.10 Global LO: 2, 3, 5

18 .

22.3 Scenario Questions Use the following information to answer the following questions.

Several years ago, scientists discovered a mutation in zebrafish larvae that prevented the absorption of lipids from dietary fat. Larvae carrying this mutation died shortly after they hatched because all cells need fat to carry out their normal functions. More recent studies have determined that the mutation leading to this disorder occurs in a single gene on chromosome 10.

When a normal gene is inserted into embryos carrying the mutation, these fish are able to process fats normally when they hatch. To discover more about the gene's function, researchers examined and compared cells from normal and mutant fish larvae under a microscope. A major difference was noticed in the intestinal cells. The Golgi apparatus in the intestinal cells of mutant larvae is much larger than those of normal larvae. As the Golgi apparatus processes fats and proteins, the lipids become trapped, resulting in the abnormally large size of the organelle.

1) Assuming that the digestive system of zebrafish works like that of a human, what substance do zebrafish need to make fats more easily digested by enzymes?

A) chyme B) bile C) lipase D) pepsin Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.5 Global LO: 2 2) Assuming that the digestive system of zebrafish works like that of a human, which portion of the digestive tract is specialized for absorption of the nutrients?

A) stomach B) small intestine C) large intestine D) pharynx Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.5 Global LO: 2

19 .

Use the following information to answer the following questions.

There are many diseases of the digestive system. Sjögren's syndrome is an autoimmune disease that destroys tear ducts and salivary glands. In megaesophagus, peristalsis fails to occur properly and the esophagus is enlarged. In achlorhydria (also called "hypochlorhydria") production of gastric acid is absent or low. When a person has diverticulitis, feces are trapped in small pouches of the large intestine, and cause infection. Infected portions of the large intestine can swell and block the large intestine. In exocrine pancreatic insufficiency, there is a progressive loss of pancreatic cells that make digestive enzymes. In gallstone cholestasis, bile cannot flow from the liver to the duodenum.

3) Difficulty swallowing could indicate ________.

A) Sjögren's syndrome B) megaesophagus C) diverticulitis D) gallstone cholestasis Answer: A Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.6 Global LO: 2, 5 4) A protein deficiency in the blood could indicate ________.

A) megaesophagus B) achlorhydria C) Sjögren's syndrome D) diverticulitis Answer: B Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.6 Global LO: 2, 5 5) Regurgitation of food could indicate ________.

A) Sjögren's syndrome B) achlorhydria C) megaesophagus D) celiac disease Answer: C Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.6 Global LO: 2, 5

20 .

6) Exocrine pancreatic insufficiency would show symptoms most similar to______.

A) Sjögren's syndrome B) megaesophagus C) diverticulitis D) celiac disease Answer: D Topic: 22.2 A Tour of the Human Digestive System Skill: Application/Analysis Learning Outcome: 22.6 Global LO: 2, 5

21 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 23 Circulation and Respiration Chapter 23 Learning Outcomes 23 Biology and Society: Avoiding “The Wall” 23.1. Explain what limits the speed and stamina of most endurance athletes.

23.1 Unifying Concepts of Animal Circulation 23.2. Describe the function and main components of animal circulatory systems, and compare the structures of different types of circulatory systems.

23.2 The Human Cardiovascular System 23.3. Describe the path of blood as it makes one full circuit through the human body, including the heart, and compare the function of each structure in enabling this circuit to be completed.

23.4. Relate heart rate to blood pressure, explaining how they are controlled and how they are measured.

23.5. Describe the components of blood, their functions, and how donation of these components works.

23.6. Explain why it is better to “live high and train low” for some athletes.

23.7. Describe the causes, frequency, treatment, and prevention of cardiovascular disease and blood disorders.

23.3 Unifying Concepts of Animal Respiration 23.8. Explain why all working cells require a steady supply of oxygen and a way to dispose of carbon dioxide, and how the four types of respiratory surfaces facilitate gas exchange.

23.4 The Human Respiratory System 23.9. Describe the three phases of gas exchange in humans, including the path of a breath of air and how breathing is controlled.

23.10. Describe the functions of hemoglobin, and how different factors can interfere with oxygen transport.

23.11. Explain how cigarette smoking affects public health.

23 Evolution Connection: Evolving Endurance 23.12. Explain how Tibetans are adapted to living at very high altitudes.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

23.1 Multiple Choice Questions 1) Animals such as hydras and jellies can exchange gases directly with the environment by ________.

A) diffusion B) active transport C) osmosis D) bulk transport Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2 2) In humans, oxygen is delivered to the cells of the body by ________.

A) a closed circulatory system B) an open circulatory system C) diffusion D) diffusion and facilitated diffusion Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2 3) Which one of the following is a characteristic of open circulatory systems but NOT closed circulatory systems?

A) a heart B) a vascular system C) blood D) open-ended blood vessels Answer: D Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2 4) In animals with a closed circulatory system, gas exchange occurs across the thin walls of ________.

A) arteries B) arterioles C) capillaries D) venules Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2

2 .

5) Veins carry ________.

A) blood away from the heart B) oxygen-rich blood C) oxygen-poor blood D) blood toward the heart Answer: D Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2 6) How does a shark's cardiovascular system differ from that of a mammal?

A) The shark's heart does not directly pump oxygenated blood to the systemic tissues.

B) The shark's heart receives both oxygenated and deoxygenated blood.

C) The shark's circulatory system has a pulmonary and a systemic circuit.

D) The shark's blood is pumped through open-ended tubes.

Answer: A Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Application/Analysis Learning Outcome: 23.2 Global LO: 2 7) What is one way in which the cardiovascular system of a mammal is different than that of an arthropod such as an insect?

A) The heart of the mammal pumps blood into arteries, while the insect heart does not.

B) Veins send blood to a mammal's lungs, while insect veins send blood to the heart.

C) A mammal's blood is always contained inside vessels, while an insect's blood sometimes leaves the vessels.

D) A mammal has a heart to pump blood, while an insect does not have a heart.

Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Application/Analysis Learning Outcome: 23.2 Global LO: 2

3 .

8) Trace the path of a red blood cell in a circuit that takes it from the capillary bed of the right kidney to the capillary bed of the left kidney. Assume that you are doing this for an animal with a double circulation system.

A) capillary bed of right kidney → venules → veins → right atrium → right ventricle → pulmonary arteries → capillaries of lungs → pulmonary veins → left atrium → left ventricle → aorta → arteries → arterioles → capillary bed of left kidney B) capillary bed of right kidney → venules → veins → right atrium → right ventricle → pulmonary veins → capillaries of lungs → pulmonary arteries → left atrium → left ventricle → aorta → arteries → arterioles → capillary bed of left kidney C) capillary bed of right kidney → venules → veins → left atrium → left ventricle → pulmonary arteries → capillaries of lungs → pulmonary veins → right atrium → right ventricle → aorta → arteries → arterioles → capillary bed of left kidney D) capillary bed of right kidney → arterioles → arteries → aorta → right atrium → right ventricle → pulmonary arteries → capillaries of lungs → pulmonary veins → left atrium → left ventricle → veins → venules → capillary bed of left kidney Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.3 Global LO: 2 9) Which of these animals has a double circulatory system?

A) fish B) grasshopper C) dog D) hydra Answer: C Topic: 23.1 Unifying Concepts of Animal Circulation Skill: Knowledge/Comprehension Learning Outcome: 23.2 10) Which of these carry(ies) oxygen-poor blood?

A) pulmonary arteries B) pulmonary veins C) aorta D) left ventricle Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3

4 .

11) A heart murmur occurs when there is a defect in ________.

A) a heart valve B) the sinoatrial node C) arterioles D) the timing of the cardiac cycle Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 12) Why is blood pressure higher during systole than during diastole?

A) The contraction of the heart during systole increases the blood pressure against arterial walls.

B) The relaxation of the heart during systole increases the blood pressure against arterial walls.

C) The contraction of the heart during diastole decreases the blood pressure against arterial walls.

D) More blood flows into the heart during systole than during diastole.

Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 Global LO: 5 13) The basic rhythm of the heartbeat is set by the ________.

A) systolic pressure B) EKG C) sinoatrial node D) "fight-or-flight" hormone Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 14) If your blood pressure were 120/70, it would mean that ________.

A) your blood pressure during systole is 120 and your blood pressure during diastole is 70 B) you have high blood pressure C) you have low blood pressure D) your blood pressure during systole is 120 and your heart rate is 70 Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 Global LO: 5

5 .

15) Blood pressure that is consistently ________ or higher would indicate that you have hypertension.

A) 120/80 B) 140/90 C) 110/85 D) 100/75 Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 Global LO: 5 16) Which blood vessels have thin, leaky walls?

A) capillaries B) venules C) arteries D) none of the above Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3 17) Blood pressure is lowest in ________.

A) veins B) capillaries C) arterioles D) venules Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 18) Heart Block is one type of electrical defect in the heart in which the electrical signal from the sinoatrial node to the relay point is delayed. Predict the effect of Heart Block on the cardiac cycle.

A) The atria relax for a shorter period of time.

B) The atria relax for a longer period of time.

C) The ventricles relax for a shorter period of time.

D) The ventricles relax for a longer period of time.

Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Synthesis/Evaluation Learning Outcome: 23.3, 23.4 Global LO: 2

6 .

19) If you separated the components of blood and looked closely at only the plasma, you might find ________.

A) white blood cells B) red blood cells C) hormones D) platelets Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.5 20) As a consequence of red blood cells' lack of nuclei and other organelles, they ________.

A) have more room to carry hemoglobin B) have a small surface area C) contain less hemoglobin than they might otherwise be able to carry D) can carry more calcium Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.5 21) Which of the following can cause anemia?

I) bone marrow disease II) iron deficiency III) low number of white blood cells A) I B) II C) III D) I and II Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Synthesis/Evaluation Learning Outcome: 23.7 Global LO: 2, 5 22) When tissue lining a blood vessel is damaged, the first thing that happens is ________.

A) erythrocytes release fibrin B) leukocytes multiply C) platelets convert fibrinogen to fibrin D) platelets adhere to the damaged tissue Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.5

7 .

23) White blood cells play a particularly important role in ________.

A) fighting infections B) supporting the activity of red blood cells C) carrying carbon dioxide D) blood clotting Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.5 24) Leukemia ________.

A) decreases the production of white blood cells B) increases the production of red blood cells C) is a cancer of the white blood cells D) is a cancer that arises in the lungs Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.7 Global LO: 5 25) You increase your risk of cardiovascular disease by reducing your consumption of ________.

A) fruits and vegetables B) red meats C) products containing trans fats D) tobacco products Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.7 Global LO: 2 26) The buildup of plaque in the walls of arteries results in ________.

A) leukemia B) atherosclerosis C) anemia D) low blood pressure Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.7

8 .

27) Gas exchange requires a surface that is both ________.

A) durable and stiff B) protected within the body and connected to the circulatory system C) thin and moist D) permeable to oxygen and impermeable to carbon dioxide Answer: C Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Knowledge/Comprehension Learning Outcome: 23.8 28) Earthworms use ________ as their respiratory surface.

A) lungs B) gills C) their skin D) tracheae Answer: C Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Knowledge/Comprehension Learning Outcome: 23.8 29) What structure do lobsters use for gas exchange?

A) gills B) lungs C) skin D) tracheae Answer: A Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Knowledge/Comprehension Learning Outcome: 23.8 30) Insects breathe using ________.

A) lungs B) tracheae C) their entire outer skin D) book lungs Answer: B Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Knowledge/Comprehension Learning Outcome: 23.8

9 .

31) Animals need O2 because it ________.

A) plays a role in obtaining energy from food B) helps animals synthesize proteins C) is necessary to make CO2 D) is needed to deliver hemoglobin to the cells of an animal's body Answer: A Topic: 23.3 Unifying Concepts of Animal Respiration Skill: Knowledge/Comprehension Learning Outcome: 23.8 32) In a human, the ________ provide(s) a common passageway for both food and air.

A) bronchioles B) trachea C) pharynx D) alveoli Answer: C Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9 33) What path does a molecule of O2 take from the nose to the respiratory surface?

A) pharynx → larynx → trachea → bronchus → bronchiole → alveolus B) larynx → pharynx → trachea → bronchus → bronchiole → alveolus C) pharynx → larynx → bronchus → bronchiole → alveolus → trachea D) pharynx → larynx → trachea → bronchiole → bronchus → alveolus Answer: A Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9 34) In the human respiratory system, gas exchange occurs across the cells of the ________.

A) diaphragm B) trachea C) bronchi D) alveoli Answer: D Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9

10 .

35) Together, inhalation and exhalation are referred to as ________.

A) diffusion B) breathing C) active transport D) negative pressure Answer: B Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9 36) Breathing is regulated by ________.

A) the diaphragm and chest muscles B) the spinal cord C) the circulatory system D) control centers in the brain stem Answer: D Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9 37) When you hold your breath, which of the following blood gas changes leads initially to the urge to breathe again?

A) rising carbon monoxide level B) rising carbon dioxide level C) falling carbon monoxide level D) rising carbon dioxide level and falling carbon monoxide level Answer: B Topic: 23.4 The Human Respiratory System Skill: Application/Analysis Learning Outcome: 23.9 Global LO: 2 38) Oxygen is transported through the body mostly ________.

A) dissolved in the blood B) dissolved in red blood cells C) bound to hemoglobin D) bound to dissolved iron Answer: C Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.10

11 .

39) Cigarette smoking ________.

A) is responsible for about one in five deaths of Americans every year B) accounts for 80—90% of all cases of lung cancer C) can affect the health of nonsmokers through secondhand smoke D) all of the above Answer: D Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.11 Global LO: 5 40) Why do cigarette smokers cough more than most people do?

A) The tar in cigarette smoke tends to make alveoli stick closed. Coughing opens them.

B) Coughing is the respiratory system's attempt to clear itself of the thick mucus that is produced in response to smoke exposure.

C) Cigarette smoking partially paralyzes the lungs; coughing exchanges the resultant "dead air."

D) Coughing stimulates blood flow to the lungs.

Answer: B Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.11 Global LO: 5 41) Which of the following best describes the pathway an oxygen molecule would take through the human circulatory system?

A) systemic tissues → alveoli → pulmonary vein → pulmonary capillaries → systemic capillaries → left ventricle → left atrium → aorta → systemic arteries B) alveoli → pulmonary capillaries → pulmonary vein → left atrium → left ventricle → aorta → systemic arteries → systemic capillaries → systemic tissues C) alveoli → pulmonary capillaries → pulmonary artery → right atrium → right ventricle → pulmonary vein → systemic arteries → systemic capillaries → systemic tissues D) alveoli → pulmonary vein → pulmonary capillaries → systemic capillaries → left atrium → left ventricle → aorta → systemic arteries → systemic tissues Answer: B Topic: 23.2 The Human Cardiovascular System, 23.4 The Human Respiratory System Skill: Application/Analysis Learning Outcome: 23.3, 23.10 Global LO: 2

12 .

42) The cardiovascular system of a mouse works like that of a human. A mouse is moved from sea level (low altitude) to the top of a mountain (high altitude). How could this mouse's cardiovascular system maintain a similar rate of oxygen delivery to its tissues now that the mouse is at the top of the mountain?

A) Decrease breathing rate.

B) Decrease heart rate.

C) Increase the depth of ventilation.

D) Increase lung pressure.

Answer: C Topic: 23.2 The Human Cardiovascular System, 23.4 The Human Respiratory System, 23 The Process of Science Skill: Application/Analysis Learning Outcome: 23.1, 23.3, 23.6, 23.9 Global LO: 2 43) The Antarctic icefishes are the only known vertebrates to lack hemoglobin. Which of the following would be LEAST likely to alter gas transport from the environment to an icefish's cells?

A) higher oceanic temperatures from global warming B) higher concentrations of carbon monoxide in the water from pollution C) higher concentrations of carbon dioxide in the water from pollution D) an injury that reduces the surface area of gills Answer: B Topic: 23.3 Unifying Concepts of Animal Respiration, 23.4 The Human Respiratory System Skill: Synthesis/Evaluation Learning Outcome: 23.10 Global LO: 2, 5, 7

13 .

23.2 Art Questions 1) The following figure illustrates ________.

A) diastolic blood pressure B) systolic blood pressure C) the pulmonary circuit D) the systemic circuit Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3 Global LO: 3

14 .

Please refer to the following art to answer the following questions.

2) The one-way flow of blood in veins is maintained by ________.

A) blood pressure B) muscles pressing against the veins C) their thick walls D) valves Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3 Global LO: 3 3) In varicose veins, the one-way flow of blood in veins is disrupted, which can cause swelling and blood clots. What might help return the blood flow in these veins to normal?

A) Reduce physical activity.

B) Raise legs above the level of the heart when resting.

C) Remove valves from varicose veins.

D) Stand or sit still for long periods of time.

Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.3 Global LO: 2, 3

15 .

4) Examine the structure of blood vessels in the following figure. Which one of the following has the structure best suited to chemical exchange between the blood and tissues?

A) venule B) capillary C) arteriole D) artery Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3 Global LO: 3

16 .

5) Examine the figure shown. During negative pressure breathing, ________.

A) the diaphragm moves downward and the rib muscles contract, increasing the size of the chest cavity and decreasing the air pressure within the chest cavity B) the nasal cavities expand and the diaphragm relaxes C) the diaphragm and rib muscles contract, decreasing the size of the chest cavity and increasing the pressure within the chest cavity D) the diaphragm moves downward and the rib muscles relax, increasing the size of the chest cavity and decreasing the air pressure within the chest cavity Answer: A Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.9 Global LO: 3

17 .

6) The figure below shows that ________.

A) hemoglobin can bind to either oxygen or carbon dioxide B) a hemoglobin molecule can bind up to four molecules of oxygen C) a red blood cell contains four hemoglobin molecules D) each iron atom can bind four oxygen molecules Answer: B Topic: 23.4 The Human Respiratory System Skill: Knowledge/Comprehension Learning Outcome: 23.10 Global LO: 3 23.3 Scenario Questions Read the following scenario to answer the following questions.

Blood flowing away from the heart is under tremendous pressure, able to travel to just about any portion of the body. However, blood pressure drops considerably as it moves away from the heart. When blood finally reaches capillaries, the blood pressure drops to nearly zero. Therefore, when a person is standing, blood returning from the feet is not moved back towards the heart by contractions of the heart.

1) Blood is propelled back to the heart by ________.

A) rhythmic contractions of muscles in the walls of veins and the action of one-way valves B) skeletal muscle contractions around veins and the action of one-way valves C) the negative pressure of the heart pulling blood into the empty chambers D) the natural flow of blood into ever-larger blood vessels leading to the heart Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.3

18 .

2) A scientist claimed that students might get better scores on written exams if they wiggle their legs frequently while taking an exam. This could work (but it is not better than studying) because wiggling legs might ________.

A) propel more blood from the legs back to the heart, increasing oxygen flow to the brain B) add more oxygen to the blood that is returning to the heart C) shake out more of the carbon dioxide that lingers in the blood returning to the heart D) break up blood clots in the legs, which slow the movement of blood back to the heart Answer: A Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.3 Global LO: 2 3) Because of the changes in blood pressure through the circulatory system, the best way to feel a pulse is by pressing a finger against ________.

A) a vein B) a capillary C) an artery D) either an artery or a vein Answer: C Topic: 23.2 The Human Cardiovascular System Skill: Knowledge/Comprehension Learning Outcome: 23.4 Read the following scenario to answer the following questions.

In sickle cell disease (SCD), a mutation in hemoglobin causes deoxygenated hemoglobin to stick together in long chains, which in turn distorts red blood cells into an elongated, sickle (crescent) shape.

4) In a person with SCD, where would red blood cells with a sickle shape be LEAST likely to be found?

A) pulmonary arteries B) pulmonary veins C) right atrium D) right ventricle Answer: B Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.3, 23.7 Global LO: 2, 5

19 .

5) Red blood cells with a sickle shape can block circulation in small blood vessels. Which blood vessels are most likely to become blocked by sickle cells?

A) veins B) arteries C) arterioles D) capillaries Answer: D Topic: 23.2 The Human Cardiovascular System Skill: Application/Analysis Learning Outcome: 23.3 Global LO: 2, 5 Read the following scenario to answer the following questions.

Yawning is a reflexive action that is often associated with sleepiness. When a person yawns, the mouth opens, and a longer than normal breath of air is inhaled, followed by a longer than normal exhalation. Hypothesizing that yawning has a regulatory mechanism similar to breathing, scientists conducted an experiment on college students to test the effect of ambient carbon dioxide levels on yawning.

6) The structure where the respiratory and digestive systems meet expands during a yawn. What is the name of this structure?

A) bronchus B) larynx C) pharynx D) trachea Answer: C Topic: 23.4 The Human Respiratory System Skill: Application/Analysis Learning Outcome: 23.9 Global LO: 2 7) When a person exhales to complete a yawn, what happens?

A) The rib muscles contract.

B) The diaphragm contracts.

C) The rib muscles act in the same way that they do in an inhalation.

D) The diaphragm relaxes.

Answer: D Topic: 23.4 The Human Respiratory System Skill: Application/Analysis Learning Outcome: 23.9 Global LO: 2

20 .

8) If yawning has a regulatory mechanism similar to breathing, then which of the following is TRUE? A) Athletes should yawn more when exercising compared to when they are not exercising.

B) Tibetan mountaineers yawn more when they are walking compared to when they are standing still.

C) People adapted to lower altitudes should yawn the same amount when they are at high altitudes.

D) Athletes who have trained at high altitudes should inhale a greater volume of air when yawning compared to those who have trained only at low altitudes.

Answer: A Topic: 23.4 The Human Respiratory System, 23 Evolution Connection Skill: Application/Analysis Learning Outcome: 23.1, 23.6, 23.9, 23.12 Global LO: 2 9) The scientists investigated carbon dioxide levels in their experiment because high carbon dioxide levels in the ________ signal control centers in the brain to increase rate and depth of inhalations and exhalations.

A) alveoli B) blood C) heart muscle D) pharynx Answer: B Topic: 23.4 The Human Respiratory System Skill: Synthesis/Evaluation Learning Outcome: 23.9 Global LO: 1, 2, 7, 9 10) To graph their results, the scientists would plot the ________.

A) number of yawns on the x-axis B) dependent variable on the x-axis C) level of carbon dioxide on the x-axis D) age of college students on the x-axis Answer: C Topic: 23.4 The Human Respiratory System Skill: Synthesis/Evaluation Learning Outcome: 23.9 Global LO: 1, 2, 3, 4

21 .

11) Which of the following would be considered support for the hypothesis tested by the scientists?

A) College students produce more carbon dioxide when they yawn more frequently.

B) College students yawn with the same frequency regardless of carbon dioxide levels.

C) College students yawn more when they are in lecture, compared to when they are in lab.

D) College students yawn more when they are exposed to higher levels of carbon dioxide.

Answer: D Topic: 23.4 The Human Respiratory System Skill: Synthesis/Evaluation Learning Outcome: 23.9 Global LO: 1, 2, 9 12) The scientists found that the level of carbon dioxide in the air did not cause college students to yawn more frequently. What other experiment could they conduct to confirm that they should reject the hypothesis that yawning is regulated in the same way as breathing?

A) Test the effect of hemoglobin amounts on the frequency of yawning.

B) Test the effect of exercise levels on the frequency of yawning.

C) Test the effect of carbon monoxide (CO) levels on the frequency of yawning.

D) Test the effect of diet on the frequency of yawning.

Answer: B Topic: 23.4 The Human Respiratory System Skill: Synthesis/Evaluation Learning Outcome: 23.9 Global LO: 1, 2, 7, 9

22 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 24 The Body's Defenses Chapter 24 Learning Outcomes 24 Biology and Society: Herd Immunity 24.1. Define herd immunity, and explain how decreasing vaccination rates can threaten herd immunity.

24.1 An Overview of the Immune System 24.2. Define the immune system, and distinguish between innate and adaptive immunity.

24.2 Innate Immunity 24.3. Compare and contrast external and internal innate defenses.

24.4. Describe the inflammatory response, the role of histamine, and the effects of drugs such as ibuprofen.

24.3 The Lymphatic System 24.5. Compare the circulatory and immune functions of the lymphatic system, and explain how lymph is formed.

24.4 Adaptive Immunity 24.6. Explain how the immune system recognizes foreign substances with antigens.

24.7. Describe the process of clonal selection, and explain how effector cells and antibodies are produced and what their functions are.

24.8. Compare and contrast the roles of cytotoxic T cells, helper T cells, and B cells in the immune response.

24.9. Explain how the immune system has “memory.”

24.10. Explain how vaccinations can prevent disease.

24.5 Immune Disorders 24.11. Define an allergen, an allergy, and anaphylactic shock. Describe the two steps of an allergic reaction.

24.12. Compare and contrast autoimmune diseases and immunodeficiency diseases.

24 Evolution Connection: Viral Evolution versus the Flu Vaccine 24.13. Explain why the preparation of flu and HIV vaccines is especially challenging.

Global Learning Outcomes 1.

2.

3.

4.

5.

6.

7.

8.

9.

Demonstrate an understanding of the principles of scientific inquiry.

Demonstrate the ability to think critically and employ critical-thinking skills.

Read and interpret models, graphs, and data.

Demonstrate the quantitative skills needed to succeed in biology.

Demonstrate an understanding of the impact of science on society.

Evaluate the credibility of scientific information from various sources.

Demonstrate the ability to make connections between concepts across biology.

Communicate effectively in writing.

Apply the scientific method to interpret information and draw conclusions.

1 .

24.1 Multiple Choice Questions 1) Herd immunity fails when what percentage of the population is NOT vaccinated?

A) 1% B) 5% C) 10% D) 50% Answer: B Topic: 24 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 24.1 Global LO: 5 2) Which of the following is one of the body's first lines of defense against infection?

A) antibodies B) obstacles such as skin and mucous membranes C) increased production of certain hormones D) decreased heart rate Answer: B Topic: 24.1 An Overview of the Immune System Skill: Knowledge/Comprehension Learning Outcome: 24.2 3) Slugs produce mucus all over their bodies that helps keep them moist and helps them move.

The mucus also can protect the slugs from pathogens. A slug's mucus is a component of which part of the immune system?

A) internal innate immunity B) external innate immunity C) adaptive immunity D) lymphatic system Answer: B Topic: 24.1 An Overview of the Immune System Skill: Application/Analysis Learning Outcome: 24.2 Global LO: 2

2 .

4) What kinds of cells engulf whatever foreign cells and molecules they encounter and recognize?

A) natural killer cells B) red blood cells C) phagocytic cells D) B cells Answer: C Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.3 5) Which of the following kinds of proteins circulates in the blood and coats the surfaces of microbes to make them more susceptible to engulfment by phagocytic cells?

A) defensive B) histamine C) B cell receptor D) antigen Answer: A Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.3 6) A major function of natural killer cells is to ________.

A) attack and kill pathogenic microorganisms B) attack virus-infected cells C) tag pathogenic microorganisms with antibodies D) phagocytize microorganisms that have been tagged with antibodies Answer: B Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.3 7) Defensive proteins can assist the immune response by ________.

A) helping viruses reproduce B) directly destroying pathogens C) reducing inflammation D) increasing lymph production Answer: B Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.3

3 .

8) A researcher detects an increase in the amount of natural killer cells in a laboratory rat and concludes that ________.

A) the rat has, or recently had, a viral infection B) the rat does not have any cancerous tumors C) the rat's lymphatic system is not functioning properly D) the rat's internal innate defenses are weakened Answer: A Topic: 24.2 Innate Immunity Skill: Application/Analysis Learning Outcome: 24.3 Global LO: 2 9) Which of the following is a response of our innate defense system?

A) adaptive immunity B) inflammation C) cytotoxic T cell response D) helper T cell response Answer: B Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.3 10) When you cut yourself, the damaged cells immediately release which of the following chemical alarm signals?

A) defensive proteins B) antibodies C) histamine D) antihistamines Answer: C Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.4 11) Histamine ________.

A) causes local blood vessels to dilate B) attracts natural killer cells C) stimulates the release of defensive proteins D) repels phagocytic cells Answer: A Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.4

4 .

12) The major result of the inflammatory response is to ________.

A) initiate the production of antibodies B) disinfect and clean damaged tissues C) initiate the release of defensive proteins D) initiate the production of natural killer cells Answer: B Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.4 13) Why do diseases involving widespread infection often result in a fever?

A) The inflammatory and immune responses result in extra heat production.

B) The microorganisms trick the brain's temperature control center into creating a hot environment that favors their growth.

C) The brain's temperature control center responds to inflammation by creating a hot environment unfavorable to the growth of microorganisms.

D) The inflammatory response result is less heat production.

Answer: C Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.4 14) A role of the lymphatic system is to ________.

A) transport histamine B) produce hormones related to fighting infections C) produce white blood cells D) return tissue fluid to the circulatory system Answer: D Topic: 24.3 The Lymphatic System Skill: Knowledge/Comprehension Learning Outcome: 24.5 15) A person's spleen may be removed (splenectomy) if it becomes enlarged due to certain types of cancer, traumatic injury, or damage. What part of the immune system will be most affected by a splenectomy?

A) internal innate immunity B) external innate immunity C) adaptive immunity D) lymphatic system Answer: D Topic: 24.3 The Lymphatic System Skill: Application/Analysis Learning Outcome: 24.5 Global LO: 2, 5

5 .

16) Antibodies are ________.

A) composed of four fatty acid chains B) a type of lymphocyte C) proteins with short carbohydrates attached D) proteins consisting of four polypeptide chains Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 17) A substance that can elicit an immune response from a lymphocyte is called a(n) ________.

A) defensive protein B) pathogen C) antibody D) antigen Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.6 18) If a person had the thymus gland removed, which of the following would NOT occur in his or her body?

A) production of B cells B) production of T cells C) maturation of B cells D) maturation of T cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Application/Analysis Learning Outcome: 24.6 Global LO: 2 19) Which statement about antigen recognition in B and T cells is TRUE? A) B cell antigen receptors can bind to intact freely circulating antigens that are bound to self proteins.

B) T cell antigen receptors can bind to intact antigens that are bound to self proteins.

C) B cell antigen receptors can bind to intact antigens that are on pathogen surfaces.

D) T cell antigen receptors can bind to intact freely circulating antigens.

Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.6

6 .

20) One kind of vaccine consists of a solution containing ________.

A) antibodies B) horse serum C) B cells D) a harmless variant of a disease-causing microbe Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.10 21) Which of the following cell types are specifically responsible for the B cell response?

A) T cells B) B cells C) phagocytic cells D) natural killer cells Answer: B Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.6 22) Which of the following cell types are specifically responsible for the cytotoxic T cell response?

A) T cells B) B cells C) natural killer cells D) phagocytic cells Answer: A Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.6 23) The immune system is capable of mounting specific responses to particular microorganisms because ________.

A) lymphocytes are able to change their antigen specificity as required to fight infection B) the body is able to determine which type of B and T cells to make C) the body contains an enormous diversity of B and T cells, each with a specific kind of antigen receptor D) the body is able to make different antigen receptors depending on the invading microorganism Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.6

7 .

24) Antibodies ________.

A) are shaped like the letter B B) are generalists in that any antibody can bind to any antigen C) assist in destroying particular antigens D) are produced by T cells Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 25) One function of antibodies is to ________.

A) deactivate defensive proteins B) stimulate the production of antigens C) phagocytose invading bacteria D) clump invader cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 26) When in its life cycle does a B cell first exhibit its particular surface antigen receptor?

A) after the memory cell giving rise to it divides B) before it ever encounters an antigen C) after it encounters several antigens D) after it encounters a single antigen Answer: B Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 27) When a B or T cell is primed by an interaction with its particular antigen, the cell ________.

A) dies, killing the antigen B) engulfs the antigen and destroys it C) grows, divides, and develops further D) sticks to other cells with attached antigens to form a large clot Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7

8 .

28) A primary immune response is the ________.

A) production of primary-type antibodies in the first day of exposure to a microorganism B) immune response elicited by the second exposure of lymphocytes to a particular antigen C) immune response elicited by the first exposure of lymphocytes to a particular antigen D) immune response elicited by the first exposure of memory cells to a particular antigen Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 29) The primary immune response ________.

A) results in the production of short-lived effector cells via clonal selection B) results in the production of short-lived memory cells via clonal selection C) peaks about 2 days after first exposure D) triggers the secondary immune response Answer: A Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 30) Which of the following cell types initiates a secondary immune response?

A) natural killer cells B) memory cells C) effector cells D) plasma cells Answer: B Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 31) The secondary response in the B cell response occurs when memory cells bind to ________.

A) antibodies B) antigens C) histamine D) defensive proteins Answer: B Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7

9 .

32) A secondary immune response differs from a primary immune response in that the secondary response ________.

A) produces helper T cells B) produces cytotoxic T cells C) produces effector cells D) produces memory cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 33) The basic function of cytotoxic T cells is to identify and destroy invaders in our ________.

A) blood or lymph B) interstitial fluid C) cells D) immune system Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.8 34) Strep throat can develop from an infection by the bacterium Streptococcus pyogenes. After infection by this bacterium, cells in the body will respond by producing antibodies against the bacterium and the toxins it produces. What type of immune response is being described in this situation?

A) cytotoxic T cell response B) helper T cell response C) B cell response D) inflammation Answer: C Topic: 24.4 Adaptive Immunity Skill: Application/Analysis Learning Outcome: 24.8 Global LO: 2, 5 35) ________ may destroy infected body cells.

A) Phagocytic cells B) Helper T cells C) Natural killer cells D) Cytotoxic T cells Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.8

10 .

36) Which of the following compounds do mast cells produce?

A) defensive proteins B) antihistamines C) histamine D) antibodies Answer: C Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.11 37) Anaphylactic shock ________.

A) occurs when blood vessels constrict abruptly B) is a symptom of an immunodeficiency disease C) causes blood pressure to drop dangerously D) has no treatment Answer: C Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.11 38) It is best to receive an organ transplant from a donor who ________.

A) looks like you B) rarely consumes alcohol C) does not have any allergies D) best matches your self proteins Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.8 39) When the immune system improperly turns against the body's own molecules, the result is ________.

A) an allergy B) AIDS C) an autoimmune disease D) an immunodeficiency disease Answer: C Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.12

11 .

40) Which of the following statements best explains why people with Hodgkin's disease often show signs of immunodeficiency?

A) The Hodgkin's disease virus infects and destroys B cells.

B) Hodgkin's disease involves the deposition of immune complexes in the kidneys.

C) Hodgkin's disease is a type of cancer that affects lymphocytes.

D) Hodgkin's disease occurs when an immune response elicited by streptococcal bacteria kills normal heart cells as well.

Answer: C Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.12 Global LO: 2 41) Which of the following types of cells does HIV preferentially infect?

A) cytotoxic T cells B) natural killer cells C) helper T cells D) phagocytic cells Answer: C Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.12 42) Suppose that you encounter an antigen for the first time. What types of cells stored in your lymph nodes can be activated in case you encounter the antigen again?

A) memory cells B) effector cells C) phagocytic cells D) helper T cells Answer: A Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.9 43) What did Jonas Salk's polio vaccine experiment find?

A) Vaccines could be developed from bacteria.

B) Vaccines were safe only for the elderly.

C) Inactivated viruses can be used as vaccines.

D) Polio could not be prevented with a vaccine.

Answer: C Topic: 24 The Process of Science Skill: Knowledge/Comprehension Learning Outcome: 24.10 Global LO: 5

12 .

44) Jonas Salk's polio vaccine trials of 1954 involved giving placebos to 201,229 children and the polio vaccine to 200,745 children. Out of the placebo group, 142 children developed polio, whereas 57 children from the vaccine group developed polio. Approximately how many more times likely was a child to develop polio if he or she were NOT vaccinated?

A) thirty B) ten C) five D) three Answer: D Topic: 24 The Process of Science Skill: Application/Analysis Learning Outcome: 24.10 Global LO: 2, 4, 5 45) Why do some viruses mutate faster than others?

A) They are usually smaller.

B) They are usually larger.

C) They usually have RNA genomes.

D) They usually have DNA genomes.

Answer: C Topic: 24 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 24.13 Global LO: 7

13 .

24.2 Art Questions 1) Examine the numerous long structures extending from the surface of some of the cells in the following figure. Cells with these long structures could be found lining ________.

A) the digestive tract B) arteries C) veins D) the trachea Answer: D Topic: 24.1 An Overview of the Immune System Skill: Application/Analysis Learning Outcome: 24.2 Global LO: 2, 3

14 .

2) The figure below shows a Y-shaped antibody molecule. How many antigens can a single antibody molecule bind?

A) one B) two C) three D) four Answer: B Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.7 Global LO: 3

15 .

3) Three B cells are shown in the figure. Which of these B cells will begin to grow, divide, and differentiate further?

A) only the B cell on the left B) only the B cell in the middle C) only the B cell on the right D) all three B cells Answer: B Topic: 24.4 Adaptive Immunity Skill: Application/Analysis Learning Outcome: 24.8 Global LO: 2, 3 4) Examine the photograph of the hand in the following figure. The person's joints are severely damaged because ________.

A) the immune system has damaged the cartilage and bone of the joints B) a viral infection has attacked the cartilage of the fingers C) cytotoxic T cells have destroyed the bone in the fingers D) T cells have reacted against the myelin in the hand Answer: A Topic: 24.5 Immune Disorders Skill: Knowledge/Comprehension Learning Outcome: 24.12 Global LO: 3 16 .

5) Suppose that the figure below shows the concentration of antibodies for an antigen produced

by Clostridium tetani, a bacterium that causes tetanus. What could trigger the increase in antibody production marked by the arrow?

A) a decrease in antigen concentration B) an increase in histamine production C) an initial exposure to Pseudomonas aeruginosa, a bacterium that causes pneumonia D) a second exposure to Clostridium tetani Answer: D Topic: 24.4 Adaptive Immunity Skill: Application/Analysis Learning Outcome: 24.8 Global LO: 2, 3

17 .

24.3 Scenario Questions Read the following scenario to answer the following questions.

Avian influenza is a viral infection that naturally occurs in wild birds with few damaging effects.

However, avian influenza is highly contagious and can quickly kill domesticated birds. Some human influenza viruses are similar to the avian influenza. People infected with avian influenza develop typical flu symptoms (fever, cough, muscle aches). However, symptoms may become more severe and life-threatening. If avian influenza evolves into a form that is easily transmissible from person to person, a global pandemic of widespread human death might occur.

1) One way to prevent a global pandemic of avian influenza would be to ________.

A) keep large doses of histamine available to treat anyone who shows signs of infection B) treat any infected birds with large doses of antibiotics C) develop a vaccine against the avian influenza virus D) develop drugs that could effectively block anaphylactic shock Answer: C Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.8 Global LO: 5 2) Which of the following cells would be active during an immune response to a viral infection?

A) natural killer cells, only B) phagocytic cells, only C) T cells, only D) all of these cell types Answer: D Topic: 24.4 Adaptive Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.8 3) Humans who are infected with avian influenza are likely to have elevated levels of ________.

A) defensive proteins B) histamine C) antihistamines D) bacterial cells Answer: A Topic: 24.2 Innate Immunity Skill: Knowledge/Comprehension Learning Outcome: 24.2

18 .

4) Which of the following methods do you think would be the best way to test the effectiveness of a vaccine against avian influenza that is intended for human use?

A) Give the vaccine to a single mouse that has the virus, and assess whether influenza symptoms develop.

B) Give the vaccine to a group of mice that have the virus, and give a placebo to another group of mice that have the virus. Assess whether influenza symptoms develop in either group.

C) Give the vaccine to a single human who has the virus, and assess whether influenza symptoms develop.

D) Give the vaccine to a group of humans who have the virus, and give a placebo to another group of humans who have the virus. Assess whether influenza symptoms develop in either group.

Answer: D Topic: 24 The Process of Science, 24 Evolution Connection Skill: Synthesis/Evaluation Learning Outcome: 24.10, 24.13 Global LO: 1, 2, 9

19 .

Read the following scenario to answer the following questions.

In order for cytotoxic T cells to kill infected cells, they must bind to the self protein on the surface of the infected cell. Other proteins on the surface of the cytotoxic T cells assist with this binding process. One of these accessory proteins, CD8, has been implicated in many immunodeficiency disorders, including AIDS. CD8 is required for cytotoxic T cells to function normally.

Chronic alcohol use is associated with increased rates of pulmonary bacterial and viral infections. A recent study examined this association by investigating the effects of alcohol on the immune system in mice. Mice were given either water or alcohol (ethanol) to drink and then were infected with the influenza virus. The number of cytotoxic T cells that have the CD8 accessory protein was measured in both groups of mice. The data collected are shown in the figure below.

5) Which group of mice has more functional cytotoxic T cells?

A) The mice that drank water.

B) The mice that drank alcohol.

C) Both groups of mice have similar amounts of functional cytotoxic T cells.

D) There is not enough information to make a conclusion.

Answer: A Topic: 24.4 Adaptive Immunity Skill: Application/Analysis Learning Outcome: 24.8 Global LO: 1, 2, 3, 9 6) Which group of mice would have a stronger cytotoxic C cell response?

A) The mice that drank water.

B) The mice that drank alcohol.

C) Both groups of mice would have the same responses.

D) There is not enough information to make a conclusion.

Answer: A Topic: 24.4 Adaptive Immunity Skill: Synthesis/Evaluation Learning Outcome: 24.8 Global LO: 1, 2, 3, 9

20 .

7) What other observation would suggest that alcohol consumption contributes to increased bacterial and viral infections?

A) decreased histamine concentration in the mice that drank alcohol B) increased histamine concentration in the mice that drank alcohol C) increased numbers of B cells in the mice that drank alcohol D) decreased numbers of B cells in the mice that drank alcohol Answer: D Topic: 24.4 Adaptive Immunity Skill: Synthesis/Evaluation Learning Outcome: 24.8 Global LO: 1, 2, 9

21 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 25 Hormones Chapter 25 Learning Outcomes 25 Biology and Society: Should Steroids Be Allowed?

25.1. Compare the advantages and disadvantages of synthetic hormone use.

25.1 Hormones: An Overview 25.2. Compare ways that water-soluble and lipid-soluble hormones trigger changes in target cells.

25.2 The Human Endocrine System 25.3. Describe different types and functions of vertebrate endocrine glands and the hormones they produce.

25.4. Draw and describe the interrelationships between the hypothalamus and the anterior and posterior pituitary glands including hormones that control each part of the system.

25.5. Explain how taking potassium iodide before or immediately after exposure to nuclear fallout can prevent thyroid cancer.

25.6. Relate type 1 and type 2 diabetes to disruption of proper hormonal regulation of glucose levels.

25.7. Explain how body posture can affect the balance of your stress hormones.

25.8. Relate endocrine disruptors to functioning of thyroid and sex hormones.

25 The Process of Science: Do ‘Roids Cause Rage?

25.9. compare the advantages and disadvantages of synthetic hormone use.

25 Evolution Connection: Steroids and Male Aggression 25.10. Compare the effects of androgens among several vertebrates.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

25.1 Multiple Choice Questions 1) Hormones are usually transported through ________ and affect only cells with ________.

A) ducts... specific receptors B) intercellular junctions... cell junctions C) blood vessels... specific receptors D) blood vessels... cell junctions Answer: C Topic: 25.1 Hormones: An Overview Skill: Knowledge/Comprehension Learning Outcome: 25.3 2) If a cell is like a house, which one of the following is most similar to the way that a steroid hormone works?

A) A postal worker leaves mail for you at your front door.

B) A visitor to your home knocks on your front door.

C) Radio signals are received by a stereo in your bedroom.

D) You walk outside of your home to get a better signal on your cell phone.

Answer: C Topic: 25.1 Hormones: An Overview Skill: Application/Analysis Learning Outcome: 25.2 Global LO: 2 3) Hormones regulate ________.

A) growth, only B) reproduction, only C) metabolism, only D) Growth, reproduction, and metabolism are regulated by hormones.

Answer: D Topic: 25.1 Hormones: An Overview Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2 4) In general, hormones that bind to plasma membrane receptors ________.

A) are steroid hormones B) bind to DNA and cause changes in transcription C) cannot pass through cell membranes D) are produced in the interstitial fluid Answer: C Topic: 25.1 Hormones: An Overview Skill: Knowledge/Comprehension Learning Outcome: 25.2

2 .

5) Generally, a cell that is affected by a particular steroid hormone would be expected to have ________.

A) DNA sites that interact with the hormone B) a receptor inside the cell that binds the hormone C) a cell-surface receptor that binds the hormone D) enzymes that are activated or inactivated by the hormone's second messenger Answer: B Topic: 25.1 Hormones: An Overview Skill: Application/Analysis Learning Outcome: 25.2 Global LO: 2 6) Steroid hormones ________.

A) begin their action outside the membrane B) usually diffuse through the plasma membrane into target cells C) bind to receptors in the plasma membrane D) are water soluble Answer: B Topic: 25.1 Hormones: An Overview Skill: Knowledge/Comprehension Learning Outcome: 25.2 7) Steroid hormones ________.

A) usually trigger a signal transduction pathway when they bind to a membrane receptor B) usually bind to mRNA in the cytoplasm to initiate transcription C) usually bind to receptors in the cytoplasm or nucleus D) usually bind to rRNA to prevent translation Answer: C Topic: 25.1 Hormones: An Overview Skill: Knowledge/Comprehension Learning Outcome: 25.2 8) Water-soluble hormones can cause different effects in different cells depending on the type of cell and ________.

A) its signal transduction pathway B) the particular organelle that is targeted C) the binding of the hormone to either DNA or RNA D) the type of ribosomes in the cell Answer: A Topic: 25.1 Hormones: An Overview Skill: Knowledge/Comprehension Learning Outcome: 25.2

3 .

9) Which of the following has both endocrine and nonendocrine functions?

A) pancreas B) salivary gland C) anterior pituitary gland D) skeletal muscle Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 10) Which of the following is a nonsteroid hormone?

A) glucagon B) a progestin C) a glucocorticoid D) androgen Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.2 Global LO: 2 11) Which of the following is part of the brain?

A) thymus B) hypothalamus C) adrenal cortex D) thyroid Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 12) Which one of the following statements is TRUE? A) The anterior pituitary is composed of nervous tissue.

B) The anterior pituitary and posterior pituitary work together to secrete the same hormones.

C) Inhibiting hormones make the anterior pituitary secrete hormones.

D) The pituitary secretes hormones that influence numerous body functions.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.4

4 .

13) Follicle-stimulating hormone (FSH) is a hormone that ________.

A) helps to regulate the female menstrual cycle B) stimulates general body growth C) raises blood glucose levels D) regulates hair growth and skin growth Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 14) Which of the following hormones is made by the hypothalamus and released by the posterior pituitary?

A) estrogen B) growth hormone C) ADH D) insulin Answer: C Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.4 15) Which of these hormones acts in opposition to diuretics such as alcohol?

A) ADH B) glucagon C) HGH D) FSH Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2, 5 16) Which of the following choices INCORRECTLY pairs an endocrine gland or hormone with an aspect of metabolism that it regulates?

A) TSH–thyroid hormone B) pancreas–blood glucose levels C) prolactin–blood potassium levels D) ovary–female sexual characteristics Answer: C Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3

5 .

17) Which of the following hormones affects the greatest variety of cell types?

A) prolactin B) insulin C) growth hormone D) calcitonin Answer: C Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 18) Eating very spicy food stimulates the release of ________.

A) endorphins B) insulin C) glucagon D) calcitonin Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 Global LO: 5 19) One of your best friends loves to run long distances. You ask her what she enjoys about running. In addition to good physical fitness, she tells you that after a run she feels extra happy.

You suspect that her joy might be related to increased production of ________ by the anterior pituitary gland.

A) endorphins B) releasing hormones C) prolactin D) adrenalin Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2, 5 20) Which gland requires the element iodine to produce its hormones?

A) thyroid B) pineal C) anterior pituitary D) ovary Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3

6 .

21) ________ can be a symptom of hypothyroidism.

A) Goiter B) A low sperm count C) Graves' disease D) Hyperactivity Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 Global LO: 5 22) Which of the following best describes the relationship of insulin to glucagon?

A) They work together to prepare the body to deal with stress.

B) Insulin stimulates the pancreas to secrete glucagon.

C) High levels of insulin inhibit pancreatic secretion of glucagon.

D) They are antagonistic hormones.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.6 23) Which structure exerts primary control over the concentration of sugar in the blood?

A) liver B) pituitary C) pineal D) pancreas Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.6 24) When the concentration of glucose in the blood rises following the digestion of a meal, what is the hormonal response?

A) Increased amounts of both glucagon and insulin are released.

B) An increased amount of glucagon is released.

C) An increased amount of insulin is released.

D) Glucagon and insulin levels in the blood stay the same.

Answer: C Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.6

7 .

25) Which of the following hormones causes a rise in the concentration of glucose in the blood?

A) insulin B) glucagon C) melatonin D) calcitonin Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.6 26) What is the metabolic abnormality that underlies the characteristic symptoms of diabetes mellitus, such as frequent urination?

A) a failure of the kidney tubules to reabsorb enough glucose from the urine B) a failure of the gastrointestinal epithelium to absorb enough glucose from food C) an inability of the body's cells to retain glucose they have absorbed from the blood D) an inability of the body's cells to absorb enough glucose from the blood Answer: D Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.6 Global LO: 2, 5 27) Which of the following is almost always associated with being overweight and underactive?

A) type 1 diabetes B) type 2 diabetes C) type 3 diabetes D) hypoglycemia Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.6 Global LO: 5 28) Which of the following glands is located nearest the kidneys?

A) ovaries B) pineal gland C) thyroid gland D) adrenal glands Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3

8 .

29) Which of the following glands secretes hormones that enable the body to respond to stress?

A) pancreas B) adrenal C) pineal D) parathyroid Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 30) Epinephrine ________.

A) decreases metabolic rate B) decreases heart rate C) increases absorption of glucose by the digestive tract D) increases breathing rate Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 31) Which of the following is(are) mostly involved in a long-lasting response to stress?

A) mineralocorticoids B) glucocorticoids C) androgens D) oxytocin Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 32) Which of the following hormones can make a person susceptible to infection when administered for too long as a drug?

A) glucagon B) growth hormone C) glucocorticoids D) antidiuretic hormone Answer: C Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3

9 .

33) Hyposecretion of ________ may inhibit your response to stress.

A) ACTH B) insulin C) HGH D) prolactin Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2 34) Estrogens stimulate the development of ________.

A) breasts B) a low-pitched voice C) sperm production D) facial hair Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 35) Which of the following are sex hormones?

A) androgens, only B) estrogens, only C) progestins, only D) All of these are sex hormones.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 36) Which of the following is secreted by a sexually mature woman?

A) testosterone, only B) estrogen, only C) progestins, only D) All of these are secreted by a sexually mature woman.

Answer: D Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2

10 .

37) If body cells have too few receptors for insulin, ________.

A) the insulin level is likely to decrease B) the blood glucose level may rise to abnormal levels C) the liver will need to break down more glycogen D) more glucagon will be needed Answer: B Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.6 Global LO: 2, 5, 7 38) Nate is gaining weight, is often tired, and feels cold. His thyroid hormone level is high as is the level of TSH. Nate also has a goiter. Which of these diagnoses is the most likely for Nate's condition?

A) defective thyroid hormone receptors in his body cells B) insufficient iodine in his diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: A Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.3 Global LO: 2, 5, 7 39) Natalie is lethargic, has poor tolerance to cold, and the amount of thyroid hormone in her body is low even though the level of TSH is high. Natalie has a goiter. Which of these diagnoses is the most likely for Natalie's condition?

A) defective thyroid hormone receptors in the body cells B) insufficient iodine in the diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: B Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.3 Global LO: 2, 5, 7

11 .

40) Jenny is losing weight, has poor tolerance to heat, and has mood swings, high blood pressure, and a rapid heart rate. She has very high levels of thyroid hormone, high levels of TSH, and a goiter. Which of these diagnoses is the most likely for Jenny's condition?

A) defective thyroid hormone receptors in the body cells B) insufficient iodine in the diet C) defective receptors for thyroid hormone control by the anterior pituitary D) too much iodine in the diet Answer: C Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.3 Global LO: 2, 5, 7 41) Which of these is generally considered a benefit of synthetic hormones?

A) effects on kidney and liver B) cardiovascular effects C) increased hostility D) mimicking estrogen Answer: D Topic: 25 Biology and Society, 25.2 The Human Endocrine System, and 25 The Process of Science Skill: Knowledge/Comprehension Learning Outcome: 25.1 Global LO: 5 42) Which of these is an example of the action of an endocrine disruptor?

A) BPA in bottles affects particular glands.

B) Feedback from estrogen inhibits FSH. C) Lack of iodine prevents synthesis of adequate thyroid hormone.

D) Lowered levels of calcitonin causes increased bone density.

Answer: A Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.8 Global LO: 5

12 .

43) Many cases of pediatric thyroid cancer occurred after the 1986 Chernobyl nuclear accident in Ukraine and the cause was traced to milk containing iodine-131. Which of these might be the most effective method to prevent thyroid cancer increase following exposure to excessive radiation?

A) Do not allow anyone to drink any milk.

B) Give dairy cows large doses of iodine.

C) Give humans large doses of iodine before exposure.

D) Give people large doses of iodine a few days following exposure.

Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.5 Global LO: 2, 5 44) Which of these behaviors is NOT associated with androgens?

A) body-slamming elephant seals B) mating songs in frogs C) territorial battles in fish D) maturation of ovaries in bears Answer: D Topic: 25 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 25.10

13 .

25.2 Art Questions Please refer to the following art to answer the following questions.

1) What is special about the target cells that allows them to respond to the hormone? Only the target cells ________.

A) are close enough to the blood vessels to respond B) touch the blood vessels C) have specific receptors to the hormone D) located in organs next to the kidneys can respond Answer: C Topic: 25.1 Hormones: An Overview Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2

14 .

2) As this boxer is finishing his fight, which of these hormone is NOT likely to be elevated?

A) adrenalin B) ADH C) insulin D) androgens Answer: C Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.3, 25.9, 25.10 Global LO: 2, 3, 7 3) The hormone being released from the organs shown in the figure is likely to be ________.

A) adrenalin B) growth C) testosterone D) calcitonin Answer: C Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.3 Global LO: 2, 3 4) If the boxer wanted to be more confident and less stressed as he entered the fight, a good strategy would be to ________.

A) eat a large amount of carbohydrates to be sure glucose is properly regulated B) assume a power pose for a period of time before the fight C) drink milk to increase the amount of calcium in his blood D) take iodide tablets to insure that sufficient thyroxin is produced Answer: B Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.7 Global LO: 2, 5

15 .

5) Examine the figure below. If blood glucose levels decline, ________.

A) the pancreas releases more glucagon, which causes glucose to be released into the blood B) the pancreas releases more insulin, which causes glucose to be released into the blood C) body cells take up more glucose D) liver cells convert glucose to glycogen Answer: A Topic: 25.2 The Human Endocrine System Skill: Application/Analysis Learning Outcome: 25.6 Global LO: 2, 3

16 .

6) Examine the figure below. The behavior exhibited by these elephant seals is promoted by ________.

A) growth hormone, which has brought about full body size B) testosterone, which has brought about sexual maturity C) calcitonin, which has produced strong bones D) antagonistic hormones, which cause aggression Answer: B Topic: 25.2 The Human Endocrine System Skill: Knowledge/Comprehension Learning Outcome: 25.3 17 .

25.3 Scenario Questions Please read the following scenario to answer the following questions.

Osteoporosis is a disease characterized by loss of bone mass and an increased susceptibility to bone fractures. It threatens more than half of all Americans over the age of 50. Women are about four times more likely to suffer from the disease than men. Osteoporosis may progress undetected until bones become so weak that they break during common activities. Prevention of osteoporosis includes regular weight-bearing exercise, recommended intake of calcium and vitamin D, and avoidance of smoking and excessive alcohol.

1) Astronauts returning from long periods in space often have very fragile bones. This is likely related to ________.

A) overproduction of thyroid hormone B) lack of gravity C) diet lacking in calcium D) excessive production of ADH Answer: B Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.2 Global LO: 2, 5 2) Calcium levels are regulated by antagonistic hormones. This is likely because ________.

A) calcium has to be produced by the body and that production must be regulated B) bone formation occurs only during puberty when many other hormones are present, thus careful regulation is necessary C) both too much and too little calcium can have disastrous effects on the body, thus the levels need tight regulation D) calcium is needed to repair bone fractures, so antagonistic hormones make sure it is available when needed Answer: C Topic: 25.2 The Human Endocrine System Skill: Synthesis/Evaluation Learning Outcome: 25.3 Global LO: 2, 5

18 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 26 Reproduction and Development Chapter 26 Learning Outcomes 26.1 Unifying Concepts of Animal Reproduction 26.1. Relate the structures and functions necessary for sexual and asexual reproduction to the advantages and disadvantages of each.

26.2 Human Reproduction 26.2. Compare the structures and functions of the female and male human reproductive systems including the processes and products of oogenesis and spermatogenesis.

26.3. Relate cycling hormonal changes to physical changes in the female reproductive cycle.

26.3 Reproductive Health 26.4. Evaluate effectiveness of the most common methods of contraception as it relates to mechanism of action.

26.5. Link major types of sexually transmitted diseases to the organisms that cause them, the symptoms, and the advantages of being tested for them.

26.4 Human Development 26.6. Describe the events of fertilization including how the structure of sperm matches its functions.

26.7. Describe stages of animal development including how cell division, cell migration, cell signaling, and apoptosis influence the formation of the embryo.

26.8. Describe how the structures of umbilical cord, amnion, and placenta function in support of the embryo.

26.9. Describe the developmental changes that occur in each of the three trimesters of pregnancy and how maternal hormones affect the stages of birth, recovery, and lactation.

26.5 Reproductive Technologies 26.10. Describe how reproductive technologies can be used to treat infertility.

26 Biology and Society: New Ways of Making Babies 26 The Process of Science: Are Babies Conceived via In Vitro Fertilization as Healthy as Babies Conceived Naturally?

26.11. Describe some of the legal and physical problems associated with modern reproductive technologies.

26 Evolution Connection: The “Grandmother Hypothesis” 26.12. Explain how natural selection may have favored females who undergo menopause.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

26.1 Multiple Choice Questions 1) Which of the following is an aspect of asexual reproduction that is sometimes disadvantageous?

A) It allows animals that do not move around to produce offspring without finding mates.

B) It allows an animal to produce many offspring quickly.

C) It saves the time and energy of gamete production.

D) It produces genetically uniform populations.

Answer: D Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.1 2) Asexual reproduction ________.

A) creates individuals with unique combinations of genes B) generates enormous genetic variation C) is an effective way for animals to expand their population quickly and exploit an available environment D) provides greater adaptability to changing environments Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.1 3) Which of the following is associated with sexual reproduction?

A) fission, only B) fragmentation, only C) budding, only D) None of these are associated with sexual reproduction.

Answer: D Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.1 4) Hermaphrodites ________.

A) possess both male and female reproductive systems B) have the gonads of one sex but the external appearance of the other C) usually fertilize themselves D) have abnormal reproductive systems Answer: A Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.1

2 .

5) Reproductive systems with external fertilization are most common in ________.

A) populations with many more males than females B) animals that are widely dispersed C) aquatic animals D) populations with many more females than males Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.1 6) What advantage is associated with human testes located in an external sac rather than in the abdominal cavity?

A) a shorter distance that semen must travel during ejaculation B) the testes can be kept at a constant temperature C) the testes can be kept cooler than the body's interior D) the testes can enlarge at sexual maturity Answer: C Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2 7) Where in a woman's reproductive tract does fertilization most often take place?

A) in the ovary B) in the oviduct C) in the follicle D) in the uterus Answer: B Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2 Global LO: 5 8) What moves the human egg through the oviduct?

A) the beating of the egg's cilia B) rhythmic contractions of the oviduct C) rhythmic contractions of the uterus D) the beating of cilia in the oviduct Answer: D Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2

3 .

9) Where does the embryo normally implant?

A) in the oviduct B) in the corpus luteum C) in the follicle of the ovary D) in the endometrium of the uterus Answer: D Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2 Global LO: 5 10) In a human female reproductive system, the ________.

A) hymen partly covers the cervical opening B) vagina secretes hormones that help maintain the uterine lining C) labia minora are a pair of thick, fatty ridges that protect the entire genital region D) outer features are collectively called the vulva Answer: D Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2 11) Which one of the following statements is TRUE? A) Meiosis in oogenesis produces four mature eggs from one primary oocyte.

B) Oogenesis begins during puberty.

C) Spermatogenesis in an individual begins before that individual is born.

D) Oogenesis in humans is completed after stimulation by sperm.

Answer: D Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.2 12) All of these are similarities between the male and female system EXCEPT one. Choose the exception.

A) Both have erectile tissue that becomes engorged with blood during sexual excitement.

B) Both have paired gamete-producing organs.

C) Both have a urethra that carries both urine and gametes.

D) Both have a pair of tubes that can carry gametes.

Answer: C Topic: 26.2 Human Reproduction Skill: Application/Analysis Learning Outcome: 26.2 Global LO: 2

4 .

13) Researchers have found a general relationship between testicular cancer and exercise.

Increased exercise is associated with a decrease in incidence of testicular cancer. However, a positive relationship (increased incidence of testicular cancer) was found between testicular cancer and riding bikes or horses. Several factors might be hypothesized to bring about this result. All but one of the following statements are reasonable hypotheses that researchers might follow to seek the cause for this relationship. Choose the exception.

A) Riding bikes or horses causes trauma to the testes.

B) The seat on bikes and the saddle on horses are made of material containing chemicals that damage testicular cells.

C) Riding bikes or horses increases scrotal temperature, which damages testicular cells.

D) Mutations that lead to testicular cancer make men more likely to ride bikes or horses.

Answer: D Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 5, 9 14) Researchers have found a general relationship between testicular cancer and exercise.

Increased exercise is associated with a decrease in incidence of testicular cancer. However, a positive relationship (increased incidence of testicular cancer) was found between testicular cancer and riding bikes or horses. Several factors might be hypothesized to bring about this result. Which of these hypotheses is properly related to a prediction that arises from it?

A) Hypothesis: Riding bikes or horses causes trauma to the testes. Prediction: Bike or horse riding will cause testes to shrink.

B) Hypothesis: The seat on bikes and the saddle on horses are made of material containing chemicals that damage testicular cells. Prediction: Chemicals found in bike seats or horse saddles damage testicular cells.

C) Hypothesis: Riding bikes or horses increases scrotal temperature, which damages testicular cells. Prediction: Bike riders are more likely to wear briefs than boxers as their underwear of choice.

D) Hypothesis: Mutations that lead to testicular cancer make men more likely to ride bikes or horses. Prediction: Men who ride bikes or horses have a higher rate of mutations than nonriders.

Answer: B Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9 15) Menstruation ________.

A) involves the breakdown of the endometrium B) is stimulated by HCG C) occurs after ovulation but prior to degeneration of the follicle D) is triggered by an LH surge Answer: A Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.3 5 .

16) In human females, the ovarian cycle begins when the ________.

A) levels of estrogen reach their maximum B) hypothalamus stimulates the anterior pituitary to increase its output of FSH and LH C) level of progesterone drops precipitously D) levels of FSH and LH drop precipitously Answer: B Topic: 26.2 Human Reproduction Skill: Knowledge/Comprehension Learning Outcome: 26.3 17) What would happen if an embryo failed to secrete HCG? A) The maternal elements of the placenta would fail to develop.

B) The fetal elements of the placenta would fail to develop.

C) Neural tube formation would not occur, and the embryo would not have a brain.

D) The embryo would be aborted.

Answer: D Topic: 26.2 Human Reproduction Skill: Application/Analysis Learning Outcome: 26.3 Global LO: 2, 5 18) Which one of the following statements is TRUE? A) Natural family planning is one of the most reliable forms of birth control.

B) Morning-after pills are about 25% effective at preventing pregnancy.

C) Tubal ligation prevents ovulation.

D) A vasectomy involves removing a section of each vas deferens.

Answer: D Topic: 26.3 Reproductive Health Skill: Knowledge/Comprehension Learning Outcome: 26.4 Global LO: 5 19) Which of the following types of pathogens cause sexually transmitted diseases that are generally NOT curable?

A) bacteria B) viruses C) fungi D) insects Answer: B Topic: 26.3 Reproductive Health Skill: Knowledge/Comprehension Learning Outcome: 26.5 Global LO: 5

6 .

20) Which one of the following STDs is NOT caused by a virus?

A) AIDS B) chlamydia C) genital warts D) genital herpes Answer: B Topic: 26.3 Reproductive Health Skill: Knowledge/Comprehension Learning Outcome: 26.5 Global LO: 5 21) A sperm cell's acrosome ________.

A) contains the sperm's nucleus and is the part of the sperm that enters the egg during fertilization B) fuses with the plasma membrane of the egg cell C) contains enzymes that are released when the sperm encounters an egg and dissolves a hole in the jellylike matrix that surrounds the egg D) contains the sperm's mitochondria Answer: C Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.6 22) Which one of the following is the earliest event in the process of fertilization?

A) Sperm contact the jelly coat around the egg.

B) The sperm head plasma membrane fuses with the egg plasma membrane.

C) Enzymes from the acrosome are released.

D) The sperm nucleus enters the cytoplasm of the egg.

Answer: A Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.6 23) Which of these events occurs first?

A) gastrulation B) cleavage C) implantation D) formation of the placenta Answer: B Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7

7 .

24) Which of the following results from cleavage?

A) formation of the nervous system B) formation of the notochord C) formation of more cells D) segmentation Answer: C Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7 25) The liver, pancreas, and lining of the digestive tract come from ________.

A) ectoderm B) endoderm C) mesoderm D) endometrium Answer: B Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7 26) Gastrulation ________.

A) produces a solid ball of cells B) changes the blastocyst into an embryo that has three tissue layers C) changes the fertilized egg into a blastocyst D) changes a gastrula into a blastocyst Answer: B Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7 27) Mesoderm gives rise to the ________.

A) heart and kidneys B) brain and skin C) nervous system and thyroid D) liver and pancreas Answer: A Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7

8 .

28) Which one of the following is a result of programmed cell death?

A) formation of fingers in humans B) gastrulation C) formation of the notochord D) formation of the brain Answer: A Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.7 29) What is gestation?

A) conception B) fertilization C) development D) pregnancy Answer: D Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 Global LO: 5 30) The lifeline between the embryo and the placenta ________.

A) is derived from the yolk sac B) is derived from the amnion C) is called the "chorion" D) is called the "umbilical cord" Answer: D Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.8 31) When does the human embryo implant in the wall of the uterus?

A) within a few hours of fertilization B) about a day after conception C) about a week after conception D) just after gastrulation Answer: C Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 Global LO: 5

9 .

32) At about what point in gestation can an ultrasound exam determine the sex of the fetus?

A) about 4 weeks after fertilization B) at the end of the first trimester C) about 20 weeks after fertilization D) at the end of the second trimester Answer: B Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 Global LO: 5 33) At about what point in gestation does the fetal heartbeat become audible by stethoscope and the fetus's movements easily felt by the mother?

A) 15 weeks B) 20 weeks C) 25 weeks D) 30 weeks Answer: B Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 Global LO: 5 34) Which of the following processes dominates the third trimester of human development?

A) formation of internal organs B) formation of external features such as arms and legs C) growth D) organ formation Answer: C Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 Global LO: 5 35) Which of the following substances stimulates contractions in uterine smooth muscle during labor?

A) progesterone B) estrogen C) oxytocin D) prolactin Answer: C Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9

10 .

36) Which of the following correctly lists the three stages of labor, in the proper order?

A) dilation, expulsion, delivery of the placenta B) dilation, crowning, expulsion C) contractions, dilation, expulsion D) contractions, dilation, crowning Answer: A Topic: 26.4 Human Development Skill: Knowledge/Comprehension Learning Outcome: 26.9 37) Which of these is NOT a legal or physical disadvantage of current reproductive technologies?

A) Babies born as a result of In Vitro Fertilization have significantly higher rates of autism.

B) Surgery is necessary to remove eggs for In Vitro Fertilization.

C) Hormone injections to promote ovulation may cause the birth of multiples.

D) It is sometimes unclear how current law applies to babies born through current reproductive technologies.

Answer: A Topic: 26.5 Reproductive Technologies; 26 The Process of Science Skill: Knowledge/Comprehension Learning Outcome: 26.10, 26.11 Global LO: 5 38) The "grandmother hypothesis" suggests that natural selection may have favored a woman ________.

A) moving away from her children and grandchildren B) focusing her energy on caring for her grandchildren, instead of producing more children C) focusing her energy on the production of as many children as possible before reaching menopause D) helping her sisters produce more children Answer: B Topic: 26 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 26.12

11 .

26.2 Art Questions 1) The animal in the accompanying figure illustrates ________.

A) fission B) regeneration C) asexual reproduction D) growth of male reproductive structures Answer: C Topic: 26.1 Unifying Concepts of Animal Reproduction Skill: Application/Analysis Learning Outcome: 26.1 Global LO: 2, 3

12 .

2) The figure shows male reproductive anatomy. In a human male reproductive system, ________.

A) sperm mature in the urethra B) the vas deferens conducts sperm between the testis and epididymis C) the sperm travel through the sperm duct before reaching the urethra during ejaculation D) sperm mature in the prostate gland Answer: C Topic: 26.2 Human Reproduction Skill: Application/Analysis Learning Outcome: 26.2 Global LO: 2, 3 3) According to the diagram above, after a vasectomy (within the scrotal sac), ________.

A) secretions from the prostate can no longer reach the urethra B) secretions from the seminal vesicles can no longer reach the urethra C) secretions from the sperm duct can no longer reach the urethra D) sperm from the testes can no longer reach the urethra Answer: D Topic: 26.2 Human Reproduction Skill: Application/Analysis Learning Outcome: 26.2 Global LO: 2, 3, 5

13 .

4) The figure shows oogenesis. What is the function of the polar bodies that are produced during oogenesis? They are a mechanism that allows for ________.

A) the shedding of excess cytoplasm during the production of a haploid ovum B) the shedding of excess genetic material during the production of a haploid ovum C) the shedding of excess mitochondria during the production of a haploid ovum D) streamlining of the ovum so as to facilitate the penetration of an ovum by a sperm Answer: B Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 2

14 .

5) The figure shows a human embryo 31 days after conception. Which of the following structures is part of the placenta?

A) embryo B) chorion C) amnion D) yolk sac Answer: B Topic: 26.4 Human Development Skill: Application/Analysis Learning Outcome: 26.8 Global LO: 2, 3

15 .

6) Examine the embryo in the following figure. The hands and feet of this embryo appear paddle-like, with no distinct toes or fingers. What process is needed to define each of the toes and fingers?

A) programmed cell death B) neurulation C) gastrulation D) induction Answer: A Topic: 26.4 Human Development Skill: Application/Analysis Learning Outcome: 26.7 Global LO: 2, 3

16 .

7) What does the ovarian cycle image above illustrate?

A) A rise in the level of luteinizing hormone brings about ovulation.

B) A rise in the level of estrogen brings about ovulation.

C) The endometrium is thinner during the first half of the cycle than during the latter half.

D) A corpus luteum is necessary for ovulation.

Answer: A Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.3 Global LO: 2, 3, 5 8) What does the ovarian cycle image above illustrate?

A) The peak of luteinizing hormone occurs slightly before mid-cycle.

B) Ovulation occurs well before mid-cycle.

C) The level of luteinizing hormone does not change much during the cycle.

D) The level of progesterone spikes just before mid-cycle.

Answer: A Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.3 Global LO: 2, 3, 5

17 .

26.3 Scenario Questions Please read the following paragraph and then answer the following questions.

Birth control methods act at many points in the reproductive cycle. Some options, such as birth control pills, are highly effective at preventing pregnancy. However, only a few commonly available methods are effective at preventing the transmission of sexually transmitted disease (STD). The Center for Disease Control estimates that each year about 10 million new STD infections strike people ages 15 to 24.

1) Which of the following birth control methods provides the most effective protection against pregnancy and sexually transmitted disease for sexually active people?

A) the pill B) latex condoms C) a diaphragm D) the rhythm method Answer: B Topic: 26.3 Reproductive Health Skill: Application/Analysis Learning Outcome: 26.4 Global LO: 2, 3, 5 2) A diaphragm functions as a birth control device by ________.

A) preventing ovulation B) preventing implantation of an embryo C) stimulating the production of sperm-killing antibodies D) preventing the movement of sperm into the uterus Answer: D Topic: 26.3 Reproductive Health Skill: Application/Analysis Learning Outcome: 26.4 Global LO: 2, 3, 5 3) A vasectomy ________.

A) prevents the production of sperm in the testes B) prevents the production of semen C) prevents the movement of sperm out of the testes D) is an effective method to prevent the transmission of sexually transmitted disease Answer: C Topic: 26.3 Reproductive Health Skill: Application/Analysis Learning Outcome: 26.4 Global LO: 2, 3

18 .

Please read the following paragraph and then answer the following questions.

Two researchers addressed the generally accepted idea that boxer shorts are better for male fertility than briefs because they lower testicular temperature. They begin by saying, "Although this idea is regarded as dogma by many in the lay community and the changing of underwear type is a therapy frequently recommended by medical practitioners, there is a paucity of data measuring scrotal temperature as a function of underwear type. ("Munkelwitz, Robert, and Gilbert, Bruce R. "Are boxer shorts really better? A critical analysis of the role of underwear type in male subfertility." The Journal of Urology, 160.4 (1998): 1329—1333.)

4) What hypothesis are these authors testing?

A) Boxer shorts allow the scrotal sac to be more exposed to outside temperature than briefs do.

B) Boxer shorts fit more loosely than briefs.

C) Boxer shorts allow the scrotal sac to have a lower temperature than briefs do.

D) Men with impaired fertility are more likely to wear briefs than boxers.

Answer: C Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9 5) Which of these describes the best experimental design to test the idea that scrotal temperature is less with boxers than with briefs?

A) Take an equal number of men wearing boxers and men wearing briefs and have them go into a clinic and have their scrotal temperatures measured.

B) Recruit a number of men of approximately the same age and have some put on boxers and some put on briefs and then measure their scrotal temperatures.

C) Recruit a number of men of approximately the same age with half wearing boxers and half wearing briefs. Have them spend time in a room of the same constant temperature and then measure their scrotal temperatures.

D) Take the first 100 men who come into a fertility clinic, record who are wearing boxers and who are wearing briefs, and then measure their scrotal temperatures.

Answer: C Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9

19 .

6) The data below are average temperatures from an experiment with more than 100 men in boxers and in briefs.

Boxers Briefs Core Body temp 36.6 36.5 Surface skin temp 30.8 30.9 Scrotal skin temp 33.8 33.6 What conclusion can be drawn from these data?

A) Men who wore briefs were cooler overall than men who wore boxers.

B) The type of underwear men wear has no impact on fertility.

C) The generally held idea is confirmed that men who wear boxers have cooler scrotal temperatures than those who wear briefs.

D) Scrotal temperature is not significantly decreased by wearing boxers rather than briefs.

Answer: D Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 3, 4, 5, 7, 9 7) What data besides core, skin, and scrotal temperatures would be good to gather to support or reject the hypothesis that underwear type affects fertility?

A) the size and position of participants' testes B) the number and quality of sperm in wearers of each type of underwear C) the ability of participants to maintain temperature in very cold or very warm conditions D) the fertility of each man's partner Answer: B Topic: 26.2 Human Reproduction Skill: Synthesis/Evaluation Learning Outcome: 26.2 Global LO: 1, 2, 5, 7, 9

20 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 27 Nervous, Sensory, and Locomotor Systems Chapter 27 Learning Outcomes 27 Biology and Society: The Seismic Sense of Elephants 27 The Process of Science: How Do New Senses Arise?

27 Evolution Connection: Seeing UV 27.1. Describe adaptations for detecting sensory input in different animals and how those adaptations evolved.

27.1 An Overview of Animal Nervous Systems 27.2. Describe the structures and functions of neurons, nervous tissue, and organs, and how they are organized into and work together in the central and peripheral nervous systems and the different divisions of the peripheral nervous system.

27.3. Describe how electrical signals are sent through a neuron and into a receiving cell, including the cellular structures and chemicals needed, and how drugs can alter transmission of electrical signals.

27.2 The Human Nervous System: A Closer Look 27.4. Describe how neuroplasticity contributes to the normal functioning of the brain, and how alterations in neurological function are associated with diseases of the nervous system.

27.3 The Senses 27.5. List and describe the components of signal transduction, and explain how signal transduction is related to sensing and responding to external and internal conditions.

27.6. List and describe sensory systems that detect different environmental stimuli, including how sensory structures are related to their functions, and how alteration of structures leads to a loss of sensory function.

27.4 Locomotor Systems 27.7. Describe the structures, arrangement, and functions of the components of bones and joints, and how skeletal injury and disorders occur and are treated.

27.8. Describe the structures, arrangement, and functions of the components of a muscle.

27.9. Explain how a motor neuron signals a muscle fiber to contract, and describe an example of an animal using its sensory receptors, central nervous system, skeleton, and muscles to perform an activity.

Global learning outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

27.1 Multiple Choice Questions 1) What evolutionary adaptation allows elephants to migrate, meet, and mate over great distances?

A) echolocation B) electroreception C) magnetoreception D) seismic detection Answer: D Topic: 27 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 27.1 2) The two major divisions of the nervous system are the ________.

A) sympathetic and parasympathetic B) central nervous system (CNS) and peripheral nervous system (PNS) C) sensory and motor D) voluntary and involuntary Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2 3) The cells that carry electric signals from one part of the body to another in the nervous system are ________.

A) dendrites B) neurons C) effectors D) synapses Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2 4) In the nervous system, integration ________.

A) occurs at the axon B) inevitably results in the attainment of a threshold potential C) is the analysis and interpretation of sensory signals and the formulation of appropriate responses D) is the assimilation of memories Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2

2 .

5) Which of the following neurons are part of the peripheral nervous system?

A) sensory neuron and motor neuron B) interneuron neuron and motor neuron C) interneuron neuron and sensory neuron D) only motor neurons Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2 6) Multiple sclerosis involves primarily ________.

A) destruction of the medulla oblongata B) deterioration of the corpus callosum C) destruction of the myelin sheath D) deterioration of parts of the spinal cord Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2, 27.4 Global LO: 5 7) Which of these carry incoming messages toward the cell body of a neuron?

A) axons B) dendrites C) actin filaments D) supporting cells Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2 8) Outnumbering neurons by up to 50 to 1, which cells protect, insulate, and reinforce neurons?

A) sensory cells B) motor cells C) satellite cells D) supporting cells Answer: D Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.2

3 .

9) The minimum change in a membrane's voltage that must occur to trigger an action potential is called the ________.

A) threshold B) synaptic terminal C) membrane potential D) resting potential Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3 10) What causes the inside of a membrane to become positively charged during an action potential?

A) Negatively charged ions rush out.

B) Positively charged ions rush in.

C) Positively charged ions rush out.

D) Negatively charged ions rush in.

Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3 11) The movement of an action potential along a neuron is most like ________.

A) the ripples created by dropping a pebble into a pond, gradually decreasing in size as the waves spread apart B) a crowd at a sporting event doing the wave around a stadium C) a radio tower emitting a signal that reaches only a small region D) the sound of your voice spreading out as you yell loudly to your friend while at a park Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Application/Analysis Learning Outcome: 27.3 Global LO: 2 12) A neuron can relay a more intense signal by ________.

A) sending a stronger action potential B) sending more action potentials in a given amount of time C) sending an action potential that travels more quickly D) sending a longer action potential Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3

4 .

13) In a chemical synapse, what is the name of the gap between the sending and receiving cells?

A) synaptic terminal B) action potential C) synaptic cleft D) myelin sheath Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3 14) Which of the following neurotransmitters is associated with sleep, mood, attention, and learning?

A) acetylcholine B) epinephrine C) serotonin D) endorphins Answer: C Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3 15) Which of the following statements is TRUE? A) Heroin binds to endorphin receptors.

B) Caffeine increases the effects of neurotransmitters that normally suppress nerve signals.

C) Alcohol is a stimulant.

D) Nicotine is a depressant.

Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Knowledge/Comprehension Learning Outcome: 27.3 16) Where would we expect to find electrical synapses?

A) within the brain B) within the heart C) within the spinal cord D) between interneurons and motor neurons Answer: B Topic: 27.1 An Overview of Animal Nervous Systems Skill: Application/Analysis Learning Outcome: 27.3 Global LO: 2

5 .

17) Which of the following is(are) part of the central nervous system?

A) motor system B) brain and spinal cord C) brain only D) spinal cord only Answer: B Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.2 18) What part of the nervous system cushions the CNS and helps supply it with nutrients and hormones, and carries away wastes?

A) cerebrospinal fluid B) spinal cord C) interneurons D) the bones of the skull Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.2 19) Which of the following effects could result from activation of the sympathetic nervous system?

A) decreased heart rate B) stimulated digestive organs C) secretion of epinephrine D) narrowing of the bronchi Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.2 20) Realizing that you did not study as much as you needed to for this exam, you start to take the test. However, it is difficult to concentrate because your heart is racing, your stomach seems tied in a knot, you are breathing too quickly, and your mouth is dry. Most likely, you are experiencing the effects of the ________.

A) motor nervous system B) sympathetic division C) parasympathetic division D) central nervous system Answer: B Topic: 27.2 The Human Nervous System: A Closer Look Skill: Application/Analysis Learning Outcome: 27.2 Global LO: 2

6 .

21) You start to trip, but you keep your balance and don't fall. Which of the following brain regions is responsible for the rapid coordination of muscle activity that kept you from falling?

A) cerebral cortex B) thalamus C) cerebellum D) cerebrum Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Application/Analysis Learning Outcome: 27.2 Global LO: 2 22) Which, if any, of the following types of personal characteristics are based in the cerebral cortex?

A) reasoning abilities only B) artistic talents only C) personality traits only D) reasoning abilities, artistic talents, and personality traits Answer: D Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.2 23) Which one of the following correctly pairs the structure with its major function(s)?

A) hypothalamus–regulates body temperature, blood pressure, and hunger B) cerebellum–regulates memory, learning, and speech C) brainstem–is the input center for sensory data going to the cerebrum D) thalamus–coordinates balance Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.2 24) The cerebral cortex is highly folded. Why might this be an advantage for the functions of the cerebrum?

A) The increased surface area increases the area for higher-level thinking.

B) The increased surface area permits greater contact between the cerebrum and the cerebellum.

C) The folds form grooves that let the bones of the skull reach deeply down between brain regions.

D) The folds increase the areas where sensory receptors can reach the brain's surface.

Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.2 Global LO: 2

7 .

25) Which of the following was supported by the terrible accident that happened to Phineas Gage?

A) The cerebrum plays a major role in the sense of balance.

B) You cannot live without your hypothalamus.

C) The frontal lobes are associated with personality.

D) The pons plays a crucial role in hearing.

Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Application/Analysis Learning Outcome: 27.4 Global LO: 2 26) Alzheimer's disease is characterized by ________.

A) mental deterioration, memory loss, and personality changes B) extreme mood swings C) loss of energy and suicidal thoughts D) increased energy and extreme talkativeness Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Knowledge/Comprehension Learning Outcome: 27.4 Global LO: 5 27) The receptor potential is the ________.

A) membrane potential produced when a neurotransmitter molecule binds to its receptor B) membrane potential produced in the receptor cell by sensory transduction C) membrane potential produced as an all-or-none phenomenon D) membrane potential produced at a muscle cell Answer: B Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.5 28) Which of the following is an example of sensory adaptation of receptors?

A) going into deep sleep B) distinguishing between different colors C) ignoring the shoes on your feet D) detecting sound and light simultaneously Answer: C Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.5 Global LO: 2

8 .

29) In contrast to action potentials, receptor potentials ________.

A) are all-or-none phenomena B) vary in intensity C) do not require a stimulus D) do not rely on changes in the membrane potential Answer: B Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.5 30) In all types of chemoreceptors, receptor cells develop receptor potentials in response to ________.

A) changes in the movement of the surrounding molecules B) the electrical properties of the surrounding cells C) chemicals dissolved in a fluid such as blood or saliva D) the addition of positively charged proteins Answer: C Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 31) Standing out in center field, the baseball player watches the hitter's bat strike the ball and then, slightly later, hears the sound of the impact. What types of sensory receptors did the player just use?

A) thermoreceptors and chemoreceptors B) photoreceptors and mechanoreceptors C) chemoreceptors and pain receptors D) pain receptors and thermoreceptors Answer: B Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.6 Global LO: 2 32) Thermoreceptors detect ________.

A) motion B) sound C) pressure D) temperature Answer: D Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6

9 .

33) Which one of the following statements is TRUE? A) Cones are more sensitive to light than rods.

B) Rods can distinguish color.

C) There are three different types of cones in the human eye.

D) The human retina is completely covered with photoreceptors.

Answer: C Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 34) A person who cannot focus well on distant objects has ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: B Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 Global LO: 5 35) A person who has blurred vision caused by a misshapen lens or cornea has ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: C Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 Global LO: 5 36) A person whose eyeball is shorter than normal suffers from ________.

A) farsightedness B) nearsightedness C) astigmatism D) cataracts Answer: A Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 Global LO: 5

10 .

37) The organ of Corti is in the ________.

A) outer ear B) inner ear C) middle ear D) eardrum Answer: B Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 38) When you hear, the ________ vibrates.

I) eardrum II) hammer III) stirrup A) I B) II C) III D) I, II, and III Answer: D Topic: 27.3 The Senses Skill: Knowledge/Comprehension Learning Outcome: 27.6 39) Some adults with attention deficit hyperactivity disorder (ADHD) have abnormally low activity of the neurotransmitter involved in pleasure, attention, memory, sleep, movement, and learning, which increases their risk of drug abuse. Which drug are they most likely to abuse?

A) cocaine B) morphine C) codeine D) alcohol Answer: A Topic: 27.1 An Overview of Animal Nervous Systems, 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.3, 27.4 Global LO: 2, 5

11 .

40) If you lay your forearm along the table, you can rotate it so that your hand changes from a palm-down to a palm-up position. This is possible because your radius and ulna join at a ________ joint.

A) ball-and-socket B) hinge C) pivot D) twist Answer: C Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.7 Global LO: 2 41) Which one of the following is used to combat osteoporosis?

A) calcium and vitamin therapy B) anti-inflammatory medicines C) opiates D) splints or casts Answer: A Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.7 Global LO: 5 42) What best helps a broken bone heal?

A) grafting new bone to the region B) exercising the area with the broken bone C) taking calcium supplements D) returning the broken bone parts back to their natural shape and then immobilizing the bone Answer: D Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.7 Global LO: 5 43) Arthritis is a common result of aging, affecting persons' ability to ________.

A) catch their breath after exercise B) move their joints C) heal broken bones D) produce red blood cells Answer: B Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.7 Global LO: 2, 5

12 .

44) Muscles are connected to bones by ________.

A) thick filaments B) ligaments C) tendons D) myofibrils Answer: C Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.8 45) Functionally, what is the muscle fiber's fundamental unit of contraction?

A) thick filament B) thin filament C) myofibril D) sarcomere Answer: D Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.8 46) A thick filament is made up of ________.

A) actin B) myosin C) sarcomere D) actin and myosin Answer: B Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.8 47) According to the sliding-filament model of muscle contraction, a sarcomere contracts when its ________.

A) thick filaments slide across the ends of the sarcomere B) thin filaments slide across the ends of the sarcomere C) thin and thick filaments slide further away from each other D) thin and thick filaments slide past each other to get closer together Answer: D Topic: 27.4 Locomotor Systems Skill: Knowledge/Comprehension Learning Outcome: 27.8

13 .

48) Would you expect motor units to vary in size? If so, which of these structures would probably have the largest ones?

A) No; all motor units are the same size.

B) Yes; a motor unit in the thigh to control leg movements would be the largest one.

C) Yes; a motor unit that controls eye movements would be the largest one.

D) Yes; a motor unit that controls hand movements would be the largest one.

Answer: B Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.8 Global LO: 2 49) A baseball player leaping for a baseball and a cricket jumping away from a frog are both using ________.

I) sensory receptors II) the central nervous system III) a muscle system A) I only B) II only C) III only D) I, II, and III Answer: D Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.9 Global LO: 2 50) In a species, what is required for a new sensory adaptation to evolve by natural selection?

A) Individuals that needed this trait mutated a sensory receptor to create the new adaptation.

B) Individuals that possessed this trait produced more offspring than those that did not possess the trait.

C) Individuals that possessed this trait survived by chance, and passed on the trait to their offspring.

D) Individuals immigrated to a new area, and brought the trait with them.

Answer: B Topic: 27 The Process of Science, 27 Evolution connection Skill: Application/Analysis Learning Outcome: 27.1 Global LO: 2, 7

14 .

27.2 Art Questions 1) Examine the figure below. Once an action potential is triggered, ________.

A) the interior of the cell becomes positively charged relative to the outside B) the interior of the cell becomes negatively charged relative to the outside C) all ion channels close D) the cell soon reaches threshold Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Application/Analysis Learning Outcome: 27.3 Global LO: 2, 3

15 .

2) Examine the neurotransmitters in the synapse in the accompanying figure. What might happen to these neurotransmitters after step 4 is complete? The neurotransmitters ________.

A) are transported back to the sending neuron B) are transported into the receiving neuron C) remain in the synaptic cleft D) trigger an action potential in the sending neuron Answer: A Topic: 27.1 An Overview of Animal Nervous Systems Skill: Application/Analysis Learning Outcome: 27.3 Global LO: 2, 3

16 .

3) The figure shows the human eye. Which part of the eye gives the eye its color?

A) sclera B) iris C) pupil D) retina Answer: B Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.6 Global LO: 2, 3

17 .

4) The figure below shows the structure of an arm bone. Which part of a bone contains stored fat?

A) red bone marrow B) cartilage C) the ends D) yellow bone marrow Answer: D Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.7 Global LO: 2, 3

18 .

5) Examine the structure of a muscle cell in the accompanying figure. Which one of the following statements about muscle structure is TRUE?

19 .

A) Each muscle cell has one nucleus.

B) Each myofibril consists of many muscle cells.

C) Each muscle cell has one sarcomere.

D) A sarcomere contains thick and thin filaments.

Answer: D Topic: 27.4 Locomotor Systems Skill: Application/Analysis Learning Outcome: 27.8 Global LO: 2, 3 27.3 Scenario Questions Please read the following paragraph and then answer the following questions.

The human eye is an incredible organ, capable of gathering light to focus on images near and far, in bright light or dim, and with quick adjustments between these extremes. However, eyes can develop problems, such as floaters, which are small particles that interfere with the transmission of light between the lens and the retina, and bloodshot eyes, which occur when irritants such as dust or smoke get in the eye.

1) Eyes can become bloodshot when irritants in the eye trigger an increased blood flow to the connective tissue covering the eye. These swollen blood vessels are located on the ________.

A) cornea B) sclera C) iris D) lens Answer: B Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.6 Global LO: 2 2) If floaters are small particles that interfere with the transmission of light between the lens and the retina, they must be located in the ________.

A) pupil B) cornea C) jellylike fluid of the eye D) blind spot Answer: C Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.6 Global LO: 2

20 .

3) When light levels suddenly increase, our eyes adjust quickly by reducing the size of the ________.

A) pupil B) retina C) iris D) cornea Answer: A Topic: 27.3 The Senses Skill: Application/Analysis Learning Outcome: 27.6 Global LO: 2 Please read the following paragraph and then answer the following questions.

Huntington's disease is a genetic disorder in which a mutation causes the production of a protein, which damages cells in the brain. Symptoms typically begin with changes in personality, attention, and reasoning. Uncoordinated and uncontrolled movements develop, such that physical abilities become limited. Cognitive problems worsen into dementia. There is currently no cure for Huntington's disease.

4) Given the symptoms of Huntington's disease, which structure in the brain is being damaged by the abnormal protein?

A) cerebellum B) cerebrum C) hypothalamus D) brainstem Answer: B Topic: 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.4 Global LO: 2, 5, 7 5) Scientists hypothesize that the abnormal protein stops vesicles from moving through the cytoskeleton. Predict the effect of this protein on the nervous system.

A) Neurotransmitters cannot be released.

B) Receptor potentials cannot occur.

C) Cerebrospinal fluid leaks out of the brain.

D) Action potentials become smaller.

Answer: A Topic: 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.4 Global LO: 2, 5, 7

21 .

Please read the following paragraph and then answer the following questions.

Amyotrophic lateral sclerosis (ALS), or Lou Gehrig's disease, is a fatal disorder characterized by muscle weakness. Stumbling when walking or difficulty with using a hand is a typical early symptom. Individuals with ALS lose the ability to consciously control movement, though cognitive and sensory functions generally remain unimpaired. There is currently no cure for ALS. 6) Given the symptoms of ALS, what part of the nervous system is functioning abnormally?

A) autonomic nervous system B) central nervous system C) motor system D) sympathetic division Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.4 Global LO: 2, 5 7) In ALS, sensory input and integration are unaffected, and muscle cells still respond to neurotransmitters when they are present. Which structure would you recommend scientists to study to find a cure for ALS? A) sensory neurons B) interneurons C) motor neurons D) mechanoreceptors Answer: C Topic: 27.2 The Human Nervous System: A Closer Look Skill: Synthesis/Evaluation Learning Outcome: 27.4 Global LO: 2, 5

22 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 28 The Life of a Flowering Plant Chapter 28 Chapter Outcomes 28 Biology and Society: The Buzz on Coffee Plants 28.1. Describe the history of cultivation and consumption of plants such as coffee, and explain why the production of chemicals, such as caffeine by coffee plants, is adaptive.

28.1 The Structure and Function of a Flowering Plant 28.2. Compare the structures of monocots and eudicots.

28.3. Describe and compare the structures, functions, and development of root and shoot systems.

28.4. Describe and compare the structure, function, and arrangements of plant cells and tissues.

28.2 Plant Growth 28.5. Distinguish between annuals, biennials, and perennials.

28.6. Distinguish between primary and secondary growth.

28.3 The Life Cycle of a Flowering Plant 28.7. Describe the structures, functions, and formation of reproductive structures for a flowering plant during its life cycle.

28 Evolution Connection: The Problem of the Disappearing Bees 28.8. Explain how flowering plants and land animals each gain from their mutually beneficial relationship, and describe the latest threat to bees.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

28.1 Multiple Choice Questions 1) Which of the following products used by humans sometimes comes from plants?

A) fuel, only B) clothing, only C) food, only D) fuel, clothing, and food Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant, 28 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 28.1 Global LO: 5 2) Most domesticated food crops come from which of the following plant groups?

A) mosses B) gymnosperms C) ferns D) angiosperms Answer: D Topic: 28 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 28.1 Global LO: 5 3) Which of the following best characterizes the monocots?

A) embryo with one seed leaf, leaves with parallel veins, stems with vascular bundles scattered, and flower parts in threes B) embryo with one seed leaf, leaves with parallel veins, stems with a ring of vascular tissue, and flower parts in fives C) embryo with two seed leaves, leaf veins not parallel, stems with ring of vascular tissue, and flower parts in fives D) embryo with two seed leaves, leaf veins not parallel, stems with vascular bundles scattered, and flower parts in threes Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.2

2 .

4) Which of the following best characterizes the eudicots?

A) flower parts in threes B) leaves with parallel veins C) an embryo with two seed leaves D) stems with scattered vascular bundles Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.2 5) Which of the following is a function of roots?

A) absorbs water only B) absorbs nutrients from the soil only C) stores food only D) stores food and absorbs water and nutrients from the soil Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3 6) Which of the following are the tiny projections found on roots that increase the surface area?

A) root hairs B) cotyledons C) nodes D) mesophyll Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3 7) Which of the following constitute the shoot system of a plant?

I) leaves II) stems III) roots A) I only B) I and II C) II and III D) I, II, and III Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3

3 .

8) Which of the following describes the sites of leaf attachment in a stem?

A) joints B) nodes C) internodes D) cotyledons Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3 9) Which of the following is a stem modification for storage?

A) tuber B) petiole C) internode D) runner Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3 10) Which of the following best describes the primary function of typical leaves?

A) anchoring B) photosynthesis C) shade D) storage of the sugars produced Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3 11) Which of the following best describes the condition in which the terminal bud of many plants produces hormones that inhibit growth of axillary buds?

A) biennial B) secondary growth C) apical dominance D) germination Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.3

4 .

12) You trim two different houseplants. The first houseplant becomes bushier, but the pruning does not affect the growth of the second plant. A possible explanation is ________.

A) you removed the axillary bud on the first plant but not the second B) the second plant forms tubers, but the first plant does not C) the first plant has compound leaves and the second plant has simple leaves D) you removed the terminal bud on the first plant but not the second Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.3 Global LO: 2, 5 13) Which of the following describes the single layer of tightly packed cells that cover the entire root?

A) xylem B) root hairs C) epidermis D) endodermis Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 14) Which of the following describes the vascular system of a typical plant?

I) It is made up of xylem and phloem.

II) It provides support.

III) It transports nutrients throughout the plant.

A) I B) I and II C) I and III D) I, II, and III Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 15) Which of the following is the waxy coating secreted on leaves and most stems?

A) cuticle B) lignin C) endodermis D) epidermis Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4

5 .

16) The ________ is the selective barrier of a root that determines which substances pass between the cortex and vascular tissue.

A) epidermis B) endodermis C) cuticle D) xylem Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 17) Which of the following do guard cells act to regulate?

A) stomata B) cuticle C) epidermis D) root hairs Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 18) Which of the following is the main site of photosynthesis in a typical leaf?

A) epidermis B) endodermis C) mesophyll D) xylem Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 19) Which of the following is the major component of most plant cell walls?

A) chloroplasts B) lignin C) starch D) cellulose Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4

6 .

20) Which of the following cell types provide support in growing parts of a plant?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) water-conducting cells Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 21) Which of the following have thick secondary cell walls strengthened with lignin, and support plants like steel beams in a building?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) water-conducting cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 22) Which of the following are the most abundant cell type found in most plants?

A) parenchyma cells B) collenchyma cells C) sclerenchyma cells D) food-conducting cells Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 23) Which of the following form chains with overlapping ends to form a system of watercarrying tubes, and are dead when mature?

A) collenchyma cells B) sclerenchyma cells C) water-conducting cells D) food-conducting cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4

7 .

24) Which of the following form tubes and are alive when mature?

A) parenchyma cells B) collenchyma cells C) water-conducting cells D) food-conducting cells Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 25) Which of the following is a function of parenchyma cells?

I) food storage II) photosynthesis III) divide and develop to become other types of cells A) I B) II C) III D) I, II, and III Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.4 26) A tree grows wider each year because of ________.

I) apical meristem II) vascular cambium III) cork cambium A) I only B) II only C) II and III D) I, II, and III Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.3, 28.4 Global LO: 2 27) A plant grows taller through ________, which involves cell division in the ________.

A) primary growth... vascular cambium B) secondary growth... vascular cambium C) primary growth... apical meristem D) secondary growth... cork cambium Answer: C Topic: 28.2 Plant Growth Skill: Knowledge/Comprehension Learning Outcome: 28.6 8 .

28) Which of the following is responsible for the increase in girth (width) of trees?

A) primary growth B) secondary growth C) growth in apical meristems D) an increase in the width of vessel elements Answer: B Topic: 28.2 Plant Growth Skill: Knowledge/Comprehension Learning Outcome: 28.6 29) Which of the following plant types complete their life cycle in 2 years?

A) annuals only B) annuals and perennials C) biennials only D) perennials only Answer: C Topic: 28.2 Plant Growth Skill: Knowledge/Comprehension Learning Outcome: 28.5 30) A homeowner uses a nail to hang a "Home Sweet Home" sign on the trunk of an oak tree.

The sign is 2 meters above the ground. The tree grows in height at a rate of 10 cm per year. How high above the ground will the sign be in 15 years?

A) 1.5 meters B) 2 meters C) 3.5 meters D) 152 meters Answer: B Topic: 28.2 Plant Growth Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2, 4 31) Flowering plants reproduce through ________.

A) asexual reproduction only B) sexual reproduction only C) asexual reproduction and sexual reproduction D) budding Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7

9 .

32) Which of the following is the part of a flower that contains the female reproductive structures?

A) carpel B) stamen C) sepal D) petal Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 33) In which structure do pollen grains develop?

A) stamen B) sepal C) filament D) anther Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 34) The ________ enclose and protect the flower bud, while the ________ advertise the flower to insects and other pollinators.

A) anthers... petals B) carpels... stigmata C) sepals... stamens D) sepals... petals Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 35) The main parts of a flower are modified versions of which of the following?

A) stems B) rhizomes C) internodes D) leaves Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7

10 .

36) Which of the following contains the developing egg and cells that support it?

A) endosperm B) ovule C) anther D) stigma Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 37) A plant's diploid form is called the ________; the haploid form is called the ________.

A) sporophyte... pollen B) sporophyte... gametophyte C) gametophyte... sporophyte D) gametophyte... fruit Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 38) Which of the following describes the delivery of pollen to the stigma?

A) fertilization B) double fertilization C) germination D) pollination Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 39) The formation of a zygote and a cell with a triploid nucleus is unique to flowering plants.

What is this process called?

A) fertilization B) double fertilization C) germination D) pollination Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7

11 .

40) Which of the following is a multicellular mass that nourishes the embryo until it becomes a self-supporting seedling?

A) the endosperm B) a seed coat C) a fruit D) a cotyledon Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 41) What typically has to happen before a fruit develops?

I) flowering II) pollination III) double fertilization A) I only B) I and II C) II and III D) I, II, and III Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 42) While on a hike, you notice that several burrs have become attached to your socks. You quickly pull them off. Inside the burr are several seeds. Burrs are produced by certain plants and frequently catch on animal fur (or people's clothing). After thinking about it, you decide that the burr is a type of ________ that is an adaptation for ________.

A) leaf...protecting plants from herbivores B) fruit...seed dispersal C) cambium...seed protection D) pollen grain...successful pollination Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.7, 28.8 Global LO: 2 43) Which of the following is the usual trigger for seed germination?

A) water B) warm temperatures C) oxygen D) sunlight Answer: A Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Knowledge/Comprehension Learning Outcome: 28.7 12 .

44) The diploid number for the tomato, a eudicot, is 24. One of its pollen grains has ________ chromosomes, and the nutritive tissue of the seed has ________ chromosomes.

A) 12… 12 B) 12… 24 C) 24… 24 D) 24… 36 Answer: D Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.7 Global LO: 2, 4, 5, 7 45) Unlike angiosperms, gymnosperms like pines have single instead of double fertilization, but otherwise have an identical life cycle. What structure should have the greatest difference between angiosperms and gymnosperms?

A) egg cell B) seedling C) seed D) leaf cell Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Synthesis/Evaluation Learning Outcome: 28.7 Global LO: 2 46) Which of the following is an example of flowering plant/animal interdependence?

I) Most angiosperms depend on insects, birds, or mammals for pollination.

II) Most angiosperms depend on insects, birds, or mammals for seed dispersal.

III) Most land animals depend on angiosperms for food.

A) I only B) I and II C) III only D) I, II, and III Answer: D Topic: 28 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 28.8

13 .

47) Bermudagrass is a plant that is commonly used on golf courses. It has a fibrous root system, and its leaf veins are parallel. Because it is mowed on a regular basis in golf courses, it spreads via horizontal stems that root at the nodes, rather than by seed. It can live for many years. What is the best classification for bermudagrass on a golf course?

A) It is a perennial monocot that reproduces asexually.

B) It is an annual eudicot that reproduces asexually.

C) It is a perennial eudicot that reproduces sexually.

D) It is an annual monocot that reproduces sexually.

Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant; 28.2 Plant Growth 28.3 The Life Cycle of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.2, 28.5, 28.7 Global LO: 2, 5 48) Humans domesticated the rose from a wild ancestor with large, scented flowers. Why might fragrant chemicals in flowers be adaptive for wild roses?

A) They attract herbivores.

B) They repel seed dispersal agents.

C) They attract pollinators.

D) They prevent seed germination.

Answer: C Topic: 28 Biology and Society, 28 Evolution Connection Skill: Application/Analysis Learning Outcome: 28.1, 28.8 Global LO: 2, 5 49) In a sporophyte of an angiosperm, growth occurs at ________ via ________.

A) meristems… mitosis B) meristems… meiosis C) flowers… fertilization D) seeds… dispersal Answer: A Topic: 28.2 Plant Growth, 28.3 The Life Cycle of a Flowering Plant Skill: Synthesis/Evaluation Learning Outcome: 28.6, 28.7 Global LO: 2, 7

14 .

28.2 Art Questions 1) What is the likely effect of pruning a plant at the dotted line?

A) The plant will grow taller.

B) The plant will grow bushier.

C) The plant will produce flowers.

D) The plant will grow more roots.

Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.3 Global LO: 2, 3

15 .

2) The arrows in the figure below illustrate ________.

A) germination B) secondary growth C) meiosis D) primary growth Answer: D Topic: 28.2 Plant Growth Skill: Knowledge/Comprehension Learning Outcome: 28.6

16 .

3) Examine the figure below. Secondary growth involves cell division in the ________.

A) cork cambium and apical meristem B) vascular cambium and apical meristem C) vascular cambium and cork cambium D) secondary xylem and secondary phloem Answer: C Topic: 28.2 Plant Growth Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2, 3

17 .

4) Examine the figure below. What process has to occur to produce a haploid embryo sac?

A) meiosis B) meiosis followed by mitosis C) mitosis followed by meiosis D) mitosis Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.7 Global LO: 2, 3

18 .

Please refer to the following art of the cross-sections of two trees to answer the following questions.

5) How old are these trees?

A) 3.5 years old B) 7 years old C) 14 years old D) 28 years old Answer: B Topic: 28.2 Plant Growth Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2, 3 6) When were the cross-sections of these trees made?

A) before completion of the first year of growth B) in the spring C) later in the summer D) in the winter Answer: B Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2, 3 7) These trees most likely grew in an environment with ________.

A) constant cold temperatures B) constant warm temperatures C) alternating warm and cold seasons D) It is not possible to predict the temperatures of the trees' environment.

Answer: C Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2, 3, 7 19 .

8) Which statement CORRECTLY compares the growth of these two trees?

A) The two trees grew at the same rate.

B) The tree on the left grew at a slower rate than the tree on the right.

C) The tree on the left grew at a faster rate than the tree on the right.

D) The growth of the two trees cannot be compared with the images shown.

Answer: C Topic: 28.2 Plant Growth, 28 The Process of Science Skill: Synthesis/Evaluation Learning Outcome: 28.6 Global LO: 2, 3, 4 28.3 Scenario Questions Read the following scenario to answer the following questions.

In late 2006, bee workers in the United States started to notice a disturbing phenomenon: the sudden disappearance of honeybees from commercial hives. This mysterious condition was called "colony collapse disorder," and it has caused a drastic reduction in commercial honeybee populations all over the country. It is estimated that one-third of our food supply relies on bees and is in danger. Crops that rely most heavily on honeybees include apples, almonds, blueberries, and pumpkins. If colony collapse disorder cannot be cured or treated effectively, farmers may have to turn to other insects, perhaps other bee species or even moths.

1) Without honeybees, which process in the life cycle of plants such as apples, almonds, blueberries, and pumpkins is most affected?

A) seed dispersal B) secondary growth C) pollination D) seed germination Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant, 28 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 28.7, 28.8 Global LO: 5 2) Which plant structure is adapted for attracting beneficial insects such as honeybees?

A) axillary bud B) terminal bud C) flower D) petiole Answer: C Topic: 28.3 The Life Cycle of a Flowering Plant, 28 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 28.8

20 .

Read the following scenario to answer the following questions.

The North American beaver is a large rodent that builds dams to convert freshwater streams into ponds. Beavers build their dams out of trees, which they cut down using their front teeth.

Beavers also eat the leaves and bark of trees, as well as the starchy roots of water lilies.

3) As a beaver chews from the outside to the inside of a tree, in what order does it encounter plant tissues?

A) secondary xylem ⇒ secondary phloem ⇒ cork ⇒ cork cambium ⇒ vascular cambium B) cork cambium ⇒ cork ⇒ secondary xylem ⇒ vascular cambium ⇒ secondary phloem C) cork ⇒ cork cambium ⇒ vascular cambium ⇒ secondary xylem ⇒ secondary phloem D) cork ⇒ cork cambium ⇒ secondary phloem ⇒ vascular cambium ⇒ secondary xylem Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.4 Global LO: 2 4) When a beaver is eating bark, what plant structures is it ingesting?

A) secondary phloem, cork cambium, and cork B) secondary xylem, secondary phloem, and cork cambium C) primary phloem, cortex, and endodermis D) primary xylem, vascular cambium, and primary phloem Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.4, 28.6 Global LO: 2 5) When a beaver is eating leaves, what plant structure(s) is it ingesting?

I) mesophyll II) parenchyma III) cork A) I B) II C) III D) I and II Answer: D Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.4 Global LO: 2

21 .

6) Water lilies store carbohydrates in their roots, which is why beavers like to eat water lily roots. What type of plant cells store these carbohydrates?

A) guard cells B) sclerenchyma cells C) parenchyma cells D) collenchyma cells Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.4 Global LO: 2 7) Beavers dams are sturdy, because the part of a tree that provides structural support when the tree is alive lends its strength to the dam, even after the tree is dead. What part of a tree provides this structural support?

A) heartwood B) bark C) collenchyma D) parenchyma Answer: A Topic: 28.2 Plant Growth Skill: Application/Analysis Learning Outcome: 28.6 Global LO: 2 8) Water lily shoots and roots have very little structural support because this support is not needed in aquatic habitats. What structures would you be LEAST likely to see in a water lily stem?

A) epidermis B) parenchyma C) sclerenchyma D) tracheids Answer: C Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Synthesis/Evaluation Learning Outcome: 28.4 Global LO: 2

22 .

Read the following scenario to answer the following questions.

The pineapple, grown for its sweet fruit, is a tropical monocot with a diploid number of 50. It can live for many years. The plant starts as one short stem with tough leaves. The flowers of the pineapple are located as a cluster at the very top of the stem. After pollination, the single fruit forms from the fusion of the ovaries of the flowers in the cluster. The seeds are located just underneath the surface of the fruit. The pineapple fruit is harvested by cutting at the base of the fruit. After the first fruit is produced, side shoots grow from the main stem, which can go on to produce additional fruits.

9) The first pineapple on a plant develops from ________, whereas the pineapples from the second harvest of the same plant develop from ________.

A) the terminal bud… the axillary buds B) the terminal bud… the root caps C) the axillary bud… the terminal buds D) primary growth… secondary growth Answer: A Topic: 28.1 The Structure and Function of a Flowering Plant, 28.2 Plant Growth Skill: Application/Analysis Learning Outcome: 28.3, 28.6 Global LO: 2 10) What evidence best supports the pineapple's classification as a monocot?

A) It does not produce woody tissue.

B) It produces a fruit.

C) Its flowers have three petals each.

D) It has double fertilization.

Answer: B Topic: 28.1 The Structure and Function of a Flowering Plant Skill: Application/Analysis Learning Outcome: 28.2 Global LO: 2 23 .

11) Where would we expect to find cells with 25 unpaired chromosomes in a pineapple plant?

A) in the leaves B) in the ovaries prior to pollination C) in the fruit D) in the fused ovaries Answer: B Topic: 28.3 The Life Cycle of a Flowering Plant Skill: Synthesis/Evaluation Learning Outcome: 28.7 Global LO: 2

24 .

Campbell Essential Biology, 6e (Simon/Dickey/Hogan/Reece) Chapter 29 The Working Plant Chapter 29 Learning Outcomes 29 Biology and Society: Planting Hope in the Wake of Disaster 29.1. Explain how phytoremediation is helping to address the damage caused by the 2011 earthquake disaster that struck Japan.

29.1 How Plants Acquire and Transport Nutrients 29.2. Describe where and how a plant obtains all the materials necessary to construct all the organic materials it needs, including the adaptations used to obtain them.

29.3. Distinguish between micronutrients and macronutrients, noting examples of each.

29.4. Describe what constitutes organic farming, and list advantages of this type of farming.

29.5. Explain the cohesion-tension hypothesis responsible for the ascent of sap in xylem, and the plant structures involved.

29.6. Explain how, when, and where phloem conducts sap.

29.2 Plant Hormones 29.7. Describe the general roles and properties of plant hormones, the specific roles of the five major types, and how they are studied and used by humans to manipulate plants.

29.3 Response to Stimuli 29.8. Define phototropism, gravitropism, and thigmotropism and explain their significance in plants.

29.9. Distinguish between short-night plants and long-night plants.

29 Evolution Connection: Plants, Bugs, and People 29.10. Explain how interacting organisms affect each other’s fitness.

Global Learning Outcomes 1.

Demonstrate an understanding of the principles of scientific inquiry.

2.

Demonstrate the ability to think critically and employ critical-thinking skills.

3.

Read and interpret models, graphs, and data.

4.

Demonstrate the quantitative skills needed to succeed in biology.

5.

Demonstrate an understanding of the impact of science on society.

6.

Evaluate the credibility of scientific information from various sources.

7.

Demonstrate the ability to make connections between concepts across biology.

8.

Communicate effectively in writing.

9.

Apply the scientific method to interpret information and draw conclusions.

1 .

29.1 Multiple Choice Questions 1) In phytoremediation, plants are used to remove ________ and ________ from the soil.

A) carbon… heavy metals B) radioactive isotopes… heavy metals C) nitrogen… phosphorus D) water… sulfur Answer: B Topic: 29 Biology and Society Skill: Knowledge/Comprehension Learning Outcome: 29.1 Global LO: 5 2) Which of the following BEST describes the essential difference between plant and animal nutrition?

A) Plants use inorganic substances and energy from the sun to produce their own food.

B) Plants use organic substances to produce their own food.

C) Plants absorb food through their roots.

D) Plant and animal nutrition are essentially the same.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 Global LO: 7 3) For a plant, carbon and nitrogen are ________.

A) macronutrients B) micronutrients C) minerals D) compost Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.3

2 .

4) Which of the following describes a chemical element that a plant must obtain from its environment in order to complete its life cycle?

A) macronutrient B) micronutrient C) essential element D) mineral Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 5) Which one of the following is a plant micronutrient?

A) iron B) oxygen C) sulfur D) phosphorus Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.3 6) The three most important nutrients contained in fertilizers are ________.

A) nitrogen, iron, and phosphorus B) zinc, sulfur, and phosphorus C) nitrogen, phosphorus, and potassium D) zinc, iron, and potassium Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.3 Global LO: 5 7) Which of the following best describes substances that enter a plant through the root system?

A) They are dissolved in water.

B) They are obtained from the air.

C) They are organic molecules.

D) They are brought in through stomata.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2

3 .

8) Which of the following supplies water and minerals to a typical plant?

A) the air B) bacteria C) sunlight D) the soil Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 9) For plants, mycorrhizae are______.

A) parasitic B) mutualistic C) an adaptation for photosynthesis D) agricultural pests Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 10) What does a plant gain from a mycorrhizal relationship?

A) It allows roots to absorb water and solutes more rapidly.

B) It increases the surface area for photosynthesis.

C) It helps to break down complex molecules in the soil to release micronutrients.

D) It helps to break down decaying organic matter into essential plant nutrients.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 11) Which of the following convert atmospheric nitrogen to ammonium?

A) nitrifying bacteria B) nitrogen-fixing bacteria C) mycorrhizae D) ammonifying bacteria Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2

4 .

12) Which of the following convert soil ammonium to nitrate?

A) nitrifying bacteria B) ammonifying bacteria C) mycorrhizae D) nitrogen-fixing bacteria Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 13) Which of the following best describes the role of plant root nodules in plants such as peas and beans?

A) They house nitrogen-fixing bacteria.

B) They help absorb nutrients from the soil.

C) They house mycorrhizae.

D) They store nutrients.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 14) Most plants rely on bacteria to supply them with a usable form of which of the following substances?

A) nitrogen B) carbon dioxide C) water D) amino acids Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 15) Which of the following best describes the conversion that occurs during nitrogen fixation?

A) ammonium to nitrate B) nitrate to ammonium C) nitrogen to ammonium D) nitrogen to ammonium or nitrate Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2

5 .

16) Which of the following best describes transpiration?

A) the loss of oxygen from a plant B) evaporation from a plant's roots C) the bulk flow movement of water in a plant D) the loss of water from plant leaves through evaporation Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5 17) Which of the following mechanisms best explains how xylem sap moves up against the downward pull of gravity?

A) cohesion-tension hypothesis B) gravitropism C) phototropism D) expenditure of ATP Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5 18) Which of the following weather conditions would cause transpiration to be most rapid?

A) hot, humid weather B) cold, humid weather C) hot, dry weather D) windy, wet weather Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5 19) Which of the following best describes the opening and closing of the stomata in most plants?

A) They are open during the day and closed at night.

B) They are open at night and closed during the day.

C) They are open almost all of the time.

D) They are closed except for brief periods of time during the day.

Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5

6 .

20) Which of the following best describes the mechanism that causes stomata to open?

A) Water accumulates below the opening and eventually causes the stoma to open.

B) A large bubble of oxygen accumulates below the stoma and eventually causes it to open.

C) Two guard cells flanking each stoma control its opening by changing shape.

D) The internal pressure of xylem sap expands the leaf, stretching the stoma open.

Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5 21) Transpiration pulls water up a plant because of two mechanisms: ________ describes water molecules sticking together and ________ describes water molecules sticking to the walls of the xylem.

A) cohesion... adhesion B) adhesion... cohesion C) adhesion... gravity D) gravity... cohesion Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.5 22) Which of the following explains how phloem sap moves within a plant?

A) cohesion-tension mechanism B) gravity pulls the phloem sap down C) pressure-flow mechanism D) transpiration Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.6 23) A location in a plant where sugar is being received for storage or consumption is ________.

A) a sugar sink B) a sugar source C) phloem sap D) phloem tube Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.6

7 .

24) A farmer decides she wants to grow certified organic corn and sets out to meet all USDA standards to do so. Her crop grows well for the first 3 years; however, she notices during the 4th and 5th years that plants are getting smaller and producing much less corn. She has not altered farming practices and begins to wonder what is happening. She remembers someone mentioning planting peanuts every 3rd year in place of a corn crop, which leads to much healthier corn. Why would a farmer want to change to a different crop, especially something like peanuts?

A) Planting a legume like peanuts increases water retention in the soil, allowing the following year's corn crop to thrive.

B) Crop rotation with a legume like peanuts will increase nitrogen in the soil, reducing the need for chemical fertilizer.

C) Planting a legume like peanuts increases the available carbon in the soil.

D) Changing from corn to peanuts, a legume, allows the soil to "rest" for a year.

Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.2, 29.4 Global LO: 2, 5 25) In a strawberry plant in the summer, the leaves are ________ and the strawberry fruits are ________.

A) sugar sources… sugar sources B) sugar sources… sugar sinks C) sugar sinks… sugar sources D) sugar sinks… sugar sinks Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.6 Global LO: 2 26) Early in the spring, cherry trees produce flowers, even before their leaves develop, by using sugars that were stored in their roots the previous year. While cherry flowers are developing, we would expect the phloem pressure near flowers to be ________, and ________ near root storage cells.

A) high… high B) high… low C) low… low D) low… high Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.6 Global LO: 2

8 .

27) Trace the flow of a water molecule that is used during photosynthesis.

A) stoma → xylem → root hair → mycorrhiza B) soil → root hair → xylem → stoma → atmosphere C) soil → root hair → xylem → leaf cell D) soil → xylem → leaf cell → atmosphere Answer: C Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.5 Global LO: 2, 7 28) Which of the following statements is TRUE? A) A given hormone has the same effect on all parts of a plant.

B) A single hormone may have different effects depending on concentration and presence of other hormones.

C) Plants and animals use hormones in very different ways.

D) Large amounts of hormones are required to affect plant growth and development.

Answer: B Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 29) Which of the following plant hormones affect(s) development in the plant body?

I) auxin II) cytokinin III) gibberellin A) I B) I and II C) III D) I, II, and III Answer: D Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 30) Which of the following hormones promotes cell elongation in stems?

A) auxin B) cytokinin C) ethylene D) gibberellin Answer: A Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7

9 .

31) Which of the following best describes the condition of a twig if the auxin produced by its apical meristem is conveyed equally down all sides?

A) It will elongate.

B) It will branch near its tip.

C) It will produce a flower.

D) It will bend to one side.

Answer: A Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 32) Which of the following hormones promotes fruit ripening and dropping of leaves?

A) auxin B) ethylene C) gibberellin D) abscisic acid Answer: B Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 33) Which of the following hormones promotes cell division?

A) auxin B) cytokinin C) gibberellin D) abscisic acid Answer: B Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 34) Which of the following hormones promotes seed germination?

A) auxin B) ethylene C) gibberellin D) abscisic acid Answer: C Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7

10 .

35) Which of the following hormones promotes seed dormancy?

A) cytokinin B) ethylene C) gibberellin D) abscisic acid Answer: D Topic: 29.2 Plant Hormones Skill: Knowledge/Comprehension Learning Outcome: 29.7 36) Which of the following is exemplified by a pea tendril contacting a string or wire and coiling around it for support?

A) gravitropism B) photoperiod C) thigmotropism D) phototropism Answer: C Topic: 29.3 Response to Stimuli Skill: Knowledge/Comprehension Learning Outcome: 29.8 37) Experimental plants that were sent up in space shuttle missions did not exhibit all of their normal tropisms. Which of the following responses would you most expect to be lacking from these plants?

A) gravitropism B) photoperiod C) thigmotropism D) phototropism Answer: A Topic: 29.3 Response to Stimuli Skill: Application/Analysis Learning Outcome: 29.8 Global LO: 2 38) Which of the following best describes night-neutral plants?

A) The plants flower at night.

B) Plants tend to flower when nights become longer.

C) Plants tend to flower when nights become shorter.

D) The flowering in these plants is not affected by photoperiod.

Answer: D Topic: 29.3 Response to Stimuli Skill: Knowledge/Comprehension Learning Outcome: 29.9

11 .

39) Which of the following triggers flowering for plants sensitive to photoperiod?

A) temperature B) night length C) day length D) intensity of sunlight Answer: B Topic: 29.3 Response to Stimuli Skill: Knowledge/Comprehension Learning Outcome: 29.9 40) Which of the following best describe(s) the dependencies of most flowering plants?

I) Many depend on insects or other animals for pollination.

II) Many depend on insects or other animals for seed dispersal.

III) Many depend on fungi to help them acquire nutrients.

A) I B) II C) I and III D) I, II, and III Answer: D Topic: 29 Evolution Connection Skill: Knowledge/Comprehension Learning Outcome: 29.10 41) Across the globe, billions of people eat rice. In order to make rice grains (the seed), a rice plant must flower and be pollinated. Rice plants flower only after days become shorter (i.e., summer to autumn). What is the best classification for rice?

A) long night B) short night C) night neutral D) long day Answer: A Topic: 29.3 Response to Stimuli Skill: Application/Analysis Learning Outcome: 29.9 Global LO: 2, 5

12 .

42) Oats are eaten by humans as oatmeal or rolled oats, and as feed for livestock such as cattle.

In order for an oat plant to make the part we eat (the seed), it must flower and be pollinated.

Typically, oat plants flower when days are lengthening (i.e., late spring to early summer). What is the best classification for oat plants?

A) long night B) short night C) night neutral D) short day Answer: B Topic: 29.3 Response to Stimuli Skill: Application/Analysis Learning Outcome: 29.9 Global LO: 2, 5 43) Three very popular strawberry cultivars grown by farmers in the United States are Earliglow, Ozark Beauty, and Tristar. Earliglow produces all of its fruit in the early summer (June-bearing).

Ozark Beauty produces fruit from mid to late summer (everbearing). Tristar produces fruit all summer long, starting when conditions become favorable for flowering and fruit production.

What is the best classification for these three strawberry cultivars?

A) Earliglow: long night; Ozark Beauty: short night; Tristar: night neutral B) Earliglow: short night; Ozark Beauty: short night; Tristar: night neutral C) Earliglow: night neutral; Ozark Beauty: short night; Tristar: long night D) Earliglow: short night; Ozark Beauty: long night; Tristar: long neutral Answer: A Topic: 29.3 Response to Stimuli Skill: Synthesis/Evaluation Learning Outcome: 29.9 Global LO: 2, 5

13 .

29.2 Art Questions 1) Examine the figure below. Which of the following is the site of carbon dioxide uptake by a plant?

A) root hairs B) stomata C) rhizomes D) internodes Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.2 Global LO: 2, 3

14 .

2) Examine the figure above. Which of the following add ammonium to the soil by decomposing organic matter?

A) nitrifying bacteria only B) ammonifying bacteria only C) nitrogen-fixing bacteria only D) nitrifying bacteria and nitrogen fixing bacteria Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.2 Global LO: 2, 3 3) In the figure above, which of the following produce nitrogen in a form that can be used directly by the plant, without need for conversion?

A) nitrifying bacteria only B) ammonifying bacteria only C) nitrogen-fixing bacteria only D) ammonifying bacteria and nitrogen fixing bacteria Answer: D Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.2 Global LO: 2, 3

15 .

4) Examine the figure below. When considering the shaded side of a grass shoot, which of the following best describes why it bends toward the light?

A) Reduction in auxin levels allows gibberellins to promote cell elongation.

B) Reduction in gibberellin levels allows auxin to promote cell elongation.

C) Increase in auxin levels promotes cell elongation.

D) Increase in auxin levels promotes cell proliferation.

Answer: C Topic: 29.2 Plant Hormones Skill: Application/Analysis Learning Outcome: 29.7 Global LO: 2, 3

16 .

5) The figure below shows plants grown in the dark, and illustrates ________ in plants.

A) photoperiod B) gravitropism C) thigmotropism D) phototropism Answer: B Topic: 29.3 Response to Stimuli Skill: Application/Analysis Learning Outcome: 29.9 Global LO: 2, 3

17 .

6) The figure below shows plants originally grown in the dark, and then a light is added on one side only (arrow). Predict the response of the plants to the addition of the light source.

A) Auxin becomes concentrated on the lighted side of the plants, and the plants begin to grow toward the light.

B) Auxin becomes concentrated on the darker side of the plants, and the plants begin to grow toward the light.

C) Auxin becomes concentrated on the lighted side of the plants, and the plants begin to grow away from the light.

D) Auxin becomes concentrated on the darker side of the plants, and the plants begin to grow away from the light.

Answer: B Topic: 29.3 Response to Stimuli Skill: Application/Analysis Learning Outcome: 29.9 Global LO: 2, 3

18 .

7) A scientist finds seeds of an unknown plant on top of the soil in a desert. She measures the concentration of two hormones in these seeds. After it rains, she collects more of these seeds, and finds that the concentration of the two hormones has changed. A graph of her results is shown above. Identify the most likely hormones measured by the scientist.

A) hormone 1: gibberellin; hormone 2: cytokinin B) hormone 1: auxin; hormone 2: ethylene C) hormone 1: abscisic acid; hormone 2: gibberellin D) hormone 1: ethylene; hormone 2: auxin Answer: C Topic: 29.2 Plant Hormones Skill: Synthesis/Evaluation Learning Outcome: 29.7 Global LO: 2, 3 8) A scientist finds seeds of an unknown plant on top of the soil in a desert. She measures the concentration of two hormones in these seeds. After it rains, she collects more of these seeds, and finds that the concentration of the two hormones has changed. A graph of her results is shown above. If the scientist returns to the desert to collect more seeds, a few days later, what should she observe?

A) The seeds that are still in the desert will be dormant.

B) The seeds that are still in the desert will be germinating.

C) The seeds that are still in the desert will be dead.

D) The seeds that are still in the desert will have increased levels of hormones 1 and 2.

Answer: B Topic: 29.2 Plant Hormones Skill: Synthesis/Evaluation Learning Outcome: 29.7 Global LO: 2, 3

19 .

29.3 Scenario Questions Read the following scenario to answer the following questions.

Nitrogen shortage is a common nutritional problem for plants. In crops, a nitrogen deficiency can result in stunted growth as well as lower nutritional content. Farmers sometimes apply fertilizers containing nitrogen as well as other essential nutrients, such as phosphorus and potassium.

Compost can also be used to fertilize soils. Compost consists of vegetable matter that adds nutrients to soil as it is decomposed by microorganisms, fungi, and animals. Certain plants, including legumes such as peas and beans, house nitrogen-fixing bacteria in swellings called "root nodules." The bacteria have enzymes that help convert atmospheric N2 to ammonium ions that can be readily used by the plants. The plant, in turn, provides the bacteria with other nutrients. When conditions are favorable, root nodule bacteria fix so much nitrogen that the nodules secrete excess ammonia.

1) Some farmers practice crop rotation, alternating between planting nonlegumes such as corn or wheat one year and legumes the next year. What is the advantage of crop rotation?

A) The legumes in the rotation will transfer nitrogen, phosphorus, and potassium to the other crop plants.

B) Planting legumes enriches the soil for the next year when root nodule bacteria fix so much nitrogen that excess ammonia is secreted into the soil.

C) The nitrogen-fixing bacteria in legumes can migrate to nonlegume crop plants and provide them with nitrogen.

D) Any nitrogen fertilizer that is applied to the soil will be converted into ammonium ions by the nitrogen-fixing bacteria.

Answer: B Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Knowledge/Comprehension Learning Outcome: 29.2 Global LO: 5 2) Which approach could an organic farmer use to deal with nitrogen deficiency?

A) plant legumes in alternate years and fertilize the soil with compost B) apply synthetic fertilizers that provide nitrogen C) plant legumes in alternate years and use synthetic fertilizers D) use genetically modified plants that require less nitrogen Answer: A Topic: 29.1 How Plants Acquire and Transport Nutrients Skill: Application/Analysis Learning Outcome: 29.4 Global LO: 2, 5

20 .

Read the following scenario to answer the following questions.

In the late 1800s, Charles Darwin and his son Francis conducted the first experiments on phototropism. Several years later, their work was furthered by Peter Boysen-Jensen, Arpad Paal, and Frits Went. Peter Boysen-Jensen separated the tip of grass shoots from the rest of the plant using either tiny blocks of agar (a gelatin) or a mica wafer (an impervious rock). Like the Darwins, Boysen-Jensen noticed that the grass did not grow toward a light without its tips.

However, when he separated the tip from the rest of the plant using agar, the grass would grow toward a light. The grass would not grow toward a light if the tip of the shoot was separated using a mica wafer. Arpad Paal cut off the tips of grass shoots that were growing in the dark. He placed these cut tips back on the shoots, but with only part of the tip covering the cut surface, and found that the plants grew, in the dark, in the opposite direction from the side with the tip covering it. Lastly, Frits Went removed the tips of many grass shoots and placed them on a large block of agar for a few hours. Then, he cut up the agar block, and was able to make grass shoots without any tips at all grow toward a light by putting these agar blocks on the cut surfaces of the shoots (i.e., no tips were placed back on the shoots, only the agar).

3) Boysen-Jensen also used the mica to separate a tip of a grass shoot only partially, by cutting the tip halfway and inserting a wafer of mica into the cut. If this experiment supported the Darwins' hypothesis, what would Boysen-Jensen have observed?

A) The grass shoot would not grow toward a light.

B) The grass shoot would grow toward a light when the mica wafer was on the side of the grass that was facing the light.

C) The grass shoot would grow toward a light when the mica wafer was on the side of the grass that was shaded from the light.

D) The grass shoot would grow toward a light no matter which direction the light was coming from.

Answer: B Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Synthesis/Evaluation Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9 4) If Paal grew his plants using a light source that was directly overhead, what should he have observed?

A) The grass shoot would not grow.

B) The grass shoot would grow upward and straight.

C) The grass shoot would grow in the opposite direction from the side with the tip covering the cut surface.

D) The grass shoot would grow in the same direction as the side with the tip covering the cut surface.

Answer: C Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Synthesis/Evaluation Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9 21 .

5) If Wents placed his agar blocks only halfway on the cut surfaces of grass shoots with their tips removed, what should he have observed?

A) The grass shoot would not grow toward a light.

B) The grass shoot would grow toward a light when the agar block was on the side of the grass that was facing the light.

C) The grass shoot would grow toward a light when the agar block was on the side of the grass that was shaded from the light.

D) The grass shoot would grow toward a light no matter which direction the light was coming from.

Answer: C Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Synthesis/Evaluation Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9 6) Considering the experiments of the Darwins, Boysen-Jensen, Paal, and Went, what do you conclude about phototropism?

A) We still do not know the mechanism for phototropism.

B) The substance that regulates phototropism is produced in the tips of plants, and causes the same response even when it comes from an external source (not from the same individual).

C) For a plant to bend toward a light source, the substance that regulates phototropism must be able to move into cells on the same side as the light source.

D) The substance that regulates phototropism is distributed throughout a plant equally, but cells on the side away from the light source are the only ones that respond to the substance.

Answer: B Topic: 29.2 Plant Hormones, 29.3 Response to Stimuli Skill: Synthesis/Evaluation Learning Outcome: 29.8, 29.9 Global LO: 1, 2, 9

22 .