Human Genetics
Exam Solutions
Course Introduction
Human Genetics explores the principles of heredity in humans, focusing on the structure, function, and transmission of genetic material. This course covers molecular genetics, chromosomal abnormalities, patterns of inheritance, population genetics, and the genetic basis of human diseases. Students will examine the role of modern genetic technologies, such as gene editing and genomic analysis, in medicine and research, as well as ethical considerations and societal impacts. The course emphasizes the application of genetic concepts to real-world scenarios and equips students with a foundational understanding essential for further study in genetics, biotechnology, medicine, and related fields.
Recommended Textbook
Concepts of Genetics 3rd Edition by Robert J. Brooker
Available Study Resources on Quizplus
24 Chapters
913 Verified Questions
913 Flashcards
Source URL: https://quizplus.com/study-set/2386 Page 2
Chapter 1: Overview of Genetics
Available Study Resources on Quizplus for this Chatper
28 Verified Questions
28 Flashcards
Source URL: https://quizplus.com/quiz/47400
Sample Questions
Q1) ________ is the use of the information in gene sequences to synthesize functional proteins that affect cellular characteristics.
A) Loss-of-function mutation
B) Gene expression
C) The human genome project
D) Proteomics
Answer: B
Q2) If a geneticist is studying the prevalence of a trait in a species,they are at the ________ level of study.
A) population
B) organismal
C) cellular
D) molecular
Answer: A
Q3) Genetic variation is ultimately based upon which of the following?
A) morphological differences
B) variations in nucleotide sequence of the DNA
C) carbohydrate content of the cell
D) translation
Answer: B
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Reproduction and Chromosome Transmission
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/47401
Sample Questions
Q1) A karyotype is a(n)________.
A) organelle of eukaryotic cells
B) stage of prophase I in meiosis
C) division of the cytoplasmic material following mitosis
D) photographic representation of the chromosomes of a cell
Answer: D
Q2) Select traits associated with prokaryotic cells.Check all that apply.
A) Genetic information is contained within a nucleoid region.
B) Genetic material is organized as a single circular chromosome.
C) They have a cell wall surrounding their plasma membrane.
D) They have membrane-bound organelles in their cytoplasm.
Answer: A,B,C
Q3) Oogenesis is a gametogenic process in which cells undergo ________ to produce
A) binary fission; sperm cells
B) mitosis; egg cells
C) meiosis; egg cells
D) meiosis; sperm cells
E) mitosis; sperm cells
Answer: C
To view all questions and flashcards with answers, click on the resource link above. Page 4
Chapter 3: Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/47402
Sample Questions
Q1) In the biological sciences,the hypothesis is usually rejected if the P value is
A) greater than 1
B) less than 0.30
C) less than 0.95
D) less than 0.05
E) less than 1
Answer: D
Q2) An individual who has two identical alleles for a trait is said to be ________.
A) homozygous
B) heterozygous
C) isozygous
D) a variant
Answer: A
Q3) In a Punnett square diagram,the outside of the box represents the ________.
A) diploid offspring
B) haploid offspring
C) diploid gametes
D) haploid gametes
Answer: D
To view all questions and flashcards with answers, click on the resource link above. Page 5
Chapter 4: Sex Determination and Sex Chromosomes
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47403
Sample Questions
Q1) Who originally identified a highly condensed structure in the interphase of nuclei?
A) Lyon
B) Barr and Bertram
C) Ohno
Q2) The genetic control of X-inactivation is governed by a short region on the X chromosome called the ________.
A) Y-inactivation center (Yic)
B) condensation center
C) X-inactivation center (Xic)
D) X-initiation center
Q3) The Lyon hypothesis attempts to explain the molecular mechanism of ________.
A) X-inactivation
B) genomic imprinting
C) maternal inheritance
D) extra nuclear inheritance
Q4) In a Z-W system,which is considered to be the homogametic sex?
A) males
B) females
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: Extensions of Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47404
Sample Questions
Q1) In overdominance,the ________ genotype is beneficial over the ________ genotypes.
A) heterozygous; homozygous
B) homozygous; heterozygous
C) homozygous dominant; homozygous recessive
D) homozygous recessive; homozygous dominant
E) incomplete dominant; codominant
Q2) In rabbits,full coat color (C)is the dominant trait.A second allele,chinchilla (c ),is recessive to full coat color.Himalayan coat color (c )is recessive to chinchilla and full coat colors,and albino (c)is recessive to all coat colors.If two chinchilla rabbits mate,what coat color is not possible in their offspring?
A) full coat color
B) chinchilla coat color
C) himalayan coat color
D) albino coat color
E) All coat colors are possible.
Q3) Incomplete dominance is an example of blending of phenotypes,not genotypes.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 7
Chapter 6: Extranuclear Inheritance, Imprinting, and Maternal Effect
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/47405
Sample Questions
Q1) Differentially methylated regions (DMRs)are associated with which of the following?
A) X-inactivation
B) genomic imprinting
C) maternal inheritance
D) extranuclear inheritance
Q2) Which of the following is true regarding mt genomes?
A) They are approximately 17,000 bp in length in humans.
B) They are linear.
C) A single copy of the mt genome is found within the mitochondrial nucleus.
D) They have all the genes necessary for mitochondrial function.
Q3) How is a chloroplast genome similar to a prokaryotic genome?
A) They are both circular.
B) They both code for all the proteins they need for functioning.
C) They are both linear.
D) There is only one chromosome per cell or chloroplast.
Q4) The symbiotic relationship of purple bacteria and cyanobacteria with eukaryotic cells was beneficial to both cell types.
A)True
B)False
Page 8
To view all questions and flashcards with answers, click on the resource link above.
Chapter 7: Genetic Linkage and Mapping in Eukaryotes
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/47406
Sample Questions
Q1) The rearrangement of alleles by the process of crossing over is called genetic linkage.
A)True
B)False
Q2) In a mapping experiment with three genes,which phenotype should occur most often in the F offspring?
A) parental phenotypes
B) phenotypes of individuals with single crossover events
C) phenotypes of individuals with double crossover events
D) All of these choices should be equal in the F generation.
Q3) A map distance of 23.6 between two genes indicates which of the following?
A) The genes are 23.6 millimeters apart.
B) There are 23.6 other genes between the two genes of interest.
C) 23.6% of the offspring exhibit recombination between the two genes.
D) 23.6% of the offspring do not survive.
Q4) Map distances above 50 are considered unreliable due to the occurrence of double-crossovers between the genes.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Variation in Chromosome Structure and
Number
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/47407
Sample Questions
Q1) Which of the following describes an organism with two complete sets of chromosomes from two different species?
A) tetraploid
B) aneuploid
C) allodiploid
D) allotetraploid
Q2) The term ________ refers to genetic differences between members of the same species.
A) chromosomal variation
B) genetic variation
C) chromosomal deletions
D) polyploidy
Q3) If a disease is associated with copy number variation,that suggests that it is caused by the presence of
A) mRNA transcripts missing the translation STOP sequence.
B) a much longer version of a gene.
C) a duplicated or deleted copy of a gene.
D) extra telomeres.
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: Genetics in Bacteria
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/47408
Sample Questions
Q1) Small circular pieces of DNA,separate from the bacterial chromosome,are called
A) heteroduplexes
B) plasmids
C) relaxosomes
Q2) In conjugation,the strand of DNA that is transferred from the donor cell to the recipient cell is single stranded.
A)True
B)False
Q3) Which of the following matings would have the highest frequency of chromosomal gene transfer?
A) F x F
B) F' x F
C) Hfr x F
Q4) How do researchers interrupt the process of conjugation?
A) using tweezers
B) using a microscope
C) using a blender
D) using a special gene
To view all questions and flashcards with answers, click on the resource link above. Page 11
Chapter 10: Genetics of Viruses
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/47409
Sample Questions
Q1) The genetic material of HIV is single-stranded RNA.
A)True
B)False
Q2) A bacteriophage that is physically integrated into the host chromosome is called a
A) heteroduplex
B) envelope phage
C) prophage
D) plaque
Q3) What is the genetic material in the T4 bacteriophage?
A) double-stranded DNA
B) single-stranded DNA
C) single-stranded RNA
D) double-stranded RNA
Q4) Most biologists consider viruses to be living organisms,which are classified with the bacteria.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 12
Chapter 11: Molecular Structure of DNA and RNA
Available Study Resources on Quizplus for this Chatper
38 Verified Questions
38 Flashcards
Source URL: https://quizplus.com/quiz/47410
Sample Questions
Q1) Select the nucleotide found only in RNA.
A) cytosine
B) guanine
C) thymidine
D) adenine
E) uracil
Q2) How is the directionality of a DNA molecule described based on the orientation of sugar molecules within the strand?
A) left to right
B) top to bottom
C) 5 to 3
D) A to T or G to C
E) All DNA molecules are different in their directionality.
Q3) These individuals determined that DNA was the genetic material in T2 phage.
A) Hershey and Chase
B) Avery, Macleod, and McCarty
C) Watson and Crick
D) Creighton and McClintock
To view all questions and flashcards with answers, click on the resource link above.
13
Chapter 12: Molecular Structure of Chromosomes and Transposition
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47411
Sample Questions
Q1) What is the highest level of chromosome condensation?
A) radial loop domain
B) 30 nm fibers
C) double helix
D) nucleosome
E) heterochromatin
Q2) What feature(s)may be found in insertion elements?
A) inverted repeats
B) transposase gene
C) reverse transcriptase gene
D) antibiotic resistance gene
E) integrase gene
Q3) Which of the following is technically NOT part of the genetic information of a transposable element?
A) insertion elements
B) inverted repeats
C) direct repeats
D) transposase
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: Dna Replication and Recombination
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/47412
Sample Questions
Q1) DNA helicase enzymes move in what direction along the DNA during DNA replication?
A) 5 to 3
B) 3 to 5
C) They travel in both directions.
D) They remain stationary.
Q2) The proofreading of the DNA occurs in the ________.
A) 5 to 3 direction
B) 3 to 5 direction
C) both directions
Q3) A primosome consists of a polymerase and a single-stranded binding protein.
A)True
B)False
Q4) How many DNA polymerases are found in prokaryotes?
A) 5
B) 7
C) 9
D) 12
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: Gene Transcription and RNA Modification
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/47413
Sample Questions
Q1) How many general transcription factors are needed for eukaryotic translation?
A) 3
B) 4
C) 5
D) 6
Q2) What is the name of the transcription start site?
A) promoter
B) terminator
C) regulation sequences
D) transcription factors
Q3) What region in eukaryotic genes contains the majority of regulatory elements?
A) 0 to 50
B) 50 to 0
C) 50 to 100
D) 100 to 150
Q4) RNA polymerase I in eukaryotes produces which type of RNA?
A) snRNA
B) tRNA
C) 5S rRNA
D) 18S rRNA
Page 16
To view all questions and flashcards with answers, click on the resource link above.
Chapter 15: Translation of MRNA
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/47414
Sample Questions
Q1) How many amino acids are encoded by the following mRNA?
5 GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3
A) 8
B) 9
C) 10
D) 11
Q2) During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.
A)True
B)False
Q3) Francis Crick proposed the adaptor hypothesis,and later the adaptor was discovered to be ________.
A) siRNA
B) amino acid
C) tRNA
D) mRNA
E) micro RNA
Q4) The wobble base is the second base of a codon.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Gene Regulation in Bacteria
Available Study Resources on Quizplus for this Chatper
37 Verified Questions
37 Flashcards
Source URL: https://quizplus.com/quiz/47415
Sample Questions
Q1) The form of regulation that involves a physical change in the shape of an enzyme is called allosteric regulation.
A)True
B)False
Q2) What is the gene responsible for attenuation in the trp operon?
A) trpL
B) trpR
C) trpD
D) trpC
Q3) Which of the following is not an example of translational regulation in prokaryotes?
A) sterically blocking the ribosome
B) phosphorylation of an enzyme
C) incorporation of antisense RNA
D) altering the structure of the mRNA
Q4) In the lac operon,the operator is an example of a trans-effect genetic regulation.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
18
Chapter 17: Gene Regulation in Eukaryotes
Available Study Resources on Quizplus for this Chatper
55 Verified Questions
55 Flashcards
Source URL: https://quizplus.com/quiz/181990
Sample Questions
Q1) DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration.
A)True
B)False
Q2) Acetylation of histones results in
A) formation of an open chromatin structure.
B) removal of histones from the histone octomer.
C) formation of a closed chromatin structure.
D) termination of transcription.
Q3) Regulatory transcription factors may be regulated by A) phosphorylation.
B) binding of carbohydrates.
C) lipid modifications.
D) sulfation.
Q4) Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Non-Coding Rnas
Available Study Resources on Quizplus for this Chatper
24 Verified Questions
24 Flashcards
Source URL: https://quizplus.com/quiz/181991
Sample Questions
Q1) In order of their occurrence what are the steps in RNA interference?
A) Processing of RNA transcript by DGCR8, transport to cytoplasm, processing by Dicer, binding to RISC, binding to target mRNA
B) Processing by Dicer, processing of RNA transcript by DGCR8, transport to cytoplasm, binding to RISC, binding to target mRNA
C) Processing of RNA transcript by DGCR8, processing by Dicer, transport to cytoplasm, binding to RISC, binding to target mRNA
D) Processing of RNA transcript by DGCR8, binding to RISC, transport to cytoplasm, processing by Dicer, binding to target mRNA
Q2) A bacterial ncRNA called OxyS regulates translation by binding to the Shine-Dalgarno sequence,which prevents ribosome binding.What is the function of this ncRNA?
A) Blocker
B) Decoy
C) Ribozyme
D) Scaffold
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter 19: Gene Mutation and DNA Repair
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/47418
Sample Questions
Q1) Which environmental agent shown can induce mutations?
A) UV radiation
B) x-rays
C) gamma rays
D) All of the answers are correct.
Q2) After screening a colony of bacteria for a given gene,you discover 100 mutant colonies out of 3 million total colonies.What is the mutation frequency for this gene in the population?
A) 1.0 x 10
B) 1.0 x 10
C) 3.0 x 10
D) 3.3 x 10
Q3) What process repairs damage from UV radiation?
A) homologous recombination repair
B) direct repair
C) base excision repair
D) mismatch repair
E) nucleotide excision repair
To view all questions and flashcards with answers, click on the resource link above.
Chapter 20: Molecular Technologies
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/47419
Sample Questions
Q1) The first organism ever cloned by researchers was Dolly the sheep in 1997.
A)True
B)False
Q2) You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?
A) Lane 4
B) Lane 3
C) Lane 2
D) Lane 1
Q3) Since cDNA is made from RNA,it lacks introns and contains only the coding sequence for the functional protein.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 22
Chapter 21: Genomics
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/47420
Sample Questions
Q1) A small glass chip that contains thousands of microscopic pieces of DNA is called a DNA microarray.
A)True
B)False
Q2) A researcher isolates mRNA from healthy and diseased liver biopsies. Each mRNA sample is converted into cDNA and subjected to next-generation sequencing.Select all statements that describe this experiment and the possible results.
A) The researcher can identify transcripts that are more abundant in healthy liver than in diseased liver, which are candidate genes for further study.
B) The researcher can identify transcripts that are less abundant in healthy liver than in diseased liver, which are candidate genes for further study.
C) This is an RNA-Seq experiment.
D) This is a DNA microarray analysis.
E) Some genes' transcripts may be present in both samples but have different splice forms in healthy and diseased liver.
To view all questions and flashcards with answers, click on the resource link above.
23
Chapter 22: Medical Genetics and Cancer
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47421
Sample Questions
Q1) What are the general ways that tumor supressors and oncogenes act?
A) Tumor suppressors inhibit the cell cycle and oncogenes stimulate the cell cycle.
B) Oncogenes inhibit the cell cycle and tumor suppressors stimulate the cell cycle.
C) Both tumor suppressors and oncogenes stimulate the cell cycle.
D) Both tumor suppressors and oncogenes inhibit the cell cycle.
Q2) In the analysis of a family,you notice that males are more likely to contract a certain disease,and the daughters of affected males produce 50% of their sons affected with the disease.This disease is displaying which of the following patterns of inheritance?
A) X-linked recessive
B) autosomal recessive
C) autosomal dominant
D) None of these choices are correct.
Q3) What can cause epigenetic changes? (Select all that apply.)
A) DNA methylation
B) Histone acetylation
C) Histone methylation
D) Histone phosphorylation
To view all questions and flashcards with answers, click on the resource link above.
Page 24
Chapter 23: Population Genetics
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/47422
Sample Questions
Q1) How does inbreeding affect the Hardy-Weinberg equilibrium?
A) It makes it more likely for the population to remain in Hardy-Weinberg equilibrium.
B) It has no effect on the Hardy-Weinberg equilibrium.
C) It results in a higher level of either dominant or recessive homozygotes.
D) It results in a higher level of heterozygotes.
Q2) A population with an allele for a gene that constitutes 99% of the alleles in the population means that the population is called monomorphic for that gene.
A)True
B)False
Q3) You are preparing to perform DNA fingerprinting by PCR for the first time.Select the reagent that would result in complications in the interpretation of your results.
A) PCR primers that anneal to the repetitive region of the microsatellites
B) PCR primers that anneal to regions flanking the microsatellites
C) Human DNA
D) Taq polymerase
To view all questions and flashcards with answers, click on the resource link above.
25
Chapter 24: Quantitative Genetics
Available Study Resources on Quizplus for this Chatper
33 Verified Questions
33 Flashcards
Source URL: https://quizplus.com/quiz/47423
Sample Questions
Q1) Which of the following is incorrect concerning quantitative traits?
A) Individuals fall into distinct classes for comparison.
B) The phenotypic variation for the trait is continuous.
C) The frequency distribution follows a bell-shaped curve.
D) All of these choices are correct.
Q2) Realized heritability may be determined from artificial selection experiments.
A)True
B)False
Q3) The amount of phenotypic variation in a group that is due to genetic variation is called heritability.
A)True
B)False
Q4) Which of the following best describes the degrees of freedom for the calculation of variance?
A) (n + 1)
B) 2(n + 1)
C) (n - 1)/n
D) (n - 1)
To view all questions and flashcards with answers, click on the resource link above.
26