Animal Biodiversity and Conservation issue 33.2 (2010)

Formerly Miscel·lània Zoològica

2010

and

Animal Biodiversity Conservation 33.2

Dibuix de la coberta: Loxia curvirostra, Trencapinyes, Piquituerto Común, Common Crossbill de Jordi Domènech.

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de redacció / Secretaría de redacción / Editorial Office

Secretària de redacció / Secretaria de redacción / Managing Editor Montserrat Ferrer

Museu de Ciències Naturals Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail abc@bcn.cat

Consell assessor / Consejo asesor / Advisory Board Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Pere Abelló Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Javier Alba–Tercedor Univ. de Granada, Granada, Spain Russell Alpizar–Jara Univ. of Évora, Portugal Xavier Bellés Centre d' Investigació i Desenvolupament–CSIC, Barcelona, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain Michael J. Conroy Univ. of Georgia, Athens, USA Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain José Antonio Donazar Estación Biológica de Doñana–CSIC, Sevilla, Spain Gary D. Grossman Univ. of Georgia, Athens, USA Damià Jaume IMEDEA–CSIC, Univ. de les Illes Balears, Spain Jordi Lleonart Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Jorge M. Lobo Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain Pablo J. López–González Univ de Sevilla, Sevilla, Spain Juan José Negro Estación Biológica de Doñana–CSIC, Sevilla, Spain Vicente M. Ortuño Univ. de Alcalá de Henares, Alcalá de Henares, Spain Miquel Palmer IMEDEA–CSIC, Univ. de les Illes Balears, Spain Javier Perez–Barberia The Macaulay Institute, Scotland, United Kingdom Oscar Ramírez Inst. de Biologia Evolutiva UPF–CSIC, Barcelona, Spain Montserrat Ramón Inst. de Ciències del Mar CMIMA­–CSIC, Barcelona, Spain Ignacio Ribera Inst. de Biología Evolutiva CSIC–UPF, Barcelona, Spain Pedro Rincón Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain Alfredo Salvador Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Ciències Naturals de Barcelona, Barcelona, Spain Carles Vilà Estación Biológica de Doñana–CSIC, Sevilla, Spain Rafael Zardoya Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana–CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle–CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Jersey, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana–CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Barcelona, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 33.2, 2010 © 2010 Museu de Ciències Naturals, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Artipapel ISSN: 1578–665X Dipòsit legal: B–16.278–58 The journal is freely available online at: http://www.bcn.cat/ABC

Animal Biodiversity and Conservation 33.2 (2010)

119

Comunidades de ortópteros (Insecta, Orthoptera) en pastizales del Chaco Oriental Húmedo, Argentina M. E. Pocco, M. P. Damborsky & M. M. Cigliano

Pocco, M. E., Damborsky, M. P. & Cigliano, M. M., 2010. Comunidades de ortópteros (Insecta, Orthoptera) en pastizales del Chaco Oriental Húmedo, Argentina. Animal Biodiversity and Conservation, 33.2: 119–129.

Abstract Orthopteran communities (Insecta, Orthoptera) in grasslands of Eastern Humid Chaco, Argentina.— Species diversity and abundance of Orthoptera communities were estimated in two grasslands of Eastern Humid Chaco from 2006 to 2007. The greatest species diversity was recorded in the grassland with intensive livestock grazing and predominance of native plant species, whereas the abundance values were higher in the grassland without grazing and characterized by introduced plant species. In total, 25 Orthoptera species were collected during the study. Acrididae (Caelifera) was the most abundant and diverse family recorded. Staurorhectus longicornis, Dichromorpha australis and Orphulella punctata were the most abundant species; the last two species being recorded during the entire sampling period. The greatest abundance was recorded in December 2006. Abundance did not show any correlation with climatic variables.

Key words: Acridoidea, Species diversity, Abundance, Spatial and temporal variation.

Resumen Comunidades de ortópteros (Insecta, Orthoptera) en pastizales del Chaco Oriental Húmedo, Argentina.— La diversidad específica y abundancia de las comunidades de Orthoptera fueron estimadas en dos pastizales del Chaco Oriental Húmedo durante el período 2006–2007. El pastizal con pastoreo intenso de ganado bovino y predominancia de especies vegetales nativas se caracterizó por presentar la mayor diversidad específica y el pastizal libre de pastoreo, con predominancia de especies vegetales introducidas, se caracterizó por una mayor abundancia. En total, se registraron 25 especies de ortópteros, siendo la familia Acrididae (Caelifera) la más numerosa y diversa. Staurorhectus longicornis, Dichromorpha australis y Orphulella punctata fueron las especies más abundantes; registrándose las dos últimas durante todo el periodo de muestreo. La mayor abundancia se detectó en el mes de diciembre de 2006. La abundancia de individuos no estuvo correlacionada con ninguna de las variables climáticas consideradas.

Palabras clave: Acridoidea, Diversidad específica, Abundancia, Variación temporal y espacial.

(Received: 7 I 10; Conditional acceptance: 17 III 10; Final acceptance: 25 V 10) Martina E. Pocco & María Marta Cigliano, División Entomología, Museo de la Plata, CCT La Plata CEPAVE CONICET–UNLP, Paseo del Bosque s/n., 1900 La Plata (Argentina).– Miriam P. Damborsky, Depto. de Biología, Fac. de Ciencias Exactas y Naturales y Agrimensura–UNNE, Avda. Libertad 5470, 3400 Corrientes (Argentina).

Corresponding autor: M. E. Pocco. E–mail: martinapocco@fcnym.unlp.edu.ar

ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

120

Introducción Los ortópteros, representados por unas 25.000 especies (Eades & Otte, 2009), constituyen un componente común de la fauna de insectos terrestres, y se distribuyen en la mayoría de las regiones biogeográficas del mundo, siendo más diversos en los trópicos (Gangwere et al., 1997).

Los miembros de los dos subórdenes que comprenden los Orthoptera, Ensifera y Caelifera, son generalmente fitófagos aunque muchas especies son omnívoras. Revisten gran importancia en la dinámica de las redes tróficas de los biomas tropicales por constituir una fuente primaria de proteínas para aves, arañas y otros insectos (Nickle, 1992a, 1992b). Dentro de los Caelifera, la superfamilia Acridoidea, conocidos como tucuras o saltamontes, son los herbívoros dominantes en la mayoría de los sistemas de pastizal.

Como consumidores primarios son importantes en el ciclo de nutrientes y de energía, y en años de explosiones poblacionales, compiten con el ganado y la fauna silvestre por el forraje (Fielding & Brusven, 1995).

Dado su carácter de insectos herbívoros, un gran número de especies de Orthoptera son consideradas perjudiciales para las actividades agrícola–ganaderas; en la Argentina, la mayoría de las especies de importancia económica pertenece a la superfamilia Acridoidea (Cigliano & Lange, 1998).

La única especie de langosta presente en la Argentina, Schistocerca cancellata (Acrididae, Cyrtacanthacridinae), ha sido considerada desde mediados del siglo XIX una de las plagas más voraces en nuestro país. Desde 1954, la invasión de áreas agrícolas ha sido evitada mediante un sistema preventivo de control de ninfas en su área de recesión en las provincias de Catamarca y La Rioja, no obstante, la langosta persiste como una amenaza potencial para la agricultura (Carbonell et al., 2006; Hunter & Cosenzo, 1990). Asimismo, numerosas especies de tucuras, principalmente de las subfamilias de Acrididae: Melanoplinae y Gomphocerinae y de la familia Romaleidae están involucradas en los daños ocasionados al agro en la Argentina (Carbonell et al., 2006). En comparación con los daños ocasionados al agro por langostas y tucuras (suborden Caelifera), los perjuicios ocasionados por especies del suborden Ensifera (Gryllidae, Gryllotalpidae y Tettigoniidae) son mínimos (Cigliano & Lange, 1998).

Los estudios ecológicos de las comunidades de Acridoidea proveen información útil para definir los métodos más adecuados para su control o manejo (García Gutiérrez et al., 2006).

Algunas especies de Acridoidea presentan periódicamente explosiones poblacionales que ocasionan severos daños a la agricultura. Junto con algunos mamíferos se consideran los herbívoros más importantes en pastizales de las zonas templadas, donde se concentra la mayor producción de alimento para el hombre (Otte, 1981).

Si bien son numerosos los estudios acerca de la biología y la importancia ecológica y económica de estos insectos en diversas regiones del planeta

Pocco et al.

(Uvarov, 1966, 1977; Capinera, 1987; Chapman & Joern, 1990; Gangwere et al., 1997; Lockwood et al., 2000), la información sobre diferentes aspectos de la estructura y variación temporal y espacial de comunidades de estos insectos en la República Argentina aún es escasa, conociéndose solo registros para la región Pampeana (Zequín et al., 1999; Cigliano et al., 2000, 2002; Beltrame et al., 2001; De Wysiecki et al., 2004).

La región del Chaco Oriental Húmedo presenta una gran variedad de ambientes (bosques, esteros, bañados, sabanas, pastizales), lo que favorece la existencia de una considerable diversidad de fauna silvestre (Ginzburg & Adámoli, 2006).

El objetivo del presente estudio es estimar la variación temporal y espacial en la abundancia y diversidad de comunidades de Orthoptera, principalmente la superfamilia Acridoidea, en dos sistemas de pastizal en el Chaco Oriental Húmedo.

Material y métodos Área de estudio El área de estudio está localizada en la Estancia Los Alisos, Departamento Presidencia de la Plaza (27º 01' 49'' S; 59º 38' 18'' O), situada en el Centro–Este de la provincia del Chaco, a 120 km de Resistencia, Argentina. Pertenece a la región fitogeográfica denominada Provincia Chaqueña, distrito Chaco Oriental Húmedo (Cabrera, 1976).

El Chaco Oriental Húmedo es una extensa región que abarca la mitad oriental de Formosa y Chaco, Noroeste de Corrientes y Norte de Santa Fe. El clima es templado húmedo, con una temperatura media anual de 22ºC y temperaturas absolutas que pueden alcanzar máximas superiores a 40ºC y mínimas bajo cero. Las precipitaciones con registros máximos en el Este, son superiores a 1.300 mm y decaen en el Oeste a 750 mm El mínimo de precipitaciones se registra durante la estación invernal, en la que se presentan sequías y algunas heladas (Ginzburg & Adámoli, 2006). Áreas de muestreo Los muestreos se realizaron en dos pastizales: uno con alto grado de perturbación por pastoreo intenso de ganado bovino, con una extensión de 40 ha., designado como pastizal I (PI), y otro, denominado pastizal II (PII), con perturbación moderada, por el acceso restringido al ganado, y una extensión de 30 ha.

El pastizal I es un pastizal con evidencias notables de pastoreo, con dos estratos bien definidos, uno sobresaliente que alcanza unos 80 cm de altura, en el que se destacan por su abundancia Sporobolus indicus, Schizachyrium microstachyum y Paspalum sp. y un estrato bajo muy denso que no supera los 10 cm de altura con predominancia de Paspalum notatum, Cynodon dactylon, Desmodium canum, Oxalis sp. y Eryngium elegans. En algunos sitios se encuentran pequeños grupos de Senecio bonariensis,

Animal Biodiversity and Conservation 33.2 (2010)

ejemplares dispersos de espinillo (Prosopis affinis) y pequeños matorrales con Celtis sp.

El pastizal II es un pastizal de pasto estrella (Cynodon plectostachyus), especie introducida e implantada en un sector abierto entre restos fragmentarios del bosque de quebracho colorado. Cynodon plectostachyus se comporta como invasiva, mantiene una altura máxima de 20 cm. En el pastizal se encuentran dispersos algunos matorrales y ejemplares arbóreos aislados de Schinopsis balansae, Astronium balansae y Prosopis kuntzei.

Los datos de temperatura, precipitación y humedad relativa corresponden a la media del mes de muestreo y fueron registrados en la estación meteorológica del Instituto Nacional de Tecnología Agropecuaria (INTA) de Colonia Benítez.

Muestreo de ortópteros En cada pastizal y en cada mes se efectuaron 250 golpes con una red entomológica de 44 cm de diámetro, se distribuyeron series de 50 golpes en cinco sitios a lo largo de un transecto de 1.000 m de longitud.

Cada golpeteo consistió en pasar la red entomológica a través de la vegetación abarcando un arco de 180º (Evans, 1984, 1988). Los individuos colectados se colocaron en bolsas plásticas y se mantuvieron en neveras hasta su traslado y procesamiento en laboratorio. Los muestreos se realizaron en los meses de octubre y diciembre de 2006, febrero, abril, junio, octubre y diciembre de 2007.

Los ortópteros adultos se separaron en morfoespecies, se identificaron a nivel específico los ejemplares de Acridoidea y a nivel taxonómico superior los restantes ejemplares. La identificación de especies del género Dichroplus (Acrididae, Melanoplinae) se efectuó disecando el complejo fálico del macho, para lo cual los ejemplares fueron colocados previamente en una cámara húmeda. La estructura genital extraída se aclaró con hidróxido de potasio al 10% y se conservó en glicerina.

El material identificado se incorporó a la colección de la Cátedra de Artrópodos de la Facultad de Ciencias Exactas y Naturales y Agrimensura, Universidad Nacional del Nordeste (CARTROUNNE).

Análisis de datos Se registró la abundancia (N), la abundancia relativa y el número de especies (S). La abundancia se expresó como el número total de individuos y la abundancia relativa como la proporción de individuos de una misma especie en relación al número total colectado en cada pastizal. Se calcularon los índices de diversidad de Shannon Wiener, de dominancia de Simpson y de Berger Parker, y de equitatividad de Pielou (Magurran, 2004). Se utilizó el programa BioDiversity–Pro (McAleece, 1997) para el cálculo de los índices. Previo al procesamiento estadístico los datos fueron transformados a logaritmo base natural (logn+1).

La abundancia, riqueza específica e índices de diversidad entre los pastizales se compararon me-

121

diante pruebas no paramétricas de permutaciones (Good, 2000), a un nivel de significancia α = 0,05. El test no paramétrico de Kruskal–Wallis (H) se aplicó para establecer diferencias en la abundancia entre los meses de muestreo.

La correlación entre la abundancia y las distintas variables abióticas (temperatura media, precipitación media y humedad relativa media) se calculó aplicando el coeficiente de correlación de Pearson a un nivel de significación α = 0,05 (InfoStat, 2002).

Resultados Abundancia y riqueza de especies En total se colectaron 701 ejemplares adultos pertenecientes a seis familias, 15 especies de Acridoidea y 10 morfoespecies de los restantes Orthoptera (tabla 1). Las familias Acrididae y Tettigoniidae fueron las más abundantes y representaron el 80,3% (563/701) y el 12,5% (88/701), respectivamente. Los restantes individuos se distribuyeron entre las familias Proscopiidae, Tetrigidae, Romaleidae (Caelifera) y Gryllidae (Ensifera).

Teniendo en cuenta los dos pastizales, la familia Acrididae estuvo representada por cinco subfamilias y por 13 especies (tabla 1), y conformó el 52% del total de especies de ortópteros colectados. Los gomfocerinos (Acrididae) fueron los más abundantes, constituyendo el 86,5% del total de acridios y casi el 70% del total de ortópteros. Las tres especies más abundantes fueron Staurorhectus longicornis, Dichromorpha australis y Orphulella punctata.

Variación espacial de la composición y estructura de las comunidades En el PI se colectaron 173 adultos pertenecientes a 21 especies, de las cuales 13 fueron especies de Acridoidea. En tanto que en el PII se capturaron 528 ejemplares adultos, pertenecientes a 18 especies, de las cuales 10 fueron acridoideos. En los dos pastizales los gomfocerinos fueron los más abundantes, registrando una abundancia relativa del 40,9% y 78,8%, respectivamente (tabla 1). Excepto Romaleidae, que fue hallada solo en PI, las restantes familias se colectaron en ambos pastizales.

En el pastizal I la diversidad de Shannon y la equitatividad fueron significativamente mayores que en el PII, la abundancia, índice de Simpson y dominancia fueron superiores en el pastizal II y no se comprobó diferencia significativa entre los pastizales con respecto a la riqueza específica (p = 0,92) (tabla 2).

En el PI la especie más abundante fue O. punctata, ésta y una morfoespecie de Conocephalinae (Ensifera) y otra de la familia Proscopiidae representaron casi el 50% del total de individuos (n = 173), mientras que en el PII dos especies, S. longicornis y D. australis, conformaron el 64.8% del total de individuos colectados (n = 528).

Del total de especies halladas (S = 25), 14 estuvieron presentes en ambos pastizales. Baeacris

122

Pocco et al.

Tabla 1. Abundancia total (N) y abundancia relativa (Ar, en %) de las especies de Orthoptera registradas en cada pastizal (PI y PII). Estancia Los Alisos, provincia del Chaco, 2006–2007.

Table 1. Total abundance (N) and relative abundance (Ar, in %) of the Orthoptera species recorded in each grassland site (PI and PII). Estancia Los Alisos, Chaco province, 2006–2007.

Pastizal I

Pastizal II

N Ar N Caelifera Acridoidea Acrididae Acridinae Cocytotettix intermedia (Bruner,1900) 0 0 2 Copiocerinae Aleuas lineatus (Stal, 1878) 1 0,6 7 Gomphocerinae Amblytropidia australis (Bruner, 1904) 6 3,5 34 Dichromorpha australis (Bruner,1900) 16 9,2 105 Orphulella punctata (De Geer, 1773) 35 20,2 39 Rhammatocerus pictus (Bruner,1900) 7 4 1 Staurorhectus longicornis (Giglio–Tos, 1897) 7 4 237 Leptysminae Tucayaca gracilis (Giglio–Tos, 1897) 7 4 13 Melanoplinae Baeacris punctulatus (Thunberg 1824) 8 4,6 0 Dichroplus exilis (Giglio–Tos, 1894) 15 8,7 16 Dichroplus fuscus (Thunberg, 1815) 0 0 1 Neopedies brunneri (Giglio–Tos, 1894) 4 2,3 0 Scotussa lemniscata (Stal, 1860) 2 1,2 0 Caelifera Acridoidea Romaleidae Romaleinae Staleochlora v. viridicata (Serville, 1839) 1 0,6 0 Xyleus laevipes (Stal, 1878) 2 1,2 0 Caelifera Eumastacoidea Proscopiidae Proscopiinae Morfoespecie 1 19 11 10 Morfoespecie 2 1 0,6 1 Caelifera Tetrigoidea Tetrigidae Morfoespecie 1 3 1,7 9 Ensifera Grylloidea Gryllidae Gryllinae Morfoespecie 1 1 0,6 0 Morfoespecie 2 0 0 1 Trigonidiinae Morfoespecie 1 0 0 2 Caelifera Tettigonioidea Tettigoniidae Conocephalinae Morfoespecie 1 32 18,5 1 Morfoespecie 2 2 1,2 0 Morfoespecie 3 3 1,7 10 Phaneropterinae Morfoespecie 1 1 0,6 39 Total de individuos

173

528

Ar

0,4 1,3 6,4 19,9 7,4 0,2 44,9 2,4 0 3 0,2 0 0

0 0

1,9 0,2 1,7

0 0,2 0,4

0,2 0 1,9 7,4

Animal Biodiversity and Conservation 33.2 (2010)

123

Tabla 2. Estructura de la comunidad de Orthoptera en el Pastizal I y II. Estancia Los Alisos, provincia del Chaco, 2006–2007: * Indica diferencias significativas entre los pastizales (α = 0,05).

Table 2. Orthoptera community structure in each grassland site (PI, PII). Estancia Los Alisos, Chaco province, 2006–2007: * Indicates significant differences between grasslands (α = 0.05).

Pastizal I

Pastizal II

Abundancia (N)*

173

528

Riqueza de especies (S)

21

18

Índice de diversidad de Shannon (H')*

2,49

1,81

Diversidad de Simpson (D)*

0,10

0,25

0,81

0,62

0,20

0,44

Equitatividad (J')* Índice de dominancia (d)*

punctulatus, Neopedies brunneri, Scotussa lemniscata, Staleochlora viridicata, Xyleus laevipes, Gryllidae morfoespecie 1 y Conocephalinae morfoespecie 2 se encontraron exclusivamente en el PI, y Cocytottetix intermedia, Dichroplus fuscus, Gryllidae morfoespecie 2 y Trigonidiinae morfoespecie 1 sólo en el PII. Variación temporal de la composición y estructura de las comunidades Analizados los atributos de las comunidades en los distintos meses, tanto en el PI (H = 18,09; p = 0,0048; gl = 6), como en el PII (H = 22,17; p = 0,0011; gl = 6), la abundancia en diciembre de 2006 resultó significativamente mayor a la registrada en los restantes meses (fig. 1).

La riqueza de especies en el PI varió entre un mínimo de 4 a un máximo de 11 especies según el mes de muestreo. Diciembre de 2006, febrero y abril (S = 11) fueron los meses de mayor riqueza específica, y octubre de 2006 y 2007 (S = 4) los de menor número de especies. En el PII la riqueza específica varió entre un mínimo de 3 especies, que correspondió al mes de junio, y un máximo de 11 especies, registradas en el mes de febrero (fig. 1).

En el PI la mayor diversidad (H' = 2,19) y menor dominancia (d = 0,2) se registraron en el mes de febrero, en tanto que octubre de 2006 fue el mes donde se registró la menor diversidad (H' = 1,16). La mayor dominancia y diversidad de Simpson (d = 0,54 y D = 0,3, respectivamente) se detectaron en el mes de octubre de 2006. En el PII durante el mes de octubre de 2006 se registró la mayor diversidad (H = 1,94), en tanto que en diciembre de 2006 se detectó la menor diversidad (H' = 0,72), menor valor de equitatividad (J' = 0,31), mayor dominancia (d = 0,83) y máxima diversidad de Simpson (D = 0,69) (fig. 1).

La especie más abundante en PI, O. punctata, fue detectada en todos los meses de muestreo, así también D. australis, que estuvo presente en todo el período de muestreo, excepto en el mes de octubre de 2006. Staurorhectus longicornis, especie más

abundante en el PII, sólo se detectó en los meses de diciembre y febrero. Dichromorpha australis fue colectada todos los meses, como también Amblytropidia australis, y Dichroplus exilis ausentes sólo en las capturas de junio (tabla 3).

La abundancia, tanto del PI como del PII, no presentó una correlación significativa con las variables abióticas analizadas (temperatura media, PI: r = 0,362, p = 0,424 y PII: r = 0,669, p = 0,100; precipitación media, PI: r = –0,041, p = 0,931 y PII: r = 0,213, p = 0,647; humedad relativa media, PI: r = 0,157, p = 0,737 y PII: r = –0,448, p = 0,313) (fig. 2).

Discusión En Argentina son numerosos los trabajos realizados sobre diversidad de acridios en la región Pampeana (Zequín et al., 1999; Beltrame et al., 2001; Cigliano et al., 2000, 2002; Torrusio et al., 2002; De Wysiecki et al., 2004). Sin embargo son escasos los estudios efectuados en otras regiones del país, no sólo de diversidad de acridios sino también de las restantes familias incluidas en el orden. Este trabajo constituye una primera estimación de la diversidad de ortópteros en la región del Chaco Oriental Húmedo.

Desde el punto de vista de la diversidad a nivel de familia, se registraron representantes de casi el 35 % del total de familias citadas hasta el presente para la Argentina (Carbonell et al., 2006; Eades & Otte, 2009).

En cuanto a la diversidad de especies de Acridoidea, en este estudio se colectó el 25% de las citadas para la provincia del Chaco (Carbonell et al., 2006). Este bajo porcentaje de especies colectadas respecto de las conocidas para la provincia podría deberse a que este estudio se llevó a cabo en ambientes de pastizal, sin considerar otros ambientes de esta provincia donde es común la presencia de estos insectos. Dentro de los acridios, las subfamilias Acridinae, Gomphocerinae y Melanoplinae se encuentran generalmente asociados a ambientes de pastizal, mientras que las especies de Leptysminae, Romaleidae y Ommexechidae se las

124

Pocco et al.

PI

PII

H'

J'

2,5

1,2 1 0,8 0,6 0,4 0,2 0

2 1,5 1 0,5 0

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

d

D

0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0

0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

S

N

15

240 220 200 180 160 140 120 100 80 60 40 20 0

10 5 0

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

Fig. 1. Variación temporal y espacial de los valores de diversidad de Shannon (H'), equitatividad (J'), dominancia (d), diversidad de Simpson (D), riqueza específica (S) y abundancia (N) de las comunidades de Orthoptera en cada pastizal. Estancia Los Alisos, provincia del Chaco, 2006–2007.

Fig. 1. Temporal and spatial variation of Shannon diversity (H'), evenness (J'), dominance (d), Simpson diversity (D), species richness (S) and abundance (N) in the Orthoptera communities in each grassland site. Estancia Los Alisos, Chaco province, 2006–2007

encuentra asociadas a otro tipo de ambientes, como ambientes palustres en el caso de los leptisminos o en el ecotono del monte a romaleidos y omexéquidos (Carbonell et al., 2006). Estas asociaciones coinciden con lo observado en este estudio, en el cual los gomfocerinos y melanoplinos fueron los más diversos y abundantes en los pastizales estudiados, mientras que se encontraron muy pocos individuos pertenecientes a solo dos de las 14 especies de romaleidos y una de las nueve especies de leptisminos citadas para esta provincia (Carbonell et al., 2006). Se destaca la presencia de D. australis, S. longicornis y A. australis (Gomphocerinae) y del acridino Cocytotettix intermedia, especies que no estaban citadas para la provincia del Chaco (Carbonell et al., 2006).

Debido a que no existen estudios previos sobre comunidades de ortópteros para la región Chaqueña, comparaciones entre los resultados aquí obtenidos se pueden realizar sólo con aquellos trabajos publicados para la región Pampeana. Si bien se trata de regiones fitogeográficas diferentes, todos estos estudios provienen de ambientes de pastizal. La riqueza específica de Acridoidea detectada fue menor a la observada por Zequín et al. (1999) en un estudio realizado en pasturas del centro Oeste de Santa Fe y centro Este de Córdoba, donde se detectaron 23 especies de tucuras durante el verano de 1999. Sin embargo, la riqueza de especies de Acridoidea fue similar a la registrada en un estudio realizado en la región Pampeana (Torrusio et al., 2002), donde se

Animal Biodiversity and Conservation 33.2 (2010)

125

Tabla 3. Especies de Acridoidea presentes en cada pastizal según el mes de muestreo. Estancia Los Alisos, provincia del Chaco, 2006–2007.

Table 3. Acridoidea species collected in each grassland site according to sampling month. Estancia Los Alisos, Chaco province, 2006–2007.

Pastizal I

X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07

Cocytotettix intermedia

Pastizal II X 06 XII 06 II 07 IV 07 VI 07 X 07 XII 07 X

X

Aleuas lineatus

X

X

X

X

Amblytropidia australis

X

X

X

X

X

X

X

X

X

X

Dichromorpha australis

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

Orphulella punctata

X

Rhammatocerus pictus

X

Staurorhectus longicornis

X

Tucayaca gracilis

X X

X X

X

Baeacris punctulatus

X

X

X

X

Dichroplus exilis

X

X

X

X

X

X

X

X X

X

X

X

Dichroplus fuscus Neopedies brunneri

X

X

Scotussa lemniscata

X

Staleochlora v. viridicata

X

Xyleus laevipes

X

X X

X

X

X

X

X

registraron en total 15 especies de tucuras durante los meses de verano del 2000.

La abundancia, tanto de ortópteros en general como de acridoideos, fue mayor en el pastizal libre de pastoreo, en coincidencia con estudios realizados en estados del oeste de Estados Unidos, en donde se detectó una mayor densidad de tucuras en sitios sin o con leve grado de pastoreo que en aquellos fuertemente pastoreados (Capinera & Sechrist, 1982; Jepson–Innes & Bock, 1989; Welch et al., 1991; Fielding & Brusven, 1995). Sin embargo, en la región pampeana Torrusio et al. (2002) señalan que la densidad y la abundancia total de tucuras muestran una tendencia a aumentar en pasturas y sitios con alto grado de perturbación y con un pastoreo intenso caracterizados por especies vegetales introducidas. Asimismo Cigliano et al.

(2002) establecen que durante años de explosión poblacional las mayores densidades se registran en pasturas con un alto grado de perturbación, se deduce que durante el período de estudio no se produjo una explosión poblacional de ortópteros. No resulta sencillo determinar si el pastoreo de ganado favorece o no al aumento de densidades de tucuras, dado que la dinámica poblacional de estos insectos varía de acuerdo a las distintas especies, la región geográfica, las comunidades vegetales, el sistema

de pastoreo y la variación climática anual (Fielding & Brusven, 1996). En general los sitios pastoreados se caracterizan por presentar una altura reducida de la vegetación y por poseer una mayor superficie de suelo desnudo en comparación con sitios sin pastoreo, además de una mayor temperatura y menor humedad relativa del suelo (Johnston et al., 1971). Esta situación podría tener efectos tanto positivos como negativos en la abundancia de las poblaciones de acuerdo a las preferencias de cada especie, por ejemplo de acuerdo a las características específicas de los sitios de oviposición (Fielding & Brusven, 1996).

Si bien en este estudio no se realizó una prueba de correlación entre la riqueza específica de ortópteros y la diversidad de la vegetación, tanto la riqueza de especies como la diversidad de ortópteros fueron superiores en el pastizal con mayor riqueza de especies vegetales (PI). Joern (2005) afirma que el pastoreo tiene efectos positivos significativos sobre la riqueza de especies de tucuras, este autor como también Fartmann et al. (2008) coinciden en señalar que la riqueza de ortópteros está directamente correlacionada con la riqueza de especies vegetales y por lo tanto es mayor en hábitats con alta heterogeneidad estructural como son aquellos sitios sujetos a perturbaciones moderadas (ej: al pastoreo).

126

Pocco et al.

A

B N 60

Abundancia ºC 30

N 250

50

25

200

40

20

30

15

20

10

10

5

0

ºC 30 25 20

150

15

100

10

50

0 X XII II IV VI X XII 2006 2007

C

Temperatura media

0

5 X XII 2006

II IV VI 2007

X

XII

0

D N 60

Abundancia mm 250

N 250

50

200

200

200

150

150

150

100

100

100

40 30 20

50

10 0

mm 250

50

50

0 X XII II IV VI X XII 2006 2007

E

Precipitación media

0

X XII 2006

II IV VI 2007

X

XII

0

F Abundancia HR% N 100 250

N 60 50 40 30 20 10 0

X XII 2006

Humedad relativa media

HR% 100

80

200

80

60

150

60

40

100

40

20

50

20

0 II IV VI X XII 2007

0

X XII 2006

II IV 2007

VI

X

XII

0

Fig. 2. Variación temporal de la abundancia de ortópteros en el PI y temperatura media (A), precipitación media (C) y humedad realtiva media (E). Variación temporal de la abundancia de ortópteros en el PII y temperatura media (B), precipitación media (D) y humedad realtiva media (F). Estancia Los Alisos, provincia del Chaco, 2006–2007.

Fig. 2. Temporal variation of Orthoptera abundance in PI and mean temperature (A), mean precipitation (C) and mean relative humidity (E); Temporal variation of Orthoptera abundance in PII and mean temperature (B), mean precipitation (D) and mean relative humidity (F). Estancia Los Alisos, Chaco province, 2006–2007.

Animal Biodiversity and Conservation 33.2 (2010)

En los pastizales muestreados la mayor abundancia se registró para la subfamilia Gomphocerinae, y en la región pampeana Melanoplinae resultó ser la subfamilia dominante (Cigliano et al., 2000, 2002; Torrusio et al., 2002; De Wysiecki et al., 2004), mientras que en estudios realizados en Córdoba y Santa Fe, Gomphocerinae es tan abundante y diversa como Melanoplinae (Zequín et al., 1999; Beltrame et al., 2001).

Staurorhectus longicornis fue la más abundante en el pastizal dominado por Cynodon plectostachyus ("pasto estrella"). En la región del Chaco seco de Paraguay, esta especie de tucura domina la fauna de artrópodos en los pastizales de pasto estrella (Wilhelmi, 1997). Asimismo, según Barrera & Paganini (1975), es muy abundante en la región del parque chaqueño en la provincia de Tucumán, prefiere gramíneas de porte alto y relativamente tupidas, y ha causado daños en cultivos de caña de azúcar, sorgo y maíz. Staurorhectus longicornis fue considerada históricamente como responsable de importantes reducciones en las gramíneas disponibles para el ganado en praderas naturales (COPR, 1982; Carbonell et al., 2006), es una de las doce especies de tucuras de mayor importancia económica en Argentina (Lieberman, 1972) y una de las tres más abundantes en el este de La Pampa y oeste de Buenos Aires (Cigliano et al., 2000). En la explosión demográfica de acridoideos ocurrida entre 1989 y 1996 en el Sur de Córdoba, Norte de La Pampa y Noroeste de Buenos Aires, fue una de las especies dominantes (Lange et al., 2005). Orphulella punctata y D. australis fueron otras de las especies más numerosas, en coincidencia con los registros de un estudio realizado en el centro oeste de la provincia de Santa Fe y centro este de Córdoba (Zequín et al., 1999). Mientras que O. punctata es considerada plaga frecuente de menor importancia, D. australis no ocasiona perjuicios económicos (Carbonell et al., 2006).

A lo largo del período de estudio, la abundancia y riqueza de especies declinó en los meses de invierno y principios de primavera, en ambos pastizales.

Esto se debería a que la mayoría de las especies colectadas serían univoltinas. Tal es el caso de lo observado en S. longicornis, que según Barrera & Paganini (1975) aparenta tener una sola generación anual. Sin embargo, O. punctata y D. australis se colectaron durante todos los meses de muestreo (en PI y PII, respectivamente), en tanto que A. australis y Dichroplus exilis también fueron detectadas durante todo el período de estudio en el PII, excepto en el mes de junio. De acuerdo a las observaciones realizadas por Barrera y Turk (1977), O. punctata y D. australis se las encuentra durante todo el año, siempre que las condiciones ambientales sean favorables, y D. exilis tendría dos generaciones estivales. Luiselli et al. (2002) reportan para D. australis y A. australis una sola generación anual, mientras que O. punctata se habría comportado como bivoltina.

A pesar que otros estudios señalan una correlación entre la abundancia de tucuras y variables climáticas (Gage & Mukerji, 1977; Capinera & Horton, 1989; Fielding & Brusven, 1990; Joern & Gaines, 1990; Belovsky & Slade, 1995; Powell et al., 2007; Branson, 2008),

127

en esta investigación no se obtuvo una correlación significativa con las variables ambientales consideradas. Sin embargo, los mayores valores de abundancia registrados en ambos pastizales coincidieron con el mayor valor de temperatura media y con el máximo valor de precipitación media del mes anterior.

Agradecimientos Los autores expresan su agradecimiento al Dr. José Luis Fontana por la descripción de las comunidades vegetales. Este trabajo fue financiado por la Secretaría de Ciencia y Técnica de la Universidad Nacional del Nordeste, Argentina.

Referencias Barrera, M. & Paganini, I. H., 1975. Acridios de Tucumán: notas bioecológicas. Acta Zoológica Lilloana, 31: 107–124.

Barrera, M. & Turk, S. Z., 1977. Acridios del NOA, II. Contribución al conocimiento de huevos, desoves y hábitos de postura de algunas especies de tucuras (Orthoptera, Acrididae), de la Provincia de Tucumán. Acta Zoologica Lilloana, 32: 167–188.

Belovsky, G. E. & Slade, G. E., 1995. Dynamics of two Montana grasshopper populations: relationships among weather, food abundance and intraspecific competition. Oecologia, 101: 383–396.

Beltrame, R., Luiselli, S., Zequín, L., Simioni, S. & Salto, C., 2001. Dinámica poblacional de tucuras (Orthoptera: Acridoidea) en agroecosistemas del centro oeste de Santa Fe y centro este de Córdoba.

Natura neotropicales, 32.

Branson, D. H., 2008. Influence of a large late summer precipitation event of food limitation and grasshopper population dynamics in a Northern Great Plains grassland. Environmental Entomology, 37: 686–695.

Cabrera, A. L., 1976. Regiones Fitogeográficas Argentinas. In: Enciclopedia argentina de agricultura y jardinería (W. F. Kugler, Ed.). ACME, Buenos Aires.

Capinera, J. L., 1987. Integrated Pest Management on Rangeland: A shortgrass Prairie perspective.

Westview, Boulder, Colorado.

Capinera, J. L. & Horton, D. R., 1989. Geographic variation in effects of weather on grasshopper infestation. Environmental Entomology, 18(1): 8–14.

Capinera, J. L. & Sechrist, T. S., 1982. Grasshopper (Acrididae) host plant associations: response of grasshopper populations to cattle grazing intensity.

Canadian Entomologist, 114:1055–1062.

Carbonell, C. S., Cigliano, M. M. & Lange, C. E., 2006. Especies de Acridomorfos (Orthoptera) de Argentina y Uruguay. CD ROM. Publications on Orthopteran Diversity. The Orthopterists’ Society at the Museo de La Plata, La Plata.

Chapman, R. F. & Joern, A., 1990. Biology of Grasshoppers. John Wiley & Sons, Inc., New York.

Cigliano, M. M., De Wysiecki, M. L. & Lange, C., 2000.

Grasshopper (Orthoptera: Acridoidea) species

128

diversity in the Pampas, Argentina. Diversity and Distributions, 6: 81–91.

Cigliano, M. M. & Lange, C. E., 1998. Orthoptera. In: Biodiversidad de Artrópodos argentinos: 67–83 (J. J. Morrone & S. Coscarón, Eds.). Ediciones Sur, La Plata.

Cigliano, M. M., Torrusio, S. & De Wysiecki, M. L., 2002. Grasshopper (Orthoptera: Acridoidea) community composition and temporal variation in the Pampas, Argentina. Journal of Orthoptera Research, 11(2): 215–221.

COPR (Centre for Overseas Pest Research), 1982.

The locust and grasshopper agricultural manual.

Centre for Overseas Pest Research, London.

De Wysiecki, M. L., Torrusio, S. & Cigliano, M. M., 2004. Caracterización de las comunidades de acridios (Orthoptera: Acridoidea) del partido de Benito Juárez, sudeste de la provincia de Buenos Aires, Argentina. Revista de la Sociedad Entomológica Argentina, 63(3–4): 87–96.

Eades, D. C. & Otte, D., 2009. Orthoptera Species File Online. Version 2.0/3.5. [retrieval date]. <http:// Orthoptera.SpeciesFile.org>.

Evans, E. W., 1984. Fire as a natural disturbance to grasshopper assemblages of tallgrass prairie.

Oikos, 43: 9–16.

– 1988. Grasshopper (Insecta: Orthoptera: Acrididae) assemblages of tallgrass prairie: influences of fire frequency, topography and vegetation. Canadian Journal of Zoology, 66: 1495–1501.

Fartmann, T., Behrens, M. & Loritz, H., 2008. Orthopteran communities in the conifer–broadleaved woodland zone of the Russian Far East. European Journal of Entomology, 105: 673–680.

Fielding, D. J. & Brusven, M. A., 1990. Historical analysis of grasshopper (Orthoptera: Acrididae) population responses to climate in Southern Idaho, 1950–1980. Environmental Entomology, 19(6): 1786–1791.

– 1995. Ecological correlates between rangeland grasshopper (Orthoptera: Acrididae) and plant communities of southern Idaho. Environmental Entomology, 24(6): 1432–1441.

– 1996. Livestock grazing and grasshoppers: An interregional perspective. University of Idaho College of Agriculture Bulletin, 785: 1–12.

Gage, S. H. & Mukerji, M. K., 1977. A perspective of grasshopper population distribution in Saskatchewan and interrelationship with weather. Environmental Entomology, 6: 469–479.

Gangwere, S. K., Muralirangan, M. C. & Muralirangan, M., 1997. The Bionomics of Grasshoppers, Katydids and Their Kin. CAB International, London.

García–Gutiérrez, C., Chaírez–Hernández, I., Rivera– García, E., Gurrola–Reyes, J. N. & González– Maldonado, M. B., 2006. Chapulines (Orthoptera: Acridoidea) de pastizales de la "Región de Los Llanos" en Durango, México. Folia Entomologica Mexicana, 45(3): 273–282.

Ginzburg, R. & Adámoli, J., 2006. Situación ambiental en el Chaco Húmedo. In: La situación Ambiental Argentina 2005: 103–113 (A. Brown, U. Martínez Ortiz, M. Acerbi & J. Corcuera, Eds.). Fundación

Pocco et al.

Vida Silvestre Argentina, Buenos Aires.

Good, P., 2000. Permutation test. A practical guide to resampling methods for testing hypotheses.

Springer, New York.

Hunter, D. M. & Cosenzo, E. L., 1990. The origin of plagues and recent outbreaks of the South American locust Schistocerca cancellata (Orthoptera: Acrididae) in Argentina. Bulletin of Entomological Research, 80: 259–300.

InfoStat, 2002. InfoStat version 1.1. Grupo InfoStat, Facultad de Ciencias Agropecuarias, Universidad Nacional de Córdoba, Argentina.

Jepson–Innes, K. & Bock, C. E., 1989. Response of grasshoppers (Orthoptera: Acrididae) to livestock grazing in southeastern Arizona: differences between seasons and subfamilies. Oecologia, 78: 430–431.

Joern, A., 2005. Disturbance by fire frequency and bison grazing modulate grasshopper assemblages in tallgrass prairie. Ecology, 86(4): 861–873.

Joern, A. & Gaines, S. B., 1990. Population dynamics and regulation in grasshoppers. In: Biology of grasshoppers: 415–482 (R. F. Chapman & A. Joern, Eds.). John Wiley & Sons, New York.

Johnston, A., Dormaar, J. F. & Smoliak, S., 1971.

Long–term grazing effects on fescue grassland soils. Journal of Range Management, 24: 185–188.

Lange, C. E., Cigliano, M. M. & De Wysiecki M. L., 2005. Los acridoideos (Orthoptera: Acridoidea) de importancia económica en la Argentina. In: Manejo integrado de la langosta centroamericana (Schistocerca piceifrons piceifrons, Walker) y acridoideos plaga en América Latina: 93–135 (L. Barrientos Lozano & P. Almaguer Sierra, Eds.). Instituto Tecnológico de Ciudad Victoria, Tamaulipas, México.

Liebermann, J., 1972. The current state of the locust and grasshopper problem in Argentina. In: Proceedings of International Study Conference on the Current and Future Problems of Acridology: 191–198 (C. F. Hemming & T. H. C. Taylor, Eds.). Center for Overseas Pest Research, London.

Lockwood, J. A., Latchininsky, A. V. & Sergeev, M. G., 2000. Grasshoppers and Grassland Health.

Managing grasshopper Outbreaks without risking Environmental Disaster, NATO Sciences series. 2.

Environmental Security. Kluwer Academic Publishers, New York.

Luiselli, S., Beltrame, R., Zequín, L., Simioni, S. & Salto, C., 2002. Ciclo ninfal de tucuras (Orthoptera: Acrididae) en agroecosistemas del centro oeste de Santa Fe y centro este de Córdoba. FAVE. Ciencias Agrarias, 1(1): 37–45.

McAleece, N., Lambshead, P. J. D. & Paterson, G. L. J., 1997. BiodiversityPro. The Natural History Museum, London.

Magurran, A., 2004. Measuring Biological Diversity.

Blackwell Publishing, Oxford.

Nickle, D. A., 1992a. Katydids of Panama (Orthoptera: Tettigoniidae). In: Insects of Panama and Mesoamerica (Selected Studies): 142–184 (D. Quintero & A. Aiello, Eds.). Oxford Science Publications, Washington DC. – 1992b. The Crickets and Mole Crickets of Panama

Animal Biodiversity and Conservation 33.2 (2010)

(Orthoptera: Gryllidae and Gryllotalpidae). In: Insects of Panama and Mesoamerica (Selected Studies): 185–197 (D. Quintero & A. Aiello, Eds.).

Oxford Science Publications, Washington DC. Otte, D., 1981. The North American Grasshoppers.

Vol. 1, Acrididae: Gomphocerinae and Acridinae.

Harvard University Press, Cambridge.

Powell, L. R., Berg, A. A, Johnson, D. L. & Warland, J. S., 2007. Relationships of pest grasshopper populations in Alberta, Canada to soil moisture and climatic variables. Agricultural and Forest Meteorology, 144: 73–84.

Torrusio, S., Cigliano, M. M. & de Wysiecki, M. L., 2002. Grasshopper (Orthoptera: Acridoidea) and plant community relationships in the Argentine pampas. Journal of Biogeography, 29: 221–229.

Uvarov, B., 1966. Grasshoppers and locusts: a handbook of general acridology, I. Cambridge University of Press, Cambridge.

– 1977. Grasshoppers and locusts: a handbook of

129

general acridology, II. Cambridge University Press, Cambridge.

Welch, J. L., Redak, R. & Kondratieff, D. C., 1991.

Effect of cattle grazing on the density and species of grasshoppers (Orthoptera: Acrididae) of the Central Plains Experimental Range, Colorado: a reassessment after two decades. Journal of the Kansas Entomological Society, 64: 337–343.

Wilhelmi, F., 1997. Staurorhectus longicornis (Giglio– Tos), a recently appearing pest species on pastures in the dry Chaco of Paraguay and semi–field tests for its control. In: New strategies in locust control: 253–254 (S. Krall, R. Peveling & D. Ba Diallo, Eds.). Birkhauser Verlag, Basilea.

Zequín, L., Beltrame, R., Luiselli, S., Salto, C. & Strasser, R., 1999. Abundancia y diversidad de tucuras (Orthoptera: Acridoidea) en el centro oeste de Santa Fe y centro este de Córdoba.

Anuario 1999. Instituto Nacional de Tecnología Agropecuaria, Rafaela.

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Animal Biodiversity and Conservation 33.2 (2010)

131

Descripción de Bathysciola liqueana sp. n. de los Pirineos centrales (Francia).

Designación de lectotipos y datos de distribución de las especies del grupo de B. meridionalis (Jacquelin du Val, 1854) (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini)

J. Fresneda, C. Bourdeau & A. Faille Fresneda, J., Bourdeau, C. & Faille, A., 2010. Descripción de Bathysciola liqueana sp. n. de los Pirineos centrales (Francia). Designación de lectotipos y datos de distribución de las especies del grupo de B. meridionalis (Jacquelin du Val, 1854) (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini). Animal Biodiversity and Conservation, 33.2: 131–142.

Abstract Description of Bathysciola liqueana n. sp. from the central Pyrenees. Designation of lectotypes and distribution data for species of the B. meridionalis group (Jacquelin du Val, 1854) (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini).― We describe a new species of the genus Bathysciola Jeannel, 1910 (B. liqueana n. sp.) belonging to the "meridionalis" group. It was collected in a subterranean environment, in Liqué cave, Larroque massif, Moulis, Ariège, France. The closest species is Bathysciola meridionalis (Jacquelin du Val, 1854), also known from Ariège. The new species differs mainly in morphological characteristics of the aedeagus: short, wide, with rounded apex in B. liqueana n. sp. whereas it is long, narrow, with pointed apex in B. meridionalis.

We discuss the taxonomical position of the new species and provide illustrations of structures showing the differences between the two species, along with distribution data, including for B. finismillennii Fresneda & Salgado, 2006. We designate lectotypes of B. meridionalis and B. nitidula Normand, 1907.

Key words: Coleoptera, Leiodidae, Bathysciola, "meridionalis" group, Pyrenees.

Resumen Descripción de Bathysciola liqueana sp. n. de los Pirineos centrales (Francia). Designación de lectotipos y datos de distribución de las especies del grupo de B. meridionalis (Jacquelin du Val, 1854) (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini).― Se describe una nueva especie del género Bathysciola Jeannel, 1910 (B. liqueana sp. n.) que pertenece al grupo "meridionalis". Se ha encontrado en medio subterráneo, en la Grotte de Liqué, macizo de Larroque, Moulis, Ariège, Francia. La especie más similar es Bathysciola meridionalis (Jacquelin du Val, 1854), también descubierta en Ariège. Los caracteres distintivos se encuentran básicamente en el edeago: es corto, ancho, con el ápice redondeado en B. liqueana sp. n. y largo, estrecho, con el ápice puntiagudo en B. meridionalis. Se discute su posición taxonómica y se completa el estudio con ilustraciones de las estructuras que permiten distinguir estos táxones, así como también los datos de distribución de que se dispone, incluyendo también a B. finismillennii Fresneda & Salgado, 2006. Se designan los lectotipos de B. meridionalis y de B. nitidula Normand, 1907.

Palabras clave: Coleoptera, Leiodidae, Bathysciola, Grupo "meridionalis", Pirineos.

(Received: 30 III10; Final acceptance: 27 V 10) Javier Fresneda, Ca de Massa, 25526 Llesp, El Pont de Suert, Lleida, Espanya (Spain); Museu de Ciències Naturals, Passeig Picasso s/n., 08003 Barcelona, Espanya (Spain).– Charles Bourdeau, 5 chemin Haut–Fournier, F–31320 Rebigue (France).– Arnaud Faille, C. P. 50, UMR 7205 du CNRS/USM 601, Origine, Structure et Evolution de la Biodiversité, Muséum National d’Histoire Naturelle, Dépt. Systématique et Evolution, Bât.

Entomologie, 45 rue Buffon, F–75005 Paris (France).

Corresponding author: J. Fresneda. E–mail: ffresned@gmail.com

ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

132

Introducción El género Bathysciola Jeannel, 1910 comprende en la actualidad 91 especies. Su área de distribución se extiende desde Euskadi, en España, hasta los confines orientales de Europa y extremo occidental de Asia, incluyendo la mayor parte de las islas mediterráneas. En la región pirenaica se han inventariado 30 táxones (Fresneda & Salgado, 2006; Fresneda & Comas, 2007; Fresneda & Fery, 2009; Fresneda et al., 2010) de los que 19 son propios de la vertiente norte, seis de la sur y cinco habitan las dos vertientes: B. catalana Coiffait, 1959, B. grenieri (Saulcy, 1872), B. madoni Jeannel, 1923, B. ovata (Kiesenwetter, 1850) y B. rugosa (Sharp, 1873). Durante el estudio y ordenación de la colección de Bathysciola del Museu de Ciències Naturals de Barcelona (proyecto de catalogación de los ejemplares de series tipo: Glòria Masó y Miquel Prieto, Departament d’Artròpodes), se han encontrado dos ejemplares de una nueva especie perteneciente al grupo "meridionalis" en una caja de una antigua colección privada; posteriores pesquisas han permitido localizar un tercer ejemplar en la colección general del Muséum National d’Histoire Naturelle de Paris. La procedencia de estos tres ejemplares es una cavidad subterránea situada en la vertiente norte de los Pirineos centrales, en el departamento del Ariège, Francia. El grupo "meridionalis" de Bathysciola fue propuesto por Fresneda & Salgado (2006); se han descrito cuatro táxones de los cuales tres se consideran válidos (Fresneda & Salgado, op. cit.; Fresneda & Fery, 2009). En este artículo se describe una cuarta especie y además se designan los lectotipos de Adelops meridionalis Jacquelin du Val, 1854 y de Bathyscia nitidula Normand, 1907. El hallazgo de un nuevo taxon emparentado con Bathysciola meridionalis (= B. nitidula) precisa de una caracterización inequívoca de los táxones relacionados.

Material y métodos Los dos ejemplares del Museu de Ciències Naturals de Barcelona (Museu de Zoologia, MZB) se encontraban en una caja de la antigua colección de J. Nègre.

El ejemplar del MNHNP se conserva en la colección general organizada por R. Jeannel en 1931–1932.

Los tres se encontraban encolados a placas de papel rectangulares; se han desenganchado y reblandecido para proceder a la extracción de los genitalia; después se han encolado de nuevo sobre las placas originales cuando su estado de conservación lo permitía, y en el caso contrario sobre placas nuevas. Se ha anotado con lápiz sobre la placa el símbolo de sexo correspondiente a cada ejemplar y se han añadido de nuevo las etiquetas identificativas originales. Para el estudio de los genitalia se ha procedido como sigue: se han extraido del abdomen y sumergido en una solución acuosa de KOH al 10% en frio durante seis horas; acto seguido se han pasado por una serie alcohólica (60º–96º) durante algunos minutos para su total deshidratación y posteriormente por un baño de xilol durante 12 horas; a continuación se han

Fresneda et al.

montado en inclusión en bálsamo del Canadá sobre una lámina de papel de acetato transparente que se conserva insertada en la misma aguja que el ejemplar.

Abreviaturas: CCB, col. C. Bourdeau (Francia, Rebigue); CJF, col. J. Fresneda (España, Llesp); CCV, col. C. Vanderbergh (Francia, Les–Clayes–sous– Bois); MNHNP, Muséum National d’Histoire Naturelle (Francia, Paris); MZB, Museu de Ciències Naturals de Barcelona (Museu de Zoologia, España, Barcelona).

En las etiquetas de los ejemplares de las series tipo: ms, manuscrito; (i) impreso; / salto de línea; [ ] entre corchetes notas y comentarios de los autores.

Resultados Bathysciola (Bathysciola) liqueana sp. n. (figs. 1, 4, 7, 10, 13, 16) Localidad típica Grotte de Liqué, Moulis, Ariège, Francia, 555 m, UTM 31T 342988 4758580 (fig. 19).

Serie tipo Holotipo: ♂ etiquetado: "Grtte Liqué / Ariège" [etiqueta blanca rectangular (ms)], "Bathysciola / nitidula = / meridionalis" [etiqueta blanca rectangular (ms)], "Holotypus / Bathysciola liqueana sp. n. / Fresneda, Bourdeau & Faille det. 2009" [etiqueta roja rectangular (ms)] (MZB).

Paratipos: un macho etiquetado "Grtte Liqué" [etiqueta blanca rectangular (ms)], "meridionalis" [etiqueta blanca rectangular (ms)], "Bathysciola / voisin de / meridionalis" [etiqueta blanca rectangular (ms)] (MZB).

Una hembra etiquetada "Gr. de Liqué / ariège" [etiqueta blanca rectangular (ms)], "MUSÉUM PARIS / 1932 / Coll. Sainte–Claire Deville" [etiqueta blanca rectangular (i)] (MNHNP). Los dos ejemplares incorporan la etiqueta "Paratypus / Bathysciola liqueana sp. n. / Fresneda, Bourdeau & Faille det. 2009" [etiqueta roja rectangular (ms)]. Una hembra de la Grotte de Liqué inferior, 19 XI 2009, Bourdeau & Fresneda leg. (Institut de Biologia Evolutiva de Barcelona, para estudio molecular). Una hembra de Cazavet, Gouffre de Peillot, 10 VIII 1977, Vanderbergh leg. (CJF).

Descripción Se trata de un animal oval de contorno regular (fig. 1); no existe ángulo pronoto–elitral; su longitud, comprendida entre el margen anterior del pronoto y el ápice de los élitros es de 2,50 mm. Toda la superficie está cubierta de fina pilosidad, amarillenta y acostada. La cabeza presenta un punteado muy fino y tiene un mechón de sedas gruesas y largas en la frente; las antenas son cortas, 1,10 mm y en la tabla 1 se pueden ver las proporciones de los antenómeros. El pronoto es transverso, con los márgenes laterales regularmente curvados, tan ancho como los élitros tomados en conjunto y muy convexo; la anchura máxima se encuentra en el tercio basal y los ángulos posteriores son agudos, con el vértice redondeado; el tegumento está marcado por un punteado muy fino, denso y desordenado; un microretículo le confiere aspecto mate.

Animal Biodiversity and Conservation 33.2 (2010)

133

2

1 mm

1

3

Figs. 1–3. Habitus de: 1. Bathysciola liqueana sp. n., holotipo de la Grotte de Liqué; 2. B. meridionalis lectotipo de Burdeos; 3. B. finismillennii de la Grotte de Sabouche.

Figs. 1–3. Habitus of: 1. Bathysciola liqueana n. sp., holotype from Grotte de Liqué; 2. B. meridionalis lectotype from Bordeaux; 3. B. finismillennii from Grotte de Sabouche.

134

Fresneda et al.

5

6

0,5 mm

4

7

8

9

Figs. 4–9. Edeago en visión dorsal y lateral de: 4–7. Bathysciola liqueana sp. n., holotipo de la Grotte de Liqué; 5–8. B. meridionalis de Gers; 6–9. B. finismillennii de Saint–Sernin.

Figs. 4–9. Aedeagus in dorsal and lateral view of: 4–7. Bathysciola liqueana n. sp., holotype from Grotte de Liqué; 5–8. B. meridionalis from Gers; 6–9. B. finismillennii from Saint–Sernin.

Animal Biodiversity and Conservation 33.2 (2010)

10

135

13

11

14

12

0,5 mm 15

Figs. 10–15. Ápice de los estilos laterales del tegmen: 10. Bathysciola liqueana sp. n., holotipo de la Grotte de Liqué; 11. B. meridionalis de Gers; 12. B. finismillennii de Saint–Sernin. Octavo urosternito de la hembra: 13. Bathysciola liqueana sp. n., paratipo de la Grotte de Liqué; 14. B. meridionalis de Gimont; 15. B. finismillennii de la Grotte de Sabouche.

Figs. 10–15. Apex of the parameres: 10. Bathysciola liqueana n. sp., holotype from Grotte de Liqué; 11.

B. meridionalis from Gers; 12. B. finismillennii from Saint–Sernin. Urite VIII of female: 13. Bathysciola liqueana n. sp., paratype from Grotte de Liqué; 14. B. meridionalis from Gimont; 15. B. finismillennii from Grotte de Sabouche.

Los élitros tienen la anchura máxima en la base y los márgenes laterales están fuertemente curvados de manera regular hasta el ápice, que es redondeado; no se aprecia la existencia de reborde marginal; no existe estría parasutural y la escultura está formada

por puntos rugosos alineados transversalmente en la mitad basal y desordenados en la apical. La quilla mesoventral es baja, resumida a un reborde y está regularmente curvada; no se prolonga sobre el metaventrito. Las patas son proporcionalmente cortas y el

136

primer artejo de los protarsos del macho es triangular y un poco más estrecho que el extremo distal de la protibia; las metatibias son rectas, las mesotibias arqueadas y los metafémures no presentan espina femoral. El lóbulo medio del edeago en visión dorsal (fig. 4) es corto, ancho, con el ápice redondeado; en visión lateral (fig. 7) es robusto y doblado formando un ángulo obtuso, casi recto; el ápice está engrosado y curvado hacia la cara ventral. Los estilos laterales del tegmen no alcanzan el ápice del lóbulo medio y en el ápice están insertadas cuatro sedas robustas, dos más largas y dos más cortas (fig. 10). El saco interno (fig. 4) tiene en la región media una serie de faneras fuertemente esclerotizadas que no dejan ninguna área vacía en el centro y por lo tanto no es visible ningún nódulo flotante; se encuentra una fanera superior de disposición transversa con una prominencia puntiaguda en el punto medio, dos verticales anchas y de forma oval, dos dorsales ocultas tras las otras en casi toda su longitud salvo en su extremo inferior, y dos faneras laterales largas, prolongadas en una punta aguda en su extremo superior y con una corta fanera asociada de disposición paralela en su parte inferior.

Fresneda et al.

Localidad típica "Bordeaux" (Jacquelin du Val, 1854) (fig. 19).

Diagnosis de la hembra Los protarsos son tetrámeros y no están dilatados.

No existe el mechón de sedas gruesas y largas de la frente. El octavo urosternito tiene la espina gastral corta y fina (fig. 13). La espermateca es del "type 1" de Perreau (1989) (fig. 16) doblada por la mitad en ángulo recto; los dos lóbulos están diferenciados y su sección es sensíblemente mayor que la del conducto tubular de unión; los dos lóbulos son de tamaño similar; el conducto espermático se engrosa en el punto de inserción con la espermateca; en el punto de inserción con la bolsa copulatriz el conducto no tiene un verdadero proceso basal sino un engrosamiento ligeramente esclerotizado y estriado.

Serie tipo Lectotipo: ♂ (a partir de la presente designación): "meridionalis / J. du V" [etiqueta blanca rectangular con dos líneas transversas (ms J. du Val)], "Type" [etiqueta roja rectangular (i)], "MUSÉUM PARIS (i) / coll (ms Jeannel) / J. du Val (ms Jeannel)" [etiqueta blanca rectangular], etiqueta de papel de acetato con el edeago montado en bálsamo del Canadá; se ha añadido la etiqueta roja rectangular: "LECTOTYPUS / Adelops meridionalis / Jacquelin du Val, 1854 / Fresneda, Bourdeau & / Faille des. 2009" y la etiqueta blanca "Bathysciola meridionalis / (Jacquelin du Val) / Fresneda, Bourdeau & / Faille det. 2009" (MNHNP).

Paralectotipo: ♀ "Cotype" [etiqueta blanca rectangular con letras rojas (i)], "MUSÉUM PARIS (i) / coll (ms Jeannel) / J. du Val (ms Jeannel)" [etiqueta blanca rectangular], etiqueta de papel de acetato con la genitalia femenina montada en bálsamo del Canadá; se ha añadido la etiqueta roja rectangular "PARALECTOTYPUS / Adelops meridionalis / Jacquelin du Val, 1854 / Fresneda, Bourdeau & Faille des.

2009" y la etiqueta blanca "Bathysciola meridionalis / (Jacquelin du Val, 1854) / Fresneda, Bourdeau & / Faille det. 2009" (MNHNP).

Bathysciola nitidula de la Grotte de Portel en Ariège fue considerada por Jeannel (1924) como sinónimo más reciente de B. meridionalis, criterio seguido en la revisión de Fresneda & Salgado (2006). No hay duda pues el edeago de los ejemplares de la Grotte de Portel es idéntico al de los ejemplares estudiados de Bordeaux, Gers, Montagagne o Labouiche. En la descripción de Normand (1907) no se indica cuantos ejemplares componen la serie tipo. Se ha encontrado un sintipo que se conserva en la colección general del MNHNP.

Etimología Bathysciola liqueana sp. n., procedente de la Grotte de Liqué, en las proximidades de la aldea de Liqué en Moulis, cerca de Saint–Girons, Ariège, Francia.

Localidad típica "Cette espèce habite la grotte du Portel, située près du village de Baulou, à 10 kilomètres de Foix (Ariège)" (Normand, 1907) (fig. 19).

Bathysciola (Bathysciola) meridionalis (Jacquelin du Val, 1854) (figs. 2, 5, 8, 11, 14, 17) Adelops meridionalis Jacquelin du Val, 1854: XXXVI Bathyscia Duv. meridionalis: Reitter, 1885: 33 Bathysciola meridionalis Duval: Jeannel, 1910: 29 Bathyscia nitidula Normand, 1907: 272 Notas taxonomicas y nomenclaturales En la descripción de la especie no se indica el número de ejemplares estudiados (Jacquelin du Val, 1854).

Se han hallado dos sintipos que se conservan en la colección general del MNHNP que originalmente se encontraban en una caja de la colección de Pierre Nicolas Camille Jacquelin du Val (1828–1862) de insectos europeos; el año 1864, dos después de la muerte de este entomólogo, su colección completa fue depositada en el MNHNP.

Serie tipo Lectotipo: ♂ (a partir de la presente designación): "Ar. / Gr. de Portel / Dr. Normand" [etiqueta blanca rectangular (i)], "Cotype" [etiqueta roja rectangular (i)], "MUSÉUM PARIS / Coll. R. Jeannel 1931" [etiqueta blanca rectangular (i)], "nitidula / Norm." [etiqueta blanca rectangular (ms Normand)]; se ha añadido la etiqueta roja rectangular "Lectotypus / Bathyscia nitidula / Normand, 1907 / Fresneda, Bourdeau / & Faille des. 2010" y la etiqueta blanca "Bathysciola / meridionalis / (Jacquelin du Val) / Fresneda, Bourdeau / & Faille det. 2010" (MNHNP).

Material adicional estudiado (fig. 19) Francia. Ariège: 1 ♂, Alzen, Grotte de la route de Montagagne, 10 II 1977, Bourdeau leg. (CCB); 1 ♂, Labouiche, Grotte du chemin de fer, 5 II 2004, Bourdeau leg. (CCB); 2 ejs., Montégut, Grotte du Fajal, 31 I 1974, Déliot leg. (CCV); 1 ♂ y 1 ♀, Grotte de

Animal Biodiversity and Conservation 33.2 (2010)

137

17

16

0,5 mm

18

Figs. 16–18. Segmento genital femenino y complejo espermatecal: 16. Bathysciola liqueana sp. n., paratipo de la Grotte de Liqué; 17. B. meridionalis de Gimont; 18. B. finismillennii de la Grotte de Sabouche.

Figs. 16–18. Female genital segment with spermathecal complex: 16. Bathysciola liqueana n. sp., paratype from Grotte de Liqué; 17. B. meridionalis from Gimont; 18. B. finismillennii from Grotte de Sabouche.

138

Portel, 1916 (ex col. Nègre, MZB); 2 ejs., Grotte de Portel, VI 1920, Jeannel leg., "nitidula" [ms Jeannel] (MNHNP); 1 ej., Taurignan–Vieux, Grotte de Touasse Peyrous, 17 7 1979, Vanderbergh leg. (CCV); 1 ♀, Ariège, sin más datos (CCB). Gers: 1 ♂, Gers, Peyerimhoff (ex col. Nègre, MZB); 1 ♀, Gers (ex col.

Nègre, MZB); 3 ♀♀, Gimont (ex col. Nègre, MZB).

Gironde: 1 ♀, Cubzac, XI 1935, G. Tempère leg. (ex col. Nègre, mzb); 1 ♀, Cussac–Fort–Médoc, III 1930, G. Tempère leg. (ex col. Nègre, MZB).

Datos publicados (fig. 19) Francia. Ariège: Portel (Normand, 1907), Montégut (Jeannel, 1924); Gers: Gimont, Sansas–Montferran– Savès (Jeannel, 1924); Gironde: Bordeaux (Jacquelin du Val, 1854; Jeannel, 1924).

Fresneda et al.

doblado en ángulo obtuso un poco después del punto central de manera que la porción apical es más corta que la basal. En el ápice de los estilos laterales del tegmen se encuentran insertadas dos a dos, cuatro sedas finas y cortas (fig. 11). El saco interno del edeago (fig. 5) tiene en la región media una serie de faneras fuertemente esclerotizadas: una superior de disposición transversa y otra inferior más pequeña de disposición también transversa, cuyos extremos están unidos por un tejido fuertemente estriado; en la parte central, en posición axial, se encuentra un nódulo redondeado aparentemente flotante; en la parte inferior de las bandas de refuerzo apical, y situado entre las dos, se encuentra una bolsa con el tegumento muy estriado que en su extremo superior muestra unas grandes espinas.

Nota Jeannel (1924) indica también la Grotte d’Eycheil (= Grotte de Sabouche) y la Grotte de Liqué de Moulis; en la primera de estas localidades se encuentra B. finismillennii, y en la segunda B. liqueana sp. n. Vista la confusión, se impone la revisión de las siguientes citas de Jeannel (1924) y Coiffait (1959): Ariège: Mérigon, Grotte de la Quère (Coiffait, 1959), Prat (Jeannel, 1924); Gers: Courrensan, Gensac, Lectoure (Jeannel, 1924). Haute–Garonne: Saint–Martin–du–Touch (Jeannel, 1924), Toulouse (Coiffait, 1959); Lot–et–Garonne: Tonneins (Jeannel, 1924). Aunque no se sabe a que especie pertenecen los ejemplares de estas localidades, también se han incluido en el mapa de distribución pues contribuyen a determinar la área colonizada por el grupo de especies; no se puede asegurar con certeza, pero una vez vista su distribución (fig. 19) se considera probable que todo ese material sea B. meridionalis.

Diagnosis de la hembra Los protarsos son tetrámeros y no están dilatados.

No existe el mechón de sedas gruesas y largas de la frente. El octavo urosternito femenino tiene la espina gastral robusta (fig. 14). La espermateca es del "type 1" (Perreau, 1989) (fig. 17) con la parte basal curvada y la apical recta; los dos lóbulos están bien diferenciados pues su sección es mayor que la de la región media; el lóbulo apical es esférico y más pequeño que el basal; el conducto espermático tiene un engrosamiento previo a su inserción en la espermateca; en el punto de inserción con la bolsa copulatriz el conducto no tiene un verdadero proceso basal sino un engrosamiento ligeramente esclerotizado y estriado.

Diagnosis del macho Es un animal oblongo de contorno regular (fig. 2); su longitud, tomada entre el margen anterior del pronoto y el ápice de los élitros se encuentra entre 2,00 y 2,40 mm. Toda la superficie está cubierta de pilosidad fina, amarillenta y tumbada. La cabeza presenta un punteado muy fino y el macho tiene un mechón de gruesas y largas sedas en la frente, ausente en la hembra; las antenas son un poco más cortas que la mitad de la longitud del animal: 1,10 mm para un ejemplar de 2,40 mm de longitud; las proporciones de los antenómeros se dan en la tabla 2. El pronoto es transverso, con los márgenes laterales regularmente curvados y el tegumento marcado por un punteado muy fino, denso y desordenado; un fino microretículo le confiere aspecto mate; la máxima anchura se encuentra en la base. Los élitros no tienen estría parasutural y la escultura la forman puntos rugosos alineados transversalmente en la mitad basal, desordenados en la apical. La quilla mesoventral es muy baja, resumida a un reborde que está regularmente curvado; no se prolonga sobre el metaventrito. Las patas son proporcionalmente cortas, el primer artejo de los protarsos del macho es cuadrangular y un poco más estrecho que el extremo distal de la protibia. El lóbulo medio del edeago en visión dorsal (fig. 5) es largo, estrecho, con el ápice puntiagudo; en visión lateral (fig. 8) está

Bathysciola (Bathysciola) (meridionalis group) finismillennii Fresneda & Salgado, 2006: 47

Bathysciola (Bathysciola) finismillennii Fresneda & Salgado, 2006 (figs. 3, 6, 9, 12, 15, 18)

Localidad típica "Grotte de Sabouche in Eycheil, Ariège (France)" (Fresneda & Salgado, 2006) (fig. 19).

Serie tipo "Type series.– Holotype: one male from Grotte de Sabouche in Eycheil, Ariége (France), VII.1958, H. Coiffait leg. (stored in col. MNHNP). Paratypes: two males and two females with the same data as the holotype; two males and one female, Grotte de Sabouche, Eycheil, Ariége, 20.XI.2002. Eric Olivier leg., in col. E. Olivier and col. Fresneda." (Fresneda & Salgado, 2006).

Material adicional estudiado (fig. 19) Francia. Ariège: 1 ♂, Saint–Sernin, La Grotto, Bourdeau leg. (CCB). 1 ♀, Eycheil, Grotte d’Eycheil (= Grotte de Sabouche), 25 V 1897, J. Bepmale leg. (MNHNP); un ejemplar, Grotte de Sabouche superior, 12 XII 2009, Bourdeau & Fresneda leg. (Institut de Biologia Evolutiva de Barcelona, para estudio molecular).

Diagnosis del macho La forma es oval con el contorno regular (fig. 3); existe un ángulo pronoto–elitral obtuso; su longitud tomada

Animal Biodiversity and Conservation 33.2 (2010)

139

Bathysciola liqueana sp. n.

Bathysciola meridionalis Bathysciola finismillennii Bathysciola sp. grupo meridionalis

100 km

Fig. 19. Mapa de los Pirineos con la distribuci贸n de Bathysciola liqueana sp. n., B. meridionalis y B. finismillennii.

Fig. 19. Map of the Pyrenees with distribution of Bathysciola liqueana n. sp., B. meridionalis and B. finismillennii.

140

entre el margen anterior del pronoto y el ápice de los élitros es de 2,30 mm. La superficie está cubierta de fina pilosidad amarillenta acostada. La cabeza tiene un punteado muy fino y la pilosidad es algo más robusta y erecta que en el resto del cuerpo; el macho tiene una prominencia frontal donde se encuentra un mechón de sedas largas y robustas, ausente en la hembra; las antenas son un poco más cortas que la mitad de la longitud total: 1,10 mm en un paratipo de 2,30 mm de longitud; la proporción de los antenómeros se da en la tabla 3.

El pronoto es transverso, con los márgenes laterales regularmente curvados; el tegumento presenta un punteado muy fino de disposición densa y desordenada; un microretículo muy fino confiere al tegumento un aspecto mate; la máxima anchura se encuentra en la mitad de su longitud. Los élitros no tienen estría parasutural y presentan puntos rugosos alineados transversalmente en la mitad basal, desordenados en la apical. La quilla mesoventral es baja y está curvada; no se prolonga sobre el metaventrito. Las patas son proporcionalmente cortas, el primer artejo de los protarsos del macho tiene forma acorazonada y es más ancho que el extremo distal de la protibia. El lóbulo medio del edeago es largo, delgado, con el ápice redondeado en visión dorsal (fig. 6); en visión lateral (fig. 9) está fuertemente doblado por la zona central de manera que forma un ángulo casi recto, y las dos mitades son prácticamente de la misma longitud. Los estilos laterales del tegmen tienen el ápice engrosado y en el se insertan nueve sedas robustas y largas (fig. 12). El saco interno del edeago (fig. 6) tiene en la región media un conjunto de faneras fuertemente esclerotizadas que forman un anillo; en la parte interior del anillo se encuentra un nódulo alargado aparentemente flotante; en la parte inferior de las bandas de refuerzo apical, situado entre ellas se encuentra una bolsa con el tegumento estriado.

Diagnosis de la hembra Los protarsos son tetrámeros y no están dilatados.

No existe el mechón de sedas gruesas y largas de la frente. El octavo urosternito femenino tiene la espina gastral muy fina, con el ápice puntiagudo (fig. 15). La espermateca es del "type 1" (Perreau, 1989) (fig. 18), regularmente curvada de un extremo al otro y con los dos lóbulos diferenciados, un poco más gruesos que la región media; el apical es esférico y más pequeño que el basal; el conducto espermático tiene un engrosamiento previo a su inserción en la espermateca; en el punto de inserción con la bolsa copulatriz el conducto no tiene un verdadero proceso basal sino un engrosamiento ligeramente esclerotizado y estriado.

Discusión Bathysciola liqueana sp. n. pertenece al grupo «meridionalis» de Bathysciola. Este grupo lo forman tres táxones (Fresneda & Salgado, 2006; Fresneda & Fery, 2009) a los que hay que añadir el que se describe en este artículo: B. finismillennii Fresneda & Salgado, 2006, B. grenieri (Saulcy, 1872), B. liqueana sp. n. y B. meridionalis (Jacquelin du Val, 1854) (= B. nitidula Normand, 1907).

Fresneda et al.

La morfología externa del conjunto formado por Bathysciola finismillenni, B. liqueana sp. n. y B. meridionalis es muy homogenea: con un aspecto muy similar, con el mismo tipo de punteado elitral, idéntica quilla mesoventral baja y redondeada, y el mismo tipo de peculiar dimorfismo sexual. La cuarta especie del grupo, B. grenieri, no responde a este modelo y las coincidencias se limitan a la estructura general del edeago: no se puede afirmar con certeza, pero probablemente derive de la cladogénesis más basal del clado. Las Bathysciola del grupo "meridionalis" se caracterizan por: 1. El edeago en vista lateral (figs. 7–9) presenta la región basal robusta y está fuertemente doblado aproximadamente en su parte media; la región apical mengua bruscamente y resulta muy fina, con el ápice prolongado y aguzado o rematado por un nódulo diminuto.

2. Los estilos laterales del tegmen son sinuosos, tan largos o un poco más cortos que el lóbulo medio; el ápice está engrosado y en el se insertan nueve largas sedas robustas (fig. 12), o es delgado y se insertan cuatro sedas de longitud y grosor variable (figs. 10–11).

3. El saco interno del edeago (figs. 4–6) presenta faneras complejas, solapadas y fuertemente esclerotizadas en la región media; el conjunto forma una suerte de anillo que puede dejar libre un espacio central, lugar donde se encuentra un nódulo aparentemente flotante de formas diversas, más redondeado o más alargado; en el extremo superior de la región media, entre las bandas de refuerzo apical, puede existir una bolsa con el tegumento fuertemente estriado; en visión lateral se puede observar que las faneras de la región media forman una especie de paréntesis.

Hay que eliminar del examen comparativo a B. grenieri ya que esta especie posee una quilla mesoventral alta y angulosa, finas estriolas transversas en toda la superfície elitral, y los machos no tienen el mechón de sedas en la frente; las estructuras genitales y la distribución de esta especie no se incluyen en este artículo pues han sido estudiadas recientemente (Fresneda & Fery, 2009): siete paralectotipos de Bathyscia schiodtei Kiesenwetter, 1850 son ejemplares de B. grenieri de La Preste (Pyrénées–Orientales, Francia). A eliminar también Bathysciola finismillennii en la cual los estilos laterales del tegmen están armados de nueve largas y robustas sedas, contra sólo cuatro en B. liqueana sp. n.; los machos de B. finismillennii también tienen el mechón de pelos frontales pero se insertan en una prominencia angulosa de la frente, que no existe en B. liqueana sp. n. Así pues, la especie más similar es B. meridionalis y las diferencias más vistosas que se pueden observar entre esta y la nueva especie son las que siguen: 1. En B. liqueana sp. n. el primer artejo de los protarsos del macho es triangular y algo mas estrecho que el extremo distal de la protíbia; en B. meridionalis es igual de estrecho pero cuadrangular.

2. En B. liqueana sp. n. la espermateca está fuertemente doblada por la mitad en ángulo casi recto (fig. 16); en B. meridionalis la parte basal está ligeramente curvada y la apical es recta (fig. 17).

Animal Biodiversity and Conservation 33.2 (2010)

141

Tabla 1. Fórmula antenaria del holotipo macho de Bathysciola liqueana sp. n. (80 unidades = 1 mm).

Table 1. Antennal formula of the holotype male of Bathysciola liqueana n. sp. (80 units = 1 mm).

Artejos

I

II

III

IV

V

VI

VII

VIII

IX

X

XI

Longitud

11

10

7

6

7

6

8

5

7

7

12

Anchura

5

4

3

3

3

3

5

4

5

5

7

Tabla 2. Fórmula antenaria del lectotipo macho de Bathysciola meridionalis (80 unidades = 1 mm).

Table 2. Antennal formula of the lectotype male of Bathysciola meridionalis (80 units = 1 mm).

Artejos

I

II

III

IV

V

VI

VII

VIII

IX

X

XI

Longitud

13

11

8

6

7

6

7

4

5

5

12

Anchura

5

5

3

3

3

3

5

4

5

5

7

Tabla 3. Fórmula antenaria de un paratipo macho de Bathysciola finismillennii (80 unidades = 1 mm).

Table 3. Antennal formula of a paratype male of Bathysciola finismillennii (80 units = 1 mm).

Artejos

I

II

III

IV

V

VI

VII

VIII

IX

X

XI

Longitud

12

11

6

5

6

5

8

4

6

6

12

Anchura

5

4

3

3

3

3

6

5

6

6

7

3. En B. liqueana sp. n. el octavo urosternito femenino tiene la espina gastral corta y fina (fig. 13), mientras que en B. meridionalis es más larga y robusta (fig. 14).

4. En B. liqueana sp. n. el lóbulo medio del edeago en visión dorsal (fig. 4) es corto, ancho, con el ápice redondeado o incluso truncado, y en vista lateral (fig. 7) robusto y doblado en ángulo casi recto. En B. meridionalis en visión dorsal (fig. 5) es largo, estrecho, con el ápice puntiagudo, y en visión lateral (fig. 8) es más grácil, doblado en forma de ángulo obtuso.

5. En B. liqueana sp. n. el saco interno del edeago (fig. 4) tiene en la región media una serie de faneras fuertemente esclerotizadas que no dejan en el centro un área vacía y por lo tanto no es visible ningún nódulo aislado; este espacio está ocupado por dos faneras de disposición vertical largas y ovales; la fanera transversa superior tiene una prominencia mediana. En B. meridionalis (fig. 5) también existe ese conjunto de faneras, pero forman una suerte de anillo que deja un área vacía en el centro; este espacio está ocupado por un nódulo redondeado aparentemente flotante; la fanera transversa superior no tiene prominencia mediana.

Distribución (fig. 19) Estas tres especies se distribuyen a lo largo de la cuenca del río Garonne, desde la vertiente norte de los Pirineos centrales ―cuenca del río Ariège― hasta su desembocadura en el océano Atlántico, en Francia.

Bathysciola liqueana sp. n. se conoce de la localidad típica, la Grotte de Liqué, en el valle del Lez, afluente del Salat, Ariège, Francia; esta cavidad es una localidad clásica de la bioespeleología, conocida desde antiguo y bien prospectada por investigadores del Laboratoire Souterrain de Moulis (Centre National de la Recherche Scientifique); probablemente los ejemplares de la serie tipo deben proceder del cono de derrubios que se encuentra en la vertical del pozo de entrada, donde además se acumula gran cantidad de hojarasca. El ejemplar recolectado el 19 XI 2009 procede de la Grotte de Liqué inferior, que está situada muy cerca de la otra; el ejemplar se encontró entre la tierra húmeda, en la boca de la cavidad. También se ha encontrado en la Gouffre de Peillot, Cazavet, en el mismo macizo que las otras cavidades. Bathysciola finismillennii se encuentra en la Grotte de Sabouche en Eycheil, valle del Salat; también en La Grotto de

142

Saint–Sernin, en la parte alta de la misma cuenca, cerca de Seix. Bathysciola meridionalis se encuentra desde los alrededores de Foix, en el macizo de Plantaurel, hasta la desembocadura del río Garonne en Bordeaux; es la especie que presenta la mayor área de distribución de su grupo y parece haberse desplazado siguiendo las cuencas de los ríos Ariège y Garonne: es probable una colonización pasiva desde los Pirineos aguas abajo arrastrada por esos ríos.

Agradecimientos Agradecemos a T. Deuve (MNHNP) y A. Taghavian (MNHNP) haber facilitado material para estudio depositado en el Muséum National d’Histoire Naturelle de Paris; también a nuestro buen amigo C. Vanderbergh (Francia, Les–Clayes–sous–Bois) por confiarnos valiosos ejemplares de su colección privada. Por último queremos expresar agradecimiento a Glòria Masó y Miquel Prieto (conservador y colaborador, respectivamente, del Departamento de Artrópodos del Museu de Ciències Naturals de Barcelona), este estudio forma parte del proyecto de catalogación de series tipo del museo. Este artículo ha sido financiado en parte por el proyecto CGL2007–61943/BOS, A. Cieslak (Museo Nacional de Ciencias Naturales, Madrid, CSIC).

Referencias Coiffait, H., 1959. Note sur les Bathysciitae de la région pyrénéenne et de Catalogne. Annales de Spéléologie, 14(1–2): 159–179.

Fresneda, J. & Comas, J., 2007. Una nueva especie del género Bathysciola Jeannel, 1910 de los Pirineos centrales, España (Coleoptera, Leiodidae, Cholevinae, Leptodirini). Graellsia, 63(2): 325–332.

Fresneda, J. & Fery, H., 2009. Descripción de Ba-

Fresneda et al.

thysciola mystica sp. n., designación de lectotipo de Bathyscia schiodtei Kiesenwetter, 1850 y notas sobre la identidad de Bathysciola aranensis Coiffait, 1959 (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini). Boletín de la Sociedad Entomológica Aragonesa, 44: 1–13.

Fresneda, J., Fery, H. & Faille, A., 2010. El complejo de Bathysciola ovata (Kiesenwetter, 1850): designación de lectotipos, establecimiento de sinonímias y consideraciones taxonómicas y corológicas (Coleoptera, Leiodidae, Cholevinae, Leptodirini). Boletín de la Sociedad Entomológica Aragonesa, 46: 95–104.

Fresneda, J. & Salgado, J. M., 2006. The genus Bathysciola Jeannel, 1910 in the Iberian Peninsula and Pyrenees. Taxonomic revision of the sections IV, VI and VII (Jeannel, 1924) (Coleoptera, Cholevidae, Leptodirinae). Graellsia, 62(1): 25–74.

Jacquelin du Val, C., 1854. Communications. Séance du 28 Juin 1854. Annales de la Société entomologique de France (Bulletin des séances), 23: XXXVI–XXXVII. Jeannel, R., 1910. Biospeologica XIV. Essai d’une nouvelle classification des silphides cavernicoles.

Archives de Zoologie Expérimentale et Générale, (5)5(1): 1–48.

– 1924. Monographie des Bathysciinae (Col. Catopidae). Archives de Zoologie Expérimentale et Générale, 63(1): 1–436.

Normand, H., 1907. Nouveaux Coléoptères de la faune française (quatrième note). Bulletin de la Société entomologique de France, 12: 272–274.

Perreau, M., 1989. De la phylogénie des Cholevidae et des familles apparentées (Coleoptera, Cholevidae).

Archives des Sciences Genève, 39(3): 579–590.

Reitter, E., 1885. Bestimmungs–Tabellen der europäischen Coleopteren, 12 Necrophaga.

Verhandlungen des naturforschenden Vereines in Brünn [1884], 23: 3–122.

Animal Biodiversity and Conservation 33.2 (2010)

143

Habitat use by European wildcats (Felis silvestris) in central Spain: what is the relative importance of forest variables?

J. Lozano

Lozano, J., 2010. Habitat use by European wildcats (Felis silvestris) in central Spain: what is the relative importance of forest variables? Animal Biodiversity and Conservation, 33.2: 143–150.

Abstract Habitat use by European wildcats (Felis silvestris) in central Spain: what is the relative importance of forest variables?— Habitat preferences of wildcats are controversial. Although they are usually considered a forest species, alternative environments such as scrubland can be preferred. In this study we compared five habitat types in relation to wildcat occurrence. Sampling was carried out between 2001 and 2002 on a series of transects in search of wildcat scats to calculate an abundance index. Structural variables of landscape and rabbit abundance were also estimated and summarised as orthogonal factors using a principal component analysis (PCA). A priori contrasts showed that wildcats tended to be more abundant in areas with Mediterranean mountain vegetation, although agricultural steppes also provided suitable habitat. The forest variables were not included in the general linear model (GLM) obtained, indicating that wildcats are mainly associated with scrubland mosaics with rabbits in this region.

Key words: Abundance, Agricultural steppe, Forest, Habitat, Scrubland, Wildcat.

Resumen Uso del hábitat por el gato montés (Felis silvestris) en España central: importancia relativa de las variables forestales.— El hábitat del gato montés es un tema controvertido: se le consideraba una especie forestal, pero otros hábitats, como el matorral, pueden ser más utilizados. En este estudio se comparan cinco tipos de hábitat, muestreando entre los años 2001 y 2002 una serie de transectos en busca de excrementos de gato montés para calcular el índice de abundancia. También se estimaron variables estructurales del hábitat y la abundancia del conejo (resumidas en un análisis de componentes principales, ACP). Las Comparaciones Planificadas (contrastes a priori) mostraron que la especie fue más abundante en las áreas de vegetación mediterránea de montaña, y que la estepa no es un hábitat rechazado por el gato montés. Un análisis mediante modelos lineales generalizados (GLM) no incluyó variables forestales, lo que sugiere que esta especie se encuentra especialmente asociada a los mosaicos de matorral con conejos.

Palabras clave: Abundancia, Estepa agrícola, Bosque, Hábitat, Matorral, Gato montés.

(Received: 13 X 09; Conditional acceptance: 11 XII 09; Final acceptance: 3 VI 10) Jorge Lozano, Depto. de Biología y Geología, Univ. Rey Juan Carlos, c./ Tulipán s/n., E–28933 Móstoles, Madrid (Spain).

Corresponding author: J. Lozano. E–mail: j.lozano.men@gmail.com

ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

144

Introduction The wildcat (Felis silvestris Schreber, 1775) is distributed over a wide geographical area that stretches from Western Europe to central India and Africa (Sunquist & Sunquist, 2002). The European subspecies (F. s. silvestris) is present from the Caucasus to the Iberian Peninsula (Driscoll et al., 2007), showing a fragmented pattern of distribution (Stahl & Artois, 1991). The species is of conservation concern and is included both in Appendix II of the Bern Convention and in Annex IV of the European Habitats Directive (92/43/ CEE). But despite this legal protection, the wildcat is facing a number of threats throughout its range (see a review in Lozano, 2009); human persecution (predator control) and habitat alteration (Lozano et al., 2007; Virgós & Travaini, 2005) are probably the most important of these.

It is clear from the species’ wide distribution that it inhabits many different habitat types (Stahl & Leger, 1992). However, few studies have investigated the wildcat’s ecological requirements and habitat preferences (see Lozano et al., 2003) and its preferred habitat continues to be a controversial matter.

The first research in Europe was carried out central Europe and it was stated that the wildcat is a forest species (Guggisberg, 1975; Parent, 1975; Ragni, 1978; Schauenberg, 1981). None of these studies, however, truly investigated habitat selection. Other early reports provided information which called this assumption into question (Artois, 1985; Corbett, 1978; Langley & Yalden, 1977). The "forest hypothesis" gained favour, however, and the Council of Europe (1993) recommended good management of forests as the principal measure for wildcat conservation.

This recommendation was accepted in Spain and the Spanish Red Data List for Mammals (Palomo et al., 2007) stated that wildcats are mainly forest inhabitants. Indeed, some studies showed that wildcat individuals may positively select forests to shape their home ranges (Daniels et al., 2001; Klar et al., 2008; Sarmento et al., 2006; Wittmer, 2001). More recent reports, however, have found that wildcats may prefer habitats other than forest, especially scrubland and pasture areas (see Easterbee et al., 1991; Lozano et al., 2003, 2007; Monterroso et al., 2009). In still other studies the role of forest cover remains unclear.

Lozano et al. (2007), for example, found that only one of three abundance models included forest cover.

It is clearly difficult to make appropriate decisions concerning habitat conservation if we do not know exactly what the preferred habitat is, or what the basic ecological requirements for the species are.

Furthermore, perhaps because of the suggestion that wildcats are forest animals, treeless environments have never been evaluated as potential habitats (except in Scotland; see Easterbee et al., 1991), even though the species is usually found in such settings (Stahl & Leger, 1992). In Spain there are various types of open habitat which might be suitable for wildcats, such as semi–arid environments, or agricultural steppes where the landscape is dominated by crops (Lozano, 2008).

Lozano

The aim of this study was to assess the relative importance for wildcats of different habitats in a region of central Spain where a wildcat occurrence study was carried out several years ago, and a first abundance model was obtained (Lozano et al., 2003). In this work agricultural steppe was considered for the first time in wildcat habitat studies. We generated a new abundance model, on a regional scale, to reveal the structural features explaining wildcat occurrence in Central Spain. Results and the new model were compared with those of Lozano et al. (2003) for the same region. Given that steppes were not considered in the first study, it was possible to test how the model changed by including a new type of habitat.

Material and methods Study area Fieldwork was conducted in central Spain, mainly in the province of Madrid, but also including nearby areas in the north of Toledo and the south of Segovia provinces (fig. 1). Between autumn 2001 and spring 2002 a number of trails throughout the region were sampled, covering a total length of 101 km. The trails were distributed across different habitat types, involving those considered by Lozano et al. (2003), plus trails crossing agricultural steppes to the south and east of Madrid.

Five habitat types were considered, defined in the present study as vegetation types: Mediterranean vegetation in plains (500–800 m a.s.l.), Mediterranean mountains (950–1,050 m a.s.l.), deciduous forests (1,250–1,700 m a.s.l.), mountain pine forests (1,250– 1,800 m a.s.l.), and agricultural steppes (located in flat areas around 500 m a.s.l.).

Mediterranean vegetation both in the plains and the mountains is a mixture of forests dominated by holm oak (Quercus ilex L.) and scrublands, with Cistus ladanifer L. and Retama sphaerocarpa L. as the main understory shrub species. These mosaics are occasionally interspersed with Mediterranean pines (Pinus pinea L. and Pinus pinaster Aiton, 1789) and Juniperus oxycedrus L. The predominant climate is dry and hot with a strong drought in summer, though this is less pronounced in the mountain areas (Rivas–Martínez et al., 1987). In addition to the climatic and elevation differences, these Mediterranean areas showed marked differences in vegetation structure and human land use, with the plains being basically devoted to hunting and the mountains to cattle raising.

Deciduous forests comprise Pyrenean oaks (Q. pyrenaica Willdenow, 1805), with Cistus laurifolius L. and Citysus scoparius L. as the main understory shrub species. In this habitat, the forest is dominant and scrub areas are spatially restricted. Climate is more humid and cooler than in the Mediterranean vegetation areas and there is a less pronounced drought. Mountain pine forests comprise Scots pine (Pinus sylvestris L.), with a smaller understory shrub cover (Citysus sp.).

They have harsher climatic conditions than deciduous forests, with colder winters that may allow several

Animal Biodiversity and Conservation 33.2 (2010)

145

Iberian peninsula

Province of Madrid

Study area (101 sites) Guadarrama range

30 km

Fig. 1. Study area in the Iberian peninsula, within the province of Madrid. A total of 101 transects with a length of 1 km each across the region were surveyed.

Fig. 1. Área de estudio en la península ibérica, dentro de la provincia de Madrid. Se muestrearon un total de 101 transectos de 1 km de longitud en toda el àrea muestreada.

weeks of snow cover (Rivas–Martínez et al., 1987).

Agricultural steppes are artificial environments in the flat areas where the landscape has been profoundly transformed and is dominated by cereal croplands.

However, scattered small patches of scrubland may also be present in these areas. More details about the ecological and climatic features of these habitat types can be found in Rivas–Martínez et al. (1987).

Survey design The study design used by Lozano et al. (2003) was rigorously followed to allow direct comparisons.

Thus, the same trails were considered (except the transects on agricultural steppes, which were new for this study) and their distribution was homogeneous across habitat types: 16 km in Mediterranean plains, 16 km in Mediterranean mountains, 21 km in deciduous forests, 25 km in pine forests, and 23 km in agricultural steppes. The sample unit (transect) was a one–kilometre survey along paths and tracks (1–3 m wide), thus accounting for a total of 101 transects of one km each. Moreover, each transect was separated from the next by at least one kilometre in order to avoid spatial data dependence problems.

For each transect we calculated an abundance index for wildcats based on the frequency of scats.

This index was calculated as the number of segments of 200 m where a wildcat scat was found, divided by five (the total number of segments in each 1–km transect). In relation to the presence of domestic cats in the study areas, their scats can be differentiated from those of wildcats following the methods of Lozano

et al. (2003) as it has been shown that in areas of sympatry only wildcats leave exposed scats along paths (Corbett, 1979; Lozano & Urra, 2007). Confusion with scats from other carnivore species seems negligible in view of the author’s experience in cat excrement identification.

An abundance index for wild rabbit (Oryctolagus cuniculus L., 1758) was also obtained by recording the number of latrines found in each 200 m segment by means of transects (50 m long and 1 m wide) perpendicular to the principal trail (see also Virgós et al., 2003). This index was calculated as the simple sum of latrines found in the five 200–m segments for each 1–km trail.

To describe microhabitat structure, various variables were visually estimated along the main transect.

As in Lozano et al. (2003), the microhabitat structure variables considered were: tree cover (%), shrub cover (%), open ground cover (%), rock cover (%), average tree height and a wildcat shelter index (shelter availability). These variables were visually estimated in a 25 m radius around the observer each 200 m.

We calculated the mean value of the different covers for each transect. To calculate the shelter index we assigned a number from 1 to 5 according to the existence of cavities in rocks and trees, and the visual permeability of the site. Maximum values thus represented environment structures that were very dense due to rock and vegetation cover, reducing the visibility to few meters. The wildcat shelter index was finally calculated as the mean shelter value per transect.

Habitat characterisation at a landscape scale was determined for all the transects calculating the fol-

146

Abundance index of wildcat

Lozano

0.30 0.28 0.26 0.24 0.22 0.20 0.18 0.16 0.14 0.12 0.10 0.08 0.06 0.04

Mean ± 0.95*SE 1

2 3 4 Habitat types

5

Fig. 2. Mean and standard error of wildcat abundance index for each habitat type considered: 1. Plains with Mediterranean vegetation; 2. Mountains with Mediterranean vegetation; 3. Deciduous forests; 4.

Mountain pine forests; 5. Agricultural steppes. The only significant difference was between habitats 2 and 4.

Fig. 2. Media y error estándar del índice de abundancia del gato montés para cada hábitat estudiado: 1.

Llanuras con vegetación mediterránea; 2. Montaña con vegetación mediterránea; 3. Bosque caducifolio; 4. Montaña con bosque de pinos; 5. Estepa agrícola. Solamente se encontraron diferencias significativas entre los hábitats 2 y 4.

lowing variables: forest cover (%), pasture cover (%), agricultural cover (%), scrub cover (%), urban cover (%), number of watercourses, roughness index and mean elevation. As in Lozano et al. (2003), to quantify the landscape variables we used land–use maps (1:50.000) to define an area of 9 km2 around each particular trail surveyed. In this area, landscape variables were measured through a grid with 121 evenly spaced points, on which the number of points in each cover type was recorded. The 9 km2 area used covers the majority of wildcat home range sizes reported in the literature, except for extreme values (Lozano, 2009). The roughness index was calculated as the mean number of 20 m contour lines intercepted by four lines (one in each cardinal direction) originating from the centre of the 9 km2 area. Watercourses were recorded by counting their total number in each 9 km2 unit, and the mean elevation was calculated as the average value of the 121 points used in the landscape cover estimate.

Statistical analyses Normality and homogeneity of variances were verified for all variables, and those that did not fulfil parametric test requirements were normalized or tested for positive kurtosis (Underwood, 1996). Differences in wildcat abundance indices between the considered habitat types were tested by performing a priori contrasts.

All variables describing the environmental structure

(both microhabitat and landscape variables) and the rabbit abundance index were summarized to a few orthogonal factors using a Principal Component Analysis (PCA), as recommended by Graham (2003) to avoid spurious effects due to multi–colinearity in multiple regression analyses. A general linear model (GLM), generated by a forward stepwise method (F to enter = 4; F to remove = 3.99), was obtained using the wildcat abundance index as a response variable and the PCA factors (which described the environment) as predictors. All statistical analyses were conducted with the software package Statistica 6.0 (StatSoft, 2001).

Results Wildcats were found in all the habitats studied, although the species was only recorded in 42 of the 101 sampled trails. However, a priori contrasts showed that the wildcat abundance index tended to be higher in the areas with Mediterranean mountain vegetation (fig. 2), according to marginally non–significant results (p = 0.063). Comparison of the abundance index in this habitat and in pine forests (the habitat type showing the lowest mean value for the abundance index) showed significant differences (p = 0.038). No difference in wildcat abundance was found between agricultural steppes and the other habitats (p = 0.37), although the abundance index tended to be lower than

Animal Biodiversity and Conservation 33.2 (2010)

147

Table 1. Factor loadings from the Principal Component Analysis (PCA) performed with variables used to describe the structure of wildcat habitat (asterisks indicate significant correlations between variables and factors, p < 0.05).

Tabla 1. Componentes resultantes del Análisis de Componentes Principales (ACP) realizado con las variables utilizadas para describir la estructura del hábitat del gato montés (los asteriscos indican una correlación significativa entre las variables y los factores, p < 0,05).

Factor 1

Factor 2

Factor 3

Microhabitat variables Rabbit abundance index

–0.562*

0.499*

0.112

Tree cover

0.88*

0.144

0.022

Shrub cover

0.382*

0.698*

–0.079

Open ground cover

–0.539*

–0.691*

0.072

Rock cover

0.562*

–0.021

–0.12

Tree height

0.868*

0.082

0.022

Shelter index

0.493*

0.589*

–0.144

Landscape variables Forest cover Pastureland cover

0.896*

–0.097

0.097

0.041

0.777*

–0.323*

Cropland cover

–0.774*

–0.576*

0.049

Scrubland cover

–0.068

0.763*

0.302*

Urban cover

0.056

–0.087

–0.929*

Number of watercourses

0.083

0.756*

0.275*

Roughness index

0.816*

0.343*

0.032

Elevation

0.882*

0.036

0.09

Eigenvalue

5.7

3.81

1.21

% Explained variance

38

25

8

in the Mediterranean mountain vegetation (p = 0.076).

Finally, no difference was observed between mountain environments and plains (p = 0.35).

The PCA performed with the original variables generated three factors that explained 71.54% of the total variance (see table 1). The first factor represented a gradient from elevated, rough and dense forests (positive scores) to plains with crops and high rabbit abundance (negative scores). The second factor accounted for rough areas shaped by a scrub–pastureland mosaic with rabbits and watercourses (positive scores) as opposed to pure croplands (negative scores). The third factor generated a gradient that separated scrublands with watercourses (positive scores) from urbanized areas and pasturelands (negative scores).

These PCA factors, which described the structure of environments, were used as predictors in multiple regression analyses (general linear model GLM, forward stepwise method) with the wildcat abundance index as a response variable. A highly significant model was obtained (F1,99 = 12.02, p < 0.001; explaining 10.82% of the variance). Only the second PCA factor was included (positively associated) in the model (table 2). Thus,

the model shows that wildcats were more numerous in scrub–pasture mosaics, with abundance of rabbits and watercourses, whereas the species was scarce in the areas where only crops were present (fig. 3).

Discussion Since the first studies in central Europe were published it was thought that the wildcat was mainly a forest species and so its occurrence would depend on the presence of large forests (Guggisberg, 1975; Parent, 1975; Ragni, 1978; Schauenberg, 1981; Stahl & Leger, 1992). However, as previously discussed (Lozano et al., 2003), the apparent importance of forests for wildcats in those central regions of the continent can be explained by the lack of alternative environments (see also Klar et al., 2008). Thus in many places wildcats simply live where they can, it being incorrect to derive general rules about habitat preferences and try to apply them to areas with different availability of habitats. On the basis of this erroneous extrapolation, the "forest hypothesis" spread.

148

Lozano

Table 2. Variables included in the general linear model (GLM), generated by a forward stepwise method, between wildcat abundance index and PCA factors: * Scrub–pastureland mosaics vs. cropland.

Tabla 2. Variables incluidas en el modelo lineal generalizado, obtenidas mediante el método de regresión paso a paso, entre el índice de abundancia del gato montés y los factores del ACP: * Mosaicos de matorral comparado con tierras de cultivo.

Variable

Beta

B

t(99)

p

Intercept 0.131 7.424 < 0.001 Factor 2*

0.329 0.061 3.466 < 0.001

Perhaps the strongest evidence against the forest hypothesis came from Great Britain. It was shown that patterns of deforestation and wildcat disappearance were not closely associated, in contrast with what would be expected for a true forest species (see Langley & Yalden, 1977). Furthermore, the first study on wildcat habitat selection, carried out in Scotland

and considering almost thirty potential habitat types, found clearly that the most preferred habitat of Scottish wildcats was not forests, but a mainly open environment without trees (Easterbee et al., 1991).

Available evidence therefore seems to confirm that the "forest hypothesis" is based on an incomplete habitat survey. It probably survived, nevertheless, for two reasons. First, because the Scottish study was published as a technical report rather than in a scientific journal; it did not thus reach the wider scientific community. Secondly, this habitat preference was apparently interpreted as a particularity of Scottish wildcats, as distinct from the continental populations (Kitchener, 1991).

The perception of European wildcats as a forest species remained until new studies were published in scientific journals more than a decade later.

Lozano et al. (2003) derived an abundance model based on the frequency of scat occurrence, and conducted in a region of central Spain (Madrid province). This model showed again that forest was not the most important habitat for wildcats, their presence being more abundant in mosaics of scrubland and pasture. Likewise, another wildcat abundance model obtained for the Monfragüe National Park, in Cáceres province (also in central Spain), highlighted the key role of scrublands for wildcats (Lozano et al., 2007). The same conclusion was also reached in another Mediterranean area (Monterroso et al., 2009).

Abundance index of wildcat

0.0 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 –0.1 –2.5

–2.0

–1.5

–1.0 –0.5 0.0 0.5 PCA Factor 2

1.0

1.5

2.0

2.5

Fig. 3. Relationship between wildcat abundance index and Factor 2 from the PCA (cropland vs. scrub– pastureland): wildcat abundance is higher in scrubland and pasture areas with rabbits, and lower in pure croplands without scrub and rabbits.

Fig. 3. Relación entre el índice de abundancia del gato montés y el Factor 2 extraído del ACP (tierra de cultivo comparado con matorral): la abundancia del gato montés es mayor en áreas de matorrales y pastizales con conejos, y menor en cultivos intensivos, carentes de matorral y conejos.

Animal Biodiversity and Conservation 33.2 (2010)

Taking all these studies into account, it appears that although the wildcat can live in forests, this is not the preferred habitat if alternative environments are available –especially scrublands in Mediterranean areas– and therefore the species can not be considered a true forest species.

Nonetheless, the relative importance of forests at the landscape scale and tree cover at the microhabitat scale could be high even in Mediterranean regions.

Indeed, the third best model obtained by Lozano et al. (2007) also included forest variables. Moreover, wildcat presence in agricultural areas can be favoured by both forest patches (Virgós et al., 2002) and riparian woodlands (Virgós, 2001). In a study in Portugal several wildcats selected forests (Sarmento et al., 2006). But it has also been shown that wildcat occurrence depends more on availability of prey and shelter than the habitat type categorically considered (Easterbee et al., 1991; Klar et al., 2008; Lozano et al., 2003, 2007; Monterroso et al., 2009).

This study has demonstrated wildcat presence in all the studied habitat types, including the agricultural steppes, showing similar abundance indices in all cases. Wildcat abundance appeared to be higher in mountain areas with Mediterranean vegetation, due to the structural elements that this environment offers in accordance with the GLM model obtained: a mosaic landscape formed by scrubs, pastures and watercourses, and with high rabbit numbers (as previously found by Lozano et al., 2003). The lowest value for the abundance index corresponded to mountain pine forests exhibiting very different structural features. Moreover, according to the GLM model the worst environmental structure for wildcats was the intensive cropland, where the lack of shelter, water and prey are probably strong limiting factors.

The case of agricultural steppes is very interesting.

On the basis of compared abundance indices, these habitats were used by wildcats as much as the other habitats: this is the first time that such a result has been reported. Certainly, on many occasions the agricultural steppes included small areas of shrubs and pastures, as well as intensive crops, and they provided sufficient shelter for the feline. Furthermore, the populations of rodents and even rabbits in such cultivated areas could be high and such mammals are the main prey for wildcats (Lozano et al., 2006a; Malo et al., 2004). These small scrub patches thus appear to fulfil a similar function to that of forest fragments and riparian forests within an agricultural matrix (Virgós, 2001; Virgós et al., 2002), explaining wildcat presence in farmed steppe landscapes.

It is important to take into account, nevertheless, that the explanatory power of the obtained abundance model is low, around 11% of variance. Indeed, most distribution and abundance patterns of wildcat in this area of central Spain remain unexplained when only habitat variables are considered, indicating that habitat structure alone is not the predominant factor for wildcat occurrence. In relation to forests, and in clear contrast to previous studies, forest variables were not included in the wildcat abundance model, not being necessary to explain the observed patterns of abundance.

149

As a principal conclusion for conservation purposes, wildcat populations should be protected wherever they are found, regardless of habitat type. If the species has one key element of environmental structure, this appears to be the presence of scrubland, at least in Mediterranean regions. Destruction of this vegetation type should therefore be prevented (Lozano et al., 2003; Mangas et al., 2008). Priorities for rural land management must be to preserve mosaic landscapes formed by both open and closed habitat patches, and to recover rabbit populations (Lozano et al., 2003, 2007; Lozano, 2009). Finally, for the long term conservation of wildcat populations, and to allow the species to recover in those areas where it is extinct, it is essential to eradicate predator control activities in hunting areas, as this is currently one of the main problems that the species is facing in Spain (Lozano et al., 2006b; Virgós & Travaini, 2005).

Acknowledgements I thank all the members of the "Wildcat team": S. Cabezas–Díaz, E. Virgós, A. F. Malo, D. L. Huertas and J. G. Casanovas, for their continuing help, support and friendship. D. Howell and C. Vilà kindly revised the English version. P. Gomes and two anonymous referees provided useful comments which greatly improved the manuscript.

References Artois, M., 1985. Utilisation de l´espace et du temps chez le renard (Vulpes vulpes) et le chat forestier (Felis silvestris) en Lorraine. Gibier Faune Sauvage, 3: 33–57.

Corbett, L. K., 1978. Current research on wildcats: why have they increased? Scottish Wildlife, 14: 17–21.

– 1979. Feeding ecology and social organization of wildcats (Felis silvestris) and domestics cats (Felis catus) in Scotland. Ph. D. Thesis, Aberdeen University.

Council of Europe, 1993. Seminar on the biology and conservation of the wildcat (Felis silvestris).

Nancy, France, 23–25 September 1992, Council of Europe, Strasbourg.

Daniels, M. J., Beaumont, M. A., Johnson, P. J., Balharry, D., Macdonald, D. W. & Barratt, E., 2001.

Ecology and genetics of wild–living cats in the north–east of Scotland and the implications for the conservation of the wildcat. Journal of Applied Ecology, 38: 146–161.

Driscoll, C. A., Menotti–Raymond, M., Roca, A. L., Hupe, K., Johnson, W. E., Geffen, E., Harley, E., Delibes, M., Pontier, D., Kitchener, A. C., Yamaguchi, N., O’Brien, S. J. & Macdonald, D., 2007. The Near Eastern Origin of Cat Domestication. Science, 317: 519–523.

Easterbee, N., Hepburn, L. V. & Jefferies, D. J., 1991.

Survey of the status and distribution of the wildcat in Scotland, 1983–1987. Nature Conservancy Council for Scotland, Edinburgh.

Graham, M. H., 2003. Confronting multicollinearity

150

in ecological multiple regression. Ecology, 84: 2809–2815.

Guggisberg, C. A. W., 1975. Wild cats of the world.

David & Charles, Newton Abbot, London.

Kitchener, A., 1991. The Natural History of the Wild Cats. Cornell University Press, Ithaca, New York.

Klar, N., Fernández, N., Kramer–Schadt, S., Herrmann, M., Trinzen, M., Büttner, I. & Niemitz, C., 2008.

Habitat selection models for European wildcat conservation. Biological Conservation, 141: 308–319.

Langley, P. J. W. & Yalden, D. W., 1977. The decline of the rarer carnivores in Great Britain during the nineteenth century. Mammal Review, 7: 95–116.

Lozano, J., 2008. Ecología del Gato montés (Felis silvestris) y su relación con el Conejo de monte (Oryctolagus cuniculus). Ph. D. Thesis, Complutense University of Madrid.

– 2009. Gato montés–Felis silvestris. In: Enciclopedia Virtual de los Vertebrados Españoles. (L. M. Carrascal & A. Salvador, Eds.). Museo Nacional de Ciencias Naturales, Madrid. http://www.vertebradosibericos.org/ Lozano, J., Casanovas, J. G., Cabezas–Díaz, S., Virgós, E. & Mangas, J. G., 2006b. El control de depredadores en España, más que discutible.

Quercus, 239: 80–82.

Lozano, J., Moleón, M. & Virgós E., 2006a. Biogeographical patterns in the diet of the wildcat, Felis silvestris Schreber, in Eurasia: factors affecting the trophic diversity. Journal of Biogeography, 33: 1076–1085.

Lozano, J. & Urra, F., 2007. El gato doméstico, Felis catus Linnaeus, 1758. Galemys, 19: 35–38.

Lozano, J., Virgós, E., Cabezas–Díaz, S. & Mangas, J. G., 2007. Increase of large game species in Mediterranean areas: is the European wildcat (Felis silvestris) facing a new threat? Biological Conservation, 138: 321–329.

Lozano, J., Virgós, E., Malo, A. F., Huertas, D. L. & Casanovas, J. G., 2003. Importance of scrub–pastureland mosaics on wild–living cats occurrence in a Mediterranean area: implications for the conservation of the wildcat (Felis silvestris). Biodiversity and Conservation, 12: 921–935.

Malo, A. F., Lozano, J., Huertas, D. L. & Virgós, E., 2004. A change of diet from rodents to rabbits (Oryctolagus cuniculus). Is the wildcat (Felis silvestris) a specialist predator? Journal of Zoology, London, 263: 401–407.

Mangas, J. G., Lozano, J., Cabezas–Díaz, S. & Virgós, E., 2008. The priority value of scrubland habitats for carnivore conservation in Mediterranean ecosystems. Biodiversity and Conservation, 17: 43–51.

Monterroso, P., Brito, J. C., Ferreras, P. & Alves, P. C., 2009. Spatial ecology of the European wildcat in a Mediterranean ecosystem: dealing with small radio–tracking datasets in species conservation.

Journal of Zoology, 279: 27–35.

Palomo, L. J., Gisbert, J. & Blanco, J. C., 2007. Atlas y Libro Rojo de los Mamíferos Terrestres de

Lozano

España. Dirección General para la Biodiversidad, SECEM–SECEMU, Madrid.

Parent, G. H., 1975. La migration récente, à caractère invasionnel, du chat sauvage, Felis silvestris silvestris Schreber, en Lorraine Belge. Mammalia, 39: 251–288.

Ragni, B., 1978. Observations on the ecology and behaviour of the wild cat (Felis silvestris Schreber, 1777) in Italy. Carnivore Genetics Newsletters, 3: 270–274.

Rivas–Martínez, S., Fernández–González, F. & Sánchez–Mata, D., 1987. El Sistema Central: de la Sierra de Ayllón a Serra da Estrela. In: La vegetación de España: 419–451 (M. Peinado & S. Rivas–Martínez, Eds.). Publicaciones Universidad de Alcalá, Madrid.

Sarmento, P., Cruz, J., Tarroso, P. & Fonseca, C., 2006. Space and habitat selection by female European wild cats (Felis silvestris silvestris). Wildlife Biology in Practice, 2: 79–89.

Schauenberg, P., 1981. Elements d’ecologie du chat forestier d’Europe Felis silvestris Schreber, 1777.

Revue d’Écologie (Terre et Vie), 35: 3–36.

Stahl, P. & Artois, M., 1991. Status and Conservation of the wild cat (Felis silvestris) in Europe and around the mediterranean rim. Council of Europe, Strasbourg.

Stahl, P. & Leger, F., 1992. Le chat sauvage (Felis silvestris, Schreber, 1777). In: Encyclopédie des Carnivores de France (M. Artois & H. Maurin, Eds.).

Société Française pour l’Etude et la Protection des Mammifères (SFEPM), Bohallard, Puceul.

StatSoft, 2001. STATISTICA® for Windows. Version 6.0 [computer program]. StatSoft Inc., Tulsa.

Sunquist, M. & Sunquist, F., 2002. Wild Cats of the World. The University of Chicago Press, Chicago.

Underwood, A. J., 1996. Experiments in Ecology.

Cambridge University Press, Cambridge.

Virgós, E., 2001. Relative value of riparian woodlands in landscapes with different forest cover for medium–sized Iberian carnivores. Biodiversity and Conservation, 10: 1039–1049.

Virgós, E., Cabezas–Díaz, S., Malo, A. F., Lozano, J. & Huertas, D. L., 2003. Factors shaping European rabbit (Oryctolagus cuniculus) abundance in continuous and fragmented populations in central Spain. Acta Theriologica, 48: 113–122.

Virgós, E., Tellería, J. L. & Santos, T., 2002. A comparison on the response to forest fragmentation by medium–sized Iberian carnivores in central Spain.

Biodiversity and Conservation, 11: 1063–1079.

Virgós, E. & Travaini, A., 2005. Relationship between Small–game Hunting and Carnivore Diversity in Central Spain. Biodiversity and Conservation, 14: 3475–3486.

Wittmer, H. U., 2001. Home range size, movements, and habitat utilization of three male European wildcats (Felis silvestris Schreber, 1777) in Saarland and Rheinland–Pfalz (Germany). Mammalian Biology, 66: 365–370.

Animal Biodiversity and Conservation 33.2 (2010)

151 Review

Suspects and evidence: a review of the causes of extirpation and decline in freshwater mussels J. A. Downing, P. Van Meter & D. A. Woolnough

Downing, J. A., Van Meter, P. & Woolnough, D. A., 2010. Suspects and evidence: a review of the causes of extirpation and decline in freshwater mussels. Animal Biodiversity and Conservation, 33.2: 151–185.

Abstract Suspects and evidence: a review of the causes of extirpation and decline in freshwater mussels.— Conservation of biodiversity requires reliable evidence of the causes of extirpation. Using freshwater mussels as an example, we performed the first–ever systematic assessment of the evidence for endangerment of any group of organisms. We surveyed articles publishing conclusions about the cause of local extirpation by assessing the quality of evidence on an objective scale. We found that only 48% of studies presented plausible links between extirpation and causes.

Analyses lacked resolution since more than 75% of all studies considered (n = 124) suggested multiple causes of extirpation. Studies performed over large areas and those presenting less evidence postulated the most causes.

Despite the frequently weak evidence, there was substantial agreement on the identity of causes; the most frequent was habitat destruction or alteration but many others were postulated. Although mussel extirpation is undoubtedly real, the evidence could be stronger. In these animals and others, evidence of the causes of extirpation has often been circumstantial. We present a systematic approach ecologists can use to strengthen the evidence concerning the causes of extirpation. We also reflect on the link between the strength of evidence and research funding priorities.

Key words: Evidence, Extinction, Extirpation, Freshwater, Mussels.

Resumen Sospechas y evidencia: revisión de las causas de la extinción local y del declive de los mejillones de agua dulce.— La conservación de la biodiversidad requiere pruebas fiables de las causas de extinción local. Utilizando los mejillones de agua dulce como ejemplo, llevamos a cabo esta valoración sistemática, la primera que se ha realizado, de la evidencia de peligro para cualquier grupo de organismos. Revisamos artículos que publicaban conclusiones sobre las causas de las extinciones locales, evaluando la calidad de las pruebas según una escala objetiva. Encontramos que únicamente el 48% de los estudios presentaban relaciones plausibles entre la extinción local y sus causas. Los análisis carecían de resolución, dado que más del 75% de los estudios considerados (n = 124) sugerían múltiples causas de extinción local. Los estudios llevados a cabo en grandes áreas, y los que presentaban menos pruebas, son los que abogaban por un mayor número de causas. A pesar de las evidencias, que frecuentemente eran débiles, existía un acuerdo sustancial sobre la identidad de las causas; la más frecuente era la destrucción o alteración del hábitat, pero se postulaban muchas más. A pesar de que la extinción local de los mejillones de agua dulce es indudablemente una realidad, las pruebas podrían ser más consistentes. En estos animales y en muchos otros, la evidencia de las causas de su extinción local a menudo ha sido circunstancial. Presentamos aquí un estudio sistemático que pueden utilizar los ecólogos, para fortalecer las evidencias concernientes a las causas de las extinciones locales. También hemos reflejado la relación entre la fortaleza de la evidencia y las prioridades económicas de las investigaciones.

Palabras clave: Evidencia, Extinción, Extinción local, Agua dulce, Mejillones.

(Received: 13 III 08; Conditional acceptance: 3 VI 09; Final acceptance: 10 VI 10) J. A. Downing & P. Van Meter, Iowa State Univ., Ecology, Evolution, and Organismal Biology, 253 Bessey Hall, Ames, IA 50011–1020, USA.– D. A. Woolnough, Central Michigan Univ., Biology Dept., 160 Brooks Hall, Mount Pleasant, MI 48859, USA. Corresponding author: John A. Downing. E–mail: downing@iastate.edu ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

152

Introduction Declining biodiversity is a consequence of the accumulation of local extinction or extirpation events that can eventually extinguish the last remaining populations of species. The population extinction rate in tropical forest regions is 0.8% per year with 16 million populations lost per year (Hughes et al., 1997). In terrestrial mammals, 50% of historic ranges have been lost where human activity is intense, signaling a substantial threat to global species diversity (Ceballos & Ehrlich, 2002; Doherty et al., 2003). Biodiversity is also declining in aquatic ecosystems (Petts, 2001) due to population and species loss rates that are often higher than those seen in terrestrial ecosystems (Ricciardi & Rasmussen, 1999; Richter et al., 1997; Strayer et al., 2004).

Although widespread extirpation is known to occur, the causes of these events may be difficult to discern. In general terms, the decline and extirpation of populations has been attributed to a variety of broad mechanisms mediated by human population growth and impact (Kremen et al., 2002; Luck et al., 2003). Specifically, local loss of species is seen as a consequence of reduction in habitable area and environmental deterioration (Brinson & Malvarez, 2002), as well as the transformation and fragmentation of natural habitats (Wilcox & Murphy, 1985; Poole & Downing, 2004). Miller & Payne (2007) give an example of a species of mussel for which both the decline and cause of decline have apparently been misjudged.

In spite of the importance of understanding the causes of extirpation, the evidence supporting cause–effect relationships varies greatly in strength.

Many judgments of its cause have been based on projections of potential harmful effects (Leuven & Poudevigne, 2002). The IUCN Redlist (www.redlist. org), one of the most valuable sources of data on lost biodiversity and its cause, is based on methods involving estimation, inference and projection, as well as temporal extrapolation of current or potential threats.

The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) regulates world trade in endangered organisms. The extensive evidence required by CITES (e.g., Favre, 1989), to document an importer’s contention that a species is not in "decline" or "threatened", underscores the difficulty of obtaining consistent evidence of the source of threats to species.

An essential step in slowing the global decline of biodiversity is to identify and discontinue its causes.

Our principal goal therefore was to summarize the evidence used to discern the causes of decline and extirpation in a frequently studied group of organisms and the causative factors that this evidence supports.

Freshwater mussels are among the most endangered faunal groups on the planet (Strayer et al., 2004); therefore we use them here as a case study of the processes used to analyze the causes of declining biodiversity. They are sensitive and vulnerable to many different sources of perturbation that lead to altered community composition (Strayer et al., 1996, 2004) and offer a rich literature for analysis because

Downing et al.

they have been declining for decades (Matteson & Dexter, 1966). They are decreasing precipitously in North America (Suloway, 1981) and are among the most seriously impacted aquatic animals worldwide (Williams et al., 1993; Bogan, 1993). The high rate of mussel extinction (1.2% per decade) (Ricciardi & Rasmussen, 1999) makes them an important, yet challenging, group for analyzing the causes of extirpation and decline.

Our objective was to summarize analyses publishing conclusions and interpretations of the causes of decline and extirpation. We aimed to determine the strength of evidence used by studies drawing conclusions about its causes, determine the most frequently hypothesized causes of it, and quantify the spatial and temporal evolution or ecology’s view of this important problem.

Further objectives were to use these analyses to focus on efficient means of collecting evidence about the causes of extirpation and discuss the accessibility of funding to support improved analyses of them.

Methods Assessing the strength of the evidence It is generally agreed that "cause" is difficult to determine in the natural sciences (Fox, 1991; Holland, 1991). The philosophical issues surrounding the determination of cause–effect relationships in the natural sciences is a debate we do not reopen here (c.f. Peters, 1991). Instead, what natural and social scientists do is collect evidence that either supports or refutes causal hypotheses. In many fields (e.g., science, law, medicine, epidemiology), it is necessary to assemble imperfect evidence that supports or refutes one or more hypotheses concerning the causation of events (e.g., crimes, diseases, epidemics, extirpation).

One of the earliest approaches to the collection of evidence concerning the association between a negative effect (disease) and a biological cause (vector) is embodied in Koch’s Postulates (see Fox, 1991).

These postulates formalized the need to show a correlation between a postulated cause and effect, then to follow the correlation analysis with experimentation that verifies the biological plausibility of the correlation.

Criminal and civil law in the United States (e.g., Osterburg & Ward, 2004) and other nations (Delmas– Marty & Spencer, 2002) have used sets of evidentiary criteria. Legal scales of many nations admit the varying strength of admissible evidence by arranging criteria into categories of evidentiary plausibility. Criminal investigators around the world recognize levels of evidence ranging from hunches, guesses and gut feelings to corroborated facts, direct observations, physical evidence, and expert interpretation of evidence (e.g., table 1). Contrary to popular belief, few criminal proceedings require "proof" but require the bulk of evidence to support the causal connection between a suspect and a crime.

Because we wished to evaluate the variable strength of evidence for judgments of causes ("suspects") of decline and extirpation, and because we

Animal Biodiversity and Conservation 33.2 (2010)

153

Table 1. Determination of levels of certainty and proof in United States criminal and civil law (Osterburg & Ward, 2004).

Tabla 1. Determinación de los niveles de certidumbre y pruebas de las leyes civiles y criminales de Estados Unidos (Osterburg & Ward, 2004).

Level of Proof Evidence Quantity Uncertainty Investigation Legal use

Scientific utility

Intuition / Hunch, guess, speculation gut feeling,

impression,

surmise

Discovery and hypothesis formulation

Articulable Considerable Useful during None suspicion about and apparent early stages possible facts but insufficient to be convincing

Probable Facts a Prima facie, Better than Basis for Basis for Basis for Cause reasonable presumptive but apparently arrest binding over theory

person would disputable facts uncertain but or search to next stage development

accept possibly warrant through

uncertain hypothesis

testing Preponderance of Evidence

Corroborated Over 50% of Some facts, facts in uncertainty eyewitness support permitted testimony, physical evidence, expert interpretation of evidence

Shows the Civil law investigation standard is on the of proof right track.

May be used to induce confessions or informants

Basis for theory development through continued testing of hypotheses

Clear and Same as >> 50% and A little Same as International Basis for Convincing preceding á almost as many uncertainty above á law standard theory

supporting may remain of proof development

facts as below â through

continued

testing of

hypotheses Beyond Same as Reasonable preceding á Doubt

Sufficient facts Almost none Basis for Criminal law Theory to preclude criminal standard all other conviction of proof competing hypotheses

sought to decrease subjectivity as much as possible, we defined an evidentiary typology based loosely on the United States’ legal model (table 2). Our typology was a clear scoring rubric that we felt would allow us to objectively assign evidentiary quality to individual studies. As in criminal investigations, we defined five levels of evidence. The five types of evidence are distinguished by (1) the degree of documentation of decline or extirpation (i.e., "the crime"), (2) the weight of evidence offered for the presence of one or more potential causative agents before or during the decline (i.e., "opportunity"), and (3) the preponderance of evidence of links between extirpation and causative agents (i.e., "the evidence"; see table 2 for operational classification criteria).

The first two levels of evidence (table 2; levels 1 and 2) included literature reviews of postulated causes, either with or without direct observation of decline or local extinction events. In both of these, there was no documentation of either a causative agent or the link of a cause with extirpation. The third category, corresponding roughly to "circumstantial evidence", included studies that observed disappearances or declines of organisms correlated in time with the occurrence of postulated causes, but that offered little or no independent evidence of a link between them. Studies classified with level 4 evidence documented extirpation events or severe declines, observed potential causative agents, and made strong linkages between disappearances and

154

Downing et al.

Table 2. Evidentiary typology used in the analysis of studies of decline and extirpation in freshwater mussels.

Tabla 2. Tipología de evidencias utilizada en el análisis de los estudios de declive y extinción local de los mejillones de agua dulce.

Quality Level of Documentation of level evidence extirpation or decline 1 Speculation

2

Documentation of potential causative agent

No; cited or extrapolated No; implied by literature from other studies review

Observed Yes effect but not cause

3 Concurrent Yes

cause/effect

Evidence of link between extirpation and causative agent No; implied from other studies

No; implied by literature review

No; implied from other studies

Yes; observed at least one causal factor implicated by other studies

No; lacking direct linkage between extirpation event and postulated cause(s)

4 Preponderance Yes Yes

of evidence

Yes; study gives strong evidence of links to some but not all potential causes; or weak links to some postulated causes

5 Clear and Yes Yes

convincing

Yes; study gives strong evidence of links to all postulated causes

some, but not all, potential causes. The highest level of evidence (level 5) made plausible links between all postulated causes and extirpation events or severe declines. Some subjectivity is inevitable in the evaluation of the strength of evidence so we looked at each study carefully, used a reproducible checklist or scoring rubric of criteria (table 2), scored the articles independently among us (JAD, PVM, DAW), and document our judgments in appendix 1. Although we read the articles critically, we strove to be as fair as possible in our triple–blind assessments.

Information and data sources We sought to capture information on the types of causes that have been most frequently cited in published research, the strength of evidence for the causes of extirpation, how the suggested causes of extirpation have changed over the last several decades, and the sources of funding used to support the collection of evidence. Therefore, we examined published papers drawing conclusions about the cause of mussel extinction or extirpation to establish current and past consensus.

Generally, these publications included those that are currently used as evidence for the existence or causes of mussel extirpation (e.g., Rypel et al., 2009; Jones

& Byrne, 2009; Doyle & Yates, 2009; Schofield et al., 2004) and those that are currently cited in reviews of the topic (e.g., McGoldrick et al., 2009; Hanlon et al., 2009; Vaughn et al., 2008; Hoftyzer et al., 2008; Bogan, 2008). Our search was not exhaustive but it was systematic. We searched electronic indexes of journal articles (e.g., Biosis Previews) available in the Parks Library of Iowa State University (www.lib.iastate.edu/ collections/db/indexabst_name.html) in 2004. Example search terms were "freshwater", "mussel", "decline", "extirpation", "reasons for decline", "unionidae", "causes of decline", "loss", and "biodiversity". Then, in order to fairly represent review articles as well as the primary studies from which they were created, we followed the trail of literature citations from the bibliographies of articles found in searches of electronic indexes to assemble a reference list that was as complete as practically possible. We included all publications that reported conclusions about one or more species of freshwater mussels. The publications we included thus likely contain both those cited as support for determining conservation status of species as well as those building general consensus about declines occurring in mussels, in general. Information about the number and types of postulated causes was taken from authors’ narratives and all causes were

Animal Biodiversity and Conservation 33.2 (2010)

155

30

Frequency (%)

25 20 15 10 5

0 Weaker

1

2

3

Quality of evidence

4

5 Stronger

Fig. 1. Frequency histogram showing the strength of evidence presented by the recent scientific literature regarding the decline and extirpation of freshwater mussels. Quality categories of evidence are defined in table 2 and are based on a modification of the model used in United States criminal law.

Fig. 1. Histograma de frecuencias que muestra la fortaleza de las pruebas presentadas en la literatura científica reciente, en relación al declive y la extinción local de los mejillones de agua dulce. Las categorías de la calidad de las pruebas se definen en la tabla 2, y se basan en una modificación del modelo utilizado en la legislación criminal en Estados Unidos.

catalogued. Some of these causes overlap and many are not mutually exclusive but we had no choice but to accept the assessments provided by the authors of each of the studies. The quality of the evidence presented for connections between extirpation and potential causal factors was evaluated by multiple investigators following the scale presented in table 2.

Since authors evaluated extirpation on many spatial scales, we quantified the approximate geographical scale by reference to the land area of political units indicated by the authors. Temporal trends in evidence were evaluated by correlation with publication dates of articles since actual years of extirpation were rarely clearly stated. Information on funding support for these studies was extracted from Acknowledgments sections of the articles. We summarized the sources of funding acknowledged by all 124 studies, counting each funding source with equal weighting.

We extracted information on the probable causes of mussel extirpation from 124 published articles (see the appendix). These articles reviewed extirpation for geographic areas ranging from single river drainages to water bodies throughout the world. Most of the studies concerned North America and Europe but some studies examined extirpation in South America. The earliest article reviewed was published in 1910 (Isely, 1910) and the median year of publication was 1995.

A full list of the references and data is contained in the appendix.

Results The strength of evidence The published evidence diagnosing the causes of decline and extirpation varied from weak and speculative to strong and convincing. Many studies presented plausible evidence of links to all identified potential causes. Less than 50% of the studies presented any evidence of linkages between postulated causes and mussel disappearance events (fig. 1). The distribution of the quality data appear somewhat bimodal.

The evidentiary record appeared equally strong across the years of publication (fig. 2). There was no discernible correlation between our assessments of the quality of evidence and the publication year of articles on mussel extinction (p > 0.05).

Possible causes of extirpation in mussels The articles we reviewed considered seventeen different factors postulated as causes of extirpation in freshwater mussels, and figure 3 offers a qualitative view of these changes. Some of these causes are not fully independent but we were bound to report the factors indicated by the authors of articles. The earliest studies cited physical and biotic changes in the environment.

Water pollution, hydrologic change, and the destruction of habitat they caused were suspected in the early

156

Downing et al.

Stronger

5

Quality of evidence

4 3 2 1

Weaker 1965 1970 1975 1980 1985 1990 1995 2000 2005 Year of publication Fig. 2. Temporal progression of the strength of evidence presented by the ecological literature regarding the causes of decline and extirpation of freshwater mussels. Not shown are data from Isley (1910) that were judged to be of quality level 3. Quality categories of evidence are defined in table 2. The sizes of the "bubbles" are proportional to the number of studies that fall on the same point. The largest corresponds to n = 5.

Fig. 2. Progresión temporal de la fortaleza de las purebas presentadas en la literatura ecológica, concerniente a las causas del declive y la extinción local de los mejillones de agua dulce. No se muestran los datos de Isley (1910), que se juzgó eran de un nivel de calidad de 3. Las categorías de la calidad de la evidencia se definen en la tabla 2. El tamaño de las "burbujas" es proporcional al número de estudios que caen en el mismo punto. El de mayor tamaño corresponde a n = 5.

1900s and were frequently cited during the 1960s and 1970s. Water pollution and water quality degradation included eutrophication, silt transport, acidification, organic and metallic pollution, and feminization by estrogenic pollutants. Hydrologic changes influencing mussel extirpation included alterations of flow regimes, diversion to irrigation, increased flashiness and low water from drainage projects, channelization, greater extremes in velocity, alterations of depth profiles, and water level fluctuation in lacustrine environments. Habitat destruction and alteration occurred through siltation, dredging, destruction of specific habitat types (e.g., riffles destroyed through impoundment), and reduction in oxygenated habitat. Also among the earliest cited causes of extirpation were increased predation by fish and mammals and alterations to benthic communities through habitat degradation.

By the 1990s, other population and community influences (e.g., recruitment failure due to rare host fish, competition from exotics), large–scale environmental changes (e.g., climate change, dams, impoundments, riparian destruction, agriculturalization of watersheds), and direct exploitation by humans were frequently cited causes of extirpation. This accumulation of ideas, causes, and technologies, over time, has complicated potential interpretations. Following advances in con-

servation biology and genetic methodologies, the causes suggested most recently implicate the small population phenomenon, restricted range limitations and genetic changes (fig. 3).

Quality evidence helps to focus on specific causes.

When considering the strongest evidence, habitat alterations are among the most highly cited causes of mussel decline (fig. 4). Mussels are nearly sessile organisms that require good water quality and stable substrata. This is why water pollution, water quality degradation, and habitat destruction were each implicated by > 20% of the studies employing the strongest evidence. This same sensitivity to habitat is indicated by the relative importance of dams and impoundments and associated hydrologic change as causes of local extinction. Native freshwater mussels use a specific intermediate host fish to carry their larvae so many of the studies indicated that failed recruitment and lack of appropriate host fish caused decline. Causes that require a high degree of technical analysis to discern were among the least frequently cited. This may be simply because these methods are less easily employed rather than the relative importance of the causes these methods can discern.

The dominance of habitat loss in the decline of mussel populations is clear (see also, Strayer et

Animal Biodiversity and Conservation 33.2 (2010)

157

Postulated causes

Genetic change Recreation disturbances Small ranges Limited resources Small populations Watershed changes Exploitation / Harvesting Exotics / Invasive species Riparian destruction Dams / Impoundment Climate change Recruitment / Hosts Pollution / Water quality Habitat destruction / Alteration Hydrologic change Predation Benthos changes

1965 1970 1975 1980 1985 1990 1995 2000 2005 Year of publication Fig. 3. Temporal progression of detailed causes postulated for the local disappearance or decline of mussel populations. Not shown are the data of Isley (1910) who indicated that mussel disappearances were due to changes in the benthic community, predation, changes in stream hydrology, habitat destruction, and water pollution.

Fig. 3. Progresión temporal de las causas detalladas que se han postulado para la desaparición local o el declive de las poblaciones de mejillones. No se muestran los datos de Isley (1910), que indicaba que las desapariciones de los mejillones se debían a cambios en la comunidad bentónica, a la depredación, a los cambios hidrológicos del caudal, a la destrucción del hábitat y a la contaminación del agua.

Recreation disturbances Genetic change Small ranges Benthos changes Limited resources Climate change Predation Small populations Riparian destruction Exploitation / Harvesting Watershed changes Exotics / Invasive species Recruitment / Hosts Hydrologic change Dams / Impoundment Habitat destruction or alteration Pollution / Water quality

0

5

10 15 Frequency (%)

20

25

Fig. 4. Frequency histograms grouping the seventeen major causes of the decline and extirpation of mussels, showing only the results of studies for the two highest categories of evidence (see table 2).

Fig. 4. Histogramas de frecuencia agrupando las diecisiete causas principales de declive y extinción local de los mejillones, mostrando sólo los resultados de los estudios de las dos categorías de evidencia más altas (véase tabla 2).

158

Downing et al.

Energy and food availability Exotics / Invasive species Global change Exploitation by humans or others Population phenomena Habitat alteration or destruction 0

10

20

30 40 50 Frequency (%)

60

70

80

Fig. 5. Frequency of broad categories of postulated causes indicated by studies offering the two strongest categories of evidence. Broad categories group individual factors shown in figures 3 and 4. "Habitat alteration and destruction" here includes all forms of habitat change (e.g., pollution, damming, hydrologic change, watershed change, riparian destruction, recreational disturbance). Population phenomena include recruitment, host availability, small population effects, genetic change, and small ranges; exploitation here includes human and other sources of predation; energy and food availability includes resource limitation and benthos changes.

Fig. 5. Frecuencia de las grandes categorías de causas postuladas, indicadas por los estudios que ofrecen las dos categorías de mayor robustez de la evidencia. Las grandes categorías agrupan los factores individuales que se muestran en las figuras 3 y 4. Aquí, el término "alteración y destrucción del hábitat" incluye todas las formas de cambio del hábitat (p.ej. contaminación, construcción de presas, cambios hidrológicos, cambios en la cuenca, destrucción de las riberas, perturbaciones debidas a actividades recreativas). Los fenómenos poblacionales incluyen: reclutamiento, capacidad de los huéspedes, efectos de las poblaciones pequeñas, cambio genético y extensiones pequeñas. La explotación incluye la depredación humana o de otro tipo, y la disponibilidad de alimentos y energía incluye la limitación de los recursos y los cambios bentónicos.

al., 2004). Considering only the studies offering the two strongest categories of evidence, > 75% of the analyses implicated habitat alteration or destruction in the loss of mussels (fig. 5). No other broad category of cause is so obvious to ecologists and no other was suggested by > 15% of studies. There is some danger of tautology in these conclusions, however, because the loss of organisms implies that there is no longer a suitable place for them to live.

One cause or many?

More than 75% of the analyses of extirpation cited more than one likely cause. There were three main reasons for this: (1) studies presenting weaker evidence had resolving power low enough that they could not distinguish among putative causal agents; (2) single extirpation events resulted from multiple causal factors working in concert; and (3) extirpation events across a large or heterogeneous geographical area may sometimes be postulated to be caused by a list of single causal factors.

The increased resolving power of stronger evidence is illustrated by figure 6. Studies involving the two lowest quality categories of evidence suggested an average of more than three causes per study. Studies drawing connections between most or all potential causal agents and observed extinction events (table 2; quality levels 4 and 5) suggested an average 2.7 and 1.7 causes, respectively. Our analysis suggests that the use of refined methods can cut the number of postulated causes of extirpation by nearly half, suggesting that rigorous methodologies could bring more clarity to the search for causes of declining biodiversity. A cluster analysis on the co–occurrence of postulated causes (not presented here) suggested that some causes showed a greater than random likelihood of co–occurrence while others were less strongly associated.

More recent analyses seem to advance an increasing number of potential causes (fig. 7). Studies in the 1960s and 1970s indicated between 1 and 3 potential causes for extirpation events. Studies published in the 1990s and 2000s advanced between 1 and 9 causes for local mussel extinction. This temporal prolifera-

Animal Biodiversity and Conservation 33.2 (2010)

Average number of causes

5

A

159

B

C

4

3

2

1

0 Weaker

1

2

3

4

Quality of evidence

5 Stronger

Fig. 6. Average number of causes indicated by studies of decline and extirpation of freshwater mussels calculated for categories of the strength of evidence. Error bars indicate ± 1 standard deviation. Quality categories of evidence are defined in table 2. Differences between the categories of evidence–strength were determined using single factor analysis of variance (Zar, 1996). Significant differences were found between the following groups: 1,5 and 2,5 (p < 0.0001); 1,4 (p = 0.009); 3,5 (p = 0.002); 4,5 (p = 0.014).

Treatments with similar results are shown by bars bridging across categories.

Fig. 6. Número promedio de las causas, indicado por los estudios del declive y la extinción local de los mejillones de agua dulce, calculado para las categorías de la fortaleza de la evidencia. Las barras de error indican una desviación estándar de ± 1. Las categorías de la calidad de la evidencia se han definido en la tabla 2. Las diferencias entre las categorías de fortaleza de la evidencia se determinaron mediante un análisis factorial simple de la varianza (Zar, 1996). Se hallaron diferencias significativas entre los siguientes grupos: 1.5 y 2.5 (p < 0,0001); 1.4 (p = 0,009); 3.5 (p = 0,002); 4.5 (p = 0,014). Los tratamientos con resultados similares se indican mediante barras que forman puentes entre las categorías.

tion of suggested causes is due both to increased awareness of potential causes within the scientific community and increased technical knowledge and techniques for determining causal connections.

Examples of the former concept might be repeated citation of seminal publications and analyses or the fact that earlier studies did not have access to as many datasets and analyses as the latter ones. Examples of the latter phenomenon might be improved inferential abilities resulting from increased access to molecular methods, genetic analyses, GIS methods and data, and accumulating survey data. The data suggest, however, that recent publications do not always pin–point specific causes of mussel decline.

The spatial scale of analysis also influences the number of potential causes of extirpation (fig. 8).

Inferences drawn for areas of < 40,000 km2 (i.e., a moderately sized US state, small Canadian province, or EU nation) usually advanced only one or two causes, while reviews for very large areas (e.g., large countries, or continents) indicated many causal fac-

tors. Therefore, when spatial and technical resolution is high, the number of potential causes was determined with greater precision and may be reduced to one or two suspects.

Strong consensus Despite the range of strength of evidence employed, ecologists have come to a striking consensus about the causes of decline and extirpation in freshwater mussels. More than 75% of the articles presenting strong evidence indicated that some form of habitat alteration or destruction has led to the local extinction of populations (fig. 5). Specific impacts have derived from pollution and water quality degradation, perturbation of specific habitat types, impoundment and damming, hydrological alteration of flow regime, watershed and riparian perturbation, and disturbance by human recreation. Although such factors as exotic and invasive species, direct exploitation, and global change have captured the public interest, habitat de-

160

Downing et al.

Number of postulated causes

10

8

6

4

2

0 1965 1970 1975 1980 1985 1990 1995 2000 2005 Year of publication Fig. 7. Relationship between the number of causes implicated by studies of decline and extirpation of mussels and the publication year of manuscripts. The sizes of the "bubbles" are proportional to the number of studies that fall on the same point. The largest corresponds to n = 6. The data show a positive relationship between publication year and number of causes indicated by authors (r = 0.22, n = 124, p = 0.01).

Fig. 7. Relación entre el número de causas implicadas en los estudios del declive y la extinción local de los mejillones, con el año de publicación de los artículos originales. Los tamaños de las "burbujas" son proporcionales al número de estudios correspondientes a cada punto. La mayor corresponde a n = 6.

Los datos demuestran una relación positiva entre el año de publicación y el número de causas indicadas por los autores (r = 0,22, n = 124, p = 0,01).

struction is overwhelmingly implicated by the scientific literature. This consensus represents the published conclusions of 124 publications and the opinions of more than 200 aquatic scientists. The overall prescription from this analysis is that watershed and habitat restoration is a prerequisite to restoring populations.

Variable funding sources More than 43% of these studies acknowledged no funding source for their research. The two most common funding sources were federal and state/provincial agencies (fig. 9). The third most frequently acknowledged source was the home institution of the investigators, including universities, departments, programs, research centers, museums, and state–federal fish and wildlife research organizations. Major funding panels were a distant fourth place in supporting extirpation research.

Discussion A stronger record of evidence is needed In the mussel literature, < 50% of the published articles met the two strongest scientific standards of

evidentiary inference. All but the two best categories in table 2 lacked the fundamental characteristic that the majority of supporting facts (i.e., evidence of a plausible link between disappearance and causative agent; table 2) agree with the hypothesized cause of extinction. This may be partially because many of the articles publishing interpretations of the causes of mussel extirpation and decline were performed for other purposes and partially because conclusions were drawn without presenting conclusive evidence.

Only 48% of the articles publishing interpretations and conclusions about the subject, however, shed new light on the problem. The bimodal distribution of quality data (fig. 1) may derive from the criterion in quality level 3 of concurrent observation of cause and effect –this is difficult for long–lived organisms such as freshwater mussels.

Further, because local species extirpations may be increasingly scrutinized by scientists and legal entities, it is desirable that analyses come as close as possible to both scientific and legal plausibility. Our evidentiary typology parallels levels of certainty and proof sought by legal courts (c.f., tables 1 and 2) (Delmas–Marty & Spencer, 2002; Osterburg & Ward, 2004). According to Osterburg & Ward (2004), only the two strongest categories

Animal Biodiversity and Conservation 33.2 (2010)

161

Number of postulated causes

10

8

6

4

2

0 0.001

0.01

0.1 1 10 100 Log area (million km2)

1000

Fig. 8. Relationship between the number of causes implicated by studies of decline and extirpation of freshwater mussels and the geographical area for which inferences were made. Geographical areas were derived from standard sources of data on world political units.

Fig. 8. Relación entre el número de causas implicadas en los estudios del declive y extinción local de los mejillones de agua dulce y área geográfica para la cual se hicieron las deducciones. Las áreas geográficas se tomaron de las bases de datos estándar de las unidades políticas mundiales.

in figure 1 would have evidentiary characteristics similar to legally persuasive evidence. Less than half of the published articles drawing conclusions about the causes of local extinction would, in themselves, contribute strong linkages of cause and effect.

The overall conclusion about the role of habitat destruction in extirpation is likely to be robust, but the conclusions and interpretations deriving from individual publications may be controversial without presentation of stronger evidence.

The frequent weakness of evidence of the causes of extirpation is a problem that is not unique to freshwater mussels but extends to many other groups of organisms. For example, studies stemming from the concern that amphibian populations are declining globally has been termed "anecdotal" (Houlahan et al., 2000), permitting little consensus about the causes of postulated extirpations (Blaustein et al., 1994). Declining biodiversity in the marine benthos is projected to have large impacts on the function of marine ecosystems but evidence concerning causative agents is poorly developed (Solan et al., 2004). Evidence about the factors causing the decline and extirpation of bat species has been called "speculative and unsubstantiated" (O’Donnell, 2000).

Determining the cause of extinction in some organisms has been so elusive that some have expressed surprise at the disappearance of endangered organisms from pristine environments (Shuey, 1997) and

others have suggested the impossibility of ascribing the cause of extirpation in small populations (Ginsberg et al., 1995).

The problem and challenge of multiple concurrent causes Multiple concurrent causes of extirpation may complicate determination of the ultimate reason for decline.

We found the three most frequently co–occurring causes of extirpation to be water quality degradation, habitat destruction and hydrologic change. These are linked because hydrologic change can degrade both water quality and habitat, and poor water quality can arise from landscape changes that alter hydrology and destroy specific habitats. Other suggested causes co–occurred. These were: (1) damming and hydrologic change; (2) increased pollution through watershed alteration; (3) habitat destruction mediated by watershed development; (4) decreased host fish for larvae through stream impoundment; (5) hydrologic alteration and riparian zone reduction due to watershed change; (6) hydrologic alteration, pollution, damming and habitat alteration; and (7) the loss of host fish through multiple impacts of watershed alteration.

The influence of some causes of extirpation may be amplified in the presence of others. For example, cluster analyses of co–occurrence of causes in the articles we canvassed (not presented here) indicated

162

Downing et al.

0

10

Frequency (%) 20 30

40

50

Federal agencies State and provincial agencies Institutional support Major funding panels NGOs Regional agencies Private enterprise Cities and counties

Fig. 9. Frequencies of funding sources acknowledged by the authors of the 124 published articles reviewed in this manuscript. Fifty–six of these publications listed no funding sources. For those acknowledging funding, we counted every one, attributing each to the categories shown in the figure. Federal agencies include offices of the federal government whose principal role is not funding research but managing resources.

State and provincial agencies are the equivalent organizations representing state or provincial political units. Institutional support indicates that funding was received from the institution employing the authors, unless this is an agency listed under one of the other categories. Major funding panels are those federal agencies whose principal role is to dispense research funding (e.g., US National Science Foundation, Natural Sciences and Engineering Research Council of Canada). NGOs signifies non–governmental organizations.

Fig. 9. Frecuencias de las financiaciones agradecidas por los autores, en los 124 artículos revisados en este estudio. Cincuenta y seis de dichos artículos no incluían el origen de sus recursos monetarios. En los casos en que se agradecían las aportaciones de fondos, contamos cada una de ellas, atribuyendo cada artículo a las categorías que se presentan en esta figura. Las agencias federales incluyen oficinas del gobierno federal, cuya función principal no es financiar la investigación, sino la gestión de los recursos. Las agencias estatales y provinciales son las organizaciones equivalentes, que representan a los estados o las unidades políticas provinciales. Financiación institucional indica que los fondos se recibieron de instituciones que empleaban a los autores, a menos que se tratara de una agencia que entrase en una de las demás categorías. Los mayores financiadores eran aquellas agencias federales, cuyo papel principal es dispensar fondos para la investigación (p.ej. National Science Foundation de Estados Unidos, y Natural Sciences and Engineering Research Council de Canadá). NGOs significa organizaciones no gubernamentales (ONGs).

that water pollution may be most frequently indicated in analyses of mussel communities that may have been weakened through impoundment or hydrologic variation. Likewise, exploitation was indicated as frequently problematic in studies of communities that were weakened by damming, water quality degradation, or hydrologic change.

Concurrent, multiple causes of extirpation are common in many environments and organisms. Extirpation and decline have been postulated to result from multiple causes in organisms as diverse as birds (Doherty et al., 2003; Jarvi et al., 2004; Goerck, 1997; Van–Noorden, 1997; Legendre et al., 1999), mammals (Lunney et al., 2002), fish (Marschall & Crowder, 1996;

Yoshiyama et al., 1998), terrestrial snails (Forys et al., 2001), marine foraminifera (Keller, 1986, 1988), amphibians (Carey, 1993), and human populations (Chakrabarty & Rao, 1988). Multiple causes of extirpation have been so pervasive that paleobiologists suggest their complexities may have been mistaken for chance extinctions (Eble, 1999).

Implications for mussel conservation and restoration biology It is vital to provide quality evidence linking specific causes with extirpation events. In the case of freshwater mussels, many species have been extirpated

Animal Biodiversity and Conservation 33.2 (2010)

without high quality evidence documenting their decline (e.g., Epioblasma spp.). Specific linkages need to be defined in order to better understand the process of extinction. Collecting quantitative data on potential parameters causing decline while documenting patterns of community distributions will go far in the defense of the persistence of freshwater mussels.

Conservation ecologists are now forecasting major declines in biodiversity far into the future and most projections derive from mechanistic models of the process of the extinction and evolution of species.

These projections will be inaccurate if salient mechanisms leading to extirpation have been misjudged or unmeasured.

Further, conservation and restoration require knowledge of pathways through which extirpation has occurred. If mechanisms could be better understood, management could target remediation of causative factors to prevent further extinctions, augment populations, and restore extant species that are currently on an extinction trajectory. Finally, science must offer organized, systematic, convincing arguments of scientific, social, and legal value. For example, new regulations are most readily enacted on the basis of compelling evidence (e.g., Environment Canada, 2009). Science can promote conservation by defining consistent standards and approaches allowing the reliable interpretation of data. Both the scientific understanding of mussel extirpation and social mechanisms for slowing it require high quality evidence.

Systematizing the collection of causal evidence The ideal field process for determining the association between an effect (disease) and a cause (vector or agent) has been summarized for epidemiology in Bradford–Hill’s (Bradford–Hill, 1965) criteria. These criteria (Holland, 1991) need to be modified (Strayer et al., 2004) to address the association between species or population declines and causal agents.

Satisfaction of the following criteria could be adopted in extirpation studies.

Demonstrate that an extirpation or decline even has occurred This can be difficult because populations can become functionally extinct long before they disappear. For example, populations that fall below the minimum viable population (MVP) size (Reed et al., 2003) or density (Silva & Downing, 1994) may constitute effective extirpation. On the other hand, even the apparent absence of a species in a given locality is dependent upon sampling effort (Strayer, 1999).

Identify putative causes that are plausible, coherent, and have analogues Once extirpation has been documented, an essential step is to assemble a list of potential causes. Such a list is required by CITES listing and the endangered species recovery plans of several nations (e.g., Environment Canada, 2009, CITES, 2007, United States Fish and Wildlife Service, 1973). The biology of the organism or the causes advanced through analogy

163

with similar extirpation events (e.g., figs. 3, 4) and known or well–studied cases of extirpation can suggest suspects. These criteria ensure that hypothesized causes agree with a priori ecological or biological knowledge. Coherence with an organism’s biology and past experience in other systems will provide a logical and biologically consistent explanation.

Establish the temporality of cause and effect The list of plausible suspected causes can be narrowed by finding those that preceded the observed decline. In practice, establishing temporality can be difficult since little historical data may be available on changes in environments or species populations, biological causes such as lack of host fish may be difficult to discern (e.g., Payne & Miller, 1989), diverse life–stages may react differently to environmental alterations (Cope et al., 2009), and different agencies may be locally responsible for monitoring environment and biology. Extirpation may also be difficult to correlate with environmental change since extinction debts (Tilman et al., 1994) and very long life–spans (Anthony et al., 2001) can cause extirpation to lag decades after environmental change (Poole & Downing, 2004).

Demonstrate the strength, consistency, and specificity of associations The list of plausible, coherent and temporally consistent causes can be narrowed by finding those with the strongest (e.g., most significant) association with extirpation. It should be borne in mind that this association may be linear or non–linear. Consistency concerns the generality of the association between cause and effect across distinct populations. Specificity of association requires that a given cause yields a specific effect. Specificity and consistency may be most useful in diagnosing declining populations since characteristics of the decline (e.g., population structure, altered growth, impediments to reproduction) may point to specific causes.

Identify gradients of causes and effects Gradients of causative agents associated with rates of decline (e.g., dose–response analyses) can provide evidence of causal links. If rates of decline of populations or regional frequencies of extirpation are correlated with the intensity of exposure to environmental change, this can provide strong evidence of causal associations when viewed within the context of strength of association and biological plausibility.

Use experiment to demonstrate linkage of causes with effects Natural or experimental manipulation of exposure to potential causative agents can be useful when seeking the cause of extirpation in wild populations. "Natural experiments", where manipulation has been done by accident or unwittingly, can be analyzed (e.g., Smith et al., 1993) to provide tests of plausibility. Another approach is to use preventive actions to see whether removal of plausible causal factors leads to reversal or stabilization of declines.

164

This systematic approach to studying the link between postulated cause and effect has been successful in epidemiology for decades. It is our opinion that applying elements of this approach would strengthen knowledge of the causes of extirpation.

Funding: one possible reason that strong evidence for cause–extirpation linkage is rare Systematic analysis of species declines and extirpation is costly and requires long–term funding commitments; this need is exacerbated by mussels’ long life–spans, their parasitic reproductive habit, and their frequent low abundance. Our survey suggests that the paucity of targeted funding may contribute to weak inference. Although all of the studies we analyzed drew conclusions and made interpretations about the causes of extirpation, investigation of the cause of extirpation was not the only question under study in many of the cases we reviewed. From the breadth of topics analyzed in these publications, it appeared to us that the collection of evidence on the causes of extirpation was frequently a by–product of a study that may have been funded for other purposes. We feel that reliable analyses of the causes of extirpation are too fundamental to rely upon chance or serendipitous investigations to reveal interpretable evidence. Therefore, we cataloged funding sources to understand how analyses of the causes of extirpation are supported.

We summarized the sources of funding acknowledged by all 124 studies, counting each funding source mentioned with equal weighting. More than 43% of these studies acknowledged no funding source for their research. The apparent lack of research support for so many studies is of concern to the conservation of these imperiled organisms. In fact, Strayer (2006) has noted that funding of such initiatives has been so scarce that median expenditure in 2003–2004 in the United States for endangered freshwater invertebrates was only $24,000 (US), and few invertebrates receive even this modest attention.

The two most common funding sources acknowledged by the studies we reviewed were federal and state/provincial/regional agencies (fig. 9). Most of these were governmental organizations charged with the management or protection of resources (e.g., Environment Canada, US Environmental Protection Agency, US Fish and Wildlife Service, US Geological Survey). Major funding panels were a distant fourth place in supporting extinction research. The two most frequently cited such funding agencies, the Natural Sciences and Engineering Research Council of Canada and the United States National Science Foundation, funded about the same number of studies. The quality assessment of evidence presented in studies funded by major funding agencies averaged 2.47, ranging from 1–5. This is slightly better than the average of all studies (see fig. 1). NGOs (e.g., Nature Conservancy, National Geographic Society, World Wildlife Fund, and various shell clubs) were nearly as frequently acknowledged as major funding agencies. Apparently, the testing of hypotheses about the sources of extirpation are infrequently funded

Downing et al.

by major agencies, while much of this research has been supported by funding sources oriented toward the management of natural resources.

Conclusion The global decline in biodiversity is an important threat to ecosystem function and ecosystem services.

Global extinction and lost biodiversity occur through the accumulation of local extirpation events, so the collection of evidence about the causes of extirpation is an important goal. Freshwater mussels have been declining for decades, are among the most endangered animal groups on the planet, and have been frequently studied, yet our understanding of the causes of extirpation is varied in resolution. Extirpation results from a diversity of multiple, interacting factors that are difficult to analyze and require substantial analytical power to resolve. Other fields have developed systematic methods for the accumulation of credible evidence of relationships between environmental causes and effects, but literature on this group of organisms suggests that we sometimes rely upon serendipitous studies with low evidentiary power. This problem appears compounded by a funding environment where such studies are done without focused programs contributing substantial, long–term support.

We feel that the need for strong evidence about the causes of extirpation is so great, and the field of suspects so large, that a positive step would be to realign funding priorities to encourage the collection of more systematic, conclusive evidence about the suspected causes of decline and extirpation of species.

Finding the means of achieving this is an essential yet controversial topic worthy of more discussion than we could present here. A few reviewers have been concerned, for example, that this critical review will do "…more harm than good…." because it may draw attention to the frailties of some studies.

They consider it could therefore be interpreted by governments and anti–conservation groups as falsifying the imperiled status of mussels, in specific, or biodiversity, in general. This would be an inaccurate interpretation of our findings. The evidence of endangerment and extirpation of mussels and other organisms is undeniable and strong in many cases. Our intention has been to examine the quality of evidence cited to support this knowledge to seek more systematic means of marshalling the evidence behind suspected and known cases of extirpation.

Further, a few reviewers have been concerned that our judgment of the quality of studies may be subjective and based only on the published evidence.

We believe that no one can make a fully objective judgment of all evidence but this is why we created an objective scoring rubric (table 2) to systematize our examination of published accounts, and why we performed the analyses in a triple–blind fashion.

Our careful reading may have missed some salient points, but these errors are unlikely to reverse our overall conclusion that improvements can be made.

The need for improvement is underscored by the

Animal Biodiversity and Conservation 33.2 (2010)

continued reliance of new publications on some of the articles we found to present weak evidence (e.g., Rypel et al., 2009; Jones & Byrne, 2009; Doyle & Yates, 2009; Schofield et al., 2004). It might also be suggested that we should expect low quality evidence of the causes of extirpation when articles draw conclusions about the causes but had diverse research objectives. The paucity of studies having a principal objective of determining the causes of extirpation is underscored by the number of recent publications citing the publications we reviewed here as demonstrations of the causes of extirpation (e.g., Bogan, 2008; Hanlon et al., 2009; Hoftyzer et al., 2008; McGoldrick et al., 2009; Vaughn et al., 2008).

The intention of this analysis was to seek means to increase scientific rigor, not to refute the known imperiled situation of mussels, or the utility of the science or publications attempting to determine and document its causes.

Acknowledgments This manuscript was completed while JAD was on a sabbatical leave at Instituto Mediterraneo de Estudios Avanzados, Esporles, Mallorca, Islas Baleares, Spain, with the generous sponsorship of the Consejo Superior de Investigaciones Científicas of Spain. Other support was provided by the Iowa Department of Natural Resources and the Wabana Lake Research Station.

We thank D. Strayer for sharing his ideas and T. Newton for organization of a workshop on freshwater mussel ecology that stimulated this work. We thank several referees for their constructive criticisms of this work and J. Khaled for useful discussions of revisions.

References Anthony, J. L., Kesler, D. H., Downing, W. L. & Downing, J. A., 2001. Length–specific growth rates in freshwater mussels (Bivalvia: Unionidae): extreme longevity or generalized growth cessation? Freshwater Biology, 46: 1349–1359.

Blaustein, A. R., Hoffman, P. D., Hokit, D. G., Kiesecker, J. M., Walls, S. C. & Hays, J. B., 1994. UV repair and resistance to solar UV–B in amphibian eggs: a link to population declines. Proceedings of the National Academy of Sciences of the United States of America, 91: 1791–1795.

Bogan, A. E., 1993. Freshwater bivalve extinctions (Mollusca: Unionoida): A search for causes. American Zoology, 33: 599–609.

– 2008. Global diversity of freshwater mussels (Mollusca, Bivalvia) in freshwater. Hydrobiologia, 595: 139–147.

Bradford–Hill, A., 1965. The environment and disease: association or causation? Proceedings of the Royal Society of Medicine, 58: 295–300.

Brinson, M. M. & Malvarez, A. I., 2002. Temperate freshwater wetlands: types, status and threats.

Environmental Conservation, 29: 115–133.

Carey, C., 1993. Hypothesis concerning the causes

165

of the disappearance of boreal toads from the mountains of Colorado. Conservation Biology, 7: 355–362.

Ceballos, G. & Ehrlich, P. R., 2002. Mammal population losses and the extinction crisis. Science, 296: 904–907.

Chakrabarty, T. & Rao, M. K. V., 1988. Ethnobotanical studies on the shompens of Great Nicobar Island India. Journal of Economic and Taxonomic Botany, 12: 39–54.

CITES, 2007. The CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) handbook. CD–Rom. Cope, W. G., Bringolf, R. B., Buchwalter, D. B., Newton, T. J., Ingersoll, C. G., Wang, N., Augspuger, T., Dwyer, F. J., Barnhart, M. C., Neves, R. J. & Hammer, E., 2009. Differential exposure, duration, and sensitivity of unionoidean bivalve life stages to environmental contaminants. Journal of the North American Benthological Society, 27: 451–462.

Delmas–Marty, M. & Spencer, J. R., Eds., 2002.

European criminal procedures, Cambridge, U.K., Cambridge University Press.

Doherty, P.–F., Jr., Sorci, G., Royle, J.–A., Hines, J.–E., Nichols, J.–D. & Boulinier, T., 2003. Sexual selection affects local extinction and turnover in bird communities. Proceedings of the National Academy of Sciences of the United States of America, 100: 5858–5862.

Doyle, M. W. & Yates, A. J., 2009. Stream ecosystem service markets under no–net–loss regulation.

Ecological Economics, 69: 820–827.

Eble, G. J., 1999. On the dual nature of chance in evolutionary biology and paleobiology. Paleobiology, 25: 75–87.

Environment Canada, 2009. Species at Risk Act policies [electronic resource]. Species at Risk Act Policies and Guidelines Series DRAFT, 38.

Favre, D. S., 1989. International trade in endangered species: a guide to CITES. Dordrecht, Netherlands, Kluwer Academic Publishers.

Forys, E. A., Quistorff, A., Allen, C. R. & Wojcik, D. P., 2001. The likely cause of extinction of the tree snail Orthalicus reses reses (Say). Journal of Molluscan Studies, 67: 369–376.

Fox, G. A., 1991. Practical causal inference for ecoepidemiologists. Journal of Toxicology and Environmental Health, 33: 359–373.

Ginsberg, J. R., Mace, G. M. & Albon, S., 1995. Local extinction in a small and declining population; Wild dogs in the Serengeti. Proceedings of the Royal Society of London Series B Biological Sciences, 262: 221–228.

Goerck, J. M., 1997. Patterns of rarity in the birds of the Atlantic forest of Brazil. Conservation Biology, 11: 112–118.

Hanlon, S. D., Petty, M. A. & Neves, R. J., 2009.

Status of native freshwater mussels in Copper Creek, Virginia. Southeastern Naturalist, 8: 1–18.

Hoftyzer, E., Ackerman, J. D., Morris, T. J. & Mackie, G. L., 2008. Genetic and environmental implications of reintroducing laboratory–raised unionid mussels in the wild. Canadian Journal of Fisheries and

166

Aquatic Sciences, 65: 1217–1229.

Holland, P. W., 1991. Statistics and causal inference.

Journal of the American Statistical Association, 81: 945–960.

Houlahan, J. E., Findlay, C. S., Schmidt, B. R., Meyer, A. H. & Kuzmin, S. L., 2000. Quantitative evidence for global amphibian population declines. Nature, 404: 752–755.

Hughes, J. B., Daily, G. C. & P. R., E., 1997. Population diversity: its extent and extinction. Science, 278: 689–694.

Isely, F. B., 1910. Preliminary Note on the Ecology of the Early Juvenile Life of the Unionidae. Biological Bulletin, 20: 77–80.

Jarvi, S. I., Tarr, C. L., Mcintosh, C. E., Atkinson, C. T. & Fleischer, R. C., 2004. Natural selection of the major histocompatibility complex (Mhc) in Hawaiian honeycreepers (Drepanidinae). Molecular Ecology, 13: 2157–2168.

Jones, H. A. & Byrne, M., 2009. The impact of catastrophic channel change on freshwater mussels in the Hunter River system, Australia: a conservation assessment. Aquatic Conservation: Marine and Freshwater Ecosystems, 20: 18–30.

Keller, G., 1986. Stepwise mass extinctions and impact events late Eocene to early Oligocene. Marine Micropaleontology, 10: 267–294.

– 1988. Extinction survivorship and evolution of planktic foraminifera across the cretaceous–tertiary boundary at El Kef Tunisia. Marine Micropaleontology, 13: 239–264.

Kremen, C., Williams, N. M. & Thorp, R. W., 2002.

Crop pollination from native bees at risk from agricultural intensification. Proceedings of the National Academy of Sciences of the United States of America, 99: 16812–16816.

Legendre, S., Clobert, J., Moller, A. P. & Sorci, G., 1999. Demographic stochasticity and social mating system in the process of extinction of small populations: The case of passerines introduced to New Zealand. American Naturalist.

Leuven, R. S. E. W. & Poudevigne, I., 2002. Riverine landscape dynamics and ecological risk assessment. Freshwater biology, 47: 845–865.

Luck, G. W., Daily, G. C. & Ehrlich, P. R., 2003. Population diversity and ecosystem services. Trends in Ecology and Evolution, 18: 331–336.

Lunney, D., O’Neill, L., Matthews, A. & Sherwin, W.–B., 2002. Modelling mammalian extinction and forecasting recovery: Koalas at Iluka (NSW, Australia). Biological Conservation, 106: 101–113.

Marschall, E. A. & Crowder, L. B., 1996. Assessing population responses to multiple anthropogenic effects: A case study with brook trout. Ecological Applications, 6: 152–167.

Matteson, M. R. & Dexter, R. W., 1966. Changes in Pelecypoda populations in Salt Fork of Big Vermillion River, Illinois, 1918–1962. Nautilus, 79: 96–101.

McGoldrick, D. J., Metcalfe–Smith, J. L., Arts, M. T., Schloesser, D. W., Newton, T. J., Mackie, G. L., Monroe, E. M., Biberhofer, J. & Johnson, K., 2009.

Characteristics of a refugre for native freshwater mussels (Bivalvia: Unionidae) in Lake St. Clair.

Downing et al.

Journal of Great Lakes Research, 35: 137–146.

Miller, A. C. & Payne, B. S., 2007. A re–examination of the endangered Higgins eye pearlymussel Lampsilis higginsii in the upper Mississippi River, USA. Endangered Species Research, 3: 229–237.

O’Donnell, C. F. J., 2000. Conservation status and causes of decline of the threatened New Zealand long–tailed bat Chalinolobus tuberculatus (Chiroptera: Verspertilionidae). Mammal Review, 30: 89–106.

Osterburg, J. W. & Ward, R. H., 2004. Criminal investigation: a method for reconstructing the past.

Anderson Publishing.

Payne, B. S. & Miller, A. C., 1989. Growth and survival of recent recruits to a population of Fusconaia ebena (Bivalvia: Unionidae) in the Lower Ohio River. American Midland Naturalist, 121: 99–104.

Peters, R. H., 1991. A critique for ecology. Cambridge, U.K., Cambridge University Press.

Petts, G., 2001. Sustaining our rivers in crisis: setting the international agenda for action. Water Science and Technology, 43: 3–16.

Poole, K. E. & Downing, J. A., 2004. Relationship of declining mussel biodiversity to stream–reach and watershed characteristics in an agricultural landscape. Journal of the North American Benthological Society, 23: 114–125.

Reed, D. H., O’Grady, J. J., Brook, B. W., Ballou, J. D. & Frankham, R., 2003. Estimates of minimum viable population sizes for vertebrates and factors influencing those estimates. Biological Conservation, 113: 23–34.

Ricciardi, A. & Rasmussen, J. B., 1999. Extinction rates of North American freshwater fauna. Conservation Biology, 13: 1220–1222.

Richter, B. D., Braun, D. P., Mendelson, M. A. & Master, L. L., 1997. Threats to imperiled freshwater fauna. Conservation Biology, 11: 1081–1093.

Rypel, A., Haag, W. & Findlay, R., 2009. Pervasive hydrologic effects on freshwater mussels and riparian trees in southeaster floodplain ecosystems.

Wetlands, 29: 497–504.

Schofield, K. A., Pringle, C. M. & Meyer, J. L., 2004.

Effects of Increased Bedload on Algal– and Detrital–Based Stream Food Webs: Experimental Manipulation of Sediment and Macroconsumers.

Limnology and Oceanography, 49: 900–909.

Shuey, J. A., 1997. Conservation status and natural history of Mitchell’s Satyr, Neonympha mitchellii mitchellii French (Insecta: Lepidoptera: Nymphalidae). Natural Areas Journal, 17: 153–163.

Silva, M. & Downing, J. A., 1994. Allometric scaling of minimal mammal densities. Conservation Biology, 8: 732–743.

Smith, E. P., Orvos, D. R. & Cairns, J., 1993. Impact assessment using the before–after–control–impact (BACI) model: concerns and comments. Canadian Journal of Fisheries and Aquatic Sciences, 50: 627–637.

Solan, M., Cardinale, B. J., Downing, A. L., Engelhardt, K. A. M., Ruesink, J. L. & Srivastava, D. S., 2004.

Extinction and ecosystem function in the marine benthos. Science, 306: 1177–1180.

Animal Biodiversity and Conservation 33.2 (2010)

Strayer, D. L., 1999. Statistical power of presence–absence data to detect population declines.

Conservation Biology, 13: 1034–1038.

– 2006. Challenges for freshwater invertebrate conservation. Journal of the North American Benthological Society, 25: 271–287.

Strayer, D. L., Downing, J. A., Haag, W. R., King, T. L., Layzer, R, J., Newton, T. J. & Nichols, S. J., 2004. Changing perspectives on pearly mussels, North America’s most imperiled animals. BioScience, 54: 429–439.

Strayer, D. L., Sprague, S. J. & Claypool, S., 1996.

A range–wide assessment of populations of Alasmidonta heterodon, an endangered freshwater mussel (Bivalvia: Unionidae). Journal of North American Benthological Society, 15: 308–317.

Suloway, L., 1981. The Unionid (Mollusca, Bivalvia) fauna of the Kankakee River in Illinois. American Midland Naturalist, 105: 233–239.

Tilman, D., May, R. M., Lehman, C. L. & Nowak, M. A., 1994. Habitat destruction and the extinction debt. Nature, 371, 65–66.

United States Fish and Wildlife Service, 1973. Endan-

167

gered Species Act: Listing a Species as Threatened or Endangered. Section 4, 50 CFR 17.11.

Van–Noorden, B., 1997. Why did the Golden Plover Pluvialis apricaria disappear as a breeding bird from The Netherlands? Limosa.

Vaughn, C. C., Nichols, S. J. & Spooner, D. E., 2008.

Community and foodweb ecology of freshwater mussels. Journal of the North American Benthological Society, 27: 409–423.

Wilcox, B. A. & Murphy, D. D., 1985. Conservation strategy: the effects of fragmentation on extinction.

American Naturalist, 125: 879–887.

Williams, J. D., Warren Jr, M. L., Cummings, K. S., Harris, J. L. & Neves, R. J., 1993. Conservation status of freshwater mussels of the United States and Canada. Fisheries, 18: 6–22.

Yoshiyama, R. M., Fisher, F. W. & Moyle, P. B., 1998.

Historical abundance and decline of chinook salmon in the Central Valley Region of California.

North American Journal of Fisheries Management, 18: 487–521.

Zar, J. H., 1996. Biostatistical analysis. Toronto, Canada, Prentice Hall.

168

Downing et al.

Appendix. Table of evidence used in this manuscript: Q. Quality of evidence; N. Number of causes; * References indicated in these notes refer to citations in original "Reference" indicated inmediately preceding the Q and N data for each assessment.

Apéndice. Índice de pruebas utilizado en este artículo: Q. Calidad de la evidencia; N. Número de causas; * Las referencias indicadas en este apartado de notas se refieren a las citas que se incluyen inmediatamente antes de Q y N para cada evaluación.

Reference Q N

Notes*

Aldridge, 1987 4

1

6

frequent exposure to turbidity and high levels of suspended solids.

2

Spain

Extirpation of Margaritifera auricularia was observed and the cause linked was dredging.

Several other causes were discussed but no clear links with these were established.

Anderson et al., 1991 2

Mississippi, USA

A link was established between the physiological energetics of freshwater mussels and

Altaba, 1990 4

Location

Kentucky, USA

A decline of freshwater mussels was observed, but no linkages were established with

causes. Circumstantial information implies that strip mining might be associated with the

decline. Other cited but unestabllished causes include the introduced Corbicula (Clarke,

1988), heavy siltation (Ahlstedt, pers. comm.; Schuster, pers. comm.), toxic metals (Dick et

al., 1986), and physical disturbances.

Arter, 1989 4

1

"In the highly eutrophic lake, the mussels grew more quickly and died earlier than in the mesotrophic lake." (p. 97, paragraph 3). Linkage was correlative.

Bailey & Green, 1989 3

4

2

Northwest territories, Canada

Low densities of adults co-occurred with lack of juvenile, mussels. Anthropogenic impact is indicated as a cause (Green, 1980) but limitations to the hypothesis are discussed.

Balfour & Smock, 1995 2

Switzerland

Virginia, USA

"…no physical, chemical, or hydrologic factors examined were significantly correlated with

mussel abundance” (p. 255, abstract; p. 365, paragraph 1). The short life span is also

thought to be caused shell erosion (p. 264, paragraph 2) but no evidence off this is offered.

Bauer et al., 1991 4

3

The causes linked to mussel distribution and densities include food availability and hydrochemical factors. Not all suggested causes were linked with solid evidence.

Beasley & Roberts, 1999 1

3

5

2

established. Linkages are cited from other published articles.

8

Louisiana, USA

Decline (p.118, paragraph 4) and mortality (p. 119, paragraph 2) of freshwater mussels was observed. Dissolved oxygen levels were linked as the cause (p. 122, paragraph 2) (p. 123, paragraph 2) and toxicity from STP effluents (p. 123, paragraph 3), total NH3–N and chronic toxicity (p. 124, paragraph 1) (p. 124-125, paragraph 5).

Bergman et al., 2000 2

Ireland

Historical records and data collected were used in this study. No specific links were

Belanger, 1991

Germany

Kansas, USA

Archeological records, historical reports, and information from recent surveys (collected

in this study) were used. No link to a cause or causes is established. Causes cited from

other articles are discussed.

Animal Biodiversity and Conservation 33.2 (2010)

169

Appendix. (Cont.)

Reference Q

N

Notes*

Blalock & Sickel, 1996 2

6

(citing several other published articles).

6

direct evidence for causes of decline was presented.

6

is presented. No direct evidence for causes of decline was provided.

5

No extinction or decline event was observed. Causes for decline were cited from other

3

Alabama, USA

Harvesting was used to survey mussels but no linkage to cited causes from other articles was made.

Box & Mossa, 1999 1

North America

articles and discussed.

Bowen et al., 1994 2

Worldwide

A review of mussel abundance and causes for decline and/or literature review extirpation

Bogan, 1998 1

Alabama, USA

Other literature was reviewed and causes cited from other articles were discussed. No

Bogan, 1993 1

Kentucky, USA

A decline was observed (abstract) and authors discuss impoundment as a possible cause

Blalock et al., 2002 1

Location

4

North America

A review of current information on the effects of sediments on unionid mussels, past sampling methods, and research needs is presented.

Butler, 2003b 1 7

Mississippi River, USA

Status assessment of spectaclecase. Threats include habitat alteration, degradation or

loss through impoundments, channelization, chemicals, sedimentation, mining activities.

Although many potential causes are cited, no explicit linkage to specific causes was made.

Butler, 2003c 1 7

Mississippi River, USA

Status assessment of the rayed bean mussel. Threats include habitat alteration,

degradation or loss through impoundments, channelization, chemicals, sedimentation,

mining activities. Although many potential causes are cited, no explicit linkage to

specific causes was made.

Butler, 2003a 1

7

Mississippi River, USA

Status assessment of the sheepnose mussel. Threats include habitat alteration,

degradation or loss through impoundments, channelization, chemicals, sedimentation,

mining activities. Although many potential causes are cited, no explicit linkage to

specific causes was made.

Byrne, 1998 4

2

not linked specifically to decline, but was attributed to functionally extinct mussels, impoundments, fish host availability, exotic species and recruitment.

Clarke, 1986 3

2

Australia

The reproduction of Hyridella depressais studied. Gametogenic or embryonic failure was

New Hampshire and Vermont, USA

Present distribution and abundance of Alasmidonta heterodon in New Hampshire and

Vermont was evaluated. Human acitivities, dams, pollution from the pulp and paper

industry are indicated as the causes, although no linkages were established or discussed.

170

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Cooper & Johnson, 1980 5

2

Location Mississippi, USA

A loss of mussels was observed. "Habitat changes, especially impoundment and

channelization of the Yalobusha River, have had a detrimental effect on the previously

existing population of bivalve mollusks." (p. 24, paragraph 4).

Cope et al., 2003 2

5

Wisconsin and Minnesota, USA

An evaluation of recovery and survival after relocation of mussels. Causes are cited

from other articles, but there was some indication that, in this study, size fractions of

substratum may play a major role (p. 31, paragraph 1).

Cosgrove & Hastie, 2001 1

5

Scotland

A review of literature indicating river engineering or development projects may be

responsible for mussel decline. Additional causes are cited from other articles as well,

but no linkages are made.

Cvancara, 1976 2

2

North Dakota, USA

Specimen of mollusks from the past and present are analyzed to determine local

extinction or loss. Possible factors (cited from other articles) are discussed but no

linkages of cause and effect were made.

Cvancara & Freeman, 1978 2

3

North Dakota, USA

Mussels were surveyed in Lake Ashtabula. Fewer species were found in this area than

other areas of Sheyenne River. No linkage was found between the number of species

and the possible causes reviewed (e.g., reproductive alteration, low levels of oxygen

fish host availability, siltation and organic enrichment (p. 7 paragraphs 2-3), decreased

biological activity, chemical factors (p. 8 paragraphs 3-4).

Day et al., 1990 5

3

QuĂŠbec, Canada

An experiment introduced mussels into pristine and polluted environments. Evidence

indicates exposure to stressful environments (toxic chemicals) affects mussels (p. 826,

paragraph 1).

Diamond & Serveiss, 2001 4

3

Virginia, USA

Results indicated multiple land uses and stressors are responsible for the decline

of mussels. Some suggested factors were poorer in-stream cover and higher substrate

embeddedness, episodic spills of toxic materials, mining and industrial activities,

sedimentation, urban areas, habitat fragmentation and recruitment. Some of the

potential causes were linked whereas some were cited from other published articles.

Diamond et al., 2002 4

3

Virginia, USA

"The number of native mussel species present was related to several land uses

including (in order of significance) percent urban area, proximity to mining, and percent

cropland". Some factors were discussed but not linked.

Di Maio & Corkum, 1995 5

1

Ontario, Canada and Michigan, USA

An extinction event of juvenile mussels was directly linked to anoxic conditions (hypoxia, thermal stress and acidic conditions) (p.187, paragraph 1-3; pp. 189-190).

Animal Biodiversity and Conservation 33.2 (2010)

171

Appendix. (Cont.)

Reference Q

N

Notes*

Dimock & Wright, 1993 5

1

Location North Carolina, USA

"The hydrological stability of a drainage basin appeared to influence the species of

unionids found in it" (p. 668, paragraph 3) "...the hydrological variability of a drainage

basin, as used in this study, can provide a meaningful measure of mussel habitat

and used to effectively characterize mussel communities (p. 670, paragraph 4). A loss

was not observed although decline was implied.

Downing et al., 1993 4

3

QuĂŠbec, Canada

Population size distribution, overall density, and degree of aggregation achieved during

spawning (p. 154, paragraph 2) influence successful reproduction in Elliptio complanata.

Evidence of the linkage was correlative.

Duncan & Thiel, 1983 4

3

Mississippi River, USA

A survey of mussels was done. Causes cited for decline were impoundment and water

quality (Fuller, 1978). Links were established between impoundments, shifting

substrates, and dredging. Not all postulated causes are linked explicitly.

Fleming et al., 1995 4

1

postulated causal factors were observed but were not linked to the mortality of mussels.

Fuller, 1978 1

2

North Carolina, USA

A die-off event occurred (p. 877) and was linked to anticholinesterase poisoning. Other Mississippi River, USA

An evaluation of impact of dredging and associated activities by United States Army

Corps of Engineers. It was found that these had only minor impacts. Only circumstantial

evidence was presented and potential impacts of causal factors were implied by

reference to other studies (p. 98).

Gagne et al., 2001 4

1

QuĂŠbec, Canada

The decline of freshwater mussels was observed and postulated to be multifactorial,

including such habitat components as habitat destruction, dredging, channeling, and

pollution. Cited factors for which there was no direct evidence included sewage and

effluents from paper mills, tanneries, chemical plants, and steel mills; acid mine runoff,

heavy metals, and pesticides (Bogan, 1993). "Thus the feminization of mussel populations

by environmental estrogens is likely to contribute to this decline." (pp. 267-268,

paragraph 2).

Green, 1972 4

1

and sodium chloride concentration. (p. 1566, paragraph 3).

Haag & Warren, 1998 3

4

Canada

Lampsilis radiata and Pyganodon grandis differed in distributions due to pH, alkalinity Alabama, USA

Statements were made indicating fish host densities were too low, impeding freshwater

mussel composition, however, a linkage between the factors and the decline does not

seem to be made.

Hallam, 1967 1

3

California, USA and Scotland

An investigation of the validity of ideas published by another author. Mussel decline inferred from a literature review.

172

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Hanson et al., 1989 5

1

5

2

4

New York, USA

Links were made between mollusk decline and habitat types, indicating substrate types and patterns, as well as chemical stresses and biotic interactions are linked to declines.

Hartfield & Hartfield, 1996 3

Alberta, Canada

Observed predation on mollusks by muskrats.

Harman, 1972

Location

Alabama, USA

The mussels were observed in high quality clear streams of Bankhead National Forest,

however they were not found in similar streams flowing through private lands, which are

more impacted by sedimentation, eutrophication, chicken and cattle feedlot runoff,

cultivation, surface mine runoff (p. 372, paragraph 3). No definitive link was made.

Hastie et al., 2000b 1

4

Mussels were surveyed and reasons for decline or lack of decline were reviewed or cited from other studies.

Hastie et al., 2001 5

1

4

2

Strong, plausible link made.

1

Scotland

Lack of suitable river bed substratum characteristics are implicated in the decline of Margaritafera margaritifera. Other causes were suggested but not definitively linked.

Hemelraad et al., 1990 5

Scotland

A die-off event occurred (p. 110, paragraphs 2-3) after a 100 year flood event occurred.

Hastie et al., 2000a

Scotland

Netherlands

"After 8 weeks of exposure to cadmium, the clams entered into the lethal phase.

Between 8 and 12 weeks of exposure, 90% of the total mortality occurred." (p. 690,

paragraph 3).

Henley & Neves, 1999 2

2

but no definitive link was made.

Hoggarth, 1990 3

2

2

No plausible cause was established observed for change in density/distribution of

2

Mississippi River, USA

No event occurred in this study and causes were cited from other articles, no links were independently established.

Hubbs et al., 2003 5

Ohio, USA

mussels.

Holland-Bartels, 1990 2

Virginia, USA

A loss of mussels was observed (p. 69, paragraph 3). Possible causes were discussed,

Tennessee River, USA

Low frequency of mussels was observed at the dredged sites and this indicates that

bottom substrates were altered by dredging and resource extraction. These operations

do not allow mussel populations to become established.

Hughes & Parmalee, 1999 1

2

Tennessee, Alabama, Kentucky, USA

Consists of a review of other articles looking at pre- and post-impoundment mussel

fauna. "Cause and effect in the study of biodiversity versus human activities is certainly

speculativeâ&#x20AC;Ś" (p. 26, paragraph 2).

Animal Biodiversity and Conservation 33.2 (2010)

173

Appendix. (Cont.)

Reference Q

N

Notes*

Isely, 1910 3

5

4

Oklahoma, USA

Juvenile specimens could not be located (p. 77) and this was suggested to cause a decline and disappearance of the mussels. No direct link to a cause is established, however.

James, 1985 4

Location

New Zealand

"The density of mussels in Tapuacharuru Bay appears to be influenced by a number of

physical and biological factors (p. 307, paragraph 1), with coarse sand and slope being

most important." (p. 311, paragraph 4).

Jansen et al., 2001 1

3

host-fish, and glochidia mortality.

Jantz & Neumann, 1992 1

4

World

No loss was observed and causes were cited from other sources: muskrat predation, River Rhine

A review of possible causes of zebra mussel mortality indicating exposure from water

level fluctuations, predatory fish, toxicity from pollution, competition from Corophiun

curvispinum (p. 59, paragraphs 1-5). No original evidence provided.

Jirka & Neves, 1990 4

2

West Virginia, USA

Survival of mussels in the New River Gorge National River precluded by scarcity of

suitable habitat and possibly by lack of suitable fish hosts (p. 138, paragraph 3). No

factors were definitively substantiated (p. 139, paragraph 2). Study makes good link to

habitat as the cause for decline.

Johnson & Brown, 1998 4

4

Louisiana, USA

According to this study: "it appears that host fish distribution could play a role in

regulating Margaritifera hembeli abundance and distribution" (p. 326, paragraph 2).

Some other causes were cited from other articles (p. 327, paragraph 2).

Johnson & Brown, 2000 4

3

Louisiana, USA

The results of this study suggest that residual populations of Louisiana pearl shells

are more likely to be found in small headwater streams with harder water and

circumneutral pH values (p. 274, paragraph 4). Margaritiafera hembeli was found to

be positively associated with several microhabitat variables (p. 274, paragraph 5),

however juvenile survival is thought to be influenced by other factors than those

influencing adults (p. 275, paragraph 4).

Keller & Zam, 1991 4

2

Canada and USA

Anodonta imbecilis was found to be as sensitive to dissolved metal pollution as zooplankton but may be more sensitive than some insects (table 6) (p. 543, paragraph 9).

Water hardness was shown to have an effect on metal toxicity to mussels (p. 544,

paragraph 2). Furthermore it was postulated that metals can be more toxic to mussels at

lower concentrations in combination than they are singly (p. 545, paragraph 2).

Kelner & Sietman, 2000 1

6

Illinois, USA

Records from recent studies were reviewed and population declines may have been observed. Factors are unclear (p. 373, paragraph 2).

174

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Killeen et al., 1998 1

2

5

and stream level as the cause (p. 247, paragraph 2). Effects inferred from literature sources.

2

from other articles (p. 574).

5

habitat availability of host fish (pp. 340-343). Direct linkages not substantiated.

6

Center Hill Dam (p. 68). Some causes inferred from published sources.

2

Fork River (p. 69, paragraph 5). Some causes inferred from published sources.

6

USA

A model was used to study the effects of fecundity rate, availability of fish hosts and suitability of the habitat. No event observed and no direct evidence of causes offered.

Liu et al., 1996 4

Kentucky, USA

Evidence linked mussel extinction to construction and operation of a dam in the Caney

Lee & DeAngelis, 1997 1

Tennessee, USA

An observed loss of species occurred mainly as a result of construction and operation of

Layzer et al., 1993 4

Kentucky, USA

Mussel distribution is based on simple and complex hydraulic variables, host fish,

Layzer et al., 1993 4

Eastern USA

Populations are observed to be reproductively isolated. Some of the causes are cited

Layzer & Madison, 1995 2

Wales

A die off event occurred (p. 247, paragraph 6) but no link was established to the habitat

King et al., 1999 4

Location

Colorado, USA

"Although pollution, fluctuation in water levels, and periodic decimation of fish stocks

can all contribute to the decline of mussels, it is not known which factor is the most

important." (p. 122, paragraph1). Some causes inferred from indirect evidence.

Makela & Oikari, 1992 5

1

Finland

This study observed the effects of pH on ionic balance in Anodonta anatina L.. Deaths

were observed at pH 2.6 and below (p. 172, paragraph 3). "This was probably due to

the loss of ions" (p. 173, paragraph 3).

Martel et al., 2001 4

1

Ontario, Canada

A decline was observed (p. 2185) following invasion of Dreissena polymorpha (p. 2189).

A link was established to this invasion but not to any of the other cited causes listed on

p. 2182, paragraph 2.

Mehlhop & Vaughn, 1994 5

7

North America

Declines have been observed in North America. Threats identified were: water quantity

and quality due to habitat destruction, pollution, recreational activities, fish hosts,

fragmentation of river drainages through impoundments, channelization and other

activities such as timber-harvesting, which alters flow and sedimentation patterns, flow

alteration. Linkages judged to be plausible.

Metcalfe et al., 1998 1

4

Canada

15 of 40 species were identified as extirpated from the Lower Great Lakes drainage (p.

439, paragraph 3). Causes were cited from other articles (p. 425, paragraph 1).

Animal Biodiversity and Conservation 33.2 (2010)

175

Appendix. (Cont.)

Reference Q

N

Notes*

Metcalfe et al., 1998 2

4

Location Canada

Records showing mussel numbers from 1860 and 1996 were compiled and reviewed

and showed evidence of a steady decline (p. 850, paragraph 1) (p. 852, paragraph 3).

Cited causes discussed : fish hosts and habitats, water chemistry, agricultural activity,

agriculture runoff, roadway crossings, cattle crossings, industrial discharges and storm

sewer discharges, dam construction, Metal toxicity. Connections based on inference

from the literature.

Metcalfe et al., 2000 2

5

direct evidence for causes of decline were illuminated.

Miller & Kott, 1989 4

1

1

4

7

Central USA

Data from ten years of sampling were reviewed. Causes were discussed (p. 188, paragraph 1) but no direct linkages were made between declines and causes.

Miller et al., 1986 3

Lake Michigan

Faunal shifts were observed with oscillations in lake level.

Miller & Payne, 1998

Ontario, Canada

Causes for mussel decline/extirpation were discussed on p. 446, paragraph 1 but no

Illinois, USA

Cited causes for loss include: sedimentation, navigation activities, pollution, reservoir

construction (many with deoxygenated, low pH, and cold water releases), and loss of

fish hosts (Fuller, 1974), recruitment, habitat alterations and range. (p. 17). Evidence for

cause inferred from principally from literature review.

Miller et al., 1999 2

1

Wisconsin , USA

The effects of water velocity changes were observed but the authors found that they did

not significantly affect the mussels. Other factors were cited from the published literature

(p. 241, paragraph 2).

Morris & Corkum, 1996 2

4

Ontario Canada

A survey of mussels in southwestern Ontario is presented. Many causes are cited from

other articles: ammonia and host fish, nitrate, nitrite and phosphate, agricultural activity,

stream size and gradient, hydrologic variability and physiography. No direct evidence of

causes for decline illuminated.

Morris & Taylor, 1978 2

5

West Virginia, USA

Mussels were absent from stations 2-6 of Kanawha River. Possible explanations

discussed are industrial and organic pollution, habitat destruction from impoundment,

and introduced species, but no direct evidence is offered.

Moulton et al., 1996 4

4

USA

Effects of pesticides on mussels were observed. Mussel deaths were observed (p. 132,

paragraph 10). Increased metabolic rate with low dissolved oxygen levels may also be

a concern (p. 135, paragraph 3).

176

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Mouthon, 1992 5

1

Location France

"A deficit in dissolved oxygen in the hypolimnion level and an excess of organic matter

in deep sediments, defined in relation to the mineralization potential of each system, are

two factors which limit the bathymetric distribution of molluscs in lakes. Low calcium

levels can also limit the vertical distribution of gastropods." (p. 155, paragraph 3).

Naimo, 1995 1

2

A literature review on bioaccumulation, tissue distribution, uptake, elimination, detoxification and ecotoxicological effects of metals on freshwater mussels is presented.

Naimo et al., 1998 5

1

2

Mississippi River, USA

A decline of Amblema plicata plicata was observed and a link was established experimentally to nutritional resources (p. 127, paragraph 2).

Nalepa et al., 1991 2

North America

Lake Erie

A decline was apparent (table 2, p. 216, paragraph 2). The specific reason for the

decrease in unionid populations is likely related to water quality decline. Other cited

causes are low oxygen, shifts in fish composition, and zebra mussels. No direct linkages

illuminated.

Nalepa et al., 1996 5

1

mussels (pp. 357-360), (p. 361, paragraph 1).

National Native Mussel Conservation Committee, 1998 1

4

Canada

Decline of unionids (p. 362, paragraph 1) was attributed to an increase in zebra USA

Freshwater mussel declines are discussed and reviewed in this paper. Causes listed

are impoundments, sedimentation, channelization, and dredging, water pollution, and the

zebra mussel, habitat degradation, water quality degradation. (p. 1419, paragraph 3).

Neves, 1999 1

7

A review of conservation of freshwater mussels is offered with no direct analyses of linkages between disappearance and causal factors.

Neves & Odom, 1989 4

1

5

1

938). Other potential causes were cited from published sources.

1

"Sites that were unstable (i.e., loose, shifting substrata) were especially low in unionid

1 2

Illinois, USA

No link was established of the cited effect: water velocity.

Pynnonen, 1990 4

West Virginia, USA

Zebra mussels were linked to the decline of freshwater mussels (pp. 177-178).

Payne & Miller, 1987 2

Kansas and Missouri, USA

numbers" (p. 49, paragraph 2). Inference judged to be strong.

Parker et al., 1998 5

Virginia, USA

This study assesses the impact of muskrat predation on endangered mussels (pp. 937-

Obermeyer et al., 1997

USA

Finland

It was found that adult mussels can withstand severe acidification. Furthermore results

"â&#x20AC;Śindicate that the reason for their disappearance from the acidified waters might be

due to reproductive failure." (p. 477, paragraph 2).

Animal Biodiversity and Conservation 33.2 (2010)

177

Appendix. (Cont.)

Reference Q

N

Notes*

Rooke & Mackie, 1984 5

1

Location Ontario, Canada

"Significant differences between mollusk densities in two intermediate-alkalinity lakes

indicate that factors other than alkalinity may have affected mollusk distributions

(abstract). Inference judged to be strong.

Schloesser et al., 1997 5

1

Schneider et al., 1998 1

Lake Erie

Zebra mussel infestation was found to cause unionid mortality (p. 70, paragraph 2).

Lake Michigan and Ilinois lakes, USA

1 A model of the risk of infestation by zebra mussels is reviewed and found to be useful

when assessing risk when data on vector movement are not available.

Strayer, 1980 2

2

Michigan, USA

A survey of mussels was compared to an older survey and decline was observed.

Possible cited causes are domestic and industrial pollution low dissolved oxygen, high

ammonia, and heavy metals. (p. 148, paragraph 3).

Straye, 1983 1

1

Michigan, USA

Records and a survey were compiled and causes for the loss of species reviewed.

Mussel distributions are controlled by ecological factors associated with stream size and

surface geology (p. 261, paragraph 2). "This study clearly shows that the catchment

of a stream is partially responsible for the biota of that streamâ&#x20AC;? (p. 263, paragraph 2),

although factors are not linked directly with decline.

Strayer, 1993 4

2

Delaware, USA

Published records were used. Variables looked at were stream size, stream gradient,

hydrologic variability, calcium concentration, physiographic province, and the presence

or absence of tidal influences. All were found to be useful predictors of mussel

distribution with stream size and tide being the most useful (p. 241, paragraphs 3-4).

Eutrophication is also thought to play a role in mussel disappearance (p. 242).

Strayer, 1999a 1

1

A review of impact of alien species on mollusk fauna. Articles citing zebra mussels and the Asian clam, habitat degradation/quality are discussed. No explicit links were established.

Strayer, 1999b 1

2

North America

New York, USA

A review of other studies shows that flow refuges are not the only means of survival (p.

474, paragraph 2) also environmental factors: dissolved oxygen, sediment size, and

frequency of desiccation may also be involved. Inference by literature citation.

Strayer & Jirka, 1997 1

9

were established between causal factors and decline.

Strayer & Ralley, 1993 4

2

New York, USA

A review of pearly mussel distributions and causes of loss were discussed. No links New York, USA

Water depth and current speed were predictors of distribution and abundance of

unionaceans (p. 254, paragraph 4). The presence or absence of macrophytes, distance

from shore, and certain aspects of sediment granulometry had some significance as

predictors of survival (p. 255, paragraph 1). Other factors were discussed (pp. 255-256).

178

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Strayer & Smith, 1996 5

1

Location Hudson River, USA

A decline in unionids was observed following arrival of the zebra mussel. Heavy

infestation was not observed therefore the authors concluded the cause to be

competition for food (p. 107, paragraph 2).

Strayer et al., 1996 4

2

New Hampshire to North Carolina, USA

"All populations in our study appear to be vulnerable to loss because of low densities,

small ranges, linear ranges, or some combinations of these factors." (p. 315,

paragraph 1). Inference strong relative to other studies.

Strayer et al., 1981 3

1

New Hampshire, USA

The population density, biomass, and annual production of unionids in Mirror Lake

were lower than in other ecosystems. Cited factors were substrate and water quality

(p. 438, paragraphs 4-5).

Sylvester et al., 1984 4

3

Mississippi River, USA

Siltation and lack of fish hosts due to pollution and stream alterations proposed as

reasons for decline in Lampsilis higginsi. Experiments on burrowing rates into various

substrates and duration of glochidial infection of host fish used as evidence for

postulated causes.

Taylor, 1989 1

2

Ohio, USA

A species list was generated from other literature to assess changes in freshwater

mussel populations. Reviewed causes for decline in mussels: habitat and environmental

degradation and modification, depth, and decreased water discharge. Inference by

review of literature.

Tevesz & Redmond, 2002 2

2

Ohio, USA

Loss of species occurred in the lower portion of Cuyahoga River, but little change

occurred in the upper reaches that are "less industrially impacted" (p. 16, paragraph 2).

No causes are linked directly to this decline although pollution is mentioned because it

coincides in time.

Theler, 1987a 4

2

Wisconsin, USA

The most probable causes for mussel mortality at this site are overharvest, siltation,

host fish, dam construction, water depth, habitat modification. Work was performed

through archaeological excavation of mussel middens. Links are quite plausible and

founded in observation.

Theler, 1987b 2

2

Wisconsin, USA

Archaeological digs showed mussels present in a region where they are now absent.

Reference to times of disappearance and environmental changes rely on literature

evidence. Causes for mortality may have been flood erosion or siltation, sedimentation

(p. 170, paragraph 6), poor habitat conditions (abstract).

Animal Biodiversity and Conservation 33.2 (2010)

179

Appendix. (Cont.)

Reference Q

N

Notes*

Thiel, 1981 5

5

Location Mississippi River, USA

A survey was performed of unionid mussels and when compared to earlier studies

â&#x20AC;&#x153;showed a continuing trend of diminishing mussel species diversityâ&#x20AC;?. Causes

discussed for the continuing trend of diminishing mussel species diversity are

harvesting, and impoundments, substrate dredging, sediment and silt, species

adaptability. (pp. 20-21). A shift in species dominance has occurred since

impoundments (p. 18, paragraph 5).

Tyrrell & Hornbach, 1998 5

1

St. Croix and Mississippi Rivers, USA

Evidence collected by comparing midden piles with live river collections of mussels.

Muskrat predation was found to affect species composition and size structure of mussel

communities. Muskrats can shift their preferences among species (p. 309, paragraph 2).

Vannote & Minshall, 1982 5

1

population size structure and relative abundance (p. 4103, paragraph 1).

Vaughn, 1993 1

3

4

understanding extinction. Species losses inferred from published data.

2

6

No strong links were established.

3

Oklahoma, USA

Arkansia wheeleri was extirpated from below impounded tributary and other cited causes were discussed. No substantial links were made.

Vaughn & Taylor, 1999 2

Oklahoma, USA

Losses of mussels were observed and causes for decline were cited from other articles.

Vaughn & Pyron, 1995

North America

Models were developed to examine mussel meta-populations as a means of

Vaughn, 1997 2

Idaho, USA

Study suggests that local lithology and fluvial geomorphic processes interact to regulate

Oklahoma and Arkansas, USA

This case study examined a mussel extinction gradient downstream from an

impoundment. A mussel extinction gradient was observed downstream from

impoundment (abstract). Three causes deriving from impoundments are discussed by

reference to other published studies (p. 916).

Waller et al., 1998 5

1

Mississippi River

Toxicity of the fish toxin 3-trifluoromethyl-4-nitrophenol (TFM) is proposed based on

laboratory experiments. "TFM caused narcotization of the mussels, as evidence by

valve gaping, extension of the foot and lack of movement, even at sublethal

concentrations. Once elicited, the mussels remained narcotized for the duration of the

exposure period." (p. 116, paragraph 2).

Watters, 1992 1

2

North America

Literature sources reviewed are listed in table 1.

180

Downing et al.

Appendix. (Cont.)

Reference Q

N

Notes*

Way et al., 1989 4

3

Location Tennessee River, USA

Mussel samples were taken along a gradient of postulated local extinction causes.

Density differed between inshore and off shore sites as did sediment deposition (p. 97,

paragraphs 2-3) and water velocity (p. 98, paragraph 1).

Weinstein, 2002 5

2

Texas, USA

Toxicity analyses of polycyclic aromatic hydrocarbons. "Environmentally relevant

concentrations of fluoranthene do pose a significant hazard to the glochidia of at least

one species of freshwater mussel" (p. 160, paragraph 1). Cumulative damage was

observed during light periods and no repair during dark periods.

Williams et al., 1993 1

6

abstract).

Williams et al., 1992 4

2

Canada and USA

A review of the current status of mussels. Threats are discussed (p. 7, paragraph 1, Alabama and Mississippi, USA

"The reduced number of species and individuals in the impounded segment of the

Tombigbee River appears to be habitat related." (p. 7, paragraph 1). Impacts of

impoundment related causes are reviewed but some connections made directly.

Yokley, 1976 5

2

A disappearance of mussels was observed. Habitat alteration by dredging was the linked cause through manipulation experiments.

Zanatta et al., 2002 2

1

Tennessee, USA

Lake St. Clair, Canada

95 sites around Lake St. Clair were surveyed. No live unionids were found at

42 of sites surveyed. 2,356 were found at 33 sites. Zebra mussels are discussed

as the cause because mussel species that dominate the fauna are those that

other studies have suggested to be resistant to infestation by zebra mussels (p.

482, paragraph 3).

Animal Biodiversity and Conservation 33.2 (2010)

181

Appendix. (Cont.)

References Aldridge, D. W., 1987. The effects of Intermittent exposure to suspended solids and turbulence on three species of freshwater mussels. Environmental Pollution, 45: 17–28.

Altaba, C. R., 1990. The last known population of the freshwater mussel Margaritifera auricularia (Bivalvia, Unionoida): a conservation priority. Biological Conservation, 52: 271–286.

Anderson, R. M., Layzer, J. B. & Gordon, M. E., 1991. Recent catastrophic decline of mussels (Bivalvia: Unionidae) in the Little South Fork Cumberland River, Kentucky. Brimleyana, 17: 1–8.

Arter, H. E., 1989. Effect of eutrophication on species composition and growth of freshwater mussels (Mollusca, Unionidae) in Lake Hallwil (Aargau, Switzerland). Aquatic Sciences, 51: 87–99.

Bailey, R. C. & Green, R. H., 1989. Spatial and temporal variation in a population of freshwater mussels in Shell Lake, N.W.T. Canadian Journal of Fisheries and Aquatic Sciences, 46: 1392–1395.

Balfour, D. L. & Smock, L. A., 1995. Distribution, age structure, and movements of the freshwater mussel Elliptio complanata (Mollusca: Unionidae) in a headwater stream. Journal of Freshwater Ecology, 10: 255–268.

Bauer, G., Hochwald, S. & Silkenat, W., 1991. Spatial distribution of freshwater mussels: the role of host fish and metabolic rate. Freshwater Biology, 26: 377–389.

Beasley, C. R. & Roberts, D., 1999. Towards a strategy for the conservation of the freshwater pearl mussel Margaritifera margaritifera in County Donegal, Ireland. Biological Conservation, 89: 275–284.

Belanger, S. E., 1991. The effect of dissolved oxygen, sediment, and sewage treatment plant discharges upon growth, survival and density of Asiatic clams. Hydrobiologia, 218: 113–126.

Bergman, S. M., Eberle, M. E. & Obermeyer, B. K., 2000. Freshwater mussels (Bivalvia: Unionoidea) in stremas of northwestern Kansas. Prairie Naturalist, 32: 1–15.

Blalock, H. H. N., Herod, J. J. & Williams, J. D., 2002. Evaluation of conservation status, distribution, and reproductive characteristics of an endemic Gulf Coast freshwater mussel, Lampsilis australis (Bivalvia: Unionidae). Biodiversity and Conservation, 11: 1877–1887.

Blalock, H. N. & Sickel, J. B., 1996. Changes in mussel (Bivalvia: Unionidae) fauna within the Kentucky portion of Lake Barkley since impoundment of the lower Cumberland River. American Malacological Bulletin, 13: 111–116.

Bogan, A. E., 1993. Freshwater bivalve extinctions (Mollusca: Unionoida): A search for causes. American Zoology, 33: 599–609.

– 1998. Freshwater molluscan conservation in North America: Problems and practices. Journal of Conchology, Special publication: 223–230.

Bowen, Z. H., Malvestuto, S. P., Davies, W. D. & Crance, J. H., 1994. Evaluation of the mussel fishery in Sheeler Reservoir, Tennessee River. Journal of Freshwater Ecology, 9: 313–319.

Box, J. B. & Mossa, J., 1999. Sediment, land use, and freshwater mussels: Prospects and problems.

Journal of the North American Benthological Society, 18: 99–117.

Butler, R. S., 2003a. Status assessment for the sheepnose, Plethobasus cyphysus, occurring in the Mississippi River system. Status Assessment. Asheville, NC, USA, Ohio River Valley Ecosystem Team, Mollusk Subgroup, United States Fish and Wildlife Service.

– 2003b. Status assessment for the spectaclecase, Cumberlandia monodonta, occurring in the Mississippi River system. Status Assessment. Asheville, NC, USA, Ohio River Valley Ecosystem Team, Mollusk Subgroup, United States Fish and Wildlife Service.

– 2003c. Status assessment report for the rayed bean, Villosa fabalis, occurring in the Mississippi River and Great Lakes systems (US Fish and Wildlife Service Regions 3, 4, and 5, and Canada). Status Assessment. Asheville, NC, USA, Ohio River Valley Ecosystem Team, Mollusk Subgroup, United States Fish and Wildlife Service.

Byrne, M., 1998. Reproduction of river and lake populations of Hyridella depressa (Unioniacea: Hyriidae) in New South Wales: Implications for their conservation. Hydrobiologia, 389: 29–43.

Clarke, A. H., 1986. Unionidae of the upper Connecticut River, a vanishing resource. The Nautilus, 100: 49–53.

Cooper, C. M. & Johnson, V. W., 1980. Bivalve Mollusca of the Yalobusha River. The Nautilus, 94: 22–24.

Cope, W. G., Hove, M. C., Waller, D. L., Hornbach, D. J., Bartsch, M. R., Cunningham, L. A., Dunn, H. L. & Kapusciniski, A. R., 2003. Evaluation of relocation of unionid mussels to in situ refugia. Journal of Molluscan Studies, 69: 27–34.

Cosgrove, P. J. & Hastie, L. C., 2001. Conservation of threatened freshwater pearl mussel populations: River management, mussel translocation and conflict resolution. Biological Conservation, 99: 183–190.

Cvancara, A. M., 1976. Aquatic mollusks in North Dakota during the last 12000 years. Canadian Journal of Zoology, 54: 1688–1693.

182

Downing et al.

Appendix. (Cont.)

Cvancara, A. M. & Freeman, P. G., 1978. Diversity and distribution of mussels (Bivalvia: Unionacea) in a eutrophic reservoir, Lake Ashtabula, North Dakota. The Nautilus, 92: 1–9.

Day, K. E., Metcalfe, J. L. & Batchelor, S. P., 1990. Changes in intracellular free amino acids in tissues of the caged mussel Elliptio complanata, exposed to contaminated environments. Archives of Environmental Contamination and Toxicology, 19: 816–827.

Di Maio, J. & Corkum, L. D., 1995. Relationship between the spatial distribution of freshwater mussels (Bivalvia: Unionidae) and the hydrological variability of rivers. Canadian Journal of Zoology, 73: 663–671.

Diamond, J. M., Bressler, D. W. & Serveiss, V. B., 2002. Assessing relationships between human land uses and the decline of native mussels, fish, and macroinvertebrates in the Clinch and Powell River watershed, USA. Environmental Toxicology and Chemistry, 21: 1147–1155.

Diamond, J. M. & Serveiss, V. B., 2001. Identifying sources of stress to native aquatic fauna using a watershed ecological risk assessment framework. Environmental Science and Technology, 35: 4711–4718.

Dimock, R. V. & Wright, A. H., 1993. Sensitivity of juvenile freshwater mussels to hypoxic, thermal and acid stress. The Journal of the Elisha Mitchell Scientific Society, 109: 183–192.

Downing, J. A., Rochon, Y. & Perusse, M., 1993. Spatial aggregation, body size, and reproductive success in the freshwater mussel Elliptio complanata. Journal of North American Benthological Society, 12: 148–156.

Duncan, R. E. & Thiel, P. A., 1983. A survey of the mussel densities in pool 10 of the upper Mississippi River. Technical Bulletin No. 139 Department of Natural Resources, 139: 1–15.

Fleming, W. J., Augspurger, T. P. & Alderman, J. A., 1995. Freshwater mussel die–off attributed to anticholinesterase poisoning. Environmental Toxicology and Chemistry, 14: 877–879.

Fuller, S. L. H., 1978. Freshwater mussels (Mollusca: Bivalvia: Unionidae) of the Upper Mississippi River: Observations at selected sites within the 9–foot channel navigation project on behalf of the United State Army Corps of Engineers. The academy of Natural Sciences of Philadelphia Division of Limnology and Ecology, 78–33: 94–98.

Gagne, F., Marcogliese, D. J., Blaise, C. & Gendron, A. D., 2001. Occurence of compounds estrogenic to freshwater mussels in surface waters in an urban area. Environmental Toxicology, 16: 260–268.

Green, R. H., 1972. Distribution and morphological variation of Lampsilis radiata (Pelecypoda, Unionidae) in some central Canadian Lakes: A multivariate statistical approach. Journal of Fisheries Resources Board of Canada, 29: 1565–1570.

Haag, W. R. & Warren, M. L., 1998. Role of ecological factors and reproductive strategies in structuring freshwater mussel communities. Canadian Journal of Fish and Aquatic Sciences, 55: 297–306.

Hallam, A., 1967. The interpretation of size–frequency distributions in molluscan death assemblages.

Palaeontology, 10: 25–42.

Hanson, J. M., Mackay, W. C. & Prepas, E. E., 1989. Effect of size–selective predation by muskrats (Ondatra zebithicus) on a population of Unionid clams (Anodonta grandis simpsoniana). Journal of Animal Ecology, 58: 15–28.

Harman, W. N., 1972. Benthic substrates: their effect on freshwater mollusca. Ecology, 53: 271–277.

Hartfield, P. & Hartfield, E., 1996. Observations on the conglutinates of Ptychobranchus greeni (Conrad, 1834) (Mollusca: Bivalvia: Unionoidea). American Midland Naturalist, 135: 370–375.

Hastie, L. C., Boon, P. J. & Young, M. R., 2000a. Physical microhabitat requirements of freshwater pearl mussels, Margaritafera margaritafera (L.). Hydrobiologia, 429: 59–71.

Hastie, L. C., Boon, P. J., Young, M. R. & Way, S., 2001. The effects of a major flood on an endangered freshwater mussel population. Biological Conservation, 98: 107–115.

Hastie, L. C., Young, M. R., Boon, P. J., Cosgrove, P. J. & Henninger, B., 2000b. Sizes, densities and age structures of Scottish Margaritifera margaritifera (L.) populations. Aquatic Conservation, 10: 229–247.

Hemelraad, J., Holwerda, D. A., Wijnne, H. J. A. & Zandee, D. I., 1990. Effects of cadmium in freshwater clams. I. Interaction with essential elements in Anodonta cygnea. Archives of Environmental Contamination and Toxicology, 19: 686–690.

Henley, W. F. & Neves, R. J., 1999. Recovery status of freshwater mussels (Bivalvia: Unionidae) in the North Fork Holston River, Virginia. American Malacological Bulletin, 15: 65–73.

Hoggarth, M. A., 1990. The Unionidae of the Chagrin River: The remnant of a Molluscan fauna. Ohio Journal of Science, 90: 168–170.

Holland–Bartels, L. E., 1990. Physical factors and their influence on the mussel fauna of a main channel border habitat of the upper Mississippi River. Journal of North American Benthological Society, 9: 327–335.

Hubbs, D., Lanier, S., McKinney, D., Sims, D. & Black, P., 2003. Evaluation of abandoned commercial sand and gravel dredge sites on the lower Tennessee River. Nashville, TN, USA, Tennessee Wildlife Resource Agency, Fisheries Management Division.

Animal Biodiversity and Conservation 33.2 (2010)

183

Appendix. (Cont.)

Hughes, M. H. & Parmalee, P. W., 1999. Prehistoric and modern freshwater mussel (Mollusca: Bivalvia: Unionidea) faunas of the Tennessee River: Alabama, Kentucky, and Tennessee. Regulated Rivers Research and Management., 15: 25–42.

Isely, F. B., 1910. Preliminary note on the ecology of the early juvenile life of the Unionidae. Biological Bulletin, 20: 77–80.

James, M. R., 1985. Distribution, biomass and production of the freshwater mussel, Huridella menziesi (Gray), in Lake Taupo, New Zealand. Freshwater Biology, 15: 307–314.

Jansen, W., Bauer, G. & Zahner–Meike, E., 2001. Glochidial mortality in freshwater mussels. In: Ecology and evolution of the freshwater mussels Unionoida (G. Bauer & K. Wachtler). Springer–Verlag Berlin Heidelberg.

Jantz, B. & Neumann, D., 1992. Shell growth and aspects of the population dynamics of Dreissena polymorpha in the River Rhine. Limnologie aktuell, 4: 49–66.

Jirka, K. J. & Neves, R. J., 1990. Freshwater mussel fauna bivalvia Unionidae of the new river Gorge National River West Virginia USA. Nautilus, 103: 136–139.

Johnson, P. D. & Brown, K. M., 1998. Intraspecific life history variation in the threatened Louisiana pearlshell mussel, Margaritifera hembeli. Freshwater Biology, 40: 317–329.

– 2000. The importance of microhabitat factors and habitat stability to the threatened Louisiana pearl shell, Margaritifera hembeli (Conrad). Canadian Journal of Zoology, 78: 271–277.

Keller, A. E. & Zam, S. G., 1991. The acute toxicity of selected metals to the freshwater mussel, Anodonta imbecilis. Environmental Toxicology and Chemistry, 10: 539–546.

Kelner, D. E. & Sietman, B. E., 2000. Relic populations of the ebony shell, Fusconaia ebena (Bivalvia: Unionidae), in the Upper Mississippi River. Journal of Freshwater Ecology, 15: 371–377.

Killeen, I. J., Oliver, P. G. & Fowles, A. P., 1998. The loss of a freshwater pearl mussel (Margaritifera margaritifera) population in NW Wales. Journal of Conchology: 245–250.

King, T. L., Eackles, M. S., Branimir, G. J. & Hoeh, W. R., 1999. Intrapecific phylogeography of Lasmigona subviridis (Bivalvia: Unionidae): conservation implications of range discontinuity. Molecular Ecology, 8: 565–578.

Layzer, J. & Madison, L. M., 1995. Microhabitat use by the freshwater mussels and recommendations for determining their instream flow needs. Regulated Rivers: Research and Management, 10: 329–345.

Layzer, J. B., Gordon, M. E. & Anderson, R. M., 1993. Mussels: The forgotten fauna of regulated rivers.

A case study of the Caney Fork River. Regulated Rivers Research and Management., 8: 63–71.

Lee, H.–L. & DeAngelis, D., 1997. A simulation study of the spatio–temporal dynamics of the unionid mussels. Ecological Modelling, 95: 171–180.

Liu, H. P., Mitton, J. B. & Herrmann, S. J., 1996. Genetic differentiation in and management recommendations for the freshwater mussel, Pyganodon grandis (Say, 1829). American Malacological Bulletin, 13: 117–124.

Makela, T. P. & Oikari, A. O. J., 1992. The effects of low water pH on the ionic balance in freshwater mussel Anodonta anatina L. Annales Zoologici Fennici, 29: 169–175.

Martel, A. L., Pathy, D. A., Madill, J. B., Renaud, C. B., Dean, S. L. & Kerr, S. J., 2001. Decline and regional extirpation of freshwater mussels (Unionidae) in a small river system invaded by Dreissena polymorpha: The Rideau River, 1993–2000. Canadian Journal of Zoology, 79: 2181–2191.

Mehlhop, P. & Vaughn, C. C., 1994. Threats to the sustainability of ecosystems for freshwater mollusks.

In: Sustainable ecological systems: Implementing an ecological approach to land management (W. Covington & L. F. Dehand, Eds.). Fort Collins, CO, US Department of Agriculture.

Metcalfe, S. J. L., Staton, S. K., Mackie, G. L. & Di Maio, J., 2000. Changes over time in the diversity and distribution of freshwater mussels (Unionidae) in the Grand River, southwestern Ontario. Journal of Great Lakes Research, 26: 445–459.

Metcalfe, S. J. L., Staton, S. K., Mackie, G. L. & Lane, N. M., 1998. Changes in the biodiversity of freshwater mussels in the Canadian waters of the lower great lakes drainage basin over the past 140 years. Journal of Great Lakes Research, 24: 845–858.

Miller, A. C. & Payne, B. S., 1998. Effects of disturbances on large–river mussel assemblages. Regulated Rivers: Research and Management, 14: 179–190.

Miller, A. C., Payne, B. S. & Shaffer, L. R., 1999. A shell gape monitor to study effects of physical disturbance on freshwater mussels. Journal of Freshwater Ecology, 14: 241–247.

Miller, A. C., Payne, B. S. & Siemsen, T., 1986. Description of the habitat of the endangered mussel Plethobasus cooperianus. The Nautilus, 100: 14–18.

Miller, B. B. & Kott, R., 1989. Molluscan faunal changes in the Lake Michigan Basin during the past 11000 years. National Geographic Research, 5: 364–373.

184

Downing et al.

Appendix. (Cont.)

Morris, J. S. & Taylor, R. W., 1978. A survey of the freshwater mussels (Bivalvia: Unionidae) of the Kanawha River of West Virginia. The Nautilus, 92: 153–155.

Morris, T. J. & Corkum, L. D., 1996. Assemblage structure of freshwater mussels (Bivalvia: Unionidae) in river with grassy and forested riparian zones. Journal of the North American Benthological Society, 15: 576–586.

Moulton, C. A., Fleming, W. J. & Purnell, C. E., 1996. Effects of two cholinesterase–inhibiting pesticides on freshwater mussels. Environmental Toxicology and Chemistry, 15: 131–137.

Mouthon, J., 1992. Snail and bivalve populations analysed in relation to physico–chemical quality of lakes in eastern France. Hydrobiologia, 245: 147–156.

Naimo, T. J., 1995. A review of the effects of heavy metals on freshwater mussels. Ecotoxicology, 4: 341–362.

Naimo, T. J., Damschen, E. D., Rada, R. G. & Monroe, E. M., 1998. Nonlethal evaluation of the physiological health of unionid mussels: methods for biopsy and glycogen analysis. Journal of North American Benthological Society, 17: 121–128.

Nalepa, T. F., Harston, D. J., Gostenik, G. W., Fanslow, D. L. & Lang, G. A., 1996. Changes in the freshwater mussel community of Lake St. Clair: From Unionidae to Dreissena polymorpha in eight years.

Journal of Great Lakes Research, 22: 354–369.

Nalepa, T. F., Manny, B. A., Roth, J. C., Mozley, S. C. & Schloesser, D. W., 1991. Long–term decline in freshwater mussels (Bivalvia: Unionidae) of the western basin of Lake Erie. Journal of Great Lakes Research, 17: 214–219.

National Native Mussel Conservation Committee, 1998. National Strategy for the conservation of native freshwater mussels. Journal of Shellfish Research, 17: 1419–1428.

Neves, R. J., 1999. Conservation and commerce: Management of freshwater mussel (Bivalvia: Unionoidea) resources in the United States. Malacologia, 41: 461–474.

Neves, R. J. & Odom, M. C., 1989. Muskrat predation on endangered freshwater mussels in Virginia, USA. Journal of Wildlife Management, 53: 934–941.

Obermeyer, B. K., Edds, D. R., Prophet, C. W. & Miller, E. J., 1997. Freshwater mussels (Bivalvia: Unionidae) in the Verdigris, Neosho, and Spring River basins of Kansas and Missouri, with emphasis on species of concern. American Malacological Bulletin, 14: 41–55.

Parker, B. C., Patterson, M. A. & Neves, R. J., 1998. Feeding interactions between native freshwater mussels (Bivalvia: Unionidae) and zebra mussels (Dreissena polymorpha) in the Ohio River. American Malacological Bulletin, 14: 173–179.

Payne, B. S. & Miller, A. C., 1987. Effects of current velocity on the freshwater bivalve Fusconaia ebena.

American Malacological Bulletin, 5: 177–179.

Pynnonen, K., 1990. Physiological responses to severe acid stress in four species of freshwater clams (Unionidae). Archives of Environmental Contamination and Toxicology, 19: 471–478.

Rooke, J. B. & Mackie, G. L., 1984. Mollusca of six low–alkalinity lakes in Ontario. Canadian Journal of Fisheries and Aquatic Sciences, 41: 777–782.

Schloesser, D. W., Smithee, R. D., Longton, G. D. & Kovalak, W. P., 1997. Zebra mussel induced mortality of unionids in firm substrata of western Lake Erie and a habitat for survival. American Malacological Bulletin, 14: 67–74.

Schneider, D. W., Ellis, C. D. & Cummings, K. S., 1998. A transportation model assessment of the risk to native mussel communities from zebra mussel spread. Conservation Biology, 12: 788–800.

Strayer, D. L., 1980. The freshwater mussels (Bivalvia: Unionidae) of the Clinton River, Michigan, with comments on man’s impact on the fauna, 1870–1978. The Nautilus, 94: 142–149.

– 1983. The effects of surface geology and stream size on freshwater mussel (Bivalvia, Unionidae) distribution in southeastern Michigan, U.S.A. Freshwater Biology, 13: 253–264.

– 1993. Macrohabitats of freshwater mussels (Bivalvia:Unionacea) in streams of the northern Atlantic Slope. Journal of North American Benthological Society, 12: 236–246.

– 1999a. Statistical power of presence–absence data to detet population declines. Conservation Biology, 13: 1034–1038.

– 1999b. Use of flow refuges by unionid mussels in rivers. Journal of North American Benthological Society, 18: 468–476.

Strayer, D. L., Cole, J. J., Likens, G. E. & Buso, D. C., 1981. Biomass and annual production of the freshwater mussel Elliptio complanata in an oligotrophic softwater lake. Freshwater Biology, 11: 435–440.

Strayer, D. L. & Jirka, K. J., 1997. The pearly mussels (Bivalvia: Unionoida) of New York State. Memoirs of the New York State Museum: + 27 plates., 26: 1–113.

Animal Biodiversity and Conservation 33.2 (2010)

185

Appendix. (Cont.)

Strayer, D. L. & Ralley, J., 1993. Microhabitat use by an assemblage of stream–dwelling unionaceans (Bivalvia), including two rare species of Alasmidonta. Journal of North American Benthological Society, 12: 247–258.

Strayer, D. L. & Smith, L. C., 1996. Relationships between zebra mussels (Dreissena polymorpha) and unionid clams during the early stages of the zebra mussel invasion of the Hudson River. Freshwater Biology, 36: 101–108.

Strayer, D. L., Sprague, S. J. & Claypool, S., 1996. A range wide assessment of populations of Alasmidonta heterodon, an endangered freshwater mussel (Bivalvia: Unionidae). Journal of the North American Benthological Society, 15: 308–317.

Sylvester, J. R., Holland, L. E. & Kammer, T. K., 1984. Observations on burrowing rates and comments on host specificity in the endangered mussel Lampsilis higginsi. Journal of Freshwater Ecology, 2: 555–560.

Taylor, R. W., 1989. Changes in freshwater mussel populations of the Ohio River: 1000 BP to recent times. Ohio Journal of Science, 89: 188–191.

Tevesz, M. J. S. & Redmond, B. G., 2002. Changes in the freshwater mussel (Mollusca: Bivalvia) fauna of the Cuyahoga River, Ohio, since late prehistory. Kirtlandia, 53: 13–18.

Theler, J. L., 1987a. Prehistoric freshwater mussel assemblages of the Mississippi River in southwestern Wisconsin. The Nautilus, 101: 143–150.

– 1987b. The prehistoric freshwater mussels (Naiades) from Brogley Roskshelter in Southwestern Wisconsin. American Malacological Bulletin, 5: 165–171.

Thiel, P. A., 1981. A survey of Unionid mussels in the Upper Mississippi River (Pools 3–11). Technical Bulletin No. 124, Dept of Natural Resources, 124: 1–23.

Tyrrell, M. & Hornbach, D. J., 1998. Selective predation by muskrats on freshwater mussels in 2 Minnesota rivers. Journal of the North American Benthological Society, 17: 301–310.

Vannote, R. L. & Minshall, G. W., 1982. Fluvial processes and local litology controlling abundance, structure, and composition of mussel beds. Proceedings of the National Academy of Sciences of the United States of America, 79: 4103–4107.

Vaughn, C. C., 1993. Can biogeographic modes be used to predict the persistence of mussel populations in rivers? Conservation and management of freshwater mussels: Proceedings of a UMRCC symposium: 117–122.

– 1997. Catastrophic decline of the mussel fauna of the Blue River, Oklahoma. The Southwestern Naturalist, 4, 333–336.

Vaughn, C. C. & Pyron, M., 1995. Arkansia wheeleri (Bivalvia: Unionidae), in the Kiamichi River, Oklahoma. Anmerican Malacological Bulletin, 11: 145–151.

Vaughn, C. C. & Taylor, C. M., 1999. Impoundments and the decline of freshwater mussels: a case study of an extinction gradient. Conservation Biology, 13: 912–920.

Waller, D. L., Rach, J. J. & Luoma, J. A., 1998. Acute toxicity and accumulation of the piscicide 3 trifluoromethyl–4–nitrophenol (TFM) in freshwater mussels (Bivalvia: Unionidae). Ecotoxicology, 7: 113–121.

Watters, G. T., 1992. Unionids, fishes, and the species–area curve. Journal of Biogeography, 19: 481–490.

Way, C. M., Miller, A. C. & Payne, B. S., 1989. The influence of physical factors on the distribution and abundance of freshwater mussels (Bivalvia: Unionidae) in the Lower Tennessee River. The Nautilus, 103: 96–98.

Weinstein, J. E., 2002. Photoperiod effects on the UV induced toxicity of fluoranthene to freshwater mussel glochidia: Absence of repair during dark periods. Aquatic Toxicology Amsterdam, 59: 153–161.

Williams, J. D., Fuller, S. L. H. & Grace, R., 1992. Effects of Impoundments on freshwater mussels (Mollusca: Bivalvia: Unionidae) in the main channel of the Black Warrior and Tombigbee Rivers in western Alabama. Bulletin Alabama Museum of Natural History, 13: 1–10.

Williams, J. D., Warren, M. L., Cummings, K. S., Harris, J. L. & Neves, R. J., 1993. Conservation status of freshwater mussels of the United States and Canada. Fisheries, 18: 6–22.

Yokley, P., 1976. The effect of gravel dredging on mussel production. Bulletin of the American Malacological Union: 20–22.

Zanatta, D. T., Mackie, G. L., Metcalfe–Smith, J. L. & Woolnough, D. A., 2002. A refuge for native freshwater mussels (Bivalvia: Unionidae) from impacts of the exotic zebra mussel (Dreissena polymorpha) in Lake St. Clair. Journal of Great Lakes Research, 28: 479–489.

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Animal Biodiversity and Conservation 33.2 (2010)

187

Genetic analysis on three South Indian sympatric hipposiderid bats (Chiroptera, Hipposideridae) C. Kanagaraj, G. Marimuthu & K. Emmanuvel Rajan

Kanagaraj, C., Marimuthu, G. & Emmanuvel Rajan, K., 2010. Genetic analysis on three South Indian sympatric hipposiderid bats (Chiroptera, Hipposideridae). Animal Biodiversity and Conservation, 33.2: 187–194.

Abstract Genetic analysis on three South Indian sympatric hipposiderid bats (Chiroptera, Hipposideridae).— In mitochondrial DNA, variations in the sequence of 16S rRNA region were analyzed to infer the genetic relationship and population history of three sympatric hipposiderid bats, Hipposideros speoris, H. fulvus and H. ater.

Based on the DNA sequence data, we observed relatively lower haplotype and higher nucleotide diversity in H. speoris than in the other two species. The pairwise comparisons of the genetic divergence inferred a genetic relationship between the three hipposiderid bats. We used haplotype sequences to construct a phylogenetic tree. Maximum parsimony and Bayesian inference analysis generated a tree with similar topology. H. fulvus and H. ater formed one cluster and H. speoris formed another cluster. Analysis of the demographic history of populations using Jajima’s D test revealed past changes in populations. Comparison of the observed distribution of pairwise differences in the nucleotides with expected sudden expansion model accepts for H. fulvus and H. ater but not for H. speoris populations.

Key words: Chiroptera, Hipposideros, mtDNA, 16S rRNA, Phylogeny.

Resumen Análisis genético de tres murciélagos hiposidéridos (Chiroptera, Hipposideridae) simpátricos del sur de la India.— Se analizaron las variaciones en las secuencias de la región del ARNr 16S del ADN mitocondrial, con el fin de deducir la relación genética y la historia de la población de tres murciélagos hiposidéridos simpátricos: Hipposideros speoris, H. fulvus e H. ater. Basándonos en los datos de las secuencias del ADN, observamos una diversidad de nucleótidos mayor y una diversidad haplotípica relativamente menor en H. speoris que en las otras dos especies. Las comparaciones por pares de la divergencia genética dio como resultado una relación genética entre los tres murciélagos hiposidéridos. Utilizamos las secuencias haplotípicas para construir un árbol filogenético. Los análisis de inferencia bayesiana y de máxima parsimonia dieron lugar a un árbol con una topología similar. H. fulvus e H. ater formaban un conglomerado, y H. speoris formaba otro conglomerado. El análisis de la historia demográfica de las poblaciones, utilizando el test D de Jajima, puso de manifiesto cambios de población sucedidos en el pasado. La comparación de la distribución observada de las diferencias de nucleótidos por pares con el modelo previsto de expansión súbita se acepta para las poblaciones de H. fulvus e H. ater, pero no así para las de H. speoris.

Palabras clave: Chiroptera, Hipposideros, ADNm, ARNr 16S, Filogenia.

(Received: 12 I 10; Conditional acceptance: 4 III 10; Final acceptance: 10 VI 10) C. Kanagaraj, Dept. of Animal Science, School of Life Sciences, Bharathidasan Univ., Tiruchirappalli 620 024 (India).– G. Marimuthu, Dept. of Animal Behaviour and Physiology, School of Biological Sciences, Madurai Kamaraj Univ., Madurai 625 021 (India).– Koilmani Emmanuvel Rajan, Dept. of Animal Science, School of Life Sciences, Bharathidasan Univ., Tiruchirappalli 620 024 (India).

Corresponding author: K. Emmanuvel Rajan. E–mail: emmanuvel1972@yahoo.com

ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

188

Introduction Recent advances in molecular methods have added new insights into studies related to organismic evolution and have revealed unexpected levels of diversity in many vertebrate groups (Meyer et al., 1990; Roca et al., 2001). In many such studies, current patterns of genetic variation are used to infer historical events such as population expansions, past population selection from refugia and evolutionary relationship (Miller & Waits, 2003; Johnson & Dunn, 2006; Hoffmann et al., 2008). Comparing genetic structure among co–distributed species may provide significant insight to the extent to which extrinsic and intrinsic factors interact to influence the scale of population differentiation or speciation event (Arbogast & Kenagy, 2001).

It is complicated to determine the exact identity of species that occupy a similar ecological niche and have very close morphological characters. Traditional morphological groupings have recently been questioned based on molecular data (Mayer & Von Helversen, 2001). Similarly, within well–studied genera, morphologically cryptic and genetically divergent species have been identified (Von Helversen et al., 2001; Thabah et al., 2006). In many regions, bats rank among the most rare and least known mammals due to very low local abundance of several species and their way of life (Hulva et al., 2004). Recent studies on molecular systematics of Chiroptera have unfolded the level of diversity in many species (Teeling et al., 2000; Campbell et al., 2004). However, many interspecific phylogenetic relationships remain poorly characterized, particularly in tropical regions where the diversity of bats is relatively high (Jones et al., 2002). Hence, it suggests that diversity within the order Chiroptera may be underestimated by the current taxonomy. Based on craniodental, postcranial morphology and other morphometric characters, the family Hipposideridae is systematically classified with 65 species, which mainly inhabit tropical and subtropical regions (Hill et al., 1986; Flannery & Colgan, 1993; Wang et al., 2003). Twelve of these species are found in India (Bates & Harrison, 1997). Species boundaries within Hipposideridae have been revised several times based on the cranial, morphological and acoustic characteristics, mtDNA and nuclear DNA data (Kingston et al., 2001; Thabah et al., 2006).

The hipposiderid bats Hipposideros speoris, H. fulvus and H. ater are non–migratory and they have a low natal dispersal system. H. speoris is the largest of the three [forearm length (FAL) 50–54 mm, body weight (BW) 8.5–12.0 g, constant frequency (CF) ca.

135 kHz] and it shares its day roost with H. fulvus (FAL 38–44 mm, BW 7–9 g, CF = ca. 157 kHz). The two species also share common foraging grounds, such as very close to the canopy, around bushes and trees, and very close to obstacles, but their foraging strategies are different (Habersetzer et al., 1984; Neuweiler et al., 1984). H ater (FAL 35–38 mm, BW 5–7 g, CF ca. 166 kHz) is smaller but superficially similar to H. fulvus. However, it does not share day roost with the other two species (Jones et al., 1994).

Studies on the genetic variation and the genetic re-

Kanagaraj et al.

lationship of closely related species provide insights into their evolutionary history (Avise, 2004) as well as important information on biodiversity (Hedrick, 2004).

We surveyed H. speoris and H. fulvus populations in southern India and found these two species lived together in the same habitat. For example, they occupied a cave close to the Madurai Kamaraj University campus. However, there was a clear spatial partition in their roosting area (G. Marimuthu, personal observations), H. ater usually occupied a separate roost. The present study aimed to address the phylogenetic relationship and genetic diversity of these three sympatric species.

Materials and methods Samples The study was carried out between June 2006 and February 2007. Using a nylon mosquito net we captured H. speoris and H. fulvus on their predawn return flight into a cave in the Pannian hills (10º 50' N, 78º 43' E), about 10 km northwest of the Madurai Kamaraj University campus. H. ater was captured using the same method in an unused building in as the village of Puliyankudi (9º 18' N, 77º 40' E), about 80 km south of Madurai city. Rhinolophus beddomei was also captured using a similar method in a cave in the High Wavy mountains (9.49º 52' N, 77.22º 58' E), about 60 km west of Madurai city. All four species were identified based on their morphological characters (Bates & Harrison, 1997). Thirty individuals representing each species of hipposiderids and one sample from the out group taxa (R. beddomei) were used in the present study. Tissue biopsies (3 mm diameter) were obtained from the wing membranes of bats and preserved in extraction buffer (100 mM Tris–Cl; 10 mM EDTA; 1.5 M NaCl; 1.0 % CTAB; 0.2% mercaptoethanol). The bats were released at their roosting sites soon after completion of the sample collection. All the procedures adopted in the study were approved by Bharathidasan University Wild Animals Ethical Committee (BUWAEC), Bharathidasan University, Tiruchirappalli, India.

Amplification of mtDNA 16S rRNA Total genomic DNA was extracted from the wing membrane samples following standard procedure (Sambrook et al., 1989). Approximately 600 bp of the 16S rRNA region from mtDNA was amplified with specific primer–light chain (L): TTACCAAAAACATCACCTCTAGC; heavy chain (H): CGGTCTGAACTCAGAT CACGTA (Lin et al., 2002). A portion of the 16S rRNA region was amplified in 50 μL reaction mixture that contained 1 unit of Pfu DNA polymerase (Invitrogen Inc, USA), 1.5 mM Mg2+, 0.2 μM of primers, 200 μM of each dNTP, and 20 ng template DNA. Amplifications were performed in a MJ–mini thermal cycler (Bio–Rad, CA, USA) by employing an initial denaturation (95ºC, 1 min), followed by 25 cycles of denaturation (94ºC, 1 min), annealing (56ºC, 1.5 min), and extension

Animal Biodiversity and Conservation 33.2 (2010)

(72ºC, 2 min) and a final extension at 72ºC for 5 min.

Amplicons were excised from agarose gel, purified with spin column (RBC gel elution kit, Taiwan), and sequenced with L primer (MWG, India).

Phylogenetic analysis All the obtained sequences were initially aligned with Clustal X software (Thompson et al., 1997) prior to further analysis. Genetic distances were calculated according to Kimura 2–parameter method in MEGA 4.0 (Tamura et al., 2007). Mitochondrial 16S rRNA haplotype sequence data set was used for the Maximum parsimony (MP) and Bayesian analyses. Based on the MP, we constructed phylogenetic relationships by using the programs MEGA 4.0 (Tamura et al., 2007), and Bayesian inferences implemented in MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003). The MP branch support was assessed by bootstrap analysis (1,000 BS replicates). In order to find the best–fitting substation model for each data set, Model Test (3.06) was used to test the likelihood ratio (Posada & Crandall, 1998).

Bayesian analysis was performed under the selected General Time–Reversible (GTR + I + G) model (Rodriguez et al., 1990) of nucleotide substitution parameters, which were estimated during the course of the run at the rate matrix: A–C = 2.99, A–G = 4.32, A–T = 1.94, C–G = 3.08, C–T = 8.57 and G–T = 1.0; nucleotide base frequencies A = 0.311, C = 0.235, G = 0.208 and T = 0.244; transition/transversion ratio = 3.128. We ran six Markov Chain Monte Carlo (MCMC) chains for 200,000 generations with trees sampled for every 100 generations. The first 30% of the sampled trees were discarded and Bayesian posterior probabilities (BPP) were estimated from the 50% majority–rule consensus tree of the retained trees.

Genetic diversity and population structure Mitochondrial haplotype diversity (h) and nucleotide diversity (π) were used to calculate the levels of mtDNA diversity by using DNASP 4.5.0 (Rozas et al., 2003).

First, the neutrality test (Tajima D) was carried out for the three species to test the population expansion hypothesis (Tajima, 1989). Afterwards, we used various methods, each with a particular sensitivity to one demographic scenario. Fu’s Fs is sensitive to excess of recent mutations, which is a pattern typical for both demographic expansion and a selective sweep (Fu, 1997). In contrast, Fu and Li’s D* are designed to detect an excess of old mutations, a characteristic of population that has experienced a historical reduction in effective population size (Fu & Li, 1993). In addition, we tested the goodness–of–fit of distributions under a model of population expansion by calculating the sum of squared deviations (SSD), which was used in other non–migratory bats (Chen et al., 2006) with ARLEQUIN 3.11 (Excoffier et al., 2005). Past events of population such as demographic expansion and contractions were also tested, using the evolution model of departure from neutral (Ramos–Onsins & Rozas, 2002), which is implemented in DNASP 4.5.0 (Rozas et al., 2003).

189

Results Phylogenetic relationships The partial sequences of 16S rRNA gene of H. speoris, H. fulvus and H. ater were aligned, and 484 bp data set was considered for phylogenetic analysis. Parsimony analysis showed that 411 of 484 siteswere constant, 46 were variable and parsimony informative, and 27 (5.6%) were variable but parsimony uninformative.

We found 24 distinct haplotypes and their sequences, deposited in GenBank, are available with the following accession number; H. speoris (FJ747652–656, FJ825630–631), H. fulvus (FJ 747658–666), H. ater (FJ747667–674) and R. beddomei (FJ009217).

We obtained the six most parsimonious trees with 123 steps, consistency index (CI = 0.84); retention index (RI = 0.96) and composite index (CI = 0.88).

Bayesian inference analysis generated a tree with 1 n L = –1375.97 (relative rate parameters estimated for this model was proportion of invariant site, I = 0.025; gamma shape, α = 1.271). The Maximum parsimony and Bayesian analysis generated tree showed a similar pattern (fig. 1A, 1B). Phylogenetic trees rooted with R. beddomei showed basal position of H. speoris with respect to H. fulvus and H. ater. Tree topology was not sensitive to transition to down–weighting or differential treatment of gap characters. The genetic relationship between H. fulvus and H. ater was supported by both models.

Population genetic structure Analysis revealed similar haplotype and high nucleotide diversity with 21 polymorphic sites in H. speoris populations than H. fulvus and H. ater populations (table 1). The neutrality test (Tajima D test) showed negative value for H. speoris, H. fulvus and H. ater populations, which suggests possible occurrence of changes in population (e.g. expanding or linkage to a locus under directional selections). Fu’s Fs test detected significant departure from the neutral/equilibrium expectation, whereas Fu and Li’s D* demonstrate nonsignificant, implicating demographic expansion in H. speoris population (table 1). While the mismatch distribution (fig. 2A) was not unimodal, the accumulations of low–frequency mutations were the characteristics of non–equilibrium population dynamics. Comparison of the observed distribution of pairwise differences with that expected under a population expansion hypothesis did not accept the sudden expansion model for H. speoris. The observed mismatch distribution of H. fulvus supports the long–term demographic equilibrium (fig. 2B). However, a significant value for Fu’s Fs, but not for Fu and Li’s D* suggests an expansion in H. fulvus. We found strong support for demographic expansion in H. ater also. The smooth unimodal shape of mismatch distribution provided a good visual fit with expectation of the sudden expansion model for H. ater (fig. 2C). Likewise, a highly significant value of Fu’s Fs and a nonsignificant value of Fu and Li’s D* supported demographic expansion (table 1). The obtained non–significant pairwise difference value from

190

Kanagaraj et al.

A Hfu1 52 Hfu2 Hfu4 Hfu9 71 Hfu8 Hfu5 Hfu6 Hfu3 98 Hfu7 Hat8 Hat4 Hat5 Hat6 Hat1 98 Hat2 Hat3 Hat7 Hsp5 67 Hsp3 Hsp2 Hsp6 99 Hsp7 Hsp1 67 73 Hsp4 Rbe

B

Hfu9 Hfu4 Hfu2 Hfu1 Hfu5 Hfu8 Hfu6 Hfu7 Hfu3 Hat6 Hat7 Hat4 Hat5 Hat3 Hat1 Hat8 Hat2 Hsp1 Hsp4 Hsp7 Hsp6 Hsp2 Hsp3 Hsp5 Rbe

67 92

70 81

100

100

94

100 97

Fig. 1. Phylogenetic relationship between the sympatric hipposiderid bats H. speoris (Hsp), H. fulvus (Hfu), H. ater (Hat) and an out group, R. beddomei (Rbe), based on the haplotype sequences of 16S rRNA: A. Maximum parsimony tree, numbers at the nodes indicate bootstrap support as percent; B. Bayesian likelihood tree for the sympatric hipposiderid bats, the tree was created using the GTR + I + G model of DNA evolution.

Fig. 1. Relación filogenética entre los murciélagos hiposidéridos simpátricos H. speoris (Hsp), H. fulvus (Hfu), H. ater (Hat) y un fuera del grupo, R. beddomei (Rbe), basada en las secuencias haplotípicas del ARNr 16S: A. Árbol de máxima parsimonia, las cifras de los nodos indican el apoyo "bootstrap" en porcentajes; B. Árbol de verosimilitud bayesiano para los murciélagos hiposidéridos simpátricos, este árbol se creó utilizando el modelo GTR + I + G de la evolución del ADN.

Table 1. Mitochondrial DNAs 16S rRNA sequence divergence parameters for three sympatric hipposiderid bats.

Tabla 1. Parámetros de divergencia de las secuencias de ARNr 16S de los ADNs mitocondriales de tres especies simpátricas de murciélagos hiposidéridos.

H. speoris

H. fulvus

Number of variable site

21

16

H. ater 6

Haplotype diversity (h)

0.911 (SD = 0.077)

0.978 (SD = 0.054)

0.956 (SD = 0.0059)

Nucleotide diversity (π)

0.01 (SD = 0.006)

0.008 (SD = 0.002)

0.004 (SD = 0.0049)

Tajma D test

–1.44030

–1.24610

–1.05965

Fu & Li’s D*

–1.65755 (P = 0.08)

–1.39100 (P = 0.10)

–0.8344 (P = 0.5)

Fu’s Fs

–0.664 (P = 0.002)

–4.258 (P < 0.001)

–4.819 (P < 0.001)

0.016

0.540

0.51

PSSD

Animal Biodiversity and Conservation 33.2 (2010)

A

191

0,25

Observed Expected

Frequency

0,20 0,15 0,10 0,05 0 0

B

2

4

6 8 10 12 Pairwise differences

14

Frequency

0,20

Observed Expected

0,15 0,10 0,05 0

0

5

C

10 15 20 Pairwise differences

25 Observed Expected

0,5 Frequency

16

0,4 0,3 0,2 0,1

0

0

5

10 15 20 Pairwise differences

25

30

Fig. 2. Distribution of the number of pairwise nucleotide differences between H. speoris (A), H. fulvus (B) and H. ater (C), based on 484 bp of 16S rRNA sequences. Solid lines represent the observed data, dashed lines represent the line fitted to the data under the expectations of the sudden expansion model, based on 1,000 simulated samples.

Fig. 2. Distribución del número de diferencias de nucleótidos por pares entre H. speoris (A), H. fulvus (B) y H. ater (C), basada en 484 pares de bases de secuencias del ARNr 16S. Las líneas continuas representan los datos observados, y las líneas de puntos representan las líneas que concuerdan con los datos de las expectativas de un modelo de expansión súbita, basado en mil muestras simuladas.

H. ater population provides additional support to the expansion hypothesis. Over all, the observed mismatch distribution for H. speoris and H. fulvus populations was multimodal, and did not confirm the expectations

of historically stable populations. The estimated genetic distances within H. speoris and H. ater were 1.5% and 0.5%, respectively. The comparison between H. speoris and H. ater was 10.1% and between H. ater

192

Kanagaraj et al.

Table 2. Measures of within (on diagonal bold) and between groups (below diagonal) genetic distances based on 484 bp of partial 16S rRNA sequences. The presence of n/c in the results denotes cases in which it was not possible to estimate evolutionary distance.

Tabla 2. Medidas dentro de los grupos (en diagonal, en negrita) y entre grupos (por debajo de la diagonal) de las distancias genéticas, en base a secuencias parciales de ARNr 16S de 484 pares de bases. La presencia de n/c en los resultados se debe a la existencia de un caso en el que no fue posible estimar la distancia evolutiva.

H. speoris

H. fulvus

H. ater

H. speoris

0.015

H. fulvus

0.092

0.010

H. ater

0.101

0.036

0.005

R. beddomei

0.149

0.128

0.146

and H. fulvus it was 3.6%, which is lower than other comparisons in the present analysis (table 2).

Discussion The mechanism for diversification in bats remains unclear. Reports from both population genetic analysis (Burland & Wilmer, 2001) and studies combining molecular and phenotypic data (Barratt et al., 1997; Kingston et al., 2001) suggest that ecological changes may promote intraspecific divergence. The genus Hipposideros is primarily classified into three groups, with seven species in each group (Hill, 1962). Based on previous studies (Giannini & Simmons, 2003; Pestano et al., 2003), we used the 16S rRNA sequence data set to investigate the phylogenetic relationship and genetic diversity of three sympatric hipposiderid bats.

Maximum parsimony and Bayesian inference analysis produce phylogenetic trees with similar topology. The relationship between H. fulvus and H. ater was strongly supported by each tree. These two species are more closely related to each other than to H. speoris. Both maximum parsimony and Bayesian analysis with high boot strap and statistical analysis support an early divergence between H. speoris and the other two species. Based on kimura 2–parameter distance model in–group variation for 16S rRNA ranges from 0–7.9%. The observed variations for the three species fall in the same range. A study on the foraging behaviour of H. speoris and H. fulvus showed that they preferred to forage in a similar area with fine structural difference (Neuweiler et al., 1984). The distribution of species specific call frequencies with marginal overlap between the three hipposiderids is attributed to interspecific resource partitioning (Jones et al., 1994) with preference to different sized prey.

Changes in sizes of populations leave particular foot prints that can eventually be detected in their DNA sequences (Tajima, 1989; Slatkin & Hudson, 1991;

R. beddomei

n/c

Rogers & Harpending, 1992). Haplotype diversity within a species leads to the stochastic process of lineage extinction with a long demographic history (Campbell et al., 2006). The observed changes in H. speoris population based on the Tajima’s neutrality test (D) may possibly be due to accumulation of low frequency mutations (Hall, 2004). Alternatively, the generated negative Tajima’s D value in the neutrality test explains the possibility of population expansion by its recent growth (Campbell et al., 2006).

Non–equilibrium and unstable demographic status of H. speoris population may possibly be due to its co–distribution and habitat association with H. fulvus.

Similar demographic expansion was observed in the co–distributed megachiropteran species of Cynopterus (Campbell et al., 2006).

Our observations of non–significant value in goodness–of–fit distribution for H. fulvus and H. ater suggest that population expansion occurred recently (Rogers, 1995). Frequency distribution of pairwise difference shows a smooth or bell–shaped model that is due to the descent of alleles from one or few ancestral types (Rogers & Harpending, 1992). However, the negative and significant Fu’s Fs statistical value observed in H. fulvus and H. ater populations provide strong evidence for past population expansion, and rule out the possibility of genetic hitching and background selection, and evolutionary force that produce a pattern similar to population expansion (Fu & Li, 1993; Fu, 1997; Okello et al., 2005). Beneficial genetic variation will generally be accumulated and maintained in a rapidly growing population (Su et al., 2001).

Our study appears to be the first report on the phylogenetic relationships and genetic diversity of the three sympatric hipposiderid bats. It is well known that H. speoris and H. fulvus share their day roost as well as foraging area (Neuweiler, 1990). Although, H. ater lives in the same area, it does not share day roost with them (G. Marimuthu and K. Emmanuvel Rajan, personal observations). As the details of the foraging strategy of

Animal Biodiversity and Conservation 33.2 (2010)

H. ater are still unknown, a study on this aspect would possibly provide valuable information to further update the relationships between the three hipposiderids.

Acknowledgements The project was financially supported by the Department of Science and Technology, Government of India, through SERC FAST Track programme to KER. We thank UGC–SAP for supporting the Department of Animal Science instrumentation facility. Additonal support was obtained from the MKU–UGC–CAS Programme.

References Arbogast, B. S. & Kenagy, G. J., 2001. Comparative phylogeography as an integrative approach to historical biogeography. Journal of Biogeography, 28: 819–825.

Avise, J. C., 2004. Molecular Markers, Natural History, and Evolution. Sinauer associates, Sunderland, Massachusetts.

Barratt, E. M., Deaville, R., Burland, T. M., Bruford, M. W., Jones, G., Racey, P. A. & Wayne, R. K., 1997. DNA answers the call of pipistrelle bat species. Nature, 387: 138–139.

Bates, P. J. J. & Harrison, D. L., 1997. Bats of the Indian Subcontinent. Harrison Zoological Museum Publication, England.

Burland, T. M. & Wilmer, J. W., 2001. Seeing in the dark: molecular approaches to the of bat populations. Biological Reviews, 76: 389–409.

Campbell, P., Schneider, C. J., Adnan, A. M., Zubaid, A. & Kunz, T. H., 2004. Phylogeny and Phylogeography of Old World fruit bats in the Cynopterus brachyotis complex. Molecular Phylogenetics and Evolution, 33: 764–781.

– 2006. Comparative population structure of Cynopterus fruit bats in peninsular Malaysia and Southern Thailand. Molecular Ecology, 15: 29–47.

Chen, S., Rossiter, S. J., Faulkes, C. G. & Jones, G., 2006. Population genetic structure and demographic history of the endomic Formosan lesser horseshoe bat (Rhinolophus monoceros). Molecular Ecology, 15: 1643–1656.

Excoffier, L., Laval, G. & Schneider, S., 2005. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1: 47–50.

Flannery, T. F. & Colgan, D. J., 1993. A new species and two new subspecies of Hipposideros (Chiroptera) from western Papua New Guinea. Records of the Australian Museum, 45: 43–57.

Fu, Y. X., 1997. Statistical tests of neutrality against population growth, hitchhiking and background selection. Genetics, 147: 915–925.

Fu, Y. X. & Li, W. H., 1993. Statistical tests of neutral mutations. 1993. Genetics, 133: 693–709.

Giannini, N. P. & Simmons, N. B., 2003. A phylogeny of megachiropteran bats (Mammalia: Chiroptera: Pteropodidae) based on direct optimization analy-

193

sis of one nuclear and four mitochondrial gens.

Cladistics, 19: 496–511.

Habersetzer, J., Schuller, G. & Neuweiler, G., 1984.

Foraging behavior and Doppler shift compensation in echolocation hipposiderid bats, Hipposideros bicolor and Hipposideros speoris. Journal of Comparative Physiology A, 155: 559–567.

Hall, B. G., 2004. Phylogenetic trees made easy. A how–to manual. Sinauer Associates, Sunderland, Massachusetts.

Hedrick, P. W., 2004. Recent developments in conservation genetics. Forest Ecology and Management, 197: 3–19.

Hill, J. E., 1962. A revision of the genus Hipposideros.

Bulletin of the British Museum of Natural History, 11: 1–129.

Hill, J. E., Zubid, A. & Davison, G. W. H., 1986. The taxonomy of leaf–nosed bats of the Hipposideros bicolor group (Chiroptera: Hipposideridae) from Southeast Asia. Mammalia, 50: 535–540.

Hoffmann, F. G., Hoofer, R. S. & Baker, R. J., 2008.

Molecular dating of the diversification of Phyllostominae bats based on nuclear and mitochondrial DNA sequences. Molecular Phylogenetics and Evolution, 49: 653–658.

Hulva, P., Horácek, I., Strelkov, P. P. & Benda, P., 2004. Molecular architecture of Pipistrellus pipistrellus/Pipistrellus pygmaeus complex (Chiroptera: Vespertilionidae): further cryptic species and Mediterranean origin of the divergence. Molecular Phylogenetics and Evolution, 32: 1023–1035.

Johnson, J. A. & Dunn, P. O., 2006. Low genetic variation in the heathen prior to extinction and implications for the conservation of prairie – chicken populations. Conservation Genetics, 7: 37–48.

Jones, K. E., Purvis, A., MacLarnon, A., Bininda– Emonds, O. R. P. & Simmons, N. B., 2002. A phylogenetic supertree of the bats (Mammalia: Chiroptera). Biological Reviews, 77: 223–259.

Jones, G., Sripathi, K., Waters, D. A. & Marimuthu, G., 1994. Individual variation in the echolocation calls of three sympatric Indian hipposiderid bats, and an experimental attempt to jam bat echolocation.

Folia Zoologica, 43: 347–362.

Kingston, T., Lara, M. C., Jones, G., Akbar, Z., Kunz, T. H. & Schneider, C. J., 2001. Acoustic divergence in two cryptic Hipposideros species: a role for social selection. Proceedings of the Royal Society B: Biological Sciences, 268: 1381–1386.

Mayer, F. & Von Helversen, O., 2001. Sympatric distribution of two cryptic bat species across Europe. Biological Journal of the Linnean Society, 74: 365–374.

Meyer, A., Kocher, T. D., Asibwaki, P. & Wilson, A. C., 1990. Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences.

Nature, 347: 550–553.

Miller, C. R. & Waits, L. P., 2003. The history of effective population size and genetic diversity in the yellowstone grizzly (Ursus arctos): implications for conservation. Proceedings of the National Academy of Sciences of the United States of America, 100: 4334–4339.

194

Neuweiler, G., 1990. Auditory adaptations for prey capture in echolocating bats. Physiological Reviews, 70: 615–641.

Neuweiler, G., Singh, S. & Sripathi, K., 1984. Audiograms of a South Indian bat community. Journal of Comparative Physiology A, 154: 133–142.

Okello, J. B., Nyakana, S., Masembe, C., Siegismund, H. R. & Arctander, P., 2005. Mitochondrial DNA variation of the common hippopotamus: evidence for a recent population expansion. Heredity, 95: 206–215.

Pestano, J., Brown, R. P., Suárez, N. M. & Fajardo, S., 2003. Phylogeography of pipistrelle–like bats within the Canary Islands, based on mtDNA sequences.

Molecular Phylogeny Evolution, 26: 56–63.

Posada, D. & Crandall, K. A., 1998. MODEL TEST: testing the model of DNA substitution. Bioinformatics, 14: 817–818.

Ramos–Onsins, S. E. & Rozas, J., 2002. Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution, 19: 2092–2100.

Roca, A. L., Georgiadis, N., Pecon–slattery, J. & O’Brien, S. J., 2001. Genetic evidence for two species of elephant in Africa. Science, 293: 1473–1477.

Rodriguez, F, Oliver, J. F., Marin, A. & Medina, J. R., 1990. The general stochastic model of nucleotide substitutions. Journal of Theoretical Biology, 142: 485–501.

Rogers, A. R., 1995. Genetic evidence for a Pleistocene population explosion. Evolution, 49: 608–615.

Rogers, A. R. & Harpending, H., 1992. Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9: 552–569.

Ronquist, F. & Huelsenbeck, J. P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572–1574.

Rozas, J., Sanchez–DelBarrio, J. C., Messeguer, X. & Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods.

Bioinformatics, 19: 2496–249.

Sambrook, J., Fritsch, E. F. & Maniatis, T., 1989. Molecular cloning: A Laboratory Manual. Cold Spring Harbor

Kanagaraj et al.

Laboratory, Cold Spring Harbor Press, New York.

Slatkin, M. & Hudson, R. R., 1991. Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics, 129: 555–562.

Su, B., Fu, Y., Wang, Y., Jin, L. & Chakraborty, R., 2001. Genetic diversity and population history in Red panda (Ailurus fulgens) as inferred from mitochondrial DNA sequence variations. Molecular Biology and Evolution, 18: 1070–1076.

Tajima, F., 1989. Statistical method for testing the neutral mutational hypothesis by DNA polymorphism. Genetics, 123: 585–595.

Tamura, K., Dudley, J., Kumar, S., Nei, M. & Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 8: 1596–1599.

Teeling, E. C., Scally, M., Kao, D. J., Romagnolli, M. L., Springer, M. S. & Stanhope, M. J., 2000. Molecular evidence regarding the origin of echolocation and flight in bats. Nature, 403: 188–192.

Thabah, A., Rossiter, S. J., Kingston, T., Zhang, S., Parsons, S., Mya, K. M., Zubid, A. & Jones, G., 2006. Genetic divergence and echolocation call frequency in cryptic species of Hipposideros larvatus s.l. (Chiroptera: Hipposideridae) from the Indo– Malayan region. Biological Journal of the Linnean Society, 88: 119–130.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G., 1997. The ClustalX windows interface: flexible strategies of multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 24: 4876–4882.

Von Helversen, O., Heller, K. G., Mayer, F., Nemeth, A., Volleth, M. & Gombkoto, P., 2001. Cryptic mammalian species: a new species of whiskered bat (Myotis alcathoe n. sp.) in Europe. Naturwissenschaften, 88: 217–233.

Wang, H., Liang, B., Feng, J., Sheng, L. & Shang, S., 2003. Molelcular phylogenetics of hipposiderids (Chiroptera: Hipposideridae) and rhinolophids (Chiroptera: Rhinolophidae) in China based on mitochondrial cytochrome b sequence. Folia Zoologica, 52: 259–268.

Animal Biodiversity and Conservation 33.2 (2010)

195

Bryconamericus macarenae n. sp.

(Characiformes, Characidae) from the Güejar River, Macarena mountain range, Colombia C. Román–Valencia, C. García–Alzate, R. I. Ruiz–C. & D. C. Taphorn B.

Román–Valencia, C., García–Alzate, C., Ruiz–C., R. I. & Taphorn B., D. C., 2010. Bryconamericus macarenae n. sp. (Characiformes, Characidae) from the Güejar River, Macarena mountain range, Colombia. Animal Biodiversity and Conservation, 33.2: 195–203.

Abstract Bryconamericus macarenae n. sp. (Characiformes, Characidae) from the Güejar River, Macarena mountain range, Colombia.— Based on 174 specimens, using morphometric, meristic and osteological characters, we describe a new species: Bryconamericus macarenae from the Güejar River in La Macarena mountain range, Orinoco Basin, Colombia. It differs from congeners in having: an incomplete lateral line (vs. complete lateral line in all except B. delta) and fewer and less conspicuous perforations in the latero–sensorial canal of the extrascapular bone (vs. conspicuous latero–sensorial canal perforation). It has four or fewer unbranched analfin rays (vs. five or more unbranched anal–fin rays), a short, thickened extrascapular bone without projections from the posterior margin, or with only a reduced apophysis (vs. extrascapular long, irregular, bony projections on its margins, and with a large undulated apophysis on its posterior margin). It also differs in live coloration.

A key of species of Bryconamericus known from the Orinoco Basin and the Catatumbo River is included.

Key words: Bryconamericus macarenae n. sp., Tropical, River, Freshwater, Osteology, Teeth.

Resumen Bryconamericus macarenae sp. n. (Characiformes, Characidae) del río Güejar, sierra de La Macarana, Colombia.— Basándonos en 174 especímenes y utilizando características morfométricas, merísticas y osteológicas describimos una nueva especie: Bryconamericus macarenae, del río Güejar en la cordillera de La Macarena, cuenca del Orinoco, Colombia. Difiere de sus congéneres por tener: la línea lateral incompleta (comparado con línea lateral completa en todos excepto B. delta) y un número menor de perforaciones, y menos conspicuas, en el canal laterosensorial del hueso extraescapular (comparado con una perforación del canal laterosensorial conspicua). Posee cuatro o menos radios no ramificados en las aletas anales (comparado con cinco o más radios no ramificados de las aletas anales), un hueso extraescapular corto y engrosado sin proyecciones desde su margen posterior, o únicamente con una pequeña apófisis (comparado con proyecciones óseas extraescapulares irregulares y largas en sus márgenes, y una gran apófisis ondulada en su margen posterior).

También difiere en su coloración en vivo. Se incluye una clave dicotómica de clasificación de las especies de Bryconamericus, pobladoras de la cuenca del Orinoco y del río Catatumbo.

Palabras clave: Bryconamericus macarenae sp. n., Tropical, Río, Agua dulce, Osteología, Dientes.

(Received: 23 XI 09; Conditional acceptance: 2 IV 10; Final acceptance: 14 VI 10) César Román–Valencia, Carlos García–Alzate, Raquel I. Ruiz–C., Univ. del Quindío, Lab. de Ictiología, A.A. 2639, Armenia, Quindío (Colombia).– Donald C. Taphorn B., 1822 North Charles Street, Belleville, IL 62221 USA. Corresponding author: C. Román–Valencia. E–mail: ceroman@uniquindio.edu.co

ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

196

Introduction Dahl (1960, 1961) gave an early overview of the La Macarena icthyofauna and described several new taxa based on the first modern ichthyological exploration of the region which took place in the 1950s. Myers & Weitzman (1960) described Brycon whitei, and Thomerson & Taphorn (1993) described Rivulus corpulentus from the same region. Useche et al. (1993) and Bernal Ramirez & Cala (1997) reported on aspects of the biology of Brycon siebenthalae and Mylossoma duriventre from a tributary of the Rio Guayabero. All these studies, however, were mainly concerned with fishes from the northwestern or southeastern portions of the La Macarena mountain range. Reports on the fishes of the Guapaya and Blanco rivers northeast of the Macarena mountains were lacking until the description of Creagrutus maculosus (Román–Valencia et al., 2010).

We recognize twenty–two Colombian species of Bryconamericus as valid (Román–Valencia, 1998, 2000, 2003a, 2003b, 2003c, 2005; Román–Valencia & Vanegas–Rios, 2009; Román–Valencia et al., 2008a, 20008b, 2009a, 2009b, Román–Valencia et al., submitted). Bryconamericus peruanus was shown to be erroneously recorded from Colombia (Román–Valencia et al., submitted). Five species are known from the Orinoco Basin and the adjacent Lake Maracaibo drainage in Colombia: B. alpha, B. cismontanus, B. cristiani, B. loisae, and B. meridae; the remaining 17 species of Bryconamericus are distributed among the rivers of the Pacific, Caribbean–Guajira, Cauca–Magdalena and Amazon drainages (Román–Valencia, 1998, 2003a, 2003b, 2005; Román–Valencia et al., 2008a, 2008b; Román–Valencia & Vanegas–Rios, 2009). The purpose of this paper is to describe a new species of Bryconamericus from near La Macarena mountain in Colombia.

Material and methods Measurements were taken with digital calipers, recorded to tenths of millimeters and expressed as percentages of standard or head length (table 1).

Counts were made using a stereo microscope with a dissection needle to extend the fins. Counts and measurements were taken from the left side of specimens when possible and in general they were taken according to guidelines in Vari & Siebert (1990). An asterisk indicates values for the holotype.

Osteology was studied using cleared and stained specimens (cs) prepared according to techniques outlined in Taylor & Van Dyke (1985) and Song & Parenti (1995); and fin counts were based on cleared and stained individuals due to unavailability of an x–ray facility.

Osteological nomenclature follows Weitzman (1962), Vari (1995), and Ruiz–C. & Román–Valencia (2006).

See Román–Valencia 2002, 2003a, 2003b, 2003c, 2005; Román–Valencia et al., 2008a, 2008b, 2009a, 2009b, 2009c for additional lists of comparative material examined of Bryconamericus.

Specimens are deposited in The Auburn University Museum Fish Collection, Auburn, Alabama (AUM);

Román–Valencia et al.

the Coleção de Peixes, Departamento de Zoologia e Botânica, Instituto de Biociencias, Letras e Ciências Exactas, Universidade Estadual Paulista–UNESP, Brasil (DZSJRP); the Ichthyology Laboratory at the Universidad del Quindío, Armenia, Colombia (IUQ); the Museum of Zoology, Department of Biological Sciences, Escuela Politécnica Nacional, Quito, Ecuador (MEPN); and the Collection of Ichthyology, Department of Biology, Pontificia Universidad Javeriana, Bogotá, Colombia (MPUJ). We use the abbreviation "m a.s.l." for meters above sea level.

The 21 morphometric characters analyzed in this study (table 1) were evaluated by principal component analysis (PCA) using the Burnaby method to eliminate the influence of size with the PAST program, session 1.81 for Windows (Hammer et. al., 2008).

Examined material Bryconamericus andresoi (see Román–Valencia, 2003c). B. alpha, B. arilepis, B. cismontanus, B. heteresthes, B. iheringi, B. lambari, B. lassorum, B. loisae, B. macrophthalmus, B. meridae, B. multiradiatus, B. orinocoense, B. orteguasae, B. pachacuti, B. pectinatus, B. phoenicopterus, B. plutarcoi, B. subtilisform, B. thomasi, B. tolimae, B. turiuba, B. yokiae and Bryconamericus sp. (see Román–Valencia et al., 2008b). B. bayano (see Román–Valencia, 2002). B. caucanus (see Román–Valencia et al., 2009b). B. cristiani (see Román–Valencia, 1998). B. dahli (see Román–Valencia, 2003a) MEPN 8–4074, 14, Ecuador, Esmeraldas, Pistolasa wetland, half hour downstream of Vargas Torres. MEPN 8–4074, 1 cs, 54.5 SL, Ecuador, Esmeraldas, Pistolasa wetland, half hour downstream of Vargas Torres. Bryconamericus delta, not B. gamma (see Román–Valencia, 2005, 2003a, 2003b; Román–Valencia et al., 2008b). B. emperador (see Román–Valencia, 2002). B. exodon: DZSJRP 9088, 3 cs, 28.2–34.6 SL. DZSJRP 9088, 12.

B. foncensis (see Román–Valencia, 2009a, 2009b). B. galvisi (see Román–Valencia, 2000). B. gonzalezoi (see paratypes, Román–Valencia, 2002). B. guaytarae (see Román–Valencia, 2003c). B. guizae (see Román–Valencia, 2003c). B. huilae (see Román–Valencia, 2003c).

B. ichoensis (see Román–Valencia, 2000). B. peruanus (see Román–Valencia et al., 2008b; Román–Valencia et al., 2009c). B. scleroparius (see Román–Valencia 2002; Román–Valencia et al., 2008b). B. singularis (see Román–Valencia et al., 2008a, 2008b). B. terrabensis (see Román–Valencia, 2002; Román–Valencia et al., 2008b). B. carlosi (see Román–Valencia, 2003b; Román–Valencia, 2008b). B. charalae (see Román–Valencia, 2005; Román –Valencia et al., 2008b. B. cinarucoense (see Román–Valencia et al., 2008a, 2008b).

B. cristiani Román–Valencia (see Román–Valencia, 1998). B. hypopterus (see Román–Valencia, 2003a).

B. terrabensis (see Román–Valencia, 2002) IUQ 874, 2 cs, 48.0–69.0 SL. IUQ 1586, 2cs, 45.0–48.3 SL. B. scleroparius: IUQ 370, IUQ 371, IUQ 372, IUQ 373, IUQ 374, IUQ 459, IUQ 741, 4cs. B. alpha (see Román–Valencia, 2003a, 2003b, 2003c), MPUJ 3754.

B. cismontanus (see Román–Valencia, 2003a). B. loisae (see Román–Valencia, 2003a).

Animal Biodiversity and Conservation 33.2 (2010)

197

Table 1. Morphometry of Bryconamericus macarenae n. sp. (n = 171; standard and total length in mm; averages in parentheses).

Tabla 1. Morfometría de Bryconamericus macarenae sp. n. (n = 171; las longitudes total y estándar se dan en mm; los promedios entre paréntesis).

Paratypes

Holotype

Standard length, SL

12.3–43.9 (26.3)

36.2

Total length , TL

23.5–41.1 (30.5)

40.9

Percentages of SL Body depth

20.4–29.1 (24.9)

26.0

Snout–dorsal fin distance

49.5–56.2 (52.9)

51.3

Snout–pectoral fin distance

19.8–28.9 (24.9)

26.6

Snout–pelvic fin distance

38.1–58.4 (45.2)

43.4

Dorsal–pectoral fin distance

31.8–42.4 (37.2)

37.8

Snout–anal fin distance

42.6–60.3 (56.8)

56.7

Dorsal fin–hypural distance

45.5–53.8 (49.8)

48.3

Dorsal–anal fin distance

22.0–30.7 (26.5)

26.8

Dorsal–fin length

13.3–27.2 (23.0)

22.1

Pectoral–fin length

14.2–26.6 (20.6)

20.1

Pelvic–fin length

9.7–18.6 (13.8)

14.2

Anal–fin length

13.9–22.3 (17.9)

14.3

Caudal peduncle depth

6.2–11.0 (9.0)

9.8

Caudal peduncle length

7.6–17.9 (11.4)

10.4

Head length

20.7–26.2 (23.6)

23.8

Percentages of HL Snout length

18.3–29.6 (23.5)

24.9

Orbital diameter

38.2–59.5 (46.2)

48.6

Postorbital distance

26.5–40.7 (32.1)

31.5

Maxilla length

13.1–41.6 (24.2)

20

Interorbital distance

25.3–45.3 (36.2)

30.6

Upper jaw distance

23.2–37.1 (29.5)

27.7

Bryconamericus macarenae n. sp. (tables 1–2, figs. 1–2) Holotype IUQ 2448, male, 36.2 SL, Colombia, Departamento Meta, Vista Hermosa, La Palestina village, Orinoco River Basin, Blanco River drainage, Pringamosal Creek, 500 m from La Palestina School, 3º 03' 15'' N, 73º 49' 54'' W, 282 m a.s.l., 9 I 2009.

Paratypes All from Colombia, Orinoco River Basin, Guapaya River drainage, Departamento Meta, Vista Hermosa municipality: AUM 50297, 4, 25.9–35.3 SL, La Palestina village, Blanco River drainage, Pringamosal Creek, 500 m north of La Palestina School, 3º03’15”N, 73º 49' 54'' W, 282 m

a.s.l., 9 I 2009; IUQ 2271, 2, 20.1–33.2 SL, Gúio creek, Palestina–Albania road, 3º 04' 43'' N, 73º 48' 25'' W, 256 m a.s.l.,10 VII 2008; IUQ 2326, 7, 22.1–33.6 SL, 1 km north from Guapaya creek on road to Playa Rica, 3º 05' 04'' N, 73º 50' 39'' W, 204 m a.s.l., 9 VII 2008; IUQ 2435, 12, 12.3–40.7 SL, creek 1 km north of Las Brisas, 3º 02' 55'' N, 73º 49' 10'' W, 278 m a.s.l., 10 VII 2008; IUQ 2437, 2 cs, 31.6–32.1 SL, creek 1 km north of Las Brisas, 3º 02' 55'' N, 73º 49' 10'' W, 278 m a.s.l., 10 VII 2008; IUQ 2441, 5, 32.4–33.8 SL, Maraco creek on Palestina–Albania road, 3º 05' 07'' N, 73º 48' 49'' W, 290 m a.s.l., 10 VII 2008; IUQ 2440,12, 15.8–43.8 SL, Buenos Aires village, Salas Creek, 3º 07' 48'' N, 73º 51' 21'' W, 316 m a.s.l., 8 VII 2008; IUQ 2442, 32, 19.2–29.5 SL, Luciana creek on Puerto Lucas–Palestina

198

Román–Valencia et al.

Table 2. Physicochemical variables in habitat of Bryconamericus macarenae n. sp., Orinoco Basin, Colombia. Localities: 1. Caño Guio; 2. Caño near Caño Guapaya; 3. 1 km from Las Brisas; 4. Caño Maraco; 5. Caño Luciana; 6. Caño 2 km from Las Brisas; 7. Caño Acacias; 8. Caño Pringamozal; 9.

Caño Irique: Substrate: Dd. Detritus and decomposing organic material; Rd. Rocks and detritus; Rs. Rocks and sand.

Tabla 2. Variables fisicoquímicas en el hábitat de Bryconamericus macarenae sp. n., cuenca del Orinoco, Colombia. (Para las abreviaturas, ver arriba.)

2

3

m a.s.l.

256

1

304

278

Water temperature (°C)

24.5

26.2

24.5

Air temperature (°C)

26.9

28

25.2

Dissolved oxygen (mg/l) Oxygen saturation (%)

Locality 4

5

6

7

290

253

264

259

8

24.9

24.6

24.9

24.6

24.4

25

26.3

24.9

25.8

27

25.8

27.6

282

9 381

5.4

4.0

5.7

5.3

6.5

5.5

7.1

7

5.3

65.1

50.5

68.5

65.4

79

67.1

89.7

84

67.8

pH

7.9

6.3

7.3

7.1

7.3

7.2

7.4

7.6

6.1

Width (m)

2-5

1-2

2-3

3-4

3-4

2-4

3-4

1-3

5-6

1

0.5

1-3

1-2

1-2

0.5-1

1-2

1-1.5

1

brown brown brown brown

clear

clear

clear

clear

clear

Rd

Rs

Rd

Rd

Rd

Depth (m) Color Substrate

Dd

Dd

Dd

road, 3º 06' 22'' N, 73º 46' 44'' W, 253 m a.s.l., 8 I 2009; IUQ 2443, 10, 14.3–34.5 SL., creek 2 km north of Las Brisas, 3º 03' 00'' N, 73º 49' 05'' W, 264 m a.s.l., 10 VII 2008; IUQ 2444, 2, 35.3–38.1 SL., Acacias creek on Puerto Lucas Vista Hermosa road, 3º 06' 51'' N, 73º 45' 44'' W, 264 m a.s.l., 10 VII 2008; IUQ 2445, 12, 27.7–39.2 SL, La Palestina village, Pringamosal Creek 1 km north of La Palestina School, 3º 03' 15'' N, 73º 49' 54'' W, 282 m a.s.l.,10 VII 2009; IUQ 2446, 38, 20.2–26.8 SL, Irique creek on Granada, 3º 33' 26'' N, 73º 41' 54'' W, 381 m a.s.l., 7 VII. 2008; IUQ 2447, 44,

Dd

18.9–36.9 SL. La Palestina village, Pringamosal Creek, Blanco River drainage, creek 500 m north of La Palestina School, 3º 03' 15'' N, 73º 49' 54'' W, 282 m a.s.l., 9 I 2009.

IUQ 2559, 2, 40, 6–42, 2 SL. Buenavista village, Creek on the Las Delicias farm, 3º 07' 02'' N, 73º 52' 29'' W, 469 m a.s.l., 9 IV 2009. IUQ 2560, 9, 26.5–42.2 SL. Buenavista village, Creek on La Prosperidad farm, 3º 07' 09'' N, 73º 52' 23'' W, 411 m a.s.l., 9 IV 2009. IUQ 2561, 27, 22.9–47.2 SL. Buenavista village, Creek on Las Delicias farm, 20 m from the house 3º 07' 02'' N, 73º 52' 20'' W, 409 m a.s.l., 9 IV 2009.

1 cm

Fig. 1. Bryconamericus macarenae n. sp., holotype: IUQ 2448, 36.2 mm SL. male, Vista Hermosa municipality, La Palestina village, Orinoco River basin, Colombia.

Fig. 1. Holotipo de Bryconamericus macarenae sp. n.: IUQ 2448, 36,2 mm de LE, macho, municipio Vista Hermosa, villa La Palestina, cuenca del Orinoco, Colombia.

Animal Biodiversity and Conservation 33.2 (2010)

199

0.48 0.32 0.16 –1.6

–1.2

–0.8

–0.4

0.4

0.8

1.2

1.6

–0,16 –0,32 –0,48 –0,64 –0.80

Fig. 2. Representation of the first two principal components (component 1 is the X axis, component 2 is the Y axis) from morphometric data of Bryconamericus delta (□), B. cristiani (+), B. alpha (◊) and B. macarenae n. sp. (o).

Fig. 2. Representación de las dos primeras componentes principales (la componente 1 es el eje X, la componente 2 es el eje Y) de los datos morfométricos de Bryconamericus delta (□), B. cristiani (+), B. alpha (◊) y B. macarenae sp. n. (o).

Diagnosis Bryconamericus macarenae differs from all other species of Bryconamericus in having an incomplete lateral line (vs. complete in all except B. delta), four or fewer unbranched anal–fin rays (vs. five or more), a short and thickened extrascapular bone which lacks or has only a reduced apophysis on its posterior tip, and only a few perforations by the latero–sensory canal (vs. large, irregular extrascapular bone,usually with several bony projections on its margins, with a large, undulated apophysis on its posterior tip, and with conspicuous perforations by the latero–sensory canal).

It also differs in its live color pattern (see below). We found the following differences that distinguish this new species from those that occur in the same basin: from B. alpha by the number of lateral teeth on the dentary (five or six vs. four), from B. cristiani by the arrangement of the teeth in the outer premaxillary row (straight line vs. zigzag), from B. cismontanus and B. loisae by the number of branched anal–fin rays 19–25 vs. 13–18 and 26–30, respectively).

Description Body slender and elongate (mean maximum body depth about 25% SL). Area above orbits flat. Dorsal

profile of head and body oblique from supraoccipital to dorsal origin and from last dorsal–fin ray to base of caudal fin. Ventral profile of body convex from snout to base of anal fin. Caudal peduncle laterally compressed. Head and snout short, upper jaw longer than lower; mouth terminal, lips soft and flexible, not covering outer row of premaxillary teeth; ventral border of upper jaw straight; posterior edge of maxilla reaching anterior edge of orbit; opening of posterior nostrils vertically ovoid; opening of anterior nostrils with membranous flap.

Premaxillary teeth in two rows. Two teeth of outer row tricuspid with central cusp larger. Internal row with four pentacuspid teeth that diminish gradually in size.

Maxilla long, posterior margin straight, with three pentacuspid teeth with central cusp slightly longer. Dentary with four or five large tricuspid teeth with central cusp largest, followed by five or six small conical teeth.

Central cusp of all teeth is two to three times longer and broader than remaining cusps.

Scales cycloid, moderately large. Lateral line incomplete, perforated scales 11–41 (17* mean = 29.8, n = 174). Scale rows between dorsal–fin origin and lateral line 5–6 (5*, mean = 5.4, n = 174); scale rows between lateral line and pelvic–fin origin 4–5, usually 4 (5*, mean = 4.5, n = 174). Predorsal scales 10–13, arranged in regular series (12*, mean =11, 7, n = 174).

200

Román–Valencia et al.

74º

C. Blanco Guapaya River

3º

74º Fig. 3. Map showing the type locality of Bryconamericus macarenae.

Fig. 3. Mapa que muestra la localidad tipo de Bryconamericus macarenae.

Dorsal–fin rays iii, 7–8 (iii, 7*, n = 174); first unbranched ray approximately one–half length of second ray, its tip reaching first bifurcation of first branched ray. Dorsal– fin origin posterior to middle of body and posterior to vertical through pelvic–fin origin.

Anal–fin rays iii–iv, 19–25 (iv, 23*, n = 174). Anal–fin origin posterior to vertical through base of last dorsal–fin ray. Pectoral–fin rays ii, 10–11 (10*, n = 174). Pelvic–fin rays ii, 6 (n = 174). Pelvic–fin origin anterior to vertical through dorsal–fin origin. Caudal fin not covered with scales, forked with short pointed lobes, principal caudal rays 1/17/1 (n = 174). Dorsal procurrent rays 12 (n = 3).

Ventral procurrent rays 12 (n = 3). Adipose fin present. Total number of vertebra 36–37. Six infraorbitals present, the first thin and narrow, extending between dorsal edge of maxilla and lateral ethmoid, with sensorial canal. Second infraorbital short and wide, covering dorsal part of angulo–articular. Anterior part of second infraorbital overlaying anterior part of first infraorbital and with a foramen that extends towards dorsal margin of first infraorbital. Its posterior margin extends below third infraorbital. Third infraorbital widest and longest, its ventral border in contact with sensorial canal of preopercle. Fourth, fifth and sixth infraorbitals short and narrow, covering posterior margin of hyomandibular.

Supraorbital absent. Five supraneurals present between head and anterior part of dorsal fin, without cartilage on upper and lower edges, and with medial sensorial canal.

Secondary sexual dimorphism Males have a row of short hooks on the last simple anal–fin ray and on the first to eleventh branched anal–fin rays, each ray with 7–15 hooks, located on the posterior–most branch. There are also 7–12 small

hooks on the simple and branched rays of the pelvic fin, located on both branches of the rays, but not extending onto the anterior–most part.

Live colors Dorsum of body and head and postventral region greenish yellow, with obvious absence of black pigment.

Body with blue lateral stripe, produced by presence of iridophores that create a bluish iridescence known as Rayleigh scattering. The iridophores are present on the sides but are restricted to the region of the coelomic cavity, where together with leucophores they produce the whitish coloration of this part of the body. The iridophores extend posteriorly as a lateral stripe to the base of the caudal peduncle. The middle caudal–fin rays are covered by a narrow band of melanophores that forms a slender arc or half–moon shape to make the caudal peduncle spot. There is a small purple spot between the fifth and sixth infraorbitals and the opercle.

The opercle has melanophores concentrated on the posterior portion. Humeral spot dark and vertically elongate via disperse pigments. Fins hyaline, but dorsal, anal and caudal fins with disperse melanophores on interradial membranes.

Distribution This species is so far known only from the Güejar River basin in Meta state, Macarena Mountain range, Orinoco system in Colombia (fig. 3).

Habitat Bryconamericus macarenae was collected along shore over sandy substrates in the mainstream of rivers,

Animal Biodiversity and Conservation 33.2 (2010)

201

Identification key to the species of Bryconamericus from the Orinoco and Lake Maracaibo Basins.

Clave de identificación para las especies de Bryconamericus de las cuencas del Orinoco y del lago Maracaibo.

1. Scales from lateral line to anal–fin base 2–3 B. meridae Scales from lateral line to anal–fin base 4 or more 2 2. Lateral line incomplete; premaxilla with two teeth

of outer row tricuspid; maxilla with three pentacuspid teeth; anterior part of second infraorbital overlaying anterior part of first infraorbital, and with a foramen that extends towards dorsal margin of the first infraorbital, and its posterior margin extending below third infraorbital B. macarenae Lateral line complete; premaxilla with four teeth of outer row bi or tricuspid; maxilla with two to six tri, sexta or heptacuspid teeth; anterior margin of first infraorbital transverse, without a foramen, and does not overlap the posterior part of the first infraorbital, its posterior margin is over the third infraorbital 3 3. 13–18 branched anal–fin rays; maxilla with serrate teeth; fewer than five scales between the lateral line and the dorsal-fin origin B. cismontanus 24–30 branched anal–fin rays; maxilla without serrate teeth; more than five scales between lateral line and dorsal-fin origin 4 4. Two or three multicuspid teeth on maxilla; four or fewer smaller lateral teeth present on dentary B. alpha More than three teeth present on maxilla, with between one and four cusps; five or more small lateral teeth on dentary 5 5. Teeth of outer premaxillary row arranged in straight line.

Six to eight small lateral teeth present on dentary B. loisae Teeth of outer premaxillary row arranged in zigzag.

Eight to 11 small lateral teeth present on dentary (behind larger front teeth) B. cristiani

as well as tributaries with flow. The transparency of the tea–colored water is usually moderate to high, pH is usually around neutral (6.07–7.06), oxygen concentration was high, 5.7 mg/l to 7.1 mg/l, as was the percent oxygen, saturation (50.5% to 90.5%) (table 2). The new taxon is sympatric with B. alpha, B. cismontanus and B. loisae.

Etymology Bryconamericus macarenae is named for the Macarena Mountain range of Colombia, where the type series was collected.

Comments When describing a new species, it is usually desirable to compare the new taxa with all other known species in the genus. However, when working with extremely large, poorly defined paraphyletic genera such as Bryconamericus, Hyphessobrycon, Hemigrammus,

or Astyanax, that occur throughout much of Central and South America, this is not feasible, nor in our opinion, necessary because in our hypothesis of phylogenetic relationships, we expect new taxa to be most closely related to those that occur in the same hydrographic basin. As regional systematic studies progress, more complete hypotheses will become possible. In the meantime, regional studies and keys are practical and useful for species identification purposes (Román–Valencia et al., 2008a, 2008b, 2009c, 2009d; Román–Valencia & Arcila–Mesa, 2008; Vari & Harold, 2001).

A principal component analysis including all species failed to reveal significant morphometric differences among them. It was useful however to show (fig. 2) that Bryconamericus macarenae differs morphologically from the sympatric species B. cristiani and B. alpha, and also from B. delta, a species that shares the character of an interrupted lateral line, along axis 1 by distance from dorsal fin to the hypurals vs. length of pelvic fins, and along axis 2 by the body

202

depth, upper jaw length and distance from dorsal to anal–fin origins. The first axis explains 75.73% of total variation, while the first and second combined explain 89.55%.

Acknowledgments The University of Quindío, Vicerrectoría de Investigaciones (grants 304 and 357) and Dept. Biology financed this study. We also with to thank the following persons and museums for loans of material under their care: R. Barriga (MEPN) and S. Prada–P. (MPUJ). We also thank J. Borrero ("La Palestina" High School, Vista Hermosa, Meta), and the Marin family (Gonzaga, Ordanet and Javier) for their help and generous hospitality at La Macarena.

References Bernal Ramírez, J. H. & Cala, P., 1997. Composición de la dieta alimenticia del Yamú, Brycon siebenthalae (Pisces: Characidae), en la parte media del Rio Guayabero, sistema del alto Rio Guaviare, Colombia. Dahlia (Revista de la Asociación Colombiana de Ictiólogos), 2: 55–63.

Dahl, G., 1960a. Nematognathous fishes collected during the Macarena expedition 1959, part I. Novedades Colombianas, 1: 302–316.

– 1961. Nematognathous fishes collected during the Macarena expedition 1959, part II. Novedades Colombianas, 1: 484–514.

Myers, S. G. & Weitzman, S. H., 1960. Two new fishes collected by general Thomas D. White in eastern Colombia. Stanford Ichthyological Bulletin, 7: 98–109.

Hammer, Ø., Harper, D. A. & Ryan, P. D., 2008. PAST – Palaeontological Statistics, ver. 1.81: 1–88.

Román–Valencia, C., 1998. Descripción de una nueva especie de Bryconamericus (Characiformes, Characidae) para la cuenca alta de los ríos Ariari y Meta, Colombia. Revista Actualidades Biológicas, 20: 109–114.

– 2000. Tres nuevas especies de Bryconamericus (Ostariophysi: Characidae) de Colombia, y diagnóstico del género. Internacional Journal Tropical Biology, 56: 1749–1763.

– 2002. Revisión sistemática de las especies del género Bryconamericus (Teleostei: Characidae) de Centroamérica. Internacional Journal Tropical Biology, 50: 173–192.

– 2003a. Sistemática de las especies Colombianas de Bryconamericus (Characiformes, Characidae).

Dahlia (Revista de la Asociación Colombiana de Ictiólogos), 6: 17–58.

– 2003b. Description of a new species of Bryconamericus (Teleostei: Characidae) from the Amazon.

Bolletino Museo regionali di Scienze naturali Torino, 20: 477–486.

– 2003c. Descripción de tres nuevas especies de Bryconamericus (Pisces: Ostariophysi: Characidae) de Colombia. Memoria de la Fundación La Salle

Román–Valencia et al.

de Ciencias Naturales, 155: 31–49.

– 2005. Sinopsis comentada de las especies del género Bryconamericus (Teleostei: Characidae) de Venezuela y norte del Ecuador, con la descripción de una nueva especie para Venezuela. Memoria de la Fundación La Salle de Ciencias Naturales, 163: 27–52.

Román–Valencia, C. & Arcila–Mesa, D. K., 2008.

Hemibrycon rafaelense n. sp. (Characiformes, Characidae), a new species from the upper Cauca river, with keys to Colombian species. Animal Biodiversity and Conservation, 31.1: 67–75.

Román–Valencia, C., Arcila–Mesa, D. K. & García, M. D., 2009d. Diversidad fenotípica en peces del género Hemibrycon (Characiformes:Characidae) del sistema del río Magdalena–Cauca, Colombia.

Brenesia, 71–72: 17–40.

Román–Valencia, C., Arcila–Mesa, D. K. & Hurtado, T., 2009c. Variación morfológica de los peces Hemibrycon boquiae y Hemibrycon rafaelense (Characiformes: Characidae) en el Río Cauca, Colombia.

Internacional Journal Tropical Biology, 57: 541–556.

Román–Valencia, C., García–Alzate, C., Ruiz–C., R. & Taphorn, D., 2010. A new species of Creagrutus (Characiformes: Characidae) from the Güejar River, Orinoco Basin, Colombia. Ichthyological Exploration Freshwater, 21: 87–95.

Román–Valencia, C., Ortega, H. & García, M. D., submitted. Estado taxonómico y geográfico de Bryconamericus peruanus (Teleostei, Characidae).

Revista Mexicana de Biodiversidad. ­Román–Valencia, C., Taphorn, D. C. & Ruiz–C., R. I., 2008a. Two new Bryconamericus: B. cinarucoense n. sp. and B. singularis n. sp. (Characiformes, Characidae) from the Cinaruco River, Orinoco Basin, with key to all Venezuelan Species. Animal Biodiversity and Conservation, 31.1: 15–27.

Román–Valencia, C. & Vanegas–Ríos, J. A., 2009.

Análisis filogenético y biogeográfico de las especies del género Bryconamericus (Characiformes, Characidae) de la Baja América Central. Caldasia, 31: 393–406.

Román–Valencia, C., Vanegas–Ríos, J. A. & García, M. D., 2009b. Análisis comparado de las especies de Bryconamericus (Teleostei: Characidae) en la cuenca de los ríos Cauca–Magdalena y Ranchería, Colombia. Revista Mexicana de Biodiversidad, 80: 465–482.

Román–Valencia, C., Vanegas–Ríos, J. A. & Ruiz–C., R. I., 2008b. Una nueva especie de pez del género Bryconamericus (Ostariophysi: Characidae) del río Magdalena, con una clave para las especies de Colombia. International Journal Tropical Biology, 56: 1749–1763.

– 2009a. Especie nueva del género Bryconamericus (Teleostei: Characidae) del río Fonce, sistema río Magdalena, Colombia. Revista Mexicana de Biodiversidad, 80: 455–463.

Ruiz–C., R. I. & Román–Valencia, C., 2006. Osteología de Astyanax aurocaudatus Eigenmann, 1913 (Pisces: Characidae), con notas sobre la validez de Carlastyanax Géry, 1972. Animal Biodiversity and Conservation, 29: 49–64.

Animal Biodiversity and Conservation 33.2 (2010)

Song, J. & Parenti, L. R., 1995. Clearing and staining whole fish specimens for simultaneous demonstration of bone, cartilage and nerves. Copeia, 1: 114–118.

Taylor, W. R. & Van Dyke, G. C., 1985. Revised procedures for staining and clearing small fishes and other vertebrates for bone and cartilage study.

Cybium, 9: 107–119.

Thomerson, J. E. & Taphorn, D. C., 1993. Rivulus corpulentus, a new killifish from Cordillera de La Macarena, Colombia (Cyprinidontiformes: Rivulidae).

Ichthyologial Exploration Freshwater, 4: 57–60.

Useche–L., C., Cala, P. & Hurtado–R., H., 1993. Sobre La ecologia de Brycon siebenthalae y Mylossoma duriventris (Pisces: Characidae) en El Rio Cafre, Orinoquia. Caldasia, 17: 341–352.

Vari, R. P., 1995. The Neotropical fish family Ctenoluciidae (Teleostei: Ostariophysi: Characiformes):

203

supra and intrafamilial phylogenetic relationship, with a revisionary study. Smithsonian Contributions to Zoology, 564: 1–96.

Vari, R. P. & Harold, A. S., 2001. Phylogenetic study of the Neotropical fish genera Creagrutus Günther and Piabina Reinhardt (Teleostei: Ostariophysi: Characiformes), with a revision of the Cis–Andean species.

Smithsonian Contribution to Zoology, 13: 1–238.

Vari, R. P. & Siebert, D. J., 1990. A new unusually sexually dimorphic species of Bryconamericus (Pisces: Ostariophysi: Characidae) from the Peruvian Amazon. Proceeding Biological Society, 103: 516–524.

Weitzman, S. H., 1962. The osteology of Brycon meeki, a generalized characid fish, with an osteological definition of the family. Stanford Ichthyological Bulletin, 8: 1–77.

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Letter to Editor 205

Animal Biodiversity and Conservation 33.2 (2010)

Did dingo control cause the elimination of kowaris through mesopredator release effects?

A response to Wallach and O’Neill (2009)

B. L. Allen

Allen, B. L., 2010. Did dingo control cause the elimination of kowaris through mesopredator release effects?

A response to Wallach and O’Neill (2009). Animal Biodiversity and Conservation, 33.2: 205–208.

Wallach & O’Neill (2009) recently suggested that poison baiting for dingoes (Canis lupus dingo and hybrids) caused the localized extinctions of kowaris (Dasyuroides byrnei) through mesopredator release effects.

However, in this paper I briefly highlight some weaknesses in their approach to show that the information presented adds little to our knowledge of dingo–mesopredator or dingo–kowari interactions.

Wallach & O’Neill (2009) visited two cattle properties in northeast South Australia once each in the winter of 2007 where they used sand plot activity indices to compare the relative abundance of several carnivore and herbivore species at each site. Observations of dingo howling and scat counts were used as measures of social structure. In line with the mesopredator release hypothesis (Crooks & Soulé, 1999), the lethal control of dingoes (usually achieved through 1080 baiting campaigns), followed by abundance increases of mesopredators and herbivores was the suggested mechanism that produced the localized extinction of kowaris at one of the sites. Unfortunately though, the study design suffers from multiple critical weaknesses in the methods applied, considerably limiting its ability to make inferences about dingo populations and ecosystem processes.

1. The authors stated that across Australia, "it is extremely rare to find dingo populations that are not being subjected to lethal control" (Wallach & O’Neill, 2009, pg. 127). This is misleading, and in the context of their paper, gives the reader the mistaken impression that stable dingo packs are rare across Australia due to widespread control. Dingoes and dingo packs are, in fact, extremely common (Fleming et al., 2001; West, 2008), and control practices in South Australia are quite conservative (Allen, 2010b). "Lethal control" is also an ambiguous term, because it includes everything from occasional shooting through to intensive and coordinated poison baiting campaigns. Hence, the degree of control can vary immensely, and in the context of their paper, different forms of lethal control are unlikely to influence social structure in the same way.

For example, it is possible that occasional shooting may simply replace natural mortality and have a minor overall effect on dingo social structure, though these processes would need to be investigated.

Furthermore, in the northeast pastoral district of South Australia where their two sites were located, official 1080 bait supply records (B. Allen, unpublished data, kept since 1972) indicate that poison baiting seldom occurs, with an average rate of 25% properties receiving baits in any given year (range: 0% in 1984 to 68% in 1991). Legislation permits a baiting intensity of up to 10 baits/km2 (APVMA, 2008). But the greatest supply of baits occurred in 1989, and equated to a regional baiting intensity of only 0.07 baits/km2 (Allen, 2010b). Requests for poison baits from the whole of the northern pastoral district have also reduced

(Received: 8 IV 10; Conditional acceptance: 27 VIII 10; Final acceptance: 13 IX 10) Benjamin L. Allen, The Univ. of Queensland, School of Animal Studies, Warrego Highway, Gatton QLD 4343, Australia.

Current address: South Australian Arid Lands Natural Resources Management Board, P. O. Box 2227, Port Augusta, South Australia 5700, Australia. E–mail: ben.allen@saalnrm.sa.gov.au ISSN: 1578–665X

© 2010 Museu de Ciències Naturals

206

Allen

dramatically over the last five years to the point where only three (out of 19) properties in the northeast region received baits in the three years prior to their study and no baits at all were supplied in 2009. This means that approximately 600,000 km2 of South Australia experienced very little dingo control that year (dingo populations in the indigenous lands in the northwest of the state —255,000 km2— have rarely, if ever, been subject to lethal control by Europeans). On a property level (i.e. 10,000 km2), even the most intensive baiting campaigns in northern pastoral areas rarely exceed 0.25 baits/km2. Therefore, lethal control of any kind may be a relatively minor fraction of total dingo mortality across the region in which Wallach & O’Neill (2009) conducted their study.

2. The use of sand plot activity indices are a common and useful tool for sampling dingo populations. However, their proper use is governed by principles that ensure that the data obtained from them can be used reliably in subsequent analyses. Specifically, activity indices cannot be validly compared between different habitats/ land uses, seasons, or species because of the way these factors potentially influence animal activity (Wilson & Delahay, 2001; Engeman, 2005). Scat counts and howling can also be useful indicators of some population parameters when sampled properly (Corbett, 2001; Mitchell & Balogh, 2007). Wallach & O’Neill (2009) understandably chose these useful methods to assess populations, but their application of them did not follow the sampling principles that ensure their reliability. For example: ● The 'index of abundance' was calculated by multiplying a continuous measure (tracks/transect/night) with a binary measure (presence/absence of tracks on 2 ha plots). This could be argued as providing a potential synergy of assumption violations —leaving little prospect for a valid variance estimate— and unnecessary if the track sampling was representative of animal usage (Engeman et al., 1998; Blaum et al., 2008). ● Even before combining them, these measures included invalidated assumptions about the ability to distinguish between "fresh" and "old" tracks and the distance of one track to another as an indication of the same individual animal. Wind can have a dramatic effect on the readability of tracks in sand, often obliterating them within minutes, and the size, shape and direction of footprints on separated but sequential sand plots/transects reveals little about the identity of the individual responsible for them (Triggs, 2004; Funston et al., 2010). ● The relative abundance estimates derived from activity indices were invalidly compared between species, potentially confusing abundance differences with behavioural differences (Wilson & Delahay, 2001; Engeman, 2005). ● A once–off collection of scats around 119 rabbit warrens, water points and carcasses in two ~500 km2 areas will provide a limited ability to assess the structure of dingo packs (or infer causal processes) at extensive rangeland sites (Wilson & Delahay, 2001; Mitchell & Balogh, 2007), and the representativeness of scats collected from resource points is unknown (Allen, 2010a). ● The opportunistic recording of dingo howls at remote water points in the presence of people (and companion dogs, A. Wallach pers. comms.) is also a particularly weak technique for making inferences about pack structure. To be useful, the sampling of vocalizations must be objective and repeatable.

Vocalizations are also communicative behaviours, and in the case of Wallach and O’Neill’s observations, dingoes may have simply been alerting any other dingoes to the presence of humans and/or other dogs.

Assessments of pack structure or social stability are founded in behavioural observations between individually identifiable animals (Whitehead, 2008), and is usually undertaken through radio collaring and/or direct observations (e.g. Corbett, 1988; Thomson, 1992). Identification of individuals was not attempted by Wallach & O’Neill (2009), and scats or howling cannot provide this information. Moreover, the once–off, opportunistic collection of dingo spoor (i.e. tracks and scats) and vocalizations cannot account for the known seasonal changes in their expression (Corbett, 2001), the multiple explanations for any given observation (Williams et al., 2002; MacKenzie et al., 2006), or the mechanisms/causes underlying any observed correlations (Caughley, 1977).

3. Ignoring these methodological issues, alternative explanations may equally describe the observations of Wallach & O’Neill (2009). For example, the greater abundance of dingoes observed at Pandie Pandie may not be due to relaxed dingo control but may be a symptom of the site’s closer proximity to Goyder’s Lagoon, a well–watered and resource–rich section of the Warburton Creek, which is not fed from local rainfall. Publicly available water–level data recorded upstream in the years preceding the study show significant flows into the lagoon which were not matched by local rainfall events on Mungerannie during the same period.

Additionally, the observed rarity of some small mammals on Mungerannie may reflect bottom–up processes, whereby rabbit abundance provides competition for vegetation, reduces it’s availability to invertebrates, and supports larger numbers of feral carnivores (increasing the risk of hyperpredation), which all work in concert to cause the localized extinction of some small mammals. These processes are known to occur with or without dingoes in the landscape.

Furthermore, the recorded activity of predators and prey alike can change rapidly in response to environmental perturbations, and their presence or absence on sand plots during a once–off survey may merely reflect such stochastic events. Such surveys have a limited ability to infer causal process because

Animal Biodiversity and Conservation 33.2 (2010)

207

there may be multiple alternative explanations for the data (Caughley, 1977; Williams et al., 2002; MacKenzie et al., 2006). Causal processes involving dingoes are best addressed using rigorous experimental techniques (such as BACI experiments) where confounding factors can be controlled (Glen et al., 2007).

In summary, while ecological data is scant for arid areas and is always welcomed, it is important to use research resources wisely in order to provide scientifically defensible information (Platt, 1964), used ultimately to inform threatened species recovery. While the conclusions of Wallach & O’Neill (2009) align nicely with the mesopredator release hypothesis, their foundations, methods, and interpretation are undermined by misleading contextual information, the poor application of otherwise robust sampling methods, and a lack of discussion on alternative explanations. As such, the study contributes little insight into the effect of dingo control on kowaris.

The study sites, methods, and results presented in Wallach & O’Neill (2009) have also been used elsewhere (Wallach et al., 2009a, 2009b, 2010), and these criticisms equally apply to those reports, and others similar to them. Researchers, reviewers and readers should therefore be vigilant in looking for design issues that may be more important than initially appears to be the case, before accepting intuitively sound conclusions on face value. Improving the quality of dingo–mesopredator studies is necessary if threatened species are to be managed more effectively.

References Allen, B. L., 2010a. Desert dingoes don’t drink daily: Visitation rates at remote water points in arid South Australia. Queensland Pest Animal Symposium. Gladstone, Queensland.

– 2010b. The effect of regional dingo control on calf production in northern South Australia, 1972–2008.

Queensland Pest Animal Symposium. Gladstone, Queensland.

APVMA, 2008. Review findings for sodium monofluoroacetate: The reconsideration of registrations of products containing sodium monofluoroacetate and approvals of their associated labels, Environmental Assessment.

Australian Pesticides and Veterinary Medicines Authority.

Blaum, N., Engeman, R. M., Wasiolka, B. & Rossmanith, E., 2008. Indexing small mammalian carnivores in the southern Kalahari, South Africa. Wildlife Research, 35: 72–79.

Caughley, G., 1977. Analysis of vertebrate populations. John Wiley and Sons, London.

Corbett, L. K., 1988. Social dynamics of a captive dingo pack: Population regulation by dominant female infanticide. Ethology, 78: 177–198.

– 2001. The dingo in Australia and Asia, J. B. Books, South Australia.

Crooks, K. R. & Soulé, M. E., 1999. Mesopredator release and avifaunal extinctions in a fragmented system.

Nature, 400: 563–566.

Engeman, R., 2005. Indexing principles and a widely applicable paradigm for indexing animal populations.

Wildlife Research, 32: 202–210.

Engeman, R. M., Allen, L. R. & Zerbe, G. O., 1998. Variance estimate for the activity index of Allen et al.

Wildlife Research, 25: 643–648.

Fleming, P., Corbett, L., Harden, R. & Thomson, P., 2001. Managing the impacts of dingoes and other wild dogs. Bureau of Rural Sciences, Canberra.

Funston, P. J., Frank, L., Stephens, T., Davidson, Z., Loveridge, A., Macdonald, D. M., Durant, S., Packer, C., Mosser, A. & Ferreira, S. M., 2010. Substrate and species constraints on the use of track incidences to estimate African large carnivore abundance. Journal of Zoology, 281: 56–65.

Glen, A. S., Dickman, C. R., Soule, M. E. & Mackey, B. G., 2007. Evaluating the role of the dingo as a trophic regulator in Australian ecosystems. Austral Ecology, 32: 492–501.

Mackenzie, D. I., Nichols, J. D., Royle, J. A., Pollock, K. H., Bailey, L. L. & Hines, J. E., 2006. Occupancy estimation and modelling: Inferring patterns and dynamics of species occurrence. Academic Press (Elsevier), London.

Mitchell, B. & Balogh, S., 2007. Monitoring techniques for vertebrate pests: Wild dogs. NSW Department of Primary Industries, Bureau of Rural Sciences, Orange.

Platt, J. R., 1964. Strong inference: Certain systematic methods of scientific thinking may produce much more rapid progress than others. Science, 146: 347–353.

Thomson, P. C., 1992. The behavioural ecology of dingoes in north–western Australia: IV. Social and spatial organisation, and movements. Wildlife Research, 19: 543–563.

Triggs, B., 2004. Tracks, scats, and other traces: A field guide to Australian mammals (revised edition). Oxford University Press, Melbourne.

Wallach, A. D., Johnson, C. N., Ritchie, E. G. & O’Neill, A. J., 2010. Predator control promotes invasive dominated ecological states. Ecology Letters, 13: 1008–1018.

Wallach, A. D., Murray, B. R. & O’Neill, A. J., 2009a. Can threatened species survive where the top predator is absent? Biological Conservation, 142: 43–52.

Wallach, A. D. & O’Neill, A. J., 2009. Threatened species indicate hot–spots of top–down regulation. Animal Biodiversity and Conservation, 32.2: 127–133.

Wallach, A. D., Ritchie, E. G., Read, J. & O’Neill, A. J., 2009b. More than mere numbers: The impact of lethal

208

Allen

control on the stability of a topâ&#x20AC;&#x201C;order predator. PloS ONE, 4, e6861.

West, P., 2008. Assessing invasive animals in Australia 2008. In: Biotext Pty Ltd. Ed. Canberra, National Land and Water Resources Audit, The Invasive Animals Cooperative Research Centre.

Whitehead, H., 2008. Analyzing animal societies: Quantitative methods for vertebrate social analysis. University of Chicago Press, Chicago.

Williams, B. K., Nichols, J. D. & M. J., C., 2002. Analysis and management of animal populations: modeling, estimation, and decision making. Academic Press, New York.

Wilson, G. J. & Delahay, R. J., 2001. A review of methods to estimate the abundance of terrestrial carnivores using field signs and observation. Wildlife Research, 28: 151â&#x20AC;&#x201C;164.

Animal Biodiversity and Conservation 33.2 (2010)

Animal Biodiversity and Conservation Animal Biodiversity and Conservation (abans Miscel·lània Zoològica) és una revista inter­ disciplinària publicada, des de 1958, pel Museu de Ciències Naturals de Barcelona. Inclou articles d'inves­tigació empírica i teòrica en totes les àrees de la zoologia (sistemàtica, taxo­nomia, morfo­logia, biogeografia, ecologia, etologia, fisiologia i genètica) procedents de totes les regions del món amb especial énfasis als estudis que d'una manera o altre tinguin relevància en la biología de la conservació. La revista no publica compilacions bibliogràfiques, catàlegs, llistes d'espècies o cites puntuals. Els estudis realit­ zats amb espècies rares o protegides poden no ser acceptats tret que els autors disposin dels permisos corresponents. Cada volum anual consta de dos fascicles.

Animal Biodiversity and Conservation es troba registrada en la majoria de les bases de dades més importants i està disponible gratuitament a internet a http://www.bcn.cat/ABC, de manera que permet una difusió mundial dels seus articles.

Tots els manuscrits són revisats per l'editor execu­ tiu, un editor i dos revisors independents, triats d'una llista internacional, a fi de garantir–ne la qualitat. El procés de revisió és ràpid i constructiu. La publicació dels treballs acceptats es fa normalment dintre dels 12 mesos posteriors a la recepció.

Una vegada hagin estat acceptats passaran a ser propietat de la revista. Aquesta es reserva els drets d’autor, i cap part dels treballs no podrà ser reproduïda sense citar–ne la procedència.

Normes de publicació Els treballs s'enviaran preferentment de forma electrònica (abc@bcn.cat). El format preferit és un document Rich Text Format (RTF) o DOC que inclogui les figures i les taules. Les figures s'hauran d'enviar també en arxius apart en format TIFF, EPS o JPEG. Si s'opta per la versió impresa, s'han d'enviar quatre còpies del treball juntament amb una còpia en disquet a la Secretaria de Redacció. Cal incloure, juntament amb l'article, una carta on es faci constar que el treball està basat en investigacions originals no publicades anterior­ment i que està sotmès a Animal Biodiversity and Conservation en exclusiva. A la carta també ha de constar, per a aquells treballs en que calgui manipular animals, que els autors disposen dels permisos necessaris i que compleixen la normativa de protecció animal vigent. També es poden suggerir possibles assessors.

Quan l'article sigui acceptat, els autors hauran d'enviar a la Redacció una còpia impresa de la versió final acompanyada d'un disquet indicant el progra­ ma utilitzat (preferiblement en Word). Les proves d'impremta enviades a l'autor per a la correcció, seran retornades al Consell Editor en el termini de 10 dies. Aniran a càrrec dels autors les despeses degudes a modificacions substancials introduïdes per ells en el text original acceptat.

ISSN: 1578–665X

I

El primer autor rebrà 50 separates del treball sense càrrec a més d'una separata electrònica en format PDF. Manuscrits Els treballs seran presentats en format DIN A­–4 (30 línies de 70 espais cada una) a doble espai i amb totes les pàgines numerades. Els manus­crits han de ser complets, amb taules i figures. No s'han d'enviar les figures originals fins que l'article no hagi estat acceptat.

El text es podrà redactar en anglès, castellà o català. Se suggereix als autors que enviïn els seus treballs en anglès. La revista els ofereix, sense cap càrrec, un servei de correcció per part d'una persona especialitzada en revistes científiques. En tots els casos, els textos hauran de ser redactats correctament i amb un llenguatge clar i concís. La redacció del text serà impersonal, i s'evitarà sempre la primera persona.

Els caràcters cursius s’empraran per als noms científics de gèneres i d’espècies i per als neologis­ mes intraduïbles; les cites textuals, independentment de la llengua, seran consignades en lletra rodona i entre cometes i els noms d’autor que segueixin un tàxon aniran en rodona.

Quan se citi una espècie per primera vegada en el text, es ressenyarà, sempre que sigui possible, el seu nom comú.

Els topònims s’escriuran o bé en la forma original o bé en la llengua en què estigui escrit el treball, seguint sempre el mateix criteri.

Els nombres de l’u al nou, sempre que estiguin en el text, s’escriuran amb lletres, excepte quan precedeixin una unitat de mesura. Els nombres més grans s'escriuran amb xifres excepte quan comencin una frase.

Les dates s’indicaran de la forma següent: 28 VI 99 (un únic dia); 28, 30 VI 99 (dies 28 i 30); 28–30 VI 99 (dies 28 a 30).

S’evitaran sempre les notes a peu de pàgina.

Format dels articles Títol. Serà concís, però suficientment indicador del contingut. Els títols amb desig­nacions de sèries numèriques (I, II, III, etc.) seran acceptats previ acord amb l'editor.

Nom de l’autor o els autors.

Abstract en anglès que no ultrapassi les 12 línies mecanografiades (860 espais) i que mostri l’essència del manuscrit (introducció, material, mètodes, resultats i discussió). S'evitaran les especulacions i les cites bibliogràfiques. Estarà encapçalat pel títol del treball en cursiva.

Key words en anglès (sis com a màxim), que orientin sobre el contingut del treball en ordre d’importància.

Resumen en castellà, traducció de l'Abstract. De la traducció se'n farà càrrec la revista per a aquells autors que no siguin castellano­parlants.

Palabras clave en castellà. © 2010 Museu de Ciències Naturals

II

Adreça postal de l’autor o autors.

(Títol, Nom, Abstract, Key words, Resumen, Pala­ bras clave i Adreça postal, conformaran la primera pàgina.)

Introducción. S'hi donarà una idea dels antecedents del tema tractat, així com dels objectius del treball.

Material y métodos. Inclourà la informació pertinent de les espècies estudiades, aparells emprats, mèto­ des d’estudi i d’anàlisi de les dades i zona d’estudi.

Resultados. En aquesta secció es presentaran úni­ cament les dades obtingudes que no hagin estat publicades prèviament.

Discusión. Es discutiran els resultats i es compa­ raran amb treballs relacionats. Els sug­geriments de recerques futures es podran incloure al final d’aquest apartat.

Agradecimientos (optatiu).

Referencias. Cada treball haurà d’anar acom­ panyat de les referències bibliogràfiques citades en el text.

Les referències han de presentar–se segons els models següents (mètode Harvard): * Articles de revista: Conroy, M. J. & Noon, B. R., 1996. Mapping of spe­ cies richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Llibres o altres publicacions no periòdiques: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Treballs de contribució en llibres: Macdonald, D. W. & Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conserva­ tion biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt & J. D. Nichols, Eds.).

Oxford University Press, Oxford. * Tesis doctorals: Merilä, J., 1996. Genetic and quantitative trait vari­ ation in natural bird populations. Tesis doctoral, Uppsala University. * Els treballs en premsa només han d’ésser citats si han estat acceptats per a la publicació: Ripoll, M. (in press). The relevance of population

studies to conservation biology: a review. Anim.

Biodivers. Conserv.

La relació de referències bibliogràfiques d’un tre­ ball serà establerta i s’ordenarà alfabè­ticament per autors i cronològicament per a un mateix autor, afegint les lletres a, b, c,... als treballs del mateix any. En el text, s’indi­caran en la forma usual: "... segons Wemmer (1998)...", "...ha estat definit per Robinson & Redford (1991)...", "...les prospeccions realitzades (Begon et al., 1999)...".

Taules. Es numeraran 1, 2, 3, etc. i han de ser sempre ressenyades en el text. Les taules grans seran més estretes i llargues que amples i curtes ja que s'han d'encaixar en l'amplada de la caixa de la revista.

Figures. Tota classe d’il·lustracions (gràfics, figures o fotografies) entraran amb el nom de figura i es numeraran 1, 2, 3, etc. i han de ser sempre ressen­ yades en el text. Es podran incloure fotografies si són imprescindibles. Si les fotografies són en color, el cost de la seva publicació anirà a càrrec dels au­ tors. La mida màxima de les figures és de 15,5 cm d'amplada per 24 cm d'alçada. S'evitaran les figures tridimensionals. Tant els mapes com els dibuixos han d'incloure l'escala. Els ombreigs preferibles són blanc, negre o trama. S'evitaran els punteigs ja que no es repro­dueixen bé.

Peus de figura i capçaleres de taula. Seran clars, concisos i bilingües en la llengua de l’article i en anglès.

Els títols dels apartats generals de l’article (Intro­ ducción, Material y métodos, Resultados, Discusión, Conclusiones, Agradecimientos y Referencias) no aniran numerats. No es poden utilitzar més de tres nivells de títols.

Els autors procuraran que els seus treballs originals no passin de 20 pàgines (incloent–hi figures i taules).

Si a l'article es descriuen nous tàxons, caldrà que els tipus estiguin dipositats en una insti­tució pública.

Es recomana als autors la consulta de fascicles recents de la revista per tenir en compte les seves normes.

Animal Biodiversity and Conservation 33.2 (2010)

Animal Biodiversity and Conservation Animal Biodiversity and Conservation (antes Miscel·lània Zoològica) es una revista inter­ disciplinar, publicada desde 1958 por el Museo Ciencias Naturales de Barcelona. Incluye artículos de investigación empírica y teórica en todas las áreas de la zoología (sistemática, taxo­nomía, mor­ fología, biogeografía, ecología, etología, fisiología y genética) procedentes de todas las regiones del mundo, con especial énfasis en los estudios que de una manera u otra tengan relevancia en la biología de la conservación. La revista no publica compila­ ciones bibliográficas, catálogos, listas de especies sin más o citas puntuales. Los estudios realizados con especies raras o protegidas pueden no ser aceptados a no ser que los autores dispongan de los permisos correspondientes. Cada volumen anual consta de dos fascículos.

Animal Biodiversity and Conservation está re­ gistrada en todas las bases de datos importantes y además está disponible gratuitamente en internet en http://www.bcn.cat/ABC, lo que permite una difusión mundial de sus artículos.

Todos los manuscritos son revisados por el editor ejecutivo, un editor y dos revisores independientes, elegidos de una lista internacional, a fin de garan­ tizar su calidad. El proceso de revisión es rápido y constructivo, y se realiza vía correo electrónico siem­ pre que es posible. La publicación de los trabajos aceptados se realiza con la mayor rapidez posible, normalmente dentro de los 12 meses siguientes a la recepción del trabajo.

Una vez aceptado, el trabajo pasará a ser propie­ dad de la revista. Ésta se reserva los derechos de autor, y ninguna parte del trabajo podrá ser reprodu­ cida sin citar su procedencia.

Normas de publicación Los trabajos se enviarán preferentemente de forma electrónica (abc@bcn.cat). El formato preferido es un documento Rich Text Format (RTF) o DOC, que incluya las figuras y las tablas. Las figuras deberán enviarse también en archivos separados en formato TIFF, EPS o JPEG. Si se opta por la versión impresa, deberán remitirse cuatro copias juntamente con una copia en disquete a la Secretaría de Redacción. Debe incluirse, con el artículo, una carta donde conste que el trabajo versa sobre inves­tigaciones originales no publi­cadas an­te­rior­mente y que se somete en ex­ clusiva a Animal Biodiversity and Conservation.

En dicha carta también debe constar, para trabajos donde sea necesaria la manipulación de animales, que los autores disponen de los permisos necesa­ rios y que han cumplido la normativa de protección animal vigente. Los autores pueden enviar también sugerencias para asesores.

Cuando el trabajo sea aceptado los autores de­ berán enviar a la Redacción una copia impresa de la versión final junto con un disquete del manuscrito ISSN: 1578–665X

III

preparado con un pro­cesador de textos e indican­ do el programa utilizado (preferiblemente Word).

Las pruebas de imprenta enviadas a los autores deberán remitirse corregidas al Consejo Editor en el plazo máximo de 10 días. Los gastos debidos a modificaciones sustanciales en las pruebas de im­ pren­­ta, introducidas por los autores, irán a ­cargo de los mismos.

El primer autor recibirá 50 separatas del trabajo sin cargo alguno y una copia electrónica en for­ mato PDF. Manuscritos Los trabajos se presentarán en formato DIN A–4 (30 líneas de 70 espacios cada una) a doble espacio y con las páginas numeradas. Los manuscritos de­ ben estar completos, con tablas y figuras. No enviar las figuras originales hasta que el artículo haya sido aceptado.

El texto podrá redactarse en inglés, castellano o catalán. Se sugiere a los autores que envíen sus trabajos en inglés. La revista ofre­ce, sin cargo ningu­ no, un servicio de corrección por parte de una persona especializada en revistas científicas. En cualquier caso debe presentarse siempre de forma correcta y con un lenguaje claro y conciso. La redacción del texto deberá ser impersonal, evitán­dose siempre la primera persona.

Los caracteres en cursiva se utilizarán para los nombres científicos de géneros y especies y para los neologismos que no tengan traducción; las citas textuales, independientemente de la lengua en que estén, irán en letra redonda y entre comillas; el nombre del autor que sigue a un taxón se escribirá también en redonda.

Al citar por primera vez una especie en el trabajo, deberá especificarse siempre que sea posible su nombre común.

Los topónimos se escribirán bien en su forma original o bien en la lengua en que esté redactado el trabajo, siguiendo el mismo criterio a lo largo de todo el artículo.

Los números del uno al nueve se escribirán con letras, a excepción de cuando precedan una unidad de medida. Los números mayores de nueve se escribirán con cifras excepto al empezar una frase.

Las fechas se indicarán de la siguiente forma: 28 VI 99 (un único día); 28, 30 VI 99 (días 28 y 30); 28–30 VI 99 (días 28 al 30).

Se evitarán siempre las notas a pie de página.

Formato de los artículos Título. Será conciso pero suficientemente explicativo del contenido del trabajo. Los títulos con designacio­ nes de series numéricas (I, II, III, etc.) serán aceptados excepcionalmente previo consentimiento del editor.

Nombre del autor o autores.

Abstract en inglés de 12 líneas mecanografiadas (860 espacios como máximo) y que exprese la esen­ cia del manuscrito (introducción, material, métodos, resultados y discusión). Se evitarán las especula­ © 2010 Museu de Ciències Naturals

IV

ciones y las citas bibliográficas. Irá encabezado por el título del trabajo en cursiva.

Key words en inglés (un máximo de seis) que especifiquen el contenido del trabajo por orden de importancia.

Resumen en castellano, traducción del abstract. Su traducción puede ser solicitada a la revista en el caso de autores que no sean castellano hablan­tes.

Palabras clave en castellano.

Dirección postal del autor o autores.

(Título, Nombre, Abstract, Key words, Resumen, Palabras clave y Dirección postal conformarán la primera página.)

Introducción. En ella se dará una idea de los ante­ cedentes del tema tratado, así como de los objetivos del trabajo.

Material y métodos. Incluirá la información referente a las especies estudiadas, aparatos utilizados, me­ todología de estudio y análisis de los datos y zona de estudio.

Resultados. En esta sección se presentarán úni­ camente los datos obtenidos que no hayan sido publicados previamente.

Discusión. Se discutirán los resultados y se compara­ rán con otros trabajos relacionados. Las sugerencias sobre investigaciones futuras se podrán incluir al final de este apartado.

Agradecimientos (optativo).

Referencias. Cada trabajo irá acompañado de una bibliografía que incluirá únicamente las publicaciones citadas en el texto.

Las referencias deben presentarse según los modelos siguientes (método Harvard): * Artículos de revista: Conroy, M. J. & Noon, B. R., 1996. Mapping of spe­ cies richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Libros y otras publicaciones no periódicas: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Trabajos de contribución en libros: Macdonald, D. W. & Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conserva­ tion biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt & J. D. Nichols, Eds.).

Oxford University Press, Oxford.

* Tesis doctorales: Merilä, J., 1996. Genetic and quantitative trait vari­ ation in natural bird populations. Tesis doctoral, Uppsala University. * Los trabajos en prensa sólo se citarán si han sido aceptados para su publicación: Ripoll, M. (in press). The relevance of population studies to conservation biology: a review. Anim.

Biodivers. Conserv.

Las referencias se ordenarán alfabética­men­te por autores, cronológicamen­te para un mismo autor y con las letras a, b, c,... para los tra­bajos de un mismo autor y año. En el texto las referencias bibliográficas se indicarán en la forma usual: "... según Wemmer (1998)...", "...ha sido definido por Robinson & Redford (1991)...", "...las prospecciones realizadas (Begon et al., 1999)...".

Tablas. Se numerarán 1, 2, 3, etc. y se reseñarán todas en el texto. Las tablas grandes deben ser más estrechas y largas que anchas y cortas ya que deben ajustarse a la caja de la revista.

Figuras. Toda clase de ilustraciones (gráficas, figuras o fotografías) se considerarán figuras, se numerarán 1, 2, 3, etc. y se citarán todas en el texto. Pueden incluirse fotografías si son imprescindibles. Si las fotografías son en color, el coste de su publicación irá a cargo de los autores. El tamaño máximo de las figuras es de 15,5 cm de ancho y 24 cm de alto. Deben evitarse las figuras tridimen­sionales. Tanto los mapas como los dibujos deben incluir la escala. Los sombreados preferibles son blanco, negro o trama. Deben evitarse los punteados ya que no se reproducen bien.

Pies de figura y cabeceras de tabla. Serán claros, concisos y bilingües en castellano e inglés.

Los títulos de los apartados generales del artículo (Introducción, Material y métodos, Resultados, Dis­ cusión, Agradecimientos y Referencias) no se nume­ rarán. No utilizar más de tres niveles de títulos.

Los autores procurarán que sus trabajos originales no excedan las 20 páginas incluidas figuras y tablas.

Si en el artículo se describen nuevos taxones, es imprescindible que los tipos estén depositados en alguna institución pública.

Se recomienda a los autores la consulta de fascículos recientes de la revista para seguir sus directrices.

Animal Biodiversity and Conservation 33.2 (2010)

V

Animal Biodiversity and Conservation

Manuscripts

Animal Biodiversity and Conservation (formerly Miscel·lània Zoològica) is an interdisciplinary journal published by the Natural Science Museum of Barce­ lona since 1958. It includes empirical and theoretical research from around the world that examines any aspect of Zoology (Systematics, Taxonomy, Morphol­ ogy, Biogeography, Ecology, Ethology, Physiology and Genetics). It gives special emphasis to studies related to Conservation Biology. The journal does not publish bibliographic compilations, listings, catalogues or col­ lections of species, or isolated descriptions of a single specimens. Studies concerning rare or protected species will not be accepted unless the authors have been granted the relevant permits or authorisation.

Each annual volume consists of two issues.

Animal Biodiversity and Conservation is regis­ tered in all principal data bases and is freely available online at http://www.bcn.cat/ABC, assuring world–wide access to articles published therein.

All manuscripts are screened by the Executive Edi­ tor, an Editor and two independent reviewers so as to guarantee the quality of the papers. The review process aims to be rapid and constructive. Once accepted, papers are published as soon as is practicable. This is usually within 12 months of initial submission.

Upon acceptance, manuscripts become the prop­ erty of the journal, which reserves copyright, and no published material may be reproduced or cited without acknowledging the source of information.

Manuscripts must be presented in DIN A–4 format, 30 lines, 70 keystrokes per page. Maintain double spacing throughout. Number all pages. Manuscripts should be complete with figures and tables. Do not send original figures until the paper has been accepted.

The text may be written in English, Spanish or Cata­ lan, though English is preferred. The journal provides linguistic revision by an author’s editor. Care must be taken to use correct wording and the text should be written concisely and clearly. Scientific names of gen­ era and species as well as untranslatable neologisms must be in italics. Quotations in whatever language used must be typed in ordinary print between quota­ tion marks. The name of the author following a taxon should also be written in lower case letters.

When referring to a species for the first time in the text, both common and scientific names should be given when possible. Do not capitalize common names of species unless they proper nouns (e.g.

Iberian rock lizard). Place names may appear ei­ ther in their original form or in the langua ge of the manuscript, but care should be taken to use the same criteria throughout the text.

Numbers one to nine should be written in full within the text except when preceding a measure. Higher numbers should be written in numerals except at the beginning of a sentence.

Specify dates as follows: 28 VI 99 (for a single day); 28, 30 VI 99 (referring to two days, e.g. 28th and 30th), 28–30 VI 99 (for more than two consecu­ tive days, e.g. 28th to 30th).

Footnotes should not be used.

Information for authors Electronic submission of papers is encouraged (abc@bcn.cat). The preferred format is DOC or RTF. All figures must be readable by Word, embedded at the end of the manuscript and submitted together in a separate attachment in a TIFF, EPS or JPEG file.

Tables should be placed at the end of the document.

If a printed version is sent, four copies should be forwarded to the Editorial Office, together with a copy on computer disc. A cover letter stating that the article reports original research that has not been published elsewhere and has been submitted exclusively for consideration in Animal Biodiversity and Conservation is also necessary. When animal manipulation has been necessary, the cover letter should also specify that the authors follow current norms on the protec­ tion of animal species and that they have obtained all relevant permits and authorisations. Authors may suggest referees for their papers.

Once an article has been accepted, authors should send a paper copy and an electronic copy of the final version. Please identify software (preferably Word).

Proofs sent to the authors for correction should be returned to the Editorial Board within 10 days.

Expenses due to any substantial alterations of the proofs will be charged to the authors.

The first author will receive 50 reprints free of charge and an electronic version of the article in PDF format.

ISSN: 1578–665X

Formatting of articles Title. Must be concise but as informative as possible.

Numbering of parts (I, II, III, etc.) should be avoided and will be subject to the Editor’s consent.

Name of author or authors.

Abstract in English, no longer than 12 typewritten lines (840 spaces), covering the contents of the article (introduction, material, methods, results and discussion). Speculation and literature citation should be avoided. The abstract should begin with the title in italics.

Key words in English (no more than six) should express the precise contents of the manuscript in order of relevance.

Resumen in Spanish, translation of the Abstract.

Summaries of articles by non–Spanish speaking au­ thors will be translated by the journal on request.

Palabras clave in Spanish.

Address of the author or authors.

(Title, Name, Abstract, Key words, Resumen, Palabras clave and Address should constitute the first page.)

Introduction. Should include the historical back­ ground of the subject as well as the aims of the paper. © 2010 Museu de Ciències Naturals

VI

Material and methods. This section should provide relevant information on the species studied, materi­ als, methods for collecting and analysing data, and the study area.

Results. Report only previously unpublished results from the present study.

Discussion. The results and their comparison with re­ lated studies should be discussed. Suggestions for future research may be given at the end of this section.

Acknowledgements (optional).

References. All manuscripts must include a bibliog­ raphy of the publications cited in the text.

References should be presented as in the following examples (Harvard method): * Journal articles: Conroy, M. J. & Noon, B. R., 1996. Mapping of spe­ cies richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Books or other non–periodical publications: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Contributions or chapters of books: Macdonald, D. W. & Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conserva­ tion biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt & J. D. Nichols, Eds.).

Oxford University Press, Oxford. * Ph. D. Thesis: Merilä, J., 1996. Genetic and quantitative trait variation in natural bird populations. Ph. D. Thesis, Uppsala University. * Works in press should only be cited if they have been accepted for publication: Ripoll, M. (in press). The relevance of population studies to conservation biology: a review. Anim.

Biodivers. Conserv.

References must be set out in alphabetical and chrono­

logical order for each author, adding the letters a, b, c,... to papers of the same year. Bibliographic citations in the text must appear in the usual way: "...according to Wemmer (1998)...", "...has been defined by Robinson & Redford (1991)...", "...the prospections that have been carried out (Begon et al., 1999)..."

Tables. Must be numbered in Arabic numerals with reference in the text. Large tables should be narrow (across the page) and long (down the page) rather than wide and short, so that they can be fitted into the column width of the journal.

Figures. All illustrations (graphs, drawings, photo­ graphs) should be termed as figures, and numbered consecutively in Arabic numerals (1, 2, 3, etc.) with reference in the text. Glossy print photographs, if essential, may be included. The Journal will publish colour photographs but the author will be charged for the cost. Figures have a maximum size of 15.5 cm wide by 24 cm long. Figures should not be tridimen­ sional. Any maps or drawings should include a scale.

Shadings should be kept to a minimum and preferably with black, white or bold hatching. Stippling should be avoided as it may be lost in reproduction.

Legends of tables and figures. Legends of tables and figures should be clear, concise, and written both in English and Spanish.

Main headings (Introduction, Material and methods, Results, Discussion, Acknowledgements and Refer­ ences) should not be numbered. Do not use more than three levels of headings.

Manuscripts should not exceed 20 pages including figures and tables.

If the article describes new taxa, type material must be deposited in a public institution.

Authors are advised to consult recent issues of the journal and follow its conventions.

Animal Biodiversity and Conservation 33.2 (2010)

Animal Biodiversity and Conservation Subscription Form  Please enter our subscription to Animal Biodiversity and Conservation  66 e Spain  69 e Europe  76 e rest of world  Single use subscription:  21 e Spain  24 e Europe  31 e rest of world  Please despatch my issues by air mail (supplement of 6 e for outside Europe)

 Please send me the Instructions to authors

Name Institution

Address

Payment method International Cheque payable to Institut de Cultura de Barcelona and drawn against a Spanish bank.

Send cheque by postal mail to: Lluïsa Arroyo

Dept. of Scientific Publications

Museu de Ciències Naturals de Barcelona

Psg. Picasso s/n.

08003 Barcelona, Spain Bank Transfer to Caixa d’Estalvis i Pensions de Barcelona ("La Caixa") IBAN: ES03 2100 3000 1422 0170 1046 Swicht code / bic code: CAIX ES BB

Send this order form by postal mail to:

Lluïsa Arroyo Dept. of Scientific Publications Museu de Ciències Naturals de Barcelona Psg. Picasso s/n.

08003 Barcelona, Spain

VII

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Animal Biodiversity and Conservation 33.2 (2010)

IX

Welcome to the electronic version of Animal Biodiversity and Conservation

th

is

to

Re c

ele

om

ct

yo u

ro

me

nic

nd

ac rl ce ibr ss ar y!

http://www.bcn.cat/ABC

Animal Biodiversity and Conservation joins the recent worldwide Open Access Initiative of providing a permanent online version free of charge and access barriers This is the result of the growing point of view that open access to research is essential for efficient and rapid scientific communication

ABC alert, a free alerting service, provides eâ&#x20AC;&#x201C;mail information on the latest issue To sign on for this service, please send an eâ&#x20AC;&#x201C;mail to: abc@bcn.cat

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Animal Biodiversity and Conservation 33.2 (2010)

XI

Arxius de Miscel·lània Zoològica vol. 8 (2010) 2010 Museu de Ciències Naturals ISSN: 1698–0476

Índex/Índice/Contents Ferman, L. M., Peter, H.–U. & Montalti, D., 2010. A study of feral pigeon Columba livia var. in urban and suburban areas in the city of Jena, Germany. Arxius de Miscel·lània Zoològica, vol. 8: 1–8.

Abstract A study of feral pigeon Columba livia var. in urban and suburban areas in the city of Jena, Germany.— A population of feral pigeons, Columba livia var. was conducted in the city of Jena, Germany, from July to December 2007. Daily censuses were conducted by walking ten transects in a selected area of the city, five transects in built up areas and five in the suburbs. Pigeon population density was higher in urban areas than in suburbs but differences were not significant. Main behavioural activities recorded were resting, preening, flying, eating, sunning and roosting. Regular locations of activities were rooftops and roof edges in urban areas, and rooftops, eaves on balconies in suburban areas. The plumage phenotype most frequently recorded in both areas was Blue bar.

Key words: Columba livia var., Feral pigeons, Urban birds, Jena city, Germany.

Fresneda, J., Bourdeau, C. & Faille, A, 2010. Sobre la presencia de Catops subfuscus Kellner, 1846 en los Pirineos (Coleoptera, Leiodidae, Cholevinae, Catopini). Arxius de Miscel·lània Zooògica, vol. 8: 9–14.

Abstract On the presence of Catops subfuscus Kellner, 1846 in the Pyrenees (Coleoptera, Leiodidae, Cholevinae, Catopini).― We provide new distribution data for Catops subfuscus Kellner, 1846. We update the geonemy of the species and, based on recent data, we confirm its presence in the subterranean environment on both sides of the Pyrenean massif. Illustrations of the aedeagus and a distribution map are provided.

Key words: Cholevinae, Catops subfuscus, Subterranean environment, Pyrenees.

Veracini, C. & Garcia–Franquesa, E., 2010. The primate collection at the Natural Science Museum of Barcelona. Arxius de Miscel·lània Zoològica, vol. 8: 15–52.

Abstract The primate collection at the Natural Science Museum of Barcelona.― The Natural Science Museum of Barcelona (MCNB) houses a total of 309 specimens of non–human primates. The collection comprises 102 stuffed animals, 33 skins, 73 skeletons, 24 postcranial skeletons, eight mounted skeletons, 54 skulls, three whole animals in alcohol, and 31 other samples (bones & other). Over the last two years the collection has been completely reviewed and reorganized. The collection contains 39 genera and includes a wide range of extant non–human primates. It houses specimens from Africa, Asia and South and Central America, with 10.26% of samples being Strepsirrhines, 26.92% New World monkeys and 62.18% Old World monkeys. The Museum houses some endangered or rare species. In this work we present the contents of the recent review with new and updated taxonomic attributions together with a complete list of samples that includes information on age, class and preservation status for each specimen.

Key words: Naturalistic Collection, Primates, Review.

Web: http://www.bcn.cat/arxiusMZ

All works are licensed under a Creative Commons Attribution 3.0 License

"La tortue greque" Oeuvres du Comte de Lacépède comprenant L'Histoire Naturelle des Quadrupèdes Ovipares, des Serpents, des Poissons et des Cétacés; Nouvelle édition avec planches coloriées dirigée par M. A. G. Desmarest; Bruxelles: Th. Lejeuné, Éditeur des oeuvres de Buffon, 1836. Pl. 7

Editor executiu / Editor ejecutivo / Executive Editor Joan Carles Senar

Secretaria de Redacció / Secretaría de Redacción / Editorial Office

Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer

Museu de Zoologia Passeig Picasso s/n 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail mzbpubli@intercom.es

Consell Assessor / Consejo asesor / Advisory Board Oleguer Escolà Eulàlia Garcia Anna Omedes Josep Piqué Francesc Uribe

Editors / Editores / Editors Antonio Barbadilla Univ. Autònoma de Barcelona, Bellaterra, Spain Xavier Bellés Centre d' Investigació i Desenvolupament CSIC, Barcelona, Spain Juan Carranza Univ. de Extremadura, Cáceres, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales CSIC, Madrid, Spain Adolfo Cordero Univ. de Vigo, Vigo, Spain Mario Díaz Univ. de Castilla–La Mancha, Toledo, Spain Xavier Domingo Univ. Pompeu Fabra, Barcelona, Spain Francisco Palomares Estación Biológica de Doñana, Sevilla, Spain Francesc Piferrer Inst. de Ciències del Mar CSIC, Barcelona, Spain Ignacio Ribera The Natural History Museum, London, United Kingdom Alfredo Salvador Museo Nacional de Ciencias Naturales, Madrid, Spain José Luís Tellería Univ. Complutense de Madrid, Madrid, Spain Francesc Uribe Museu de Zoologia de Barcelona, Barcelona, Spain

Consell Editor / Consejo editor / Editorial Board José A. Barrientos Univ. Autònoma de Barcelona, Bellaterra, Spain Jean C. Beaucournu Univ. de Rennes, Rennes, France David M. Bird McGill Univ., Québec, Canada Mats Björklund Uppsala Univ., Uppsala, Sweden Jean Bouillon Univ. Libre de Bruxelles, Brussels, Belgium Miguel Delibes Estación Biológica de Doñana CSIC, Sevilla, Spain Dario J. Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain Alain Dubois Museum national d’Histoire naturelle CNRS, Paris, France John Fa Durrell Wildlife Conservation Trust, Trinity, United Kingdom Marco Festa–Bianchet Univ. de Sherbrooke, Québec, Canada Rosa Flos Univ. Politècnica de Catalunya, Barcelona, Spain Josep Mª Gili Inst. de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Edmund Gittenberger Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands Fernando Hiraldo Estación Biológica de Doñana CSIC, Sevilla, Spain Patrick Lavelle Inst. Français de recherche scient. pour le develop. en cooperation, Bondy, France Santiago Mas–Coma Univ. de Valencia, Valencia, Spain Joaquín Mateu Estación Experimental de Zonas Áridas CSIC, Almería, Spain Neil Metcalfe Univ. of Glasgow, Glasgow, United Kingdom Jacint Nadal Univ. de Barcelona, Barcelona, Spain Stewart B. Peck Carleton Univ., Ottawa, Canada Eduard Petitpierre Univ. de les Illes Balears, Palma de Mallorca, Spain Taylor H. Ricketts Stanford Univ., Stanford, USA Joandomènec Ros Univ. de Barcelona, Barcelona, Spain Valentín Sans–Coma Univ. de Málaga, Málaga, Spain Tore Slagsvold Univ. of Oslo, Oslo, Norway

Animal Biodiversity and Conservation 24.1, 2001 © 2001 Museu de Zoologia, Institut de Cultura, Ajuntament de Barcelona Autoedició: Montserrat Ferrer Fotomecànica i impressió: Sociedad Cooperativa Librería General ISSN: 1578–665X Dipòsit legal: B–16.278–58

Les cites o els abstracts dels articles d’Animal Biodiversity and Conservation es resenyen a / Las citas o los abstracts de los artículos de Animal Biodiversity and Conservation se mencionan en / Animal Biodiversity and Conservation is cited or abstracted in: Abstracts of Entomology, Agrindex, Animal Behaviour Abstracts, Anthropos, Aquatic Sciences and Fisheries Abstracts, Behavioural Biology Abstracts, Biological Abstracts, Biological and Agricultural Abstracts, Biology and Environmental Sciences, Biosis, Current Contents/Agriculture, Current Primate References, Dialnet, Doaj, Dulcinea, Ecological Abstracts, Ecology Abstracts, Entomology Abstracts, Environmental Abstracts, Environmental Periodical Bibliography, Genamics JournalSeek, Genetic Abstracts, Geographical Abstracts, Índice Español de Ciencia y Tecnología, International Abstracts of Biological Sciences, International Bibliography of Periodical Literature, International Developmental Abstracts, Marine Sciences Contents Tables, Oceanic Abstracts, Raco, Recent Ornithological Literature, Referatirnyi Zhurnal, Science Abstracts, Scientific Commons, Scopus, Serials Directory, Ulrich’s International Periodical Directory, Web of Science (SCIE), Zoological Records.

Índex / Índice / Contents Animal Biodiversity and Conservation 33.2 (2010) ISSN 1578–665X

119–129 M. E. Pocco, M. P. Damborsky & M. M. Cigliano Comunidades de or tópteros (Insecta, Orthoptera) en pastizales del Chaco Oriental Húmedo, Argentina

187–194 C. Kanagaraj, G. Marimuthu & K. Emmanuvel Rajan Genetic analysis on three South Indian sympatric hipposiderid bats (Chiroptera, Hipposideridae)

131–142 J. Fresneda, C. Bourdeau & A. Faille Descripción de Bathysciola liqueana sp. n. de los Pirineos centrales (Francia). Designación de lectotipos y datos de distribución de las especies del grupo de B. meridionalis (Jacquelin du Val, 1854) (Insecta, Coleoptera, Leiodidae, Cholevinae, Leptodirini)

195–203 C. Román–Valencia, C. García–Alzate, R. I. Ruiz–C. & D. C. Taphorn Bryconamericus macarenae n. sp. (Characiformes, Characidae) from the Güejar River, Macarena mountain range, Colombia

143–150 J. Lozano Habitat use by European wildcats (Felis silvestris) in central Spain: what is the relative importance of forest variables?

151–185 Review J. A. Downing, P. Van Meter & D. A. Woolnough Suspects and evidence: a review of the causes of extirpation and decline in freshwater mussels

205–208 Letter to Editor B. L. Allen Did dingo control cause the elimination of kowaris through mesopredator release effects? A response to Wallach and O’Neill (2009) XI Abstracts del volum 8 (2010) d'Arxius de Miscel·lània Zoològica Abstracts del volumen 8 (2010) de Arxius de Miscel·lània Zoològica Abstracts of issue 8 (2010) of Arxius de Miscel·lània Zoològica