Skip to main content

Inside Medicine Magazine Fall 2019

Page 1

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

1


Matthew T. Owen, MD

Specialty: Knee, Shoulder Medical School: University of Alabama at Birmingham Residency: University of Alabama at Birmingham Medical Center Fellowship: Taos Orthopaedic Institute

and function of the Attune total knee improve the daily life of my patients vs total greater overall range of motion and stability. Many patients insist they “forget� they even have a total knee implanted. -Jack Moore, MD

2

Spring Issue 2019


From here, Anywhere.

Patients implanted with the ATTUNE® Knee have reported improvements in the following outcomes: stability, function, range of motion, and reduced pain.1 The ATTUNE Knee can help you get back to your life and pursuing your passions sooner vs. other knee brands.2,3 1. Hamilton WG, Brenkel, I, Clatworthy M,, Dwyer K, Gibbon A, Kantor S, Lesko J, Himden, S. Early Outcomes with a New primary TKA system vs. contemporary TKA: interim results of two worldwide, multi-center prospective studies. American Academy of Orthopaedic Surgeons (AAOS), San Diego, California. March 14-18, 2017; Poster #106. Other implants tested: SIGMA Knee (DePuy), NexGen® (Zimmer), Triathlon® (Stryker). 2. Etter K, Lerner J, Kalsekar I, de Moor C, Yoo A, Swank M. Comparative Analysis of Hospital Length of Stay and Discharge Status of Two Contemporary Primary Total Knee Systems. J Knee Surg. 2017. 1(212): 1-10. DOI https://doi.org/10.1055/s-0037-1604442. 3. Clatworthy, M. (2015). An Early Outcome Study of the ATTUNE® Knee System vs. the SIGMA® CR150 Knee System. DePuy Synthes Companies White Paper. DSUS/JRC/0814/0418. In an IRB approved early outcomes study, physiotherapists collected data on 40 patients implanted with ATTUNE® Knees and 40 patients with SIGMA® CR150 knees. The results demonstrated that patients implanted with the ATTUNE Knee had statistically significant improvements in some early outcomes, other outcomes demonstrated a trend favoring the ATTUNE Knee, and some outcomes were equivalent.

For more information, visit www.ATTUNEknee.com © DePuy Synthes 2017. All rights reserved. DSUS/JRC/1117/2458 The third party trademarks used herein are the trademarks of their respective owners.

Inside Medicine | Spring Issue 2019

3


TREATMENT

that stands up One out of two adults has back pain. When it keeps you from doing your routine, then it’s time to find the options that are right for you. Call us to treat your entire spine. It’s care that helps get you back to your life.

(256) 533-1600 | spineandneuro.org 4

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


HEALING STARTS HERE. • Knee, Shoulder and Hip Pain • Hand, Wrist and Elbow Injuries • Foot and Ankle Conditions • Arthroscopic Surgery • Joint Replacement • Sports Medicine • Spine Medicine • Neurosurgery • Podiatry

256.881.5151 Huntsville

22

Inside Medicine | Spring Issue 2019

256.230.9607 Athens

256.306.0800 Decatur

www.sportsmedalabama.com

256.464.8200 Madison

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

5


features &

CONTENTS

Sharing with Purpose

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

VOL 3

ISSUE 15

CO N T R I B U T O R S

Kimberly Waldrop, MA

FEATURES Cancer Warrier a story of survival

Information is Power learn your cancer risk

Ethnic Diversity in Medical Research

08

CONTENT Mental Health & the Holidays

20

32

changing personalized medicine

The Perfect Home

helping a loved one with a disability

Controlling Allergies how to handle them all year long

Margetta Thomas Josh Woods Jackie Makowski Rachel Sullivan, MFTA

tips to handle it with ease

12

Kari Kingsley, MSN, CRNP

Larry Parker, MD

26

Rodney Farmer Kelly Reese Victor Chin, MD

50

Patricia Hartley Tiernan O'Neill Elizabeth McCleskey, DO Marilyn Ligon, MD S A LE S & M A R K E T I NG

Kelly Reese, Founder

Join our mission to establish and grow an alliance among our community and healthcare providers. Together, we can change the way healthcare information has been and will be distributed for years to come.

To reach our readers, whether through editorial contribution or advertising, please contact Kelly Reese at kellyreese. im@gmail.com or 256.652.8089

Making a Difference

MD

Lisa Layton, VP Sales/Marketing CH I E F E D I T O R I A L W RITER

Kimberly Waldrop, MA GRAPHIC DESIGN

Leigha Parker P U B LI S H E R S

Blake Bentley, President w w w . i n s i d e m e d i c i n e m a g a z i n e.com

The information and opinions contained in this publication constitute general medical information only and should not be construed as medical advice. Before making important medical decisions, readers should consult with a physician or trained medical provider of their choice and have their needs and concerns assessed in a clinical setting appropriate for their problem. 6

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


}

Life

starts all over again when it gets crisp in the -F. Scott Fitzgerald

fall.

Another change of the season and another issue of Inside Medicine…two of my favorite things!! I don’t know how we’ve packed so much good information and editorial into one magazine, but we have done our best. There are so many things to read about, learn about, and share in this edition. The crisp in the air and the smell of a good fire should have you ready to sit and relax and read. In this issue, you can read about things ranging from acupuncture to stories of back pain and cancer studies. We have a few mental health articles to help us remember to handle the stress and pressures of society around us! Our hope and prayer with this publication is to always reflect God’s love. We work hard to try and give you stories that are uplifting, informative, and even sometimes spiritual. In this edition of Inside Medicine, we hope you find something you can use or share with others. I love Kari Kingsley’s story about the Yoga Ranger. Michael Streeter proves to be a man with a vision of perseverance and determination. He wasn’t going to let pain stop him and he has shown just that. Find out how he faced his battles and overcame. Kari also shares the story of Pammie Jimmar. Pammie was diagnosed with cancer and took the battle on as a warrior. I know you will enjoy reading about both of these happy endings. You can also read about up and coming alternative medicines and what they can do to improve our lives. Not surprisingly, the use and prevalence of these antidotes are growing and succeeding. What is CBD oil and is it legal? Find out in this issue! There are many more stories to enjoy and so much information is available to you. As always, we hope you enjoy our magazine and will share it with others. If you ever have any questions or concerns, ideas for stories, or want to be a contributor, please let us know

p o r d l a W y l r e b Kim

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

7


Cancer Warrior Not all of us will be presented with the opportunity to look death in the face and rise up to fight.

Pammie Eagle Jimmar is the Vice Vice President President of of Small Small Business & Events at the the Huntsville-Madison Huntsville-Madison County County Chamber of Commerce. She would would like like to to especially especially thank the amazing team at at Clearview Clearview Cancer Cancer Institute Institute and Hudson Alpha for continuing their their fight fight to to cure cure cancer. She would also like to to thank thank Inside Inside Medicine Medicine for affording her the opportunity to share share her her journey. journey. 8

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

by, Kari Kingsley, MSN, CRNP

Life always gives you a choice. Lay down and die or stand up and fight. Fighting is not a given. It’s a choice. A choice to become a warrior. But we are not born warriors. Life presents challenges and obstacles, and we make the choice to go to war. Webster’s Dictonary defines a warrior as a person engaged in struggle or conflict. But it is how that person enters into battle that makes them a true warrior. Rather than fighting out of obedience or allegiance, a true warrior engages in battle out of personal choice. On February 21, 2019, Pammie Eagle Jimmar was faced with the battle of her life. On that day, she heard the one word that would change her life forever. Cancer. Through all the amazing advancements in medical science, this one word can shake a person to their core. Pammie was diagnosed with Stage 2 Invasive Ductal Carcinoma. A million thoughts went through her mind as her doctor laid out the unnerving news. “I am human. All kinds of things were going through my mind. I cried and cried and I cried!” Pammie’s thoughts immediately jumped to those she loved. “How would I tell my family and friends? Should I just keep silent?” After crying for what seemed like an eternity, Pammie drove home and told her Mom. Together they decided that this was just a bump in the road and that she, with the help of her family, would get through this. “I remember saying God’s got my back and I’ve got so much FAITH, so let’s get this battle started!” Rather than taking her new diagnosis lying down, Pammie took on this fight with grace, passion, intensity, and intelligence. She had unwavering faith that God’s grace and mercy would see her through. Pammie chose to become a warrior. The next few days were a blur. MRIs, CTs, Bone Density Scans, lab work and doctor appointments flooded Pammie’s schedule. She remembers the fear that came with each test. “It was scary because the machines were so huge, sterile and cold.” Pammie recalls crying at every doctor’s visit in the beginning because of fear of the unknown. This was a new diagnosis. New terminology. She had no idea what to expect. Luckily, she was placed in the care of a compassionate oncologist at Clearview Cancer Institute. The physician immediately told Pammie that together they would win this fight. His main goal was to keep her alive. This was music to her anxious ears. Soon after, Pammie underwent placement for a port-a-cath and began chemotherapy. She underwent a total of 4 treatments of Adriamycin to target


the tumor. Better known as the Red Devil, she renamed it the Red Angel. “This treatment drained all of the energy from me, took my appetite away, and made me sick, however I knew it was working in my favor. Next, Pammie endured an additional 16 rounds of chemotherapy and a lumpectomy, followed by 16 more rounds of treatment in combination with radiation. A series of tests were arranged to determine the amount of tumor regression. Pammie and physician were faced with difficult news. The cancer began to grow in a contained area of the breast. “He went over several options, and I decided to go with a unilateral mastectomy; coupled with 16 rounds of chemotherapy.” After the 11th round of chemo she began to develop neuropathy in her fingers and toes. Her physician again reviewed her options and together they made the decision to stop the chemo treatments. The decision paid off. On September 13,2019. Pammie was considered cancer free. Pammie says she has always had faith. “Faith is believing. I won this battle because of my faith in knowing that I would be cured of cancer coupled with lots and lots of prayer.” A dear friend and cancer survivor gave Pammie a book by Christine Caine called “Unshakable”. She read the little book during her meditation hour daily. She recalls what she calls a “golden nugget” from the book –“Unshakable faith is impossible to change, shake, or beat down. The kind of faith that is confident in knowing Jesus, our Rock and Mighty Fortress. The One who promised to never leave us nor forsake us. The One who causes us to triumph over any hurdle or situation trying to destabilize us or stop us from fulfilling our God-given purpose.” She triumphantly says “I Thank God for saving me. Because of him I am cancer free!” Pammie has been overwhelmed by the support she has received from family and friends. “They have been amazing. My mom is my HERO! She has been with me throughout this entire journey. She has never once left my side.” Pammie moved to the Huntsville area 7 years ago knowing only family members and her boss. “I’d have to say this is the best community I’ve ever lived in. Everyone rallied for me and just stepped in and helped me and my family in more ways that you could ever imagine. My heart is full just thinking about it. I never knew how much people loved and cared about me and my family. I am so blessed to have witnessed the love and support this community has given me.” Pammie says she has surrounded herself with the most positive people. “They radiate positive vibes,” Pammie feels God knew this is exactly what she needed in her life to complete this journey. Pammie is grateful to her coworkers at Huntsville-Madison County Chamber of Commerce for their tremendous moral support. When asked who the most inspirational person in her life is, she answers with grace and pride. “My beautiful mom inspires me every day of my life. “She has been my rock throughout this entire journey and my loudest cheerleader.” She never missed an appointment, scan, test, or chemo

More than 4,200 tests taken already More than 4,200 tests taken already and

genetic testing genetic testing for risk for cancer cancer risk

AAsimple cheekswab swab simple cheek can help help empower you can empower you tomake make important to important healthcare forfor healthcaredecisions decisions you and your family. you and your family. Learn about your genetic risk for certain

Learn about your genetic risk for certain cancers including breast, ovarian, cancers including breast, ovarian, colorectal and prostate cancer. In collaboration with yourcancer. physician colorectal and prostate a genetic counselor, use the In and collaboration with your physician information to plan future medical care. and a genetic counselor, use the information to plan future medical care. Remember: you share genetics with your family. What you learn could potentially Remember: share genetics with your impact youryou parents, siblings, children, cousins andyou others. Have a conversation family. What learn could potentially with your aboutsiblings, the Information is impact yourfamily parents, children, Power and initiative. cousins others. Have a conversation

with your Men are family also at about risk forthe Information is breast cancer. The genes Power initiative. included in this test are

Men are alsofor at all. risk for meaningful breast cancer. The genes To order yourare test kit, visit included in this test meaningful for all. www.information-is-power.org

Questions? 256-327-9597 or

informationispower@hudsonalpha.org sponsored by our generous friends at

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

9


...cont’d from page 9

treatment. Pammie also says that all survivors of cancer inspire her daily. “They are mighty, fierce warriors.” Cancer warriors. It is possible to fight more than one battle at a time. “I haven’t shared this with many people but not only was I about to put on all of my armor and fight the battle of my life, I was also going through a divorce. I know this sounds crazy, but I never really got the opportunity to process the divorce because so much was going on in my life. The divorce, the cancer diagnosis, preparing a house to be sold, preparing my baby boy to head off to college 1,300 miles from home, and trying to wrap my head around the changes in my life was a huge pill to swallow.” Pammie’s faith never wavered. “I just knew God would take care of me through all of this.” Pammie knew that He had a plan and purpose for all of this and if she would just have faith and know that He would not put more on her than she could bear she would be protected on this journey. Pammie has helped others by sharing her courageous battle with cancer publicly. She radiates grace and keeps faith that God is always working in her favor. “Cancer is an awful disease and I feel once people know you have it, they begin to feel sad and sorry for you. I never wanted people to feel this way about me. I wanted them to feel hopeful that I would beat this disease. Hands down, I wanted them to know that I had faith and that this too would pass. God was helping me along with their prayers to win this battle. I love this community and after a while, everyone began to see that I was strong and mighty and had faith to get through this journey.” When asked what she would tell someone with a new diagnosis of breast cancer, she replies, “I would first tell them that I am on the battlefield with them, battling this disease with them and that they don’t have to go through this alone. Let your family and friends help you on this journey. Stay positive and surround yourself with positive people, and don’t forget to sprinkle all of the above with a lot of faith.” Pammie has been chosen as the honorary guest speaker at the 2019 Tie the Ribbons Luncheon supporting Hudson Alpha’s breast and ovarian cancer research. She says she is also honored to be recognized as a Breast Cancer Survivor and to be able to share her story with others in hopes of inspiring someone who may be going through the same journey. When she meets those she has encouraged, she calls it receiving Golden Nuggets. “Going through this journey, these were very powerful for me to receive – little blessings from God.”

Pammie is the most courageous of warriors. Not only has she taken onthe battle to save her own life and beat breast cancer, she has also taken on the battle of bringing awareness to her journey in the hopes of supporting and helping others. Blessed be the LORD, my rock, who trains my hands for war, and my fingers for battle – Psalm 144:1.

Pammie is a true cancer warrior.

Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.

10

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

Photo credits: Savannah Pedersen


I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

11


In 2014, world-renowned geneticist Dr. Mary-Claire King challenged the HudsonAlpha Institute for Biotechnology to offer free and reduced cost genetic cancer risk screening, regardless of family history.

Alabama men & women learn their cancer risk through Information is Power by Margetta Thomas


HudsonAlpha accepted that challenge and launched the Information is Power initiative in 2015, which has continued to expand. Now in its fourth year, Information is Power has given 4,200 individuals more information about their cancer risk. The test, offered by genetic testing company Kailos Genetics, tests the well-known BRCA1 and BRCA2 genes, as well as several dozen other genes linked to breast, ovarian, colon and other cancers. Jill Howell, a native of Huntsville, Ala. lost her mother to ovarian cancer 35 years ago. After turning 50 – the same age as her mother was when she passed away – Jill made the decision to undergo genetic testing to learn her ovarian cancer risk. Through Information is Power, Jill learned she was at a higher risk of getting breast cancer than ovarian cancer and underwent both a hysterectomy and a mastectomy. "By having the positive results, I was able to qualify to have a hysterectomy," she said, "The surprise was, I didn't know I was going to have a mastectomy, too. "I could have waited for the mastectomy for a year or even two years because the doctors would say we could find that early, but I didn't want them to find it, ever." The test is offered for free to women and men 28-30 years of age who reside in Madison, Morgan, Limestone, Jackson and Marshall county. Other adults, 19 and older residing in those counties, may take the test for a reduced cost of $129. Brad Garland of Decatur, Ala. wanted to learn more bout his health risks and see what he could potentially pass on to his children. When he heard about Information is Power, he decided to add it to his Christmas list. “I have two children, so as an adoptee, it’s great to know that I found out a little bit more about my health history," said Brad. Three percent of participants have received a positive result, which means they have an increased risk of cancer. However, a negative result does not does not guarantee that you will never develop cancer. Hannah Ward – who now lives in Birmingham but was a Huntsville reporter at the time of testing – said after watching her mother and grandmother battle breast cancer, she began to wonder, “Was I next?” This uncertainty drew her towards Information is Power. Although her results were negative, she still plans to frequently see and talk to her doctors about her family history. "The most important part of the initiative is that it starts a conversation,” said Hannah. “I chose to take the test because I knew it was actionable information that would only help me prepare for the future.”

Jill Howell Jill Howell

Hannah Ward

Brad Garland

Information is Power is made possible by support from the Russel Hill Cancer Foundation, community partnerships and philanthropic support. To order a test or gift a test to a loved one, visit information-is-power.org.


} COVER FEATURE

by, Josh Woods

14

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


ceso's mission: to equip physical therapists with the tools in healing, strengthening, and empowering people. Aceso Design was launched with the passion to intersect modern engineering and physical therapy and to advance the effectiveness of patient rehabilitation. By replacing traditional weights with a combination of a high-powered servo motor and advanced software controls, Aceso has built a system specializing in three fields of physical therapy: strength training, exercise science, and rehabilitation. Strength training with Aceso aims to offer the most intuitive and accurate workout every time. Paired with an app in the user’s device and using templated settings, Aceso automatically adjusts to ensure that each rep maximizes work within the parameters of the individual’s rehab schedule and physical ability without risk of injury or damage. Integrated micro processors in the machine evaluate each workout live in conjunction with your device to recommend new routines, helping reach your fitness goals. In the focus of exercise science, Aceso’s servo motor can process over 1,000 data points per second in real time to your connected device. From your device, the data from each workout can be clearly viewed according to the metrics you choose to focus on. Aceso specializes in gathering data sets such as range of motion, velocity of workouts, dynamic weight ranges, and many more. We believe this data will open the opportunity to more efficiently and effectively improve the performance of future users. Through the use of dynamically adjusting resistance, Aceso offers eccentric, iso-metric, and iso-kinetic routines all from one machine. Using the data from these workouts, PT’s are able to more accurately guide patients in their recovery and training. Among a myriad of workout modes and data visualization options, the machine has several “fail-safe” systems in place. Aceso uses a mechanical 3-point safety system, demanding total security in the machine’s usage. But that’s enough about the abilities and features of the machine. I believe where a company comes from is as important as where it is headed. Aceso started a few years ago when I had the privilege to work with classmates at the University of Alabama in Huntsville on a summer design project. Somehow, I convinced my friends to help build a device that could read muscle strain vs weight in a leg raise device. This experience fueled my interest in the world of physical therapy, and the more I learned the more I fell in love with creating advanced solutions to complex needs within the field. Having close friends struggle to recover after ACL surgeries, or seeing a mother with double knee surgeries unable to tie her child's shoes fueled my ambition and trajectory of my research. I knew I couldn’t ignore the call I felt and had to use my knowledge and skills in mechanical engineering to help improve the field of sports science and rehibition.

I love engineering and technology. I went to school to learn the necessary skills to build, design, and develop complex machines and systems, but I think what it is essential to ask several questions. Why? Why work hard? Why spend hours upon hours studying engineering statistics and dynamics? Why start a company with your friends and try to change the world? My answer: people.

It’s simple when I think about it. There's nothing that even begins to take precedence over my relationships with other people. It's the only thing that truly matters. My relationships with other people have been my greatest struggles and my greatest accomplishments. I can only say that I am blessed to have been given the opportunity in life to work with an amazing team, deliver to excited clients, and impact people in a meaningful way. It means the world to me.

Josh Woods CEO Aceso Designs acesodesign.com

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

15


}MISSIONS

16

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

Inside Medicine | Spring Issue 2019

51


BACK PAIN… a patient testimonial by Jackie Makowski

From jumping out of airplanes with a parachute strapped tight around his body to patrolling the dusty streets of postwar Iraq, Taurus Smith has had a distinguished 20-year career in the United States military. As a high school graduate, Smith had joined the ROTC as a way to pay for college. What he found in the military was a fulfilling career his family could be proud of and a powerful camaraderie of service men and women who shared his ideals. Yet some of the challenging, mandatory training in the military has led to back pain in recent years. When Smith, who is a military member stationed in Huntsville, Alabama, began experiencing excruciating back pain several years ago, he thought the military career he loved was in jeopardy. After seeing several different types of doctors, he eventually found his way to the Tennessee Valley Pain Consultants, who successfully reduced his pain and helped make it possible for him to continue serving the country. TAURUS SMITH’S PATIENT STORY There is a saying in the military that “everyone is a rifleman.” Since every serviceman can be deployed around the world at any time, the military requires every member to stay at high standards of physical fitness. For Smith, there have been challenging 12-mile road marches carrying a 40-lb rucksack on his back and a weapon in his arms. He’s jumped out of a helicopter and accidentally landed in a tree with his feet dangling six feet off the ground. He’s completed four-mile runs followed by 12-mile road marches while training lieutenants. For most of his career, Smith completed the physical fitness tests and exercises with no problems. But then the pain started a few years ago.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

17


...cont’d from page 17

“It was really bad aching pain, a throbbing in my lower and middle back. It got to the point where I started taking all types of anti-inflammatories. When I was ordered to do a physical fitness test, I would take painkillers and then take more after the test was over just to reduce the pain,” Smith said. “Sometimes it would take a while to stand up straight.” “I was pretty sure that my military career was going to be over.” Smith sought treatment from a variety of doctors who couldn’t quite pinpoint the condition or provide significant relief. He first saw a physical therapist who worked with him on a program of exercises to strengthen the hip and stabilize the pelvic area – to no avail. His primary care physician referred him to a rheumatologist to examine him for rheumatoid arthritis. Another doctor examined him to see if he had a bulging disc in the spine. “No one could say specifically what the problem was,” he said. GETTING PAIN RELIEF Finally, Smith was referred to the Tennessee Valley Pain Consultants at Huntsville Hospital, where specialists in pain management pinpointed the source of his pain. They administered a series of facet joint injections, which has dramatically increased his mobility and reduced his pain. Dr. John Roberts is a double board-certified physician in anesthesiology and pain management at the Tennessee Valley Pain Consultants who has treated many patients like Taurus Smith in his career. Dr. Roberts served 12 years with the United States Air Force and was the Chief Anesthesiologist and Director of Acute and Chronic Pain Services at Keesler Air Force Base in Biloxi, Mississippi.

When patients like Mr. Smith come in with injuries and progressive pain over many years and they may not have been given discriminate information about the cause of the condition, our physicians will take an extensive patient history, conduct a physical exam, and look at the imaging to determine the source of the pain. 18

- John Roberts, MD, DABA

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

For Taurus Smith, the team at the Huntsville Hospital and Tennessee Valley Pain Consultants then administered diagnostic injections to determine the exact part of the spine that was generating the pain. Mr. Smith was diagnosed with spondylosis, a degenerative condition affecting the joints or facets in his spine. A physician administered facet joint injections which delivers anti-inflammatory steroid medication. The injections were successful and reduced Smith’s pain by 50 percent. Getting significant relief from longstanding pain means that patients like Taurus Smith can start stretching and moving the joints and muscles that have become less mobile over the years. The immobility caused by the enduring pain typically shortens the muscles and deconditions the part of the body where the pain is found, which causes even more pain and suffering. “Our goal is to break that cycle of pain,” Dr. Roberts said. Dr. Roberts emphasized that while there is no cure for degenerative problems that have caused progressive pain, “What we can do is manage the pain and improve people’s lives and their daily functioning.” Taurus Smith currently receives quarterly facet joint injections administered by his physician in Huntsville Hospital’s outpatient procedural suites located in Governors Medial Tower. The relief from his back pain has made it possible for him continue his military career, including resuming his duty of leading high intensity trainings for young lieutenants. “The pain isn’t gone but the level of intensity has been reduced from a 9 to a 5. Now it’s more manageable to stay fit,” he said. “I’ve been in military the 20 years, going on 21. It’s the only real job and career I’ve had in my life and it’s all I’ve known since I’ve been an adult. I identify with being a military member and love working with other people who have the same ideals of selfless service, protecting freedom and the Constitution,” Smith said. “It was disappointing to hear someone tell me initially that I’m medically unable to continue this career, so it was definitely great to have found a way to continue to serve without excruciating pain.”

Tennessee Valley Pain Consultants offers immediate appointments for patients with acute and chronic pain. Call (256) 2657246 to schedule an appointment with an expert in anesthesiology and pain management. For more than 20 years, Tennessee Valley Pain Consultants and Huntsville Hospital have been the regional leader in nonsurgical pain relief services. The practice has the area’s only team of double-board certified physicians in anesthesiology and pain management with more than century of combined experience. tnvalleypain.com (256) 265-7246


I nI snisdi ed eMM e de idciicni en e | |S pFa r ilnl gI sIssus ue e2 20 01 19 9

19 5


Mental Health the Holidays by Rachel Sullivan, MFTA

Perhaps you experience stress around the holidays or have heard of people that do. We see it advertised as this amazing time of thankfulness and joy, and while it can be, the reality is it does not always feel that way. Family members we do not care to see, houses that bring back awful memories, the constant obligation to be “merry and bright�. Ugh.

20

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


Stress is your body’s response to external stimuli that presents a challenge or demand. It manifests as a feeling of emotional or physical tension and results from any event that creates feelings of anger, frustration, nervousness, and even motivation.

stimuli appropriately and become overwhelmed by the

information. In a nutshell, stress is the way we describe the feeling we get when are faced with something that seems out of our control or beyond our abilities. Combatting stress, especially around the holidays can be helpful since lower stress levels equates to a higher likelihood to enjoy the present. Relishing in the hereand-now triggers our brain to transmit positive neural signals which assist in creating new, happier memories. This process is crucial in rewriting negative or unhelpful memories from the past. How do we execute this on a practical level?

This narrative is all too familiar in my office this time of year. Individuals who are functioning optimally throughout the year but mid-October hits and so does the dread. They share how the pit begins in their stomach and they just cannot shake it. Or they feel their blood pressure is through the roof 24/7 until after December 31st. They begin experiencing panic attacks, overwhelming anxiety, and high levels of stress, all because they are thinking about the impending holiday season. The range of symptoms that result from compromised mental health during the holidays is serious. We are aware that high levels of stress can affect you physically in many ways, this season is a prime time for those issues to arise. I invite you to discover why we feel this stress and what we can do about it. Stress is not inherently bad. There are many benefits of the stress response when we are properly managing the effects and input. Think about how you use to stress to finish that assignment at the last moment or push through a tough workout. However, stress becomes a negative when we are struggling to process the received

1. RECOGNIZE WHAT YOUR TRIGGERS ARE. Stress tends to present itself in similar situations. For example, you may experience the same feelings from hanging out with family who do not communicate clearly and frequently leave you struggling to be heard as well as in a work setting where your coworkers are not listening to your input. The trigger here is the reality, or anticipation, of being unheard. The physical tension grows in your body as it recalls the defeat in past engagements with these people. The physical may be joined by emotional anguish from feeling so desperately voiceless. Your stress response in this moment is informing you of how your system was unable to find a solution in the past. That deficit is trying to warn you to avoid the situation in order to prevent experiencing those feelings again. Recognizing the trigger helps you understand BEFORE the event that you may need to consider your options before jumping in. 2. UNDERSTAND YOU CAN SET BOUNDARIES FOR YOURSELF. Boundaries are often misrepresented as a bad thing but should be a part of all relationships. Boundaries allow an individual the opportunity to take their beliefs, needs, and limitations into account in order to advocate for and protect themselves from situations or people who cannot or will not bring them life. As humans we all have limits, recognizing what those are and establishing safeguards that keep us protected from harm is a normal part of relating with othI n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

21


...cont’d from page 21

ers. While boundaries are not cutting off everyone who makes us feel uncomfortable, you may have a need to cease contact with certain people in your life. As individuals, the limits we have look vastly different from person to person. Thus, it is crucial we establish personal boundaries that are based on our own unique needs. Discovering what those necessary boundaries are will require some mindfulness about how we feel in those stressful life moments. Healthy boundaries include: deciding to take a step back from a toxic relationship, not participating in a holiday at a certain family members house, or choosing to protect a specific night of the week for your family. The process of implementing boundaries is often stressful. It can be helpful to remember the following: You see a need for this boundary for a reason. Not everyone has to understand the need, they are not managing your stress around this situation. When you implement and respect your own boundaries, others are more likely to follow suit. 3. SCHEDULE TIME FOR ENJOYABLE THINGS. The pressure is on to be at all the mandatory events and celebrations. The stress creeps in when we are not purposeful about taking time to engage in activities we enjoy. During the holidays it can be especially difficult to carve out time for ourselves. However, if we want to reduce our stress levels and increase the enjoyability of the season, doing so should be non-negotiable. Self-care through personal time and hand-picked activities can reset our stress levels and help us approach the must-dos with more patience and strength. A key here is knowing ahead of time what we really enjoy and how much time those activities will take so we can pencil them in accordingly. 30 minutes on a Thursday afternoon? Have your current book ready for reading. One hour on a Saturday? Enjoy that walk around your neighborhood. Remember that self-care is necessary, not selfish. As with all matters of mental health, techniques to reduce stress are not a one-size fits all. However, these tips can be a great starting place in the journey toward a healthier mental state. I encourage you to take the time to be mindful, identify your triggers, recognize what your stress response looks like, and consider what healthy boundaries need to be in place in your life. Give yourself some grace, enjoy the delicious food, and have a Happy Holiday season! Rachel Sullivan, MFTA Solid Ground Counseling Center 9694 Madison Blvd Suite A7 Madison, AL 35758 256-503-8586 solidgroundmadison.com 22

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

Make your home a healthier place. Air Duct Cleaning • HVAC Installation and Repair Chimney Cleaning • Central Vac Cleaning FREE Estimates! • Active Military Discounts We Service All Makes & Models

Over 25 Years Experience AL# 11127

www.AirEssentials.com Serving Huntsville and Madison: 256.217.2273


READY TO FEEL

BETTER?

WHAT ARE YOU WAITING FOR? There’s no time like the start of a new year to work on a new you! TherapySouth can help you heal, move better and overcome the challenges of your physical life. If you haven’t tried physical therapy for the things that keep you from moving without pain—we’re here for you! We can help you get back to the things you love.

Start now and make 2019 your best year ever! TherapySouth is an outpatient physical therapy practice with a fun, family-oriented environment. Our experienced physical therapists know our patients by name and strive to help you achieve your physical goals. You don’t need a doctor’s referral to see a PT, so give us a call today!

Huntsville 6485 University Drive, Suite C | 256.513.8280 www.therapysouth.com

WHO IS

Drop by and meet Clinic Director Michael Beuoy and his team in Huntsville!

YOUR

PT?

ridgeline construction residential / commercial

roofing & exteriors

256-325-1345 I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

23


ABC's of Good Posture

by, Larry M. Parker, MD

As an orthopedic spine specialist, I can tell you that your posture is essential to your health. Good posture helps reduce back and neck pain, minimizes your chances of needing spine surgery, and enables you to live an active lifestyle. But how can you learn to practice good posture? It’s as simple as ABC. EXPERIENCE GOOD POSTURE Spine specialists use the term sagittal balance to describe a patient's spinal alignment or posture. The best way to learn good sagittal balance is to experience what it feels like. Here are the ABCs that I teach my patients to help them experience the feeling of good posture:

STEP A • Begin standing up with your hands by your thighs–slowly arch your lower back and elongate your stomach muscles.

• Gently pull your belly button towards your spine. In this position you should feel your lower back muscles, upper torso, and shoulders aligning over your heels. STEP B • Rotate your shoulders outward so that your thumbs are pointing away from your body.

• At the same time, draw your shoulder blades together. Adding this step should allow you to feel the muscles between your shoulder blades.

STEP C • With your neck muscles relaxed, look up until your ears line up over your shoulders.

• During this step it’s vital that you relax your jaw and breathe through your mouth and nose. After step C, you should feel your elongated stomach and lower back muscles, the strong muscles between your shoulder blades, and your supporting neck muscles. This is the feeling of good posture. 24

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

IDENTIFY POOR POSTURE HABITS On top of experiencing good posture, you can protect your spine by identifying your poor posture habits. Here are some of the posture issues I see at my practice: • In today's world of smart phones and iPads, from a young age we spend countless hours staring down at devices with our necks flexed forward and shoulders slumped. This practice is so widespread that it has led to an epidemic of back and neck pain, or “text neck,” amongst children and teenagers. • As we grow older, we enter the workforce and spend untold hours—with few breaks—sitting at our desk while staring at a computer. This unfortunate habit deconditions our postural muscles and stiffens our spines. • Towards retirement, the cumulative effect of decades of poor posture may result in postural kyphosis, or a permanent flexed-forward posture. A flexed-forward posture comprises quality of life by limiting function, inhibiting balance, and increasing the risk for spinal fractures and chronic back pain. Make posture a good habit You can quickly improve your posture by practicing the ABCs several times a day. If you feel that you need more personalized instruction and strengthening exercises, a physical therapist can evaluate your posture and provide you with additional instruction. Remember that good posture can’t prevent all health problems. If you experience severe back/neck pain or numbness in your arms/legs consult with a spine specialist—these may be symptoms of spinal stenosis or another condition. Take a break right now and practice your ABCs. Good posture can go a long way towards keeping your spine happy and healthy for a lifetime.


I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

25


The Perfect Home by Rodney Farmer

Searching for a new home evokes excitement and anxiety. The average family seeks an intellectually rigorous school district for their children, a community of engaging neighbors, close proximity to work, and safety to flourish. These challenges can be daunting for the average family but imagine finding an ideal home for an intellectually disabled loved one that requires support beyond what you can give them. Where to start? What are the resources available in our area?

26

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


My brother is intellectually disabled and my mother and I faced these same decisions a few years ago. The small town of Fayetteville, TN, was lacking in resources for special needs individuals. My mother developed health issues and we began searching for a group home to assist my brother. He struggles with mental health (it’s not uncommon for special needs people to have mental health problems) and before a group home would consider him, a hospital psychiatric evaluation was required. A case management worker informed us there was only one group home with an available bed 45 minutes north in rural Shelbyville. We hoped for the best. Unfortunately, over time we realized this home did not meet my brother’s needs as he was the only intellectually disabled resident. His opportunities to socialize in the community at this home were limited to an occasional trip to Walmart, the bowling alley, or a Chinese restaurant. I conducted an exhaustive search lasting over a year and eventually found a privately-owned group home in Huntsville with several intellectually and developmentally challenged residents. Although my brother was already receiving Social Security Disability benefits, he was unable to qualify for the Alabama Medicaid waiver for the intellectually disabled due to not yet being a resident of the state. Eventually this problem was resolved. At this second home my brother experienced semi-independent living, shared a small home with one roommate, and lived directly across the street from the main home where meals were offered and entertainment was provided. He was able to participate in a variety of community outings such as bowling and going to church. Sadly, after a few months, it was mutually determined between the home and our family the semi-independent living arrangement was not in his best interest due to his mental health struggles and a more closely supervised setting was deemed necessary. Frustratingly, my brother was admitted to the local hospital for yet another mental health evaluation. After two weeks in the hospital, my brother finally received the Medicaid waiver. Immediately thereafter, case management notified us of a few available homes in the Huntsville area. I spent many hours touring each of these homes and meeting with each facility manager. Eventually my mother and I settled on a third group home for my brother. Three years later, my brother is prospering in this home. He lives in an apartment with supportive group home staff available around-the-clock. He functions independently, cooking and cleaning for himself as well as exercising at the gym. Transportation is provided to all doctor appointments, his place of employment, and to any events in which he wishes to participate. He also lives closer to my wife, newborn daughter, and I, as well as our mother who has since relocated to Huntsville. After 3 attempts and several years, my family finally found the environment in which my brother now thrives. I wish

to reduce the stress other families endure when searching for an intellectually/developmentally-disabled group home endure when searching for a group home by sharing what I have learned about our resources in North Alabama: A 1975 Alabama state law designated Act 310 provides for the formation of public corporations to contract with the Alabama Department of Mental Health to construct facilities and operate programs for mental health services. Such entities are commonly referred to as “310 Boards.” The Madison County 310 Board’s website, madisoncounty310board.org , lists several requirements for the intellectually disabled applicant: • In order to qualify for placement on the wait list, you must FIRST call 1-800-361-4491. An intake coordinator will contact the parents or guardian and schedule an intake appointment to obtain all documentation to support waitlist placement. The application is then forwarded to the Department of Mental Health, Region One Community Services, who ultimately determines eligibility and approves placement on the waitlist. • An I.Q. less than 70 in order to be eligible for services (this test can be performed by a psychologist). • Applicant must demonstrate significant or substantial functional limitations in three or more of the following major life activities: self-care, receptive and expressive language, learning, self-direction, mobility, and capacity for independent living; these must occur prior to the age of 18. • Once awarded, the intellectual disabilities waiver provides a variety of services including but not limited to: residential living, day habilitation, pre-vocational services, job coaching, physical therapy, behavioral therapy, personal care transportation, skilled nursing, crisis intervention and more. North Alabama offers those with intellectual and developmental disabilities several areas of employment, cultural events, and educational opportunities. Many disabled people are employed at the Arc of Madison County, Publix, and the YMCA. Huntsville has been one of many host cities yearly for The Night to Shine prom, sponsored by former University of Florida and NFL quarterback Tim Tebow to provide a unique experience for those with special needs. Merrimack Hall Performing Arts Center in Huntsville has a mission to provide visual and performing arts education and cultural activities to children and adults with special needs. Several athletes represent Huntsville and north Alabama every I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

27


...cont’d from page 27

“The Madison County 310 Board provides support coordination and case management services to the citizens of Madison County who are diagnosed with an Intellectual Disability (ID) and/or Developmental Disabilities. It is the mission of Madison County 310 Board to ensure provision of a system of effective and efficient services The system of services shall be person- and family-driven, provided in the least restrictive setting, promote and protect a person's rights, maximize person and family input, and use existing support systems whenever possible. Our staff advocate for the wants and needs of persons served, follow through to assist them in accessing and obtaining services, and follow up to ensure the needs are met. Every person served should always be treated with dignity and respect; and our goal is to work to ensure this basic human right is met.” -Kate DuBois, Support Coordinator Supervisor, Madison County 310 Board

“I will have been with The Arc of Madison County for 16 years this November. During this time The Arc has experienced a lot of changes in how services are provided to individuals with intellectual and/or developmental disabilities. We have transitioned from a program that only provides day habilitation services to one that provides opportunities for community employment, volunteering, community exploration and experience, early intervention and transition services for high school students, to include 2 Project Search sites which provide internships for high school and young adults. In addition, The Arc recently was awarded certification by the Commission on Accreditation of Rehabilitation Facilities which opens the door for us to be able to provide employment services to a more diverse population.” -Terri Haisten, Work Programs Coordinator, Arc of Madison County

year in the state Special Olympics held annually in Troy. As of September 5, 2018, there were 5,260 slots available to those with Intellectual Disabilities in the state of Alabama. A 2014 article written on al.com stated there were over 3,100 individuals on the waiting list for services through the state’s Medicaid Waiver. The lack of slots for those in need is unfortunately an issue not unique to Alabama. In 2015, an estimated 2,100 were waiting for group home placement in Connecticut. From 2015 to 2018, the numbers rose from 2,000 to nearly 3,000 in Colorado. Presently, over 13,000 intellectually disabled individuals are currently waiting for services in Pennsylvania. My one word of advice to families of special needs individuals is to be persistent in obtaining waiver support and group home placement. I also hope to encourage everyone to support and advocate the broadening of resources for intellectually and developmentally disabled people in north Alabama. Mr. Farmer is a 3rd-year medical student at the Edward Via College of Osteopathic Medicine, Auburn Campus.


Visit us at UrgentMedcareOnline.com Visit us at UrgentMedcareOnline.com

Urgent Care ing Urgent Care ing We are your fast & friendly urgent care resource. We are your fast & friendly urgent care resource. • Injuries, Illnesses & Physicals • Injuries, Illnesses & Physicals • No Appointment Necessary • No Appointment Necessary • Open 7 Days a Week with • Open 7 Days a Week with Extended Hours Extended Hours • On-site Lab & Digital X-rays • On-site Lab & Digital X-rays

Hwy 72

26

Inside Medicine | Spring Issue 2019

Nick Davis Rd

Steger Rd

1 43

Nick Davis Rd

Steger Rd

1

d sR ld ie Sh d sR ld ie Hwy 72 Sh

Jordon Rd

256-828-1154 256-828-1154

12287 US-231/431 N Meridianville, AL 35759 Mon-Fri: 8am-7pm Meridianville, AL 35759 Sat-Sun: 8am-7pm 9am-5pm Mon-Fri: Sat-Sun: 9am-5pm

43

MooresMoores Mill RdMill Rd

Jordon Rd

256-830-5777 256-830-5777

7583 Wall Triana Hwy Madison, AL 35757 Mon-Fri: 8am-7pm Madison, AL 35757 Sat-Sun: 8am-7pm 9am-5pm Mon-Fri: Sat-Sun: 9am-5pm

Ln on Ln rson Patte Patters

256-382-3680 256-382-3680

MERIDIANVILLE MERIDIANVILLE 12287 US-231/431 N

Wall Triana Wall Triana Hwy Hwy

46 Shields Huntsville, ALRd 35811 Mon-Fri: 8am-7pm Huntsville, AL 35811 Sat-Sun: 8am-7pm 9am-5pm Mon-Fri: Sat-Sun: 9am-5pm

MADISON MADISON 7583 Wall Triana Hwy

Wi llo Willo w Oa w Oa kD kD r r

HUNTSVILLE HUNTSVILLE 46 Shields Rd

• Staffed by Experienced Healthcare • Staffed by Experienced Healthcare Professionals Professionals • Most Insurance Plans Accepted, • Most Insurance Plans Accepted, and Reasonable Cash-pay Pricing and Reasonable Cash-pay Pricing • Occupational Health Services • Occupational Health Services

Monroe Rd

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9 Monroe Rd

29


s i t Wha ULTRACELL? by, Kelly Reese

The population has been rising year after year and life expectancies have topped out at a higher average age than ever before. We are all hoping and preparing to live longer than our grandparents and parents. But, are we prepared for the financial burdens that are expected as medical costs increase with time and age? On top of just medical costs, insurance premiums can now be more than a car payment and in some cases, higher than a mortgage. Because of this, alternative medical treatments are hitting the market and flying off the shelves. If you have watched the news or read trending social media feeds, then you are well aware of the CBD oil that has grown in the past few years as a significant resource for the consumer. Not only is it great for consumers but stay at home moms and busy professionals have resorted to flexible hours by switching gears from corporate

30

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

America to financial freedom by becoming a distributor. The vast majority of people still skeptical of the actual benefits would like to understand the strategy behind an industry promising health, wealth, and life balance. Let's find out from entrepreneur Denise Moore about her company, Zilis and their product UltraCell. WHAT IS ULTRACELL? It is the main request of consumers. It is Cannabidiol (CBD)/Hemp oil, CBD UltraCell Topical, and the newest CBG oil. We are adding products that will help our Endocannabinoid System. Our UltraCell is pet-friendly and not all CBD products are. HOW CAN CBD IMPROVE YOUR OVERALL HEALTH? The human body creates its own endocan-


nabinoids, (the Endocannabinoid System), to maintain a healthy body by getting enough sleep, combating illness and disease, and regulating pain. When the system becomes unbalanced or deficient we do not sleep well, we feel pain, and we fall ill. Ultra cell is a full spectrum CBD/hemp oil, and with phytocannabinoids naturally found in hemp, our product helps balance the ECS. IS CBD LEGAL? Yes! With the passage of the 2018 Farm bill, all states are legal with no more than .3% THC. Ours is less than the .3% to allow everyone to use it without worrying about it showing up on a drug test. WHAT QUESTIONS DO YOU FACE DAILY WHEN ACTIVELY SELLING YOUR PRODUCT LINES? I get a lot of questions about how it can help and is it legal. DO YOU SEE A CONSIDERABLE RISE IN THE MARKET OVER THE NEXT TEN YEARS? Definitely! It is expected to be a trillion-dollar business by 2030. HOW WILL THE EVOLUTION OF THIS MARKET CHANGE THE WAY MEDICINE AND BIG PHARMA COMPANIES RESPOND? Full-Spectrum Science? Unlike other hemp oils that draw upon only isolated portions of the hemp plant, UltraCell is derived using full-spectrum hemp oil extract, known as cannabidiol, or CBD. While CBD has known health benefits, the reality is the other CBD-isolate products cannot benefit the body like our full-spectrum hemp oil, which utilizes all parts of the hemp plant and its phytocannabinoids. UltraCell contains over 400 biologically active compounds, including CBD and an entourage of other cannabinoids, flavonoids, terpenes, vitamins, fatty acids, and minerals. By utilizing all aspects of the hemp plant in its natural state, UltraCell creates an environment where the natural compounds work together to create a synergistic effect. WHAT DO YOU LOOK FOR WHEN FINDING A GOOD QUALITY CBD OIL? You want to find a CBD Oil that has a human study, CBD oil that is full spectrum, water soluble, has a 3rd Party Testing Certificate and is U.S. Hemp Authority Certified.

Ultracell is produced by Zilis, The Ultra Company. For more information visit their website www.zilis.com/dmoore. Thank you is expressed to Denise Moore.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

31


WHY WE NEED ETHNIC DIVERSITY IN MEDICAL RESEARCH by, Victor Chin, MD

32

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


Imagine you are being treated for cancer with a chemotherapeutic drug. You assume the drug is approved by the U.S. Food and Drug Administration (FDA) to be safe and effective for your particular cancer condition based upon results from medical research trials. Did you know if you are a person of color your cancer drug may have never been tested in your unique ethnic or racial group? In essence, you could be an unwitting participant in an unregistered medical experiment. MINORITIES ARE UNDERREPRESENTED IN RESEARCH STUDIES: Cancer specialist Dr. Jonathan Loree and colleagues in the August 15, 2019 edition of Journal of the American Medical Association Oncology reviewed 230 cancer drug trials conducted from 2008-2018 that involved over 112,293 participants. Only 7.8% of the 230 studies documented participants from the 4 major races in the United States (white, Hispanic, black, Asian). The percentage of trials including participants from different racial groups did not change significantly over the 10 year period. The percentage of Hispanic and black participants in the cancer studies was far lower than the proportion of Hispanic and black patients who would have disease in the general population. The burden of disease among minority groups was not addressed in the makeup of participants in cancer research studies. THE EFFICACY OF A MEDICATION CAN VARY IN DIFFERENT RACIAL GROUPS: Why is it important to study medications in various racial/ethnic populations? A particular medication’s efficacy may vary depending on the patient population. For example, current guidelines from the American Heart Association recommend that for treatment of hypertension in black patients a physician start with a thiazide-type diuretic or a calcium channel blocker. In research studies, these medications have shown relative greater efficacy in blacks for hypertension as opposed to an angiotensin converting enzyme (ACE) inhibitor, which is often used first-line in other patients. THE ARGUMENT FOR SOCIAL JUSTICE IN MEDICAL RESEARCH: Numerous advocates raise the issue of social justice in medicine - the idea that racial group disparities in the delivery of healthcare and outcomes in health should be eliminated. The inclusion of people of color in medical research is crucial to improving health for all people in our society. The FDA has recognized the importance of diversity in medical research and in 2016 issued a non-legally-binding guidance statement encouraging study sponsors to include more racially/ethnically diverse participants in trials:

“FDA expectations are that sponsors enroll participants who reflect the demographics for clinically relevant populations with regard to age, gender, race, and ethnicity.” In June 2019 the FDA released a new draft guidance statement furthering its encouragement of diversity in medical research in which it stated: “Broadening eligibility criteria and adopting more inclusive enrollment practices will open clinical trials to a diverse participant population reflective of the population that will use the drug if the drug is approved.”

Personalized healthcare and medicine have brought this issue front and center. The keyword here is ‘personal’ which for me involves the reality that every male on my biological father’s side of the family died from cancer. The fact that I have sons that may be affected by the lack of racial diversity in medical research hits home. I could no longer be a bystander when witnessing the lack of ethnic diversity in both genomic research and clinical trials. I thought that if government and policymakers will not address this form of health disparity and health inequality, then it is up to me to intervene and make a positive impact. I want to ensure the treatments of the future apply to people of color.” -Delmonize “Del” Smith, founder and CEO of Acclinate Genetics explaining his inspiration to diversify medical research.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

33


...cont’d from page 33

A CALLTO ACTION FROM ACCLINATE GENETICS: Calls for social justice alone in medicine have resulted in inadequate results. It is time to utilize the unique problem-solving abilities of the world of business to reduce racial differences in health. More than just a headhunter to match people of color to medical trials, Acclinate Genetics aims to build and maintain relationships with college graduates of color. Acclinate Genetics serves as a liaison between the medical research industry and well-educated patients of color by vetting research opportunities and educating its participants about medical research. Acclinate Genetics strives to bridge the lack of trust many minority patients have in the medical research system. By having well-educated active participants of color in research trials, pharmaceutical companies can produce better quality research trials with fewer patients lost to follow-up. By testing in a diverse population, unique efficacies/toxicities of drugs may be found in specific racial/ Acclinate Genetics ethnic groups that would go undiscovered if only a white 601 Genome Way Huntsville, AL 35806 acclinategenetics.com male study population were used.

Some of the more common symptoms seen in patients at The Smith Family Clinic for Genomic Medicine include, but aren’t limited to:

The Smith Family Clinic uses the power of genomic medicine to diagnose diseases impossible to diagnose through other means. From your DNA, we derive answers that can guide care and make therapeutic decisions.

• Epilepsy • Cognitive or developmental delay • Adult-onset neurological disease (neuropathies, dystrophies, myopathies) • Primary immune disorders • Congenital heart defects, cardiomyopathies, or arrhythmias • Other unexplained or unusual disease processes

The Smith Family Clinic could help. Talk to your doctor or contact the clinic today.

256.327.9640

701 McMillian Way NW, Ste.A., Huntsville, AL 35806 on the campus of HudsonAlpha Institute for Biotechnology

34 52

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9 I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8


Could Acupuncture

Be the Treatment You Never Knew You Needed? by Patricia Hartley

“Your body is like a car,” explains Dr. Ly. "At around 100,000 or 200,000 miles, parts start to wear out, and most all of us will have pain.” What can we do to help alleviate our pain? Your answer may just be acupuncture.

A WIDE RANGE OF BENEFITS Most of Dr. Ly’s patients first visit his practice with multiple problems, and most often these include neck and back pain. He explained when we have one problem, for example, pain in one knee, our body will compensate by shifting weight to the other side of our body. This leads to more problems in the spine and hips if we wait to seek treatment. Dr. Ly recommends that patients start out with four visits, after which they can really tell the acupuncture treatments are working. Most sessions last about an hour, but can vary based on the reason for the visit. Although acupuncture can indeed fix the root cause of pain, it may come back simply because of our habits, lifestyles, Acupuncture is one component of Traditional Chinese Medicine or the work we do. For example, if we don’t improve our posture or (TCM), a holistic approach to overall wellness and health which continue to keep our heads down and focused on our phones, the the Chinese embraced more than 5000 years ago. Acupuncture pain that acupuncture resolved may return. The benefits of acupuncture go well beyond just treating pain, was added to the TCM regimen of herbs, acupressure, exercise, and a healthy diet around 1000 BC. Acupuncture continues to though. Dr. Ly says that he regularly treats patients for sinus and allergy problems, arthritis, fibromyalgia, and headaches. Acupuncgrow in popularity today as more people experience its benefits. ture is also a recommended and proven treatment for infertility and immune system disorders. However, the second most popular TCM IS BASED ON THE THREE BASIC BELIEFS: treatment at his practice is his weight loss regimen. • The body can heal, “Acupuncture treatments on the ears can help to shut down • Every aspect of the body is connected, like a small universe, your appetite,” said Dr. Ly. “As part of the weight loss program, we and also have natural Chinese herbal supplements that will help with • Preventive health and wellness practices will help you avoid metabolism.” pain and illness. There are so many benefits to acupuncture and so many reasons to try it. Dr. Ly and his staff personalize treatments and programs WHY ACUPUNCTURE? According to Dr. Frank Ly, a fourth-generation TCM practi- to each individual patient and his or her needs, and does not retioner and acupuncture specialist based in Huntsville, Alabama, quire a physician referral to schedule an appointment. no one is exactly sure how or why acupuncture works so well. “There are 14 main meridians in the body that we work on, and Acupuncture and Wellness Center we know acupuncture helps with any type of injury or pain,” said Dr. Frank Ly, DOM, C.A. and Dr. Orlando Ly, C.A. Dr. Ly. “For thousands of years, practitioners have talked about 7500 Memorial Pkwy SW, Suite 120 Huntsville, AL 35802 (256) 882-5508 lyacupuncture@att.net how acupuncture at these points opens up energy within the body. www.acupunctureandwellnesscenters.com There’s still a lot of mystery about how exactly this happens.” New research at Duke University found that “energy” acupuncture releases may have something to do with endorphins and dopamine the procedure releases. Our bodies naturally produce endorphins like cortisone to alleviate and eliminate pain and inflammation, and dopamine helps our bodies relax and experience feelings of happiness — all without prescription medications or invasive procedures. “In this country, when we hurt, we take pain pills,” explained Dr. Ly. “These medicines can lead to digestion problems, and they’re usually only treating the symptoms of an issue and not the problem that led to the pain in the first place. Acupuncture works on the whole body, the whole system, not just the pain.”


Making a Difference

Connecting our community our medical experts

&

For more information on contributing, testimonials, editorials or advertisements, contact Kelly Reese at kellyreese.im@gmail.com

insidemedicinemagazine.com


38

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


yoga ranger by, Kari Kingsley, MSN, CRNP

Most of us breathe an average of 12-18 times a minute. That’s close to a thousand breaths an hour. If we are lucky, we may reach 700,000,000 breaths in a lifetime. Breathing is so simple that the body’s autonomic nervous system takes over when we forget. Tiny nerve cells in the brainstem automatically send signals to our intercostal muscles and diaphragm to contract and relax in consistency and cooperation. Breathing is vital for aerobic creatures such as humans. The body uses oxygen delivered through breath to break down food for energy. But breath is so much more than the delicate bodily service keeping us alive. Michael Streeter is a yoga teacher and former army ranger. He currently teaches classes at Hot Yoga of Huntsville, Light on Yoga, and the YMCA. He also teaches private sessions. You can follow Michael Streeter on Instagram: YogaRanger275 I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

39


...cont’d from page 39

Everyone in a delivery room waits with nervous anticipation until they hear a newborn infant take her first breath and then wail as she forces air out of her lungs for the first time. Sometimes a friend’s “humph” or “sigh” (perhaps with rolling eyes) can convey an entire paragraph. Breath can also signal great loss when it ceases. Think back to a difficult situation when you told yourself to “just breathe”. A stressful midterm. Mounting tensions with a coworker. The moments after a terrifying event when you are trying to right yourself. It’s simple, right? Just…. Breathe…… If only it were that easy. The simplicity of the command is outweighed by the looming shadow of anxieties driving the need to halt the racetrack of thoughts and emotions in our cerebral cortex. Breathing is more than drawing in oxygen-rich blood to nourish vital physiologic structures. Being able to breathe signifies our ability to calm the mind. So, what happens when the mind encounters a disconnect and loses the ability to tell our body to “just breathe”? In these intense moments, we may still be fulfilling the function of breathing, but trauma, stress, and anxiety can bombard the brain with a misfire of signals leading to activation of our “fight or flight” reflexes.

Breath:

Air taken into and exhaled out of the lungs. Something so effortless yet so multifaceted.

For Michael Streeter, years of mental and physical trauma began to manifest in the form of post-traumatic stress disorder. Streeter, as he prefers to be called, reached his lifelong dream of joining the special forces in the 1990s. He served with Alpha Company weapon’s platoon, 2nd Battalion, 75th Ranger regiment and deployed to many conflicts throughout the world. He has incredible memories of the time he served and literally lived the stuff Hollywood turns into blockbuster movies. But his heroic journey came at a price and left him with considerable mental and physical scars. While serving in Jordan, a parachuting accident turned disastrous. Streeter plummeted 100 feet to hard earth, resulting in broken vertebrae and a shattered left ankle. Even after the fall, Streeter tried to “Ranger Up” and continue performing his duties, not knowing the extent of his injuries. Eating Motrin like M&M’s, he continued to parachute and even went on an assault climber’s course in Alaska. Eventually, he was unable to perform his duties and parted ways with the Army in 1999. But Streeter faced a new battle. Acclimating to civilian life with chronic pain, an unhealthy lifestyle, and evolving depression would prove nearly insurmountable. Memories of the fall and vivid images of those suffering around the world would haunt his dreams and waking moments. Suffering from a traumatic brain injury, he began to feel very angry and paranoid with coworkers, friends, and family members. His anger would become so heightened, he would black out. He describes the paralyzing moments leading up to these episodes as if he were watching his life unfold with no control over his actions. “No one was in the driver seat. I couldn’t be reasoned with. And there was no switch to turn it off.” He lost several jobs and was on the brink of divorce. He lost his ability to breathe.

May the rulers of the earth keep to the path of virtue For protecting the welfare of all generations. May the religious, and all people be forever blessed, May all beings everywhere be happy and free. - Mangala mantra

40

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


After years of emotional turmoil and taking dozens of prescription medications to treat pain, depression, anxiety, and insomnia, Streeter found a lifeline. He entered into a holistic program at the Ralph H. Johnson VA Medical Center pain clinic under the care of an inspirational physician. Dr. Robert Freeman had practiced as a primary care provider for many years and was seeing little to no results with mainstay pharmacologic therapies. At 300 pounds and on numerous prescription medications, Streeter and his skilled team of providers had their work cut out for them. A combination of exercise, clean eating, meditation, and acupuncture had him on the right track. But Streeter’s life was forever changed after he began practicing yoga. Streeter had been breathing his entire life but he finally learned how to take a breath. Breath became a way of life. Inhale fully, exhale fully. He was able to change his breathing techniques and use the whole breath. As his core became stronger, his back pain subsided and the weight melted away. After a year of Vinyasa flow, he began to practice Astanga on a regular basis. The Astanga primary series spoke to Streeter’s comfort of routine and offered strong physical challenges. The practice helped him link mind and body through breath in a manner most accessible to his Ranger mentality. Streeter was so inspired and motivated by his journey to health that he enrolled at the Jiva Yoga Center in Hilton Head, South Carolina to become a yoga instructor. He is now member of the Yoga Alliance and active with several local and national organizations that address veterans, addiction, and PTSD. Streeter is affiliated with Bearded Warriors, Comfort Farms, and GallantFew. He has recently been invited to participate as the honorary guest speaker at the 2019 North Alabama Out of the Darkness Walk hosted by the American Foundation for Suicide Prevention. Streeter says “Yoga is a lifestyle. The definition of yoga is the union between two things: mind and body. And those two things are connected through breath. Yoga gives us the tools to manage life experiences.” Streeter said he was faced with a choice. He could let his injuries and mental health issues define him as a victim, or he could move forward through forgiveness and self-reflection. “Society forces habits on us.” He, like many others, had been taught to be a “Man’s Man”. Suck it up buttercup. Stand up and take it. Swallow the pill. Push through the pain. “Our society views mental health issues as weakness. Society also attaches mistrust to alternative therapies such as acupuncture, meditation, and yoga. Streeter advises his students to “trust the process”. Embrace the breath. Streeter’s favorite mantra is om gan ganapataye namo namah. Streeter explains that Ganesh (son of Shiva) is known as the remover of obstacles. This mantra encourages strength and wisdom to overcome what stands in your way.

At 300 pounds and on numerous prescription medications, Streeter and his skilled team of providers had cut out for them. A Optiontheir 4: Evenwork your options have options! Try a combination of the three. Many people elect to have a small combination of exercise, cleanAfrin, eating, nasal procedure combined with quitting or using short-term oral steroids and/or switching to non-addicmeditation, and acupuncture had tive medications like nasal steroid sprays as well as safer herbal on remedies Xylitol sprays. But Streeter’s him thelike right track. Be sure to discuss your treatment options as well as alternative your primary after care doctor life wasmedications foreverwithchanged heor ENT. Patient expectation is CRUCIAL. When using intranasal practicing steroid and antihistamine began yoga. sprays, a butter knife is not going to cut like a machete! But how do you eat an elephant? One bite at a time! “Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.” I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

41


WHAT CAN I EXPECT FROM MY PRIMARY CARE CLInIC WHEN SCHEDULING AN APPOINTMENT? by Tiernan O’Neill

42

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9


ne of the most common concerns of both patients and doctors alike seems to be what can they both reasonably expect when an appointment is made at their clinic. As premiums and deductibles rise for patients there can be greater frustration when they don’t believe their money has been sufficiently spent. And for clinics and providers as workload, administrative burden and lastly patient expectations become more and more cumbersome they too wish to find a happy balance between desire and reality. This article is meant to address scheduling, problems covered, financial responsibilities and follow-up and how each directly affects patients as well as providers. SCHEDULING A patient should expect timely access to their primary care provider, and rightfully so. This generally means a routine acute or chronic condition appointment availability within 24-48 hours (business days). Access is one of the main reason patients will or won’t establish themselves with a primary care physician over utilizing urgent care services instead. As an established patient at a clinic, that clinic holds detailed historical information on a patient that can expedite and ease scheduling. Now from the clinic’s perspective, a timely appointment is typically determined by three major components and each of them is heavily influenced by reasonable expectations. There actually has to be an opening on the schedule. No clinic can or should schedule a patient quickly thereby inconveniencing other patients who have had the foresight and organization to plan ahead. Additionally, patients need to be flexible. Should you be unwilling to budge from a specific day or time you need to understand that availability on the schedule could be problematic through no fault of the clinic; as well it is typically not the best way to work with the scheduler so they work with you. Finally, the nature and range of issues wished to discuss within that appointment should be reasonable and practical to fit within the confines and limitations of the clinic’s schedule. Specialty appointments (new patients, physicals, procedures) tend to take more time on the schedule and thus they have limited availability and tend to book out farther in the future. PROBLEMS COVERED A patient should expect to cover the issues they have been scheduled for. When a patient is clear and detailed in the problems they wish to cover in an appointment, every reasonable effort should be made by the clinic and provider to meet those expectations. Within the appointment itself, it is incumbent on the patient to be organized and satisfied with the care they receive. It is often helpful to have your thoughts, issues and possible refills written down to reference throughout the appointment. It does little good other than scheduling a second appointment to call back later and say you forgot something. I would I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

43


...cont’d from page 43

also highly recommend when you are dealing with a new issue, a health issue that is potentially life changing that you bring a friend or family member along with you to the appointment. Many people are often surprised what a second set of ears can hear when your mind is racing with possible implications of news you are receiving. From the provider side, you often hear clinics complain about the “oh by the way” factor. Patients will often add issues within their appointments, which can be the main cause of primary clinics running behind from their pre-set schedule. To this, I generally respond by saying “tough.” Primary care has been, is and always will be affected by these issues. It is the nature of the beast. When these issues present themselves a clinic should have a schedule or method allotted to handle this problem. Now, since primary care clinics have vast histories and tendencies of their patients they should also have a system to recognize, deal with and deter patients who chronically abuse this accommodation on purpose. Ultimately a patient, within reason, can expect to have their concerns and issues covered. A second issue that is worth discussing within this topic is what a patient can expect to get out of their annual physical. A routine physical is for screening purposes only. While it is possibly intended to find health problems that are not normally obvious, it is not designed to coincide with acute issues, known chronic problems, or the possibility of abnormal findings. While some offices will allow patients to coincide annual physicals or preventative visits with diagnostic appointments, patients need to be aware this will add, specifically to the cost, of the encounter. Many people misunderstood the inception of free yearly physicals as a chance to address all of their health problems in one visit without charges. Billing guidelines set forth by the American Medical Association and endorsed by every insurance company clearly allow for clinics to bill for a diagnostic visit (and procedures) along with the physical charges as well. FINANCIAL RESPONSIBILITIES A patient should rightfully expect to satisfy their financial responsibilities in a manner as dictated by the guidelines of the clinic. This is probably an issue or a stance most patients don’t want to hear. But if a clinic is clear and consistent with their guidelines, patients need to follow them. It has been extremely unfortunate the business of health care has for so long and continues to be viewed as a credit industry. Whereby patients or really in fact consumers believe they should receive services and pay at a later date when it feels appropriate to them. You would never imagine a scenario where you buy food at your local grocery store now a days and simply say bill me later. In response to ever escalating costs and collections, many clinics have countered by collecting charges, coinsurances, and deductibles at time of service. Additionally, there has be44

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

come a greater trend lately to keep patient financial credit cards on file for money collecting purposes after insurance determinations.Rather than arguing or even refusing to make such payments, you are best advised to find either an insurance plan or clinic where you can feel most comfortable with your financial responsibilities at time of service. FOLLOW-UP A patient should rightfully expect for timely and complete follow-up from their appointment. Test results, medication refills, and answers to your questions close the loop and should be considered an integral part of the appointment yourself. Providers have a reasonable expectation for their method of choice in delivery to such components to be respected and valued by their patients. Clinics will use a wide array of methods from lower staff relaying information to electronic portal communication to their patients. In cases of other staff relaying information (medical assistants or nurses), as long as the communication is provided by a competent and well versed professional a patient shouldn’t expect relay of information by the provider over the phone directly. Requests that contradict the clinic’s model will often be met with a need for a second appointment and you should understand there are additional scheduling, coverage and financial concerns associated with such. CONCLUSION Both a patient and a provider have every reason to have their above rights to be met. Reasonable expectations contained within should always be granted. Ultimately, no clinic is one size fits all. Should a patient feel they are not getting what they value they can feel free to search out another clinic that will better serve their needs. But patients should be forewarned if your expectations are not reasonable or clear you will likely find yourself bouncing from clinic to clinic and never find the continuity you search for in a primary care clinic. Conversely, no clinic should feel they have to alter their operations or reasonable expectations to meet the needs of every individual patient and their differing desires; and in these cases it is not wrong to suggest a patient they should go elsewhere. However, clinics should also be aware and responsive to popular expectations or they will quickly see their patient panel size shrink below a sustainable level.


MAKE MOVE EVERY COUNT When you Move More every day, you can reach some pretty big goals over time. With motivation, dedication and great foot support, your small daily steps can add up to huge strides. Let your feet take you places you never thought possible!

10

2.5

of stretching is like walking the length of a football field

of walking every week for a year is like walking across the state of Wyoming

Minutes

Hours

30

1

Minutes

Hour

of singles tennis is like walking a 5K

of dancing every week for a year is like walking from Chicago to Indianapolis

20 30

Minutes of vacuuming is like walking one mile

Minutes

of grocery shopping every other week for a year is like walking a marathon

FOR MORE WAYS TO ADD ACTIVITY TO YOUR LIFE, VISIT

Source: http://www.purdue.edu/walktothemoon/activities.html

HEART.ORG/MOVEMORE


Lifestyle Medicine

VS. CANCER by Elizabeth McCleskey, DO

An illness may result in the loss of something of greatest value, namely some aspect of one’s health. When considering cancer, you may think “I am at risk of losing my health and there is nothing to be done about it.” But, is this really true? According to research by Mingyang Song, MD, ScD and Edward Giovannucci, MD, ScD, “about 20-40% of cancer cases and about half of cancer deaths can be potentially prevented through lifestyle modification.”1 Yet, individuals continue to believe there is nothing preventative to be done under the mistaken notion that cancer is about non-modifiable–“nothing I can do about them–risk factors such as genetics, age, or race. Enter the good news, Lifestyle Medicine has evidence-based information on modifiable risk factors and the actions you can take to help counter them: What you put in or on your body, and what you do for your body. Someone is already thinking, “If that were true, then why do picture-of-heath individuals get cancer”? Generally speaking, information about disease and its etiology, complications, etc., fill medical school libraries and is profoundly beyond the scope of this article. Further, certain details of an individual’s life, e.g., childhood and workplace environmental exposures, may never be known and therefore impossible to factor into the individual’s equation. However, it is generally agreed that 40% of cancer diagnoses are preventable with changes to lifestyle. Before you write off lifestyle consider the following: EXPOSURE Smoking has long been linked to lung cancer, sun exposure to melanoma, radiation to thyroid cancer, and Human Papilloma Virus (HPV) to cervical and other cancers. And, have you seen the legal advertisements on TV with regard to asbestos exposure and Mesothelioma? Most of us are aware of at least some cancer/exposure links. Lesser known associations include alcohol’s link with six different kinds of cancer. Another is Diethylstilbestrol (DES), a synthetic estrogen used during pregnancy between 19401971, which resulted in cancer in some of these women and their offspring. Studies are now ongoing in their 46

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

grandchildren. So, the message here is avoidance of exposure to limit your risks. IMMUNITY Think of the immune system as your body’s own little army of “soldiers.” A “foreign invader” such as bacteria, a virus, or even an abnormal cell forming inside the body sends the “soldiers” into action to prevent invasion, replication and dispersion. But, as with certain illnesses like HIV/AIDS, impairment of the immune system can occur. Transplant recipients require immunosuppressive medication to prevent the “soldier” cells from mistakenly attacking the new organ. These “soldiers” also may not be able to destroy unrelated cancer-causing infections or cancer cells, hence the restrictions placed upon these patients regarding crowd exposure, etc. INFLAMMATION When an injury occurs, the body’s immune system sends white blood cells and chemicals to heal the area. This will present as a warm, red area around the wound. However, sometimes after the injury is healed, the inflammation remains. It is even possible to have inflammation without an injury or infection; this chronic inflammation can damage healthy cells and weaken the immune system, leading to development and growth of cancer cells. EXAMPLES FROM EACH OF THREE AREAS Viruses, bacteria, and parasites are all part of the problem. By exposure, they enter the body. Some disrupt the cell communications; others weaken the immune system, decreasing the body’s ability to defend itself against other cancer-causing infections; and a few lead to chronic inflammation. Some like H. pylori (best known as causing stomach ulcers) and Hepatitis C have treatments available. Others such as Hepatitis B and HPV have vaccines available for prevention before exposure. Your doctor will guide you regarding appropriateness of vaccines for yourself and your family. When traveling, educate yourself about the geographic area and the preventive measures you can take to reduce exposure to pathogens.


GENETICS But, what about genes? “If I am programmed this way, I will get cancer.” Not necessarily. There is an exciting area called epigenetics. Let’s explain it this way: DNA is a molecule composed of two strings of building blocks.

CCAAGGCTACTTAGGACTACGGTGA GGTTCCGATGAATCCTGATGCCACT

Genes are certain segments on the DNA that instruct the body by making proteins or performing certain functions.

this mean supplements? No, real food! Blueberries for example, are showing amazing potential in studies to not only prevent cancer from forming but to assist in cancer therapy by making the cancer cell more susceptible to treatment. To see other ways foods can positively affect your health refer to the “The Nutrition Rainbow”2. So, what else can I do? Shown below are other activities you can incorporate and their cancer-busting potential.

CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT Protein 1

Function 1

Protein 2

Protein 3

Protein 4 Function 2

Not all of these instructions are working at the same time. The genes that are not working are “off ” and the ones that are working are “on.”

CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT OFF

ON Function 1

ON Protein 2

OFF

ON Protein 4

ON Function 2

One way cancer can develop is when the DNA is exposed to something such as radiation that causes damage.

XXXX GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT NonFunctional

Function 1

Protein 2

Protein 3

Protein 4

Function 2

But in epigenetics, the DNA is normal. It is how the genes are turned on and off that can initiate cancer. The exciting part is a healthy lifestyle may turn off health damaging genes and turn on the health promoting ones. CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT ON Protein 1

ON Function 1

OFF

ON Protein 3

OFF

ON Function 2

Another way to look at this is a house that is wired with electricity. The lights may be on in three rooms in the morning, two during the afternoon, and one at night. The wiring (DNA) does not change, just how we use it. Turning a light off may be bad (there is a monster under the bed) or good (a romantic evening by the fire). In the same way, genes turning on or off may be good or bad. SO, HOW TO AFFECT THESE AREAS Every time you eat, it is an opportunity to put something into your body to make it function better. Does I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

47


...cont’d from page 47

Hopefully, this article has given you a brief introduction to the relationship between lifestyle changes and their ability to perhaps lessen potential cancer risks, all presented in a way that is understandable to those not seated at the science nerd table. Or, maybe you are still caught up in the “this is too much trouble; this is too unlikely; this is not do-able in a family of five; this isn’t going to mitigate the strong history of “x” cancer in my family,” etc. But, you read the article…all the way to the end. In a nutshell, Motivational Interviewing, a counseling technique, defines five stages of change: (1) Pre-contemplation – “Leave me alone.” (2) Contemplation – “I’m thinking about it, but on the fence.” (3) Preparation – “I’m going to do it.” (4) Action – Do it. (5) Maintenance – Ongoing monitoring. Remember, you read the article…all the way to the end, so you may well be at Stage 2 or even 3. Continue to digest the information and maybe even look up some additional sources online or chat with your primary care doctor or Lifestyle Medicine physician. Should you undertake to make changes, remember perfection isn’t expected or being broadcast on social media. Any change, however small, you undertake to promote better health can only help.

Our therapists provide highly specialized treatments based on a thorough hands-on manual techniques and exercises to facilitate quick and complete recovery.

Call Today 256.883.063 6

www.focus-physio.com 1140 Eagletree Lane SE • Huntsville, AL 35801

48

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

References: 1. Song M and Giovannucci E. JAMA Oncol. 2016;doi:10.1001/jamaoncol.2016.0843. 2. “The Nutrition Rainbow” by The Physician’s Committee for Responsible Medicine. Dr. Elizabeth McCleskey Board Certified in Family and Lifestyle Medicine 103 Intercom Drive , Suite B Madison, AL 35758 Phone: 256-280-3990 Fax: 256-280-3991 HealthStylesDr.com


Tips: The more naturally colorful your meal is, the more likely it is to have an abundance of cancer-fighting nutrients. Pigments that give fruits and vegetables their bright colors represent a variety of protective compounds. The chart below shows the cancer-fighting and immune-boosting power of different-hued foods.

www.PhysiciansCommittee.org • 202-686-2210

17246-NTR • 20171102

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

49


TIPS FROM THE DOC:

Controlling Allergies Whether it is spring or fall in Alabama, allergies seem to be a problem. You may be packing away the past season’s clothes, bringing out the garden tools, or visiting a cotton field but you also better be preparing for the billions of allergen molecules in the Tennessee Valley. Just for reference, in 2012, Alabama was ranked as number two in the country when it comes to the pollen index. If you greet the arrival of spring or fall with watery eyes, sneezing, dark circles under the eyes, and a stuffy nose, it's time to learn a few tricks about coping with seasonal allergies. The most common allergy triggers, according to the Asthma and Allergy Foundation of America, are listed below: • Trees, grass and weed pollen • Mold spores • Dust mite and cockroach allergens • Cat, dog and rodent dander

HOW DO WE CREATE A PERFECTLY GOOD SEASON WHEN IT COMES TO ALLERGIES? TREAT ALLERGIES EARLY • start the medications early to prevent a snowball effect of your symptoms KNOW YOUR OTC (OVER-THE-COUNTER) MEDICATIONS • be careful with some of the oral decongestants which can cause elevated blood pressure, palpitations, or elevated liver enzymes 50

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

by Marilyn Ligon, MD

POLLEN COUNTER • know what type of pollen is swirling around in your area today WASH YOUR HAIR BEFORE BED • so that pollen collected on your hair won't rub off on your pillow LEAVE YOUR SHOES AT THE DOOR • lessens the amount of allergens in the home CONTROL YOUR ENVIRONMENT • use protective allergy masks for tasks like washing the car, mowing the grass, or raking the leaves USE THE RECIRCULATE OPTION IN THE CAR • service the filters in your furnace and air conditioner for better breathing ADJUST THE INDOOR HUMIDITY LEVEL • if your allergies are from spores of mold, aim for a humidity level of less than 50% AVOID SITTING OUTDOORS AROUND FRESH CUT GRASS • this can cause sensitivity for some IMMUNOTHERAPY / ALLERGY SHOTS • proven to provide long-term relief of allergic rhinitis symptoms

I hope you and your sinuses both enjoy the outdoors this year


TRAVELING FOR HEALTHCARE Patients & Families Deserve Comfort

Relax in the Comfort of our Care

Our area’s Top Providers treat patients who travel from all over the country. When it comes to arranging your accommodations, let Hampton Inn & Suites by Hilton service your needs.

AMENITIES ARE OUR SPECIALTY • A short drive from area hospitals • Only two miles from Robert Trent Jones Hampton Cove Golf Course • Conveniently located only 10 minutes from downtown Huntsville • Spacious outdoor pool • Hampton’s free hot breakfast

Hampton Inn & Suites Hampton Cove 6205 Hwy 431 South Huntsville, AL 35763 phone: 256.532.2110 fax: 256.532.1933


I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8

57


Turn static files into dynamic content formats.

Create a flipbook
Inside Medicine Magazine Fall 2019 by Inside Medicine - Issuu