Haematologica. Volume 101, issue 5

haematologica Journal of the European Hematology Association Published by the Ferrata Storti Foundation

Editor-in-Chief Jan Cools (Leuven)

Deputy Editor Luca Malcovati (Pavia)

Managing Director Antonio Majocchi (Pavia)

Associate Editors Hélène Cavé (Paris), Ross Levine (New York), Claire Harrison (London), Pavan Reddy (Ann Arbor), Andreas Rosenwald (Wuerzburg), Juerg Schwaller (Basel), Monika Engelhardt (Freiburg), Wyndham Wilson (Bethesda), Paul Kyrle (Vienna), Paolo Ghia (Milan), Swee Lay Thein (Bethesda), Pieter Sonneveld (Rotterdam)

Assistant Editors Anne Freckleton (English Editor), Cristiana Pascutto (Statistical Consultant), Rachel Stenner (English Editor), Kate O’Donohoe (English Editor)

Editorial Board Omar I. Abdel-Wahab (New York); Jeremy Abramson (Boston); Paolo Arosio (Brescia); Raphael Bejar (San Diego); Erik Berntorp (Malmö); Dominique Bonnet (London); Jean-Pierre Bourquin (Zurich); Suzanne Cannegieter (Leiden); Francisco Cervantes (Barcelona); Nicholas Chiorazzi (Manhasset); Oliver Cornely (Köln); Michel Delforge (Leuven); Ruud Delwel (Rotterdam); Meletios A. Dimopoulos (Athens); Inderjeet Dokal (London); Hervé Dombret (Paris); Peter Dreger (Hamburg); Martin Dreyling (München); Kieron Dunleavy (Bethesda); Dimitar Efremov (Rome); Sabine Eichinger (Vienna); Jean Feuillard (Limoges); Carlo Gambacorti-Passerini (Monza); Guillermo Garcia Manero (Houston); Christian Geisler (Copenhagen); Piero Giordano (Leiden); Christian Gisselbrecht (Paris); Andreas Greinacher (Greifswals); Hildegard Greinix (Vienna); Paolo Gresele (Perugia); Thomas M. Habermann (Rochester); Claudia Haferlach (München); Oliver Hantschel (Lausanne); Christine Harrison (Southampton); Brian Huntly (Cambridge); Ulrich Jaeger (Vienna); Elaine Jaffe (Bethesda); Arnon Kater (Amsterdam); Gregory Kato (Pittsburg); Christoph Klein (Munich); Steven Knapper (Cardiff); Seiji Kojima (Nagoya); John Koreth (Boston); Robert Kralovics (Vienna); Ralf Küppers (Essen); Ola Landgren (New York); Peter Lenting (Le Kremlin-Bicetre); Per Ljungman (Stockholm); Francesco Lo Coco (Rome); Henk M. Lokhorst (Utrecht); John Mascarenhas (New York); Maria-Victoria Mateos (Salamanca); Simon Mendez-Ferrer (Madrid); Giampaolo Merlini (Pavia); Anna Rita Migliaccio (New York); Mohamad Mohty (Nantes); Martina Muckenthaler (Heidelberg); Ann Mullally (Boston); Stephen Mulligan (Sydney); German Ott (Stuttgart); Jakob Passweg (Basel); Melanie Percy (Ireland); Rob Pieters (Rotterdam); Stefano Pileri (Milan); Miguel Piris (Madrid); Andreas Reiter (Mannheim); Jose-Maria Ribera (Barcelona); Stefano Rivella (New York); Francesco Rodeghiero (Vicenza); Richard Rosenquist (Uppsala); Simon Rule (Plymouth); Claudia Scholl (Heidelberg); Martin Schrappe (Kiel); Radek C. Skoda (Basel); Gérard Socié (Paris); Kostas Stamatopoulos (Thessaloniki); David P. Steensma (Rochester); Martin H. Steinberg (Boston); Ali Taher (Beirut); Evangelos Terpos (Athens); Takanori Teshima (Sapporo); Pieter Van Vlierberghe (Gent); Alessandro M. Vannucchi (Firenze); George Vassiliou (Cambridge); Edo Vellenga (Groningen); Umberto Vitolo (Torino); Guenter Weiss (Innsbruck).

Editorial Office Simona Giri (Production & Marketing Manager), Lorella Ripari (Peer Review Manager), Paola Cariati (Senior Graphic Designer), Igor Ebuli Poletti (Senior Graphic Designer), Marta Fossati (Peer Review), Diana Serena Ravera (Peer Review)

Affiliated Scientific Societies SIE (Italian Society of Hematology, www.siematologia.it) SIES (Italian Society of Experimental Hematology, www.siesonline.it)

haematologica Journal of the European Hematology Association Published by the Ferrata Storti Foundation

Information for readers, authors and subscribers Haematologica (print edition, pISSN 0390-6078, eISSN 1592-8721) publishes peer-reviewed papers on all areas of experimental and clinical hematology. The journal is owned by a non-profit organization, the Ferrata Storti Foundation, and serves the scientific community following the recommendations of the World Association of Medical Editors (www.wame.org) and the International Committee of Medical Journal Editors (www.icmje.org).

Haematologica publishes editorials, research articles, review articles, guideline articles and letters. Manuscripts should be prepared according to our guidelines (www.haematologica.org/information-for-authors), and the Uniform Requirements for Manuscripts Submitted to Biomedical Journals, prepared by the International Committee of Medical Journal Editors (www.icmje.org).

Manuscripts should be submitted online at http://www.haematologica.org/.

Conflict of interests. According to the International Committee of Medical Journal Editors (http://www.icmje.org/#conflicts), “Public trust in the peer review process and the credibility of published articles depend in part on how well conflict of interest is handled during writing, peer review, and editorial decision making”. The ad hoc journal’s policy is reported in detail online (www.haematologica.org/content/policies).

Transfer of Copyright and Permission to Reproduce Parts of Published Papers. Authors will grant copyright of their articles to the Ferrata Storti Foundation. No formal permission will be required to reproduce parts (tables or illustrations) of published papers, provided the source is quoted appropriately and reproduction has no commercial intent. Reproductions with commercial intent will require written permission and payment of royalties.

Detailed information about subscriptions is available online at www.haematologica.org. Haematologica is an open access journal. Access to the online journal is free. Use of the Haematologica App (available on the App Store and on Google Play) is free.

For subscriptions to the printed issue of the journal, please contact: Haematologica Office, via Giuseppe Belli 4, 27100 Pavia, Italy (phone +39.0382.27129, fax +39.0382.394705, E-mail: info@haematologica.org).

Rates of the International edition for the year 2016 are as following: Print edition

Institutional Euro 500

Personal Euro 150

Advertisements. Contact the Advertising Manager, Haematologica Office, via Giuseppe Belli 4, 27100 Pavia, Italy (phone +39.0382.27129, fax +39.0382.394705, e-mail: marketing@haematologica.org).

Disclaimer. Whilst every effort is made by the publishers and the editorial board to see that no inaccurate or misleading data, opinion or statement appears in this journal, they wish to make it clear that the data and opinions appearing in the articles or advertisements herein are the responsibility of the contributor or advisor concerned. Accordingly, the publisher, the editorial board and their respective employees, officers and agents accept no liability whatsoever for the consequences of any inaccurate or misleading data, opinion or statement. Whilst all due care is taken to ensure that drug doses and other quantities are presented accurately, readers are advised that new methods and techniques involving drug usage, and described within this journal, should only be followed in conjunction with the drug manufacturer’s own published literature.

Direttore responsabile: Prof. Edoardo Ascari; Autorizzazione del Tribunale di Pavia n. 63 del 5 marzo 1955.

Printing: Tipografia PI-ME, via Vigentina 136, Pavia, Italy. Printed in April 2016.

haematologica calendar of events

Journal of the European Hematology Association Published by the Ferrata Storti Foundation

New Drugs In Hematology Società Italiana di Ematologia (SIE) Chair: PL Zinzani May 9-11, 2016 Bologna, Italy

ESH-EBMT 20th Training Course on Haemopoietic Stem Cell Transplantation ESH EBMT Chairs: J Apperley, E Carreras, E Gluckman, T Masszi May 11-14, 2016 Budapest, Hungary

21st Congress of the European Hematology Association European Hematology Association June 9-12, 2016 Copenhagen, Denmark

EHA Scientific Conference on Bleeding Disorders Scientific Program Committee: C Balduini (Chair), A Falanga (Chair), F Rodeghiero, I Pabinger, M Makris September 14-17, 2016 Barcelona, Spain

2nd International Conference on New Concepts in B-Cell Malignancies European School of Haematology (ESH) Chairs: M Hallek, L Staudt, S Stilgenbauer, A Thomas-Tikhonenko September 9-11, 2016 Estoril, Portugal

10th Hodgkin Symposium University hospital of Cologne Chairs: A Engert, B von Treskow, B Böll October 22-25, 2016 Cologne, Germany

Hematology Tutorial on managing complications in patients with hematologic malignancies in the era of new drugs EHA-ROHS-RSH Chairs: E Parovichnikova, I Poddubnaya, R Foà July 1-3, 2016 Moscow, Russian Federation

Summer School of Personalised Medicine for Health Care Professionals European Alliance for Personalised Medicine (EAPM) July 4-7, 2016 Cascais, Portugal

Calendar of Events updated on April 1, 2016

haematologica Journal of the European Hematology Association Published by the Ferrata Storti Foundation

Table of Contents Volume 101, Issue 5: May 2016 Cover Figure Stem cell transplantation (Image created by www.somersault1824.com)

Editorials 515

Next generation research and therapy in red blood cell diseases Roberta Russo, et al.

518

Innovations in treatment and response evaluation in multiple myeloma Ruth Wester and Pieter Sonneveld

Review Articles 521

Nonmyeloablative allogeneic hematopoietic cell transplantation - Leaders in Hematology review series Rainer Storb and Brenda M. Sandmaier

531

Role of the tumor microenvironment in mature B-cell lymphoid malignancies Nathan H. Fowler, et al.

541

Chronic myeloid leukemia: reminiscences and dreams Tariq I. Mughal, et al.

Articles Red Cell Biology & Its Disorders

559

ATP11C is a major flippase in human erythrocytes and its defect causes congenital hemolytic anemia Nobuto Arashiki, et al.

566

Cannabinoid receptor-specific mechanisms to alleviate pain in sickle cell anemia via inhibition of mast cell activation and neurogenic inflammation Lucile Vincent, et al.

Blood Transfusion

578

Metabolic pathways that correlate with post-transfusion circulation of stored murine red blood cells Karen de Wolski, et al.

587

Impaired killing of Candida albicans by granulocytes mobilized for transfusion purposes: a role for granule components Roel P. Gazendam, et al.

Myeloproliferative Disorders

597

Long-term serial xenotransplantation of juvenile myelomonocytic leukemia recapitulates human disease in Rag2–/–γc–/– mice Christopher Felix Krombholz, et al.

Haematologica 2016; vol. 101 no. 5 - May 2016 http://www.haematologica.org/

haematologica Journal of the European Hematology Association Published by the Ferrata Storti Foundation

Acute Myeloid Leukemia

607

Association of acute myeloid leukemia’s most immature phenotype with risk groups and outcomes Jonathan M. Gerber, et al.

Plasma Cell Disorders

616

Pre-clinical evaluation of CD38 chimeric antigen receptor engineered T cells for the treatment of multiple myeloma Esther Drent, et al.

Cell Therapy & Immunotherapy

626

Effects of anti-NKG2A antibody administration on leukemia and normal hematopoietic cells Loredana Ruggeri, et al.

Stem Cell Transplantation

634

Reduced intensity haplo plus single cord transplant compared to double cord transplant: improved engraftment and graft-versus-host disease-free, relapse-free survival Koen van Besien, et al.

644

Allogeneic unrelated bone marrow transplantation from older donors results in worse prognosis in recipients with aplastic anemia Yasuyuki Arai, et al.

Letters to the Editor Letters are available online only at www.haematologica.org/content/101/5.toc

e164

Using zebrafish to model erythroid lineage toxicity and regeneration Anna Lenard, et al. http://www.haematologica.org/content/101/5/e164

e168

ε-globin expression is regulated by SUV4-20h1 Yadong Wang, et al. http://www.haematologica.org/content/101/5/e168

e173

Anti-hemojuvelin antibody corrects anemia caused by inappropriately high hepcidin levels Suzana Kovac, et al. http://www.haematologica.org/content/101/5/e173

e177

Impaired formation of erythroblastic islands is associated with erythroid failure and poor prognosis in a significant proportion of patients with myelodysplastic syndromes Guntram Buesche, et al. http://www.haematologica.org/content/101/5/e177

e182

Pegylated interferon alpha-2a for essential thrombocythemia during pregnancy: outcome and safety. A case series Yan Beauverd, et al http://www.haematologica.org/content/101/5/e182

e185

Acute myeloid leukemia patients’ clinical response to idasanutlin (RG7388) is associated with pre-treatment MDM2 protein expression in leukemic blasts Bernhard Reis, et al. http://www.haematologica.org/content/101/5/e185

Haematologica 2016; vol. 101 no. 5 - May 2016 http://www.haematologica.org/

haematologica Journal of the European Hematology Association Published by the Ferrata Storti Foundation

e189

Structural modeling of JAK1 mutations in T-cell acute lymphoblastic leukemia reveals a second contact site between pseudokinase and kinase domains Kirsten CantĂŠ-Barrett, et al. http://www.haematologica.org/content/101/5/e189

e192

Activity of the Janus kinase inhibitor ruxolitinib in chronic lymphocytic leukemia: results of a phase II trial David E. Spaner, et al. http://www.haematologica.org/content/101/5/e192

e196

Safety and efficacy of lenalidomide in combination with rituximab in recurrent indolent non-follicular lymphoma: final results of a phase II study conducted by the Fondazione Italiana Linfomi Stefano Sacchi, et al. http://www.haematologica.org/content/101/5/e196

e200

Identification of a novel stereotypic IGHV4-59/IGHJ5-encoded B-cell receptor subset expressed by various B-cell lymphomas with high affinity rheumatoid factor activity Richard J. Bende, et al. http://www.haematologica.org/content/101/5/e200

e204

Early Th1 immunity promotes immune tolerance and may impair graft-versus-leukemia effect after allogeneic hematopoietic cell transplantation Brian G. Engelhardt, et al. http://www.haematologica.org/content/101/5/e204

e209

Natural killer cell licensing after double cord blood transplantation is driven by the self-HLA class I molecules from the dominant cord blood Nicolas Guillaume, et al. http://www.haematologica.org/content/101/5/e209

Comments Comments are available online only at www.haematologica.org/content/101/5.toc

e213

Why should hemophilia B be milder than hemophilia A? Shrimati Shetty, et al. http://www.haematologica.org/content/101/5/e213

e214

Failure to effectively treat chronic graft-versus-host disease: a strong call for prevention Andrea Bacigalupo, et al. http://www.haematologica.org/content/101/5/e214

Haematologica 2016; vol. 101 no. 5 - May 2016 http://www.haematologica.org/

EDITORIALS Next generation research and therapy in red blood cell diseases Roberta Russo,1,2 Immacolata Andolfo,1,2 and Achille Iolascon1,2 1 Dipartimento di Medicina Molecolare e Biotecnologie Mediche, Università degli Studi di Napoli Federico II; and 2CEINGE Biotecnologie Avanzate, Napoli, Italy

E-mail: achille.iolascon@unina.it

P

doi:10.3324/haematol.2015.139238

athogenetic studies on red blood cell (RBC) diseases have always represented a powerful model for the study of medical genetics and for technology innovation in both diagnostics and research. This has mainly been due to the availability of these cells compared to others, such as neurons, myocytes, and so on, that are not so easily available. Indeed, the first and the best molecular characterization of genetic diseases was carried out in RBC disorders.

It is now over 50 years since the first pioneer studies on abnormal globin and glucose 6-phosphate dehydrogenase (G6PD) genes, the forerunners of the current research and molecular diagnosis of Mendelian disorders, and completion of the Human Genome Project was a crucial milestone in the diagnosis and research of genetic disorders. The assembly and refinement of the reference genome provide the mainstay for current knowledge in the field of human genetics. In recent years, scientists have spent much time and effort in identifying genes and mutations that are causative of several diseases, with great success. Although the identification of these genetic variants has improved our knowledge of disease etiology, there is still a considerable gap in our understanding of the genetic factors that modify disease severity. In this context, it is important to consider that there has been a substantial evolution in diagnostic and research technologies. The implementation of the new technologies is changing the approach to diagnosis and research. We started out using Sanger sequencing, and we are now embracing next generation sequencing (NGS), moving from a monogenic approach to an oligo/multigenic one. The application of next generation approaches will increase our knowledge of genetic and genomic differences among individuals, gradually leading to a shift in the clinical management and the therapeutic plan from a populationbased approach to personalized therapy for the individual patient.

The ‘next generation’ era in the field of RBC physiopathology provided important insights into the molecular mechanisms of normal and diseased RBC homeostasis. These findings generated several novel therapeutic approaches that are now being examined in clinical trials.

In the last few years, several studies have supplied new concepts about the regulation of erythrocyte volume. In particular, PIEZO1 has been discovered to be the causative gene of hereditary xerocytosis, also known as dehydrated hereditary stomatocytosis (DHS, OMIM 194380), an autosomal dominant hemolytic anemia characterized by primary erythrocyte dehydration.1,2 Piezo proteins have recently been identified as ion channels mediating mechanosensory transduction in mammalian cells.3 Mutations in PIEZO1 show a partial gain-offunction phenotype with delayed inactivation of the channel suggesting increased cation permeability that leads to erythrocyte dehydration.1,2 In 2015, a second causative gene of DHS was identified, KCNN4, encoding a Gardos channel (a Ca2+ sensitive, intermediate conductance, potassium selective chanhaematologica | 2016; 101(5)

nel).4-6 Similarly to gain-of-function genetic variants in PIEZO1, heterozygous dominantly inherited mutations in the KCNN4 gene lead to greater activity of the channel when compared to the wild type.4 The identification of PIEZO1 and KCNN4 variants in DHS patients strongly indicates that both genes play a critical role in normal erythrocyte deformation and in maintenance of erythrocyte volume homeostasis. Moreover, the identification of variants in these genes will open up new studies on their role in the improvement or worsening of RBC hydration in patients with primary (DHS) and secondary erythrocyte hydration disorders such as sickle cell disease (SCD).

Thus, the routine introduction of NGS targeted panels would most likely facilitate, not only the diagnosis, but also the prognostic evaluation of these patients.

Among the disorders of secondary erythrocyte hydration, recent advances in the pathophysiology of SCD and β-thalassemia have elucidated new possible therapeutic approaches. A clinical trial on senicapoc (ICA-17043), a potent blocker of the Gardos channel, demonstrated that treatment of SCD patients resulted in increased hemoglobin and reduced markers of hemolysis, strongly suggesting that the survival of sickle red blood cells was improved.7 Despite the lack of any reduction in the frequency of pain episodes, the increasing recognition that hemolysis contributes to the development of several SCD-related complications suggests that senicapoc may be beneficial in this disease by decreasing hemolysis.7 Thus, blockers of Gardos and PIEZO1 channels could be used in future clinical practice for the treatment of primary and secondary disorders of erythrocyte hydration.

Likewise, another promising approach for the treatment of both β-thalassemia and SCD is gene replacement therapy. In this approach, samples of multipotent hematopoietic stem progenitor cells (HSPCs) are collected from the patient and subsequently modified to express a β-like globin gene in erythroid precursors; these cells are then re-infused.8 The modified HSPCs will reconstitute the hematopoietic system, thus producing normal, gene-corrected RBCs. This approach still presents many challenges: i) to reduce the tendency of integrated viral vectors; ii) to activate nearby genes; and also iii) to further increase β-like globin expression. Early results of a clinical trial in β-thalassemia major patients treated with improved vectors are promising, and it is hoped that they will lead to advances in the treatment of thalassemic patients.9 The application of gene therapy to treat erythroid disorders regards not only β-thalassemia and hemoglobinopathies. For example, gene therapy has been investigated for Diamond Blackfan anemia (DBA) and other erythroid diseases, such as red cell enzyme disorders, including severe forms of G6PD and pyruvate kinase deficiency.10,11 For most of the anemias due to RBCs defects, blood transfusion therapy or treatment by erythropoiesis stimulating agents (ESAs), such as recombinant EPO, are the front-line therapies.

However, neither of these treatment approaches is without 515

Editorials

Figure 1. Integration between technological updates and clinical applications in diagnosis and therapy of red blood cell (RBC) diseases. Adult hematopoietic stem progenitor cells (HSPCs) or induced pluripotent stem cells (iPSCs) can be used for gene-therapy approaches. DNA extracted from a peripheral blood sample can be used to identify genetic variations by next generation sequencing (NGS). The causative role of these variations can be validated by in vitro/in vivo functional studies and then the commonly used CD34+ HSPCs may be corrected directly by gene therapy or genome editing by CRISPR/CAS9 technology. Alternatively, somatic cells can be isolated by fibroblasts of the patient and reprogrammed to pluripotency, with the resulting iPSCs then being corrected by gene therapy or genome editing and differentiated through erythroid lineage.

risks and they are not effective in all cases. For example, patients with ineffective erythropoiesis do not respond to EPO. Thus, there is a clinical need for novel agents with a different mechanism of action from current ESAs. Members of the transforming growth factor beta (TGF-β) superfamily, which include activins (A-B), growth differentiation factors (GDFs), and bone morphogenetic proteins (BMPs), have been studied as potential regulators of erythropoiesis, iron regulation and globin expression. Some recent studies have investigated the role played by two drugs, an activin receptor IIA (ActRIIA) ligand trap (ACE011 or sotatercept) and a modified ActR type IIB (ActRIIB) ligand trap (ACE-536) in the regulation of late-stage erythropoiesis. It has been recently demonstrated that a mouse version of both drugs, termed RAP-011 and RAP-536, is able to induce differentiation of erythroid cells, improve ineffective erythropoiesis, correct anemia, and limit iron overload in a mouse model of β-thalassemia intermedia.12,13 Both drugs act through inhibition of GDF11, a newly identified regulator of erythropoiesis that will contribute significantly to the understanding of the fine regulation of erythropoiesis and iron metabolism, and to the development of new drugs. So far, two phase II clinical trials have provided proof of the importance of ActR ligand trap molecules in the use of sotatercept in adults with β-thalassemia (clinicaltrials.gov identifier: 01571635) and in transfusion-dependent DBA patients (clinicaltrials.gov identifier: 01464164).

Finally, another no less interesting approach for future therapy in RBC diseases is represented by genome editing technologies. These have mainly been used to study gene function, in the discovery of therapeutic targets, and to develop disease models in several disorders. Considerable 516

progress has been made in genome editing in the past decade via the use of either engineered nucleases systems, such as zinc finger nucleases (ZFNs), transcription activatorlike effector nucleases (TALENs), or of the RNA-guided engineered nucleases based on CRISPR-Cas9 (clustered regularly inter-spaced short palindromic repeats/CRISPR-associated nuclease 9).14-16 The most promising progress has been seen in the use of CRISPR/Cas9 technology for genome correction of specific DNA sequences including changes in either coding or non-coding regions of autologous cell genome.17 This system has become a simple-todesign and cost-effective tool for various genome editing purposes, including gene therapy studies; indeed, it offers several advantages, the main one being its ability to edit multiple genes simultaneously.18 Current challenges for genome editing of HSPCs include optimizing the delivery of gene-editing tools, improving the efficiency of introducing targeted modifications, and avoiding the creation of potentially harmful off-target mutations. β-thalassemia mutations have been corrected by gene editing in induced pluripotent stem cells (iPSCs) by converting β-thalassemic mutations from homozygous to heterozygous state, thus restoring HBB gene expression in erythrocytes differentiated from the corrected iPSCs.19 This gene editing strategy will provide a crucial step to cure monogenic disease by genetic repair of patient-specific iPSCs. We can envision a future in which the functional integration between next generation technologies for genomic screening and genomic editing will allow us to achieve our goal of targeted diagnosis and therapy (Figure 1).

The importance and the advantages of next generation technologies are obvious. However, despite the widespread haematologica | 2016; 101(5)

Editorials

use of these tools in clinical practice, some considerations on their limitations and/or disadvantages should be made.

On the one hand, will the different stages of data processing represent a major limitation of NGS genome screening, or will the need to accurately profile and control the off-target effects of genome editing compromise its use in gene therapy? Unlike ex vivo cell therapies, genome-editing technologies can potentially affect the human germline, and international committees to study the ethical, legal, and social implications of human gene editing have already been appointed. For example, the Hinxton Group is working to guide decision-makers on the use of these technologies in humans (http://www.hinxtongroup.org/). Thus, the education and training of all professional figures involved in the clinical practice of molecular medicine still remains one of the main aims of the scientific community.

References 1. Zarychanski R, Schulz VP, Houston BL, et al. Mutations in the mechanotransduction protein PIEZO1 are associated with hereditary xerocytosis. Blood. 2012;120(9):1908-1915.

2 Andolfo I, Alper SL, De Franceschi L, et al. Multiple clinical forms of dehydrated hereditary stomatocytosis arise from mutations in PIEZO1.

Blood. 2013;121(19):3925-3935.

3. Ge J, Li W, Zhao Q, et al. Architecture of the mammalian mechanosensitive Piezo1 channel. Nature. 2015;527(7576):64-69.

4. Andolfo I, Russo R, Manna F, et al. Novel Gardos channel mutations linked to dehydrated hereditary stomatocytosis (xerocytosis). Am J Hematol. 2015;90(10):921-926.

5. Rapetti-Mauss R, Lacoste C, Picard V, et al. A mutation in the Gardos channel is associated with hereditary xerocytosis. Blood.

2015;126(11):1273-1280.

6. Glogowska E, Lezon-Geyda K, Maksimova Y, Schulz VP, Gallagher PG. Mutations in the Gardos channel (KCNN4) are associated with hereditary xerocytosis. Blood. 2015;126(11):1281-1284.

haematologica | 2016; 101(5)

7. Ataga KI, Reid M, Ballas SK, et al. Improvements in haemolysis and indicators of erythrocyte survival do not correlate with acute vasoocclusive crises in patients with sickle cell disease: a phase III randomized, placebo-controlled, double-blind study of the Gardos channel blocker senicapoc (ICA-17043). Br J Haematol. 2011;153(1):92-104.

8. Kohn DB, Pai SY, Sadelain M. Gene therapy through autologous transplantation of gene-modified hematopoietic stem cells. Biol Blood Marrow Transplant. 2013;19:S64-S69.

9. Thompson AA, Rasko EJ, Hongeng S, et al. Initial Results from the Northstar Study (HGB-204): A Phase 1/2 Study of Gene Therapy for βThalassemia Major Via Transplantation of Autologous Hematopoietic Stem Cells Transduced Ex Vivo with a Lentiviral βA-T87Q-Globin Vector (LentiGlobin BB305 Drug Product). Blood. 2014;124(21):549.

10. Rovira A, De Angioletti M, Camacho-Vanegas O, et al. Stable in vivo expression of glucose-6-phosphate dehydrogenase (G6PD) and rescue of G6PD deficiency in stem cells by gene transfer. Blood.

2000;96(13):4111-4117.

11. Meza NW, Alonso-Ferrero ME, Navarro S, et al. Rescue of pyruvate kinase deficiency in mice by gene therapy using the human isoenzyme.

Mol Ther. 2009;17(12):2000-2009.

12. Dussiot M, Maciel TT, Fricot A, et al. An activin receptor IIA ligand trap corrects ineffective erythropoiesis in β-thalassemia. Nat Med. 2014;20(4):398-407.

13. Suragani RN, Cawley SM, Li R, et al. Modified activin receptor IIB ligand trap mitigates ineffective erythropoiesis and disease complications in murine β-thalassemia. Blood. 2014;123(25):3864-3872.

14. Cong L, Ran FA, Cox D, et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339(6121):819-823.

15. Doulatov S, Vo LT, Chou SS, et al. Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via respecification of lineage-restricted precursors. Cell Stem Cell.

2013;13(4):459-470.

16. Mali P, Yang L, Esvelt KM, et al. RNA-guided human genome engineering via Cas9. Science. 2013;339(6121):823-826.

17. Lupiáñez DG, Kraft K, Heinrich V, et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 2015;161(5):1012-1025.

18. Xiao-Jie L, Hui-Ying X, Zun-Ping K, Jin-Lian C, Li-Juan J. CRISPR-Cas9: a new and promising player in gene therapy. Med Genet.

2015;52(5):289-296.

19. Xie F, Ye L, Chang JC, et al. Seamless gene correction of β-thalassemia mutations in patient-specific iPSCs using CRISPR/Cas9 and piggyBac. Genome Res. 2014;24(9):1526-1533.

517

Editorials

Innovations in treatment and response evaluation in multiple myeloma Ruth Wester and Pieter Sonneveld Erasmus MC Cancer Institute (EMC), Rotterdam, The Netherlands.

E-mail: r.wester@erasmusmc.nl

doi:10.3324/haematol.2016.142737

M

ultiple myeloma (MM) is still an incurable disease. Recently, overall survival (OS) and progression-free survival (PFS) have improved with the introduction of immunomodulatory agents (IMIDs) and proteasome inhibitors (PI). Overall, an increase in 5-year relative survival from 28.8% to 34.7% was reported between 1990-1992 and 2002-2004 by Brenner et al.1 Palumbo et al. reported a 10-year OS of 30% in transplant eligible patients.2 Innovative agents (i.e. monoclonal antibodies) may further increase response rates and the quality of responses. Consequently, there will be a need for a more sensitive response assessment and risk-adapted treatment schedules.

In this editorial we will discuss the role of two innovative approaches to evaluate response in MM, minimal residual disease (MRD) and response evaluation with positron emission tomography-computed tomography (PET-CT), in the context of recent treatment innovations.

needed to identify patients who require additional therapy.

The International Myeloma Working Group (IMWG) defined uniform response criteria for MM in 2006. In 2011, two new categories, stringent complete response (sCR) and very good partial response (VGPR) were added.5 However, the current definition of complete response (CR) fails to predict a distinct overall outcome. Using MRD for response evaluation may give a better prediction of OS.6,7 With multiparameter flow cytometry (FCM) or next generation sequencing (NGS) it is possible to detect a tumor load of 105 (Figure 1).5,6,8-10 This is clinically relevant since time to progression (TTP) in patients with MRD below 10-5 is significantly better than in patients with MRD between 10-5 to 103 or above 10-3 (80 vs. 48 vs. 27 months).11 MRD combined with cytogenetics gives a better prediction of outcome than standard CR.7 Therefore, MRD has now been incorporated into several clinical trials.

Prognostic factors

Bone marrow infiltration in patients with MM can be patchy. This implies that because of sampling error, MRD may be negative even in the presence of extramedullary disease (EMD). Therefore imaging techniques are increasingly applied to assess EMD.12 Magnetic resonance imaging (MRI) seems the most sensitive imaging technique for detection of bone involvement in the spine;6 however, EMD may not be visualized with this technique. PET-CT can detect bone involvement as well as EMD. Patients with persistence of abnormal 18F-fluorodeoxyglucose (FDG) uptake following high-dose therapy and stem cell trans-

The International Staging System (ISS) has recently been revised (R-ISS)3 to facilitate stratification of patients with different clinical outcome. The R-ISS is a combination of ISS with chromosomal abnormalities (CA) and serum lactate dehydrogenase (LDH). CA t(4;14), t(14;16), del(17p), and potentially del(1p) and gain(1q), are associated with an adverse outcome.4 At present, a dichotomy arises between patients with poor CA and patients with potential long PFS and OS. Reliable, sensitive techniques for response assessment are

Evaluation by PET-CT

Figure 1. In the last two decades, response criteria have changed because novel treatments have improved the quality of response.

518

haematologica | 2016; 101(5)

Editorials

plantation (SCT) have a poor prognosis.13 While small defects may be missed because of low spatial resolution, the use of PET-CT in detection of MRD seems promising enough to warrant further evaluation in clinical trials.

Novel agents and treatment strategies Treatment modalities have greatly expanded in the last two decades and we will discuss some of the novel agents in the context of new treatment strategies. IMIDs such as lenalidomide and thalidomide have increased OS and PFS in newly diagnosed multiple myeloma (NDMM).14,15 Pomalidomide is a next generation IMID. It has direct antiproliferative, pro-apoptotic, and antiangiogenic effects, as well as modulatory effects on bone resorption, the immune system and the bone marrow microenvironment.16-18 The pivotal phase III trial assessed the efficacy and safety of pomalidomide with/without low-dose dexamethasone in patients with relapsed/refractory multiple myeloma (RRMM). At a follow up of 14.2 months, median PFS was 4.2 versus 2.7 months (HR=0.68; P=0.003), overall response rates (ORRs) were 33% and 18% (P=0.013), median response duration was 8.3 and 10.7 months, and OS was 16.5 and 13.6 months, respectively.19,20 The other class of novel agents is made up of proteasome inhibitors (PI). Bortezomib has improved CR rate, PFS and OS in elderly patients (VMP, VD) and in transplant eligible MM (PAD, VCD, VTD); as an example, in the HOVON65/GMMG-HD4 trial, addition of bortezomib increased CR from 25% in controls to 36% (P<0.001) and PFS was also superior (28 vs. 35 months; P=0.002).21 Novel PIs have emerged: carfilzomib, oprozomib, marizomib and ixazomib. Carfilzomib is an epoxyketone proteasome inhibitor that binds selectively and irreversibly to the constitutive proteasome and immunoproteasome. The ASPIRE trial evaluated safety and efficacy of adding carfilzomib to lenalidomide/dexamethasone (RD) versus RD alone in patients with relapsed MM. PFS was significantly better with carfilzomib versus control group (26.3 vs. 17.6 months, respectively).22 The ENDEAVOR trial compared carfilzomib with bortezomib in patients with RRMM; PFS was 18.7 months with carfilzomib versus 9.4 months with bortezomib (P<0.0001).23 Ixazomib is a reversible boronic ester prodrug PI. Pre-

clinical studies have shown activity in myeloma cells resistent to bortezomib. Combination of ixazomib with RD gave good responses also in unfavorable CA.24,25 Monoclonal antibodies [daratumumab, SAR650984 (SAR) and elotuzumab] have set the stage for a new treatment modality in MM. Elotuzumab is a monoclonal antibody targeting signaling lymphocytic activation molecule F7 (SLAMF7). This is a cell surface glycoprotein highly expressed on MM cells and normal plasma cells. A phase III trial was recently performed in patients with RRMM. Patients were randomized between treatment with RD with/without elotuzumab. Median PFS was 19.4 months in the elotuzumab group versus 14.9 months in the control group (P<0.001). OS in the elotuzumab group was 79% versus 66% in the control group (P<0.001).26 Daratumumab is an anti-CD 38 monoclonal antibody. It induces cell killing by multiple mechanisms: complementdependent cytotoxicity, antibody-dependent cellular cytotoxicity and antibody-dependent cellular phagocytosis through activation of complement proteins, natural killer cells, and macrophages, respectively.27,28 A phase I/II study in heavily pre-treated patients with RRMM induced response in 42% of patients.29 Daratumumab is currently under investigation in several phase III trials, including the IFM2015/HOVON131 randomized phase III trial in NDMM who are transplant eligible. This study investigates the efficacy of the combination of daratumumab with VTD for induction and consolidation followed by daratumumab maintenance treatment. During this trial, assessment of MRD will be performed using NGS on bone marrow and peripheral blood samples collected from subjects who achieve at least VGPR (Figure 2).

Histone deacetylase inhibitors (panobinostat, vorinostat and ricolinostat) inhibit cell growth and induce apoptosis.

In the PANORAMA-1 trial, treatment with bortezomib, dexamethasone plus panobinostat resulted in significantly longer PFS (12 months vs. 8 months; P<0.0001).30

Conclusions During the last two decades, diagnostic methods and treatment modalities in MM have greatly improved. In deciding how to treat a particular patient, prognostic factors such as cytogenetic abnormalities are becoming more important.

Figure 2. IFM2015/HOVON 131.

Patients are randomized between treatment with VTD with/without daratumumab followed by highdose melphalan (HDM) and autologous stem cell transplantation (ASCT). After ASCT, patients receive two consolidation cycles.

Patients with at least a partial response (PR) will be randomized after determination of response at approximately day 100 after ASCT, and will enter the Maintenance Phase. Minimal residual disease (MRD) assessment will be performed before the first induction cycle, before ASCT, at day 100 after ASCT, and during maintenance in patients who achieve at least a very good partial response (VGPR).

haematologica | 2016; 101(5)

519

Editorials

Treatment schedules should be adapted to these prognostic factors. This requires further evaluation in clinical trials.

Novel agents induce deeper responses. This implies the need for a more sensitive response assessment such as determination of MRD by FCM or NGS. Therefore, clinical trials with novel agents should include standard panels for cytogenetics, MRD, and optimal imaging.

References 1. Brenner H, Gondos A, Pulte D. Recent major improvement in longterm survival of younger patients with multiple myeloma. Blood.

2008;111(5):2521-2526.

2. Palumbo A, Anderson K. Multiple myeloma. N Engl J Med. 2011;364(11):1046-1060.

3. Palumbo A, Avet-Loiseau H, Oliva S, et al. Revised International Staging System for Multiple Myeloma: A Report From International Myeloma Working Group. J Clin Oncol. 2015;33(26):2863-2869.

4. Hebraud B, Magrangeas F, Cleynen A, et al. Role of additional chromosomal changes in the prognostic value of t(4;14) and del(17p) in multiple myeloma: the IFM experience. Blood. 2015;125(13):2095-2100.

5. Durie BG, Harousseau JL, Miguel JS, et al. International uniform response criteria for multiple myeloma. Leukemia. 2006;20(9):14671473.

6. Paiva B, van Dongen JJ, Orfao A. New criteria for response assessment: role of minimal residual disease in multiple myeloma. Blood.

2015;125(20):3059-3068.

7. Rawstron AC, Gregory WM, de Tute RM, et al. Minimal residual disease in myeloma by flow cytometry: independent prediction of survival benefit per log reduction. Blood. 2015;125(12):1932-1935.

8. Blade J, Samson D, Reece D, et al. Criteria for evaluating disease response and progression in patients with multiple myeloma treated by high-dose therapy and haemopoietic stem cell transplantation.

Myeloma Subcommittee of the EBMT. European Group for Blood and Marrow Transplant. Br J Haematol. 1998;102(5):1115-1123.

9. Cavo M, Rajkumar SV, Palumbo A, et al. International Myeloma Working Group consensus approach to the treatment of multiple myeloma patients who are candidates for autologous stem cell transplantation. Blood. 2011;117(23):6063-6073.

10. Durie BG, Miguel JF, Blade J, Rajkumar SV. Clarification of the definition of complete response in multiple myeloma. Leukemia.

2015;29(12):2416-2417.

11. Martinez-Lopez J, Lahuerta JJ, Pepin F, et al. Prognostic value of deep sequencing method for minimal residual disease detection in multiple myeloma. Blood. 2014;123(20):3073-3079.

12. Dimopoulos MA, Hillengass J, Usmani S, et al. Role of magnetic resonance imaging in the management of patients with multiple myeloma: a consensus statement. J Clin Oncol. 2015;33(6):657-664.

13. Caers J, Withofs N, Hillengass J, et al. The role of positron emission tomography-computed tomography and magnetic resonance imaging in diagnosis and follow up of multiple myeloma. Haematologica.

2014;99(4):629-637.

14. Palumbo A, Hajek R, Delforge M, et al. Continuous lenalidomide treatment for newly diagnosed multiple myeloma. N Engl J Med. 2012;366(19):1759-1769.

15. Benboubker L, Dimopoulos MA, Dispenzieri A, et al. Lenalidomide and dexamethasone in transplant-ineligible patients with myeloma. N Engl J Med. 2014;371(10):906-917.

520

16. Ruchelman AL, Man H-W, Zhang W, et al. Isosteric analogs of lenalidomide and pomalidomide: Synthesis and biological activity. Bioorg Med Chem Lett. 2013;23(1):360-365.

17. Richardson PG, Mark TM, Lacy MQ. Pomalidomide: new immunomodulatory agent with potent antiproliferative effects. Crit Rev Oncol Hematol. 2013;88 Suppl 1:S36-44.

18. Shortt J, Hsu AK, Johnstone RW. Thalidomide-analogue biology: immunological, molecular and epigenetic targets in cancer therapy.

Oncogene. 2013;32(36):4191-4202.

19. Richardson PG, Siegel DS, Vij R, et al. Pomalidomide alone or in combination with low-dose dexamethasone in relapsed and refractory multiple myeloma: a randomized phase 2 study. Blood. 2014;123(12):18261832.

20. San Miguel J, Weisel K, Moreau P, et al. Pomalidomide plus low-dose dexamethasone versus high-dose dexamethasone alone for patients with relapsed and refractory multiple myeloma (MM-003): a randomised, open-label, phase 3 trial. Lancet Oncol. 2013;14(11):10551066.

21. Sonneveld P, Schmidt-Wolf IG, van der Holt B, et al. Bortezomib induction and maintenance treatment in patients with newly diagnosed multiple myeloma: results of the randomized phase III HOVON-65/ GMMG-HD4 trial. J Clin Oncol. 2012;30(24):2946-2955.

22. Stewart AK, Rajkumar SV, Dimopoulos MA, et al. Carfilzomib, lenalidomide, and dexamethasone for relapsed multiple myeloma. N Engl J Med. 2015;372(2):142-152.

23. Dimopoulos MA, Moreau P, Palumbo A, et al. Carfilzomib and dexamethasone versus bortezomib and dexamethasone for patients with relapsed or refractory multiple myeloma (ENDEAVOR): a randomised, phase 3, open-label, multicentre study. Lancet Oncol. 2016;17(1):27-38.

24. Moreau P, Masszi T, Grzasko N, et al. Ixazomib, an Investigational Oral Proteasome Inhibitor (PI), in Combination with Lenalidomide and Dexamethasone (IRd), Significantly Extends Progression-Free Survival (PFS) for Patients (Pts) with Relapsed and/or Refractory Multiple Myeloma (RRMM): The Phase 3 Tourmaline-MM1 Study (NCT01564537). Blood. 2015;126(23)(Abstract 727).

25. Kumar SK, Berdeja JG, Niesvizky R, et al. Safety and tolerability of ixazomib, an oral proteasome inhibitor, in combination with lenalidomide and dexamethasone in patients with previously untreated multiple myeloma: an open-label phase 1/2 study. Lancet Oncol.

2014;15(13):1503-1512.

26. Lonial S, Dimopoulos M, Palumbo A, et al. Elotuzumab Therapy for Relapsed or Refractory Multiple Myeloma. N Engl J Med. 2015; 373(7):621-631.

27. Overdijk MB, Verploegen S, Bogels M, et al. Antibody-mediated phagocytosis contributes to the anti-tumor activity of the therapeutic antibody daratumumab in lymphoma and multiple myeloma. MAbs. 2015;7(2):311-321.

28. de Weers M, Tai YT, van der Veer MS, et al. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors. J Immunol.

2011;186(3):1840-1848.

29. Lokhorst HM, Laubach J, Nahi H, et al. Dose-dependent efficacy of daratumumab (DARA) as monotherapy in patients with relapsed or refractory multiple myeloma (RR MM). ASCO Annual Meeting Proceedings. 2014;2014:8513.

30. San-Miguel JF, Hungria VT, Yoon SS, et al. Panobinostat plus bortezomib and dexamethasone versus placebo plus bortezomib and dexamethasone in patients with relapsed or relapsed and refractory multiple myeloma: a multicentre, randomised, double-blind phase 3 trial.

Lancet Oncol. 2014;15(11):1195-1206.

haematologica | 2016; 101(5)

Leaders in Hematology review series

Nonmyeloablative allogeneic hematopoietic cell transplantation Rainer Storb and Brenda M. Sandmaier

REVIEW ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

Fred Hutchinson Cancer Research Center and the University of Washington, Seattle, WA, USA

ABSTRACT

Haematologica 2016 Volume 101(5):521-530

M

ost hematological malignancies occur in older patients. Until recently these patients and those with comorbidities were not candidates for treatment with allogeneic hematopoietic transplantation because they were unable to tolerate the heretofore used high-dose conditioning regimens. The finding that many of the cures achieved with allogeneic hematopoietic transplantation were due to graft-versus-tumor effects led to the development of less toxic and well-tolerated reduced intensity and nonmyeloablative regimens.

These regimens enabled allogeneic engraftment, thereby setting the stage for graft-versus-tumor effects. This review summarizes the encouraging early results seen with the new regimens and discusses the two hurdles that need to be overcome for achieving even greater success, disease relapse and graft-versus-host disease.

Introduction Conditioning for allogeneic hematopoietic cell transplantation (HCT) in the treatment of hematologic malignancies has traditionally involved high doses of total body irradiation (TBI) and/or chemotherapy. The dual purpose of conditioning has been to reduce the patients’ burden of malignant cells before HCT and suppress their immune system so that the allogeneic grafts are not rejected. The high intensity of the traditional regimens has precluded using allogeneic HCT in older patients or those with comorbidities because of unacceptable toxicities. This has been unfortunate, given that the median ages of patients at the time of diagnosis of most candidate malignancies, e.g. acute myelocytic leukemia (AML) or nonHodgkin lymphoma (NHL), range from 65 to 75 years. The finding that the cure of hematologic malignancies not only results from intense conditioning but also in large part from the killing of tumor cells by transplanted donor immune cells, termed “graft-vs.-tumor” (GVT) effect, set the stage for the development of reduced-intensity conditioning (RIC) regimens. Such regimens need to be immunosuppressive enough to allow sustained engraftment, thereby enabling GVT effects.

The markedly reduced toxicities associated with these novel regimens have allowed for the extension of allogeneic HCT to include older and medically infirm patients. The relative intensities of individual conditioning regimens vary considerably as far as their immunosuppressive and myelosuppressive properties are concerned (Figure 1). The choice of a given regimen may, in part, be dictated by the nature of the underlying malignancy and, in part, by comorbidities. The results of trials using RIC or nonmyeloablative (NMA) regimens have been surprisingly encouraging. However, all the trials share two major problems that have limited trial outcomes. These are non-relapse mortality (NRM), mainly related to concurrent or preceding graft-vs.-host disease (GVHD) and its treatment, and relapse mortality.

This review will describe the preclinical basis for some of the RIC and NMA regimens, address GVT effects, summarize trial results with HLA-matched and mismatched grafts, address the use of older sibling donors, and explore ways to reduce the risks of GVHD and relapse.

haematologica | 2016; 101(5)

Correspondence: rstorb@fredhutch.org

Received: December 29, 2015.

Accepted: February 5, 2016.

Pre-published: no prepublication. doi:10.3324/haematol.2015.132860

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/521

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use. A permission in writing by the publisher is required for any other use.

521

R. Storb and B.M. Sandmaier

Pre-clinical studies We used a canine model of major histocompatibility complex (MHC=DLA)-matched marrow grafts to develop a minimal-intensity or NMA conditioning regimen. We found that 2 Gy TBI either without postgrafting immunosuppression or with monotherapy using cyclosporine (CSP) did not enable consistently sustained engraftment.1 However, when a short course of mycophenolate mofetil (MMF) was combined with CSP following 2 Gy TBI, synergism between the two drugs was noted, host T-cells were prevented from rejecting the donor marrow, and sustained engraftment was seen.2 Similar synergism was observed with rapamycin used in lieu of MMF.3 In other studies, which substituted 4.5 Gy irradiation targeted to the cervical, thoracic, and upper abdominal lymph node chain for 2 Gy TBI, we saw sustained engraftment in nonirradiated marrow and lymph node spaces, suggesting that the donor T-lymphocytes created space for grafts to home.4 The results of the canine studies were the basis for the successful clinical introduction of an NMA regimen of 2 Gy TBI combined with fludarabine (FLU) before and MMF/calcineurin inhibitor after HLA-matched related and unrelated HCT. Further canine work focused on replacing or augmenting 2 Gy TBI with radiolabeled monoclonal antibodies (mAbs).5 Current clinical studies have already employed mAb to CD45 or CD20 coupled to beta-emitting radionuclides such as iodine-131 (131I)6or yttrium-90 (90Y);7 however, the disadvantages of the beta-emitters became apparent, and included relatively long path lengths, long halflives, and low energy. Therefore, we turned to alpha-emitting radionuclides, including bismuth-213 (213Bi)8 and astatine-211 (211At).9 211At coupled to an anti-CD45 mAb turned out to be more effective than 213Bi.10 Other advantages of 211 At include that it is produced at the University of Washington Cyclotron Facility, has a short half-life of 7.2 hours, has high energy, and, importantly, a very short path length of approximately 0.04-0.06 mm, thereby reducing the risk of off-target effects. Dose-finding toxicity studies in dogs have been completed, and DLA-identical marrow grafts successfully established using a 211At-labeled antiCD45 mAb.9 Clinical studies are in preparation that are aimed at increasing tumor cell kill in patients with hematologic malignancies and replacing systemic chemo/radiation therapy in those with nonmalignant diseases.

In 1991 Japanese investigators showed that treating MHC-mismatched murine recipients with high-dose cyclophosphamide (CY) after HCT induced tolerance of the grafted lymphocytes to host tissues, while not impairing hematopoietic engraftment.11 This has been possible since hematopoietic stem cells are protected against the toxic effect of CY metabolites by the presence within these cells of aldehyde dehydrogenase. These observations and those by investigators from Johns Hopkins Medical School12,13 set the stage for the development of an effective HLA-haploidentical transplant protocol. The protocol utilized the basic FLU/2 Gy TBI NMA regimen with two additional small doses of CY for conditioning.14 Patients were then given one or two high doses of CY on days 3 and/or 4 post-grafting, followed by MMF/calcineurin inhibitor.

Clinical results HLA-matched related and unrelated HCT. The choice of conditioning regimen intensity depends in part on the 522

underlying malignancy, disease burden, and comorbidities. The effects these variables can have on transplantation outcome are illustrated by results in 1,092 patients with advanced hematologic malignancies given a uniform NMA regimen of FLU/2 Gy TBI, which allowed for the purest assessment of GVT effects apart from conditioning and the best determination of GVHD not augmented by toxicities related to the regimen.15 Patients were either older or had serious comorbidities. Their median age was 56 (range 7 to 75) years. Thirty-five percent of patients were older than 60 years. Six hundred and eleven patients had HLA-matched related donors and 481 had unrelated donors (one HLA allele-level mismatch was permitted).

Diseases and disease stages are shown in Table 1. Twenty percent of patients had failed high-dose autologous or allogeneic HCT or had developed a secondary, usually myeloid malignancy after autologous HCT for another malignancy. Forty-five percent of patients had HCTComorbidity Index (CI) scores of 3 or greater. Cumulative incidence rates of acute GVHD were 37% for grade 2, 9 % for grade 3, and 4% for grade 4, respectively; the rates were lower for related than for unrelated recipients. Table 1 divides patients based on low, standard, or high-risk of relapse as assessed by relapse rate per patient year. It is evident that disease and disease burden were major determinants for relapse risk. For example, patients with highgrade NHL in remission had a relapse rate of 0.16 per patient year in years 1-2, while those not in remission had a rate of 0.48. Similar findings were made for other diseases. These data suggested that reducing the tumor burden in certain diseases and disease stages before HCT might reduce the risk of relapse after HCT. Most relapses occurred in the first 2 years, and relapse rates in subsequent years were generally low. Five-year relapse mortality rates ranged from 18% to 50% depending on relapse risk (Figure 2). Of note, 5-year overall relapse mortality was the same among related and unrelated recipients, at 34.5% for both. Figure 2 also shows 5-year overall survivals which ranged from as low as 25% in patients with high relapse risk and high comorbidity scores to 60% in patients with low relapse risk and low comorbidity scores.

Unrelated recipients had a significantly increased risk of GVHD-associated NRM compared to related recipients.

Of note, a single HLA allele-level mismatch at class I did not adversely affect HCT outcome. Five-year overall NRM was 24% (20% related to preceding or concurrent GVHD), ranging from 14.7% (12% related to GVHD) among related recipients with low comorbidity scores to 36% (31.8% related to GVHD) among unrelated recipients with comorbidity scores of 3 and higher.

A phase II randomized clinical trial was carried out as part of an ongoing effort to optimize control of acute GVHD without reducing the GVT effect after unrelated HCT.16 Patients were randomized between three different post-HCT immunosuppressive regimens. In arm 1, tacrolimus was administered for 180 days and MMF for 95 days (n=69). In arms 2 (n=71) and 3 (n=68), tacrolimus and MMF were administered for 150 and 180 days, respectively, with the addition of 80 days of sirolimus in arm 3.

Grade II-IV acute GVHD rates in the 3 arms were 64%, 48% and 47% at day 150. Steroid use was significantly lower at day 150 in arm 3 (32% vs. 55% in arm 1 and 49% in arm 2; and the day 150 incidence of cytomegalovirus reactivation was significantly lower in arm 3 (arm 1, 54%; arm 2, 47%; arm 3, 22%) (Figure 3). Currently a 2-arm haematologica | 2016; 101(5)

Nonmyeloablative allogeneic hematopoietic cell transplantation

phase III trial is ongoing using cyclosporine and MMF with and without sirolimus, in order to further evaluate the role of sirolimus.

Table 2 shows results with RIC or NMA regimens reported by registries or individual transplant centers.

Most regimens used were more intense and relied less on GVT effects than the NMA regimen used in studies shown in Table 1 and Figures 2 and 3. Information on comorbidity scores were generally not provided. The two NMDP studies focused on results with unrelated donors.

Five-year outcomes in the former of the two included 38% NRM, 42% relapse, and 23% overall survival.17 The second study had a median follow-up of 3 years and showed that outcomes after RIC were comparable to those after NMA regimens, with approximately 34% NRM, 37% relapse, and 32% overall survival in both groups.18 A large French registry study included slightly younger patients receiving grafts from related or unrelated donors.19 Median follow-up was short at 1.75 years. Even though NRM was low at 15 %, overall survival was only 42%. A Dana-Farber report included 433 related and unrelated recipients given RIC.20 The median follow-up was 2 years. NRM rates were 6% for related and 8% for unrelated recipients, relapse rates were 65% and 52%, and overall survival rates were 50% and 56%, respectively. A large CIBMTR study of RIC and either T-replete or in vivo T-depleted (ATG or Campath) grafts from related or unrelated donors reported results with a median follow-up of 3 years.21 NRM ranged from 21% to 26%, relapse from 38% to 51%, and survival from 38% to 50%, respectively, with slightly better outcomes seen with T-replete grafts. A

smaller single-center study from Marseille had a median follow-up of 5 years with grafts from related donors after RIC. NRM was 25%, relapse 22%, and survival 60%.22 Among other comparisons, a second large CIBMTR study compared results with marrow and PBSC grafts after RIC to grafts after NMA conditioning.23 Donors were either related or unrelated. With a median follow-up of 3 years, NRM ranged from 33.5% to 38%, relapse from 35% to 40%, and survival from 35% to 40%. An EBMT registry study in younger patients given either related or unrelated grafts after RIC, showed a 2-year NRM rate of 35%, relapse of 34% and event-free survival of 29%. In summary, the median follow-up in these studies was 3 (range, 1.75 to 5) years.24 Across the studies the median event rates were 43% (range, 22–65%) for relapse, 34% (range, 6–38%) for NRM and 38% (range, 22–65%) for overall survival.

A phase III trial investigating conditioning intensity by the Blood and Marrow Transplant Clinical Trials Network (BMT CTN)25 randomized patients with MDS or AML to either a RIC regimen (FLU/BU2 or FLU/Mel) or a myeloablative conditioning (MAC) regimen (FLU/BU4, BU4Cy, or CyTBI). Inclusion criteria included <5% blasts, being between 18-65 years of age, an HCT-CI of < 4, both related and unrelated donors with 7/8 or 8/8 HLA loci matching, and either marrow or PBSC. The primary diagnosis was AML (80 %) and 92 % of patients received PBSC. The study was stratified by center. The primary endpoint was 18 months overall survival. The DSMB closed the study early at the second interim analysis after 272 patients were enrolled (MAC n=135; RIC n=137). Overall survival and

Table 1. Relapse rates per patient year among 1,092 patients.15

Diagnosis*

Stage

No. of Patients Years 1 and 2

Low-risk MPN CLL Waldenström’s syndrome NHL ALL MM Standard-risk CLL CML MM AML MDS High-risk NHL AML HL MDS CML ALL

Relapse Rate Years 3-5

Any CR Any Any stage of mantle cell and low-grade; aggressive CR CR1† CR

18 9 10 140 28 38

0.10 0.11 0.13 0.16 0.17 0.19

0.00 0.14 0.06 0.02 0.04 0.06

No CR CP1 No CR CR‡ RA / RARS

113 24 179 191 30

0.24 0.24 0.32 0.33 0.35

0.05 0.00 0.17 0.02 0.00

Aggressive; no CR No CR; evolved from MDS After failed autologous HCT RAEB; CMML; second CP2; AP; BC ≥ CR2; no CR

50 98 61 62 23 18

0.48 0.65 0.61 0.65 0.71 1.03

0.00 0.04 0.14 0.04 0.07 -

ALL: acute lymphoblastic leukemia; AML: acute myeloid leukemia; AP: accelerated phase; BC: blast crisis; CLL: chronic lymphocytic leukemia; CML: chronic myelocytic leukemia; CMML: chronic myelomonocytic leukemia; CP: chronic phase; HCT: hematopoietic cell transplantation; HL: Hodgkin lymphoma; MDS: myelodysplastic syndrome; MPN: myeloproliferative neoplasms; MM: multiple myeloma; NHL: non-Hodgkin lymphoma; RAEB: refractory anemia with excess blasts; RARS: refractory anemia with ring sideroblasts. *There were 243 patients in the low-risk group (53% related and 47% unrelated donors); 537 patients in the standard-risk group (58% related and 42% unrelated donors), and 312 patients in the high-risk group (54% related and 46% unrelated donors). †Before HCT, 14% of patients had minimal residual disease. ‡Before HCT, 13% of patients had minimal residual disease. Reprinted with permission. From: Storb R, et al. Graft-versus-host disease and graft-versus-tumor effects after allogeneic hematopoietic cell transplantation. J Clin Oncol 31(12), 2013; 1530-1538. ©2013 American Society of Clinical Oncology. All rights reserved.

haematologica | 2016; 101(5)

523

R. Storb and B.M. Sandmaier

progression-free survival at 18 months were 77.4% and 68.8% (MAC) and 67.7% and 47.3% (RIC), respectively (P=0.07; P<0.01). The incidences of both acute and chronic GVHD were significantly higher in MAC patients (P=0.024 and P=0.019, respectively). The primary causes of death were GVHD in the MAC arm (52%) and relapse in the RIC arm (82%). The conclusion was that MAC remains the treatment of choice for younger patients with MDS or AML. HLA-mismatched unrelated HCT. While many patients who would benefit from HCT have a HLA-matched donor, a substantial number will not, particularly those who do not have white European ancestry. An analysis was performed on data from the NMDP unrelated donor and cord blood registries to predict the likelihood of identifying suitable donors for U.S. patients.26 The likelihood of finding an 8/8 HLA loci match ranged from 75% in white Europeans to 16-19% for Black/African racial groups. If one accepts a 7/8 HLA loci matched donor, the numbers increase to 97% and 66-76%, respectively. The CIBMTR compared outcomes in 563 recipients of a single HLA locus mismatch with 2,025 recipients of 8/8 HLA loci high-resolution matched unrelated RIC HCT.27 There were more grades II-IV acute GVHD, higher NRM and lower disease free survival and overall survival in recipients of 7/8 HLA loci matched URD. Interestingly, there was no difference in chronic GVHD or relapse. The decreases in overall and disease free survival using a 7/8 HLA loci matched donor were slightly less than those in the myeloablative setting, suggesting a role of tissue damage in mortality following higher dose regimens. The findings in this large registry study are consistent with another smaller prospective study.28 Taken together these studies show that relapse and

NRM, mostly related to GVHD, represent the two major obstacles for patients given RIC or NMA regimens that need addressing in future trials.

HLA-haploidentical HCT. Many patients, particularly members of ethnic minorities, lack HLA-matched unrelated donors; however, most patients have a relative who is HLA-haploidentical. The development of low-toxicity regimens sufficient to overcome the immunologic barriers to engraftment is equally important for such patients.

Johns Hopkins University and the Fred Hutchinson Cancer Research Center investigated a novel HLA-haploidentical marrow transplant trial using the fludarabine and 2 Gy TBI regimen and additional immunosuppression with CY both before and after HCT for the treatment of hematologic malignancies.14 This regimen was well tolerated and, considering the strong immunological barriers that needed to be overcome, the rejection incidence was low. In addition, the incidences of severe acute and chronic GVHD were encouragingly low. These results were confirmed in a multi-site trial conducted by the BMT CTN29 which also showed a relatively high relapse rate. A currently ongoing randomized study, BMT CTN Protocol 1101, compares HLA-haploidentical marrow vs. cord blood as a stem cell source.

A recent European publication noted a pronounced increase in the use of HLA-haploidentical family donors and a concurrent decrease in the use of cord blood donors.30 More than twice the number of HLA-haploidentical grafts have been reported since 2010 compared to cord blood transplants. CIBMTR is reporting similar trends in North America.

A recent CIBMTR study compared outcomes in 2,174 patients with AML given grafts from HLA-matched unrelated (n=1,982) or HLA-haploidentical related donors

Table 2. Results of retrospective analyses of transplantation outcomes in patients with hematologic malignancies after reduced intensity (RIC) or nonmyeloablative (NMA) conditioning.

Transplant Group (Reference)

# of Patients

Median age in Years (Range)

Donors

NMDP (Giralt)17 NMDP (Pulsipher)18

285 160

URD URD

French Registry (Michallet)19 Dana Farber (Ho)20

1,108

53 (18–79) 56 (1–75) 57 (17–73) 51 (1–72)

433

56 (18–73)

IBMTR (Soiffer)21

879 584 213 100 273 768 407 130 1,092 1,349 825 372

(21–69)

Marseille (Blaise)22 CIBMTR (Luger)23

EBMT (Belkacemi)24 Seattle (Storb)15 CIBMTR (Ciurea)31 Hopkins (McCurdy)34 524

49 (18–64) 51 (19–69)

17–41 57 (7–75) 21-70 55(18-75)

MRD > URD MRD URD MRD URD MRD MRD/URD MRD/URD MRD/URD MRD/URD MRD/URD URD/Haplo URD/Haplo Haplo

Conditioning Regimen

Median Follow-up (Years)

NRM

RIC RIC NMA RIC

5 3 3 1.75

38 34 34 15

43 37 37

23 32 32 42

RIC RIC T-replete ATG Campath RIC RIC (BM) RIC (PBSC) NMA RIC NMA MAC RIC/NMA NMA

2

6 8 23 26 21 25 38 35 335 35 24 20/14 23/9 11 (1 yr)

65 52 38 49 51 22 39 35 40 34 34.5 39/44 42/58 46

50 56 46 38 50 60 38 40 35 29 (EFS) 25–60 45/50 37/37 50

3 3 3 5 3 3 3 2 5 3 3 3

% Relapse

OS

haematologica | 2016; 101(5)

Nonmyeloablative allogeneic hematopoietic cell transplantation

given regimens using post-HCT Cy (n=192).31 The study included patients with myeloablative (unrelated n=1,245; HLA-haploidentical n=104) and RIC/NMA conditioning (unrelated n=737; HLA-haploidentical n=88). There was no difference in overall and disease free survival between the different donor types in either the myeloablative or RIC/NMA recipients (Table 2 and Figure 4). There was significantly more acute and chronic GVHD in recipients of unrelated grafts but a lower risk of NRM (P=0.01), and a borderline increase risk of relapse (P=0.05) in RIC/NMAconditioned recipients of HLA-haploidentical related grafts. A similar CIBMTR study compared outcomes in 917 patients with NHL receiving HLA-haploidentical related versus HLA-matched unrelated HCT, the latter either with or without ATG.31 There was no significant difference in overall survival between the 3 groups but there was inferior survival in those unrelated patients who received ATG. In a single center series of 372 patients, patients were stratified by the refined Disease Risk Index (DRI)32,33 and evaluated for outcomes. By refined DRI, 3-year progression-free survival in low, intermediate and high/very high-risk groups were 65%, 37% and 22%, respectively (Table 2).34 These results are similar to those historically seen with HLA-matched HCT, suggesting that prospective randomized trials are warranted to evaluate the use of alternative donors given the lower incidence of chronic GVHD seen after HLA-haploidentical HCT. It has been suggested that the use of PBSC may reduce the risk of relapse among HLA-haploidentical recipients without increasing the risk of GVHD. Concurrent studies using PBSC were carried out at 4 centers and analyzed together.35 Grades 2 and 3 acute GVHD developed in 53% and 8% of patients, respectively, and the 2 year incidence of chronic GVHD was 18%. The 2 year rates of NRM and

relapse were 23% and 28%, respectively, suggesting that PBSC can be substituted for marrow in HLA-haploidentical HCT. Other strategies to prevent, preempt or treat relapse include planned donor lymphocyte infusions.36 A more novel approach includes preemptive infusions of donor NK cells. Thirty-six heavily pre-treated patients with hematologic malignancies, median age of 46 (range 8-75) years, were given donor NK cells on day 7 after HLA-haploidentical HCT.37 Patients had a median time from cancer diagnosis to transplant of 2.1 (0.3 – 9.9) years, including 7 patients with prior autologous HCT and 6 patients with 1 or more prior allogeneic HCT. Overall and relapse-free survivals at 1 year of 74% and 69%, and at 2 years of 63% and 51% were observed, respectively.

Engraftment kinetics and donor chimerism The overall goal in malignant disorders is to achieve high levels of or even complete donor T-cell chimerism early after HCT, as this has been associated with lower risks of graft rejection and relapse.38-40 While complete donor chimerism develops rapidly following myeloablative allogeneic HCT, varying degrees of mixed donor host chimerism are seen initially following NMA conditioning, though the majority of patients will have full donor chimerism by day 100 after HCT. Many of the RIC regimens that are more myelosuppressive have kinetics of donor engraftment similar to those of myeloablative regimens. In addition to regimen intensity, other factors influence the kinetics of engraftment including the use of PBSC and in vivo T-cell depleting agents (such as ATG or alemtuzumab) and HLA disparity between donor and recipient. Patients who received myelosuppressive chemotherapy or a preceding autologous HCT had a more rapid engraftment of donor T-cells. An association between high

Figure 1.

Reproduced from: Sandmaier BM, Storb R. Reduced-intensity allogeneic transplantation regimens, Chapter 21, In: Thomas’ Hematopoietic Cell Transplantation, 5th Edition. Forman SJ, Negrin RS, Antin JH, and Appelbaum FR, Eds., ©John Wiley & Sons, Ltd., in press.

haematologica | 2016; 101(5)

525

R. Storb and B.M. Sandmaier

A

B

C

D

Figure 2. Five-year relapse mortality and overall survival of patients with advanced hematologic malignancies who were conditioned with FLU/2 Gy TBI before HLAmatched related or unrelated HCT and post-grafting immunosuppression with MMF/calcineurin inhibitor. Survival is shown depending on relapse risk and hematopoietic comorbidity scores (HCT-CI).

levels of donor T-cell chimerism and GVHD has been observed using different conditioning regimens.39,40 When both NK and T-cell chimerism were modeled as continuous variables, only early donor T-cell chimerism was associated with acute GVHD, whereas high levels of NK chimerism were significantly associated with lower relapse rates but not with increased GVHD.41 A phase III trial among patients treated with 2 Gy TBI alone vs. TBI with fludarabine 90mg/m2 showed that adding fludarabine contributed to a more rapid T and NK cell chimerism and significantly less relapse (40 % vs. 55%), resulting in superior survival (60 % vs. 54% at 3 years).42 This supported the previous observations of higher donor chimerism being protective for relapse.

Toxicities and infections High-dose conditioning is associated with higher NRM from organ toxicities and infectious complications. The former include hepatic sinusoidal obstruction syndrome/veno-occlusive disease (SOS / VOD) and idiopathic pneumonia syndrome (IPS). No cases of SOS were observed among 193 patients given NMA conditioning.43 Acute renal failure (ARF) (defined as a >50% decrease in glomerular filtration rate) occurred less often in patients given NMA HCT compared to myeloablative conditioning (43% vs. 73%), despite greater age and comorbidities 526

among NMA recipients.44 A separate multivariate analysis revealed that ARF during the first 100 days was associated with the development of chronic kidney disease (CKD).

CKD was defined as at least a 25% reduction in GFR from baseline. Previous autologous HCT, long-term calcineurin inhibitor use and extensive chronic GVHD were independently associated with CKD. CKD following NMA HCT appears to be a distinct clinical entity and likely not related to radiation nephritis.45 Pulmonary function was evaluated in patients before, at day 100, and 1 year after HCT.46 Results suggested that, despite having worse pretransplant lung function, NMA patients experienced less pulmonary toxicity than myeloablative patients. The incidences and outcomes of IPS among NMA (n=183) versus myeloablative (n=917) patients were compared. The cumulative incidence of IPS was significantly lower at 120 days after NMA conditioning (2.2% vs. 8.4%). IPS occurred early after transplant, progressed rapidly, and had a high mortality rate (75%) despite aggressive support.

These findings support the concept that lung damage from conditioning regimen plays a crucial role in IPS after HCT. Following NMA conditioning, patients have less cytopenias including less neutropenia. Significantly fewer NMA recipients (n=503) required platelet transfusions (25% vs.

99%) and red blood cell transfusions (64% vs. 96%) than myeloablative (n=1,353) recipients.47 Among the NMA haematologica | 2016; 101(5)

Nonmyeloablative allogeneic hematopoietic cell transplantation

patients, platelet and RBC transfusions were less frequent among related compared to unrelated recipients.

Major/bidirectionally ABO-mismatched recipients required more RBC transfusions than ABO-matched recipients, though ABO-mismatching did not affect other NMA HCT outcomes. It was also hypothesized that NMA conditioning would be associated with less neutropenia after day 28 following engraftment. However, while NMA conditioning had protective effects on anemia and thrombocytopenia after day 28 there was no significant reduction of neutropenia either overall or in the context of ganciclovir use.48 Elderly patients appear to be more prone to cumulative toxicities of post-HCT drug regimens, but NMA conditioning, optimized HLA matching, and higher doses of CD34+ cell infusions reduced the risk of cytopenia after day 28.

Multiple studies have shown that the incidence of infections early after HCT is reduced after RIC and NMA conditioning. There is less bacteremia in the first month presumably due to a lesser degree of neutropenias.49 While the incidence of CMV infection is the same in CMV positive recipients, NMA-HCT was associated with a lower risk of high-grade CMV infection.50

pared to younger (<60 years) donors (median 7.7 × 106 cells/kg). However, sustained engraftment rates among recipients with older and younger donors were comparable. Sustained grafts were seen in 97% and 98% of patients given myeloablative and NMA conditioning, respectively, who had younger donors, and 90% and 100%, respectively, for those who had older donors. Also the tempo of neutrophil and platelet recoveries and donor chimerism did not show significant differences, except for an average 1.3-day delay in neutrophil recovery among myeloablative patients with older donors (P=0.04).

Moreover, aged stem cells did not convey an increased risk of donor-derived clonal disorders after HCT since none were seen. Both myeloablative and NMA recipients with older sibling donors had significantly less grade 2–4 acute GVHD compared to recipients with grafts from younger

A

Older donors As the age of HCT recipients has increased, the age of their sibling donors has increased as well. Concern has been raised that increasing donor age might adversely affect the functional fitness of hematopoietic cells and thereby impair the marrow recovery after transplantation.

Hematopoietic cells are subject to aging mechanisms such as accumulated DNA damage, telomere shortening, and epigenetic modification. However, studies on the effect of donor age on the function of hematopoietic cells have yielded controversial results, especially the work on stem cell aging in murine model systems. Dutch investigators commented on the variable results seen: “the discrepant conclusions of these studies, however, could be partly caused by (the different) mouse strains used, because strain-dependent increases or decreases in primitive hematopoietic cell frequency and function have been reported.”51 Another concern is related to the longevity of hematopoietic stem cells which makes them ideal targets for mutagenic changes.52 The theoretical possibility was raised that recipients of aged stem cells might be at an increased risk of developing malignant clonal disorders.

Published clinical results on the effects of aging on stem cells also vary. An NMPD study from 2001 reported inferior survival among patients given grafts from donors older than 45 years.53 A French study initially saw no significant impact of donor age among MDS and AML patients undergoing transplantation.54 In contrast, a later analysis by the French group found that donor age ≥60 years had a significant adverse impact on overall recipient survival.55 A CIBMTR analysis from 2013 reported that outcomes were superior in recipients of grafts from HLAidentical sibling donors >50 years old compared to those with grafts from HLA-matched unrelated donors <50 years of age.56 We analyzed the effects of donor age on the speed of hematopoietic engraftment and donor chimerism, acute and chronic GVHD, and NRM among 1,174 patients undergoing myeloablative and 367 patients undergoing NMA conditioning before HLA-matched related or unrelated HCT.57 CD34 cell harvests were reduced in older (60-82 years) donors (median 5.6 × 106 cells/kg) comhaematologica | 2016; 101(5)

B

Figure 3. Overall survival. (A) The probability of OS by donor type after myeloablative conditioning regimen, adjusted for age and disease risk index. (B) The probability of OS by donor type after reduced intensity conditioning regimen, adjusted for disease risk index and secondary AML. (Originally published in Blood. Ciurea SO, Zhang MJ, Bacigalupo AA, et al. Haploidentical transplant with posttransplant cyclophosphamide vs. matched unrelated donor transplant for acute myeloid leukemia. Blood. 2015;126(8):1033-1040. ©The American Society of Hematology).

527

R. Storb and B.M. Sandmaier

unrelated donors. Rates of grade 3 and 4 acute GVHD, chronic GVHD, and NRM among recipients with older donors were not significantly different from those seen in recipients with younger donors. We concluded from this single-center study that grafts from donors ≥60 years of age did not adversely affect outcomes of HCT compared to grafts from younger donors <60 years of age.

A

Relapse Relapse or progression of the underlying malignancy has remained the principal cause of failure of allogeneic HCT. This has been especially true in patients who for reasons of age or comorbidities have been conditioned with NMA regimens, where cure of malignancy depends almost entirely on GVT effects. The following sections will discuss outcomes with a minimal-intensity conditioning regimen and use the results as a basis for proposing ways to reduce relapse or progression.

We maintained the NMA FLU/low-dose TBI platform for patients with advanced hematologic malignancies because most of our patients either did not need or would not tolerate higher dose regimens, and because the regimen best defines the limits of GVT effects.15,58 Powerful GVT effects were seen across all disease stages except for ALL in CR2 and beyond, where all patients progressed. As shown in Figure 2, between 45% and 75% of patients experienced sustained remissions depending on the nature and stage of the underlying malignancy. Overall 5-year relapse mortality was 34.5%. Seventy percent of relapse or progression occurred in year 1 and much of the remainder in year 2 after HCT. We hypothesize that early disease relapse or progression was due to blunted GVT effects from early post-transplantation immune compromise.

Later, as the donor immune system was being built up and immunosuppressive drugs tapered and then discontinued, the “brakes were taken off” the immune cells, enabling GVT effects. This hypothesis is indirectly supported by former extensive immune function studies showing recovery of antibody responses to neoantigens, such as bacteriophage fX174 and keyhole limpet hemocyanin, among others, as well as cellular immunity within 1-3 years after HCT.59 Consistent with this hypothesis, relapse rates in most diseases were markedly reduced in years 3-5.

The options for decreasing the still existing relapse or progression risk are limited. Increasing the intensity, and thereby the toxicity, of the conditioning regimen may be problematic for at least two reasons. One is that a majority of patients did not relapse and, therefore, would be exposed to unnecessary toxicity. The other is that most patients were elderly and/or had comorbidities which preempted dose escalation. Also, more than one-fifth of patients had failed preceding high-dose HCT and another one-fifth had planned autologous HCT, and receiving another high-dose HCT regimen might be too toxic.

Given these limitations, we envision two principal approaches for reducing the risk of relapse or progression in elderly or medically infirm patients.

One approach is based on the hypothesis that delaying disease relapse or progression until the grafted immune system is recovered sufficiently to generate GVT effects would increase cure rates. Such a delay would be accomplished with well-tolerated drugs or antibody-drug conjugates which, even though not curative on their own, would pave the way for curative GVT effects. An example 528

B

Figure 4. Graft-versus-host disease and use of systemic steroids. (A) Cumulative incidence of use of systemic steroids in arm 1 (n=69), arm 2 (n=71) and arm 3 (n=68). (B) Viral infections. Cumulative incidence of cytomegalovirus reactivation in arm 1 (n=69), arm 2 (n=71) and arm 3 (n=68). Originally published in Haematologica (Kornblit B, et al. A randomized phase II trial of tacrolimus, mycophenolate mofetil and sirolimus after non-myeloablative unrelated donor transplantation. Haematologica 2014; 99(10): 1624-1631. ©2014 Ferrata Storti Foundation).

of such an approach has been the treatment of patients with Ph1+ ALL in first remission with a tyrosine kinase inhibitor for one year after HCT.60 The overall 5-year survival rate was 69% and 85% in the subgroup without MRD before HCT, which is impressively better than previous results without tyrosine kinase inhibitors.

Candidate agents for patients with other malignancies include antibodies to CD20 (NHL) and CD30 (Hodgkin lymphoma), proteosome inhibitors (MM), and the FLT3 inhibitors (AML).

A second approach would be to reduce the tumor burden before HCT. One way to accomplish this is through the use of chimeric antigen receptor (CAR) T-cells in patients who have B cell lymphoid malignancies expressing CD19.61,62 Another way is to increase the pre-transplant tumor cell kill by low-toxicity, targeted radiation therapy using a mAb to CD45 coupled to radionuclides used in addition to the basic FLU/2 Gy TBI regimen. One preliminary study summarized early results in 58 patients with advanced AML or high-risk MDS who were older haematologica | 2016; 101(5)

Nonmyeloablative allogeneic hematopoietic cell transplantation

than 50 years and treated with the anti-CD45 mAb coupled to 131I.6 One-year survival was 41%. Another study added 90Y coupled to an anti-CD20 mAb to FLU/2 Gy TBI in 40 patients with persistent, high-risk NHL. The estimated 30-month progression-free survival was 51%.7 Several properties of the beta-emitting radionuclides 131I and 90Y limit their effectiveness including their long half-lives of 2.5 and 8 days, their relatively low energy of 0.7 and 2.3 MeV, and their long path lengths of 0.8-11.3 mm, respectively, which result in off-target effects. Additionally, 131I emits weak gamma radiation during its decay which necessitates placing patients in isolation rooms for several days. To get around these limitations, we have focused our attention on an alpha-emitting radionuclide, 211At, which has a half-life of 7.2 hours, high energy (5.9 MeV), and a path length of only 0.04-0.06 mm. This results in the unique ability of killing mAb-targeted cells while causing minimal damage to surrounding tissues. Moreover, the alpha particles cause multiple strand breaks, hence DNA repair mechanisms are inhibited, which reduces the risk of secondary cancer. An additional advantage of 211At is that it is relatively cheap compared to other alternatives. Our first clinical protocol has been firmly based on 15 years of

References 1. Yu C, Storb R, Mathey B, et al. DLA-identical bone marrow grafts after low-dose total body irradiation: Effects of high-dose corticosteroids and cyclosporine on engraftment.

Blood. 1995;86(11):4376-4381.

2. Storb R, Yu C, Wagner JL, et al. Stable mixed hematopoietic chimerism in DLAidentical littermate dogs given sublethal total body irradiation before and pharmacological immunosuppression after marrow transplantation. Blood. 1997;89(8):30483054.

3. Hogan WJ, Little M-T, Zellmer E, et al.

Postgrafting immunosuppression with sirolimus and cyclosporine facilitates stable mixed hematopoietic chimerism in dogs given sublethal total body irradiation before marrow transplantation from DLA-identical littermates. Biol Blood Marrow Transplant.

2003;9(8):489-495.

4. Storb R, Yu C, Barnett T, et al. Stable mixed hematopoietic chimerism in dog leukocyte antigen-identical littermate dogs given lymph node irradiation before and pharmacologic immunosuppression after marrow transplantation. Blood. 1999;94(3):11311136.

5. Appelbaum FR, Brown P, Sandmaier B, et al.

Antibody-radionuclide conjugates as part of a myeloblative preparative regimen for marrow transplantation. Blood. 1989;73(8): 2202-2208.

6. Pagel JM, Gooley TA, Rajendran J, et al.

Allogeneic hematopoietic cell transplantation after conditioning with 131I-anti-CD45 antibody plus fludarabine and low-dose total body irradiation for elderly patients with advanced acute myeloid leukemia or high-risk myelodysplastic syndrome. Blood.

2009;114(27):5444-5453.

7. Gopal AK, Guthrie KA, Rajendran J, et al.

90Y-Ibritumomab tiuxetan, fludarabine, and TBI-based nonmyeloablative allogeneic

haematologica | 2016; 101(5)

8.

9.

10.

11.

12.

13.

14.

15.

experience with alpha-emitting radionuclides in a canine allogeneic HCT model.

Conclusions Allogeneic HCT after RIC or MMA regimens to treat older or medically infirm patients with advanced hematological malignancies is feasible and effective. This is enabled in large part by GVT effects, and results in cures of appreciable numbers of malignancies. Increasing disease control and decreasing NRM, the latter mostly associated with or preceded by GVHD, will need to be addressed in future trials.

Funding The authors are grateful for research funding from the National Institutes of Health, Bethesda, MD, USA, grants CA078902, CA018029, CA015704 and HL122173. Further support came from the Laura Landro Salomon Endowment Fund. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health nor its subsidiary Institutes and Centers.

transplantation conditioning for patients with persistent high-risk B-cell lymphoma.

Blood. 2011;118(4):1132-1139.

Sandmaier BM, Bethge WA, Wilbur DS, et al. Bismuth 213-labeled anti-CD45 radioimmunoconjugate to condition dogs for nonmyeloablative allogeneic marrow grafts.

Blood. 2002;100(1):318-326.

Chen Y, Kornblit B, Hamlin DK, et al.

Durable donor engraftment after radioimmunotherapy using -emitter astatine-211labeled anti-CD45 antibody for conditioning in allogeneic hematopoietic cell transplantation. Blood. 2012;119(5):1130-1138.

Nakamae H, Wilbur DS, Hamlin DK, et al.

Biodistribution, myelosuppression, and toxicities in mice treated with an anti-CD45 antibody labeled with the -emitting radionuclides bismuth-213 or astatine-211.

Cancer Res. 2009;69(6):2408-2415.

Eto M, Mayumi H, Tomita Y, et al. Specific destruction of host-reactive mature T cells of donor origin prevents graft-versus-host disease in cyclophosphamide-induced tolerant mice. J Immunol. 1991;146(5):1402-1409.

Luznik L, Engstrom LW, Iannone R, Fuchs EJ. Posttransplantation cyclophosphamide facilitates engraftment of major histocompatibility complex-identical allogeneic marrow in mice conditioned with low-dose total body irradiation. Biol Blood Marrow Transplant.

2002;8(3):131-138.

Luznik L, O'Donnell PV, Fuchs EJ. Posttransplantation cyclophosphamide for tolerance induction in HLA-haploidentical bone marrow transplantation. Semin Oncol.

2012;39(6):683-693.

Luznik L, O'Donnell PV, Symons HJ, et al.

HLA-haploidentical bone marrow transplantation for hematologic malignancies using nonmyeloablative conditioning and highdose, post-transplantation cyclophosphamide. Biol Blood Marrow Transplant.

2008;14(28):641-650.

Storb R, Gyurkocza B, Storer BE, et al.

Graft-versus-host disease and graft-versus-

16.

17.

18.

19.

20.

21.

22.

tumor effects after allogeneic hematopoietic cell transplantation. J Clin Oncol. 2013;31 (12):1530-1538.

Kornblit B, Maloney DG, Storer BE, et al. A randomized phase II trial of tacrolimus, mycophenolate mofetil and sirolimus after nonmyeloablative unrelated donor transplantation. Haematologica. 2014;99(10): 1624-1631.

Giralt S, Logan B, Rizzo D, et al. Reducedintensity conditioning for unrelated donor progenitor cell transplantation: long-term follow-up of the first 285 reported to the National Marrow Donor Program. Biol Blood Marrow Transplant. 2007;13(7):844852.

Pulsipher MA, Chitphakdithai P, Logan BR, et al. Donor, recipient, and transplant characteristics as risk factors after unrelated donor PBSC transplantation: beneficial effects of higher CD34+ cell dose. Blood.

2009;114(13):2606-2616.

Michallet M, Le QH, Mohty M, et al.

Predictive factors for outcomes after reduced intensity conditioning hematopoietic stem cell transplantation for hematological malignancies: a 10-year retrospective analysis from the Societe Francaise de Greffe de Moelle et de Therapie Cellulaire. Exp Hematol. 2008;36(5):535-544.

Ho VT, Kim HT, Aldridge J, et al. Use of matched unrelated donors compared with matched related donors is associated with lower relapse and superior progression-free survival after reduced-intensity conditioning hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2011;17(8): 11961204.

Soiffer RJ, Lerademacher J, Ho V, et al.

Impact of immune modulation with anti-Tcell antibodies on the outcome of reducedintensity allogeneic hematopoietic stem cell transplantation for hematologic malignancies. Blood. 2011;117(25):6963-6970.

Blaise D, Farnault L, Faucher C, et al.

Reduced-intensity conditioning with

529

R. Storb and B.M. Sandmaier

23.

24.

25.

27.

28.

29.

30.

31.

32.

33.

34.

530

Fludarabin, oral Busulfan, and thymoglobulin allows long-term disease control and low transplant-related mortality in patients with hematological malignancies. Exp Hematol.

2010;38(12):1241-1250.

Luger SM, RingdĂŠn O, Zhang M-J, et al.

Similar outcomes using myeloablative vs reduced-intensity allogeneic transplant preparative regimens for AML or MDS. Bone Marrow Transplant. 2012;47(2):203211.

Belkacemi Y, Labopin M, Hennequin C, et al. Reduced-intensity conditioning regimen using low-dose total body irradiation before allogeneic transplant for hematologic malignancies: Experience from the European Group for Blood and Marrow Transplantation. Int J Radiat Oncol Biol Phys. 2007;67(2):544-551.

Scott BL, Pasquini MC, Logan B, et al.

Results of a phase III randomized, multi-center study of allogeneic stem cell transplantation after high versus reduced intensity conditioning in patients with myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML): Blood and Marrow Transplant Clinical Trials Network (BMT CTN) 0901.

Blood. 2015;126(23):LBA-8.

26.

Gragert L, Eapen M, Williams E, etal.

HLA match likelihoods for hematopoietic stem-cell grafts in the U.S. registry. N Engl J Med. 2014;371(4):339-348.

Verneris MR, Lee SJ, Ahn KW, et al. HLA mismatch Is associated with worse outcomes after unrelated donor reducedIntensity conditioning hematopoietic cell transplantation: an analysis from the center for international blood and marrow transplant research. Biol Blood Marrow Transplant. 2015;21(10):1783-1789.

Nakamae H, Storer BE, Storb R, et al. Lowdose total body irradiation and fludarabine conditioning for HLA class I-mismatched donor stem cell transplantation and immunologic recovery in patients with hematologic malignancies: a multicenter trial. Biol Blood Marrow Transplant.

2010;16(3):384-394.

Brunstein CG, Fuchs EJ, Carter SL, et al.

Alternative donor transplantation after reduced intensity conditioning: results of parallel phase 2 trials using partially HLAmismatched related bone marrow or unrelated umbilical cord blood grafts. Blood.

2011;118(2):282-288.

Passweg JR, Baldomero H, Bader P, et al.

Hematopoietic SCT in Europe 2013: recent trends in the use of alternative donors showing more haploidentical donors but fewer cord blood transplants. Bone Marrow Transplant. 2015;50(4):476-482.

Ciurea SO, Zhang MJ, Bacigalupo AA, et al.

Haploidentical transplant with posttransplant cyclophosphamide vs matched unrelated donor transplant for acute myeloid leukemia. Blood. 2015;126(8):1033-1040.

Sayer HG, KrĂśger M, Beyer J, et al. Reduced intensity conditioning for allogeneic hematopoietic stem cell transplantation in patients with acute myeloid leukemia: disease status by marrow blasts is the strongest prognostic factor. Bone Marrow Transplant.

2003;31(12):1089-1095.

Armand P, Kim HT, Logan BR, et al.

Validation and refinement of the Disease Risk Index for allogeneic stem cell transplantation. Blood. 2014;123(23):3664-3671.

McCurdy SR, Kanakry JA, Showel MM, et al. Risk-stratified outcomes of nonmyeloablative HLA-haploidentical BMT with highdose posttransplantation cyclophosphamide. Blood. 2015;125(19):3024-3031.

35. Jaiswal SR, Chakrabarti A, Chatterjee S, et al. Haploidentical peripheral blood stem cell transplantation with post-transplantation cyclophosphamide in children with advanced acute leukemia with a fludarabine, busulfan and melphalan based conditioning.

Biol Blood Marrow Transplant. 2015 pii:S1083-8791(15)00737-5.

36. Ghiso A, Raiola AM, Gualandi F, et al. DLI after haploidentical BMT with post-transplant CY. Bone Marrow Transplant.

2015;50(1):56-61.

37. Thakar M, Hari PN, Keever-Taylor CA, et al.

Donor natural killer (NK) cell immunotherapy following non-myeloablative HLA-haploidentical hematopoietic cell transplantation (HCT) improves relapse and progression free survival (PFS) in patients with hematologic malignancies [abstract]. Biol Blood Marrow Transplant. 2016 (epub).

38. McSweeney PA, Niederwieser D, Shizuru JA, et al. Hematopoietic cell transplantation in older patients with hematologic malignancies: replacing high-dose cytotoxic therapy with graft-versus-tumor effects. Blood.

2001;97(11):3390-3400.

39. Childs R, Clave E, Contentin N, et al.

Engraftment kinetics after nonmyeloablative allogeneic peripheral blood stem cell transplantation: full donor T-cell chimerism precedes alloimmune responses. Blood.

1999;94(9):3234-3241.

40. Baron F, Baker JE, Storb R, et al. Kinetics of engraftment in patients with hematologic malignancies given allogeneic hematopoietic cell transplantation after nonmyeloablative conditioning. Blood. 2004;104(8):2254-2262.

41. Baron F, Petersdorf EW, Gooley T, et al.

What is the role for donor natural killer cells after nonmyeolablative conditioning? Biol Blood Marrow Transplant. 2009;15(5):580588.

42. Kornblit B, Maloney DG, Storb R, et al.

Fludarabine and 2 Gy TBI is superior to 2 Gy TBI as conditioning for HLA-matched related hematopoietic cell transplantation: a phase III randomized trial. Biol Blood Marrow Transplant. 2013;19(9):1340-1347.

43. Hogan WJ, Maris M, Storer B, et al. Hepatic injury after nonmyeloablative conditioning followed by allogeneic hematopoietic cell transplantation: a study of 193 patients.

Blood. 2004;103(1):78-84.

44. Parikh CR, Schrier RW, Storer B, et al.

Comparison of ARF after myeloablative and nonmyeloablative hematopoietic cell transplantation. American Journal of Kidney Diseases. 2005;45(3):502-509.

45. Weiss AS, Sandmaier BM, Storer B, Storb R, McSweeney PA, Parikh CR. Chronic kidney disease following nonmyeloablative hematopoietic cell transplantation. Am J Transplant. 2006;6(1):89-94.

46. Fukuda T, Hackman RC, Guthrie KA, et al.

Risks and outcomes of idiopathic pneumonia syndrome after nonmyeloablative and conventional conditioning regimens for allogeneic hematopoietic stem cell transplantation. Blood. 2003;102(8):2777-2785.

47. Wang Z, Sorror ML, Leisenring W, et al. The impact of donor type and ABO incompatibility on transfusion requirements after nonmyeloablative hematopoietic cell transplantation. Br J Haematol. 2010;149(1):101-110.

48. Nakamae H, Storer B, Sandmaier BM, et al.

Cytopenias after day 28 in allogeneic hematopoietic cell transplantation: impact of recipient/donor factors, transplant conditions and myelotoxic drugs. Haematologica.

2011;96(12):1838-1846.

49. Junghanss C, Marr KA, Carter RA, et al.

Incidence and outcome of bacterial and fun-

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

gal infections following nonmyeloablative compared with myeloablative allogeneic hematopoietic stem cell transplantation: a matched control study. Biol Blood Marrow Transplant. 2002;8(9):512-520.

Nakamae H, Kirby KA, Sandmaier BM, et al.

Effect of conditioning regimen intensity on CMV infection in allogeneic hematopoietic cell transplantation. Biol Blood Marrow Transplant. 2009;15(6):694-703. de Haan G, Nijhof W, Van Zant G. Mouse strain-dependent changes in frequency and proliferation of hematopoietic stem cells during aging: correlation between lifespan and cycling activity. Blood. 1997;89(5):15431550.

Rossi DJ, Jamieson CH, Weissman IL. Stems cells and the pathways to aging and cancer (Review). Cell. 2008;132(4):681-696.

Kollman C, Howe CWS, Anasetti C, et al.

Donor characteristics as risk factors in recipients after transplantation of bone marrow from unrelated donors: the effect of donor age. Blood. 2001;98(7):2043-2051.

Robin M, Porcher R, Ades L, et al. Matched unrelated or matched sibling donors result in comparable outcomes after non-myeloablative HSCT in patients with AML or MDS. Bone Marrow Transplant. 2013; 48(10): 1296-1301.

Peffault de Latour R, Brunstein CG, Porcher R, et al. Similar overall survival using sibling, unrelated donor, and cord blood grafts after reduced-intensity conditioning for older patients with acute myelogenous leukemia.

Biol Blood Marrow Transplant. 2013;19(9): 1355-1360.

Alousi AM, Le-Rademacher J, Saliba RM, et al. Who is the better donor for older hematopoietic transplant recipients: an older-aged sibling or a young, matched unrelated volunteer? Blood. 2013;121(13):25672573.

Rezvani AR, Storer BE, Guthrie KA, et al.

Impact of donor age on outcome after allogeneic hematopoietic cell transplantation.

Biol Blood Marrow Transplant. 2015; 21(1):105-112.

Storb R, Gyurkocza B, Storer BE, et al.

Allogeneic hematopoietic cell transplantation following minimal intensity conditioning: predicting acute graft-versus-host disease and graft-versus-tumor effects. Biol Blood Marrow Transplant. 2013;19(5):792798.

Witherspoon RP, Storb R, Ochs HD, et al.

Recovery of antibody production in human allogeneic marrow graft recipients: Influence of time posttransplantation, the presence or absence of chronic graft-versushost disease, and antithymocyte globulin treatment. Blood. 1981;58(2):360-368.

Ram R, Storb R, Sandmaier BM, et al. Nonmyeloablative conditioning with allogeneic hematopoietic cell transplantation for the treatment of high-risk acute lymphoblastic leukemia. Haematologica. 2011;96(8):11131120.

Davila ML, Riviere I, Wang X, et al. Efficacy and toxicity management of 19-28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Science Transl Med. 2014;6(224): 224ra25.

Turtle CJ, Berger C, Sommermeyer D, et al.

Anti-CD19 chimeric antigen receptor-modified T cell therapy for B cell non-Hodgkin lymphoma and chronic lymphocytic leukemia: Fludarabine and cyclophosphamide lymphodepletion improves in vivo expansion and persistence of CAR-T cells and clinical outcomes [abstract]. Blood.

2015;126(23):184.

haematologica | 2016; 101(5)

REVIEW ARTICLE

Role of the tumor microenvironment in mature B-cell lymphoid malignancies

Nathan H. Fowler,1 Chan Yoon Cheah,1,2,3 Randy D. Gascoyne,4 John Gribben,5 Sattva S. Neelapu,1 Paolo Ghia,6,7 Catherine Bollard,8 Stephen Ansell,9 Michael Curran,1 Wyndham H. Wilson,10 Susan O’Brien,11 Cliona Grant,12 Richard Little,13 Thorsten Zenz,14 Loretta J. Nastoupil,1 and Kieron Dunleavy10

Department of Lymphoma/Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX, USA; 2Department of Haematology, Pathwest Laboratory Medicine WA and Sir Charles Gairdner Hospital, Perth, Western Australia; 3University of Western Australia, Perth; 4 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada; 5 Department of Haemato-Oncology, Barts Cancer Institute, London, UK; 6Università VitaSalute San Raffaele, Division of Experimental Oncology, IRCCS Istituto Scientifico San Raffaele, Milan, Italy; 7Department of Onco-Hematology, Ospedale San Raffaele, Milan, Italy; 8Children’s Research Institute, Washington, DC, USA; 9Division of Hematology, Mayo Clinic, Rochester, MN, USA; 10Lymphoid Malignancies Branch, National Cancer Institute, Bethesda, MD, USA; 11University of California, Irvine, CA, USA; 12St. James’ Hospital, Dublin, Ireland; 13Cancer Therapeutic Evaluation Program, National Cancer Institute, Bethesda, MD, USA; and 14University of Heidelberg, Germany

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

1

Haematologica 2016 Volume 101(5):531-540

ABSTRACT

T

he tumor microenvironment is the cellular and molecular environment in which the tumor exists and with which it continuously interacts. In B-cell lymphomas, this microenvironment is intriguing in that it plays critical roles in the regulation of tumor cell survival and proliferation, fostering immune escape as well as the development of treatment resistance. The purpose of this review is to summarize the proceedings of the Second Annual Summit on the Immune Microenvironment in Hematologic Malignancies that took place on September 11-12, 2014 in Dublin, Ireland. We provide a timely overview of the composition and biological relevance of the cellular and molecular microenvironment interface and discuss the role of interactions between the microenvironment and neoplastic cells in a variety of B-cell lymphomas. In addition, we focus on various novel therapeutic strategies that target the tumor microenvironment, including agents that modulate B-cell receptor pathways and immune-checkpoints, chimeric antigen receptor T cells and immunomodulatory agents.

Correspondence: nfowler@mdanderson.org

Received: December 10, 2015.

Accepted: January 28, 2016.

doi:10.3324/haematol.2015.139493

Introduction Recent advances in the understanding of the pathogenesis of hematologic malignancies have focused attention on the role of the tumor microenvironment. In Bcell lymphomas, the cellular infiltrate intimately associated with the malignant lymphocytes, and the molecules that can be released or trapped within it, may aid tumor cell proliferation and survival as well as escape from immunosurveillance.1 Recognition of the microenvironment’s importance has paved the way for the development of exciting novel strategies that target the microenvironment and its interactions with neoplastic cells. In particular, drugs targeting B-cell receptor (BCR) signaling and programmed death-1 (PD-1) pathways as well as chimeric antigen receptor (CAR) T-cell therapy represent promising advances in lymphoma treatment. The purpose of this review is to summarize the proceedings of the Second Annual Summit on the Role of the Immune Microenvironment in B-cell Lymphomas that took place in Dublin, Ireland on September 11-12, 2014. The manuscript reflects the meeting’s structure: the first half is devoted to an overview of the tumor microenvironment in various lymphoma subtypes, and the remaining is a discussion of novel therapeutic approaches targeting the tumor microenvironhaematologica | 2016; 101(5)

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/531

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

531

N.H. Fowler et al.

ment and practical aspects concerning the design and conduct of studies evaluating these agents.

Overview of the microenvironment in B-cell malignancies The tumor microenvironment of B-cell lymphomas is highly variable with regards to both spatial arrangement and composition of cells, including immune and inflammatory cells, blood and lymphatic vascular networks and the extracellular matrix. The cellular composition of the microenvironment generally mirrors that of the normal tissue at the site of development, the exception being classical Hodgkin lymphoma (see below). Tumor cells retain a degree of dependence on interactions with non-malignant cells and stromal elements of the tumor microenvironment for survival and proliferation.2 However, tumor cells also use these interactions to generate immunosuppressive mechanisms that promote tumor escape from immune surveillance and lead to disease progression.2-4 Increasing data indicate a critical role for the tumor microenvironment in mediating treatment resistance.5 The cellular composition and spatial characteristics of the microenvironment demonstrate significant heterogeneity depending on a number of factors, including the lymphoma subtype.

Scott and Gascoyne have proposed three major models that divide up the broad range of tumor microenvironments described in B-cell lymphomas (Figure 1).2 The first, re-education, is typified by follicular lymphoma (FL), in which malignant cells retain dependence on the microenvironment for survival and proliferation signals; the second, recruitment, is observed in classical Hodgkin lymphoma (cHL) in which the infrequent Reed-Sternberg cells are surrounded by an extensive support milieu of nonmalignant cells that is distinct from the composition of normal lymphoid tissue; the third, effacement, is seen in Burkitt lymphoma (BL) and to some extent in diffuse large B-cell lymphoma (DLBCL), whereby genetic aberrations, such as translocation of MYC, within the malignant cell lead to autonomous, microenvironment-independent growth and survival.2 These tumors rely little on the microenvironment, which is sparse when compared to the microenvironment in cHL. Thus, the extent to which different histological subtypes of lymphoid malignancy are susceptible to agents targeting the immune microenvironment is likely to vary depending on the degree to which the tumor cells are dependent on external stimuli for growth or proliferation. In the following section, we provide an overview of the current understanding of the structure, composition and function of the tumor microenvironment in B-cell lymphomas and chronic lymphocytic leukemia (CLL).

Aggressive lymphomas Diffuse large B-cell lymphoma DLBCL is the most common type of non-Hodgkin lymphoma and is recognized as a heterogeneous disease with distinct molecular subtypes that are derived from different stages of B-cell differentiation.6,7 Alizadeh et al. first described gene expression profiling to define distinct subtypes of DLBCL: activated B cells and germinal center B cells.6 Seminal work by the Leukemia/Lymphoma Molecular Profiling Project further described two stromal 532

signatures (termed stromal-1 and -2) in the tumor microenvironment, present in both activated and germinal center subtypes, which were predictive of outcome.8 Although key genetic lesions may explain some of this disparity, other factors, such as the microenvironment, likely play an important role. The contribution of the tumor microenvironment to the pathogenesis and tumor survival of DLBCL is poorly understood; however, several recent studies have yielded intriguing findings and shed some light on the microenvironment’s possible roles. One recent study in DLBCL demonstrated that 29% of cases have mutations or deletions resulting in inactivation of the β2-microglobulin gene (B2M) and 21% feature inactivations in the CD58 gene (CD58), two molecules that are critically involved in the immune recognition of tumor cells by circulating T-lymphocytes and natural killer (NK) cells, respectively.9 The immune escape from these important immune cells (circulating T-lymphocytes and NK cells) implicates the evasion of immune recognition as playing an important role in the pathogenesis of DLBCL. Thus, in the majority of cases of DLBCL these two gene alterations may be co-selected during lymphomagenesis to avoid cytotoxic circulating T-lymphocytes and NK cells.

Many studies have looked at the role of PD-1 and PDL1, which are expressed in many aggressive B-cell lymphomas and have also been associated with mechanisms of immune evasion.3,10-12 The MHC class II transactivator CIITA is commonly fused to PD-L1 and PD-L2, which can result in a decrease in HLA-DR expression.10 A study by Steidl et al. looked at rearrangements of CIITA in B-cell lymphomas;10 combined with PD-L1 copy number gains and translocations independent of CIITA, this fusion resulted in T-cell exhaustion and immune escape. In addition, translocations and copy-number gains of PD-L1/2 appear to be a dominant mechanism of immune escape in primary mediastinal B-cell lymphoma (PMBL).13-15 Kiyasu et al. studied 1253 DLBCL biopsies and found tumor cell, but not microenvironmental, expression of PD-L1 was associated with adverse overall survival, a difference that was present even among the subgroup of patients treated with R-CHOP or similar regimens.16 Tumor PD-L1 expression was significantly associated with non-germinal center B-cell phenotype.

Other studies have investigated the role of chemokines and cytokines such as CCL22, CCL17, GAL-1 and TGF-β vis-à-vis how they recruit and/or retain immunosuppressive cells such as M2 macrophages, regulatory T cells (Tregs), and exhausted T cells, and in that way contribute to the pathogenesis of B-cell lymphomas.2,17,18 Riihijarvi et al. found that both CD68 mRNA levels and CD68+ tumorassociated macrophages, detected by immunohistochemistry, were adverse prognostic factors for overall survival among patients treated uniformly with chemotherapy in a prospective clinical trial.19 In contrast, among patients treated with chemo-immunotherapy, the impact of CD68+ tumor-associated macrophages was reversed, such that patients with high CD68+ tumor-associated macrophages had improved overall survival. This interesting observation led the authors to speculate that rituximab may alter the function of tumor-associated macrophages from having a pro-survival effect to an anti-tumor one.

Mantle cell lymphoma The molecular hallmark of mantle cell lymphoma (MCL) is the t(11;14) translocation, which results in conhaematologica | 2016; 101(5)

The microenvironment in B-cell lymphoid malignancies

stitutive expression of cyclin D1, leading to cell cycle deregulation. However, extrinsic microenvironmentderived signals also play a role in the pathogenesis of this disease.20 MCL is biologically characterized by a tendency toward extranodal dissemination, mediated by attraction and retention through a highly regulated process involving chemokine gradients and adhesion molecules such as VLA-4, CCR7, CXCR5 and CXCR4.21 Through this mechanism, MCL cells interact with stromal cells such as fibroblasts and macrophages. Adhesion to stromal elements is an important mechanism of chemoresistance, and is likely a reason for the incurability of patients following chemotherapy.22 Another means by which MCL cells are protected from chemotherapy is through interleukin (IL)-6 secretion, which may be secreted by the MCL cells themselves or by bone marrow stromal cells.23 IL-6 activates the JAK/STAT3 and PI3K/Akt pathways, known to be key regulators of MCL growth and survival.

Relative to other lymphoma subtypes, the precise composition of the MCL tumor microenvironment is not well characterized. Macrophages have been described in MCL although, in contrast to FL and cHL, systematic evaluation of their prognostic or pathogenic implications is lacking.24 Studies in small series have suggested that increased numbers of macrophages are associated with aggressive clinical behavior.25,26 Two studies indicate that MCL cells induce microenvironmental changes to evade the host immune response. Firstly, intratumoral biopsies showed that CD4+CD25+Foxp3+ Tregs are present in MCL, where they likely contribute to a reduction of anti-tumor cytotoxicity.18 Secondly, PD-L1 (B7-H1) was shown to be expressed by MCL cell lines, in which it resulted in impaired T-cell proliferation after tumor exposure, inhibited specific anti-tumor T-cell responses and impaired Tcell-mediated tumor cell killing.27 The negative PI3K regulator PTEN is often inactivated by phosphorylation in MCL.28 This, along with antigenic stimulation via the BCR, resulted in constitutive activation of Syk, Btk and PI3kAkt, which are critical in MCL disease progression and maintenance.29 Inhibition of Syk and Btk has been shown to inhibit BCR-mediated adhesion of MCL to bone marrow stromal cells and to increase apoptosis.30

Hodgkin lymphoma The tumor microenvironment in cHL has been extensively studied, with four variant morphological patterns described: nodular sclerosing, mixed cellularity, lymphocyte-rich and lymphocyte-depleted. Neoplastic Hodgkin Reed-Sternberg (HRS) cells account for <5% of the tumor, with the remaining cells comprising B and T cells, eosinophils, neutrophils, mast cells, fibroblasts and macrophages.31 These cells are attracted by chemokines secreted by HRS cells such as CCL17 (TARC) and CCL12.32,33 HRS cells also secrete cytokines such as macrophage migration inhibition factor, which induces macrophage M2 polarization,34 and IL-9, which promotes mast cell differentiation (which in turn results in angiogenesis and fibrosis).35 Thus, HRS cells both attract and induce the differentiation of immune cells resulting in a tumor microenvironment favorable for tumor cell growth and survival.36 The importance of the tumor microenvironment in cHL was illustrated in studies by two independent groups who used gene expression profiling to demonstrate overexpression of genes associated with macrophages in biopsies haematologica | 2016; 101(5)

taken from patients who experienced treatment failure.37 This tied in neatly with the findings of immunohistochemical studies, in which increased number of CD68+ cells in diagnostic biopsy specimens was prognostic of inferior progression-free survival and disease-specific survival in patients treated with doxorubicin, bleomycin, vinblastine and dacarbazine, independently of established clinical and laboratory parameters.38 The adverse prognostic impact of CD68 expression on overall survival was validated in another study from Barts Cancer Institute.39 CD68 is not specific for macrophages, as it stains other myeloid cells, and some fibroblasts.40 Increased numbers of CD163+ cells [whose expression is restricted to M2 polarized (immunosuppressive) macrophages] has been suggested by some studies to be a superior adverse prognostic marker.41-43 An interesting recent study showed that patients with Hodgkin lymphoma have higher numbers of circulating myeloid-derived suppressor cells in their peripheral blood than have healthy controls, and that increased levels of CD34+ myeloid-derived suppressor cells were predictive of inferior progression-free survival.44 With regard to lymphocyte subsets in the tumor microenvironment, increased numbers of non-follicular B cells are associated with favorable survival, indicating that they likely play an important role in the immunological control of cHL.39,45,46 Somewhat counter-intuitively, increased numbers of FOXP3+ Tregs have been associated with superior progression-free and overall survival.39,47,48 while increased numbers of granzyme B+ cytotoxic T cells have the opposite effect on survival.47,48 Although these findings require validation in larger, prospectively treated cohorts of patients, they suggest that Tregs have a contrasting function in cHL compared with solid tumors, such as direct suppression of HRS cells.

Indolent lymphomas Follicular lymphoma In FL and mucosal-associated lymphoid tissue (MALT) lymphoma, tumor cells appear to depend heavily on the microenvironment for survival and proliferation.2 Gene expression profiling of tumor infiltrating lymphocytes (TIL) in FL revealed two immune response signatures which predicted disparate clinical outcomes.49 Interactions between TIL and tumor cells can result in modulation of the immune response, which can have prognostic implications.50-54 For example, studies have shown that high numbers of PD1+ TIL are prognostically favorable, while patients with â&#x2030;¤5% PD1+ TIL had a higher risk of histological transformation to DLBCL.55 In another study from Vancouver, the follicular localization of Tregs was found to be an adverse prognostic factor for overall survival and transformation risk.56 Tumor-associated macrophages also appear to predict an unfavorable clinical course.52 Analysis of the gene expression profiles of CD4+ and CD8+ FL TIL revealed altered gene expression that resulted in impaired actin polymerization and immune synapse formation and decreased cytotoxicity and T-cell motility, leading to T-cell exhaustion and immunosuppression.57-60 This altered gene expression in TIL has prognostic significance with respect to overall survival and time to transformation.57 In terms of the potential therapeutic implications of these findings in T cells, an interesting study demonstrated that FL cells 533

N.H. Fowler et al.

with T-cell immunological synapse dysfunction can be repaired with the immunomodulatory agent lenalidomide.59

Marginal zone lymphoma Extranodal marginal zone lymphomas (MZL) of MALT provide a classical illustration of the role of the microenvironment in lymphomagenesis through B-cell antigen stimulation. Chronic infections may provide antigenic stimulation, which results in different manifestations of MZL at various anatomic sites. Examples include gastric MALT and Helicobacter pylori,61 splenic MZL and hepatitis C,62 ocular adnexal MZL and Chlamydophilia psittaci,63 and cutaneous MZL and Borrelia.64 Eradication of the implicated microorganism leads to lymphoma regression in many cases, supporting antigenic dependence.65 The occurrence of secondary genetic lesions, in particular t(11;18), has been associated with poor responses to eradication therapy for gastric MALT lymphoma, presumably due to the development of independence from the microenvironment for growth and survival.66 Although splenic MZL generally has an indolent course, up to one-third of patients experience rapid disease progression. Dense infiltrates of CD40+ cells within the bone marrow correlate with inferior prognosis, likely through interactions with CD40L with surrounding cells in the tumor microenvironment (including mast cells, helper T cells, dendritic cells, macrophages and B cells) resulting in immune cell activation through phosphorylation of STAT3 and resultant secretion of TNF/IL-6 – the net effect of which is the induction of a microenvironment favoring tumor growth and survival.67

Chronic lymphocytic leukemia Studies examining tumor escape in CLL differ as to whether changes in expression of classical and non-classical human leukocyte antigens by tumor cells can modulate the interactions of NK- and T-cell subpopulations with target cells.68 In CLL, T-cell dysfunction is mediated by

expression of inhibitory molecules such as CD200, CD270, PD-L1 and B7-H3 on tumor cells, with predominant influences mediated by PD-L1 expression.69,70 Expression of these molecules has been linked to a poor prognosis in patients with CLL.69 Interestingly, reducing expression of these genes in tumor cells can improve T-cell function. In addition, treatment of TIL with lenalidomide has been shown to reverse the signs of T-cell exhaustion and improve T-cell function.69 BCL-2 expression71 has been suggested to be in part controlled by miR-15/16 expression, but alternative microenvironmental interactions may be associated with BCL-2 upregulation and increased cell survival in CLL.72 Indeed, BCL-2 can be up-regulated by CD40/CD40L interactions, as shown by the increased expression upon culture with soluble CD40L. This interaction may potentially occur in the infiltrated lymphoid tissues and in particular in the proliferation centers where CD4+ T cells can be found in close proximity to leukemic B cells. Moreover, additional studies have shown that co-culture of CLL cells and stromal cells results in up-regulation of BCL-2 expression, thereby providing survival and drug-resistance signals to CLL cells.73 Investigations into the types of stromal cells that may mediate these interactions show that monocytes contribute to CLL survival and mediate expansion of CLL cells.74,75 Analyses in murine models show that depleting monocyte levels can decrease CLL burden in the mice.74 Similarly, the stimulation of surface receptors, including Toll-like receptors76 and BCR, is able to induce upregulation of BCL-2 and other anti-apoptotic molecules suggesting that a wide array of signals from the microenvironment can indeed be responsible for the regulation of apoptosis. All these signals translate into activation of downstream signaling pathways, including the MAPK and the NF-κB pathways, which contribute to the survival of leukemic cells. ERK is constitutively active in approximately 50% of CLL patients,77 likely due to the stimulation by anergizing antigenic elements, while SYK and NF-κB

Table 1. Overview of lymphoma subtypes, examples of impact of tumor microenvironment on outcome and novel agents of potential therapeutic relevance.

Lymphoma subtype Hodgkin lymphoma

Diffuse large B-cell lymphoma

Follicular lymphoma

Marginal zone lymphoma Mantle cell lymphoma Chronic lymphocytic leukemia

Key tumor microenvironment elements, prognostic impact +

Therapeutic agents 37

Increased macrophage gene expression, CD68 infiltrate (adverse) Increased myeloid derived suppressor cells (adverse)44 Increased Treg (favorable)39, 47, 48 Increased non-follicular B cells (favorable)39 Increased cytotoxic T cells (adverse)47, 48 Increased CD68+ TAM and CD68 mRNA (adverse in patients treated with chemotherapy, favorable in patients treated with chemo-immunotherapy)19 Increased tumor microenvironment PD-L1 expression16 Immune response signature-1 (favorable)49 Increased TAM53 Increased PD1+ TIL (favorable)55 Intra- or peri-follicular Treg (adverse)56 Dense infiltrates of CD40+ cells (adverse)67 Increased TAM associated with aggressive clinical behavior25, 26 Tumor cell adhesion to stromal elements (adverse)21 Tumor-stromal interactions73 Induction of myeloid derived suppressor cells75 Promotion of BCR signaling and NFκB activation78

PD-1 inhibitors153

Rituximab19 PD-1 inhibitors89

Lenalidomide59 Lenalidomide and rituximab132 PD-1 inhibitors90

BTK inhibitors108 Lenalidomide154 BTK inhibitors106 PI3K inhibitors121

PD-1: programmed cell death-1; PD-L1, programmed cell death ligand-1; TAM: tumor associated macrophage; TIL: tumor infiltrating lymphocyte.

534

haematologica | 2016; 101(5)

The microenvironment in B-cell lymphoid malignancies

are upregulated in virtually all cases of CLL, with many patients having recurrent mutations within the NF-κB pathway78,79 in addition to induction by the microenvironment.

Novel therapies targeting the microenvironment The following section focuses on several novel classes of agents that therapeutically exploit the dependence of lymphoma cells on microenvironmental stimuli as part of their mechanism of action.

Checkpoint inhibitors PD-1 limits the response of activated T cells at sites of infection and prevents autoimmunity.80,81 Binding of PD-1 by its ligands PD-L1 and PD-L2 produces inhibitory signals that ultimately result in apoptosis of activated T cells, the

so-called “immune checkpoint”.82 However, PD-1 is also present on other immune cells including Treg, B and NK cells. Thus, PD-1 blockade enhances anti-tumor cytotoxicity through increased NK-cell killing and Treg suppression.83,84 Tumor cells are able to exploit the pathway in a similar manner by expressing PD-L1 on TIL.85 In vitro experimental models indicate that PD-L1 expression by tumors results in the impairment of anti-tumor responses.86 Antibodies targeting the PD-1 axis thus “release the brakes” from effector T cells and promote anti-tumor cytotoxicity.87 Antibody-dependent cell-mediated cytotoxicity (ADCC) of tumor cells expressing PD-1 or PD-L1 does not appear to be a mechanism of action for these agents, as PD-1/PD-L1 surface expression by tumor cells or tumor microenvironment does not seem to be necessary for their activity.88 Various agents targeting the PD1 axis are under development; however, preliminary data

Figure 1. Schematic diagram of the typical microenvironment of the three B-cell lymphoma subtypes that represent the extremes of the spectrum of tumor microenvironment — recruitment, re-education and effacement. These lymphoma subtypes represent the range of tumor cell content, from ~1% in cHL to typically more than 90% in BL. The other B-cell lymphomas fall within this range, as shown for the most common B-cell lymphomas (center). Typically, the ratio of malignant cells to microenvironmental cells increases across the range, from cHL to BL, as shown. DLBCL, diffuse large B-cell lymphoma; FOXP3, forkhead box protein P3; HRS, Hodgkin Reed–Sternberg; MALT, mucosa-associated lymphoid tissue; MCL, mantle cell lymphoma; TFH, follicular T helper; TH, T helper; TFR, follicular regulatory T. Reproduced from Scott and Gascoyne2 with permission from Nature Publishing Group.

haematologica | 2016; 101(5)

535

N.H. Fowler et al.

Much has been written about the success of investigational anti-CD19 CAR T-cell therapy in relapsed/refractory acute lymphoblastic leukemia, CLL and DLBCL.94-96 This technology uses gene-modified autologous T cells with antigen specificity for CD19, expressed mainly on the surface of B cells.97 CD19 represents a near optimal tumor-associated antigen to target, as its restricted expression minimizes off-target toxicity. One of the problems with CAR T-cell therapy is to overcome the immunosuppressive tumor microenvironment that includes M2 polarized macrophages, Tregs, and myeloid-derived suppressor cells.98 Investigators have approached this problem by modifying the CAR T-cell construct number in a number of customized ways, including the incorporation of proinflammatory cytokines such as IL-12,99 expression of dominant negative TGF-β,100 anti-apoptotic Fas-knockdowns101 and the expression of survival signals such as Bclxl.102 An alternate approach would be to combine CAR T cells with agents targeting the PD-1 axis to enhance the anti-tumor cytotoxicity.

shown that ibrutinib may antagonize ADCC induced by anti-CD20 monoclonal antibodies such as rituximab, in the clinical setting ibrutinib in combination with rituximab is highly active.113,114 More selective Btk inhibitors that spare Itk do not appear to have the same antagonism and may prove more effective in combinations. Through Itk inhibition, ibrutinib also influences T-cell polarization toward type 1 T helper cells and effector T cells.115 Preclinical work

by Levy et al. at Stanford also suggests that ibrutinib potently enhances immunological tumor control when coadministered with a TLR9 agonist through stimulation of antigen-presenting cells in the tumor microenvironment.116 The same group also described how ibrutinib enhanced the T-cell anti-tumor activity of PD-L1 inhibitors, a finding with clear implications for combination studies.117 Btk plays a role in polarizing macrophages to an M1 (inflammatory) phenotype; as mice deficient in Btk are skewed towards M2 (immunosuppressive) polarization, which suggests a theoretical potential for ibrutinib to induce an unhelpful change in the microenvironment.118 However, we are unaware of data regarding macrophage polarization in ibrutinib-treated patients.

Several PI3K inhibitors with various isoform specificities are in development. The most advanced, idelalisib, is a selective inhibitor of the p110δ isoform of PI3K. It has demonstrated excellent clinical activity in patients with relapsed/refractory CLL/small lymphocytic lymphoma and FL, indications for which it has gained approval from both the Food and Drug Administration (FDA) and the European Medicines Agency (EMA).119-121 PI3Kδ is expressed by both normal and malignant lymphoid cells, and PI3k inhibition by idelalisib in vitro leads to induction of apoptosis.122 Like ibrutinib, idelalisib interferes with pro-survival microenvironment-derived signals, chemotaxis and adhesion.123,124 Its antagonism of ADCC induced by anti-CD20 monoclonal antibodies is weaker that that of ibrutinib in vitro.125 Idelalisib does not appear cytotoxic to T-cell subsets;126 however, the investigational dual PI3K p110γ and p110δ inhibitor duvelisib (IPI-145) reduces the viability of T and NK cells and impairs T-cell production of pro-inflammatory cytokines.127

B-cell receptor pathway inhibitors

Immunomodulatory drugs

B cells depend on signals mediated through the BCR to govern a variety of cellular processes including proliferation, apoptosis and differentiation.103 Deregulation of the BCR pathway is thought to be central to the pathogenesis of many B-cell lymphomas.104 The BCR signaling cascade involves numerous tyrosine kinases including Btk, Syk and PI3K, and small molecule inhibitors targeting these kinases have been developed.

Ibrutinib is a selective, small molecule that irreversibly binds to Btk.105 Ibrutinib has excellent activity in CLL,106,107 MCL108 and Waldenström macroglublinemia109 and has gained regulatory approval for the treatment of relapsed or refractory patients with these diseases and also for first-line therapy in patients with del(17p) CLL. Although the mechanism of action of ibrutinib involves direct effects on malignant B cells, including induction of apoptosis and disruption of cell adhesion and migration,110 the effects on the tumor microenvironment are also important. Btk regulates NK cell function in response to antigen presentation.111 However, ibrutinib also inhibits Itk, which is involved in NK cell effector function following FcR-mediated engagement.112 Interestingly, while some preclinical studies have

Immunomodulatory drugs exert pleiotropic effects both directly on lymphoma cells and on the immune microenvironment. Lenalidomide (FDA-approved for multiple myeloma and relapsed MCL) has activity in a range of lymphoma subtypes both as a single agent128-131 and in combination with rituximab, particularly in MCL and FL.132-137 The molecular mechanism of action of lenalidomide has only recently been described in detail.

Immunomodulatory drugs bind to the E3 ubiquitin ligase cereblon (CRBN), which is re-directed by lenalidomide to induce proteosomal degradation of the transcription factors Ikaros (IKZF1) and Aiolos (IKZF3).138-140 These transcription factors provide pro-survival signals for tumor cells and suppress IL-2 production. The binding of immunomodulatory drugs to CRBN therefore blocks survival signals to tumor cells and leads to increased IL-2 production and enhancement of T-cell co-stimulation.138 Furthermore, lenalidomide induces type 1 T helper cell polarization,141 reduces Treg cells, increases antigen presentation to effector T-cell populations,142 repairs the immune synapse between tumor cells and cytotoxic T cells,69 restores impaired T-cell motility and interferes with com-

on three agents are currently available. The investigational agent pidilizumab is a humanized IgG1 monoclonal antibody directed against PD-1, which has been explored in phase II studies in DLBCL89 and FL.90 Pidilizumab increased in CD4+CD25+PD-L1+ activated T helper cells and PD-1 ligand-bearing monocytes in a phase II study in DLBCL,89 and in a phase II study of pidilizumab and rituximab in patients with FL a 41-gene signature representing immune activation correlated with improved progression-free survival.90 In both studies, pidilizumab was well tolerated and appeared to increase efficacy relative to historic controls.

Pembrolizumab (humanized) and nivolumab (fully human), both investigational in hematologic malignancies, are IgG4 antagonistic anti-PD-1 monoclonal antibodies with outstanding activity in heavily pre-treated Hodgkin lymphoma.91,92 Preliminary results regarding nivolumab show promise in a variety of subtypes of non-Hodgkin lymphomas93 and phase II studies in multiple histological types are planned or underway.

Chimeric antigen receptor T-cell therapy

536

haematologica | 2016; 101(5)

The microenvironment in B-cell lymphoid malignancies

munication between endothelial and tumor cells, reducing neoangiogenesis.143 Lenalidomide also induces a change in the tumor microenvironment from an M2 macrophage immunosuppressive state to a pro-inflammatory state through polarization of macrophages toward an M1 phenotype.144 Lenalidomide augments the ADCC of antiCD20 monoclonal antibodies145,146 and lowers the activation threshold of NK cells.147 The multitude of mechanisms by which lenalidomide is able to alter the tumor microenvironment into a hostile one for lymphoma provides a satisfactory explanation for the activity observed in the clinic â&#x20AC;&#x201C; an excellent illustration of the potential benefits of targeting the lymphoma cell niche.

Future directions Novel combinations It is unlikely that any one agent or modulator of a single pathway will prove successful in inhibiting tumor cell survival over the long-term in B-cell lymphoproliferative diseases. Effective curative strategies will likely require optimal synergistic combinations of effective agents.

However, the large number of possible combinations, limited resources and paucity of patients for clinical trials make it an imperative to prioritize and develop those combinations that are most likely to be curative.

Designing logical combinations with strong pre-clinical rationales is, therefore, a priority of translational research in hematologic malignancies. Strategies that include the targeting of various steps of the cancer-immunity cycle148 will be imperative. For example, drugs targeting the PD-1 axis enhance the host anti-tumor response and may be logically used in combination with many of the aforementioned novel agents.148 Furthermore, â&#x20AC;&#x153;precision immunologyâ&#x20AC;? should consider the immunological milieu of both host and tumor. For example, highly immunogenic tumors (such as cHL) may benefit from rational strategies that include immunostimulatory combinations such as PD1/PD-L1 inhibitors plus T-cell priming treatments.149 In contrast, immunologically inert lymphomas may be better approached with strategies such as CAR T cells in combination with agents such as monoclonal antibodies.150 Caution in developing such combination studies is required and vigilant monitoring for clinical or laboratory adverse events is essential. Two studies using the combination of lenalidomide, rituximab and idelalisib in relapsed/refractory FL were recently terminated due to an

References 1. Shaffer AL 3rd, Young RM, Staudt LM. Pathogenesis of human B cell lymphomas.

Annu Rev Immunol. 2012;30:565-610.

2. Scott DW, Gascoyne RD. The tumour microenvironment in B cell lymphomas. Nat Rev Cancer. 2014;14(8):517-534.

3. Andersen MH. The targeting of immunosuppressive mechanisms in hematological malignancies. Leukemia. 2014;28(9):17841792.

4. Brusa D, Serra S, Coscia M, et al. The PD1/PD-L1 axis contributes to T-cell dysfunction in chronic lymphocytic leukemia.

Haematologica. 2013;98(6):953-963.

haematologica | 2016; 101(5)

unexpected frequency and severity of hepatotoxicity, including two deaths.151,152 These episodes highlight the need to incorporate correlative studies into all multi-agent investigational protocols to survey for unexpected toxicities as well as to understand tumor biology and the reasons for treatment resistance better.

Monitoring the microenvironment during therapy Although researchers typically obtain a snapshot of the microenvironment at the time of diagnostic biopsy, the development of processes that enable dynamic assessment is important. Although tumors with a circulating phase, such as CLL, are comparatively easy to assess at serial time-points from blood samples, obtaining biopsies during treatment poses major logistic challenges in most patients with lymphoma. To address this challenge, novel strategies that can assess circulating tumor DNA and mutational analyses in the peripheral blood are welcomed and should be incorporated in future studies aimed at developing therapies directed at the microenvironment.

Conclusion Improved understanding of tumor biology and the role of the tumor microenvironment has led to advances in the diagnosis, classification, prognostication and novel treatment of patients with hematologic malignancies. In particular, translational research leading to drugs that target the interaction between the tumor microenvironment and malignant cells has provided many promising new approaches to cancer therapy. Ongoing dynamic and correlative studies of tumor biology and the contribution of the tumor microenvironment in the context of novel drug development should be encouraged to identify optimal therapies for various lymphomas and improve the curability of these diseases.

Acknowledgments This manuscript was developed, in part, based on discussions from the Second Annual Summit on the Immune Microenvironment in Hematologic Malignancies that took place on September 11-12, 2014, in Dublin, Ireland. The Second Annual Summit was sponsored by a grant from AbbVie Inc., Acerta Pharma, Celgene Corporation, F. Hoffman-La Roche LTD, Infinity Pharmaceuticals, Inc., Pharmacyclics, Inc., and TG Therapeutics, Inc. Project management support for this manuscript was provided by BioConnections, LLC.

5. Meads MB, Gatenby RA, Dalton WS. Environment-mediated drug resistance: a major contributor to minimal residual disease. Nat Rev Cancer. 2009;9(9):665-674.

6. Alizadeh AA, Eisen MB, Davis RE, et al.

Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403(6769):503-511.

7. Dunleavy K, Roschewski M, Wilson WH. Precision treatment of distinct molecular subtypes of diffuse large B-cell lymphoma: ascribing treatment based on the molecular phenotype. Clin Cancer Res. 2014;20(20): 5182-5193.

8. Lenz G, Wright G, Dave SS, et al. Stromal gene signatures in large-B-cell lymphomas.

N Engl J Med. 2008;359(22):2313-2323.

9. Challa-Malladi M, Lieu YK, Califano O, et al. Combined genetic inactivation of beta2microglobulin and CD58 reveals frequent escape from immune recognition in diffuse large B cell lymphoma. Cancer Cell.

2011;20(6):728-740.

10. Steidl C, Shah SP, Woolcock BW, et al. MHC class II transactivator CIITA is a recurrent gene fusion partner in lymphoid cancers.

Nature. 2011;471(7338):377-381.

11. Andorsky DJ, Yamada RE, Said J, et al.

Programmed death ligand 1 is expressed by non-Hodgkin lymphomas and inhibits the activity of tumor-associated T cells. Clin Cancer Res. 2011;17(13):4232-4244.

12. Chen BJ, Chapuy B, Ouyang J, et al. PD-L1 expression is characteristic of a subset of

537

N.H. Fowler et al.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

538

aggressive B-cell lymphomas and virus-associated malignancies. Clin Cancer Res. 2013;19(13):3462-3473.

Twa DD, Chan FC, Ben-Neriah S, et al.

Genomic rearrangements involving programmed death ligands are recurrent in primary mediastinal large B-cell lymphoma.

Blood. 2014;123(13):2062-2065.

Dunleavy K, Steidl C. Emerging biological insights and novel treatment strategies in primary mediastinal large B-cell lymphoma.

Semin Hematol. 2015;52(2):119-125.

Twa DD, Mottok A, Chan FC, et al.

Recurrent genomic rearrangements in primary testicular lymphoma. J Pathol.

2015;236(2):136-141.

Kiyasu J, Miyoshi H, Hirata A, et al.

Expression of programmed cell death ligand 1 is associated with poor overall survival in patients with diffuse large B-cell lymphoma.

Blood. 2015;126(19):2193-2201.

Ishida T, Ishii T, Inagaki A, et al. Specific recruitment of CC chemokine receptor 4positive regulatory T cells in Hodgkin lymphoma fosters immune privilege. Cancer Res. 2006;66(11):5716-5722.

Yang ZZ, Novak AJ, Stenson MJ, et al.

Intratumoral CD4+CD25+ regulatory T-cellmediated suppression of infiltrating CD4+ T cells in B-cell non-Hodgkin lymphoma.

Blood. 2006;107(9):3639-3646.

Riihijarvi S, Fiskvik I, Taskinen M, et al.

Prognostic influence of macrophages in patients with diffuse large B-cell lymphoma: a correlative study from a Nordic phase II trial. Haematologica. 2015;100(2):238-245.

Perez-Galan P, Dreyling M, Wiestner A. Mantle cell lymphoma: biology, pathogenesis, and the molecular basis of treatment in the genomic era. Blood. 2011;117(1):26-38.

Burger JA, Ford RJ. The microenvironment in mantle cell lymphoma: cellular and molecular pathways and emerging targeted therapies. Semin Cancer Biol. 2011;21(5): 308-312.

Kurtova AV, Tamayo AT, Ford RJ, et al.

Mantle cell lymphoma cells express high levels of CXCR4, CXCR5, and VLA-4 (CD49d): importance for interactions with the stromal microenvironment and specific targeting.

Blood. 2009;113(19):4604-4613.

Zhang L, Yang J, Qian J, et al. Role of the microenvironment in mantle cell lymphoma: IL-6 is an important survival factor for the tumor cells. Blood. 2012;120(18): 3783-3792.

Cohen PL, Kurtin PJ, Donovan KA, et al.

Bone marrow and peripheral blood involvement in mantle cell lymphoma. Br J Haematol. 1998;101(2):302-310.

Argatoff LH, Connors JM, Klasa RJ, et al.

Mantle cell lymphoma: a clinicopathologic study of 80 cases. Blood. 1997;89(6):20672078.

Pittaluga S, Wlodarska I, Stul MS, et al.

Mantle cell lymphoma: a clinicopathological study of 55 cases. Histopathology.

1995;26(1):17-24.

Wang L, Qian J, Lu Y, et al. Immune evasion of mantle cell lymphoma: expression of B7H1 leads to inhibited T-cell response to and killing of tumor cells. Haematologica.

2013;98(9):1458-1466.

Dal Col J, Zancai P, Terrin L, et al. Distinct functional significance of Akt and mTOR constitutive activation in mantle cell lymphoma. Blood. 2008;111(10):5142-5151.

Buggy JJ, Elias L. Bruton tyrosine kinase (BTK) and its role in B-cell malignancy. Int Rev Immunol. 2012;31(2):119-132.

Bernard S, Danglade D, Gardano L, et al.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

Inhibitors of BCR signalling interrupt the survival signal mediated by the micro-environment in mantle cell lymphoma. Int J Cancer. 2015;136(12):2761-2774.

Swerdlow SH CE, Harris N, et al. WHO Classification of Tumors of the Hematopoeitic and Lymphoid Tissues.

Lyon: IARC, 2008.

Plattel WJ, van den Berg A, Visser L, et al.

Plasma thymus and activation-regulated chemokine as an early response marker in classical Hodgkin's lymphoma.

Haematologica. 2012;97(3):410-415.

Hedvat CV, Jaffe ES, Qin J, et al.

Macrophage-derived chemokine expression in classical Hodgkin's lymphoma: application of tissue microarrays. Mod Pathol.

2001;14(12):1270-1276.

Ma Y, Visser L, Roelofsen H, et al.

Proteomics analysis of Hodgkin lymphoma: identification of new players involved in the cross-talk between HRS cells and infiltrating lymphocytes. Blood. 2008;111(4):2339-2346.

Glimelius I, Edstrom A, Amini RM, et al. IL9 expression contributes to the cellular composition in Hodgkin lymphoma. Eur J Haematol. 2006;76(4):278-283.

Liu Y, Sattarzadeh A, Diepstra A, et al. The microenvironment in classical Hodgkin lymphoma: an actively shaped and essential tumor component. Semin Cancer Biol.

2014;24:15-22.

Sanchez-Aguilera A, Montalban C, de la Cueva P, et al. Tumor microenvironment and mitotic checkpoint are key factors in the outcome of classic Hodgkin lymphoma.

Blood. 2006;108(2):662-668.

Steidl C, Lee T, Shah SP, et al. Tumor-associated macrophages and survival in classic Hodgkin's lymphoma. N Engl J Med. 2010;362(10):875-885.

Greaves P, Clear A, Coutinho R, et al.

Expression of FOXP3, CD68, and CD20 at diagnosis in the microenvironment of classical Hodgkin lymphoma is predictive of outcome. J Clin Oncol. 2013;31(2):256-262.

Pulford KA, Sipos A, Cordell JL, et al.

Distribution of the CD68 macrophage/ myeloid associated antigen. Int Immunol.

1990;2(10):973-980.

Klein JL, Nguyen TT, Bien-Willner GA, et al.

CD163 immunohistochemistry is superior to CD68 in predicting outcome in classical Hodgkin lymphoma. Am J Clin Pathol.

2014;141(3):381-387.

Zaki MA, Wada N, Ikeda J, et al. Prognostic implication of types of tumor-associated macrophages in Hodgkin lymphoma.

Virchows Arch. 2011;459(4):361-366.

Tan KL, Scott DW, Hong F, et al. Tumorassociated macrophages predict inferior outcomes in classic Hodgkin lymphoma: a correlative study from the E2496 Intergroup trial. Blood. 2012;120(16):3280-3287.

Romano A, Parrinello NL, Vetro C, et al.

Circulating myeloid-derived suppressor cells correlate with clinical outcome in Hodgkin lymphoma patients treated up-front with a risk-adapted strategy. Br J Haematol.

2015;168(5):689-700.

Panico L, Tenneriello V, Ronconi F, et al.

High CD20+ background cells predict a favorable outcome in classical Hodgkin lymphoma and antagonize CD68+ macrophages. Leuk Lymphoma. 2014:1-7.

Tudor CS, Distel LV, Eckhardt J, et al. B cells in classical Hodgkin lymphoma are important actors rather than bystanders in the local immune reaction. Hum Pathol.

2013;44(11):2475-2486.

Alvaro T, Lejeune M, Salvado MT, et al.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

Outcome in Hodgkin's lymphoma can be predicted from the presence of accompanying cytotoxic and regulatory T cells. Clin Cancer Res. 2005;11(4):1467-1473.

Kelley TW, Pohlman B, Elson P, et al. The ratio of FOXP3+ regulatory T cells to granzyme B+ cytotoxic T/NK cells predicts prognosis in classical Hodgkin lymphoma and is independent of bcl-2 and MAL expression. Am J Clin Pathol. 2007;128(6): 958-965.

Dave SS, Wright G, Tan B, et al. Prediction of survival in follicular lymphoma based on molecular features of tumor-infiltrating immune cells. N Engl J Med. 2004;351(21): 2159-2169.

Alvaro T, Lejeune M, Salvado MT, et al.

Immunohistochemical patterns of reactive microenvironment are associated with clinicobiologic behavior in follicular lymphoma patients. J Clin Oncol. 2006;24(34):53505357.

Dave SS, Wright G, Tan B, et al. Prediction of survival in follicular lymphoma based on molecular features of tumor-infiltrating immune cells. N Engl J Med. 2004;351 (21):2159-2169. de Jong D, Fest T. The microenvironment in follicular lymphoma. Best Pract Res Clin Haematol. 2011;24(2):135-146.

Farinha P, Masoudi H, Skinnider BF, et al.

Analysis of multiple biomarkers shows that lymphoma-associated macrophage (LAM) content is an independent predictor of survival in follicular lymphoma (FL). Blood.

2005;106(6):2169-2174.

Glas AM, Knoops L, Delahaye L, et al. Geneexpression and immunohistochemical study of specific T-cell subsets and accessory cell types in the transformation and prognosis of follicular lymphoma. J Clin Oncol.

2007;25(4):390-398.

Carreras J, Lopez-Guillermo A, Roncador G, et al. High numbers of tumor-infiltrating programmed cell death 1-positive regulatory lymphocytes are associated with improved overall survival in follicular lymphoma. J Clin Oncol. 2009;27(9):1470-1476.

Farinha P, Al-Tourah A, Gill K, et al. The architectural pattern of FOXP3-positive T cells in follicular lymphoma is an independent predictor of survival and histologic transformation. Blood. 2010;115(2):289-295.

Kiaii S, Clear AJ, Ramsay AG, et al. Follicular lymphoma cells induce changes in T-cell gene expression and function: potential impact on survival and risk of transformation. J Clin Oncol. 2013;31(21):2654-2661.

Myklebust JH, Irish JM, Brody J, et al. High PD-1 expression and suppressed cytokine signaling distinguish T cells infiltrating follicular lymphoma tumors from peripheral T cells. Blood. 2013;121(8):1367-1376.

Ramsay AG, Clear AJ, Kelly G, et al.

Follicular lymphoma cells induce T-cell immunologic synapse dysfunction that can be repaired with lenalidomide: implications for the tumor microenvironment and immunotherapy. Blood. 2009;114(21):47134720.

Ramsay AG, Gribben JG. The kiss of death in FL. Blood. 2011;118(20):5365-5366.

Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, et al. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet. 1991;338(8776):1175-1176.

Suarez F, Lortholary O, Hermine O, et al.

Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood.

2006;107(8):3034-3044.

haematologica | 2016; 101(5)

The microenvironment in B-cell lymphoid malignancies 63. Ferreri AJ, Guidoboni M, Ponzoni M, et al.

Evidence for an association between Chlamydia psittaci and ocular adnexal lymphomas. J Natl Cancer Inst. 2004;96(8):586594.

64. Kutting B, Bonsmann G, Metze D, et al.

Borrelia burgdorferi-associated primary cutaneous B cell lymphoma: complete clearing of skin lesions after antibiotic pulse therapy or intralesional injection of interferon alfa-2a. J Am Acad Dermatol. 1997;36(2 Pt 2):311-314.

65. Wotherspoon AC, Doglioni C, Diss TC, et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet. 1993;342(8871): 575-577.

66. Inagaki H, Nakamura T, Li C, et al. Gastric MALT lymphomas are divided into three groups based on responsiveness to Helicobacter pylori eradication and detection of API2-MALT1 fusion. Am J Surg Pathol. 2004;28(12):1560-1567.

67. Franco G, Guarnotta C, Frossi B, et al. Bone marrow stroma CD40 expression correlates with inflammatory mast cell infiltration and disease progression in splenic marginal zone lymphoma. Blood. 2014;123(12):1836-1849.

68. Guillaume N, Marolleau JP. Is immune escape via human leukocyte antigen expression clinically relevant in chronic lymphocytic leukemia? Focus on the controversies.

Leuk Res. 2013;37(4):473-477.

69. Ramsay AG, Clear AJ, Fatah R, et al.

Multiple inhibitory ligands induce impaired T-cell immunologic synapse function in chronic lymphocytic leukemia that can be blocked with lenalidomide: establishing a reversible immune evasion mechanism in human cancer. Blood. 2012;120(7):14121421.

70. Riches JC, Davies JK, McClanahan F, et al. T cells from CLL patients exhibit features of Tcell exhaustion but retain capacity for cytokine production. Blood. 2013;121(9): 1612-1621.

71. von Bergwelt-Baildon M, Maecker B, Schultze J, et al. CD40 activation: potential for specific immunotherapy in B-CLL. Ann Oncol. 2004;15(6):853-857.

72. Allegra D, Bilan V, Garding A, et al.

Defective DROSHA processing contributes to downregulation of MiR-15/-16 in chronic lymphocytic leukemia.

Leukemia.

2014;28(1):98-107.

73. Kurtova AV, Balakrishnan K, Chen R, et al.

Diverse marrow stromal cells protect CLL cells from spontaneous and drug-induced apoptosis: development of a reliable and reproducible system to assess stromal cell adhesion-mediated drug resistance. Blood.

2009;114(20):4441-4450.

74. Hanna B, McClanahan F, Zaborsky N, et al.

Targeting dysfunctional myeloid cells delays disease development and improves immune fucntion in a CLL mouse model. Blood.

2014;124(21):3298.

75. Jitschin R, Braun M, Buttner M, et al. CLLcells induce IDOhi CD14+HLA-DRlo myeloid-derived suppressor cells that inhibit T-cell responses and promote TRegs. Blood.

2014;124(5):750-760.

76. Fonte E, Apollonio B, Scarfo L, et al. In vitro sensitivity of CLL cells to fludarabine may be modulated by the stimulation of Toll-like receptors. Clin Cancer Res. 2013;19(2):367379.

77. Muzio M, Apollonio B, Scielzo C, et al.

Constitutive activation of distinct BCR-signaling pathways in a subset of CLL patients:

haematologica | 2016; 101(5)

78.

79.

80.

81.

82.

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

a molecular signature of anergy. Blood.

2008;112(1):188-195.

Herishanu Y, Perez-Galan P, Liu D, et al. The lymph node microenvironment promotes Bcell receptor signaling, NF-kappaB activation, and tumor proliferation in chronic lymphocytic leukemia. Blood. 2011;117(2):563574.

Mansouri L, Sutton LA, Ljungstrom V, et al.

Functional loss of IkappaBepsilon leads to NF-kappaB deregulation in aggressive chronic lymphocytic leukemia. J Exp Med. 2015;212(6):833-843.

Freeman GJ, Long AJ, Iwai Y, et al.

Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J Exp Med. 2000;192(7):1027-1034.

Nishimura H, Nose M, Hiai H, et al.

Development of lupus-like autoimmune diseases by disruption of the PD-1 gene encoding an ITIM motif-carrying immunoreceptor. Immunity. 1999;11(2):141-151.

Seo SK, Seo HM, Jeong HY, et al. Coinhibitory role of T-cell-associated B7-H1 and B7-DC in the T-cell immune response.

Immunol Lett. 2006;102(2):222-228.

Francisco LM, Salinas VH, Brown KE, et al.

PD-L1 regulates the development, maintenance, and function of induced regulatory T cells. J Exp Med. 2009;206(13):3015-3029.

Terme M, Ullrich E, Aymeric L, et al. IL-18 induces PD-1-dependent immunosuppression in cancer.

Cancer Res. 2011;71(16):5393-5399.

Ahmadzadeh M, Johnson LA, Heemskerk B, et al. Tumor antigen-specific CD8 T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired. Blood.

2009;114(8):1537-1544.

Iwai Y, Ishida M, Tanaka Y, et al.

Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade.

Proc Natl Acad Sci USA. 2002;99(19):1229312297.

Brahmer JR, Drake CG, Wollner I, et al.

Phase I study of single-agent anti-programmed death-1 (MDX-1106) in refractory solid tumors: safety, clinical activity, pharmacodynamics, and immunologic correlates. J Clin Oncol. 2010;28(19):3167-3175.

Weber JS, Kudchadkar RR, Yu B, et al.

Safety, efficacy, and biomarkers of nivolumab with vaccine in ipilimumab-refractory or -naive melanoma. J Clin Oncol.

2013;31(34):4311-4318.

Armand P, Nagler A, Weller EA, et al.

Disabling immune tolerance by programmed death-1 blockade with pidilizumab after autologous hematopoietic stem-cell transplantation for diffuse large B-cell lymphoma: results of an international phase II trial. J Clin Oncol. 2013;31(33):4199-4206.

Westin JR, Chu F, Zhang M, et al. Safety and activity of PD1 blockade by pidilizumab in combination with rituximab in patients with relapsed follicular lymphoma: a single group, open-label, phase 2 trial. Lancet Oncol. 2014;15(1):69-77.

Moskowitz CH, Ribrag V, Michot J-M, et al.

PD-1 blockade with the monoclonal antibody pembrolizumab (MK-3475) in patients with classical Hodgkin lymphoma after brentuximab vedotin failure: preliminary results from a phase 1b study (KEYNOTE013). Blood. 2014;124(21):290.

Ansell SM, Lesokhin AM, Borrello I, et al.

PD-1 Blockade with nivolumab in relapsed or refractory Hodgkin's lymphoma. N Engl J Med. 2015;372(4):311-319.

93. Lesokhin AM, Ansell SM, Armand P, et al.

Preliminary results of a phase I study of nivolumab (BMS-936558) in patients with relapsed or refractory lymphoid malignancies. Blood (ASH Annual Meeting Abstracts). 2014;124(21):291.

94. Porter DL, Levine BL, Kalos M, et al.

Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. N Engl J Med. 2011;365(8):725-733.

95. Maude SL, Frey N, Shaw PA, et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med. 2014;371(16):1507-1517.

96. Kochenderfer JN, Dudley ME, Kassim SH, et al. Chemotherapy-refractory diffuse large Bcell lymphoma and indolent B-cell malignancies can be effectively treated with autologous T cells expressing an anti-CD19 chimeric antigen receptor. J Clin Oncol.

2015;33(6):540-549.

97. Kochenderfer JN, Feldman SA, Zhao Y, et al.

Construction and preclinical evaluation of an anti-CD19 chimeric antigen receptor. J Immunother. 2009;32(7):689-702.

98. Vesely MD, Kershaw MH, Schreiber RD, et al. Natural innate and adaptive immunity to cancer. Annu Rev Immunol. 2011;29:235271.

99. Pegram HJ, Lee JC, Hayman EG, et al.

Tumor-targeted T cells modified to secrete IL-12 eradicate systemic tumors without need for prior conditioning. Blood.

2012;119(18):4133-4141.

100. Foster AE, Dotti G, Lu A, et al. Antitumor activity of EBV-specific T lymphocytes transduced with a dominant negative TGFbeta receptor. J Immunother. 2008;31(5):500505.

101. Dotti G, Savoldo B, Pule M, et al. Human cytotoxic T lymphocytes with reduced sensitivity to Fas-induced apoptosis. Blood.

2005;105(12):4677-4684.

102. Eaton D, Gilham DE, O'Neill A, et al.

Retroviral transduction of human peripheral blood lymphocytes with Bcl-X(L) promotes in vitro lymphocyte survival in pro-apoptotic conditions. Gene Ther. 2002;9(8):527-535.

103. Niiro H, Clark EA. Regulation of B-cell fate by antigen-receptor signals. Nat Rev Immunol. 2002;2(12):945-956.

104. Kuppers R. Mechanisms of B-cell lymphoma pathogenesis. Nat Rev Cancer. 2005;5(4): 251-262.

105. Honigberg LA, Smith AM, Sirisawad M, et al. The Bruton tyrosine kinase inhibitor PCI32765 blocks B-cell activation and is efficacious in models of autoimmune disease and B-cell malignancy. Proc Natl Acad Sci USA. 2010;107(29):13075-13080.

106. Byrd JC, Furman RR, Coutre SE, et al.

Targeting BTK with ibrutinib in relapsed chronic lymphocytic leukemia. N Engl J Med. 2013;369(1):32-42.

107. Byrd JC, Brown JR, O'Brien S, et al. Ibrutinib versus ofatumumab in previously treated chronic lymphoid leukemia. N Engl J Med. 2014;371(3):213-223.

108. Wang ML, Rule S, Martin P, et al. Targeting BTK with ibrutinib in relapsed or refractory mantle-cell lymphoma. N Engl J Med. 2013;369(6):507-516.

109. Treon SP, Tripsas CK, Meid K, et al. Ibrutinib in previously treated Waldenstrom's macroglobulinemia. N Engl J Med. 2015;372(15):1430-1440.

110. Ponader S, Chen SS, Buggy JJ, et al. The Bruton tyrosine kinase inhibitor PCI-32765 thwarts chronic lymphocytic leukemia cell survival and tissue homing in vitro and in vivo. Blood. 2012;119(5):1182-1189.

539

N.H. Fowler et al.

111. Ni Gabhann J, Spence S, Wynne C, et al.

Defects in acute responses to TLR4 in Btkdeficient mice result in impaired dendritic cell-induced IFN-gamma production by natural killer cells. Clin Immunol. 2012;142(3): 373-382.

112. Khurana D, Arneson LN, Schoon RA, et al.

Differential regulation of human NK cellmediated cytotoxicity by the tyrosine kinase Itk. J Immunol. 2007;178(6):3575-3582.

113. Kohrt HE, Sagiv-Barfi I, Rafiq S, et al.

Ibrutinib antagonizes rituximab-dependent NK cell-mediated cytotoxicity. Blood.

2014;123(12):1957-1960.

114. Burger JA, Keating MJ, Wierda WG, et al.

Safety and activity of ibrutinib plus rituximab for patients with high-risk chronic lymphocytic leukaemia: a single-arm, phase 2 study. Lancet Oncol. 2014;15(10):10901099.

115. Dubovsky JA, Beckwith KA, Natarajan G, et al. Ibrutinib is an irreversible molecular inhibitor of ITK driving a Th1-selective pressure in T lymphocytes. Blood. 2013;122(15): 2539-2549.

116. Sagiv-Barfi I, Kohrt HE, Burckhardt L, et al.

Ibrutinib enhances the antitumor immune response induced by intratumoral injection of a TLR9 ligand in mouse lymphoma.

Blood. 2015;125(13):2079-2086.

117. Sagiv-Barfi I, Kohrt HE, Czerwinski DK, et al. Therapeutic antitumor immunity by checkpoint blockade is enhanced by ibrutinib, an inhibitor of both BTK and ITK. Proc Natl Acad Sci USA. 2015;112(9):E966-972.

118. Ni Gabhann J, Hams E, Smith S, et al. Btk regulates macrophage polarization in response to lipopolysaccharide. PLoS One. 2014;9(1):e85834.

119. Gopal AK, Kahl BS, de Vos S, et al. PI3Kδ inhibition by idelalisib in patients with relapsed indolent lymphoma. N Engl J Med. 2014;370(11):1008-1018.

120. Flinn IW, Kahl BS, Leonard JP, et al. Idelalisib, a selective inhibitor of phosphatidylinositol 3-kinase-delta, as therapy for previously treated indolent non-Hodgkin lymphoma.

Blood. 2014;123(22):3406-3413.

121. Brown JR, Byrd JC, Coutre SE, et al.

Idelalisib, an inhibitor of phosphatidylinositol 3-kinase p110delta, for relapsed/refractory chronic lymphocytic leukemia. Blood.

2014;123(22):3390-3397.

122. Lannutti BJ, Meadows SA, Herman SE, et al.

CAL-101, a p110delta selective phosphatidylinositol-3-kinase inhibitor for the treatment of B-cell malignancies, inhibits PI3K signaling and cellular viability. Blood.

2011;117(2):591-594.

123. Hoellenriegel J, Meadows SA, Sivina M, et al. The phosphoinositide 3'-kinase delta inhibitor, CAL-101, inhibits B-cell receptor signaling and chemokine networks in chronic lymphocytic leukemia.

Blood.

2011;118(13):3603-3612.

124. Maffei R, Bulgarelli J, Fiorcari S, et al.

Endothelin-1 promotes survival and chemoresistance in chronic lymphocytic leukemia B cells through ETA receptor. PLoS One. 2014;9(6):e98818.

125. Roit FD, Engelberts PJ, Taylor RP, et al.

Ibrutinib interferes with the cell-mediated anti-tumor activities of therapeutic CD20 antibodies: implications for combination therapy. Haematologica. 2015;100(1):77-86.

126. Herman SE, Gordon AL, Wagner AJ, et al.

540

Phosphatidylinositol 3-kinase-delta inhibitor CAL-101 shows promising preclinical activity in chronic lymphocytic leukemia by antagonizing intrinsic and extrinsic cellular survival signals. Blood. 2010;116(12):20782088.

127. Dong S, Guinn D, Dubovsky JA, et al. IPI145 antagonizes intrinsic and extrinsic survival signals in chronic lymphocytic leukemia cells. Blood. 2014;124(24):35833586.

128. Witzig TE, Vose JM, Zinzani PL, et al. An international phase II trial of single-agent lenalidomide for relapsed or refractory aggressive B-cell non-Hodgkin's lymphoma.

Ann Oncol. 2011;22(7):1622-1627.

129. Wiernik PH, Lossos IS, Tuscano JM, et al.

Lenalidomide monotherapy in relapsed or refractory aggressive non-Hodgkin's lymphoma. J Clin Oncol. 2008;26(30):49524957.

130. Habermann TM, Lossos IS, Justice G, et al.

Lenalidomide oral monotherapy produces a high response rate in patients with relapsed or refractory mantle cell lymphoma. Br J Haematol. 2009;145(3):344-349.

131. Zinzani PL, Vose JM, Czuczman MS, et al.

Long-term follow-up of lenalidomide in relapsed/refractory mantle cell lymphoma: subset analysis of the NHL-003 study. Ann Oncol. 2013;24(11):2892-2897.

132. Fowler NH, Davis RE, Rawal S, et al. Safety and activity of lenalidomide and rituximab in untreated indolent lymphoma: an openlabel, phase 2 trial. Lancet Oncol.

2014;15(12):1311-1318.

133. Wang M, Fowler N, Wagner-Bartak N, et al.

Oral lenalidomide with rituximab in relapsed or refractory diffuse large cell, follicular and transformed lymphoma: a phase II clinical trial. Leukemia. 2013;27(9):19021909.

134. Wang M, Fayad L, Wagner-Bartak N, et al.

Lenalidomide in combination with rituximab for patients with relapsed or refractory mantle-cell lymphoma: a phase 1/2 clinical trial. Lancet Oncol. 2012;13(7):716-723.

135. Kimby E, Martinelli G, Ostenstad B, et al.

Rituximab plus lenalidomide improves the complete remission rate in comparison with rituximab monotherapy in untreated follicular lymphoma patients in need of therapy.

Primary endpoint analysis of the randomized phase-2 trial SAKK 35/10. Blood.

2014;124(21):799.

136. Martin P, Jung S-H, Johnson JL, et al.

CALGB 50803 (Alliance): a phase II trial of lenalidomide plus rituximab in patients with previously untreated follicular lymphoma. ASCO Meeting Abstracts. 2014;32 (15_suppl):8521.

137. Ruan J, Martin P, Shah BD, et al. Sustained remission with the combination biologic doublet of lenalidomide plus rituximab as initial treatment for mantle cell lymphoma: a multi-center phase II study report. Blood (ASH Annual Meeting Abstracts). 2014;124 (21):625.

138. Gandhi AK, Kang J, Havens CG, et al.

Immunomodulatory agents lenalidomide and pomalidomide co-stimulate T cells by inducing degradation of T cell repressors Ikaros and Aiolos via modulation of the E3 ubiquitin ligase complex CRL4(CRBN.). Br J Haematol. 2014;164(6):811-821.

139. Lu G, Middleton RE, Sun H, et al. The

myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Science. 2014;343(6168):305-309.

140. Kronke J, Udeshi ND, Narla A, et al.

Lenalidomide causes selective degradation of IKZF1 and IKZF3 in multiple myeloma cells. Science. 2014;343(6168):301-305.

141. Lee BN, Gao H, Cohen EN, et al. Treatment with lenalidomide modulates T-cell immunophenotype and cytokine production in patients with chronic lymphocytic leukemia. Cancer. 2011;117(17):3999-4008.

142. Henry JY, Labarthe MC, Meyer B, et al.

Enhanced cross-priming of naive CD8+ T cells by dendritic cells treated by the IMiDsÂŽ immunomodulatory compounds lenalidomide and pomalidomide.

Immunology. 2013;139(3):377-385.

143. Maffei R, Fiorcari S, Bulgarelli J, et al.

Endothelium-mediated survival of leukemic cells and angiogenesis-related factors are affected by lenalidomide treatment in chronic lymphocytic leukemia. Exp Hematol. 2014;42(2):126-136 e121.

144. Fiorcari S, Martinelli S, Bulgarelli J, et al.

Lenalidomide interferes with tumor-promoting properties of nurse-like cells in chronic lymphocytic leukemia.

Haematologica. 2015;100(2):253-262.

145. Zhang L, Qian Z, Cai Z, et al. Synergistic antitumor effects of lenalidomide and rituximab on mantle cell lymphoma in vitro and in vivo. Am J Hematol. 2009;84(9):553-559.

146. Wu L, Adams M, Carter T, et al. lenalidomide enhances natural killer cell and monocyte-mediated antibody-dependent cellular cytotoxicity of rituximab-treated CD20+ tumor cells. Clin Cancer Res. 2008;14(14): 4650-4657.

147. Lagrue K, Carisey A, Morgan DJ, et al.

Lenalidomide augments actin remodelling and lowers NK cell activation thresholds.

Blood. 2015;126(1):50-60.

148. Chen DS, Mellman I. Oncology meets immunology: the cancer-immunity cycle.

Immunity. 2013;39(1):1-10.

149. Ansell SM, Hurvitz SA, Koenig PA, et al.

Phase I study of ipilimumab, an anti-CTLA4 monoclonal antibody, in patients with relapsed and refractory B-cell non-Hodgkin lymphoma. Clin Cancer Res. 2009;15(20): 6446-6453.

150. Kochenderfer JN, Rosenberg SA. Chimeric antigen receptor-modified T cells in CLL. N Engl J Med. 2011;365(20):1937-1938.

151. Cheah CY, Nastoupil LJ, Neelapu SS, et al.

Lenalidomide, idelalisib, and rituximab are unacceptably toxic in patients with relapsed/refractory indolent lymphoma.

Blood. 2015;125(21):3357-3359.

152. Smith S, Pitcher BN, Jung SH, et al.

Unexpected and serious toxicity observed with combined idelalisib, lenalidomide and rituximab in relapsed/refractory B cell lymphomas: Alliance A051201 and A051202 (Abstract 3091). Blood. 2014;124 (21):3091.

153. Ansell SM, Lesokhin AM, Borrello I, et al.

PD-1 blockade with nivolumab in relapsed or refractory Hodgkin's lymphoma. N Engl J Med. 2015;372(4):311-319.

154. Chanan-Khan A, Miller KC, Musial L, et al.

Clinical efficacy of lenalidomide in patients with relapsed or refractory chronic lymphocytic leukemia: results of a phase II study. J Clin Oncol. 2006;24(34):5343-5349.

haematologica | 2016; 101(5)

REVIEW ARTICLE

Chronic myeloid leukemia: reminiscences and dreams

Tariq I. Mughal,1 Jerald P. Radich,2 Michael W. Deininger,3 Jane F. Apperley,4 Timothy P. Hughes,5 Christine J. Harrison,6 Carlo Gambacorti-Passerini,7 Giuseppe Saglio,8 Jorge Cortes,9 and George Q. Daley10

Tufts University Medical Center, Boston, MA, USA; 2Fredrick Hutchinson Cancer Center, University of Washington, Seattle, WA, USA; 3University of Utah, Huntsman Cancer Institute, Salt Lake City, UT, USA; 4Imperial College London, Hammersmith Hospital, UK; 5 University of Adelaide, Australia; 6Newcastle University, Newcastle-upon-Tyne, UK; 7 University of Milano-Bicocca, Monza, Italy; 8University of Turin, Italy; 9MD Anderson Cancer Center, Houston, TX, USA; and 10Boston Children’s Hospital, Harvard Medicine School, Boston, MA, USA

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

1

Haematologica 2016 Volume 101(5):541-558

ABSTRACT

W

ith the deaths of Janet Rowley and John Goldman in December 2013, the world lost two pioneers in the field of chronic myeloid leukemia. In 1973, Janet Rowley, unraveled the cytogenetic anatomy of the Philadelphia chromosome, which subsequently led to the identification of the BCR-ABL1 fusion gene and its principal pathogenetic role in the development of chronic myeloid leukemia. This work was also of major importance to support the idea that cytogenetic changes were drivers of leukemogenesis. John Goldman originally made seminal contributions to the use of autologous and allogeneic stem cell transplantation from the late 1970s onwards. Then, in collaboration with Brian Druker, he led efforts to develop ABL1 tyrosine kinase inhibitors for the treatment of patients with chronic myeloid leukemia in the late 1990s. He also led the global efforts to develop and harmonize methodology for molecular monitoring, and was an indefatigable organizer of international conferences.

These conferences brought together clinicians and scientists, and accelerated the adoption of new therapies. The abundance of praise, tributes and testimonies expressed by many serve to illustrate the indelible impressions these two passionate and affable scholars made on so many people’s lives.

This tribute provides an outline of the remarkable story of chronic myeloid leukemia, and in writing it, it is clear that the historical triumph of biomedical science over this leukemia cannot be considered without appreciating the work of both Janet Rowley and John Goldman.

Introduction: the power of targeted therapy The biology and treatment of patients with chronic myeloid leukemia (CML), a rare heterogeneous clonal hematopoietic stem cell disorder characterized by a consistent cytogenetic abnormality (the Philadelphia chromosome) and the presence of the BCR-ABL1 fusion gene, must surely be ranked as one of the most successful cancer medicine stories of the past century. The BCR-ABL1 fusion gene encodes the oncoprotein BCR-ABL1 (also referred to as p210 or BCR-ABL) with a constitutive active tyrosine kinase activity that is the primary cause of the chronic phase of CML.1,2 The discovery in 1996 that this kinase activity could be pharmacologically inactivated by a modified 2-phenylaminopyrimidine paved the way for the successful introduction of imatinib (also known as STI571, glivec, or gleevec) as an initial oral treatment for newly diagnosed CML patients.3 Imatinib, now termed a 1stgeneration tyrosine kinase inhibitor (TKI), substantially and durably reduces the number of CML cells in the chronic phase at a daily oral dose of 400 mg, and has improved the 10-year survival rates from less than 20% to around 83% (Figure 1).4 haematologica | 2016; 101(5)

Correspondence: tmughal911@hotmail.com tmughal@tuftsmedicalcenter.org

Received: November 12, 2015.

Accepted: January 20, 2016.

doi:10.3324/haematol.2015.139337

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/541

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

541

T.I. Mughal et al.

The greatest advance is in those patients who achieve a complete cytogenetic response (CCyR) within two years of starting imatinib leading to life spans indistinguishable from the general population.5 These impressive results with imatinib therapy have had profound effects on the natural history of CML and its prevalence. Current estimates suggest that in the USA, where about 5500 new cases are diagnosed annually, the prevalence will increase to about 120,000 by 2020 and to about 200,000 by 2050.6 However, imatinib is far from perfect, with only approximately 60% of patients remaining on the standard daily dose of 400 mg after six years due to either lack of drug tolerance or drug resistance.7 Imatinib is inducing responses also in the more advanced phases of CML, but these responses are not durable. There are now four newer TKIs, three so-called 2nd-generation inhibitors and one 3rdgeneration inhibitor, all of which are more potent than imatinib in in vitro assays. Of the 2nd-generation drugs, nilotinib (also known as AMN107) and dasatinib (also known as BMS-354825) are licensed in the US and many other parts of the world for patients with CML in the chronic phase as first-line and subsequent therapies, while bosutinib (also known as SKI-606), is currently licensed for CML patients resistant or refractory to first-line drugs and is anticipated to be approved for first-line use in the near future. The 3rd-generation inhibitor ponatinib (also known as AP24534), is the newest and is licensed for CML patients who either have a T315I mutation or who fail to respond to any of the other currently approved TKIs. Current experience suggests both nilotinib and dasatinib achieve deeper and faster molecular responses than imatinib, but the precise benefits of such responses remain an enigma. Thus far, there is little evidence of a statistically significant improvement in overall survival (OS), though long-term follow up confirmed a superior rate of freedom from progression compared with patients with less deep molecular responses at the same time points.8 The advent of TKIs in the treatment of CML has opened a new era of precision medicine for diverse malignancies in which relatively non-specific and often toxic drugs are gradually being replaced by safer and better tolerated agents whose mechanism of action is precisely defined, and for which the treatment algorithm is guided by individual patient genomic information.9 Indeed, many TKIs have activity against other tyrosine kinases and could, therefore, be useful in treating patients whose malignancies harbor these gene mutations. In this review, we discuss the various milestones in the study, diagnosis, monitoring and treatment of CML, and speculate on the notion of cure and candidates for future therapy.10

Cytogenetics and molecular biology Claims of priority can almost always be challenged but it is generally agreed that Alfred Velpeau in France be credited with the first detailed description of what must have been leukemia in 1827.11 As a result of astute clinical observations, he described a 63-year old florist and lemonade salesman who presented with gross hepatosplenomegaly and was noted to have “globules of pus” in his blood. The precise diagnosis, however, remained elusive. The first plausible story of what we now know as CML probably 542

Janet Rowley and John Goldman.

began in 1845 almost simultaneously by John Bennett in Edinburgh and Rudolph Virchow in Berlin.12,13 They both published accurate case reports and probably neither were aware of the other’s publication until later. Major progress in both the therapy and, indeed, the understanding of the disease did not occur until 1960. Figure 2 depicts the principal milestones in the study and treatment of CML.

Janet Rowley defines the cytogenetics of the Philadelphia chromosome Following the discovery by Joe Tjo and Albert Levan in 1956 that humans have 46 chromosomes, many efforts were directed to the study of chromosomal abnormalities in human cancers.14 By 1959, reports pertaining to the presence of constitutional abnormalities related to particular phenotypes began to appear, the most well known being the association of the gain of chromosome 21 in patients with Down syndrome.15 The work of Peter Nowell and David Hungerford led in 1960 to the discovery of the Philadelphia (Ph) chromosome.16 These investigators were tinkering with cytological techniques, which revealed metaphase spreads in bone marrow by accidentally rinsing slides with water. Among a series of bone marrow samples from patients with leukemia were 2 males with CML, in which they observed a “minute” chromosome. From cutting out the chromosomes from photographs of metaphases and laying them in rows according to centromere position and size, they deduced that this abnormal chromosome was a deletion of the Y chromosome. As these 2 patients had received therapy, there was some debate that the chromosomal abnormality had resulted from chromosomal damage induced by the treatment. Following additional work, they speculated that the chromosomal abnormality was probably not constitutive and may well be causally associated to CML. At around the same time, Balkie and colleagues made the same discovery in Edinburgh, Scotland.17 They showed the presence of the same “small” chromosome in bone marrow and blood samples, but not in skin cells.

With this observation, they were able to conclude that the abnormal chromosome was an acquired abnormality associated with the leukemia, particularly as the bone marrow and blood samples contained a high level of myeloblasts. In addition, a number of their patients were untreated, thus refuting the claim that the abnormality was therapy induced. They concluded that this small haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

chromosome was derived from the group of small acrocentric chromosomes, known as chromosomes 21 and 22.

As Down syndrome is associated with an increased risk of developing leukemia, although not CML, they made the assumption that the small chromosome must have arisen from a chromosome 21 and that the most likely explanation was a deletion. The Ph chromosomal abnormality was heralded as the first consistent cytogenetic abnormality in a human malignancy and the superscript ‘1’ was added, Ph1, on the premise that additional abnormalities would be discovered. This did not occur and the superscript had been dropped by 1990. The formal recognition that a human cancer might be caused by an acquired chromosomal aberration, vindicated the hypothesis postulated

by Theodore Boveri in Germany in 1914 that cancer may be caused by acquired chromosomal abnormalities.18 The next important observations which established that CML was a stem cell-derived clonal disease came from Phillip Fialkow and colleagues in 1967.19 They applied a genetic technique developed by Ohno et al. based on X chromosome mosaicism in females, and by demonstrating polymorphism in the X-linked glucose-6-phosphatase dehydrogenase locus, established the clonal nature of CML.20 With the advent of the new chromosomal banding techniques in the early 1970s, it became possible to accurately identify the individual chromosome for the first time.

Janet Rowley from Chicago used these techniques, which she had learnt whilst on a visit to Oxford, UK. Among samples from patients with hematologic malignancies collected over previous years were those from patients with CML in whom the Ph chromosome was present. Whilst laboriously comparing the chromosomal preparations made in the conventional manner with those prepared using these novel approaches, she noted on chromosome 9 “a duly fluorescein segment resembling the end of chromosome 22, but equally other chromosomes”. This remarkable observation of the balanced reciprocal translocation of genetic material between the long arms of chromosomes 9 and 22, t(9;22)(q34;q11) was published with difficulty in Nature in June 1973 (Figure 3).21 There were some valuable quotations in that paper which remain unchanged to this day: “the mechanism for the production of such a specific chromosomal translocation (if this is the correct explanation of these findings) is not clear”; “this would constitute the only specific translocation in

Figure 1. Survival with chronic myeloid leukemia over time (1993-2013): the German CML-Study Group experience. Courtesy of Prof H Kantarjian; adapted, with permission, from Harrison’s Principles of Internal Medicine, 2014.

haematologica | 2016; 101(5)

humans that has been identified”; “this abnormality is involved in initiation rather than a consequence”.

The Molecular Biology Story Janet Rowley’s seminal work in deciphering the Ph chromosome provided the framework for the unraveling of the genomic architecture, structure and function of the oncogene driving CML, which would become known as BCR-ABL1. These molecular events began in 1982, when Nora Heisterkamp et al. in Rotterdam, the Netherlands, observed that c-Abl, the human homolog of v-Abl, the oncogene of a murine leukemia virus first described by Abelson in 1970, localized to human chromosome 9.21-24 This discovery rekindled interest in a possible role of c-Abl in Ph-positive leukemia, even after attempts to demonstrate transforming capacity for c-Abl had proven unsuccessful.

The proof that c-abl was implicated in the Ph translocation was achieved on the basis of somatic cell hybrids generated by fusions of murine or hamster cell lines with cells from CML patients and healthy controls. These lines contained the rearranged chromosomes from the Ph translocation or their normal counterparts. Southern blot analysis was performed on DNA from the various

Figure 2. Milestones in the study and treatment of chronic myeloid leukemia.

543

T.I. Mughal et al.

hybridoma lines using human c-Abl probes and unequivocally demonstrated the translocation of c-Abl sequences to the Ph chromosome,25 and was confirmed at the cytogenetic level.26 While the breakpoints on chromosome 9 spanned a large genomic region, breakpoints on chromosome 22 localized to a relatively small genomic region that was hence called “breakpoint cluster region” or BCR.23 This name was later used to designate the previously unknown gene on chromosome 22 that serves as the 5’ fusion partner for ABL1. Thereafter, the BCR-ABL fusion mRNA was demonstrated and the proof that it gave rise to the p210 BCR-ABL1 protein followed. By the mid-1980s the molecular anatomy of the BCR-ABL1 oncogene had been unraveled (Figure 4).1,27,28 The next major step forward in our understanding of CML was the demonstration that BCR-ABL1 was a tyrosine kinase and that tyrosine kinase activity was critical to its ability to transform cells. v-Abl had been recognized as a tyrosine kinase in 1980 and subsequent deletion mutagenesis revealed that the sequences containing the tyrosine kinase were critical to cellular transformation.29,30 As early as 1984, the Witte lab had identified an altered c-Abl protein in K562 cells and suspected that a structural alteration present in the 210 kD protein had unmasked c-Abl’s tyrosine kinase activity, leading to cellular transformation.31 This was subsequently substantiated by experiments that convincingly showed a correlation between the tyrosine kinase activity of BCR-ABL1 proteins and their transforming capacity.32,33 In 1990, George Daley and Rick van Etten, working with the Nobel laureate David Baltimore, showed that transplantation of bone marrow infected with a BCR-

A

B

Figure 3. Detection of the t(9;22)(q34;q11) chromosomal translocation. (A) Karyotype from a patient with chronic myeloid leukemia depicting the translocation, t(9;22)(q34;q11) (abnormal chromosomes arrowed). (B) A partial karyotype of the same chromosomes 9 and 22 with the relevant FISH probes for BCR and ABL1 is shown. The red green fusion signals of the BCR-ABL1 and ABL1-BCR on chromosomes 22 and 9, respectively, are also shown. A metaphase counterstained with DAPI (blue) indicates their appearance under the fluorescent microscope (C).

Figure 4. The structure of the normal BCR and ABL1 genes and the fusion transcripts found in Ph-positive leukemias. The ABL1 gene contains two alternative 5' exons (named 1b and 1a) followed by 10 ‘common’ exons numbered a2–a11 (green boxes). Breakpoints in CML and Ph-positive ALL usually occur in the introns between exons 1b and 1a or between exons 1a and a2 (as shown by vertical arrows). The BCR gene comprises a total of 23 exons, 11 exons upstream of the M-BCR region, five exons in the M-BCR that were originally termed b1–b5 and now renamed e12–e16, and seven exons downstream of M-BCR (orange boxes). For convenience, only exons e1, e12–e16 and e23 are shown.

Breakpoints in CML usually occur between exons e13 (b2) and e14 (b3) or between exons e14 (b3) and e15 (b4) of the M-BCR (as shown by two vertical arrows placed centrally).

The majority of patients with Ph-positive ALL have breakpoints in the first intron of the gene, between e1 and e2 (arrow at left). Three possible BCR–ABL1 mRNA transcripts are shown below. The first two (e13a2 and e14a2, respectively) are characteristic of CML. The bottom mRNA (e1a2) is found in the majority of patients with Ph-positive ALL.

544

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

ABL1 retrovirus into lethally irradiated syngeneic recipient mice induced a disease that resembled human CML, providing a causal connection between the BCR-ABL1 cDNA and the clinical disease phenotype of CML.34 This was confirmed by work by Elephanty et al. in Australia and Kelliher et al. in Los Angeles.35,36 The notion that the BCRABL1 fusion gene could have a central role in CML was thereafter generally accepted and established a scientific rationale to target BCR-ABL1 kinase activity for the treatment of ABL-related leukemias.37 The 1990s saw the elucidation of the complex signaling network operated by the BCR-ABL1 kinase, with contributions from many laboratories. Myc, Ras, phosphatidyl inotisol 3â&#x20AC;&#x2122; kinase (PI3K), JAK/STAT and cytoskeletal proteins were identified as pathways activated by BCR-ABL1 or as important downstream mediators (Figure 5).38-43 However, what proved to be very difficult was identifying transformation critical molecules downstream of BCR-ABL1, testimony to a high level of redundancy in the signaling network.

Moreover, the more became known about signal transduction in BCR-ABL1 transformed cells, the more it became evident that fundamental differences exist between leukemia cell lines and primary leukemia cells, limiting the applicability of conclusions derived from in vitro studies. Experiments on primary cells and murine models identified additional molecules important for

BCR-ABL1 transformation, including β-catenin, Hedgehog, PP2A, BCL-6 and Alox5, amongst others.44-48 Involvement of these pathways in CML stem cell survival suggests they may be excellent therapeutic targets, but their role in the sustenance of normal hematopoiesis and/or normal development could also limit their utility.49 Since CML stem cells are not addicted to BCR-ABL1, unlike progenitor cells, the search for specific molecular vulnerabilities in leukemic founder cells continues, as does the molecular story of CML.50

Treatment options Historical perspectives Efforts to improve the quality of life by controlling the symptoms attributed to CML probably began with the use of arsenicals by Thomas Fowler in 1865, and Arthur Doyle in 1882, and continued in the first half of the 20th century with radiation therapy to the spleen in 1902, antileukocyte sera in 1932, benzene in 1935, urethane in 1950 and leukapheresis in the 1960s.51 There were a number of other notable treatment attempts, but most, if not all, were unsuccessful. Busulfan, an alkylating agent, was introduced by David Galton in London in 1953.52 Galton then carried out the first prospective randomized study in CML, comparing busulfan and splenic radiation, and showed improved survival in the busulfan cohort. In the

Figure 5. Cytoplasmic BCRABL1 activates a myriad of signal pathways.

BCR-ABL1 domain structure and simplified representation of molecular signaling pathways activated in chronic myeloid leukemia (CML) cells. Following dimerization of BCR-ABL1, autophosphorylation generates docking sites on BCRABL1 that facilitate interaction with intermediary adapter proteins (brown) such as GRB2.

CRKL and CBL are also direct substrates of BCR-ABL1 that are part of a multimeric complex.

These BCR-ABL1-dependent signaling complexes in turn lead to activation of multiple pathways whose net result is enhanced survival, inhibition of apoptosis, and perturbation of cell adhesion and migration. A subset of these pathways and their constituent transcription factors (blue), serine/threonine-specific kinases (purple), cell cycle regulatory protein (yellow) and apoptosis-related proteins (red) are shown. Also included are a few pathways that have been more recently implicated in CML stem cell maintenance and BCRABL1-mediated disease transformation (orange). However, it is important to note that this is a simplified diagram and that many more associations between BCR-ABL and signaling proteins have been reported.

haematologica | 2016; 101(5)

545

T.I. Mughal et al.

mid-1960s, busulfan was replaced by hydroxycarbamide (previously hydroxyurea), a ribonucleotide reductase inhibitor, following recognition that busulfan is mutagenic, and a randomized study confirming the superiority of hydroxycarbamide, though neither drug was able to reduce the proportion of Ph positive cells or prolong overall survival.53,54 Interferon alpha (IFN-α) was introduced into the clinics in the mid-1980s and proved popular, despite frequent side-effects such as flu-like symptoms and fatigue.55 In the early 1990s, several randomized studies comparing IFN-α or interferon-α n1 (wellferon) with hydroxycarbamide or busulfan were undertaken and demonstrated an improvement in overall survival by about 2-3 years with IFN-α.56-58 In addition, a French study testing the addition of cytarabine to IFN-2b found this to result in an increased proportion of patients achieving a cytogenetic response.59 Thereafter, interferon, either alone or in combination with cytarabine, replaced hydroxycarbamide as the preferred treatment for CML in the chronic phase.60 The precise mode of action of IFN-α remains unclear, but is probably related to its immunomodulatory properties. IFNα was replaced by imatinib as the preferred treatment for patients with CML in the chronic phase in the summer of 2001 following a randomized study comparing imatinib with IFN-α plus cytarabine.61-63 The results were very impressive and established the firm position of imatinib, and also constituted the final proof of the importance of the BCR-ABL1 oncoprotein to CML. The introduction of imatinib was rapidly followed by the development of the next generation tyrosine kinase inhibitors (TKIs).

The Imatinib Story It is remarkable how, in 1994, against a background of considerable skepticism about any possible clinical value of TKIs, Brian Druker in Portland, Oregan, and collaborating scientists at Ciba-Geigy (now Novartis) in Basel, Switzerland, developed a compound, imatinib, that could reverse the clinical and hematologic features of CML.3,68 Imatinib, a 2-phenylaminopyrimidine, inhibits the enzymatic action of the activated BCR-ABL1 tyrosine kinase by occupying the ATP-binding pocket of the tyrosine kinase component of the BCR-ABL1 oncoprotein, thereby blocking the capacity of the enzyme to phosphorylate and activate downstream effector molecules that cause the leukemic phenotype. It also binds to an adjacent part of the kinase domain in a manner that holds the ABL-activation loop of the oncoprotein in an inactive configuration (Figure 6).69 The International Randomized Study of Interferon and STI571 (IRIS) demonstrated that imatinib induced ‘cumulative best’ CCyR, equivalent to a 2-log reduction in BCRABL1 transcripts level, in 82% of all previously untreated patients with CML in the chronic phase.60,70 About 2% of all patients in the chronic phase progress to advancedphase disease each year, which contrasts with estimated annual progression rates of more than 15% for patients treated with hydroxycarbamide and about 10% for patients receiving IFN-α, either with or without cytarabine.4,71 The 8-year event-free survival was 83% and the estimated overall survival was 93% (corrected for CMLrelated deaths only), confirming the notion that imatinib

Prognostic and predictive factors Various efforts have been made to establish criteria definable at diagnosis that may help to predict response to therapy and survival for individual patients.

Historically, the Sokal score was developed in 1984 for patients treated with busulfan, and the Hasford (also known as the Euro) score in 1998 for patients treated with IFN-α.64,65 Both scoring systems have since been confirmed to be useful in the TKI era. Stratifying patients into good-, intermediate-, and poor-risk categories may assist in the decision-making process regarding appropriate treatment options. In 2011, a simpler and TKI-specific score, the European Treatment and Outcome Study (EUTOS), was proposed but requires further confirmation before it can be widely used.66 More recently, the response to TKIs at a given time point, disease risk and stage, BCR-ABL1 genotype, the presence of comorbidities, financial aspects and local monitoring capabilities are all being increasingly used to personalize treatment.67

Figure 6. Imatinib binds an Inactive ABL1 conformation. Adapted, with permission, from Schindler et al. Science 2000.

Table 1. Definitions of response.

Type of response CHR MCyR CCyR MMR MR4.0 MR4.5 CMR

Definition Complete hematologic response Major cytogenetic response Complete cytogenetic response Major molecular response

Complete molecular response

Normal differential, WBC and platelets within the normal range 0%-35% Ph+ marrow metaphases 0% Ph+ marrow metaphases BCR-ABL1/ABL1 ratio ≤ 0.1% (international scale) BCR-ABL1/ABL1 ratio ≤ 0.01% (international scale): this is a 4-log reduction BCR-ABL1/ABL1 ratio ≤ 0.003% (international scale): this is a 4.5-log reduction Undetectable BCR-ABL1 (test of sensitivity ≥ 4.5 logs)

WBC: white blood cells.

546

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

substantially prolongs overall survival compared with historical patients who received IFN-Îą or hydroxycarbamide.72 A substantial proportion of the patients in CCyR also achieve a 3-log reduction or more in BCR-ABL1 transcripts (referred to as MMR, or MR3), and this proportion seems to have continued to increase steadily with time on imatinib. A minority of patients achieve a deeper molecular response with more than 4-log or 4.5-log reduction in BCR-ABL1 transcripts [referred to as MR4.0 and MR,4.5 respectively; MR4.5 was previously referred to as a complete molecular response (CMR)] (Table 1).73,74 These results were confirmed by independent single centers as well as company-led registration studies.75 It should also be said that the success of these and other CML treatment studies epitomize the critical importance of an optimal molecular monitoring methodology (see below).

The standard starting daily dose of imatinib is 400 mg for newly diagnosed patients in the chronic phase, but the optimal dose is not known and no maximum tolerated dose was established in the initial phase I study.60 Several single-arm studies suggest that higher doses, up to 800 mg daily, might give better results with a greater proportion of patients achieving CCyR and MMR.76,77 Such studies also suggest better PFS and transformation-free survival, but with potentially more side-effects, particularly myelosuppression. Amongst randomized studies, the TOPS (Tyrosine Kinase Inhibitor Optimization and Selectivity) study showed imatinib 800 mg to induce MR3 more rapidly than imatinib 400 mg, but at one year there was no statistically significant difference.78 In contrast, there is persuasive evidence from the recent randomized German (CML IV) study that optimized high-dose imatinib allows most patients to achieve MR4.5, and this may provide an improved therapeutic basis for treatment discontinuations.79 A subset analysis from this randomized study also showed a greater benefit for patients over 65 years of age.80 Another recent randomized intergroup phase II study also demonstrated deeper molecular responses in the 800 mg daily arm compared with 400 mg daily, with MR4 of 25% and 10%, respectively, with a trend for improved progression-free and overall survival, but with substantially more grade 3 and 4 side-effects.81 There is also some evidence that imatinib 600 mg daily is tolerated in more than 80% of CML patients and results in superior cytogenetic and molecular responses at 12 and 24 months compared to the conventional 400 mg daily dose.82 It is also of interest to note that in the German CML IV study, the median daily dose of imatinib was actually 628 mg, lending additional support to the 600 mg dose strategy.

Regardless of the dose of imatinib, the current safety analysis of imatinib is quite impressive, with very few potentially serious long-term side-effects noted after ten years or more continuous use.83 Table 1 depicts the relative toxicities of all currently available TKIs for CML. When the drug is used at the standard starting daily dose of 400 mg, most adverse effects occur within the first two years of starting therapy, and are generally mild to moderate (grades 1 and 2). Most of these include lethargy, nausea, headache, various skin reactions (including StevenJohnson syndrome), infraorbital edema, bone pains, and sometimes, generalized fluid retention. In general these effects are easily manageable and potentially reversible.

Significant cytopenias, in particular neutropenia and/or haematologica | 2016; 101(5)

thrombocytopenia and sometimes anemia occur less commonly and usually in the first 6-12 months of therapy.

Liver chemistry can also be abnormal, and this may, on rare occasions, progress to liver failure. Rare incidences of prolongation of the QTc interval on the electrocardiograph have also been reported. It is possible that some patients, such as older patients and those with other co-morbidities such as impaired cardiac function, might be more susceptible to toxicity. The longer-term follow-up studies do, however, indicate an adverse effect on the quality of life, particularly in younger female patients, and other unique effects, such as effects on bone growth and mineralization and gynecomastia.84-86 Finally, although there appears to be no definitive evidence to suggest exposure to imatinib increases the risk of developing a second malignancy, it is reasonable for specialists to remain cautious and follow patients on long-term treatment carefully.87

The next generation-TKI story Further research into the imatinib story has shown that only about 60% of CML patients remain on the standard dosages of imatinib after six years, implying that about 40% have required an alternative treatment or higher doses of imatinib.88 In addition, a population-based report found that only half of newly diagnosed patients with CML in chronic phase were in CCyR and receiving imatinib at two years after starting treatment.89 The main reasons for this are secondary (acquired) resistance which in most cases results from the expansion of subclones with point mutations in the BCR-ABL1 kinase domain (KD).90-92 A variety of other resistance mechanisms have also been described, including poor adherence, amplification of the BCR-ABL1 fusion gene, relative overexpression of BCRABL1 protein, and overexpression of the multidrug resistant P-glycoprotein (MDR1).

Point mutations in the kinase domain of BCR-ABL1 that confer resistance to imatinib code for amino acid substitutions that may preclude entry of imatinib into the ATPbinding pocket or, in general, the inhibitory action of imatinib. The precise position of the mutation appears to dictate the degree of resistance to the drug. Some mutations are associated with minor degrees of drug resistance, while the T315I (also referred to as the gatekeeper) mutation confers a very high level of resistance.93 The precise significance, and indeed the kinetics, of the over 100 currently well-characterized mutations have only partially been characterized (Figure 7).94 It is also possible, though not confirmed in vivo, that resistant mutant clones could enhance the fitness of sensitive clones by altering their microenvironment by generating paracrine factors, such as IL-3.95 Primary resistance to imatinib appears to be very rare, and when observed may be related to poor drug compliance, poor gastrointestinal absorption, p450 cytochrome polymorphisms, interactions with other medications, or abnormal drug efflux and influx at the cellular level due to low drug influx transporter (OCT1).96 The recognition of imatinibâ&#x20AC;&#x2122;s qualified success led efforts to develop the nextgeneration TKIs and other alternative treatments. Initial efforts focused on two 2nd-generation TKIs: nilotinib and dasatinib (Figure 8).97 Nilotinib was designed as a chemical modification of imatinib in an effort to increase its selectivity and activity.

547

T.I. Mughal et al.

Indeed, nilotinib has little activity against other kinases inhibited by imatinib, such as KIT and PDGFRA/B.98 Nilotinib is taken orally twice daily with food restrictions due to its bioavailibity being affected adversely by high fat intake. Like imatinib, it acts as an ATP-competitive inhibitor by binding to the closed (inactive) conformation of the ABL1 kinase domain, but with a much higher affinity. In vitro studies suggest that nilotinib is approximately 30- to 50-fold more potent than imatinib. Nilotinib is also active in 32 of the currently 33 imatinib-resistant cell lines with mutant BCR-ABL1, but like imatinib has no activity against the T315I mutation.99 Dasatinib is a thiazole-carboxamide structurally unrelated to imatinib which binds to the ABL1 kinase domain regardless of the conformation of the activation loop (i.e. whether open or closed).100,101 It also inhibits some of the Src family kinases that are involved in signal transduction in lymphoid cells and results in NK-cell expansion. Preclinical studies showed that dasatinib is 300-fold more potent than imatinib and is active against 18 of 19 tested imatinib-resistant BCR-ABL1 mutants, with the notable exception of the T315I mutant.99 In 2004, both drugs entered studies of patients who were resistant or intolerant to imatinib at standard dosages. The efficacy, but not the toxicity, of both drugs was fairly similar, with about 45% of the imatinib-resistant patients achieving CCyR and a 4-year overall survival of 78%. The results for the imatinib-intolerant group were slightly better for both drugs.99-109 All responses were similar in patients with or without mutations, except for the cohort with T315I mutation, where no responses were noted with either drug. Though these results are impressive, it is interesting that only one-third of the responding patients remained on nilotinib or dasatinib at five years, which means that two-thirds of patients required a further change of therapy. In an analysis of a sub-set receiving dasatinib for imatinib-resistant/intolerant disease, it was noted that dasatinib maintained durable efficacy irrespective of the presence or absence of pre-existing KD mutations.110

The most common nilotinib treatment-related toxicity was myelosuppression (although this was less pronounced than that observed with most other TKIs) followed by headaches, pruritus, and rashes (Table 2).

Overall, 22% of the patients in the chronic phase experienced thrombocytopenia, with 19% having either grade 3 or 4 severity; 16% had neutropenia and a further 16% had anemia; metabolic effects included hyperglycemia.

Following longer follow up, an increased incidence of cardiovascular events, in particular peripheral arterial disease, was noted, although many affected patients had predisposing risk factors.111 About 19% of all patients experience arthralgia, and about 14% experience fluid retention, particularly pleural effusions, and rarely pericardial effusions and other unique effects, such as panniculitis.104,112 In the dasatinib-treated cohort, hematologic toxicity was more common, with neutropenia and/or thrombocytopenia occurring in one-half of all patients and anemia in 20%.108 Non-hematologic toxicity includes diarrhea, headaches, superficial edema, pleural effusions, and occasional pericardial effusions. Grades 3/4 side effects were rare; grades 3/4 pleural effusions occurred in 6% of patients.

Following these encouraging results, both nilotinib and dasatinib entered clinical trials for first-line therapy of newly diagnosed patients in 2006. Nilotinib at two dosages, either 300 mg/day or 400 mg/day, was tested against imatinib 400 mg/day in the Evaluating Nilotinib Efficacy and Safety in Newly Diagnosed Patients (ENESTnd) randomized study, with the rate of MR3 at 12 months as the primary end point.113 Dasatinib was tested at a dose of 100 mg/day in a trial known as Dasatinib versus Imatinib Study in Treatment-NaĂŻve CML Patients (DASISION), with confirmed CCyR at 12 months as the primary end point.114 Both of these primary end points were met: ENESTnd accorded higher rates of MR3 at 12 months for both doses of nilotinib compared with imatinib (44% and 43% vs. 22%; P<0.001) and DASISION showed that dasatinib resulted in more frequent confirmed CCyR at 12 months compared with imatinib (77 vs. 66%; P=0.007). Both drugs were licensed for first-line use in patients with CML in the chronic phase in 2010.

Table 3 summarizes the latest updates from both trials.

Figure 7. Mutations in the kinase domain of ABL1 identified in tyrosine kinase inhibitors (TKI) resistant chronic myeloid leukemia cells. The 10 most frequent mutations, accounting for approximately 70% of TKI-resistant CML patients are highlighted in red.

548

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

Many of the secondary end points were also met in both trials, and the overall results suggested that front-line therapy with dasatinib or nilotinib (at either dose) achieves earlier and higher molecular response rates, in particular faster and deeper molecular responses (MR3, MR4 and beyond), that in turn appear to decrease the rates of progression to the advanced phases of CML.115-117 Nilotinib was associated with hyperglycemia, hypercholesterolemia, increased triglycerides, and an increased incidence of cardiovascular, cerebrovascular and peripheral arterial occlusive disease.118,119 Dasatinib was associated with substantial hematologic toxicity, pleural effusions and, infrequently, pericardial effusions and pulmonary hypertension (Table 2).120 Discontinuation rates for disease progression or treatment failure for any cause appears to be similar at around 33%38% at three years for both drugs, with the caveat that the definitions of progression and the duration of follow up prior to censoring in these two large studies were not uniform. A recent independent North American consortia trial comparing daily dasatinib 100 mg to daily imatinib 400 mg produced very similar results to DASISION in terms of efficacy and safety.121 Collectively, neither of these two studies, nor the ENESTnd or the companion ENESTcmr studies, demonstrated a survival advantage for a 2nd-generation TKI being used for first-line therapy of a newly diagnosed patient with CML in chronic phase, despite the superior early molecular responses and the subsequent MR4.5 responses.122 In addition, the associated cardiovascular toxicity in all three trials has been higher than that seen with imatinib. nd

The third and newest of the 2 -generation TKIs, bosutinib, an oral dual ABL1 and SRC inhibitor, is chemically different from both dasatinib and nilotinib, and appears to be able to overcome binding impediments conferred by

several kinase domain mutations to imatinib, nilotinib, or dasatinib (Figure 8).123 Phase II studies of once daily bosutinib 500 mg/day in CML patients who were either resistant or intolerant to imatinib demonstrated a CCyR of 47%, an overall survival at two years of 88% in the imatinib-resistant cohort, and a remarkable 98% in the imatinib intolerant cohort; three years later, 40% of patients remained on bosutinib.124-127 The principal side-effects included diarrhea, abnormal liver chemistry and various skin rashes, all of which were easily manageable with dose reduction and/or concomitant medications (Table 2).

Based on these results, the drug was approved in 2012 for the treatment of adult CML patients with chronic phase or advanced phase disease who were resistant to prior TKI therapy. The drug was then tested in the phase III Bosutinib Efficacy and safety in CML (BELA) study, in newly diagnosed patients with CML in the chronic phase.128 Since the primary end point was not met, and with the CCyR results being similar in both arms of the study (70% for bosutinib and 68% for imatinib) the drug was not approved for first-line use. It is, however, of interest that the MR3 rates at 12 months were significantly improved at 41% with bosutinib compared to 27% with imatinib, and the drug discontinuation rate was 37% at two years for bosutinib and 29% for imatinib.

Furthermore, the risk of transformation to the advanced phases was significantly lower for bosutnib. These latest molecular results lend some support for the drugâ&#x20AC;&#x2122;s future candidacy as first-line therapy.

Ponatinib is a 3rd-generation TKI which has an interesting chemical structure based on a modification of a purine scaffold and a central triple carbon-carbon bond with a substructure beyond the bond that is similar to imatinib (Figure 8).129 The drug inhibits ABL1, SRC and a variety of other kinases, including KIT, PDFGRA, FGFR1 and FLT3.130,131 It was developed initially for patients who were considered to have become resistant to TKIs as a result of a T315I subclone. This feature is attributed to the compoundâ&#x20AC;&#x2122;s unique structure which allows it to bind and inhibit ABL1 with no steric hindrance due to the T315I mutation.132,133 The drug was tested in the Ponatinib Phpositive acute lymphoblastic leukemia (ALL) and CML Table 2. Adverse events related to tyrosine kinase inhibitors in patients with chronic myeloid leukemia.

Imatinib Dasatinib Nilotinib

Figure 8. Chemical structures of imatinib, nilotinib, dasatinib, bosutinib and ponatinib.

haematologica | 2016; 101(5)

Peripheral edemas Pulmonary hypertension Effusions Diarrhea Rash Nausea Hyperglycemia PAOD Arterial thrombosis Venous thrombosis Asthenia Skin fragility Muscle cramps

Bosutinib Ponatinib

++ + +++ + + +

+

++

+

++ +++ ++

+ +++ + +

++ ++

++ +++ ++

++ ++ ++

PAOD: peripheral arterial occlusive disease.

549

T.I. Mughal et al.

Evaluation (PACE) phase II study in which 449 patients with CML in the chronic and advanced phases and Phpositive ALL with resistant to or intolerance from dasatinib or nilotinib or with the T315I mutation were enrolled. The patients received once daily 45 mg ponatinib, and the results indicated that the drug had considerable activity in all patients, including those in advanced phase disease, regardless of base-line kinase domain mutations and the responses seemed to be durable.134,135 The study results showed that there were 46% CCyR (40% without T315I; 66% with T315I) and 34% MR3 (27% without T315I; 56% with T315I). The most common sideeffect was thrombocytopenia, rash, dry skin and abdominal pain, and platelet dysfunction was also noted (Table 2).136 Serious thrombotic events were observed in 9%, but considered to be treatment-related in 3%. The study drugdiscontinuation rate due to toxicity was 12%.

The Evaluation of Ponatinib versus Imatinib in CML (EPIC) phase III randomized study of ponatinib and imatinib in newly diagnosed patients began in 2012 and preliminary results suggest that the drug accords high rates of early molecular response and MR3 compared with imatinib.137 The drug was licensed in December 2012 for patients with CML in the chronic or advanced phases resistant or intolerant to prior TKI therapy and Ph-chromosome positive ALL resistant or intolerant to prior TKI therapy. This approval constituted ponatinib to be the only licensed TKI with activity against the T315I subclone. Unfortunately, in October 2013, concerns about excessive arterial vascular events led to the suspension of the drug and the manufacturer elected to discontinue the EPIC study.118,119 In early 2014, despite these serious risks, ponatinib was re-licensed exclusively for the treatment of adult patients with T315I-positive CML in all phases or T315I-positive Ph-chromosome positive ALL and adult patients with CML in all phases or Ph-chromosome positive ALL for whom no other TKI therapy was indicated.

The precise mechanisms of ponatinib-related arterial vascular events, and indeed those associated with nilotinib, which seem to occur at a considerably lower frequency, still remain elusive.

bone marrow “sandwiches; flavored by port-wine” (to improve taste), sporadic attempts at marrow transplantation were taken much earlier.140 The modern era of bone marrow transplantation [now stem cell transplantation (SCT)] did not begin until a basic understanding of the histocompatibility system was gained in 1958. Much of the pioneering work thereafter was carried out by the Nobel laureate E. Donnall Thomas in Seattle, resulting in the first successful allo-SCT using syngeneic donors in 1979.141,142 In 1978, John Goldman in London showed that marrow-populating stem cells were present in the peripheral blood of untreated CML patients.143 This led to the use of an autograft for patients ineligible for an allo-SCT, and though in some patients Ph-negative hematopoiesis was restored, very few patients remained Ph-negative for extended periods.

Subsequent efforts in allo-SCT using sibling and volunteer unrelated donors were increasingly successful, as a result of the recognition that the graft-versus-leukemia (GvL) effect plays a major role in eradicating CML after allo-SCT, and improvements in the conditioning regimens.144,145 This coupled with the availability of hematopoietic stem cells from a variety of sources, improvements in SCT technology, and a better understanding and treatment of the alloimmmune-mediated graft-versus-host disease (GvHD) led to significantly improved results for the majority of patients transplanted in the chronic phase, and indeed made SCT more widely available to higher risk and also older patients.146-148 The potential to accord long-term survival and probable cure for patients with CML in the chronic phase was firmly established by the early 1990s, and an allograft was then considered the first-line treatment for all eligible patients in the chronic phase.149 The use of donor lymphocyte infusions to treat early relapse after allograft by exploiting the GvL effect became popular in the mid-1990s, and confirmed the importance of the donor derived immune system to overcome residual leukemic cells.150,151

The allogeneic stem cell transplantation story

The major factors influencing survival are patient age, disease phase at time of SCT, disease duration, degree of histocompatibility between donor and recipient, and gender of donor.152 The best results are achieved following a full intensity (conventional) allograft, using an HLA-identical sibling donor or a suitable matched unrelated donor; the 5-year leukemia-free survival is 80% and 60%, respectively (Figure 9).149 The results following a reduced intensity regiment are generally inferior.153 There is a roughly 20% chance of transplant-related mortality and a 15% chance of relapse. The possible major complications include GvHD, reactivation of infection with cytomegalovirus or other viruses, idiopathic pneumonitis and sinusoidal obstruction syndrome (previously known as veno-occlusive disease of the liver). Post-transplant molecular monitoring studies suggest that most, but not all, patients who are negative for BCR-ABL1 transcripts at five years following the allograft, remain negative for long periods, and it is likely that, in the majority of these patients, the CML may truly have been eradicated.154,155

“Thy bones are marrowless, thy blood is cold” (The Tragedy of Macbeth: William Shakespeare, 1606).

Though the original concept of bone marrow transplantation was probably first advocated by Thomas Fraser in 1894, when he famously recommended that patients eat

Since 1999, the numbers of allografts performed for CML have dramatically decreased, interestingly, some three years prior to the licensing of imatinib for CML. This trend has continued, and the use of allo-SCT is now

There is continuing interest in developing effective treatments for T315I-positive CML, which are of additional interest given the challenges with ponatinib.

Omecetaxine (formerly called homoharringtonine) is a semi-synthetic plant alkaloid that enhances apoptosis of CML cells. It has actually been under investigation in CML and other myeloid malignancies since the 1970s.138 The results of recent studies were encouraging, with modest activity noted in patients with CML in the chronic and advanced phases, including some with the T315I subclone. The drug was licensed in 2014 for use in patients with CML (all phases) who were resistant or intolerant to two or more TKIs. Another candidate drug that has shown some activity in T315I subclone is HS-438, which has been tested in clinical trials.139

550

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

Figure 9. Chronic myeloid leukemia survival after allo-stem cell transplantation. Data from the Fred Hutchinson Cancer Research Center, Seattle. *Includes both matched related and unrelated donors. Patients receiving allografts at the Fred Hutchinson Cancer Research Center from 1995 to the present.

Figure is courtesy of Dr Ted Gooley. SCT: stem cell treatment.

increasingly being restricted to patients who have failed multiple lines of TKIs, or harbor a T315I mutation and are either ineligible for or have failed ponatinib. Earlier experience in patients who proceed to a transplant after treatment with imatinib did suggest a higher relapse incidence compared with historical patients, but more recent experience did not confirm this.156,157 Current data also suggest that prior treatment with any TKI does not increase the probability of transplant-related mortality. Moreover, patients with kinase domain mutations appear to fare as well post transplant as those lacking such mutations.158 Current challenges include the development of clinical and biological predictors of outcome following relapse post allo-SCT as well as earlier recognition of TKI failures.159 The value of using a TKI after a successful allograft is unknown, particularly as most patients come to transplant having failed 3 or more TKIs. In this regard, it is of interest that the National Comprehensive Cancer Network (NCCN) recommends considering 12 months of standard dose imatinib following allo-SCT.160,161 Finally, it is also reasonable to consider an allo-SCT for patients in the advanced phases of CML, in particular for those who show an initial response to TKI with or without conventional chemotherapy.162,163 In general, responses to TKIs for such patients tend to be short term and the probability of relapse to blast crisis high.

How to stop TKI treatment: the problem of the leukemia stem cells The great success story of the treatment of CML patients has also brought several related translational and clinical research issues sharply into focus.164 The notion of CML stem cells, while not perfect, has become fairly convincing, and the 15 years of TKI use has confirmed our inability to eliminate them, even with the most potent TKIs.165 Seminal studies demonstrate how these stem cells survive despite virtually complete inhibition of the BCRABL1 kinase activity, indicating that they are probably not dependent on BCR-ABL1 for survival.166 It, therefore, begs the question as to whether it is necessary to eliminate CML stem cells for a conventional cure, or whether we should simply accept the â&#x20AC;&#x2DC;operational cureâ&#x20AC;&#x2122; offered at present. Clearly a principal goal in cancer medicine is to provide cure and discontinue medication safely and effectivehaematologica | 2016; 101(5)

ly. An operational cure in CML can be defined by sustained molecular remission upon stopping medication.

This would be of additional interest due to the impact of TKIs on quality of life, the high cost of these drugs, and of course, many other issues, such as pregnancy and nursing.167 Our best insights are probably provided by the preliminary results from clinical studies of stopping TKIs in patients with CML who were in MR4 or MR4.5 for at least two years. The French Stop Imatinib (STIM), the European Stop Kinase Inhibitor (EURO-SKI) and the Australian CML8 trials probably represent the best efforts so far and have yielded similar results with molecular relapse rates of about 60% within the first six months of stopping TKIs. Results of a smaller study of stopping firstline nilotinib or dasatinib indicate similar findings.168,169 The efforts so far have identified patients with a low Sokal risk score, male sex, and longer duration of imatinib treatment as potential prognostic factors for the maintenance of MR4 or MR4.5 after stopping medication.170 It is, therefore, reasonable to speculate that, for patients with CML, irrespective of achieving a deeper molecular response, additional treatment approaches targeting pathways that regulate the survival and maintenance of CML stem cells might be required to eliminate residual CML stem cells that might contribute to relapse.171 Candidate pathways that appear to be activated by BCR-ABL1 include the JAK-STAT, mTOR, PI3K/AKT and autophagy signaling pathways, and the mechanisms by which CML stem cells interact with their microenvironment (Figure 10).172,173 Studies combining JAK 1/2 inhibitors with TKIs are ongoing, specifically in patients with CML in chronic phase who appear not to have achieved an optimal response to TKIs alone.174 When considering bone marrow microenvironment, it is particularly important to consider the marrow niche, a physico-chemical space that not only protects the stem cells, but also appears to play a major role in the trafficking and retention of these cells via the chemokine receptor CXCR4 and its ligand CXCL12.175-177

The monitoring story Today, we are able to monitor the quantity of leukemia in an individual patient, following starting treatment with 551

T.I. Mughal et al.

Table 3. DASISION and ENESTnd: summary of data from different studies.

Cumulative MR³ at 4 years MR4 by 3 years MR4.5 by 3 years Progression to AP/BC (ITT) Overall survival Progression-free survival

Dasatinib 100 mg qd n = 259

Imatinib 400 mg qd n = 260

74%* 36%# 22%# 8 (3.1%) 92.9% 90%

46% 22% 12% 13 (5%) 92.1% 90.2%

Nilotinib 300 mg bid n = 282 77%* 50%* 32%* 9 (3.2%)‡ 95.1% 96.9%

Nilotinib 400 mg bid n = 281

Imatinib 400 mg qd n = 283

77%* 44%* 28%# 6 (2.1%)§ 97.0% 98.3%

60% 26% 15% 19 (6.7%) 94.0% 94.7%

ITT: intention to treat;*versus imatinib, P<0.0001; #versus imatinib, P<0.003; ‡versus imatinib, P=0.05; §versus imatinib, P=0.007.

TKI, with considerable precision. First by an examination of the peripheral blood we confirm normalization of the blood count, second by bone marrow metaphase cytogenetic we confirm CCyR and finally by measuring numbers of BCR-ABL1 transcripts in the blood or marrow by quantitative reverse transcriptase PCR (RQ-PCR) we confirm a molecular response (MR). The use of fluorescence in situ hybridization (FISH) to detect a BCR-ABL1 fusion gene in interphase cells is more sensitive than metaphase cytogenetics but much less sensitive than RQ-PCR. Molecular monitoring was initially developed in 1988 as a qualitative assay to detect early relapse following an allograft and was thereafter replaced by quantitative PCR, which is now generally considered the optimal method for monitoring patients with CML during treatment.178-181 Unfortunately, there remains widespread inconsistency in RQ-PCR results. This is mainly due to interlaboratory differences in technology and methodology employed since molecular monitoring was popularized in the early imatinib era. The RQ-PCR standardization project was started

by John Goldman in 2006 in Bethesda, Maryland, to address some of these challenges.182 The results are expressed as a ratio of BCR-ABL1 copy numbers to copy numbers of a control gene (x 100% on a log scale) or as a log10 reduction from standardized value of 0 for untreated patients. In practice, the recommended way of expression is to use a laboratory-specific conversion factor to convert the value obtained in a given laboratory to a value of the International Scale (IS), where 100% is the value for a specific cohort of untreated patients studied in 2002, based on 30 newly diagnosed patients with CML in the chronic phase, tested in three laboratories.183 Patients who achieve a transcript number of 0.1% on the IS, which is equivalent to a 3-log reduction from the baseline for untreated patients, are said to have achieved a MR3, and those without detectable transcripts have achieved a MR4.5, as discussed in the section on treatment (Table 3).184 Despite the many efforts towards harmonization of molecular methods, widespread inconsistency remains.185 It is likely that some of the intrinsic difficulties related to the complex time consuming methodology which requires specialized skills and knowledge may be overcome by the new automated BCR-ABL1 assay that is contained within a single-use microfluidic cartridge, using a specialized instrument, such as the Cepheid GeneXpert.186 It is of interest that this specialized equipment was initially developed for bioterrorism assays following the anthrax 552

attacks in the USA soon after the September 11 attacks in 2001. In this system, RNA extraction and real-time PCR is prepared. This system incorporates conversion to the BCR-ABL1 international reporting scale and has the same sensitivity as usual quantitative methods. This system is especially attractive for hospitals where only sporadic CML cases are treated.

Further improvements include the introduction of digital PCR; in particular with regards to the assessment of the impact of deep molecular response, which is increasingly recognized as an effective clinical strategy to allow for discontinuing TKI therapy safely in some patients, even in the presence of minimal residual disease.187 This is a conceptual approach where a sample is partitioned into thousands of separate reactions. This partitioning can be performed either by sorting into different reaction wells by pumps and valves (Fluidigm), or by diluting the sample into separate micelles (BioRad). Either method seems to increase sensitivity by over a log compared to conventional RQ-PCR. This powerful digital tool appears to be particularly attractive to help improve efforts to discontinue TKI therapy safely in candidate patients who have been in MR4, MR4.5 or MR5. It is likely that further improvements will be made by the application of the next generation DNA sequencing approaches.188 Conversely, many efforts are addressing suitable methodology and technology for wider and, importantly, more affordable use of RQ-PCR.189 Another important test in molecular monitoring of CML patients is BCR-ABL1 kinase domain mutation analysis in those who have acquired TKI resistance and who might require an alternative treatment, or those who progress to advanced phase disease. This test also helps to determine the clinical consequences of clonal diversity of BCR-ABL1 and the co-existence of subclones. Next generation sequencing (NGS) techniques appear to be superior to the current Sanger sequencing, in particular for the identification of compound mutations, which might be more frequent in acquired resistance to 2nd- and 3rd-generation TKIs.190 Compound mutations are two or more mutations in the same BCR-ABL1 allele, and not multiple clones with different mutations. It is of interest that while over 100 different point mutations have now been described, only 12 positions appear to be involved in compound mutations, many of which include the T315I mutation. New technologies incorporating computer modeling help us understand how the leukemic cells develop clever tactics haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

to evade selective pressures of the more potent TKIs, in particular ponatinib, and result in structural changes which limit or exclude TKI binding.132,133

Expert panel definition of response and failure to respond to TKI treatment The recommendations of an expert panel of hematologists convened under the aegis of the European LeukemiaNet (ELN) up-dated a series of recommendations in 2013, designed to help the clinician in optimal management of CML and to benefit from the 15 years of experience with TKI treatment in patients with CML (Table 4).191

The panel had been providing such recommendations since 2005 when the original consensus report was collated. They recommended as initial treatment with imatinib, nilotinib or dasatinib, with response being assessed by RQ-PCR and/or conventional cytogenetics at three, six and 12 months. Optimal response was defined as BCRABL1 transcript levels of less than 10% at three months, less than 1% at six months, and less than 0.1% from 12 months onwards, whereas more than 10% at six months and more than 1% from 12 months onward define failure and required alternative treatment. Interestingly, the panel also considered a partial cytogenetic response (PCyR) at

Table 4. European LeukemiaNet 2013 Guidelines: response to first-line treatment with imatinib, nilotinib or dasatinib.

Optimal

Warning

Failure

Baseline

NA

NA

3 months

- BCR-ABL ≤ 10% and/or - Ph+ ≤ 35%

- HIGH RISK, - CCA/Ph+ (major route) - BCR-ABL >10% and/or - Ph + 36%-95% - BCR-ABL 1-10% and/or Ph + 1%-35%

6 months

12 months

- BCR-ABL < 1% and/or - Ph+ 0 - BCR-ABL ≤ 0.1%

Then, and at any time

- BCR-ABL ≤ 0.1%

- BCR-ABL 0.1%-1 %

- BCR-ABL 0.1%-1%

- No CHR and/or - Ph + > 95% - BCR-ABL > 10% and/or - Ph + > 35% - BCR-ABL > 1% and/or - Ph + > 0% - Loss of CHR, loss of CCYR, confirmed loss of MMR, mutations and CCA/Ph+

NA: not applicable.

Figure 10. Targeting chronic myeloid leukemia cells at different levels.

haematologica | 2016; 101(5)

553

T.I. Mughal et al.

three months and a CCyR from six months onwards as comprising optimal response, whereas no cytogenetic response at three months, less than PCyR at six months, and less than CCyR from 12 months onward define failure. This reflects the opinions of several other CML experts, highlighting the notion of a CCyR, rather than a deep molecular response, being associated with survival.5,192 The panel felt that despite the notion of an early molecular response being a clear predictor of outcome and impending risk, a change of therapy was not mandatory since current studies do not suggest that a change of therapy at three months changes the outcome. In tandem, some experts consider that halving BCR-ABL1 transcripts within 76 days together with the achievement of a BCRABL1 less than 10% by six months, in addition to a CCyR at one year and beyond, may be reasonable milestones for change of therapy.193-196

Future prospects and conclusions The CML success story has unfolded over a relatively short period of time and the efforts of Janet Rowley and John Goldman have been crucial to our understanding of the biology of what is now considered a genetically simple cancer. Their work has provided vital insights that have resulted in the success of molecularly targeted therapy, not only for CML patients, but also for other malignancies.197 Two decades since Brian Druker’s initial studies with imatinib, a personalized treatment algorithm is available for the newly diagnosed patient with CML. Treatment involves a choice of three first-line orally administered drugs and two effective next-line therapies that should be used based on risk stratification, co-morbidities, the side-effects profile and the BCR-ABL1 genotype. Furthermore, drug access and the cost of TKI therapy are significant issues on the agenda of world-wide healthcare, given the increased prevalence of CML across the globe.165,198 Currently, there is little difference in the pricing structure of the licensed first-line drugs, but this should change dramatically now that generic imatinib becomes available as the patent for Gleevec (imatinib mesylate) expired in the US in 2015 and in Europe expires in 2016. Regardless of the initial choice of TKI, the vast majority of patients achieve a durable CCyR, with a lifes-

References 1. Ben-Neriah Y, Daley GQ, Mes-Masson AM, et al. The chronic myelogenous leukemiaspecific P210 protein is the product of the bcr/abl hybrid gene. Science. 1986;233 (4760):212-214.

2. Goldman JM. Melo JV. Targeting the BCRABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 2001;344(14):10841086.

3. Druker BJ, Tamura S, Buchdunger E, et al.

Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2(5):561-566.

4. Druker BJ, Guilhot F, O’Brien SG, et al. Fiveyear Follow-up of Patients Receiving Imatinib for Chronic Myeloid Leukemia. N Engl J Med. 2006;355(23):2408-2417.

5. Kantarjian H, Cortes JE. Complete cytoge-

554

6.

7.

8.

9.

pan approaching that of the general population. In most instances the medication must be continued indefinitely, and a principal challenge now is to develop strategies to stop TKIs safely and effectively. For the moment, it is probably best to discontinue the TKI therapy only within the framework of a clinical trial.

It seems crucial to improve our understanding of the various resistance mechanisms, in particular the emerging role of the bone marrow microenvironment and stem cell niche, and to assess the importance of the persistence of BCRABL1 by PCR, even in patients who have confirmed MR4.5 and beyond.199 Challenges also remain in the optimal monitoring of patients with CML on treatment, in particular with regard to the interlaboratory discrepancy in results, and indeed, harmonizing results to the international standard. The monitoring technology would also benefit from being further simplified, and importantly, by being more affordable. Last, but not least, the ELN 2013 recommendations should be up-dated to harmonize expert opinions. A recent French report expressed some concern in not being able to validate the current recommendations with regards to identifying optimal response, though treatment failure was confirmed for a cohort of 180 patients being treated with imatinib.200 Our understanding of the mechanisms and treatment of patients with advanced phase disease remains limited. In addition, questions remain with regard to the initiating biological event, at least in some patients with CML in chronic phase.201 Clearly, the CML story is richly studded with insight, innovation and scientific breakthroughs.

Arguably, however, there is much work to be done in order to pay tribute to, and to continue the story that was initiated by Janet Rowley and John Goldman.

Acknowledgments The authors wish to thank Alpine Oncology Foundation, in particular Dr. Alpa Parmar, for organizing the Janet Rowley and John Goldman Special Colloquium during the 19th EHA Meeting and Novartis Oncology Global for their support. TIM wishes to thank Professor Bob Lowenberg for his mentorship and help in arranging this event, Professor Christine Chomienne (President of EHA-2014) for her opening address and the International CML Foundation. JFA acknowledges the support of NIHR Biomedical Research Centre funding

netic response, not deep molecular response, is associated with survival in chronic myeloid leukemia. J Clin Oncol. 2014;32 (27):3077.

Huang XL, Cortes J, Kantarjian H. Estimations of the increasing prevalence and plateau prevalence of chronic myeloid leukemia in the era of tyrosine kinase inhibitor therapy. Cancer. 2012;118(12): 3123-3127.

Mughal TI, Cortes J, Cross NCP, et al.

Chronic myeloid leukemia – some topical issues. Leukemia. 2007;21(7):1347-1352.

Falchi L, Kantarjian HM, Wang X, et al.

Significance of deeper molecular responses in patients with chronic myeloid leukemia in early chronic phase treated with tyrosine kinase inhibitors. Am J Hematol. 2013;88 (12):1024-1029.

Mughal TI, Goldman JM. An essay in cancer medicine: Lessons learned from patients

10.

11.

12.

13.

14.

15.

with chronic myeloid leukaemia. Clin Med. 2005;1:2-7.

Cheah CY, Burbury K, Apperley JF, et al.

Patients with myeloid malignancies bearing PDGFRB fusion genes achieve durable longterm remissions with imatinib. Blood.

2014;123(23):3574-3577.

Velpeau A. [Sur la resorption du puseat sur l’alteration du sang dans les maladies Clinique de persection nenemant.] Premier observation. Rev Med. 1827;2:216.

Bennett JH. Case of hypertrophy of the spleen and liver in which death took place from suppuration of the blood. Edinb Med Surg J. 1845;64:413-423.

Virchow R. [Weisses Blut]. Froriep’s Notzien 1845;36:151-156.

Tjio JH, Levan A. The chromosome number of man. Hereditas. 1956;42:1-6.

Lejeune J, Turpin R, Gautier M. [Chromosomic diagnosis of mongolism].

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

Archives Francaises de Pediatrie. 1959;16: 962-963.

Nowell PC, Hungerford DA. A minute chromosome in human granulocytic leukemia.

Science. 1960;132:1497.

Baikie AG, Court-Brown WM, Buckton KE, Harnden DG, Jacobs PA, Tough IM. A possible specific chromosome abnormality in human chronic myeloid leukaemia. Nature.

1960;188:1165-1166.

Boveri T. [Frage der Entstehung maligner Tumoren.] Jena: Gustav Fischer;1914.

Fialkow PJ, Garler SM, Yoshida A. Clonal origin of chronic myelocytic leukemia in man. Proc Natl Acad Sci USA. 1967;58(4): 1468-1471.

Ohno S, Makino S. The single X-nature of sex chromatin in man. Lancet. 1961;1 (7168):78-79.

Rowley JD. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature.

1973;243(5405):290-293.

Abelson HT, Rabstein LS. Lymphosarcoma: virus-induced thymic-independent disease in mice. Cancer Res. 1970;30(8):2213-2222.

Groffen J, Stephenson JR, Heisterkamp N, de Klein A, Bartram CR, Grosveld G. Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell. 1984;36(1):93-99.

Heisterkamp N, Groffen J, Stephenson JR, et al. Chromosomal localization of human cellular homologues of two viral oncogenes.

Nature. 1982;299(5885):747-749. de Klein A, van Kessel AG, Grosveld G, et al.

A cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukaemia. Nature. 1982;300(5894): 765-767.

Bartram CR, de Klein A, Hagemeijer A, et al.

Translocation of c-abl oncogene correlates with the presence of a Philadelphia chromosome in chronic myelocytic leukaemia.

Nature. 1983;306(5940):277-280.

Stam K, Heisterkamp N, Grosveld G, et al.

Evidence of a new chimeric bcr/c-abl mRNA in patients with chronic myelocytic leukemia and the Philadelphia chromosome.

N Engl J Med. 1985;313(23):1429-1433.

Shtivelman E, Lifshitz B, Gale RP, et al.

Alternative splicing of RNAs transcribed from the human abl gene and from the bcrabl fused gene. Cell. 1986;47(2):277-284.

Witte ON, Dasgupta A, Baltimore D. Abelson murine leukaemia virus rotein is phosphorylated in vitro to form phosphotyrosine. Nature. 1980;283(5750):826-831.

Prywes R, Foulkes JG, Baltimore D. The minimum transforming region of v-abl is the segment encoding protein-tyrosine kinase. J Virol. 1985;54(1):114-122.

Konopka JB, Watanabe SM, Witte ON. An alteration of the human c-abl protein in K562 leukemia cells unmasks associated tyrosine kinase activity. Cell. 1984;37(3): 1035-1042.

Daley GQ, Baltimore D. Transformation of an interleukin 3-dependent hematopoetic cell line by chronic myelogenous leukemiaspecific P210 bcr/abl protein. Proc Natl Acad Science. 1988;85(23):9312-9316.

Lugo TG, Pendergast AM, Muller AJ, et al.

Tyrosine kinase activity and transformation potency of bcr-abl oncogene products.

Science. 1990;247(4946):1079-1082.

Daley GQ, van Etten, Baltimore D. Induction of chronic myelogenous leukemia in mice by P210 BCR/ABL gene of the Philadelphia chromosome. Science. 1990;

haematologica | 2016; 101(5)

247(4944):824-830.

35. Elephanty AG, Hariharan IK, Cory S. Bcrabl, the hallmark of chronic myeloid leukeima in man, induces multiple hemopoietic neoplasms in mice. EMBO J. 1990;9(4):1069-1078.

36. Kelliher MA, McLaughlin J, Witte ON, Rosenberg N. Induction of a Chrnic myeloid leukemia-like Syndrome in Mice with v-abl and BCR/ABL. Proc Natl Acad Sci USA. 1990;87(17):6649-6653.

37. Anafi M, Gazit A, Gilon C, et al. Selective interactions of transforming and normal abl proteins with ATP, tyrosine-copolymer substrates, and tyrphostins. J Biol Chem.

1992;267(7):4518-4523.

38. Sawyers CL, Callahan W, Witte ON. Dominant negative MYC blocks transformation by ABL oncogenes. Cell. 1992; 70(6):901-910.

39. Pendergast AM, Quilliam LA, Cripe LD, et al. BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adaptor protein. Cell.

1993;75(1):175-185.

40. Neshat MS, Raitano AB, Wang HG, et al.

The survival function of the Bcr-Abl oncogene is mediated by Bad- dependent and independent pathways: roles for phosphatidylinositol 3- kinase and Raf. Mol Cell Biol. 2000;20(4):1179-1186.

41. Sillaber C, Gesbert F, Frank DA, et al. STAT5 activation contributes to growth and viability in Bcr/Abl- transformed cells. Blood.

2000;95(6):2118-2125.

42. Salgia R, Sattler M, Pisick E, et al. p210BCR/ABL induces formation of complexes containing focal adhesion proteins and the protooncogene product p120c-Cbl. Exp Hematol. 1996;24(2):310-313.

43. Sattler M, Mohi MG, Pride YB, et al. Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell. 2002;1(5):479-492.

44. Zhao C, Blum J, Chen A, et al. Loss of betacatenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell.

2007;12(6):528-541.

45. Dierks C, Beigi R, Guo GR, et al. Expansion of Bcr-Abl-positive leukemic stem cells is dependent on Hedgehog pathway activation. Cancer Cell. 2008;14(3):238-249.

46. Neviani P, Harb JG, Oaks JJ, et al. PP2A-activating drugs selectively eradicate TKI-resistant chronic myeloid leukemic stem cells. J Clin Invest. 2013;123(10):4144-4157.

47. Hurtz C, Hatzi K, Cerchietti L, et al. BCL6mediated repression of p53 is critical for leukemia stem cell survival in chronic myeloid leukemia. J Exp Med. 2011;208 (11):2163-2174.

48. Chen Y, Hu Y, Zhang H, et al. Loss of the Alox5 gene impairs leukemia stem cells and prevents chronic myeloid leukemia. Nat Genet. 2009;41(7):783-792.

49. O'Hare T, Zabriskie MS, Eiring AM, et al.

Pushing the limits of targeted therapy in chronic myeloid leukaemia. Nat Rev Cancer.

2012;12(8):513-526.

50. Corbin AS, Agarwal A, Loriaux M, et al.

Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity. J Clin Invest.

2011;121(1):396-409.

51. Mughal T, Goldman J. Chronic myeloid leukemia: a historical perspective. In: Mughal T, Goldman J, (eds.) Chronic Myeloproliferative Disorders. Paul Street, London: Informa Healthcare 2008: pp1-16.

52. Dalton DAG. Myelran in chronic myeloid leukaemia. Lancet. 1953;1:208.

53. Kennedy BJ, Yarbo JW. Metabolic and thera-

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

peutic effects of hydroxyurea in chronic myelogenous leukemia. Trans Assoc Am Physicians. 1965;78:391-399.

Hehlmann R, Heimpel H, Hasford J, et al.

Randomized comparison of busulfan and hydroxyurea in chronic myelogenous leukemia: prolongation of survival by hydroxyurea. The German CML Study Group. Blood. 1993;82(2):398-407.

Talpaz M, Kantarjian H, McCredie K, et al.

Hematologic remission and cytogenetic improvement induced by recombinant human interferon alpha A in chronic myelogenous leukemia. N Engl J Med. 1986;314 (17):1065-1069.

Hehlmann R, Heimpel H, Hasford J, et al; on behalf of the German CML Study Group.

Randomized comparison of interferon-alpha with busulphan and hydroxyurea in chronic myelogenous leukemia.

Blood.

1994;84(12):4064-4077.

The Italian Cooperative Study Group on Chronic Myeloid Leukemia. Interferon alfa2a as compared with conventional chemotherapy for the treatment of chronic myeloid leukemia. N Engl J Med. 1994; 330(12):820-825.

Allan NC, Richards SM, Shepherd PC. UK Medical Research Council randimised, multicentre trial of interferon-alpha n1 for chronic myeloid leukaemia: improved survival irrespective of cytogenetic response.

The UK Medical Research Council’s Working Parties for Therapeutic Trials in Adult Leukaemia. Lancet. 1995;345(8962): 1392-1397.

Guilhot F, Chastang C, Michallet M, et al; on behalf of the French Chronic Myeloid Leukemia Study Group. Interferon alfa-2b combined with cytarabine versus interferon alone in chronic myelogenous leukemia. N Engl J Med. 1997;337(4):223-329.

Silver RT, Woolf SH, Hehlmann R, et al. An evidence-based analysis of the effect of busulfan, hydoxyurea, interferon, and allogeneic bone marrow transplantation in treating the chronic phase of chronic myeloid leukemia: developed for the American Society of Hematology.

Blood.

1999;94(5):1517-1536.

Druker BJ, Talpaz M, Resta DJ, et al. Efficacy and safety of a specific inhibitor of the BCRABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 2001;344(14):10311037.

Mughal TI, Goldman JM. Chronic myeloid leukaemia: A therapeutic challenge. Ann Oncol. 1995;6(7):637-644.

Mughal TI, Goldman JM. Chronic Myeloid leukemia: Current Status and Controversies.

Oncology (Williston Park). 2004;18(7):837847.

Sokal JE, Cox EB, Baccarani M, et al.

Prognostic discrimination in “good-risk” chronic granulocytic leukemia. Blood.

1984;63(4):789-799.

Hasford J, Pfirrmann M, Hehlmann R, et al.

A new prognostic score for survival of patients with chronic myeloid leukaemia treated with interferon alpha. J Natl Cancer Inst. 1998;90(11):850-858.

Hoffman VS, Baccarani M, Lindoerfer D, et al. The EUTOS prognostic score: review and validation in 1288 patients with CML treated frontline with imatinib. Leukemia.

2013;27(10):2016-2022.

Mughal TI, Barbui T, Abdel-Wahab O, et al.

Novel insights into the biology and treatment of chronic myeloproliferative neoplasms. Leuk Lymphoma. 2015;56(7):19381948.

555

T.I. Mughal et al.

68. Druker BJ, Lydon NB. Lessons learned from the development of an abl tyrosine kinase inhibitor for chronic myelogenous leukemia.

J Clin Invest. 2000;105(1):3-7.

69. Deininger MW, Buchdunger E, Druker BJ. The development of imatinib as a therapeutic agent for chronic myeloid leukemia.

Blood. 2005;105(7):2640-2653.

70. Kantarjian H, Sawyers C, Hochhaus A, et al.

Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia. N Engl J Med. 2002;346(9):645652.

71. Hochhaus A, Druker B, Sawyers C, et al.

Favorable long-term follow-up results over 6 years for response, survival, and safety with imatinib mesylate therapy in chronic-phase chronic myeloid leukemia after failure of interferon-alpha treatment.

Blood.

2008;111(3):1039-1043.

72. Deininger MW, O’Brien SG, Guilhot F, et al.

International Randomized Study of Interferon vs STI571 (IRIS) 8 years Followup: Sustained Survival and Low Risk for Progression or Events in Patients with Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase Treated with Imatinib. ASH Annual Meeting Abstracts 2009;114:1126-.

73. Baccarani M, Soverini S. Molecular Response in CML: Where is the bar? Blood.

2014;124(4):469-471.

74. Mughal TI, Vannucchi AM, Soverini S, et al.

Preclinical and clinical issues in chronic myeloproliferative neoplasms.

Haematologica. 2014;99(5):797-801.

75. Kantarjian H, O’Brien S, Jabbour E, et al.

Improved survival in chronic myeloid leukemia since the introduction of imatinib: a single-institution historical experience.

Blood. 2012;119(9):1981-1987.

76. Kantarjian H, Talpaz M, O’Brien S, et al.

High-dose imatinib mesylate therapy in newly diagnosed Philadelphia chromosomepositive chronic phase chronic myeloid leukemia. Blood. 2004;103(8):2873-2878.

77. Cortes JE, Kantarjian HM, Goldberg SL, et al.

High-dose imatinib in newly diagnosed chronic-phase chronic myeloid leukemia: high rates of rapid cytogenetic and molecular responses. J Clin Oncol. 2009;27(28): 4754-4759.

78. Cortes JE, Baccarani M, Guilhot F, et al.

Phase III, randomized. Open-label study of daily imatinib mesylate 400mg versus 800mg in patients with newly diagnosed, previously untreated chronic myeloid leukemia in chronic phase using molecular end points: tyrosine kinase inhibitor optimization and selectivity study. J Clin Oncol.

2010;28(3):424-430.

79. Hehlmann R, Muller MC, Lauseker M, et al.

Deep Molecular Response Is Reached by the Majority of Patients Treated With Imatinib, Predicts Survival, and Is Achieved More Quickly by Optimized High-Dose Imatinib: Results From the Randomized CML-Study IV. J Clin Oncol. 2014;32(5):415-423.

80. Proetel U, Pletsch N, Lauseker M, et al.

Older patients with chronic myeloid leukemia (>65 years) profit more from higher imatinib doses than younger patients: a subanalysis of the randomized CML-Study IV. Ann Hematol. 2014;93(7):1167-1176.

81. Deininger MW, Kopecky KJ, Radich JP, et al.

Imatinib 800mg daily induces deeper molecular responses than imatinib 400mg daily: results of SWOG S0325, an intergroup randomized PHASE II trial in newly diagnosed chronic phase chronic myeloid leukaemia.

Br J Haematol. 2014;164(2):223-232.

556

82. Preudhomme C, Guilhot J, Nicolini FE, et al.

Imatinib plus peginterferon alfa-2a in chronic myeloid leukemia. N Engl J Med. 2010;363(26):2511-2521.

83. Gambacorti-Passerini C, Antolini L, Mahon FX, et al. Multicenter independent assessment of outcomes in chronic myeloid leukemia patients treated with imatinib. J Nat Cancer Inst. 2011;103(7):553-561.

84. Mughal TI, Schreiber A. Long term toxicity of imatinib when used as a first-line therapy in chronic myeloid leukemia. Biologics.

2010;4:315-323.

85. Efficace F, Baccarani M, Breccia M, et al.

Chronic fatigue is the most important factor limiting health-related quality of life of chronic myeloid leukemia patients treated with imatinib. Leukemia. 2013;27(7):15111519.

86. Gambacorti-Passerini C, Tornaghi L, Cavagnini F, et al. Gynaecomastia in men with chronic myeloid leukaemia after imatinib. Lancet. 2003;361(9373):1954-1956.

87. Verma D, Kantarjian H, Strom SS, et al.

Malignancies occurring during therapy with tyrosine kinase inhibitors (TKIs) for chronic myeloid leukemia (CML) and other hematologic malignancies. Blood. 2011;118(16): 4353-4358.

88. de Lavallade H, Apperley JF, Khorashad JS, et al. Imatinib for newly diagnosed patients with chronic myeloid leukemia: incidence of sustained responses in an intention-to-treat analysis. J Clin Oncol. 2008;26(20):33583363.

89. Lucas CM, Wang L, Austin GM, et al. A population study of imatinib in chronic myeloid leukemia demonstrates lower efficacy than in clinical trials. Leukemia. 2008;22(10): 1963-1966.

90. Apperley JF. Chronic myeloid leukaemia.

Lancet. 2015;385(9976):1447-1459.

91. Gorre ME, Mohammed M, Ellwood K, et al.

Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science. 2001;293(5531):876680.

92. Apperley JF. Part I: mechanisms of resistance to imatinib in chronic myeloid leukemia.

Lancet Oncol. 2007;8(11):1018-1029.

93. Khorashad JS, de Lavallade H, Apperley JF, et al. Finding of kinase domain mutations in patients with chronic phase chronic myeloid leukemia responding to imatinib may identify those at risk of disease progression. J Clin Oncol. 2008;26(29):4806-4813.

94. Soverini S, Branford S, Nicolini FE, et al.

Implications of BCR-ABL1 kinase domainmediated resistance in chronic myeloid leukemia. Leuk Res. 2014;38(1):10-20.

95. Eiring AM, Deininger MW. Individualizing kinase-targeted cancer therapy: the paradigm of chronic myeloid leukemia. Genome Biol. 2014;15(9):461.

96. Watkins DB, Hughes TP, White DL. OCT1 and imatinib transport in CML: is it clinically relevant? Leukemia. 2015;29(10):1960-1969.

97. Goldman JM. How I treat chronic myeloid leukemia in the imatinib era. Blood.

2007;110(8):2828-2837.

98. Weisberg E, Manley PW, Breitenstein W, et al. Characterization of AMN107, a selective inhibitor of native and mutant Bcr-Abl. Cancer Cell. 2005;7(2):129-141.

99. Bradeen HA, Eide CA, O’Hare T, et al.

Comparison of imatinib mesylate, dasatinib (BM-354825) and nilotinib (AMN107) in an N-ethyl-N-nitrosourea (ENU)-based mutagenesis screen: high efficacy of drug combinations. Blood. 2006;108(7):2332-2338.

100. Tokarski JS, Newitt JA, Chang CYJ, et al.

The structure of dasatinib (BMS-354825) bound to activated ABL kinase domain elucidates its inhibitory activity against imatinib-resitant ABL mutants. Cancer Res. 2006;66(11):5790-5797.

101. Schittenhelm MM, Shiraga S, Schroeder A, et al. Dasatinib (BMS-354825), a dual SRC/ABL kinase inhibitor inhibits the kinase activity of wild-type, juxtamembrane, and activation loop mutant KIT isoforms associated with human malignancies. Cancer Res. 2006;66(1):473-481.

102. Milojkovic D, Apperley JF, Gerrad G, et al.

Responses to second-line tyrosine kinase inhibitors are durable: an intention-to-treat analysis in chronic myeloid leukemia patients. Blood. 2012;119(8):1838-1843.

103. Kantarjian H, Giles F, Wunderle L, et al.

Nilotinib in imatinib-resistant CML and Philadelphia chromosome-positive ALL. N Engl J Med. 2006;354(24):2542-2551.

104. Giles FJ, le Coutre PD, Pinilla-Ibarz J, et al.

Nilotinib in imatinib-resistant or imatinibintolerant patients with chronic myeloid leukemia in chronic phase: 48-month follow-up results of a phase II study. Leukemia.

2013;27(1):107-112.

105. Talpaz M, Shah NP, Kantarjian H, et al.

Dasatinib in imatinib-resistant Philadelphia chromosome-positive leukemias. N Engl J Med. 2006;354(24):2531-2541.

106. Hochhaus A, Baccarani M, Deininger M, et al. Dasatinib induces durable cytogenetic responses in patients with chronic myelogenous leukemia in chronic phase with resistance or intolerance to imatinib. Leukemia.

2008;22(6):1200-1206.

107. Shah NP, Kantarjian HM, Kim DW, et al.

Intermittent target inhibition with dasatinib with dasatinib 100mg once daily preserves efficacy and improves toerability in imatinib-resistant and – intolerant chronic-phase chronic myeloid leukemia. J Clin Oncol.

2008;26(19):3204-3212.

108. Shah NP, Guilhot F, Cortres JE, et al. Longterm outcome with dasatinib after imatinib failure in chronic-phase chronic myeloid leukemia: follow-up of a phase 3 study.

Blood. 2014;123(15):2317-2324.

109. Brümmendorf TH, Shah NP, Cortes JE, et al.

Long-term efficacy and safety of dasatinib 100mg once daily (QD) in patients with imatinib resistant/intolerant chronic-phase chronic myeloid leukemia (CML-CP): 5-year folow-up from CA180-034. Onkologie.

2011;34:263.

110. Müller MC, Cortes JE, Kim DW, et al.

Dasatinib treatment of chronic-phase chronic myeloid leukemia: analysis of responses according to preexisting BCR-ABL mutations. Blood. 2009;114(24):4944-4953.

111. Le Coutre P, Rea D, Abruzzese E, et al.

Severe peripheral arterial disease during nilotinib therapy. J Natl Cancer Inst.

2011;103(17):1347-1348.

112. Assouline S, Laneuville P, GambacortiPasserini C. Panniculitis during dasatinib therapy for imatinib-resistant chronic myelogenous leukemia. N Engl J Med. 2006;354 (24):2623-2624.

113. Saglio G, Kim DW, Issaragrisil S, et al.

Nilotinib versus imatinib for newly diagnosed chronic mye;loid leukemia. N Engl J Med. 2010;362(24):2251-2259.

114. Kantarjian H, Shah NP, Hochhaus A, et al.

Dasatinib versus imatinib in newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med. 2010;362(24):22602270.

115. Larson RA, Hochhaus A, Clark RE, et al.

Nilotinib vs imatinib in patients with newly

haematologica | 2016; 101(5)

Chronic myeloid leukemia: reminiscences and dreams diagnosed Philadelphia chromosome-positive chronic myeloid leukemia in chronic phase: ENESTnd 3-year follow-up.

Leukemia. 2012;26(10):2197-2203.

116. Jabbour E, Kantarjian HM, Saglio G, et al.

Early response with dasatinib or imatinib in chronic myeloid leukemia: 3-year follow-up from a randomized phase 3 trial (DASISION). Blood. 2014;123(4):494-500.

117. Tefferi A. Nilotinib treatment-associated accelerated atherosclerosis: when is the risk justified? Leukemia. 2013;27(9):1939-1940.

118. Giles FJ, Mauro MJ, Hong F, et al. Rates of peripheral arterial occlusive disease in patients with chronic myeloid leukemia in the chronic phase treated with imatinib, nilotinib, or non-tyrosine kinase therapy: a retrospective cohort analysis. Leukemia.

2013;27(6):1310-1315.

119. Montani D, Bergot E, Gunther S, et al.

Pulmonary arterial hypertension in patients treated with dasatinib. Circulation.

2012;125(17):2128-2137.

120. Radich JP, Kopecky KJ, Appelbaum FR, et al.

A randomized trial of dasatinib 100mg versus imatinib 400mg in newly diagnosed chronic-phase chronic myeloid leukemia.

Blood. 2012;120(19):3898-3905.

121. Hughes TP, Saglio G, Kantarjian HM, et al.

Early molecular response predicts outcomes in patients with chronic myeloid leukemia in chronic phase treated with frontline nilotinib or imatinib. Blood. 2014;123(9):494500.

122. Hughes TP, Lipton JH, Spector N, et al. Deep molecular responses achieved in patients with CML-CP who are switched to nilotinib after long-term imatinib.

Blood.

2014;124(5):729-736.

123. Remsing LL, Rix U, Colinge J, et al. Global target profile of the kinase inhibitor bosutinib in primary chronic myeloid cells.

Leukemia. 2009;23(3):477-480.

124. Cortes JE, Kantarjian HM, Brummendorf TH, et al. Safety and efficacy of bosutinib (SKI-606) in chronic phase Philadelphia chromosome-positive chronic myeloid leukemia patients with resistance or intolerance to imatinib. Blood. 2011;118(17):45674576.

125. Kantarjian HM, Cortes JE, Kim DW, et al.

Bosutinib safety and management of toxicity in leukemia patients with resistance or intolerance to imatinib and other tyrosine kinase inhibitors. Blood. 2014;123(9):13091318.

126. Gambacorti-Passerini C, Brummendorf TH, Kim DW, et al. Bosutinib efficacy and safety in chronic phase chronic myeloid leukemia after imatinib resistance or intolerance: minimum 24-month follow-up. Am J Hematol.

2014;89(7):732-742.

127. Lipton JH, Cortes JE, Khoury HJ, et al. Longterm bosutinib in patients with chronic phase chronic myeloid leukemia after prior imatiniib failure. J Clin Oncol. 2015;33(15): 7076.

128. Brümmendorf TH, Cortes JE, de Souza CA, et al. Bosutinib versus imatinib in newly diagnsoed chronic-phase chronic myeloid leukaemia: results from the 24-month follow-up of the BELA trial. Br J Haemtol.

2015;168(1):69-81.

129. O’Hare T, Shakespeare WC, Zhu X, et al.

AP24534, a pan-BCR-ABL inhibitor for chronic myeloid leukemia, potentially inhibits the T315I mutant and overcomemutation-based resistance. Cancer Cell. 2009; 16(5):401-412.

130. Goldman JM. Ponatinib for Chronic Myeloid Leukemia. N Engl J Med 2012;

haematologica | 2016; 101(5)

367(22):2148-2149.

131. Lierman E, Smits S, Cools J, et al. Ponatinib is active against imatinib-resistant mutants of FIP1L1-PDGFRA and KIT, and against FGFR1-derived fusion kinases. Leukemia.

2012;26(7):1693-1695.

132. Zabriskie M, Eide CA, Tantravahisk, et al.

BCR-ABL1 compound mutations combining key kinase domain positions confer clinical resistance to ponatinib in Ph chromosomepositive leukemia. Cancer Cell. 2014;26(3): 428-442.

133. Deininger MW, Hodgson JG, Shah NP, et al.

Compound mutations in BCR-ABL1 are not major drivers of primary or secondary resistance to ponatinib in CP-CML patients.

Blood. 2015 Nov 24. [Epub ahead of print] 134. Cortes JE, Kantarjian HM, Shah NP, et al.

Ponatinib in refractory Philadelphia chromosome-positive leukemias. N Engl J Med. 2012;367(22):2075-2088.

135. Cortes JE, Kim D-W, Pinella-Ibarz J, et al. A phase 2 trial of ponatinib in Philadelphia chromosome-positive leukemias. N Engl J Med. 2013;369(19):1783-1796.

136. Neelkantan P, Marin D, Laffan M, et al.

Platelet dysfunction associated with ponatinib, a new pan BCR-ABL inhibitor with efficacy for CML resistant to multiple tyrosine kinase inhibitor therapy.

Haematologica. 2012;97(9):1444.

137. Lipton JH, Chuah C, Guerci-Bresler A, et al.

EPIC: A phase III trial of ponatinib (PON) versus imatinib (IM) in patients with newly diagnosed CR-CML. Blood. 2014;124(21): 519.

138. Gandhi V, Plunkett W, Cortes JE, et al.

Omacetaxine: A protein translation inhibitor for treatment of chronic myelogenous leukemia. Clin Cancer Res. 2014;20(7):17351740.

139. Yun SM, Jung KH, Kim SJ, et al. HS-438, a new inhibitor of imatinib-resistant BCRABL T315I mutation in chronic myeloid leukemia. Cancer Lett. 2014;348(1-2):50-60.

140. Mughal TI, Kavita R. Port-wine flavoured sandwiches and haematopoetic stem cell transplantation. Lancet Oncology. 2009;10 (9):926.

141. Appelbaum FR. Hematopoietic-cell transplantation at 50. N Engl J Med. 2007; 357(15):1472-1475.

142. Mughal T. Chronic leukemias. Classic papers in Hematologic Malignancies. Ed Thomas, Nathan, Goldman. Pub: Taylor Francis, London and New York. 2001;13944.

143. Goldman JM, Catovsky D, Galton DA. Reversal of blast-cell crisis in C.G.L. by transfusion of stored autologous buffy-coat cells. Lancet. 1978;1(8061):437-438.

144. Goldman JM, Baughan AS, McCarthy DM, et al. Marrow transplantation for patients in the chronic phase of chronic granulocytic leukaemia. Lancet. 1982;2(8299):623-625.

145. Hansen JA, Gooley TA, Martin PJ, et al. Bone marrow transplants from unrelated donors for patients with chronic myeloid leukemia.

N Engl J Med. 1998;338(14):962-968.

146. Gluckman E, Broxmeyer HA, Auerbach AD, et al. Hematopoietic reconstitution in a patient with Fanconi’s anemia by means of umbilical-cord blood from an HLA-identical sibling. N Engl J Med. 1989;321(17):11741178.

147. Goldman JM, Apperley JF, Jones L, et al.

Bone Marrow Transplantation for patients with Chronic Myeloid Leukemia. N Engl J Med. 1986;314(4):202-207.

148. Apperley JF, Jones J, Hale G, et al. Bone marrow transplantation for patients with chron-

ic myeloid leukaemia: T-cell depletion with Campath-1 reduces the incidence of graftversus-host disease but may increase the risk of leukaemic relapse. Bone Marrow Transplant. 1986;1(1):53-66.

149. Innes AJ, Milojkovic D, Apperley JF. Allogeneic transplantation for CML in the TKI era: striking the right balance. Nat Rev Clin Oncol. 2015 Nov 17 [Epub ahead of print] 150. Kolb HJ, Mittermüller J, Clemm C, et al.

Donor leukocyte transfusions for treatment of recurrent chronic myelogenous leukemia in marrow transplant patients. Blood.

1990;76(12):2462-2465.

151. McKinnon S, Papadopoulos EB, Carabasi MH, et al. Adoptive immunotherapy evalutaing escalating doses of donor leukocytes for relapse of chronic myeloid leukemia after bone marrow transplantation: separation of graft-versus-leukemia responses from graft-versus-host disease. Blood. 1995; 86(4):1261-1268.

152. Gratwohl A, Hermans J, Goldman JM, et al.

Risk assessment for patients with chronic myeloid leukemia before allogeneic blood or marrow transplantation. Lancet. 1998;352 (9134):1087-1082.

153. Crawley C, Szydlo R, Lalancette M, et al.

Outcomes of reduced-intensity transplantation for chronic myeloid leukemia: an analysis of prognostic factors from the Chronic Leukemia Working Party of the EBMT. Blood. 2005;106(9):2969-2976.

154. Mughal TI, Yong A, Szydlo R, et al. The probability of long-term leukemia free survival for patients in molecular remission 5 years after allogeneic stem cell transplantation for chronic myeloid leukemia in chronic phase. Br J Haematol. 2001;115(3):569-574.

155. Radich JP, Gooley T, Bryant E et al. The significance of bcr-abl molecular detection in chronic myeloid leukemia patients “late,” 18 months or more after transplantation. Blood.

2001;98(6):1701-1707.

156. Sauselle S, Lauseker M, Gratwohl A, et al.

Allogeneic hematopoietic stem cell transplantation (allo SCT) for chronic myeloid leukemia in the imatinib era: evaluation of its impact within a subgroup of the randomized German CML Study IV. Blood.

2010;115(10):1880-1885.

157. Oyekunle A, Zander A, Binder M, et al.

Outcome of allogeneic SCT in patients with chronic myeloid leukemia in the era of tyrosine kinase inhibitor therapy. Ann Hematol.

2013;92(4):487-496.

158. Jabbour E, Cortes JE, Santos FP, et al. Results of allogeneic hematopoietic stem cell transplantation for chronic myelogenous leukemia patients who failed tyrosine kinase inhibitors after developing BCR-ABL1 kinase domain mutations.

Blood.

2011;117(13):3641-3647.

159. Jain NA, Ito S, Tian X, et al. Clinical and biological predictors of outcome following relapse of CML post-allo-SCT. Bone Marrow Transplant. 2015;50(8):1138-1140.

160. Shimoni A, Volchek Y, Koren-Michowitz M, et al. Phase 1/2 study of nilotinib prophylaxis after allogeneic stem cell transplantation in patients with advanced chronic myeloid leukemia or Philadelphia chromosome-positive acute lymphoblastic leukemia. Cancer.

2015;121(6):863-871.

161. O’Brien S, Abboud CN, Akhtari M, et al.

Clinical Practice Guidelines in Oncology.

Chronic Myelogenous Leukemia, Version 3.

National Comprehensive Cancer Network.

[Last accessed June 2 2014].

162. Sawyers CL, Hochhaus A, Feldman E, et al.

557

T.I. Mughal et al.

Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenous leukemia in myeloid blast crisis: results of a phase II study. Blood.

2002;99(10):3530-3539.

163. Apperley JF, Cortes JE, Kim DW, et al.

Dasatinib in the treatment of chronic myeloid leukemia in accelerated phase after imatinib failure: the START-A trial. J Clin Oncol. 2009;27(21):3472-3479.

164. Bjorkholm M, Ohm L, Eloranta S, et al.

Success story of targeted therapy in chronic myeloid leukemia: a population-based study of patients diagnosed in Sweden from 1973 to 2008. J Clin Oncol. 2011;29(18):25142520.

165. Gallipoli P, Abraham SA, Holyoake TL. Hurdles Toward a Cure for CML: The CML Stem Cell. Hematol Oncol Clin North Am. 2011;25(5):951-966.

166. Copland M, Hamilton A, Elrick LJ, et al.

Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction. Blood. 2006;107(11):45324539.

167. CML Experts. The price of drugs for chronic myeloid leukemia (CML) is a reflection of the unsustainable prices of cancer drugs: from the perspective of a large group of CML experts. Blood. 2013;121(22):44394442.

168. Mahon F, Rea D, Guilhot J, et al.

Discontinuation of imatinib in patients with chronic myeloid leukemia who have maintained complete molecular remission for at least 2 years: the prospective multicentre Stop Imatinib (STIM) trial. Lancet Oncol.

2010;11(11):1029-1035.

169. Ross DM, Branford S, Seymour JF, et al.

Safety and efficacy of imatinib cessation for CML patients with stable undetectable minimal residual disease: results from the TWISTER study. Blood. 2013;122(4):515522.

170. Branford S, Yeung DT, Ross DM, et al. Early molecular response and female sex strongly predict stable undetectable BCR-ABL1, the criteria for imatinib discontinuation in patients with CML. Blood. 2013;121(19): 3818-3824.

171. Ahmed W, van Etten RA. Alternative approaches to eradicating the malignant clone in chronic myeloid leukemia: tyrosinekinase inhibitor combinations and beyond.

Hematology Am Soc Hematol Educ Program. 2013;2013:189-200.

172. Oâ&#x20AC;&#x2122;Hare T, Zabriske MS, Eiring AM, Deininger MW. Pushing the limits of targeted therapy in chronic myeloid leukemia. Nat Rev Cancer. 2012;12(8):513-526.

173. Bhatia R. Altered microenvironment regulation of CML stem cells. Leuk Supplements.

2014;S1-S2.

174. Gallipoli P, Cook A, Rhodes S, et al.

JAK2/STAT5 inhibition by nilotinib with ruxolitinib contributes to the elimination of chronic phase CML CD34+ cells in vitro and in vivo. Blood 2014;124(9):1492-1501.

175. Zhang B, Ho YW, Maeda T, et al. Altered

558

microenvironmental regulation of leukemic and normal stem cells in chronic myelogenous leukemia. Cancer Cell. 2012;21(4):577592.

176. Weisberg E, Azab AK, Manley PW, et al.

Inhibition of CXCR4 in CML cells disrupts their interaction with the bone marrow microenvironment and sensitizes them to nilotinib. Leukemia. 2012;26(5):985-990.

177. Krause DS, Scadden DT. A hostel for the hostile: the bone marrow niche in hematologic neoplasms.

Haematologica.

2015;100(11):1376-1387.

178. Kawasaki ES, Clark SS, Coyne MY, et al.

Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA. 1988;85(15):5698-5702.

179. Sawyers CL, Timpson L, Kawasaki ES, Clark SS, Witte ON, Champlin R. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction. Proc Natl Acad Sci. 1990;87(2):563-567.

180. Hughes TP, Morgan GJ, Martiat P, Goldman JM. Detection of residual leukemia after bone marrow transplant for chronic myeloid leukemia: role of polymerase chain reaction in predicting relapse. Blood. 1991;77(4):874878.

181. Cross NC, Feng L, Chase A, Bungey J, Hughes TP, Goldman JM. Competitive polymerase chain reaction to estimate the number of BCR-ABL transcripts in chronic myeloid leukemia patients after bone marrow transplantation. Blood. 1993;82(6): 1929-1936.

182. Hughes T, Deininger M, Hochhaus A, et al.

Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCRABL transcripts and kinase domain mutations and for expressing results. Blood.

2006;108(1):28-37.

183. Hughes TP, Kaeda J, Branford S, et al.

Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newly diagnosed chronic myeloid leukemia.

N Engl J Med. 2003;349(15):1423-1432.

184. Cross NCP, White HE, MĂźller MC, Saglio G, Hochhaus A. Standardized definitions of molecular response in chronic myeloid leukemia. Leukemia. 2012;26(10):2172-2175.

185. Cross NCP, White HE, Colomer D, et al.

Laboratory recommendations for scoring deep molecular responses following treatment for chronic myeloid leukemia.

Leukemia 2015;29(5):999-1003.

186. Winn-Deen ES, Helton B, Van Atta R, et al.

Development of an integrated assay for detection of Bcr-Abl RNA. Clin Chem.

2007;53(9):1593-1600.

187. Oehler VG, Wuin J, Ramakrishnan R, et al.

Absolute quantitative detection of ABL tyrosine kinase domain point mutations in chronic myeloid leukemia using a novel nanofluidic platform and mutation-specific PCR. Leukemia. 2009;23(2):396-399.

188. Ross D, Branford S. Seymour JF, et al.

Patients with chronic myeloid leukemia who maintain a complete molecular remission after stopping imatinib treatment have evidence of persistent leukemia by DNA PCR Leukemia. 2010;24(10):1719-1724.

189. LaBarre P, Hawkins KR, Gerlach J, et al. A simple, inexpensive device for nucleic acid amplification without electricity-toward instrument-free molecular diagnostics in low-resource settings. PLoS One. 2011;6(5): e19738.

190. Soverini S, Hochhaus A, Nicolini FE, et al.

BCR-ABL kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inhibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood. 2011;118(5): 1208-1215.

191. Baccarani M, Deininger MW, Rosti G, et al.

European LeukemiaNet Recommendations for the management of Chronic Myeloid Leukemia. Blood. 2013;122(6):872-884.

192. San-Miguel JF, Kantarjian HM. Improved understanding of disease biology and treatment: Multiple Myeloma and Chronic Myeloid Leukaemias in 2014. Nat Rev Clin Oncol. 2015;12(2):71-72.

193. Branford S, Yeung DT, Parker WT, et al.

Prognosis for patients with CML and >10%BCR-ABL1 after 3 months of imatinib depends on the rate of BCR-ABL1 decline.

Blood. 2014;124(4):511-518.

194. Branford S, Roberts N, Yeung DT, et al.

Any BCR-ABL reduction below 10% at 6 months of therapy significantly improves outcome for CML patients with a poor response at 3 months. Blood. 2013;122(21): (Abstract 254).

195. Kim DD, Hamad N, Lee HG, et al. BCR/ABL level at 6 months identifies good risk CML subgroup after failing early molecular response at 3 months following imatinib therapy for CML in chronic phase. Am J Hematol. 2014;89(6):626-632.

196. Neelakantan P, Gerrad C, Lucas C, et al.

Combining BCR-ABL1 transcript levels at 3 and 6 months in chronic myeloid leukemia: implications for early intervention strategies.

Blood. 2013;121(14):2739-2742.

197. The Lancet Haematology. Chronic myeloid Leukaemia: time to push for a cure? Lancet.

2015;2(5):e175.

198. Mathisen MS, Kantarjian HM, Cortes JE, Jabbour E. Practical issues surrounding the explosion of tyrosine kinase inhibitors for the management of chronic myeloid leukemia. Blood Rev. 2014;28(5):179-187.

199. Holyoake Tl, Helgason GV. Do we need more drugs for CML? Immunol Rev. 2015;263(1):106-123.

200. Etienne G, Dulucq S, Lascaux A, et al. ELN 2013 response status criteria: Relevance for de novo imatinib chronic phase chronic myelpoid leukemia patients? Am J Hematol.

2015;90(1):37-41.

201. Ross TS, Mgbemena VE. Re-evaluating the role of BCR/ABL in chronic myelogenous leukemia. Mol Cell Oncol. 2014;1(3): e963450.

haematologica | 2016; 101(5)

ARTICLE

Red Cell Biology & its Disorders

ATP11C is a major flippase in human erythrocytes and its defect causes congenital hemolytic anemia

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

Nobuto Arashiki,1 Yuichi Takakuwa,1 Narla Mohandas,2 John Hale,2 Kenichi Yoshida,3 Hiromi Ogura,4 Taiju Utsugisawa,4 Shouichi Ohga,5 Satoru Miyano,6 Seishi Ogawa,3 Seiji Kojima,7 and Hitoshi Kanno,4,8

Department of Biochemistry, School of Medicine, Tokyo Women’s Medical University, Japan; 2Red Cell Physiology Laboratory, New York Blood Center, NY, USA; 3Department of Pathology and Tumor Biology, Graduate School of Medicine, Kyoto University, Japan; 4 Department of Transfusion Medicine and Cell Processing, School of Medicine, Tokyo Women’s Medical University, Japan; 5Department of Pediatrics, Graduate School of Medicine, Yamaguchi University, Japan; 6Laboratory of DNA Information Analysis, Human Genome Center, Institute of Medical Science, The University of Tokyo, Japan; 7 Department of Pediatrics, Graduate School of Medicine, Nagoya University, Japan; and 8 Division of Genomic Medicine, Department of Advanced Biomedical Engineering and Science, Graduate School of Medicine, Tokyo Women's Medical University, Japan 1

Haematologica 2016 Volume 101(5):559-565

ABSTRACT

P

hosphatidylserine is localized exclusively to the inner leaflet of the membrane lipid bilayer of most cells, including erythrocytes. This asymmetric distribution is critical for the survival of erythrocytes in circulation since externalized phosphatidylserine is a phagocytic signal for splenic macrophages. Flippases are P-IV ATPase family proteins that actively transport phosphatidylserine from the outer to inner leaflet. It has not yet been determined which of the 14 members of this family of proteins is the flippase in human erythrocytes. Herein, we report that ATP11C encodes a major flippase in human erythrocytes, and a genetic mutation identified in a male patient caused congenital hemolytic anemia inherited as an X-linked recessive trait. Phosphatidylserine internalization in erythrocytes with the mutant ATP11C was decreased 10-fold compared to that of the control, functionally establishing that ATP11C is a major flippase in human erythrocytes. Contrary to our expectations phosphatidylserine was retained in the inner leaflet of the majority of mature erythrocytes from both controls and the patient, suggesting that phosphatidylserine cannot be externalized as long as scramblase is inactive. Phosphatidylserine-exposing cells were found only in the densest senescent cells (0.1% of total) in which scramblase was activated by increased Ca2+ concentration: the percentage of these phosphatidylserine-exposing cells was increased in the patient’s senescent cells accounting for his mild anemia. Furthermore, the finding of similar extents of phosphatidylserine exposure by exogenous Ca2+-activated scrambling in both control erythrocytes and the patient’s erythrocytes implies that suppressed scramblase activity rather than flippase activity contributes to the maintenance of phosphatidylserine in the inner leaflet of human erythrocytes.

Introduction In human erythrocytes, phosphatidylserine (PS) is present exclusively in the inner leaflet of the membrane lipid bilayer as a result of ATP-dependent active transport (flipping) of aminophospholipids (such as PS and phosphatidylethanolamine) from the outer to inner leaflet. PS interacts with spectrin, a cytoskeletal protein underneath erythrocyte membranes, to maintain membrane deformability and mechanical stability of the erythrocytes1 and protects spectrin from glycation, which haematologica | 2016; 101(5)

Correspondence: kanno.hitoshi@twmu.ac.jp

Received: January 13, 2016.

Accepted: February 26, 2016.

Pre-published: March 4, 2016. doi:10.3324/haematol.2016.142273

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/6/559

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

559

N. Arashiki et al.

decreases the membrane deformability necessary for traversing narrow capillaries and the splenic sinuses.2 More importantly, preventing surface exposure of PS is critical for erythrocyte survival: exposure of PS on the outer surface of the membrane at the end of the 120-day lifespan of erythrocytes is a phagocytic signal for splenic macrophages to remove the senescent cells.3-5 Indeed in these cells, the Ca2+ concentration is elevated to activate lipid scrambling, with consequent surface exposure of PS, which is recognized as an â&#x20AC;&#x153;eat-me signalâ&#x20AC;? by macrophages.4-7 Besides being exposed on normal senescent cells, PS is exposed prematurely by sickle erythrocytes and thalassemic erythrocytes, resulting in a shortened life span of the red blood cells and consequent hemolytic anemia in these disorders.7-10 Maintenance, regulation, and disruption of the asymmetric PS distribution are, therefore, important for both erythrocyte survival and death. While it has been well established that PS distribution is determined by flippase and scramblase activities, the molecular identities of these activities in human erythrocytes have not been defined. Furthermore, the relative contributions of these two activities in maintaining the asymmetric distribution of PS under physiological and pathological states are not well understood.

Flippases are members of the P-IV ATPase family of proteins composed of 10 transmembrane domains (Figure

1A).11,12 They contribute to localization of PS in the inner leaflet of erythrocyte membranes through ATP-dependent active transport of aminophospholipids (such as PS) from the outer to inner leaflet.13-15 However, the flippase in human erythrocytes has not yet been definitively identified. Among the 14 family members, ATP8A1, ATP8A2, ATP11A, and ATP11C were previously shown to transport PS in the plasma membrane.12,16-19 ATP11C has been implicated as one of the candidates in murine erythrocytes based on the finding that its mutation in mice resulted in anemia with stomatocytosis.20 However, there are differences between the characteristics of human and murine erythrocytes, including their life span, cell volume and cell hemoglobin content. Furthermore, recent studies have documented significant differences in gene expression during human and murine erythropoiesis.21 For example, GLUT1 which is abundantly expressed in human erythrocytes is not expressed by murine erythrocytes. As such it is important to identify the major flippase in human erythrocytes.

In the present study, we identified a point mutation in ATP11C through whole-exome sequencing of DNA from a male patient with mild hemolytic anemia without morphological abnormalities. Detailed analyses established that this mutation is responsible for hemolysis and related clinical features and that ATP11C is a major flippase in

A

B

C

560

Figure 1. Schematic representation of ATP11C, erythrocyte morphology, and genotyping for the ATP11C mutation. (A) Schematic of ATP11C and the site of a c.1253C>A missense mutation coding for Thr418Asn. (B) Phase-contrast microscopy images (Ă&#x2014;1,000; prepared from original images without any modifications) of Giemsastained blood from the healthy control and proband. No morphological abnormality was observed. (C) Wave data from direct sequencing of genomic DNA for exon 13, which includes the coding region of Thr418. The sequence of the antisense strand corresponding to the sense strand represented in (A) is displayed. Arrows indicate position of the mutations.

haematologica | 2016; 101(5)

ATP11C, a major flippase in human erythrocytes

human erythrocyte membranes. By defining the contribution of ATP11C to PS distribution when scramblase is inactive under physiologically low Ca2+ concentrations and when it is activated under elevated high Ca2+ concentrations, as in senescent cells, we established that suppressed scramblase activity rather than flippase activity contributes to the maintenance of PS in the inner leaflet of human erythrocytes.

three times with 1 mL TBS-G including 1% BSA to remove A23187 from the erythrocyte membranes. Ten microliters of the packed erythrocytes were suspended in 1 mL TBS-G including 5 mM CaCl2. Thereafter, 1 μL 0.25 mg/mL fluorescein isothiocyanate (FITC)-conjugated annexin V was added, and the fluorescence on erythrocytes quantified by FACS as described above. The cut-off for identification of PS-positive cells was set at a fluorescent signal value 20-fold higher than that detected in the absence of FITC-annexin V.

Methods Results This study was approved by the Ethics Committee for Human Genome/Gene Analysis Research of Tokyo Women’s Medical University (#223D). The healthy volunteer, the proband, and the proband’s mother provided informed consent for blood sample collection and the blood was used in all of the studies outlined.

Suppliers of all reagents and laboratory instruments, and the composition of buffer solutions are given in the Online Supplementary Information.

Whole-exome sequencing Whole-exome sequencing was performed as reported previously.22 Briefly, genomic DNA was extracted from leukocytes, and coding sequences were enriched with a SureSelect Human All Exon V4 kit and used for massively parallel sequencing with the HiSeq 2000 platform with 100-bp paired-end reads. Candidate germline variants were detected through our in-house pipeline for whole exome-sequencing analysis. Single nucleotide variants with an allele frequency >0.25 and insertion-deletions with an allele frequency >0.1 were called. Identified variants were verified by Sanger sequencing of polymerase chain reaction amplicons (details of the methods are given in the Online Supplementary Information).

Measurement of phosphatidylserine flipping activity in erythrocytes

To measure PS flipping activity, 1 μL of 1 mg/mL Fluorescent PS (NBD-PS) was added to 1 mL suspension of washed erythrocytes at a hematocrit of 5% in phosphate-buffered saline with glucose (PBS-G) and incubated for 0–20 min at 37 °C. Twenty microliters of the erythrocyte suspension were washed with 1 mL PBS-G with 1% bovine serum albumin [BSA; BSA (+)] to remove NBDPS remaining in the outer leaflet.20 To measure loaded NBD-PS after the 20-min incubation, incubated erythrocytes were washed with PBS-G in the absence of BSA [20 min BSA (-)]. NBD-derived fluorescence associated with variously treated erythrocytes was measured by fluorescence activated cell sorting (FACS). For all samples, 100,000 cells were analyzed. To determine the basal level of flippase-independent flipping activity, the cell suspension was treated with 5 mM N-ethylmaleimide (NEM) in PBS-G for 20 min at 37 °C, which irreversibly and non-specifically inactivates flippases.9

Analysis of phosphatidylserine-exposing cells PS exposed on the erythrocyte cell surface was analyzed by Ca2+-dependent binding of fluorescently labeled annexin V.1 Washed, unfractionated erythrocytes and senescent erythrocytes fractionated by density centrifugation, as we reported previously,23 were suspended in nine volumes of Tris-buffered saline with glucose (TBS-G). To control the intracellular Ca2+ concentration, erythrocytes were treated for 20 min at 37 °C with 2 μM A23187,5 a Ca2+ ionophore, in TBS-G; accurate final concentrations of free Ca2+ were determined by adding 1 mM EGTA and calculating the concentration of CaCl2 using Calcon free software (e.g., 0.958 mM for a final 1 μM). After incubation, the erythrocytes were washed haematologica | 2016; 101(5)

Clinical history and analyses of a male patient with congenital hemolytic anemia A male proband was born at full-term after a clinically normal pregnancy without any apparent anomalies. At the age of 4 years, his mother noted that the boy had pigmented urine, but medical advice was not sought until he was 13 years old, when he was diagnosed with unknown congenital hemolytic anemia (Table 1). Neither mental nor growth retardation was noted, and he began studying computer sciences at the age of 18. The marriage between his parents was not consanguineous and his parents and siblings (a sister and a brother) are healthy. Laboratory data indicated mild hemolytic anemia without any particular morphological abnormality of the erythrocytes (Table 1, Figure 1B). The leukocyte count was within the normal range, and the platelet count was slightly low. With regards to the lymphocytes, CD2-positive T-lymphocytes accounted for 84% (normal range, 72-90%) and CD20positive B-lymphocytes for 12% (normal range, 7-30%).

Extensive laboratory analyses investigating erythrocyte deformability, membrane proteins and lipids, erythrocyte enzymes, and hemoglobins failed to elucidate a cause, such as hereditary spherocytosis, erythrocyte enzyme Table 1. Clinical laboratory parameters for the proband at age 13 and 19.

9

White blood cell count (10 / L) Red blood cell count (1012/ L) Hemoglobin (g/dL) Hematocrit (%) MCV (fL) MCH (pg) MCHC (%) RDW-CV (%) Platelet count (109/ L) Reticulocytes (%) Haptoglobin (mg/dL) Total bilirubin (mg/dL) Direct bilirubin (mg/dL) Serum total protein (g/dL) Aspartate aminotransferase (IU/L) Alanine aminotransferase (IU/L) Lactate dehydrogenase (IU/L) γ-Glutamyl transpeptidase (IU/L)

Age 13

Age 19

2.3 3.80 11.8 36.4 95.8 31.1 32.4 13.2 125 1.4 10 1.8 0.8 7.7 23 13 183 10

4.0 3.76 12.3 39.3 105 32.7 31.3 12.4 149 1.7 17 1.8 0.6 7.2 16 11 138 9

MCV: mean corpuscular volume; MCH; mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration; RDW: red cell distribution width.

561

N. Arashiki et al.

deficiency, or unstable hemoglobinopathy, of the hemolysis (Online Supplementary Figure S1, Online Supplementary Table S1).

To identify the molecular etiology of the hemolytic anemia in the proband, we performed whole-exome sequencing as described previously22 and identified 349 candidate variants: 46 indels and 303 non-synonymous single nucleotide variants: none of which was previously known to be causative genes for hemolytic anemia (Online Supplementary Table S2). We focused on ATP11C since its defect has been associated with anemia in mice.20 We identified a missense mutation in ATP11C (GenBank Accession Number NM_001010986) on the X chromosome, c.1253C>A, corresponding to p.Thr418Asn. The proband is hemizygous and the mother is heterozygous for this mutation, determined by direct sequencing (Figure 1C).

Flippase activity in the patient’s erythrocytes Flipping activity was measured by monitoring PS internalization using flow cytometry. Fluorescent PS (NBDPS) was loaded exogenously onto membranes of control, the patient’s, and maternal erythrocytes in similar amounts and incubated for up to 20 min at 37 °C [Figure 2A; BSA (-)]. After the indicated times, NBD-PS remaining in the outer leaflet was extracted with 1% BSA such that the remaining cell-associated fluorescence represented PS that flipped to the inner leaflet (Figure 2). In control erythrocytes, all cells were clearly NBD-positive after 5 min, indicating that NBD-PS translocated from the outer to inner leaflet by flippase activity (Figure 2A). In contrast, the patient’s erythrocytes showed very little NBD fluorescence even after 20 min, indicating dramatically decreased flippase activity. Quantitative analyses confirmed the importance of ATP11C for PS internalization: 35% of loaded PS was transported to the inner leaflet at 20 min in normal erythrocytes, but only ~3% (10-fold decrease) was transported in the patient’s erythrocytes (Figure 2B). To confirm the contribution of ATP11C in normal cells, erythrocytes were treated with NEM, a non-specific flippase inhibitor,9 before loading NBD-PS. NEM-treated control erythrocytes showed very little PS internalization, confirming the importance of ATP11C for flipping activity (Figure 2B, Online Supplementary Figure S2). The residual flippase activity in the patient’s erythrocytes was also diminished by NEM treatment (Figure 2B).

The maternal erythrocytes comprised two populations: 55-60% showed exactly the same peak positions as the control for all incubation periods, and the other 40–45% were identical to those of the patient (Figure 2A). The former possessed normal PS transport activity, and the latter lacked flippase activity. The total internalized PS was 5560% of the control amount, reflecting the proportion of erythrocytes with normal activity (Figure 2B). The presence of two populations suggests random inactivation of the X chromosome in the erythroblast populations.

Phosphatidylserine-exposing erythrocytes in the circulation To understand the mechanisms underlying the proband’s “mild” hemolytic anemia, the percentages of PS-exposing erythrocytes in whole blood samples and cell fractions enriched for senescent cells were measured by analyzing the binding of FITC-conjugated annexin V to PS on the cell surface using flow cytometry (Figure 3).

Senescent cells were collected as the densest fraction 562

(0.1% of total cells) by density gradient centrifugation.23 There was no apparent difference in the proportion of the dense cell populations among the different blood samples studied (data not shown). The percentage of PS-positive cells among total erythrocytes was slightly higher for the patient (8.86%) than in the control (6.32%) and increased further in the patient’s senescent erythrocytes: 15.86% versus 9.17% in the control. Maternal erythrocytes had a profile similar to that of the control cells. PS-positive erythrocytes were greatly increased only in the densest senescent cells, suggesting that PS exposure did not occur until very late stages of the erythrocytes’ lifespan.

Phosphatidylserine exposure promoted by Ca2+-activated scrambling in the patient's erythrocytes In senescent erythrocytes, PS exposure on the cell surface is promoted by the Ca2+-activated scramblase, which translocates phospholipids, including PS, between the inner and outer leaflets.4-7 To examine whether ATP11C prevents Ca2+-activated PS externalization, the proportion of PS-exposing erythrocytes was measured under different Ca2+ concentrations controlled by treatment with A23187, a Ca2+ ionophore (Figure 4). With increasing Ca2+ concentrations up to 50 μM, the proportion of PS-positive cells increased. The control and patient’s erythrocytes exhibited similar annexin V binding profiles with no apparent differences in the percentages of PS-positive cells at all Ca2+ concentrations tested.

Discussion In the present study ATP11C was identified as a major flippase molecule of human erythrocyte membranes through whole-exome sequencing of a male patient with an ATP11C missense mutation on X chromosome, c.1253C>A, corresponding to p.Thr418Asn. This mutation is not recorded in SNP databases (dbSNP132 and 135) or our in-house database for Japanese patients with congenital anemia due to bone marrow failure, red cell aplasia, or hemolytic anemia. The patient’s erythrocytes showed 10-fold less flipping activity compared with control cells, clearly demonstrating that ATP11C is a major flippase in human erythrocytes. Thr418 is near Asp412, the phosphorylation site for forming the 4-aspartyl phosphate intermediate essential for active transport of PS.24 The amino acid sequence between Asp412 and Thr418 is conserved among all P-type ATPases. We, therefore, hypothesized that this mutation could disturb the functional activity of ATP11C. It should be noted that the residual flipping activity (~3%) in the patient’s red cells may arise from other flippases such as ATP8A1, ATP8A2, and ATP11A. RNAseq analyses of normal human erythroblasts generated from CD34-positive cells in an in vitro culture system21 demonstrated that mRNA of the three candidate flippase genes, ATP8A1, ATP11A, and ATP11C, were indeed expressed at all stages of human terminal erythroid differentiation (Online Supplementary Figure S3A).

Alternatively, the missense mutation may not completely abolish the enzymatic activity of ATP11C. This residual activity may contribute to PS internalization during erythropoiesis, especially in the patient’s erythrocytes.

Investigation of the molecular basis of the congenital hemolytic anemia in the proband (Table 1) using several diagnostic tests for already-known hemolytic anemias haematologica | 2016; 101(5)

ATP11C, a major flippase in human erythrocytes

A

B Figure 2. Flipping activity of erythrocytes with the ATP11C mutation. (A) Primary NBD-derived fluorescence data from flow cytometry. Left: NBD-PS loaded onto erythrocyte membranes for 20 min without BSA treatment [20 min BSA (-)].

Right: time-dependent internalization of NBD-PS with BSA treatment to remove NBD-PS remaining in the outer leaflet.

Events are indicated with arbitrary units. (B) Quantitation of the proportion of internalized NBD-PS calculated by mean fluorescence obtained from (A). The values were obtained by dividing internalized NBD-PS by loaded NBD-PS in each individual. NEM-treated cells from control (C + NEM), the patient’s (P + NEM), and maternal erythrocytes (M + NEM) were also analyzed to confirm the contribution of ATP11C to observed flipping activity. Primary flow data are shown in Online Supplementary Figure S2.

failed to elucidate the cause of hemolysis as hereditary spherocytosis, a red cell enzyme deficiency, or unstable hemoglobinopathy (Online Supplementary Figure S1, Online Supplementary Table S1). The identification of a mutation in the gene encoding the flippase, ATP11C, enabled us to discover a new candidate gene responsible for human congenital hemolytic anemia.

Although we predicted that loss of flipping activity could lead to a definitive increase of PS-exposing (positive) erythrocytes in the majority of the patient’s circulating cells, this was not found to be the case. PS was retained in the inner leaflet of the vast majority of both control erythrocytes and those from the patient, suggesting that PS is not exposed on the erythrocyte cell surface as long as scramblase is inactive, regardless of flippase activity. The proportion of PS-exposing cells increased only in the densest senescent cells (0.1% of total) in which scramblase was activated to transport PS from the inner to outer leaflet by increased Ca2+ concentration. The proportion increased further in the patient’s senescent cells with deficiency of flippase activity, indicating that ATP11C does play a role in active transport of externalized PS back to the inner leaflet to some extent in senescent erythrocytes. The distinct increase in PS-exposing cells in a small population of seneshaematologica | 2016; 101(5)

cent cells from the patient indicated that PS exposure occurred at a very late stage of the patient’s erythrocyte lifespan. It should be emphasized that PS-positive cells are continuously removed from the circulation by phagocytosis and those remaining in the circulation reflect the population that has not yet been cleared. The increased percentage of PS-positive senescent cells in the patient’s circulation does, therefore, indicate persistent and mild hemolysis, corresponding to the clinical symptoms such as mild jaundice.

Interestingly, the maternal erythrocytes comprised two populations; 55-60% possessed normal PS transport activity, and 40-45% lacked flippase activity, like those of the patient, suggesting random inactivation of the X chromosome in the erythroblast populations. The proportion of PSpositive circulating erythrocytes in the mother was similar to that in controls and the woman is not anemic. These findings imply that hemolytic anemia in the proband with ATP11C mutation is inherited as an X-linked recessive trait.

A balance between flipping and scrambling activities maintains the asymmetric distribution of PS. Our finding that the proportion of PS-positive cells in which lipid scrambling was promoted by exogenous Ca2+ incorporation up to 50 μM was very similar between control erythrocytes and the patient’s erythrocytes implies that ATP11C cannot com563

N. Arashiki et al.

pete sufficiently with Ca2+-activated PS scrambling to maintain PS asymmetry. In normal erythrocytes, the Ca2+ concentration increases transiently under shear stress-induced deformation during passage through narrow vessels and gradually increases during red cell senescence.25,26 Under these conditions, scramblase is activated to scramble PS from the inner to outer leaflet, and the concerted effort of ATP11C and other flippases may not be sufficient to prevent Ca2+-activated PS externalization in these cells.

Together, our findings imply that suppression of scramblase activity rather than flippase activity is the major contributor to maintenance of PS in the inner leaflet of normal erythrocytes and that PS externalization as an “eat-me signal” depends primarily on scramblase activity at the end of the erythrocytes’ lifespan.

Asymmetric PS distribution is important in other human cells. For instance, in platelet membranes PS is distributed in the inner leaflet probably by flippase activity under static conditions and exposed to the cell surface by Ca2+-activated scrambling via TMEM16F when blood coagulation is initially activated.27,28 Based on our findings concerning erythrocyte senescence, flippase activity cannot fully compensate for significantly increased scrambling activity.

No morphological change was observed in human erythrocytes with ATP11C mutation, while Atp11c mutant mice have anemia with stomatocytosis.20 Other differences between the human and murine systems is that while there is 10-fold less flippase activity in mature human erythrocytes with mutant ATP11C, flippase activity is nearly normal in mature erythrocytes from Atp11c mutant mouse. In addition, while mRNA levels of both ATP11A and ATP11C were very similar in human erythroblasts, only Atp11c mRNA was highly expressed in mice, with no expression of Atp11a (Online Supplementary Figure S3). These findings suggest that total flippase activity might be significantly decreased or absent in the ery-

Figure 3. PS cell surface exposure in circulating erythrocytes with the ATP11C mutation. Exposed PS was detected by Ca2+-dependent specific binding of FITCannexin V. Unfractionated erythrocytes (total) and fractionated erythrocytes obtained from density gradient centrifugation (senescence) for the control, patient, and mother were suspended in isotonic buffer including 5 mM CaCl2 before adding FITC-annexin V. Primary data obtained from flow cytometry analyses of FITC-derived fluorescence on erythrocytes are displayed. Events are shown with arbitrary units. The values in each panel indicate the proportion of PS-positive cells.

Figure 4. PS cell surface exposure in Ca2+-loaded erythrocytes with the ATP11C mutation. Effect of Ca2+-stimulated scrambling on PS exposure in control and patient’s erythrocytes. Ca2+ was introduced by a Ca2+ ionophore, A23187, for 20 min at 37 °C. After removal of the Ca2+ ionophore, PS-exposed cells were analyzed by monitoring FITC-annexin V binding to erythrocytes.

564

haematologica | 2016; 101(5)

ATP11C, a major flippase in human erythrocytes

throblasts of Atp11c mutant mice with resultant PS exposure on the outer membrane with subsequent gradual flipping back of the PS to the inner leaflet due to other flippases in mature erythrocytes, inducing the stomatocytic shape change.29,30 On the other hand, the flippase activity is presumably maintained in the erythroblasts of human subjects with ATP11C deficiency, due to compensation by other flippases including ATP11A. As a result, mature erythrocytes with ATP11C deficiency may maintain the biconcave disc shape because most PS is located in the inner leaflet from the erythroblast stage to the mature erythrocyte stage. Anemia in the mutant mouse may result from PS-positive erythroblasts being possibly eliminated (ineffective erythropoiesis) as previously documented in the case of pyruvate kinase deficient mice.31 Based on the expression of ATP8A1 in mature murine erythrocytes,32 it is likely that flippase activity in murine erythrocytes is primarily driven by ATP8A1 while ATP11C is the primary

References 12.

1. Manno S, Takakuwa Y, Mohandas N. Identification of a functional role for lipid asymmetry in biological membranes: phosphatidylserine-skeletal protein interactions modulate membrane stability. Proc Natl Acad Sci USA. 2002;99(4):1943-1948.

2. Manno S, Mohandas N, Takakuwa Y. ATPdependent mechanism protects spectrin against glycation in human erythrocytes. J Biol Chem. 2010;285(44):33923-33929.

3. Crosby WH. Siderocytes and the spleen.

Blood. 1957;12(2):165-170.

4. Lauber K, Blumenthal SG, Waibel M, Wesselborg S. Clearance of apoptotic cells: getting rid of the corpses. Mol Cell.

2004;14(3):277-287.

5. Basse F, Stout JG, Sims PJ, Wiedmer T. Isolation of an erythrocyte membrane protein that mediates Ca2+-dependent transbilayer movement of phospholipid. J Biol Chem. 1996;271(29):17205-17210.

6. Bratosin D, Estaquier J, Petit F, et al.

Programmed cell death in mature erythrocytes: a model for investigating death effector pathways operating in the absence of mitochondria.

Cell Death Differ.

2001;8(12):1143-1156.

7. Boas FE, Forman L, Beutler E. Phosphatidylserine exposure and red cell viability in red cell aging and in hemolytic anemia. Proc Natl Acad Sci USA. 1998;95(6): 3077-3081.

8. Chiu D, Lubin B, Roleofsen B, van Deenen LL. Sickled erythrocytes accelerate clotting in vitro: an effect of abnormal membrane lipid asymmetry. Blood. 1981;58(2):398-401.

9. Kuypers FA, Lewis RA, Hua M, et al.

Detection of altered membrane phospholipid asymmetry in subpopulations of human red blood cells using fluorescently labeled annexin V. Blood. 1996;87(3):11791187.

10. Kuypers FA, Yuan J, Lewis RA, et al.

Membrane phospholipid asymmetry in human thalassemia. Blood. 1998;91(8):30443051.

11. Paulusma CC, Oude Elferink RPJ. The type 4 subfamily of P-type ATPases, putative aminophospholipid translocases with a role

haematologica | 2016; 101(5)

13.

14.

15.

16.

17.

18.

19.

20.

21.

flippase in human erythrocytes.

In summary, our analyses of a patient with mild hemolytic anemia identified ATP11C as a major flippase in human erythrocytes and showed that genetic mutation of ATP11C causes congenital mild hemolytic anemia inherited as an X-linked recessive trait. We suggest that the contribution of ATP11C to the maintenance of PS in the inner leaflet is important in senescent cells when scramblase is active but very subtle under physiological, low Ca2+ concentrations when scramblase is inactive.

Acknowledgments We thank the proband and his mother who made this work possible. We would also like to thank Editage (www.editage.jp) for English language editing. This work was supported by JSPS KAKENHI grant number 25460375 (YT) and 25461609 (HK),

by AMED for the Practical Research Project for Rare/Intractable Diseases grant number 27280301 (for the research group organ-

in human disease. Biochim Biophys Acta.

2005;1741(1â&#x20AC;&#x201C;2):11-24.

Lopez-Marques RL, Theorin L, Palmgren MG, Pomorski TG. P4-ATPases: lipid flippases in cell membranes. Pflugers Arch.

2014;466(7):1227-1240.

Seigneuret M, Devaux, PF. ATP-dependent asymmetric distribution of spin-labeled phospholipids in the erythrocyte membrane: Relation to shape changes. Proc Natl Acad Sci USA. 1984;81(12):3751-3755.

Zachowski A, Favre E, Cribier S, HervĂŠ P, Devaux PF. Outside-inside translocation of aminophospholipids in the human erythrocyte membrane is mediated by a specific enzyme. Biochemistry. 1986;25(9):25852590.

Daleke DL, Lyles JV. Identification and purification of aminophospholipid flippases.

Biochim Biophys Acta. 2000;1486(1):108127.

Zhou X, Graham TR. Reconstitution of phospholipid translocase activity with purified Drs2p, a type-IV P-type ATPase from budding yeast. Proc Natl Acad Sci USA. 2009;106(39):16586-16591.

Coleman JA, Kwok MC, Molday RS. Localization, purification, and functional reconstitution of the P4-ATPase Atp8a2, a phosphatidylserine flippase in photoreceptor disc membranes. J Biol Chem.

2009;284(47):32670-32679. van der Velden LM, Wichers CG, van Breevoort AE, et al. Heteromeric interactions required for abundance and subcellular localization of human CDC50 proteins and class 1 P4-ATPases. J Biol Chem.

2010;285(51):40088-40096.

Takatsu H, Tanaka G, Segawa K, et al.

Phospholipid flippase activities and substrate specificities of human type IV P-type ATPases localized to the plasma membrane.

J Biol Chem. 2014;289(48):33543-33556.

Yabas M, Coupland LA, Cromer D, et al.

Mice deficient in the putative phospholipid flippase ATP11C exhibit altered erythrocyte shape, anemia, and reduced erythrocyte life span. J Biol Chem. 2014;289(28):1953119537.

An X, Schulz VP, Li J, et al. Global transcriptome analyses of human and murine terminal erythroid differentiation. Blood.

2014;123 (22):3466-3477.

22. Kunishima S, Okuno Y, Yoshida K, et al.

ACTN1 mutation cause congenital macrothrombocytopenia. Am J Hum Genet.

2013;92(3):431-438.

23. Arashiki N, Kimata N, Manno S, Mohandas N, Takakuwa Y. Membrane peroxidation and methemoglobin formation are both necessary for band 3 clustering: mechanistic insights into human erythrocyte senescence.

Biochemistry. 2013;52(34):5760-5769.

24. Vestergaard AL, Coleman JA, Lemmin T, et al. Critical roles of isoleucine-364 and adjacent residues in a hydrophobic gate control of phospholipid transport by the mammalian P4-ATPase ATP8A2. Proc Natl Acad Sci USA. 2014;111(14):E1334-E1343.

25. Johnson RM, Tang K. Induction of a Ca(2+)activated K+ channel in human erythrocytes by mechanical stress. Biochim Biophys Acta.

1992;1107(2):314-318.

26. Brain MC, Pihl C, Robertson L, Brown CB. Evidence for a mechanosensitive calcium influx into red cells. Blood Cells Mol Dis. 2004;32(3):349-352.

27. Castoldi E, Collins PW, Williamson PL, Bevers EM. Compound heterozygosity for 2 novel TMEM16F mutations in a patient with Scott syndrome. Blood. 2011;117(16): 4399-4400.

28. Lhermusier T, Chap H, Payrastre B. Platelet membrane phospholipid asymmetry: from the characterization of a scramblase activity to the identification of an essential protein mutated in Scott syndrome. J Thromb Haemost. 2011;9(10):1883-1891.

29. Daleke DL, Huestis WH. Incorporation and translocation of aminophospholipids in human erythrocytes. Biochemistry. 1985;24 (20):5406-5416.

30. Daleke DL, Huestis WH. Erythrocyte morphology reflects the transbilayer distribution of incorporated phospholipids. J Cell Biol.

1989;108(4):1375-1385 31. Aizawa S, Harada T, Kanbe E, et al.

Ineffective erythropoiesis in mutant mice with deficient pyruvate kinase activity. Exp Hematol. 2005;33(11):1292-1298.

32. Soupene E, Kuypers FA. Identification of an erythroid ATP-dependent aminophospholipid transporter. Br J Haematol. 2006;133(4): 436-438.

565

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Red Cell Biology & Its Disorders

Ferrata Storti Foundation

Cannabinoid receptor-specific mechanisms to alleviate pain in sickle cell anemia via inhibition of mast cell activation and neurogenic inflammation Lucile Vincent, Derek Vang, Julia Nguyen, Barbara Benson, Jianxun Lei, and Kalpna Gupta

Haematologica 2016 Volume 101(5):566-577

Vascular Biology Center, Division of Hematology, Oncology and Transplantation, Department of Medicine, University of Minnesota, Minneapolis, MN, USA

ABSTRACT

S

Correspondence: gupta014@umn.edu

ickle cell anemia is a manifestation of a single point mutation in hemoglobin, but inflammation and pain are the insignia of this disease which can start in infancy and continue throughout life. Earlier studies showed that mast cell activation contributes to neurogenic inflammation and pain in sickle mice. Morphine is the common analgesic treatment but also remains a major challenge due to its side effects and ability to activate mast cells. We, therefore, examined cannabinoid receptor-specific mechanisms to mitigate mast cell activation, neurogenic inflammation and hyperalgesia, using HbSS-BERK sickle and cannabinoid receptor-2-deleted sickle mice. We show that cannabinoids mitigate mast cell activation, inflammation and neurogenic inflammation in sickle mice via both cannabinoid receptors 1 and 2. Thus, cannabinoids influence systemic and neural mechanisms, ameliorating the disease pathobiology and hyperalgesia in sickle mice. This study provides ‘proof of principle’ for the potential of cannabinoid/cannabinoid receptor-based therapeutics to treat several manifestations of sickle cell anemia.

Introduction Received: September 14, 2015.

Accepted: December 18, 2015.

Pre-published: December 24, 2015. doi:10.3324/haematol.2015.136523

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/566

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

566

Sickle-cell anemia (SCA) is one of the most common inherited disorders and is associated with both unpredictable recurrent acute pain and chronic pain1.

Morphine, an opioid, has been the drug of choice for the treatment of severe pain associated with SCA.1,2 However, morphine is highly histaminergic, and is known to activate mast cells.2 We showed earlier that mast cells contribute to neurogenic inflammation and hyperalgesia in sickle mice.3 We also found that cannabinoids mitigate chronic and hypoxia/reoxygenation (H/R)-evoked acute hyperalgesia in sickle mice.4,5 Cannabinoids have anti-inflammatory effects and provide protection from ischemia/reperfusion injury.6-10 Since pain is a manifestation of complex sickle pathobiology including inflammation, vascular dysfunction and ischemia/reperfusion injury, we investigated cannabinoid receptor-specific modulation of vascular function, inflammation and hyperalgesia.

Cannabinoid receptors, CB1R and CB2R, are expressed in both the central nervous system and non-central nervous system tissues, including inflammatory cells.1115 CB1R and CB2R activation on mast cells has been shown to inhibit degranulation and inflammation, respectively.16 Activation of CB2R peripherally generates an antinociceptive response in inflammatory and neuropathic pain.17 CB2R is involved in neuroinflammation and the CB2R agonist, JWH-133, mitigates stress-related neuroinflammation-dependent pathologies.18,19 Selective activation of peripheral cannaboid receptors is appealing because it would avoid neuropsychiatric adverse effects associated with activation of CB1R in the central nervous system.

Sickle mice display neurogenic inflammation and hyperalgesia via a mast-celldependent mechanism.3 Cannaboid receptors are important modulators of vascular function with an anti-ischemic effect and direct anti-inflammatory effects by inhibiting mast cell degranulation.19 Since vascular dysfunction, ischemia/reperfuhaematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

sion injury and inflammation are hallmark features of SCA, we hypothesized that targeting specific cannaboid receptors may have beneficial effects on sickle pathobiology and pain. We used transgenic HbSS-BERK mice, hereafter referred to as sickle mice, which show features of pain and inflammation similar to patients with SCA,4,5,20 and sickle mice with deletion of CB2R, to examine the contribution of each cannaboid receptor in mast cell activation, neurogenic inflammation, and pain.

Methods The procedures are described in detail in the Online Supplementary Methods.

Blood flow measurement Blood flow in the dorsal skin was measured with a laser Doppler blood perfusion monitor (LaserfloR Model BPM 403, Vasamedics, Inc., St. Paul, MN, USA).23

Mast cell activation At the endpoint of the study, skin punch biopsies (4 mm) were incubated for indicated times and the culture medium was analyzed for cytokines (Q-Plex™ Array; Quansys Biosciences, Inc., Logan, UT, USA) and neuropeptides by enzyme-linked immunosorbent assays.3 Degranulating mast cells in skin sections were quantified and cultured mast cells from skin were immunostained for co-expression of mast cell specific c-kit/CD117 (BD Bioscience, San Jose, CA, USA), FcεR1 (eBioscience, San Diego, CA, USA) and tryptase3 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).

Animals Sickle (HbSS-BERK) and control mice (HbAA-BERK): BERK transgenic mice are murine α and β globin knockouts that express human sickle hemoglobin (S), demonstrating severe sickle cell disease, or normal (A) hemoglobin.4,5,21 CB2R knockout (CB2R-/-) mice: CB2R-/- mice (Stock # 005786; Jackson Laboratory, Bar Harbor, ME, USA) were backcrossed with BERK mice to obtain sickle and control mice without CB2R (HbSS/CB2R-/-; HbAA/CB2R-/-), and littermates with CB2R (HbSS/CB2R+/+; HbAA/CB2R+/+). Sickle or control mice with CB2R-/or CB2R+/+ were identified by polymerase chain reaction with primers specific for the CB2R (Cnr2) gene (Jackson Laboratory).

Sickle (HbSS) and control (HbAA) mice were bred and phenotyped for sickle and normal human hemoglobin by iso-electric focusing4 and genotyping for the knockout and hemoglobin transgenes (Transnetyx, Cordova, TN, USA). All experiments were performed following protocols approved by the University of Minnesota’s Institutional Animal Care and Use Committee.

Hematopathology of blood

Treatments

Cannabinoids mitigate chronic hyperalgesia in sickle mice

The cannabinoid receptor agonist, CP55,940, (Tocris Bioscience, Bio-Techne, Minneapolis, MN, USA), was prepared in 2% dimethylsulfoxide (DMSO) and 98% normal saline. Mice were treated daily with 0.3 mg/Kg CP55,940 or 2% DMSO in saline intraperitoneally in a volume of 25 μL/10 g of body weight.

To evaluate the contribution of individual cannaboid receptors, mice were treated with ACEA (Tocris Bioscience), a CB1R selective agonist (Ki = 1.4 nM), or JWH-133 (National Institute on Drug Abuse-NIDA, USA), a CB2R selective agonist (Ki = 3.4 nM).22 Mice received 1 mg/Kg ACEA or JWH-133 prepared in 2% DMSO and 98% normal saline intraperitoneally in a volume of 25 μL/10 g of body weight.

Pain-related behaviors Mice were acclimatized to each test protocol in a quiet room at constant temperature and tested for thermal- (heat and cold), mechanical-, and deep tissue-hyperalgesia (grip force), and catalepsy (bar test).4

Hyoxia/reoxygenation Mice were exposed to hypoxia with 8% O2 and 92% N2 for 3 h followed by re-oxygenation in room air for 1 h.5

Neurogenic inflammation Plasma extravasation in response to vehicle (10% ethanol, 7.5% Tween in saline), capsaicin (1.6%), or substance P (100 nM) injected intradermally in the dorsal skin was assessed by the Miles assay using Evans blue dye (Sigma-Aldrich, St. Louis, MO, USA).3 haematologica | 2016; 101(5)

Hematocrit, total hemoglobin, complete blood counts and red cell indices (% sickle red blood cells) were determined as previously described.3

Statistical analysis All data were analyzed using Prism software (v 5.0a, GraphPad Prism Inc., San Diego, CA, USA). Repeated measures analysis of variance (ANOVA) with the Bonferroni correction was used to compare the responses between treatments. A summary of the significance analysis of ANOVA [F(DFn, DFd) values] is given in Online Supplementary Table S1. A P-value of <0.05 was considered statistically significant. All data are presented as mean ± standard error of mean (SEM).

Results

Similar to chronic pain in SCA, HbSS-BERK sickle mice demonstrate tonic hyperalgesia4,5,20 compared to HbAABERK control mice and H/R evoked acute hyperalgesia simulating the pain of a vaso-occlusive crisis.5 Earlier we showed that a single injection of CP55,940, a non-selective cannabinoid receptor agonist, at a dose of 0.3 mg/Kg relieved tonic deep tissue as well as CFA-induced mechanical hyperalgesia in these sickle mice.4 Chronic pain requires repeated treatment, which can result in tolerance; we, therefore, examined whether chronic treatment with CP55,940 had a sustained analgesic effect over a period of time. Daily treatment with CP55,940 significantly reduced deep tissue, mechanical and thermal hyperalgesia in sickle mice (Figure 1A-F). The effect of CP55,940 was sustained over a period of 3 weeks. Due to the elaborate number of values for each test and each time point, statistical significance between vehicle and CP55,940 for each time point and for CP55,940 as compared to baseline (before treatment) are indicated in the figures and legends. Chronic treatment did not lead to catalepsy since the bar test did not show a significant difference between animals treated with CP55,940 or vehicle (Figure 1G).

Cannabinoids mitigate hyperalgesia via cannabinoid receptors Using pharmacological and genetic approaches we analyzed whether cannabinoids relieved chronic and acute 567

L. Vincent et al.

hyperalgesia via CB1R and/or CB2R. Sickle mice were treated with vehicle, CP55,940, the CB1R agonist ACEA, or the CB2R agonist JWH-133, for a week (normoxia), followed by 3 h of hypoxia and 1 h of reoxygenation. Deep tissue, mechanical and thermal hyperalgesia were measured before starting the treatment, at baseline, after 7 days of treatment under normoxia, and after H/R for different

A

B

C

D

E

F

periods. Under normoxic conditions 7 days of treatment with CP55,940 and the CB1R agonist ACEA significantly reduced deep tissue, mechanical and thermal (heat and cold) hyperalgesia as compared to the levels at baseline (P<0.05) or in vehicle-treated sickle mice (P<0.05; Figure 2). However, the CB2R agonist was only able to decrease the deep tissue hyperalgesia significantly following 7 days

G Figure 1. Acute and chronic treatment with CP55,940 decreases hyperalgesia in sickle mice. Sickle mice were treated with vehicle (Veh) or CP55,940 (0.3 mg/kg/day) for 3 weeks. Pain measures were obtained before starting the drug treatments on day 0 (baseline, BL), and periodically following the treatment. Measures of (A) deep tissue pain (grip force), (B,C) mechanical hyperalgesia (threshold and PWF), (D to F) thermal sensitivity to heat and cold, and (G) catalepsy are shown. *P<0.05; **P<0.01; ***P<0.001 Veh vs.

CP55,940; †P<0.05, ††P<0.01 vs. BL of matching group (ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for summary of F (DFn, DFd). Each value is the mean ± SEM from eight male mice (~5 months old) with three observations per mouse. Abbreviations, PWF, paw withdrawal frequency; PWL, paw withdrawal latency; Veh, vehicle.

568

haematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

of treatment (P<0.05 versus baseline or vehicle; Figure 2A).

The CB2R agonist did not show a significant effect on mechanical or thermal (heat and cold) hyperalgesia (Figure 2B-D). Thus, under normoxic conditions representative of chronic pain in SCA, the CB1R agonist as well as the nonselective cannaboid receptor agonist CP55,940 appear to be uniformly effective in attenuating different pain phenotypes including deep tissue, mechanical and thermal hyperalgesia in sickle mice. On the other hand, the CB2R agonist only mitigated deep tissue hyperalgesia, suggesting that CB1R agonism is critical for treating phenotypically diverse chronic pain in SCA. Earlier we found that H/R-evoked acute deep tissue hyperalgesia in sickle mice was attenuated by a single injection of CP55,940.4 Here we examined whether treatment with cananbinoids could prevent HR-evoked hyperalgesia. Pre-treatment of mice with CP55,940, and the CB1R agonist for 7 days decreased tonic hyperalgesia and also prevented H/R-evoked deep tissue, mechanical and thermal hyperalgesia (Figure 2A-D). However, treatment with the CB2R agonist decreased tonic as well as H/R-

evoked deep tissue hyperalgesia (Figure 2A) but did not reduce tonic or H/R-evoked mechanical or thermal (heat and cold) hyperalgesia (Figure 2B-D).

Furthermore, to determine the contribution of either CB1R or CB2R to the analgesia provided by CP55,940, we treated CB2R-deleted (HbSS CB2R-/-) and intact CB2R (HbSS CB2R+/+) sickle mice with a single dose of CP55,940 under normoxia (Figure 3). Control CB2R-/- and sickle CB2R-/- mice did not differ in baseline hyperalgesia as compared to control CB2R+/+ and sickle CB2R+/+, respectively. An increase in grip force was observed in control CB2R+/+ mice following CP55,940 treatment, but not in control CB2R-/- mice (Figure 3A). CP55,940 had no effect on mechanical or cold sensitivity in control CB2R-/- mice or CB2R+/+ mice (Figure 3B,D). Conversely, CP55,940 increased heat sensitivity in control CB2R-/- mice but had no effect on control CB2R+/+ (Figure 3C). CP55,940 treatment did not lead to catalepsy since the bar test (Figure 3E) did not show a significant difference from baseline in any group.

Sickle CB2R-/- and sickle CB2R+/+ mice displayed similar

A

B

C

D

Figure 2. Cannabioids attenuate hypoxia/reoxygenation-evoked hyperalgesia in a receptor-specific manner. Sickle mice (HbSS) were treated with vehicle (Veh), CP55,940, CB1R agonist (ACEA) or CB2R agonist (JWH-133) for 7 days. All mice were then treated with 3 h of hypoxia and 1 h of reoxygenation (H/R). Pain measures were obtained before starting the drug treatments on day 0 (baseline, BL) and at the conclusion of drug treatments, day 7 (D7) prior to H/R, immediately after H/R and periodically up to 24 h after H/R. Measures of (A) deep pain, (B) mechanical hyperalgesia and (C-D) thermal sensitivity to heat and cold are shown. ¶P<0.05, ¶¶ P<0.01 vs. BL of matching group; †P<0.05 vs. Day 7 (D7) of matching group; *P<0.05, **P<0.01 vs. Veh of matched time point. (Two-way ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for the summary of F (DFn, DFd). Each value is the mean ± SEM from five male mice (4-5 months old) with three observations per mouse. Abbreviations, H/R, hypoxia/reoxygenation.

haematologica | 2016; 101(5)

569

L. Vincent et al.

pain behaviors at baseline and a significant decrease in hyperalgesia following CP55,940 treatment (Figure 3A-D).

However, significantly greater relief from heat (P<0.001) and deep tissue hyperalgesia (P<0.01) was observed in sickle CB2R-/- mice compared to sickle CB2R+/+ mice following CP55,940 treatment. Thus, CB1R or CB2R may be used to variable extents to respond to cannabinoid therapy in cases of different pain phenotypes. Together, these data suggest that under conditions of both chronic and acute pain, activation of CB1R is critical to attenuate hyperalgesia, and CB2R may partly contribute to cananbinoid analgesia, perhaps by modulating inflammatory sickle pathobiology.

A

B

C

D

Cannabinoids attenuate mast cell activation in sickle cell anemia We recently reported that mast cell activation occurs in SCA and contributes to hyperalgesia and observed a correlative increase in dorsal skin blood flow with neurogenic inflammation and mast cell activation.3 We, therefore, analyzed whether cannabinoids influence vascular flow and mast cell activation. Sickle mice treated with CP55,940 daily for 3 weeks showed a significant decrease in dorsal skin blood flow 1 h after CP55,940 injection and the decrease persisted for the entire duration of treatment (P<0.01 versus vehicle 1 h after treatment and P<0.001 1 day, and 1, 2 and 3 weeks; Figure 4A). Treatment with

E

Figure 3. Cannabinoid analgesia is modulated in CB2R-knockout sickle mice.

HbAA-CB2R+/+, HbAA-CB2R-/-, HbSS-CB2R+/+ and HbSS-CB2R-/- mice were treated with a single injection of CP55,940 (0.3 mg/kg, i.p.). Pain measures were obtained before starting the drug treatments (at baseline, BL), and periodically after the injection.

Measures of (A) deep pain, (B) mechanical hyperalgesia and (C-D) thermal sensitivity to heat and cold, and (E) catalepsy are shown. *P<0.05, **P<0.01, ***P<0.001 vs.

HbAA-CB2-R+/+ at matching time point; P<0.05, P<0.01 vs. HbSS-CB2-R+/+ at matching time point; ¶P<0.05, ¶¶P<0.01 vs. BL of matching group (ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for the summary of F (DFn, DFd). Each value is the mean ± SEM from five mice (3 males and 2 females, ~4.5 months old) with three observations per mouse.

570

haematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

CP55,940 significantly decreased activation (degranulation) of mast cells in sickle mice compared to sickle mice treated with vehicle (Figure 4B-D). Sickle mice treated with CP55,940 showed about 40% less activated mast cells compared to those treated with the vehicle (P<0.01; Figure 4D). Similarly, mast cells isolated from the skin of sickle mice treated with CP55,940 exhibited lower immunoreactivity for c-kit, FcεRI and tryptase (Figure 4E) and released significantly less substance P and tryptase as compared to mast cells from vehicle-treated mice (P<0.05 for both; Figure 4F-G). Earlier we showed that mast cell activation contributes to inflammation in sickle mice by enhancing the release of several cytokines or chemokines.3 We observed that, compared to vehicle treatment, CP55,940 treatment of sickle mice for 3 weeks significantly decreased the cytokines released from skin biopsies (IL1α, IL-6, TNF-α, MCP-1; P<0.01, Figure 2H). Consistent with decreased mast cell activation, treatment with CP55,940 lowered the levels of granulocte macrophage colony-stimulating factor (GM-CSF) and regulated on activation, normal T-cell expressed and secreted (RANTES), two chemokines involved in mast cell recruitment and function,24,25 by at least 35% (P<0.01). GM-CSF plays a critical role in regulating leukocyte counts, which are often elevated in SCA.26 We have previously reported leukocytosis in sickle mice and have shown that mast cells play a role in this process.3 Treatment with CP55,940 significantly decreased white blood cell counts and sickle red blood cells, compared to the effect of vehicle, both under normoxia and following H/R incitement (Table 1). Thus CP55,940 treatment dampens the inflammatory response and sickling of red blood cells by decreasing the activation of mast cells.

Hypoxia/reoxygenation-induced mast cell activation is attenuated by cannabinoids in a receptor-specific manner Next we determined cannaboid receptor-specific inhibition of mast cell activation in sickle mice under normoxia and H/R. Sickle mice showed a trend towards increased mast cell activation following H/R injury as compared to normoxia (Figure 5A,B). Additionally, treatment with

CP55,940 for 7 days led to a significant reduction in mast cell activation, both under normoxia and following H/R, compared to vehicle under the respective conditions (P<0.05 for each condition; Figure 5B). Although the CB1R agonist ACEA caused appreciable inhibition of mast cell activation, the CB2R agonist JWH-133 produced a significant decrease in degranulating mast cells (P<0.05).

Consistent with the inhibitory effect on mast cell activation, administration of CP55,940, compared to treatment with only the vehicle, significantly reduced plasma tryptase, β-hexosaminidase and serum amyloid protein after H/R injury in sickle mice (P<0.05; Figure 5C). The level of serum substance P was elevated after H/R injury compared to the level in normoxia in sickle mice (P<0.05; Figure 5D). CP55,940 treatment decreased the levels of substance P both under normoxia and following H/R injury (P<0.01; Figure 5D,E). Following H/R, the CB2R agonist significantly reduced substance P levels as compared to the levels in vehicle-treated mice (P<0.05; Figure 5E). The CB1R agonist tended to decrease serum substance P but the difference was not statistically significant.

Together, these data suggest that H/R-evoked mast cell activation leading to neuroinflammation is predominantly mediated by CB2R.

Cannabinoids reduce neurogenic inflammation Earlier we found that mast cell activation contributes to neurogenic inflammation in sickle mice.3 Considering the H/R-induced mast cell activation described above, we examined the role of cannaboid receptors in relieving neurogenic inflammation. Evans blue leakage increased significantly in the skin of sickle mice following H/R incitement compared to the leakage in normoxia (P<0.05; Figure 6A).

CP55,940 decreased Evans blue leakage in sickle mice under normoxia as well as following H/R (P<0.001; Figure 6A). Evoked leakage of Evans blue by intradermal injection of capsaicin or substance P is higher in sickle mice than in control mice under normoxia.3 Treatment with CP55,940 or CB1R and CB2R agonists significantly reduced Evans blue leakage evoked by capsaicin (CP55,940, P<0.001; CB1R and CB2R P<0.05) and substance P (CP55,940, CB1R and CB2R P<0.001) as com-

Table 1. The effect of CP55,940 on hematologic parameters in SCA.

Parameter

NORMOXIA HbAA-BERK HbSS-BERK Veh CP55,940 Veh CP55,940

HYPOXIA/REOXYGENATION HbAA-BERK HbSS-BERK Veh CP55,940 Veh CP55,940

Peripheral blood RBC (109/L) Total Hb (g/dL) Hematocrit (%) WBC (109/L) Neutrophils (109/L) Lymphocytes (109/L) Monocytes (109/L)

11.4 ± 0.3 12.7 ± 0.6 45.2 ± 1.0 7.3 ± 0.4 1.7 ± 0.2 4.3 ± 0.4 0.2 ± 0.1

11.2 ± 0.1 12.7 ± 0.5 44.4 ± 0.9 7.1 ± 0.3 1.5 ± 0.2 4.3 ± 0.3 0.3 ± 0.1

10.0 ± 0.3 10.2 ± 0.4* 41.6 ± 1.0** 18.7 ± 0.5*** 7.8 ± 0.2*** 6.3 ± 0.4* 1.1 ± 0.1*

10.2 ± 0.1 9.8 ± 0.3* 41.5 ± 0.8 15.1 ± 0.4**¶ 6.4 ± 0.2**¶ 5.7 ± 0.3 0.5 ± 0.1

11.0 ± 0.3 12.9 ± 0.7 45.6 ± 1.1 8.9 ± 0.3 2.1 ± 0.2 5.3 ± 0.4 0.5 ± 0.1

10.2 ± 0.1 12.5 ± 0.3 43.5 ± 0.9 7.9 ± 0.3 1.9 ± 0.2 4.9 ± 0.3 0.4 ± 0.1

9.1 ± 0.2 9.3 ± 0.3 9.6 ± 0.3# 9.9 ± 0.6 ## 40.8 ± 1.1 40.1 ± 0.9## ¶### 22.8 ± 0.8 16.9 ± 0.9##°° ### 9.0 ± 0.2 5.6 ± 0.2#° # 7.5 ± 0.5 6.0 ± 0.6 1.4 ± 0.2# 0.6 ± 0.1°

RBC indices Sickle RBC (% total)

n/a

n/a

28.9 ± 1.8

18.4 ± 1.2¶¶

n/a

n/a

37.9 ± 1.8¶¶ 23.8 ± 1.5¶°°°

Complete blood counts were measured in whole blood after 7 days of treatment with vehicle (Veh) or CP55,940. On day 7, mice were separated into two groups: the normoxia group (control condition) or the hypoxia/reoxygenation group in wich mice were treated with 3 h of hypoxia and 1 h of reoxygenation (H/R). Blood was collected on day 8, (24 h after the end of treatment or after H/R). RBC: red blood cells; Hb: hemoglobin; WBC: white blood cells; n/a: not applicable. *P<0.05, **P<0.01, ***P<0.001 vs. HbAA-BERK Veh Normoxia; ¶P<0.05, ¶¶P<0.01 vs. HbSS- BERK Veh Normoxia; #P<0.05, ##P<0.01, ###P<0.001 vs. HbAA-BERK Veh H/R; °P<0.05, °°P<0.01, °°°P<0.001 vs. HbSS-BERK Veh H/R. n = five male mice in each group. Data are mean ± SEM (ANOVA, with the Bonferroni correction).

haematologica | 2016; 101(5)

571

L. Vincent et al.

pared to vehicle (Figure 6B,C). Thus CP55,940 reduces H/R-mediated neurogenic inflammation via both CB1R and CB2R. Since neurogenic inflammation is orchestrated by peripheral nerves in conjunction with mast cell activation, it is likely that CB2R predominantly mediates the cannabinoid response on mast cells as indicated above, while CB1R mediates the response on peripheral nerves.

Discussion Pain in SCA may be a result of vascular dysfunction,

A

B

inflammation and direct neural injury, involving multiple targets. Moreover, the unique acute pain due to a “crisis” in addition to chronic pain further adds to the complexity and heterogeneity of SCA pain as compared to severe pain in other conditions. It is not, therefore, surprising that current pain management strategie, requiring identification of therapeutic modalities acting on multiple targets peripherally and in the central nervous system are not always effective. Cannabinoid receptors are unique targets because of their peripheral and central activity at a multicellular level.

Given the psychotropic effects of CB1R, attention is

C

E D

F

H

572

G

Figure 4. CP55,940 reduces mast cell activation.

Mice were treated with CP55,940 (0.3 mg/kg/day, i.p.) or vehicle for 3 weeks and analyzed as described. (A) Measures of cutaneous blood flow in the dorsal skin. **P<0.01, ***P<0.001; †P<0.01 vs. respective baseline (BL) before starting the treatments. Each value is the mean ± SEM from eight male mice (~5 months old) with three observations per mouse. (B,C) Representative images of toluidine blue stained dorsal skin sections of HbSS mice treated for 3 weeks with vehicle (Veh) or CP55,940 (CP). Each image is representative of images from five mice per condition. Scale bar = 100 μm. (D) Ratio of degranulating/total mast cells. *P<0.01; †P<0.05, ††P<0.001 vs. HbAA Veh. (E) Representative confocal images of skin mast cells in culture stained for c-kit/CD117 (red), FcεRI (green), and tryptase (blue). Scale bar = 5 μm. n=5.

(F,G) Substance P and tryptase in mast cell conditioned medium. *P<0.05; **P<0.01; †P<0.05 vs.

HbSS Veh. (H) Skin biopsies were incubated in culture medium for 24 h and cytokines released in conditioned medium were analyzed. HbSS BERK Veh and HbSS CP55,940 are represented by red and blue bars, respectively. Values are expressed as a percent of HbSS Veh. *P<0.05, **P<0.01 vs.

HbSS Veh (ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for the summary of F (DFn, DFd). Each value is the mean ± SEM from five male mice (~5 months old).

haematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

being focused on the possibility of targeting CB2R, which does not have psychotropic effects.27,28 CB2R agonists and/or knockout mice provide compelling evidence that CB2R activation mitigates neuropathic and inflammatory pain, and is protective against ischemia/reperfusion injury by decreasing the endothelial expression of adhesion molecules and secretion of chemokines,15,29,30 and by attenuat-

ing leukocyte adhesion to the endothelium, transendothelial migration, and interrelated oxidativenitrosative damage,31,32 all of which are consistent with the pathobiology of SCA. We show here that targeting the cannabinoid receptors is effective in reducing inflammation, mast cell activation and neurogenic inflammation, which orchestrate pain.

A

B

C

E

D

Figure 5. CP55,940 reduces hypoxia/reoxygenation-evoked mast cell activation. Mice were treated with vehicle (Veh), CP55,940 (CP), CB1R agonist (CB1-R Ag, ACEA) or CB2R agonist (CB2-R Ag, JWH-133) for 1 week followed by normoxia (N) or hypoxia/reoxygenation (H/R) and analyzed as described. (A) Representative images of toluidine blue stained dorsal skin sections of HbSS mice. Each image is representative of images from five male mice per condition. Scale bar = 50 μm.

(B) Ratio of degranulating/total mast cells. *P<0.05 vs. HbSS Veh H/R. (C) Levels of tryptase, β-hexosaminidase (β-hex) and serum amyloid protein (SAP) after H/R. *P<0.05, **P<0.01 vs. HbSS Veh normo, †P<0.05 vs. HbSS Veh H/R (ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for the summary of F (DFn, DFd). (D-E) Levels of substance P in HbSS mice in normoxia or after H/R injury. Substance P expressed as the percentage of HbAA Veh in normoxia (C,E) or HbSS Veh (D). Each value in (B-E) is the mean ± SEM from five male mice, ~5 months old.

haematologica | 2016; 101(5)

573

L. Vincent et al.

A

B

C

Figure 6. CP55,940 reduces hypoxia/reoxygenation injury-evoked neurogenic inflammation.

(A) Spontaneous Evans blue leakage in HbSS treated with vehicle (Veh, red), or CP55,940 (0.3 mg/kg/day, blue) for 1 week, under normoxia or after hypoxia/reoxygenation (H/R). **P<0.0001; *P<0.05. (B) Evans blue leakage evoked by injection of saline, capsaicin, or substance P in the dorsal skin of HbSS mice treated with vehicle, CP55,940 (0.3 mg/kg), CB1R agonist (CB1-R Ag, ACEA) or CB2R agonist (CB2-R Ag, JWH-133) for 7 days followed

by H/R. *P<0.05, **P<0.001 vs. Veh for each treatment; †P<0.05 vs. CP55,940 (ANOVA, with the Bonferroni correction, see Online Supplementary Table S1 for the summary of F (DFn, DFd)). (C) Images showing Evans blue leakage in the dorsal skin of sickle mice after H/R. Each image represents reproducible images from five male mice; and each value is the mean ± SEM from five male mice, ~5 months old.

Sickle mice exhibit spontaneous musculoskeletal pain and cutaneous hyperalgesia to mechanical, heat and cold stimuli.4,5 These symptoms recapitulate the pain phenotype observed in patients with SCA.1,20 Previously we observed that an acute dose of CP55,940 attenuated deep tissue hyperalgesia and mechanical hyperalgesia induced by complete Freud’s adjuvant (CFA) in sickle mice.4,5 Our present observations that sickle mice exhibit sustained analgesia over 3 weeks of chronic treatment with CP55,940 suggest that tolerance to cannabinoid analgesia does not develop.

Cannabinoids have been found to be protective against ischemia/reperfusion injury.33 CP55,940 prevented sickling induced by H/R in sickle mice, suggesting that some of the analgesic effects of cannabinoids could be due to their effect on sickle pathobiology. Furthermore, treatment with specific CB1R (ACEA) and CB2R (JWH-133) agonists reduced deep hyperalgesia, but only the CB1R agonist was able to reduce mechanical and thermal (heat and cold) hyperalgesia following H/R. Complementary to these observations, CP55,940 treatment had an antihyperalgesic effect in HbSS CB2R-/- mice on mechanical and thermal 574

(heat and cold) hyperalgesia but not on deep tissue hyperalgesia under normoxia. Cannabinoid analgesia is, therefore, mediated through both CB1R and CB2R, which is specific to the sickle pain phenotype. Thus, cannaboid receptors agonists not only have an analgesic effect but also have a systemic effect on the disease pathophysiology because pre-treatment with cannabinoids for a week prevented H/R-induced hyperalgesia. Together with our earlier studies demonstrating that CP55,940 is effective in decreasing chronic and CFA-induced hyperalgesia,4 the present findings highlight the analgesic potential of cannabinoids to relieve different pain phenotypes under normoxia (representing chronic pain) and under H/R (representing the pain of a vaso-occlusive crisis). Importantly, the present data support the use of both CB1R and CB2R agonists for overall analgesia but, depending on the characteristics of the pain, one or the other agonist may potentially be more useful.

Mast cell activation contributes to sickle pathophysiology by mediating inflammation and pain.3 Inflammatory mediators, proteases including tryptase and pro-inflammatory cytokines are released from mast cells upon activahaematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

tion and contribute to heightened inflammation in SCA. Tryptase, in addition to enhancing inflammation and neurogenic inflammation, activates protease activated receptor 2 (PAR2) on peripheral nerve endings and promotes nociception.3,34,35 Thus, the sickle microenvironment favors persistent mast cell activation, consecutively causing nociceptor sensitization, which in turn aggravates hyperalgesia. Indeed our recent studies showed nociceptor sensitization and activation of the p38MAPK pathway in the spinal cords of sickle mice, suggestive of central sensitization.36 The cannabinoid receptors CB1R and CB2R are found on mast cells.37,38 Since, mast cells produce endocannabinoids, including anandamide, palmitoylethanolamide, and 2-arachidonylglycerol, a potential autocrine regulatory loop may exist.39 Mast cells are tightly controlled by the endocannabinoid system in the skin thereby limiting excessive activation and maturation.

Human mucosal-type mast cells use CB1R-mediated signaling to limit degranulation and maturation from progenitor mast cells.37 Mast cell activation was attenuated following CP55,940 treatment with a correlative decrease in tryptase, substance P and cytokines released from the skin and in cutaneous blood flow. Significantly higher acetylcholine-induced forearm blood flow has been reported in sickle patients as compared to normal subjects, and significantly increased blood flow was observed in females as compared to male sickle patients.40 Sickle females were responsive to blood flow inhibition with the nitric oxide synthase inhibitor, NG-monomethyl-L-arginine, but sickle males were not, suggesting that gender-based nitric oxidedependent and -independent mechanisms are involved.

Since, CP55,940 inhibited blood flow in male mice in our study, it may be acting via nitric oxide-independent mechanisms, but may also inhibit nitric oxide-dependent blood flow in females, an aspect that requires further examination.

Mast cell activation also occurs in response to ischemia/reperfusion injury.41 Factors associated with mast cell activation were also reduced in H/R-incited sickle mice following CP55,940 treatment. GM-CSF and white blood cell counts are elevated in SCA patients26 and in sickle mice, and are both further increased by H/R incitement.3 Our finding that CP55,940 decreased GM-CSF levels, leukocyte counts and also sickle red blood cells has important implications for improving vaso-occlusive crises and the accompanying pain. A direct effect of CP55,940 on reducing sickling of red blood cells is an exciting possibility, but the reduction could also be due to an indirect effect, which warrants further investigation. Importantly, the observed inhibitory effect of both CB1R and CB2R agonists on neurogenic inflammation and mast cell activation suggests the beneficial effect of cannabinoids on complex inflammatory and vascular sickle pathobiology and associated conditions.

Several studies support the analgesic effect of cannabinoids in humans.42,43 Sativex, a cannabis-derived oromucosal spray, containing equal proportions of THC and cannabidiol has been shown to be effective in treating symptoms of multiple sclerosis, including spasticity and neuropathic pain.44,45 Sativex is also being tested in two phase 3 trials for cancer pain and neuropathic pain.46 Furthermore, Abrams et al.47 showed that using vaporized cannabis in conjunction with opioids augments the analgesic effects of opioids. Unfortunately, side effects associated with higher doses such as sedation, dizziness, blurred haematologica | 2016; 101(5)

vision, impaired cognitive functioning and the risk of addiction limit the use of cannabinoids for therapy.

However, targeting the CB1R and CB2R receptors simultaneously in the periphery would minimize the side effects and concurrently help in managing pain. A recent report by Khasabova et al.48 described that the activation of peripheral CB1R and CB2R synergistically reduced tumorevoked hyperalgesia. A questionnaire-based study evaluating the use of marijuana in sickle patients found that 52% of patients who indulged in marijuana used it to reduce or prevent acute or chronic pain.49,50 Pain in SCA could be of mixed type, including nociceptive, neuropathic and inflammatory mechanisms with the involvement of both peripheral and central nociceptor sensitization.1 The CB1R agonist was able to improve hyperalgesia significantly in sickle mice, and the CB2R agonist significantly attenuated mast cell activation and neurogenic inflammation, which may improve the condition of the systemic disease, consequently reducing pain. Since, deep hyperalgesia was mitigated by the CB2R agonist (JWH-133), targeting both CB1R and CB2R simultaneously may be of advantage in treating the complex, mixed type of pain that typically occurs in SCA. CP55,940, via the CB2R, was demonstrated to stimulate serotonin 2A receptor activity in the pre-frontal cortex of rats, suggesting of an influence on cognitive and mood disorders.51 The effect of cannabinoids on neuropsychiatric conditions in SCA does, therefore, require consideration.

Interestingly we did not see an increase in hyperalgesia with the deletion of CB2R in either control or sickle mice.

Earlier studies in CB2R-deleted C57BL/6 mice, compared to wild-type C57BL/6 animals, did not show an effect on baseline hyperalgesia in paw withdrawal latency in response to heat or mechanical allodynia induced using von Frey filaments or in a tail withdrawal assay.28,52 In this study on CB2R-/- mice, an effect on morphine-induced antinociception was observed only in the early inflammatory phase of formalin-induced nociception, which diminished later (after 60 min). Similarly, we observed an increase in paw withdrawal latency in control CB2R-/- following CP55,940 treatment, which could be due to an increase in inflammation in CB2R-/- and may demonstrate an anti-inflammatory effect of CP55,940 perhaps via CB1R. An increase in grip force in control mice occurred following CP55,940 treatment but not in the control CB2R-/-, suggesting that CB2R is required to alleviate deep hyperalgesia. Similar to our observations of no effect of CP55,940 on mechanical hyperalgesia but an increase in heat-provoked paw withdrawal latency in control CB2R-/- mice, in a previous study WIN 55,212-2 (a potent cannaboid receptor agonist) did not influence mechanical hyperalgesia but led to an increase in heatprovoked paw withdrawal latency in CB2R-/- C57BL/6 mice in a model of neuropathic pain.28 These data suggest a role of CB2R in the anti-allodynic effect in a neuropathic pain model. In the sickle mice we observed a uniform effect of CP55,940 on deep tissue, mechanical and thermal hyperalgesia. This shows the diverse pathobiology of sickle pain, perhaps involving inflammation and neuropathy, making both CB1R and CB2R agonists necessary to achieve analgesia.

CB1R-mediated psychotropic effects and utilization of smoked cannabis are major deterrants to the use of cannabis as a medicine.53 However, the recent discovery of cannaboid receptor-specific agonists and delivery following 575

L. Vincent et al.

vaporization provide advantages to the use of cannabinoids in the medical setting, following well-controlled clinical trials.47 Societal stigma against “marijuana” also calls for the development of cannabis-derived medications in userfriendly drug-delivery systems to dignify their use.

Evidence-based knowledge about cannabis-derived medications, their dosage and side effects needs to be acquired in disease-specific, pre-clinical and clinical investigations, as emphasized recently.53,54 It is noteworthy that in the states of the USA in which cannabis has been legalized for medical use, the mean annual opioid overdose mortality rates between 1999 and 2010 were reduced by 24.8% (95% CI, -37.5% to -9.5%; P=0.003).55 Pain in SCA is associated with a poor quality of life and increased morbidity and opioids, with all their side effects, remain the mainstay of therapy.1 Our observations in a pre-clinical setting of SCA provide a compelling rationale to examine the potential of cannaboid

References 1. Ballas SK, Gupta K, Adams-Graves P. Sickle cell pain: a critical reappraisal. Blood.

2012;120(18):3647-3656.

2. Gupta M, Msambichaka L, Ballas SK, Gupta K. Morphine for the treatment of pain in sickle cell disease. Sci World J. 2015;2015: 540154.

3. Vincent L, Vang D, Nguyen J, et al. Mast cell activation contributes to sickle cell pathobiology and pain in mice. Blood. 2013;122 (11):1853-1862.

4. Kohli DR, Li Y, Khasabov SG, et al. Painrelated behaviors and neurochemical alterations in mice expressing sickle hemoglobin: modulation by cannabinoids. Blood.

2010;116(3):456-465.

5. Cain DM, Vang D, Simone DA, Hebbel RP, Gupta K. Mouse models for studying pain in sickle disease: effects of strain, age, and acuteness. Br J Haematol. 2012;156(4):535544.

6. Klein TW. Cannabinoid-based drugs as antiinflammatory therapeutics. Nat Rev Immunol. 2005;5(5):400-411.

7. Nagarkatti P, Pandey R, Rieder SA, Hegde VL, Nagarkatti M. Cannabinoids as novel anti-inflammatory drugs. Future Med Chem.

2009;1(7):1333-1349.

8. Pacher P, Bátkai S, Kunos G. The endocannabinoid system as an emerging target of pharmacotherapy.

Pharmacol Rev. 2006;58(3):389-462.

9. Hillard CJ. Role of cannabinoids and endocannabinoids in cerebral ischemia. Curr Pharm Des. 2008;14(23):2347-2361.

10. Zhang M, Adler MW, Abood ME, Ganea D, Jallo J, Tuma RF. CB2 receptor activation attenuates microcirculatory dysfunction during cerebral ischemic/reperfusion injury.

Microvasc Res. 2009;78(1):86-94.

11. Di Marzo V, Stella N, Zimmer A. Endocannabinoid signalling and the deteriorating brain. Nat Rev Neurosci. 2015;16(1): 30-42.

12. Van Sickle MD, Duncan M, Kingsley PJ, et al. Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science. 2005;310(5746):329-332.

13. Munro S, Thomas KL, Abushaar M.

576

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

receptor-specific agonists and cannabinoids to treat pain and ameliorate the associated pathobiology in SCA. Acknowledgments Funding: this work was supported by NIH RO1 grants HL68802 and 103773 and UO1 HL117664 and Institute for Engineering in Medicine grants to KG. Confocal imaging was performed using the Olympus FluoView 1000 IX2 instrument at the University of Minnesota - University Imaging Centers, http://uic.umn.edu. The authors would like to thank Stefan Kren, Katherine NH Johnson, Sugandha Rajput, Ritu Jha and Susan Thompson for breeding, genotyping, phenotyping mice and/or technical assistance; Drs. Robert P. Hebbel and David Archer for providing breeder sickle mice; Drs. David Largaespada and Anindya Bagchi for advice on mouse genetics; Dr Donald A. Simone for a critical review of the manuscript; and Michael J. Franklin and Carol Taubert for editorial assistance.

Molecular characterization of a peripheral receptor for cannabinoids. Nature. 1993;365 (6441):61-65.

Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, Bonner TI. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature.

1990;346(6284):561-564.

Rajesh M, Pan H, Mukhopadhyay P, et al.

Pivotal advance: Cannabinoid-2 receptor agonist HU-308 protects against hepatic ischemia/reperfusion injury by attenuating oxidative stress, inflammatory response, and apoptosis. J Leuko Biol. 2007;82(6):13821389.

Small-Howard AL, Shimoda LM, Adra CN, Turner H. Anti-inflammatory potential of CB1-mediated cAMP elevation in mast cells.

Biochem J. 2005;388(Pt 2):465-473.

Ibrahim MM, Deng H, Zvonok A, et al.

Activation of CB2 cannabinoid receptors by AM1241 inhibits experimental neuropathic pain: Pain inhibition by receptors not present in the CNS. Proc Natl Acad Sci USA. 2003;100(18):10529-10533.

Zoppi S, Madrigal JL, Caso JR, et al.

Regulatory role of the cannabinoid CB2 receptor in stress- induced neuroinflammation in mice. Br J Pharmacol.

2014;171(11):2814-2826.

Pini A, Mannaioni G, Pellegrini-Giampietro D, et al. The role of cannabinoids in inflammatory modulation of allergic respiratory disorders, inflammatory pain and ischemic stroke. Curr Drug Targ.

2012;13(7):984-993.

Brandow AM, Stucky CL, Hillery CA, Hoffmann RG, Panepinto JA. Patients with sickle cell disease have increased sensitivity to cold and heat. Am J Hematol.

2013;88(1):37-43.

Paszty C, Brion CM, Manci E, et al.

Transgenic knockout mice with exclusively human sickle hemoglobin and sickle cell disease. Science. 1997;278(5339):876-878.

Pertwee RG. Pharmacology of cannabinoid receptor ligands. Curr Med Chem.

1999;6(8):635-664.

McCulloch KM, Ji SA, Raju TNK. Skin blood-flow changes during routine nursery procedures. Early Hum Dev. 1995;41(2):147156.

24. Mattoli S, Ackerman V, Vittori E, Marini M. Mast cell chemotactic activity of RANTES. Biochem Biophys Res Commun. 1995;209 (1):316-321.

25. Galli SJ, Borregaard N, Wynn TA. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils.

Nat Immunol.

2011;12(11):1035-1044.

26. Conran N, Saad SO, Costa F, Ikuta T. Leukocyte numbers correlate with plasma levels of granulocyte–macrophage colonystimulating factor in sickle cell disease. Ann Hematol. 2007;86(4):255-261.

27. Murineddu G, Deligia F, Dore A, Pinna G, Asproni B, Pinna GA. Different classes of CB2 ligands potentially useful in the treatment of pain. Recent Pat CNS Drug Disc.

2013;8(1):42-69.

28. Desroches J, Charron S, Bouchard JF, Beaulieu P. Endocannabinoids decrease neuropathic pain-related behavior in mice through the activation of one or both peripheral CB1 and CB2 receptors.

Neuropharmacol. 2014;77:441-452.

29. Murikinati S, Juttler E, Keinert T, et al.

Activation of cannabinoid 2 receptors protects against cerebral ischemia by inhibiting neutrophil recruitment.

FASEB J. 2010;24(3):788-798.

30. Montecucco F, Lenglet S, Braunersreuther V, et al. CB(2) cannabinoid receptor activation is cardioprotective in a mouse model of ischemia/reperfusion. J Mol Cell Cardiol.

2009;46(5):612-620.

31. Pacher P, Hasko G. Endocannabinoids and cannabinoid receptors in ischaemia-reperfusion injury and preconditioning. Br J Pharmacol. 2008;153(2):252-262.

32. Zhang M, Martin BR, Adler MW, et al.

Modulation of cannabinoid receptor activation as a neuroprotective strategy for EAE and stroke. J Neuroimmune Pharmacol.

2009;4(2):249-259.

33. Tuma RF, Steffens S. Targeting the endocannabinod system to limit myocardial and cerebral ischemic and reperfusion injury.

Curr Pharm Biotechnol. 2012;13(1):46-58.

34. Galli SJ, Tsai M. IgE and mast cells in allergic disease. Nat Med. 2012;18(5):693-704.

35. Oliveira SM, Silva CR, Ferreira J. Critical role of protease-activated receptor 2 activation

haematologica | 2016; 101(5)

Mechanisms of cannabinoid analgesia in sickle mice

36.

37.

38.

39.

40.

41.

by mast cell tryptase in the development of postoperative pain.

Anesthesiology.

2013;118(3):679-690.

Cataldo G, Rajput S, Gupta K, Simone DA. Sensitization of nociceptive spinal neurons contributes to pain in a transgenic model of sickle cell disease. Pain. 2015;156(4):722-730.

Sugawara K, Zakany N, Hundt T, et al.

Cannabinoid receptor 1 controls human mucosal-type mast cell degranulation and maturation in situ. J Allergy Clin Immunol.

2013;132(1):182-193.

Stander S, Schmelz M, Metze D, Luger T, Rukwied R. Distribution of cannabinoid receptor 1 (CB1) and 2 (CB2) on sensory nerve fibers and adnexal structures in human skin. J Dermatol Sci. 2005;38(3):177188.

Bisogno T, Maurelli S, Melck D, DePetrocellis L, DiMarzo V. Biosynthesis, uptake, and degradation of anandamide and palmitoylethanolamide in leukocytes. J Biol Chem. 1997;272(6):3315-3323.

Gladwin MT, Schechter AN, Ognibene FP, et al. Divergent nitric oxide bioavailability in men and women with sickle cell disease.

Circulation. 2003;107(2):271-278.

Reichel CA, Lerchenberger M, Uhl B, et al.

Plasmin inhibitors prevent leukocyte accumulation and remodeling events in the

haematologica | 2016; 101(5)

42.

43.

44.

45.

46.

47.

48.

postischemic microvasculature. Plos One. 2011;6(2):e17229.

Williamson EM, Evans FJ. Cannabinoids in clinical practice. Drugs. 2000;60(6):13031314.

Croxford JL, Miller SD. Immunoregulation of a viral model of multiple sclerosis using the synthetic cannabinoid R(+)WIN55,212. J Clin Invest. 2003;111(8):1231-1240.

Barnes MP. SativexÂŽ: clinical efficacy and tolerability in the treatment of symptoms of multiple sclerosis and neuropathic pain. Exp Opin Pharmacother. 2006;7(5):607-615.

Collin C, Ehler E, Waberzinek G, et al. A double-blind, randomized, placebo-controlled, parallel-group study of Sativex, in subjects with symptoms of spasticity due to multiple sclerosis. Neurol Res. 2010;32(5): 451-459.

Brower V. New pain drugs in pipeline, but challenges to usage remain. J Natl Cancer Inst. 2012;104(7):503-505.

Abrams DI, Couey P, Shade SB, Kelly ME, Benowitz NL. Cannabinoid-opioid interaction in chronic pain. Clin Pharmacol Ther.

2011;90(6):844-851.

Khasabova IA, Chandiramani A, HardingRose C, Simone DA, Seybold VS. Increasing 2-arachidonoyl glycerol signaling in the periphery attenuates mechanical hyperalge-

49.

50.

51.

52.

53.

54.

55.

sia in a model of bone cancer pain.

Pharmacol Res. 2011;64(1):60-67.

Howard J, Anie KA, Holdcroft A, Korn S, Davies SC. Cannabis use in sickle cell disease: a questionnaire study. Br J Haematol.

2005;131(1):123-128.

Elikkottil J, Gupta P, Gupta K. The analgesic potential of cannabinoids. J Opioid Manag.

2009;5(6):341-357.

Franklin JM, Carrasco GA. Cannabinoid receptor agonists upregulate and enhance serotonin 2A (5-HT(2A)) receptor activity via ERK1/2 signaling. Synapse. 2013;67 (3):145-159.

Desroches J, Bouchard JF, Gendron L, Beaulieu P. Involvement of cannabinoid receptors in peripheral and spinal morphine analgesia. Neuroscience. 2014;261:23-42.

Volkow ND, Baler RD, Compton WM, Weiss SRB. Adverse health effects of marijuana use. N Engl J Med. 2014;370(23):22192227.

Wilkinson ST, D'Souza DC. Problems with the medicalization of marijuana. JAMA. 2014;311(23):2377-2378.

Bachhuber MA, Saloner B, Cunningham CO, Barry CL. Medical Cannabis laws and opioid analgesic overdose mortality in the United States, 1999-2010. JAMA Intern Med. 2014;174(10):1668-1673.

577

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Blood Transfusion

Ferrata Storti Foundation

Metabolic pathways that correlate with posttransfusion circulation of stored murine red blood cells

Karen de Wolski,1 Xiaoyoun Fu,1,2 Larry J. Dumont,3 John D. Roback,4 Hayley Waterman,1 Katherine Odem-Davis,1 Heather L. Howie,1 and James C. Zimring1,2,5

Haematologica 2016 Volume 101(5):578-586

1 Bloodworks NW Research Institute, Seattle, WA, USA; 2University of Washington Department of Internal Medicine, Division of Hematology, Seattle, WA, USA; 3Geisel School of Medicine at Dartmouth, Lebanon; 4Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA, USA; and 5University of Washington Department of Laboratory Medicine and Department of Internal Medicine, Division of Hematology, Seattle, WA, USA

ABSTRACT

T Correspondence: jzimring@BloodworksNW.org

Received: November 7, 2015.

Accepted: February 15, 2016.

Pre-published: February 26, 2016.

ransfusion of red blood cells is a very common inpatient procedure, with more than 1 in 70 people in the USA receiving a red blood cell transfusion annually. However, stored red blood cells are a non-uniform product, based upon donor-to-donor variation in red blood cell storage biology. While thousands of biological parameters change in red blood cells over storage, it has remained unclear which changes correlate with function of the red blood cells, as opposed to being co-incidental changes. In the current report, a murine model of red blood cell storage/transfusion is applied across 13 genetically distinct mouse strains and combined with high resolution metabolomics to identify metabolic changes that correlated with red blood cell circulation post storage. Oxidation in general, and peroxidation of lipids in particular, emerged as changes that correlated with extreme statistical significance, including generation of dicarboxylic acids and monohydroxy fatty acids. In addition, differences in anti-oxidant pathways known to regulate oxidative stress on lipid membranes were identified. Finally, metabolites were identified that differed at the time the blood was harvested, and predict how the red blood cells perform after storage, allowing the potential to screen donors at time of collection. Together, these findings map out a new landscape in understanding metabolic changes during red blood cell storage as they relate to red blood cell circulation.

doi:10.3324/haematol.2015.139139

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/578

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

578

Introduction Transfusion of stored red blood cells (RBCs) is amongst the most frequent inpatient therapies; for example, in the United States, approximately 1 out of every 70 people are transfused each year. However, while the process of RBC collection, storage, and transfusion is well-controlled, there remains substantial variability in the quality of RBC units, presumably as a result of varying donor characteristics.1 It is understood that some donors’ RBCs consistently store poorly, and there are currently no methodologies to identify such donors (other than autologous 51-Cr survival studies).1 Thus, measuring and standardizing the quality of stored RBCs remains elusive.

The biological changes that occur during RBC storage, collectively called the “storage lesion” consist of myriad cellular and biochemical alterations.2,3 While the catalog of changes known to occur with RBC storage continues to grow into the thousands (with the application of omics technologies), it remains unclear which changes correlate to clinical performance of transfused RBCs and which are coincidental. Both historical and more recent data have demonstrated that RBCs change haematologica | 2016; 101(5)

Metabolic predictors of RBC storage in mice

during storage and the underlying metabolism of RBCs are both heritable traits in humans.4-9 Much attention has been paid in recent years to the concern that transfusion of longer stored RBC units may result in worse medical outcomes. These concerns are largely fueled by numerous retrospective studies reporting such an effect.10 Recently, several randomized controlled trials, in particular in clinical settings, have been completed, and no There difference was observed between groups.11-13 remains considerable debate surrounding this issue;14 however, this is unrelated to the goal of providing the best RBC units available, and to storing RBCs so as to generate the most efficacious product. The goal of the current study is to elucidate donor biology that affects RBC storage, and the ability of the RBC to circulate post transfusion.

To identify biochemical components of the storage lesion that are correlated with RBC performance, in particular the ability of stored RBCs to circulate post transfusion, we analyzed 13 commonly available inbred strains of mice.

Herein, we report significant variation amongst strains, both with respect to post-transfusion recovery of stored RBCs, and also the basic metabolomics of stored RBCs. Moreover, significant correlations between biochemical pathways and RBC storage are identified. In particular, lipid metabolism and oxidation (and underlying anti-oxidant pathways), emerged as a dominant theme in differences in RBC storage from genetically distinct murine donors. Together, these findings help to distinguish biochemical components of the storage lesion that correlate with RBC function in a mouse model. These studies provide mechanistic insight into the biology of RBC storage, define the landscape of murine specifics for ongoing basic research, and also highlight novel hypotheses to provide a rational basis for subsequent human studies.

recipients by intravenous tail vein injection. The remaining sample of stored RBCs was snap frozen in liquid nitrogen for future metabolomics analysis. Ratios of donor blood to HOD tracer RBCs was enumerated, both at baseline in the cells to be transfused (pre-transfusion mixture) and also in peripheral blood acquired from recipients 24 h after transfusion (post-transfusion samples collected into ACD). Pre-transfusion and post-transfusion RBCs were washed three times with PBS, and stained for 30 min with 0.5 µg anti-Fy3 (clone MIMA29) in 50 µl PBS. Stained cells were then washed three times with PBS and incubated with 0.2 µg APC goat-anti-mouse Igs (BD cat. 550826) in 50 µl PBS for 30 min, which stains RBCs bound with MIMA-29, and thus identifies HOD tracer RBCs. Cells were then washed three times, re-suspended in PBS, and analyzed by flow cytometry; 500 HOD+ events were counted for each sample. This approach utilizes MIMA-29 to stain HOD tracer RBCs with a color that is different than the GFP RBCs, which fluoresce spontaneously. Forward and side scatter were used to exclude fragmented or lysed RBC fragments, such that counts reflected intact RBCs. Final RBC survival was calculated by the formula: (Circulating Stored RBC/HOD RBC of post-transfusion sample) /(Stored RBC/HOD pre-transfusion sample) For experiments studying “fresh RBCS”, the RBCs were collected and processed identically to stored RBCs, with the only difference being they were used after collection and without further storage.

Ultrahigh performance liquid chromatography-tandem mass spectroscopy and gas chromatography-mass spectroscopy

Methods

Details of ultrahigh performance liquid chromatography-tandem mass spectroscopy (UPLC-MS/MS) and gas chromatographymass spectroscopy (GC-MS) are available in the Online Supplementary Appendix. Mass Spec was carried out by a commercial vendor (Metabolon Inc., NC, USA).

Mice

Statistical analysis

The following strains of mice were purchased from Jackson Labs (Bar Harbor, ME, USA): KK/HIJ, LG/J, AKR/J, FVB/NJ, C3H/HeJ, DBA/2J, NOD/ShiLtJ, 129X1/SvJ, 129S1/SvImJ, A/J, BTBR/ T+ tf/J, Balb/cByJ, C57Bl/6J). All were female and used for blood donation at 12-15 weeks of age. UbiC-GFP male mice, which are on a C57BL/6 background, were bred to FVB/NJ females in the Bloodworks NW Research Institute (BWNWRI) Vivarium and offspring were used as RBC recipients at 24-28 weeks of age. HOD mice, used as a fresh tracer population for transfused RBCs, were likewise bred in the BWNWRI Vivarium.

The HOD mouse was first described on an FVB background,15 but has now been backcrossed onto C57BL6J for greater than 20 generations. All mice were maintained on standard rodent chow and water in a temperature- and light-controlled environment. All experiments were performed according to approved Institutional Animal Care and Use Committee (IACUC) procedures.

Comparisons of recoveries between strains were performed separately on each experiment using one-way ANOVA followed

by Tukey’s multiple comparisons test, with a single pooled variance. In the case of stored RBCs, the data were first log10-transformed to approximate a normal distribution; the data from the fresh RBCs required no data transformation. Analyses were performed using Graphpad PRISM 6 software. Linear correlations were summarized by Pearson’s coefficient with P values by F-tests and q-values to account for multiple testing in the evaluation of statistical significance.

Collection and storage of blood

Whole blood (600 μl) was collected via cardiac puncture into 84 μl CPDA-1 (12.3%) in a sterile 1.7 mL snapcap microcentrifuge tube. Hematocrits were adjusted to approximately 75% (by removal of supernatant) and samples were stored in Eppendorf tubes for seven days at 4ºC. After storage, 50 μl stored RBCs were resuspended in 510 μl PBS and 5 μl of fresh HOD packed RBCs were added to the suspension as an internal control. The mixture of RBCs was then directly transfused into FVB/NJ x UbiC-GFP haematologica | 2016; 101(5)

Results Strain dependent variation in post-transfusion recoveries of stored red blood cells To test the genetic variation in RBC storage phenotype amongst mice, a panel of inbred strains was analyzed.

These strains were chosen due to commercial availability, well characterized biology and resolved genetic sequence.

Consideration was also given to sampling different phylogenetic arms (Figure 1A). A well-characterized murine model of RBC storage was utilized17 with minor modifications (see Methods). RBCs from each of the indicated test strains were collected, processed, and either transfused as “fresh” RBCs or stored for seven days. The post-transfusion circulation of test RBCs, 24 h after transfusion (24-h 579

K. de Wolski et al.

recovery) was determined by transfusing test RBCs into GFP-F1 recipients and enumerating GFP negative populations in peripheral blood 24 h post transfusion. This approach allows analysis of RBC recovery without having to risk altering the RBCs through any labeling procedure.

To isolate donor biology as a variable, a single common transfusion recipient was utilized for all donor strains; in particular, an F1 cross between UbiC-GFP and FVB mice (GFP-F1). RBCs from UbiC-GFP mice express high levels of green fluorescent protein (GFP) in RBCs and are on a C57BL/6 background. Thus, the GFP-F1 mice are heterozygous at all loci between B6 and FVB mice and have a GFP transgene.

To control for differences in transfusion volume and phlebotomy, and also to allow enumeration on a cell by cell basis, a â&#x20AC;&#x153;fresh tracerâ&#x20AC;? control RBC population was added to each test RBC population prior to transfusion (Figure 1B, left panel). The tracer population consisted of HOD RBCs, which express an easily detectable transgene on RBCs. Essentially no GFP negative events are observed in untransfused recipient mice (Figure 1B, upper right panel). The ratio of test RBCs to tracer RBCs 24 h after transfusion (Figure 1B, lower right panel) was then corrected to the pre-transfusion ratio. Recovery was evaluated for each strain for both seven days of storage and in freshly isolated RBCs. Three independent experiments were performed for stored RBCs from each of the indicated strains, and the

results of each experiment are shown (Figure 1C).

Whereas there was relative consistency in a given strain across experiments, there was substantial strain-to-strain variability in RBC recoveries after storage; no statistically significant differences in 24-h recovery were observed from freshly isolated samples from the 13 different strains (Figure 1D). Extensive ANOVA comparisons between each strain, for both stored and fresh RBCs, were performed and multiple differences of statistical significance were noted only for stored RBCs (Online Supplementary Table S1).

General metabolomic analysis of strain variation in red blood cell storage For each experiment, prior to transfusion, a sample of the RBCs was snap-frozen. Samples were subsequently subjected to analysis of metabolites by LC-MS/MS, resulting in the resolution and relative quantification of 520 compounds of known identity. Principal component analysis (PCA) showed a clear distinction between fresh and stored RBC samples within each of the 13 mouse strains, as a function of the RBC metabolome (Figure 2). In addition, fresh samples from the C57Bl/6J strain demonstrated limited segregation from the general sample groupings and suggest that this strain may exhibit a base-line metabolic profile that further differentiates it from other strains. However, there was otherwise no clear distinction in general metabolomes between strains as a function of storage.

A

B

C

D

Figure 1. Twenty-four hour recovery of fresh and stored red blood cells (RBCs) across 13 inbred strains of mice. (A) Phylogenetic distribution of mouse strains used for this study (reproduced from Genome Res 2004:14:1806-11 with kind permission of Dr. Petkov and Genome Research16). (B) Representative flow cytometry plots are shown to indicate the enumeration of fresh tracer and test RBCs in a pre-transfusion sample (left panel). Recipient GFP+ RBCs are shown, including empty gates where fresh tracer and test RBCs appear (upper right panel). The final mixture in a recipient mouse 24 h after transfusion is shown (lower right panel). (C) Individual results of three out of three experiments of stored RBCs is shown. (D) Individual results of three out of three experiments of fresh RBCs is shown (only 2 replicates were obtained for fresh RBCs for KK/HiJ, LG/J and the C3H/HeJ mouse strains).

580

haematologica | 2016; 101(5)

Metabolic predictors of RBC storage in mice

Glucose metabolism of red blood cell storage across inbred mouse strains Analysis of RBC storage has traditionally focused on generation of ATP as a necessary energy source for maintenance of RBC physiology. In addition, much attention has been paid to generation and maintenance of 2,3-DPG, due to its ability to regulate oxygen affinity by hemoglobin. Analysis of glycolytic metabolites across strains demonstrated decreases in glucose during storage in all cases (Figure 3A). Likewise, in all strains, 2,3-DPG dropped substantially at seven days storage (Figure 3B).

The end point of glycolysis (lactate) had a similar increase in stored RBCs from each strain (Figure 3C). ATP was not detected as a metabolite by this approach, and thus was not assessed in the current study.

Metabolites and pathways that correlate with red blood cell storage To investigate which metabolites (and metabolic pathways) may be associated with the ability of RBCs to survive post transfusion, metabolites in stored RBC units were chosen based upon the following criteria (correlation greater than 0.5 or less than -0.5, P<0.05, q value <0.01; see Online Supplementary Table S2 for a full list of compounds). Using these criteria, 11 metabolites had a positive correlation with RBC storage (Online Supplementary Table S2, stored RBCs, positive correlation), 9 of the 11 metabolites identified were lipids, although various lipid subspecies were identified, including free fatty acids (polyunsaturated, and monohydroxy), lysolipids, and glycerol species. Also noted was vitamin E (alpha-tocopherol), a common cellular anti-oxidant most involved with oxidative stress in the lipid compartment. 12-HETE is an arachidonic acid (AA) metabolite that has biological properties. Finally, tryptophan was noted. As examples of the typical distributions, both of the fatty acids docos-

apentaenoate (DPA) and docosahexaenoate (DHA) showed a pattern (in general) of decrease over storage in strains that stored poorly and increase in storage of strains that stored well (Figure 4A and C) resulting in a positive correlation with final levels and 24-h RBC recovery (Figure 4B and D).

A total of 49 metabolites had a negative correlation with stored RBCs that fit the above criteria, the majority of which were lipid species (Online Supplementary Table S2, stored RBCs, negative correlation). Of these, 19 were either dicarboxylic acids (DCAs) or monohydroxy fatty acids (MHAs), known to be associated with lipid oxidation and peroxidation, 10 of which had inverse correlations greater than 0.80 with both P values and q values less than 0.0001. In all of these cases, levels were low at time of collection and increased over storage, to a greater extent in strains that stored poorly. Representative box plots of the relative amounts of a DCA (dodecanedioate) and a MHA (16-hydroxypalmitate) are shown (Figure 4E and G) along with the correlation plots between these analytes and 24-h RBC recovery (Figure 4F and H). Of note, among the MHAs identified are products with known biological function, including 13-HODE, 9-HODE and the dihydroxy fatty acid (9,10-DiHOME). In addition, 4-hydroxy2-nonenal fit these criteria, and is a well-known product and mediator of lipid peroxidation.18 5-HETE, which is an eicosanoid, was also observed to have a similar pattern (Figure 4I and J). Of note, a related species (12-HETE) showed an opposite correlation (Figures 4K and L), although to a less dramatic effect. Two lysolipids and a monoacylglycerol were also observed (Online Supplementary Table S2). In addition to lipid species, negative correlates also included metabolites involved in glutathione metabolism (4-hydroxy-nonenal-glutathione and methionine sulfoxide).

To test the hypothesis that base-line metabolite levels,

Figure 2. Principal component analysis of metabolites measured in fresh and stored red blood cells (RBCs). PCA for the indicated strains (based on color) are shown for both fresh (spheres) and stored (cylinders) RBCs.

haematologica | 2016; 101(5)

581

K. de Wolski et al.

present at time of blood collection, would predict quality of RBC storage over time, correlations were calculated between metabolite levels in freshly collected RBCs and post-transfusion recovery after storage (Online Supplementary Table S2, fresh RBCs). The same cut-off values of significance were used as above (correlation >0.5 or <-0.5, P<0.05, q value <0.01). Fourteen metabolites met these criteria with regards to positive correlation, in a variety of pathways, including amino acid metabolism, pyrimidine metabolism, and the urea cycle (Online Supplementary Table S2, fresh RBCs, positive correlation).

Aspartate is presented as an example of a positively correlating analyte (Figure 4M). Twenty-four metabolites met the criteria with a negative correlation (Online Supplementary Table S2, fresh RBCs, negative correlation).

Like the negative correlation of metabolites after storage, a substantial clustering of fatty acid metabolites was

observed, including 9 long chain fatty acids of different composition, polyunsaturated fatty acids (linoleate and derivatives), and monoacylglycerols. As an example, palmitate (16:1) is shown (Figure 4N). In addition, tocopherol, 4-hydroxy-nonenal-glutathione, and other amino acid metabolites were observed, which is expanded on in the discussion of anti-oxidant pathways below. Finally, correlations were analyzed for the fold change of a given analyte over storage by calculating the ratio in fresh RBCs compared to seven days of storage (Online Supplementary Table S2, ratio of stored to fresh). The analysis of fold change reveals the same general patterns as observed by analyzing data from seven days of storage, with 17 ratios having a positive correlation and 33 ratios having a negative correlation, which fit the same significance criteria as above. In general, the same classes of compounds emerged, with a few notable differences, discussed below.

A

B

C

Figure 3. Products of glycolysis are common across strains and do not correlate with 24-h recovery. (A) Glucose levels were equivalent in fresh red blood cells (RBCs) from each strain and decreased commonly after storage. (B) 2,3-DPG was equivalent across strains and uniformly decreased after seven days of storage.

(C) Lactate was uniformly low in fresh RBCs and increased equivalently, over storage, for all strains analyzed. Open boxes represent levels at time of collection whereas gray boxes indicate levels after storage. All levels of metabolites are relative concentrations based upon areas under the peaks and are averages for all three experiments shown in Figure 1.

582

haematologica | 2016; 101(5)

Metabolic predictors of RBC storage in mice

Analysis of common anti-oxidant pathways Due to the preponderance of lipid peroxidation products, we analyzed differences in common anti-oxidant pathways. Alpha-tocopherol (vitamin E) is a major hydrophobic anti-oxidant that mainly exerts its effects in

A

B

C

D

E

F

G

H

I

J

K

M

haematologica | 2016; 101(5)

L

N

lipid membranes. Levels of alpha-tocopherol in fresh RBCs negatively correlated with recoveries of stored RBCs (Figure 5A and F, top panel). At the same time, levels of alpha-tocopherol in stored RBCs positively correlated with recoveries (Figure 5F, middle panel). In other words,

Figure 4. Levels of the indicated metabolite are shown in fresh (white) and stored (gray) samples, as are the correlations of the metabolite with 24-h red blood cell (RBC) recovery. (A and B) DPA, (C and D) DHA, (E and F) dodecanedioate, (G and H) 16hydroxypalmitate, (I+J) 5-HETE, (K and L) 12-HETE. Correlations of levels of aspartate (M) and palmitate (N) in freshly isolated RBCs are shown versus the 24-h RBC recovery after seven days of storage. Open boxes represent levels at time of collection whereas gray boxes indicate levels after storage. Correlation calculations represent Pearsonâ&#x20AC;&#x2122;s coefficient. All levels of metabolites are relative concentrations based upon areas under the peaks and are averages for all three experiments shown in Figure 1.

Correlation plots show combined data from all three of the indicated experiments in Figure 1.

583

K. de Wolski et al.

the less alpha-tocopherol present at the time of collection and the more alpha-tocopherol that remained after storage, the better the RBC recoveries. These data are inconsistent with a simple model of increased alpha-tocopherol providing increased resistance to oxidation. However, juxtaposition of starting and ending levels of alpha-tocopherol showed that strains that stored poorly started with higher alpha-tocopherol levels than strains that stored well; however, by the end of storage, strains that stored poorly had lower levels of alpha-tocopherol than strains that stored well (Figure 5A). Strains that stored well had little change in alpha-tocopherol at all, whereas poorly storing strains rapidly depleted their alpha-tocopherol.

This trend becomes clear when the correlation(s) are analyzed with regards to the ratio of alpha-tocopherol from fresh RBCs to stored RBCs (Figure 5F, bottom panel).

These data are equally consistent with poorly storing strains generating more oxidative stress, having decreased anti-oxidant regeneration, or both. Alternatively, alphatocopherol could represent non-causal association and be a surrogate marker.

Although less dramatic than the pattern seen with alpha-tocopherol, GSH showed a similar trend (Figures 5B and G). Since the most common anti-oxidant pathway of GSH is for 2 GSH molecules to form GSSG; GSSG levels were examined (Figure 5C); however, no obvious pattern emerged to correlate with changes in GSH levels. In contrast, a clear trend was seen with the analysis of 4hydroxy-nonenal-glutatione, a common product of GSH anti-oxidant activity upon a product of lipid peroxidation (Figure 5D). Of note, increases in 4-hydroxy-nonenal-glutathione from fresh RBCs to stored RBCs correlated with poor RBC recoveries (Online Supplementary Table S2 and data not shown). Because vitamin C serves as an intermediate between GSH and alpha-tocopherol, vitamin C levels were examined, but no meaningful trend was observed (Figure 5E) and ascorbate levels did not correlate with RBC storage (data not shown). Finally, although its correlation was 0.48 (and thus technically below the 0.5 cut off), N-acetylcysteine (which is both an antioxidant and also a GSH precursor) had levels in stored RBCs that correlated well with 24-h RBC recovery (Figure 5H).

Discussion The current report makes the observation that, similar to donor-to-donor variation in storage of human RBCs, genetically distinct stains of mice have a wide range of RBC storage biology regarding both metabolome and post-storage circulation. The ability of an RBC to circulate does not guarantee its full function (e.g. traversing micocapillary beds, delivering oxygen to tissues, removing CO2, etc.); however, it seems a fair statement that an RBC that does not circulate will certainly not function. Thus, 24-h recovery is a meaningful, if not all encompassing, metric and is currently used as licensing criteria for RBC storage systems.

The current studies are carried out in a tractable animal model; however, like all models, it suffers the potential that it may not translate into human biology.

Nevertheless, it serves to generate new knowledge of mammalian RBC storage biology which may translate into humans, and which provides (from amongst the numerous changes in RBCs during storage) a focused list 584

of compounds and pathways to test in human RBC storage. It is worth noting that lipid peroxidation is a wellknown component of storage of human RBCs.19-23 In addition, a number of studies have been reported regarding metabolomics of human RBCs and these show heritable differences amongst donors and different storage conditions;6,7,24-28 to the best of our knowledge no human studies have been reported that have combined metabolomics and in vivo recovery.

It is worth noting that, in the current study, the stored RBCs were not leukoreduced. The majority of (although certainly not all) stored RBCs in humans are leukoreduced.

Given the volume of mouse blood required for leukoreducction, this approach was not considered feasible in the setting of broad screening of multiple strains. However, we have previously reported metabolomics analysis of B6 and FVB strains, using filter leukoreduced products. In this setting, the same lipid oxidation pathways are associated with poor storage.29 In addition, dicarboxylic acids remain associated with poor storage in leukoreduced RBCs (data not shown). Thus, while some of the associated change may be due to contaminating leukocytes and/or platelets, the major findings of lipid peroxidation persist even with leukoreduction. A second consideration is that a 7-day storage time was chosen for this study, since this allowed the widest range of differences between strains to be observed, while still allowing for the best storing strains to have recoveries of greater than 75% (in line with FDA standards for human RBC storage).

To control for potential differences in recipient phagocytic biology, a single common recipient strain of mice was used for all donors in the current study. This approach also allowed an experimental design in which donor RBCs did not have to be manipulated or labeled prior to transfusion. However, there is a theoretical risk that one is crossing alloimmune barriers between strains, which could account for some differences in survival. Naturally occurring RBC alloantibodies (analogous to ABO in humans) have not been described in mice, and 24-h recovery is typically too short a period of time for adaptive humoral responses to occur; thus, we did not predict any problems with alloimmunity in the current studies. In support of this notion, there were no statistically significant differences in 24-h recovery of freshly isolated RBCs, thus indicating that, even if alloantibodies were present, they had no clear functional outcome. Nevertheless, one must give theoretical consideration to possible effects of crossing strain barriers.

The biological underpinnings that regulate lipid oxidation across strains are unclear; however, alpha-tocopherol and GSH are candidates for being involved in the underlying processes that lead to lipid peroxidation. Alpha-tocopherol does have the ability to inhibit chemical oxidation of RBCs;30 however, the extent to which such is a normal pathway during RBC storage is unclear and has only been tested in an in vitro setting.31 Of interest, it has recently been reported that vitamin C and N-acetylcysteine mitigate oxidative stress in in vitro human RBC studies.32 In vivo studies in mice have shown that vitamin C supplementation can improve storage as measured by 24-h recovery.33 The generation of products of lipid oxidation not only gives insight into underlying RBC storage biology, but may in themselves represent a biologically significant component of transfused RBCs. Among the lipid oxidation products that were observed to both increase with haematologica | 2016; 101(5)

Metabolic predictors of RBC storage in mice

storage and negatively correlate with RBC recoveries are 5-HETE and the bioactive lipids 9,10-DiHOME, and (13HODE+9-HODE). In addition, 4-hydroxy-2-nonenal has biological and signaling properties, in addition to being a common indicator of lipid peroxidation. Interestingly, in contrast to 5-HETE, 12-HETE had a significant positive correlation to RBC storage. Both 5-HETE and 12-HETE are arachidonic acid metabolites generated by separate lipoxygenase enzymes. Bioactive lipids are known to be involved in complex biologies including inflammation, coagulation, vascular tone and immunity. Bioactive lipids have been implicated in the pathogenesis of transfusionrelated acute lung injury (TRALI), a potentially lethal

A

sequela of blood transfusion.34-36 It is also worth considering the source of substrates for lipid oxidation pathways, such as eicosanoid generation. Levels of both medium and long chain fatty acids were strongly correlated with RBC recovery, and lysolipids and monoacylglycerols increased with storage, suggesting release of the observed free fatty acids from glycerophospholipid breakdown. It is unclear if release of free fatty acids from phospholipids precedes lipid oxidation as a separate step or is the result of lipid peroxidation, but it is clear that both correlate.

Increases in long chain fatty acids at the time of RBC collection strongly correlated with the post-storage RBC recovery. Of these, 4 particular long chain fatty acids had a nega-

G

F

B

C

D

H

E

Figure 5. Anti-oxidant pathways during red blood cell (RBC) storage. Levels of alpha-tocopherol in freshly collected RBCs and after storage are shown (A). Correlation plots are shown for alpha-tocopherol for levels in fresh, stored, and the ration of fresh/stored (F). Levels of GSH in freshly collected RBCs and after storage are shown (B).

Correlation plots are shown for GSH for levels in fresh, stored, and the ration of fresh/stored (G). Levels of GSSG (C), 4-hydroxy-nonenal-glutathione (D), and ascorbate (E) are shown in freshly collected RBCs and after storage. Correlations between the ratio of N-acetylcysteine (fold change) is shown (H). Open boxes represent levels at time of collection; gray boxes indicate levels after storage. Correlation calculations represent Pearsonâ&#x20AC;&#x2122;s coefficient. All levels of metabolites are relative concentrations based upon areas under the peaks and are averages for all three experiments shown in Figure 1. All horizontal axes labeled 24-h recovery represent RBCs circulating 24-h post transfusion, as described in Methods. Correlation plots show combined data from all three of the indicated experiments in Figure 1.

haematologica | 2016; 101(5)

585

K. de Wolski et al.

tive correlation both in fresh RBCs and stored RBCs (palmitate, palmitoleate,10-heptadecenoate, and cis-vaccenate).

There was no significant change in the levels of these 4 long chain fatty acids between time of collection and after storage. Although one cannot rule out a simultaneous increase in production and consumption resulting in an unaltered steady state, a more likely explanation is that increased lipid breakdown (or processes that are associated with it), as a function of the normal RBC biology, predispose RBCs to poor storage. In contrast to the above long chain fatty acids, omega-3 fatty acids DPA and DHA had a positive correlation with 24-h recovery when measured after storage. EPA can be converted into DPA, which then can be converted to DHA. EPA was detected in this panel, but had no correlation to RBC recoveries. These findings are of potential practical value, as they may serve as criteria to evaluate how RBCs will store through screening at time of donation.

In summary, a model emerges from the current studies

References 1. Dumont LJ, AuBuchon JP. Evaluation of proposed FDA criteria for the evaluation of radiolabeled red cell recovery trials.

Transfusion. 2008;48(6):1053-1060.

2. Hess JR. Red cell changes during storage.

Transfus Apher Sci. 2010;43(1):51-59.

3. Hess JR. Red cell storage. J Proteomics.

2010;73(3):368-373.

4. Brewer GJ. Genetic and population studies of quantitative levels of adenosine triphosphate in human erythrocytes. Biochem Genet. 1967;1(1):25-34.

5. Dern RJ, Wiorkowski JJ. Studies on the preservation of human blood. IV. The hereditary component of pre- and poststorage erythrocyte adenosine triphosphate levels. J Lab Clin Med. 1969;73(6):10191029.

6. van 't Erve TJ, Doskey CM, Wagner BA, et al. Heritability of glutathione and related metabolites in stored red blood cells. Free Radic Biol Med. 2014;76:107-113.

7. van 't Erve TJ, Wagner BA, Martin SM, et al.

The heritability of metabolite concentrations in stored human red blood cells.

Transfusion. 2014;54(8):2055-2063.

8. van't Erve TJ, Wagner BA, Martin SM, et al.

The heritability of hemolysis in stored human red blood cells. Transfusion. 2015; 55(6):1178-1185.

9. van 't Erve TJ, Wagner BA, Ryckman KK, Raife TJ, Buettner GR. The concentration of glutathione in human erythrocytes is a heritable trait. Free Radic Biol Med. 2013; 65:742-749.

10. Zimring JC. Established and theoretical factors to consider in assessing the red cell storage lesion. Blood. 2015;125(14):21852190.

11. Fergusson DA, Hebert P, Hogan DL, et al.

Effect of fresh red blood cell transfusions on clinical outcomes in premature, very lowbirth-weight infants: the ARIPI randomized trial. JAMA. 2012;308(14):1443-1451.

12. Lacroix J, Hebert PC, Fergusson DA, et al.

Age of transfused blood in critically ill adults. N Engl J Med. 2015;372(15):14101418.

13. Steiner ME, Ness PM, Assmann SF, et al.

Effects of red-cell storage duration on patients undergoing cardiac surgery. N Engl J Med. 2015;372(15):1419-1429.

586

in which lipid peroxidation is associated with poor 24-h recovery. Future experimental studies in mice will be required to test the functional relevance of the tocopherolascorbate-GSH axis and lipid peroxidation. Human studies will also be required to assess the extent to which the observations generated herein predict human RBC storage biology. The further resolution of these issues is a much needed step in advancing the ability to predict and control the quality of stored human RBCs. Acknowledgments We would like to acknowledge the technical and scientific staff at Metabolon Inc., who carried out the mass spectroscopy analysis of the RBC specimens.

Funding This work was supported, in part, by a grant from the National Heart Lung and Blood Institute (HL095479-05).

14. Qu L, Triulzi DJ. Clinical effects of red blood cell storage. Cancer Control. 2015; 22(1):26-37.

15. Desmarets M, Cadwell CM, Peterson KR, Neades R, Zimring JC. Minor histocompatibility antigens on transfused leukoreduced units of red blood cells induce bone marrow transplant rejection in a mouse model.

Blood. 2009;114(11):2315-2322.

16. Petkov PM, Ding Y, Cassell MA, et al. An efficient SNP system for mouse genome scanning and elucidating strain relationships. Genome Res. 2004 Sep;14(9):18061811.

17. Gilson CR, Kraus TS, Hod EA, et al. A novel mouse model of red blood cell storage and posttransfusion in vivo survival.

Transfusion. 2009;49(8):1546-1553.

18. Uchida K. 4-Hydroxy-2-nonenal: a product and mediator of oxidative stress. Prog Lipid Res. 2003;42(4):318-343.

19. Arun P, Padmakumaran Nair KG, Manojkumar V, Deepadevi KV, Lakshmi LR, Kurup PA. Decreased hemolysis and lipid peroxidation in blood during storage in the presence of nicotinic acid. Vox Sang.

1999;76(4):220-225.

20. Karon BS, van Buskirk CM, Jaben EA, Hoyer JD, Thomas DD. Temporal sequence of major biochemical events during blood bank storage of packed red blood cells.

Blood Transfus. 2012;10(4):453-461.

21. Knight JA, Searles DA, Blaylock RC. The effect of metal chelators on lipid peroxidation in irradiated erythrocytes. Ann Clin Lab Sci. 1992;22(6):417-422.

22. Knight JA, Voorhees RP, Martin L. The effect of metal chelators on lipid peroxidation in stored erythrocytes. Ann Clin Lab Sci. 1992;22(4):207-213.

23. Knight JA, Voorhees RP, Martin L, Anstall H. Lipid peroxidation in stored red cells.

Transfusion. 1992;32(4):354-357.

24. D'Alessandro A, Blasi B, D'Amici GM, Marrocco C, Zolla L. Red blood cell subpopulations in freshly drawn blood: application of proteomics and metabolomics to a decades-long biological issue. Blood Transfus. 2013;11(1):75-87.

25. D'Alessandro A, Hansen KC, Silliman CC, Moore EE, Kelher M, Banerjee A. Metabolomics of AS-5 RBC supernatants following routine storage. Vox Sang.

2015;108(2):131-140.

26. D'Alessandro A, Nemkov T, Hansen KC,

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

Szczepiorkowski ZM, Dumont LJ. Red blood cell storage in additive solution-7 preserves energy and redox metabolism: a metabolomics approach. Transfusion.

2015;55(12):2955-2966.

D'Alessandro A, Nemkov T, Kelher M, et al. Routine storage of red blood cell (RBC) units in additive solution-3: a comprehensive investigation of the RBC metabolome.

Transfusion. 2015;55(6):1155-1168.

Roback JD, Josephson CD, Waller EK, et al.

Metabolomics of ADSOL (AS-1) red blood cell storage. Transfus Med Rev. 2014;28(2):41-55.

Zimring JC, Smith N, Stowell SR, et al.

Strain-specific red blood cell storage, metabolism, and eicosanoid generation in a mouse model. Transfusion. 2014;54(1):137148.

Claro LM, Leonart MS, Comar SR, do Nascimento AJ. Effect of vitamins C and E on oxidative processes in human erythrocytes. Cell Biochem Funct. 2006;24(6):531535.

Leonart MS, Weffort-Santos AM, Munoz EM, Higuti IH, Fortes VA, Nascimento AJ. Effect of vitamin E on red blood cell preservation. Braz J Med Biol Res. 1989;22(1):8586.

Pallotta V, Gevi F, D'Alessandro A, Zolla L. Storing red blood cells with vitamin C and N-acetylcysteine prevents oxidative stressrelated lesions: a metabolomics overview.

Blood Transfus. 2014;12(3):376-387.

Stowell SR, Smith NH, Zimring JC, et al.

Addition of ascorbic acid solution to stored murine red blood cells increases posttransfusion recovery and decreases microparticles and alloimmunization. Transfusion.

2013;53(10):2248-2257.

Silliman CC, Moore EE, Kelher MR, Khan SY, Gellar L, Elzi DJ. Identification of lipids that accumulate during the routine storage of prestorage leukoreduced red blood cells and cause acute lung injury. Transfusion.

2011;51(12):2549-2554.

Silliman CC, Bjornsen AJ, Wyman TH, et al. Plasma and lipids from stored platelets cause acute lung injury in an animal model.

Transfusion. 2003;43(5):633-640.

Silliman CC, Voelkel NF, Allard JD, et al.

Plasma and lipids from stored packed red blood cells cause acute lung injury in an animal model. J Clin Invest. 1998;101(7):14581467.

haematologica | 2016; 101(5)

ARTICLE

Blood Transfusion

Impaired killing of Candida albicans by granulocytes mobilized for transfusion purposes: a role for granule components

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

Roel P. Gazendam,1 Annemarie van de Geer,1 John L. van Hamme,1 Anton T.J. Tool,1 Dieke J. van Rees,1 Cathelijn E.M. Aarts,1 Maartje van den Biggelaar,1 Floris van Alphen,1 Paul Verkuijlen,1 Alexander B. Meijer,1 Hans Janssen,2 Dirk Roos,1 Timo K. van den Berg1 and Taco W. Kuijpers1,3

Sanquin Research, and Landsteiner Laboratory, Academic Medical Center, University of Amsterdam; 2The Netherlands Netherlands Cancer Institute, Division of Cell Biology, Amsterdam; 3Emma Childrenâ&#x20AC;&#x2122;s Hospital, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands 1

Haematologica 2016 Volume 101(5):587-596

ABSTRACT

G

ranulocyte transfusions are used to treat neutropenic patients with life-threatening bacterial or fungal infections that do not respond to anti-microbial drugs. Donor neutrophils that have been mobilized with granulocyte-colony stimulating factor (G-CSF) and dexamethasone are functional in terms of antibacterial activity, but less is known about their fungal killing capacity. We investigated the neutrophil-mediated cytotoxic response against C. albicans and A. fumigatus in detail. Whereas G-CSF/dexamethasone-mobilized neutrophils appeared less mature as compared to neutrophils from untreated controls, these cells exhibited normal ROS production by the NADPH oxidase system and an unaltered granule mobilization capacity upon stimulation. G-CSF/dexamethasone-mobilized neutrophils efficiently inhibited A. fumigatus germination and killed Aspergillus and Candida hyphae, but the killing of C. albicans yeasts was distinctly impaired. Following normal Candida phagocytosis, analysis by mass spectrometry of purified phagosomes after fusion with granules demonstrated that major constituents of the antimicrobial granule components, including major basic protein (MBP), were reduced. Purified MBP showed candidacidal activity, and neutrophil-like Crisp-Cas9 NB4-KO-MBP differentiated into phagocytes were impaired in Candida killing. Together, these findings indicate that G-CSF/dexamethasone-mobilized neutrophils for transfusion purposes have a selectively impaired capacity to kill Candida yeasts, as a consequence of an altered neutrophil granular content.

Introduction The intensified use of chemotherapy and immunosuppressive treatment modalities and related neutropenia results in increased morbidity and mortality due to bacterial and fungal infections.1,2 Invasive fungal infections in particular are characterized by mortality rates of up to 90%, and this is in a large part due to the growing resistance to antifungals.1-3 Granulocyte transfusions are administered to critically ill patients with neutropenia or neutrophil dysfunction and infections that do not respond to antimicrobial therapy.4,5 Granulocyte-colony stimulating factor (G-CSF) and dexamethasone treatment of donors increases the yield of granulocytes for transfusion (GTX), but it also recruits a distinct pool of neutrophils from the bone marrow with an altered gene expression profile.6 We previously found that certain genes known to be involved in the antifungal immune response were downregulated in G-CSF/dexamethasone-mobilized neutrophils.6 However, it is not known whether this altered gene expression profile also impacts the cytotoxic response haematologica | 2016; 101(5)

Correspondence: r.gazendam@sanquin.nl

Received: September 15, 2015.

Accepted: January 14, 2016.

Pre-published: January 22, 2016. doi:10.3324/haematol.2015.136630

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/587

Š2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

587

R.P. Gazendam et al.

against the clinically relevant fungal pathogens, Aspergillus fumigatus and Candida albicans.

In general, human neutrophil killing mechanisms include reactive oxygen species (ROS) production by the NADPH oxidase system and non-oxidative cytotoxic mechanisms.7,8 G-CSF has been shown in vitro to enhance neutrophil chemotaxis, phagocytosis and NADPH oxidase activation,9,10 whereas dexamethasone exerts immunosuppressive effects on human and murine neutrophil function.11,12 We and others have shown that neutrophils from G-CSF/dexamethasone-treated donors display prolonged survival rates, intact NADPH oxidase activation and a normal antimicrobial response against gram-positive and gram-negative bacteria.13-16 Nevertheless, G-CSFmobilized donor neutrophils have been reported to contain reduced levels of lactoferrin for example, derived from the specific granules, as compared to neutrophils from untreated controls.17 During granulopoiesis granular proteins are synthesized, and when released by the mature neutrophil these proteins employ cytotoxic activity or limit the availibility of nutrients for the pathogen.7,18 These granule-dependent cytotoxic mechanisms are pivotal in the host defense against fungal pathogens. It has, for instance, been shown that the human neutrophil inhibition of A. fumigatus germination depends on specific granule-derived lactoferrin, which mediates the sequestration of iron.19 Granular extracts from human neutrophils, containing in particular cathepsin G and major basic protein (MBP), but also azurocidin and defensins, demonstrated candidacidal activity.20,21 Previously, we found that genes involved in the antifungal response, including the gene that encodes for CARD9, were downregulated in the GCSF/dexamethasone-mobilized neutrophils.6 Human CARD9 deficiency is characterized by invasive fungal infection and impaired neutrophil candidacidal activity.22 In the present study we have investigated the killing of fungi by G-CSF/dexamethasone-mobilized neutrophils in detail. Our results demonstrate that G-CSF/dexamethasone-mobilized neutrophils have immature characteristics, produce normal amounts of ROS, efficiently inhibit A. fumigatus germination and kill their hyphae. However, the killing of C. albicans was substantially impaired in G-CSF/dexamethasone-mobilized neutrophils relative to their normal counterparts. Analyses of the phagosomes after fusion with granules revealed reduced levels of antimicrobial proteases, including MBP, in G-CSF/dexamethasone-mobilized neutrophils. Interestingly, MBP is required for the killing of Candida and contributes to the observed killing defect in G-CSF/dexamethasone-mobilized neutrophils.

Methods Cell isolation and study approval Heparinized venous blood was collected from healthy granulocyte donors, with or without G-CSF/dexamethasone treatment.

Donors received G-CSF (600 μg subcutaneously) and dexamethasone (8 mg orally), 16 to 20 hours before blood donation. The study was approved by the Sanquin Research Ethical Medical Committee (Amsterdam, The Netherlands) and in accordance with the Declaration of Helsinki (version Seoul 2008).

The granulocytes were isolated by centrifugation of heparin blood over isotonic Percoll with a specific density of 1.076 g/ml and after lysis of the erythrocytes with isotonic 588

Table 1. Distinct composition of the G-CSF/dexamethasone-mobilized phagosomes after fusion with granules.

Protein

Function

Major Basic Protein Homolog (MBPH) Resistin (RETN) Poly(rC)-binding protein 1 (PCBP1) Serine/arginine-rich splicing factor 4 (SRSF4) Adenylyl cyclase-associated protein 1 (CAP1) Lipocalin-2 (LCN2)

C-type lectin, cytotoxin Pro-inflammatory RNA binding RNA binding

Major Basic Protein (MBP) Eosinophil peroxidase (EPX) Peptidoglycan recognition protein 1 (PGLYRP1) Vesicle-associated membrane protein 8 (VAMP8) Grancalcin (GCA)

Receptor resistin, filament dynamics Ferric siderophore, metalloprotease C-type lectin, cytotoxin Peroxidase activity Peptidoglycan receptor Vesicular fusion Pro-inflammatory

Neutrophils from healthy controls and G-CSF/dexamethasone-treated donors were stimulated with C. albicans for 45 minutes; subsequently, the phagosomes were isolated and analyzed by Mass Spectrometry. The proteins that were significantly decreased in the neutrophil phagosomes from the G-CSF/dexamethasone-treated donors as compared to untreated controls are shown. N=5, FDR = 0.05 and S = 0.6

NH4Cl-KHCO3-EDTA solution resuspended in Hepes-buffered saline solution (Hepes-buffer).22

Killing of microorganisms The microbicidal activity of granulocytes was assessed for Candida albicans (strain SC5314) and a clinical isolate of Aspergillus fumigatus. The microorganisms were grown under aerobic conditions at 30°C for 7 days on potato dextrose agar (Aspergillus) (Neogen, Lansing, Michigan, USA) or overnight in Luria-Bertani broth (LB) (Candida).

Hereafter, the Aspergillus yeasts were collected by centrifugation, washed twice in PBS and resuspended in RPMI 1640 medium (Life Technologies, Bleiswijk, The Netherlands). Opsonization was performed with 10% v/v human pooled serum for 15 minutes, at 37°C. For the neutrophil-mediated inhibition of germination, the same number of Aspergillus yeast cells were incubated with an increasing number of neutrophils (0.25, 0.5, 1.0 or 1.5 *105 cells/ml, E:T 1:2000, 1:1000, 1:500 or 1:350, respectively) in a 96well plate overnight at 37°C in RPMI 1640 medium containing L-glutamine and 10% (v/v) FCS (Life Technolgies). Subsequently, the neutrophils were lysed in water/NaOH, pH 11.0 and incubated with MTT (3-[4,5-dimethylthiazol-2-yl]-2,5- diphenyltetrazolium bromide; thiazolyl blue) (Sigma). After the addition of acidic isopropanol (0.04 M HCl) the optical density was measured in the plate reader at 570 nm (Tecan, Männedorf, Switzerland) and the A. fumigatus hyphae viability was calculated as compared to the incubation without neutrophils (i.e. 100%). To assess the A. fumigatus and the C. albicans hyphae killing, neutrophils (0-1x105 cells) were cultured for one hour (Aspergillus) or 2 hours (Candida) on a preformed monolayer at 37 °C. Hereafter, the cells were lysed in water/NaOH, pH 11.0 and incubated with MTT. The absorbance of the acidic isopropanol-diluted samples was measured on the plate reader (Tecan) and the viability calculated as a percentage of the viability after incubation without neutrophils.

To determine the neutrophil killing of Candida, the yeasts were collected by centrifugation, washed twice in PBS and resuspended haematologica | 2016; 101(5)

Mobilized neutrophils and impaired Candida killing

A

B Figure 1. Maturation and NADPH oxidase activity in G-CSF/dexamethasone-mobilized neutrophils. (A) Neutrophils from untreated controls or G-CSF/dexamethasonetreated controls were stained for the expression of maturation markers EMR3, CXCR4, CD16, CD32, CD11b and the NADPH oxidase component gp91phox by flow cytometry, left panel. Morphological characteristics were assessed on a cytospin, right panel. The arrows indicate a multi-lobular control neutrophil or a band-shaped G-CSF/dexamethasone-mobilized neutrophil. (B) To measure the production of hydrogen peroxide, control and G-CSF/dexamethasone-mobilized neutrophils were stimulated with various stimuli: zymosan, serum-treated zymosan, phorbol-12-myristate13-acetate (PMA), or platelet-activating factor (PAF) followed by formyl-Met-Leu-Phe (fMLP), in the presence of Amplex Red and horseradish peroxidase. Results are means ± SEM, N=5. *P< 0.05 compared to untreated controls.

in Hepes-medium. After opsonization with 10% (v/v) pooled serum for 15 min, at 37°C, the Candida was added at a ratio of 4 : 1 neutrophil (5x106 cells/ml). At the desired time points, 100-μl samples were diluted in 2.5 ml of water/NaOH, pH 11.0. At the end of the incubation period, the number of viable microorganisms in each sample was determined by the pourplate method in LB agar. The colony-forming units (CFU) were determined after overnight incubation at 37°C, and the percentage of killing was calculated as described.22 The recombinant proteins for the candidacidal experiments were major basic protein (MBP) (kind gift from prof. G.J. Gleich, Utah, USA, recombinant protein produced in our lab) and major basic protein homologue (recombinant protein produced in our lab, detailed methodology in the Online Supplementary Appendix).

Immunostaining and FACS analysis The expression of surface-bound receptors on granulocytes was assayed in total leukocyte samples by flow cytometry (FACS), with the commercially available antibodies against human-CD11b (clone 44A, ATCC, Rockville, MD, USA), CD32 (clone AT10, AbD Serotec, Oxford, UK), CD16 (clone 3G8, BD Pharmingen, Breda, the Netherlands), EMR3 (clone 3D7, AbD, Puchheim, Germany), CXCR4 (Clone 44717, R&D systems, Oxford, UK) and gp91phox (clone 7D5, MBL, Woburn, MA, USA).

As a secondary antibody, Alexa488 rabbit anti-mouse-IgG (Molecular Probes, Bleiswijk, the Netherlands) was used.

Samples were analyzed on an LSRII flow cytometer equipped with FACSDiva software (BD Biosciences). Cells were gated based on their forward and side scatter, and 10,000 gated events were collected per sample.

in a shaking water-bath before adding the (priming) agents PAF (1 μM, 5 minutes, Sigma, Steinheim, Germany) or cytochalasin B (5 μg/ml, 5 minutes, Sigma) were added. Subsequently, the cells were stimulated with fMLP (1 μM, Sigma, 15 minutes). After stimulation, the cells were put on ice, washed with Hepes buffer once, and subsequently stained with antibodies against neutrophil granule markers: CD63-PE (IgG1, 435); CD66b-FITC (IgG1, CLBB13.9). Data are expressed as mean fluorescence intensities (MFI).

The cells were analyzed on an LSRII flow cytometer equipped with FACSDiva software (BD Bioscience). The release of elastase and lactoferrin was evaluated with ELISA kits (HyCult Biotech) according to the manufacturer’s instructions. The proteolytic activity was determined by incubating neutrophils (2.5×106/ml in Hepes buffer) with DQ-Green BSA (10 μg/ml, Molecular Probes).

Upon stimulation with cytochalasin B (5 μg/ml, Sigma)/ fMLP (1 μM) the fluorescence was monitored at 30-second intervals for 1 hour by infinitiPRO2000 plate reader (Excitation 485 nm; Emission 535 nm) (Tecan).

Statistics Statistical analysis was performed with GraphPad Prism version 6.00 for Windows (GraphPad Software, San Diego, CA, USA). MS data were analyzed with Proteome Discoverer Software (Thermo Scientific, version 1.4), Scaffold (Proteome Software, version 4.0) and MaxQuant (FDR set at 0.05 and S0.6, version 1.4.1.2). Data were evaluated by paired, two-tailed student’s t-test, two-way ANOVA with post hoc Bonferroni test and by the Mann-Whitney test. The results are presented as the mean ± SEM, as indicated.

Data were considered significant when P<0.05.

Supplemental methods Degranulation assays Neutrophils (2×106/ml) were incubated in Hepes buffer at 37ºC haematologica | 2016; 101(5)

Detailed methodology of the Online Supplementary Figures is described in the Online Supplementary Appendix.

589

R.P. Gazendam et al.

A

B

C

D

E

F

Figure 2. The mobilization and proteolytic activity of azurophilic and specific granules.

Neutrophils from untreated controls and G-CSF/dexamethasone-treated donors were stimulated with cytochalasin-B/fMLP or PAF/fMLP, and the plasma membrane expression of CD63 (A) as well as the extracellular concentration of elastase, MPO (B,C) (azurophilic granule markers) and CD66b as well as lactoferrin (specific granule markers) (D,E) were measured by flow cytometry or ELISA. (F) Proteolytic activity was measured in the extracellular medium of untreated neutrophils and G-CSF/dexamethasone-mobilized neutrophils upon stimulation with cytochalasin-B/fMLP, PAF/fMLP or in TX-100 cell lysate by DQ-Green BSA assay. Results are means Âą SEM, N=5.

Results G-CSF/dexamethasone treatment recruits immature neutrophils with normal NADPH oxidase activity and granule mobilization capacity Previously, we found that the G-CSF/dexamethasonemobilized neutrophils demonstrated an altered gene expression profile, and this could either be due to the recruitment of a relatively immature population of neutrophils or direct gene-regulatory effects of G-CSF/dexamethasone. A single administration of subcutaneous G-CSF is combined with an oral dose of dexamethasone to obtain an optimal number of neutrophil mobilization for transfusion.23 We isolated neutrophils from healthy donors treated with G-CSF and dexamethasone, which resulted in a ~10-fold increase in circulating neutrophils (Online Supplementary Figure S1). The chemokine receptor CXCR4 involved in neutrophil retention in the bone marrow was reduced on the surface of G-CSF/dexamethasone-mobilized neutrophils as compared to control neutrophils (Figure 1A, left panel).24 The G-CSF/dexamethasone-mobilized neutrophils demonstrated band-shaped nuclei as compared to the multilobular nuclei observed in neutrophils from healthy controls (Figure 1A, right panel). The G-CSF/dexamethasonemobilized neutrophils also showed low surface expression of the late neutrophil maturation markers EMR3 and CD16, but normal levels of the early myeloid maturation markers CD11b and CD32, when compared to expression levels on circulating neutrophils from untreated controls (Figure 1A, left panel). Given the fact that the proteins involved in the antimicrobial functions of neutrophils, including the 590

NADPH oxidase and the different intracellular granules, are gradually formed during granulopoiesis,18 it was of interest to assess these in G-CSF/dexamethasone-mobilized neutrophils. Surface expression of gp91phox, i.e. the catalytic plasma membrane component of the NADPH oxidase enzyme complex, was normal when detected with the mAb 7D5 (Figure 1A). The functional NADPH oxidase activity upon cell activation was also comparable between control and G-CSF/dexamethasone-mobilized neutrophils (Figure 1B).14 Furthermore, the mobilization of azurophilic granules was measured by the membrane expression of CD63 and the release of elastase and MPO upon stimulation with cytochalasin-B/fMLP (Figure 2A-C). The mobilization of specific granules was evaluated by the membrane expression of CD66b and the release of lactoferrin upon stimulation with PAF/fMLP (Figure 2D,E). The overall serine protease activity in the extracellular medium was determined (i.e. DQ BSA fluorescence upon proteolytic cleavage) (Figure 2F). All were found to be intact in G-CSF/dexamethasone-mobilized neutrophils as compared to normal neutrophils. Finally, immuno-EM analysis demonstrated the normal appearance and frequency of myeloperoxidase (MPO)-positive azurophilic granules in the G-CSF/dexamethasone-mobilized neutrophils (Online Supplementary Figure S2). Therefore, it appears that although the GCSF/dexamethasone-mobilized neutrophils show signs of immaturity with respect to their nuclear morphology and the expression of certain surface markers, both the NADPH oxidase activity and the presence and mobilization of azurophilic and specific granule markers appeared to be unaltered. haematologica | 2016; 101(5)

Mobilized neutrophils and impaired Candida killing

A

D

H

B

E

C

F

G

I

Figure 3. The killing of A. fumigatus and C. albicans by mobilized neutrophils. Untreated neutrophils from healthy controls or G-CSF/dexamethasone-treated donors were co-cultured overnight with Aspergillus fumigatus yeasts (A) or with a preformed hyphae monolayer (B), and the viability was assessed with the MTT assay and calculated as a percentage of the viability after incubation without neutrophils. (C) Control and G-CSF/dexamethasone-mobilized neutrophils were incubated with a C. albicans preformed hyphae monolayer, and the viability was assessed with the MTT assay. Neutrophils from healthy controls or G-CSF/dexamethasone-treated donors were incubated with serum-opsonized (D) or unopsonized (E) C. albicans yeast for 2 hours, and the long-term (20 hours) (F) killing was determined as the percentage of viable Candida yeasts relative to incubation without neutrophils by a colony-forming unit assay. (G) Control and G-CSF/dexamethason-mobilized neutrophils were incubated overnight with Candida yeasts and the clusters of hyphae were quantified by confocal microscopy. (H) Control neutrophils and G-CSF/dexamethasone-mobilized neutrophils were incubated with unopsonized (□) or serum-opsonized (○) C. albicans yeasts -FITC, and the phagocytosis was determined by confocal microscopy. The percentage of phagocytosis is the number of FITC-positive neutrophils relative to the total number of neutrophils. (I) Neutrophils from untreated controls and donors treated with G-CSF, dexamethasone or both were incubated with C. albicans yeasts, and the short-term (2 hours) killing was determined. Results are means ± SEM, N=3-12 * P<0.05 compared to untreated controls.

haematologica | 2016; 101(5)

591

R.P. Gazendam et al.

A

B

Figure 4. Distinct composition of the G-CSF/dexamethasone-mobilized neutrophil phagosomes after fusion with granules. (A) Neutrophils from healthy controls and G-CSF/dexamethasone-treated donors were stimulated with C. albicans for 45 minutes, the phagosomes were isolated and analyzed by mass spectrometry. The proteins that were significantly decreased in the phagosomes from the G-CSF/dexamethasone-treated donors as compared to untreated controls are shown in the heat map. The red boxes show upregulated and green downregulated proteins in G-CSF/dexamethasone-mobilized phagosomes compared to controls. (B) The differentially expressed proteins between the control and G-CSF/dexamethasone-mobilized phagosomes are depicted in a volcano plot. N=5, FDR = 0.05 and S = 0.6

Antifungal activity by G-CSF/dexamethasone-mobilized neutrophils Next, we determined directly the cytotoxic capacity against A. fumigatus and C. albicans. Invasive infections start with the germination of yeasts into hyphae that enables them to invade tissues and spread via the bloodstream, which forms the basis for their pathogenicity.25 Therefore we assessed both the intracellular killing of yeasts by neutrophils, which functions to prevent germination, as well as the extracellular destruction of preformed hyphae.

The neutrophils from G-CSF/dexamethasone-treated donors normally inhibited the A. fumigatus germination after overnight incubation with the yeasts as compared to untreated controls (Figure 3A). The G-CSF/dexamethasone-mobilized neutrophils also efficiently degraded a monolayer of preformed A. fumigatus hyphae (Figure 3B).

A preformed monolayer of C. albicans hyphae was also as effectively degraded by the G-CSF/dexamethasone-mobilized neutrophils as by control neutrophils (Figure 3C).

However, we observed that G-CSF/dexamethasone-mobilized neutrophils showed a clear and distinctive defect in both the short-term (2 hours) and long-term (20 hours) killing of the C. albicans yeasts as compared to the neutrophils from untreated controls (Figure 3D-F). In addition, the G-CSF/dexamethasone-mobilized neutrophils were less able to inhibit the C. albicans yeast germination in an overnight assay (Figure 3G). This defect in yeast killing could not be explained by changes in the phagocytic capacity, since the phagocytosis and killing of both unopsonized and serum-opsonized C. albicans yeasts was completely normal (Figure 3H).

We assessed whether the in vivo treatment with G-CSF or dexamethasone seperately could be held responsible for 592

the Candida killing defect of the G-CSF/dexamethasonemobilized neutrophils. Neutrophils were isolated from healthy donors treated with G-CSF or dexamethasone separately, each of which resulted in a ~7- or ~2-fold increase in circulating neutrophils, respectively (Online Supplementary Figure S1). When compared to the neutrophils from untreated controls, we observed that the dexamethasone-mobilized neutrophils were not impaired in the killing of C. albicans yeasts or any of the other fungal killing tests performed (Figure 3I), whereas the neutrophils from G-CSF-treated donors showed a significant C. albicans killing defect (Figure 3I), although not exactly to the same extent as in the case of donor-derived neutrophils mobilized with both G-CSF and dexamethasone (Figure 3I).

Taken together, a selective C. albicans yeast killing defect was observed for G-CSF/dexamethasone-mobilized neutrophils, whereas these neutrophils showed a normal cytotoxic response against the Aspergillus yeasts and hyphae, as well as against preformed Candida hyphae.

Candida-induced phagosome formation To obtain further insight into the Candida yeast killing defect of G-CSF/dexamethasone-mobilized neutrophils upon normal phagocytosis, we decided to explore the contents of the Candida phagosome in more detail. Under normal conditions of phagocytosis the granules fuse with the phagosome containing internalized pathogens, thereby creating a cytotoxic environment for the degradation of microbes.26,27 To determine the cytotoxic composition of the phagosome after fusion with granules, we magnetically labeled Candida yeast, and - after synchronized phagocytosis and lysis of the neutrophils - we isolated the phagosomes and measured their composition by mass haematologica | 2016; 101(5)

Mobilized neutrophils and impaired Candida killing

A

B

D

C

E

spectrometry, according to a previously reported method.28 First, confocal analyses confirmed that the isolated phagosomes after granule fusion were highly positive for Candida (green), MPO (red) and elastase (yellow) (Online Supplementary Figure S3A). Secondly, kinetic analyses showed that the number of elastase peptides in Candida phagosomes similarly increased with time, which confirmed the normal phagocytosis by G-CSF/dexamethasone-mobilized neutrophils and indicates phagosomal maturation (Figure 3H, Online Supplementary Figure S3B,C).

Comparison of the G-CSF/dexamethasone-mobilized and control neutrophil Candida-phagosomes after fusion with granules for some of the known components showed a similar expression of e.g. the membraneexpressed integrin CR3 (CD11b/CD18, αMβ2) (Online Supplementary Figure S3C), which is critically involved in the recognition, uptake and killing of C. albicans.8 This is haematologica | 2016; 101(5)

Figure 5. MBP candidacidal activity and impaired Candida killing by neutrophil-like NB4 MBP-KO cells. (A) Overnight incubation of Candida with purified MBP or with buffer only, and assessment of germination by microscopy. (B) Recombinant MBP (50 ng/ml), MBPH (50 ng/mL) or buffer only were incubated for 2 hours with Candida and the viability was determined by the colony-forming unit assay. (C) Neutrophil-like NB4-WT, NB4-scrambled or NB4 MBP-KO cells were incubated with C. albicans yeasts, and the percentage of viable Candida yeasts was calculated relative to incubation without cells by a colony-forming unit assay. (D) Neutrophillike NB4-WT or NB4 MBP-KO cells were incubated with C. albicans hyphae, and the viability was calculated relative to incubation without cells by the MTT assay. (E) Neutrophil-like NB4-WT or NB4 MBP-KO cells were incubated with A. fumigatus conidia, and the germination was determined as the percentage of viable A. fumigatus hyphae relative to incubation without cells by a MTT assay. Results are means ± SEM, N=2-3, *P<0.05.

clearly consistent with the comparable phagocytosis of Candida yeasts by G-CSF/dexamethasone-mobilized and control neutrophils (see above). In addition, cytochrome b558 of the NAPDH oxidase system was identified (Online Supplementary Figure S3C), which reinforces the normal ROS production upon uptake of Candida yeasts. Finally, the phagosomes after fusion with granules also contained a variety of components that were derived from the various granules in neutrophils, i.e. MPO (azurophilic), elastase (azurophilic), lactoferrin (specific) and MMP9 (gelatinase) (Online Supplementary Figure S3C), and there appeared to be no differences in the fusion of these granules with the phagosome upon comparison of G-CSF/dexamethasone-mobilized and control neutrophil phagosomes.

We subsequently evaluated whether there were differences in the phagosomal composition between 593

R.P. Gazendam et al.

G-CSF/dexamethasone-treated donors and untreated controls that could potentially explain the observed killing defect in G-CSF/dexamethasone-mobilized neutrophils.

In total 11 neutrophil-derived proteins were identified to be significantly decreased in the G-CSF/dexamethasonemobilized phagosomes after fusion with granules (Figure 4). The neutrophil-derived proteins that we observed to be decreased in the G-CSF/dexamethasone-mobilized phagosomes have been described to be involved in various aspects of cellular innate immunity, including cytotoxic activity, vesicular fusion, pro-inflammatory activation and actin-filament rearrangement (Table 1).20,29-32 In the G-CSF/dexamethasone-mobilized phagosomes after fusion with granules, 79 proteins were signficantly upregulated, including 65 Candida-derived proteins and 14 proteins of human origin. Several of these host proteins are known to be involved in vesicular trafficking and as a negative regulator of phagosomal formation, e.g. Rap1A and Rab27A (Online Supplementary Table S1).33,34 We focused on the most pronounced differences between the G-CSF/dexamethasone-mobilized and control phagosomes after fusion with granules. The proteins major basic protein (MBP, PRG2) and major basic protein homolog (MBPH, PRG3) were virtually absent in the GCSF/dexamethasone-mobilized phagosomes after fusion with granules (Figure 4). MS analyses of whole cell neutrophil lysates demonstrated that MBP, MBPH and EPX were also significantly reduced in neutrophils from GCSF/dexamethasone-treated donors as compared to healthy controls (Online Supplementary Figure S4).

Interestingly, MBP has a C-type lectin domain, and upon cleavage of the propeptide, becomes cytotoxic.35,36 Upon testing the candidacidal effect of MBP and MBPH in the absence of neutrophils, we found that incubation for 2 hours or overnight of purified MBP or MBPH with Candida yeast resulted in strongly decreased yeast viability and germination (Figure 5A,B). The addition of MBP or MBPH did not affect the viability of A. fumigatus (Online Supplementary Figure S5). We used the Crispr-Cas9 technique to generate MBP knock-outs in NB4 cells (NB4-MBP-KO), which become neutrophil-like upon stimulation with ATRA (Online Supplementary Figure S6).37 Both the Crispr technique and the knock-out of the protein MBP in particular did not interfere with important cytotoxic responses, including the ROS production by the NADPH oxidase system and Candida phagocytosis (Online Supplementary Figure S6). The neutrophil-like NB4-MBPKO cells demonstrated a complete Candida killing defect when compared to neutrophil-like NB4-WT or NB4 cells that were transfected with a scrambled construct against a non-mammalian protein (Figure 5C). The neutrophil-like MBP knock-out cells normally killed Candida hyphae and inhibited the Aspergillus conidia germination, as also did the wild-type neutrophil-like NB4 cells (Figure 5D,E).

These experiments further indicate that the killing of Candida depends on the presence of MBP and MBPH in the phagosome to contribute to the cytotoxic activity.

Discussion In the present study we determined the cytotoxic activity against Candida albicans and Aspergillus fumigatus by neutrophils mobilized with G-CSF and dexamethasone for transfusion purposes. G-CSF/dexamethasone-mobi594

lized neutrophils efficiently inhibited A. fumigatus germination and killed both the Aspergillus and Candida hyphae.

However, the early and late killing of C. albicans yeasts were impaired by G-CSF/dexamethasone-mobilized neutrophils relative to normal neutrophils. Analyses of the phagosomes after fusion with granules revealed reduced levels of antimicrobial proteases, including MBP, in G-CSF/dexamethasone-mobilized neutrophils.

Interestingly, MBP was required for the killing of Candida and contributes to the observed killing defect in G-CSF/dexamethasone-mobilized neutrophils.

G-CSF has been shown in vitro to enhance neutrophil functions in terms of chemotaxis, phagocytosis and NADPH oxidase activation,9,10 whereas dexamethasone has immunosuppressive effects.11,12 The incubation of neutrophils with dexamethasone prevents A. fumigatus hyphae killing and the addition of G-CSF restores the defect.12 We found that the neutrophils from the G-CSF/dexamethasone-treated donors normally killed a monolayer of Aspergillus hyphae. An explanation for this discrepancy in results could be that Roilodes et al. added the dexamethasone in vitro, whereas the donors in our study were treated with a single dose of dexamethasone and/or G-CSF overnight in vivo. It has been described that neutrophils from donors treated for 5 consecutive days with G-CSF demonstrated normal MPO levels but decreased lactoferrin levels.17 The neutrophil-mediated inhibition of Aspergillus yeasts germination depends on iron-sequestration by lactoferrin.19 After one day of donor pretreatment we found normal levels of both MPO and lactoferrin in the G-CSF/dexamethasone-mobilized neutrophil phagosomes. In line with this observation the GCSF/dexamethasone-mobilized neutrophils were completely able to inhibit the germination of A. fumigatus. The neutrophil killing of Aspergillus hyphae depends on ROS production by the NADPH oxidase system.38 Both the ROS production and A. fumigatus hyphae killing was normal by the G-CSF/dexamethasone-mobilized neutrophils.

The G-CSF/dexamethasone-mobilized neutrophils showed an effective cytotoxic response in the inhibition of A. fumigatus germination and the killing of the hyphae.

The G-CSF/dexamethasone-mobilized neutrophils were able to phagocytose C.albicans, but showed a clear defect in the intracellular killing. Analyses of the Candidaphagosomes revealed that several proteins were reduced in the G-CSF/dexamethasone-mobilized cells, whereas the aforementioned granule markers lactoferrin, MPO and elastase were found in comparable levels to controls. The most significant differences were MBP and MBP homolog (MBPH), present in controls and virtually absent in GCSF/dexamethasone-mobilized phagosomes after fusion with granules and in whole G-CSF/dexamethasone-mobilized neutrophils. Since G-CSF/dexamethasone treatment recruits an immature pool of neutrophils, some granule components, including MBP, may not have been fully synthesized. MBP is mostly known as a marker for eosinophils. Borregaard et al. have already reported that MBPH is also present in various granules of neutrophils,39 while we have now confirmed by Immuno-EM analysis that neutrophil granules do contain MBP (Online Supplementary Figure S7). Both MBP and MBPH have been demonstrated to desintegrate membranes and exert antimicrobial activity.35,36 Gabay et al. investigated the antimicrobial properties of purified granule-derived proteins and found that MBP is one of the most potent candihaematologica | 2016; 101(5)

Mobilized neutrophils and impaired Candida killing

dacidal proteins, e.g. it is 70-fold more toxic than defensins.20 Purified human MBP also displayed strong in vitro inhibition of Candida germination under our conditions, which confirmed its fungicidal activity. Moreover, in a knock-out cell model to support the role of MBP, the neutrophil-like NB4-MBP-KO cells were found to be completely impaired in Candida killing without any effect on phagocytosis and ROS production. The results in this neutrophil-like cell model confirmed that MBP is involved in Candida killing.

In addition to MBPH, the analyses of the phagosomes identified several other proteins that were significantly decreased in the G-CSF/dexamethasone-mobilized phagosomes after fusion with granules. Eosinophil peroxidase (EP) is not strictly eosinophil specific39 and found to be differentially expressed between G-CSF/dexamethasonemobilized and control neutrophils, as well as in their phagosomes after granule fusion (Figure 4). Peroxidase activity is important, as neutrophils from MPO-deficient patients fail to kill Candida.21 Although no difference in the major azurophil granule protein MPO was detected, we cannot exclude a contribution of EPO to the observed Candida killing defect in the G-CSF/dexamethasone-mobilized cells. The hormone resistin and its receptor adenylyl cyclase-associated protein 1 (CAP1) were also decreased in the G-CSF/dexamethasone-mobilized phagosomes after fusion with granules. Resistin is produced by granulocytes upon activation and has pro-inflammatory effects.29 However, Candida killing improved only slightly when resistin was added, and was observed in both control and G-CSF/dexamethasone-mobilized neutrophils (Online Supplementary Figure S8). The G-CSF/dexamethasonemobilized phagosomes after fusion with granules also showed reduced levels of the calcium-binding protein grancalcin and lipocalin-2. Although little is known about their exact role in humans, neutrophils from the respective knock-out mice showed normal candidacidal responses.40,41 The number of defensin-1 peptides were slightly decreased in the G-CSF/dexamethasone-mobilized phagosomes after fusion with granules (Online Supplementary Figure S3C). Defensins are derived from azurophilic granules and have been described to be cytotoxic for Candida albicans.20 Although MBP proteins (PRG2) contributes to a

References 1. Denning DW, Bromley MJ. Infectious Disease. How to bolster the antifungal pipeline. Science. 2015;347(6229):14141416.

2. Gudlaugsson O, Gillespie S, Lee K, et al.

Attributable mortality of nosocomial candidemia, revisited. Clin Infect Dis. 2003;37(9):1172-1177.

3. Johnston DL, Lewis V, Yanofsky R, et al.

Invasive fungal infections in paediatric acute myeloid leukaemia. Mycoses.

2013;56(4):482-487.

4. Drewniak A, Kuijpers TW. Granulocyte transfusion therapy: randomization after all? Haematologica. 2009;94(12):16441648.

5. Marfin AA, Price TH. Granulocyte Transfusion Therapy. J Intensive Care Med.

haematologica | 2016; 101(5)

very large extent, it may be the combined reduction of granule-derived antimicrobial proteins in the G-CSF/dexamethasone-mobilized neutrophil phagosomes that aggravates the Candida killing defect. It would be a relevant topic of future investigations to determine whether G-CSF or dexamethasone administration results in decreased expression of these granule-derived antimicrobial proteins.

Furthermore, the killing of Candida hyphae by the G-CSF/dexamethasone-mobilized neutrophils was normal. We have investigated the neutrophil-mediated killing mechanisms of Candida yeasts and hyphae. It appeared that both the NADPH oxidase system and the phagosomal maturation are required for the neutrophil-mediated killing of Candida yeasts, whereas these toxic mechanisms are redundant in the killing of Candida hyphae (data not shown).8 This may explain why G-CSF/dexamethasonemobilized neutrophils show a selective killing defect for Candida yeasts but not hyphae.

In conclusion, we have investigated the killing of A. fumigatus and C. albicans by G-CSF/dexamethasonemobilized neutrophils in detail. Our results demonstrate that G-CSF/dexamethasone-mobilized neutrophils produce normal amounts of ROS, efficiently inhibit A. fumigatus germination and kill their hyphae. However, the killing of C. albicans yeasts was substantially impaired in G-CSF/dexamethasone-mobilized neutrophils relative to their normal counterpart. Analyses of the phagosomes after fusion with granules revealed reduced levels of antimicrobial proteins and in particular MBP in G-CSF/dexamethasone-mobilized neutrophil phagosomes, which contribute to the observed Candida killing defect. On some occasions, the Candida yeast form also plays a critical role in fungal dissemination, e.g. Candida glabrata yeasts do not form hyphae but cause severe infections.42 In critically ill neutropenic patients with a Candida sepsis, the indications for G-CSF/dexamethasone neutrophil transfusions may not alter, because these neutrophils are still capable to help kill the invasive Candida hyphae when antifungals seem ineffective.

Funding RPG was supported by the Landsteiner Foundation for Blood Transfusion Research (LSBR 1706) awarded to TWK.

2013;30(2):79-88.

6. Drewniak A, van Raam BJ, Geissler J, et al.

Changes in gene expression of granulocytes during in vivo granulocyte colony-stimulating factor/dexamethasone mobilization for transfusion purposes. Blood. 2009; 113(23):5979-5998.

7. Brown GD. Innate antifungal immunity: the key role of phagocytes. Annu Rev Immunol. 2011;29:1-21.

8. Gazendam RP, van Hamme JL, Tool AT, et al. Two independent killing mechanisms of Candida albicans by human neutrophils: evidence from innate immunity defects.

Blood. 2014;124(4):590-597.

9. Kitagawa S, Yuo A, Souza LM, Saito M, Miura Y, Takaku F. Recombinant human granulocyte colony-stimulating factor enhances superoxide release in human granulocytes stimulated by the chemotactic peptide. Biochem Biophys Res Commun.

1987;144(3):1143-1146.

10. Roilides E, Walsh TJ, Pizzo PA, Rubin M. Granulocyte colony-stimulating factor enhances the phagocytic and bactericidal activity of normal and defective human neutrophils. J Infect Dis. 1991;163(3):579583.

11. Nohmi T, Abe S, Tansho S, Yamaguchi H. Suppression of anti-Candida activity of murine and human neutrophils by glucocorticoids. Microbiol Immunol. 1994; 38(12):977-982.

12. Roilides E, Uhlig K, Venzon D, Pizzo PA, Walsh TJ. Prevention of corticosteroidinduced suppression of human polymorphonuclear leukocyte-induced damage of Aspergillus fumigatus hyphae by granulocyte colony-stimulating factor and gamma interferon.

Infect Immun.

1993; 61(11):4870-4877.

13. Dale DC, Liles WC, Llewellyn C, Rodger E,

595

R.P. Gazendam et al.

14.

15.

16.

17.

18.

19.

20.

21.

22.

596

Price TH. Neutrophil transfusions: kinetics and functions of neutrophils mobilized with granulocyte-colony-stimulating factor and dexamethasone. Transfusion. 1998; 38(8):713-721.

Drewniak A, Boelens JJ, Vrielink H, et al.

Granulocyte concentrates: prolonged functional capacity during storage in the presence of phenotypic changes.

Haematologica. 2008;93(7):1058-1067.

Mochizuki K, Kikuta A, Ohto H, et al.

Extended storage of granulocyte concentrates mobilized by G-CSF with/without dexamethasone and collected by bag separation method. Transfus Med. 2007; 17(4):296-303. van Raam BJ, Drewniak A, Groenewold V, van den Berg TK, Kuijpers TW. Granulocyte colony-stimulating factor delays neutrophil apoptosis by inhibition of calpains upstream of caspase-3. Blood.

2008;112(5):2046-2054.

Leavey PJ, Sellins KS, Thurman G, et al. In vivo treatment with granulocyte colonystimulating factor results in divergent effects on neutrophil functions measured in vitro. Blood. 1998;92(11):4366-4374.

Borregaard N, Sehested M, Nielsen BS, Sengelov H, Kjeldsen L. Biosynthesis of granule proteins in normal human bone marrow cells. Gelatinase is a marker of terminal neutrophil differentiation. Blood.

1995;85(3):812-817.

Zarember KA, Sugui JA, Chang YC, KwonChung KJ, Gallin JI. Human polymorphonuclear leukocytes inhibit Aspergillus fumigatus conidial growth by lactoferrinmediated iron depletion. J Immunol.

2007;178(10):6367-6373.

Gabay JE, Scott RW, Campanelli D, et al.

Antibiotic proteins of human polymorphonuclear leukocytes. Proc Natl Acad Sci USA. 1989;86(14):5610-5614.

Lehrer RI. Functional aspects of a second mechanism of candidacidal activity by human neutrophils. J Clin Invest. 1972;51 (10):2566-2572.

Drewniak A, Gazendam RP, Tool AT, et al.

Invasive fungal infection and impaired neu-

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

trophil killing in human CARD9 deficiency.

Blood. 2013;121(13):2385-2392.

Liles WC, Rodger E, Dale DC. Combined administration of G-CSF and dexamethasone for the mobilization of granulocytes in normal donors: optimization of dosing.

Transfusion. 2000;40(6):642-644.

Devi S, Wang Y, Chew WK, et al.

Neutrophil mobilization via plerixaformediated CXCR4 inhibition arises from lung demargination and blockade of neutrophil homing to the bone marrow. J Exp Med. 2013;210(11):2321-2336.

Kumamoto CA, Vinces MD. Contributions of hyphae and hypha-co-regulated genes to Candida albicans virulence. Cell Microbiol.

2005;7(11):1546-1554.

Kinchen JM, Ravichandran KS. Phagosome maturation: going through the acid test.

Nat Rev Mol Cell Biol. 2008;9(10):781-795.

Zhao XW, Gazendam RP, Drewniak A, et al. Defects in neutrophil granule mobilization and bactericidal activity in familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) syndrome caused by STXBP2/Munc18-2 mutations. Blood.

2013;122(1):109-111.

Lonnbro P, Nordenfelt P, Tapper H. Isolation of bacteria-containing phagosomes by magnetic selection. BMC Cell Biol. 2008;9:35.

Jiang S, Park DW, Tadie JM, et al. Human resistin promotes neutrophil proinflammatory activation and neutrophil extracellular trap formation and increases severity of acute lung injury. J Immunol. 2014;192(10): 4795-4803.

Jones LC, Moussa L, Fulcher ML, et al.

VAMP8 is a vesicle SNARE that regulates mucin secretion in airway goblet cells. J Physiol. 2012;590(Pt 3):545-562. van EM, van Roomen CP, Renkema GH, et al. Characterization of human phagocytederived chitotriosidase, a component of innate immunity. Int Immunol. 2005;17 (11):1505-1512.

Xu P, Roes J, Segal AW, Radulovic M. The role of grancalcin in adhesion of neutrophils.

Cell Immunol. 2006;240(2):116-121.

33. Pizon V, Desjardins M, Bucci C, Parton RG, Zerial M. Association of Rap1a and Rap1b proteins with late endocytic/phagocytic compartments and Rap2a with the Golgi complex. J Cell Sci. 1994;107( Pt 6):16611670.

34. Yokoyama K, Kaji H, He J, et al. Rab27a negatively regulates phagocytosis by prolongation of the actin-coating stage around phagosomes. J Biol Chem. 2011;286(7): 5375-5382.

35. Lehrer RI, Szklarek D, Barton A, Ganz T, Hamann KJ, Gleich GJ. Antibacterial properties of eosinophil major basic protein and eosinophil cationic protein. J Immunol.

1989;142(12):4428-4434.

36. Plager DA, Loegering DA, Weiler DA, et al. A novel and highly divergent homolog of human eosinophil granule major basic protein. J Biol Chem. 1999;274(20):14464-14473.

37. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11 (8):783-784.

38. Rex JH, Bennett JE, Gallin JI, Malech HL, Melnick DA. Normal and deficient neutrophils can cooperate to damage Aspergillus fumigatus hyphae. J Infect Dis. 1990;162(2):523-528.

39. Rorvig S, Ostergaard O, Heegaard NH, Borregaard N. Proteome profiling of human neutrophil granule subsets, secretory vesicles, and cell membrane: correlation with transcriptome profiling of neutrophil precursors. J Leukoc Biol. 2013;94(4):711-721.

40. Ferreira MC, Whibley N, Mamo AJ, Siebenlist U, Chan YR, Gaffen SL. Interleukin-17-induced protein lipocalin 2 is dispensable for immunity to oral candidiasis. Infect Immun. 2014;82(3):1030-1035.

41. Roes J, Choi BK, Power D, Xu P, Segal AW. Granulocyte function in grancalcin-deficient mice. Mol Cell Biol. 2003;23(3):826830.

42. Zaoutis TE, Greves HM, Lautenbach E, Bilker WB, Coffin SE. Risk factors for disseminated candidiasis in children with candidemia. Pediatr Infect Dis J. 2004; 23(7): 635-641.

haematologica | 2016; 101(5)

ARTICLE

Myeloproliferative Disorders

Long-term serial xenotransplantation of juvenile myelomonocytic leukemia recapitulates human disease in Rag2–/–γc–/– mice

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

Christopher Felix Krombholz,1,2 Konrad Aumann,3 Matthias Kollek,1,2 Daniela Bertele,1 Silvia Fluhr,1,4 Mirjam Kunze,5 Charlotte M. Niemeyer,1,6 Christian Flotho,1,6* and Miriam Erlacher,1,6*

Department of Pediatrics and Adolescent Medicine, Division of Pediatric Hematology and Oncology, University Medical Center, Freiburg; 2Faculty of Biology, University of Freiburg; 3Department of Pathology, University Medical Center, Freiburg; 4Hermann Staudinger Graduate School, University of Freiburg; 5Department of Obstetrics and Gynecology, University Medical Center, Freiburg; and 6The German Cancer Consortium, Heidelberg, Germany 1

*These authors contributed equally to this work

Haematologica 2016 Volume 101(5):597-606

ABSTRACT

J

uvenile myelomonocytic leukemia is a clonal malignant disease affecting young children. Current cure rates, even with allogeneic hematopoietic stem cell transplantation, are no better than 50%-60%.

Pre-clinical research on juvenile myelomonocytic leukemia is urgently needed for the identification of novel therapies but is hampered by the unavailability of culture systems. Here we report a xenotransplantation model that allows long-term in vivo propagation of primary juvenile myelomonocytic leukemia cells. Persistent engraftment of leukemic cells was achieved by intrahepatic injection of 1x106 cells into newborn Rag2–/–γc–/– mice or intravenous injection of 5x106 cells into 5-week old mice. Key characteristics of juvenile myelomonocytic leukemia were reproduced, including cachexia and clonal expansion of myelomonocytic progenitor cells that infiltrated bone marrow, spleen, liver and, notably, lung. Xenografted leukemia cells led to reduced survival of recipient mice. The stem cell character of juvenile myelomonocytic leukemia was confirmed by successful serial transplantation that resulted in leukemia cell propagation for more than one year. Independence of exogenous cytokines, low donor cell number and slowly progressing leukemia are advantages of the model, which will serve as an important tool to research the pathophysiology of juvenile myelomonocytic leukemia and test novel pharmaceutical strategies such as DNA methyltransferase inhibition.

Introduction Juvenile myelomonocytic leukemia (JMML) is a malignant myeloproliferative disorder of infancy and early childhood with an aggressive clinical course. Clinical symptoms are caused by hematopoietic insufficiency and excessive proliferation of leukemic monocytes and granulocytes, leading to hepatosplenomegaly, lymphadenopathy, skin rash and respiratory failure.1-3 JMML is caused by hyperactivation of the RAS signaling pathway due to acquired activating mutations in the KRAS, NRAS or PTPN11 genes,4-7 or due to acquired loss of heterozygosity of the constitutionally deficient NF1 gene in patients with neurofibromatosis type 1 or of the CBL gene in the Noonan-like “CBL syndrome”.8-13 JMML is rapidly fatal unless allogeneic hematopoietic stem cell transplantation (HSCT) is performed, but even this approach is burdened with a significant risk of recurrence.14,15 A serious obstacle to research into JMML is the lack of suitable experimental models, impeding the development and pre-clinical evaluation of novel therapeutic haematologica | 2016; 101(5)

Correspondence: miriam.erlacher@uniklinik-freiburg.de

Received: October 26, 2015.

Accepted: February 12, 2016.

Pre-published: February 17, 2016. doi:10.3324/haematol.2015.138545

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/597

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

597

C.F. Krombholz et al.

approaches. Primary JMML leukemia cells cannot be maintained in culture as they differentiate and become apoptotic.16 An immortalized cell line derived from JMML cells has not yet been successfully established.17 The generation of induced pluripotent stem cell lines originating from JMML cells was reported, but conceptually such systems are limited by their artificial nature and the risk of further transformation during reprogramming.18 Several of the “canonical” JMML mutations that deregulate the RAS signaling pathway were studied in genetically engineered mouse models, successfully inducing myeloproliferative disorders in the experimental animals.19-28 Those were, however, still murine leukemias, and critical disease characteristics of JMML such as recurrent monosomy 7 or elevated fetal hemoglobin are not simulated in transgenic systems.

Xenotransplantation into murine hosts offers the unique possibility of basic and translational research into living primary JMML cells, while at the same time propagating and multiplying this precious clinical material. However, earlier attempts at JMML xenotransplantation were compromised by difficult leukemia cell engraftment (presumably owing to residual natural killer cell activity of the host strains) or rapid demise of engrafted animals within a few weeks, and not all reports documented the xenologous engraftment of long-term leukemia-initiating cells via successful serial transplantation.29-31 In addition, the experiments depended on high input cell numbers (up to 5x107 cells), a considerable practical obstacle concerning the limited availability of primary clinical JMML material, and on costly repeated application of human granulocytemacrophage colony-stimulating factor (GM-CSF).

Here we report the suitability of the Rag2–/–γc–/– mouse strain for the reproduction of primary human JMML in recipient animals. The system is characterized by good phenotypic imitation of typical disease features, long duration of xenologous engraftment, quantitative expansion of leukemic cell material outside the human organism, and the possibility of retransplantation to further expand cell numbers and extend the duration of experiments without additional input of cryopreserved material.

Not least, the data support the stem cell character of longterm leukemia-initiating cells in JMML.

Methods Primary cells Human cells were collected after obtaining informed consent from parents or legal guardians and approval from institutional review committees. Samples from JMML patients were collected in the context of the European Working Group of MDS in Childhood (EWOG-MDS). Clinical information is provided in Online Supplementary Table S1. Single cell suspensions obtained from mashed spleens were subjected to density gradient centrifugation (Ficoll) to separate and cryopreserve mononuclear cells (MNC). Where indicated, MNC were depleted from CD3+ T cells (MACS immunobeads, Miltenyi; <0.15% remaining T cells). Cord blood was obtained from healthy newborns and CD34+ cells were enriched by the MACS technique (Miltenyi; purity >90%).

Xenotransplantation All experiments were approved by local authorities and followed the German “Tierversuchsgesetz”. Rag2–/–γc–/– BALB/c mice32 were maintained in a specific pathogen-free environment.

598

Newborn mice were irradiated with 2.5 Gy within their first four days of life. Eight hours after irradiation, JMML MNC were thawed and 1x106 viable cells were injected intrahepatically (30 μl). Alternatively, 5-week old mice were irradiated with 3 Gy and transplanted intravenously with 5x106 viable MNC. Single cell suspensions were obtained from bone marrow (BM), spleen and blood. Liver, kidney and lung were digested with collagenase D and DNase (Roche) followed by density gradient centrifugation.

For serial transplantation, 1-4x106 BM cells from engrafted mice (containing 60%-70% human cells) were injected into recipients.

Flow cytometry Cell suspensions were subjected to red blood cell lysis and stained with antibodies listed in Online Supplementary Table S2.

Cytometric Bead Array kits (human inflammatory and Th1/Th2 cytokines; BD) were used according to the manufacturer’s instructions. A FACSCalibur (BD) was used; analyses were performed using FlowJo (FlowJo) and Cyflogic (Cyflo). The gating strategy is shown in Online Supplementary Figure S1.

Immunohistochemistry Organs were fixed in 4% buffered formalin, and sternums were decalcified. After paraffin-embedding, sections were deparaffinized in xylene and graded alcohols. H&E and chloracetate esterase staining followed standard protocols.

Immunohistochemical staining was performed after specific antigen retrieval in “low pH target retrieval solution” (Dako) for 30 min. Primary and secondary antibodies are listed in Online Supplementary Table S2. The EnVision FLEX System or the APK5005 system were used for visualization (Dako). Sections were counterstained with hematoxylin (Dako) and mounted.

Genetic analysis Human-specific PCR for PTPN11 was performed on hematopoietic cells isolated from murine organs (forward primer ATCCGACGTGGAAGATGAGA, reverse primer TCAGAGGTAGGATCTGCACAGT). Human HL60 cells and hematopoietic cells from non-transplanted mice were used as positive and negative controls. PCR products were sequenced bidirectionally (BigDye Terminator kit, Life Technologies; ABI 3730xl or 3130xl capillary sequencers).

Pyrosequencing Human-specific PTPN11 PCR products were generated as above using a biotinylated reverse primer and pyrosequenced on a Pyromark Q24 (Qiagen) using sequencing primer ACATCAAGATTCAGAACACT. The wild-type/mutant allelic ratio of PTPN11 point mutations was calculated using PyroMark Q24 software v.2.0 (Qiagen).

Statistical analysis Charts show mean values and standard errors of the mean (SEM). Mann-Whitney test, Kaplan-Meier analysis and MantelCox log rank test were used (Statview 4.1 software). P<0.05 was considered statistically significant.

Results Xenotransplantation of human JMML cells into Rag2–/–γc–/– mice results in leukemic engraftment

We chose Rag2 and interleukin-2 receptor gamma chain double-deficient mice (Rag2–/–γc–/–) as recipients for the JMML xenografts. The genetic defect of this strain leads to near-complete abolishment of residual T cell, B cell, and haematologica | 2016; 101(5)

JMML xenograft in Rag2–/–γc–/– mice

natural killer cell activity,32 a prerequisite for successful JMML xenotransplantation.31 The mice were transplanted with MNC isolated from splenectomy preparations of 5 children with JMML. Flow cytometry showed that the pre-transplantation MNC samples consisted of a median of 21% CD34+ stem/progenitor cells (range 1%-65%), 44% CD33+ myeloid cells (range 18%-89%), 13% CD3+ T cells (range 3%-23%) and 27% CD19+ B cells (range 9%-31%). The cellular viability upon thawing and the cell composition of xenotransplanted material from individual patients is shown in Online Supplementary Figure S2. Based on our own previous experience with a xenotransplantation system for healthy human hematopoiesis using the same host strain,33 we started by using intrahepatic injection of graft cells into newborn mice (1x106 viable JMML MNC per mouse) as route of transplantation. To see if the procedure could be simplified and make the model less dependent on the timely birth of pups, we also transplanted 5-week old mice via conventional intravenous injection; these mice received 5x106 JMML MNC to compensate for the higher body weight at that age. The xenografted cells were monitored in all mice by biweekly collection of blood and flow cytometry of human CD45+ cells. Whereas most animals were sacrificed at elected time points (ranging from 10 to 20 weeks after transplantation) for pheno-

type analysis and harvest of JMML cells, a subset of mice was euthanized only when in poor condition so as to learn about the natural disease course.

We defined the level of human engraftment in a given murine organ as the proportion of human CD45+ cells within the total population of murine and human CD45+ cells. Following an accepted convention in xenotransplantation models,30,34 the occurrence of 0.5% or more human CD45+ cells in the murine BM was scored as successful engraftment. Using these definitions, JMML MNC from 4 children (Patients #1, #2, #3 and #5) engrafted into recipient mice with an overall leukemic engraftment rate of 58/82 mice (Figure 1), not counting 16 animals with nonleukemic T-cell engraftment (see below). Transplantation from one patient was unsuccessful (Patient #4, n=9 recipient mice) (Figure 1). In total, 64% (58/91) mice engrafted.

Levels of human engraftment were variable and there was no correlation between percentage of human CD45+ cells and time from transplantation or condition of the mice.

However, we cannot exclude the possibility that leukemic engraftment in mice might have reached higher levels in some mice if sacrificed later.

To confirm the presence of JMML cells and rule out the possibility that co-transplanted healthy hematopoietic stem cells were engrafted into recipient mice, human

Figure 1. Sustained engraftment of xenotransplanted juvenile myelomonocytic leukemia (JMML) cells in Rag2–/–γc–/– mice. Spleen mononuclear cells (MNC) from JMML Patients #1 to #5 were transplanted into sublethally irradiated mice (1x106 cells per mouse via intrahepatic injection or 5x106 cells per mouse via intravenous injection). Hematopoietic cells were obtained from indicated organs at 7-37 weeks post transplant. Human cell engraftment as assessed by flow cytometry of CD45+ cells is shown for animals transplanted from Patient #1 (n=31 mice), Patient #2 (n=37 mice), Patient #3 (n=10 mice) and Patient #5 (n=4 mice). The level of human engraftment was defined as proportion of human CD45+ cells within the total population of murine and human CD45+ cells. Cells from Patient #4 consistently failed to engraft (n=9 mice). The dotted line represents the definition of successful engraftment (≥0.5% human CD45+ cells).

haematologica | 2016; 101(5)

599

C.F. Krombholz et al.

CD45+ cells were isolated from BM of 43 recipient mice after transplantation from Patients #1 and #2 and used for sequence analysis of the PTPN11 gene. In all mice, the JMML-related mutation (PTPN11 c. G181T and c. C215T, respectively) was detected in infiltrating cells.

Sustained leukemic engraftment in Rag2–/–γc–/– xenotransplanted mice recapitulates characteristic features of human JMML

To analyze the leukemic phenotype of xenografted animals, BM, spleen, liver, lung, and kidney of all mice were evaluated for human cell infiltration by flow cytometry, histopathology and immunohistochemistry. We observed consistent involvement of BM, spleen, liver and, importantly, lung. The kidney was unaffected in all animals.

Flow cytometry revealed a strong predominance of human myeloid CD33+ cells in infiltrated murine organs (Figure 2A). The number of immature CD34+ cells was

highest in BM and liver, reflecting the sites of perinatal hematopoiesis. Mature myeloid CD13+ cells were most abundant in lung. Only a minor proportion of human cells were B or T lymphocytes. On gross examination, significant splenomegaly was observed in mice with successful xenologous leukemic engraftment as opposed to nonengrafted animals (Figure 2B). Together, these features closely resemble JMML in children.

A total of 19 mice was informative for survival analysis.

These mice were euthanized only at terminal disease and fulfilled the criteria of leukemic engraftment outlined above (Figure 3). Leukemia established in the recipient mice by JMML-initiating cells led to death of host animals at 51-224 days post transplantation whereas the survival of non-engrafted or non-transplanted mice was not reduced.

The histopathology of JMML-xenotransplanted mice showed that the BM, spleen and liver were infiltrated by a

A

B

600

Figure 2. Organ infiltration and human cell subpopulations after xenotransplantation of juvenile myelomonocytic leukemia (JMML) cells in Rag2–/– γc–/– mice. (A) Hematopoietic cells were obtained from indicated organs at 7-37 weeks after transplantation from 4 patients with JMML (n=58 mice). Cell subpopulations were assessed by flow cytometry with antibodies to human CD45, CD34, CD33, CD13, CD15, CD11B, CD19 and CD3. Bars indicate mean value and standard error. (B) Representative example of splenomegaly in mice with JMML cell engraftment (top) and normal spleen size in non-engrafted mice (bottom). The spleen weight of 49 engrafted and 17 non-engrafted mice was measured (right panel).

haematologica | 2016; 101(5)

JMML xenograft in Rag2–/–γc–/– mice

predominant population of differentiating myelomonocytic cells (Figure 4A). Immature forms with blast-like appearance were detected to a lesser degree. Leukemic infiltrates were focal and displaced the normal murine hematopoiesis in BM and spleen or the murine hepatocytes in liver. Some parts of the organs were completely destroyed by the leukemic foci, while other parts remained unaffected (Figure 4B). Consistent with flow cytometry and the observation that many animals developed respiratory distress after xenologous engraftment, histopathology demonstrated human cell infiltration also in the lung (Figure 4A). BM immunohistochemistry showed that human CD34+ immature cells resided closer to the endosteal niches whereas more mature cells (lysozyme-positive or CD68+) were located towards the medulla. Not all cells with leukemic morphology stained positive for human CD45. However, mouse-specific antibodies excluded the murine origin of these cells (Figure 4A). We assume that such cells represent CD45-negative JMML progeny, for example early erythroid progenitors.

We noted that several mice transplanted with JMML cells from Patient #2 carried a predominant blast cell population, while the majority of mice receiving cells from this donor showed the usual infiltration with differentiating myelomonocytic cells. This suggests the outgrowth of an acute myeloid leukemia (AML)-like subclone in single animals.

To determine if the two transplantation techniques resulted in different disease phenotypes, we prospectively compared 6 mice after neonatal intrahepatic transplantation (Online Supplementary Figure S3) with 5 mice transplanted intravenously at 5-weeks of age (Online Supplementary Figure S4). For the purpose of this experiment, the mice were killed only at terminal disease. We found no difference in engraftment levels in BM, spleen, liver, or lung (Online Supplementary Figures S3A and S4A).

The length of survival was identical between the intrahepatic (Online Supplementary Figure S3B) and the intravenous (Online Supplementary Figure S4B) group. Likewise, the differentiation profile of infiltrating cells was the same in both groups (Online Supplementary Figures S3C and S4C).

To compare JMML engraftment with non-leukemic xenologous hematopoiesis, we transplanted human CD34+ cells derived from umbilical cord blood of a healthy newborn into 7 Rag2–/–γc–/– mice (Online Supplementary Figure S5). Contrary to mice transplanted with JMML cells, and in line with previous observations,33 the human cells found in these mice were predominantly B cells and myeloid differentiation was barely detectable. The mice did not develop organomegaly and their survival after transplantation was no shorter.

The Rag2–/–γc–/– xenotransplantation model is independent of exogenous stimulation with GM-CSF

A hallmark feature of JMML progenitor cells is their hypersensitivity to GM-CSF,17,35-37 and previous JMML xenograft models depended on continuous administration of human GM-CSF.30 To analyze the effect of exogenous GM-CSF in our model, we xenotransplanted 9 newborn mice, 4 of which received weekly injections of 5 μg human GM-CSF beginning eight weeks after transplantation (Figure 5A). We observed no difference to 5 unstimulated mice regarding human CD45+ or CD34+ cell content in bone marrow or spleen even when GM-CSF treatment was continued for as long as 20 weeks after transplant haematologica | 2016; 101(5)

Figure 3. Xenologous engraftment of juvenile myelomonocytic leukemia (JMML) cells in Rag2–/–γc–/– mice results in decreased survival. Of 58 mice with xenologous JMML cell engraftment after transplantation, 39 were sacrificed at elected time points (not included in this Figure) and 19 were informative for survival analysis (solid line). Survival of non-transplanted control mice was unaffected (dotted line, n=5) (P=0.0004, Mantel-Cox log rank test).

(Figure 5B). Histopathology did not reveal any noteworthy differences either. As expected, higher proportions of human CD33+ myeloid cells were noted in mice treated with GM-CSF (Figure 5B). It appears that paracrine secretion of human cytokines by differentiating monocytes is sufficient to sustain the JMML-initiating cells in the Rag2–/–γc–/– microenvironment. Accordingly, we detected the human cytokines interleukin-8, tumor necrosis factoralpha and interferon-gamma in the serum of engrafted mice (Online Supplementary Figure S6).

Graft-versus-host disease originating from T lymphocytes may overwhelm the leukemic engraftment of individual JMML samples Whereas the xenotransplantation of unfractionated spleen MNC from Patients #1, #2 and #5 invariably led to myeloid leukemic engraftment in recipient mice, the spleen MNC from Patient #3 caused massive T lymphocyte infiltration of all organs and rapid death within 22-36 days after transplantation (Online Supplementary Figure S7).

Flow cytometry with human-specific antibodies confirmed the human origin of these cells. Upon genetic analysis, the JMML-specific PTPN11 mutation was undetectable, indicating that co-transplanted non-leukemic T cells had expanded in the animals. When CD3+ lymphocytes were depleted from spleen MNC prior to transplantation using immunomagnetic beads, regular JMML cell engraftment but no T-cell expansion or graft-versus-host disease occurred in the recipient animals (see Figure 1, Patient #3). Hence, a T-cell depletion step may be required for successful xenotransplantation depending on the individual cell composition of the clinical material.

JMML-initiating cells are serially retransplantable and re-establish disease in mice To assess the self-renewal capacity of long-term JMMLinitiating cells, serial transplantations were performed.

Seventeen weeks after xenotransplantation with JMML cells from Patient #1, BM was obtained from 2 mice and injected into 9 mice as second-generation xenograft.

Successful leukemic engraftment was observed in all 9 601

C.F. Krombholz et al.

mice (Figure 6A). The survival of recipient mice was similar to that of primary recipients (Figure 6B). The secondary recipients developed splenomegaly and showed predominant myeloid infiltration (Figure 6C). The overall level of organ infiltration with human cells and the lineage distri-

bution of human cell progeny were comparable to firstgeneration xenograft mice.

At ten weeks after xenotransplantation with JMML MNCs from Patient #2, 8 secondary recipients were transplanted with BM harvested from 4 mice. Four of the sec-

A

B

Figure 4. Histopathology demonstrates human myelomonocytic infiltration in murine tissues. (A) Histology and immunohistochemistry of bone marrow, spleen, liver and lung at time of terminal illness revealed leukemic infiltration with differentiating myelomonocytic cells that replaced regular murine tissue. Immunostaining with antibodies to murine CD45 and human CD45 confirmed the human origin of the leukemic cells (top panel, first row). Immature CD34-positive cells were located in the peritrabecular region and had a blast-like appearance. By contrast, lysozyme- and CD68-positive, more differentiated myelomonocytic cells were found in the center of the medullary cavity (top panel, second and third row). The murine spleen was infiltrated by myelomonocytic cells positive for human CD45 and lysozyme but negative for murine CD45 (middle panel). Human myelomonocytic cells were also found in murine liver and lung (bottom panel). (B) Focal displacement of murine hematopoiesis by human CD45-positive myelomonocytic cells. Dotted frames indicate areas with higher magnification shown on the right.

602

haematologica | 2016; 101(5)

JMML xenograft in Rag2–/–γc–/– mice

ondary recipients showed successful engraftment. BM cells from these mice were then used for tertiary transplantation and led to engraftment in 8 of 8 mice (Online Supplementary Figure S8). Again, the level of leukemic organ infiltration and length of survival were comparable to first-generation xenograft mice. Mutation analysis demonstrated that the leukemia-specific PTPN11 mutation was invariably present when human cells were retrieved from serially engrafted mice, regardless of infiltrated organ or graft generation (data not shown). This ruled out the possibility that the leukemic clone might have been lost after repeated xenotransplantation and that longlived non-leukemic progenitors might have prevailed. In addition, quantitative pyrosequencing was employed to compare the mutant allele fraction between source material (spleen MNC) and purified human CD45+ cells

retrieved from BM cells of serially xenografted mice (Figure 7). We observed that close to 100% of human cells were of leukemic origin in primary, secondary, or tertiary recipients.

Discussion The need for a pre-clinical model of JMML that can be used for basic research, biomarker identification and drug testing prompted us to establish a xenotransplantation system for this leukemia in immunodeficient mice. Other investigators have previously xenografted JMML cells but reported various difficulties.29-31 Lapidot et al., using SCID mice as host strain, observed a rapid decline in well-being and cachexia as soon as 2-4 weeks after xenotransplanta-

A

B

Figure 5. Application of exogenous granulocyte-macrophage colony-stimulating factor (GM-CSF) increases myeloid differentiation without affecting overall engraftment. (A) Schematic diagram of the experimental set up. Nine mice were transplanted intrahepatically with 1x106 juvenile myelomonocytic leukemia (JMML) mononuclear cells of Patient #2.

Five weeks later, human cell engraftment was confirmed by flow cytometry of CD45+ peripheral blood cells. Mice were divided into two experimental groups matched for level of engraftment in peripheral blood. Four mice received weekly injections of 5 μg recombinant human GM-CSF, while saline was administered in 5 mice. Applications were started eight weeks after transplantation. The animals were analyzed 12 weeks later. (B) The human CD45+ cell engraftment, the proportion of CD34+ progenitor cells and the proportion of CD33+ myeloid cells were determined in bone marrow (left) and spleen (right).

Levels of human CD45+ and CD34+ cells were comparable between untreated (open symbols) and treated (filled symbols) animals. The proportion of CD33+ cells was significantly higher in bone marrow and spleen of treated animals (P=0.01, Mann-Whitney test).

haematologica | 2016; 101(5)

603

C.F. Krombholz et al.

A

B

C

tion of JMML cells.30 Their experiments involved continuous treatment of host mice with human GM-CSF. In the absence of exogenous human GM-CSF the leukemic cells did not engraft at all. Nakamura et al. reported highly variable levels of myeloid engraftment in NOD/SCID/γc–/– mice (average 18.7% CD33+ of human CD45+ cells in the bone marrow, range 9.4%-37.7%), although the number of cells transplanted was fairly high (107 cells per mouse).31 In addition, those previous reports on JMML xenotransplantation lacked a detailed analysis of the natural disease course of recipient mice as all animals were sacrificed no later than 12 weeks after transplantation.29-31 However, we felt that a system with a more chronic disease course would be desirable if JMML were to be modeled in experimental animals for pre-clinical research.

In an attempt to overcome the obstacles discussed above we chose Rag2–/–γc–/– mice as hosts and intrahepatic injection into newborn recipients as mode of transplantation. We favored this technique because of an earlier description by Traggiai and the documented suitability for transplantation of healthy cord blood-derived CD34+ cells.33,38 Adopting an intrahepatic strategy seemed especially appropriate for JMML since it is a disease of early childhood, frequently affects the liver and most probably originates from fetal hematopoietic cells, which appear to be supported better by neonatal than adult tissues.39,40 In addition, intravenous injection would be technically challenging in newborn mice. When we later compared the 604

Figure 6. Analysis of secondary recipient mice after serial xenotransplantation. (A) Seventeen weeks after xenotransplantation with juvenile myelomonocytic leukemia (JMML) cells from Patient #1, bone marrow (BM) cells from 2 mice were re-transplanted into 9 second-generation mice (1x106 cells per animal). The secondary recipient animals were sacrificed for analysis when terminally sick (165-328 days after transplantation).

The level of human engraftment was defined as proportion of human CD45+ cells within the total population of murine and human CD45+ cells.

Open triangles indicate first-generation (donor) mice; closed diamonds, second-generation recipients. The dotted line represents the definition of successful engraftment (≥0.5% human CD45+ cells). (B) Secondary recipient mice (solid line) had significantly reduced survival compared to untransplanted control mice (dotted line, n=5) (P<0.01, Mantel-Cox log rank test). (C) Hematopoietic cells were obtained from indicated organs and cell subpopulations were assessed by flow cytometry with antibodies to human CD45, CD34, CD33, CD13, CD15, CD11B, CD19 and CD3.

Bars indicate mean value and standard error.

phenotype of mice transplanted intrahepatically with that of animals xenografted at older age via the intravenous route we found no significant differences in level of organ infiltration, length of survival after transplantation, or other aspects of the ensuing leukemia. Although we did not perform systematic titrations of input cell numbers, we believe that the intrahepatic technique might be the better choice if clinical samples with limited cell number were to be transplanted.

Juvenile myelomonocytic leukemia cells from 4 patients readily engrafted in the mice whereas transplantation from one child was unsuccessful. We can only speculate whether this failure relates to low amounts of JMML-initiating cells in the spleen MNC preparations (Online Supplementary Table S1) or to poor material quality (i.e. latency between splenectomy and cryopreservation).

After successful engraftment, the xenotransplanted mice displayed symptoms similar to those observed in children with JMML, including hepatosplenomegaly, cachexia and pulmonary infiltration with respiratory distress. Detailed analysis of murine hematopoietic organs revealed focal infiltration by human myelomonocytic CD33+ cells. CD13 expression indicated the presence of cells at more mature stages of differentiation and was stronger in spleen and lung than BM and liver, consistent with the physiological route of myeloid differentiation. Immature CD34+ leukemic cells were located in the endosteal regions of bone indicating that they shared hematopoietic niches haematologica | 2016; 101(5)

JMML xenograft in Rag2–/–γc–/– mice

Figure 7 (right). Leukemic allele frequency was maintained during serial transplantations. Pyrosequencing was performed on human CD45+ cells obtained from murine bone marrow to determine the mutant allele frequency of PTPN11 c.C215T (Patient #1, upper panel) and PTPN11 c.G181T (Patient #2, lower panel) in serially transplanted animals. Since the leukemic mutations were heterozygous, a 50% allele frequency corresponds to 100% leukemic cells.

with their normal counterparts, similar to a recent observation in AML.41 The lineage composition of engrafted JMML cell progeny clearly differed from that of xenotransplanted cord blood-derived healthy CD34+ cells, where B cells predominated and only minor myeloid populations were observed. Importantly, xenotransplanted mice showed a chronic disease course with a median survival of more than 20 weeks. This makes it possible to evaluate

References 1. Niemeyer CM, Arico M, Basso G, et al.

Chronic myelomonocytic leukemia in childhood: a retrospective analysis of 110 cases.

European Working Group on Myelodysplastic Syndromes in Childhood (EWOG-MDS). Blood. 1997;89(10):35343543.

2. Locatelli F, Niemeyer CM. How I treat juvenile myelomonocytic leukemia. Blood.

2015;125(7):1083-1090.

3. Chang TY, Dvorak CC, Loh ML. Bedside to bench in juvenile myelomonocytic leukemia: insights into leukemogenesis from a rare pediatric leukemia. Blood. 2014;124 (16):2487-2497.

4. Flotho C, Valcamonica S, Mach-Pascual S, et al. RAS mutations and clonality analysis in children with juvenile myelomonocytic leukemia (JMML). Leukemia. 1999;13(1):3237.

5. Tartaglia M, Niemeyer CM, Fragale A, et al.

haematologica | 2016; 101(5)

6.

7.

8.

9.

10.

pharmaceuticals with delayed activity, in particular the DNA-hypomethylating agent azacitidine which has recently gained clinical interest for use in JMML.42,43 In contrast to previous JMML xenotransplantation models, Rag2–/–γc–/– mice efficiently sustained engrafting JMML cells in the absence of exogenous human GM-CSF. Weekly application of human GM-CSF enhanced myeloid differentiation but did not influence the total level of engraftment or time to leukemia.

Serial transplantation of JMML cells confirmed the presence of long-term JMML-initiating cells with self-renewal capacity. Phenotype and disease kinetics were similar in primary, secondary and tertiary recipients. Importantly, typical morphology with differentiating myelomonocytic cells was preserved over time and no disease acceleration was observed. Serial transplantability is not only important to the scientific concept of leukemia-initiating cells, but is also a valuable tool for the expansion of primary JMML cells from a practical perspective. Using the Rag2–/–γc–/– JMML system and serial retransplantation we have maintained JMML cells in vivo for 1.5 years in total.

In the process, unmanipulated clinical JMML material was expanded rather than consumed. This has not so far been feasible by in vitro culture.

In summary, we present a novel xenotransplantation model of JMML that closely mimics human disease. We are confident that the model will be useful to further characterize the JMML-initiating cell, amplify scarce and valuable clinical material, and complement the recently evolving early-phase clinical trials for novel pharmaceutical strategies such as epigenetic therapy.

Acknowledgments We are grateful to A. Meier, N. Fischer and B. Stopp for technical assistance and to N. Krause, B. Müller and K. Thumm for animal care. We thank H. Pahl and H. Eibel for insightful discussions.

Funding German Research Foundation (CRC 992-C05 to CF and SPP1463 FL345/4-2 to CF) and Freiburg Institute for Advanced Studies (fellowship to ME).

Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet. 2003;34(2):148-150.

Kratz CP, Niemeyer CM, Castleberry RP, et al. The mutational spectrum of PTPN11 in juvenile myelomonocytic leukemia and Noonan syndrome/myeloproliferative disease. Blood. 2005;106(6):2183-2185.

Miyauchi J, Asada M, Sasaki M, et al.

Mutations of the N-ras gene in juvenile chronic myelogenous leukemia. Blood.

1994;83(8):2248-2254.

Bader JL, Miller RW. Neurofibromatosis and childhood leukemia. J Pediatr. 1978;92(6): 925-929.

Stiller CA, Chessells JM, Fitchett M. Neurofibromatosis and childhood leukaemia/lymphoma: a population-based UKCCSG study. Br J Cancer. 1994;70(5):969972.

Side LE, Emanuel PD, Taylor B, et al.

Mutations of the NF1 gene in children with juvenile myelomonocytic leukemia without

11.

12.

13.

14.

clinical evidence of neurofibromatosis, type 1. Blood. 1998;92(1):267-272.

Steinemann D, Arning L, Praulich I, et al.

Mitotic recombination and compound-heterozygous mutations are predominant NF1inactivating mechanisms in children with juvenile myelomonocytic leukemia and neurofibromatosis type 1. Haematologica.

2010;95(2):320-323.

Loh ML, Sakai DS, Flotho C, et al. Mutations in CBL occur frequently in juvenile myelomonocytic leukemia.

Blood.

2009;114(9): 1859-1863.

Niemeyer CM, Kang MW, Shin DH, et al.

Germline CBL mutations cause developmental abnormalities and predispose to juvenile myelomonocytic leukemia. Nat Genet. 2010;42(9):794-800.

Locatelli F, Nollke P, Zecca M, et al.

Hematopoietic stem cell transplantation (HSCT) in children with juvenile myelomonocytic leukemia (JMML): results of the EWOG-MDS/EBMT trial. Blood.

2005;105(1):410-419.

605

C.F. Krombholz et al.

15. Bergstraesser E, Hasle H, Rogge T, et al.

Non-hematopoietic stem cell transplantation treatment of juvenile myelomonocytic leukemia: a retrospective analysis and definition of response criteria. Pediatr Blood Cancer. 2007;49(5):629-633.

16. Sakashita K, Kato I, Daifu T, et al. In vitro expansion of CD34(+)CD38(-) cells under stimulation with hematopoietic growth factors on AGM-S3 cells in juvenile myelomonocytic leukemia. Leukemia.

2015;29(3):606-614.

17. Gualtieri RJ, Castleberry RP, Gibbons J, et al.

Cell culture studies and oncogene expression in juvenile chronic myelogenous leukemia. Exp Hematol. 1988;16(7):613-619.

18. Gandre-Babbe S, Paluru P, Aribeana C, et al.

Patient-derived induced pluripotent stem cells recapitulate hematopoietic abnormalities of juvenile myelomonocytic leukemia.

Blood. 2013;121(24):4925-4929.

19. Jacks T, Shih TS, Schmitt EM, et al. Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat Genet.

1994;7(3):353-361.

20. Hawley RG, Fong AZ, Ngan BY, Hawley TS. Hematopoietic transforming potential of activated ras in chimeric mice. Oncogene.

1995;11(6):1113-1123.

21. MacKenzie KL, Dolnikov A, Millington M, Shounan Y, Symonds G. Mutant N-ras induces myeloproliferative disorders and apoptosis in bone marrow repopulated mice. Blood. 1999;93(6):2043-2056.

22. Araki T, Mohi MG, Ismat FA, et al. Mouse model of Noonan syndrome reveals cell type- and gene dosage-dependent effects of Ptpn11 mutation. Nat Med. 2004;10(8):849857.

23. Tuveson DA, Shaw AT, Willis NA, et al.

Endogenous oncogenic K-ras(G12D) stimulates proliferation and widespread neoplastic and developmental defects. Cancer Cell.

2004;5(4):375-387.

24. Kim A, Morgan K, Hasz DE, et al. Beta common receptor inactivation attenuates myeloproliferative disease in Nf1 mutant mice.

Blood. 2007;109(4):1687-1691.

25. Cutts BA, Sjogren AK, Andersson KM, et al.

606

26.

27.

28.

29.

30.

31.

32.

33.

Nf1 deficiency cooperates with oncogenic K-RAS to induce acute myeloid leukemia in mice. Blood. 2009;114(17):3629-3632.

Naramura M, Nandwani N, Gu H, Band V, Band H. Rapidly fatal myeloproliferative disorders in mice with deletion of Casitas B-cell lymphoma (Cbl) and Cbl-b in hematopoietic stem cells. Proc Natl Acad Sci USA. 2010;107(37):16274-16279.

Wang J, Liu Y, Li Z, et al. Endogenous oncogenic Nras mutation promotes aberrant GM-CSF signaling in granulocytic/monocytic precursors in a murine model of chronic myelomonocytic leukemia. Blood. 2010;116 (26):5991-6002.

Chang YI, You X, Kong G, et al. Loss of Dnmt3a and endogenous Kras cooperate to regulate hematopoietic stem and progenitor cell functions in leukemogenesis. Leukemia.

2015;29(9):1847-1856.

Iversen PO, Lewis ID, Turczynowicz S, et al.

Inhibition of granulocyte-macrophage colony-stimulating factor prevents dissemination and induces remission of juvenile myelomonocytic leukemia in engrafted immunodeficient mice. Blood. 1997;90(12): 4910-4917.

Lapidot T, Grunberger T, Vormoor J, et al.

Identification of human juvenile chronic myelogenous leukemia stem cells capable of initiating the disease in primary and secondary SCID mice. Blood. 1996;88(7):26552664.

Nakamura Y, Ito M, Yamamoto T, et al.

Engraftment of NOD/SCID/gammac(null) mice with multilineage neoplastic cells from patients with juvenile myelomonocytic leukaemia. Br J Haematol. 2005;130(1):5157.

Goldman JP, Blundell MP, Lopes L, et al.

Enhanced human cell engraftment in mice deficient in RAG2 and the common cytokine receptor gamma chain. Br J Haematol. 1998;103(2):335-342.

Labi V, Bertele D, Woess C, et al.

Haematopoietic stem cell survival and transplantation efficacy is limited by the BH3only proteins Bim and Bmf. EMBO Mol Med. 2013;5(1):122-136.

34. Notta F, Mullighan CG, Wang JC, et al.

Evolution of human BCR-ABL1 lymphoblastic leukaemia-initiating cells. Nature.

2011;469(7330):362-367.

35. Gualtieri RJ, Emanuel PD, Zuckerman KS, et al. Granulocyte-macrophage colony-stimulating factor is an endogenous regulator of cell proliferation in juvenile chronic myelogenous leukemia. Blood. 1989;74(7):23602367.

36. Emanuel PD, Bates LJ, Castleberry RP, Gualtieri RJ, Zuckerman KS. Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia hematopoietic progenitors. Blood. 1991;77(5):925-929.

37. Freedman MH, Cohen A, Grunberger T, et al. Central role of tumour necrosis factor, GM-CSF, and interleukin 1 in the pathogenesis of juvenile chronic myelogenous leukaemia. Br J Haematol. 1992;80(1):40-48.

38. Traggiai E, Chicha L, Mazzucchelli L, et al.

Development of a human adaptive immune system in cord blood cell-transplanted mice.

Science. 2004;304(5667):104-107.

39. Wulf-Goldenberg A, Keil M, Fichtner I, Eckert K. Intrahepatic transplantation of CD34+ cord blood stem cells into newborn and adult NOD/SCID mice induce differential organ engraftment. Tissue Cell.

2012;44(2):80-86.

40. Arora N, Wenzel PL, McKinney-Freeman SL, et al. Effect of developmental stage of HSC and recipient on transplant outcomes. Dev Cell. 2014;29(5):621-628.

41. Boyd AL, Campbell CJ, Hopkins CI, et al.

Niche displacement of human leukemic stem cells uniquely allows their competitive replacement with healthy HSPCs. J Exp Med. 2014;211(10):1925-1935.

42. Furlan I, Batz C, Flotho C, et al. Intriguing response to azacitidine in a patient with juvenile myelomonocytic leukemia and monosomy 7. Blood. 2009;113(12):2867-2868.

43. Cseh A, Niemeyer CM, Yoshimi A, et al.

Bridging to transplant with azacitidine in juvenile myelomonocytic leukemia: a retrospective analysis of the EWOG-MDS study group. Blood. 2015;125(14):2311-2313.

haematologica | 2016; 101(5)

ARTICLE

Acute Myeloid Leukemia

Association of acute myeloid leukemia’s most immature phenotype with risk groups and outcomes

EUROPEAN HEMATOLOGY ASSOCIATION

Ferrata Storti Foundation

Jonathan M. Gerber,1 Joshua F. Zeidner,2 Sarah Morse,3 Amanda L. Blackford,3 Brandy Perkins, Breann Yanagisawa,3 Hao Zhang,3 Laura Morsberger,3 Judith Karp,3 Yi Ning,3 Christopher D. Gocke,3 Gary L. Rosner,3 B. Douglas Smith,3 and Richard J. Jones3 1 Levine Cancer Institute, Charlotte, NC; 2Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC; and 3The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Johns Hopkins University, Baltimore, MD, USA

*JMG and JFZ contrbuted equally to this work.

Haematologica 2016 Volume 101(5):607-616

ABSTRACT

T

he precise phenotype and biology of acute myeloid leukemia stem cells remain controversial, in part because the “gold standard” immunodeficient mouse engraftment assay fails in a significant fraction of patients and identifies multiple cell-types in others. We sought to analyze the clinical utility of a novel assay for putative leukemia stem cells in a large prospective cohort. The leukemic clone’s most primitive hematopoietic cellular phenotype was prospectively identified in 109 newly-diagnosed acute myeloid leukemia patients, and analyzed against clinical risk groups and outcomes. Most (80/109) patients harbored CD34+CD38– leukemia cells. The CD34+CD38– leukemia cells in 47 of the 80 patients displayed intermediate aldehyde dehydrogenase expression, while normal CD34+CD38– hematopoietic stem cells expressed high levels of aldehyde dehydrogenase. In the other 33/80 patients, the CD34+CD38– leukemia cells exhibited high aldehyde dehydrogenase activity, and most (28/33, 85%) harbored poor-risk cytogenetics or FMS-like tyrosine kinase 3 internal tandem translocations. No CD34+ leukemia cells could be detected in 28/109 patients, including 14/21 patients with nucleophosmin-1 mutations and 6/7 acute promyelocytic leukemia patients. The patients with CD34+CD38– leukemia cells with high aldehyde dehydrogenase activity manifested a significantly lower complete remission rate, as well as poorer event-free and overall survivals. The leukemic clone’s most immature phenotype was heterogeneous with respect to CD34, CD38, and ALDH expression, but correlated with acute myeloid leukemia risk groups and outcomes. The strong clinical correlations suggest that the most immature phenotype detectable in the leukemia might serve as a biomarker for “clinically-relevant” leukemia stem cells. ClinicalTrials.gov: NCT01349972.

Correspondence: rjjones@jhmi.edu

Received: August 12, 2015.

Accepted: January 22, 2016.

Pre-published: January 27, 2016. doi:10.3324/haematol.2015.135194

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/607

Introduction More than two decades ago, Lapidot et al. reported that acute myeloid leukemia (AML) cells capable of engrafting immunodeficient mice expressed a CD34+CD38– normal hematopoietic stem cell (HSC) phenotype.1 These so-called leukemia stem cells (LSCs) gave rise to partially differentiated progeny that constituted the bulk of the leukemia, but possessed only limited proliferative potential.2 More recently, leukemic cells of varying surface phenotypes, even within the same patient, have been shown to be capable of engrafting immunodeficient mice, the generally accepted “gold standard” for LSC activity.3,4 However, this traditional approach for LSC identification has proven to be somewhat elusive. Not only is the assay cumbersome and non-quantitative,5 but haematologica | 2016; 101(5)

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

607

J.M. Gerber et al.

in a significant fraction of AML patients no leukemia cell subset will engraft5-10 even using the newer mouse models.11 This inability to confirm the identity of LSCs in many patients is at least in part the reason that the clinical relevance of LSCs remains uncertain.12 Regardless of their tumorigenic potential in immunodeficient mice, leukemic cells that persist after therapy [i.e. minimal residual disease (MRD)] are arguably the most clinically important.13,14 We recently showed that MRD during complete remission (CR) was enriched for CD34+CD38– leukemic cells, and their presence after therapy was highly associated with subsequent clinical relapse.13 Others found that CD34+CD38– leukemia cell frequency correlated with prognosis.7,15 Thus, accumulating evidence now suggests that initial clinical responses likely reflect the behavior of the bulk leukemia, while long-term survival/cure requires the eradication of LSCs.7,13-15 We also showed that the leukemic CD34+CD38– cells from most patients, particularly those with core-binding factor (CBF) AMLs, could be separated from normal HSCs by their expression of aldehyde dehydrogenase 1 (ALDH). Normal HSCs exhibited high ALDH expression (CD34+CD38–ALDHhigh), while the putative LSCs expressed intermediate levels (CD34+CD38–ALDHint).13 These findings have recently been confirmed.16,17 Clinical outcomes in AML are highly diverse with some patients curable with standard therapies, others initially refractory to all known therapies, and the majority eventually relapsing and succumbing to the disease after initially achieving CRs. While patient factors such as age and performance status may influence the heterogeneous outcomes, the underlying biology - currently best reflected by cytogenetic and molecular markers - is the major determinant. AML’s highly diverse biology suggests that the LSCs are also heterogeneous. Accordingly, our previous report identified two patients, both primary refractory to induction, whose putative LSCs demonstrated high ALDH expression indistinguishable from normal HSCs.13 We could not detect any CD34+ leukemia cells in two other patients.13 Other groups have also described heterogeneous CD34 and ALDH expression in AMLs.8,16-20 Since no leukemia subset from many patients will engraft immunodeficient mice,5-11 and no leukemic CD34+CD38– cells can be identified in some patients,4,13,15,16,21 other means for LSC identification are needed to allow for their study clinically.14 Based on our smaller study of mostly CBF AML patients,13 we hypothesized that the most primitive hematopoietic cell phenotype that could be found in leukemia cells might have important clinical relevance. Thus, we prospectively assessed the leukemia’s most immature phenotype in a multi-institutional randomized clinical trial comparing two induction therapies in patients lacking favorable-risk cytogenetics: standard cytarabine-based “7+3" therapy22 and a novel regimen called FLAM (flavopiridol, cytarabine, mitoxantrone).23,24 To fully assess heterogeneity of the leukemic clone’s most immature phenotype, we also studied patients who initially agreed to the trial but were ultimately ineligible because they were found to have favorable-risk cytogenetics. Here we find that the most primitive hematopoietic cellular phenotype present in leukemia cells is not only heterogeneous for CD34, CD38, and ALDH expression, but also that this phenotypic heterogeneity correlates with both AML risk groups and outcomes. Moreover, the robust clinical correlations suggest that the most immature phenotype detectable in the leukemia might serve as a biomarker for “clinically-relevant” LSCs. 608

Methods Patients Patients aged 18-70 with newly-diagnosed AML, excluding CBF AMLs and APL, were eligible for this multicenter clinical study (clinicaltrials.gov NCT01349972).24 Patients were randomized 2:1 to FLAM or the standard “7+3” regimens, respectively.24 Patients who achieved complete or partial responses to the first cycle were eligible to receive a second cycle of FLAM or high-dose cytarabine (HiDAC), and/or could undergo allogeneic bone marrow transplantation (alloBMT) as per physician discretion. Johns Hopkins patients who were study ineligible because their cytogenetics proved favorable were also included in this analysis. Informed consent for participation in NCT01349972, as well as for the bone marrow donations by the patients not treated on trial, was obtained in accordance with the Declaration of Helsinki as approved by the Johns Hopkins Institutional Review Board.

Isolation of cells Specimens were collected between April 2011 and April 2013.

Marrow mononuclear (MMNC) and CD34+ cell subsets were identified and isolated as previously described.13,25 At least 500,000 cells from each AML specimen were then stained with Aldefluor (Aldagen, Durham, NC, USA) to assess ALDH activity according to the manufacturer’s instructions utilizing diethylaminobenzaldehyde (DEAB) controls. Next, cells were labeled with monoclonal phycoerythrin-conjugated anti-CD34 and allophycocyanin (APC)-conjugated anti-CD38 (BD Biosciences, San Jose, CA, USA) and analyzed with a MoFlo cell sorter (Beckman Coulter, Brea, CA, USA). Gating for CD34 and CD38 populations was based on clearly distinguishable populations, or in the absence of such, the negative antibody control.25 A representative example of gating is shown in Online Supplementary Figure S1.

Fluorescence in situ hybridization (FISH) and molecular analyses For patients with cytogenetic abnormalities detectable by FISH, 250-1000 cell aliquots were sorted directly onto slides and fixed with 3:1 methanol-glacial acetic acid (Sigma-Aldrich, St. Louis, MO, USA). FISH was performed and analyzed by the Johns Hopkins Kimmel Cancer Center Cytogenetics Core, using probes specific for the patients’ known cytogenetic abnormalities per manufacturer’s guidelines (Abbot Molecular, Des Plaines, IL, USA) as we previously described.13 Real-time polymerase chain reaction for FLT3 internal tandem duplication (ITD) (qPCR) and NPM1 mutations (reverse transcriptase-qPCR) was performed by Johns Hopkins Molecular Hematopathology Laboratory.

Data analysis The AML’s most immature phenotype was scored in a blinded fashion by RJJ, BP, and SM as we previously described.13 Any differences in scoring were to be decided by a simple majority, but there was complete concordance on all observations. The samples were then de-identified by the Johns Hopkins Kimmel Cancer Center Specimen Accessioning Core for statistical analysis. Clinical outcomes were determined by the NCT01349972 clinical study team24 blinded to the AML phenotypic data. Event-free survival (EFS) was defined as the date of treatment to the occurrence of persistent AML, relapse, or death. Poor-risk cytogenetics [> 3 clonal abnormalities, -5, 5q-, -7, -7q, t(3;3), inv 3, non-t(9;11) 11q23 excluding t(6;9), t(9;22)] and molecular abnormalities (FLT3-ITD mutation) were classified according to the European LeukemiaNet reporting system.26

Statistical analysis P-values for differences in categorical data were determined by haematologica | 2016; 101(5)

Relevance of the AML most primitive phenotype

Fisher’s exact tests or T-tests, and for differences in outcome, stratified by treatment arm (FLAM vs. 7+3), by Mantel-Haenszel tests.

Overall survival (OS) and EFS were estimated using the KaplanMeier method. Differences in OS and EFS according to the leukemic clone’s most primitive hematopoietic cellular phenotypes were analyzed with hazard ratios (HR) from Cox proportional hazards models that adjust for treatment arm, and tested for significance using likelihood ratio tests. Analyses were completed using R version 3.1.1.27

Results Patient characteristics The leukemia clone’s most primitive hematopoietic cellular phenotype was assessed in all patients entered in NCT0134997224 with adequate bone marrow specimens for analyses. Of the 147 patients entered in the clinical trial, bone marrow samples from 98 patients were analyzed. The main reason for patients not being analyzed was the absence of a research sample because not enough cells could be obtained with the diagnostic marrow (43 patients). The specimen arrived in the laboratory but was not adequate for analysis in 4 patients, and consent for the laboratory study was withdrawn in 2 patients. Over the same time frame, seven patients with CBF AML and 14 with APL were newly diagnosed and treated at Johns Hopkins. Bone marrow samples from 4 of the CBF patients and 7 of the APL patients were available for analysis. The clinical characteristics of the 98 patients on trial and the 11 favorable-risk patients not eligible for the trial are shown in Table 1.

The leukemia’s most immature phenotype was heterogeneous We defined the most immature phenotype present in the AML based on CD34, CD38, and ALDH expression, as we previously described.25,28,29 As CD34+CD38–ALDHhigh HSCs16,28,30 differentiate into more committed progenitors, both CD34 and ALDH expression decrease while CD38 expression increases.29,31-33 Thus, CD34+CD38-ALDHint, CD34+CD38+, and CD34- cells were considered increasingly more differentiated phenotypes. The leukemic versus normal origin of the hematopoietic phenotypes was determined by cytogenetic (FISH) or molecular (FLT3-ITD or NPM1) markers when present.

CD34+ cells comprised a median of 12% (range 0.07 - 81%) of total MMNCs from the 98 patients in NCT01349972. In

A

22/98 of the patients, the AML phenotype was clinically determined to be CD34- by standard flow cytometry critei.e., CD34+ cells represented ria:7,16,34 < 1% of the MMNCs (Table 1, Online Supplementary Figure S2A). In all 22 patients with < 1% CD34+ cells in the MMNCs, the small fraction (mean + SEM - 0.52+0.08) of CD34+ cells was completely CD38-ALDHhigh (Table 2, Figure 1A), and displayed low forward (FSC) and side (SSC) scatter on flow cytometry (data not shown). Only a small percentage (2.2+1.6%) of the CD34+CD38-ALDHhigh cells contained the leukemia-specific marker present in the five CD34– leukemias with cytogenetics detectable by FISH (Table 2).

Likewise, when an AML with < 1% CD34+ cells was FLT3ITD or NPM1-mutated (14/22 patients), the CD34+ cells did not harbor the mutation (Figure 1B).

CD34+ cells comprised a mean of 25.3+3.1% of MMNCs in the 76 patients from NCT01349972 who harbored CD34+ leukemia cells; the CD34+CD38– cells comprised 44.8+3.4% of the CD34+ cells in these patients. In 43 of these 76 patients, the majority (65.1+3.4%) of CD34+CD38– cells were ALDHint (Table 2, Online Supplementary Figure S2B), while the ALDHhigh population represented 1.7+0.5% of the CD34+CD38– cells (Figure 2A, Table 2). In the 11/43 cases with leukemia-specific cytogenetics scorable by FISH, we confirmed that the CD34+CD38–ALDHint cells were predominantly leukemic (Table 2). In contrast, the small number of CD34+CD38–ALDHhigh cells predominantly lacked the FISH marker that characterized the leukemia (Table 2). Likewise, when AMLs with prominent CD34+CD38–ALDHint populations exhibited FLT3-ITD mutations (3 patients) or were NPM1-mutated (4 cases), the CD34+CD38–ALDHint cells exhibited the mutation while the CD34+CD38–ALDHhigh cells did not (Figure 2B). The CD34+CD38–ALDHhigh HSCs exhibited much lower FSC (data not shown) and SSC than the CD34+CD38–ALDHint AML cells (Figure 2A). These data are consistent with the CD34+CD38–ALDHhigh cells representing normal HSCs as we previously demonstrated.13 The 4 CBF patients also displayed prominent leukemic CD34+CD38– ALDHint populations harboring, and small CD34+CD38– ALDHhigh fractions lacking, the FISH abnormality (Tables 1, 2).

Only ALDHhigh CD34+CD38– cells were present in 26 of the 76 patients in NCT01349972 with > 1% CD34+ cells (Tables 1, 2 and Figure 3A). In the 14 patients with leukemia-specific mutations scorable by FISH, the CD34+CD38–ALDHhigh population contained mostly (78+6.7%) leukemic cells (Table 2).

Similarly, this population was mostly leukemic in those

B Figure 1. Assessment of CD34+ cells from an NPM1 and FLT3-ITD mutated AML patient with < 1% CD34+ cells. (A) Representative flow cytometric staining pattern of ALDH activity by CD34 is displayed on MMNCs from patient. All the CD34+ cells are CD34+CD38–ALDHhigh. The CD34+ALDHhigh cells are shown in rectangle. (B) FLT3-ITD status of isolated cell fractions. The CD34– blasts harbored the FLT3-ITD mutation, while the CD34+ cells exclusively displayed the 330bp wild-type gene.

haematologica | 2016; 101(5)

609

J.M. Gerber et al.

patients with AML-specific mutations (6 patients with FLT3ITD and 2 with NPM1 mutations) (Figure 3B). The CD34+CD38–ALDHhigh leukemia cell population contained many more cells, and also exhibited much higher FSC (data not shown) and SSC on flow cytometry, than CD34+CD38–ALDHhigh HSC populations (Figure 2A) as others have also found.7 In 7 of the 76 patients with CD34+ AML

cells, two nearly equal-sized (or dual) CD34+CD38–ALDHint (34.4+3.3 of CD34+CD38-cells) and CD34+CD38–ALDHhigh (40.2+5.2% of CD34+CD38– cells) populations were seen (Figure 3C, Tables 1, 2). Adequate numbers of cells were sorted for FISH in 4 of these 7 patients, and both the CD34+CD38–ALDHint andCD34+CD38–ALDHhigh populations were leukemic (Table 2).

Table 1. Clinical characteristics of patients studied. Clinical Trial NCT01349972 Patients.

Patient characteristics

Total (%) (n=98)

Median Age 60 (Range: 29-70) Male 50 (51%) WBC>50,000/mm3 9 (9%) Adverse Cytogenetics 41 (42%) Complex Karyotype 29 (30%) Monosomal Karyotype 23 (23%) FLT3-ITD mutation 9 (9%) NPM1 mutation 22 (22%) Secondary AML (prior MDS or MPN) 39 (40%) Treatment-related 10 (10%) Favorable-risk 12 (12%) Intermediate-1 risk 30 (31%) Intermediate-2 risk 18 (18%) Adverse-risk 38 (39%) FLAM 69 (70%) 7+3 29 (30%) Complete remissions 63 (64%)

CD34– (n=22)

CD34+CD38–ALDHint (n=43)

58 (Range: 31-70) 9 (41%) 2 (9%) 1 (5%) 1 (5%) 0 3 (14%) 14 (64%) 5 (23%) 2 (9%) 10 (45%) 7 (32%) 3 (14%) 1 (5%) 16 (73%) 6 (27%) 19 (86%)

62 (Range: 30-70) 25 (58%) 4 (9%) 14 (33%) 9 (21%) 5 (12%) 3 (7%) 6 (14%) 16 (37%) 4 (9%) 2 (5%) 15 (35%) 14 (33%) 14 (33%) 29 (67%) 14 (33%) 29 (67%)

CD34+CD38–ALDHhigh Dual ALDHhigh & ALDHint (n=26) (n=7) 60 (Range: 32-70) 14 (54%) 2 (8%) 17 (65%) 14 (54%) 14 (54%) 6 (23%) 2 (8%) 15 (58%) 4 (15%) 0 8 (31%) 1 (4%) 17 (65%) 19 (73%) 7 (27%) 13 (50%)

58 (Range: 29-65) 2 (29%) 1 (14%) 7 (100%) 4 (57%) 3 (43%) 0 0 3 (43%) 0 0 0 0 7 (100%) 5 (71%) 2 (29%) 2 (29%)

Concomitant CBF and APL patients CD34+CD38–ALDHint CD34+CD38–ALDHhigh Dual ALDHhigh & ALDHint (n=4) (n=0) (n=0)

Patient characteristics

Total (%) (n=11)

CD34– (n=6)

Median Age Male WBC>50,000/mm3 t(8;21)(q22;q22) inv (16) APL* Complete Remissions

55 (Range: 21-70) 2 (18%) 0 (%) 2 2 7 11 (100%)

60 (Range: 21-70) 2 (33%) NA 0 0 6 6 (100%)

40 (Range: 31-65) 0 (0%) NA 2 2 0 4 (100%)

NA NA NA 0 0 0 NA

NA NA NA 0 0 0 NA

ALDH: aldehyde dehydrogenase; NA: not applicable; WBC: white blood count; AML: acute myeloid leukemia; MDS: myelodysplastic syndrome; MPN: myeloid proliferative neoplasm; FLAM: flavopiridol, cytarabine, mitoxantrone; CBF: core binding factor; APL: acute promyelocytic leukemia; *the most primitive leukemic phenotype detectable in one APL patient was CD34+CD38+ALDHint.

Table 2. Characterization of the most immature phenotype present in the leukemia by CD34, CD38, and ALDH.

AML Subtype CD34– APL CD34+CD38–ALDHint CBF CD34+CD38–ALDHhigh CD34+CD38– dual ALDHint/ALDHhigh

# 22 7 43 4 26 7

% CD34+ 0.52+0.08 0.15±0.04# 26.1±4.1 13.8±7.7 25.2±4.6 21.2±16.9

*% CD34+ CD38– 100 100 45.3±4.5 22.4±9.1 43.1±5.9 40±8.7

CD34+CD38–ALDHint % %FISH+

^

0 0 65.1±3.4 78.1±5.6 0 34.4±3.3

NA NA 69.4±13.6 98±0.3 NA 94±4

CD34+CD38–ALDHhigh ^% %FISH+ 100 100 1.7±0.5 3.8±3.5 65.6±2.5 40.2±5.2

2.2±1.6 0 2.9±1.8 0 78±6.7 92±5

AML: acute myeloid leukemia; ALDH: aldehyde dehydrogenase; int: intermediate expression; FISH: fluorescence in situ hybridization. CBF: core-binding factor; APL: acute promyelocytic leukemia; *of total CD34+ cells, ^of total CD34+CD38– cells, #1 of 7 APL patients had 27.3% CD34+ cells and is not included in these data; NA: not applicable.

610

haematologica | 2016; 101(5)

Relevance of the AML most primitive phenotype

Absence of detectable CD34+ AML cells is associated with NPM1 mutations or APL Of the 22 patients in NCT01349972 with < 1% CD34+ cells in the MMNCs, 14 harbored NPM1 mutations compared to 8 of the 76 patients with CD34+ AML cells (Table 1; Online Supplementary Figure S2A, S2B, P<0.001). Of the 12 patients with NPM1 mutations as the sole abnormality, no CD34+ leukemia cells could be detected in 11 (Online Supplementary Figure S2A) and one harbored CD34+ CD38–ALDHint leukemia cells (Online Supplementary Figure S2B) (P<0.002). The only two patients in the series with t(9;11) were among the other 8 non-NPM1-mutated patients in this CD34– group (P<0.001), as were 4 patients with normal cytogenetics (Online Supplementary Figure S2A). Only one CD34– patient harbored poor-risk cytogenetics, and 3 of the CD34– NPM1mutated patients also manifested FLT3-ITD mutations (Online Supplementary Figure S2A). Of the 8 CD34+NPM1mutated patients, 6 had a predominant population of CD34+CD38–ALDHint (5 had additional detectable mutations) and 2 (both with complex cytogenetics) had CD34+CD38–ALDHhigh leukemia cells (Online Supplementary Figure S2B).

Of the 7 APL patient specimens available for study, 6 also had < 1% (0.15+0.04) CD34+ cells (Tables 1, 2). These 6 patients showed exactly the same pattern as the other AMLs with <1% CD34+: i.e., the CD34+ cells were exclusively CD38–ALDHhigh and lacked the t(15;17) by FISH (Table 2).

CD34+ cells comprised 27.3% of the MMNCs in the other APL patient (Table 2); very few (0.9%) of the CD34+ cells from this patient were CD38–, and they all lacked t(15;17) by FISH. In contrast, the CD34+CD38+ cells did harbor the translocation.

CD34+CD38–ALDHhigh leukemia cells are associated with poor-risk AML Of the 26 patients in NCT01349972 displaying a predominant CD34+CD38–ALDHhigh leukemic population, 17 had

A

poor-risk cytogenetics and an additional 4 patients had FLT3ITD mutations (Table 1). All 7 of the patients with dual CD34+CD38–ALDHint and CD34+CD38– ALDHhigh leukemia populations also harbored poor-risk cytogenetics: 4 had highly complex cytogenetic changes, two del 7q, and one del 5q (Table 1). Thus, 28/33 (85%) patients with CD34+CD38–ALDHhigh AML cells harbored poor-risk genetic markers, while only 4 of the 22 (18%) patients with <1% CD34+ cells and 16 out of 43 (37%) patients with predominant CD34+CD38–ALDHint populations harbored poor-risk cytogenetics or FLT3-ITD mutations (P<0.0001). The patients with CD34+CD38–ALDHhigh AML cells were also more likely to have AML arising out of myelodysplastic syndrome or myeloproliferative disease (18/33, 55%) than the CD34+CD38–ALDHint and CD34– groups (21/65, 32%, P=0.04).

The leukemias’ most primitive hematopoietic cell phenotype correlates with outcomes Not surprisingly, given the strong association with poorrisk genetics, patients harboring CD34+CD38–ALDHhigh leukemic populations displayed relative drug resistance.

There was a significantly lower CR rate for patients harboring CD34+CD38–ALDHhigh leukemic populations when compared to patients with CD34+CD38–ALDHint or no CD34+ cells AML cells (Table 3, P=0.007). The CR rates for the patients with CD34+CD38–ALDHhigh leukemic populations were similar with FLAM (11/24, 46%) and 7+3 (4/9, 44%).

However, there was a trend for more CRs on the FLAM arm (36/45, 80%) than on the 7+3 arm (12/20, 60%) in the other 65 patients (P=0.1).

We next studied if the most immature phenotype present in the leukemia also showed a correlation with survival. OS was significantly different according to most immature leukemia phenotype present in the leukemia (P=0.02, Table 3, Figure 4A), with patients harboring CD34+CD38–ALDHhigh AML cells demonstrating the worst OS. There was also a sig-

B

Figure 2. Prominent ALDHint population of CD34+CD38– cells from a patient with FLT3-ITD AML. (A) Representative flow cytometric staining pattern of ALDH activity by side scatter (SSC) is displayed for CD34+CD38– cells isolated from patient. (B) FLT3-ITD status of isolated cell fractions. The CD34+CD38–ALDHint population (oval) harbored the FLT3-ITD mutation, while the CD34+CD38–ALDHhigh cells (square) exclusively displayed the 330bp wild-type gene.

haematologica | 2016; 101(5)

611

J.M. Gerber et al.

Table 3. Clinical outcomes of patients in NCT01349972 by leukemia’s most primitive hematopoietic cellular phenotype.

Complete remission Median OS (months) Median EFS (months) AlloBMT in CR1 Continuously EF Median EFS (months) No BMT in CR1 Continuously EF Median EFS (months)

CD34+CD38–ALDHhigh (including dual) (n=33)

CD34+CD38–ALDHint (n=43)

CD34– (n=22)

P*

15/33 (45%) 9.4 (95% CI: 6-36) HR – 1.3 (95% CI: 0.7-1.4) 2.2 (95% CI: 2-6) HR = 2.2 (95% CI: 1.2-3.9) 8/15 (53%) 5/8 (63%) Not reached 7/15 (47%) 0/7 4.6 (95% CI: 3 – 32)

29/43 (67%) 18.7 (95% CI: 13-36) HR – 1 11.3 (95% CI, 4-36) HR - 1 16/29 (55%) 7/16 (44%) Not reached 13/29 (45%) 4/13 (31%) 11.9 (95% CI: 5 – 32)

19/22 (86%) Not reached HR - 0.4 (95% CI: 0.2–1) 13 (95% CI: 4-36) HR - 0.6 (95% CI: 0.3-1.3) 6/20 (30%) 5/6 (83%) 23.1 (95% CI: 23 – 35) 13/20 (65%) 7/13 (54%) Not reached

0.007 0.02 0.001

0.2

0.06

ALDH: aldehyde dehydrogenase; int: intermediate expression; EF: event (relapse or death)-free; EFS: event-free survival; OS: overall survival; alloBMT: allogeneic bone marrow transplantation; CR1: first complete remission; HR: hazard ratio; CI: confidence interval; *P values for Fisher’s exact tests.

nificant difference in EFS according to the most primitive leukemia phenotype (P<0.001, Table 3, Figure 4B). The EFS probability at 1-year was 61% (95% CI, 41-90%), 45% (95% CI 29-69%), and 19% (95% CI 8-47%) for patients without detectable CD34+ leukemia cells and those with CD34+CD38–ALDHint and CD34+CD38–ALDHhigh leukemia cells, respectively (P<0.001).

As others have found a strong correlation between just leukemic CD34+CD38– cell numbers (without using ALDH expression) at diagnosis and outcome,7,15 we analyzed the prognostic impact of total CD34+CD38– numbers. There was a trend for total CD34+CD38– cell numbers at diagnosis to correlate with outcome. For patients with detectable CD34+ AML cells in trial NCT01349972, CD34+CD38– cells represented 5.6+1.5% of the MMNCs for those who entered a CR compared to 11+3% in those who did not (P=0.08, t-test). Of those patients with < 5% CD34+CD38– cells, 23% remained event-free compared to 9.5% with > 5% CD34+CD38– cells (P=0.2, Fisher's exact test). The mean frequency of CD34+CD38– cells was the same in both the ALDHint and ALDHhigh groups at 7.6+1.8% and 7.5+2.5%, respectively.

The type of postremission therapy was not specifically mandated on this trial, and many of the patients went onto alloBMT (Table 3). AlloBMT was very effective in all patients in NCT01349972, regardless of their most primitive leukemia phenotype. Of the patients with ALDHhigh leukemia cells, 8/15 who achieved a CR underwent alloBMT in CR1 and 5 remain alive and disease-free (Table 3). Similarly, 16 of the CD34+CD38–ALDHint and 6 of the CD34– patients underwent alloBMT in CR1, and 7 and 5 patients remain alive and disease-free, respectively (Table 3, P=0.2). In contrast, the outcomes of the patients who did not receive alloBMT in CR1, with most receiving cytarabine-based consolidation therapy, differed significantly by the most primitive phenotype present in leukemia cells. Seven patients with CD34+CD38–ALDHhigh leukemia cells did not undergo alloBMT in CR1, and all relapsed including 3 with normal cytogenetics and wild-type FLT3/NPM1 (Table 3). In contrast, 4/13 (3/9 with normal cytogenetics and wild-type FLT3/NPM1) patients with CD34+CD38–ALDHint leukemia cells and 7/13 (1 of 2 with normal cytogenetics and wild-type FLT3/NPM1) CD34– patients who did not undergo alloBMT remain alive and disease-free in CR1 (Table 3, P=0.06).

612

Discussion The failure of CRs to reliably translate into cures in AML35,36 can be explained by the LSC paradigm. However, the true clinical relevance of LSCs remains the focus of considerable debate.3-20,37 Several groups have shown that CD34+CD38– leukemia cell numbers present at diagnosis have strong prognostic significance, providing support for a clinical relevance for LSCs.7,15 Patients with increased numbers of CD34+CD38– at diagnosis in clinical trial NCT01349972 showed a trend toward worse outcomes. Our inability to show a stronger clinical correlation between CD34+CD38– leukemia cell numbers at diagnosis and outcome may relate to the exclusion of favorable-risk cytogenetic-risk groups from the study. We also did not use the same methodology as others who showed a stronger correlation; we analyzed only total CD34+CD38– numbers, while others further refined the CD34+CD38– subset to include the expression of leukemic stem cell associated markers7 or CD123.15 We did find that the most immature hematopoietic cellular phenotype present in leukemia cells was heterogeneous, ranging from CD34– to that of primitive HSCs (i.e., CD34+CD38–ALDHhigh), but was relatively consistent across AML risk groups.

Perhaps most importantly, the strong association between the leukemic clone’s most immature phenotype and outcome in this prospective patient cohort supports further testing of this clinical biomarker in future studies.

The vast majority of AML patients (80/109) in our series harbored CD34+CD38– leukemia cells, as initially reported

by Lapidot et al.1 Moreover, we confirmed our prior data13 that the majority of non poor-risk AMLs, including all of the CBF patients, harbored CD34+CD38– leukemia cells that could be separated from normal HSCs by their lower ALDH activity. However, 33 out of 98 (34%) of patients from NCT01349972 harbored CD34+CD38–ALDHhigh leukemia cells. This group of patients was more likely to harbor poor-risk cytogenetics or FLT3-ITD mutations, and had a statistically lower chance of achieving CRs than the other AML patients. Importantly, the presence of CD34+CD38–ALDHhigh leukemia cells was associated with a significantly lower EFS and OS, even when no unfavorable genetic or cytogenetic abnormalities could be identified.

Even though patients with CD34+CD38–ALDHhigh LSCs did haematologica | 2016; 101(5)

Relevance of the AML most primitive phenotype

A

B

C

Figure 3. Prominent ALDHhigh populations of CD34+CD38– cells. (A) Representative flow cytometric staining pattern of ALDH activity by side scatter (SSC) is displayed for CD34+CD38– cells isolated from patient. The CD34+CD38-ALDHhigh cells represented essentially all of the total CD34+CD38- cells. (B) FLT3-ITD status of isolated cell fractions. The CD34+CD38-ALDHhigh population harbored the FLT3-ITD mutation. (C) Representative flow cytometric staining pattern of ALDH activity by side scatter (SSC) is displayed for CD34+CD38– cells isolated from a patient with dual CD34+CD38–ALDHint and CD34+CD38–ALDHhigh populations.

poorly overall, 5/8 of those patients who got to alloBMT remain alive and disease-free. Several groups have also described ALDHhigh LSCs in a fraction of AML patients who appeared to have a worse prognosis.8,17-20 No CD34+ leukemia cells could be detected in 22/98 patients from NCT01349972. As others have also described,7,16,34 the CD34+ cells in these patients represented <1% of the cells at diagnosis, were exclusively CD38–ALDHhigh, and lacked the leukemic mutation. Thus, the CD34+ cells in such patients likely represented residual normal HSCs. NPM1 mutations were detected in 14 (64%) of the 22 AML patients who lacked detectable CD34+ cells, and 11/12 AML patients with NPM1 mutation as a sole abnormality were in this group. No CD34+ cells were detected in 6/7 APL patients, as others have also found.38 The one APL patient in this series with CD34+ AML cells only had the t(15;17) detected in the CD34+CD38+ cells. Other groups have reported that CD34 expression is a bad prognostic factor for both NPM1-mutated AMLs39 and APLs;40-42 the small numbers of these patients in our cohort may have hindered demonstrating similar statistical significance.

The phenotype of the LSCs in NPM1-mutated AML has been somewhat controversial. Two other groups also found that most NPM1-mutated AMLs were CD34–, with the CD34+ cells lacking leukemia mutations.4,16 However, Martelli et al. found that the NPM1 mutation was present in CD34+CD38– cells, and these cells generated AML in immunodeficient mice.43 Interestingly, CD34+ cells represented >1.5% of the MMNCs in all the NPM1-mutated AMLs transplanted into mice in that report.43 We also found the mutation in the CD34+CD38– cells from all 8 NPM1-mutated AML patients with >1% CD34+ MMNCs. Of note, 7 of these patients had cytogenetic or FLT3-ITD mutations in addition to NPM1. Thus, it appears that the most immature leukemic cell in NPM1-mutated AMLs can be either CD34+ or CD34–; it is possible that the differences can be explained by the fact that Martelli et al. did not perform immunodeficient mouse transplants with any of the 18 patients in their series harboring < 1% CD34+ cells.43 Despite our inability to detect AML cells by PCR in the small population of CD34+ cells present in the diagnostic marrows of the CD34– AMLs, a very small number (2.2%) of CD34+CD38–ALDHhigh cells had the FISH marker that charachaematologica | 2016; 101(5)

terized the AML (Table 2). Zeijlemaker et al. recently suggested that although the vast majority of AML patients with < 1% CD34+ cells in their diagnostic marrow lacked CD34+ AML cells, a small number did harbor neoplastic CD34+ cells.21 It is similarly possible that CD34+CD38–ALDHhigh AML cells may be present at very low levels in the patients whose leukemias’ most immature phenotype appeared to be CD34+CD38–ALDHint; however, based on the low FSC/SSC of these CD34+CD38–ALDHhigh cells , we believe that these small leukemic populations by FISH represent flow sorting contamination. We also previously found that the CD34+CD38–ALDHhigh cells present in AMLs harboring large CD34+CD38–ALDHint populations only produced normal hematopoiesis when transplanted into immunocompromised mice.13 Importantly, the phenotype of the most primitive hematopoietic cells found to harbor predominately leukemia-specific mutations correlated with AML risk groups and outcomes.

Our data raise the possibility that the most immature phenotype present in leukemia may be a function of the stage of hematopoietic differentiation at which the leukemogenic mutation develops. Those AMLs harboring leukemia cells sharing a phenotype with primitive normal HSCs (CD34+CD38–ALDHhigh) had the worst prognosis, while CBF and intermediate-risk AMLs’ most primitive phenotype was that of more differentiated hematopoietic progenitors (CD34+CD38–ALDHint). The most immature hematopoietic phenotype found in the most favorable-risk AMLs, APLs and those with NPM1-mutations as sole abnormalities, expressed even more differentiated phenotypes: CD34+CD38+ and CD34–CD38+.

These findings suggest that the leukemia clones’ most primitive hematopoietic cellular phenotype might serve as a biomarker for risk-stratifying patients at diagnosis. About 3040% of AML patients lack any cytogenetic or usual genetic prognostic factors,44 and even when present such prognostic factors may not be available for days or weeks. The most immature phenotype present in leukemia cells can be readily determined in essentially all patients by flow cytometry within hours of diagnosis. Rapid risk-stratification may be particularly useful for patients harboring CD34+CD38–ALDHhigh leukemia cells, which appear to identify high-risk patients often refractory to induction 613

J.M. Gerber et al.

A

B

Figure 4. (A) OS and (B) EFS in clinical trial NCT01349972 by the most immature phenotype detectable in leukemia cells. With a median followup of 22 (range 12-36) months, OS (P=0.02) and EFS (P<0.001) were significantly different according to the leukemias’ most primitive hematopoietic phenotype.

chemotherapy.

Although the phenotype of CD34+CD38–ALDHhigh leukemia cells is the same as normal HSCs, the flow cytometric pattern of the CD34+CD38–ALDHhigh population at AML diagnosis allows the primitive leukemic phenotype to be clearly distinguished from HSCs even in the absence of cytogenetic or genetic markers. The ALDHhigh cells represent the vast majority of the CD34+CD38– cells and had higher FSC/SSC at diagnosis when leukemic (Figures 3A, Table 2), while the low FSC/SSC ALDHhigh HSCs represented only a very small percentage (on average 1-2%) of the total CD34+CD38– cells (Figure 2A, Table 2). Others have published similar findings.7 Should studies confirm the adverse prognosis of a CD34+CD38–ALDHhigh leukemia phenotype, rapid identification of such patients could allow them early access to clinical trials studying novel induction approaches. Moreover, a CD34+CD38–ALDHhigh leukemic phenotype could be used to guide patients toward alloBMT when no prognostic cytogenetic or genetic abnormalities are present.

Acknowledgments The authors thank the patients who contributed research samples, 614

investigators who enrolled patients on this clinical trial and graciously shared patient samples (Matthew C. Foster: University of North Carolina, Mark R. Litzow: Mayo Clinic-Rochester, MN, Lawrence E. Morris: The Blood and Marrow Transplant Group at Northside Hospital, Stephen Strickland: Vanderbilt University Medical Center, Jeffrey E. Lancet: H. Lee Moffitt Cancer and Research Institute, Prithviraj Bose: Virginia Commonwealth University, M. Yair Levy: Texas Oncology, Baylor Charles A. Simmons Cancer Center, and Raoul Tibes: Mayo Clinic-Scottsdale, AZ, USA), the Cancer Therapy Evaluation Program (L. Austin Doyle, John J. Wright, Richard F. Little) at the NCI for sponsoring and supporting the clinical study, and the research staff at the Johns Hopkins Kimmel Cancer Center who assisted in specimen procurement. J.F.Z. is a recipient of a 2013 Young Investigator Award, in memory Dr. John R. Durant, and a 2014-2017 LLS Special Fellow in Clinical Research Award.

Funding This work was supported by the Leukemia & Lymphoma Society (LLS) (TRP R6459-13, R.J.J. and J.M.G.), and the National Institutes of Health [grants P01 CA015396 (R.J.J.), U01 A70095 (J.E.K.), 5T32 HL007525 (J.M.G.), and P30 CA006973]. haematologica | 2016; 101(5)

Relevance of the AML most primitive phenotype

References 1. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature.

1994;367(6464):645-648.

2. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3(7):730-737.

3. Sarry JE, Murphy K, Perry R, et al. Human acute myelogenous leukemia stem cells are rare and heterogeneous when assayed in NOD/SCID/IL2Rgammac-deficient mice. J Clin Invest. 2011;121(1):384-395.

4. Taussig DC, Vargaftig J, Miraki-Moud F, et al.

Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34(-) fraction. Blood. 2010;115(10):1976-1984.

5. Pearce DJ, Taussig D, Zibara K, et al. AML engraftment in the NOD/SCID assay reflects the outcome of AML: implications for our understanding of the heterogeneity of AML. Blood. 2006;107(3):1166-1173.

6. Cheung AM, Chow HC, Kwong YL, Liang R, Leung AY. FLT3/internal tandem duplication subclones in acute myeloid leukemia differ in their engraftment potential in NOD/SCID mice. Leuk Res. 2010;34(1):119-122.

7. Terwijn M, Zeijlemaker W, Kelder A, et al.

Leukemic stem cell frequency: a strong biomarker for clinical outcome in acute myeloid leukemia. PLoS One. 2014;9(9):e107587.

8. Cheung AM, Wan TS, Leung JC, et al.

Aldehyde dehydrogenase activity in leukemic blasts defines a subgroup of acute myeloid leukemia with adverse prognosis and superior NOD/SCID engrafting potential. Leukemia. 2007;21(7):1423-1430.

9. Monaco G, Konopleva M, Munsell M, et al.

Engraftment of acute myeloid leukemia in NOD/SCID mice is independent of CXCR4 and predicts poor patient survival. Stem Cells.

2004;22(2):188-201.

10. Ailles LE, Gerhard B, Kawagoe H, Hogge DE. Growth characteristics of acute myelogenous leukemia progenitors that initiate malignant hematopoiesis in nonobese diabetic/severe combined immunodeficient mice. Blood.

1999;94(5):1761-1772.

11. Feuring-Buske M, Gerhard B, Cashman J, Humphries RK, Eaves CJ, Hogge DE. Improved engraftment of human acute myeloid leukemia progenitor cells in beta 2microglobulin-deficient NOD/SCID mice and in NOD/SCID mice transgenic for human growth factors.

Leukemia.

2003;17(4):760-763.

12. Rombouts WJ, Martens AC, Ploemacher RE. Identification of variables determining the engraftment potential of human acute myeloid leukemia in the immunodeficient NOD/SCID human chimera model.

Leukemia. 2000;14(5):889-897.

13. Gerber JM, Smith BD, Ngwang B, et al. A clinically relevant population of leukemic CD34+CD38 - cells in acute myeloid leukemia. Blood. 2012;119(15):3571-3577.

14. Ghiaur G, Gerber J, Jones RJ. Concise review: Cancer stem cells and minimal residual disease. Stem Cells. 2012;30(1):89-93.

15. Vergez F, Green AS, Tamburini J, et al. High

haematologica | 2016; 101(5)

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

levels of CD34+CD38low/-CD123+ blasts are predictive of an adverse outcome in acute myeloid leukemia: a Groupe Ouest-Est des Leucemies Aigues et Maladies du Sang (GOELAMS) study.

Haematologica.

2011;96(12):1792-1798.

Schuurhuis GJ, Meel MH, Wouters F, et al.

Normal hematopoietic stem cells within the AML bone marrow have a distinct and higher ALDH activity level than co-existing leukemic stem cells. PLoS One. 2013; 8(11):e78897.

Hoang VT, Buss EC, Wang W, et al. The rarity of ALDH(+) cells is the key to separation of normal versus leukemia stem cells by ALDH activity in AML patients. Int J Cancer.

2015;137(3):525-536.

Pearce DJ, Taussig D, Simpson C, et al.

Characterization of cells with a high aldehyde dehydrogenase activity from cord blood and acute myeloid leukemia samples.

Stem Cells. 2005;23(6):752-760.

Ran D, Schubert M, Pietsch L, et al.

Aldehyde dehydrogenase activity among primary leukemia cells is associated with stem cell features and correlates with adverse clinical outcomes.

Exp Hematol.

2009;37(12):1423-1434.

Ran D, Schubert M, Taubert I, et al.

Heterogeneity of leukemia stem cell candidates at diagnosis of acute myeloid leukemia and their clinical significance. Exp Hematol.

2012;40(2):155-165.

Zeijlemaker W, Kelder A, Wouters R, et al.

Absence of leukaemic CD34 cells in acute myeloid leukaemia is of high prognostic value: a longstanding controversy deciphered. Br J Haematol. 2015;171(2):227-238.

Estey EH. How to manage high-risk acute myeloid leukemia.

Leukemia.

2012;26(5):861-869.

Karp JE, Blackford A, Smith BD, et al. Clinical activity of sequential flavopiridol, cytosine arabinoside, and mitoxantrone for adults with newly diagnosed, poor-risk acute myelogenous leukemia. Leuk Res. 2010;34(7):877882.

Zeidner JF, Foster MC, Blackford AL et al.

Randomized multicenter phase 2 study of flavopiridol (alvocidib), cytarabine, and mitoxantrone (FLAM) versus cytarabine/daunorubicin (7+3) in newly diagnosed acute myeloid leukemia.

Haematologica. 2015;100(9):1172-9.

Gerber JM, Qin L, Kowalski J et al.

Characterization of chronic myeloid leukemia stem cells. Am J Hematol.

2011;8631-37.

Dohner H, Estey EH, Amadori S et al.

Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood.

2010;115(3):453-474.

R: R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Viena, Austria.

2014.

Ghiaur G, Yegnasubramanian S, Perkins B, Gucwa JL, Gerber JM, Jones RJ. Regulation of human hematopoietic stem cell self-renewal by the microenvironment's control of retinoic acid signaling. Proc Natl Acad Sci USA.

2013;110(40):16121-16126.

29. Gerber JM, Gucwa JL, Esopi D et al.

Genome-wide comparison of the transcriptomes of highly enriched normal and chronic myeloid leukemia stem and progenitor cell populations. Oncotarget. 2013;4(5):715-728.

30. Storms RW, Trujillo AP, Springer JB et al.

Isolation of primitive human hematopoietic progenitors on the basis of aldehyde dehydrogenase activity. Proc Natl Acad Sci U S A. 1999;96(16):9118-9123.

31. Krause DS, Fackler MJ, Civin CI, May WS. CD34: structure, biology, and clinical utility.

Blood. 1996;87(1):1-13.

32. Jones RJ, Barber JP, Vala MS, et al.

Assessment of aldehyde dehydrogenase in viable cells. Blood. 1995;85(10):2742-2746.

33. Jones RJ, Collector MI, Barber JP, et al.

Characterization of mouse lymphohematopoietic stem cells lacking colony-forming activity. Blood. 1996;88(2):487-491.

34. van der Pol MA, Feller N, Roseboom M, et al.

Assessment of the normal or leukemic nature of CD34+ cells in acute myeloid leukemia with low percentages of CD34 cells.

Haematologica. 2003;88(9):983-993.

35. Appelbaum FR, Gundacker H, Head DR, et al. Age and acute myeloid leukemia. Blood.

2006;107(9):3481-3485.

36. Cheson BD, Bennett JM, Kopecky KJ, et al.

Revised recommendations of the International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia. J Clin Oncol.

2003;21(24):4642-4649.

37. Becker MW, Jordan CT. Leukemia stem cells in 2010: current understanding and future directions. Blood Rev. 2011;25(2):75-81.

38. Turhan AG, Lemoine FM, Debert C, et al.

Highly purified primitive hematopoietic stem cells are PML-RARA negative and generate nonclonal progenitors in acute promyelocytic leukemia. Blood. 1995; 85(8):2154-2161.

39. Dang H, Chen Y, Kamel-Reid S, Brandwein J, Chang H. CD34 expression predicts an adverse outcome in patients with NPM1-positive acute myeloid leukemia. Hum Pathol.

2013;44(10):2038-2046.

40. Lee JJ, Cho D, Chung IJ, et al. CD34 expression is associated with poor clinical outcome in patients with acute promyelocytic leukemia. Am J Hematol. 2003;73(3):149-153.

41. Breccia M, De Propris MS, Stefanizzi C, et al.

Negative prognostic value of CD34 antigen also if expressed on a small population of acute promyelocitic leukemia cells. Ann Hematol. 2014;93(11):1819-1823.

42. Ahmad EI, Akl HK, Hashem ME, Elgohary TA. The biological characteristics of adult CD34+ acute promyelocytic leukemia. Med Oncol. 2012;29(2):1119-1126.

43. Martelli MP, Pettirossi V, Thiede C, et al.

CD34+ cells from AML with mutated NPM1 harbor cytoplasmic mutated nucleophosmin and generate leukemia in immunocompromised mice. Blood. 2010;116(19):3907-3922.

44. Walker AR ,Marcucci G. Management of patients with cytogenetically normal acute myeloid leukemia who have neither favorable nor unfavorable markers. J Natl Compr Canc Netw. 2014;12(4):527-534.

615

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Plasma Cell Disorders

Ferrata Storti Foundation

Pre-clinical evaluation of CD38 chimeric antigen receptor engineered T cells for the treatment of multiple myeloma

Esther Drent,1,2 Richard W.J. Groen,1,3 Willy A. Noort,1,3 Maria Themeli,1 Jeroen J. Lammerts van Bueren,6 Paul W.H.I. Parren,6,7,8 JĂźrgen Kuball,4 Zsolt Sebestyen,5 Huipin Yuan,9 Joost de Bruijn,9,10 Niels W.C.J. van de Donk,1 Anton C.M. Martens,1,3,5 Henk M. Lokhorst,1,4 and Tuna Mutis1,2

Department of Hematology, VU University Medical Center, Amsterdam, the Netherlands; 2Departments of Clinical Chemistry and Hematology, Utrecht, the Netherlands; 3Department of Cell Biology, University Medical Center, Utrecht, the Netherlands; 4Department of Hematology, University Medical Center, Utrecht, the Netherlands; 5Department of Immunology, University Medical Center Utrecht, the Netherlands; 6Genmab, Utrecht, the Netherlands; 7Department of Cancer and Inflammation Research, Institute of Molecular Medicine, University of Southern Denmark, Odense, Denmark; 8Department of Immunohematology and Blood Transfusion, Leiden University Medical Center, the Netherlands; 9Xpand Biotechnology BV, Bilthoven, the Netherlands; 10The School of Engineering and Materials Science, Queen Mary University of London, UK 1

Haematologica 2016 Volume 101(5):616-625

ABSTRACT

A

Correspondence: t.mutis@vumc.nl

Received: October 6, 2015.

Accepted: February 3, 2016.

Pre-published: February 8, 2016. doi:10.3324/haematol.2015.137620

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/616

Š2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

616

doptive transfer of chimeric antigen receptor-transduced T cells is a promising strategy for cancer immunotherapy. The CD38 molecule, with its high expression on multiple myeloma cells, appears a suitable target for antibody therapy. Prompted by this, we used three different CD38 antibody sequences to generate second-generation retroviral CD38chimeric antigen receptor constructs with which we transduced T cells from healthy donors and multiple myeloma patients. We then evaluated the preclinical efficacy and safety of the transduced T cells. Irrespective of the donor and antibody sequence, CD38-chimeric antigen receptor-transduced T cells proliferated, produced inflammatory cytokines and effectively lysed malignant cell lines and primary malignant cells from patients with acute myeloid leukemia and multi-drug resistant multiple myeloma in a cell-dose, and CD38-dependent manner, despite becoming CD38-negative during culture. CD38-chimeric antigen receptor-transduced T cells also displayed significant anti-tumor effects in a xenotransplant model, in which multiple myeloma tumors were grown in a human bone marrow-like microenvironment. CD38-chimeric antigen receptor-transduced T cells also appeared to lyse the CD38+ fractions of CD34+ hematopoietic progenitor cells, monocytes, natural killer cells, and to a lesser extent T and B cells but did not inhibit the outgrowth of progenitor cells into various myeloid lineages and, furthermore, were effectively controllable with a caspase-9-based suicide gene. These results signify the potential importance of CD38-chimeric antigen receptor-transduced T cells as therapeutic tools for CD38+ malignancies and warrant further efforts to diminish the undesired effects of this immunotherapy using appropriate strategies.

Introduction Multiple myeloma (MM), a malignant disorder of antibody-producing clonal plasma cells, is the second most common hematologic neoplasia worldwide.1 Despite four decades of drug innovation, MM remains incurable with chemotherapy. Furthermore, the prognosis of MM patients who become refractory to recently developed novel agents is very poor.2 On the other hand, clinical and experimental data collected over the past decades suggest that MM could be successfully treated through (cellular) immunotherapy.3,4 The curative potential of cellular haematologica | 2016; 101(5)

CD38-CART cells for multiple myeloma treatment

immunotherapy in MM is illustrated by the induction of long-term sustained remissions after allogeneic stem cell transplantation or donor lymphocyte infusions in a subset of patients.5,6 A highly appealing and more specific immunotherapy strategy for cancer is the adoptive transfer of cytotoxic T cells that are genetically engineered to express chimeric antigen receptors (CAR).7,8 A CAR is an artificial hybrid receptor, in which the antigen-recognizing domain of a tumor-reactive monoclonal antibody is fused with T-cell signaling domains. Upon retroviral or lentiviral transduction of cytotoxic T cells, CAR expressed on the cell surface redirect the cytotoxic T cells toward the original target of the antibody in a non-HLA-restricted manner,7,8 making it possible to apply the therapy regardless of the patient’s HLA type. Currently the most successful CAR-approaches are based on targeting the CD19 molecule, which is broadly expressed in several B-cell malignancies but not on the malignant plasma cells from patients with MM. Among a few potential CAR candidates for MM,9 the CD38 molecule, with its high and uniform expression on malignant plasma cells, has long been suggested a suitable target for antibody therapy of MM. The utility of CD38 as a suitable target has been supported by the results of recently initiated clinical trials in which MM patients were safely and effectively treated with the CD38-specific human monoclonal antibody daratumumab.10 Encouraged by these clinical results, we started to explore the feasibility of development of a CART-cell therapy based on targeting the CD38 molecule. Using variable heavy and light chain sequences of three different human CD38 antibodies, we generated three different CD38CAR. We transduced T cells from healthy individuals and MM patients with the CD38-CAR and evaluated them for essential functions such as antigen-specific proliferation and cytokine production, for in vitro and in vivo anti-tumor efficacy and for potential undesired effects such as targeting normal CD38+ cell fractions in the peripheral blood and bone marrow. We also evaluated the feasibility of controlling CD38-CART cells by introducing a caspase-9based suicide gene.

Methods Bone marrow mononuclear cells from patients with multiple myeloma or acute myeloid leukemia

which are distinct from, but display similar affinities to the recently documented daratumumab10 (Online Supplementary Table S1) were kindly provided by Genmab. Cloning methods are described in the Online Supplementary Methods.

Retroviral chimeric antigen receptor transduction into T cells Transduction methods are described in the Online Supplementary Methods.

Flow cytometry-based cell lysis assays To detect the lysis of various cell subsets by CART cells in mononuclear cells from whole bone marrow or peripheral blood, serial dilutions of CART cells were incubated with CFSE-labeled bone marrow mononuclear cells or peripheral blood mononuclear cells for 24 h. The cells were then harvested, stained for different CD markers and topro3 or LIVE/DEAD® Fixable Near-IR (Life Technologies L10119) and were quantitatively analyzed through volume-equalized measurements using a FACS Canto flow cytometer. For each cell subset identified with a CD marker, CFSE+, viable+/Topro3- cells were counted as surviving target cells.

Percentage cell lysis in a treated sample was calculated as follows and only if the analyzed target cell population contained >500 viable cells in the untreated samples. % lysis cells = 1 − (absolute number of surviving cells in treated wells / absolute number of surviving cells in untreated wells) × 100%.

Bioluminescence imaging-based cell lysis assays To determine the lysis of Luc-GFP-transduced human malignant cell lines by CD38-CART cells, serial dilutions of mock or CD38CART cells were co-incubated with the malignant cell lines. The luciferase signal produced by surviving malignant cells was determined after 16-24 h with a SpectraMax luminometer (Molecular Devices) within 15 min after the addition of 125 μg/mL beetle luciferin (Promega).11 The percent lysis was then calculated as in the flow-based cytotoxicity assay above.

Experimental animals

RAG2-/-γc-/- mice used in this study were originally obtained from the Amsterdam Medical Center (AMC, Amsterdam, the Netherlands). The mice were bred and maintained in filter top cages under specified pathogen-free conditions at the Central Animal Facility (GDL, Utrecht University, Utrecht, the Netherlands) and received sterile water and radiation-sterilized food pellets ad libitum.

In vivo efficacy of CD38-chimeric antigen receptortransduced T cells against multiple myeloma tumors growing in a humanized microenvironment

Bone marrow mononuclear cells containing 5-20% malignant plasma cells or ~50% acute myeloid leukemia (AML) blasts were isolated from bone marrow aspirates of MM/AML patients through Ficoll-Paque density centrifugation and cryopreserved in liquid nitrogen until use. All bone marrow and blood sampling from the patients was performed after informed consent and approved by the institutional medical ethical committee.

To create a human bone marrow-like environment in mice, hybrid scaffolds were coated in vitro with human mesenchymal stromal cells. After a week of in vitro culture, humanized scaffolds were seeded with CD38+ UM9 cells and implanted subcutaneously into the mice, as described previously,11,12 and in the Online Supplementary Methods.

Peripheral blood mononuclear cells from healthy individuals

Results

Peripheral blood mononuclear cells were isolated from the buffy coats of healthy blood-bank donors by Ficoll-Paque density centrifugation after informed consent and approval by the institutional medical ethical committee.

Generation of CD38-chimeric antigen receptor-transduced T cells

Retroviral constructs

We used the variable heavy and light chain sequences of three different CD38 antibodies with CD38 binding affinities comparable to that of daratumumab (Online

The sequences of three different human CD38 antibodies, haematologica | 2016; 101(5)

617

E. Drent et al.

Supplementary Table S1), which is now being tested in clinical trials. T cells from healthy peripheral blood mononuclear cells were transduced with the different CD38-CAR genes or with the empty vector (mock) separately. After selection of transduced cells to high purity by neomycin treatment, the surface expression of CAR was determined by incubating the T cells with biotinylated bacterial protein L, which specifically binds to the variable region of kappa light chains of antibodies.13 Indirect staining with phycoerythrin-conjugated streptavidin revealed the expression of all three CAR on >95% of the T cells, whereas T cells transduced with an empty vector (mocktransduced T cells) displayed only background staining (Figure 1B, left panel). The CAR-transduced cells contained variable levels of both CD4+ and CD8+ cells (Figure 1B, right panel).

One AML cell line, the Burkitt lymphoma-derived cell line Daudi as well as normal T cells appeared less sensitive to CD38-CART cell-mediated lysis as compared to MM cell lines with similar levels of CD38 expression (Figure 2C).

A B

CD38-dependent proliferation and cytokine secretion of CD38-chimeric antigen receptor-transduced T cells To analyze their proliferative and functional properties, neomycin-selected, highly purified CD38-CART cells were expanded using irradiated feeder cells in the presence of phytohemagglutinin and interleukin-2. While the mock T cells initially expanded better than the CD38CART cells (Figure 1C, left panel), the growth disadvantage of CD38-CART cells disappeared in the second round of expansion (Figure 1C, right panel), indicating that transduction of the CD38-CAR construct did not affect the proliferative capacity of T cells. We then tested whether CD38-CART cells can be activated by CD38-triggering.

To this end, we co-cultured mock- and CD38-CAR-transduced T cells with the irradiated CD38+ MM cell line UM9 and used the CD38- MM cell line U266 as a control (Figure 1D, left panel). CD38-CART cells, but not mock T cells, specifically proliferated and produced interferon-γ, tumor necrosis factor-α and interleukin-2 (Figure 1D, right panel), but not interleukin-4, -5 or -10 (data not shown) upon stimulation with UM9 cells. These results indicate that CD38CART cells had no defects in cytokine production but displayed a typical Th1-like cytokine response upon target recognition. Furthermore, the CD38- cell line U266 was unable to stimulate CD38-CART cells, demonstrating the proper antigen-specific function of CD38-CART cells.

C

D

CD38-dependent lysis of multiple myeloma cell lines

by CD38-chimeric antigen receptor-transduced T cells To determine the CD38-dependent lysis of malignant cells by CD38-CART cells, we first used luciferase-transduced MM cell lines with variable CD38 expression levels in bioluminescence imaging-based cytotoxicity assays.11,14 As expected, there was no CD38-CAR-specific lysis of the CD38- U266 cell line (Figure 2A). In contrast, all three types of CD38-CART cells, but not mock T cells, effectively lysed the CD38+ MM cell line UM9 in a cell-dose dependent manner (Figure 2B), showing the feasibility of generating effective CART cells with any of the CD38 antibody sequences we used. Since there was no functional difference between the three different CD38-CAR (028, 056, 026), we continued our investigation with one type of CD38-CART cell (CAR056). Flow cytometry and bioluminescence imaging-based cytotoxicity assays, performed using other malignant cell lines expressing various levels of CD38 (Online Supplementary Figure S1) as target cells, revealed a good correlation between CD38 expression and CD38-CART cell-mediated lysis (Figure 2C).

618

Figure 1. CD38-CAR construct and CD38-CART-cell phenotype. (A) Schematic overview of the CD38-CAR construct. The CD38-scFv sequence is based on three different antibody sequences (028, 056 and 026, see also Online Supplementary Table S1), with CD8a as a transmembrane domain and 4-1BB and CD3ζ as intracellular domains. (B) CAR expression on the cell surface of healthy donor T cells was determined by binding of biotinylated protein L to the scFv domain (left panel), stained with phycoerythrin-labeled streptavidin. The results for CD38-CART cells generated with CAR056, representative of all three CAR, are shown. The expression of surface markers CD4 and CD8 (right panel) was determined by fluorescence-labeled monoclonal antibodies. (C) The expansion of mock and CD38-CART cells after transduction (left panel) and after the second round of stimulation (right panel; new stimulation set at “0”). (D) The relative 3H-thymidine uptake (left panel) of mock and CD38-CART cells after 72 h stimulation with the CD38+ MM cell line UM9: responder ratio of 3:1. Error bars represent mean + SEM, n=3. The results are expressed as relative stimulation index, compared to mock, and considered significant if the stimulation index is ≥3. The cytokine secretion (right panel) from mock and CD38-CART cells stimulated with αCD3/CD28 beads or the MM cell line UM9. The cytokine secretion was measured with a flow cytometry-based CBA kit (BD) in the cell-free supernatants after 24 h of stimulation. The graph shows the secretion of interferon (IFN)-γ, tumor necrosis factor (TNF) and interleukin (IL)-2. Secretion of IL-4, -5 and -10 was below the detection limits. These data are not therefore shown in this figure. Similar results were obtained in two independent assays.

haematologica | 2016; 101(5)

CD38-CART cells for multiple myeloma treatment

Lysis of primary multiple myeloma and acute myeloid leukemia cells by CD38-chimeric antigen receptor-transduced T cells To test the efficacy of CD38-CART cells against primary MM and AML cells, we used a previously described flow cytometry-based ex vivo cytotoxicity assay, in which the lysis of malignant cells is tested directly in bone marrow mononuclear cells without isolating them from other cells.15 As depicted in Figure 3A, primary CD138+CD38+ MM cells from three different MM patients, who were refractory to treatment with lenalidomide and bortezomib (left panel), were effectively lysed by CD38-CART cells, but not by mock-transduced T cells. Similarly, in the bone marrow mononuclear cells of two AML patients’ malignant cells, which were identified as CD13+ CD45+ cells and expressed either low/intermediate (patient 1) or high (patient 2) levels of CD38, were effectively lysed by CD38-CART cells (Figure 3A). Finally, CD38-CART cells that were generated (Figure 3B) from a MM patient were effective towards autologous malignant MM cells in bone marrow mononuclear cells, indicating the feasibility of generating effective CD38-CART cells also from MM patients.

Fully functional CD38-chimeric antigen receptor-transduced T cells are negative for CD38 While CD38-CART cells had no apparent functional deficiencies, a phenotyping assay revealed that, despite a mixed effector/central memory phenotype, they lost the expression of CD38 (Figure 4A). Interestingly, when we co-cultured CD38-CART cells with an autologous CD19CART cell population, these CD19-CART cells also became largely negative for CD38 expression but fully maintained their capacities to proliferate, secrete cytokines and kill the relevant target cells in a CD19dependent fashion (Online Supplementary Figure S2), indicating that the loss of CD38 was not associated with detectable T-cell dysfunction. Nonetheless, since the CD38 molecule could also play a role in migration, we evaluated whether CD38- CD38-CART cells could migrate properly through endothelial layers in a transwell migration assay (Figure 4B). These assays revealed no differences between the mock-transduced, CD38+ and CD38-CAR-transduced CD38- T cells, ruling out an apparent migratory dysfunction of CD38-CART cells.

A

B

C

Figure 2. Efficacy of CD38-CART cells at lysing MM cell lines. In 24 h cytotoxicity assays, three different types of CD38-CART cells were tested against two MM cell lines with different CD38 expression levels: (A) U266, a CD38– cell line, (B) UM9, a CD38+ cell line. Effector:target ratios are indicated. Target cells per well were 10,000 MM cells. Closed circles () indicate mock cells and open squares, triangles and diamonds (□, , ) indicate the CAR028, 056 and 026 constructs, respectively. Error bars indicate mean ± SD. (C) Correlation between mean fluorescent intensity (MFI) of CD38 on target cells and consequential CD38-CAR specific lysis. CD38-CART cells (CAR056) were co-cultured with leukemic cell lines and allogeneic healthy donor peripheral blood mononuclear cells. The resulting lysis in a 3:1 ratio was determined with bioluminescence imaging or flow cytometry, minus the spontaneous lysis caused by mock T cells. Open circles () indicate MM cell lines (LME-1, UM9, MM1.S, U266, L363 and UM3), triangles ( ) indicate AML (HEL, MOLM13), T lymphoblast (CEM) and Burkitt lymphoma (Daudi), and closed circles () indicate healthy immune cells (T=T cells, B=B cells, NK=NK cells, Mo=monocytes, C=CEM, H=HEL, M=MOLM13, D=Daudi), Error bars represent mean ± SEM of duplicate measurements.

haematologica | 2016; 101(5)

619

E. Drent et al.

In vivo efficacy of CD38-chimeric antigen receptortransduced T cells against multiple myeloma tumors growing in a humanized microenvironment To substantiate the in vitro results, we questioned whether the CD38- CART cells could mediate anti-MM effects in vivo after systemic injection in our recently developed model in Rag2-/-γc-/- mice, in which a humanized bone marrow-like niche for MM cells is generated by subcutaneous implantation of ceramic scaffolds coated with human bone marrow stromal cells11,12 (Figure 4). Thus, we implanted such scaffolds seeded with luciferase-transduced UM9 MM cells in the back of the mice (6 scaffolds per mouse). Upon detection of the luciferase signal by bioluminescence imaging, we treated the mice with intravenous injections of CD38-CART cells using a previously established treatment scheme.16 Mock-transduced T cells were used as controls. As illustrated in Figure 4B, in the control group treated with mock T cells, tumors showed

fast progression. Although not curative, treatment of the tumor-bearing mice with CD38-CART cells induced a significant anti-tumor effect (Figure 4B,C) underscoring the potential of CD38-CART cells to properly infiltrate and lyse MM tumors growing in their natural, protective niche. Post mortem analyses revealed that the remaining CD138+ tumors were still positive for CD38 (Figure 4D), thus ruling out tumor escape due to “antigen loss” variants.

Impact of CD38-chimeric antigen receptor-transduced T cells on CD38+ normal hematopoietic cells and hematopoietic progenitor cells Besides the high levels expressed in MM cells, the CD38 molecule is expressed at intermediate levels on a subset of hematopoietic progenitor cells17 and on a fraction of normal hematopoietic cells including activated T cells, natural killer cells, B cells and monocytes. We, therefore, evaluat-

A

B

620

C

Figure 3. Efficacy of CD38-CART cells generated from healthy individuals at lysing primary MM cells. (A) Bone marrow-derived mononuclear cells from three MM patients, all three refractory to lenalidomide and bortezomib, and bone marrow mononuclear cells from two AML patients were co-incubated with no, mock- or CD38-CART cells generated from healthy peripheral blood mononuclear cells for 16 h. Closed circles () indicate mock and open squares (□) indicate CAR056T cells (representative of all CAR). The graphs depict the resulting lysis of CD138+/CD38+ cells (MM) or CD13+/CD7+/CD45dim/CD38+ cells (AML1, moderate CD38 expression) and CD33+/CD133+/CD45dim/CD38+ cells (AML2, high CD38 expression) in three effector:target cell ratios. The percent lysis in these flow cytometry assays was calculated as described in the Methods section. (B) Efficacy of CD38CART cells generated from a MM patient: CAR expression on the cell surface of the patient’s T cells was determined by flow cytometry with protein L staining (see also Figure 1). (C) Bone marrow-derived mononuclear cells from the MM patient were co-incubated with autologous mock- or CD38-CART cells for 16 h. The graph depicts resulting lysis of CD138+/CD38+ cells at two ratios, determined in flow cytometry-based assays.

haematologica | 2016; 101(5)

CD38-CART cells for multiple myeloma treatment

ed the possible negative impact of CART cells on these cell subsets by co-incubating unsorted bone marrow mononuclear cells with CD38-CART cells. CD38-CART cells appeared to eliminate the CD38+ fractions of mature T, B, natural killer and monocyte cell subsets (Figure 5A) and the CD38+ fraction of CD34+ cells (Figure 5B) in a 4 h assay. The lysis of CD34+CD38+ cells did not, however, have any influence on the development of colony-forming units of monocytes or of granulocytes in a 14-day hematopoietic precursor cell colony-forming assay18,19 (Figure 5C,D).

A

B

Specific elimination of CD38-chimeric antigen receptor-transduced T cells using a suicide gene (iCasp9) Although CD38-CART cells did not lyse the CD38- fractions of mature hematopoietic cells and did not inhibit the outgrowth of these cell populations, a cautious approach toward the clinical application of this construct is still required. As a first step towards safer application of CD38-CART cells, we tested the possibility of controlling them with a suicide gene based on the inducible caspase9 (iCasp9) gene that is activated with a small dimerizer molecule AP20187 (B/B).20 Thus, we inserted an iCasp9

C

D

E

Figure 4. Tumor growth in mock- and CD38-CART-cell-treated mice. (A) Analysis of CD38-CART cells after 2 weeks of in vitro culture, with fluorescence-labeled monoclonal antibodies for CD45RA and CD62L and CD38. (B) Leukocyte transmigration assay, in which mock and CART cells were cultured in a transwell system in the inserts with human umbilical vein endothelial cells, which were activated with tumor necrosis factor (TNF)-α. Spontaneous TNFα-induced transmigration was compared to active migration induced by 10% human serum in the lower compartment. % migrated cells = [Relative Fluorescence Units (RFU) of cells in lower compartment / RFU of total cells in both compartments] * 100%. (C) Analysis of tumor load in mice by quantification of bioluminescent imaging measurements. Each group contained six mice, each harboring six scaffolds. Results are mean tumor load (cpm/cm2) of six mice per group. Closed circles () indicate mock cells and open squares (□) indicate CAR056 cells. The error bars represent mean + SEM, n=6. The differences between groups were analyzed after week 6 using an unpaired Student T test, P<0.0001 (D) Bioluminescent imaging of mice on the right side; mice were implanted with fully humanized bone marrow stromal cell scaffolds each coated with 1×106 UM9-GFP-Luc tumor cells. At 7, 9 and 13 days after implantation, mice were injected intravenously with 20×106 mock or CD38-CART cells. (E) Representative immunohistochemistry figure: remaining tumors were stained with CD38 and CD138 antibody, T = tumor, sc = scaffold.

haematologica | 2016; 101(5)

621

E. Drent et al.

vector containing a green fluorescent protein (GFP) marker gene into the CD38-CART cells by retroviral transduction. Around 50% of the CD38-CART cells were transduced, as detected by GFP expression (Figure 6A, upper panel). When tested without sorting the iCasp9-transduced (GFP+) cells, all iCasp9-transduced, GFP+, but none of the iCasp9-non-transduced, GFP-CD38-CART cells were eliminated upon incubation with the dimerizer AP20187 (Figure 6A, lower panel). As expected, the dimerizer treatment also resulted in a proportional decrease in the lysis of the MM cell line UM9. (Figure

A

6B). There was still some remaining lysis due to the surviving iCasp9-negative CD38-CART cells, indicating that triggering the suicide gene did not induce bystander damage to the cells in the close vicinity. When tested after sorting for GFP+ cells (Figure 6C,D), almost all GFP+ cells died after treatment with the dimerizer (Figure 6C) and there was no CD38-specific lysis left (Figure 6D), confirming the results obtained in previous studies,20,21 and suggesting the possibility of controlling CD38-CART cells using the iCasp9 suicide gene without undesired consequences.

C

D

B

Figure 5. The impact of CD38-CART cells on non-malignant hematopoietic cells in bone marrow and outgrowth of hematopoietic cell lineages. (A) Bone marrow mononuclear cells from three MM patients were co-incubated with none, mock- or CD38-CART cells for 16 h. The graphs depict the resulting lysis of the total or the CD38+ fractions of CD3+ (T cells), CD56+ (mainly natural killer cells), CD14+ (monocytes) and CD19+ (B cells) subsets at three effector:target rations, determined with flow cytometry and calculated as described in the Methods section. Results are from three individual experiments combined. Closed circles () indicate mock cells and open squares (□) indicate CAR056 cells. Error bars represent mean ± SEM, n=3. (B) CD34+ fraction of bone marrow mononuclear cells from healthy donors was co-incubated with none, mock- or CD38-CART cells for 4 h at different target:effector cell ratios before being transferred into the semisolid hematopoietic progenitor cell culture medium. After incubation, cells were analyzed by flow cytometry for surviving CD34+ cells with CD38 expression. The graphs depict the resulting lysis of the total or the CD38+ fraction of CD34+ cells. Closed circles () indicate mock cells and open squares (□) indicate CAR056 cells. (C) After 14 days of culture in plastic dishes, colony-forming unit-monocytes (CFU-M), and CFU-granulocytes (CFU-G) were visible. (D) The numbers of CFU-M and CFU-G colonies were determined microscopically. Results of a representative experiment are shown as mean ± SD.

622

haematologica | 2016; 101(5)

CD38-CART cells for multiple myeloma treatment

Discussion While cellular immunotherapy of hematologic malignancies has been applied for many decades in the most non-specific form as allogeneic stem cell transplantation or donor lymphocyte infusions, it has recently entered a more specific level of innovation with several encouraging strategies, including vaccination with antigen-loaded dendritic cells or adoptive immunotherapy with T-cell receptor-gene transferred T cells, tumor infiltrating T cells and more recently with cytotoxic T cells endowed with tumor-reactive CAR. Among these strategies, CAR-based therapies are perhaps the most appealing, as CART cells recognize their target antigens in an MHC-independent manner. Setting out to develop a CAR-based strategy for MM, we have been encouraged by the highly promising clinical results of therapy with daratumumab, which targets CD38, a type II transmembrane glycoprotein, expressed at high and uniform levels in most, if not all, MM cells in all stages of the disease.10 Daratumumab has recently been administered to several patients at moderate to high doses and for prolonged periods with little or no toxicity, despite the fact that the CD38 molecule is also expressed, albeit at lower levels, on a fraction of hematopoietic cells, cerebellar Purkinje cells, liver and lung smooth muscle cells, and insulin-secreting β cells of pancreas.17 Our study was, therefore, designed to test the feasibility, potential efficacy and pitfalls of a CD38-based

A

CART-cell approach for MM. To investigate the feasibility of generating CD38-CAR, we started the study using three distinct human CD38 antibodies, which showed similar binding affinities to CD38 as that of daratumumab (Online Supplementary Table S1). Based on successful usage of 4-1BB-containing CAR in recent studies22–24 we constructed CAR containing 4-1BB (CD137) co-stimulatory and CD3ζ activating domains. Our results demonstrate the successful generation of CD38-CAR and CD38-CART cells regardless of the antibody sequences. T cells transduced with these CD38-CAR are highly proliferative, produce inflammatory Th1-like cytokines and, most importantly, are effective in killing malignant cells and normal hematopoietic cells in a CD38-dependent fashion, with some subtle differences between cell lines or hematopoietic cell types.

More importantly, CD38-CART cells appeared capable of eliminating primary CD38+ MM cells from patients who had become resistant to various chemotherapies.

This suggests that CD38-CAR therapy could be a viable choice for patients with few or no further chemotherapy options. These in vitro data were substantiated by the results obtained in our in vivo model. Although we did not observe the complete eradication of MM cells in our in vivo assays, we need to note that, since our CD38-CART cells appeared to lose their CD38 expression upon culture, we primarily designed our in vivo assays to determine the antitumor efficacy of these CD38-, but long-term cultured

B

C

D

haematologica | 2016; 101(5)

Figure 6. Dimerizer AP20187-mediated elimination of the iCasp9 suicide gene-transduced CD38-CAR T cells. (A) Flow cytometry histogram plots: CD38-CAR T cells that were additionally transduced with the iCasp9-GFP construct. The upper panel shows the untreated cells: 50% GFP+; the lower panel shows the cells treated with 100 nM dimerizer AP20187 (B/B). (B) Lysis of the UM9 cell line by iCasp9-transduced CD38-CAR T cells that were untreated or treated with the dimerizer. The significant reduction of GFP+ cells (A) is a consequence of cell death activated by the dimerizer B/B. Note (in B) the decrease in cytolysis is proportional to the elimination of the suicide gene-transduced cells (50% of all CAR+ cells in (A). The residual cytolysis is thus caused by the CAR+ cells that were not transduced with iCasp9 n=2, mean ± SD. (C) CD38-CART iCasp9-GFPhigh sorted cells. The upper panel shows the untreated cells 100% GFP+; the lower panel shows the cells treated with 100 nM dimerizer B/B. (D) Lysis of the UM9 cell line by iCasp9high-CD38-CART cells that were untreated or treated with the dimerizer. Closed circles () indicate mock cells and open diamonds ( ) and triangles ( ) indicate CAR056 without and with B/B, respectively. n=2, mean ± SD.

623

E. Drent et al.

CD38-CART cells. This may have negatively influenced the anti-tumor efficacy, since it is known that long-term cultured T cells rapidly lose their in vivo persistence capacities.25,26 In addition, and perhaps even more importantly, in our model, unlike all previously reported CAR studies, the human MM tumors were grown to larger masses in a fully humanized bone marrow microenvironment. The MM microenvironment is known to provide essential signals for survival, growth and, more importantly, immune resistance of MM cells.11,12,27,28 Since our model includes some of the microenvironment-related aspects, our results suggest that the efficacy of CART-cell treatment could be improved if the therapy were to be combined with immune checkpoint inhibitors and/or with survivin and/or MCL-1 inhibitors which are effective modifiers of cell adhesion-mediated immune resistance induced by the tumor microenvironment.11 Unlike a number of earlier reports, which mainly focused on the anti-tumor efficacy of CD38-CART cells,29– 31 we devoted a considerable part of our investigation to identifying the potential drawbacks and risks of CD38CART-cell therapy. Although CD38-CART cells eliminated the CD38+ fractions of immune cell subsets as well as the CD38+ fraction of hematopoietic progenitor cells, we observed no inhibition of the outgrowth of hematopoietic lineages from CD34+CD38- progenitor cells. Furthermore, CD38-CART cells did not induce complete depletion of mature hematopoietic cells in the periphery. The CD38fractions of important immune cells, such as B and T cells, were also unaffected. These results suggest that the therapy will spare sufficient numbers of T and B cells for these to maintain their functions. However, since CD38 is a well-known T-cell activation molecule, and has also been implicated in chemotaxis,32 T-cell development,33 dendritic cell trafficking and humoral immune responses,34 it would be relevant to determine whether an intact immune response would be possible in the absence of CD38. A partial solution to this issue came from the analyses of CD38-CART cells: remarkably, we discovered that the CD38-CART cells, regardless of which single chain variant fragment was used, became completely devoid of CD38 expression on their surface in various independently generated batches of cells. The loss of CD38 was thus unlikely to be caused by a genetic defect, but was most probably due to the “self lysis” of the CD38+ fractions, which was also described in another CD38-CAR study.29 Our CD38CD38-CART cells, however, had no growth disadvantage, had a highly activated status, displayed CD38-dependent proliferation, cytokine production, and cytotoxic activities and showed no other detectable functional aberrancies.

This was also the case for CD19-CART cells which became CD38- after co-culture with CD38-CART cells (Online Supplementary Figure S2). Furthermore CD38CART cells did not show any defects in transmigration assays and they also mediated significant anti-MM effects

References 1. Kyle RA, Rajkumar SV. Multiple myeloma.

N Engl J Med. 2004;351(18):1860–1873.

2. Kumar SK, Lee JH, Lahuerta JJ, et al. Risk of progression and survival in multiple myelo-

624

in vivo, thus indicating their capacity to migrate properly and infiltrate into the MM niches and to kill them. Thus, it seems likely that: (i) not all activated T cells have to be CD38+, and (ii) CD38 expression is not essential for T cells to fulfill their functions. This latter conclusion is also supported by the fact that there is still no evidence, even from CD38 knockout mice,32 that CD38-deficient effector T cells are functionally defective.

On the other hand, the relatively broad expression of the target antigen of CD38-CART cells increases the risk of the so-called “cytokine release syndrome” due to massive activation of CART cells, as has been observed in previous trials with ERBB2- and CD19-CART cells. 35–37 Although the interleukin-6 receptor antagonist tocilizumab appears to reduce cytokine release syndrome38 it would still be desirable to minimize the occurrence of such severe side effects. Furthermore, since we cannot rule out toxicities occurring due to the possible attack of nonhematopoietic CD38+ cells, development of an optimal CD38-CART-cell therapy would require the improvement of the target-specificity as well as the in vivo control of CD38-CART cells, and probably also in the case of other CART-cell approaches targeting the kappa light chain,39 CD138,40 Lewis Y antigen,41 BCMA,42 CS1,43,44 and CD44v6.45 One future option to improve the target-specificity could be optimization of the target cell affinity of CART cells. In addition, suicide genes may enable the in vivo control of adoptively transferred CART cells. Indeed, in our first attempt to improve the safety profile of CD38CART cells we observed that the iCasp9 gene20,46 can effectively control CART cells. These results, which are in agreement with those of other studies,20,45,47 provide positive prospects for future clinical trials. The safety profile of CART cells could also be improved by the generation of inducible CAR constructs or using the recently developed dual CAR technologies.

Considering all the data together, we conclude that CD38-CART cells are powerful immunotherapeutic tools and can be beneficial, especially for MM patients who have no other chemotherapy options. These results warrant further studies aimed at diminishing the undesired effects of CD38-CART cells against normal CD38+ cells through optimizing the formers’ CD38 affinity and improving in vivo controllability.

Acknowledgments We thank Dr. C. June for providing the sequence for the 4-1BBCD3ζ transgene, Dr. D. Spencer for the inducible caspase-9 plasmid (15567), Dr. M. Sadelain for providing viral supernatant for CD19-CAR, Drs G.J. Ossenkoppele, A.A. van de Loosdrecht and S. Zweegman for critically reading the manuscript and suggestions, R. de Jong-Korlaar, M. Emmelot and L. Lubbers for technical assistance with in vivo experiments. The RAG2-/-γc-/- mice used in this study were originally obtained from the Amsterdam Medical Center, Amsterdam, the Netherlands.

ma relapsing after therapy with IMiDs and bortezomib: a multicenter International Myeloma Working Group study. Leukemia.

2012;26(1):149-157.

3. Kröger N, Damon L, Zander AR, et al.

Secondary acute leukemia following mitoxantrone-based high-dose chemotherapy for primary breast cancer patients. Bone

Marrow Transplant. 2003;32(12):1153-1157.

4. Bensinger WI, Buckner CD, Anasetti C, et al.

Allogeneic marrow transplantation for multiple myeloma: an analysis of risk factors on outcome. Blood. 1996;88(7):2787-2793.

5. Kröger N, Miyamura K, Bishop MR. Minimal residual disease following allogeneic hematopoietic stem cell transplantation.

haematologica | 2016; 101(5)

CD38-CART cells for multiple myeloma treatment

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

Biol Blood Marrow Transplant. 2011;17(1 Suppl):S94-100.

Lokhorst HM, Schattenberg A, Cornelissen JJ, et al. Donor lymphocyte infusions for relapsed multiple myeloma after allogeneic stem-cell transplantation: predictive factors for response and long-term outcome. J Clin Oncol. 2000;18(16):3031-3037.

Brentjens RJ, Davila ML, Riviere I, et al.

CD19-targeted T cells rapidly induce molecular remissions in adults with chemotherapy-refractory acute lymphoblastic leukemia.

Sci Transl Med. 2013;5(177):177ra38.

Grupp SA, Kalos M, Barrett D, et al.

Chimeric antigen receptor–modified T cells for acute lymphoid leukemia. N Engl J Med. 2013;368(16):1509-1518.

Garfall AL, Fraietta JA, Maus M V. Immunotherapy with chimeric antigen receptors for multiple myeloma. Discov Med. 2014;17(91):37-46.

Lokhorst HM, Plesner T, Laubach JP, et al.

Targeting CD38 with daratumumab monotherapy in multiple myeloma. N Engl J Med. 2015;373(13):1207-1219.

De Haart SJ, van de Donk NWCJ, Minnema MC, et al. Accessory cells of the microenvironment protect multiple myeloma from Tcell cytotoxicity through cell adhesion-mediated immune resistance. Clin Cancer Res. 2013;19(20):5591-5601.

Groen RWJ, Noort WA, Raymakers RA, et al. Reconstructing the human hematopoietic niche in immunodeficient mice: opportunities for studying primary multiple myeloma.

Blood. 2012;120(3):e9-e16.

Zheng Z, Chinnasamy N, Morgan RA. Protein L: a novel reagent for the detection of chimeric antigen receptor (CAR) expression by flow cytometry. J Transl Med. 2012;10(1):29.

McMillin DW, Delmore J, Weisberg E, et al.

Tumor cell-specific bioluminescence platform to identify stroma-induced changes to anticancer drug activity. Nat Med. 2010;16(4):483-489.

Van der Veer MS, de Weers M, van Kessel B, et al. Towards effective immunotherapy of myeloma enhanced elimination of myeloma cells by combination of lenalidomide with the human CD38 monoclonal antibody daratumumab. Haematologica. 2011;96(2): 284-290.

Spaapen RM, Groen RWJ, van den Oudenalder K, et al. Eradication of medullary multiple myeloma by CD4+ cytotoxic human T lymphocytes directed at a single minor histocompatibility antigen.

Clin Cancer Res. 2010;16(22):5481-5488.

Malavasi F, Deaglio S, Funaro A, et al.

Evolution and function of the ADP ribosyl cyclase/CD38 gene family in physiology and pathology. Physiol Rev. 2008;88(3):841886.

Mutis T, Schrama E, van Luxemburg-Heijs SA, et al. HLA class II restricted T-cell reactivity to a developmentally regulated antigen shared by leukemic cells and CD34+ early progenitor cells. Blood. 1997;90(3): 1083-1090.

Miller CL, Lai B. Human and mouse hematopoietic colony-forming cell assays.

haematologica | 2016; 101(5)

Methods Mol Biol. 2005;290:71-89.

20. Straathof KC, Pulè MA, Yotnda P, et al. An inducible caspase 9 safety switch for T-cell therapy. Blood. 2005;105(11):4247-4254.

21. Tey S-K, Dotti G, Rooney, Cliona M et al.

Inducible caspase 9 suicide gene to improve the safety of allodepleted T cells after haploidentical stem cell transplantation. Biol Blood Marrow Transplant. 2007;13(8):913924.

22. Kalos M, Levine BL, Porter DL, et al. T cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. Sci Transl Med. 2011;3(95):95ra73.

23. Frigault MJ, Lee J, Basil MC, et al.

Identification of chimeric antigen receptors that mediate constitutive or inducible proliferation of T cells. Cancer Immunol Res. 2015;3(4):356-367.

24. Imai C, Mihara K, Andreansky M, et al.

Chimeric receptors with 4-1BB signaling capacity provoke potent cytotoxicity against acute lymphoblastic leukemia. Leukemia.

2004;18(4): 676-684.

25. Spaulding C, Guo W, Effros RB. Resistance to apoptosis in human CD8+ T cells that reach replicative senescence after multiple rounds of antigen-specific proliferation. Exp Gerontol. 1999;34(5):633-644.

26. Akbar AN, Henson SM. Are senescence and exhaustion intertwined or unrelated processes that compromise immunity? Nat Rev Immunol. 2011;11(4):289-295.

27. Mitsiades CS, Mitsiades NS, Richardson PG, Munshi NC, Anderson KC. Multiple myeloma: A prototypic disease model for the characterization and therapeutic targeting of interactions between tumor cells and their local microenvironment. J Cell Biochem.

2007;101(4):950-968.

28. Meads MB, Hazlehurst LA, Dalton WS. The bone marrow microenvironment as a tumor sanctuary and contributor to drug resistance.

Clin Cancer Res. 2008;14(9): 2519-2526.

29. Mihara K, Yanagihara K, Takigahira M, et al. Activated T-cell-mediated immunotherapy with a chimeric receptor against CD38 in B-cell non-Hodgkin lymphoma. J Immnotherapy. 2009;32(7):737-743.

30. Bhattacharyya J, Mihara K, Kitanaka A, et al.

T-cell immunotherapy with a chimeric receptor against CD38 is effective in eradicating chemotherapy-resistant B-cell lymphoma cells overexpressing survivin induced

by BMI-1. Blood Cancer J. 2012;2(6):e75.

31. Mihara K, Bhattacharyya J, Kitanaka A, et al.

T-cell immunotherapy with a chimeric receptor against CD38 is effective in eliminating myeloma cells. Leukemia. 2012;32(7): 737-743.

32. Partida-Sánchez S, Cockayne DA, Monard S, et al. Cyclic ADP-ribose production by CD38 regulates intracellular calcium release, extracellular calcium influx and chemotaxis in neutrophils and is required for bacterial clearance in vivo. Nat Med. 2001;7(11):1209-1216.

33. Bean AG, Godfrey DI, Ferlin WG, et al.

CD38 expression on mouse T cells: CD38 defines functionally distinct subsets of alpha beta TCR+CD4-CD8- thymocytes. Int Immunol. 1995;7(2):213-221.

34. Partida-Sánchez S, Goodrich S, Kusser K, et al. Regulation of dendritic cell trafficking by the ADP-ribosyl cyclase CD38: impact on the development of humoral immunity.

Immunity. 2004;20(3):279-291.

35. Morgan R a, Yang JC, Kitano M, et al. Case report of a serious adverse event following the administration of T cells transduced with a chimeric antigen receptor recognizing ERBB2. Mol Ther. 2010;18(4):843-851.

36. Kochenderfer JN, Dudley ME, Feldman SA, et al. B-cell depletion and remissions of malignancy along with cytokine-associated toxicity in a clinical trial of anti-CD19 chimeric-antigen-receptor-transduced T cells. Blood. 2012;119(12):2709-2720.

37. Casucci M, Hawkins RE, Dotti G, Bondanza A. Overcoming the toxicity hurdles of genetically targeted T cells. Cancer Immunol Immunother. 2015;64(1):123-130.

38. Maude SL, Barrett D, Teachey DT, Grupp SA. Managing cytokine release syndrome associated with novel T cell-engaging therapies. Cancer J. 2014;20(2):119-122.

39. Vera J, Savoldo B, Vigouroux S, et al. T lymphocytes redirected against the kappa light chain of human immunoglobulin efficiently kill mature B lymphocyte-derived malignant cells. Blood. 2006;108(12):38903897.

40. Jiang H, Zhang W, Shang P, et al.

Transfection of chimeric anti-CD138 gene enhances natural killer cell activation and killing of multiple myeloma cells. Mol Oncol. 2014;8(2):297-310.

41. Peinert S, Prince HM, Guru PM, et al. Genemodified T cells as immunotherapy for multiple myeloma and acute myeloid leukemia expressing the Lewis Y antigen. Gene Ther.

2010;17(5):678-686.

42. Carpenter RO, Evbuomwan MO, Pittaluga S, et al. B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma. Clin Cancer Res. 2013;19(8):2048-2060.

43. Chu J, Deng Y, Benson DM, et al. CS1-specific chimeric antigen receptor (CAR)-engineered natural killer cells enhance in vitro and in vivo antitumor activity against human multiple myeloma. Leukemia.

2014;28(4):917-927.

44. Chu J, He S, Deng Y, et al. Genetic modification of T cells redirected toward CS1 enhances eradication of myeloma cells. Clin Cancer Res. 2014;20(15):3989-4000.

45. Casucci M, Nicolis di Robilant B, Falcone L, et al. CD44v6-targeted T cells mediate potent antitumor effects against acute myeloid leukemia and multiple myeloma.

Blood. 2013;122(20):3461-3472.

46. Hoyos V, Savoldo B, Quintarelli C, et al.

Engineering CD19-specific T lymphocytes with interleukin-15 and a suicide gene to enhance their anti-lymphoma/leukemia effects and safety. Leukemia. 2010;24(6): 1160-1170.

47. Budde LE, Berger C, Lin Y, et al. Combining a CD20 chimeric antigen receptor and an inducible caspase 9 suicide switch to improve the efficacy and safety of T cell adoptive immunotherapy for lymphoma.

PLoS One. 2013;8(12):e82742.

625

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Cell Therapy & Immunotherapy

Ferrata Storti Foundation

Effects of anti-NKG2A antibody administration on leukemia and normal hematopoietic cells Loredana Ruggeri,1 Elena Urbani,1 Pascale André,2 Antonella Mancusi,1 Antonella Tosti,1 Fabiana Topini,1 Mathieu Bléry,2 Lucia Animobono,1 François Romagné,3 Nicolai Wagtmann,2 and Andrea Velardi1

Division of Hematology and Clinical Immunology and Bone Marrow Transplantation Program, Department of Medicine, University of Perugia, Italy; 2Innate Pharma, Marseille, France; and 3Division of Immunology, University of Marseille, France

1

Haematologica 2016 Volume 101(5):626-633

ABSTRACT

N

Correspondence: loredana.ruggeri@unipg.it

Received: August 18, 2015.

Accepted: December 23, 2015.

Pre-published: December 31, 2015. doi:10.3324/haematol.2015.135301

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/626

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

626

atural killer cells are key cells of the innate immune system.

Natural killer cell receptor repertoires are diversified by a stochastic expression of killer-cell-immunoglobulin-like receptors and lectin-like receptors such as NKG2 receptors. All individuals harbor a subset of natural killer cells expressing NKG2A, the inhibitory checkpoint receptor for HLA-E. Most neoplastic and normal hematopoietic cells express HLA-E, the inhibitory ligand of NKG2A. A novel antihuman NKG2A antibody induced tumor cell death, suggesting that the antibody could be useful in the treatment of cancers expressing HLA-E. We found that immunodeficient mice, co-infused with human primary leukemia or Epstein-Barr virus cell lines and NKG2A+ natural killer cells, pre-treated with anti-human NKG2A, were rescued from disease progression. Human NKG2A+ natural killer cells reconstituted in immunodeficient mice after transplantation of human CD34+ cells. These natural killer cells are able to kill engrafted human primary leukemia or EpsteinBarr virus cell lines by lysis after intraperitoneal administration of antihuman NKG2A. Thus, this anti-NKG2A may exploit the anti-leukemic action of the wave of NKG2A+ natural killer cells recovering after hematopoietic stem cell transplants or adoptive therapy with natural killer cell infusions from matched or mismatched family donors after chemotherapy for acute leukemia, without the need to search for a natural killer cell alloreactive donor.

Introduction Natural killer (NK) cells play a critical role in host defense against infections and tumors by secreting cytokines and killing infected or transformed cells. Activation of NK-cell effector functions is regulated by activating and inhibitory receptors that recognize ligands on potential target cells. NK cell-mediated killing is efficient when target cells abundantly express stress- or transformation-induced ligands for activating NK receptors, and few or no major histocompatibility complex (MHC)class I molecules, which are ligands for inhibitory receptors on NK cells. In humans, a family of killer cell immunoglobulin-like receptors (KIR) bind distinct subgroups of human leukocyte antigen (HLA) class I allotypes. KIR are clonally expressed on NK cells, creating a repertoire of NK cells with specificities for different HLA class I molecules. Due to extensive genetic polymorphisms, there are significant variations in the repertoire of KIR+ NK cells among individuals in the population.

Another inhibitory receptor, with broad specificity, the CD94-NKG2A complex, recognizes HLA-E, a non-classical MHC class I molecule. CD94-NKG2A and its HLA-E ligand exhibit very limited polymorphism. CD94-NKG2A is expressed primarily on NK cells that do not express an inhibitory KIR for a self-HLA class I, so it fills gaps in the KIR repertoire. However, some NK cells co-express CD94NKG2A and one or more inhibitory KIR with different MHC class I specificities.1-3 The NKG2A receptor is also expressed on T cells. haematologica | 2016; 101(5)

Antileukemic effect of anti-human NKG2A antibody

Individuals harbor NK cells in their repertoire that may express, as the only inhibitory receptor, a single KIR that is inhibited by one self-MHC class I KIR ligand. Target cells that lack this KIR ligand do not block NK cell activation, and are killed. The clinical relevance of such missing self-recognition was demonstrated in adult patients with acute myeloid leukemia (AML) and in children with acute lymphoblastic leukemias (ALL).4-9 Haploidentical stem cell transplantation from KIR ligand mismatched donors (NK alloreactive donors) was associated with a reduced risk of relapse and increased survival rates.4-8 Unfortunately, NK alloreactive donors cannot be identified for about 50% of patients who express each of the main three groups of KIR ligands (HLA-C group 1 and 2 and Bw4 specificity) which block all the NK cells in the donor repertoire. To extend the benefits of NK cell alloreactivity to these patients another strategy had to be found. A human anti-KIR monoclonal antibody (lirilumab) was generated to bind to all KIR2D inhibitory receptors specific for groups 1 and 2 HLA-C alleles. In vitro and murine model studies showed that lirilumab efficiently promoted NK cell alloreactivity and killing of otherwise resistant HLA-C group 1+ or group 2+ targets, such as normal and tumor cells.10-13 Phase I clinical trials demonstrated that the anti-inhibitory KIR mAb is safe.14 Phase II clinical trials with lirilumab are ongoing.

Another approach has been to generate and explore the role of an anti-human NKG2A antibody. Every individual possesses NKG2A+ NK cells which are always blocked by HLA-E. Since HLA-E is expressed by most normal and neoplastic hematopoietic cells, these are protected from killing by CD94-NKG2A+ NK cells.1-3 Stem cell transplantation remains the only curative treatment option for many patients with acute leukemia.

Interestingly, in the immediate post-transplant period, most reconstituting NK cells are NKG2A+.15 Nguyen and Godal have already demonstrated in vitro that anti-NKG2A antibody treatment is able to reconstitute NKG2A+ NK cell lysis against acute leukemia cells.16,17 Administering an anti-NKG2A monoclonal antibody could strengthen many of the benefits of NK cell alloreactivity and potentiate the anti-leukemic action of NK cells recovering after hematopoietic transplants or of NK cell infusions from matched or mismatched family donors without the need to search for an NK alloreactive donor.

We have generated a novel, humanized anti-NKG2A therapeutic monoclonal antibody that is being developed for treatment of solid tumors such as ovarian cancer and hematologic malignancies. In this study, we investigated the potential clinical role of this new therapeutic monoclonal antibody in vitro and in humanized mouse models.

NKG2C and CD94-NKG2E, to ensure specificity for CD94NKG2A. The selected humanized clone, designated humZ270, or IPH2201, was expressed as an IgG4 with a single point mutation in the Fc heavy chain to prevent formation of half-antibodies.

Cell isolation All neoplastic cells were obtained from patients’ bone marrow aspirates or peripheral blood. All the normal lympho-hematopoietic cell types were obtained from healthy donors. Patients and donors provided prior written informed consent to the use of their biological material in accordance with the Declaration of Helsinki.

Neoplastic cells (if >95% of all cells) were obtained from peripheral blood or marrow samples after Ficoll-Hypaque gradient separation.

Human T and B cells and monocytes were purified from peripheral blood mononuclear cells on a Ficoll-Hypaque gradient and enriched by human T and B isolation kits or anti-CD14+ microbeads, respectively, and immunomagnetic selection (Miltenyi Biotec, Bergisch Gladbach, Germany). Dendritic cells were obtained as described elsewhere.19 Human NK cells were purified from peripheral blood mononuclear cells on a Ficoll-Hypaque gradient, then enriched by a human NK isolation kit and immunomagnetic selection (Miltenyi Biotec).

Single KIR+/NKG2A- NK cells were cloned and used as controls for NK cell alloreactivity assay as previously described.7 NKG2A+/KIRNK cells were depleted of KIR2DL1/2/3+ and KIR3DL1+ cells using anti-KIR2DL2/L3/S2 (clone CH-L, IgG2b) (BD Biosciences San José, CA, USA), anti-KIR2DL1 (clone #143211, IgG1) (R&D Systems Inc., Minneapolis, MN, USA) and KIR3DL1 (Miltenyi Biotech) phycoerythrin (PE)-conjugated monoclonal antibodies and negative selection by anti-PE immunomagnetic microbeads (Miltenyi Biotech). NKG2A+/KIR- NK cells were stimulated by 1% phytohemagglutinin (Biochrom, Berlin, Germany) and 250 IU/mL interleukin-2 (Novartis Farma S.p.A., Origgio, Italy), and expanded for up to 7 days. At the end of culture, before their use, the final purity of the NKG2A+ NK cells was >95%.

CD34+ stem cells were obtained from healthy donors’ peripheral blood after mobilization with granulocyte colony-stimulating factor, leukapheresis and positive selection by immunomagnetic microbeads conjugated with anti-human CD34+ monoclonal antibody (Miltenyi Biotec).

Epstein-Barr virus cell lines HLA-E+ Epstein-Barr virus (EBV)-transformed B-cell lines, which were resistant to NKG2A+ NK cell lysis, were a kind gift from the European Collection for Biomedical Research (ECBR). Anti-human HLA-E-PE (IgG1, clone 3D12, eBioscience, San Diego, CA, USA) was used to estimate HLA-E expression on EBV cell lines and all the other normal and neoplastic human hematopoietic cells by flow cytometry.

In vitro cytotoxicity assays Methods Therapeutic anti-NKG2A monoclonal antibody The murine anti-human NKG2A monoclonal antibody clone Z270 was generated and characterized as previously described.18 Details of the generation and characterization of humanized Z270 will be reported elsewhere. In brief, the murine Z270 monoclonal antibody was humanized by grafting the Kabat complementarity determining regions onto a human acceptor framework, and expressed in Chinese hamster ovary cells. Recombinant humanized clones were screened to identify those that retained binding to CD94-NKG2A with similar affinity as the original murine monoclonal antibody. Clones were then counter-screened on CD94haematologica | 2016; 101(5)

NKG2A+/KIR- NK cells were pre-treated with humanized antihuman NKG2A antibody or with an isotype control antibody (10 μg/1x106 cells/mL). Single KIR+/NKG2A- and KIR-/NKG2A+ NK cells were screened for alloreactivity by standard 51Cr release cytotoxicity assays at an increasing effector-to-target (E:T) ratio (from 1:1 to 20:1) against KIR ligand mismatched HLA-E+ B and T cells, monocytes, dendritic cells, EBV cell lines, chronic lymphatic leukemia (CLL) cells, T-cell ALL, AML and multiple myeloma (MM) cells.

Mouse models Colonies of non-obese diabetic - severe combined immunodeficiency (NOD-SCID) mice and NOD-scidIL2rgtm (NSG) mice 627

L. Ruggeri et al.

were bred at the University of Perugia Animal House. Breeders were obtained from Jackson Laboratory (Bar Harbor, Maine, USA).

All experiments were performed in accordance with the National Ethic Approval Document for animal experimentation.

Female 10-week old mice were irradiated with 3.5 Gy. The next day NOD-SCID mice received an intravenous co-infusion of primary AML cells (12x106) or EBV-transformed B-cell line (12x106) and NKG2A+ non-alloreactive, interleukin-2-activated NK cells (1x106) that had been pre-treated with anti-human NKG2A monoclonal antibody (10 μg/1x106 cells/mL) at the E:T ratio of 1:12.

Isotype control antibody-pretreated NK cells were infused in control mice at the E:T ratio of 1:12.

Mice that succumbed to leukemia or EBV lymphoproliferative disease were assessed for AML or EBV organ infiltration by flow cytometry analysis with a specific panel of anti–human monoclonal antibodies which previously characterized the neoplastic cells (see below).

In a model of engrafted disease, we infused the same mouse strain with AML or EBV cell lines. When bone marrow engraftment was around 20-30%, mice were given escalating doses of interleukin-2-activated NKG2A+ NK cells that had been pre-treated with anti-human NKG2A monoclonal antibody (10 μg/1x106 cells/mL) (from 1 to 10x106 per mouse, intravenously). Mice that died of leukemia or lymphoma were assessed for AML or EBV organ infiltration by flow cytometry analysis using a specific panel of anti-human monoclonal antibodies (see below).

In other mouse models, the day after irradiation, female 10week old NSG mice were given 10x106 human CD34+ hematopoietic stem cells intravenously. At day 20 mice were infused intravenously with 5x106 HLA-E+ EBV cells or AML cells. When CD34+ stem cells had differentiated into CD56+/CD3-/NKG2A+ NK cells, mice received an intraperitoneal administration of 200, 250 or 300 µg anti-human NKG2A monoclonal antibody. Control mice were left untreated or treated with the same doses of isotype control antibody.

From day 40 onwards mice were evaluated for EBV or AML engraftment with a combination of anti-human CD45 monoclonal antibody and monoclonal antibody specific for AML or the EBV cell line (anti-CD20, anti-CD19, anti-IgM, anti-kappa, anti-lambda, anti-CD23, anti-CD3, anti-CD33, anti-CD34, anti-CD56, antiCD117, anti-CD8, CD4, CD34 monoclonal antibodies, eBioscience).

Mice that succumbed to EBV lymphoproliferative disease or leukemia were assessed for EBV or AML organ infiltration by flow cytometry analysis with a combination of anti-human monoclonal antibodies (see above). Mice that survived were sacrificed after 100 days, and tumor organ infiltration analyzed with the same antibody combination.

Statistical analyses The Student t test was used to compare variables and was applied by Graphpad Prism 5. The Kaplan-Meier method was used to evaluate murine survival. All P values are two-sided and considered statistically significant at P values <0.05.

Results In vitro treatment with anti-human NKG2A antibody triggers NKG2A+ natural killer cell lysis of HLA-E+ hematopoietic lineage targets In order to assess the susceptibility of normal and neoplastic hematopoietic lineage targets to alloreactive NK 628

cell lysis, we generated single inhibitory KIR+NKG2A- NK cell clones and evaluated their ability to kill KIR ligandlacking targets such as B and T cells, monocytes, dendritic cells, EBV cell lines, CLL, T-ALL, AML and MM cells.

These normal and neoplastic hematopoietic lineage cells expressed HLA-E and were resistant to NKG2A+ NK cells.

Figure 1 shows that most acute leukemias express HLA-E. All HLA-E+ lympho-hematopoietic cell types were targets of alloreactive NK cell killing when they did not express the appropriate inhibitory KIR ligand for the single inhibitory KIR receptor expressed by alloreactive NK cell clones (Figure 2A). We pre-treated NKG2A+ NK cells with anti-human NKG2A antibody and assessed their ability to kill otherwise resistant HLA-E+ hematopoietic lineage cells. Treatment with anti-NKG2A monoclonal antibody converted NKG2A+KIR- NK cells into cells that were functionally “alloreactive” against HLA-E+ lympho-hematopoietic cells i.e. killed B and T cells, monocytes, dendritic cells, EBV cell lines, CLL, T-ALL, AML and MM cells. The most effective lysis was obtained with an E:T ratio of 15:1 (Figure 2B).

Each cytotoxicity assay was repeated with three targets for each category of cells and the mean ± standard deviation is shown.

In vivo treatment with the anti-human NKG2A antibody eradicates HLA-E+ leukemia and lymphoma In order to evaluate the in vivo efficacy of anti-NKG2A monoclonal antibody at triggering NKG2A+ NK cells to kill neoplastic cells, we developed xenogenic murine models of human neoplastic disease. NOD-SCID mice that received the HLA-E+ EBV-cell lines or AML cells died of high-grade lymphoma or AML. In these mice, co-infusion of human NKG2A+ non-alloreactive NK cells did not prevent engraftment of EBV or AML cells and mice died of the diseases.

In contrast, infusion of NKG2A+ NK cells that had been pre-treated with anti-NKG2A monoclonal antibody, prevented engraftment of human EBV cell lines and AML cells and mice survived without symptoms or signs of tumor localization (Figure 3A). In fact, mice were sacrificed 100 days after cell infusion and cytofluorimetric analysis confirmed the absence of neoplastic infiltration. We pooled results from eight experiments with four mice per group for each experiment.

NKG2A+ NK cell elimination of engrafted human AML or human EBV cell lines was evaluated in escalating dose experiments. At least 3x106 NKG2A+ NK cells per mouse, pre-treated with anti-NKG2A, were necessary to rescue 80% mice (Figure 3B). Repeating intraperitoneal doses of antibody did not improve the results because of autologous NK cell killing (fratricide effect).

In order to assess the ability of endogenously generated NKG2A+ NK cells to cure leukemia or lymphoma, we transplanted NSG mice with 10x106 human CD34+ hematopoietic cells. The transplanted CD34+ hematopoietic stem cells differentiated into various hematopoietic lineage cells, including NKG2A+ NK cells.20 Twenty days after the CD34+ cell infusion, mice received HLA-E+ EBV cell lines or AML tumor cells. On day 30 after the CD34+ cell infusion, when the numbers of NKG2A+ NK cells reached a plateau value in the bone marrow and spleen, we treated three groups of mice with 200, 250 or 300 µg of the anti-NKG2A monoclonal antibody. Control mice treated with isotype control monoclonal antibody, and haematologica | 2016; 101(5)

Antileukemic effect of anti-human NKG2A antibody mice that received 200 Îźg of anti-NKG2A monoclonal antibody, succumbed to EBV lympho-proliferative disease or leukemia. In contrast, mice that received 250 or 300 Îźg of anti-NKG2A monoclonal antibody survived (Figure 4A and 4B, respectively). NKG2A+ NK cells totally ablated the EBV cell line or AML cells in the bone marrow (Figure 4C and 4D, respectively) and spleen (Figure 4E and 4F, respectively). Thus, treatment with anti-human NKG2A monoclonal antibody enabled endogenously generated human NKG2A+ NK cells to kill lethal EBV lymphoproliferative disease or leukemia. We pooled results from three experiments with five mice per group for each experiment.

In vivo treatment with the anti-NKG2A antibody transiently depletes non-neoplastic lympho-hematopoietic lineage cell In order to evaluate the impact of anti-NKG2A monoclonal antibody on the various lympho-hematopoietic lineage cell subsets in vivo, NSG mice were transplanted with

A

D

B

E

C

human CD34+ hematopoietic stem cells and the differentiated lympho-hematopoietic cell subpopulations were analyzed. One month after CD34+ cell infusion, human CD4+/CD8+ double positive thymocytes in the thymus, and myeloid lineage cells, B cells, NK cells and dendritic cells in the bone marrow and in the spleen reached plateau values (Figure 5). At this time point mice were treated with antihuman NKG2A monoclonal antibody. Monitoring human myeloid, B, and dendritic cell subpopulations in the bone marrow and spleen and human thymocytes at different times after anti-NKG2A treatment showed that all these hematopietic lineage cells were transiently depleted. They returned to pre-treatment values within 10 days (Figure 5).

Analysis of the T-cell receptor repertoire in thymocytes revealed that it was polyclonal (data not shown). Thus, in vivo treatment with anti-human NKG2A monoclonal antibody did not induce persistent ablation of normal hematopoietic cells. We pooled results from three experiments with five mice per group for each experiment.

F

Figure 1. HLA-E expression on acute leukemia cells. (A-C) HLA-E expression on AML cells from three patients. (D-F) HLA-E expression on ALL cells (1 T-ALL and 2 B-ALL) from three patients.

haematologica | 2016; 101(5)

629

L. Ruggeri et al.

Discussion The present investigation into the clinical potential of a recently developed humanized anti-NKG2A antibody showed that it converted NKG2A+ NK cells into effector

NK cells able to kill most HLA-E+ NK resistant lymphohematopoietic cells, including B and T lymphocytes, dendritic and myeloid cells, leukemic cells (CLL, T-ALL and AML), high-grade lymphoma and MM cells. We also demonstrated in mouse models that pre-treatment of

A

B

Figure 2. In vitro treatment with anti-human NKG2A monoclonal antibody reconstitutes NKG2A+ NK cell lysis against HLA-E+ normal and neoplastic lymphohematopoietic cells. (A) Percentage lysis of KIR ligand-mismatched HLA-E+ B and T cells, monocytes, dendritic cells, EBV cell lines, CLL, T-ALL, AML and MM cells mediated by single KIR+ alloreactive NK clones at the E/T 15:1 in a standard 51Cr release cytotoxicity assay. (B) Percentage lysis of HLA-E+ B and T cells, monocytes, dendritic cells, EBV cell lines, CLL, T-ALL, AML and MM cells mediated by activated and cultured in IL2 NKG2A+/KIR- NK cells at the E:T of 15:1 after treatment with antihuman NKG2A monoclonal antibody (10 μg/1x106 cells/mL) in a standard 51Cr release cytotoxicity assay. Lysis mediated by NKG2A+ NK cells after treatment with anti-human NKG2A monoclonal antibody is comparable to lysis mediated by single KIR+ alloreactive NK cell clones. Each cytotoxicity assay was repeated with three targets for each category of cells and the mean ± SD is shown.

A

B

Figure 3. Pre-treatment of human NKG2A+ NK cells with the anti-human NKG2A monoclonal antibody prevents engraftment of human EBV cell lines and AML cells and cures engrafted disease in NOD-SCID mice. (A) One million NKG2A+/KIR- NK cells were pre-treated with anti-human NKG2A monoclonal antibody (10 μg) and co-infused with EBV cell line (■) or AML (○) expressing HLA-E at an E:T of 1:12. Control mice were co-infused with isotype control antibody-pretreated NKG2A+/KIRNK cells and EBV cell line (●) or AML (▲) expressing HLA-E at an E:T of 1:12. Mice co-infused with human EBV cell lines or human AML cells and treated with isotype control antibody-pretreated NKG2A+ NK cells died of disease progression. The anti-human NKG2A monoclonal antibody pre-treatment prevented disease engraftment and all mice survived. We pooled results of eight experiments with four mice per group for each experiment. (B) Mice engrafted with AML or EBV cell lines (20-30% of bone marrow infiltration) were infused with escalating doses of NKG2A+ KIR- NK cells, pre-treated with anti-human NKG2A monoclonal antibody (10 μg/1x106 NK cells). Control mice were co-infused with isotype control antibody-pretreated NKG2A+ KIR- NK cells and EBV cell line or AML cells. At least 3x106 NKG2A+ KIR- NK cells pre-treated with anti-human NKG2A monoclonal antibody cured 80% of mice with EBV or AML. Treatment of engrafted mice with at least 4x106 pretreated NKG2A+NK cells rescued 100% of mice affected by EBV (■) or AML (○). Mice engrafted with human EBV cell lines (●) or human AML cells (▲) and infused with more than 4x106 isotype control antibody-pretreated NKG2A+ NK cells died of disease progression. The anti-human NKG2A monoclonal antibody pre-treatment cured engrafted diseases. We pooled results of eight experiments with four mice per group for each experiment.

630

haematologica | 2016; 101(5)

Antileukemic effect of anti-human NKG2A antibody

NKG2A+ NK cells with anti-human NKG2A monoclonal antibody prevented engraftment of otherwise lethal EBV cell lines or AML cells.

Interestingly, the repertoire of each individual expresses a certain percentage of NKG2A+ NK cells and, after hematopoietic stem cell transplantation, a large population of reconstituting NK cells express the CD94-NKG2A inhibitory receptor.15 Consequently, the use of humanized anti-NKG2A antibody could enlarge the NK cell population that exerts an anti-tumor effect to the benefit of patients with hematologic malignancies.

Potential side effects such as autoreactivity against hematopoietic stem cells and subsequent cytopenia could develop, particularly after transplantation. To test this hypothesis, we transplanted mice with human CD34+ stem cells and then leukemic cells, which engrafted because the stem cells could not develop into mature T cells or alloreactive single KIR+NKG2A- NK cells.20 Human hematopoietic stem cells could, however, develop into NKG2A+ NK cells.20 Anti-NKG2A antibody treatment reconstituted NKG2A+ NK cell-mediated lysis of HLA-E+ engrafted leukemic cells, rescuing mice from death. The

A

E

C

D

B

side effects appear slight as cytopenia of normal hematopoietic cells was transient and mice recovered quickly. The slight, transient cytopenia in the committed myeloid line may be due to either alloreactive NK cell fratricide or to CD34+ cell conservation. In fact, recurrent dosing does not seem to reduce the number of CD34+ cells as engraftment was always successful (data not shown). One might hypothesize that they are not a target of alloreactive NK cells.

Interestingly these in vitro and in vivo results are in accordance with previous findings that lirilumab bound to all KIR2D inhibitory receptors for groups 1 and 2 HLA-C alleles and blocked NK cell inhibitory recognition of self-HLAC. It activated NK cell killing in vivo, eradicating tumors in mice.10-13 In fact, clinical trials of this fully human anti-KIR antibody as a single agent are ongoing in patients with acute leukemia.14 We might hypothesize about using the humanized antiNKG2A antibody as an alternative to chemotherapy.

Some studies demonstrated safety and a promising clinical role of haploidentical alloreactive NK cell infusions in combination with chemotherapy for the treatment of eld-

F

Figure 4. In vivo treatment with the anti-human NKG2A monoclonal antibody rescues NSG mice engrafted with human CD34+ hematopoietic stem cells and HLAE+ human AML cells or an EBV cell line. After 3.5 Gy total body irradiation, mice were infused with 10x106 human CD34+ hematopoietic stem cells. After 20 days they were infused with an EBV cell line or AML cells. When NKG2A+ NK cells differentiated from CD34+ cells, mice were treated with anti-human NKG2A monoclonal antibody. Mice that received 250 μg (○) or 300 μg (●) of anti-human NKG2A monoclonal antibody survived, control mice (isotype control antibody) (■) or mice that received 200 μg of the antibody (▲) succumbed to EBV lympho-proliferative disease (A) or AML (B). NKG2A+ NK cells ablated the EBV cell line in bone marrow* (C) and spleen (E) and AML cells in bone marrow* (D) and spleen (F). The normal human CD45+ hematopoietic population, which developed from CD34+ cells, was transiently depleted after administration of human anti-NKG2A antibody. We pooled results of three experiments with five mice per group for each experiment. * Bone marrow cell numbers are from two femurs per mouse.

haematologica | 2016; 101(5)

631

L. Ruggeri et al.

A

B

C

Figure 5. Treatment with the anti-human NKG2A monoclonal antibody transiently depleted HLA-E+ autologous myeloid, B, T, NK and DC subpopulations in NSG mice engrafted with human CD34+ hematopoietic stem cells. After 3.5 Gy total body irradiation, mice were infused with human CD34+ hematopoietic stem cells.

One month after, when NKG2A+ NK cells differentiated from CD34+ cells reached a plateau value, mice were treated with 300 Îźg of anti-human NKG2A monoclonal antibody. Transient depletion of human myeloid, B, dendritic, and NK cell subpopulations in the bone marrow* (A) and spleen (B) and double negative (DN), single CD8+ or CD4+, CD4+/CD8+ double positive (DP) thymocytes (C) was followed by recovery of all cell subsets within 10 days. We pooled results of three experiments with five mice per group for each experiment. *Bone marrow cell numbers are from two femurs per mouse.

erly or pediatric patients with high-risk acute leukemias.22,23 We speculate that humanized anti-NKG2A may be useful in similar settings, in order to reconstitute lysis by NKG2A+ NK cells obtained from non-alloreactive haploidentical or identical donors.

The role of the NKG2A receptor in autoimmune diseases is controversial. Activated NK cells with NKG2A down-regulation may play a role in the pathogenesis of psoriasis.24 However, since reconstituted NK cell lysis by means of the anti-NKG2A antibody is also directed against activated autologous T and B cells which mediate autoimmune diseases, the antibody might also be envisaged as therapy against human autoimmune diseases. In a murine model of rheumatoid arthritis, an anti-murine NKG2A (Fab) antibody selectively increased lysis of autologous TH17 and TFH cells, which are the mediators of rheumatoid arthritis. The antibody blockade of the inhibitory interaction between the NKG2A receptor and its Qa-1 ligand enhanced the NK cell-dependent elimina-

References 1. Vivier E, Raulet DH, Moretta A, et al.

Innate or adaptive immunity? The example of natural killer cells. Science. 2011;331 (6013):44-49.

2. Caligiuri MA. Human natural killer cells.

Blood. 2008;112(3):461-469.

3. Moretta L, Moretta A. Unravelling natural killer cell function: triggering and inhibitory human NK receptors. EMBO J. 2004;23(2): 255-259.

4. Ruggeri L, Capanni M, Casucci M, et al.

Role of natural killer cell alloreactivity in HLA-mismatched hematopoietic stem cell transplantation. Blood. 1999;94(1):333-339.

632

tion of pathogenic T cells, resulting in blockade of disease onset or progression.25 In vitro and in vivo findings suggest that the humanized anti-NKG2A antibody described here constitutes a unique, relatively safe, therapeutic approach to malignant hematologic and autoimmune diseases. Phase I/II clinical trials with anti-human NKG2A antibody are ongoing in patients with tumor types known to express HLA-E, including CLL (ClinicalTrials.gov :NCT02557516), head and neck cancer (ClinicalTrials.gov: NCT02331875) and ovarian cancer (ClinicalTrials.gov NCT02459301)26 in order to validate the present observations and provide hope for those 50% of patients with hematologic and solid malignancies who cannot find alloreactive NK cell donors.

Acknowledgments The authors thank Dr Geraldine Anne Boyd for editorial assistance. LR is a Leukemia and Lymphoma Society Scholar in Clinical Research.

5. Ruggeri L, Capanni M, Urbani E, et al.

Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants. Science. 2002;295(5562):20972100.

6. Karre K. A perfect mismatch. [commentary] Science. 2002;295(5562):2029-2031.

7. Ruggeri L, Mancusi A, Capanni M, et al.

Donor natural killer cell allorecognition of missing self in haploidentical hematopoietic transplantation for acute myeloid leukemia: challenging its predictive value.

Blood. 2007;110(1):433-440.

8. Velardi A, Ruggeri L, Mancusi A, Aversa F, Christiansen FT. Natural killer cell allorecognition of missing self in allogeneic hematopoietic transplantation: a tool for

immunotherapy of leukemia. Curr Opin Immunol. 2009;21(5):525-530.

9. Pende D, Marcenaro S, Falco M, et al. Antileukemia activity of alloreactive NK cells in KIR ligand-mismatched haploidentical HSCT for pediatric patients: evaluation of the functional role of activating KIR and redefinition of inhibitory KIR specificity.

Blood. 2009;113(13):3119-3129.

10. Romagne F, Andre P, Spee P, et al. Pre-clinical characterization of 1-7F9, a novel human anti-KIR therapeutic antibody that augments NK-mediated killing of tumor cells. Blood. 2009;114(13):2667-2677.

11. Sola C, AndrĂŠ P, Lemmers C, et al. Genetic and antibody-mediated reprogramming of natural killer cell missing-self recognition in

haematologica | 2016; 101(5)

Antileukemic effect of anti-human NKG2A antibody

12.

13.

14.

15.

16.

vivo. Proc Natl Acad Sci USA. 2009;106 (31):12879-12884.

Benson DM, Jr Bakan CE, Zhang S, et al.

IPH2101, a novel anti-inhibitory KIR antibody, and lenalidomide combine to enhance the natural killer cell versus multiple myeloma effect. Blood. 2011;118 (24):6387-6391.

Kohrt HE, Thielens A, Marabelle A, et al.

Anti-KIR antibody enhancement of antilymphoma activity of natural killer cells as monotherapy and in combination with anti-CD20 antibodies. Blood. 2014;123(5): 678-686.

Vey N, Bourhis JH, Boissel N, et al. A phase 1 trial of the anti-inhibitory KIR mAb IPH2101 for AML in complete remission.

Blood. 2012;120(22):4317-4323.

Stern M, De Angelis C, Urbani E, et al.

Natural killer cell KIR repertoire reconstitution after haploidentical stem cell transplantation. Bone Marrow Transplant. 2010; 45(11):1607-1610.

Godal R, Bachanova V, Gleason M, et al.

Natural killer cell killing of acute myelogenous leukemia and acute lymphoblastic leukemia blasts by killer cell immunoglobulin-like receptor-negative natural killer cells after NKG2A and LIR-1 blockade. Biol

haematologica | 2016; 101(5)

17.

18.

19.

20.

21.

Blood Marrow Transplant. 2010;16(5):612621.

Nguyen S, Dhedin N, Vernant JP, et al. NKcell reconstitution after haploidentical hematopoietic stem-cell transplantations: immaturity of NK cells and inhibitory effect of NKG2A override GvL effect.

Blood. 2005;105(10):4135-4142.

Moretta A, Vitale M, Sivori S, et al. Human natural killer cell receptors for HLA-class I molecules. Evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles. J Exp Med. 1994;180(2):545-555.

Mancusi A, Ruggeri L, Urbani E, et al.

Haploidentical hematopoietic transplantation from KIR ligand-mismatched donors with activating KIRs reduces non relapse mortality. Blood. 2015;125(20):3173-82.

AndrĂŠ MC, Erbacher A, Gille C, et al. Longterm human CD34+ stem cell-engrafted nonobese diabetic/SCID/IL-2R gamma(null) mice show impaired CD8+ T cell maintenance and a functional arrest of immature NK cells. J Immunol. 2010;185(5):2710-2720.

Miller JS, Soignier Y, Panoskaltsis-Mortari A, et al. Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer. Blood.

2005;105(8):3051-3057.

22. Rubnitz JE, Inaba H, Ribeiro RC, et al.

NKAML: a pilot study to determine the safety and feasibility of haploidentical natural killer cell transplantation in childhood acute myeloid leukemia. J Clin Oncol.

2010;28(6):955-959.

23. Curti A, Ruggeri L, D'Addio A, et al.

Successful transfer of alloreactive haploidentical KIR ligand-mismatched natural killer cells after infusion in elderly high risk acute myeloid leukemia patients. Blood.

2011;118(12):3273-3279.

24. Son SW, Kim EO, Ryu ES, et al.

Upregulation of Fas and downregulation of CD94â &#x201E;NKG2A inhibitory receptors on circulating natural killer cells in patients with new-onset psoriasis. Br J Dermatol.

2009;161(2):281-288.

25. Leavenworth JW, Wang X, Wenander CS, Spee P, Cantor H. Mobilization of natural killer cells inhibits development of collagen-induced arthritis. Proc Natl Acad Sci USA. 2011;108(35):14584-14589.

26. Seymour L, Tinker A, Hirte H, Wagtmann N, Dodion P. Phase I and dose ranging, phase II studies with IPH2201, a humanized monoclonal antibody targeting HLA-E receptor CD94/NKG2A. Ann Oncol.

2015;26 (Suppl. 2):ii3-ii5.

633

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Stem Cell Transplantation

Ferrata Storti Foundation

Reduced intensity haplo plus single cord transplant compared to double cord transplant: improved engraftment and graft-versus-host disease-free, relapse-free survival

Koen van Besien,1 Parameswaran Hari,2 Mei-Jie Zhang,2 Hong-Tao Liu,3 Wendy Stock,3 Lucy Godley,3 Olatoyosi Odenike,3 Richard Larson,3 Michael Bishop,3 Amittha Wickrema,3 Usama Gergis,1 Sebastian Mayer,1 Tsiporah Shore,1 Stephanie Tsai,1 Joanna Rhodes,1 Melissa M. Cushing,4 Sandra Korman,2 and Andrew Artz1

Department of Hematology/Oncology and Meyer Cancer Center – Stem Cell Transplant Program, Weill Cornell Medical College, New York, NY; 2Center for International Bone Marrow Transplant Research, Medical College of Wisconsin, Milwaukee, WI; 3Section of Hematology/Oncology-Hematopoietic Cellular Therapy Program, University of Chicago, Il; and 4Department of Pathology – Cellular Therapy Laboratory, Weill Cornell Medical College, New York, NY, USA 1

Haematologica 2016 Volume 101(5):634-643

ABSTRACT

U Correspondence: kov9001@med.cornell.edu

Received: October 27, 2015.

Accepted: February 5, 2016.

Pre-published: February 11, 2016. doi:10.3324/haematol.2015.138594

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/634

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

634

mbilical cord blood stem cell transplants are commonly used in adults lacking HLA-identical donors. Delays in hematopoietic recovery contribute to mortality and morbidity. To hasten recovery, we used co-infusion of progenitor cells from a partially matched related donor and from an umbilical cord blood graft (haplo-cord transplant).

Here we compared the outcomes of haplo-cord and double-cord transplants. A total of 97 adults underwent reduced intensity conditioning followed by haplo-cord transplant and 193 patients received reduced intensity conditioning followed by double umbilical cord blood transplantation. Patients in the haplo-cord group were more often from minority groups and had more advanced malignancy. Haplo-cord recipients received fludarabine-melphalan-anti-thymocyte globulin. Double umbilical cord blood recipients received fludarabine-cyclophosphamide and low-dose total body irradiation. In a multivariate analysis, haplo-cord had faster neutrophil (HR=1.42, P=0.007) and platelet (HR=2.54, P<0.0001) recovery, lower risk of grade II-IV acute graft-versus-host disease (HR=0.26, P<0.0001) and chronic graft-versus-host disease (HR=0.06, P<0.0001). Haplo-cord was associated with decreased risk of relapse (HR 0.48, P=0.001). Graft-versus-host disease-free, relapse-free survival was superior with haplo-cord (HR 0.63, P=0.002) but not overall survival (HR=0.97, P=0.85). Haplo-cord transplantation using fludarabine-melphalan-thymoglobulin conditioning hastens hematopoietic recovery with a lower risk of relapse relative to double umbilical cord blood transplantation using the commonly used fludarabine-cyclophosphamide-low-dose total body irradiation conditioning. Graft-versus-host disease-free and relapse-free survival is significantly improved. Haplo-cord is a readily available graft source that improves outcomes and access to transplant for those lacking HLA-matched donors. Trials registered at clinicaltrials.gov identifiers 00943800 and 01810588.

Introduction Allogeneic transplantation with HLA-identical donors is an effective and potentially curative therapy for hematologic malignancies. Limited availability of HLAidentical donors, particularly in patients from under-represented minority groups, haematologica | 2016; 101(5)

Haplocord vs. double cord transplant

has generated interest in transplantation using mismatched unrelated umbilical cord blood (UCB) stem cells.

The promise of cord blood transplantation resides in its ability to provide a source of stem cells that can engraft across HLA barriers with low rates of graft-versus-host disease (GvHD) and exert potent graft-versus-leukemia (GvL) effects, possibly mediated by contaminating maternal cells.1-5 But cord blood transplantation is hampered by the low progenitor cell doses in the grafts, and hence often very delayed recovery of neutrophils and platelets, particularly in adult recipients.6,7 This in turn leads to prolonged hospitalization, expense, morbidity and early mortality.

Though smaller studies have shown encouraging results,8,9 a recent study found that the outcomes of cord blood transplantation in older adults were inferior to those of 8/8 matched unrelated donor transplant recipients, mostly because of increased early treatment-related mortality.7 Several recent studies have been conducted to improve hematopoietic recovery after umbilical cord blood transplantation in adults in order to reduce early morbidity and mortality, and possibly health care utilization. Double UCB transplantation is perhaps the most commonly used of these procedures. But in a recently reported randomized study in pediatric patients, it was not associated with improved outcomes relative to single cord transplant.10 We and others have investigated an alternative strategy: the use of third-party CD34 selected adult haplo-identical stem cells to supplement a single UCB stem cell graft.11-15 In an initial report using a reduced intensity conditioning approach, we showed encouraging rates of engraftment and of long-term outcome.16 We also showed how the initial engraftment of the haplo-identical stem cells was, in the large majority of cases, ultimately superseded by the outgrowth of UCB cells. Since then, more than 150 additional such transplants have been performed at two institutions in the US, where they have become the preferred form of alternative donor transplantation. Here we conducted a formal comparison with patients undergoing reduced intensity conditioning and double UCB transplantation. The comparison group consisted of adult double UCB blood transplant recipients who had received the most widely used reduced intensity conditioning regimen.

Trials were registered at clinicaltrials.gov identifiers 00943800 and 01810588.

mg/dL, creatinine less than 1.5 times the upper limit of normal, preserved heart and lung function, and no evidence of chronic active hepatitis or cirrhosis. HIV negativity was required, and pregnant females were excluded from the study. The studies were approved by the Institutional Review Board of both institutions, and all patients and donors provided written informed consent.

The studies were conducted in accordance with the Declaration of Helsinki and were registered on clinicaltrials.gov.

Cases (n=97) include patients consecutively enrolled on these two studies and receiving reduced intensity conditioning between January 2007 and mid-2013. One pediatric patient was excluded, as were 2 patients undergoing transplant for myelofibrosis and the single patient with myeloma.

The control group consisted of adult patients with leukemia, lymphoma or myelodysplastic syndrome reported to the Center for International Blood and Marrow Transplant Research (CIBMTR) who received a double UCB graft following reduced intensity conditioning using fludarabine, cyclophosphamide, and low-dose total body irradiation between 2007 and 2011 at US transplant centers. This is the most widely utilized reduced intensity conditioning regimen for cord blood transplantation in adults with an acceptable treatment-related mortality and is used as the conditioning regimen in several national clinical trials.6,7,17 Patients with Karnofsky Performance Score (KPS) less than 60, with incomplete background or follow-up information, who received antithymocyte globulin (ATG) or who did not receive a calcineurin inhibitor after transplant, were excluded. A total of 193 CIBMTR patients fulfilled these criteria and were included as a control group. Seven of the 193 control patients had donors that were poorly matched (HLA 3/6). Their exclusion did not affect the results of the analysis.

Donors and stem cell processing Cord blood Cord-blood units for haplo-cord were selected based on HLAtyping and cell count. Grafts were matched for at least 4 of 6 HLA loci by the standard cord criteria (i.e. low resolution for HLA-A and HLA- B, and high resolution for HLA-DR)18 and contained a minimum cell count of 1x107 nucleated cells per kilogram (kg) of the recipientâ&#x20AC;&#x2122;s body weight before freezing. In contrast with common practice, we prioritized matching over cell dose. As of mid2012, for graft selection we utilized high-resolution HLA typing for HLA A, B, C and DR.19

Haploidentical donor Methods Patients and controls In 2007, a prospective study was initiated at the University of Chicago for haplo-cord transplantation following reduced intensity conditioning (clinicaltrials.gov identifier 00943800). As of 2012, this was followed by a joint prospective study of reduced intensity conditioning conducted by Weill Cornell Medical College and University of Chicago (clinicaltrials.gov identifier 01810588). The primary objective of the latter study was to define the optimal cell dose of the umbilical cord blood graft for haplo-cord transplantation, and, if possible, to match for inherited paternal antigens and non-inherited maternal antigens. Eligibility criteria for both studies were similar.

Patients with hematologic malignancies in need of an allogeneic stem cell transplant (SCT) who lacked an HLA-identical related or unrelated donor were eligible. Additional eligibility criteria included Eastern Cooperative Oncology Group (ECOG) performance status less than or equal to 2, bilirubin less than or equal to 2 haematologica | 2016; 101(5)

The haploidentical donor was a relative. Donors underwent stem cell mobilization using filgrastim for four consecutive days.

Apheresis was started on day 5 and continued daily until at least 5x106 CD 34+ cells / recipient kg were collected. After collection, and prior to cryopreservation, haplo-identical grafts were T-cell depleted initially using the Isolex 300i CD34 selection device. As of early April 2010, the Isolex 300i CD34 selection device was no longer available, and instead, the Miltenyi CliniMACS device was used under an Investigational New Device (IND) from the United States Food and Drug Agency. In the initial protocol (clinicaltrials.gov identifiers 00943800) the cell dose of the haplo-cord donor was based on CD3 cell dose (<1x106 CD3 per kgrec).16 In that study, it was noted that the administration of very high doses of haplo CD34 cells correlated with failure of umbilical cord blood engraftment. Subsequently, the cell dose of the haplo graft has been based on CD34 dose with a target dose of 3-5 x106 CD34 per kgrec.

Donor directed antibodies As of the tenth patient enrolled on the initial protocol, UCB and haplo-identical donor selection was also based on avoidance of 635

K. van Besien et al.

Table 1. Pre-transplant characteristics of patients included in the UC/WCMC and CIBMTR study cohorts.

Variable Total n Age, in years, n (%) 20-29 30-39 40-49 50-59 60-69 70+ Median (range) Sex, n (%) Male Female Weight in kg, n, median (range)

UC/WCMC Haplo+Cord

CIBMTR Double UCB

97

193

8 (8) 15 (15) 18 (19) 24 (25) 29 (30) 3 (3) 54 (20-73)

11 (6) 13 (7) 31 (16) 63 (33) 70 (36) 5 (3) 57 (20-72)

60 (62) 37 (38) n=61 80 (49, 136)

107 (55) 86 (45) n=185 79 (46, 146)

0.15

Sorror Comorbidity Index, n (%) 0 32 (33) 1-2 29 (30) 3+ 39 (37) Missing 0 N, median (range) 1 (0, 8) Race, n (%) White 59 (61) Black 23 (24) Others 6 (6) Unknown/declined 9 (9) Ethnicity, n (%) Hispanic 9 (9) Non-Hispanic 64 (66) Unknown/declined 24 (25) KPS, n (%) 90-100% 77 (79) 60- 80% 20 (21) Missing 0 Disease, n (%) AML 54 (56) ALL 12 (12) CLL 1 (1) CML 4 (4) Other acute leukemia 1 (1) Other leukemia 2 (2) Myelodysplastic disorders 11 (11) Non-Hodgkin lymphoma 8 (8) Hodgkin lymphoma 4 (4) Disease risk, n (%) Low 34 (35) Moderate 21 (22) High 42 (43) Conditioning regimen, n (%) TBI + fludarabine + Cy 0 Fludarabine + melphalan + ATG 97 (100) GvHD prophylaxis, n (%) CSA alone 0 CSA + MMF 97 (100) CSA + MTX 0 HLA-match for CB units,a n (%) 6/6 10 (10) 5/6 64 (66) 4/6 23 (24) â&#x2030;¤ 3/6 0 Missing 0 TNC cell dose at infusion (x107/kg), n, median (range) Unit 1 n=97 1.7 (0.5, 9.0) Unit 2 Sum of units Year of transplant, n (%) 2007-2009 2010-2013

P

-

52 (27) 52 (27) 88 (45) 1 (1) 2 (0, 10) 152 (79) 19 (10) 19 (10) 3 (2) 20 (10) 162 (84) 11 (6) 119 (62) 57 (30) 17 (9) 108 (56) 21 (11) 8 (4) 3 (2) 3 (2) 0 18 (9) 21 (11) 11 (6) 92 (48) 68 (35) 33 (17) 193 (100) 0 4 (2) 185 (96) 4 (2)

0.03 0.30 0.48 0.29

0.13 <0.0001

0.05*

0.04**

0.95

<0.0001

<0.0001 0.17

<0.0001 7 (4) 59 (31) 119 (62) 7 (4) 1b (1) n=167 2.1 (0.6,5.2)

-

n=159 2.0 (0.3, 5.1) n=159 4.1 (1.1, 9.2)

17 (18) 80 (82)

88 (46) 105

-

<0.0001 (54)

For double UCB blood transplants, degree of HLA-match is defined as the value of the lower HLA-matched unit. HLA-matched data were available for one of two CB units. UC: University of Chicago; WCMC: Weill Cornell Medical College; CIBMTR: Center for International Bone Marrow Transplant Research; KPS: Karnofsky Performance Score. *Calculation excluding category unknown/declined. **Calculation excluding Category Misssing.

a

636

Haplocord vs. double cord transplant

donor-directed HLA antibodies.20 For this purpose, all donors underwent high-resolution HLA typing including DP typing. A donor targeted by pre-existing recipient HLA-antibodies [i.e. donor specific antibodies or (DSA)] was avoided or, when unavoidable, various strategies were used to limit exposure of the graft to DSA.21

Conditioning regimen and post-transplant immunosuppression Haplo-cord patients received fludarabine 30 mg/m2/day IV for five consecutive days (days -7,-6,-5,-4,-3), rabbit anti-thymocyte globulin (thymoglobulin, r-ATG) at 1.5 mg/kg every other day for 4 doses (days -7, -5, -3, and -1), and melphalan 70 mg/m2 /day for 2 doses on day -3 and day -2 (Figure 1). The haploidentical cells were infused on day 0 followed by cord blood later the same day or on day 1. As of mid-2012, ATG was reduced to three doses for patients aged 50 years and older. Double UCB transplant recipients received fludarabine, low-dose total body irradiation (TBI) 200 cGy and cyclophosphamide; these patients did not receive ATG. All haplo-cord recipients and the majority of double UCB recipients received tacrolimus and mycophenolate mofetil (MMF).

End point definitions and statistical analysis Engraftment: the time to neutrophil engraftment was defined as the first of three consecutive days with an absolute neutrophil count of 0.5x109 per liter or higher, and the time to platelet engraftment as the first of seven consecutive days with a platelet count of 20x109 per liter or higher without platelet transfusion. Acute GvHD and chronic GvHD were diagnosed and graded according to consensus criteria.22 Transplant-related mortality (TRM) was defined as death without evidence of relapse/progression of malignancy. Probabilities of TRM, relapse, acute and chronic GvHD were generated using cumulative incidence estimates to accommodate competing risks. Probability of overall survival (OS) was calculated using the Kaplan-Meier estimator, with the variance estimated by Greenwood’s formula. For progression-free survival (PFS), subjects were considered treatment failures at the time of relapse or progression or death from any cause. Patients alive

A

without evidence of disease relapse or progression were censored at last follow up, and the PFS event was summarized by a survival curve. Similarly, the probability of GvHD-free/relapse-free survival (GRFS) was summarized by defining events to include grade 3-4 acute GvHD, extensive cGvHD, relapse, or death.23 Cox proportional hazards regression was used to compare outcomes between cases and controls. The following variables were considered in the multivariate models: age (18-59 vs. ≥ 60 years), patient gender, Karnofsky Performance Score (90%-100% vs.

60%-80%), disease (lymphoma/CLL vs. acute leukemia/MDS vs. other leukemia), and disease risk (Low vs. Medium vs. High).

Disease risk was defined (low vs. medium vs. high) using the American Society of Blood and Marrow Transplantation (ASBMT) criteria.24 The assumption of proportional hazards for each factor in the Cox model was tested using time-dependent covariates. A step-wise model selection approach was used to identify all significant risk factors. Each step of model building contained the main effect for graft source. Factors significant at a 5% level were included in the final model. Potential interaction between main graft source effect and all significant risk factors were tested.

Adjusted cumulative incidence functions of neutrophil and platelet engraftment, aGvHD, cGvHD, TRM, relapse and adjusted probabilities of PFS, GRFS and OS were generated from the final regression models stratified on cases versus controls.25,26

Results Patients’ and graft characteristics Characteristics of the patients in both groups are shown in Table 1. Median age of haplo-cord recipients was slightly lower (54 vs. 57 years; P=0.03) while the proportion above 60 years of age was similar between haplo-cord and double UCB recipients (33% vs. 39%). There were no significant differences in average weight or comorbity score by the hematopoietic cell transplantation-comorbidity index. The percentage of African Americans (24% vs.

10%; P=0.0001) was higher among haplo-cord recipients.

B

Figure 1. (A) Adjusted cumulative incidence function for time to neutrophil engraftment.

(B) Time to platelet engraftment.

haematologica | 2016; 101(5)

637

K. van Besien et al.

There was a higher percentage of patients with KPS 90100 among haplo-cord recipients (79% vs. 62%; P=0.04), but KPS was missing in 9% of controls. Almost two-thirds of patients in both groups had acute myeloid leukemia or MDS but the percentage of patients with high-risk disease was 43% among haplo-cord vs. 17% in the double UCB group (P<0.0001).

The UCB nucleated cell dose for the haplo-cord recipients was 1.7x107/kg compared to a cumulative dose of 4.1x107/kg for both grafts in the double UCB recipients.

Only 24% of haplo-cord recipients received a graft that was 4/6 HLA identical; 66% were 5/6 HLA matched and 10% were 6/6 matched. By contrast, 66% of double UCB recipients received at least one graft that was 4/6 or less well matched (P<0.0001). Lastly, the haplo-cord transplant recipients were on average transplanted more recently (82% vs. 54% in the period 2010-2013; P<0.0001).

Engraftment By day 30, 90% of the haplo-cord recipients had recovered neutrophil counts versus 82% of double UCB recipients. The Hazard Ratio (HR) for neutrophil engraftment was 1.42 (95%CI: 1.10-1.84; P=0.007). Similarly 58% of haplo-cord versus 12% of double UCB had platelet engraftment by day 30 and the HR for platelet recovery was 2.54 (95%CI: 1.88-3.42; P<0.0001) (Figure 1). In multivariable analysis, the only other predictor for platelet recovery was ASBMT high-risk disease score which was associated with slower platelet recovery (Table 2).

A

B

Treatment-related mortality, relapse, progression-free, and overall survival Treatment-related mortality was 30% (95%CI: 21-39) at one year for haplo-cord recipients versus 21% (95%CI: 1627) for double UCB recipients, but this difference was not statistically significant (P=0.15) In multivariate analysis, age was the only significant predictor for TRM (HR=2.43, 95%CI: 1.54-3.85, for those â&#x2030;Ľ 60 years vs. <60 years; P=0.0002) (Table 2).

Cumulative Incidence of relapse at one year was 24% (95%CI: 16-33) for haplo-cord recipients versus 46% (95%CI: 40-53) for double UCB recipients (HR=0.48; 95%CI: 0.31-0.75; P=0.001) (Figure 3). Other risk factors for relapse included ASBMT high-risk score and underlying diagnosis. Patients with lymphoma or CLL had a lower risk of disease recurrence (Table 2).

Progression-free survival at one year was 45% (95%CI: 33-55) for haplo-cord versus 34% (95%CI: 28-41) for double UCB recipients, but this difference was not statistically significant (HR=0.78, 95%CI: 0.56-1.08; P=0.13) (Figure 3). Significant predictors of inferior PFS included high ASBMT risk score and age over 60 years (Table 2).

Overall survival at one year was 50% (95%CI: 39-61) for haplo-cord versus 52 (95%CI: 45-59) for double cord (HR=0.97, P=0.85) recipients (Figure 3). In multivariate analysis, age was the only significant predictor for OS. Patients over 60 years of age had a 50% reduction in the likelihood of OS (HR=2.04, 95%CI: 1.50-2.78; P<0.0001) (Table 2).

C

Figure 2. Adjusted cumulative incidence function for (A) acute graft-versus-host disease (GvHD) grade II-IV, (B) acute GvHD Grade III-IV and (C) chronic GvHD.

638

haematologica | 2016; 101(5)

Haplocord vs. double cord transplant

Table 2. Multivariate results.a

P Event

N

Hazard Ratio (95%CI)

193 97

1 1.42 (1.10-1.84)

190 97

1 2.54 (1.88-3.41)

124 (low) 89 (med) 74 (high)

0.97 (0.72-1.31) 0.63 (0.43-0.92) 0.61 (0.43-0.88)

165 122

1 1.31 (1.00-1.71)

193 97

1 0.26 (0.15-0.45)

126 (low) 89 (med) 75 (high)

1.42 (0.97-2.09) 0.53 (0.31-0.91) 0.75 (0.44-1.29)

193 97

1 0.24 (0.09-0.60)

189 97

1 0.06 (0.01-0.26)

193 97

1.0 1.34 (0.83-2.16)

183 107

1 2.43 (1.53-3.85)

193 97

1 0.48 (0.31-0.75)

126 (low) 89 (med) 75 (high)

1.68 (1.06-2.64) 1.94 (1.22-3.11) 3.26 (2.08-5.12)

224b 13c 53d

0.36 (0.20-0.64) 0.94 (0.37-2.23) 2.59 (0.89-7.49)

193 97

1 0.78 (0.55-1.08)

126 (low) 89 (med) 75 (high)

1.19 (0.85-1.66) 1.62 (1.10-2.39) 1.93 (1.34-2.78)

183 107

1 1.45 (1.08-1.93)

Overall

Pairwise

9

ANC > 500x10 /L Study cohort Double UCB Haplo+Cord Platelet > 20x109/L Study cohort Double UCB Haplo+Cord Disease risk-ASBMT Medium vs. Low High vs. Medium High vs. Low Sex Male Female Grade II – IV acute GvHD Study cohort Double UCB Haplo+Cord Disease risk-ASBMT Medium vs. Low High vs. Medium High vs. Low Grade III – IV acute GvHD Study cohort Double UCB Haplo+Cord Chronic GvHD Study cohort Double UCB Haplo+Cord Treatment-related mortality Study cohort Double UCB Haplo+Cord Age in years 20-59 ≥ 60 Relapse progression Study cohort Double UCB Haplo+Cord Disease risk-ASBMT Medium vs. low High vs. medium High vs. low Disease group Lymphoma/CLL vs. acute leukemia/MDS Other leukemia vs. acute leukemia/MDS Other leukemia vs. lymphoma/CLL Disease-free survival Study cohort Double UCB Haplo+Cord Disease risk-ASBMT Medium vs. Low High vs. Medium High vs. Low Age at HAPLO-CORDT, in years 20-59 ≥ 60

haematologica | 2016; 101(5)

0.007

<0.0001 0.02 0.85 0.02 0.007 0.048

<0.0001 0.04 0.07 0.02 0.30 0.002

0.0001

0.23 0.0002

0.001 <0.0001 0.02 0.005 <0.0001 0.0002 0.0005 0.88 0.08 0.13 0.002 0.31 0.01 0.0004 0.01

639

K. van Besien et al.

Overall survival Study cohort Double UCB Haplo+Cord Age at HAPLO-CORDT, in years 18-59 ≥ 60 GvHD/relapse-free survival GRFS Study cohort Double UCB Haplo+Cord Karnofsky Score 60-80% vs. 90-100%

0.85 193 97

1.0 0.97 (0.68-1.36)

183 107

1 2.04 (1.50-2.78)

187 97

1.0 0.63 (0.46-0.85)

<0.0001

0.002

0.65 (0.48-0.89)

0.02 0.005

a Risk factors evaluated: age (18-59 years vs. ≥60 years), sex, Karnofsky Performance Score (KPS) (90%-100% vs. 60%-80% vs. missing), disease [(lymphoma/chronic lymphocytic leukemia (CLL) vs. acute leukemia/myelodysplastic syndromes (MDS) vs. other leukemia)], disease risk (low vs. medium vs. high). bAcute leukemia/MDS, n=224. cOther leukemia, n=13. dLymphoma/CLL, n=53.

Graft-versus-host disease and relapse-free survival (GRFS) The cumulative incidence of acute GvHD grade 2-4 by day 120 was 17% (95%CI: 10%-25%) in the haplo-cord patients versus 51% (95%CI: 44%-57%) in the double UCB group (P<0.0000). Grade 3-4 acute GvHD at day 120 was similarly reduced in haplo-cord recipients versus controls 4% versus 19% (P<0.0001). Finally, chronic GvHD was much reduced in haplo-cord versus controls with a cumulative incidence at one year of 3% versus 30% (P<0.0000) (Figure 4).

Combining these important clinical end points, at one year 38% of haplo-cord recipients were alive without disease progression or serious GvHD versus 21% of double UCB recipients. There was a 37% improvement in hazard rate for GRFS (HR=0.63, 95%CI: 0.47-0.85; P=0.002) (Figure 4). A higher KPS (≥90%) was also associated with a superior GRFS (Table 2).

All calculations related to TRM, relapse, PFS, survival, GvHD and GRFS were repeated after excluding from the control group those patients with under 4/6 HLA matched grafts or with missing graft HLA information.

This had no impact on any of the outcomes (Online Supplementary Table S1).

Discussion Here we conducted a comparison of 97 adults who underwent haplo-cord transplant with a control group of patients reported to the CIBMTR undergoing reduced intensity conditioning and double UCB transplantation.

The control group was restricted to patients receiving fludarabine-cyclophosphamide low-dose TBI conditioning.

Originally developed at the University of Minnesota, it appears safer than many other conditioning regimens and has been widely adopted.7,17 In a recent CIBMTR study, it was the regimen utilized in over two-thirds of US adults undergoing non-myeloablative conditioning and UCB transplant, and therefore a logical choice for our control group. The tolerability of this regimen results in part from its minimal myelosuppression,27 and typically a minimum UCB cell dose of more than 3x107 nucleated cells is considered a requisite.6,18 For our study patients, we used a regimen that includes thymoglobulin, and that in addition is much more myelosuppressive and may occasionally lead to irreversible myelosuppression.28 Despite this, we 640

demonstrated more rapid neutrophil recovery and even more notably accelerated platelet recovery after haplocord transplantation. This should have considerable impact on duration of hospitalization, transfusion needs, and the expense of alternative donor transplantation in general.29,30 We were also able to achieve this result despite accepting lower doses of umbilical cord blood cells, a practice that in other studies of cord blood transplantation has been associated with increased failure rates.18,31,32 We were unable to show a significant improvement in TRM despite the more rapid engraftment. This is somewhat paradoxical, but the benefits of rapid neutrophil and platelet recovery were possibly offset by the more intensive conditioning regimen used for haplo-cord and potentially by infections related to thymoglobulin-mediated T-cell depletion.

The rate of disease recurrence after haplo-cord transplantation was significantly decreased. Whether the reduction in relapse relates to the difference in conditioning, rather than to a graft-related effect, cannot be ascertained from our data,32,33 but it occurred despite the use of thymoglobulin in the haplo-cord patients. ATG may be necessary to assure a smooth transition over time between the haplo-graft and umbilical cord blood predominance. In its absence, severe rejection and prolonged second nadirs have been reported.15,34 The use of ATG has been controversial because of concerns over higher rates of disease recurrence and increased rates of infections, toxicity and post-transplant lymphoproliferative disease.35 Increasing evidence, supported by our findings, suggests that many side-effects are dose related and that with appropriate dosing and monitoring, rabbit ATG is safe and not associated with increased rates of disease recurrence.36 Despite the reduction in disease recurrence, progression-free and OS were not significantly improved.

We also observed a very significant decrease in the incidence of acute and chronic GvHD with haplo-cord transplantation. In part, this can be attributed to our use of ATG. The control group did not receive ATG and all patients received double UCB blood transplantation which was recently shown to be associated with more acute GvHD.10 There may be additional reasons for the decrease in acute and chronic GvHD. For example, since the size of the cord blood unit no longer determines the rate of engraftment, we were able to choose smaller, better matched UCB units; better matching has been shown to be a major determinant of decreased GvHD.19 Lastly, haematologica | 2016; 101(5)

Haplocord vs. double cord transplant

A

C

B

D

Figure 3. Adjusted cumulative incidence function for (A) treatment-related mortality (TRM), (B) disease progression and adjusted Kaplan-Meier estimate for (C) progression-free survival and (D) survival.

there may be an inhibitory effect of the haplo-graft on GvHD. Although the haplo-graft was initially considered merely a “bridge”, it contains pluripotent progenitors, which in some cases readily persist in the peripheral blood T-cell compartment. Such persistent “mixed chimerism” may be mitigating the occurrence of GvHD and it is conceivable that the high doses of CD34 cells in the haplograft exert a veto-effect, preventing the GvH-like reactions of cord blood lymphocytes, similar to their role in prevention of graft rejection.37 Regardless of the mechanism, the profound reduction of severe acute and chronic GvHD together with reduced recurrence rates is intriguing.

The long-term detrimental effect of chronic GvHD has been highlighted in numerous recent studies. Chronic GvHD leads to severe chronic morbidity, sequelae of steroid use, increased risk for cardiovascular disease and skin cancer, and dramatically increased risk for late nonrelapse mortality.38-40 GRFS is a novel composite end point that takes into account relapse, non-relapse mortality and severe acute and chronic GvHD.23 As proposed by the original authors, “GRFS has value as a novel end point for benchmarking new therapies since it measures freedom from ongoing morbidity and represents ideal transplant recovery”.23 GRFS was significantly improved in haplocord transplant recipients compared to double UCB recipients.

Lastly, the ability to use smaller UCB units with haplocord transplant is of particular interest for transplant in patients of minority descent, and particularly of African descent. They tend to have rare HLA-types, and the genetically better matched UCB units are often quite small.41,42 Our ability to use these smaller units may at least partially haematologica | 2016; 101(5)

Figure 4. Adjusted Kaplan-Meier estimate for GvHD and progression-free survival (GRFS).

explain the much higher proportion of minority patients (historically underserved43 and with worse outcomes)44,45 in the haplo-cord group.

As experience has been gained with haplo-cord transplantation, advances in the field and our own observations have led to modifications, including most importantly: 1) strict monitoring for Epstein-Barr virus reactivation and reduction of the dose of ATG by 25%;46-49 2) more stringent selection of CBU units based on viability, bank of origin and high resolution HLA typing;18,50 3) limitation of the haplo graft dose to avoid rare instances where the haplo641

K. van Besien et al. graft outcompetes the UCB unit;16 and 4) avoidance of donors targeted by HLA antibodies, since these were associated with graft failure.20 The most noteworthy limitations of this analysis relate to the non-randomized comparison and potential bias of two different data sources (i.e. center-specific data relative to registry data). Adjustment for standard transplant covariates reduces but does not negate the lack of other patient covariates not captured and may influence the results. GvHD outcomes may have been captured differently for the haplo-cord centers (either better or worse) relative to the registry. We believe differences in relapse and PFS are probably accurate, as we would not expect a major difference in relapse detection. Ideally, we would have compared our outcomes to patients receiving a similar conditioning regimen, but this turned out to be impossible. The fludarabine-melphalan-ATG regimen has only been studied in limited numbers (and with different dosing regimens) in double UCB studies.51,52 In the CIBMTR data-set, fludarabine-alkylator combinations were used in fewer than 10% of older adults with AML receiving reduced intensity conditioning and double UCB trans-

References 1. Gluckman E, Ruggeri A, Volt F, et al.

Milestones in umbilical cord blood transplantation. Br J Haematol. 2011;154(4):441447.

2. Sanz J, Sanz MA, Saavedra S, et al. Cord blood transplantation from unrelated donors in adults with high-risk acute myeloid leukemia. Biol Blood Marrow Transplant.

2010;16(1):86-94.

3. Brunstein CG, Gutman JA, Weisdorf DJ, et al. Allogeneic hematopoietic cell transplantation for hematological malignancy: relative risks and benefits of double umbilical cord blood. Blood. 2010;116(22):4693-4699.

4. Laughlin MJ, Eapen M, Rubinstein P, et al.

Outcomes after transplantation of cord blood or bone marrow from unrelated donors in adults with leukemia. N Engl J Med. 2004;351(22):2265-2275.

5. Barker JN, Scaradavou A, Stevens CE. Combined effect of total nucleated cell dose and HLA match on transplantation outcome in 1061 cord blood recipients with hematologic malignancies. Blood. 2010;115(9):18431849.

6. Brunstein CG, Fuchs EJ, Carter SL, et al.

Alternative donor transplantation after reduced intensity conditioning: results of parallel phase 2 trials using partially HLAmismatched related bone marrow or unrelated double umbilical cord blood grafts.

Blood. 2011;118(2):282-288.

7. Weisdorf D, Eapen M, Ruggeri A, et al.

Alternative donor transplantation for older patients with acute myeloid leukemia in first complete remission: a center for international blood and marrow transplant researcheurocord analysis. Biol Blood Marrow Transplant. 2014;20(6):816-822.

8. Peffault de Latour R, Brunstein CG, Porcher R, et al. Similar overall survival using sibling, unrelated donor, and cord blood grafts after reduced-intensity conditioning for older patients with acute myelogenous leukemia.

Biol Blood Marrow Transplant. 2013;19(9):

642

plant. Lastly, there is a remote possibility that the observed advantages in rate of engraftment are simply a result of better HLA-matching, which was achieved because of our CBU unit selection strategy. This is highly unlikely given the well described predominance of the haplo-graft early after transplant.53 Several competing technologies are under development involving in vitro expansion of UCB cells or other progenitors or methods to enhance homing.54 Additional trials will be required to determine if any of these procedures will ultimately be superior. CD34 selected haplo-identical cells have the advantage of available technology and rapidity. Haploidentical transplantation with non-selected cells provides another readily available, affordable and technically less burdensome alternative. In parallel phase II studies it resulted in earlier engraftment than double cord transplant, but had higher rates of disease recurrence.6 Further studies will be needed to compare outcomes and of these competing technologies, and to further advance the field.

Funding Supported by an unrestricted grant from Miltenyi Biotec.

1355-1360.

9. Eapen M, Rocha V, Sanz G, et al. Effect of graft source on unrelated donor haemopoietic stem-cell transplantation in adults with acute leukaemia: a retrospective analysis.

Lancet Oncol. 2010;11(7):653-660.

10. Wagner JE Jr, Eapen M, Kurtzberg J. Oneunit versus two-unit cord-blood transplantation. N Engl J Med. 2015;372(3):288-293.

11. Fernandez MN, Regidor C, Cabrera R, et al.

Unrelated umbilical cord blood transplants in adults: Early recovery of neutrophils by supportive co-transplantation of a low number of highly purified peripheral blood CD34+ cells from an HLA-haploidentical donor. Exp Hematol. 2003;31(6):535-544.

12. Gormley NJ, Wilder J, Khuu H, et al. CoInfusion of Allogeneic Cord Blood with Haploidentical CD34+ Cells Improved Transplant Outcome for Patients with Severe Aplastic Anemia Undergoing Cord Blood Transplantation. ASH Annual Meeting Abstracts. 2011;118:654.

13. Kwon M, Bautista G, Balsalobre P, et al.

Haplo-cord transplantation using CD34+ cells from a third-party donor to speed engraftment in high-risk patients with hematologic disorders. Biol Blood Marrow Transplant. 2014;20:(12):2015-2022.

14. Liu H, van Besien K. Alternative donor transplantation-"mixing and matching": the role of combined cord blood and haplo-identical donor transplantation (haplo-cord SCT) as a treatment strategy for patients lacking standard donors. Curr Hematol Malig Rep. 2015;10(1):1-7.

15. Lindemans CA, van Besien K. Topping it up: methods to improve cord blood transplantation outcomes by increasing the number of CD34+ cells. Cytotherapy. 2015;17(6):723729.

16. Liu H, Rich ES, Godley L, et al. Reducedintensity conditioning with combined haploidentical and cord blood transplantation results in rapid engraftment, low GVHD, and durable remissions. Blood. 2011;118 (24):6438-6445.

17. Brunstein CG, Eapen M, Ahn KW, et al.

Reduced-intensity conditioning transplantation in acute leukemia: the effect of source of unrelated donor stem cells on outcomes.

Blood. 2012;119(23):5591-5598.

18. Barker JN, Byam C, Scaradavou A. How I treat: the selection and acquisition of unrelated cord blood grafts. Blood. 2011;117(8): 2332-2339.

19. Eapen M, Klein JP, Ruggeri A, et al. Impact of allele-level HLA matching on outcomes after myeloablative single unit umbilical cord blood transplantation for hematologic malignancy. Blood. 2014;123(1):133-140.

20. Yoshihara S, Taniguchi K, Ogawa H, Saji H. The role of HLA antibodies in allogeneic SCT: is the type-and-screen strategy necessary not only for blood type but also for HLA? Bone Marrow Transplant.

2012;47(12):1499-1506.

21. Gergis U, Mayer S, Gordon B, et al. A strategy to reduce donor-specific HLA Abs before allogeneic transplantation. Bone Marrow Transplant. 2014;49(5):722-724.

22. Filipovich AH, Weisdorf D, Pavletic S, et al.

National Institutes of Health consensus development project on criteria for clinical trials in chronic graft-versus-host disease: I. Diagnosis and staging working group report.

Biol Blood Marrow Transplant.

2005;11(12):945-956.

23. Holtan SG, DeFor TE, Lazaryan A, et al.

Composite end point of graft-versus-host disease-free, relapse-free survival after allogeneic hematopoietic cell transplantation.

Blood. 2015;125(8):1333-1338.

24. American Society of Blood and Marrow Transplantation. ASBMT RFI 2015 -Disease Classifications Corresponding to CIBMTR Classifications.

Available from: http://c.ymcdn.com/sites/www.asbmt.org/r esource/resmgr/RFI/RFI_2015__CIBMTR_Disease_Cl.pdf. Last accessed 22 March 2016.

25. Zhang X, Zhang MJ. SAS macros for estimation of direct adjusted cumulative incidence curves under proportional subdistribution

haematologica | 2016; 101(5)

Haplocord vs. double cord transplant

26.

27.

28.

29.

30.

31.

32.

33.

34.

hazards models. Comput Methods Programs Biomed. 2011;101(1):87-93.

Zhang X, Loberiza FR, Klein JP, Zhang MJ. A SAS macro for estimation of direct adjusted survival curves based on a stratified Cox regression model. Comput Methods Programs Biomed. 2007;88(2):95-101.

Brunstein CG, Barker JN, Weisdorf DJ, et al.

Umbilical cord blood transplantation after nonmyeloablative conditioning: impact on transplantation outcomes in 110 adults with hematologic disease. Blood. 2007;110(8): 3064-3070. van Besien K, Smith S, Anastasi J, et al.

Irreversible myelosuppression after fludarabine-melphalan conditioning: observations in patients with graft rejection. Blood.

2004;103(11):4373-4374.

Majhail NS, Mothukuri JM, Brunstein CG, Weisdorf DJ. Costs of hematopoietic cell transplantation: comparison of umbilical cord blood and matched related donor transplantation and the impact of posttransplant complications. Biol Blood Marrow Transplant. 2009;15(5):564-573.

Ramirez P, Brunstein CG, Miller B, Defor T, Weisdorf D. Delayed platelet recovery after allogeneic transplantation: a predictor of increased treatment-related mortality and poorer survival. Bone Marrow Transplant.

2011;46(7):981-986.

Laughlin MJ, Barker J, Bambach B, et al.

Hematopoietic engraftment and survival in adult recipients of umbilical-cord blood from unrelated donors. N Engl J Med. 2001;344(24):1815-1822.

Rio B, Chevret S, Vigouroux S, et al.

Decreased nonrelapse mortality after unrelated cord blood transplantation for acute myeloid leukemia using reduced-intensity conditioning: a prospective phase II multicenter trial. Biol Blood Marrow Transplant.

2015;21(3):445-453. de Lima M, Anagnostopoulos A, Munsell M, et al. Non-Ablative versus Reduced Intensity Conditioning Regimens in the Treatment of Acute Myeloid Leukemia and High-Risk Myelodysplastic Syndrome. Dose is Relevant for Long-Term Disease Control after Allogeneic Hematopoietic Stem Cell Transplantation. Blood. 2004;104(3):865872.

Lindemans CA, te Boome LCJ, Admiraal R, et al. Sufficient Immune-suppression with Thymoglobulin is essential for a successful Haplo-myeloid Bridge in Haplo-Cord Blood

haematologica | 2016; 101(5)

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

Transplantation. Biol Blood Marrow Transplant. 2015;21(19):1839-1845.

Soiffer RJ, Lerademacher J, Ho V, et al.

Impact of immune modulation with anti-Tcell antibodies on the outcome of reducedintensity allogeneic hematopoietic stem cell transplantation for hematologic malignancies. Blood. 2011;117(25):6963-6970.

Segovia J, van Besien K. Antithymocyte globulin for graft-versus-host disease prophylaxis: mistakenly maligned. Leuk Lymphoma. 2015;56(4):841-842.

Ophir E, Reisner Y. The use of donorderived veto cells in hematopoietic stem cell transplantation. Front Immunol. 2012;3:93.

Storb R, Gyurkocza B, Storer BE, et al. Graftversus-host disease and graft-versus-tumor effects after allogeneic hematopoietic cell transplantation.

J Clin Oncol.

2013;31(12):1530-1538.

Bhatia S, Francisco L, Carter A, et al. Late mortality after allogeneic hematopoietic cell transplantation and functional status of long-term survivors: report from the Bone Marrow Transplant Survivor Study. Blood.

2007;110(10):3784-3792.

Boyiadzis M, Arora M, Klein J, et al. Impact of chronic graft-versus-host disease on late relapse and survival on 7489 patients after myeloablative allogeneic hematopoietic cell transplantation for leukemia. Clin Cancer Res. 2015;21(9):2020-2028.

Page KM, Mendizabal A, Betz-Stablein B, et al. Optimizing donor selection for public cord blood banking: influence of maternal, infant, and collection characteristics on cord blood unit quality. Transfusion. 2014;54(2): 340-352.

Cairo MS, Wagner EL, Fraser J, et al.

Characterization of banked umbilical cord blood hematopoietic progenitor cells and lymphocyte subsets and correlation with ethnicity, birth weight, sex, and type of delivery: a Cord Blood Transplantation (COBLT) Study report. Transfusion.

2005;45(6):856-866.

Joshua TV, Rizzo JD, Zhang MJ, et al. Access to hematopoietic stem cell transplantation: effect of race and sex. Cancer.

2010;116(14):3469-3476.

Baker KS, Davies SM, Majhail NS, et al. Race and socioeconomic status influence outcomes of unrelated donor hematopoietic cell transplantation. Biol Blood Marrow Transplant. 2009;15(12):1543-1554.

Schwake CJ, Eapen M, Lee SJ, et al.

46.

47.

48.

49.

50.

51.

52.

53.

54.

Differences in characteristics of US hematopoietic stem cell transplantation centers by proportion of racial or ethnic minorities. Biol Blood Marrow Transplant.

2005;11(12):988-998.

Blaes AH, Cao Q, Wagner JE, et al.

Monitoring and preemptive rituximab therapy for Epstein-Barr virus reactivation after antithymocyte globulin containing nonmyeloablative conditioning for umbilical cord blood transplantation. Biol Blood Marrow Transplant. 2010;16(2):287-291.

Heslop HE. How I treat EBV lymphoproliferation. Blood. 2009;114(19):4002-4008.

Baron F, Labopin M, Blaise D, et al. Impact of in vivo T-cell depletion on outcome of AML patients in first CR given peripheral blood stem cells and reduced-intensity conditioning allo-SCT from a HLA-identical sibling donor: a report from the Acute Leukemia Working Party of the European Group for Blood and Marrow Transplantation. Bone Marrow Transplant. 2014;49(3):389-396.

Salem G, Ruppert AS, Elder P, et al. Lower dose of antithymocyte globulin does not increase graft-versus-host disease in patients undergoing reduced-intensity conditioning allogeneic hematopoietic stem cell transplant. Leuk Lymphoma. 2015;56(4):10581065.

Eapen M, Klein JP, Sanz GF, et al. Effect of donor-recipient HLA matching at HLA A, B, C, and DRB1 on outcomes after umbilicalcord blood transplantation for leukaemia and myelodysplastic syndrome: a retrospective analysis. Lancet Oncol. 2011;12(13): 1214-1221.

Cutler C, Stevenson K, Kim HT, et al.

Double umbilical cord blood transplantation with reduced intensity conditioning and sirolimus-based GVHD prophylaxis. Bone Marrow Transplant. 2011;46(5):659-667.

Ballen KK, Spitzer TR, Yeap BY, et al.

Double unrelated reduced-intensity umbilical cord blood transplantation in adults. Biol Blood Marrow Transplant. 2007;13(1):82-89. van Besien K, Liu H, Jain N, Stock W, Artz A. Umbilical Cord Blood Transplantation Supported by Third-Party Donor Cells: Rationale, Results, and Applications. Biol Blood Marrow Transplant. 2013;19(5):682691.

Lund TC, Boitano AE, Delaney CS, Shpall EJ, Wagner JE. Advances in umbilical cord blood manipulation-from niche to bedside.

Nat Rev Clin Oncol. 2015;12(3):163-174.

643

ARTICLE EUROPEAN HEMATOLOGY ASSOCIATION

Stem Cell Transplantation

Ferrata Storti Foundation

Haematologica 2016 Volume 101(5):644-652

Allogeneic unrelated bone marrow transplantation from older donors results in worse prognosis in recipients with aplastic anemia

Yasuyuki Arai,1 Tadakazu Kondo,1 Hirohito Yamazaki,2 Katsuto Takenaka,3 Junichi Sugita,4 Takeshi Kobayashi,5 Yukiyasu Ozawa,6 Naoyuki Uchida,7 Koji Iwato,8 Naoki Kobayashi,9 Yoshiyuki Takahashi,10 Ken Ishiyama,11 Takahiro Fukuda,12 Tatsuo Ichinohe,13 Yoshiko Atsuta,14,15 Takehiko Mori,16 and Takanori Teshima4 on behalf of the Japan Society for Hematopoietic Cell Transplantation

Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University; 2Division of Transfusion Medicine, Kanazawa University Hospital; 3 Department of Medicine and Biosystemic Science, Kyushu University Graduate School of Medicinal Sciences, Fukuoka; 4Department of Hematology, Hokkaido University Graduate School of Medicine, Sapporo; 5Hematology Division, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, Tokyo; 6Department of Hematology, Japanese Red Cross Nagoya First Hospital; 7Department of Hematology, Toranomon Hospital, Tokyo; 8Department of Hematology, Hiroshima Red Cross Hospital & Atomic-Bomb Survivors Hospital; 9Department of Hematology, Sapporo Hokuyu Hospital; 10Department of Pediatrics, Nagoya University Graduate School of Medicine; 11 Department of Hematology, Kanazawa University Hospital; 12Hematopoietic Stem Cell Transplantation Division, National Cancer Center Hospital, Tokyo; 13Department of Hematology and Oncology, Hiroshima University Hospital; 14Japanese Data Center for Hematopoietic Cell Transplantation, Nagoya; 15Department of Healthcare Administration, Nagoya University Graduate School of Medicine; and 16Division of Hematology, Department of Internal Medicine, Keio University School of Medicine, Tokyo, Japan 1

ABSTRACT

Correspondence: tadakazu@kuhp.kyoto-u.ac.jp

Received: November 14, 2015.

Accepted: February 3, 2016 Pre-published: Febraury 8, 2016. doi:10.3324/haematol.2015.139469

Check the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/101/5/644

©2016 Ferrata Storti Foundation Material published in Haematologica is covered by copyright. All rights reserved to the Ferrata Storti Foundation. Copies of articles are allowed for personal or internal use.

Permission in writing from the publisher is required for any other use.

644

A

llogeneic bone marrow transplantation is an essential therapy for acquired aplastic anemia and prognosis has recently improved.

However, engraftment failure and graft-versus-host disease are potential fatal complications. Various risk factors for poor prognosis have been identified, such as patient age and human-leukocyte antigen disparity, but the relationship between donor age and prognosis is still unknown. Therefore, we performed a cohort study to compare the prognosis of unrelated bone marrow transplantation from younger and older donors using the registry database in Japan. We evaluated 427 patients (age 16-72 years) with aplastic anemia who underwent bone marrow transplantation from younger (≤39 years, n=281) or older (≥40 years, n=146) unrelated donors. Overall survival of the older donor group was significantly inferior to that of the younger donor group (adjusted hazard ratio 1.64; 95% confidence interval 1.15-2.35; P<0.01).

The incidence of fatal infection was significantly higher in the older donor group (13.7% vs. 7.5%; P=0.03). Primary engraftment failure and acute graft-versus-host disease were significantly more frequent in the older donor group (9.7% vs. 5.0%; adjusted hazard ratio 1.30; P=0.01, and 27.1% vs. 19.7%; adjusted hazard ratio 1.56; P=0.03, respectively).

Acute graft-versus-host disease was related to a worse prognosis in the whole cohort. This study showed the inferiority of older donors in aplastic anemia; thus, donor age should be considered when multiple donors are available. A large-scale prospective study is warranted to establish a better donor selection algorithm for bone marrow transplantation in aplastic anemia. haematologica | 2016; 101(5)

Prognosis and donor age in unrelated BMT for AA

Introduction

Methods

Allogeneic hematopoietic cell transplantation is an effective and, therefore, indispensable therapy for acquired aplastic anemia (AA) in adults.1 Patients with AA are eligible for transplant if they are under 40 years of age or when they are refractory to immunosuppressive therapy;1,2 bone marrow transplantation (BMT) from a human leukocyte antigen (HLA)-matched sibling donor or an unrelated donor is selected according to the donor availability.2 The prognosis of BMT for AA has recently improved and 5-year overall survival (OS) is as high as 72% for younger patients (≤40 years old) and 53% for older patients (>40 years).3 However, severe complications, such as engraftment failure, infection, and graft-versus-host disease (GvHD), are problems that need to be addressed in order to improve the overall prognosis of AA, especially for unrelated BMT.2,3 Various risk factors are reportedly associated with these complications and poor prognosis, such as older patient age, longer periods from diagnosis to transplantation, HLA-mismatched donors, and female donors.2-4 In addition to these, biological speculation from previous published studies regarding hematopoietic stem cell repopulation and donor-derived T-cell function have suggested that transplantation from older donors may result in a higher incidence of engraftment failure and acute GvHD (aGvHD), and, as a result, increase transplant-related death and lead to inferior OS. According to murine studies, hematopoietic stem cells from older donors do not re-populate as efficiently,5,6 and grafts from older donors have a higher ratio of memory T cells to naïve T cells;7 an increase in peripheral blood memory T cells has been shown to be related to the occurrence of aGvHD in humans.8,9 The influence of donor age in unrelated hematopoietic cell transplantation has long been discussed in various studies, and some have shown a relationship between older donor and worse prognosis.10-15 Most of these cohorts, however, were mainly composed of hematologic malignancies, and AA cases were not included,11-15 or, if they were, they made up only a small proportion of the cohort.10 AA should be analyzed independently from malignant diseases, especially with regard to engraftment and GvHD, because the incidence of graft failure is more often documented in AA, and GvHD more directly impacts OS.2 Moreover, engraftment and GvHD are closely related to pre- or post-transplant tumor load in hematologic malignancies, which is irrelevant to AA patients.16-18 As far as we know, however, no studies have investigated donor age as a candidate risk factor for poor prognosis in transplantation for AA. Therefore, we performed a cohort study to compare the prognosis of patients with AA who underwent BMT from younger donors versus older donors using the Japanese transplant registry database, in particular on engraftment and GvHD. We focused on BMT from unrelated donors in order to avoid the correlation between patient and donor age; thus, BMT from related sibling donors were excluded because siblings tend to be born only a few years apart.10 Our study should provide important insights into donor selection algorithms for BMT in patients with AA.

Inclusion criteria and clinical procedures in BMT

haematologica | 2016; 101(5)

Data for adult patients (age >16 years) with AA who underwent a first allogeneic BMT from unrelated donors between January 1 1993 and December 31 2013 were obtained from the Transplant Registry Unified Management Program (TRUMP) in Japan.19 The eligibility criteria for transplantation was in accordance with international guidelines and recommendations;1,2 BMT is the first-line treatment for young patients with severe AA with a sibling donor, and the second-line treatment following immunosuppressive treatment in older patients or in those to be grafted from an unrelated donor.2 The unrelated donor selection was based primarily on HLA disparity, and candidates were nominated among 8/8 or, if not available, 7/8 (or lower) HLA-A, B, C, and DR allele matched volunteers (age 20-55 years) registered in the Japanese Marrow Donor Program. Data on 10 alleles including HLA-DQ were not available. The donor was finally determined after consideration of various factors, such as ABO blood type, sex, and body weight; donor age usually has little significance on donor selection in Japan.20 Selection of conditioning regimens and GvHD prophylaxis is at the discretion of attending physicians in each institute, considering disease status, number of transfusions and amounts transfused, patients’ age and performance status, the risk of infections, etc.; donor age is not usually considered. Donorderived serum and/or erythrocytes were depleted from grafts in cases of mismatched ABO blood types, and grafts were transplanted without ex vivo T-cell depletion. Our protocol complied with the Declaration of Helsinki and was approved by the TRUMP Data Management Committee and by the Ethics Committee of Kyoto University where the study was performed. Patient information was anonymized, so consent was not required.

Data collection and definition of each covariate From the registry database, we extracted data on basic pretransplant characteristics and post-transplant clinical courses.

Donors were categorized into two groups with respect to age (younger vs. older than the 75th percentile; the closest value which is the multiple of 5 was adopted as the cut-off point).

Donor age was considered a continuous variable and its influence was analyzed. Conditioning regimens were summarized according to the definitions of myeloablative conditioning (MAC) and reduced-intensity conditioning (RIC), which were consistent with those established in the RIC regimen workshop.21 Data on the use of anti-thymocyte or anti-T-cell globulin (ATG) before and after BMT were also collected. Periods between diagnosis and BMT were calculated from the day of initial diagnosis of AA. With respect to the post-transplant clinical course, engraftment of neutrophils and platelets was defined as the first of three consecutive days during which neutrophil and platelet counts were at least 500/μL and 5.0x104/μL without transfusion support, respectively. Diagnosis and classification of GvHD were defined according to traditional criteria.22,23 A protective environment, prophylactic administration of antibiotics, and intravenous immunoglobulin replacement were adopted as standard prevention strategies for infection in accordance with the guideline from the Japanese Society for Hematopoietic Cell Transplantation.

Analytical methods are shown in the Online Supplementary Appendix.

645

Y. Arai et al.

Results Patients’ characteristics We evaluated 427 patients aged 16-72 years (median 30 years) who underwent unrelated BMT for AA. Donor age ranged from 21 to 55 years old (median 35 years; 75th percentile 42 years); therefore, the cut-off point for age was set at 40 years (the multiple of 5 which is the closest to 75th percentile), and younger donors were defined as 39 years old or under (n=281) and older donors as 40 years or over (n=146) (Table 1). There was no significant correlation between patient and donor age in the whole cohort (Pearson correlation coefficient 0.09) (Online Supplementary Figure S1) or in any subgroups regarding patients’ pretransplant characteristics (data not shown). There were a

median 355.5 days between diagnosis and BMT (range 138-827 days), and no significant differences were seen between the donor age groups (P=0.40). During these periods, all the patients underwent at least one course of immunosuppressive therapy, such as rabbit anti-human thymocyte immunoglobulin (ATG) (81.0%) and/or cyclosporine (88.8%) with or without granulocyte colonystimulating factor (53.0%); type of previous therapies showed no correlation with donor age. MAC regimens were mainly composed of cyclophosphamide plus total body irradiation (TBI) (CY/TBI; CY 120 mg/kg; TBI 10-12 Gy) with or without ATG (Online Supplementary Table S1).

High-dose TBI (10-12 Gy) was selected in cases transplanted before 2006, but not in more recent cases (after 2006); this regimen is strongly discouraged due to higher adverse

Table 1. Patients’ characteristics.

Variables

Total (n=427) N

Patient sex Patient age

Periods between diagnosis and BMT

HLA disparity

Sex disparity

ABO disparity

Harvested NCC Conditioning Usage of ATG

GVHD prophylaxis

Year of BMT Follow-up period

Female Male Median (range), y - 29 30 - 39 40 - 49 50 Median (range), d -1y 1yUnknown Matched Mismatched 1 allele 2 alleles or more Unknown Matched M to F F to M Matched Minor mismatched Major mismatched Both Unknown Median/PtBW(Kg) MAC RIC No Yes Unknown CyA-based Tac-based Unknown - 2005 2006 Median (range), d

193 234 30 (16 - 72) 213 106 52 56 355.5 (138 – 827) 223 203 1 131 269 106 163 27 253 107 67 198 102 80 46 1 2.87×108 84 343 199 226 2 142 275 10 194 233 1,777 (61 – 6,983)

%

Younger donor (n=281) N %

45.2 54.8

126 155

49.9 24.8 12.2 13.1

150 65 30 36

44.8 55.2 28 (16 - 65) 53.4 23.1 10.7 12.8 366 (138 – 827)

52.3 47.5 0.2 30.7 63.0 24.8 38.2 6.3 59.2 25.1 15.7 46.4 23.9 18.7 10.8 0.2

140 140 1 96 162 65 97 23 171 66 44 131 67 53 29 1

49.8 49.8 0.4 34.2 57.6 23.1 34.5 8.2 60.8 23.5 15.7 46.6 23.8 18.9 10.3 0.4 8

2.91×10 19.7 80.3 46.6 52.9 0.5 33.3 64.4 2.3 45.4 54.6

63 218 129 151 1 97 178 6 132 149

22.4 77.6 45.9 53.7 0.4 34.5 63.4 2.1 47.0 53.0 1,945 (61 – 6,012)

Older donor (n=146) N % 67 45.9 79 54.1 32 (16 - 72)0.15 63 43.2 41 28.1 22 15.1 20 13.7 309 (232 – 682) 83 56.8 63 43.2 0 0.0 35 24.0 107 73.3 41 28.1 66 45.2 4 2.7 82 56.1 41 28.1 23 15.8 67 45.9 35 24.0 27 18.5 17 11.6 0 0.0 8 2.71×10 21 14.4 125 85.6 70 48.0 75 51.3 1 0.7 45 30.8 97 66.5 4 2.7 62 42.5 84 57.5 1,324 (94 – 6,983)

P

0.84

0.21 0.40

0.31

< 0.01*

0.56

0.95 0.22 0.05*

0.82

0.71 0.38 0.10

BMT: bone marrow transplantation; HLA: human leukocyte antigen; M to F: male to female; F to M: female to male; NCC: nucleated cell count; PtBW: body weight of patients; MAC: myeloablative conditioning; RIC: reduced-intensity conditioning; ATG: anti-thymocyte or T-cell globulin; GvHD: graft- versus-host disease; CyA: cyclosporine; and Tac: tacrolimus. *Indicates statistically significant (P<0.05).

646

haematologica | 2016; 101(5)

Prognosis and donor age in unrelated BMT for AA

events.24 On the other hand, RIC consisted of CY (200 mg/kg), TBI (2-4 Gy), and/or fludarabine (100-120 mg/m2) with or without ATG (Thymoglobulin), 2.5-10 mg/kg, or rabbit anti-human T-cell immunoglobulin (ATG-F), 10-25 mg/kg. GvHD prophylaxis was composed of cyclosporine- and tacrolimus-based regimens, and both were usually coupled with short-term methotrexate (98.6% and 94.2%, respectively). There was no significant difference between distribution of donor age according to year of BMT (before vs. after 2006).

Overall survival was significantly worse following BMT from older donors Overall survival of the older donor group was inferior to that of the younger donor group (65.9% vs. 77.7% at 1 year, 54.3% vs. 71.7% at 5 years after BMT) (Figure 1).

This difference was significant in the univariate analysis [hazard ratio (HR)] of overall mortality in the older donor group compared to the younger donor group, 1.65; 95% confidence interval (CI) 1.19-2.29; P<0.01] (Table 2).

Among other variables, older age of patients (≥30 years) (Online Supplementary Figure S2), ABO blood type major mismatch, GvHD prophylaxis with cyclosporine, and BMT before 2006 were associated with a worse survival (P<0.1). In the multivariate analysis, including these factors and the other known confounders (HLA disparity and

conditioning regimens), the older donor group showed significantly higher overall mortality (HR 1.64; 95%CI: 1.15-2.25; P<0.01) (Table 2).

This inferiority of OS in the older donor group (i.e. superiority in the younger donor group) was observed in each subgroup according to patient characteristics, with adjusted HRs being more than 1 in almost all subgroups (Figure 2). This tendency was also confirmed when we confined the analysis to only more recent cases (BMT after 2006) transplanted within one year after diagnosis using RIC regimen including ATG (n=128; adjusted HR 2.03; 95%CI: 0.94-4.39; P=0.07). Moreover, we compared OS between each donor group using Kaplan-Meier curves stratified by subgroups of patient age, HLA disparity, and conditioning regimens (Online Supplementary Figure S3), because patient age is a known strong prognostic factor,2 and HLA and conditioning regimens were statistically related to donor age in this cohort (Table 1). Differences in survival according to donor age were also apparent in each subgroup.

When treating donor age as a continuous variable (supposing that the increase of one year in donor age has the same impact on OS), it is significantly related to poorer OS in multivariate analyses adjusted by confounding factors (HR 1.03; 95%CI: 1.01-1.05 per one year increase in age, P<0.01; HR 1.36; 95%CI: 1.08-1.70 per 10 years increase in age) (Online Supplementary Table S2), supporting our

Table 2. Overall mortality according to each variable before BMT.

Variables Donor age

Younger Older Patient sex Female Male Patient age - 29 y 30 y Periods between diagnosis and BMT -1y 1yHLA disparity Matched Mismatched Sex disparity Matched M to F F to M ABO disparity Matched Minor mismatched Major mismatched Both Harvested NCC Lower Higher Conditioning MAC RIC Usage of ATG No Yes GVHD prophylaxis CyA-based Tac-based Year of BMT - 2005 2006 -

HR

Univariate analysis 95%CI

1.00 1.65 1.00 1.07 1.00 1.59 1.00 1.00 1.00 1.22 1.00 1.35 1.32 1.00 1.25 1.46 1.06 1.00 1.14 1.00 0.86 1.00 0.85 1.00 0.69 1.00 0.62

reference 1.19 - 2.29 reference 0.77 - 1.49 reference 1.14 – 2.21 reference 0.72 - 1.38 reference 0.84 - 1.77 reference 0.93 - 1.97 0.84 - 2.05 reference 0.83 - 1.87 0.96 - 2.23 0.59 - 1.90 reference 0.82 - 1.58 reference 0.58 - 1.26 reference 0.61 - 1.18 reference 0.49 - 0.97 reference 0.44 - 0.87

P

HR

Multivariate analysis 95%CI

P

< 0.01*

1.00 1.64

reference 1.15 – 2.35

< 0.01*

1.00 1.97

reference 1.34 – 2.90

< 0.01*

1.00 1.29

reference 0.87 – 1.90

0.21

1.00 1.31 1.53 1.31

reference 0.85 – 2.02 0.97 – 2.43 0.71 – 2.42

0.22 0.07 0.39

1.00 0.80

reference 0.51 – 1.26

0.34

1.00 0.73 1.00 0.62

reference 0.50 – 1.08 reference 0.42 – 0.93

0.68 < 0.01* 0.98 0.29 0.12 0.23 0.29 0.08 0.85 0.43 0.45 0.32 0.04* < 0.01*

0.11 0.02*

HR: hazard ratio; CI: confidence interval. BMT: bone marrow transplantation; HLA: human leukocyte antigen; M to F: male to female; F to M: female to male; NCC: nucleated cell count; MAC: myeloablative conditioning; RIC: reduced-intensity conditioning; ATG: anti-thymocyte or T-cell globulin; GvHD: graft- versus-host disease; CyA: cyclosporine; and Tac: tacrolimus.*Indicates statistically significant (P<0.05).

haematologica | 2016; 101(5)

647

Y. Arai et al.

findings obtained by analyses treating donor age as the binary variable, and indicating that donor age is the independent risk factor.

The causes of mortality were summarized and compared between the two donor groups (Table 3). The major causes included infection and organ failure in both groups, and the incidence of fatal infections, especially bacterial infections, was significantly higher in the older donor group (13.7% vs. 7.5%; P=0.03). The reasons for mortality beyond one year after BMT were also summarized, because OS decreased during this period, especially in the older donor group. GvHD, infections, and organ failures were more often documented in patients transplanted from older donors, though no significant differences were detected because of the relatively smaller number of patients (Online Supplementary Table S3).

Poorer engraftment and higher incidence of aGvHD were associated with older donors In order to address the causes underlying the differences in OS and mortality between the younger and the older donor groups, we compared clinical courses between donor age groups, with a particular focus on engraftment and GvHD because they are critical parameters that may determine the prognosis of patients with AA after BMT.2 As for engraftment, the older donor group showed a significantly lower proportion of neutrophil and platelet engraftment following BMT (Table 4 and Figure 3A).

Primary engraftment failure was more frequently observed in the older donor group than in the younger donor group (9.7% vs. 5.0%, HR 1.15; P<0.01). Neutrophil

engraftment or engraftment failure was still significantly higher in the older donor group after multivariate analyses adjusted for confounding factors such as patient age, HLA disparity, ABO disparity, harvested NCC, conditioning regimens, and GvHD prophylaxis (adjusted P=0.01) (Table 4). When treating donor age as the continuous variable, adjusted HR of engraftment failure per 1-year increase in age is 1.01 (95%CI: 1.003-1.03; P<0.01) and this is 1.16 per 10-year increase (95%CI: 1.03-1.32).

With regard to GvHD, grade II-IV aGvHD was significantly more frequent in the older donor group (27.1% vs.

19.7%; adjusted HR 1.56; P=0.03) (Table 4 and Figure 3B), while there was no significant difference in grade III-IV aGvHD between groups (8.3% vs. 6.9%; adjusted HR 1.32; P=0.45); in addition, the incidence of cGvHD was almost the same in both groups (24.6% vs. 27.8%; adjusted HR 0.91; P=0.66) (Table 4 and Figure 3B). The incidence of grade II-IV aGvHD in the older donor groups compared with the younger donor groups was analyzed in various subgroups; the older donor group showed a tendency to have higher incidence of aGvHD in many subgroups, with higher HRs in older patients and HLA-mismatched transplantation (adjusted HR 2.07 and 1.61, respectively).

Among patients diagnosed with grade II aGvHD, 33.5% of them were refractory to the primary corticosteroid administration, requiring the stronger immunosuppressive therapies for longer periods, while 66.6% in grade III-IV aGvHD patients underwent secondary therapies.

When treating donor age as the continuous variable, adjusted HR of grade II-IV aGvHD per 1-year increase in age is 1.03 (95%CI: 1.01-1.05; P=0.01) and per 10-year increase is 1.34 (95%CI: 1.05-1.72).

Table 3. Comparisons of the causes of mortality in each age group of donors.

Younger donor (n=281) N % Infection Bacteria Virus Fungus Organ failure Lung CNS Liver Heart Kidney GvHD Acute chronic Graft failure TMA/VOD Hemorrhage Secondary malignancy Others/unknown Total Figure 1. Prognosis after BMT in each donor age group. Overall survival (OS) is calculated with the Kaplan-Meier method in each donor age group, and compared with Cox proportional hazards model after being adjusted for confounding factors (see Table 2).

648

21 10 3 8 23 9 4 2 4 3 7 5 2 4 2 11 6 9 83

7.5

8.2

2.5

1.4 0.7 3.9 2.1 3.2 29.5

Older donor (n=146) N % 20 11 2 4 17 4 1 5 4 3 5 1 4 4 2 7 1 7 63

P

13.7

0.03*

11.6

0.24

3.4

0.56

2.7 1.4 4.8 0.7 4.8 43.2

0.34 0.60 0.67 0.26

Any fatal infections and organ failures following GvHD or other post-transplant complications are all categorized into “infection” and “organ failure” as the causes of NRM. TMA: thrombotic microangiopathy; VOD: veno-occlusive disease; CNS: central nervous system; GvHD: graft- versus-host disease. *Indicates statistically significant (P<0.05).

haematologica | 2016; 101(5)

Prognosis and donor age in unrelated BMT for AA

Impact of aGvHD on overall survival and its relationship to mortality

Discussion

It has been thought that complications with aGvHD may directly result in poor OS in patients with AA because the graft-versus-host effect does not have the same merit as the graft-versus-leukemia effects observed in transplant for leukemia.17 To confirm this hypothesis in our cohort, we determined OS regarding aGvHD as a time-dependent covariate;25 as a result, aGvHD (grade IIIV) showed a tendency towards a worse prognosis in the whole cohort (adjusted HR 1.42; 95%CI: 0.95-2.11; P=0.08) and in both donor age groups. Landmark analysis (on day 30 or day 60 after BMT) also showed a trend towards a worse survival in patients with aGvHD (data not shown). Poor response to immunosuppressive therapies even in grade II aGvHD can support these data, and the higher incidence of aGvHD in the older donor group may partially account for the worse prognosis in this group due to cases of infection and organ failure (Table 3 and Online Supplementary Table S3).

This cohort study regarding donor age and prognosis of unrelated BMT for AA revealed three major findings: 1) OS in transplantation from older donors (>40 years old) was significantly worse than that from younger donors; 2) neutrophil and platelet engraftment was suppressed and engraftment failure was more often observed following transplant from older donors; and 3) the older donor group had a higher incidence of aGvHD. First, we clearly showed an inferior prognosis in the older donor group compared to the younger donor group.

This result was confirmed by multivariate and various subgroup analyses, in order to exclude the influence of confounding factors, such as patient age, HLA disparity, conditionings, etc. Our data indicate that older donor age can be considered an independent risk factor for poor prognosis after unrelated BMT for AA irrespective of whether it is treated as the binary covariate or the continuous covariate. It should be emphasized that donor age

Figure 2. Subgroup analyses of overall survival (OS) with respect to patientsâ&#x20AC;&#x2122; pre-transplant characteristics. OS is compared in each subgroup with respect to pre-transplant patientsâ&#x20AC;&#x2122; characteristics.

Hazard ratios (HRs) of overall mortality in the older donor group are shown in comparison with the younger donor group (i.e. HR >1 indicates better OS in the younger donor group). Black dots: HRs. Black bars: 95%CI ranges. CyA: cyclosporine; Tac: tacrolimus.

haematologica | 2016; 101(5)

649

Y. Arai et al.

was not correlated with patient age (which is the strongest prognostic factor2) either in our whole cohort (Online Supplementary Figure S1) or in any subgroup of patients’ characteristics, such as sex, HLA disparity, conditioning regimens, GvHD prophylaxis, and year of BMT. As far as we know, so far there have been no reports of a relationship between donor age and prognosis in AA patients.

This difference in prognosis can be explained in part by the significantly higher incidence of fatal infection (especially bacterial infection) in the older donor group (Table 3), which may have been due to insufficiency or dysfunction of immune cells derived from older donor grafts.

Actually, this speculation is supported by previous studies in mice indicating that recovery of the absolute number of lymphocytes in the early post-transplant period was delayed in recipients transplanted from older donors even after bone marrow engraftment, suggesting the delayed recovery of cytotoxic T cells and immunoglobulin-secreting B cells (leading to hypogammaglobulinemia).26,27 Moreover, suppression of neutrophil function was shown in neutrophils from aged donors due to the decrease in secondary messenger generation, such as diacylglycerol and inositol-triphosphate, and the defect in superoxide generation which is essential for bacterial killing.28

Unfortunately, there were no data on lymphocyte characteristics and neutrophil function in our dataset, but our epidemiological data and biological studies in mice suggest that controlling severe infection, especially bacterial infection, might be a key issue in improving prognosis following transplantation from older donors.

Next, we observed a relationship between older donor grafts and a higher incidence of primary graft failure in both analyses, whether treating donor age as the binary or as the continuous variables. Engraftment of donor grafts is an essential factor in transplantation in AA.2 The inferiority in engraftment with older donors in combination with poor recovery of CD4+ naïve T cells and B cells mentioned above may increase opportunistic infections and account for the worse OS. In addition, higher transplant-related mortality following salvage secondary transplant after engraftment failure generally results in an even worse prognosis.

Poor engraftment with older donors has also been shown in murine transplant models,5,6 and this kind of “aging” in grafts from older donors may be related to ageassociated modifications in DNA methylation patterns29 and/or shorter length of telomeres in hematopoietic stem or progenitor cells from older donors.30

A

B

Figure 3. Cumulative incidence of engraftment and graft-versus-host disease (GvHD) in each donor age group. Incidence of (A) neutrophil and platelet engraftment and (B) acute GvHD (aGvHD) (grade II-IV) and chronic GvHD (cGvHD) (all grades) are calculated with Gray’s method considering death or salvage transplantation (after graft failure) as competing risks. Fine-Gray proportional hazard models are used to compare these incidences; P values are adjusted according to confounding factors, such as patient age, HLA disparity, ABO disparity, harvested NCC, conditionings, and GvHD prophylaxis.

650

haematologica | 2016; 101(5)

Prognosis and donor age in unrelated BMT for AA

Table 4. Comparisons of clinical courses after BMT in each group of donors.

Variables Engraftment Neutrophil Platelet aGvHD Grade II – IV Grade III – IV cGvHD All Extensive

Cumulative incidence (%) Younger Older donor donor

HR

95%CI

P

95.0 77.4

90.3 63.1

0.77 0.76

0.63 – 0.94 0.58 – 0.99

0.01* 0.04*

19.7 6.9

27.1 8.3

1.56 1.32

1.04 – 2.37 0.64 – 2.74

0.03* 0.45

27.8 14.0

24.6 12.4

0.91 1.01

0.59 – 1.39 0.56 – 1.85

0.66 0.96

Hazard ratios (HR) and P values are adjusted with potential confounding factors, such as patient age, HLA disparity, ABO disparity, harvested NCC, conditionings, and graft- versushost disease (GvHD) prophylaxis. aGVHD: acute GvHD; cGvHD: chronic GvHD. CI: confidence interval.*Indicates statistically significant (P<0.05).

Finally, we showed a higher incidence of aGvHD in older donors in both analyses, whether treating donor age as the binary or the continuous variable. This may be explained by the higher ratio of memory T-cell to naïve Tcell subsets in older people;7 recent clinical studies have shown that peripheral blood CD8+ effector memory T cells are closely associated with aGvHD in humans,8,9 in contrast to previous findings in a murine model.31 Different gene expression profiles regarding GvHD, such as transforming growth factor-β in CD4+ and CD8+ T cells, were also shown in older donors.32 In our cohort, all the grafts were injected without ex vivo T-cell depletion; therefore, it may be speculated that massive amounts of antigen-experienced memory T cells (including those which can recognize and attack the recipient-specific major and/or minor histocompatibility antigens) were injected, especially in cases with older donors, which initiated an allo-reaction leading to aGvHD. At the same time, a hyper-acute phase of aGvHD targeting the bone marrow niche may induce engraftment failure in BMT from an older donor.33 These speculations suggest that appropriate use of ATG could be helpful in overcoming this disadvantage in choosing older donor-derived bone marrow grafts.

The impact of aGvHD on OS is another important point that needs to be discussed. In transplantation for hematologic malignancies, aGvHD, if not severe and beyond control, can be an indicator for better survival because GvHD may guarantee graft-versus-tumor effects that can suppress post-transplant relapse.17 In AA, however, we confirmed that GvHD, regardless of the severity, does not have any beneficial effects on patients, and worsens prognosis; grade II-IV aGvHD was related to inferior OS in both donor age groups, and grade III-IV aGvHD increased mortality to an even greater extent (HR 3.19; P<0.01). One of the explanations for this inferior survival is the refractoriness of aGvHD in our cohort; more than 30% of patients were refractory to the initial steroid therapy even in grade II aGvHD, and more than 60% of those with grade III-IV required secondary immunosuppressive therapies. Therefore, the higher incidence of aGvHD following BMT from older donors may also explain the worse prognosis in this group.

Graft-versus-host disease was selected as the main cause of mortality in only a small number of patients, and there was no difference between donor age groups (Table 3). It haematologica | 2016; 101(5)

is suspected that most of the patients who experienced long-term episodes of GvHD acquired fatal infection or organ dysfunction after continuous immunosuppressive status due to the nature of the GvHD itself or its treatment.34,35 Among these patients, the main cause of mortality was recorded as infection or organ failure in our database.

In summary, we found the inferiority of older donors in unrelated BMT for AA compared to younger donors (treated as the binary covariate; >40 years vs. >39 years or older, or the continuous covariate), mainly because of the higher incidence of engraftment failure and aGvHD in the former group; these complications can induce fatal infections. This analysis suggests that donor age should receive a special focus as criterion when multiple unrelated donors are available for AA, and there should be a concerted effort to recruit younger voluntary candidate BMT donors.

Our study, however, was retrospective in design and was conducted in only one country. In addition, due to the long period of patient recruitment, protocols were not necessarily compatible with the current guidelines in some patients; the widely recommended protocol is to transplant as soon as possible after diagnosis with a conditioning regimen including cyclophosphamide, ATG, and lowdose TBI.24 We confirm that our main results can be reproduced in the subgroup analyses of patients who were treated according to the current guidelines. Moreover, it is difficult to carry forward a discussion regarding the choice between a younger unrelated donor and an older matched sibling donor in a retrospective study; therefore, largescale international prospective studies are needed to validate these results and to revise the donor selection algorithm for the future.

Acknowledgments The authors would like to thank all the physicians and data managers at the centers who contributed valuable data on transplantation to the Japan Society for Hematopoietic Cell Transplantation (JSHCT), Japan Marrow Donor Program (JMDP), and TRUMP. Funding This study was supported by research funding from the Ministry of Education, Science, Sports, and Culture in Japan to T. Kondo.

651

Y. Arai et al.

References 1. Marsh JC, Ball SE, Cavenagh J, et al.

Guidelines for the diagnosis and management of aplastic anaemia. Br J Haematol.

2009;147(1):43-70.

2. Marotta S, Pagliuca S, Risitano AM. Hematopoietic stem cell transplantation for aplastic anemia and paroxysmal nocturnal hemoglobinuria: current evidence and recommendations. Expert Rev Hematol.

2014;7(6):775-789.

3. Gupta V, Eapen M, Brazauskas R, et al.

Impact of age on outcomes after bone marrow transplantation for acquired aplastic anemia using HLA-matched sibling donors.

Haematologica. 2010;95(12):2119-2125.

4. Stern M, Passweg JR, Locasciulli A, et al.

Influence of donor/recipient sex matching on outcome of allogeneic hematopoietic stem cell transplantation for aplastic anemia. Transplantation. 2006;82(2):218-226.

5. Liang Y, Van Zant G, Szilvassy SJ. Effects of aging on the homing and engraftment of murine hematopoietic stem and progenitor cells. Blood. 2005;106(4):1479-1487.

6. Kamminga LM, van Os R, Ausema A, et al.

Impaired hematopoietic stem cell functioning after serial transplantation and during normal aging. Stem Cells. 2005;23(1):82-92.

7. Miller RA. The aging immune system: primer and prospectus.

Science.

1996;273(5271):70-74.

8. Khandelwal P, Lane A, Chaturvedi V, et al.

Peripheral Blood CD38 Bright CD8+ Effector Memory T Cells Predict Acute Graft-versus-Host Disease. Biol Blood Marrow Transplant. 2015;21(7):1215-1222.

9. Loschi M, Porcher R, Peffault de Latour R, et al. High number of memory t cells is associated with higher risk of acute graftversus-host disease after allogeneic stem cell transplantation. Biol Blood Marrow Transplant. 2015;21(3):569-574.

10. Kollman C, Howe CW, Anasetti C, et al.

Donor characteristics as risk factors in recipients after transplantation of bone marrow from unrelated donors: the effect of donor age. Blood. 2001;98(7):2043-2051.

11. Carreras E, Jimenez M, Gomez-Garcia V, et al. Donor age and degree of HLA matching have a major impact on the outcome of unrelated donor haematopoietic cell transplantation for chronic myeloid leukaemia. Bone Marrow Transplant.

2006;37(1):33-40.

12. Mehta J, Gordon LI, Tallman MS, et al.

Does younger donor age affect the outcome of reduced-intensity allogeneic hematopoietic stem cell transplantation for hematologic malignancies beneficially?

Bone Marrow Transplant. 2006;38(2):95100.

652

13. Fabre C, Koscielny S, Mohty M, et al.

Younger donor's age and upfront tandem are two independent prognostic factors for survival in multiple myeloma patients treated by tandem autologous-allogeneic stem cell transplantation: a retrospective study from the Societe Francaise de Greffe de Moelle et de Therapie Cellulaire (SFGMTC). Haematologica. 2012;97(4):482-490.

14. Finke J, Schmoor C, Bethge WA, et al.

Prognostic factors affecting outcome after allogeneic transplantation for hematological malignancies from unrelated donors: results from a randomized trial. Biol Blood Marrow Transplant. 2012;18(11):17161726.

15. Servais S, Porcher R, Xhaard A, et al. Pretransplant prognostic factors of long-term survival after allogeneic peripheral blood stem cell transplantation with matched related/unrelated donors. Haematologica.

2014;99(3):519-526.

16. Arai Y, Aoki K, Takeda J, et al. Clinical significance of high-dose cytarabine added to cyclophosphamide/total-body irradiation in bone marrow or peripheral blood stem cell transplantation for myeloid malignancy. J Hematol Oncol. 2015;8(102).

17. Arai Y, Takeda J, Aoki K, et al. Efficiency of high-dose cytarabine added to CY/TBI in cord blood transplantation for myeloid malignancy. Blood. 2015;126(3):415-422.

18. Olsson R, Remberger M, Schaffer M, et al.

Graft failure in the modern era of allogeneic hematopoietic SCT. Bone Marrow Transplant. 2013;48(4):537-543.

19. Atsuta Y, Suzuki R, Yoshimi A, et al.

Unification of hematopoietic stem cell transplantation registries in Japan and establishment of the TRUMP System. Int J Hematol. 2007;86(3):269-274.

20. Kanda J, Fuji S, Kato S, et al. Decision analysis for donor selection in stem cell transplantation-HLA-8/8 allele-matched unrelated donor vs HLA-1 AG mismatched related donor. Blood Cancer J. 2014;4:e263.

21. Giralt S, Ballen K, Rizzo D, et al. Reducedintensity conditioning regimen workshop: defining the dose spectrum. Report of a workshop convened by the center for international blood and marrow transplant research. Biol Blood Marrow Transplant.

2009;15(3):367-369.

22. Glucksberg H, Storb R, Fefer A, et al.

Clinical manifestations of graft-versus-host disease in human recipients of marrow from HL-A-matched sibling donors.

Transplantation. 1974;18(4):295-304.

23. Filipovich AH, Weisdorf D, Pavletic S, et al.

National Institutes of Health consensus development project on criteria for clinical trials in chronic graft-versus-host disease: I. Diagnosis and staging working group

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

report. Biol Blood Marrow Transplant.

2005;11(12):945-956.

Socie G. Allogeneic BM transplantation for the treatment of aplastic anemia: current results and expanding donor possibilities.

Hematology Am Soc Hematol Educ Program. 2013;2013:82-86.

Iacobelli S, Committee ES. Suggestions on the use of statistical methodologies in studies of the European Group for Blood and Marrow Transplantation. Bone Marrow Transplant. 2013;48 Suppl 1:S1-37.

Hirayama M, Azuma E, Jiang Q, et al. The reconstitution of CD45RBhiCD4+ naive T cells is inversely correlated with donor age in murine allogeneic haematopoietic stem cell transplantation. Br J Haematol.

2000;111(2):700-707.

Azuma E, Hirayama M, Yamamoto H, Komada Y. The role of donor age in naive T-cell recovery following allogeneic hematopoietic stem cell transplantation: the younger the better. Leuk Lymphoma.

2002;43(4):735-739.

Lipschitz DA, Udupa KB, Indelicato SR, Das M. Effect of age on second messenger generation in neutrophils.

Blood.

1991;78(5):1347-1354.

Poglio S, Cahu X, Uzan B, et al. Rapid childhood T-ALL growth in xenograft models correlates with mature phenotype and NFkappaB pathway activation but not with poor prognosis. Leukemia. 2015;29(4):977980.

Gadalla SM, Wang T, Haagenson M, et al.

Association between donor leukocyte telomere length and survival after unrelated allogeneic hematopoietic cell transplantation for severe aplastic anemia. JAMA. 2015;313(6):594-602.

Moncrieffe H, Coles M, Stockinger B. The influence of CD4 T-cell subsets on control of CD4 T-cell-mediated graft-versus-host disease. Immunology. 2008;125(4):459-468.

Baron C, Somogyi R, Greller LD, et al.

Prediction of graft-versus-host disease in humans by donor gene-expression profiling. PLoS Med. 2007;4(1):e23.

Shono Y, Ueha S, Wang Y, et al. Bone marrow graft-versus-host disease: early destruction of hematopoietic niche after MHC-mismatched hematopoietic stem cell transplantation. Blood. 2010;115(26):5401-5411.

Arai Y, Yamashita K, Mizugishi K, et al.

Risk factors for hypogammaglobulinemia after allo-SCT. Bone Marrow Transplant.

2014;49(6):859-861.

Arai Y, Yamashita K, Mizugishi K, et al.

Serum neutrophil extracellular trap levels predict thrombotic microangiopathy after allogeneic stem cell transplantation. Biol Blood Marrow Transplant. 2013; 19(12): 1683-1689.

haematologica | 2016; 101(5)