ISSN 2177-918X
ANNUAL ACTIVITY REPORT
ANNUAL ACTIVITY REPORT 2010 - National Institute of Science and Technology - Antarctic Environmental Research
Support
Collaborations
N a t i o n a l I n s t i t u t e o f S c i e n c e a n d Te c h n o l o g y Antarctic Environmental Research
A nnual Ac t ivi t y Rep o r t 2010 Expedient
Editors
Production Management Proofreader
Collaboration Photograph Courtesy
Yocie Yoneshigue Valentin – IB/UFRJ Adriana Galindo Dalto – IB/UFRJ Helena Passeri Lavrado – IB/UFRJ Editora Cubo Rafael Mozeto and Larissa Orlandi Yocie Yoneshigue Valentin – IB/UFRJ Adriana Galindo Dalto – IB/UFRJ Geyze Magalhães de Faria – IB/UFRJ Caio Amitrano de Alencar Imbassahy – IB/UFRJ Geyze Magalhães de Faria – IB/UFRJ Caio Amitrano de Alencar Imbassahy – IB/UFRJ Adriana Galindo Dalto (Backgrounds: Cover, Expedient, Summary, Presentation, Introduction, Science Highlights, Thematic Area 3, Facts and Figures) Andre Monnerat Lanna (Background: Thematic Area 1, Thematic Area 4, Education and Outreach Activities, Publications, Email) Luiz Fernado Wurdig Roesch (Background: Thematic Area 2)
The editors express their gratitude to the INCT-APA colleagues that contribute to this edition. This document was prepared as an account of work done by INCT-APA users and staff. Whilst the document is believed to contain correct information, neither INCT-APA nor any of its employees make any warranty, expresses, implies or assumes any legal responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed within. As well, the use of this material does not infringe any privately owned copyrights.
Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais (INCT-APA) INCT-APA Headquarters
Telephone/ Fax E-mail Home Page
Instituto de Biologia, Centro de Ciências da Saúde (CCS) Universidade Federal do Rio de Janeiro (UFRJ) Av. Carlos Chagas Filho, 373 - Sala A1-94 - Bloco A Ilha do Fundão, Cidade Universitária - CEP: 21941-902 Rio de Janeiro - RJ, Brazil +55 21 2562-6322 / +55 21 2562-6302 inctapa@gmail.com www.biologia.ufrj.br/inct-antartico
Management Committee General Coordinator Yocie Yoneshigue Valentin – IB/UFRJ
Education and Outreach Activities – Team Leader Déia Maria Ferreira – IB/UFRJ
Vice-coordinator Rosalinda Carmela Montone – IO/USP
International Scientific Assessor Lúcia de Siqueira Campos – IB/UFRJ
Thematic Area 1 (Antarctic Atmosphere) – Team Leader Neusa Paes Leme – INPE
Project Manager Assessor
Thematic Area 2 (Antarctic Terrestrial Environment) – Team Leader Antonio Batista Pereira – UNIPAMPA Thematic Area 3 (Antarctic Marine Environment) – Team Leader Helena Passeri Lavrado – IB/UFRJ Thematic Area 4 (Environmental Management) – Team Leader Cristina Engel de Alvarez – UFES
Adriana Galindo Dalto – IB/UFRJ Executive Office Carla Maria da Silva Balthar – IB/UFRJ Finance Technical Support Maria Helena Amaral da Silva – IBCCF/UFRJ Marta de Oliveira Farias – IBCCF/UFRJ
Support
Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais (INCT-APA) Collaborations
Production
Instituto de Biologia, Centro de Ciências da Saúde (CCS) Universidade Federal do Rio de Janeiro (UFRJ) Av. Carlos Chagas Filho, 373 - Sala A1-94 • Bloco A Ilha do Fundão, Cidade Universitária - CEP: 21941-902 Rio de Janeiro- RJ, Brazil +55 21 2562-6322 / +55 21 2562-6302 inctapa@gmail.com www.biologia.ufrj.br/inct-antartico
National Institute of Science and Technology Antarctic Environmental Research
Cataloguing Card I59a National Institute of Science and Technology Antarctic Environmental Research Annual Activity Report / National Institute of Science and Technology Antarctic Environmental Research = Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais (INCT-APA). – 2009– . – Rio de Janeiro : INCT-APA, 2010–. 240 p. ISSN 2177-918X 1. Environmental research. 2. Antarctica. I. Title. CDD 363.7
SUMMARY 4 Presentation 10 Introduction 13 Science Highlights 228 Education and Outreach Activities 232 Facts and Figures 234 Publications 238 E-mails
PRESENTATION National Institute of Science and Technology – Antarctic Environmental Research Instituto Nacional de Ciência e Tecnologia – Antártico de Pesquisas Ambientais (INCT-APA)
The importance of Antarctica Research
Protection of the Environment, which came into force in
Antarctica is the most preserved region of the planet and
1998. This protocol established directives and procedures,
one of the most vulnerable to global environmental changes.
which should be adopted in the undertaking of activities in
For this reason, alterations in the Antarctic environment,
Antarctica. The monitoring of the environmental impact of
natural or caused by humans, has the potential to provoke
Brazilian activities in Antarctica is a commitment assumed
biological, environmental and socio-economic impacts,
by the Brazilian Government through the ratification of the
which can affect the terrestrial system as a whole. Because
Madrid Protocol.
it is an essential part of the global environmental system, the Antarctic region not only sends out climate signals that Anthropic environmental impacts occurring on the planet
What is the INCT – Antarctic Environmental Research?
are reflected in Antarctica, including those that emanate
The National Institute of Science and Technology -
from South America.
Antarctic Environmental Research (abbreviated as INCT in
affect global climate, but also absorbs global climatic signals.
For this reason, the scientific research in the Polar
Brazilian Portuguese used in this document as INCT-APA
Regions is of great environmental and economic importance,
hitherto) were created by the Brazilian Ministry of Science
since it contributes to the comprehension of climatic and
and Technology (Ministério de Ciência e Tecnologia
environmental changes observed in these regions.
(MCT) in search of excellence in scientific activities at an
The monitoring of terrestrial, marine and atmospheric
international level in strategic areas defined by the Action
systems is fundamental for the evaluation of such changes,
Plan 2007-2010 of the Science Programme, Technology and
which means collecting environmental data on a continuous
Innovation for Antarctica, by means of programmes and
basis, with quality control and for a long period of time,
instruments made operational by CNPq and by FAPERJ
registered in a long temporal series, thus permitting a more
(Research support Foundations at different levels). The
precise evaluation of future implications, offering support
referred initiative has the view to implement a network
to decision-making.
of atmospheric, terrestrial and marine monitoring, in the
The protection of the environment of Antarctica is
Antarctic region.
one of highest priorities of all the nations that operate on the Antarctic continent. For this reason the region
4
should continue to be the most preserved of the planet,
Who are we?
harmonizing the presence of man and the attendance of
INCT-APA consists of more than 70 researchers who
mankind’s needs related to the mitigation of environmental
in an integrated manner evaluate the local and global
impact of an ecosystem which is highly fragile.
environmental impacts in the atmospheric, terrestrial
In 1991, the concerns over the consequences of human
and marine areas of Maritime Antarctica systems and
activity in the Antarctic environment became a reality
in addition are involved in the related educational and
through the Protocol of the Treaty of Antarctica for the
scientific outreach of their activities. The research developed
| Annual Activity Report 2010
by INCT-APA will contribute to influence initiatives
Aims
concerning biological diversity and environmental
To be an institute of reference in Antarctic environmental
protection of Antarctica, principally in the scope of the
research and in the preservation of this continent as an
Ministry of Science and Technology and the Ministry of
asset for humanity.
the Environment. Furthermore it assists in educational processes with the purpose of divulging Antarctica research to the public in general.
The purpose of INCT-APA: • To develop scientific investigations in marine, terrestrial
Mission To valorise the region of Antarctica as an opportunity for
and atmospheric environments in the Antarctic region; • To structure and operate a local and global environmental management system; and
development of transdisciplinary scientific investigations,
• To promote the education and the diffusion of
promoting education and divulging information and
information committed to the construction of a global
environmental management.
environmental conscience.
Presentation |
5
6
| Annual Activity Report 2010
INCT-APA MANAGEMENT COMMITTEE GENERAL COORDINATION Prof. Rosalinda Carmela Montone (IO/USP) Vice-team leader of INCT – APA
Prof. Yocie Y Y Yoneshigue Valentin (IB/UFRJ) V General team leader of INCT T – APA P
THEMATIC AREA TEAM LEADERS Dr. Neusa Paes Leme (INPE) Thematic Area 1 - Team Leader
Prof. Helena Passeri Lavrado (IB/UFRJ) Thematic Area 3 - Team Leader
Prof. Antonio Batista Pereira (UNIPAMPA) Thematic Area 2 - Team Leader
Prof. Cristina Engel de Alvarez (UFES) Thematic Area 4 - Team Leader
ASSESSORS Prof. Lúcia de Siqueira Campos (IB/UFRJ) Coordination Executive Office and International Science
Prof. Déia Maria Ferreira (IB/UFRJ) Outreach and Education Assessor
Dr. Adriana Galindo Dalto (IB/UFRJ) Project Manager Assessor
THEMATIC AREA 1
THEMATIC AREA 2
THEMATIC AREA 3
THEMATIC AREA 4
UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE
The activities of this institute will contribute to influence
INCT- Antarctic Environmental Research
initiatives concerning biological diversity and protection of
(INCT- Antártico de Pesquisas Ambientais)
the Antarctic environment, especially in the sphere of the
INCT-APA is based at the Federal University of Rio de
Ministry of Science and Technology and the Ministry of the
Janeiro — Universidade Federal do Rio de Janeiro (UFRJ),
Environment, including the development of educational,
Institute of Biology, under the coordination of Professor
formative and informative processes directly related to
Yocie Yoneshigue Valentin (Botany Department - Institute
Antarctica.
of Biology/ UFRJ). The team consists of approximately
See more at: www.biologia.ufrj.br/inct-antartico
200 people, amongst them fully certified researchers,
Contact: inctapa@gmail.com
undergraduation and graduate students, belonging to 16
Presentation |
7
universities and other research institutes distributed in eight Brazilian states: Rio de Janeiro, São Paulo, Espírito Santo, Rio Grande do Norte, Goiás (Brasília), Paraná, Santa Catarina and Rio Grande do Sul.
3. To know and monitor the impact of human activities on Antarctic marine environment; 4. To develop an integrated management model for monitoring and evaluating local and global environmental changes;
INCT-APA – Objectives:
5. To valorise Antarctic science for Brazilian society, promoting education and outreach.
1. To know and monitor Antarctica’s atmosphere and its environmental impact on South America; 2. To know and monitor the impact of global changes on Antarctic terrestrial environment;
The objectives of INCT-APA related to Environmental Research are portrayed in the thematic modules described below:
Thematic Research Areas Adriana G. Dalto
Adriana G. Dalto
Thematic Area 1
Thematic Area 2
Antarctic Atmosphere and Environmental Impacts in South America
Global Changes on Terrestrial Antarctic Environment
Operated through the knowledge and monitoring of
impact of global, natural and anthropogenic origins in
Antarctica’s atmosphere and its environmental impacts
the Antarctic terrestrial environment.
Operated through the study and monitoring of the
on South America
Objectives:
1. To measure the alterations to vegetation cover
1. To monitor and evaluate:
and the alteration to the diversity of vegetation
• The regions of movement of Antarctic Cold Fronts
communities;
as far as South America, especially Brazil; • The greenhouse effect perceived in Antarctica; • The chemical alterations of the atmosphere and their influence on the climate, involving: the interaction Sun - Earth, the temperature of the mesosphere and the hole in the ozone layer; 2. To offer supporting information to numeric models of climate and weather forecasting.
8
Objectives:
| Annual Activity Report 2010
2. To evaluate the fluctuation and distribution of seabird populations.
Adriana G. Dalto
Andre M. Lanna
Thematic Area 3
Thematic Area 4
Impact of Human Activities on the Antarctic Marine Environment
Environmental Management
Operate in the study and monitoring of the impact
development of tools to valorise Antarctic science for
of global, natural and anthropogenic origins in the
Brazilian society, promoting education, dissemination
Antarctic marine environment.
of scientific information.
Objectives:
Objectives:
Operated through the development of integrated environmental management for the Antarctic region, especially for the Admiralty Bay. Furthermore, in the
1. To study the effects of the environmental impact
1. To develop an environmental management system
(natural and anthropogenic) on the comprehension
for the Antarctic region, especially Admiralty Bay,
of the ecosystemic processes which require longer
encompassing diagnostic, planning, decision-
temporal series, by means of monitoring of the
making, implementation, accompaniment and
marine environment;
permanent evaluation of the Antarctic environment;
2. To supplement the processes and environmental
2. To organize a system with the existing environmental
management instruments, following the example
indicators and integrate them in the form of a model
of Admiralty Bay Management Plan (Plano de Manejo da Baia do Almirantado), with information acquired from studies described in objective 1 of
DPSIR (Drive Forces) 3. To operate a permanent monitoring and evaluation system.
this module. 3. To identify the presence of exotic marine species and define possible endemic species. Marcio M. B. Ten贸rio
Marcio M. B. Ten贸rio
Andre M. Lanna
Presentation |
9
INTRODUCTION Antarctica Environmental Research: Global Approach Yocie Yoneshigue Valentin – General Coordinator
10
The central focus of the activities of the National Institute
since the increase of ice free areas, exposing rocks and
of Science and Technology-Antarctica Environmental
soil, favours the colonization of these areas by small size
Research (INCT-APA) is the Antarctica Biocomplex
vegetation, such as, mosses, lichens and some angiosperms,
Ecosystem. The concept of “Biocomplexity� incorporates the
which in turn contribute to the formation of new areas of
study of several biotic compartments of the Antarctica and,
nidification of seabirds, such as the Brown Skua, penguins
principally, its structural and functional inter-relationships,
and others seabirds.
as well as the actions of abiotic factors (wind, temperature,
In the marine environment, two systems and their
salinity, tides, ultraviolet radiation, ozone layer, solar
relationships shall be considered, the Pelagic and the
interaction, the earth, etc) which act positively or negatively
Benthic. The Pelagic consists of plankton (phytoplankton,
on the biota. To complete the framework of inter-relations
zooplankton) and nekton (fish and other swimming
between the biota and the environment, the atmospheric
organisms) and the benthic system considering the
variables should be analysed concomitantly, as well as the
phytobenthic (micro and macroalgae) and zoobenthic.
anthropic activities. Thus, it is a question of investigating
The marine flora and fauna are well adapted to the extreme
the complex network of inter-relationships in this important
climatic conditions with very low temperatures (including
and peculiar biome of our planet, basing ourselves on a
below zero) the effect of the ice, prolonged freezing of
conceptual model which will be presented in continuity in
expanses of sea, and the extreme variations in the periods
a simplified form (Figure 1).
of solar radiation between summer and winter. Studies
The biocomplexity will be subject of study in the
concerning the vital processes of some abundant animals
terrestrial and marine environments, with a view to
and species of vegetation in the circumpolar region of
studying the inherent communities. The vegetation
Antarctica are being undertaken with the purpose of
and the top predators, as well as the seabirds, make up
understanding the survival of these organisms in relation
the two axis of the terrestrial community studies. Their
to freezing, melting, and consequently, the reduction of salt
relationships will be investigated, together with the
in the water. It is known that natural alterations in relation
increase of ultraviolet radiation, which might possibly
to climate affect biological communities and forms, as well
cause harm to the chlorophyll molecules of algae and
as those stemming from human activity. These factors
plants. Furthermore, the UVB radiation represents 1.5%,
are of fundamental importance for the conservation and
of the total spectrum that reaches the terrestrial surface.
preservation of these environments.
This radiation is the most damaging, being able to cause
To give due credit to Antarctica Science it is necessary
negative effects alike to aquatic organisms as to terrestrial,
to promote education on the subject and to disseminate
including human activity in the Antarctica region, by
scientific information by means of tools which have a
means of the introduction of contaminants such as
broad capacity of propagation throughout society. The
petroleum hydrocarbons, present in the surroundings
multi-disciplinary themes investigated by INCT-APA
of the Antarctica Research Bases. The receding of the
promote the formation and consolidation of human
glaciers is another relevant factor to be considered,
resources directed to research in the Polar Regions. All
| Annual Activity Report 2010
these activities converge on the integrated environmental
ecosystem, we intend to achieve an integrated vision of
management of Admiralty Bay and the surrounding
the processes that lead to how this environment functions
regions, being the principal areas of study of this Institute.
and to how it is structured, which in essence is the overall
With the development of this set of research studies
objective of INCT-APA.
articulated around the biocomplexity of the Antarctic
ANTHROPIC ACTIVITY
ATMOSPHERE
BIOCOMPLEXITY
MARINE COMMUNITIES
PELAGOS
TERRESTRIAL COMMUNITIES
BENTHOS
PHYTO
PLANKTON
VEGETATION
TOP PREDATORS (Ex. Birds)
ZOO
NECTON
PHYTO
ZOO
Figure 1. Conceptual model of the inter-relations between biota and environment. (Illustration: Edson Rodrgues).
Introduction |
11
SCIENCE HIGHLIGHTS 14 Thematic Area 1
ANTARCTIC ATMOSPHERE AND ENVIRONMENTAL IMPACTS IN SOUTH AMERICA
54 Thematic Area 2
GLOBAL CHANGES ON TERRESTRIAL ANTARCTIC ENVIRONMENT
100 Thematic Area 3
IMPACT OF HUMAN ACTIVITIES ON THE ANTARCTIC MARINE ENVIRONMENT
200 Thematic Area 4
ENVIRONMENTAL MANAGEMENT
THEMATIC AREA 1
ANTARCTIC ATMOSPHERE AND ENVIRONMENTAL IMPACTS IN SOUTH AMERICA
14
20
Monitoring of Atmospheric Changes Related to Sun-Earth Interactions
27
Studies of Gravity Waves at Ferraz Station (62째 S) and Recent Observations
33
Influence of the Antarctic Ozone Hole Over the South of Brazil in 2008 and 2009
38
Atmospheric SO2 Measurements at the Brazilian Antarctic Station
44
Monitoring Greenhouse Gases in Comandante Ferraz Antarctic Station, King George Island
48
Considering New Parameters in the Study of Atmospheric Impacts at Admiralty Bay
| Annual Activity Report 2010
Coordinator
Dr. Neusa Maria Paes Leme – INPE/CRN Vice-Coordinator
Dr. EmĂlia Correia – INPE/CRAAM
Introduction The monitoring of the Antarctic atmosphere and its
The increase in greenhouse gases (carbon dioxide,
influence on South America is being built using solid
methane, etc.), at the bottom of the atmosphere (up to 30 km
foundations from the studies that for decades have been
altitude) can cause a drop in temperature of the mesosphere
undertaken by Brazilian researchers in the Antarctic region.
between the 80 and 90 km altitude. The decline in the
The proposal is to continue these studies, which require
concentration of the ozone layer causes the temperature
long term series of data for a greater understanding and
of the stratosphere (between the 15 and 50 km area) to
monitoring of environmental changes. The information obtained also offers support to numerical models of weather and climate forecasts, which can thus become more reliable. In all, the research already undertaken and presently underway represents more than two decades of continuous research of the influence of cold fronts from the Antarctic on Brazilian climate, monitoring of the ozone hole, variation of UV radiation and other highly relevant studies. The monitoring of the impacts of solar phenomena in the Antarctic atmosphere is designed to identify the contribution of activity and changes in the medium and long term (solar cycle) in the upper atmosphere. Thus we can establish the connection between changes in the interplanetary medium and the terrestrial climate, considering the sociological and coupling of the various layers of the atmosphere. The observations of chemical emissions on top of the Antarctic mesosphere (80-100 km altitude) are used in studies of the dynamics of atmospheric waves that propagate
decrease. Thus temperature measurement is an important parameter to monitor changes on the long term. A new issue has arisen with the temperature change in the region of the ozone layer. What will happen to the connection between the layers and the equilibrium with the lowering of the temperature of the upper atmosphere and increased temperature on the ground? The variations of temperature and UV radiation will produce changes in both the chemistry and the dynamics of the layers of the atmosphere. The atmospheric aerosols play an important role in global radiation balance and their importance on the subAntarctic is not yet completely understood. The Antarctic Peninsula region is strongly influenced by different sources of aerosols, such as aerosols of marine origin due to the high primary productivity of ocean regions adjacent to the Patagonian desert dust, volcanic activity of the southern Andes and long distance transport from urban areas and forest fires in South America. For this reason, there is the intention to simultaneously monitor aerosols in two seasons
toward the upper atmosphere. Accompanying these
in Patagonia (Punta Arenas) and King George Island.
movements will allow greater understanding of the effects
Furthermore, the effect of local anthropogenic pollution
of the Antarctic polar vortex and the transport of energy
resulting from human settlement areas in the Antarctic
into the upper atmosphere. This issue stands out as one of
region as well as the contribution of bio-aerosols is still
the main topics in understanding the processes responsible
unknown. Thus, monitoring of aerosols will have two
for global climate variations.
purposes: to diagnose the impact of local human presence,
Science Highlights - Thematic Area 1 |
15
model the dynamics of plumes of pollutants from local
the region of the ozone layer, especially during the
sources, and investigate the long-distance transport, with
occurrence of the “hole in the ozone layer.”
emphasis on the influence on South America.
Goals
• The impact of solar radiation on the environment. • Modelling the spatial atmospheric impact due to local sources to study the atmospheric transport between South America and Antarctic Peninsula.
Monitor and evaluate • The region where cold fronts move toward Brazil and the respective changes and variations to the climate; • The greenhouse effect seen in Antarctica;
Over the past 65 years, average annual air temperatures
• Changes in chemistry and physics of the atmosphere
in Admiralty Bay show an average warming of +0.23 °C.
and its influence on climate, involving: the interaction
However, one must consider that in this region climatological
Sun-Earth, the temperature in the mesosphere and
measurements were only standardized in the last 30 years
Figure 1. Thematic Area 1 flowchart. (Illustration: Edson Rodrigues).
16
Offer subsidies to numerical models of weather and climate
| Annual Activity Report 2010
and the data from this period does not indicate a warming
the stratosphere and affects the chemical makeup of some
climate. Over the past 14 years, the average annual air
greenhouse gases like CO2 and ozone surface forming a line
temperatures recorded in EACF showed a downward trend
to the Rio Grande South excessively increasing the incidence
(≈ –0.6 °C / decade, Setzer et al., 2009). According to these
of UV-B radiation and contributing to the increase in the
researchers from the weather team, the winters of 2007
number of cases of glaucoma, skin cancer and damage to
and 2009 were very severe, freezing the two lakes that feed
DNA in this region of the country, as well as damage to the
EACF and the expanse of ice covering Admiralty Bay peaked
chlorophyll molecules in plants and algae. In large urban
with frozen sea to the vicinity of the Polish station, near the
areas increased UV radiation alters the photochemistry of
entrance to the Bay. January and February 2010 were the
the atmosphere enhancing the effect of greenhouse gases
coolest summers on record at EACF in 37 years (mean air
at ground level.
temperature +1.0 °C + 0.2 °C in January and February).
The studies of the dynamics of the Sun-Earth system
Measurements of ozone concentration obtained by Brazilian
and monitoring of ultraviolet radiation and ozone on the
researchers, from 1990 to date have shown a large variation
Antarctic Peninsula, Punta Arenas (Chile) and in southern
in annual figures for Keller Peninsula region (King George
Brazil have shown the influence to wind patterns and
Island, Antarctica). The latter, ranging from 70% in 2006
intensity of UV radiation that reaches the earth’s surface,
to 55% in 2010 compared to the normal concentration,
cloud cover and precipitation. Continuous measurements
before 1980, when observations were first made, by which
of UV-A and UV-B in these regions have shown an increase
time the ozone layer was declining over the South Pole.
in radiation during the occurrence of the ozone hole. In
Furthermore the time of ozone recovery has also changed
2009 and 2010 in the terrain around EACF an increase
showing reductions in the month of December, which due
in UV radiation above 150% compared to the normal
to high temperatures the atmosphere is already showing
concentration was recorded, without the presence of the
a scenario of normalizing the previous destruction. The
ozone hole.
ozone hole occurs only in very cold atmosphere (typical of
From 11 to 30 November 2009 the Antarctic vortex was
the south pole) and every year when summer arrives in the
located just south of the southern tip of South America
Antarctic, the hole recovers (in December), but not on par
rather than at its climatological position over Antarctica.
with the year of 1980 which is the benchmark for what we consider as normal.
Analysis of 30 years of assimilated total O3 column and UV index measurements shows that this 20 day event was
One consequence of this decrease in concentration of
unique in the history of the ozone hole for these latitudes.
the ozone layer is increased UV radiation. This increase in
During this period, small total O3 columns and large
radiation is confirmed by extreme events over Antarctica
UV index values were observed over the southern tip of
and South America, including southern Brazil where in
South America. Comparison of ground based and satellite
2010 we observed a reduction of 25% of the concentration
measurements of total O3 columns and satellite based
of ozone. The southern region of Brazil is subject to
calculations of the UVI index – never designed nor validated
reductions of ozone in October and November, which
for such extreme Southern Hemisphere conditions – show
could be called side effects of the Antarctic ozone hole. This
excellent consistency. (de Laat et al., 2010 ).
shows that there is still a lot of chlorofluorocarbon (CFC)
The effect of UV and its potentially harmful effect to
in the Antarctic atmosphere, and its annual variability
marine life may also enhance the toxic effects of some
is due to the temperature in the stratosphere (the region
contaminants such as petroleum hydrocarbons, commonly
between 15 to 50 km altitudes) in the Antarctic winter.
present in the vicinity of research stations. A recent study
The monitoring of the ozone layer has also shown that
has demonstrated that the mortality of marine amphipod
the decrease of the same causes change in temperature of
crustacean Gondogeneia Antarctica, submitted to the effects
Science Highlights - Thematic Area 1 |
17
of anthracene, increased significantly in the presence of UV
lower ionosphere, the study also suggested an interannual
(Gomes et al., 2009), reinforcing the importance of knowing
behaviour, which has been observed in physical atmospheric
the biological responses of species to the synergistic action
parameters, and is attributed to the interaction between the
(the various natural and anthropogenic environmental
atmospheric waves and winds.
factors). The variability observed in the ozone layer and in the ground intensity of the UV-A and UV-B radiation, in the last years, was accompanied by changes in the ionized layer of our atmosphere, the ionosphere. Study of the ionosphere behaviour done in the Brazilian Antarctic Station in the last six years confirmed it is controlled by the solar radiation, showing variations in close association with the decreasing activity of the 23 rd solar cycle. Furthermore, during the local wintertime (April to October in the southern hemisphere), the ionosphere behaviour was strongly affected by meteorological processes from below in all of the years. The dynamic processes of the lower-lying atmospheric levels are associated with the generation of waves, particularly the gravity waves (period of minutes/hours) and planetary
One of the most important properties of the atmosphere is its ability to withstand movement of waves. The gravity waves are well known to play an important role in Earth’s atmosphere, for example, their influence on the thermal state and the atmospheric circulation. Observations of gravity waves have been performed on a large scale in regions of low and mid latitudes. However, at high latitudes, as in Antarctica, these observations are sparse and little is known of the characteristics of waves. Studies are being conducted on them in the Comandante Ferraz Antarctic Station (62° S and 58° W), with campaigns of observations with airglow imagers at different latitudes (Bageston et al., 2009). The study of planetary waves and gravity waves can identify and better assist with the understanding of the dynamics
waves (period of days), amongst others. This study showed
of the neutral upper atmosphere (mesosphere) and their
that during the wintertime the planetary waves can strongly
interaction with the other layers of the atmosphere. The
affect the lower ionosphere (Correia, 2011), evidencing
observation of the dynamics from Antarctica to Ecuador will
the coupling between the different atmospheric layers.
identify the various processes of transport and connection
In addition to the effect of the planetary waves in the
and how it affects the atmosphere.
References de Laat, A.T.J.; van der A., R.J.; Allaart, M.A.F.; van Weele, M.; Benitez, G.C.; Casiccia, C.; Paes Leme, N.M.; Quel, E.; Salvador, J. & Wolfram, E. (2010). Extreme sunbathing: Three weeks of small total O3 columns and high UV radiation over the southern tip of South America during the 2009 Antarctic O3 hole season, Geophysical Research Letters, 37, L14805, doi:10.1029/2010GL043699. Bageston, J. V.; Wrasse, C. M.; Gobbi, D.; Tahakashi, H. & Souza, P. (2009). Observation of mesospheric gravity waves at Comandante Ferraz Antarctica Station (62°S). Annales Geophysicae, 27: 2593-8. Correia, E. (2011). Study of Antarctic-South America connectivity from ionospheric radiosoundings. Oecologia Australis, 15: 10-17. Gomes, M. S. (1999). Determinação de elementos metálicos em sedimentos da Baía do Almirantado, Ilha Rei George, Península Antártica. Dissertação de Mestrado. 193 p. Universidade de São Paulo. Gomes, V.; Passos, M.J.A.C.R.; Leme, N.M.P.; Santos, T.C.A.; Campos, D.Y.F.; Hasue, F.M. & Phan, V.N. (2009). Photo-induced toxicity of anthracene in the Antarctic shallow water amphipod, Gondogeneia antarctica. Polar Biology, 32(7): 1009–21. Setzer, A.; Villela, F.N.J. & Deniche, A.G.P. (2009). Antarctic Metereology. Annual Activity Report of National Institute of Science and Technology Antarctic Environmental Research, p. 20-21.
18
| Annual Activity Report 2010
Science Highlights - Thematic Area 1 |
19
1 MONITORING OF ATMOSPHERIC CHANGES RELATED TO SUN-EARTH INTERACTIONS Emília Correia1,2,*, Jean Pierre Raulin2, Pierre Kaufmann2, Fernando C.P. Bertoni2, Juliano Moro1 Instituto Nacional de Pesquisas Espaciais, São José dos Campos, SP, Brazil Centro de Rádio Astronomia e Astrofísica Mackenzie, Escola de Engenharia, Universidade Presbiteriana Mackenzie, São Paulo, SP, Brazil
1 2
*e-mail: ecorreia@craam.mackenzie.br
Abstract: Our upper atmosphere is affected by solar forcing, whose main sources are the ionizing radiation and space weather. The solar ionizing radiation changes in association with the 11-year solar cycle, 27-day rotation and solar flares. VLF soundings have confirmed the solar Lyman-alpha as responsible through the formation and maintenance of the ionized layer of our atmosphere, the ionosphere, which shows variations in close association with the 11-year solar cycle. Excess of X-ray radiation produced during the solar flares, when the solar radiation can increase in order of magnitude, strongly disturbs the lower ionosphere. Ionosphere studies using VLF technique have identified that even very weak solar flares (B2 as X-ray classification from GOES satellite) can be enough to affect the ionosphere during the minimum of solar activity, but this limit increases as the Sun becomes more active. The ionosphere is also affected by forcing coming from the lower-lying atmospheric layers. The influence of the planetary waves of neutral atmosphere origin has been observed, and it is dominant during the local wintertime. The studies have shown the influence of the Sun-earth interaction in the chemistry and dynamics of our atmosphere, and also the exchange of energy between the different atmospheric layers, which might affect the terrestrial and marine environment, especially in the polar region. Keywords: atmosphere, sun-earth interaction, atmospheric radio sounding
Introduction
20
The earth´s upper atmosphere is basically controlled by
with the 11-year solar cycle (Lastovicka, 2006). During
solar forcing from above, the solar ionizing radiation being
periods when the Sun is active, the base of the ionosphere
responsible through the formation and maintenance of the
is strongly affected by the excess of X-ray emission of solar
ionosphere, the atmospheric layer being between about
flares. The excess of X-ray emission is detected by very low
60 km and 1000 km in height. The variability of the solar
frequency (VLF) radio technique, in the form of variations
ionizing radiation is mainly due to the 11-year solar cycle,
in the amplitude and phase of the signals propagating in
27-day rotation and solar flares. The lower ionosphere
the ground-ionosphere waveguide, because they depend
(<100 km altitude), the D-region, is essentially maintained
sensitively on the waveguide electrical conductivity.
during quiet conditions by the solar Lyman-alpha radiation,
The phase variations are called sudden phase anomalies
which ionizes the minor neutral atmospheric constituent
(SPAs), and the study of their incidence has shown that the
nitric oxide. Variations in the Lyman-alpha produce
ionosphere reference height is lower (by about 1 km) at solar
changes in the ionization rates of D-region associated
maximum (McRae & Thomson, 2004; Raulin et al., 2006).
| Annual Activity Report 2010
The ionosphere is also disturbed by forcing from below,
Material and Methods
which is mainly due to the upward propagating gravity and
The ionosphere at EACF (62.11° S and 58.41° W) has been
planetary waves originated in the neutral atmosphere. The
probed by various radio sounding techniques, which give
effects of the neutral atmospheric waves in the ionosphere
information about the ionospheric disturbances.
have been observed particularly during the wintertime (Lastovicka, 2006). The low ionosphere presents a complex and extremely variable behaviour due to these two external competitive forcings (Lastovicka, 2009), of difficult characterization. The base of the ionosphere (~60-70 km) is not accessible to in situ measurements, being only accessible by rockets or by ground-based soundings, which results in the ionospheric region being less understood.
VLF technique is used to study the lower ionosphere, D-region, which is between 60 and 85 km. It consists in detecting signals at frequencies between 1 and 50 kHz, propagating over long distances inside the earth–ionosphere waveguide. The conductivity gradient and the reference height changes in the low ionosphere can be detected as amplitude and phase variations of the VLF signals. Since 2006, the VLF measurements at EACF have been done with an Atmospheric Weather Electromagnetic system for Observation, Modelling
The upper atmosphere is maintained and controlled
and Education receiver - AWESOME (Scherrer et al. 2008),
by solar forcing from above, but it is also affected by the
which detects the VLF amplitude and phase with 20 ms time
wave activity from the lower-lying layers, which shows
resolution of defined stations, as well as broad-band data in
a coupling between the different atmospheric layers in a
all frequency ranges. The VLF measurements at EACF are
wide range of heights (30 km to 300 km) from troposphere
complemented with measurements done at Itapetinga Radio
to the mesosphere. This coupling between the different atmospheric layers shows the Sun-Earth interactions that affect the upper atmosphere, can also indirectly/directly affect the lower atmosphere. Thus, the monitoring of the upper atmosphere is important to define the influence of the solar forcing on it, and how that can affect the lowerlying layers, which can help us to understand how they can affect the terrestrial and marine environment, especially in the polar region.
Observatory in Atibaia/SP (23.21° S and 46.51° W) using another AWESOME receiver, and by the South America VLF Network (SAVNET, Raulin et al., 2009) that is operating with six receivers in South America, three of them in Brazil. The most powerful VLF transmitter stations tracked are from US Navy, which permits the study of different ionospheric paths, some of them inside the South Atlantic Magnetic Anomaly (SAMA). The Total Electron Content (TEC) of ionosphere can be obtained from GPS measurements done with dual frequency
To improve our understanding of the external forcing in
receivers. This technique is based on the property that dual
the ionosphere, simultaneous and integrated observations
frequency radio signals (L1: 1.6 GHz and L2: 1.2 GHz)
are desirable to evaluate the coupling processes with the
propagating through the ionosphere are subjected to a
magnetosphere, as well with the lower-lying atmospheric layers. The atmospheric studies at higher latitudes are especially important because there the signatures of the interplanetary space processes are footprinted. In the following we present the current capabilities for probing the ionosphere at Comandante Ferraz Brazilian Antarctic Station (EACF) and in South America, and some recent
differential phase change due to the dispersive nature of the plasma. As a first–order approximation the differential phase shifts is directly proportional to the TEC, which is defined as the line integral of the electron concentration along the path from a satellite to a receiver. The ionosphere has been monitored at EACF since 2004 using a dual frequency Javad GPS receiver with best time resolution of 1s. The GPS measurements at EACF are complemented with
scientific results showing the response of the ionosphere
data from the Brazilian GPS network (Rede Brasileira de
to external forcing.
Monitoramento Contínuo, RBMC) of the Instituto Brasileiro
Science Highlights - Thematic Area 1 |
21
de Geografia e Estatística (IBGE), which nowadays has more than 60 operational receivers covering almost all the
Results The influence of the solar forcing in the ionosphere during
Brazilian territory (IBGE, 2010), and permits the study of
the last long minimum of solar activity (2006-2008) was
the latitudinal extension of the ionospheric disturbances,
analyzed from the sudden phase anomalies (SPAs) of the
from Antarctica to equatorial regions.
VLF signal detected by the SAVNET network. SPAs are
The lower ionosphere has being also probed using a
produced by the excess f the X-ray emission produced
relative ionospheric opacity meter (riometer) that monitors
during solar flares. This study showed that 100% of the
the background cosmic radio noise at 20-50 MHz received
solar X-ray events with peak flux above 5 × 10–7 W/m2 in
on the ground after crossing the ionosphere. At EACF,
the 0.1-0.8 nm wavelength range produce a significant SPA,
since the beginning of 2009, three 1-channel riometers
but a weak X-ray event with flux of about 2.7 × 10–7 W/m2
at 30 and 38 MHz are operating. They consist of a simple
can be enough to affect the lower ionosphere in 20% of the
dipole antenna that receives cosmic radio noise with a broad
cases (Figure 1), (Raulin et al., 2010).
beam (>60o), two are for measuring intensity and one for
The solar forcing in the ionosphere was also studied
polarization. This technique is based on the comparison of
using preterit daytime VLF amplitude from 2003 to 2009.
the received signal with a Quiet Day Curve (QDC) obtained
The study considered the VLF signal from NPM transmitter
during geomagnetically undisturbed days, which gives the
detected at EACF. This data analysis, which covered the decay
attenuation of the signal and hence the cosmic radio noise absorption (CNA) at the monitored frequency. Most of the absorption occurs in the D-layer due the variations of the electron density produced by external forcing. The riometers at EACF are elements of the South America Riometer Network (SARINET - an International Scientific Cooperation between Japan, Brazil, Argentina and Chile) that is operating with an array of 11 riometers (1-channel and imaging) in operation in South America, four of them in Brazil.
of the 23rd solar cycle, showed an overall decrease of about –0.63 dB/year in the VLF amplitude in close association with the Lyman-alpha emission decrease (Figure 2a), similarly the behaviour found during the decay of the 22nd solar cycle (Thomson & Clilverd, 2000). This behaviour during the decay of solar activity is explained by the reduction of the ionizing solar Lyman-alpha radiation, which ionizes the nitric oxide (NO) molecules (Nicolet & Aikin, 1960). The daytime VLF amplitude also shows an annual variation,
We also used one ionosonde that consists of one transmitter at frequencies between 1 and 20 MHz, and one receiver that detects the reflected signals. The echoes of the signal reflected by the F and E regions of the ionosphere provide a profile of reflection frequency versus virtual height (ionogram), which gives the electron density (directly related to the reflection frequency) profile as a function of actual height (Piggott & Rawer, 1972). The vertical sounding plays a crucial role in understanding the temporal and spatial evolution of the ionosphere, as well the study of the coupling between different atmospheric layers. At EACF, in March 2009, a Canadian Advanced Digital Ionosonde (CADI), (MacDougall, 1997) with drifting measurements started to operate, which produces ionograms every 5 minutes and drift measurements every 2.5 minutes.
22
| Annual Activity Report 2010
Figure 1. Solar flare probability detection P, as a function of the soft X-ray peak flux Px for the long NPM - ATI VLF propagation path, and for solar zenith angle greater (dashed line) or lower (full line) than 40 degrees. Figure adapted from Raulin et al. (2010).
Figure 2. a) NPM Daytime VLF amplitude as received at EACF from 1/1/2003 to 31/12/2008 (NPM trace) compared with 27-day smoothed solar Lyman-alpha radiation (Ly-alpha irradiance trace) and the stratosphere temperature measured at southern midlatitudes (temperature trace). b) Wavelet analysis of daytime VLF amplitude for 2007.
decreasing from April to October, which can be explained
an intensity of about –51 nT, which is considered to be
by the reduction of solar illumination during the wintertime
moderate intensity, and was accompanied by increases in
in the southern hemisphere (Figure 2b). During wintertime
the Auroral Electrojet (AE) index of about 1500 nT (box
of all the years, the VLF amplitude showed pronounced fast
in Figure 3a). The QDC was obtained considering the
increases, which in 2007 had a well defined 16-day period
geomagnetically quiet days of September. Figure 3b shows
(Correia et al., 2011a, b) as obtained from a wavelet analysis.
the daily intensity of the cosmic noise (blue) from 3 to 8 for
This periodicity is typical of planetary waves of neutral
one central antenna of the array and the QDC curve (red)
atmosphere origin as observed by Day & Mitchell (2010)
which shows an increase of absorption of cosmic noise
during the same period, and is in agreement with previous
during the geomagnetic storm. The preliminary results of
works (e.g. Lastovicka, 2006).
the absorption imaging are in Figure 3c, which shows that
The impact of space weather in the ionosphere was also
the cosmic noise absorption started in the main phase of
studied during the geomagnetic storm of 4 September 2008.
the geomagnetic storm, becomes stronger on 5th September,
During geomagnetic storms the magnetic field lines of the
and suggests a northeastward drift during the recovery
Earth changes and allows an increase in energetic particles,
phase (Moro et al., 2010). This ionospheric absorption can
which can increase the radiation belts population, and in
be attributed to the precipitation of energetic electrons in
turn, in special conditions can precipitate and affect the
the SAMA region during the geomagnetic storm, which is
ionosphere. The effects of these precipitating particles in
in agreement with past riometer observations (Abdu et al.,
the ionosphere were studied using the imaging riometer
1973), as well from observations using ionosonde (Batista
operating at Southern Space Observatory in São Martinho/
& Abdu, 1977) and VLF technique (Abdu et al., 1981).
RS. This riometer is an element of the SARINET network,
These recent studies confirmed that the ionosphere is
which consists of 4 × 4 antenna dipoles at 38 MHz covering
controlled by the 11-year variation of the solar ionizing
an area of 330 × 330 km at a height of 100 km, and is inside
radiation, by the space weather impacts, as well as by the
the South Atlantic Anomaly. The geomagnetic storm had
forcing from below of lower-lying atmospheric layers.
Science Highlights - Thematic Area 1 |
23
a
b
c
Figure 3. a) Geomagnetic indices for September 2008 (http://wdc.kugi.kyoto-u.ac.jp/wdc/Sec3.html). In the black box is shown the geomagnetic storm that disturbed the ionosphere as observed by imaging riometer at SSO/RS. b) Comparison of the daily intensity of the cosmic noise (blue) with the QDC curve (red) during the geomagnetic storm. c) Time series of the absorption images at every 2 hours for 3-7 September 2008.
24
Discussion and Conclusion
the 11-year solar cycle, so it is desirable to understand how
The Sun is our main source of energy, and is responsible for
our atmosphere responds to solar variations.
life on Earth. But, it is also true that if the atmosphere did
The ionospheric studies done during the decay of the
not exist, life conditions here would be very different. The
last solar cycle improved our understanding about the main
atmosphere is responsible for filtering the solar radiation
drivers affecting our atmosphere. They confirmed that solar
that is nocive to terrestrial and marine life, especially the
ionizing radiation is the main driver of the ionosphere
X-rays and ultraviolet. The solar radiation changes following
changes on an 11-year scale. Variations in shorter time
| Annual Activity Report 2010
scales (minutes to hours) occur in close association with
will be very important because the Sun has just started to
the solar flares, when the excess of X-ray emission strongly
become active after a long minimum. The actual solar cycle
affects the lower ionosphere. As the Sun becomes more
is the 24th, which really started in January 2008, and some
active, the stronger are the solar flares and they can be
strong solar flares have been reported (SolarCycle24, 2010).
accompanied by particle events, which increase the impacts in our atmosphere affecting lower heights especially in the polar region. On the other hand, the wave activity of the troposphere and stratosphere can also propagate upward and affect the ionosphere. These results show there is a strong coupling between all atmospheric layers. So it is desirable to simultaneously monitor all the atmospheric layers to understand the
Acknowledgements This work was partially sponsored by the Brazilian Antarctic Program (PROANTAR/MMA, CNPq process nº.: 52.0186/06-0), SECIRM, INPE and INCT-APA (Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais, CNPq process nº 574018/2008-5
energy exchange from the upper to the low atmosphere
and FAPERJ process n° E-16/170.023/2008). EC would
to characterize the influence of Sun-Earth interaction in
like to thank CNPq (Procs: 300710/2006-2) for their partial
the actual climate changes, which affect the terrestrial and
support, and the technicians Armando Hadano and José
marine environment. In the next few years, this monitoring
Roberto Chagas from INPE, for the support in Antarctica.
References Abdu, M.A.; Ananthakrishnan, S.; Coutinho, E.F.; Krishnan, B.A. & Reis, S. (1973). Azimutal Drift and Precipitation of Electrons into the South Atlantic Geomagnetic Anomaly and SC Magnetic Storm. Journal of Geophysical Research, 78:5830-36. Abdu, M.A.; Batista, I.S.; Piazza, L.R. & Massambani, O. (1981). Magnetic storm associated enhanced particle precipitation in the South Atlantic anomaly: Evidence from VLF phase measurements. Journal of Geophysical Research, 86: 7533-42. Batista, I.S. & Abdu, M.A. (1977). Magnetic storm associated delayed sporadic E enhancements in the Brazilian geomagnetic anomaly. Journal of Geophysical Research, 82(29): 4777-83. Correia, E. (2011a). Study of Antarctic-South America connectivity from ionospheric radio soundings. Oecologia Australis, 15: 10-17. Correia, E.; Kaufmann, P.; Raulin, J. P.; Bertoni, F. C.; Gavilán,H. R. (2011b). Analysis of daytime ionosphere behavior between 2004 and 2008 in Antarctica. Journal of Atmospheric and Solar-Terrestrial Physics, 73: 2272-2278. Day, K.A. & Mitchell, N.J. (2010). The 16-day wave in the Arctic and Antarctic mesosphere and lower thermosphere. Atmospheric Chemistry and Physics, 10: 1461-72. IBGE – Instituto Brasileiro de Geografia e Estatística (2010) - Available from: <http://www.ibge.gov.br/home/geociencias/ geodesia/rbmc/rbmc_inf.php.> accessed in december, 2010. Lastovicka, J. (2006). Forcing of the ionosphere by waves from below. Journal of Atmospheric and Solar-Terrestrial Physics, 68: 479-97. Lastovicka, J. (2009). Lower ionosphere response to external forcing: A brief review. Advances in Space Research, 43(1): 1-14. MacDougall, J.W. (1997). Canadian Advanced Digital Ionosonde Users Manual. University of Western Ontario, Scientific Instrumentation. Ltd. 90p. McRae, W.M. & Thomson, N.R. (2004). Solar flare induced ionospheric D-region enhancements from VLF phase and amplitude observations. Journal of Atmospheric and Terrestrial Physics, 66: 77-87.
Science Highlights - Thematic Area 1 |
25
Moro, J.; Correia, E.; Denardini, C.M.; Abdu, M.A.; Makita, K.; Schuch, N.J.; Resende, L.C.; Almeida, P.D. & Guizelli, L.M. (2010). The analysis of ionospheric absorption of galactic radio noise in three geomagnetic disturbed periods using imaging riometer. Eos Trans. AGU, 91(26), The Meeting of the Americas, Suppl., Abstract SA33A-08. Nicolet, M. & Aikin, A.C. (1960). The Formation of the D-Region of the Ionosphere. Journal of Geophysical Research, 65(5): 1469-83. Piggott, W.R. & Rawer, K. (1972). U.R.S.I. Handbook of Ionogram Interpretation and Reduction,World Data Center A for Solar-Terrestrial Physics. NOAA, Boulder, CO. 90p. Raulin, J.-P.; Abe Pacini, A.; Kaufmann, P., Correia, E.; Aparecida, G. & Martinez, M. (2006). On the detectability of solar X-ray flares using very low frequency sudden phase anomalies. Journal of Atmospheric and Terrestrial Physics, 68: 1029-35. Raulin, J.-P.; David, P.; Hadano, R.; Saraiva, A.C.V.; Correia, E. & Kaufmann, P. (2009). The South America VLF NETwork (SAVNET). Earth, Moon and Planets, 104: 247-61. Raulin, J-P.; Bertoni, F.C.P.; Gavilån, H.R.; Guevara-Day, W.; Rodriguez, R.; Fernandez, G.; Correia, E.; Kaufmann, K.; Pacini, A.; Stekel, T.R.C.; Lima, W.L.C.; Schuch, N.J.; Fagundes, P.R. & Hadano, R. (2010). Solar flare detection sensitivity using the South America VLF Network (SAVNET). Journal of Geophysical Research, 115: A07301, doi:10.1029/2009JA015154 Scherrer, D.; Cohen, M.; Hoeksema, T.; Inan, U.; Mitchell, R. & Scherrer, P. (2008). Advances in Space Research, 42: 1777-85. SolarCycle24 (2010) – Available from: <http://www.solarcycle24.com>, accessed in december, 2010. Thomson, N.R. & Clilverd, M.A. (2000). Solar cycle changes in daytime VLF subionospheric attenuation. Journal of Atmospheric and Solar-Terrestrial Physics, 62: 601-8.
26
| Annual Activity Report 2010
2 STUDIES OF GRAVITY WAVES AT FERRAZ STATION (62° S) AND RECENT OBSERVATIONS José Valentin Bageston1,*, Paulo Prado Batista1, Cristiano Max Wrasse2, Delano Gobbi1, Neusa M. Paes Leme1, Robert Hibbins3,4, David Fritts5 Instituto Nacional de Pesquisas Espaciais, São José dos Campos, SP, Brazil 2 Vale Soluções em Energia, São José dos Campos, SP, Brazil 3 British Antarctic Survey, Cambridge, United Kingdom 4 Norwegian University of Science and Technology, Trondheim, Norway 5 Colorado Research Associates, Boulder, United States of America
1
*e-mail: bageston@gmail.com
Abstract: In this study we will present a brief review of mesospheric gravity waves that have been observed at Comandante Ferraz Antarctica Station, EACF (62.1° S and 58.4° W). First, we will show the main results of a campaign conducted from April to October of 2007, with more than 230 events. The main characteristics of the gravity waves are presented as follows: horizontal wavelengths between 10 and 65 km; periods between 5 and 35 minutes, and phase speed ranging from 5 to 120 m/s. Later, we will show the recent advances related to the observations of temperature, winds and gravity waves in the Mesosphere and Lower Thermosphere (MLT) over Ferraz station. In this sense, examples of temperature and wind data will be presented. Finally, we will show the partial conclusions and future prospects. Keywords: airglow, gravity waves, temperature, winds
Introduction The middle atmosphere is a region rich in chemical
found primarily in the lower atmosphere, and can propagate
interactions and with a large variability in terms of
through the atmosphere until they reach the region of
dynamics. A wide variety of structures are found in this
the mesosphere and lower thermosphere (70-100 km
region, amongst which can be pointed out the airglow
height). These waves occur as a result of a displacement
layers, metals layers and, at high latitudes a special type of
of air masses, caused by cold fronts, winds blowing over
phenomena known as noctilucent clouds. Recent studies
mountains or by jet streams in the stratosphere. Gravity
suggest that the increase in the concentration of CO and
waves are well known and studied in the meteorology field.
CH during this century can result in significant changes in
However, this phenomenon has received great attention
temperature, density and composition of the atmosphere.
due to its important role in the transporting of energy
Thus, the middle atmosphere has received considerable
and momentum from the lower to the upper atmosphere,
attention mainly due to the circulation system and global
varying the thermal structure and general circulation in
climate change (Gardner, 1995). Considerable progress has
the middle and upper atmosphere (Takahashi et al., 1999).
been made in the last decades in the study and understanding
Among the several techniques available for the observation
of the phenomenon of gravity waves in the middle
of gravity waves in the middle atmosphere, we can mention
atmosphere (Fritts & Alexander, 2003). Gravity waves are
meteoric and medium frequency radars, laser techniques,
Science Highlights - Thematic Area 1 |
27
in-situ observations by rockets, optical measurements from
it was necessary to see the images in an animation (“.avi”
the ground and from satellites. However, each technique
file format) to identify the gravity waves occurrence, and
has its own limitation related to the observation of gravity
subsequently select a time interval and a spatial region on
waves and only a fraction of the spectrum of these waves can
the images where each wave was identified. Furthermore,
be solved within a wide spectrum of frequencies and wave
after this pre-visualization, it was necessary to apply a
number (Nakamura et al., 1999). Thus, the combination of
pre-processing of the images before the application of the
observational methods is very important in order to study
FFT. The pre-processing basically consists of a rotation in the
the characteristics of gravity waves (Taylor & Gardner,
images in order to align the top to the geographic north, and
1998). This paper presents results from a campaign of
then mapping the image at the height of the airglow emitting
atmospheric gravity waves conducted in 2007 at Ferraz
layer to correct the effects of distortion in the images due
station (62.1° S, 58.4° W). We will also show and discuss
to the optical system effects. This process is known as
briefly some examples of temperature and winds observed
linearization, and the corrected images are called unwarp
at Comandante Ferraz station.
images. The next step is the removal of the stars, followed by a filtering in the images, and finally the FFT analysis can be
Data and Methodology The main data used in this study was from the airglow
a gravity wave event is occurring (identified previously in
images, from which it was possible to identify the gravity
the “.avi” animation). The details of this methodology can
wave activity in the atmosphere at the altitudes where the
be found in the thesis work of Bageston (2010) and in the
airglow emissions occur. In this study, the observed airglow
pertinent references.
emission is the hydroxyl in the near infrared spectrum
28
applied to a chosen region on the image, portion on which
(OH NIR, 715-930 nm), with emission peak around 87 km
Results and Discussion
high. Recently, a meteor radar that operates at a frequency
The main results already obtained are related to the
of 36.90 MHz was installed at Comandante Ferraz station
characterization of gravity waves for those observed in
with the aim of observing and studying the wind field over
2007. We will also show some recent observations of winds
the King George Island in the MLT altitude range. The
and gravity waves. The waves characteristics observed at
installation and operation of this radar is a collaborative
Comandante Ferraz during 2007 were obtained from the
effort between National Institute for Space Research (INPE),
analysis of the images observed trough the NIR OH airglow
Brazil, and Colorado Research Associates (CoRA), United
emission, including a total of 234 wave events. Figure 1
States of America. Simultaneous observations of wind
shows the observed parameters, that is, the horizontal
and gravity waves will be valuable to better understand
wavelength, period and phase speed for these waves. The
the dynamics of the MLT region on King George Island,
intrinsic parameters were also inferred and showed a
and consequently in the Antarctic Peninsula region.
similar behaviour to the observed characteristics, but with
Furthermore, the temperature structure in the Mesopause
a maximum occurrence slightly shifted due to the wind
region (~87 km high) has been monitored at Comandante
effect (Doppler shift).
Ferraz station since 2002. Since 2005 an airglow CCD camera
The horizontal wavelengths were distributed from
that observes the OH(6-2) emission through an annular field
10 to 65 km, with a maximum occurrence between
of view of 22.6° centred at the zenith has been in use.
20 and 40 km. The observed periods were mainly distributed
The methodology used to extract the wave parameters
between 5 and 35 minutes, but the maximum concentration
was based on analysis of the airglow all-sky images. This
was between 5 and 15 minutes. The observed phase speed
analysis uses the well established Fast Fourier Transform
has a distribution that extends from 5 to 120 m/s. The
(FFT) technique, but prior to the application of this analysis
majority of the waves had velocities between 10 and 70 m/s.
| Annual Activity Report 2010
b
a
c
Figure 1. Histogram plots of the gravity wave characteristics observed at Comandante Ferraz station in 2007. The panels show, from top to bottom, the horizontal wavelength, observed period and horizontal phase speed.
The results presented in Figure 1 are very similar to
the night could be related to small scale gravity waves. The
the observations reported in the literature, especially
large and abrupt decrease in the OH(6-2) intensity and
considering the results of observations conducted at other
temperature, denoted by the arrows, were related to the
Antarctica stations: Halley (76° S and 27° W) (2000-2001)
passage of a mesospheric wall (extensive gravity wave event)
and Rothera (68° S and 68° W) (2002-2003) (Nielsen,
above Ferraz (Bageston et al., 2011).
2007; Nielsen et al., 2009). The horizontal propagation
Recently, gravity wave and wind observations at
directions showed an anisotropic behaviour during the
Comandante Ferraz station are registering good quality
winter (Bageston et al., 2009), with similarities to the
recordings, and this data will be used soon for a detailed
observations conducted at Rothera and Halley, i.e., with
investigation of the dynamics of the MLT region over
preferential propagation direction to southwest and south
Comandante Ferraz. However, this data, including
(Nielsen, 2007).
temperature data, are still in Antarctica, and will be
Temperature in the MLT region has been monitored
sent to Brazil by the end of this year. Fortunately, some
at Comandante Ferraz since 2002, and from 2005 with a
examples of winds data were obtained remotely from
airglow camera, in order to study effects of gravity waves in
Comandante Ferraz. Figure 3 shows one example of winds
this parameter and also to investigate, in the future, the long
observed during two days, 12-13 September 2010. The
term variability in the Mesopause region. Figures 2 (a) and
main characteristic observed from Figure 3 is the well
(b) shows one example of temperature and airglow intensity,
defined semi-diurnal tide, that is, oscillations in the zonal
respectively, during one entire night during 2007. The small
and meridional wind components over a period of about
scale variability in the temperature and OH intensity during
12 hours. In addition, it is possible to identify that the winds
Science Highlights - Thematic Area 1 |
29
a
b
Figure 2. Temperature and OH(6-2) airglow intensity observed at Comandante Ferraz by an imaging spectrometer on 16-17July 2007.
in the upper altitudes (94 km) are more intense than at lower
dynamics and the thermal structure of the mesosphere and
altitudes (85 km).
lower thermosphere over the King George Island. The most
Gravity wave activity observed last year, by analysing
recent instrument installed at Comandante Ferraz, at the
some observed nights, seems to be similar to the activity
beginning of last year, was the meteor radar that is currently
observed in 2007, but with less useful data in 2010 in
in operation through a collaborative effort between the
comparison to the observations carried out in 2007.
Colorado Research Associates (CoRA), from United States, and National Institute for Space Research (INPE), from
30
Conclusions and Future Prospects
Brazil. The primary objective of this radar is to observe the
In summary, the present study has shown the main
wind structure between 80 and 100 km altitude. Besides the
characteristics of the gravity waves observed at Comandante
radar, other two airglow cameras (which belong to INPE)
Ferraz station in 2007, which were consistent with
are in operation with the aim of monitoring the gravity
previous observations in Antarctica, in particular to
wave activity in the mesosphere, and then characterize these
the wave parameters obtained from the observations at
waves, and observe the mesopause temperature structure. By
Rothera. Currently, three instruments are in operation
using temperature observations it is possible to monitor the
at Comandante Ferraz with the objective of studying the
long term variability of the thermal structure, and conduct
| Annual Activity Report 2010
Figure 3. Examples of winds observed on 12-13 September 2010 by the meteor radar installed at Comandante Ferraz station in March 2010.
studies to identify signature of waves of different scales in the temperature and in its day-to-day variability. Future
Acknowledgements J. V. Bageston thanks to FAPESP for the post-doctorate
investigation will include the use of local winds, as observed
fellowship under the process nº 2010/06608-2. This work
by the meteor radar, to study the wave filtering process due
was partially sponsored by the Brazilian Antarctic Program
to the background winds. Moreover, these winds also will
(PROANTAR/MMA, CNPq process nº: 52.0186/06-0), and
be useful in investigations of the gravity wave sources with
INCT-APA (CNPq process n° 574018/2008-5 and FAPERJ
the reverse ray tracing modelling.
process n° E-16/170.023/2008).
Science Highlights - Thematic Area 1 |
31
References Bageston, J.V. (2010). Caracterização de ondas de gravidade mesosféricas na Estação Antártica Comandante Ferraz. Tese em Geofísica Espacial, Instituto Nacional de Pesquisas Espaciais. Available from: <http://www.inpe.br/biblioteca/> Bageston, J.V.; Wrasse, C.M.; Gobbi, D.; Tahakashi, H. & Souza, P. (2009). Observation of mesospheric gravity waves at Comandante Ferraz Antarctica Station (62°S). Annales Geophysicae, 27(s/n): 2593-8. Bageston, J.V.; Wrasse, C.M.; Hibbins R.E.; Batista, P.P.; Gobbi, D.; Tahakashi, H. Fritts, D.C.; Andrioli, V.F.; Fechine, J.; & Denardini, C.M. (2011). Case study of a mesospheric wall event over Ferraz Station, Antarctica (62° S). Annales Geophysicae, 29(s/n): 209-19. Fritts, D. C. & Alexander, M.J. (2003). Gravity wave dynamics and effects in the middle atmosphere. Reviews of Geophysics, 41(1): 1-46. Gardner, C. S. (1995). Introduction to aloha/anlc-93 - the 1993 airborne lidar and observations of the Hawaiian airglow airborne noctilucent cloud campaigns. Geophysical Research Letters, 22(20): 2789-92. Nakamura, T.; Higashikawa, A.; Tsuda, T. & Matsushita, Y. (1999). Seasonal variations of gravity wave structures in oh airglow with a CCD imager at Shigaraki. Earth Planets Space, 51(7-8): 897-906. Nielsen, K. (2007). Climatology and case studies of mesospheric gravity waves observed at polar latitudes. PhD Thesis, Utah State University. Nielsen, K.; Taylor, M.; Hibbins, R. & Jarvis, M. (2009). Climatology of short-period mesospheric gravity waves over Halley, Antarctica (76°S, 27°W). Journal of Atmospheric and Solar-Terrestrial Physics, 71(s/n): 991-1000. Takahashi, H., Batista, P.P.; Buriti, R.A.; Gobbi, D.; Tsuda, N.T. & Fukao, S. (1999). Response of the airglow OH emission, temperature and mesopause wind to the atmospheric wave propagation over Singaraki, Japan. Earth Planets and Space, 51(7-8): 863-75. Taylor, M. & Gardner, C.S. (1998). Observational limits for lidar, radar, and airglow imager measurements of gravity wave parameters. Journal of Geophysical Research, 103 (D6):6427-37.
32
| Annual Activity Report 2010
3 INFLUENCE OF THE ANTARCTIC OZONE HOLE OVER THE SOUTH OF BRAZIL IN 2008 AND 2009 Damaris Kirsch Pinheiro1,*, Neusa Paes Leme2, Lucas Vaz Peres1, Elenice Kall1 Laboratório de Ciências Espaciais de Santa Maria – LACESM, Departamento de Engenharia Química, Universidade Federal de Santa Maria – UFSM, Camobi, Santa Maria, RS, Brazil 2 Centro Regional do Nordeste, Instituto Nacional de Pesquisas Espaciais – CRN/INPE, Natal, RN, Brazil 1
*e-mail: damaris@ufsm.br
Abstract: The Antarctic Ozone Hole is a cyclical phenomenon which occurs over the Antarctic region from August to November each year. The polar vortex turns it into a restricted characteristic dynamics for this region. However, when the polar vortex begins to weaken in October, air masses with low ozone concentration could escape and reach regions of lower latitudes. This study presents the influence of the Antarctic Ozone Hole over the South of Brazil in the years 2008 and 2009. To verify the events of influence, data of ozone total column from Brewer Spectrophotometer installed at the Southern Space Observatory (29.42° S, 53.87° W), in São Martinho da Serra, South of Brazil was used, and OMI Spectrometer overpass data for the same location. In addition to Brewer and OMI data, potential vorticity maps using GrADS (Grid Analysis and Display System) generated with the NCEP data reprocessed, and backward trajectories of air masses, using the HYSPLIT model of NOAA, were analysed. Ozone total column for the days with lower ozone were compared with the climatological average of twenty years for September and October. For statistical reasons, only the days with ozone total column lower than climatological monthly average minus 1.5 times the standard deviation, were analysed. Considering only the days with less ozone, increased absolute potential vorticity and backward trajectories indicating the origin of polar air masses, 3 events in 2008 and 2 events in 2009, with an average decreased about 9.7 ± 3.3% when compared with climatological means, were observed. Keywords: mid-latitude, potential vorticity, backward trajectories, Antarctic ozone hole
Introduction In the Antarctic continent, a significant decrease in total
latitudes (Prather & Jaffe, 1990; Semane et al., 2006). These
ozone content has been detected from August to November
events of the Antarctic Ozone Hole which have an influence
each year. This decrease is known as the Antarctic ozone
on the South of Brazil were first observed by Kirchhoff et al.
hole (Farman et al., 1985; Solomon, 1999). The atmosphere
(1996). The study developed here presents the events for the
in the southern hemisphere at high latitudes has undergone
years of 2008 and 2009.
marked changes over the past recent decades. According to Hansen (2010), a record of the Antarctic Ozone Hole
Methodology
area occurred during the spring of 2006, reaching a size of
To verify Antarctic ozone hole influence over South
10.6 million square miles. Because of the polar vortex, this
of Brazil, ozone total column data from Brewer MKIII
is restricted to the region. However, when the polar vortex
Spectrophotometer #167 installed at the Southern
begins to weaken in late September and October, ozone-
Space Observatory - OES/CRS/CIE/INPE - MCT
poor air masses can escape and reach regions of lower
(29.42° S and 53.87° W), in São Martinho da Serra, Brazil
Science Highlights - Thematic Area 1 |
33
a
b
c
Figure 1. Event of 26 October 2008. a) Maps showing of the increase of the absolute potential vorticity at the level of 620 K from 24 to 26 October, b) backward trajectory generated with the HYSPLIT model showing the polar origin of the air mass over Southern Space Observatory and c) image generated using data from OMI spectrophotometer.
34
and OMI Spectrometer overpass data for the same location,
PV can be used as a tracer of stratospheric ozone. Similar
were used. To verify the Antarctic influence, potential
methodology using ozone and PV correlation was used
vorticity (PV) maps on isentropic surfaces generated using
by Semane et al. (2006) and Narayana Rao et al. (2003),
GrADS, with NCEP reanalysis data, were used. Danielsen
over the Southern Hemisphere and Northern Hemisphere,
(1968) found a good correlation between ozone mixing
respectively. In this study, analysis of atmospheric backward
ratio and potential vorticity (PV) and demonstrated that
trajectories of air masses, using the HYSPLIT model (Hybrid
| Annual Activity Report 2010
a
b
c
Figure 2. Event of 05 September 2009. a) Maps showing of the increase of the absolute potential vorticity at the level of 620 K from 04 to 05 September, b) backward trajectory generated with the HYSPLIT model showing the polar origin of the air mass over Southern Space Observatory and c) image generated using data from OMI spectrophotometer.
Single-Particle Lagrangian Integrated Trajectory) developed
September and October. For statistical reasons, only the days
by NOAA and Australia’s Bureau of Meteorology, was also
with ozone total column lower than climatological average
used. Ozone total column for the days with lower ozone was
minus 1.5 times the standard deviation for the years 2008
compared with the climatological average of twenty years for
and 2009, were analysed.
Science Highlights - Thematic Area 1 |
35
Table 1. Events of the Antarctic ozone hole influence over Southern Space Observatory with corresponding reduction of ozone.
Events days
Ozone (DU)
Reduction (%)
28/09/2008
275.2
6.9
12/10/2008
267.8
8.1
26/10/2008
266.5
8.5
05/09/2009
261.2
11.6
06/09/2009
249.9
15.5
01/10/2009
270.2
7.3
Average
265.1 ± 8.8
9.7 ± 3.3
Results Climatological averages of ozone total column measured by Brewer Spectrophotometer at Southern Space Observatory
with an average decreased about 9.7 ± 3.3% when compared with climatological means.
from 1992 to 2009 were 295,6 ± 10,2 DU for September
Conclusion
and 291,5 ± 8,9 DU for October. The days of 2008 and 2009
The analysis of all days with decrease of ozone total column at
with ozone total column lower than these climatological
Southern Space Observatory showed the influence of Antarctic
averages minus 1.5 times the standard deviation was
Ozone Hole over South of Brazil. 3 events in 2008 and 2 events
analyzed according to the methodology described above.
in 2009, with an average decreased about 9.7 ± 3.3% when
The examples of 26 October 2008 and 05 September 2009
compared with climatological means, were observed.
are shown in Figure 1 and Figure 2, respectively, where an increase of absolute potential vorticity at the level of 620 K
Acknowledgements
(a), the backward trajectories of air masses poor of ozone
The authors would like to express their thanks to ATMANTAR
(b) and OMI data (c) are represented showing the influence
Project for International Polar Year, process n° 52.0182/2006-
of Antarctic Ozone Hole over South of Brazil. Considering
5, PROANTAR/MCT/CNPq, Instituto Nacional de Ciência e
only the days with decreased ozone measured at Southern
Tecnologia Antártico de Pesquisas Ambientais, CNPq process
Space Observatory, increased absolute potential vorticity
n° 574018/2008-5 and FAPERJ process n° E-16/170.023/2008.
shown at GRADS maps and HYSPLIT backward trajectories
Acknowledgements also to PIBIC/UFSM-CNPq/MCT and
indicating the origin of polar air masses, it was observed
PIBIC/INPE-CNPq/MCT for fellowships and NASA/TOMS
3 events in 2008 and 2 events in 2009 presented at Table 1,
and NCEP/NCAR for use of the data.
References Danielsen, E.F. (1968). Estratospheric-tropospheric exchange based on radioactivity, ozone and potential vorticity. Journal of Atmospheric Science, 25: 502-18. Farman, J.C.; Gardiner, B.G. & Shanklin, J.D. (1985). Large losses of total ozone in Antarctica reveal seasonal ClOx/NOx interaction. Nature, 315: 207-210. Hansen, K. (2010). 2008 Ozone Hole Maximum Announced. <http://www.nasa.gov/topics/earth/features/ozonemax_2008. html> (Accessed: 05 sep. 2010).
36
| Annual Activity Report 2010
Kirchhoff, V.W.J.H.; Schuch, N.J.; Pinheiro, D.K.; Harris, J.M. (1996). Evidence for an ozone hole perturbation at 30ยบ south. Atmospheric Environment, 33(9):1481-8. Narayana Rao, T.; Kirkwood, S.; Arvelius, J.; von der Gathen, P. & Kivi, R. (2003). Climatology of UTLS ozone and the ratio of ozone and potential vorticity over northern Europe. Journal of Geophysical Research, 108(D22): 4703, doi:10.1029/2003JD003860. Prather, M. & Jaffe, H. (1990). Global impact of the Antarctic ozone hole: chemical propagation. Journal of Geophysical Research, 95: 3413-92. Semane, N.; Bencherif, H.; Morel, B.; Hauchecorne, A. & Diab, R.D. (2006). An unusual stratospheric ozone decrease in Southern Hemisphere subtropics linked to isentropic air-mass transport as observed over Irene (25.5ยบ S, 28.1ยบ E) in mid-May 2002. Atmospheric Chemistry and Physics, 6: 1927-36. Solomon, S. (1999). Stratospheric ozone depletion: a review of concepts and history. Reviews of Geophysics, 37(3): 275-316.
Science Highlights - Thematic Area 1 |
37
4 ATMOSPHERIC SO2 MEASUREMENTS AT THE BRAZILIAN ANTARCTIC STATION Ericka Voss Chagas Mariano1,*, Neusa Maria Paes Leme2, Plinio Carlos Alvalá3 1 Programa de Pós-Graduação em Geofísica Espacial, Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil 2 Centro Regional do Nordeste, Instituto Nacional de Pesquisas Espaciais – CRN/INPE, Natal, RN, Brazil 3 Centro de Ciência do Sistema Terrestre – CCST, Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil
*e-mail: erickavoss@gmail.com
Abstract: For a better comprehension of the atmospheric chemical and radiative properties, it is necessary to understand the behaviour of trace gases and aerosols; some of these gas types have not been deeply studied. Sulphur dioxide (SO2) is found in the troposphere, as a result of both natural and anthropogenic emissions. To study the behaviour of this gas in the Antarctic continent, the data collected by the Brewer Spectrophotometer installed in the Brazilian Antarctic Station Comandante Ferraz (62° 05’ S and 58° 24’ W) was used. With this ground-based instrument, the total column of SO2 was measured from the beginning of springtime, to the start of summer, during the years 2003 to 2009. It was possible to observe that the total columns of SO2 did not show any differences in the time of the development of the ozone hole, as compared to other periods. The main sources of anthropogenic SO2 pollution in this region are the generation of energy, the operations with ships, and the burning of garbage, being a punctual impact. The natural generation of SO2 in this region is mainly related to the conversion of DMS (dimethyl sulfide) emitted by the ocean. In a few days, the SO2 total column exceeded the values considered normal for remote regions (>2 UD), and these high concentrations must have their sources identified and monitored. Keywords: atmospheric chemistry, sulfur dioxide, Brewer Spectrophotometer
Introduction Antarctica is the coldest, windiest, and driest continent on
a result of natural phenomena as well as anthropogenic
Earth, with a remote location far from the major centres
activities, such as fossil fuel combustion, volcanic eruptions,
of population. Yet as one of the two heat sinks in the
biomass burning and the oxidation of organic materials
global climate system it plays a crucial role in the general circulation of the atmosphere and has a profound effect on the atmospheric and oceanic conditions across the Southern Hemisphere (Turner, 2003). The study of the changes in the atmospheric SO 2 concentration is important because this gas has effects in the atmospheric chemistry and in the radiation field,
38
in soil and of dimethyl sulfide (DMS) over oceans. The sulfur dioxide (SO 2) found in the Antarctic region is mostly originated from DMS. SO2 also plays an important role in cloud formation physics, leading to clouds of high reflectivity. In the stratosphere SO2 is also oxidized and combines with water to form sulfate aerosols (Bekki, 1995).
with climatic consequences. In this case, the climate and
These aerosols scatter solar radiation and absorb long-wave
atmosphere research requires continuous SO2 observations
radiation, causing heating in the stratospheric region and
(Fioletov et al., 1998). SO2 is emitted in the atmosphere as
net cooling at the Earth’s surface (Georgoulias et al., 2009).
| Annual Activity Report 2010
In regions where the air pollution is small, the SO2
internal operations. This microprocessor is connected to a
concentration is lower than 2 DU, whereas in polluted
computer that, through the Brewer software, controls the
regions this value reaches 4 to 6 DU (Fioletov et al., 1998),
functioning of the instrument, and the data reduction and
and in extreme cases reaching 20 DU or higher, as in the
storage. The five wavelengths of operation are located in the
case of volcanic eruption events (De Muer & De Backer,
ultraviolet band of the O3 and SO2 absorption spectrum,
1992). Cappellani and Bieli (1994) state that SO2 in the air
which have a strong and variable absorption in this region:
vertical column is concentrated in the low troposphere,
306.3; 310; 313.5; 316.8; 320 nm.
mainly trapped in the mixture layer. De Muer & De Backer
The measurement of the total column of an atmospheric
(1992) say that, occasionally, higher amounts of SO2 in
gas made by a ground based instrument is based on the
the stratosphere, resulting from volcanic eruptions, may
principle of absorption of radiation that penetrates a
be observed. However, the conclusions presented by these
quantity of matter. Surface based methods use radiance
authors work show that, in general, almost every SO2 in the
measurements of an external source, such as the Sun or
vertical is found in the lower troposphere.
the moon, after the radiation had been extinguished, as a
Several methods have been developed for measuring
result of atmospheric absorption, molecular scattering and
not only near surface concentrations but also the total
aerosol (particle) scattering, all of them dependant on the
atmospheric content using ground-based instruments
wavelength (Whitten & Prasad, 1985).
(Georgoulias et al., 2009). The Brewer spectrophotometer was developed at the beginning of the 1980s to precisely measure ozone (O3) (Kerr et al., 1981), and also measures sulphur dioxide (SO2), nitrogen dioxide (NO2) and spectral irradiance in the ultraviolet band. This instrument is widely used by the Global Atmosphere Watch (GAW) program of the World Meteorological Organization (WMO) to measure the O3 columns. Today, there are more than 180 instruments installed around the globe (Fioletov et al., 2005).
Materials and Methods
Data collection and treatment The Ozone Laboratory, that belongs to the National Institute for Space Research, has a network of Brewer Spectrophotometers in South America. The data presented here was obtained in the Brazilian Antarctic Station Comandante Ferraz, from 2003 to 2009 through the Direct Sun method, using the direct solar beam as a radiation source. The data collected by the Brewer required reducing in order to be evaluated. This process is undertaken by an analysis program developed specially for the instrument - the Brewer Spectrophotometer B Data Files
Brewer spectrophotometer
Analysis Program. This program reads the Brewer files
The Brewer spectrophotometer is a ground based
according to the calibration data of each instrument. Since
instrument which makes measurements of solar radiation,
each instrument has a distinct calibration, this stage of
allowing the measurement of the total column of the
the data treatment takes longer to be completed. For the
following atmospheric gases: ozone (O3), sulphur dioxide
analysis of the data collected for this research, techniques
(SO2) and nitrogen dioxide (NO2). It can also measure the solar global radiation in the band ultraviolet B (UVB). This
of Descriptive Statistics were used.
instrument uses the Dobson unit (DU) to express the total
Results and Discussion
columns of O3, NO2 and SO2.
It is possible to notice a great variability in the data
The Brewer spectrophotometer is totally automated and
(Figure 1), including negative results, which are due
made up of three parts: tripod, tracker (a system that traces
to the Brewer SO2 algorithm and must be considered
the sun) and the spectrophotometer itself. The instrument
corresponding to very low total columns. When the total
contains a microprocessor, responsible for the equipment’s
column increases, on isolated days, it is not likely that this is
Science Highlights - Thematic Area 1 |
39
Figure 2. Number of days with SO2 total column higher than 2 Dobson Units DU for the period studied. Figure 1. Daily average of the SO2 total column for the Brazilian Antarctic Station from August to December, from 2003 to 2009.
Table 1. Annual average of the SO2 total columns for the Brazilian Antarctic station.
Year
Average
2003
–0,9
2004
–1,7
2005
–0,9
2006
0,9
2007
2,5
2008
1,6
2009
3,0
Figure 3. Correlation between the SO2 total column and Wind speed for the studied period.
associated with an increase of SO2 in the stratosphere, unless when this is related to volcanic eruptions, which is not the case in this study. In the Antarctic region, the main natural contribution to the maintenance of the SO2 column (even in low concentrations) is the conversion of organic material from the soils, and the oxidation of DMS over the ocean. It was possible to observe an increase in the average total SO2 column over the years for each annual period evaluated (Table 1). From 2006, the average turned positive. This coincides with the beginning of the construction of the expansion of the station, which may indicate an increase in the emission of pollutants. As the Antarctic region is a remote location, total columns above 2 DU can already be
40
| Annual Activity Report 2010
Figure 4. Correlation between the SO2 total column and solar radiation for the studied period.
Figure 5. Correlation between the SO2 total column and the O3 total column for the studied period.
Figure 6. Predominant Wind direction for the days with SO2 higher than 2 Dobson Units.
Figure 7. Map of the King George Island, showing the main stations. Adapted from http://hs.pangaea.de/Images/Maps/King_George_Island/King_George_ Island_Map.pdf.
Science Highlights - Thematic Area 1 |
41
considered relatively high, taking into account the level of
respectively. The energy generator is adjacent to the station,
local natural pollution. The maximum value of 9.9 DU was
and the contribution coming from the Martel inlet may be
observed in 2007, a rate comparable with that seen in cities
related to operations with ships.
like Cubatão, known for its high levels of pollution.
Few studies on the SO2 total column were carried out in
It is possible to see in Figure 2 the increase in the
Antarctica. Chakrabarty and Peshin (2007) found a pattern
number of days with total column higher than 2 DU from
in the total column of SO2 different from that found in
the year 2006. In all years, 145 days were observed with
this study. In the case of the Brazilian station Comandante
total column above this value, and in 2006 the number of
Ferraz, the data appears more scattered, while at Maitri
days was more than three times higher than the previous
(70.7° S and 11.7° E) the distribution is approximately
year. In Antarctica, the most significant anthropogenic
normal. They also found a correlation with UV-B radiation,
contributions are related to power generation, operations
which was not shown by this study.
with ships, and waste burning, being a punctual impact. When analyzing the graph with the number of days with
Conclusions
SO2 higher than 2 DU (Figure 2), it is possible to see that
SO2 total columns present a somewhat scattered behaviour,
from 2006 this number increased dramatically, possibly due
which indicates the source as being anthropogenic activities.
to the expansion of the Antarctic Brazilian station.
No correlation was found between SO2 total column with
With respect to wind speed (Figure 3), a correlation of
solar radiation, wind speed and O3 total column. Wind
0.08 between the observed data was found, i.e., no significant
direction indicates contribution from the Martel Inlet and
correlation. The same was seen for solar radiation (Figure 4),
the Brazilian Antarctic station. This work is a previous
with a correlation coefficient of –0.10, indicating a weak
treatment as part of an effort to establish a methodology for
correlation. Also, for O3, no significant correlation was
the use of SO2 data from the Brewer Spectrophotometer .
found (Figure 5). Evaluating the wind direction when the total column
Acknowledgments
exceeds 2 DU (Figure 6), it is possible to note that the
This work was partially sponsored by the Brazilian
preferred directions of wind are west, north and east, in
Antarctic Program (PROANTAR/MCT/CNPq process
that order. Looking at the map with the positioning of
nº.: 52.0182/2006-5), SECIRM, INPE and INCT-APA
the weather station and the Brewer spectrophotometer
(Instituto Nacional de Ciência e Tecnologia Antártico de
with respect to the Comandante Ferraz Antarctic Station
Pesquisas Ambientais, CNPq process nº 574018/2008-5 and
(Figure 7), it is possible to see that the increase in the
FAPERJ process n° E-16/170.023/2008 and the technicians
total column of SO2 occurs when the wind blows from the
Armando Hadano and José Roberto Chagas from INPE, for
Keller Peninsula, the Brazilian station, and the Martel inlet,
the support in Antarctica.
References Bekki, S. (1995). Oxidation of volcanic SO2: a sink for stratospheric OH and H2O. Geophysical Research Letters, 22(8): 913-6. Cappellani, E. & Bielli, A. (1994). Correlation between SO2 and NO2 measured in an atmospheric column by a Brewer spectrophotometer and at ground-level by photochemical techniques. Environmental Monitoring and Assessment, 35(2): 77-84. Chakrabarty, D.K. & Peshin, S.K. (2007). Effect of stratospheric O3 depletion on tropospheric SO2 column in Antarctica. Journal of Atmospheric and Solar-Terrestrial Physics, 69(12): 1377-87. De Muer, D. & De Backer, H. (1992). Revision of 20 years of Dobson total ozone data at Uccle (Belgium) - Fictitious Dobson total ozone trends induced by sulfur dioxide trends. Journal of Geophysical Research, 97(D5): 5921-37.
42
| Annual Activity Report 2010
Fioletov, V.E.; Griffioen, E.; Kerr, J.B. & Wardle, D.I. (1998). Influence of volcanic sulfur dioxide on spectral UV irradiance as measured by Brewer spectrophotometers. Geophysical Research Letters, 25(10): 1665-8. Fioletov, V.E.; Kerr, J.B.; McElroy, C.T.; Wardle, D.I.; Savastiouk, V. & Grajnar, T.S. (2005). The Brewer Reference Triad. Geophysical Research Letters, 32(20): 1-4. Georgoulias, A.K.; Balis, D.; Koukouli, M.E.; Meleti, C.; Bais, A. & Zerefos, C. (2009). A study of the total atmospheric sulfur dioxide load using ground-based measurements and the satellite derived Sulfur Dioxide Index. Atmospheric Environment, 43(9): 1693-701. Kerr, J.B.; McElroy, C.T. & Olafson, R.A. (1981). Measurements of ozone with the Brewer spectrophotometer, In: London, J. (ed.). Proceedings of the Quadrennial International Ozone Symposium. Natl. Cent. for Atmos. Res., Boulder, Colo. pp. 74-79, Turner, J. (2003). The Antarctic climate. In: Holton, J.R.; Curry, J.A. & Pyle, J.A. (eds.). Encyclopedia of Atmospheric Sciences. Academic Press. Whitten, R.C. & Prasad, S.S. (1985). Ozone photochemistry in the stratosphere. In: Whitten, R.C.; Prasad, S.S. (eds.). Ozone in the free atmosphere. New York: Van Nostrand Reinhold. p. 81-122.
Science Highlights - Thematic Area 1 |
43
5 MONITORING GREENHOUSE GASES IN COMANDANTE FERRAZ ANTARCTIC STATION, KING GEORGE ISLAND Luciano Marani1,*, Plínio Carlos Alvalá1,** Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil
1
e-mail: *lmarani@gmail.com; **plino@dge.inpe.br
Abstract: This document presents the results of the monitoring of Greenhouse Gases (GHG) at Brazilian Antarctic Station Comandante Ferraz (EACF). The samples were taken near the Ozone and Meteorology Modules, weather conditions, such as direction and intensity of the wind, being annotated. For measurements of the concentration of GHG, a collection system that used a diaphragm pump, with samples of air being stored in stainless steel cylinders, was used. Concentrations of gases of interest in the samples collected were determined by the ozone gas chromatography laboratory, in São José dos Campos/SP. Furthermore, a continuous infrared monitor (model LI-820 Licor Gas Analyzer) was installed in the Ozone Module. There was great stability of the concentration values obtained by liquor, in that the average for these records were 378.8 ± 2.0 ppm (parts per million by volume), very close to that reported at NOAA’s (National Oceanic and Atmospheric Administration) polar station (385 ppm). Analyses of nitrous oxide (N2O) collected in the cylinders in the months of January to March 2010 resulted in an average of 334.7 ± 2.0 ppb (parts per billion by volume), very close to that reported by NOAA as a global average (323 ppb), however it was noted that this value was virtually constant in all samples, which reflected in low standard deviation, revealing an offset in our pattern to be given in subsequent samples. Samples collected in cylinders in the same period and analyzed for methane showed an average 1,791.4 ± 38.0 ppb. This value is higher than expected for the region (1,750 ppbv). However there was a wide variability in the samples (represented by the standard deviation) reflecting local sample point, mainly in the samples collected near the station. CO data did not pass in the validation tests, mainly due to their long storage time. As the CO is reactive and can undergo alteration inside the cylinder through other compounds, the storage time led to reactions inside the cylinders, causing the invalidation of the samples for this gas. Keywords: greenhouse effect, carbon dioxide, carbon monoxide, methane, Antarctica
Introdution
44
The Earth can be considered a body in thermal equilibrium,
between 7 and 14 µm, where the absorption by CO2 and
so the radiation absorbed by the surface must be distributed
water vapour is weak (Vianello & Alves, 1991). The heated
by it so that the balance is maintained. The Earth’s surface,
atmosphere emits radiation in all directions and a fraction of
heated, re-emits the absorbed radiation through wavelengths
this radiation is absorbed by the surface again, contributing
greater in the infrared range, called planetary radiation. On
to further warming, the greenhouse effect.
its way into space, some of this radiation is absorbed by the
Among the various greenhouse gases, the main ones are
atmosphere, warming it. Only 6% of the radiation emitted
carbon dioxide (CO2), which is responsible for more than
from the surface escapes directly into space, especially in
60% of the increase of temperature, methane (CH4), nitrous
the spectral region known as the “atmospheric window”
oxide (N2O), and CFCs 11 and 12. The GWP of a gas is an
| Annual Activity Report 2010
index that expresses how effective this is for the greenhouse
the earth’s crust, oceans and volcanic eruptions. Thus,
effect. It is measured in terms of the effect of the introduction
maintenance of natural conditions in this region is of vital
of a molecule in the atmosphere (or gram) of gas over
importance for understanding the impact of large scale
the effect of the introduction of a molecule (or gram) of
impacts occurring in various continents and potentially
CO2, calculated for a certain time period (integration
those that have an influence on the Antarctic region.
period). This calculation also takes into account indirect
The gases CO, CH4, N2O and CO2 are greenhouse gases
effects, such as chemical reactions that act as sink for gas, but
and their monitoring is essential over time. Moreover, these
that generate other greenhouse gases. For carbon dioxide,
gases may be used for monitoring environmental pollution
GWP is set to 1. Thus to say that the GWP of CFC-12, for
produced in the region of Antarctic Station Comandante
an interval of 100 years, is 10,600, is equivalent to saying
Ferraz (EACF).
that the addition of a molecule of CFC-12 is equivalent to adding 10,600 molecules of CO2.
Materials and Methods
The increase in the concentration of the gases responsible
For the measurements of concentration of greenhouse gases,
for global radiation absorption, called greenhouse gases, is
which began in November 2009, a system of collection
causing a further rise in temperature, which can lead to an
with a diaphragm compressor pump was used, with air
environmental imbalance. It is estimated that the increased
samples being stored in stainless steel cylinders using an
concentrations of some gases (such as carbon dioxide,
electropolishing procedure. Figure 1 shows the process of
methane, nitrous oxide and CFCs) is responsible for a rise
collections in the vicinity of EACF (62.11° S and 58.41° W).
of about 0.3 °C in average global temperature per decade
The frequency of sampling was weekly and the sampling
(with an uncertainty of 0.2 to 0.5 °C per decade), maintained
was done in pairs, with two cylinders being pressurized in
their current growth rates (Cotton & Pielke, 1995).
sequence. The pairs of samples collected were considered
Besides the natural variations of the atmosphere,
valid only when the difference in the mixing ratios between
there are variations in the concentrations of certain gases
the two cylinders was at most 5%. At the time of sampling,
by interference of man. The most typical example is the
the weather conditions, like the wind direction and intensity,
case of the stratospheric ozone layer and the increase of
were recorded. The detailed meteorological data at the
Greenhouse gases. Artificially produced chemicals and
time of collection, such as wind speed, temperature and
greenhouse gases emitted in the industrial era just reacting
humidity were obtained through the address www.cptec.
and dramatically affecting the chemistry and dynamics of
inpe.br/antartica.
the atmosphere, producing environmental impacts such
The samples were brought to the Ozone Laboratory
as a slow and progressive reduction of the concentration
at the National Institute for Space Research (INPE) to
of ozone at all latitudes and the increase of the surface
be analysed. To determine the mixing ratio of methane a
temperature of the Earth.
chromatograph Shimadzu GC-14A equipped with a flame
However, in the current frame of Global Changes,
ionization detector (FID) and two columns of stainless
other complementary information about the variation
steel 1/8 inch in diameter, were used. The first column,
of atmospheric parameters is necessary to measure the
2.5 m, was filled with silica gel and was used to minimize
impact of these changes in the atmosphere and so that the
the total analysis time for the retention of water vapour,
environment can be assessed and quantified.
CO2 and carbon compounds heavier than methane. The
The Antarctic environment is in the region of lowest
second was a column packed with zeolite 5Å molecular
global human impact. Due to its condition and its remote
sieve (5 angstrom), 3.0 m in length, which was responsible
low-impact feature, this region is taken as reference for
for the gas chromatographic separation of the sample. The
studies of global dispersal of pollutants and products from
standard gas used was purchased from NOAA (National
Science Highlights - Thematic Area 1 |
45
Figure 1. Collect the air samples using stainless steel cylinders with electropolishing internal pressurized to 2 atm, near (left, on the beach) and far from the station (right).
Oceanic and Atmospheric Administration), and showed a
Results and Conclusions
concentration of 1749.4 ± 4.5 ppbv. The sample was injected
Because it is monitoring work, its continuation is necessary
through a sampling loop of 2.2 mL. The speakers operated
so that the behaviour of greenhouse gases can be duly
at 100 °C and the detector at 120 °C. The chromatographic
studied. The monitoring is important because it may give
gases used for the FID(H2, N2 and synthetic air) had a high purity (99.999%). The relative accuracy obtained in the analysis of three aliquots of each sample was 0.7% or better (Alvalá et al., 2004; Marani & Alvalá, 2007). A detector of oxide of mercury was used for determining the mixing ratio of CO, with a relative precision of 3.5% or better for analysis of three aliquots (Kirchhoff et al., 2003). To determine the
Antarctica. In terms of results already obtained, we observed a greater stability of CO2 concentration values obtained by the Licor, and the average for these observations were 378.8 ± 2.0 ppm (parts per million by volume), very close to that observed in polar station NOAA (385 ppm). There were problems with pump parts in June 2010 and a new pump was planned to reach EACF by November 2010 for
mixing ratio of N2O and CO2 a gas chromatograph equipped
monitoring to continue. Figure 2 shows the daily averages of
with electron capture detector (ECD), with relative accuracy
CO2 obtained in EACF using cylinders (between December
of 0.7% or better, was used. All standard gases used were
2009 and January 2010), while in April, May and June, the
obtained from NOAA.
data corresponds to daily averages obtained using the Licor
In addition, a continuous infrared carbon dioxide monitor (model LI-820 Gas Analyzer) was installed near the ozone module (100 m distant from EACF), which provided instantaneous concentrations of gas and that should remain at the station performing the monitoring of the concentration of atmospheric CO2. The Licor determines the
46
indications of the impact of human presence in this region of
equipment. The analysis of nitrous oxide (N2O) in the cylinders collected from January to March 2010 resulted in an average of 334.7 ± 2.0 ppb (parts per billion by volume). This value was found to be 10 ppb above the global average of NOAA (323 ppb), but observed that this value was almost constant in all samples, which resulted in low standard deviation,
concentration of CO2 every second, but for this monitoring,
revealing a shift in our pattern to be given for the next
the daily averages were chosen.
samples.
| Annual Activity Report 2010
the samples (represented by standard deviation) reflecting the local sampling, mainly in samples collected near a station with favourable wind. The CO data did not pass the validation tests, mainly due to long storage time. As the CO is reactive and can undergo alteration inside the cylinder through other compounds, the storage time led to reactions inside the cylinders, characterizing the samples as invalid for this gas. As a result, one of the difficulties was to perform the analysis of samples in smaller time intervals. Delays and changes in flight dates to support the work and difficulty in dispatch, resulted in cylinders being collected from São José dos Campos at shorter intervals, particularly during winter.
Acknowledgements Figure 2. CO2 (March 2009 to January 2010), obtained from samples collected in drums (purple) and those obtained by continuous monitoring (blue).
To PROANTAR, SECIRM, INPE, INCT-APA (National Institute of Science and Technology Antarctic Environmental Research), FAPERJ (process n° E-16/170.023/2008), CNPq (process nº 574018/2008-5) and ATMANTAR/IPY/ MCT/
The samples collected in cylinders in the same
CNPq, (process n° 52.0182/2006-5). We would also like to
period and analyzed for methane exhibited an average of
thank Dr. Neusa Paes Leme and technicians José Roberto
1791.4 ± 38.0 ppb. This value is higher than expected for the
Chagas, and William Jose Ferreira of Ozone Laboratory
region (1750 ppbv). However there was a large variability in
(INPE) for their support in Antarctica.
References Alvalá, P.C.; Boian, C. & Kirchhoff, V.W.J.H. (2004). Measurements of CH4 and CO during ship cruises in the South Atlantic. Atmospheric Environment, 38(27), 4583–8. Cotton, W.R. & Pielke, R.A. (1995). Human impacts on weather and climate. Cambridge: Cambridge University Press, 288p. Kirchhoff, V.W.J.H.; Aires, C.B. & Alvalá, P.C. (2003). An experiment to determine atmospheric CO concentrations of tropical South Atlantic air samples. Quarterly Journal of the Royal Meteorological Society.129(B), 1891–903. Marani, L. & Alvalá, P.C. (2007). Methane emissions from lakes and floodplains in Pantanal, Brazil. AtmosphericEnvironment, 41(8): 1627-33. Vianello, R.L. & Alves, A.R. (1991). Meteorologia básica e aplicações. Viçosa: Universidade Federal de Viçosa, Imprensa Universitária. 449p.
Science Highlights - Thematic Area 1 |
47
6 CONSIDERING NEW PARAMETERS IN THE STUDY OF ATMOSPHERIC IMPACTS AT ADMIRALTY BAY Eduardo Delfino Sodré1, Heitor Evangelista1,*, Lavínia Brito1, Sergio Machado Corrêa2 Laboratório de Mudanças Globais e Radioecologia –DBB, Instituto de Biologia Roberto Alcântara Gomes –IBRAG, Universidade Estadual do Rio de Janeiro – UERJ, Rio de Janeiro, RJ, Brazil 2 Departamento de Química e Ambiental, Faculdade de Tecnologia, Universidade Estadual do Rio de Janeiro –UERJ, Resende, RJ, Brazil
1
*e-mail: evangelista.uerj@gmail.com
Abstract: The purpose of this research is to deepen the investigation of atmospheric impact as a result of aerosol and gas emissions at Comandante Ferraz Brazilian Antarctic Base (henceforth EACF). As a consequence of a campaign during 2009/2010 summer and re-analysis of 1998 filters (whereby there became available an annual set of continuous samples), levoglucosan (the product cellulose pyrolysis) as an indicator of burning of organic material by the Brazilian Station was verified. The numeric model of atmospheric dispersion used for Admiralty Bay was suitable for study of the impact on the atmosphere in Admiralty Bay and in zoned areas of biological importance within the Antarctic Specially Managed Area of King George Island, using a simulation with stations and ships operating simultaneously. The preliminary results of the chemical analyses for carbonyls and BTEX have shown that the direct atmospheric impact zone of EACF, due to these chemicals, is restricted to a radius of a maximum of 400 m, falling sharply in all directions Keywords: King George Island, atmospheric impact, air polution, levoglucosano, BETEX
Introduction An Antarctic Specially Managed Area (ASMA) of greater
together with their logistical maintenance support systems,
interest for the Brazilian Antarctic Programme has been
personnel transport carriers, and materials. Admiralty Bay
delineated around Admiralty Bay and covers the location
also receives several tourist ships that contribute to the
of 2 permanent research stations: EACF (Brazil) and Arctowski (Poland) and 2 of a smaller size, which operate only during the austral Summer: Machu Picchu (Peru) and Pieter J. Lenie-Copacabana (U.S.A), (Weber & Montone, 2006). All these stations have power generating systems operated on the basis of the burning of fossil fuels (with the exception of Copacabana) and also incinerate organic waste. These operational pattern make the stations sources of research related to local pollution. The Brazilian base is
48
increase of the local atmospheric pollution. The orography of the region is characterised by fjords surrounded by mountainous areas, which results in a large basin area making difficult the dispersion of pollutants generated there, especially during periods of high atmospheric stability. In this research work, we present the results of new simulations using the mathematical model of atmospheric dispersion presently in use, ISCST3 (Industrial Source Complex -
the one which sustains a greater amount of human activity
Short Term Version 3), and the employment of chemical
due to the great number of research scientists and technical
markers (levoglucosan, total BTEX and total carbonyls)
support professionals, who are based there every year,
representative of the anthropic activities at ASMA.
| Annual Activity Report 2010
Preliminary Results Atmospheric dispersion model The mathematical atmospheric pollutant dispersion models are important tools for understanding the behaviour of some gaseous and particle pollutants using data from the study of topography, emissions and meteorology. These models estimate the impact of one or more sources on the air quality of a certain region. The dispersion model used in this research was Figure 1. A modelled scenario of atmospheric dispersion using multiple sources in the interior of Admiralty Bay/King George Island.
the ISCST3 (Industrial Source Complex - Short Term
Figure 2. (Upper) seasonal average of global fire spots; (bottom) inter-annual concentrations of Levoglucosan in 1998 measured at EACF.
Science Highlights - Thematic Area 1 |
49
Figure 3. Back-trajectory model (Hyspit/NOAA), during the the increase of Levoglucosan levels over the King George Island in January 1998.
Version 3), a Gaussian Plume Model in a steady-state
apart from local impacts, an important part of Admiralty
condition that can be used in the evaluation of pollutant
Bay receives the combined atmospheric impact of these
concentrations and/or in the deposition fluxes from a
pollutants sources.
great variety of complex sources (Vidal, 2008). In this
Chemical tracers: Levoglucosan
study, the plume model was configured for a critical scenario whereby 3 scientific stations and 4Â ships were operating simultaneously in Admiralty Bay. The result is
50
Levoglucosan (1,6 anhydro-β-D-glucopyranose), the product of cellulose pyrolysis, has been studied as a forest and agricultural biomass burning tracer due to its resistance
shown in Figure 1 and considers an average distribution
to weathering and its dispersion in the atmosphere during
of local wind, topoghaphy and the predominant classes of
occurrences of slash-and-burn. Another potential source
stability. It can be observed that in these circumstances,
of levoglucosan in Antarctica is the practice of organic
| Annual Activity Report 2010
Figure 4. Spatial distribution of the atmospheric samples during the first phase of the 2009/2010 summer at EACF. The dotted contour line indicates where significant increases of BTEX and Carbonylic compounds were observed. The lower square close up detail, to the right, shows EACF and the reserve fuel tanks.
waste incineration by the research stations. An analysis
Trying to corroborating the hypothesis concerning
undertaken concerning the filter samples in 1998, whose
the relevance of the local sources related to levoglucosan,
monitoring spanned a complete annual sequence, showed
regarding long distance displacement, the Hysplit/NOAA
that the level of greater concentration of levoglucosan coincided with the period of greatest human activity at EACF, at which moments the incinerator is used with greater frequency. From the seasonal point of view, the peaks of Levoglucosan differ from the occurrence of peaks of the forest slash-and-burn, not only in South America/Africa, but also in terms of worldwide slash-and-burn, according to the database of the European Space Agency – ESA, Figure 2. Considering that the displacement time of the plumes of smoke from slash-and-burn between South America and the Antarctic Peninsula occur in approximately 7-15 days, the time lag observed does not justify a continental origin
model was used with in order to investigate the nature of the back-trajectories of the air masses, referring to the sample dates that show high concentrations. A typical structure is shown in Figure 3, calculated for January 2008. In this case, it was verified that during the periods of high level of Levoglucosan, the air masses that prevailed over the King George Island were basically from polar-oceanic nature, justifying, in principle, the influence of forest slash-andburn over that region.
Carbonylic and monoaromatic hydrocarbons In general the main carbonylic compounds in the troposphere are formaldehyde, acetaldehyde and acetone, and the first is considered carcinogenic by IARC. The
for the levoglucosan, making the incineration of organic
monitoring of these compounds is an American regulatory
waste at EACF the most probable cause.
ruling by USEPA. In the vicinity of EACF, 14 air samples
Science Highlights - Thematic Area 1 |
51
a
b
Figure 5. a) Total BTEX and b) Total Carbonyl. The colored rectangles distinct the samples with higher values and the environmental levels. The identification of the samples refers to Figure 4. Sampling station A19 was set close to the emission point.
were collected and analysed according to USEPA(1997) methodology. The results showed the presence of these compounds, mainly inside a 200-400 m radius from EACF (Figures 4 and 5). The same occurred for BTEX, aromatic hydrocarbons present in diesel and with high resistance to environmental degradation and and high volatility. In sub-polar environments the latter form becomes more persistent, since the low temperatures delay their degrading process. Among the 21 air samples analysed for BTEX, an analogue spatial distribution behaviour for the carbonylic compounds was observed. A cluster analysis between the results of the atmospheric chemical pollutants and meteorological data obtained in situ (in the case, pressure, humidity, wind intensity, air temperature and solar radiation), indicated the presence of 3 groups when a tolerance limit of 0.35 was adopted; that is, a first group that relates pressure and relative humidity
52
| Annual Activity Report 2010
Figure 6. Cluster analysis of Carbonylic Compounds and meteorological data for the 2009 summer around EACF.
which illustrates the dynamism of the frontal systems in
The fuel transfer into the storage tanks at EACF occur
the region, which carry oceanic humidity to King George
between the end of spring and the beginning of summer.
Island. A second group that relates the air temperature and global solar radiation, as a result of heating up of the local
Conclusion
atmosphere through the direct effect of solar radiation, and a
The samples analysed up to the present, clearly demonstrate
third group that concentrates the greater part of its chemical
an existing impact due to the use of fossil fuel and
compounds (with exception to propionaldehyde) grouped
incineration of organic waste. However, this impact, from
together with wind intensity which is a meteorological
the atmospheric point of view, seems to be restricted,
modulating parameter of the air concentrations. The result
signicantly, to the occupational and infrastructure zones
of the cluster (Figure 6) indicates the nature of the local
(~200-400 m around EACF). The reason is probably the
emissions.
persistent strong local winds and the atmospheric stability
As a final remark, the EACF is potentially a source of fugitive emissions from fuel tanks. These refer to unintended
pattern, important in the process of dispersion of gases and particulate material emitted by the EACF.
release of gases from defective, vents, connections and pressure valves, the latter being a big problem for the
Aknowledgments
petrochemical industry. Their control is usually associated
We kindly thank the Instituto Nacional de Ciência
to maintenance. In the case of storage and fuel supply, the
e Tecnologia Antártico de Pesquisas Ambientais
question refers to the escape of gases through the vents and
(INCT-APA) and the grants CNPq/574018/2008-5 and
fuel tank entrances. In many European countries there is an
FAPERJ/E-16/170.023/2008 that made possible this work.
environmental requirement that at the time of fuel transfers
Also Dr. Neusa Paes Leme/INPE for her great help in the
the saturated gases in the storage tanks shall be collected.
logistics and invitation to join INCT-APA.
References USEPA. Compendium Method TO-11A. (1997). Determination of Formaldehyde in Ambient Air Using Adsorbent Cartridge Followed by High Performance Liquid Chromatography (HPLC). EPA-625/R-96/010b. Cincinnati, OH: U.S. Environmental Protection Agency. Vidal, C.M.C. (2008). Descrição da Metodologia do Cálculo da Dispersão de Plumas Aplicada a um Complexo industrial Dissertação de Mestrado- Instituto de Química - UERJ. Weber R.R. & Montone, R.C. (2006). Gerenciamento Ambiental da Baía do Almirantado, Ilha Rei George- Antártica - Rede 2 – MMA.
Science Highlights - Thematic Area 1 |
53
THEMATIC AREA 2
GLOBAL CHANGES ON TERRESTRIAL ANTARCTIC ENVIRONMENT
54
58
Plant Communities from Ice-Free Areas of Demay Point, King George Island, Antarctica
63
Global Patterns in Soil Bacterial Community Composition Across a Continental Scale
68
Conservation Status of Plant Communities at Ulmann Point and Comandante Ferraz Antarctic Station Area, Admiralty Bay, King George Island, Antarctica, Based on the Index of Ecological Significance
73
Insecticidal Effects of Antarctic Algae Prasiola Crispa Extract in the Adult Fruit Fly Drosophila Melanogaster
78
Penguin Colonies and Weather in Admiralty Bay in a Colder Year
82
Distance Associations Among Antarctic and Subantarctic Seabirds
87
Topographical Characteristics Used by Southern Giant Petrel Macronectes Giganteus at Stinker Point, Elephant Island
91
Factors Influencing Brown Skua Reproductive Success at Elephant Island – Antarctica
95
Nest Attendance of Southern Giant Petrel (Macronectes Giganteus) on Elephant Island
| Annual Activity Report 2010
Coordinator
Antonio Batista Pereira Vice-coordinator
Maria Virginia Petry
The thematic module “Global Changes Impact on Antarctic
was written taking into consideration soil and seabird
Environment” was proposed with the aim of researching
populations as crucial factors for the presence or absence
Antarctic ice-free areas through the study of biologic
of certain plant populations which characterize vegetation
communities looking for relationships among plants,
communities.
seabirds and soil microorganism communities. We intend
The study “Conservation status of plant communities
to implement an environmental network to monitor ice-
in Ullmann Point and Comandante Ferraz Base Area,
free area communities through the study of the entire ecosystem. Monitoring terrestrial ecosystems as a whole is essential to detect and comprehend how global changes affect the Antarctica Continent, particularly the plants and the seabirds, as they are the most representative populations and also the most susceptible to global changes. Since vegetal communities are closely related to seabird colonies, it is important to develop studies that take into consideration this previous association. Some vegetal species are classified as ornitocoprophilous and some as ornitocoprophobous. In the same way that seabirds and plants are found to be interconnected, plants can be associated to soil microorganisms, hence, it is also important that they are studied and understood.
Admiralty Bay, King George Island, Antarctica based on the index of ecological significance” is one of the first studies written based on Antarctic plant population and is important because it brings together relevant data, which will be decisive to evaluate environmental impacts, in complementation of seabird and soil microorganism communities. The study “Global patterns in soil bacterial community composition across a continental scale” is new in the way that its aim is to put together information that enables checking the methodology of soil microbial community studies in ice-free areas compared to what has been carried out in Brazil. Over the length of millions of years of isolation,
To achieve our goals we will focus our research on:
Antarctic organisms have evolved particular characteristics
1 - Plant cover; 2 – Biodiversity; 3 – Seabird reproductive
as a response to environmental pressure. Those characteristic
colonies distribution; 4 – Seabird colonies size variation
variations are registered in their genes, which can
and distribution; 5 – Seabird reproductive success. All those
be considered an Antarctic treasure. With the study
research branches will be investigated in relation to global
“Insecticidal effects of Antarctic algae Prasiola crispa extract
climatic changes, ice-free areas and anthropogenic impact.
in the adult fruit fly Drosophila melanogaster” we aim to
Here we present a group of studies developed at
obtain better comprehension of Antarctic plant species and
Admiralty Bay, South Shetlands, with ice-free areas
explain the fragility and peculiarity of this environment’s
biological communities. In order to obtain vegetation
populations.
and microorganism community data, field work was
Seabird breeding colonies annual variation is evaluated
simultaneously under taken. Thus, the study “Plant from ice-
through mapping all species breeding colonies year
free areas of Demay Point, King George Island, Antarctica”
upon year. The study “Penguin Colonies and Weather
Science Highlights - Thematic Area 2 |
55
Figure 1. Thematic Area 2 flowchart. (Illustration: Edson Rodrigues).
56
Suzana Seibert
Suzana Seibert
Figure 2. Petrel in carpet moss communities.
Figure 3. Prasiola crispa communities in a Penguin colony.
| Annual Activity Report 2010
Rodrigo Machado
influence of inter- and intra-specific interaction over the breeding success, thus, exemplifying the importance of biotic local factors for seabird demography. The paper titled “Nest attendance of Southern Giant Petrel (Macronectes giganteus) on Elephant Island” applies a tracking method with radio transmitters to monitor the nest attendance of Southern Giant Petrels. The nest attendance depends on the environmental factors. Years with climatic extremes and low food availability influence the decision of birds on when to begin and eventually when to abort breeding. We expect differences in parental investment between genders in species such as the Southern Giant Petrel whose sexual
Figure 4. Skua in carpet moss communities.
dimorphism is marked, being able to shift as a response to climatic conditions as well.
in Admiralty Bay, King George Island, in a Colder Year”
Since local factors can influence population breeding,
exemplifies such an approach. By making area and
furthermore oceanic factors during the non-breeding
distribution measurements every year we are able to detect
season are important to determine survival and returning
fine variations in population density. It will be possible to
rates of the breeding colonies. Seabirds are affected in the
correlate those variations to environmental data (mainly
open ocean by productivity, temperature and weather
climatic variables and the annual sea-ice caps) through long
fronts. Such influences can be driven by the interaction
term data sampling.
among species. Seabirds interact to optimize their food
Antarctic seabird population parameters can also be
detection by a constant monitoring of each other’s
affected by local factors. The local landscape parameters
behaviour in the sea. The paper “Association distances
are influential in the decision of where the birds will place
among Antarctic and Sub-Antarctic seabirds” measures
their nests. The paper “Topographical characteristics used by
such associations. This is a first effort to evaluate seabirds
the Southern Giant Petrel Macronectes giganteus in Stinker
and environmental interactions in the open ocean. Seabird
Point, Elephant Island” makes a preliminary evaluation of
species are sampled every year at the beginning and end of
the Southern Giant Petrels nest distribution by application
their breeding seasons of Antarctic and Brazilian waters, so
of GIS and exploratory analyses. The comparison of
we will be able to detect wide interactions of non-breeding
topography between nests and random points demonstrated
seabirds with weather conditions and ocean productivity
that the choice of nesting is not random. On the other hand,
during their non-breeding movements, and thus make
the paper “Factors influencing Brown Skua reproductive
inferences of how much such interaction is determinant
success at Elephant Island – Antarctica” evaluates the
on breeding seasons.
Science Highlights - Thematic Area 2 |
57
1 PLANT COMMUNITIES FROM ICE-FREE AREAS OF DEMAY POINT, KING GEORGE ISLAND, ANTARCTICA Antonio Batista Pereira1,*, Márcio Rocha Francelino2, Valdir Marcos Stefenon1, Adriano Luis Schünemann1, Luiz Fernando Wurdig Roesch1 1 Universidade Federal do Pampa – UNIPAMPA, São Gabriel, RS, Brazil Universidade Federal Rural do Rio de Janeiro – UFRRJ, Seropédica, RJ, Brazil
2
*e-mail: anbatistape@gmail.com
Abstract: This research presents the study of plant communities in ice-free areas of Demay Point, which is located at the south of the Admiralty Bay, King George Island, Antarctica. The aim of this research was to collect data about the plant coverage, classification and distribution of plant communities, contributing with the evaluation of possible environmental impacts of anthropogenic or natural origin, following the evolution of such communities over the length of time. The study started with the classification and description of the plant communities based mainly on the plant physiognomy, biodiversity and the relation with local abiotic factors. Each community was mapped with an Astech Promark II DGPS and the data was processed using AstechSolutions software to obtain sub-metric accuracy. Seven plant communities were identified and described as: 1 Grass and cushion chamaephyte formation; 1.2 Deschampsia and mosses subformation; 2 Moss carpet formation; 3 Moss hummock formation; 4 Moss tuft formation; 5 Fruticose lichen and moss tuft formation and 6 Fellfield communities. These plant communities are shown in a map, with their description. Keywords: vegetation, plant coverage, King George Island, Antarctica
Introduction
58
Demay Point is an ice-free area located in the south of
Allison and Lewis-Smith (1973), using mainly quantitative
Admiralty Bay, within the SSSI 8, being delimited by the
characters from the populations – was completed just six
Baranowski Glacier to the North and by Windy Glacier
decades after the work of Skottsberg. Lewis-Smith (1988)
to the South. Since it is located within an area of scientific
was one of the first to present a classification for population
interest, very important for preservation and rich in plant
groups of the plant communities of Antarctica, clustering
communities, it constitutes an excellent ecosystem for
them in formations and sub-formations. Pereira and Putzke
monitoring plant communities.
(1994) presented a study of the plant communities of Stinker
Regarding the study of plant communities of Antarctica,
Point, Elephant Island, Antarctica, in which they classified
one of the first attempts of describing the plant populations
the plant communities based mainly on the work of Lewis-
occurring in ice-free areas of this continent was made by
Smith and Gimingham (1976). Putzke and Pereira (1998)
Skottsberg (1912), who identified and classified some lichens
presented a study of the moss communities of the Rip Point,
and moss communities, based mainly on the physiognomy of
Nelson Island, Antarctica, using the quadrat method.
the plant formations. A further piece of research describing
In addition to these studies, there is the work of
the plant formations from Antarctica – performed by
Pereira et al. (2007), presenting a map with the description
| Annual Activity Report 2010
and distribution of the plant communities of the Keller
the identification of moss and the research work of Øvstedal
Peninsula, King George Island, and the work of Victoria et al.
and Lewis-Smith (2001) and of Redón (1985), for the
(2009), about the composition and distribution of the
identification of lichens. In some areas, the quadrat method,
moss formations in ice-free areas near the Polish Station
modified from Braun-Blanquet (1964), was employed. Based
Arctowski, King George Island, South Shetlands.
on the data collected, the plant communities were identified
The present study had the purpose of collecting and registering data about the diversity and the plant coverage
and classified according to Pereira and Putzke (1994) and Lewis-Smith and Gimngham (1976).
of ice-free areas in Antarctica, given that these aspects are
The plant communities were geo-referenced and
outstanding indicators of environmental changes. Because it
mapped utilizing the Astech Promark II® DGPS, which
is an area of environmental protection, this data is important
is able to obtain sub-metric accuracy after processing the
for an evaluation of the environmental impacts of both,
data with Astech Solutions® software, based on data from
anthropogenic and natural origin.
the active GPS station of the Comandante Ferraz Brazilian Antarctic Base.
Material and Method The study of the vegetation of ice-free areas in Demay
Results and Discussion
Point started with the identification of the most
This is the first study on vegetation cover and distribution
representative populations (Figures 1 and 2). The studies of
of plant communities at Demay Point, hence there is no
Putzke and Pereira (2001) and Ochyra (1998) were used for
historical data to be discussed and compared for this area.
Figure 1. Location of study area.
Science Highlights - Thematic Area 2 |
59
Figure 2. Spatial disitribution of vegetation communities in Demay Point, King George Island, Anarctica.
Based primarily on the biodiversity and physiognomy, it
Deschampsia and moss subformation
was possible to recognize six plant formations and one
These subformations were represented by a small,
subformation (Figure 2), which can be clearly identified
discontinuous formation located near the beach, in the
and delimited:
central part of the studied region (Figure 2). This is an area
Grass and cushion chamaephyte formation These formations were present in two areas situated close to the beach. In these communities, the soil is usually deep, originating mainly from the sediments carried by the water from the melting process. The floristic composition is formed mostly by dense populations of Deschampsia antarctica Desv. (Poaceae) and rare grass turf of Colobanthus quitensis (Kunth.) Bart. (Caryophylaceae). The moss is
60
with relatively well-differentiated soil, originated mostly from the decomposition of sediments carried by the water from the defrosting process. The vegetation is composed of Deschampsia antarctica associated with Colobanthus quitensis. The moss populations are more representative than in the Deschampsias communities. Among the moss species, Sanionia uncinata, Bryum spp. and Polytrichastrum alpinum (Hedw.) G.L.Sm. represent the higher biomass.
represented by small and rare populations of Sanionia
Moss carpet formation
uncinata Hedw. Loeske. Populations of Bryum spp. occur
The moss carpet formations were usually located in fairly
in wet places, mostly along the drainage lines.
flat areas, in the coastal region, formed by jackstone or by
| Annual Activity Report 2010
small rock fragments. In this substrate, the species with
associated with lichen communities of the region are less
higher biomass are mainly Sanionia uncinata, with rare grass
representative in these areas. These communities occur in
turf of Deschampsia antarctica. In sites where there is soil or
areas with predominance of big blocks of rock or of rocky
deposit of thin sediments, the most abundant populations
outcrops, without soil formation. Moss populations are
are formed by Polytrichum juniperinum in areas without
less frequent. Populations made up of representatives of
the influence of guano. Where guano is present, the most
the genus Pohlia can appear in wet locations among the
common Politrichaceae is Polytrichastrum alpinum, both
rocks with soil decomposition. Populations of Sanionia
associated with Bryum spp. and Syntrichia spp..
uncinata and Polytrichum juniperinum can occur in other
Moss hummock formation These communities were very similar to the Deschampsia
places. Polytrichastrum alpinum can happen in places of bird nesting.
and moss communities. The main difference is the higher
Fellfield communities
biomass and higher biodiversity of moss associated with
In Demay Point, fellfield communities occupy the biggest
flowering plants. The most frequent moss populations
areas in terms of extension. In these areas, the substrate
were of Polytrichastrum alpinum, Polytrichum juniperinum
available for the plant populations are areas with deposition
Hedw. and Syntrichia princeps (De Not.) Mitt. Populations of
of rock fragments or coarse non-consolidate sediments
Bryum spp. occured in wet areas and along drainage lines.
frequently moved and washed by the water from the
These communities can be found frequently in areas with
defrosting process. The vegetation is usually represented
soil, represented by large formations along the beach in the
by rare and small grass turf of Colobanthus quitensis and
central region of Demay Point.
Deschampsia antarctica. The most representative mosses
Moss tuft formation The moss tuft formations are characterized primarily by a floristic composition where moss populations predominate, without forming carpets or cushions, since the populations usually are isolated in small, more or less discontinuous spots. The biodiversity depends mainly on the presence of soil and the influence of guano. While Polytrichastrum alpinum, which is ornithocoprophilic, occurs primarily in areas near the bird colonies, Polytrichum juniperinum, which is ornithocoprophobous, grows in regions distant from the guano. Other moss species like Syntrichia spp. and Bryum spp. are frequent. Deschampsia antarctica and Colobanthus quitenses are represented by small and rare grass turf. In Demay Point, this community is represented in the north extremity, by a small area.
are small populations of Sanionia uncinata, Syntrichia spp. and Bryum spp., among others.
Conclusion The vegetation of Demay Point is apparently a continuity occurring in the region of Copacabana and in the coastal areas of Punta Thomas. However, it differs from the last ones by the little influence of the guano, since the population of birds is much smaller. Since it is located at the entrance of Admiralty Bay, the vegetation is different from the vegetation occurring in other areas with lower influence of the guano, like the Keller Peninsula and Hannequim Point, due to the fact that these areas face towards the interior of the bay, free of the action of the humidity from the winds of the open sea. The total vegetation cover on the studied areas is
Fruticose lichen and moss tuft formation
described as follows: Glass and cushion chamaephyte
The Fruticose lichen and moss tuft formations are
formation represents 2.43%, Deschampsia and moss sub-
characterized mainly by the predominance of Usnea
formations 0.09%, Moss carpet formations 2.52%, Moss
aurantiaco-atra (Jacq.) Bory and Usnea antarctica Du Rietz.
hummock formations 1.69%, Fruticose lichen and moss
populations. Other species of fruiticulous lichens usually
tuft formations 11.53% and Fellfield communities 81.73%.
Science Highlights - Thematic Area 2 |
61
Acknowledgements This work was supported by the Brazilian Antarctic Program through the CNPq (process nº. 574018/2008), FAPERJ (process E-26/170.023/2008), Ministry of Environment – MMA, Ministry of Science and Technology – MCT and CIRM.
References Allison, S.E. & Lewis-Smith, R.I. (1973). The vegetation of Elephant Island, South Shetland Island. British Antarctic Survey Bulletin, 33-34: 185-212. Braun-Blanquet, J. (1964). Plant Sociology: The study of plant communities. New York, McGraw-Hill. Lewis-Smith, R.I. (1988). Classification and ordination of cryptogamic communities in Wilkes Land, Continental Antarctica. Vegetatio 76: 155-66. Lewis-Smith, R.I. & Gimingham, C.H. (1976). Classification of cryptogamic communities in the maritime Antarctic. British Antarctic Survey Bulletin, 33-34: 89-122. Ochyra, R. (1998). The moss flora of King George Island Antarctica. Polish Academy of Sciences. Cracow, 198 p. Øvstedal, D.O. & Lewis-Smith, R.I. (2001). Lichens of Antarctica and South Georgia – A guide to their identification and ecology. Studies in Polar Research. Cambridge University Press. 411p. Pereira, A.B, & Putzke, J. (1994). Floristic composition of Stinker Point. Elephant Island, Antarctica. Korean Journal of Polar Research, 5(2): 37-47. Pereira, A.B.; Spielmann, A.A.; Martins, M.F.N. & Francelino, M. R. (2007) Plant Communities from ice-free areas of Keller Peninsula, King George Island, Antarctica. Oecologia Brasiliensis, 10(1): 14-22. Putzke, J. & Pereira, A.B. (1998). Moss communities of Rip Point in Northern Nelson Island, Antarctica. Pesquisa Antártica Brasileira, 3(1): 104-15. Putzke J. & Pereira, A.B. (2001). The Antarctic Moss with special reference to the Shetland Island. Canoas. Ed. ULBRA. Redón, J. (1985). Líquenes Antárticos. Instituto Antártico Chileno (INACH), Santiago de Chile. 123p. Skottsberg, C.J.E. (1912). Einigi Bemerkung über die Vegetationsverhaltnisse des Grahamlandes. Wissenchaftliche Ergebnisse der Schwedischen Südpolar Expedition - 1901-1903, 4(13):1-16. Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2009). Composition and distribution of moss formations in the ice-free areas adjoining the Arctowski region, Admiralty Bay, King George Island, Antarctica. Iheringia Série Botânica, 64(1): 81-91.
62
| Annual Activity Report 2010
2 GLOBAL PATTERNS IN SOIL BACTERIAL COMMUNITY COMPOSITION ACROSS A CONTINENTAL SCALE Leandro Nascimento Lemos1, Afnan Khalil Ahmad Suleiman1, Antônio Batista Pereira1, Luiz Fernando Wurdig Roesch1,* Universidade Federal do Pampa – UNIPAMPA, Campus São Gabriel, São Gabriel, RS, Brazil
1
*e-mail: luizroesch@unipampa.edu.br
Abstract: Although patterns of variation regarding macroorganisms have been studied extensively, the links between microbial biogeography and the environmental factors that shape microbial communities are largely unexplored. Here we tested the Baas Becking hypothesis for microbial community distribution by analysing the soil bacterial community from the Brazilian Pampa and King George Island, Antarctica. The genetic community structure was assessed by automated ribosomal intergenic spacer analysis (ARISA fingerprint). Bacterial patterns were quantified by using hierarchical clustering and by the detection of the shared taxonomic unities between the environments. Geographical patterns in bacterial community structure were detected by broad-spectrum (between samples from different geographic locations) and specific-spectrum (within samples from different geographic locations), suggesting that microbial communities exhibit biogeographic patterns at different scales and that, at least, some taxonomic unities have a wide distribution. These preliminary results support the idea that “everything is everywhere, but, the environment selects”. Key words: Antarctica, Brazilian Pampa, biodiversity, culture-independent technique
Introduction Biogeography is the study of the distribution of biodiversity
(de Wit & Bouvier, 2006; Martiny et al., 2006). It implies that
over space and time, which describes general trends
different contemporary environments maintain distinctive
and location of populations and their attributes into a
microbial assemblages but also implies that microorganisms
geographic context (Lomolino et al., 2006). Although
have such enormous dispersal capabilities that they rapidly
patterns of variation with respect to macroorganisms
erase the effects of past evolutionary and ecological events.
have been studied extensively, the links between microbial
This is especially important for monitoring and better
biogeography and the environmental factors (e.g. vegetation
understanding the impact of global changes on the Antarctic
cover, latitude, climate, temperature, and animal abundance)
terrestrial environment.
that shape microbial communities are largely unexplored.
Our understanding of the spatial distribution patterns
Some research studies support the idea that microbial
of microbial diversity is narrow because most studies are
communities differ in different places and the extent of
limited to local scales (for example, Chow et al., 2002;
this spatial variation is due to contemporary environmental
Hackl et al., 2004; Lamarche et al., 2007; Yergeau et al.,
factors and historical contingencies. This is the so-called Baas
2010). In this work we tested the Baas Becking hypothesis
Becking hypothesis for microbial community distribution:
by analysing the bacterial community across a broad
“everything is everywhere, but, the environment selects”
continental scale. Soils from two sites across the southern
Science Highlights - Thematic Area 2 |
63
hemisphere were chosen and samples included from
The amplification product fragments were then resolved
two continents, Antarctica (King George Island) and the
on a 2% agarose gel. Size standards were also resolved in
Americas (Rio Grande do Sul, Brazil).
separate wells to estimate the size of each PCR product. The Bray–Curtis similarity index was calculated to assess the degree of similarity among the samples and produce
Material and Methods Samples were collected from three distinct environments across a broad geographical scale and included a wellpreserved gallery forest and anthropogenic grassland under severe degradation in the Brazilian Pampa and soil samples from ice-free areas located in the northwest side of the Keller Peninsula at 1,300 m from the Brazilian Antarctic Base at King George Island, Antarctica (Table 1). Bacterial community composition was assessed by ARISA, a culture-independent technique for constructing bacterial community fingerprints based on the length heterogeneity of the intergenic transcribed spacer region of bacterial rRNA operons (Fisher & Triplett, 1999). A set of 21 soil samples (Table 1) were collected from the top 10 cm of the surface and microbial DNA was extracted directly from the soil samples using the MoBio Power Soil extraction kit (MoBio, Carlsbad, CA, USA). PCR was performed with the GoTaq PCR core system (Promega, Madison, WI, USA). The mixtures contained 5 ml of PCR buffer, 200 mM dNTPs, 100 mM of each primer, 2.5 U of Taq polymerase and approximately 100 ng of DNA template in a final volume of 50 µL. The primers used were S-D-Bact- 1522-b-S-20
a similarity matrix. The resulting matrices with pairwise similarities were used to group samples that represented similar bacterial community composition. Hierarchical clustering was calculated by using complete linkage algorithm and the results were represented by a dendrogram with the x axis representing the full set of samples and the y axis defining a similarity level at which two samples were considered to have fused. All data analyses for the ARISA bands were conducted using the software PRIMER 6 version 6.1.9 (PRIMER-E Ltd, Luton, UK). The overall fraction of taxonomic unities shared between the microbiome detected in the Brazilian Pampa and the Antarctica was determined by assessing the presence/absence of specific ARISA bands.
Results The first step in assessing habitat distributions for bacteria was to determine the degree of similarity among samples and group them based on the communities composition. The dendrogram depicting this cluster analysis is shown in Figure 1a. Bacterial communities were more similar within the Brazilian Pampa and Antarctica sites and least similar between both environments. Nevertheless the
and L-D-Bact-132-a-A-18 (Ranjard et al., 2001). Reaction
samples presented a high overall variability clustering
mixtures were held at 94 °C for 3 minutes, followed by
at low similarity even within the samples from the same
30 cycles of amplification at 94 °C for 45 seconds, 55 °C for
geographical location. Cluster III made up of five samples
1 minutes and 72 °C for 2 minutes and a final extension of
collected from Antarctica was fused at 30% similarity while
72 °C for 7 minutes.
Cluster I made up of most of the samples from the Brazilian
Table 1. Origin of the soil sample, location, elevation and number of samples collected in each environment analyzed.
64
Origin of soil
Latitude/longitude
Elevation
Number of samples
Gallery forest, Brazilian Pampa
30° 24’ 09.3” S 53° 52’ 59.1” W
140 m
10
Grassland, Brazilian Pampa
30° 24’ 08.9” S 50° 53’ 05.9” W
230 m
5
King George Island, Antarctica
62° 03’ 51.1” S 58° 24’ 47.5” W
32 m
6
| Annual Activity Report 2010
a
b
Figure 1. a) Dendrogram illustrating the arrangement of the clusters based on the presence/absence of ARISA fragments using DNA samples from gallery forest and grassland soil samples from the Brazilian Pampa and soil samples from defrosting areas in the King George Island, Antarctica. b) Venn diagram showing overall overlap of taxonomic unities between two microbial communities Antarctica and the Brazilian Pampa. The numbers are expressed in percentage of taxonomic unities.
Pampa was fused at 25% similarity. This result indicates a
Discussion
large spatial variability even between samples from similar
Since microbial composition affects ecosystem
environments. On the other hand, the dendrogram also
processes (McGrady-Steed et al., 1997), the motivation
shows a single cluster (Cluster IV) with 40% similarity
for understanding microbial biogeography extends
among samples made up of representatives from each
beyond drawing and interpreting a map of microbial
environment analysed denoting that there is a link between
diversity. Even under similar environmental conditions,
bacterial community composition. The cluster analysis encouraged us to examine bacterial diversity more directly using the ARISA bands to detect taxonomic unities that were in common between the Brazilian Pampa and the Antarctica samples. The results of this analysis are summarized in a Venn diagram, which presents the fraction of taxonomic unities that are unique and shared between both environments (Figure 1b). Several taxonomic unities were distinct to habitats (14.3 and
microbial communities from different environments might function differently. Therefore, a better understanding of microbial biogeography is essential to predict such effects (Martiny et al., 2006). In this study, ARISA profiles were assumed to be indicative of bacterial community composition, and differences in ARISA profiles were assumed to reflect variation in the composition of the respective bacterial communities. Although this technique lacks resolution and can bias the identification of potentially important groups
42.8% found only in Antarctica and the Brazilian Pampa
across the environment, the data collected allowed us to
respectively), while 42.8% of the taxonomic unities appeared
map the co-occurrence of microbial groups within two
to be shared between environments.
distinct environments separated by more than 3,700 km
Science Highlights - Thematic Area 2 |
65
and presenting distinct vegetation cover and climate. On
samples from different geographic locations), suggesting
the other hand, examples of bacterial endemism have been
that microbial communities exhibit biogeographic patterns
found among many research studies. Fulthorpe et al. (1998)
at different scales and that, at least, some taxonomic
found regional endemisim of 3-chlorwobenzoate degrading
units have a wide distribution. These preliminary results
soil bacteria sampled from six geographic regions at the level
support the idea that “everything is everywhere, but, the
of REP genotype (whole genome fingerprinting), but not at the ARDRA (16S rRNA) level. Cho & Tiedje (2000) used the same soil collection to isolate widely dispersed fluorescent Pseudomonads, and also found no geographic pattern at the ARDRA level, some at the ITS level, but strong endemicity at BOX genotype level. More recently, Wawrik et al. (2007) demonstrated the distinctiveness of New Jersey versus Uzbekistan actinomycete populations by looking at their polyketide synthase (PKS) genes. These studies demonstrate that geographic location and environmental conditions exert strong selection pressure on species composition. However the Taxonomic units found
environment selects”. Larger sampling and more powerful approaches would help to resolve the biases in studies involving molecular methods to determine the diversity of microorganisms and better understand the importance of the environmental and spatial factors in driving the composition of microbial communities.
Acknowledgements This work was supported by the Fundação de Amparo a Pesquisa do Estado do Rio Grande do Sul – FAPERGS (grant number 0901855) and the Instituto Nacional de
in our work were not extant and ubiquitous; at least 40% of
Ciência e Tecnologia Antártico de Pesquisas Ambientais
them were in fact present in the 21 samples tested.
- INCT-APA (CNPq process no. 574018/2008-5, FAPERJ E-26/170.023/2008, the Ministry of Science and Technology,
Conclusions
and the secretariat for the Marine Resources Interministerial
Geographical patters in bacterial community structure were
Committee (SECIRM). LFW Roesch and LN Lemos receive
detected at broad-spectrum (between samples from different
research fellowships from the CNPq (process number
geographic locations) and specific-spectrum (within
503370/2009-6).
References Cho, J.C. & Tiedje, J.M. (2000). Biogeography and degree of endemicity of fluorescent Pseudomonas strains in soil. Applied and Environmental Microbiology, 66(12): 5448-56. Chow, M.L.; Radomski, C.C.; McDermott, J.M.; Davies, J. & Axelrood, P.E. (2002). Molecular characterization of bacterial diversity in Lodgepole pine (Pinus contorta) rhizosphere soils from British Columbia forest soils differing in disturbance and geographic source. FEMS Microbiology Ecology, 42(3): 347-357, 2002. de Wit, R. & Bouvier, T. (2006). ‘Everything is everywhere, but, the environment selects’; what did Baas Becking and Beijerinck really say? Environmental Microbiology, 8(4): 755-8. Fisher, M.M. & Triplett, E.W. (1999). Automated approach for ribosomal intergenic spacer analysis of microbial diversity and its application to freshwater bacterial communities. Applied and Environmental Microbiology, 65(10): 4630-36. Fulthorpe, R.R.; Rhodes, A.N. & Tiedje, J.M. (1998). High levels of endemicity of 3-chlorobenzoate-degrading soil bacteria. Applied and Environmental Microbiology, 64(5): 1620-27. Hackl, E.; Zechmeister-Boltenstern, S.; Bodrossy, L. & Sessitsch, A. (2004). Comparison of diversities and compositions of bacterial populations inhabiting natural forest soils. Applied and Environmental Microbiology, 70(9): 5057-65.
66
| Annual Activity Report 2010
Lamarche, J.; Bradley, R.L.; Hooper, E.; Shipley, B.; Beaunoir, A.M.S. & Beaulieu, C. (2007). Forest floor bacterial community composition and catabolic profiles in relation to landscape features in Quebec’s Southern Boreal Forest. Microbial Ecology, 54(1): 10-20. Lomolino, M.V.; Riddle, B.R. & Brown, J.H. (2006). Biogeography. Third edition. Sinauer Associates. Martiny, J.B.H.; Bohannan, B.J.M.; Brown, J.H.; Colwell, R.K.; Fuhrman, J.A.; Green, J.L.; Horner-Devine, M.C.; Kane, M.; Krumins, J.A.; Kuske, C.R.; Morin, P.J.; Naeem, S.; Ovreas, L.; Reysenbach, A.L.; Smith, V.H. & Staley, J.T. (2006). Microbial biogeography: putting microorganisms on the map. Nature Reviews Microbiology, 4: 102-12. McGrady-Steed J.; Harris, P.M. & Morin, P.J. (1997). Biodiversity regulates ecosystem predictability. Nature, 390: 162-5. Ranjard, L.; Poly, F.; Lata, J.-C.; Mougel, C.; Thioulouse, J. & Nazaret, S. (2001). Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints: Biological and methodological variability. Applied and Environmental Microbiology, 67(10): 4479-87. Wawrik, B.; Kudiev, D.; Abdivasievna, U.A.; Kukor, J.J.; Zystra, G.J. & Kerkhof, L. (2007). Biogeography of actinomycete communities and type II polyketide synthase genes in soils collected in New Jersey and Central Asia. Applied and Environmental Microbiology, 73(9): 2982-9. Yergeau, E.; Bezemer, T.M.; Hedlund, K.; Mortimer, S.R.; Kowalchuk, G.A. & Van Der Putten, W.H. (2010). Influences of space, soil, nematodes and plants on microbial community composition of chalk grassland soils. Environmental Microbiology, 12: 2096-106.
Science Highlights - Thematic Area 2 |
67
3 CONSERVATION STATUS OF PLANT COMMUNITIES AT ULMANN POINT AND COMANDANTE FERRAZ ANTARCTIC STATION AREA, ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA, BASED ON THE INDEX OF ECOLOGICAL SIGNIFICANCE Filipe de Carvalho Victoria1,*, Margéli Pereira de Albuquerque2, Antonio Batista Pereira2 1
Plants Genomics Center, Universidade Federal de Pelotas – UFPel, Capão do Leão, RS, Brazil 2 Universidade Federal do Pampa – UNIPAMPA, São Gabriel, RS, Brazil *e-mail: filipevictoria@gmail.com
Abstract: The aim of this study has been to research the conservation status of the plant communities in ice-free areas of Ullmann Point and Comandante Ferraz Antarctic Station vicinities, Admiralty Bay, King George Island, Antarctica. The study started with the classification and description of the plant communities based primarily on phytosociological and biodiversity data. The coverage degree and frequency of each species found was used to calculate the index of ecological significance. At Ullmann Point 12 plant species were found in higher frequency, when at Ferraz beach only 9 highly frequent species were found. The most important species in both studied areas were Sanionia uncinata (Hedw.) Loeske. Syntrichia princeps and Bryum pseudotrichetrum were found associated with the most important species at Ullmann Point and Ferraz Station beach respectively. These results have demonstrated the fragility of plant communities in Maritime Antarctica, based on the low frequency and coverage of moss species known in this area. Keywords: Antarctic mosses conservation, ice-free areas, plant communities
Introduction
68
Considering the physiognomy and the floral composition
especially flowering plants, since such conditions inhibit
of plant communities of the Admiralty Bay ice-free areas
the reproductive cycle. For this reason, only two species
(62° 03’ 40” – 62° 05’ 40” S and 58° 23’ 30”– 58° 24’ 30” W),
of flowering plants are known in Antarctica, Deschampsia
evidence has been found that these communities are very
antarctica Desv. and Colobanthus quitensis Kunth. On the
different from those identified in other islands of Maritime
other hand, moss and lichen species are more adaptable, so
Antarctica. In Antarctica, summer is short and cold,
much so that they have developed well in polar conditions
with a maximum temperature around zero °C. During
being the main representative plants of Antarctica (Putzke
this period, permanent rainy periods and strong snow
& Pereira, 2001). The moss formations are most expressive
precipitations are common (Rakusa-Suszczewski et al.,
and complex in ice-free areas, occurring mainly in tufts
1993). For Pereira and Putzke (1994), these conditions,
and carpets at lower levels such as beach and drainage lines
along with those imposed by a long dark winter, also create
(Victoria et al., 2009), but moss cushion species can be
limitations for the occurrence of plant species in the region,
observed on rocky outcrops of marine emerged tablelands
| Annual Activity Report 2010
(Schaeffer, 2004) as well on rocks next to bird colonies
Pereira (1990). The index of ecological significance (IES)
(Pereira & Puztke, 1994).
was calculated based in the Lara and Mazimpaka (1998), as
In order to complement the knowledge of plant
follows: IIE = F(1 + C), where: F is the relative frequency of
communities in the ice-free areas of Admiralty Bay,
the species in the area or habitat (generated by the number
communities of lichens and mosses observed during a
of occurrences (x) divided by the total number of samples
phytosociologic study of the region are described. A status
considered (n): F = 100x/n. C is the average coverage of
of conservation of these species based on the coverage
the specie in the samples: C = Σ(ci)/x; where ci is the cover
and frequency of most representative species sampled are
class and x, the number of sampling points in which the
presented.
species occur.
Materials and Methods
Results and Discussion
During the 2004/2005 austral summer, plant communities
It was possible to verify the occurrence of 4 moss species in
in the vicinities of Comandante Ferraz Station, beside the
the adjoining area of Comandante Ferraz Station (Table 1)
Cousteau Whale’s, and at Ullmann Point beach were studied.
and 9 moss species at Ullmann Point beach (Table 2) such
This study started from the phytosociological survey,
as the most frequent species considering the 58 moss species
using Braun-Blanquet (1932) quadrats method, adapted
found in Admiralty Bay. The lichen Psoroma cinnamomeum
to Antarctic conditions (Kanda, 1986). After throwing c.a
Malme was verified as being the most frequent lichen. The
160 quadrats of 25 × 25 cm, within an altitude gradient
two flowering plants know in Antarctica were observed at
varying from sea level up to about 150 m high. Whenever
lower frequencies when compared with the most frequent
possible, samples of lichens with highly developed ascomas
species found in both studied areas.
(presence of apothecia or perithecia) were made. Saxicolous
However with the IES of each species it was possible to
species were collected with the help of a geologists’ hammer,
verify that most of them can be easily seen in the area, in
and muscicolous and/or terricolous species, with the help
despite of the lower coverage (IES > 50). Compared with
of a knife, to guarantee that individuals would collect
other initiatives these two areas are less complex, with a
them with some substrate. High coverage moss species or
lower number of species in higher abundance and coverage
dominant lichen species were also sampled. Identification
(Ochyra, 1998; Victoria et al., 2009). These results can be
of the species was based on the work of Redon (1985),
representative of the sensibility of these plant communities
Ochyra (1998), Pereira and Putzke (1994) and Putzke and
to environmental changes, since this species was found in
Table 1. The most frequent species found in Comandante Ferraz Antarctic Station vicinities. C = average coverage. F = frequency for each species in all samples. IES= Index of ecological significance.
Species
C(*)
F (%)
IES
Bryum pseudotriquetrum (Hedw.) Schwaegr.
1
68.18
136.36
Hennediella heimii (Hedw.) Zand.
0.28
22.72
27.89
Syntrichia saxicola (Card.) Zand.
0.09
9.09
9.91
Sanionia uncinata (Hedw.) Loeske
3.59
95.45
438.22
Deschampsia antarctica Desv.
0.36
36.36
49.58
Colobanthus quitensis Kunth.
0.09
13.63
14.87
Leptogium sp.
0.02
4.54
4.64
Psoroma cinnamomeum Malme
0.18
18.18
21.48
*Coverage classes - 1(1-10%), 2(11-25%), 3(26-50%), 4(51-75%) and 5(75-100%).
Science Highlights - Thematic Area 2 |
69
Table 2. The most frequent species found at Ulmann Point. C = average coverage. F= frequency for each species in all samples. IES= Index of ecological significance.
Species
C(*)
F(%)
IES
Bryum dichotomum Hedw.
0.03
5
5.18
Bryum orbiculatifolium Card. Et Broth.
0.15
15
17.25
Bryum pseudotriquetrum (Hedw.) Schwaegr.
0.63
32.5
53.21
Brachythecium austrosalebrosum (C. Muell.) Kindb.
0.05
5
5.25
Polytrichastrum alpinum (Hedw.) G.L.Smith
0.27
17.5
22.31
Syntrichia princeps (De Not.) Mitt
0.91
60
114.75
Syntrichia saxicola (Card.) Zand.
0.17
10
11.75
Sanionia uncinata (Hedw.) Loeske
1.82
70
197.75
Deschampsia antarctica Desv
0.57
40
63
Polytrichum juniperinum Hedw
0.07
7.5
8.06
Colobanthus quitensis Kunth.
0.21
22.5
27.28
Psoroma cinnamomeum Malme
0.41
30
42.37
*Coverage classes - 1(1-10%), 2(11-25%), 3(26-50%), 4(51-75%) and 5(75-100%).
small patches and populations, indicating lower resistance
proximity of Ferraz this species being the most frequent
and resilience. Whenever the relationships within the
in the plant communities, occurring in 95% of samples
organisms was reduced (Schaefer et al. 2004), the impacts
and having an average of 50% coverage in each sample. At
in these species were subject to irreversibility (Victoria &
Ullmann Point this species occurs with a 70% frequency
Pereira, 2007).
and has a mean coverage of 25% per sample. For this
For example, we can cite the most frequent Bryum species found. Bryum pseudotriquetrum (Hedw.) Schwaegr. and Bryum orbiculatifolium Card. Et Broth. Depends on ice melting found in the water lines in the austral summer (Allison & Lewis-Smith 1973; Kanda 1986). B. pseudotrichetrum showed a high abundance in our samples and can be considered a lower degree threatened species compared to B. orbiculatifolium. The size of B. pseudotrichetrum population provides a better response in the case of fast environmental changes, perhaps indicating better adaptative success related of a higher coverage level (Lewis-Smith 2001). Ochyra (1998) reports Sanionia uncinata (Hedw.) Loeske and Polytrichastrum alpinum (Hedw.) G.L.Smith as the most
70
reason this species can be considered the most important in studied plant communities (IES/Ferraz = 438.22; IES/Ullmann = 197.75). These results were also encountered by Victoria and Pereira (2007) for the Arctowski region and Hennequin Point (IES = 215.20 and IES = 153.54, respectively). P. alpinum was found in other areas of Admiralty Bay being the second most important species (Ochyra, 1998; Victoria & Pereira 2007; Victoria et al., 2009), but in the present study the latter did not occur, in that these species were encountered only at Ullmann Point in a lower frequency (17%). B. pseudotrichetrum, for Ferraz beach, and Syntrichia princeps (De Not.) Mitt, for Ullmann Point were recorded as the second most important species
abundant moss species in the Maritime Antarctic, being
for each area (IES = 136.36 and IES = 114.75, respectively),
at lower risk of threats compared with other moss species
perhaps because of the lower complexity of these two plant
in this area. For Ullmann Point and Comandante Ferraz
communities sampled, whereby these communities consist
beach the latter was also observed only for first species. S.
mainly of fellfield species, like these two species mentioned
uncinata occurred in higher frequency and coverage, in the
(Victoria et al., 2004).
| Annual Activity Report 2010
The others frequent moss species were found as
combustibles and produces high amounts of residues,
important species for the plant communities at Hennequin
creating unclear impacts in Antarctica wildlife (ATCPs
Point and in the Arctowski region (Victoria & Pereira,
1993; Olech 1996).
2007), except for Hennediela heimii (Hedw.) Zand, which was encountered in higher frequency in Ferraz beach in the present study compared with other areas. All moss species, as well as the land biota found in Admiralty Bay, were directly and indirectly affected
This study demonstrates the fragility of moss formation in the in ice-free areas of Maritime Antarctica. A descriptive data bank can collaborate towards the continued monitoring of plant communities, contributing to the conservation of
by human presence. The maintenance of scientists and
plant species in Admiralty Bay area. The phytossociological
military personnel inside and outside of research stations,
studies can contribute to the management of scientific
shelters and camps, involves a high consumption of fossil
activities related to the Brazilian Antarctic Program.
References Allison, J.S. & Lewis-Smith, R.I. (1973). The vegetation of Elephant Island, South Shetland Islands. British Antarctic Survey Bulletin, 33-34: 185-212. ATCPs. (1993). Protocol on Environmental Protection to the Antarctic Treaty, with Annexes. Polar Record, 29(170): 256-75. Braun-Blanquet, J. (1932). Plant Sociology: The study of plant communities. New York, McGraw-Hill. Kanda, H. (1986). Moss communities in some ice-free areas along the Söya Coast, East Antarctica. Memoirs of Natural. Institute of Polar Research, Special Issue. 44: 229-40. Lara, F. & Mazimpaka, V. (1998). Sucession of epiphytic bryophytes in a Quercus pyrenaica forest from Spanish Central Range (Iberian Peninsula). Nova Hedwigia, 67: 125-38. Lewis-Smith, R. I. (2001). Plant Colonisation Response to climate change in the Antarctic. Folia Fac. Sci. nat. Univ. Masarykianae Brunensis, Geográica, 25: 19-33. Ochyra, R. (1998). The moss flora of King George Island Antarctica. Polish Academy of Sciences. Cracow. Olech, M. (1996). Human impact on terrestrial ecosystems in West Antarctica. Proccedings of NIPR Symposium on Polar Biology, 9: 299-306. Pereira, A.B. & Putzke, J. (1994). Floristic composition of Stinker Point. Elephant Island, Antarctica. Korean Journal of Polar Research, 5(2): 37-47. Putzke, J. & Pereira, A.B. (1990). Mosses of King George Island. Pesquisa Antártica Brasileira. 2(1): 17-71. Putzke, J. & Pereira, A.B. (2001) The Antarctic Mosses with special reference to the Shetland Island. Canoas, Ed. ULBRA. Rakusa-Suszczewski, S.; Mietus, M. & Piasecki, J. (1993). Weather and Climate. In: Rakusa-Suszczewski, S. (Ed.) The Maritime Antarctic Coastal Exosystem of Admiralty Bay, Departamente of Antarctic Biology, Polish Academy of Sciences. Redón, J. (1985). Líquenes Antárticos. Instituto Antártico Chileno (INACH), Santiago de Chile. Schaefer, C.E.G.R.; Dias, L.E.; Albuquerque, M.A.; Francelino, M.R.; Costa, L.M. & Ribeiro, J.R.E.S. (2004). Monitoramento ambiental e avaliação dos impactos nos ecossistemas terrestres da Antártica Marítima: Princípios e aplicação. In: Schaefer, C.E.G.R.; Simas, F.N.B.; Filho, M.R.A. (Eds.). Ecossistemas costeiros e monitoramento ambiental da Antártica Marítima. Baía do Almirantado, Ilha Rei George. Viçosa, NEPUT.
Science Highlights - Thematic Area 2 |
71
Victoria, F.C. & Pereira, A.B. (2007). Índice de valor ecológico (IES) como ferramenta para estudos fitossociológicos e conservação das espécies de musgos na Baia do Almirantado, Ilha Rei George, Antártica Marítima. Oecologia Brasiliensis, 11(1): 50-55. Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2004). Characterization of plant communities in ice-free areas adjoining the Polish Station H. Arctowski, Admiralty Bay, King George Island, Antarctic. Actas del V° Simposio Argentino y I° Latinoamericano sobre Investigaciones Antárticas 2004, Resúmen Expandido N° 202BB. Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2009). Composition and distribution of mos formations in the ice-free areas adjoining the Arctowski region, Admiralty Bay, King George Island, Antarctica. Iheringia Série Botânica, 64(1): 81-91.
72
| Annual Activity Report 2010
4 INSECTICIDAL EFFECTS OF ANTARCTIC ALGAE Prasiola crispa EXTRACT IN THE ADULT FRUIT FLY Drosophila melanogaster Thaís Posser1,*, Betina Kappel Pereira2, Ana Paula Pegoraro Zemolin1, Cháriston André Dal Belo1, Antonio Batista Pereira3, Jeferson Luis Franco1 1
Centro Interdisciplinar de Pesquisas em Biotecnologia, Universidade Federal do Pampa –UNIPAMPA, São Gabriel, RS, Brazil 2 Colégio Cristo Redentor, Universidade Luterana do Brasil –ULBRA, Canoas, RS, Brasil 3 Universidade Federal do Pampa –UNIPAMPA, São Gabriel, RS, Brazil *e-mail: thaisposser@unipampa.edu.br
Abstract: In the present study, we aimed to investigate the toxic effects of Prasiola crispa extract on a fruit fly (Drosophila melanogaster) model. Toxicity was assessed as % mortality, negative geotaxis behaviour and acetylcholine esterase (AchE), glutathione S-transferase (GST), catalase (CAT) activities as well as glutathione content (GSH) and hydroperoxide formation. Administration of algae extract (2 mg/mL) to flies for 24 hours resulted in a massive increase in mortality (7.6 fold increase, compared to control). A significant increase in climbing performance, indicating an alteration in negative geotaxis behaviour, was also observed. The AchE activity was unchanged after algae extract treatment for 24 hours. However, GST activity was significantly increased after Prasiola crispa administration. The CAT activity was significantly diminished in flies that received algae extract for 24 hours. Glutathione levels and hydroperoxide formation remained unchanged. Our results show for the first time the toxic effects of an Antarctic algae extract in Drosophila melanogaster. The insecticide action of Prasiola crispa may be related to changes on vital antioxidant systems. Further studies are necessary to elucidate the exact mechanisms of toxicity of this Antarctic alga to Drosophila melanogaster. Keywords: Prasiola crispa, toxicity, Drosophila melanogaster, Antarctica
Introduction The insecticidal properties of a number of plants have been
for plant of the genus Prasiola sp. (Mostaert et al., 2006),
investigated for thousands of years, and some of the plants
highlighting the biotechnological importance of this
can substitute many synthetic means of control (Sujatha,
organism. A study carried out with three Antarctic plant
2010). In this respect, it is important to emphasize that
species (Deschampsia antarctica Desv., Colobanthus quitensis
natural agents are environmentally less harmful than
(Kunth) Bartl., and Polytrichum juniperinum Hedw), have
synthetic pesticides. Moreover, natural agents can act in
demonstrated low toxic effects for mammalian and non-
many insects in different ways (Sujatha, 2010).
mammalian cells, associated with protective effects against
Prasiola crispa is a terrestrial eukaryotic green alga
UV-induced damage (Pereira et al., 2009).
from Antarctica continent. Although there are no studies
It has been recognized that organisms living in Polar
targeting the biological effects of this algae, interesting
Regions, are subject to extreme environmental conditions.
characteristics, like adhesive properties has been described
This fact has led to the development of natural strategies
Science Highlights - Thematic Area 2 |
73
extreme environmental conditions on Earth. Among these
Drosophila culture and Prasiola crispa extract treatment
strategies of adaptation is the production of photoprotective
Flies were maintained at 25 °C on a standard diet
compounds, such as mycosporine-like amino acids,
(Golombieski et al., 2008). For P. crispa extract exposition
scytonemim secreted by cyanobacteria and flavonoids
experiments, 60 male adult flies were placed in a vial
secreted by plants (Pereira et al., 2009). This fact emphasizes
containing cotton wool soaked in 2 M sucrose with or
the importance of studies concerning the biological effects
without dissolved Prasiola crispa extract (2 mg/mL). The
of these organisms, which may present in its constitution a
flies were maintained under these conditions up to 24 hours.
combination of chemical compounds normally not found
Finished the period of treatment, 15 individual flies were
in other organisms.
submitted to behavioural test and a total of 45 flies were
that enable the survival of these organisms under the most
In this respect, the main aim of this study was to evaluate the effects of the extract of the terrestrial eukaryotic green alga from Antarctica, Prasiola crispa on survival of adult D. melanogaster, and in parallel, to verify a possible modulation of antioxidant enzymes activity and locomotor performance in response to the exposure of this organism to the Prasiola crispa extract. The fruit fly Drosophila melanogaster, belongs to the order Diptera
was repeated 3 times using different fly cultures.
Flies mortality Finished the treatments, the number of dead flies were counted and plotted as percent of total flies.
Negative geotaxis and response to flight test Locomotor ability was determined though the negative
and family Drosophilidae. This model is recognized for its
geotaxis assay as described by Bland et al. (2009), with some
high sensitivity to toxic substances, thus being considered a
modifications. For the assays, 15 adult flies were anesthetized
bioindicator for detection of pollutants and also to test the
and placed separately in a vertical glass column (length,
biological action of natural substances.
25 cm; diameter, 1.5 cm) (Jimenez-Del-Rio et al., 2010). The
Materials and Methods Plant material Prasiola crispa (Lightfoot) Kützing (1843) was collected in the ice-free areas near Arctowski Polish Base Region, Admiralty Bay, King George Island (61° 50’ - 62° 15’ S and 57° 30’ - 59° 00’ W), Antarctica. The plants were dried in
74
homogenized for biochemical analysis. Each experiment
assays were repeated three times at 1 minute intervals. After 30 minutes recovery, individual flies were gently tapped to the bottom of the column and the time required to reach 8 cm in the columns was registered. To test the response to flight of the insects, the flies were gently tapped to the bottom of a glass flask. After 30 seconds, the numbers of flies remaining in the base and in the top of the flask were counted.
a dark chamber with circulating air at 40 °C and stored
Biochemical measurements
in dark bags in a freezer. The dried and powdered plant
Flies were homogenized in 0.1 M phosphate buffer
material (about 100 g) was submitted to extraction using
pH 7.0 and centrifuged at 1000 g for 5 minutes (4 °C).
methanol (powder/solvent ratio = 1:10 w/v) by maceration
The supernatant was isolated and an aliquot separated for
at room temperature. After 24 hours of extraction the sample
determination of acetylcholinesterase activity, glutathione
was filtered through Whatman number 1 filter paper and
and hydroperoxide content based on protocols previously
the same plant material was extracted again with another
described (Franco et al., 2009). The remaining supernatant
1000 mL of methanol. This procedure was repeated for
was then centrifuged at 20,000 g for 30 minutes. The resulted
3 days, after which the methanolic solutions were combined
supernatant was used for determination of glutathione
and evaporated to dryness under reduced pressure by rotary
S-transferase (GST) and catalase (CAT) activity according
evaporator at 40-50 °C to obtain the methanolic extracts.
to methods described earlier (Franco et al., 2009).
| Annual Activity Report 2010
a
b
c
Figure 1. Drosophila melanogaster mortality and behaviour after treatment with Prasiola crispa extract. Flies were treated for 24 hours with 2 mg/mL. After treatment, (a) mortality was observed for a period of 24 hours. Surviving flies were used for determination of (b) negative geotaxis behaviour and (c) response to flight. Statistical significance was assessed by Student’s t-test. *p<0.05.
Table 1. Enzyme activities, glutathione and hydroperoxide levels.
AchE (mU/mg protein)
GST (mU/mg protein)
CAT (mU/mg protein)
GSH (µmol/mg protein)
Hydroperoxides (nmol/mg protein)
Control
30.1 ± 5.0
92.9 ± 15.5
159.4 ± 8.3
0.20 ± 0.03
0.26 ± 0.001
Extract
27.2 ± 0.4
141.1 ± 13.3*
128.2 ± 12.8*
0.23 ± 0.001
0.24 ± 0.004
Statistical significance was assessed by Student’s t-test. *p<0.05.
Results
search for novel biopesticides are ongoing. In the present
Treatment of flies with 2 mg/mL of Prasiola crispa extract
study, we investigated the potential insecticidal action of
resulted in a substantial increase (7.6 fold increase, p < 0.05)
an Antarctic algae extract. It has been reported that plant
in mortality after 24 hours (Figure 1a). An increase in
derived compounds may pose toxicity to a wide range of
neurolocomotor activity, assessed by negative geotaxis
insects including flies and cockroaches (Kiran et al., 2007).
behaviour was also observed. In this task, flies that received
Plant derived chemicals such as terpenoids and flavonoids
algae extract were significantly more efficient (p < 0.05) in climbing performance (Figure 1b). Fly response was not altered by algae extract administration during 24 hours (Figure 1c). Acetylcholine esterase activity (AchE), glutathione levels (GSH) and hydroperoxide formation (LPO) was not changed after Prasiola crispa extract administration to Drosophila melanogaster for 24 hours (Table 1). However, it was possible to observe a significant increase (p < 0.05) in glutathione S-transferase (GST) activity while catalase
have been studied for their insect repellent activity as well as antimicrobial action (Bell et al., 1990; Ndemah et al., 2002). Our results demonstrated that exposure of fruit flies to a 2 mg/mL solution of Prasiola crispa, for 24 hours caused signs of toxicity related to disruption of neurobehavioural function as well as important cell defence antioxidant systems. Treatment of flies with algae extract caused a massive increase in mortality. This effect was accompanied by changes in negative geotaxis, a commonly used
(CAT) was significantly inhibited (p < 0.05) in flies treated
behaviour addressed to assess neurolocomotor function
with 2 mg/mL of algae extract (Table 1).
in Drosophila melanogaster. This result suggests that Prasiola crispa extract toxicity may be related to a potential
Discussion
interaction of phytochemicals derived from this plant with
Commercial insecticides and repellents with lower
neurotransmission systems involved in the regulation of
mammalian toxicity are desirable and studies focusing the
such behavioural task.
Science Highlights - Thematic Area 2 |
75
Glutathione S-transferase is an important antioxidant
still remain to be elucidated, however, interaction with
enzyme and is involved in phase II detoxification systems
antioxidant systems may be pointed out as a clue in further
(Sau et al., 2010). The observed increased GST activity
studies.
in Drosophila melanogaster exposed to Prasiola crispa extract may be related to an adaptive response related to an increased elimination of toxic plant derivatives. The inhibition of CAT activity may also be an important mechanism of toxicity of the extract, since this enzyme has a crucial role in the clearance of hydrogen peroxide from cells (Aebi, 1984). The disruption of cell defence antioxidant systems has been pointed out as a central mechanism of action in a variety of models of investigation of drug/
This study comprehends part of the work of Brazilian researchers from the “Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais INCT-APA” related to Antarctic plant chemistry and its biotechnological applications. It is believed that knowledge on the biotechnological potentials of Antarctic plants, in addition to research on plant/communities biology and evolving processes are essential to the preservation of these
compound toxicity (Franco et al., 2009).
natural resources.
Conclusion
Acknowledgements
In conclusion, our results show preliminary data on the
Authors acknowledge the “Instituto Nacional de Ciência e
insecticidal effects of Prasiola crispa extract in a Drosophila
Tecnologia Antártico de Pesquisas Ambientais - INCT-APA”,
melanogaster model. The exact mechanisms of toxicity
CNPq (574018/2008-5) and FAPERJ (E-16/170.023/2008).
References Aebi, H. (1984). Catalase in vitro. Methods in Enzymology, 105:121-6. Bell, A.E.; Fellows, L.E. & Simmonds, S.J. (1990). Natural products from plants for the control of insect pests. In: Hodgson, E. & Kuhr, R.J., (Eds.). Safer insecticide development and use. Marcel Dekker. USA. Bland, N.D.; Robinson, P.; Thomas, J.E.; Shirras, A.D.; Turner, A.J. & Isaac, R.E. (2009). Locomotor and geotactic behavior of Drosophila melanogaster over-expressing neprilysin 2. Peptides 30:571-4. Franco, J.L.; Posser, T.; Mattos, J.J.; Trevisan, R.; Brocardo, P.S.; Rodrigues, A.L.; Leal, R.B.; Farina, M.; Marques, M.R.; Bainy, A.C. & Dafre, A.L. (2009). Zinc reverses malathion-induced impairment in antioxidant defenses. Toxicology Letters, 187:137-43. Golombieski, R.M.; Graichen, D.A.; Pivetta, L.A.; Nogueira, C.W.; Loreto, E.L. & Rocha, J.B. (2008). Diphenyl diselenide [(phse)2] inhibits Drosophila melanogaster delta-aminolevulinate dehydratase (delta-ala-d) gene transcription and enzyme activity. Comparative Biochemistry and Physiology - Part C: Toxicology & Pharmacology, 147(2):198-204. Jimenez-Del-Rio, M.; Guzman-Martinez, C. & Velez-Pardo, C. (2010). The effects of polyphenols on survival and locomotor activity in Drosophila melanogaster exposed to iron and paraquat. Neurochemical Research, 35(2):227-238. Kiran, S.R.; Devi, P.S. & Reddy, K.J. (2007). Bioactivity of essential oils and sequiterpenes of Chloroxylon swietenia DC against the Helicoverpa armigera. Current Science, 93:544-8. Mostaert, A.S.; Higgins, M.J.; Fukuma, T.; Rindi, F. & Jarvis, S.P. (2006). Nanoscale mechanical characterisation of amyloid fibrils discovered in a natural adhesive. Journal of Biological Physics, 32(5): 393-401. Ndemah, R.; Gounou, S. & Schulthess, F. (2002). The role of wild grasses in the management of lepidopterous stem-borers on maize in the humid tropics of Western Africa. Bulletin of Entomological Research, 92(6): 507-19.
76
| Annual Activity Report 2010
Pereira, B.K.; Rosa, R.M.; da Silva, J.; Guecheva, T.N.; Oliveira, I.M.; Ianistcki, M.; Benvegnu, V.C.; Furtado, G.V.; Ferraz, A.; Richter, M.F.; Schroder, N.; Pereira, A.B. & Henriques, J.A. (2009). Protective effects of three extracts from antarctic plants against ultraviolet radiation in several biological models. Journal of Photochemistry and Photobiology B: Biology, 96(2):117-29. Sau, A.; Pellizzari, T.F.; Valentino, F.; Federici, G. & Caccuri, A.M. (2010). Glutathione transferases and development of new principles to overcome drug resistance. Archives of Biochemistry and Biophysics, 500(2): 116-22. Sujatha, S. (2010). Essential oil and its insecticidal activity of medicinal aromatic plant Vetiveria zizanioides (L.) against the red flour beetle Tribolium castaneum (Herbst). Asian Journal of Agricultural Sciences 2(3):84-8.
Science Highlights - Thematic Area 2 |
77
5 PENGUIN COLONIES AND WEATHER IN ADMIRALTY BAY IN A COLDER YEAR Maria Virginia Petry1,*, Rafael Gomes de Moura1, Lucas Krüger1 Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, São Leopoldo, Rio Grande do Sul, Brazil
1
*e-mail: vpetry@unisinos.br
Abstract: Climate change will affect many species in the next decades. Antarctic seabirds are of special concern given their dependence on the balance of sea ice-caps. The objective of this paper is to present information about weather and penguin colonies in the last extreme cold summer of 2009/2010. We verified the average temperature in November (beginning of seabird breeding) which was lower than for most years since 1987 with a slight tendency to decline, and thus the number of snow days was also high in relation to the period average, with a tendency to increase in time. The Adelie Penguin has the biggest colony area followed by Chinstrap Penguin, while Gentoo Penguin has the smallest area. As seabirds breed on ice-free areas, the joint effect of lower temperatures and enhanced precipitation in Spring can affect habitat availability for nesting, potentially disrupting reproduction timing and the future breeding population and success. Keywords: air temperature, climate change, ice-fre areas, Pygoscelids genus
Introduction Climate change may affect a great number of species in
phenomenon was characterized by the lowest temperatures
the next decades (Walther et al., 2002; Thomas et al.,
in the last 40 years (INPE, 2010).The aim of this study is to
2004). Antarctic seabirds may be particularly sensitive to
describe this phenomenon and evaluate its potential effect
climate change since they rely on sea ice cap dynamics,
on the area of penguin colonies at Admiralty Bay.
which is the factor behind the Antarctic food web balance
78
(Smetacek et al., 1990). The penguins remain on the edge
Materials and Methods
of sea ice caps during the winter months, depending on
The study was conducted in all the ice-free areas of
the Antarctic resources even then, thus they are still more
Admiralty Bay, King George Island, South Shetlands in
affected by severe weather variations (Ballerini et al., 2009;
the 2009/2010 summer. The summer was characterized by
Dugger et al., 2010) more than flying Antarctic Seabirds
lower temperatures than the average for previous years. The
(Santora et al., 2009). In the last 2009/2010 summer, the
average summer temperature in Admiralty bay between
temperature conditions and ice-free areas were limiting
1987 and 2009 was 1.7 °C, while the average in 2009/2010
factors for most penguin colonies in Admiralty Bay. The
was 0.6 °C (INPE, 2010). The average temperature at the
enhanced snow accumulation, as a consequence of a
beginning of seabird breeding (November) was even lower
rigorous winter registered by the Instituto Nacional de
than in most years (Figure 1a), and also snow days were
Pesquisas Espaciais (INPE, 2010), lasted until mid-February,
relatively high (Figure 1b). The effect of higher precipitation
when most areas were expected to be ice-free. This weather
with lower temperatures was the reason for late snow
| Annual Activity Report 2010
accumulation. The areas were visited by boat or on foot,
dimensions in the last summer have provided strong
and all the periphery of penguin colonies were mapped
indications of how penguins will answer to predicted
through GPS receivers.
weather in Admiralty Bay. The ice-free lands are the most
2010
points, Chabrier Rock and Demay Point (Figure 3).
0 2008
Adelie only at Point Thomas, while Gentoo occurred in two
5
2006
smallest amount of area. We found colonies of Gentoo and
10
2004
in Admiralty Bay, while Gentoo Penguins occupied the
15
2002
Penguins showed the greatest amount of occupied area
2000
and Chinstrap (P. antarctica, Figure 2c) (Table 1). Adelie
b
20
1988
Gentoo (P. papua, Figure 2a), Adelie (P. adelie, Figure 2b)
–3
1989
We found a total of 10 colonies of the three Pygoscelis species:
–2
1984
Results
0 –1
1982
the average.
1
1989
precipitation, despite the greater annual variation below
a
2
1987
trend of enhancement in the number of days with snow
Snow day on beginning of season
trend in average temperature since the 80’s, and a slight
Temperature on beginning of season (°C)
Figure 1 shows that there has been a slight declining
Year
Discussion Our results aim only to describe the colonies during the especially cold weather event without assuming any trend, but the distribution of colonies and their analyzed
a
Figure 1. Weather at the beginning of the seabird breeding season (November) in Admiralty Bay: monthly average temperature (a) and cumulative number of days with snow precipitation. The average temperature in these years is –0.1 °C ± 1.2, and the average snow days are 11.9 ± 5. Thus, 2009/2010 summer was a relatively cold season (–2.2 °C) with snow days above average (17).
c
b
Figure 2. Pygoscelids species that breed at Admiralty Bay: (a) Gentoo P. papua, (b) Adelie P. adeliae, and (c) Chinstrap P. antarctica.
Science Highlights - Thematic Area 2 |
79
used locations by these species, and the joint effect of greater
indicate a cooling in Antarctica in different seasons, and
precipitation and lower temperatures has an immediate
although the peninsula tends to warming, South Shetlands
disrupting effect on the future reproduction of these species
average temperature, in particular, is showing a slight decline
of penguin. We can not justify the effects of temperature on
in Spring. This season is fundamental for breeding seabirds
population trends, but the effect of weather is indicative,
as it is the moment they start reproduction, choosing nesting
verified by climate research (Doran et al., 2002; Turner et al., 2005), related to penguins. The several research studies
Table 1. Number of Breeding Groups and total colony areas of each Pygoscelis species at Admiralty Bay in the 2009/2010 breeding season.
ice-free areas available at this time and lack of availability can delay the start of reproduction lowering the average success of a colony (Barbraud &Weimerskirch, 2006). Also, late snow-storms and cold fronts can cause greater egg loss and nest abandonment by adults (Mallory et al., 2009),
Penguin species
Number of breeding groups
Total area (m2)
Chinstrap
7
2469
Elephant Island as well. Other studies provide evidence of
Adelie
1
7704
the negative effect of enhanced cold for penguins, affecting
Gentoo
2
47
success, adult survival and size of the breeding population
Figure 3. Penguin Colonies at Admiralty Bay in the 2009/2010 breeding season.
80
places and re-establishing their colonies. Seabirds rely on the
| Annual Activity Report 2010
as observed in our field samples at Admiralty Bay and in
(Croxall et al., 2002; Ballerini et al., 2009; Lescröel et al.,
breeding populations to ice and temperature variation as
2009; Dugger et al., 2010).
well; in this way enabling that our expectations can be tested.
Conclusion
Acknowledgements
Extreme weather events can potentially affect seabird
Brazilian data sampling received support from INCT-
population parameters and colony dynamics. As is expected
APA (CNPq Process no. 574018/2008-5, FAPERJ
by weather in Admiralty Bay, the possible scenarios are not
E-26/170.023/2008), WCS (Wildlife Conservation Society)
favourable in an a priori assumption. Our analysis must in
and supported by the Ministry of Environment, Ministry of
the future include the timing between ice-free areas and
Science and Technology, and the Secretariat for the Marine
penguin breeding, plus the variation of colony areas and
Resources Interministerial Committee (SECIRM).
References Ballerini, T.; Tavecchia, G.; Olmastroni, S.; Pezzo, F. & Focardi, S. (2009). Nonlinear effects of winter sea ice on the survival probabilities of Adélie Penguins. Oecologia, 161: 253-65. Barbraud, C. & Weimerskirch, H. (2006). Antarctic birds breed later in response to climate change. PNAS, 103: 6248-51. Croxall, J.P., Trathan, P.N.; & Murphy, E.J. (2002). Environmental change and Antarctic seabird populations. Science, 297:1510–14. Doran, P.T.; Priscu, J.C.; Lyons, W.B.; Walsh, J.E.; Fountain, A.G.; McKnight, D.M.; Moorhead, D.L.; Virginia, R.A.; Wall, D.H.; Clow, G.D.; Fritsen, C.H.; McKay, C.P. & Parsons, A.N. (2002). Antarctic climate cooling and terrestrial ecosystem response. Nature, 415: 517- 20. Dugger, K.M.; Ainley, D.G.; Lyver, P.O´B.; Barton, K. & Ballard, G. (2010) Survival differences and the effect of environmental instability on breeding dispersal in an Adélie Penguin meta-population. PNAS, 107: 12375-80. INPE (2010) Instituto Nacional de Pesquisas Espaciais. www.antartica.cptec.inpe.br; accessed in: 04/27/2010. Lescroël, A.; Dugger, K.M.; Ballard, G.; & Ainley, D.G. (2009). Effects of individual quality, reproductive success and environmental variability on survival of a long-lived seabird. Journal of Animal Ecology, 78: 798-806. Mallory, M.L.; Gaston, A.J.; Forbes, M.R. & Gilchrist, H.G. (2009). Influence of weather on reproductive success of northern fulmars in the Canadian High Arctic. Polar Biology, 32: 529-538. Santora, J.A.; Reiss, C.S.; Cossio, A.M. & Veit, R.R. (2009). Interannual spatial variability of krill (Euphausia superba) influences seabird foraging behavior near Elephant Island, Antarctica. Fisheries Oceanography, 18(1): 20-35. Smetacek, V.; Scharek, R. & Nöthig, E. M. (1990). Seasonal and regional variation in the pelagial and its relationship to the life history cycle of krill. In: Kerry, K.R. & Hempel, G. Antarctic Ecosystems: ecological change and conservation. Springer-Verlag, Berlin. Thomas, C.D.; Cameron, A.; Green, R.E.; Bakkernes, M.; Beaumont, L.J.; Collingham, Y.C.; Erasmus, B.F.N.; Siqueira, M.F.; Grainger, A.; Hannah, L.; Hughes, L.; Huntley, B.; Van Jaarsveld, A.S.; Midgley, G.F.; Miles, L.; Ortega-Huerta, M.A.; Peterson, A.T.; Phillips, O.L. & Williams, S.E. (2004). Extinction risk from climate change. Nature, 427: 145- 148. Turner, J.; Colwell, S.R.; Marshall, G.J.; Lachlan-Cope, T.A.; Carleton, A.M.; Jones, P.D.; Lagun, V.; Reid, P.A. and Iagovkina, S. (2005). Antarctic climate change during last 50 years. International Journal of Climatology, 25: 279-294. Walther, G.R.; Post, E.; Convey, P.; Menzel, A.; Parmesan, C.; Beebee, T.J.C.; Fromentin, J.M.; Hoegh-Guldberg, O. & Bairlein, F. (2002). Ecological responses to recent climate change. Nature, 416: 389-95.
Science Highlights - Thematic Area 2 |
81
6 DISTANCE ASSOCIATIONS AMONG ANTARCTIC AND SUBANTARCTIC SEABIRDS Maria Virginia Petry1,*, Elisa de Souza Petersen1, Lucas Krüger1 1
Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, São Leopoldo, RS, Brazil *e-mail: vpetry@unisinos.br
Abstract: Seabirds seek environmental cues for find food at sea. One of the cues is the behaviour of other seabirds. The present study aims to demonstrate through spatial correlation analysis, the distance at which species of seabirds are able to associate. Seabird counting was conducted onboard the Brazilian Polar Ship NPo Almirante Maximiano between Southern Argentina and South Shetland Islands, Antarctica. Birds were counted during 10 minutes censuses at intervals of one and half hours during the whole day. Abundances of Daption capense, Macronectes giganteus, Thalassarche melanophrys, Petrels and Albatrosses in spatial correlations were used. We tested if there were any intra-specific associations (autocorrelation) and/or any inter-specific associations (cross-correlation). The coefficients of auto and cross-correlation were used in linear regression with average distance lags to estimate the distance at which seabirds influence each other. All the Autocorrelation coefficients of the evaluated species were negatively related with lag average distance, that is, the further away the seabirds are the less they are able to detect each other. Even so, there were marked differences among species, since R² varied from 0.3 (all petrels added together) and close to 0.9 for Southern Giant Petrels. But the inter-specific association does not appear to be related with distance, since from the nine possible pairs, for only three, were the spatial cross-correlations related with the distance. Keywords: Antarctic seabirds, environmental cues, feeding behaviour
Introduction
82
Seabirds develop mechanisms to override the dificulty for
Cape Petrels Daption capense and Southern Giant Petrels
food detection imposed by the homogeneity of the sea.
Macronectes giganteus change flight pattern when they
The mechanisms rely on detection using olfactive cues
find food spots, they continuously change flight direction
(Nevitt, 2008), and sight cues, despite the apparent absence
and they land on the water. Hence individuals associate
of detectable spatial heterogeneity on the ocean surface
to enhance their individual capacity for food searching
(Silvermann et al., 2004). Seabirds use morphological and
on wide and homogenous landscapes (Silvermann & Veit,
physiological mechanisms to search for odours at over
2001).Both the sensorial strategies (olfaction and sight)
great distances (Nevitt, 1999; Nevitt, 2008; Van Buskirk &
are simultaneously applied (Nevitt, 2008). Despite the
Nevitt, 2008). Greater and more aggressive seabirds may
evidence for such multimodal hypothesis for foraging,
detect odours that indicate foraging by other seabirds,
the olfaction strategy is more testable to test. Diomedea
while smaller species detect the krill foraging upon
albatrosses, however, often use visual searching, since they
phytoplankton (Nevitt, 2008). Seabirds respond to low
are less attracted to odours than other species (Nevitt et al.,
prey visual detectability by monitoring other individuals
2004; Mardon et al., 2010). Silvermann et al., (2004)
for optimizing food detection. Veit (1999) verified that
points out there is a lack of information describing seabird
| Annual Activity Report 2010
association feeding flocks, and data of how seabirds
Results
search for prey at sea is scarce. Hence, the present study
All the Autocorrelation coefficients of the evaluated species
aims to demonstrate the distances that seabird species are
were negatively related with lag average distance, that is, the
able to associate, and demonstrate the distances detected
farther the seabirds are from each other the less they are able
when seabirds are involved in intra and/or interspecific
to detect each other. Although there were marked differences
associations. The way seabirds are engaged in associations
among species, since R² varied from 0.3 (all petrels added
have consequences on distribution, food detection and,
together) and close to 0.9 for Southern Giant Petrels
hence, on adult survival, an important demographic
(Table 1, Figure 1). The Southern Giant Petrels seems to be
parameter for seabird populations.
the species that is able to detect its own species behavior at
Materials and Methods
who seem to be limited to smaller distances (Table 1).
long distances, followed by Albatrosses, and Cape Petrels But the inter-specific association does not appear to be
Seabird counting was conducted aboard the Brazilian Polar
related with distance, since from the nine possible pairs,
Ship NPo Almirante Maximiano in October 2009. Seabirds
the spatial cross-correlations related with the distance
were counted during the ship’s deployment between southern
only for three species. They were Cape Petrels and Black
Argentina and South Shetlands, Antartica, including here
Browed Albatrosses, Cape Petrels and Albatrosses, Black
Drake Passage. Birds were counted during 10 minutes
Browed Albatrosses and Petrels (Figure 2), all pairs with
censuses at intervals of one and half hours during the whole
low R-squares (Table 2). This indicates seabirds may opt
day, using the ship’s side opposed to the sun. Ship-Following
for use of their own species as sight cues when foraging at
birds were excluded from the analysis. Abundances of
greater distances, while they may use other species as cue
Daption capense (Cape Petrel), Macronectes giganteus
when they are near available.
(Southern Giant Petrel), Thalassarche melanophrys (Black
Discussion
Browed Albatrosses), Petrels and Albatrosses were used
Greater associations occur among individuals from the
in spatial correlations. Additive Ln transformations were
same species, which has also been established in other
conducted before running the spatial correlations. We tested
studies (Silvermann & Veit, 2001; Silvermann et al.,
if there were intra-specific association (autocorrelation)
2004). Silvermann et al., (2004) showed that albatrosses
and inter-specific association (cross-correlation). The
are indicators of environmental cues for other species by
coefficients of auto and cross-correlation were used in linear
their conspicuousness. The latter has not been entirely
regression with average distance lags to estimate the distance
discarded from our results since the greater inter-specific
seabirds influence one another.
correlations were those in which Albatrosses were involved.
Table 1. R², P and equation parameters (a and b) of linear regression Between Autocorrelation coefficient and estimated average lag distance, for each seabird species between Argentina and South Shetlands Island.
Especies
R²
P
A
B
Cape Petrel
0.34
0.018
0.902
–0.108
Black Browed Albatross
0.551
0.001
1.123
–0.132
Southern Giant Petrel
0.857
<0.001
2.259
–0.248
Albatrosses
0.61
<0.001
1.419
–0.152
Petrels
0.315
0.024
0.792
–0.096
Science Highlights - Thematic Area 2 |
83
The association between Cape Petrels and Albatrosses
which is even found in the olfactory strategies adopted by
suggests the Black Browed Albatross is a major contributor,
smaller species (Nevitt, 1999; Nevitt et al., 2004).Although,
mainly due to its abundance in the sampled region. On the
available literature about sight association between seabirds
other hand, some cross-correlation tended to be negative
sampled mainly marine areas close to breeding colonies
(however non-significant), and an indication that there is
within the breeding season when the birds are engaged in
a certain level avoidance between some species, i.e. Cape
breeding activities (Silvermann et al., 2004), our sample
Petrel and other Small Petrels do not seem to interact
was madeat the beginning of breeding season when
with Giant Petrels, a potential predator, in accordance
most birds were just starting to breed. The energy inputs
with the available literature (Silvermann & Veit, 2001),
required at the peak of reproduction justifies a change in
Figure 1. Spatial Autocorrelation coefficients in response to estimated average lag distance for species. Cape Petrels (CP), Black Browed Albatrosses (BBA), Southern Giant Petrel (SGP), Sum of Albatrosses (ALB) and sum of Petrels (PTR).
Figure 2. Spatial cross-correlation coefficients in response to estimated average lag distance for pairs of species. Cape Petrels and sum of Albatrosses (CP-ALB), Cape Petrel and Black Browed Albatrosses (CP-BBA), Black Browed Albatrosses and sum of other Albatrosses (BBA-ALB).
Table 2. R², P and equation parameters (a and b) of linear regression Between cross-correlation coefficient and estimated average lag distance, for each pair of seabird species between Argentina and South Shetland Island. The equation parameters presented are from significant regressions with R² greater than 0.2.
84
Pairs
R²
P
A
B
Cape Petrels and other Petrels
0.054
0.195
-
-
Cape Petrels and Southern Giant Petrels
0.04
0.265
-
-
Cape Petrels and Black Browed Albatrosses
0.297
0.001
0.476
–0.039
Cape Petrels and Albatrosses
0.351
<0.001
0.535
–0.042
Black Browed Albatrosses and Southern Giant Petrel
0.109
0.065
-
-
Black Browed Albatrosses and Other Albatrosses
0.116
0.05
-
-
Black Browed Albatrosses and Petrels
0.21
0.008
0.394
–0.028
Southern Giant Petrels and Other Petrels
0.01
0.92
-
-
Southern Giant Petrels and Albatrosses
0.045
0.23
-
-
| Annual Activity Report 2010
the foraging habits of seabirds (Markones et al., 2010). The
can be considered valid. In this case, the area we sampled is
interaction differences may also exist as intrinsic factors
crossed by the Antarctic Circumpolar Current, suggesting
of the communities as a response to abiotic gradients in
the longitudinal movements of the seabirds.
the hydrographic, bathymetric and climatic characteristics (Woehler et al., 2010). Yet our responses suggest similarities
Conclusion
with Silvermann et al. (2004).
The association between birds in open sea is a sparsely
Due to restrictions in segregation of sampling space
explored field of research in ornithology. There are few
and time, in order that our model could be validated it is
evaluations of seabird species association related to sight,
necessary to inform that in the span of a short time interval
principally in the pelagic environment, and the efforts on the
(up to 24 hours), one individual remained in a similar
theme are justified. On the other hand, the relation of birds
latitude, that is, its position being able to vary longitudinally,
regarding weather and productivity as a response to climatic
just because our samples were spatialized in a latitudinal
changes is an actual and expanding topic in marine ecology.
gradient. Hyrenbach et al. (2007) demonstrates that between
Further research on the deviation of bird associations as a
a set of spatial variables, there is an association of many
response to the biotic and abiotic environment would allow
species with longitudinal gradients.
a broader understanding of the changes on the Antarctic
Associations may therefore be an important process
Environment.
in the foraging behaviour, and so the effect on the foraging success is obvious. The successful detection of
Acknowledgements
food will allow a bird to fulfil its energy requirements
Brazilian data was provided through projects financed by
(Markones et al., 2010) and survive. Adult survival is the
INCT-APA (CNPq Process no. 574018/2008-5, FAPERJ
most important demographic parameter driving population
E-26/170.023/2008), and supported by the Ministry of
dynamics of seabirds (Rolland et al., 2009).
Environment, Ministry of Science and Technology, and
By accepting that seabirds are strongly associated with productive ocean currents (Bost et al., 2009), our model
the Secretariat for the Marine Resources Interministerial Committee (SECIRM).
References Bost, C.A.; Cotté, C.; Bailleul, F.; Cherel, Y.; Charassin, J.B.; Guinet, C.; Ainley, D.G. & Weimerskirch, H. (2009). The importance of oceanographic fronts to marine birds and mammals of the southern ocean. Journal of Marine Systems, 78: 363-76. Hyrenbach, K.D.; Veit, R.R.; Weimerskirch, H.; Metzl, N. & Hunt, G.L. (2007). Community structure across a large-scale ocean productivity gradient: Marine bird assemblages of the Southern Indian Ocean. Deep Sea Research I, 54: 1129-45. Mardon, J.; Nesterova, A.P.; Traugott, J.; Saunders, S.M. & Bonadonna, F. (2010). Insight of scent: experimental evidence of olfactory capabilities in the wandering albatross (Diomedea exulans). The Journal of Experimental Biology, 213: 558-63. Markones, N.; Dierschke, V. & Garthe, S. (2010). Seasonal differences in at-sea activity of seabirds underline high energetic demands during the breeding period. Journal of Ornithology, 151: 329-36. Nevitt, G. A. (2008). Sensory ecology on the high seas: the odor world of the procellariiform seabirds. The Journal of Experimental Biology, 211: 1706-13. Nevitt, G.; Reid, K. & Trathan, P. (2004). Testing olfactory foraging strategies in an Antarctic seabird assemblage. Journal of Experimental Biology, 207: 3537-44. Nevitt, G. (1999). Olfactory foraging in Antarctic seabirds: a species-specific attraction to krill odors. Marine Ecology Progress Series, 177: 235-41.
Science Highlights - Thematic Area 2 |
85
Rolland, V.; Nevoux, M.; Barbraud, C. & Weimerskirch, H. (2009) Respective impact of climate and fisheries on the growth of an Albatross population. Ecological applications 19: 1336-46. Silvermann, E.D.; Veit, R.R. & Nevitt, G.A. (2004). Nearest neighbors as foraging cues: information transfer in a patchy environment. Marine Ecology Progress Series, 277: 25-35. Silvermann, E.D. & Veit, R.R. (2001). Association among Antarctic seabirds in mixed-species feeding flocks. Ibis, 143:51-62. Van Buskirk, R.W. & Nevitt, G.A. (2008). The influence of developmental environment on the evolution of olfactory foraging behavior in procellariiform seabirds. Journal of Evolutionary Biology, 21: 67-76. Veit, R.R. (1999). Behavioral responses by foraging petrels to swarms of Antarctic krill Euphausia superba. Ardea, 87: 41-50 Woehler, E. J.; Raymond, B.; Boyle, A.; & Stafford, A. (2010). Seabird assemblages observed during the Broke-west survey of the Antarctic coastline (30°E-80°E), January – March 2006. Deep-Sea Research II, 57: 982-91.
86
| Annual Activity Report 2010
7 TOPOGRAPHICAL CHARACTERISTICS USED BY SOUTHERN GIANT PETREL Macronectes giganteus AT STINKER POINT, ELEPHANT ISLAND Maria Virginia Petry1,*, Lucas Krüger1, Rafael Gomes de Moura1 1
Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, São Leopoldo, Rio Grande do Sul, Brazil *
e-mail: vpetry@unisinos.br
Abstract: The choice of breeding site is important for a seabird with consequences on the successful raising of its chicks. Seabirds may choose a breeding site taking into account many environmental and biological factors. This study aims to test the association of Southern Giant Petrel nests with topographical parametersat Stinker Point, Elephant Island. 33 Southern Giant Petrel nests were identified using a GPS receptor, and generated 33 random points. The points were plotted on a raster DEM and variables were extracted. We verified the nests were associated with terrain slope and altitude, and that Petrels were using the intermediary elevations (below 90 m) in plain terrains at Stinker Point. As there are also other variables that can influence habitat use, further analysis is needed to establish the exact role of topography on nesting habitat selection. Keywords: digital elevation model, habitat selection, habitat use, nesting
Introduction Habitat selection is a hierarchical process of behavioural
wind, snow, from excessive or insufficient insulation, and
responses that result in the disproportional use of one or
protection from predators (Danchin & Wagner, 1997). Birds
few habitat attributes in relation to others, such differences
may use the information of conspecific success for choosing
in use may positively affect the breeding success (Jones,
their own nesting site, it is, the presence of an experienced
2001). Decisions on which habitat is preferable for a
breeder in one site is the indicative that this site can provide
bird are influenced by many parameters of the chosen
suitable habitat for reproduction (Forbes & Kaiser, 1994),
location itself and by parameters of the populations and
so, thus, enhancing the importance of local characteristics
communities occupying them, habitat includes as broad
from the analytical point of view.The objective of the
parameters as size, quality, structure, accessibility, resource
present paper is to evaluate topographical characteristics to
availability and so on, while population and communities
which Southern Giant Petrels are nest-associated at Stinker
impose that birds make choices to avoid competition and
Point, Elephant Island, in an attempt to understand factors
predation (Guthrie & Moorhead, 2002). For a seabird, the
explaining colony distribution.
choice of nesting ground plays a fundamental role on the reproductive success, most species breed in colonies with
Materials and Methods
a hundred to a thousand individuals, but the only resource
The study was conducted at Stinker Point, Elephant Island,
for wich they compete in colonies is area. Choosing a good
South Shetland Island on the austral summer of 2009/2010.
place for nesting implies in occupying places protected from
At Stinker point there are two main colonies of Southern
Science Highlights - Thematic Area 2 |
87
Giant Petrel (SGP), and during this season 931 breeding pairs were counted. We accompanied 33 nests of SGP which
Results The SGPs nested at Stinker Point in areas from 13 to 86 metres
adults were incubating in December 2009. We marked the
above sea level with terrain face directed from South (180°)
georreferences of the 33 nests with a GPS receptor. Random
to Southwest (240°) and Slope variation between 0.006° and
points were generated through random function using
0.021° (Table 1). The Principal Component Analysis resulted
Microsoft Office Excel 2007. The random points were used
in three components (Table 2), both Component 1 and
for accessing the entire variation of topography a priori
Component 2 explained 76% of data variance. Component
available to birds. A Digital Elevation Model (DEM) was
1 is explained by Elevation and Slope, while Component 2
elaborated from an altimetry satellite image through Arc-
is explained by Aspect (Table 3). The PCA shows that the
Gis Software (Figure 1). The DEM allowed us to extract the
SGPs were breeding in a habitat that was a fraction of the
following topographical parameters: Elevation (meters),
potentially available area at Stinker Point, that is, the nests
Slope (terrain inclination), and Aspect (direction of terrain
represented only a small group in the middle of the random
inclination). To evaluate the association of nests with the
points (Figure 2).
topographical parameters we used Principal Component Analysis.
Two distinct groups existed within the nests, however, one occupied the South face (negative association
Figure 1. Stinker Point DEM, Elephant Island, classified in elevation intervals, with sampling points plotted.
88
| Annual Activity Report 2010
Table 1. Descriptive Statistics of Topographical parameters.
Parameters
Range
Minimum
Maximum
Mean
Std. Deviation
Elevation (m)
72.40
13.77
86.17
45.38
18.96
Slope (°)
0.02
0.006
0.021
0.013
0.01
Aspect (°)
59.04
180.00
239.04
209.78
23.02
Table 2. Eigenvalue and percentage of variance explained by the three Principal Components (PC).
PC
Eigenvalue
%
1
1.26
42.06
2
1.03
34.18
3
0.71
23.75
Table 3. Correlation of each topographical variable with the Principal Components.
Variable
PC1
PC2
PC3
Aspect
–0.14
0.96
0.26
Elevation
0.81
–0.13
0.58
Slope
0.77
0.31
–0.56
Figure 2. Principal Components plot with the two first components explaining 76% of the data variation. Blue circles are the Southern Giant Petrel nests, and green circles are the random points. Component 1 is explained by Elevation and Slope, while Component 2 is explained by Aspect.
with Component 2), and the other Southwest (positive
non-measured factors that could contribute to the presence
association with Component 2). Component 1 revealed
of seabird colonies in a given place, such as solar incidence,
that both groups were established at lower Elevations and
wind exposure, ice-free land, distance from predators
Lower Slopes, however, South groups tended to occur in small numbers athigh elevations and ata fewer number of the smaller slopes than the Southwest group (Figure 2).
Discussion Southern Giant Petrels seems to be adapted to nest at a very specific habitat in Stinker Point, at Elevations below 90 m on almost flat terrains. The direction to which these flat areas were pointed (Aspect) was not selected by the SGPs, it seemedonly to be a consequence of the topography
(Brown Skuas in Stinker Point), inter- and intra-specific competition, density and parasites (Rönkä et al., 2008). Potentially, there are others places where a colony was expected to be seen, mainly areas of Glacier retraction (MVP pers. comm.), which could be placed among those specific reliefs used by SGP. One explanation is social attraction (Danchin et al., 1998; Parejo et al., 2006), that is, the previous observation of conspecific success being indicative of site quality for breeding. In other words, where one experienced
selected by SGPs than for any other reason, while Elevation
bird chose to breed would probably be a good location,
and Slope played a more explicit role in influencing nest
hence younger birds and first breeders would tend to use
position at Stinker Point. However, there were a lot of other
such places through this socially available information.
Science Highlights - Thematic Area 2 |
89
Conclusion
Acknowledgements
More profound analyses are still needed to understand the
Brazilian data was provided through projects financed by
observed trend. GIS is a very useful tool for the development
INCT-APA (CNPq Process no. 574018/2008-5, FAPERJ
of models for explaining the colonies distribution.
E-26/170.023/2008)], and supported by the Ministry of
Incorporating a wide range of topographic, abiotic and
Environment, Ministry of Science and Technology, and
biotic information can cause the emergence of a coherent
the Secretariat for the Marine Resources Interministerial
understanding of why SGPs at Stinker Point are using flat
Committee (SECIRM).
areas below 90 m from sea level, and if there is any effect of those characteristics on fitness, so they can be seen as true Habitat Selection parameters.
References Danchin, E. & Wagner, R. (1997). The evolution of coloniality: the emergence of new perspectives. Trends in Ecology and Evolution, 12:342-7. Danchin, E., Boulinier, T. & Massot, M. (1998). Conspecific reproductive success and breeding habitat selection: implications for the study of coloniality. Ecology 79(7): 2415-28. Forbes, L.S. & Kaiser, G.W. (1994). Habitat choice in breeding seabirds: when to cross the information barrier. Oikos, 70: 377-84. Guthrie, C.G. & Moorhead, D.L. (2002). Density-dependent habitat selection: evaluating isoleg theory with a Lotka-Volterra model. Oikos, 97:184-94. Jones, J. (2001). Habitat selection studies in avian ecology: a critical review. The Auk, 118(2): 557-62. Parejo, D., Oro, D. & Danchin, E. (2006). Testing habitat copying in breeding habitat selection in a species adapted to variable environments. Ibis, 148: 146-54. RÜnkä, M., Tolvanen, H., Lehikoinen, E., Numers, M. & Rautkari, M. (2008) Breeding habitat preferences of 15 bird species on South-western Finnish archipelago coast: applicability of digital spatial data archives to habitat assessment. Biological Conservation, 141:402-16.
90
| Annual Activity Report 2010
8 FACTORS INFLUENCING BROWN SKUA REPRODUCTIVE SUCCESS AT ELEPHANT ISLAND – ANTARCTICA Suzana Seibert1,*, Adriando Duarte1, Maria Virginia Petry1 Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, São Leopoldo, Rio Grande do Sul, Brazil
1
*e-mail: suzanaseibert@gmail.com
Abstract: The objective of the present study is to evaluate how some variables could influence breeding successes of Brown Skua (Catharacta lonnbergi) at Stinker Point, Elephant Island, Antarctica. Variables measured were Intra-specific Nearest Neighbour Distance (NND), Penguin Colony Distance (PCD) and egg laying date per breeding pair. Variables that could influence Chick Survival Probability were analysed through logistic regression (forward). Data was collected during the 2009/10 austral summer. The studied population consisted of 37 breeding pairs, from which 23.7% (n = 9) successfully raised chicks to fledging. NND and PCD significantly affected chick survival (Nagelkerke R2 = 0.21, p < 0.001 and Nagelkerke R2 = 0.54, p < 0.05, respectively), showing that chicks have lower survival probability among closer nests and among the nests that are near penguin colony. There is a positive and significant relation between NND and PCD (Linear R2 = 0.38, p < 0,001). There was no significant relationship between the chick survival and egg laying date. Analysis showed different tendencies from those presented in other studies where chick survival probability was lower in nests near the penguin colony and an early egg laying date did not reflect a higher chick survival probability as expected. The last one probably caused by severe weather during the beginning of the studied breeding season and many nests were covered by snow, which caused the loss of many eggs resulting in very low reproductive success. Keywords: Catharacta lonnbergi, chick, near neighbour, spatial distribution
Introduction Brown Skua (Catharacta lonnbergi) is a top-predator seabird,
Peter, 2003; Ritz et al., 2005) and adult quality (Phillips et al.,
mainly found in the Southern Oceans and the Antarctic
1998; Ritz et al., 2005). In some populations, Brown
Continent (Watson, 1975). Reproductive success is one of
Skua individuals defend feeding territory in a penguin
the measures used to monitor bird populations. Finding out how many breeding pairs have successfully raised their chicks and knowing what factors can be determining for some specific population’s reproductive success, offers information whether a population is growing, declining or stable and what forces can guide one or other condition. Researchers have suggested some factors influencing
colony. Hagelin and Miller (1997) suggested that Skuas breeding near penguin colonies select their territories to be sufficiently close to penguin colonies to have accessible resources, but sufficiently far from penguin colonies to avoid egg and chick loss due to penguin deployments and to avoid other skua territories and intra-specific predation,
breeding success, such as distance from the nest to the
but not evaluating if this habitat selection could influence
nearest breeding penguin group (Pezzo et al., 2001), egg
breeding success. The number of near neighbours and
laying date (Phillips et al., 2004), hatching date (Hahn &
the distances from them can play an important factor on
Science Highlights - Thematic Area 2 |
91
chick body-condition, which influence breeding success
Probability were NND (Nagelkerke R2 = 0.52; P < 0.001)
(Phillips et al., 1998).
and PCD (Nagelkerke R2 = 0.22; P < 0,01). Results indicate
One biological characteristic that many studies show to be
that the further nests are from each other, the higher is
very important for reproductive success is egg laying date
chick survival probability (Figure 1). The same tendency
and hatching date. Breeding pairs that lay their eggs earlier
was confirmed for PCD. A positive relationship was found
have higher chick survival probability (Phillips et al., 2004),
between NND and PCD (Linear R2 = 0.38, P<0,001),
which is a common characteristic in bird reproductive
where nests located near the penguin colony were densely
ecology (Pezzo et al., 2001). The potential advantage of
distributed. There was no significant relationship of chick
individuals occupying different nest locations within the
survival with egg laying date (P > 0,05) (Figure 2), which
colony and their individual biological characteristics can be
ranged between 13 December of 2009 and 5 January of
studied by comparing the characteristics of successful and
2010.
unsuccessful nests. The objective of the present study is to evaluate the effect of conspecific nearest neighbour distance, distance from breeding pairs to the nearest penguin colony and, egg laying date on breeding successes of Brown Skua population (Catharactalonnbergi) in Elephant Island, Antarctica.
Materials and Methods The field work was carried out at Stinker Point (61° 13’ S and 55° 22’ W), Elephant Island, South Shetland, Antarctic Peninsula during the 2009/10 austral summer. Brown Skua population consisted of 37 breeding pairs. Variables measured for each breeding pair were the mean of three conspecific Nearest Neighbour Distance (NND), Penguin Colony Distance (PCD) and egg laying date. To access the breeding success and egg laying date, the nests were visited
Figure 1. Distance to near neighbour – Catharacta lonnbergi chick survival predicted probability in relation to the mean distance of three nearest conspecific neighbours, Elephant Island, Antarctica.
every three days. Chicks were assumed to have fledged if they had survived until the end of the study period (age ± 34 days). Nest positions were recorded with a handheld GPS receiver (60CSx, Garmim). The parameters NND and PCD were calculated by means of GIS software ArcView. Logistic regression (forward) was used in order to analyze the influence of variables over Chick Survival Probability.
Results From the 37 Brown Skua breeding pairs 24.3% (n = 9) successfully raised chicks to fledging, which meant 0.24 chick fledged per breeding pair. Mean Skua Nearest Neighbour Distance (NND) was 51 ± 71 m (ranging from 3.1 to 407.3 m). Variables influencing Chick Survival
92
| Annual Activity Report 2010
Figure 2. Egg laying date – Catharacta lonnbergi chick survival predicted probability in relation to egg laying date, where date 0 is time (t) of first egg recording, Elephant Island, Antarctica.
Discussion One of the causes of breeding failure in Brown Skua populations is conspecific predation (Osborn, 1985), what can be higher within closer nests. The mean distance from one nest to three nearest neighbours informs how dense or spread is the nest distribution around each studied breeding pair, so that, the greater the nest density, the greater chicks chances of conspecific predation, which may be one of the causes of higher chick death among closer nests (Figure 1). Skuas are known to be a territorial species, hence establishing and maintaining a territory usually includes costs for the owners in terms of defence efforts, such as being alert to detect and expel intruders (Hahn & Bauer, 2008). Furthermore this behaviour results in energy wasting and consequently fitness loss. Individuals whose nests are far away from others will not have to waste so much energy on holding territory as individuals that have closer nests. In this way, adults that have distant nests are supposed to spend more energy on feeding than protecting chicks. On the other hand, closer nests were also those located closer to a penguin colony, a fact that could add some benefits to parents and chicks. Pezzo et al. (2001) also found a higher nest aggregation around penguin colonies, and states that the key factor for successful breeding in their study seemed to be the proximity to penguins, since mean fledging success was higher in nests located less than 15 m from penguins. According to Young and Millar (1999), the opportunity to gain food quickly (having a territory near a penguin colony) has important implications for skua breeding, it benefits the chicks in two ways: first, through higher nest attendance, they should be better protected against other skuas; and second, chicks are less likely to suffer intense hunger than those with parents foraging at sea or among few penguins - affecting survival directly or through stimulating sibling aggression. Despite these arguments, analysis showed an opposite tendency whereby nests near the penguins showed lower probabilities of fledging chicks successfully. This may happen because, nests close to penguins are densely distributed, which increases the potential competition among breeding skuas and potentially increases intraspecific predation. Many studies show a high relation of
chick condition, or probability to survive, to egg laying date and chick hatching (Pezzo et al., 2001; Hahn & Peter, 2003; Ritz et al., 2005; Phillips et al., 1998). Egg laying date and hatching is often an index for adult quality (including age, experience, structural size and condition) rather than a date hatching factor influencing chick growth (Ritz et al., 2005). The egg laying date analysis was not significant (Figure 2), but it does not reveal inexperienced adult population because there are many other facts involved, such as climate. There is evidence that worsening environmental factors within a season are responsible for a decreasing chick growth performance and survival. Severe weather occurred during the beginning of the studied breeding season and many nests were covered with snow, which in itself caused the loss of many eggs or later as a consequence of snow melting. The loss of eggs is revealed through the very low number of fledged chicks (0.24 chick fledged per breeding pair), which is much below the figures recorded in studies (Phillips et al., 2004; Pezzo et al., 2001), but has already been registered in a similar way in the study of Ensor (1979). This significant chicks loss can affect Elephant Island Brown Skua population some years from now. If in the next few seasons the number of young skuas does not increase, the population could reach a limit of individuals below recoverable.
Conclusion Analysis showed different tendencies from those presented in other studies. Chick survival probability was lower in nests near a penguin colony and an early egg laying date did not reflect a higher chick survival probability as expected. Although those tendencies can be explained, there is a huge need for more field data to monitor population trends in the coming years.
Acknowledgements We are very grateful to National Science and Technology Institute- Antarctic of Environmental Research (INCTAPA) (CNPq Process no. 574018/2008-5, FAPERJ E-26/170.023/2008) who financially supported the project, to the Brazilian Ministry of Environment, the Ministry of Science and Technology, the Secretariat for the Marine Resources Interministerial Committee (SECIRM) and all friends who helped with field work.
Science Highlights - Thematic Area 2 |
93
References Ensor, P.H. (1979). The effect of storms on the breeding success of South Polar Skuas at Cape Bird, Antarctica.Notornis 26: 349-52 Hagelin, J.C. & Miller, G.D. (1997). Nest site selection in south polar skuas: balancing nest safety and access to resources. Auk 114: 638-45. Hahn, S. & Bauer, S. (2008). Dominance in feeding territories relates to foraging success and offspring growth in brown skuas Catharacta antarctica lonnbergi. Behavior Ecology Sociobiology 62: 1149-57. Hahn, S. & Peter, H-U. (2003). Feeding territoriality and the reproductive consequences in brown skuas Catharacta antarctica lonnbergi. Polar Biology 26(8): 552-9. Osborn, B. C. (1985). Aspects of the breeding biology and feeding behavior of the Brown Skua Catharacta lonnbergi on Bird Island, South Georgia. British Antarctic Survey Bulletin. 66: 57-71. Pezzo, F.; Olmastroni, S.; Crosolini, S. & Focardi, S. (2001). Factors affecting the breeding success of south polar skua Catharacta maccormicki at Edmonson Point, Victoria Land, Antarctica. Polar Biology 24: 389-93. Phillips, R.A.; Furness, E.W. & Stewart, F.M. (1998).The influence of territory on the vulnerability of Arctic skuas Stercorarius parasiticus to predation. Biological Conservation 86: 21-31. Phillips, R.A.; Phalan, B. & Forster, I.P. (2004). Diet and long-term changes in population size and productivity of brown skuas Catharacta antarctica lonnbergi at Bird Island, South Georgia. Polar Biology 27(9): 555-61. Ritz, M. S.; Hahn, S. & Peter, H-U. (2005). Factors affecting chick growth in the South Polar Skua (Catharacta maccormicki): food supply, weather and hatching date. Polar Biology 29(1): 53-60. Watson, G.E. (1975). Skuas and Jaegers: Stercorariidae. In: Birds of the Antarctic and Sub-Anterctic. Richmond: The William Byrd Press Inc. Young, E.C. & Millar, C.D. (1999).Skua (Catharacta sp.) foraging behavior at the Cape Crozier Adelie Penguin (Pygoscelisadeliae) colony, Ross Island, Antarctica, and implications for breeding. Notornis 46:287-97.
94
| Annual Activity Report 2010
9 NEST ATTENDANCE OF SOUTHERN GIANT PETREL (Macronectes giganteus) ON ELEPHANT ISLAND Uwe Horst Schulz1,*, Lucas Krüger 1, Maria Virginia Petry1 Universidade do Vale do Rio Sinos –UNISINOS, São Leopoldo, Rio Grande do Sul, Brazil
1
*e-mail: uwe@unisinos.br
Abstract: According to expressive size dimorphism between Southern Giant Petrel genders, differences in foraging and nest attendance are expected between female and male petrels. This study aims to investigate differences in nest attendance duration and frequency. 14 Adults were tagged with radio-transmitters, seven females and seven males, of which five were breeding pairs, in Stinker Point, Elephant Island. The radio signals were registered by an Automatic Listening Station between December 2009 and February 2010. Females attend more often the nest than males (binominal test, Chi2 = 799.3; P < 0.001), although the mean number of days each gender attended the nest was not different (F = 0.01; P = 0.92). Our results suggest a higher breeding effort in females while larger males may trade off reproduction success in favor of own survival, at least in anomalous summers. Under severe climatic conditions like the austral summer of 2009/2011 males tend to abandon the nest earlier than females. Keywords: behavior, nesting, radio-transmitters, telemetry
Introduction The Southern Giant Petrel (Macronectes giganteus) is a
(Macronectes halli). They found substantial segregation
circumpolar cold-water seabird of the southern oceans and
between males and females in relation to foraging strategies,
the Antarctic (Onley & Scofield, 2007). It is a long-lived
foraging areas and feeding resources. Males made shorter
species that undertakes long-distance migrations between
trips than females, principally feeding on penguin and
the breeding periods (Harrison, 1983). The breeding period
seal carrion on the beaches close to the breeding sites.
is a key element in the bird’s lifecycle. Several studies
Females were encountered more frequently in pelagic
focus on the behavior of the parents during the breeding
habitats than males and fed more often on marine prey.
process. In species with sex size dimorphism differences in
Gonzáles-Solís et al. (2002) reported two types of trips
provision frequency and duration of foraging trips between
by satellite tracking in Giant Petrels: pelagic with mean
genders can be expected. Gender related differences in
duration of 15 days and coastal trips of median durations of
foraging behavior were reported for several albatross
eight days. Unfortunately, the author’s do not differentiate
species (Weimerskirch et al., 1993; Phillips et al., 2004).
results nor for species neither for genders. The objectives
Size differences between female and male giant albatrosses
of our study were a) to perform a radio tagging pilot study
are expressive. Males are up to 20% heavier than females
to test the deployment of unattended Automatic Listening
(Gonzáles-Sólis et al., 2000a) and sex related differences in
Stations (ALS) in a pilot study on Elephant Island and b)
foraging duration and frequency can be expected. Studies
investigate sex related differences in nest attendance during
of Gonzáles-Sólis et al. (2000a,b) and Gonzáles-Sólis
the breeding period of Giant Southern Petrel and to describe
(2004) concentrated particularly on Northern Giant Petrel
presence / absence patterns of both sexes.
Science Highlights - Thematic Area 2 |
95
Materials and Methods
set to 5s, expected transmitter life 641d. Tagging procedure
Study area
temperatures at –5 °C and gust winds of up to 35 miles h-1.
The tagging experiment was conducted at Stinker point on Elephant Island, South Shetland Islands (Figure 1). 95% of the island is under permanent ice cover. All colonies of seabirds are concentrated on the remaining 5% which may be ice free at late Antarctic summer. Mean annual temperature is –2 °C, mean summer temperature 1 °C (Instituto Hidrografico de la Armada Chile, 1989). Even
extended 7 days, due to the weather conditions with We tagged seven females and seven males on nine nests, of which five were occupied by couples (Table 1). All individuals were tagged when sitting on the nest. One leg was gently extended without securing the body of the bird. The transmitter, glued on a piece of soft foam, was attached to the tarsus-metatarsus by 3M Silver tape, the whip antenna extending in the direction of the foot (Figure 2).
in the austral summer snowstorms and low visibility due
Some individuals, mostly males, had to be secured holding
to fog are frequent.
the body. When these individuals were released after tagging, they escaped flying. Usually they returned to nest
Tagging
in less than two minutes.
For tagging digitally coded transmitters (LOTEK; type
The radio signals were registered by an Automatic
MCTF-3A weight 16 g, 149 MHz) were used. Burst rate was
Listening Station (ALS) which consisted of a SRX 400
Figure 1. Antarctic Elephant Island. The rectangle indicates the study area at Stinker Point.
96
| Annual Activity Report 2010
Table 1. Tagging date, digital transmitter code, gender and nest number of tagged individuals. Note that nest number 1, 3, 5 and 14 were occupied by one tagged parent only.
Date
Hour
Code
04-DEC-09
11.00
102
04-DEC-09
11.00
103
Female
04-DEC-98
12.00
105
10.00
114
04-DEC-09
11.00
101
05-DEC-09
12.00
104
X
03-DEC-09
16.00
107
X
05-DEC-09
12.00
106
03-DEC-09
16.00
108
05-DEC-09
12.00
109
16.00
110
04-DEC-09
12.00
112
06-DEC-09
10.00
111
09-DEC-09
11.00
113
Nest
X
1
X
06-DEC-09
03-DEC-09
Male
3 X
X X
2 2 7
X X
7
Figure 2. Leg mounted radiotransmitters on Southern Giant Petrel.
8 X
8 10
Results
X
10
During the three month period of tracking two technical
X
11
problems occurred. The first was power supply, which
11
accidentally disconnected and caused a data loss of two days.
X
X
5 14
The second was related to false absence data. On several occasions the presence of a tagged bird was confirmed by receiver with data logger function (LOTEK, Canada) equipped with a standard omnidirectional whip antenna. Time partition was set to 30 minutes to optimize data logger memory capacity of 524288 bytes. The power was supplied by the internal batteries of the receiver, which were automatically recharged in a 12 hours rhythm by the electric generator of the research unit. Birds were tagged in two
visual observation but the ALS did not receive the signal. All tagged individuals remained in the study area and their signals were registered throughout the investigation period (Figure 3). A total of 8086 events of radio signals were registered by the ALS, of which 5314 were produced by the presence of females and 2772 by males. This difference in presence of both genders is highly significant (multinominal test, Chi2 = 799.3; P < 0.001). Of all 14 tagged
different breeding groups at 170 m distance to the receiver.
petrels 11 resumed breeding activities after tagging. Three
The tracking period extended from 03 December 2009 to
individuals did not: a male without tagged partner (nest 1)
10 February 2010. Between 07 January and 10 February
and a couple (nest 11). The breeding individuals produced
the equipment was left unattended. During this period
distinct presence/absence patterns (Figure 3, Table 1).
power was supplied by a 300 Ah truck battery. Data from
Although females were present during 18 periods (min.
the ALS was downloaded in three days intervals. During
3 days, max. 9 days) and males only 5 periods (min. 2, max.
the absence of the research team data accumulated for
13 days) mean nest attendance (females 6.4 days ± 0.56;
approximately one month in the internal receiver memory.
males 6.8 ± 1.3) was not significantly different in both sexes
When necessary data were ln-transformed to meet the
(F = 0.01; P = 0.92). All nests were abandoned during the
criteria of homogeneity of variances for ANOVA, tested
study period. The first was nest 8 on 18 December, the last
by Levene´s statistic. Binominal test was used to test for
nest 10 on 23 January. The attendance pattern of codes
differences in presence data between genders. Significance
110 (female) and 112 (male; Figure 3) show, that the male
level in all tests was set to P < 0.05. The dispersion measure
ceases breeding on 27 December. At this date occurred a
is the standard error (s.e.).
switch in nest attendance. The departing male was registered
Science Highlights - Thematic Area 2 |
97
Figure 3. Nest attendance periods of tagged Giant Southern Petrel. Codes on the left refer to individuals of Table 1. Numbers on the left inside the figure refer to nests.
the last time at 12.30 hours and the arriving female at
breeding colony is far more intensive. The higher number
12.36 hours. Since then the female remained for a period of
of uninterrupted attendance periods (18) reinforces this
eight days on the nest and left for four. She left and returned
result, although mean attendance duration did not differ
three times, with decreasing periods of nest attendance until
from males. These results indicate a higher breeding effort
the nest was abandoned ultimately on 23 January.
in females while larger males may trade off reproduction success effort in favor of own survival (Bijleveld & Mullers,
Discussion
98
2009). Adult survival is a principal demographic parameter that drives the population dynamics in long-lived seabirds
The results of our study showed, that the deployment of
(Rolland et al., 2009). Further tagging experiments, which
unattended ALS is technically viable under the severe
are planned for the season 2011/2012 have to confirm the
climatic conditions of Elephant Island. Signal reception
present tendency on a broader data base. De Villiers et al.
problems may be reduced in future experiments by the
(2006) documented high stress levels in congeneric
use of directional antennas. Tagging data revealed that the
Northern Giant Petrel when disturbed. This stress sensitivity
signal count of tagged females is significantly higher than
may have caused the interruption of the breeding process in
for males. This means, that female Petrel presence in the
three individuals as consequence of the tagging procedure.
| Annual Activity Report 2010
All other individuals initially continued breeding and
abandoned their nests probably as consequence of tagging
abandoned the nests later. No chick hatched in nests
stress. During the tracking period, female Giant Petrel
where one or both parents were tagged. Most probably
displayed a higher breeding effort than males. Under severe
the unusual extreme weather conditions of the 2009/2010 austral summer caused the reproduction failures. Heavy snow precipitation and gust winds of 90 km h–1 occurred frequently at the beginning of the tracking period. Snow
climatic conditions like the austral summer of 2009/2011 males tended to abandon the nest earlier than females.
cover extended until mid December. When the research
Acknoledgements
team returned on 13 February, census data showed, that
The study had financial support from INCT-APA (CNPq
only 5.8% of pairs successfully raised a fledge.
Process n° 574018/2008-5), FAPERJ (E-26/170.023/2008), WCS (Wildlife Conservation Society) and supported
Conclusions
by the Ministry of Environment, Ministry of Science
The deployment of unattended ALS is technically viable
and Technology and the Secretary of Marine Resources
for a period of up to five weeks. Three out of 14 individuals
(SECIRM).
References Bijleveld, A.I. & Mullers, R.H.E. (2009). Reproductive effort in biparental care: an experimental study in long lived Cape gannets. Behavioral Ecology, 20(4): 736-44. De Villiers, M.; Bause, M.; Giese, M. & Fourie, A. (2006). Hardly hard-hearted: heart rate responses of incubating Northern Giant Petrels (Macronectes halli) to human disturbance on sub-Antarctic Marion Island. Polar Biology, 29(8): 717-20. Gonzáles-Solís, J.; Croxall, J.P. & Wood, A.G. (2000a). Sexual dimorphism and sexual segregation in foraging strategies of northern giant petrels Macronectes halli during incubation. Oikos, 90: 390-98. Gonzáles-Solís, J.; Croxall, J.P. & Wood, A.G. (2000b). Foraging partitioning between giant petrels Macronectes spp. And its relationship with breeding population changes at Bird Island, South Georgia. Marine Ecology Progress Series, 204: 279-88 Gonzáles-Solís, J.; Croxall, J. P. & Briggs, D. R. (2002). Activity patterns of giant petrels, Macronectes spp., using different foraging strategies. Marine Biology, 140: 197-204. Gonzáles-Sólis, J. (2004). Sexual sixe dimorphism in northern giant petrels: ecological correlates and scaling. Oikos, 105: 247-54. Harrison, P. (1983). Seabirds, an identification guide. Boston: Houghton Mifflin. Instituto Hidrografico de la Armada Chile. (1989). Derrotero de la costa de Chile. 2 ed. Santiago, I.H.A pub. 3006, v. 6, 251 pages. Onley, D. & Scofield, P. (2007). Albatrosses, petrels and shearwaters of the world. New Jersey: Princeton University Press. Phillips, R. A.; Silk, J. R. D.; Phalan, B.; Catry, P. & Croxall, J. P. (2004). Seasonal sexual segregation in two Thallassarche albatross species: competitive exclusion, reproductive role specialization or foraging niche divergence. Proceedings of the Royal Society of London - Series B - Biological Science, 271: 1283–91. Rolland, V.; Novoux, M.; Barbraud, C. & Weimerskirch, H. (2009). Respective impact of climate and fisheries on the growth of an Albatross population. Ecological Applications, 19: 1336-46. Weimerskirch, H.; Salamolard, M.; Sarrazin, F. & Jouventin, P. (1993). Foraging strategy of wandering albatrosses through the breeding season: a study using satellite telemetry. Auk, 110: 325-42.
Science Highlights - Thematic Area 2 |
99
THEMATIC AREA 3
IMPACT OF HUMAN ACTIVITIES ON THE ANTARCTIC MARINE ENVIRONMENT 108 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island, West Antarctic Peninsula (Wap): Pico, Nano and Microplankton and Chlorophyll Biomass
115 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island, West Antarctic Peninsula (Wap): Chlorophyll Biomass and Size-Fractionated Chlorophyll During Austral Summer 2009/2010
121 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island West Antarctic Peninsula (Wap): Composition of Phytoplankton and Influence of Benthic Diatoms
126 Effect of Temperature, Salinity and Fluoride on the Plasmatic Constituents Concentration of Antarctic Fish Notothenia rossii (Richardson, 1844)
131 Arginase Kinetic Characterization of the Gastropod Nacella concinna and its Physiological Relation with Energy Requirement Demand and the Presence of Heavy Metals
137 Arsenic, Copper and Zinc in Marine Sediments from the Proximity of the Brazilian Antarctic Base, Admiralty Bay, King George Island, Antartica
141 Molecular Differentiation of Two Antarctic Fish Species of the Genus Notothenia (Notothenioidei: Nototheniidae) by Pcr-Rflp Technique
145 Distribution of Sterols In Sediment Cores from Martel Inlet, Admiralty Bay, King George Island, Antarctica 150 Background Values and Assessment of Fecal Steroids Discharged into Two Inlets (Mackelar And Ezcurra) in Admiralty Bay, King George Island, Antarctica
155 The Role of Early Diagenesis in the Sedimentary Steroids around Penguin Island, Antarctica 162 Occurrence of Microbial Faecal Pollution Indicators in Sediment and Water Samples at Admiralty Bay, King George Island, Antarctica
167 Aspects of Population Structure of Nacella concinna (Strebel, 1908) (Gastropoda – Nacellidae) at Admiralty Bay, King George Island, Antarctica
171 Monitoring the Impact of Human Activities in Admiralty Bay, King George Island, Antarctica: Preliminary Results of the Meiofauna Community
176 Role of Meteorological Events on the Macrofauna Community and Sediment Composition of the Shallow Waters of Martel Inlet (Admiralty Bay, Antarctica)
182 Monitoring the Impact of Human Activities in Admiralty Bay, King George Island, Antarctica: Isotopic Analysis of C And N in the Summer of 2005/2006
188 Associated Fauna of Prasiola crispa (Chlorophyta) Related to Penguin Rookery at Arctowski (King George Island, South Shetland Islands, Maritime Antarctic)
194 Assessing Non-Native Species in the Antartic Marine Benthic Environment
100
| Annual Activity Report 2010
Coordinator
Dr. Helena Passeri Lavrado Vice-Coordinator
Dr. Edson Rodrigues
The Antarctic Specially Managed Area (ASMA #1) of
of biological information to the data generated from the
Admiralty Bay encompasses the scientific facilities of five
physical and chemical monitoring of the marine, terrestrial
countries (Brazil, Ecuador, Peru, Poland and U.S.A). The
and atmospheric environment. This initiative was recognised
marine topography is similar to that of fjords and has been
by the international scientific community and ratified the
subject to a strong impact from the global climate changes
Brazilian commitment to the Madrid Protocol. With the
recorded in the last decades.
creation of INCT-APA (National Institute for Science and
The importance of the continuous environmental
Technology-Antarctic Environmental Research) by the
monitoring of Antarctica became evident with the approval
Brazilian Ministry of Science and Technology (MCT), in
of the Environmental Protection Protocol (Madrid
2008, the monitoring programme originally proposed by
Protocol) through the consultative parties of the Antarctica
Network 2 was broadened and consolidated.
Treaty in 1991. The subsequent technical and scientific
The Thematic Area 3 of INCT- APA is responsible
meetings undertaken in the sphere of COMNAP (Council
for the long-term ecological programme of the ASMA#1
of Managers of National Antarctic Programs) and SCAR
marine environment and aggregates information of the
(Scientific Committee on Antarctic Research) resulted in
atmospheric and terrestrial environments (Figure 1). Long
a technical manual with standard methodologies for the
term climate series with records of solar radiations (ultra-
physical and chemical monitoring of environmental factors
violet, for example), speed and direction of winds, air
(COMNAP, 2000). However, this protocol does not include
temperature and atmospheric phenomena (Correia et al.,
the biota monitoring and its biological responses as a way of
2010; Marani & Alvalá, 2010; Pinheiro et al., 2010) have
predicting natural and anthropic impacts on the Antarctic
contributed to the comprehension of the climatic effects in
ecosystems.
the behaviour of the terrestrial and marine biota. Data of
The first long-term environmental monitoring initiative
the vegetation and the bird populations are also essential to
in Admiralty Bay, King George Island, Antarctica, was
evaluate the transfer of energy between the terrestrial and
conceived in the 70’s by the researcher Wayne Z. Trivelpiece,
marine environments. Different from what occurs in the
of Seabird Research, U.S. Antarctic Marine Living Resources
marine environment of tropical and subtropical regions, the
Division (Trivelpiece et al., 1987), with focus on the
seasonality of the photoperiod in Antarctica significantly
monitoring of bird populations in the region. In 2001,
reduces sea primary production during winter and imposes
under the title of “Environmental management of Admiralty
long periods of food restrictions (Brockington, 2001).
Bay, King George Island, Antarctica (Network 2)”, the
However, during summer, the photoperiod is much longer
Brazilian Antarctic Programme (Proantar) implemented a
offering a true explosion of life in the Antarctic seas. The
broader proposal of environmental monitoring, supported
phytoplankton studies undertaken in the summer of the
by the National Council for Scientific and Technological
Brazilian Antarctic Expedition XXVIII (2009/2010) revealed
Development (CNPq) and the Brazilian Ministry of the
that the benthic microalgae and diatoms have an important
Environment (MMA). The proposal included the addition
role in the primary productivity of the pelagic coastal region
Science Highlights - Thematic Area 3 |
101
of Admiralty Bay (Tenenbaum et al., 2010b), with some
rocks by melt waters transports high concentrations of
changes in phytoplankton community structure over the
heavy metals to the intertidal and shallow subtidal zones
summer (Tenenbaum et al., 2010a) and with relatively low
(Ahn et al., 1996). Besides the natural stress, the intertidal
and spatially heterogeneous concentrations of chlorophyll
organisms are subject to pollution from the scientific
(Tenório et al., 2010).
stations, ships and small vessels used to load and unload
Differently to subtidal zones, which present high thermal
material/personnel on the beaches (Naveen et al., 2001).
stability, the intertidal zones suffer the direct seasonal effect
The gastropod Nacella concinna is the most conspicuous
of the terrestrial climate. The frequent emersion of this
macroinvertebrate of the intertidal zone and has been
region exposes the organisms to desiccation, solar radiation
postulated as the sentinel organism for heavy metals
and to relatively high temperatures during the Antarctic
monitoring (Ahn et al., 2002). Preliminary data of
summer. In winter, however, the challenges are of another
Figueiredo and Lavrado (2010) reveal that the Brazilian
nature, with the presence of foot ice and low temperatures
presence in the region apparently does not interfere in the
favouring freezing conditions. The lixiviation of the volcanic
population dynamics of this gastropod in Admiralty Bay.
Figure 1. The connections (interrelations) of the long-term ecological programme on the marine environment of Admiralty Bay, King George Island, Antarctica (Thematic Area 3 of INCT-APA). The scientific activities developed in the sphere of the marine environment includes information of the water column (hydrology, phytoplankton and zooplankton), the benthic system (phytobenthos and zoobenthos), the physical-chemical and microbiological composition of the sediment (POPs, MOPEs, metals, etc), the biological responses to natural and anthropic impacts (biochemical, cellular and histopathological biomarkers) and the trophic web. The information on the atmospheric environment is complementary to the marine environmental studies. The exchange of scientific information between the marine and terrestrial environments facilitates the comprehension of the energy transfer processes. Finally, the scientific data generated in the sphere of the marine environment offers support to the environmental management module. (Illustration: Edson Rodrigues).
102
| Annual Activity Report 2010
The differences found between the sampling sites seem to be
understanding of cycles involving the organic matter in the
related to natural causes and not with the pollution effects
sediments (Ceschim et al., 2010). The low level of anthropic
of the Brazilian station. Studies about energy metabolism
impact in Admiralty Bay also became evident in the analysis
modulation of this gastropod, showed that L-arginine
of arsenic, copper and zinc in marine sediments of locations
metabolism has a fundamental role in the thermal stress
close to EACF (Ribeiro et al., 2010).
recovery (Pörtner et al., 1999). In this respect, the arginases
The energy transfer of the water column productivity to
have been postulated as key-enzymes in the control of the
higher trophic levels seems to be more efficient in the marine
cellular levels of L-arginine in non-ureotelic animals and
environments of high latitudes. Although several ecological
in the extra-hepatic tissues of ureotelics (Jenkinson et al.,
studies have revealed a high benthic biomass in the coastal
1996). Arginase kinetic characterization of the N.
region of Admiralty Bay, the first estimate of energy transfer
concinna foot muscle and gills was undertaken during the
over the trophic web in that region, on the basis of isotopic
Brazilian Antarctic Expedition XXVIII, with specimens
analysis δ13C, was undertaken by Corbisier et al. (2004). In
collected in the intertidal zone near the diesel oil tanks
a recent study, concerning the benthic meiofauna in front
of the Comandante Ferraz Antarctic Station (EACF) as a
of EACF, Corbisier et al. (2010b) verified a possible impact
preliminary evaluation of the biomarker potential of this
of human activity in the marine environment. However, the
enzyme (Rodrigues et al., 2010b).
results of isotopic δ 13C, comparing the beginning and end of
Studies concerning the contamination of the marine
summer, did not indicate an increase of the sewage influence
environment around the Antarctic scientific stations of
on the structure of the trophic web (Corbisier et al., 2010a).
McMurdo (Ross Island), Casey (East Antarctica), Rothera
On the other hand, it becomes important to monitor
(Adelaide Island) and Comandante Ferraz (King George
simultaneously the effects of natural phenomena in the
Island) revealed that the contamination by metals and
structure of benthic communities, in order to distinguish
hydrocarbons, derived from human activities, can have a
natural impacts from those caused by human activities. The
significant impact on the benthic communities. High levels
effect of strong and moderate winds on the hydrodynamics of
of heavy metals and coliform bacteria have been detected
this coastal region, for example, can change the composition
in sediments close to the sewage outfall. Several variables,
of the sediment and cause a significant short-term variation
including the composition of the marine sediments (total
in the density of the macrofauna (Monteiro et al., 2010),
organic carbon, grain size, heavy metals, amongst others),
masking the effects of human activities in the region.
have been correlated with the biological communities found
The use of fishes in monitoring programmes presents
in the region (Lohan et al., 2001; Montone et al., 2010;
some advantages, such as easy species identification, the
Stark et al., 2003).
species distribution in different trophic levels and their
The detection of high levels of the bacteria Escherichia
long life cycle, which allows the generation of a long time
coli and Clostridium perfringens in samples from EACF
series of biological data (Whitfield & Elliott, 2002). The
suggest that the contamination is persistent, with small
Antarctic ichthyofauna is dominated by the suborder
impact and did not increase when compared to the results
Notothenioidei which is made up of eight families and
of the previous years (Ushimaru et al., 2010). Analyses
101 described species. The endemism is high (88%) being
of sterols present in the marine sediments of Admiralty
at least three times greater than any other isolated marine
Bay is also contributing to the comprehension of the
environment (Eastman, 2005). The Antarctic fish Notothenia
environmental changes caused by natural and anthropic
rossii and Notothenia coriiceps were selected as target-
factors (Wisnieski et al., 2010). The ratio between stanol/
organisms for biochemical and histopathological biomarker
stenol concentrations has been used to indicate the degree
studies considering their distribution and abundance in
of redox potential in anaerobic environments and in the
Admiralty Bay. However, the species N. coriiceps described
Science Highlights - Thematic Area 3 |
103
by Richadson, in 1884, and Notothenia neglecta, described
significant effects on the physiology and biology of this
by Nybelin in 1951, were considered the same species by
species over the time.
DeWitt (1966) motivating systemic doubts. The study with
Lastly, anthropic impacts may not be restricted just to
mitochondrial DNA, conducted by Machado et al. (2010),
local human activities. The risk of introducing exotic species
using samples of these notothenioids collected in Admiralty Bay, confirm them to be one sole species. The identification of metabolic responses as potential biomarkers of natural and anthropic impacts in Antarctic fish in Admiralty Bay has taken into account the effects of climate warming, low salinity and of the trophic fluoride availability. In this respect, there exists evidences that the temperature increase leads to a reduction in the levels of chloride and magnesium in the blood of Antarctic fish N. rossii, and the low salinity
in a pristine environment like Antarctica, with a high level of endemic species, has increased in the last decades. This is due to not only the intensification of human activities in the Antarctic region, such as research and tourism, but also to an expansion of the geographic distribution of the species from slightly warmer regions, due to the gradual increase of the temperature in the Antarctic region (Frenot et al., 2005). Recent data shows that information on the benthic Antarctic biota which could allow an accurate risk analysis of bioinvasion (Bastos & Junqueira, 2011) are really scarce,
(20 psu) reduces in a significant way the plasmatic levels
indicating the urgency for an up-to-date marine biota survey
of calcium (Rodrigues et al., 2010a), which may have
in order to identify possible introduced species.
References Ahn, I.-Y.; Lee, S.H.; Kim, K.T.; Shim, J.H. & Kim, D.-Y. (1996). Baseline heavy metal concentrations in the Antarctic clam, Laternula elliptica in Maxwell Bay, King George Island, Antarctica. Marine Pollution Bulletin, 32: 592-8. Ahn, I.Y.; Kim, K.W. & Choi, H.J. (2002). A baseline study on metal concentrations in the Antarctic limpet Nacella concinna (Gastropoda: Patellidae) on King George Island: Variations with sex and body parts. Marine Pollution Bulletin, 44(5): 424-31. Bastos, A.C.F. & Junqueira, A.O.R. (2011). Assessing non-native species in Antarctic marine benthic environment, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Brockington, S. (2001). The seasonal energetics of the Antarctic bivalve Laternula elliptica (King and Broderip) at Rothera Point, Adelaide Island. Polar Biology, 24(7): 523-30. Ceschim, L.M.M.; Montone, R.C. & Martins, C.C. (2010). Role of early diagenesis in the sedimentary steroids around Penguin Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. COMNAP (2000). Antarctic Environmental Monitoring Handbook. COMNAP and SCAR, Hobart Tasmania. Corbisier, T.; Petti, M.V.; Skowronski, R.P. & Brito, T.S. (2004). Trophic relationships in the nearshore zone of Martel Inlet (King George Island, Antarctica): d13C stable-isotope analysis. Polar Biol. 27, 75-82. Corbisier, T.N.; Bromberg, S.; Gheller, P.F.; Piera, F.E. & Petti, M.A.V. (2010a). Monitoring the impact of human activities in Admiralty Bay, King George Island: Isotopic analysis of C and N in summer 2005/2006, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Corbisier, T.N.; Gheller, P.F.; Ujikawa, M.C.U.; Bromberg, S. & Petti, M.A.V. (2010b). Monitoring the impact of human activities in Admiralty Bay, King George Island: Preliminary results of the meiofauna community, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Correia, E.; Raulin, P.J.; Kaufmann, P. & Bertoni, F.C.P. (2010). Studies of lower ionosphere response to external forcing, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN.
104
| Annual Activity Report 2010
DeWitt, H.H., (1966). A revision of the Antarctic and southern genus Notothenia (Pisces, Notothenidae) Stanford University, Palo Alto, 469. Eastman, J.T. (2005). The nature of the diversity of Antarctic fishes. Polar Biology, 28(2): 93-107. Figueiredo, M.I.S. & Lavrado, H.P. (2010). Aspectos of population structure of Nacella concinna (Strebel, 1908) (Gastropoda - Nacellidae) at Admiralty Bay, King George Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Frenot Y, Chown S. L, Whinam J, Selkirk P. M, Convey P, Skotnicki M, Bergstrom D. M. Biological invasions in the Antarctic: extent, impacts and implications. Biological Reviews, 80:45–72.doi:10.1017/S1464793104006542 [PubMed] 2005. Jenkinson, C.P.; Grody, W.W. & Cederbaum, S.D. (1996). Comparative properties of arginases. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 114(1): 107-32. Lohan, M.; Statham, P. & Peck, L. (2001). Trace metals in the Antarctic soft-shelled clam Laternula elliptica: implications for metal pollution from Antarctic research stations. Polar Biology, 24(11): 808-17. Machado, C.; Shimada, M.K.; Fragoso, S.P.; Fanta, E.; Kawall, H.G;, Rodrigues, E. & Donatti, L. (2010). Molecular differentiation of two Antarctic fish species of the genus Notothenia (Notothenioidei: Nototheniidae) by PCR-RFLP tecnhique, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Marani, L. & Alvalá, P.C. (2010). Monitoriamento de gases do efeito estufa na Estação Antártica Comte Ferraz, in: W. INCTAPA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Monteiro, G.S.; Petti, M.A.V.; Santos, M.C.E.R.; Grotto, B.W.; Gheller, P.F.; Nonato, E.F. & Corbisier, T.N. (2010). Role of meteorological events on the macrofauna community and sediment composition at the shallow waters of Martel Inlet (Admiralty Bay, Antarctica), in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Albuquerque Moreira da Silva, D.; Campos, L.S. & Weber, R.R. (2010). Distribution of sewage input in marine sediments around a maritime Antarctic research station indicated by molecular geochemical indicators. Science of the Total Environment, 408(20): 4665-71. Naveen, R.; Forrest, S.C.; Dagit, R.G.; Blight, L.K.; Trivelpiece, W.Z. & Trivelpiece, S.G. (2001). Zodiac landings by tourist ships in the Antarctic Peninsula region, 1989-99. Polar Record, 37: 121-32. Pinheiro, D.K.; Leme, N.P.; Peres, L.V. & Kall, E. (2010). Influence of the Antarctic ozone hole over south of Brazil in 2008 and 2009, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Pörtner, H.O.; Peck, L.; Zielinski, S. & Conway, L.Z. (1999). Intracellular pH and energy metabolism in the highly stenothermal Antarctic bivalve Limopsis marionensis as a function of ambient temperature. Polar Biology, 22(1): 17-30. Ribeiro, A.P.; Figueira, R.C.L.; Martins, C.C.; Silva, C.R.A.; França, E.J.; Bícego, M.C.; Mahiques, M.M. & Montone, R.C. (2010). Arsenic, copper and zinc in marine sediments from the proximity of brazilian Antarctic station, Admiralty Bay, King George Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Rodrigues, E.; Donatti, L.; Suda, C.N.K.; Rodrigues Júnior, E.; Feijós de Oliveira, M.; Carvalho, C.S. & Vani, G.S. (2010a). Effect of temperature, salinity and fluoride on the plasmatic constituents concentration of Antarctic fish Notothenia rossii (Richardson, 1844), in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Rodrigues, E.; Lavrado, H.P.; Donatti, L.; Suda, C.N.K.; Rodrigues Júnior, E.; Feijós de Oliveira, M. & Vani, G.S. (2010b). Arginase kinetic characterization of the gastropod Nacella concinna and its physiological relation with energy requirement demand and the presence of heavy metals, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Stark, J.S.; Riddle, M.J.; Snape, I. & Scouller, R.C. (2003). Human impacts in Antartic marine soft-sediment assemblages: correlations between multivariate biological patterns and environmental variables at Casey Station. Estuarine, Coastal and Shelf Science, 56(3-4): 717-34.
Science Highlights - Thematic Area 3 |
105
Tenenbaum, D.R.; Barreira-Alba, J.J.; Duarte, R.B. & Ten贸rio, M.M.B. (2010a). Plankton structure of shallow coastal zone at Admiralty Bay, King George Island, West Antarctic Peninsula (WAP): pico, nano and microplankton and chlorophyll biomass, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Tenenbaum, D.R.; Lange, P.; Fernandes, L.; Calixto, M.; Barreira-Alba, J.J. & Garcia, V.M.T. (2010b). Plankton structure of shallow coastal zone at Admiralty Bay, King George Island, West Antarctic Peninsula (WAP): composition of phytoplankton an influence of benthic diatoms, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Ten贸rio, M.M.B.; Duarte, B.R.; Barreira-Alba, J.J. & Tenenbaum, D.R. (2010). Plankton structure of shallow zone at Admiralty Bay, King George Island: chlorophyll biomass and size-fractionated chlorophyll during austral summer 2009/2010, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Trivelpiece, W.Z.; Trivelpiece, S.G. & Volkman, N.J. (1987). Ecological segregation of Adelie, gentoo, and chinstrap penguins at King George Island, Antarctica. Ecology, 68(2): 351-61. Ushimaru, P.I.; Nakayama, C.R.; Vilella, D. & Pellizari, V.H. (2010). Occurrence of microbial faecal pollution indicators in sediment and water samples at Admiralty Bay, King George Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. Whitfield, A.K. & Elliott, M. (2002). Fishes as indicators of environmental and ecological changes within estuaries: A review of progress and some suggestions for the future. Journal of Fish Biology, 61(Suppl. A): 229-50. Wisnieski, E.; Ceschim, L.M.M.; Aguiar, S.N. & Martins, C.C. (2010). Distribution of sterols in sediment cores from Martel Inlet, Admiralty Bay, King George Island, Antarctic Peninsula, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN.
106
| Annual Activity Report 2010
Science Highlights - Thematic Area 3 |
107
1 PLANKTON STRUCTURE A IN SHALLOW COASTAL ZONE AT ADMIRALTY BAY, KING GEORGE ISLAND, WEST ANTARCTIC PENINSULA (WAP): PICO, NANO AND MICROPLANKTON AND CHLOROPHYLL BIOMASS Denise Rivera Tenenbaum1,*, José Juan Barrera-Alba1,**, Renatha Barboza Duarte1, Márcio Murilo Barboza Tenório1,*** Laboratório de Fitoplâncton Marinho, Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil
1
e-mail: *deniser@biologia.ufrj.br; **juanalba@biologia.ufrj.br; ***marcio.tenorio@biologia.ufrj.br
Abstract: The phytoplankton composition and biomass are being monitored in Admiralty Bay, Antarctic Peninsula since 2002 to detect possible interannual changes on a long-term perspective. In this report, we present the preliminary results of the 2009/2010 monitoring program regarding phytoplankton size-structure and biomass. Even if mean microplankton densities were similar between December 2009 and February 2010, diferent phytoplankton groups dominated each sampling period. Pennate diatoms showed highest contribution in December, whereas athecate dinoflagellates were the most abundant microplanktonic group in February. Pico and nanoplankton were only detailed during the second sampling period, and results showed that phytoplankton were dominated by cells <10 µm (~104 and 107 cells.L–1, respectively). The shift in phytoplankton structure pointed out by the dominance of pico- and nano-size cells in phytoplankton and heterotrophic dinoflagellates in late summer must be confirmed by continuing the long-term monitoring program and the implementation of microvariation sampling effort to identify the factors that are actually influencing phytoplankton populations in this environment. Keywords: microbial community, size-fraction structure, Antarctic coastal zone, PROANTAR
Introduction
108
The West Antarctic Peninsula (WAP) waters undergo
undertaken until 2010, through four surveys, including
extreme seasonal fluctuations in terms of light regime,
samplings in both early and late austral summer. Recent
sea-ice concentration and productivity (Delille, 2004). The
studies showed that in the Admiralty Bay, picoplankton and
WAP has experienced a significant rise in air temperature
nanoplankton are the dominant groups, with microplankton
during the last 50 years (±0.56 °C per decade) (Marshall et al.,
diatoms as the second group in abundance. Between the
2002). Monitoring of biodiversity in shallow waters (30 m)
decades of 1990 and 2000, several studies showed a decline
at Admiralty Bay was implemented in 2002 by PROANTAR
in diatom contribution (Kopczynska, 2008), in relation to
(Brazilian Antarctic Program) during the PROANTAR
those observed in the continental shelf region. Based on
Operation XX (OPERANTAR) aiming to study the effects
these facts, since 2009 new approaches to phytoplankton
of environmental factors (natural and anthropogenic)
monitoring have been established, including the analysis
on the microplanktonic community structure, through
of size-fractioned pigments by spectrofluorometry, and the
analysis of long-term temporal series. These activities were
analysis of density and biovolume of pico- and nanoplankton
| Annual Activity Report 2010
by epifluorescence microscopy, and furthermore through
At the same time, temperature and salinity
a higher sampling frequency effort. Additionally, the
measurements were carried out by the Laboratório
composition of microphytobenthos species will be carried
de Química Orgânica Marinha (LabQOM), Instituto
out to study the effects of environmental changes on this
Oceanográfico da Universidade de São Paulo (The Marine
community in the nearshore Antarctic ecosystem.
Organic Chemistry Laboratory of the Oceanographic
In the present study we show preliminary results during the OPERANTAR XXVIII, between December 2009 and February 2010.
Materials and methods Study area Admiralty Bay (62° 03’-12’ S and 58° 18’-38’ W), located at King George Island, is a deep fjord-like embayment with 500 m maximum depth at its centre (Rakusa-Suszczewski et al., 1993). The waters from the bay mix with the deep oceanic waters from Bellingshausen and Weddell Seas at its southern opening, which connects to the Bransfield Strait (RakusaSuszczewski, 1980; Lipski, 1987). The maximum depth varies between 60 m along the shores and 500 m in the centre of the bay. Deep currents generated by tides, frequent upwellings, vertical mixing of the entire water column and current velocities of 30-100 cm.s−1 in the 0-100 m surface stratum are characteristic of the bay (Rakusa−Suszczewski, 1993). In the context of water column production, Admiralty Bay at nearshore can be considered as “high nutrient – low chlorophyll” (HNLC) Platt et al. (2003) showing high inorganic dissolved nitrogen (16.6-46.9 µM) and phosphate (0.2-9.9 µM) concentrations, while chlorophyll levels are lower than 1.7 µg.L–1 (Lange et al., 2007).
Sampling The analysis of microplankton and chlorophyll was performed from aliquots of the 5 L water samples collected with a Van Dorn bottle from surface, middle water column and near the bottom (≈30m) at five stations in December 2009 and in February 2010. The fractionation analysis of pico- and nanoplankton was performed only at three
Institute of the University of São Paulo).
Fixation and preparation of samples For microplankton (>20 µm), 1 L aliquots were fixed with buffered formaldehyde (2% f.c.). In the laboratory, samples were analysed using the settling technique (Utermöhl, 1958) in an Olympus IX70® inverted microscope at 400x magnification. For pico- (<2 µm) and nanoplankton (<20 µm), aliquots of 250 mL were stored in dark bottles and fixed with 0.22 µm filtered glutaraldehyde (2% f.c.) at 4 °C until analysis. 5 and 30 mL were stained with DAPI (4’,6-diamidino2-phenylindole) at a final concentration of 0.01 µg.L–1 (Martinussen & Thingstad, 1991), during 10 minutes and filtered respectively by 0.22 µm (picoplankton) and 1.0 µm (nanoplankton) polycarbonate black membrane filters (Poretics®), and mounted on microscope slides between layers of immersion oil. Slides were stored at –20 °C. Analyses were performed using an Olympus BX51® epifluorescence microscope with 1,000 x magnification. The number of heterotrophs was calculated based on the total counted using DAPI (UV filter combination) minus the number of autotrophs analysed by autofluorescence (Blue filter combination). For chlorophyll biomass, 2 L aliquots were filtered through Whatman® GF/F filters for pigments analyses, while 0.8-2 L was used for the size structure study. In the latter case, water sampled at 3 depths was fractionated by serial filtration on 10 μm and 2 μm polycarbonate filters and GF/F. The filters were folded, placed into a 1.2 mL cryotube and immediately quick-frozen in liquid nitrogen (−196 °C) and stored at −80 °C. Concentrations of chlorophyll a and phaeophytin a were assessed using a modified version of Neveux and Lantoine’s (1993) method.
stations (AR, MP and CF) in February 2010, when three
In order to normalize distributions and eliminate
surveys were done. The Admiralty Bay location and the
zero values, the biological data was transformed using
position of the sampling stations are shown in Figure 1.
log10(x + 1). Differences among surveys and sampling
Science Highlights - Thematic Area 3 |
109
Figure 1. Study area (modified from Moura, 2009) with the position of the sampling sites: Ferraz Station (CF), Botany Point (BP), Machu Picchu (MP), Point Thomas (PT), Arctowski (AR).
stations were tested by a One-Way ANOVA with a Kruskal-
higher in early summer (0.34 µg.L–1) than in late summer
Wallis test (p < 0.05). Spearman’s correlation factor was also
(0.20 µg.L–1), no significant differences were observed
calculated.
among sampling stations inside each sampling period
Results Microplankton and total chlorophyll biomass between early and late summer Although salinity showed little variation between sampling periods, values were on average lower in February 2010 (33.9 ± 0.2) than in December 2009 (34.2 ± 0.1). During the early summer, the water was relatively colder (–0.13 ± 0.11 °C) than during late summer (0.68 ± 0.25 °C). Although no great differences in salinity and temperature between sampling stations during each period, on Machu
110
(Figures 2c, d). An average cellular density of 3 x 103 ± 0.3 x 103 cells.L–1 was observed for microplankton, with little variation between sampling periods (≈103 cells.L–1). The contribution is shared by the diatoms (mainly at the beginning of summer with 56%) and dinoflagellates (at the end of the summer with 68%). Among diatoms the pennate type was predominant (90% in December 2009 and 70% in February 2010). Athecate forms, especially heterotrophs, were more abundant among dinoflagellates during February (69%), while thecate forms representing ~70% of
Picchu (MP) the lowest salinity and temperature were
total dinoflagellates in December. Among sampling sites,
observed in December 2009, while at EACF the lowest
microplankton registered maximum cellular density at
values for both variables were registered in January 2010
MP due to the predominance of pennate diatoms during
(Figures 2a, b). Total chlorophyll biomass was on average
December 2009 (Figure 2e).
| Annual Activity Report 2010
a
d
b
e
c
f
Figure 2. Results of salinity (continuous line), temperature (dotted line), chlorophyll a concentration (µg.L–1) and microplankton density (cells.L–1) at December 2009 (a, b and c) and February 2010 (d, e and f).
Pico and Nanoplankton abundance and size-fractioned chlorophyll in late summer
size-fraction, while the picoplankton was dominated by
During February 2009 pico- and nanoplankton densitiy
only <1% of picoplankton, abundances relatively high
did not show significant differences among sampling sites,
for this group were observed (2.1 – 8.2 × 107 cells.L–1).
but differences were observed among sampling periods
Autotrophic nanoplankton was positively correlated with
(p < 0.01). Chla concentrations varying between 0.18 and
total and <10 µm size-fraction of Chla (p < 0.01), although
0.74 µg.L–1 were observed, with the size-fraction <10 µm
autotrophic picoplankton was negatively correlated with
representing more than 80% of the total. An increase in
total and <0.2 µm size-fraction of Chla (p < 0.05).
heterotrophs (~99%). Despite autotrophic cells represented
Chla concentrations was observed from the first to the last survey, although the fraction 2-10 µm registered higher values during the second survey (Figure 3b). Nanoplankton and picoplankton abundances showed a similar pattern, with higher mean values (8.5 ± 2.8 × 10
6
Discussion Microplankton and total chlorophyll biomass between early and late summer
and 1.2 ± 0.2 × 1011 cells.L–1, respectively) during the second
Microplankton cellular densities and chlorophyll biomass
survey (Figures 3c, d). The nanoplankton community
observed in this study were low when compared to those
was dominated by the autotrophic (>75%) and 2-10 µm
registered for Admiralty Bay during the decades of the
Science Highlights - Thematic Area 3 |
111
a
b
c
d
Figure 3. Results at the different sampling periods during February 2010: a) salinity (continuous line) and temperature (dotted line); b) size-fractioned chlorophyll a concentration (µg.L–1); c) picoplankton density (autotrophs in 107 L–1 cells; heterotrophs in 109 cells.L–1); d) nanoplankton density (106 cells.L–1).
1970s, 1980s and 1990s, when densities of 105 cells.L–1 were
nanoplankton, both in abundance and chlorophyll biomass.
usually registered (i.e. Kopczynska, 1981; Brandini, 1993;
In previous studies the dominance of nanoflagellates and
Kopczynska, 2008). However densities were similar to those
monads for this region had been observed (i.e. Kopczynska,
observed by Lange et al. (2007) in a study developed during
1980; Kopczynska, 1981; Brandini, 1993; Kopczynska,
the austral summer 2002/2003.
2008). Maxima of flagellates at Admiralty Bay in windless
Dominance of diatoms over dinoflagellates in the microplankton fraction has been usually observed for Admiralty Bay (Lange et al., 2007; Kopczynska, 2008), but a diminished percentage of contribution of diatoms in the phytoplankton assemblages was observed in a study developed in 2003-2005 (Kopczynska, 2008). Our results showed that the contribution of diatoms decrease especially during late summer, while at the same time heterotrophic dinoflagellates (i.e. Gyrodinium lachryma) became more abundant.
112
days and little variation in atmospheric pressure was reported, which resulted in an increase of water column stability (Kopczynska, 1981). Although Kopczynska (2008) showed the co-dominance of picoplankters from inverted microscope cell counting technique at Admiralty Bay, this was the first attempt to quantify the real contribution of picoautotrophs to total phytoplankton density and biomass, and densities were in the same range of those observed in other Antarctic regions (i.e. Umani et al., 2005; Delille et al., 2007). In the nearshore coastal waters along the Antarctic
Pico and Nanoplankton abundance and size-fractioned chlorophyll in late summer
Peninsula, a recurrent shift in phytoplankton community
Phytoplankton community at Admiralty Bay during the
documented due to high temperatures along the Peninsula
late summer of 2009/2010 was dominated by pico- and
increasing the extent of coastal melt-water zones promoting
| Annual Activity Report 2010
structure, from diatoms to cryptophytes, has been
seasonal prevalence of cryptophytes (Moline et al., 2004).
contribution of autotrophs pico- and nanoplankton to total
The dominance of pico and nano-size cells in phytoplankton,
density and biomass in late summer, suggest that changes
which are not grazed efficiently by Antarctic krill, will likely
could be occurring in Admiralty Bay food web. Thus, it is
cause a shift in the spatial distribution of krill and may
necessary to continue the long-term monitoring program
allow also for the rapid asexual proliferation of carbon poor
and the implementation of microvariation sampling
gelatinous zooplankton, salps in particular (Moline et al.,
effort to identify the factors that are actually influencing
2004), and probably the dominance of heterotrophic
phytoplankton populations in this environment.
dinoflagellates observed during the late summer period of this study.
Conclusion
Acknowledgements To the Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais, contracts CNPq n° 574018/2008-5
In the context of the regional warming trend of WAP,
and FAPERJ n° E-16/170.023/2008, Laboratório de
preliminary results of the present study showed a shift
Química Orgânica Marinha (LabQOM- USP), Instituto
in Admiralty Bay plankton community, with significant
Oceanográfico (USP), Ministério do Meio Ambiente
variability both in short- and medium-term scales, from
(MMA), Ministério de Ciência e Tecnologia (MCT) and
day to day and months. Low microplankton densities,
Comissão Interministerial para os Recursos do Mar (CIRM).
dominance of dinoflagellates, mainly heterotrophs, and high
Also to Rafael Bendayan de Moura for Admiralty Bay map.
References Brandini, F.P. (1993). Phytoplankton biomass in an Antarctic coastal environment during stable water conditions - implications for the iron limitation theory. Marine Ecology Progress Series, 93: 267-75. Delille, D. (2004) Abundance and function of bacteria in the Southern Ocean. Cellular and Molecular Biology, 50(5): 543-51 Delille D.; Gleizon, F. & Delille, B. (2007). Spatial and temporal variations of bacteria and phytoplankton in a subAntarctic coastal area (Kerguelen Archipelago). Journal of Marine Systems, 68(3-4): 366-80 Kopczynska, E.E. (1980). Small scale vertical distribution of phytoplankton in Ezcurra Inlet, Admiralty Bay, South Shetland Islands. Polish Polar Research, 1: 77-96. Kopczynska, E.E. (1981). Periodicity and composition of summer phytoplankton in Ezcurra Inlet, Admiralty Bay, King George Island, South Shetland Islands. Polish Polar Research, 2: 55-70. Kopczynska, E.E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years of monitoring. Polish Polar Research, 29(2): 117-139. Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B. & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at Admiralty Bay (King George Island, Antarctica) during the summer 2002-2003. Polar Biology, 30(11): 1483-92. Lipski, M. (1987). Variations of physical conditions, nutrients and chlorophyll a contents in Admiralty Bay (King George Island, South Shetland Islands). Polish Polar Research, 8: 307-32. Marshall G.J.; Lagun V. & Lachlan-Cope T.A. (2002). Changes in Antarctic Peninsula tropospheric temperatures from 1956 to 1999: a synthesis of observations and reanalysis data. International Journal of Climatology, 22(3): 291-310. Martinussen, I. & Thingstad. T.F. (1991). A simple double-staining method for enumeration of autotrophic and heterotrophic nano- and picoplankton. Marine Microbial Food Webs, 5: 5-11. Moline, M.A.; Claustre, H.; Frazer, T.K.; Schofield, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic Peninsula in response to a regional warming trend. Global Change Biology, 10: 1973-1980, doi: 10.1111/j.1365-2486.2004.00825.x
Science Highlights - Thematic Area 3 |
113
Moura, R.B. (2009). Estudo taxonômico dos Holothuroidea (Echinodermata) das Ilhas Shetland do Sul e do Estreito de Bransfield, Antártica. Dissertação de Mestrado, Museu Nacional, Universidade Federal do Rio de Janeiro. Neveux, J. & Lantoine, F. (1993). Spectrofluorometric assay of chlorophylls and phaeopigments using the least squares approximation technique. Deep-Sea Research I, 40(9): 1747-65. Platt T.; Broomhead D.S.; Sathyendranath S.; Edwards A.M. & Murphy E.J. (2003). Phytoplankton biomass and residual nitrate in the pelagic ecosystem. Proceedings of the Royal Society A, 459: 1063-73. Rakusa-Suszczewski, S. (1980) Environmental conditions and the functioning of Admiralty Bay (South Shetland Islands) as part of the near shore Antarctic ecosystem. Polish Polar Research, 1(1):11-27. Rakusa-Suszczewski S.; Mietus M. & Piasecki, J. (1993). Weather and climate. In: Rakusa-Suszczewski, S. (ed.) The maritime coastal ecosystem of Admiralty Bay. Warsaw: Polish Academy of Science, pp 19-25. Umani, F.S.; Monti, M.; Bergamasco, A.; Cabrini, C.; De Vittor, C.; Burba, N. & Del Negro, P. (2005). Plankton community structure and dynamics versus physical structure from Terra Nova Bay to Ross Ice Shelf (Antarctica). Journal of Marine Systems, 55(1-2): 31-46. Utermöhl H. (1958). Zur Vervollkommung der quantitativen Phytoplankton-Methodik. Mitteilungen der Internationale Vereinigung für Teoretische und Angewandte Limnologie, 9: 1-38.
114
| Annual Activity Report 2010
2 PLANKTON STRUCTURE A IN SHALLOW COASTAL ZONE AT ADMIRALTY BAY, KING GEORGE ISLAND, WEST ANTARCTIC PENINSULA (WAP): CHLOROPHYLL BIOMASS AND SIZE-FRACTIONATED CHLOROPHYLL DURING AUSTRAL SUMMER 2009/2010 Márcio Murilo Barboza Tenório1,*, Renatha Barboza Duarte1, José Juan Barrera-Alba1,**, Denise Rivera Tenenbaum1,*** Laboratório de Fitoplâncton Marinho, Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil
1
e-mail: *marcio.tenorio@biologia.ufrj.br; **juanalba@biologia.ufrj.br; ***deniser@biologia.ufrj.br
Abstract: Chlorophyll a concentration and size structure of the phytoplankton community were studied in Admiralty Bay in early and late summer of 2009/2010, using spectrofluorometry chlorophyll analysis. Chlorophyll a biomass was generally low (<5 µg.L–1) and showed a relatively spatial homogeneity. In this study the contribution of size fractions (<2 µm, 2-10 µm and >10 µm) in chlorophyll a biomass was analyzed for the first time in Admiralty Bay. Size fraction <10 µm represented more than 80% of the chlorophyll a concentrations. Keywords: size structure, spectrofluorometry, Antarctic, King George Island
Introduction Phytoplankton pigments (chlorophylls, carotenoids,
ecosystems and in the global flux of organic matter towards
phycobiliproteins) remain a major source of information on
the aphotic layer (Jacques & Panouse, 1991). Size structures
biomass, community structure, dynamic, and physiological
of phytoplankton communities are quantitative expressions
state of phytoplankton (Neveux et al., 2009). Among the
of the relative success of certain different community
pigments, chlorophyll a concentration is used to access
size compartments to survive or grow in an essentially
biomass of phytoplankton. Chlorophyll a distribution in the
unstable environment controlled by physical and chemical
Southern Ocean showed high spatial and temporal variability
characteristics (Rodriguez & Guerrero, 1994). Recent
(Marrari et al., 2008). The area surrounding the South
studies demonstrated that in the West Antarctic Peninsula
Shetland Islands along the Antarctic Peninsula, where King
(WAP), picoplankton and nanoplankton are the dominant
George Island is located, exhibits high phytoplankton biomass
groups, with microplankton diatoms being the second
during the austral summer, with high nutrients and low
group in abundance (Montes-Hugo, 2009). In this study
chlorophyll (HNLC) conditions in Drake Passage to the north
we presented the preliminary results of the monitoring
and in the Bransfield Strait to the south (Hewes et al., 2009).
program of chlorophyll a biomass and chlorophyll a size
The size distribution of the primary producers plays
fraction conducted in Admiralty Bay, King George Island,
an important role in the trophic organization of marine
during the summer of 2009/2010.
Science Highlights - Thematic Area 3 |
115
Materials and Methods
bottle from the surface, middle water column and near the
Study area
February 2010. At the same time temperature and salinity
Admiralty Bay (62° 03’-12’ S and 58° 18’-38’ W), located at King George Island (Figure 1), is a deep fjord-like embayment with 500 m maximum depth at its centre (Rakusa-Suszczewski et al., 1993). The waters from the bay
bottom (≈30 m) at five stations in December 2009 and in analyses were carried out by the Laboratório de Química Orgânica Marinha (LabQOM), Instituto Oceanográfico da Universidade de São Paulo.
mix with the deep oceanic waters from the Bellingshausen
Chlorophyll a and phaeophytin a
and Weddell Seas at its southern opening, which connects
Water samples (2 L) were filtered onto Whatman® GF/F
to the Bransfield Strait (Rakusa-Suszczewski, 1980; Lipski,
(Ø 47 mm) for total pigment analyses, while 0.8-2 L were
1987). The maximum depth varies between 60 m at the shores and 500 m in the centre of the bay. Deep currents generated by tides, frequent upwellings, vertical mixing and current velocities of 30-100 cm.s–1 in the 0-100 m surface stratum are characteristic of the bay (RakusaSuszczewski et al., 1993).
Sampling
used for the size structure study. In the latter case, during late summer sampling at CF, MP and AR stations (Figure 1), water sampled at 3 depths was fractionated by serial filtration on 10 µm and 2 µm polycarbonate filters and GF/F (Ø 47 mm). The filters were folded, placed into a 1.2 mL cryotube and immediately quick-frozen in liquid nitrogen (–196 °C) and stored at −80 °C. For pigment extraction, GF/F filters were dipped in 5.4 mL of 100% acetone (final
The fractionate analysis of chlorophyll a was performed
concentration ≈90% acetone taking into account water
from splits of the 5 L water sample collected using a Niskin
retention by the filter (≈0.621 ± 0.034 mL) and ground
Figure 1. Study area (modified from Moura, 2009) with the position of the sampling sites: Ferraz Station (CF), Botany Point (BP), Machu Picchu (MP), Thomas Point (TP), Arctowski (AR).
116
| Annual Activity Report 2010
with the freshly broken end of a glass rod, and left in the
than those observed during late summer (0.81 ± 0.23 °C,
dark at 4 °C for a 12 hours extraction. Polycarbonate filters,
n = 45). Negative values were observed during early summer
on the other hand, were just left in the dark at 4 °C for a
and increased throughout the season (Figure 2a). Although
24 hours in 5 mL of 90% acetone. Following extraction, the tubes were centrifuged for 5 minutes at 3500 rpm and the extracted fluorescence was measured with a Varian Cary Eclipse® spectrofluorometer. Concentrations of chlorophyll-a and phaeophytin-a were assessed using a modified version of Neveux and Lantoine’s (1993) method. The modifications were as follows: 1) data acquisition was performed by recording the fluorescence emission spectra for each of 15 excitation wavelengths (3-nm increments from 390 to 432 nm), emission spectra were recorded at 4 nm intervals from 659-715 nm, yielding 29 data points for each spectrum. Pigment concentrations were estimated from the resulting 435 data points, and 2) where the least squares approximation technique was constrained to discard negative solutions.
salinity decreased during the sampling period, mean values were similar between early summer (34.2 ± 0.1, n = 60) and late summer (34.1 ± 0.2, n = 45) (Figure 2b). During late summer, inner sampling stations (CF, BP and MP) showed the greatest changes in surface salinity, mainly on 13th and 19th February (Figure 2b).
Chlorophyll a biomass and size structure Chlorophyll-a (Chla) biomass was often low, and varied from 0.34 µg.L-1 (± 0.07, n = 60) to 0.47 µg.L-1 (±0.21, n = 45) during early and late summer, respectively, with no great variability observed among stations and vertical profiles during each period. Values lower than 0.5 µg.L-1 were observed in 93% and 56% of the samples during late and early summer, respectively. Chla increased in both
Statistical analyses
periods, especially during late summer, when biomass
Differences among surveys and sampling stations were
varied from 0.24 to 0.65 µg.L-1 (Figure 3a). The increasing
tested using a One-Way ANOVA with a Kruskal-Wallis test (p < 0.05). Spearman’s correlation factor was also calculated.
in Chla biomass in late summer was positively correlated with water temperature (r = 0.39; p < 0,05). In late summer, picoplanktonic fraction (<2 µm) represented on average
Results
37% (±8.4, n = 36) of Chla, whereas the class size between
Thermohaline structure
2-10 µm represented 44% (±3.7, n = 36) (Figure 3b).
During the sampling period, water temperature was
The fraction >10 µm accounted on average for only 19%
characterized both by spatial and vertical homogeneity. Early
(± 8.6, n = 36); and this contribution decreased over 50%
summer presented colder waters (0.09 ± 0.44 °C, n = 60)
towards the end of the sampling period, mainly due to the
a
b
Figure 2. Temporal variation of water temperature °C (a) and salinity (b) in Admiralty Bay during December 2009 and February 2010.
Science Highlights - Thematic Area 3 |
117
a
b
Figure 3. Temporal variation of Chlorophyll a : a) concentrations during December 2009 and February 2010, b) contribution to size distribution during February 2010.
increase of picoplankton contribution. As observed for total
vertical distribution during all the sampling period was also
Chla biomass, the vertical and spatial variability of size
observed by Brandini and Rebello (1994).
fractionated Chla was not significantly different.
The size distribution of the primary producers plays an important role in the trophic organization of marine
Discussion
ecosystems and in the global flux of organic matter
Hidrology
contribution of size fractions (<2 μm, 2-10 μm and >10 μm)
Early and late summer values of temperature and salinity
to Chla biomass at Admiralty Bay is described for the first
observed in the present study were similar to those reported
time. In the Admiralty Bay, Chla was co-dominated by pico
in previous studies (Brandini, 1993; Lange et al., 2007). The
(37%) and 2-10 μm size-class (44%), while cells >10 μm
greatest variability in surface salinity observed during late
represented only 19% of the Chla biomass. Previous studies
summer at the most inner stations (CF, BP and MP) was mainly due to the inflow of freshwater, which increased from melting snow and glacial ice as a consequence of the rise in temperature. Chlorophyll-a, an indicator of overall phytoplankton abundance and chlorophyll a size structure Low Chla biomass (<1 µg.L-1), as observed in Admiralty Bay during late summer of 2009/2010, was commonly reported in previous studies (Brandini, 1993; Lange et al., 2007) as well
118
towards the aphotic layer (Jacques & Panouse, 1991). The
in the same area have reported nano-size cell dominance on phytoplankton (Brandini, 1993; Kopczynska, 2008). Size-class distribution in the present study were similar to those observed in the vicinity of Elephant Island (Weber & El-Sayed, 1987), where the contribution to total Chla ranged between 39-98% for nanoplankton and between 5-74% for picoplankton. Moreau et al. (2010) also observed a piconanoplankton dominance and microplankton in very low abundances at Melchior Archipelago (Antarctic Peninsula) during a spring-season study.
as on adjacent areas (Brandini & Kutner, 1986; Kang & Lee,
Phytoplankton biomass and growth in the water column
1995) and in Antarctic oceanic waters, despite high nutrient
at Admiralty Bay can be strongly influenced by wind-driven
concentrations (Platt et al., 2003). The relatively homogeneous
turbulence (Brandini & Rebello, 1994). In coastal areas wind-
| Annual Activity Report 2010
driven turbulence may have a positive effect, leading to a phytoplankton biomass accumulation as a consequence of benthic diatoms (generally larger than 10 µm) resuspension, and, consequently, affecting secondary production. In this study they observed Chla increasing during a low wind and water column stabilization period after an intense upwelling event promoted by wind stress. The low biomass and low contribution of cells >10 µm to Chla observed in the present study suggest a long low-wind period; however, this will need to be checked later in our studies. The temperature sensitivity of planktonic organisms suggests that Southern Ocean plankton communities may be particularly sensitive to global warming (Wright et al., 2009). In the nearshore coastal waters along the Antarctic Peninsula, a recurrent shift in phytoplankton community structure, from diatoms to cryptophytes, has been documented (Moline et al., 2004). A change in the size spectrum of Southern Ocean phytoplankton would be expected to have serious consequences for krill and
Conclusion The preliminary results of the present study showed a relatively spatial homogeneity in chlorophyll a concentration. Temporal variation presented a significant variability between early and late summer and among the three samplings during late summer, highlighting that a shortterm temporal variation study is necessary to understand the environmental effects on phytoplankton organisms. Phytoplankton populations were co-dominated by nano and picoplanktonic cells, which represented more than 80% of chlorophyll a concentrations. Chlorophyll a biomass and size fractionated studies in the Admiralty Bay proved to be a good tool for monitoring the global effect of changes on the region.
Acknowledgements To the Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais, contracts CNPq n° 574018/2008-5
other herbivores that are adapted to a diet of nano- and
and FAPERJ n° E-16/170.023/2008, Laboratório de Química
microplankton, and would also affect the dynamics of the
Orgânica Marinha (LabQOM- USP), Instituto Oceanográfico
microbial loop and the transport of carbon to the deep
(USP), Ministério do Meio Ambiente (MMA), Ministério de
ocean (Wright et al., 2009). These observations highlight
Ciência e Tecnologia (MCT) and Comissão Interministerial
the importance of a long-term monitoring study of Chla
para os Recursos do Mar (CIRM). To FAPERJ/CAPES for the
size fraction data in this region.
post-doctoral scholarship to M.M.B. Tenório.
References Brandini, F.P. & Kutner, M.B.B. (1986). Composition and distribution of summer phytoplankton in the Bransfield Strait, Antarctica. Anais da Academia Brasileira de Ciências, 58: 1-11. Brandini, F.P. (1993). Phytoplankton biomass in an Antarctic coastal environment during stable water conditions - implications for the iron limitation theory. Marine Ecology Progress Series, 93: 267-75. Brandini, F.P. & Rebello, J. (1994). Wind field effect on hydrography and chlorophyll dynamics in the coastal pelagial of Admiralty Bay, King George Island, Antarctica. Antarctic Science, 6(4): 433-42. Hewes, C.D.; Reiss, C.S. & Holm-Hansen, O. (2009). A quantitative analysis of sources for summer time phytoplankton Variability over 18 years in the South Shetland Islands (Antarctica) region. Deep-Sea Research I, 56(8):1230–41. Jacques, G. & Panouse, M. (1991). Biomass and composition of size fractionated phytoplankton in the WeddelI-Scotia Confluence area. Polar Biology, 11(5): 315-28. Kang, S. & Lee, S. (1995). Antarctic phytoplankton assemblages in the western Bransfield Strait region, February 1993: composition, biomass, and mesoscale distributions. Marine Ecology Progress Series, 129: 253-67.
Science Highlights - Thematic Area 3 |
119
Kopczynska, E.E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years of monitoring. Polish Polar Research, 29(2): 117-39. Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at Admiralty Bay (King George Island, Antarctica) during the summer 2002-2003. Polar Biology, 30(11): 1483-92. Lipski, M. (1987). Variations of physical conditions, nutrients and chlorophyll a contents in Admiralty Bay (King George Island, South Shetland Islands). Polish Polar Research, 8: 307-32. Marrari, M.; Kendra, L.D. & Hu, C. (2008). Spatial and temporal variability of SeaWiFS chlorophyll a distributions west of the Antarctic Peninsula: Implications for krill production. Deep-Sea Research II, 55(3-4): 377-92. Moline, M.A.; Claustre, H.; Frazer, T. K.; Schofield, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic Peninsula in response to a regional warming trend. Global Change Biology, DOI: 10.1111/j.1365-2486.2004.00825.x Montes-Hugo, M.; Doney, S.C.; Ducklow, H.W.; Fraser, W.; Martinson, D.; Stammerjohn, S.E. & Schofield, O. (2009). Recent changes in phytoplankton communities associated with rapid regional climate change along the western Antarctic Peninsula. Science, 323: 1470-73. Moreau, S.; Ferreyra, G.A.; Mercier, B.; Lemarchand, K.; Lionard, M.; Roy, S.; Mostajir, B.; Roy, S.; van Hardenberg, B. & Demers, S. (2010). Variability of the microbial community in the western Antarctic Peninsula from late fall to spring during a low ice cover year. Polar Biology, DOI: 10.1007/s00300-010-0806-z Moura, R. B. (2009). Estudo taxonômico dos Holothuroidea (Echinodermata) das Ilhas Shetland do Sul e do Estreito de Bransfield, Antártica. Dissertação de Mestrado, Museu Nacional, Universidade Federal do Rio de Janeiro. Neveux, J.; Tenório, M.M.B.; Jacquet, S.; Torréton, J.-P.; Douillet, P.; Ouillon, S. & Dupouy, C. (2009). Chlorophylls and phycoerythrins as markers of environmental forcings including Cyclone Erica effect (March 2003) on phytoplankton in the South west Lagoon of New Caledonia and oceanic adjacent area. International Journal of Oceanography, DOI:10.1155/2009/232513. Neveux, J. & Lantoine, F. (1993). Spectrofluorometric assay of chlorophylls and phaeopigments using the least squares approximation technique. Deep-Sea Research I, 40(9): 1747-65. Platt T.; Broomhead D.S.; Sathyendranath S.; Edwards A.M. & Murphy E.J. (2003). Phytoplankton biomass and residual nitrate in the pelagic ecosystem. Proceedings of the Royal Society A, 459:1063-73. Rakusa-Suszczewski, S. (1980). Environmental conditions and the functioning of Admiralty Bay (South Shetland Islands) as part of the near shore Antarctic ecosystem. Polish Polar Research, 1(1):11-27. Rakusa-Suszczewski S.; Mietus M. & Piasecki, J. (1993). Weather and climate. In: Rakusa-Suszczewski, S. (ed.) The maritime coastal ecosystem of Admiralty Bay. Warsaw: Polish Academy of Science, pp 19-25. Rodriguez, V. & Guerrero, F.J. (1994). Chlorophyll a size-fractionated summer phytoplankton blooms at a coastal station in Málaga Bay, Alboran Sea. Estuarine, Coastal and Shelf Science, 39(4):413-9. Weber, L.H. & El-Sayed, S.Z. (1987). Contributions of the net, nano- and picoplankton to the phytoplankton standing crop and primary productivity in the Southern Ocean. Journal of Plankton Research, 9(5): 973:94. Wright, S.W.; Ishikawa, A.; Marchant, H.J.; Davidson, A.T.; van den Enden, R.L. & Nash, G.V. (2009). Composition and signicance of picophytoplankton in Antarctic waters. Polar Biology, 32(5): 797-808.
120
| Annual Activity Report 2010
3 PLANKTON STRUCTURE A IN SHALLOW COASTAL ZONE AT ADMIRALTY BAY, KING GEORGE ISLAND WEST ANTARCTIC PENINSULA (WAP): COMPOSITION OF PHYTOPLANKTON AND INFLUENCE OF BENTHIC DIATOMS Denise Rivera Tenenbaum1,*, Priscila Lange1,3, Luciano F. Fernandes2, Mariana Calixto-Feres2, José Juan Barrera-Alba1, Virgínia M. T. Garcia3 1
Laboratório de Fitoplâncton Marinho, Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 2 Departamento de Botânica, Setor de Ciências Biológicas, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 3 Laboratório de Fitoplâncton e Microorganismos Marinhos, Instituto de Oceanografia, Universidade Federal do Rio Grande – FURG, Rio Grande, RS, Brazil *e-mail: deniser@biologia.ufrj.br
Abstract: The phytoplankton composition and biomass are being monitored in Admiralty Bay, Antarctic Peninsula since 2002 to detect possible interannual changes on a long-term monitoring perspective. In this report, we present the results of the 2009/2010 monitoring program regarding the phytoplankton composition during the PROANTAR XVIII operation. The community was dominated by both planktonic and benthic diatoms. A total of 140 species were found, many of them awaiting further morphological studies to determine their specific identity. A preliminary assessment of habitat preferences was made, showing that the diatoms in the Admiralty Bay came from distinct substrates like ice, rocks, sediments, plankton and macroalgae. These results indicate that benthic microalgae, particularly diatoms, play an important role in primary productivity of the pelagic community in inshore waters. The next steps will be to refine identification to analyse the whole water samples and to relate the results with the environmental and hydrographical features in Admiralty Bay. Keywords: phytoplankton, monitoring, Admiralty Bay, Antarctic Peninsula
Introduction Phytoplankton is the main contributor to primary
Sayed & Fryxell, 1993). After the decaying of diatom bloom,
production in the Antarctic food web, making the
the prymnesiophyte Phaeocytis predominates. In warmer
organic carbon available to most of the higher trophic
winters cryptophytes become also important affecting small
level consumers; for instance, the krill Euphausia superba
zooplankton consumers such as krill and microcrustaceans
(Knox, 1994). Summer phytoplankton blooms, are usually
(Moline et al., 2004). The Antarctic phytoplankton, like
composed of diatoms (e.g. Fragilariopsis, Nitzschia, Porosira
other marine organisms, have been affected by the recent
and Corethron), particularly when the preceding winter is a
global climate changes registered over the past three
long one, and the ice cover is greater, offering more substrate
decades. The main physical and chemical consequences to
for diatoms apart from the water column, which is, in turn,
the water column are: 1) the progressive delay in ice covering
dominated by Asteromphalus, Chaetoceros, Thalassiosira (El-
during autumn and the earlier ice melting in Spring;
Science Highlights - Thematic Area 3 |
121
2) the warming of seawater southward; 3) the freshening
technique (Utermöhl, 1958) using an Olympus IX70
of saltwater in neritic regions; and 4) alterations in nutrient
inverted microscope at 200 to 400 x magnification. Live
concentrations. Moreover, the ozone depletion has led to a
samples were observed at EACF laboratory immediately
dramatic increase of damaging ultra violet radiation, which
after the sampling processes. A 20 µm mesh plankton
has been shown to induce photoinhibition of photosynthesis
net was towed from the bottom to the surface of all the
in phytoplankton. Therefore, the phytoplankton community
stations. Samples were screened alive to record delicate or
can be used as indicator of global changes, especially when
abundant species, and then preserved in formaldehyde 2%
long term data is gathered in monitoring stations, providing
final concentration. Frustules were cleaned following the
more consistent results and allowing for the prediction
technique of Hasle and Fryxell (1970). Permanent slides
of future negative effects from human interference.
were prepared using Naphrax (r.i. = 1.74) as mounting media
Indeed, some studies have already detected a shifting in
and observed in Light Microscopy using a Olympus IX-70
phytoplankton communities due to climate changes along
equipped with phase and differential contrast systems. A
the Western Antarctic Peninsula (WAP). In the northern
Philips LX30 scanning electron microscope was used under
region, phytoplankton is being replaced by temperate, ice
10-20 KV acceleration voltages. For Transmission Electron
avoiding non-diatom species, with a concurrent decline
Microscope observations, a small drop of cleaned or distilled
of primary production, while in the southern sector the
water washed material was gently placed onto 150 mesh
phytoplankton has increased in biomass contribution,
nickel grids coated with Formvar and Carbon. Grids were air
becoming diatom based and displaying higher production
dried and kept in desiccators until the TEM sessions with a
(Montes-Hugo et al., 2009). These strong latitudinal
Jeol JM120 EXII electron microscope. Terminology followed
shifts at the base of the food web can be the cause of the
Round et al. (1990) and Hasle and Syvertsen (1997).
observed reorganization of the biota in the Northern region of the Antarctic Peninsula in recent years, especially the krill Euphausia superba and the Antarctic silverfish
A total of 140 species has been found for the time being,
Pleurogramma antarcticum. A phytoplankton monitoring
many of them still awaiting further examination to
program was established in 2002 at Admiralty Bay, aiming
determine their species level. Diatoms were by far the
to record the composition, biomass and its relationship
phytoplankton dominant group (Plate 1, Figures 1-23).
with environmental parameters in shallow waters (<30 m)
A few cells of dinoflagellates Protoperidinum spp.,
during the Antarctic summer. On a long term perspective,
Amphidinium spp., Gymnodinium spp., Gyrodinum spp.
this study can lead to the detection of changes in species
and Prorocentrum spp. were detected. The silicoflagellate
composition and abundance, associating them both to local
Distephanus speculum appeared in some samples. Although
and the global changes, as well as the anthropogenic impacts
no quantitative assessment has been done until now, it is
inside the bay due to human activities. In this paper the
clear that some species are more abundant than others like
first results of the 2009-2010 phytoplankton monitoring at
Corethron pennatum, Fragilariopsis spp., Thalassiosira spp.,
Admiralty Bay during the XXVIII PROANTAR (Brazilian
Achnanthes sp. and Fragilaria striatula. A preliminary
Antarctic Operation) are reported, as well as a preliminary
assessment of habitat preferences was made, showing
discussion about the diversity of diatoms associated to their
that the diatoms in the Admiralty Bay came from distinct
different substrate preferences.
environs. The main diatom genera found in 2002-2010, and
Material and Methods
122
Results
the potential substrate preference of each one are listed in Table 1.
Water samples were fixed with buffered formaldehyde
There were 21 planktonic genera recorded, and
(final concentration 2%) and analysed by the settling
22 benthic (epiphytic, epilithic, epipsamic and eponthic),
| Annual Activity Report 2010
Figures 1-23. Common species found in Admiralty Bay, Antartic Peninsula: 1) Fragilaria striatula; 2, 3) Synedropsis recta; 4) Licmophora belgicae; 5) L. antarctica; 6) Licmophora sp.; 7, 8) Achnanthes brevipes; 9, 10) Cocconeis sp.; 11) Cocconeis sp.; 12) Cocconeis "antiqua"; 13, 14) Cocconeis sp.; 15) Cocconeis sp.; 16) Navicula sp.; 17) Navicula cf directa; 18) Pseudogomphonema kamtschaticum; 19) Amphora sp.; 20) Fragilariopsis obliquecostata; 21) Fragilariopsis curta; 22) Fragilariopsis cylindrus; 23) Pseudo-nitzschia sp. Scale bar: 10 Âľm.
Science Highlights - Thematic Area 3 |
123
Table 1. List of genera (number of species) and habitat preference of commonly found diatoms in Admiralty Bay during 2002-2010 monitoring program of phytoplankton.
Achnanthes (4) B
Diploneis (1) P,Ep,El
Hantzschia (1) Ep
Pinnularia (1) P
Stauroneis (1) P
Actinocyclus (2) P
Entomoneis (1) Ep,El
Haslea (1) E, B
Plagiotropsis (1) P
Stellarima (1) P
Amphora (4) B, P
Ephemera (1) P
Licmophora (6) B
Pleurosigma (2) Ep,El,P
Surirella (10) El, B
Asteromphalus (1) P
Eucampia (1) P
Manguinea (1) P
Porosira (2) P
Synedra (1) E, El
Chaetoceros (7) P
Fragilaria (1) Ep,Ep
Melosira (2) P
Proboscia (1) P
Synedropsis (2) B
Cocconeis (12) B
Fragilariopsis (10) Ep
Membraneis (1) P
Pseudogomphonema (2) B
Tabularia (1) B
Corethron (2) Ep, P
Gephyria (1) E
Navicula (12) B,P
Pseudo-nitzschia (2) P
Thalassionema (1) P
Coscinodiscus (3) P
Gomphonema (3) B
Nitzschia (7) B
Rhizosolenia (2) P
Thalassiosira (6) P
Cylindrotheca (1) Ep
Grammatophora (1) B
Odontella (3) P
Rhoicosphenia (1) B
Thalassiothrix (1) P
Dactyliosolen (1) P
Gyrosigma (1) Ep,El
Parlibellus (1) El
Rhopalodia (1) B
B: benthic anywhere; E: epiphytic; Ep: eponthic; El: epilithic; P: planktonic.
all of them in the water column. During the phytoplankton
as the planktonic species, and even surpassed its biomass,
analysis based on whole water samples used in the
in shallow areas and inlets around the Antarctic Peninsula
monitoring program, many species could not be identified
(Ahn et al., 1994, 1997; Kang et al., 1997). The relevance
(Lange et al., 2007). This problem was partially solved when
of the origin of benthic diatoms as regards their substrate
light microscope slides were prepared. Even so, many species
affinity has been emphasized, except for ice algae (s. review
still remained unidentified until more advanced techniques
of Medlin & Priddle, 1990). There are four recent studies
were used, like electron microscopy.
that specifically focus on benthic species other than
Discussion
Al-Handal & Wulff, 2009a, b). The authors analyzed the
A fairly high diversity of phytoplankton was found during the 2002-2010 monitoring, especially taking into account the contribution of benthic community to the water column. Usually diatoms dominated the composition and the biomass of the plankton community. Other research programs on phytoplankton monitoring, near the Polish Station have found similar results. Kopczynska (2008) reviewed the outcomes of plankton monitoring in Admiralty Bay and found the diatoms Fragilariopsis, Pseudo-nitzschia and Thalassiora to be abundant in inshore locations while Proboscia and Thalasiosira species were found at other sites. In our study, many microalgae (like
124
originating from ice (Everett & Thomas, 1986; Kloser, 1998; composition of microalgae growing on different substrates such as sediments and various macroalgae species in Potter Cove, Antarctic Peninsula, recording some preference for substrate among the diatoms, as well the large dominance of some genera like Licmophora, Cocconeis, Pleurosigma and Pseudogomphonema. All these authors claimed that the investigations on taxonomy and ecology of diatoms are urgently needed, especially because they have become scarce, and they can provide background data to evaluate the impacts of global changes over phytoplankton and microphytobenthos (Wulff et al., 2009). In this preliminary examination of phytoplankton samples, some taxonomic and nomenclatural problems have been detected, which
Cocconeis and Pseudogomphonema) are known to live
will be dealt with through electronic microscopy and
associated to a substrate in some way. It is becoming clear
closer examination of the literature. Despite taxonomical
that they play an important role in the pelagic primary
difficulties, it was possible in this research to underline the
production during the austral summer. Several authors
role of benthic diatoms in biodiversity and habitat ecology
found that microphytobenthic diatoms were as important
in the studied Antarctic environment.
| Annual Activity Report 2010
Acknowledgements
facilities and the electron microscopes. Ministério do Meio
To the Instituto Nacional de Ciência e Tecnologia Antártico
Ambiente (MMA), Ministério de Ciência e Tecnologia
de Pesquisas Ambientais, contracts CNPq n° 574018/2008-5
(MCT) and Comissão Interministerial para os Recursos do
and FAPERJ n° E-16/170.023/2008. The Center of Electron
Mar (CIRM). M. C.- F. is supported by the UFPR/Botany
Microscopy of UFPR for making available the laboratory
graduate program and the REUNI system.
References Al-Handal, A. & Wulff, A. 2009a. Marine epiphytic diatoms from the shallow sublittoral zone in Potter Cove, King George Island, Antarctica. Botanica Marina 51(5): 411-35. Al-Handal, A. & Wulff, A. 2009b. Marine benthic diatoms from Potter Cove, King George Island, Antarctica. Botanica Marina, 51(1): 51-68. Ahn, I.Y.; Chung, H.; Kang, J.S. & Kang, S.H. (1994). Preliminary studies on the ecology of neritic marine diatoms in Maxwell Bay, King George Island, Antarctica. The Korean Society of Phycology, 9: 37-45. Ahn, I.Y.; Chung, H.; Kang, J.S. & Kang, S.H. (1997). Diatom composition and biomass variability in nearshore waters of Maxwell Bay, Antactica, during the 1992/1993 austral summer. Polar Biology, 17(2): 123-30. El-Sayed, S.Z. & Fryxell, G.A. (1993). Phytoplankton. In: Friedmann, E.I. Antarctic Microbiology. New York: Willey-Liss p. 65-122. Hasle, G.R. & Fryxell, G.A. (1970). Diatoms: cleaning and mounting for light and electron microscope. Transactions of American Microscopical Society, 89: 469-474. Hasle, G.R. & Syvertsen, E.E. (1997). Marine Diatoms. In Tomas,C.R. (ed.), Identifying marine phytoplankton. Academic Press a division of Harcourt Brace and Company, San Diego, USA, 2:5-385. Kang, J.S.; Kang, S.H.; Lee, J.H.; Chung, K.H. & Lee, M.Y. (1997). Antarctic Micro- and Nano-sized phytoplankton assemblages in the surface water of Maxwell Bay during the 1997 austral summer. Korean Journal of Polar Research, 8: 35-45. Kloser, H. (1998). Habitats and distribution patterns of benthic diatoms in Potter Cove (King George Island, Antarctica) and its vicinity. Berichte zur Polarforschung, 299: 105. Knox, G.A. (1994). The biology of the Southern Ocean. Cambridge University Press. 193: 220. Kopczynska, E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years of monitoring. Polish Polar Research, 29(2): 117-39. Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B. & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at Admiralty Bay (King George Island, Antarctica) during the summer 2002-2003. Polar Biology, 30(11): 1483-92. Medlin, L.K. & Priddle, J. (1990). Polar marine diatoms. British Antarctic Survey/NERC. Moline, M.A.; Claustre, H.; Frazer, T.K.; Schofield, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic Peninsula in response to a regional warming trend. Global Change Biology, 10: 1973-80. Montes-Hugo, M.; Doney, S.C.; Ducklow, H.W.; Fraser, W.; Martinson, D.; Stammerjohn, S.E. & Schofield, O. (2009). Recent changes in phytoplankton communities associated with rapid regional climate change along the western Antarctic Peninsula. Science, 323: 1470- 73. Round, F.E.; Crawford, R.M. & Mann, D.G. (1990). Diatoms: Biology & Morphology of the genera. Cambridge University Press: 747pp. Utermöhl, H. (1958). Perfeccionamento del método cuantitativo de fitoplancton. Comun. Assoc. Int. Limnol. Teor. Apl. 9: 1-89. Wulff, A.; Iken, K.; Quartino, M.L.; Al-Handal, A.; Wiencke, C. & Clayton, M.N. (2009). Biodiversity, biogeography and zonation of marine benthic micro- and macroalgae in the Arctic and Antarctic. Botanica Marina, 52(6): 491–507.
Science Highlights - Thematic Area 3 |
125
4 EFFECT OF TEMPERATURE, SALINITY AND FLUORIDE ON THE PLASMATIC CONSTITUENTS CONCENTRATION OF ANTARCTIC FISH Notothenia rossii (Richardson, 1844) Edson Rodrigues1,*, Lucélia Donatti, Cecília N. K. Suda1, Edson Rodrigues Júnior2, Mariana Feijó de Oliveira1, Cleoni dos Santos Carvalho3 and Gannabathula Sree Vani1 Departamento de Biologia, Instituto Básico de Biociências, Universidade de Taubaté – UNITAU, Campus do Bom Conselho, Taubaté, SP, Brazil 2 Programa de Pós-graduação em Biologia Molecular e Celular, Centro Politécnico, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 3 Departamento de Biologia, Universidade Federal de São Carlos – UFSCar, Campus Sorocaba, Sorocaba, SP, Brazil 1
*e-mail: rodedson@gmail.com
Abstract: The Antarctic marine environment has unique characteristics such as isolation, low and even temperatures, as well as high levels of fluoride in the trophic web. The objective of the present study is to verify the effect of temperature, salinity and dietary fluoride in the diet on the levels of plasma constituents of the fish Notothenia rossii. The sample collection and the bioassay were conducted at Antarctic scientific station Comandante Ferraz. The fish were acclimated in an aquarium at temperatures of 0 and 4 °C; salinity of 35 and 20 psu, using feed with and without fluoride. The combination of these variables resulted in 8 experimental groups. The calcium serum levels were reduced in hyposaline stress and temperature elevation reduced the plasmatic levels of magnesium and chloride. The trophic fluoride isolatedly was not capable of changing the non-protein electrolytes levels. Keywords: Antarctica, biomarker, blood, Nothothenia rossii
Introduction
126
The compiled ichthyofauna data of the south Antarctic
The Antarctic demerso-pelagic fish Notothenia rossii
Polar Frontier shows the existence of 322 species distributed
is one of the four dominant species of the South Shetland
in 50 families dominated by benthonic fish (70%) of the
Islands (Casaux et al., 1990) and can be easily captured
Notothenioidei family (Eastman, 2005). Even though the
using a fish hook. Its diet is very diversified and includes
marine fish are represented by approximately 16,764 species,
fish, krill, gastropods, polychaetes among other organisms
the Antarctica ichthyofauna is only 1.9% of this species
(Barrera-Oro, 2002). The vertical migration during summer
(Eschmeyer et al., 2010). The low Antarctic fish diversity has
permits its feeding through pelagic organisms (Casaux et al.,
been correlated with, the tectonic events which physically
1990), especially krill, this explains the high levels of bone
isolated this region, low temperatures and the probable
tissue fluoride, even though the fluoride tolerance is in
alterations occurred in the trophic structure during the
study (Camargo, 2003). The thermal metabolic plasticity
Miocene (Eastman, 2005).
limit of Antarctic fish has raised questions about the high
| Annual Activity Report 2010
temperature impact in the adaptation of this ichtyofauna
salinity (35 and 20 psu) and diet a with/without fluoride
(Mark (Mark et al. , 2005).
(15 mg/kg fish). Each bioassay was performed on eight fish
Considered as the most pristine region of the planet,
specimens, all of similar size (475 g ± 350 g) (media ± SD)
the increase in antrophic activity (scientific and tourism)
and kept in experimental conditions for 11 days. At the
in Antarctica is a factor of questioning for the scientists.
end of the experiment, the caudal vein was punctured and
Admiralty Bay in the King George Island, South Shetland
the blood collected with heparin, centrifuged at 2000 rpm
Islands Archipelago, has a narrow cove similar to fjords
for 5 minutes and the plasma frozen in liquid nitrogen. In
(Barnes et al., 2006) with inshore surface water salinity
the same manner blood samples were collected from five
values fluctuating between 16.4 to 34.2 psu (Romão et al,.
specimens of N. rossii, directly from Punta Plaza (PP) and
2001). Admiralty Bay is an Antarctic Specially Managed
Glacier Ecology (ECO), which are respectively, farther away
Area (ASMA) and shelters five countries scientific
and close to Arctowski Penguin Rookeries. In this case, the
stations (Brazil, Ecuador, Poland, Peru and USA).The
caudal vein puncture was undertaken aboard boat as soon
monitoring of Admiralty Bay ASMA is the main scope of
as the fish was taken from the water to register the closest
the National Institute of Antarctic Science, Technology
physiological condition.
and Environmental Research (INCT-APA) of the Brazilian
Plasma assay
Antarctic Program. Using a long time series of the physical, chemical and biological processes, INCT-APA is interested in understanding the natural and anthropic impacts on the region. The studies about biomarker responses to environmental pollution integrate the activities of INCT-APA. The biomarkers research for ASMA of Admiralty bay has the objective of identifying sufficiently sensible biological responses to differentiate the natural impact for those caused by pollutants. The aim of the present study was to investigate how warming, salinity reduction and the wide fluoride distribution in the Antarctic trophic web will be inducing biochemical responses in the blood
The plasmatic electrolytes chloride, magnesium, calcium and inorganic phosphate were assay spectrophotometrically by methods of the mercuric thiocyanate, xylidyl blue, O-cresolphthalein complexone, phosphomolybdate, re s p e c t i v e l y ( B u r t i s & As hw o o d , 1 9 9 4 ) . T h e spectrophotometer reading was carried out in 384 wells micro plates using the micro plate reader Fluostar of BMG.
Statistical analysis The differences between the control (0 °C and 35 psu) and the experimental group as well as the nature controls were tested at 5% significance levels using t-test with Welch’s
of N. rossii Antarctic fish.
correction.
Material and Methods
Results and Discussion
Animals
specimens of N. rossii from bioassays, as well as for the
The concentration of the plasmatic constituents of the
Specimens of N. rossii were collected using fish hooks, in
control of the nature from Punta Plaza (PP) and the Glacier
Punta Plaza (62º 05' 35.8" S and 58º 24' 11.8" W) and Glacier
Ecology (ECO) are summarized in Figure 1.
Ecology (62º 10' 11.9" S and 58º 27' 17.2" W), Admiralty Bay,
Independently, the fluoride was not able to change
King George island, Antarctica, at depths of 10-20 m, during
the plasmatic levels of calcium, inorganic phosphate,
the summer of 2009-2010. A total of 8 experiments were
magnesium and chloride. Directly or indirectly all the
carried out in the Commandante Ferraz Antarctic Station.
Antarctic vertebrates consume krill, so consequently are
The control conditions were 0 °C, 35 psu and a fluoride
exposed to high levels of fluoride present in this euphausiid
free diet. The remaining experiments were done with a
exoskeleton. The apparent lack of symptoms for fluorosis,
combination of conditions: temperature (0 °C and 4 °C),
rouse questions about the protective adaptive mechanisms
Science Highlights - Thematic Area 3 |
127
Figure 1. Plasma levels of chloride, inorganic phosphate, magnesium, and calcium in the Antarctic fish Notothenia rossii subjected to thermal and salinity stress. Fluoride was supplied by trophic pathway. Results expressed as mean ± standard error of the mean.
against the toxic effect of fluoride (Yin et al., 2010).
tends to reduce the blood osmolality of Antarctic fish,
Differences were also not observed between the means
without an increase in cortisol or hematocrit, indicating
values of controls, experimental and nature (PP and ECO)
that the acclimatization to warming is not mediated by
groups. The choice of ECO and PP was taken into account
stress response (Hudson et al., 2008). As the osmolality
considering the probable effect of fluoride present in high
is principally maintained by NaCl (Dobbs III & DeVries,
concentrations in the soils and sediments near the Penguin
1974), chloride reduction in the N. rossii blood should
Rookeries (Xie & Sun, 2003), on the plasmatic levels of
be expected by warming (Figure 2), even though studies
non-protein electrolytes.
with Notothenia neglecta showed that low salinity did not
The low salinity expressively decrease the levels of plasmatic calcium, whereas chloride and magnesium levels
128
significantly change the levels of Na+ and Cl- in the blood after 10 days exposure to ≅ 16 psu (Romão et al., 2001).
were reduced by thermal stress. Fluoride was capable to
Calcium and magnesium have a key role in a large range
induce reduction of chloride plasmatic levels, only under
of physiological processes. The renal tissue of Antarctic
thermal and salinity stress. It is well known that warming
fish is capable of excreting magnesium and chloride in the
| Annual Activity Report 2010
Figure 2. Interrelation between hyposmotic acclimation, drinking ratio, osmolality and serum levels of calcium, chloride and sodium. The metabolic answer of hyposaline and thermal acclimation effect of Antarctic fish Notothenia rossii is shown on the left. The warm acclimation effect on osmolality and drinking ratio of Trematomus bernacchii is shown on the right (data from Petzel (2005) and fish images from (Fischer & Hureau, 1985)).
urine against a gradient concentration as part of control
calcium concentration in the 20 psu seawater through a rise
mechanisms evolved in maintenance of blood osmolality
in drinking volume (Figure 2).
(Dobbs III & DeVries, 1974). In warm acclimation of Antarctic fish, Petzel (2005) observed that the blood
Conclusion
osmolality reduction was accompanied by a rise in drinking
The present study revealed that warming, hyposalinity
ratio and reduction of chloride and sodium serum levels
and trophic fluoride interfere with plasmatic non protein
(Figure 2).
electrolytes levels of Antarctic fish N. rossi. Considering
The calcium entrance to the blood in marine teleosts
the variables studied and blood parameters analyzed the
is basically through intestine (drinking). Gills and kidneys
plasmatic calcium stand out as an excellent biochemical
have a central role in calcaemia control and are capable of
biomarker of hyposaline stress.
actively excreting this metallic cation (Pinto et al., 2010). The hypocalcaemia of N. rossii acclimated a 0 °C e 20 psu
Acknowledgements
can be due to low calcium concentration in the seawater
This study was sponsored by INCT-APA (CNPq Process
at 20 psu. Although in warm and hyposaline acclimation
No. 574018/2008-5, FAPERJ E-26/170.023/2008)], and
(4 °C e 20 psu), N. rossii calcaemia was maintained close to
supported by Environmental Ministry (MMA), the
control levels (0 °C e 35 psu). In this case, the thermic stress
Secretariat for the Marine Resources Interministerial
(4 °C) could be causing reduction of blood osmolality and
Committee (SECIRM) and Ministry of Science and
increase the drinking rate of N. rossii compensating the low
Technology (MCT).
Science Highlights - Thematic Area 3 |
129
References Barnes, D.K.A.; Fuentes, V.; Clarke, A.; Schloss, I.R. & Wallace, M.I. (2006). Spatial and temporal variation in shallow seawater temperatures around Antarctica. Deep-Sea Research Part II: Topical Studies in Oceanography, 53(8-10): 853-65. Barrera-Oro, E. (2002). The role of fish in the Antarctic marine food web: differences between inshore and offshore waters in the southern Scotia Arc and west Antarctic Peninsula. Antarctic Science, 14(4): 293-309. Burtis, C.A. & Ashwood, E.R. (1994). Tietz Textbook of Clinical Chemistry. Second. Saunders Company, Philadelphia, Pennsylvania. 2326p. Camargo, J.A. 2003. Fluoride toxicity to aquatic organisms: a review. Chemosphere, 50(3): 251-64. Casaux, R.J.; Mazzotta, A.S. & Barrera-Oro, E.R. (1990). Seasonal aspects of the biology and diet of nearshore nototheniid fish at Potter Cove, South Shetland Islands, Antarctica. Polar Biology, 11(1): 63-72. Dobbs III, G.H. & DeVries, A.L. (1974). Renal function in Antarctic teleost fishes: Serum and urine composition. Marine Biology, 29(1): 59-70. Eastman, J.T. (2005). The nature of the diversity of Antarctic fishes. Polar Biology, 28(2): 93-107. Eschmeyer, W.N.; Fricke, R.; Fong, J.D. & Polack, D.A. (2010). Marine fish diversity: history of knowledge and discovery (Pisces). Zootaxa, 2525: 19-50. Fischer, W. & Hureau, J.C. (1985). FAO Species identification sheets for fishery purposes. Rome: FAO. 470p. Hudson, H.A.; Brauer, P.R.; Scofield, M.A. & Petzel, D.H. (2008). Effects of warm acclimation on serum osmolality, cortisol and hematocrit levels in the Antarctic fish Trematomus bernacchii. Polar Biology, 31(8): 991-7. Mark, F.; Hirse, T. & Pรถrtner, H. (2005). Thermal sensitivity of cellular energy budgets in some Antarctic fish hepatocytes. Polar Biology, 28: 805-14. Petzel, D. (2005). Drinking in Antarctic fishes. Polar Biology, 28(10): 763-8. Pinto, P.I.S.; Matsumura, H.; Thorne, M.A.S.; Power, D.M.; Terauchi, R.; Reinhardt, R. & Canรกrio, A.V.M. (2010). Gill transcriptome response to changes in environmental calcium in the green spotted puffer fish. BMC Genomics, 11: 476. Romรฃo, S.; Freire, C.A. & Fanta, E. (2001). Ionic regulation and Na+,K+-ATPase activity in gills and kidney of the Antarctic aglomerular cod icefish exposed to dilute sea water. Journal of Fish Biology, 59: 463-8. Xie, Z. & Sun, L. 2003. Fluoride content in bones of Adelie penguins and environmental media in Antarctica. Environmental Geochemistry and Health, 25(4): 483-90. Yin, X.; Chen, L.; Sun, L.; Wang, M.; Luo, H.; Ruan, D.; Wang, Y. & Wang, Z. 2010. Why do penguins not develop skeletal fluorosis? Fluoride, 43: 108-18.
130
| Annual Activity Report 2010
5 ARGINASE KINETIC CHARACTERIZATION OF THE GASTROPOD Nacella concinna AND ITS PHYSIOLOGICAL RELATION WITH ENERGY REQUIREMENT DEMAND AND THE PRESENCE OF HEAVY METALS Edson Rodrigues1,*,Helena Passeri Lavrado2, Lucélia Donatti, Cecília N. K. Suda1, Edson Rodrigues Júnior3, Mariana Feijó de Oliveira1, Gannabathula Sree Vani1 Departamento de Biologia, Instituto Básico de Biociências, Universidade de Taubaté – UNITAU, Campus do Bom Conselho, Taubaté, SP, Brazil 2 Departamento de Biologia Marinha, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 3 Programa de Pós-graduação em Biologia Molecular e Celular, Centro Politécnico, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 1
*e-mail: rodedson@gmail.com
Abstract: Arginases are metalloenzymes broadly distributed in nature. These enzymes catalyze the L-arginine hydrolyses to L-ornithine and urea. The aim of the present work is to determine the tissue levels of arginase, its kinetic properties and subcellular localization. In December 2009, specimens were collected in Admiralty Bay, King George Island near the Brazilian Research Station. The argininolytic specific activity of foot muscle, gills and pool of other tissues was 87.0 ± 15.1; 9.8 ± 1.8 and 3.8 ± 1.0 mU/mg protein, respectively. Mainly localized in the cytosol, gills and muscular arginase Km values for L-arginine were 57.0 ± 10.5 and 66.2 ± 14.6 mM, respectively. High arginase levels in gills could be related to the systemic control of L-arginine concentrations, which is vital for energetic metabolism of phospho-L-arginine and of polyamines in the control of cell proliferation though the probable physiologic metal cation is Mn2+, some arginases are activated by Co2+ and Ni2+. The muscle Nacella concinna arginases were activated by Mn2+ and Co2+ and inhibited by Cd2+ whereas; gills arginase was activated only by Mn2+ and inhibited by Cd2+ and Zn2+. Keywords: Antarctica, arginase, Nacella concinna, heavy metal
Introduction The organisms that inhabit the intertidal zone on the
Cd2+ (Ahn et al., 2004; Keil et al., 2008). Intertidal zones
coasts of the Antarctic Peninsula and adjacent Islands are
are also most vulnerable to anthropogenic pollutants. The
periodically exposed to the thermal regime of the terrestrial
gastropod Nacella concinna, is the most conspicuous macro
environment as well as summer melt waters. The melt water
invertebrate in the Antarctic intertidal zone, which has been
creates micro environments with low salinity and elevated
used in the biomonitoring, for example in the diesel fuel
levels of heavy metals derived from lithogenic sources
spill from the vessel, Bahia Paradise, in Arthur Harbour
(Ahn et al. 1999, 2002). In addition, microphytobenthos
(Kennicutt II & Sweet, 1992).
are considered the principal food source and are also an
Arginases are metalloenzymes that need a divalent cation
important natural source of heavy metals, particularly
to attain maximum activity. The probable physiological
Science Highlights - Thematic Area 3 |
131
cation is Mn2+, though Co2+ and Ni2+ have the capacity to activate some arginases (Carvajal et al., 1995). In non ureotelic organisms, the central physiological role of arginases is the control of the levels of the amino acid L-arginine (Jenkinson et al., 1996). The metabolism of the essential amino acid L-arginine, has been studied in different classes of organisms. In general, the L-arginine participates as a substrate in various metabolic processes such as synthesis of nitric oxide, protein and phospho-L-arginine, as well as, of polyamines indirectly through the non-protein amino acid L-ornithine (Figure 1)
Figure 1. Conceptual diagram illustrating the pathways of L-arginine metabolism and production of phospho-L-arginine and its utilization in thermal stress involving L-arginine pools.
(Wu & Morris Junior, 1998; Pellegrino et al., 2004). In N. concinna a probable importance of argininolytic metabolism is the control of phospho-L-arginine levels. When this invertebrate is subjected to thermal stress, the
described in the figures. The statistical differences between
phospho-arginine is used to produce ATP from ADP,
the treatments and controls were obtained using one-way
followed by a reduction in the levels of L-arginine (Figure 1)
ANOVA followed by Tukey’s post-tests.
(Pörtner et al., 1999; Ahn et al., 2004). In this case, the reduction in the L-arginine concentration could be related to tissue argininolytic activity, so studies about arginase
The argininolytic activity of the gills was 9 to 23 times higher
are important for understanding some of the physiological
than that of the foot muscle and the pool of the other tissues
activities of this Antarctic invertebrate. Arginase had been
respectively (Figure 2a). At subcellular level, the cytosol
used as biomarker of many mammal pathological processes
concentrates most of the arginase activity, both in gills
(Mielczarek-Puta et al. 2008). The present study aims to
(99%) and foot muscle (86.4%). Carvajal et al. (2004) also
characterize tissue distribution, subcellular localization
verified that gill cells of Semele solida had 91% of the arginase
and kinetic properties of N. concinna arginase as a potential
activity in cytosolic fraction. Most of the studies dealt with
biomarker of the intertidal zone pollution.
tissue levels rather than subcellular levels. The high levels
Materials and Methods
132
Results and Discussion
of gills arginase activity could be related to the excretion of urea arising from the hydrolysis of L-arginine for the
Specimens of N. concinna (n = 5) were collected on
systemic control of this amino acid. The levels of arginase
December 2009, in the Keller Peninsula, Admiralty
in the foot muscle could be related to the control of energy
Bay, King George Island, Antarctica. The tissues were
metabolism of phospho-L-arginine. As the presence of
homogenized in 20 mM buffer Tri-HCL, pH 7.4, containing
arginase in muscle tissue is uncommon, arginase in muscle
1 mM trimethylamin-N-oxide, 5 mM of potassium
tissue of Chiton latus has been associated with the removal of
phosphate, 0.5 mM EDTA, 250 mM sucrose, sonicated for
arginine to accelerate the utilization of phospho-L-arginine
30 seconds and centrifuged at 14000 g for 10 minutes. All
(Carvajal et al., 1988).
kinetic studies were conducted at 0 °C using supernatant.
The km values (Michaelis constant) for arginase in the
The L-ornithine formed in the reaction was measured using
foot muscle and gills were 57.0 ± 10.5 and 66.2 ± 14.6 mM,
a spectrophotometer after reacting with ninhydrin and
respectively. The L-arginine activity was inhibited by
the activity expressed in mmol of L-ornithine formed per
L-arginine concentrations above 80 and 100 mM in the foot
minute. The reaction systems used for kinetic studies are
muscle and gills, respectively (Figure 2b). The km values
| Annual Activity Report 2010
a
b
Figure 2. Tissue levels of arginase (a) and the effect of L-arginine concentration on the gills argininolytic activity of N. concinna (b). Results expressed as mean ± standard error of the mean.
and the inhibition by substrate L-arginine are similar to
Zn2+ is one of the metals released by the combustion of
the arginase of polyplacophoran Chiton latus, which also
coal, oil and gasoline. This metal can also be released from
has relatively high levels of arginase activity in the foot
lead battery. It is also present in soils near stations which
muscle and gills (Carvajal et al. 1988). Tormanen (1997)
have used brass, steel coated nails and paints (Claridge et al.,
also observed arginase inhibition with high concentrations
1995; Webster et al., 2003), leaching of volcanic rocks also
of substrate L- arginine in Zebra mussel. The effects of heavy metals on the arginase activity in the foot muscle and gills are summarized in Figure 3. Similar to the arginases in other organisms, the gills and the foot muscle arginases of N. concinna, were activated in the presence of Mn2+, confirming that Mn2+ is the probable physiological cation necessary for the activation of this enzyme. On the other hand, the foot muscle arginase was also activated by Co2+, the same activation was not observed in gills tissue (Figure 3a, b). Cations like Co have also 2+
results in high levels of Fe3+ and Zn2+ (Ahn et al., 1999; Weihe et al., 2010). Arginase activity in the presence of Zn2+ and Fe3+ alone or combined with Mn2+ in foot muscle did not show any significant alteration, whereas, gills arginase was inhibited by Zn2+ and Fe3+ alone or combined with Mn2+ (Figure 4a, b). Carvajal et al. (1984, 1988, 1994) observed inhibition of arginases by Zn2+ in gills and foot muscle of Chiton latus, gills of Concholepas concholepas and gills of Semele solida whereas Tormanen (1997) observed same inhibition by Zn2+ in Zebra mussel. Foot muscle and gill arginase is also inhibited by Cd2+.
been reported to activate some arginases, Carvajal et al.
The same inhibition is not present in gills arginase of Semele
(1984, 1988) observed activation of arginase by Co2+ in
solida (Carvajal et al., 1994). High concentrations of Cd2+
gills and foot muscle arginase of Chiton latus, gills arginase
in surface waters of the Southern ocean is referred to as
of Concholepas concholepas, whereas Tormanen (1997)
“Cd anomaly”, during the austral summer the upwelling
observed the same activation in arginase of Zebra mussel.
of waters favours uptake of Cd2+ by primary consumers
Science Highlights - Thematic Area 3 |
133
a
b
Figure 3. Effect of metallic cations on the foot muscle arginase activity of N. concinna. The activities were determined in 20 mM of Hepes buffer, pH 7.4, containing 30 mM of L arginine. The control activity (C) was determined in a reaction system without the addition of metallic cations. The isolated effect of 1 mM metallic cations (a) and combined effect of 1 mM Mn2+ with a second 1 mM metallic cation (b). Differences between control activity of arginase and the arginase activity with metals were significant for p < 0.05 (*) and p < 0.001(***).
a
b
Figure 4. Effect of metallic cations on the gills arginase in N. concinna. The activity was determined in 20mM of Hepes buffer, pH 7.4 containing 30 mM of L-arginase. The control activity (C) was determined in a reaction system without the addition of metallic cations. The isolated effect of 1 mM metallic cations (a) and combined effect of 1 mM Mn2+ with a second 1 mM metallic cation (b). Differences between control activity of arginase and the arginase activity with metals were significant for p < 0.05 (**) and p < 0.001(***).
134
| Annual Activity Report 2010
and high availability of this metal in the food chain. High
cations Mn2+ and Co2+ were capable of activating foot
concentration of this metal is found in digestive glands and
muscle arginase, where as Zn2+, Fe3+ and Cd2+ did not inhibit
kidneys of some Antarctic mollusks, this indicating binding
significantly. The gills arginase showed a distinct behaviour,
of these metals with metallothioneins which are associated
was activated by Mn2+ and inhibited by Zn2+, Fe3+ and Cd2+.
with detoxifying role (Bargagli et al., 1996; Lohan et al.,
The different behaviour of gills and foot muscle arginase of
2001; Keil et al., 2008).
N. concinna can have a relation to the entry of heavy metals to these tissues.
Conclusion Gills and foot muscle of N. concinna express arginases with
Acknowledgements
distinct kinetic properties. The presence of arginase in the
This study was sponsored by INCT-APA (CNPq Process No.
foot muscle supports the hypothesis that argininolytic
574018/2008-5, FAPERJ E-26/170.023/2008), and supported
activity can be involved in control of phopho-L-arginine
by Environmental Ministry (MMA), the Secretariat for the
metabolism. The gills and muscular argininolytic activity
Marine Resources Interministerial Committee (SECIRM)
of N. concinna is basically in the cytosolic faction. The
and Ministry of Science and Technology (MCT).
References Ahn, I.Y.; Chung, K.H. & Choi, H.J. (2004). Influence of glacial runoff on baseline metal accumulation in the Antarctic limpet Nacella concinna from King George Island. Marine Pollution Bulletin, 49(1-2): 119-27. Ahn, I.Y.; Kang, J. & Kim, D.Y. (1999). Preliminary Study on Heavy metals in the Antartctic limped, Nacella cocinna (Strebel, 1908) (Gastropoda: Patellidae) in an Intertidal Habitat on King George Island. Korean journal of Polar Reasearch, 10(1): 108. Ahn, I.Y.; Kim, K.W. & Choi, H.J. (2002). A baseline study on metal concentrations in the Antarctic limpet Nacella concinna (Gastropoda: Patellidae) on King George Island: Variations with sex and body parts. Marine Pollution Bulletin, 44(5): 424-31. Bargagli, R.; Nelli, L.; Ancora, S. & Focardi, S. (1996). Elevated cadmium accumulation in marine organisms from Terra Nova Bay (Antarctica). Polar Biology, 16(7): 513-20. Carvajal, N.; Bustamante, M.; Hinrichsen, P. & Torres, A. (1984). Properties of arginase from the sea mollusc Concholepas concholepas. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 78(3): 591-4. Carvajal, N.; Kessi, E.; Bidart, J. & Rojas, A. (1988). Properties of arginase from the foot muscle of Chiton latus. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 90(2): 385-8. Carvajal, N.; Orellana, M.S.; Borquez, J.; Uribe, E.; Lopez, V. & Salas, M. (2004). Non-chelating inhibition of the H101N variant of human liver arginase by EDTA. Journal of Inorganic Biochemistry, 98(8): 1465-9. Carvajal, N.; Torres, C.; Uribe, E. & Salas, M. (1995). Interaction of arginase with metal ions: studies of the enzyme from human liver and comparison with other arginases. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 112(1): 153-9. Carvajal, N.; Uribe, E. & Torres, C. (1994). Subcellular localization, metal ion requirement and kinetic properties of arginase from the gill tissue of the bivalve Semele solida. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 109(4): 683-9. Claridge, G.G.C.; Campbell, I.B.; Powell, H.K.J.; Amin, Z.H. & Balks, M.R. (1995). Heavy metal contamination in some soils of the McMurdo Sound reg ion, Antarctica. Antarctic Science, 7(1): 9-14. Jenkinson, C.P.; Grody, W.W. & Cederbaum, S.D. (1996). Comparative properties of arginases. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 114(1): 107-32.
Science Highlights - Thematic Area 3 |
135
Keil, S.; de Broyer, C. & Zauke, G.-P. (2008). Significance and Interspecific Variability of Accumulated Trace Metal Concentrations in Antarctic Benthic Crustaceans. International Review of Hydrobiology, 93(1): 106-126. Kennicutt II, M.C. & Sweet, S.T. (1992). Hydrocarbon contamination on the Antarctic peninsula: III. The Bahia Paraiso - Two years after the spill. Marine Pollution Bulletin, 25(9-12): 303-6. Lohan, M.; Statham, P. & Peck, L. (2001). Trace metals in the Antarctic soft-shelled clam Laternula elliptica: implications for metal pollution from Antarctic research stations. Polar Biology, 24(11): 808-17. Mielczarek-Puta, M.; Chrzanowska, A.; Grabon´, W. & Baran´czyk-Kuz´ma, A. 2008. New insights into arginase. Part II. Role in physiology and pathology. Postepy higieny i medycyny doswiadczalnej, 62: 214-221. Pellegrino, D.; Palmerini, C.A. & Tota, B. (2004). No hemoglobin but NO: the icefish (Chionodraco hamatus) heart as a paradigm. Journal of Experimental Biology, 207(22): 3855-3864. Pörtner, H.O.; Peck, L.; Zielinski, S. & Conway, L.Z. (1999). Intracellular pH and energy metabolism in the highly stenothermal Antarctic bivalve Limopsis marionensis as a function of ambient temperature. Polar Biology, 22(1): 17-30. Tormanen, C.D. (1997). The effect of metal ions on arginase from the zebra mussel Dreissena polymorpha. Journal of Inorganic Biochemistry, 66(2): 111-8. Webster, J.; Webster, K.; Nelson, P. & Waterhouse, E. 2003. The behaviour of residual contaminants at a former station site, Antarctica. Environmental Science and Technology, 123(2): 163-179. Weihe, E.; Kriews, M. & Abele, D. (2010). Differences in heavy metal concentrations and in the response of the antioxidant system to hypoxia and air exposure in the Antarctic limpet Nacella concinna. Marine Environmental Research, 69(3): 127-35. Wu, G. & Morris, S.M., JR. (1998). Arginine metabolism: nitric oxide and beyond. Biochemical Journal, 336: 1-17.
136
| Annual Activity Report 2010
6 ARSENIC, COPPER AND ZINC IN MARINE SEDIMENTS FROM THE PROXIMITY OF THE BRAZILIAN ANTARCTIC BASE, ADMIRALTY BAY, KING GEORGE ISLAND, ANTARTICA Andreza Portella Ribeiro1,*, Rubens César Lopes Figueira1, César de Castro Martins2, Charles Roberto de Almeida Silva1, Elvis Joacir de França1, Márcia Caruso Bícego1, Michel Michaelovitch de Mahiques1, Rosalinda Carmela Montone1 2
1 Instituto Oceanográfico da Universidade de São Paulo, São Paulo, SP, Brazil Centro de Estudos do Mar da Universidade Federal do Paraná, Pontal do Sul, Pontal do Paraná, PR, Brazil
*e-mail: andrezpr@usp.br
Abstract: Marine sediments collected, in March/2010, close to the Comandante Ferraz Base, located in Admiralty Bay, Antarctica, were analyzed to determine arsenic (As), copper (Cu) and zinc (Zn) levels, in order to indicate the impact of the Brazilian activities in the study area. Labile concentrations of As ranged from 6 to 10 μg.kg–1, Cu and Zn content ranged from 80 to 91 and 50 to 57 μg.kg–1, respectively. The preliminary results indicated a slight increase of As with depth. Nonetheless, no relevant trace element inputs were observed, according to the chemical analysis adopted in the present research study. Keywords: arsenic, metals, sediments, Comandante Ferraz Base-Antarctica
Introduction Brazilian activities in the Antarctic Continent are coordinated
atmospheric pollutants (Bargagli, 2005). Moreover, local
by the Brazilian Antarctic Program (PROANTAR), in which
emissions from Scientific Stations and tourism also
scientific researchers are concentrated at the Brazilian
contribute to the dispersing of contaminants, thereby
Antarctic Base “Comandante Ferraz” (geographical
concentrating and accumulating pollutants in sediments.
coordinates of 62° 08' S and 58° 40' W), Admiralty Bay,
There are few studies underlying chemical substances
Peninsula Keller, King George Island, Antarctic Peninsula
and trace elements present in sediments from the proximity
(Feitosa, 2009).
of Comandante Ferraz Base. For example, Santos et al.,
Antarctica is linked to other regions of the world
(2005) investigated the heavy metal contamination in
through the circulation of the atmosphere and the oceans.
32 sediments and 14 soil samples. Total and bioavailable
The huge difference between the Equator distance and the
contents of 16 elements (including Cu and Zn) were
temperature of this Continent drives the poleward heat
determined by ICP OES technique. According to the
transport and the general circulation of the air masses,
authors, the results showed an increase of bioavailability
turning Antarctica into the main heat sink of the Southern
of soils in comparison to the sediments, probably due
Hemisphere. Considering the complexity of the air mass
to the different redox properties of soils and sediments.
circulation, Antarctica plays an impressive role in the
The total average concentrations of metals in the samples
global climate system, as well as acts as a sink for persistent
presented no important temporal (during the summer
Science Highlights - Thematic Area 3 |
137
2002/2003) and depth-related variability. Total metals were extracted with an adaptation of methods extensively used in literature, in which the sample is digested with aqua-regia and hydrofluoric acid. A recent study with five sediment profiles from the Admiralty Bay has suggested a slight increase of As levels, since 1985. According to the authors, the increase of As content may be associated with the Brazilian activities in the bay (Ribeiro et al., 2010). Otherwise, there is no evidence
Results and Discussion Certified reference materials (CRM) Experimental data for the CRM presented relative standard deviation lower than 6%. The agreement between the observed and the certified concentrations of As, Cu and Zn were better than 9%f, indicating the precision and the accuracy for the methodology employed in the chemical analysis.
of relevant impact to the ecosystem due to trace element
Trace elements
sources in the region (Santos et al., 2005; Martins et al.,
Table 1 shows the range contents of As, Cu and Zn
2005). Nevertheless, the studies that have been concerned
determined in 18 samples, representing the sediments
with determining inorganic contaminants, in Antarctica,
collected close to the Comandante Ferraz Base, in Admiralty
are still scarce. Accordingly, this work was undertaken to
Bay, King George Island, Antarctic Peninsula. Table 1 also
evaluate the real anthropogenic impact of potentially toxic
presents the data comparison with literature values available
elements (As, Cu and Zn) in the Admiralty Bay, Antarctica.
elsewhere for trace elements in Antarctic sediments.
Materials and Methods
values were observed for Cu and Zn (ranging from 80 to 91
Sampling
in Admiralty Bay sediments could be explained by the
Sediment samples were taken using a mini-box corer
mineralogy of studied sediments, which were mainly
(MBC), especially designed for sampling soft sediments
produced by glacier erosion of volcanic rocks such as
and benthic macrofauna (Filgueiras et al., 2007). MBC
basalt and andesite. These rocks are respectively composed
presents 0.0625 m of sampling area, 25 x 25 x 55 cm box,
primarily by olivine and pyroxene and by plagioclase and
55 kg weight (Filgueiras et al., 2007; Martins et al., 2010).
pyroxene (Fourcade, 1960). Salomons & Förstner (1984)
2
According to the results, the highest concentration and 50 to 57 mg.kg–1, respectively). In fact, high Cu content
Samples were placed into pre-cleaned recipients and stored at -20 °C. Sediments were freeze-dried; further, they were carefully homogenized in mortar and stored in polyethylene bags until laboratory analysis.
Site
As
Cu
ICP OES
Admiralty Bay1
6 - 10
80 - 91
50 - 57
Sediment test portions of 500 mg were transferred into
Ferraz Station2
8 - 33
-
87 - 134
100 mL cleaned glass beakers and chemically digested using
Botany Point2
4-6
-
81 - 95
the reagent mixture of HNO3, H2O2 and HCl, according to
Ferraz Station
the Method 3050A (USEPA, 1996). Filtered digest solution
Admiralty Bay4
were analyzed by ICP OES using a Varian spectrometer,
Mc Murdo Station5
model 710ES, for determining As, Cu, and Zn. All reagents were of a comparable pure grade. Geological certified reference materials SCP Science EnviroMat SS-1 and SS-2 were analyzed together the samples to assess the quality of the analytical procedure for the chemical analysis.
138
Table 1. Trace element ranges (mg.kg–1, expressed in dry weight) determined in the Antarctic sediments and compared with literature values.
| Annual Activity Report 2010
Zn
-
92
89
2-12
-
-
4-5
31 - 100
114 - 156
Princess Regnheld Station
4-7
-
26 - 134
Ross Sea
-
10 - 38
52 - 144
Potter Cove8
-
73 - 156
3
6
7
46 - 63
This study; Santos et al. (2007); Ribeiro et al. (2010) ; Negri et al. (2006); 6Waheed et al. (2001); 7Ianni et al. (2010); 8Andrade et al. (2001).
1
2,3
4
5
Figure 1. As contents (mg.kg ) in the sediment from the proximity of Ferraz Station, Admiralty Bay. –1
Figure 2. Cu contents (mg.kg–1) in the sediment from the proximity of Ferraz Station, Admiralty Bay.
have reported that, during magmatic differentiation, Cu is incorporated – among others metals, such as Zn – into olivine, pyroxene and plagioclase. Copper mean concentrations in these mineral are 115 mg.kg–1, 120 mg.kg–1 and 62 mg.kg–1, respectively. According to Machado et al. (2001), the high levels of Cu in sediments may be associated with the widespread mineralization of chalcopyrite in the area. The data comparison with literature indicated that the trace elements levels were in the same order of magnitude of previous contents already obtained in different periods and Antarctic regions. Moreover, contents of As, Cu, and Zn were in conformity with those determined by Santos et al. (2005, 2007) in sediments from Admiralty Bay.
Figure 3. Zn contents (mg.kg–1) in the sediment from the proximity of Ferraz Station, Admiralty Bay.
Conclusions This work presented its preliminary results related to
Figures 1 to 3 show the mean contents with depth.
the As, Cu, and Zn in sediments from the proximity of
Likewise previous work (Ribeiro et al., 2010), the results
Brazilian Antarctic Base, in the Admiralty Bay. The study
indicated a slight decrease of As with depth (Figure 1),
provided some baseline information on trace elements of
suggesting that the human activities may be contributing
environmental interest for the Antarctic region. In general,
to the As enrichment in the study site. The data set suggests
chemical composition of sediments was in accordance
the natural sources are the main inputs for Cu and Zn
with the literature values, thereby suggesting a low level
(Figures 2 and 3) in the Antarctic ecosystem. Even though,
of environmental contamination in the areas of human
in order to understand the geochemical distribution of
activities in the Admiralty Bay region. Continuous
the trace elements in the surface sediments, a study of
environmental monitoring, determination of baseline levels,
geochemical partitioning of As, Cu and Zn is necessary and
chemical speciation methods will be essential for controlling
will be developed in the near future.
and preventing pollution in the Antarctic Continent.
Science Highlights - Thematic Area 3 |
139
Acknowledgements
the Conselho Nacional de Desenvolvimento Científico e
The authors would like to thank the Instituto Nacional de
Tecnológico (CNPq) and the logistical support from the
Ciência e Tecnologia Antártico de Pesquisas Ambientais
Comissão Interministerial para Recursos do Mar (CIRM),
(CNPq n 574018/2008-5 and FAPERJ n 16/170.023/2008)
Ministério da Ciência e Tecnologia (MCT) and Ministério
and the Programa Antártico Brasileiro (PROANTAR) for
do Meio Ambiente (MMA).
o
o
the financial support through the bursary provided by
References Andrade, S., Poblet, A., Scagliola, M., Vodopivez, C., Curtosi, A., Pucci, A. & Marcovecchio, J. (2001) Distribution of heavy metals in surface sediments from an Antarctic marine ecosystem. Environmental Monitoring and Assessment, 66: 147-158. Bargagli, R. (2005) Antarctic Ecosystems Environmental Contamination: Climate Change, and Human Impact. Springer: Ecological Studies. Feitosa G.L. (2009). Brazil contributes to research in the Antarctic. Hobeco Ltda - Rio de Janeiro/Brazil, Available on: http://www.vaisala.com/files/Brazil_contributes_to_research_in_the_Antarctic.pdf. Filgueiras, V.L.; Campos, L.S.; Lavrado, H.P.; Frensel, R. & Pollery, R.C.G. (2007). Vertical distribution of macrobenthic infauna from the shallow sublittoral zone of Admiralty Bay, King George Island, Antarctica. Polar Biology, 30(11): 1439-47. Fourcade N. H. (1960). Estudio geológico y petrográfico de Caleta Potter, isla 25 de Mayo, Islas Shetland del Sur, Instituto Antártico Argentino, Publicación N 8, 115 p. Ianni, C., Magi, E., Soggia, F., Rivaro, P. & Frache, R. (2010) Trace metal speciation in coastal and off-shore sediments from Ross Sea (Antarctica), Microchemical Journal, 96(2): 203-212. Machado A.; Lima E.F.; Chemale Jr. F.; Liz J.D. & Ávila J.N. (2001) Química mineral de rochas vulcânicas da Península Fildes (Ilha Rei George), Antártica. Revista Brasileira de Geociências, 31(3): 299–306. Martins C.C.; Montone R.C.; Gamba R.C. & Pellizari V.H. (2005) Sterols and fecal indicator microorganisms in sediments from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1/2): 1-12. Martins, C.C., Bícego, M.C., Rose, N.L., Taniguchi, S., Lourenço, R.A., Figueira, R.C., Mahiques M.M. & Montone, R.C. (2010). Historical record of polycyclic aromatic hydrocarbons (PAHs) and spheroidal carbonaceous particles (SCPs) in marine sediment cores from Admiralty Bay,King George Island, Antarctica. Environmental Pollution 158(1): 192-200. Negri, A., Burns, K., Boyle, S., Brinkman, D. & Webster, N. (2006) Contamination in sediments, bivalves and sponges of McMurdo Sound, Antarctica. Environmental Pollution 143(3): 456-67. Ribeiro, A.P., Figueira, R.C.L., Martins, C.C., Silva, C.R.A., França, E.J., Bícego, M.C., Mahiques, M.M. & Montone, R.C. (2010) Arsenic content in five sediment profile from Admiralty Bay, King George Island, Antarctica., National Institute of Science and Technology Antarctic Environmental Research-Annual Activity Report, 1: 52-57. Salomons W. & Förstner U. (1984). Metals in the hydrocycle. Springer-Verlag, Berlin. Santos, I.R, Silva-Filho, E.V., Schaefer, C.E.G.R., Albuquerque-Filho, M.R. & Campos, L.S., (2005) Heavy metal contamination in coastal sediments and soils near the Brazilian Antarctic Station, King George Island. Marine Pollution Bulletin, 50(2): 185-94. Santos, I.R, Fávaro, D.I.T, Schaefer, C.E.R.G & Silva-Filho, E.V. (2007) Sediment geochemistry in coastal maritime Antarctica (Admiralty Bay, King George Island): Evidence from rare earths and other elements. Marine Chemistry, 107(4): 464-74. USEPA (1996). United States Environmental Protection Agency. Method 3050B. Acid digestion of sediments, sludges and soil. Revision 2. December. Waheed, S., Ahmad, S., Rahman, A. & Qureshi, I.H. (2001) Antarctic marine sediments as fingerprints of pollution migration. Journal of Radioanalytical and Nuclear Chemistry, 250(1): 97-107.
140
| Annual Activity Report 2010
7 MOLECULAR DIFFERENTIATION OF TWO ANTARCTIC FISH SPECIES OF THE GENUS Notothenia (NOTOTHENIOIDEI: NOTOTHENIIDAE) BY PCR-RFLP TECHNIQUE Cintia Machado1, Marcia Kiyoe Shimada2, Stênio Perdigão Fragoso2, Edith Fanta1, Helena G. Kawall1, Edson Rodrigues3, Lucélia Donatti1,* Departamento de Biologia Celular, Setor de Ciências Biológicas, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 2 Fundação Oswaldo Cruz, Instituto Carlos Chagas – ICC, Paraná, Curitiba, PR, Brazil 3 Laboratório de Bioquímica, Instituto Básico de Biociências – IBB, Universidade de Taubaté – UNITAU, Taubaté, SP, Brazil
1
*e-mail: donatti@ufpr.br
Abstract: The Antarctic fish Notothenia rossii and Notothenia coriiceps were selected as target organisms for studies of biomarker responses of environmental monitoring research of Admiralty Bay, King George Island. In this case, molecular taxonomy analysis of the referred population became an important study subject in order to increase the knowledge of especies diversity. The taxonomy of Antarctic fish has been predominantly based on morphological characteristics rather than on genetic criteria. A typical example is the Notothenia group, which consists of N. coriiceps, N. neglecta and N. rossii. The Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP) technique was used to determine whether N. neglecta and N. coriiceps are different or whether they are the same species with morphological, physiological and behavioural variability. N. rossii was used as control. Mitochondrial DNA (mtDNA) was isolated from muscle specimens of N. neglecta, N. coriiceps and N. rossii, which were collected in Admiralty Bay, King George Island. The DNA was used to amplify a fragment (690 base pairs) of the coding region of the mitochondrial gene for NADH subunit 2. Further, the amplicon was digested with following restriction enzymes: DdeI, HindIII and RsaI. The results showed a variation of the digestion pattern of the fragment amplified between N. rossii and N. coriiceps or N. neglecta species. No differences were found between N. coriiceps and N. neglecta specimens. Keywords: Notothenia species, DNA mitochondrial, NADH-2, PCR-RFLP
Introduction The Antarctic fish Notothenia rossii and Notothenia coriiceps
The species Notothenia coriiceps was first described by
were selected as target organisms for studies of biomarker
Richardson in 1844. Nybelin (1951) described N. neglecta
responses of environmental monitoring research proposed
as a new species of the genera, contested in 1966 by DeWitt
in Module 3 INCT-APA (Instituto Nacional de Ciência
who considered N. neglecta a subspecies of N. coriiceps.
e Tecnologia Antártico de Pesquisas Ambientais) for
Fischer and Hureau (1988) supported the hypotheses that
Admiralty Bay, King George Island (Rodrigues et al., 2009).
N. coriiceps and N. neglecta are distinct species, presenting
In this case, molecular taxonomy analysis of the referred
differences in the number of fin rays of the pectoral and
population became an important study subject to increase
second dorsal fins, interorbital width and head length.
the knowledge of the diversity of this species.
Nowadays, most authors consider that N. coriiceps and
Science Highlights - Thematic Area 3 |
141
N. neglecta are the same species (Kock, 1992; Eastman, 1993;
Amplification reaction
Eastman & Eakin, 2000).
The coding region of the mitochondrial gene for subunit 2 of
Mitochondrial DNA has been used in research at the
the NADH (ND2) was amplified using the following primer
population level as well as in studies on molecular taxonomy.
pairs: ND2F (5’ - ACCACCCCCGGGCAGTTGAAG - 3’) and
The present work used Polymerase Chain Reaction and
ND2R (5’ - GCGGTGGGAGCTAGCTCTTGTTTA - 3’).
Restriction Fragment Length Polymorphism (PCR-RFLP)
These primers were designed from conserved regions
techniques of a region of NADH dehydrogenase subunit
obtained from the alignment of the sequences of the ND2
2 gene of the mitochondrial DNA (Meyer, 1993), with the
gene of Antarctic fish deposited in GenBank (NCBI, 2004).
purpose of analysing the polymorphism among Notothenia species to assess the existence of N. neglecta and N. coriiceps
PCR-RFLP technique
separate species.
The amplicons of the ND2 were digested with 5 U of the following restriction enzymes: DdeI, HindIII and RsaI
Methods
(New England BioLabs, Beverly, MA). The treated samples were subjected to electrophoresis in 10% acrylamide gel.
Specimen collection and DNA extraction
Molecular size of restriction DNA fragments were estimated
Specimens of Notothenia coriiceps Richardson, 1844,
by comparison with 1 Kb Plus Ladder (Invitrogen).
N. neglecta Nybelin, 1951 and N. rossii Richardson, 1844 were collected at different localities near the Comandante
Results
Ferraz Brazilian Station (62° 05’ S and 58° 24’ W) in Admiralty
Digestion profiles of ND2 amplified fragments showed
Bay, King George Island, South Shetland Islands. Notothenia
that N. rossii does not possess a site for restriction enzymes
rossii, a phylogenetically close species was used as control.
HindIII and RsaI, whereas the amplicon of N. coriiceps
Thirty-six specimens were used for molecular analyses: 11
and N. neglecta exhibited one restriction site for HindIII
N. coriiceps, 11 N. neglecta and 14 N. rossii specimens. Counts
and RsaI (Figure 1b, c). The fragment patterns produced
of meristic characters and morphometric measurements
by digestion with restriction enzyme DdeI indicated three
from the specimens examined in this study following
restriction sites in N. rossii and two for N. coriiceps and
procedures by Fischer and Hureau (1988) (Table 1).
N. neglecta (Figure 1a).
A fragment of muscle tissue (1 cm3) of the tail region was collected and preserved in absolute ethanol until
The molecular differentiation between N. rossii and
processing. The Easy-DNA kit extraction (Invitrogen,
N. coriiceps was possible using the NADH2 gene of the
Carlsbad, CA) was used for DNA extraction, according to
mitochondrial DNA by PCR-RFLP technique. However,
the manufacturer’s instructions.
no difference was found within N. coriiceps and N. neglecta
Table 1. Meristic counts and morphometric measurements of the Notothenia specimens (n = 36) captured from Admiralty Bay, with sample separated by species according Fischer and Hureau (1988). Numbers of specimens are 11 for N. coriiceps, 11 for N. neglecta and 14 for N. rossii.
Characteristics
142
Species
N. rossii
N. coriiceps
N. neglecta
N° of first dorsal fin rays
4-7
4-6
3-7
N° of second dorsal fin rays
32 - 35
35 - 37
37 - 40
N° of pectoral fins rays
22 - 24
16 - 18
16 - 19
N° of anal fin rays
27 - 30
27 - 30
29 - 32
interorbital width / head length
29 - 31
23 - 25
26 - 33
| Annual Activity Report 2010
b
a
c
Figure 1. Digestion profile of a fragment (690 base pairs) of the coding region amplified of the mitochondrial gene of the subunit 2 of the NADH using PCR-RFLP technique. a) Amplicon digested by restriction enzyme DdeI. Lines 1 and 2 corresponding to N. rossii specie. Lines 3 and 4: N. coriiceps. Lines 5 and 6: N. neglecta; b) Amplicon digested by restriction enzyme HindIII. Lines 1 and 2 corresponding to N. rossii specie. Lines 3 and 4: N. coriiceps. Lines 5 and 6: N. neglecta; c) Amplicon digested by restriction enzyme RsaI. Lines 1 and 2 corresponding to N. coriiceps specie. Lines 3 and 4: N. neglecta. Lines 5 and 6: N. rossii. M: 1kb Plus Ladder (Invitrogen).
specimens, by the digestion profile obtained for the DdeI,
a distinct species, showing differences in the number of fin
HindIII and RsaI restriction enzymes (Figure 1).
rays of the pectoral and second dorsal fins, interorbital width and head length. In 1966, DeWitt considered N. neglegta as
Discussion
a subspecies of N. coriiceps justifying that Nybelin had used
The species N. coriiceps, described by Richardson 1844, is
a small number of samples to present its classification (Gon
largely distributed in shallow waters of the Southern Ocean
& Heemstra, 1990).
and found in high densities in Admiralty Bay. It presents a great deal of morphological variation. Nybelin (1951)
Conclusion
described N. neglecta as a new species of the genera. Fischer
The results of the study presented here confirmed that
and Hureau (1988) considered N. coriiceps and N. neglecta as
N. coriicepsis genetically different to N.rossii, being two
Science Highlights - Thematic Area 3 |
143
distinct species, while there was no evidence of genetic divergence between N. neglecta and, N. coriiceps. However,
Acknowledgements The authors wish to thank the Conselho Nacional de Pesquisa
additional information on independent genetic loci (nuclear
e Desenvolvimento (CNPq) for financial support to the
markers) will be required to reject the hypothesis of Nybelin
Projects nº 52.0125/2008-8 (API), 57.4018/2008-5 (INCT-
that these two morphotypes are separate species.
APA) and a Productivity in Research stipend for L. Donatti
Also, in addition to the information from Meyer
nº 305562/2009-6; Fundação de Amparo à Pesquisa do
(1993), we have shown that the gene ND2 is a good gene
Estado do Rio de Janeiro (FAPERJ) nº E-26/170.023/2008;
to differentiate the species of fish of the same genus. In the
REUNI/SESU for a Doctorate Stipend to C. Machado; the
comparison between N. coriiceps and N. rossi, by the RFLP
PROANTAR/SECIRM of the Brazilian Navy, and the staff
technique, the bands pattern was clear and presented good
of the Brazilian Antarctic Station Comandante Ferraz for
reproducibility.
all their logistical support.
References Eastman, J.T. (1993). Antarctic fish biology. San Diego: Academic Press, 322 pp. Eastman, J.T. & Eakin, R.R. (2000).An updated species list for notothenioid fish (Perciformes; Notothenioidei), with comments on Antarctic species. Archive of Fishery and Marine Research. 48(1), 11-20. Fischer, W. &Hureau, J.C. (1988). Oceano austral. 1985. Vol II. Roma: Organizacion de lasNaciones Unidas para Alimentacion e la Agricultura, 471 pp. Gon, O.& Heemstra, P.C. (1990). Fishes of the Southern Ocean.J. L. B. Smith Institute of Ichthyology. South Africa: Grahamstown, 462 pp. Kock, K.H. (1992). Antarctic fish and fisheries; studies in polar research. Cambridge: Cambridge University Press, 359 pp. Meyer, A. (1993). Evolution of mitochondrial DNA in fishes. In: Hochachka and Mommsen, Biochemistry and molecular biology of fishes, vol.2. Elsevier Science Publishers, New York, pp. 1-38. NCBI - National Center for Biotechnology Information (2004). Available from: <www.ncbi.nlm.nih.gov>. Accessed in August 11th 2004. Rodrigues, E.; Donatti, L.; Vani, G.S.; Lavrado, H.P.; Rios, F.S.; Suda, S.N.K.; Piechnik, C.A.; Machado, D.; Rodrigues Junior, E.; Oliveira, M. F.; Silva, F.B.V. & Cettina, L.B. 2009. Natural and anthropic impact assessment on biochemical and histopathological biomarkers of fishes and invertebrates at coastal region of Admiralty Bay – King George Island. Annual Activity Report of Institute of Science and technology Antarctic Environmental Research. São Carlos, pp. 44-49.
144
| Annual Activity Report 2010
8 DISTRIBUTION OF STEROLS IN SEDIMENT CORES FROM MARTEL INLET, ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA Edna Wisnieski1,*, Liziane Marcella Michelotti Ceschim2, Sabrina Nart Aguiar1,César de Castro Martins1,** 1 Centro de Estudos do Mar, Universidade Federal do Paraná – UFPR, Pontal do Paraná, PR, Brazil Laboratório de Química Orgânica Marinha, Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil
2
e-mail: *ednawisnieski@gmail.com; **ccmart@ufpr.br
Abstract: In the present study, sterols organic markers were applied to identify the sources of organic matter in Admiralty Bay. For this purpose, sediment samples were extracted using a Soxhlet system, clean up with column chromatography and injected into a gas chromatograph. Measurable levels of all sterols analyzed confirm the multiplicity of sources of sedimentary organic matter. In BTN and STH,the most abundant sterol was the colest-5-en-3β-ol (cholesterol) with 2.24 µg.g–1 and 4.12 µg.g–1, respectively, while in FER, itwas the 24-metil-colest-5-en-3β-ol (campesterol) with 1.83 µg.g–1. The saturated sterols have smaller concentrations in relation to parental unsaturated, which may indicate a low rate of bacterial and hydrogenation processes. A generic profile of the vertical distribution representing all 15 sterols studied was obtained by Principal Component Analysis (PCA). In three cores, the vertical distribution pattern of organic material presented the smallest values in the bottomdepth layers, reflecting the organic matter already immobilized while in the upper layers values showed a gradual increase towards the top, representing the recentdeposition of organic matter. Keywords: sediments, sterols, organic matter, Antarctica
Introduction Organic markers, such as sterols, are chemical compounds
because they are key components of cell membranes
with characteristics of degradation resistance and specificity
and for the regulation of specific metabolic processes
according to their origin. They can be used as indicators of
(Laureillard et al., 1997). Particulate organic matter, living
events and processes in the environment on a time scale
organisms and sediment show the presence ofsterols, thus
(Colombo et al., 1989). Particularly, sterols have been
the determination of these organic markers helps in the
widely used as indicators of sources, bacterial reworking
understanding of sources and fate of organic matter into
and diagenetic transformations of organic matter deposited
the marine environment, as well as fingerprints of primary
in the marine sediment, such as an indicator of sewage
production (Hudson et al., 2001).
introduction into the marine environment (Green &
In marine organic matter the main sterols that can
Nichols, 1995; Hughes & Thompson, 2004; Volkman, 2005;
be found are:4α,23,24-trimetil-colesta-22E-en-3β-ol
Yunker et al., 2005).
(dinosterol - photosynthetic dinoflagellates), colest-5-en-3β-
Sterols represent a small proportion of biogenic organic
ol, (cholesterol - fito and zooplankton), 24-etil-colest-5-en-
matter, however, they are essential to marine organisms,
3β-ol (sitosterol), 24-metil-colest-5-en-3β-ol(campesterol)
Science Highlights - Thematic Area 3 |
145
(algae and bacteria) and 24-metil-colesta-5,22E-dien-3β-ol
preservation or degradation of marine organic matter in
(brassicasterol - diatoms). The saturated sterols such as
sediment cores of Martel Inlet, Admiralty Bay, Antarctica.
5α-colestan-3β-ol (cholestanol), 24-metil-colesta-22E-en-
Material and Methods
3β-ol (campestanol) and 24-etil-colestan-3β-ol (sitostanol), are also present in different marine organisms and can
Study area
be formed as result of diagenetic processes and bacterial
The study area was the Martel Inlet, in Admiralty Bay,
hydrogenation of unsaturated sterols (Volkman, 2005).
King George Island located in the South Shetland Islands,
Currently, the organic geochemical aspects related to
Antarctic Peninsula (62° 02’ S and 58° 21’ W) (Figure 1).
the contribution and the conversion of sedimentary organic matter indicated by sterols in a given time scale in the
Admiralty Bay has an area of 131 km², reaches depths of
Antarctic environment has been barely investigated. The
up to 530 m and has a coastline with many bays (Santos et al.,
distribution of these compounds in sediment cores may
2007), the largest bay being at King George Island, one of
be useful for the understanding of the temporal and local
the South Shetlands Islands. There are three large inlets in
environmental changes based on natural and anthropogenic
Admiralty Bay: Martel, Mackelar and Ezcurra and each of
events in the recent past.
them possesses a research station. The Mackelar and Martel
The aim of this research has been to study the temporal
Inlets form the northern part of the Bay while the Ezcurra
distribution of sterols as indicators of origin, input,
Inlet is in the west (Bromberg et al., 2000). Comandante
40° 50°
South America
62°
W
5’ 60°
Macchu Pichu Station
S
3
A
7’
Map - 02
Steinhouse
1 2
B
E
6’
70°
Ferraz Station
N
4’
Botany Point
Hennequin Point
8’
80°
9’
Thomas Point C
10’
Arctowski Station
Antarctico 11’ Map - 01
Admiralty Bay
12’ 13’
sf
an
Br
d iel
ait
Str
14’ (A) Martel Inlet (B) Mackelar Inlet (C) Enzcurra Inlet
15’ 16’ Map - 02 58°
40’
38’
36’
34’
32’
30’
28’
26’
24’
22’
0 1 2 3 4 km 20’
18’
16’
Figure 1. Sampling stations at Admiralty Bay, King George Island, Antarctica. (1): ComandanteFerraz Brazilian Antarctic Station (FER); (2): Steinhouse Glacier (STH); (3): Botany Point (BTN).
146
| Annual Activity Report 2010
Ferraz Antarctic Station (EACF), the Brazilian station, is
with a flame ionization detector (GC-FID). Instrumental
located in Martel Inlet.
details are described by Montone et al. (2010).
Sampling Sampling was carried out during the austral summer of 2007/08, in three different points in Martel Inlet named: Ferraz Station (FER), Steinhouse Glacier (STH) and Botany Point (BTN). The cores were obtained from a box core sampler, and sub-sampled into sections of 1 cm.
Results and Discussion The most abundant compound in BTN and STH was the colest-5-en-3β-ol (cholesterol) (2.24 µg.g –1 and 4.12 µg.g–1, respectively), producedby various organisms that inhabit the region, including seals, whales, phyto and zooplankton (Volkman, 2005).In FER, the 24-metil-colest5-en-3β-ol (campesterol) (1.83 µg.g–1), biosynthesized by
Analytical procedure The analytical method used for the analysis of sterols in sediments is described in Kawakami and Montone (2002). Around 20 g of sediment from each site were extracted using a Soxhlet system for 8 hours with 70 mL of ethanol. The surrogate, 5α-cholestane was added before each extraction. The ethanol extract was reduced to c. 2 mL by rotoevaporation and submitted to a clean up with column chromatography using 2 g of 5% deactivated alumina and elution with 15 mL of ethanol. The extracts were evaporated to dryness and derivatized to form trimethylsilyl ethers
Prymnesiophycean algae (Phaeocystissp) and cyanobacteria (Volkman, 2005) was the most abundant sterol. The detected concentrations of 15 different sterols analyzed are evidence of the variety of sources of composition of sedimentary organic matter in Martel inlet. The presence of saturated sterols in the sediment indicates the occurrence of diagenic process although they are not commonly found in significant abundance in organisms (Hassett & Lee, 1977). However, the lower concentrations of saturated sterols in relation to the unsaturated homologue may indicate low rate of bacterial and hydrogenation diagenetic processes.
using BSTFA (bis(trimethylsilyl)trifluoroacetamide) with
A generic profile of the vertical distribution of all
1% TMCS (trimethylchlorosilane) for 90 minutes at 65 °C.
sterols analyzed was obtained by Principal Component
The mixture of TMS-sterols derivatives was determined by
Analysis (PCA), using the concentration of each compound
the injection of 2 µL into a gas chromatograph equipped
according to different depth sections of sediment cores.
a
b
c
Figure 2. Vertical profilesobtained by Principal Component Analysis (PCA) to BTN, STH and FER sites.
Science Highlights - Thematic Area 3 |
147
As expected, the general profile of the three sites
shown detectable concentrations in most of the sections of
(Figure 2) showed highest concentrations in the upper
the three cores analyzed, despite of evident degradation in
layers. The sterol levels decreased with depth, suggesting
down-core sections.
degradation after depositional and little changes in sources of organic matter in the recent past (Hudson et al., 2001). In BTN (Figure 2a), a constant behavior can be visualized in depth sections up to 10-11 cm, indicating the immobilized organic matter (Muri & Wakeham, 2006). The lowest value at ~10 cm suggesting declines in productivity or fluxes of poor-sterol material at this point (Hudson et al., 2001). A more significant peak can be seen between 15 and 16 cm and it may be associated with large inputs of organic matter to
The vertical profiles generated by PCA presented lower values in the depth layers, reflecting the organic matter already immobilized while in the upper layers values showed increased concentrations, representing the recent inputs of organic matter. The results of this research can contribute to a better understanding of the processes related to contribution and the transformation of organic matter in Martel Inlet, serving
the bottom sediments of Martel Inlet as a result of natural
as a basis for other environmental studies, in development
events (period of increased melting, significant fluctuations
in the region.
in populations of marine organisms or changes in sediment particle size) (Hudson et al., 2001). From sections 9-10 cm
Acknowledgements
up to surface layers, the increased values are compatible with
Edna Wisnieski expresses gratitude forthe scholarship
the recent organic matter deposition, weakly transformed in the water column and by post depositional processes. In the cores STH (Figure 2b) and FER (Figure 2c), a similar distribution to BTN was found, except for a peak at 2 and 3 cm (STH) and from 1 to 3 cm (FER), which may have been due to the presence of fine grained particles (visual observation) in these sections resulting in high organic matter accumulation and strong accumulation of sterols
148
granted by (FundaçãoAraucária – PR). Liziane M. M. Ceschim expresses gratitude for the DTI-3 scholarship (CNPq 382434/2009-9) related to Brazilian “National Science and Technology Institute on Antarctic Environmental Research” (INCT-APA, CNPq 574018/2008-5 and FAPERJ E-16/170023/2008). C.C. Martins expresses gratitude for the PQ-2 Grant (CNPq 307110/2008-7). The authors
due to physical adsorption(Meyers, 1994).
thank the financial support obtained from the Ministério
Conclusions
Tecnologia (MCT) and Conselho Nacional de Pesquisa
do Meio Ambiente (MMA), Ministério de Ciência e
Based on the results obtained from this work, a multiplicity
(CNPq - GEOLs Project 550014/2007-1) and the logistical
of sources of marine organic matter to sediments of Martel
support from Comissão Interministerial para os Recursos
Inlet could be verified, due to all sterols analyzed having
do Mar (CIRM).
| Annual Activity Report 2010
References Bromberg, S.; Nonato, E.F.; Corbisier, T.N. & Petti, M.A.V. (2000) Polychaete distribution in the near-shore zone of Martel inlet, Admiralty Bay (King George Island, Antarctica). Bulletin of Marine Science, 67(1): 175-88. Colombo, J.C.; Pelletier, E.; Brochu, C.; Khalil, M. & Catoggio, J.A.(1989). Determination of hydrocarbon sources using n-alkane and polyaromatic hydrocarbon distribution indexes. Case study: Rio de la Plata Estuary, Argentina. Environmental Science Technology, 23(7): 888-94. Green, G. & Nichols, P.D. (1995). Hydrocarbons and sterols in marine sediments and soils at Davis Station, Antarctica: a survey for human-derived contaminants. Antarctic Science, 7(2): 137-44. HassetJr, J.P.& Lee, G.F. (1977).Sterols in natural water and sediment. Water Research, 11(11): 983-9. Hudson, E.D.; Parrish, C.C. & Helleur, R.J.(2001).Biogeochemistry of sterols in plankton, settling particles and recent sediments in a cold ocean ecosystem (Trinity Bay, Newfoundland). Marine Chemistry, 76(4): 253-70. Hughes, K.A. & Thompson, A. (2004). Distribution of sewage pollution around a maritime Antarctic research station indicated by faecal coliforms, Clostridium perfringens and faecal sterol markers. Environmental Pollution, 127(3): 315-21. Kawakami, S.K. & Montone, R.C. (2002).An efficient ethanol-based analytical protocol to quality fecal steroids in marine sediments.Journal of Brazilian Chemical Society, 13(2): 226-32. Laureillard, J.; Pinturier, L.; Fillaux, J. & Saliot, A.(1997). Organic geochemistry of marine sediments of the Subantarctic Indian Ocean sector: Lipid classes – sources and fate. DeepSea Research II, 44(5): 1085-108. Meyers, P.A. (1994). Preservation of elemental and isotopic source identification of sedimentary organic matter. Chemical Geology, 114(3-4): 289-302. Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Silva, D.A.M.; Campos, L.S. & Weber, R.R. (2010). Distribution of sewage input in marine sediments around a maritime Antarctic research station indicated by molecular geochemical indicators. Science of the Total Environment, 408(20): 4665-71. Muri, G. & Wakeham, S.G. (2006). Organic matter and lipids in sediments of Lake Bled (NW Slovenia): Source and effect of anoxic and oxic depositional regimes. OrganicGeochemistry, 37(12): 1664-79. Santos, I.R.; Fávaro, D.I.T.; Schaefer, C.E.G.R. & Silva-Filho, E.V. (2007). Sediment geochemistry in coastal maritime Antarctica (Admiralty Bay, King George Island): Evidence from rare earths and other elements. Marine Chemistry, 107(4): 464-74. Volkman, J.K. (2005). Sterols and other triterpenoids: source specifity and evolution of biosynthetic pathways. Organic Geochemistry, 36(2): 139-59. Yunker, M.B.; Belicka, L.L.; Harvey, H.R. & Macdonald, R.W. (2005).Tracing the inputs and fate of marine and terrigenous organic matter in Arctic Ocean sediments: A multivariate analysis of lipid biomarkers.Deep Sea Research II, 52(24-26): 3478-508.
Science Highlights - Thematic Area 3 |
149
9 BACKGROUND VALUES AND ASSESSMENT OF FECAL STEROIDS DISCHARGED INTO TWO INLETS (MACKELAR AND EZCURRA) IN ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA Sabrina Nart Aguiar1,*, Liziane Marcella Michelotti Ceschim2, Edna Wisnieski1, César de Castro Martins1,** 1 Centro de Estudos do Mar, Universidade Federal do Paraná – UFPR, Pontal do Paraná, PR, Brazil Laboratório de Química Orgânica Marinha, Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil
2
e-mail: *sabrina.oceano@gmail.com; **ccmart@ufpr.br
Abstract: Steroids are efficient geochemical markers of natural and anthropogenic environmental events, because they present stability and resistance to the degradation process, keeping a record of their signature origin, allowing interpretations about the organic matter sources. The Antarctic region is considered one of the best preserved environments in the world; however human activities have resulted in changes in this pristine location. Sampling was collected during the 2006/07 austral summer at three points: Refuge II (REF) (Mackelar Inlet), Thomas Point (PTH) and Barrel Point (BAR) (Ezcurra Inlet). After Soxhlet extraction, clean up using adsorption column and derivatization, steroids concentrations were determined by gas chromatography with flame ionization detector (GC-FID). Concentrations of fecal sterols (coprostanol and epicoprostanol) in all locations studied were <0.10 µg.g–1, suggesting natural contributions of these compounds. This statement is corroborated by values found for the coprostanol/epicoprostanol ratio for all cores (<2.50). Based on these results, background values were established for the analyzed compounds in the two studied inlets. The values for REF, PTH and BAR were, respectively, (0.06 ± 0.02), (0.04 ± 0.03) and (0.03 ± 0.01) for coprostanol + epicoprostanol. Keywords: fecal sterols, coprostanone, background values, Admiralty Bay
Introduction
150
The Antarctic region is considered one of the best-
These results showed the importance of monitoring inputs
preserved environments in the world. However, there are
and to treat waste, preventing environmental contamination.
approximately 79 centers of research in Antarctica located
To study the extent of the sewage contribution around
mainly in coastal areas, discarding their sewage, directly
research stations, research involving organic markers has
into the open sea (Hughes & Thompson, 2004). A study
been developed (Green & Nichols, 1995; Martins et al.,
realized by Hughes (2004) showed that the influence of
2002), due to specific source, resistance to degradation
untreated sewage discharged by Rothera Research Station –
processes and chemical stability (Colombo et al., 1989).
UK (Marguerite Bay), reached approximately 570 m to the
Martins et al. (2005), using organic geochemical markers
North and more than 800 m east of this station. In 2004,
such as sterols, verified that the presence of sewage from
this influence was not detected in locations with more than
Comandante Ferraz station had reached up to 400 m
50 m, due the implantation of sewage treatment facilities.
distant from the initial sewage discharge. As the Admiralty
| Annual Activity Report 2010
Bay environment is subjected to little human influence
the injection of 2 µL into a gas chromatograph equipped
and fecal steroids can be associated to marine mammals,
with a flame ionization detector (GC-FID). Instrumental
the determination of background values of these organic
details are described by Montone et al. (2010).
markers in different Antarctic regions are important for future studies, especially in places where scientific stations are established (Montone et al., 2010). Thus, background
Results and Discussion The sedimentation rates used in this work to determine
values of fecal steroids, based on the concentration of these
the time scale indicated by the cores were calculated by
markers, were obtained from three short sedimentary
Martins et al. (2010). BAR presented 0.13 cm.y–1. For other
columns, which were sampled at Mackelar and Ezcurra Inlet.
cores (REF and PTH), we used a mean value between several
Material and Methods
sites in Admiralty Bay (0.22 cm.y–1). Among the most widely used sterols, coprostanol and
Admiralty Bay is situated in King George Island, in the
epicoprostanol (named fecal sterols) are found in sediments
South Shetland Islands. Human occupation in the Bay is
contaminated by sewage (Venkatesan & Kaplan, 1990;
represented by the presence of three main stations and
Venkatesan & Santiago, 1989), because they are associated
some refuges. Martel Inlet is the location of Brazilian
primarily with human feces (Grimalt et al., 1990). However,
Ferraz Station and two refuges; Mackelar Inlet is the base
feces of marine animals, such as some species of whales,
of the Peruvian Macchu Picchu station, located near Crepin
seals, sea lions, contributes with large quantities of these
Point, while the Polish Henryk Arctowski station is located
compounds to the Antarctic environment (Venkatesan et al.,
at Ezcurra Inlet, on the western side of the Admiralty Bay.
1986; Venkatesan & Santiago, 1989) and it is assumed as
Two cores were collected in Ezcurra Inlet, near the
“natural contribution”. The same sources can be assigned
Thomas Point and Barrel Point; both at 30 m deep, and the
to ketone coprostanone (Martins et al., 2002; Venkatesan
third core was collected on the opposite side of Macchu
& Kaplan, 1990). González-Oreja and Saiz-Salinas (1998)
Pichu station, near the Brazilian refuge, at 20 m deep, in
proposed limits to coprostanol in order to define natural
Mackelar Inlet. The sampling was undertaken using a box
input or sewage contribution, where values below 0.50 µg.g–1
corer between December 2006 and January 2007. 25 mm
may be related pristine environments.
diameter wide aluminum tubes were introduced into the
In REF, the coprostanol presented values between
box, and cores of approximately 20 cm were sampled and
0.01 and 0.06 μg.g –1 and the epicoprostanol between
sectioned at 1 cm intervals.
0.01 and 0.04 μg.g–1 (Table 1). These values are below the
Steroid analysis was based on a method described by
established limit, suggesting an introduction related to
Kawakami and Montone (2002). More than 20 g of sediment
marine mammals, despite of this point being located on
from each site were extracted using a Soxhlet system for
the opposite side to a research station (Macchu Pichu).
8 hours with 70 mL of ethanol. The surrogate, 5α-cholestane,
To the PTH, the values of coprostanol and epicoprostanol
was added before each extraction. The ethanol extract was
were also below the limit, between 0.01 and 0.04 μg.g–1 and
reduced to c. 2 mL by rotoevaporation. The concentrated
0.01 and 0.09 μg.g–1, respectively (Table 1). As well as in REF,
ethanol extract was submitted to a clean up with column
the maximum values for each fecal sterol are lower than
chromatography using 2 g of 5% deactivated alumina and
the limit established by González-Oreja and Saiz-Salinas
elution with 15 mL of ethanol. The extracts were evaporated
(1998). These values suggest that although variations occur
to dryness and derivatized to form trimethylsilyl ethers
throughout the profile, the introduction of these compounds
using BSTFA (bis(trimethylsilyl)trifluoroacetamide) with
seems to be from natural sources, despite the proximity of
1% TMCS (trimethylchlorosilane) for 90 minutes at 65 °C.
these sites to human activities. As verified in other points,
The mixture of TMS-sterols derivatives was determined by
the coprostanol and epicoprostanol were also low in BAR
Science Highlights - Thematic Area 3 |
151
152
| Annual Activity Report 2010
20022007
0.04
0.04
3.62
1.00
Date
Coprostanol
Epicoprostanol
Coprostanone
cop/e-cop
20022007
0.04
0.04
0.32
1.00
Date
Coprostanol
Epicoprostanol
Coprostanone
cop/e-cop
0-1 cm
19992007
0.02
0.01
0.02
2.00
Section
Date
Coprostanol
Epicoprostanol
Coprostanone
cop/e-cop
Barrel Point
0-1 cm
Section
Thomas Point
0-1 cm
Section
Refuge II
0.50
0.02
0.02
0.01
19921999
1-2 cm
1.50
0.15
0.02
0.03
19982002
1-2 cm
2.50
1.37
0.02
0.05
19982002
1-2 cm
0.67
0.03
0.03
0.02
19761992
2-4 cm
0.44
0.52
0.09
0.04
19931998
2-3 cm
0.75
0.69
0.04
0.03
19931998
2-3 cm
0.50
0.02
0.02
0.01
19691976
4-5 cm
2.00
0.12
0.01
0.02
19891993
3-4 cm
2.00
0.49
0.02
0.04
19891993
3-4 cm
0.50
0.02
0.02
0.01
19611969
5-6 cm
1.00
0.04
0.01
0.01
19841989
4-5 cm
1.00
0.46
0.04
0.04
19841989
4-5 cm
1.00
0.01
0.01
0.01
19531961
6-7 cm
1.00
0.03
0.01
0.01
19801984
5-6 cm
1.67
0.46
0.03
0.05
19751980
6-7 cm
1.00
0.01
0.01
0.01
19451953
7-8 cm
0.50
0.06
0.02
0.01
19711975
7-8 cm
nc
0.17
<LD
0.06
19661971
8-9 cm
0.50
0.01
0.02
0.01
19381945
8-9 cm
2.00
0.08
0.01
0.02
19661971
8-9 cm
2.50
0.47
0.02
0.05
19571962
10-11 cm
1.00
0.60
0.01
0.01
19221930
10-11 cm
1.00
0.01
0.01
0.01
19621966
9-10 cm
3.00
0.11
0.01
0.03
19521957
11-12 cm
0.50
<LD
0.02
0.01
19151922
11-12 cm
2.00
0.06
0.01
0.02
19571962
10-11 cm
1.00
0.04
0.01
0.01
19481952
12-13 cm
1.00
<LD
0.02
0.02
19071915
12-13 cm
1.50
0.21
0.02
0.03
19431948
13-14 cm
1.00
< LD
0.02
0.02
18991907
13-14 cm
1.50
0.23
0.02
0.03
19391943
14-15 cm
1.00
<LD
0.01
0.01
18841899
14-16 cm
0.86
0.02
0.02
0.01
Mean
1.24
0.14
0.02
0.02
Mean
1.67
0.69
0.02
0.04
Mean
0.40
0.01
0.01
0.005
SD
0.57
0.15
0.02
0.01
SD
0.71
0.94
0.01
0.01
SD
Table 1. Concentration (in µg.g–1) of fecal sterols and ketone coprostanone in cores collected at REF, PTH and BAR. Mean value and standard deviation (SD) were calculated for all sections of each core.
and associated to natural contribution. Values observed for
(0.03 ± 0.01) μg.g−1 (BAR). Coprostanone did not present
these compounds are 0.01 to 0.02 μg.g–1 (coprostanol) and
a regular distribution according to the depth, showing
0.01 to 0.03 μg.g (epicoprostanol) (Table 1).
increased concentrations in the top layers and low levels
–1
Concentrations of coprostanone also can be attributed to
in the bottom cores, in that it is difficult to establish
natural contribution, since it is assigned to marine mammal
background values to this compound. In this case, it is
feces, such as fecal sterols. Higher values (>0.50 μg.g ) in
necessary to consider the degradation processes in top
the most recent layers are found at REF (0.69 – 3.62 μg.g )
sections and unusual inputs in specific layers of REF and
and PTH (0.32 – 0.52 μg.g ). Coprostanone from sewage
PTH.
–1
–1
–1
input in these sites was not expected as none of the stations located in the two inlets discharge sewage in the region
Conclusions
(Martins et al., 2002).
Concentrations of fecal sterols (coprostanol and
In order to minimize the ambiguity of sources for these
epicoprostanol) in all locations studied were <0.10 µg.g–1,
compounds, the use of numerical ratio involving fecal
suggesting natural contributions of these compounds
sterols are important tools in the differentiation of the
and corroborated by values found for the coprostanol/
sources of fecal organic matter. Venkatesan and Santiago
epicoprostanol ratio for all cores (<2.50). The background
(1989) have proposed specific indexes as the ratio between
values related to natural sources of fecal sterols (coprostanol
the concentration of coprostanol and epicoprostanol,
+ epicoprostanol) to Mackelar and Ezcurra inlet were lower
as a way to distinguish the places studied in relation to
than Martel Inlet and this information can be used for
the contribution of fecal sterols from human or marine
future evaluations about sewage discharges from stations
mammals, specifically to the Antarctic environment. Values
established in the inlets studied.
below 2.50 may indicate natural contribution, while values above 2.50 are strongly related to sewage. REF did not show values exceeding 2.50 in any section (1.67 ± 0.71), suggesting
Acknowledgements Sabrina Nart Aguiar expresses gratitude for the scholarship
that the main source of sterols are marine mammals. The
(PIBIC/CNPq). Liziane M. M. Ceschim expresses gratitude
same results occurred to the sediment cores from Ezcurra
for DTI-3 scholarship (CNPq 382434/2009-9) related
Inlet (1.24 ± 0.57 – PTH; and 0.86 ± 0.40 – BAR) (Table 1).
to Brazilian “National Science and Technology Institute
The results of this ratio showed that the source of
on Antarctic Environmental Research” (INCT-APA,
sedimentary fecal steroids is from natural contributions. At
CNPq 574018/2008-5 and FAPERJ E-16/170023/2008). C.C.
which point, background values can be determined, which
Martins thanks for the PQ-2 Grant (CNPq 307110/2008-7)
are useful to evaluate a hypothetical sewage discharge in these
and GEOLs Project (CNPq 550014/2007-1). C.C.
regions. In Martel Inlet, the background values related to
Martins expresses gratitude for the PQ-2 Grant
natural sources of fecal sterols (coprostanol+epicoprostanol)
(CNPq 307110/2008-7). The authors thank the financial
have been established as 0.19 μg.g (Montone et al., 2010).
support obtained from the Ministério do Meio Ambiente
Considering the mean value obtained for each three
(MMA), Ministério de Ciência e Tecnologia (MCT) and
cores, the background values to the sum of coprostanol
Conselho Nacional de Pesquisa (CNPq - GEOLs Project
and epicoprostanol, the purpose of this study are:
550014/2007-1) and the logistical support from Comissão
(0.06 ± 0.02) μg.g (REF), (0.04 ± 0.03) μg.g (PTH) and
Interministerial para os Recursos do Mar (CIRM).
−1
−1
−1
Science Highlights - Thematic Area 3 |
153
References Colombo, J.C.; Pelletier, E.; Brochu, C.; Khall, M. & Catoggio, J.A. (1989) Determination of Hydrocarbon Sources Using n-Alkane and Polyaromatic Hydrocarbon Distribution Indexes. Case Study: Rio de La Plata Estuary, Argentina. Environmental Science & Technology, 23(7): 888-94. González-Oreja, J.A. & Saiz-Salinas, J.I. (1998). Short-term spatio-temporal changes in urban pollution by means of faecal sterols analysis. Marine Pollution Bulletin, 36(11): 868-75. Green, G. & Nichols, P.D. (1995). Hydrocarbons and sterols in marine sediments and soils at Davis Station, Antarctica: a survey for human-derived contaminants. Antarctic Science, 7(2): 137-44. Grimalt, J.O.; Fernandez, P.; Bayona, J.M. & Albaiges, J. (1990). Assessment of fecal sterols and ketones as indicator of urban sewage inputs to coastal waters. Environmental Science & Technology, 24(3): 357-63. Hughes, K.A. (2004). Reducing sewage pollution in the Antarctic marine environment using a sewage treatment plant. Marine Pollution Bulletin, 49(9-10): 850-53. Hughes, K.A. & Thompson, A. (2004). Distribution of sewage pollution around a maritime Antarctic research station indicated by faecal coliforms, Clostridium perfringens and faecal sterol markers. Environmental Pollution, 127(3): 315-21. Kawakami, S.K. & Montone, R.C. (2002) An efficient ethanol-based analytical protocol to quality fecal steroids in marine sediments. Journal of the Brazilian Chemical Society, 13(2): 226-32. Martins, C.C.; Venkatesan, M.I. & Montone, R.C. (2002). Sterols and linear alkylbenzenes in marine sediments from Admiralty Bay, King George Island, South Shetland Islands. Antarctic Science, 14(3): 244-52. Martins, C.C.; Montone, R.C.; Gamba, R.C. & Pellizari, V.H. (2005). Sterols and fecal indicator microorganisms in sediments from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1/2): 1-12. Martins, C.C.; Bícego, M.C.; Rose, N.L.; Taniguchi, S.; Lourenço, R.A.; Figueira, R.C.L.; Mahiques, M.M. & Montone, R.C. (2010). Historical record of polycyclic aromatic hydrocarbons (PAHs) and spheroidal carbonaceous particles (SCPs) in marine sediment cores from Admiralty Bay, King George Island, Antarctica. Environment Pollution, 158(1): 192–200. Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Silva, D.A.M.; Campos, L.S. & Weber, R.R. (2010). Distribution of sewage input in marine sediments around a maritime Antarctic research station indicated by molecular geochemical indicators. Science of the Total Environment, 408(20): 4665–71. Venkatesan, M.I.; Ruth, E. & Kaplan, I.R. (1986). Coprostanols in Antarctic marine sediments: A biomarker for marine mammals and not human pollution. Marine Pollution Bulletin, 17(12): 554-7. Venkatesan, M.I. & Santiago C.A. (1989). Sterols in oceans sediments: novel tracers to examine habitats of cetaceans, pinnipeds, penguins and humans. Marine Biology, 102: 431-7. Venkatesan, M.I. & Kaplan, I.R. (1990). Sedimentary Coprostanol as an index of sewage addition in Santa Monica Basin, southern California. Environmental Science & Technology, 24(2): 208-14.
154
| Annual Activity Report 2010
10 THE ROLE OF EARLY DIAGENESIS IN THE SEDIMENTARY STEROIDS AROUND PENGUIN ISLAND, ANTARCTICA Liziane M. M. Ceschim1,2,*, Rosalinda C. Montone2, César C. Martins1,** 1 Centro de Estudos do Mar, Universidade Federal do Paraná, Pontal do Paraná, PR, Brazil Laboratório de Química Orgânica Marinha, Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil
2
e-mail: *lceschim@usp.br; **ccmart@ufpr.br
Abstract: The role of lipids in polar environments is of primary importance for understanding the cycling of carbon organic and associated elements. Thus, the knowledge of the nature and quality of organic matter is necessary to evaluate the overall impact in this area and to model the carbon cycle. The aim of this study was to determine the transformations of organic matter in the marine environment by analysis of a specific group of lipid biogeochemical markers, the sedimentary steroids. Sediment cores were collected during the 2007/08 austral summer in the vicinity of the Penguin Island (2 cores). In general, the cores were sectioned at 1 cm intervals and the steroids analyzed by gas chromatography with flame ionization detection (GC-FID), after Soxhlet extraction, adsorption column chromatography and derivatization. The results showed that organic matter had been subjected to extensive degradation and transformation with depth in the two corers and the general increase of the stanol/ stenol ratio may have represented the progressive reduction of stenols to stanols within the deepest sediment layers. According to the linear regression (R2) applied, the process at Penguin Island is governed by a natural supply, and a random pattern in the concentration values with increasing depth. These results contribute to the understanding of the current processes of organic matter transformation in this important region of Antarctic environment. Keywords: steroids, sediments, organic matter, Antarctica
Introduction Advanced studies about biogeochemical cycles in the
relative rates of primary production for those communities
relatively unpolluted areas of the world, such as Antarctica,
in the ocean and its interactions with chemical and
have been of great interest. Thus, the Southern Ocean
biological systems is important to evaluate the overall
appears an attractive region due to the distance from major
impact in this area and modeling the world carbon cycle
sources of human pollution, very cold average temperatures,
(Mudge & Norris, 1997; Villinski et al., 2008).
a strong seasonality and the almost complete absence of higher plants (Laureillard et al., 1997).
Based on this expectation, this work has the purpose to investigate different organic compounds in the marine
The role of lipids in polar environments is of primary
sediments to determine the transformations of organic
importance for understanding the cycling of carbon organic
matter in the Antarctic environment by analysis of a specific
and associated elements. Knowledge of the nature and
group of lipid biogeochemical markers, the sedimentary
quality of organic matter, assemblages of organisms and
steroids.
Science Highlights - Thematic Area 3 |
155
Material and Methods Study area Penguin Island (62° 06’ S and 57° 54’ W; area 1.7 km2) is situated on the southeastern side of King George Island, South Shetland Islands, Antarctica (Figure 1). It lies within a belt of inactive volcanoes that developed in the Bransfield Strait (Birkenmajer, 1982). Almost all this island is dominated by species of birds and according to Sander et al. (2007) nine bird species nest on Penguin Island, among them Pygoscelis antarctica (chinstrap penguin) and Pygoscelis adeliae (adélie penguin). These populations contribute significantly to a large amount of guano, influencing strongly the physical and chemical properties of local soils, producing ornithogenic soil (Michel et al., 2006; Zhu et al., 2009).
Sampling Sediment cores were taken by mini-box corer (25 × 25 × 55 cm) during the 2007/08 austral summer. In general, the cores were sectioned on board to a resolution of 1-2 cm prior to sub-sampling for chemical and physical characterization, and placed into pre-cleaned aluminum foil and stored at –20 °C until analyzed in laboratory.
Extraction and fractioning of sterols
were < 0.01 µg.g–1 for all compounds analyzed.
Results and Discussion The ratio between stanol/stenol has been used to indicate microbial reduction in anaerobic environments. Studies about redox effects on organic matter degradation/ preservation have shown that the residence times for organic compounds present in marine sediments can vary as a result of environmental conditions such as bioturbation, physical mixing and the presence or absence of oxygen and other electron acceptors (Wakeham & Canuel, 2006). Stanols may be formed within the sediments by bacterial reduction of stenols in highly or permanently anoxic sediments (Nishimura & Koyama, 1977). Consequently, the stanol/stenol ratio has been used to describe the redox conditions of the sediments (Gagosian et al., 1980). Since stanols are synthesized by some plankton, notably dinoflagellates (Robinson et al., 1984) and diatoms (Barrett et al., 1995), changes in the distribution of marine phytoplankton through time may provide an additional source of variability in the sedimentary stanol/stenol ratio. Sterols undergo a variety of chemical and microbial reactions in the surface layers of marine sediments. It is seems evident that they have been subjected to degradation
In the present study, all samples were analyzed for
and transformation with depth in the two corers (Figure 2),
17 different steroids, including 15 sterols and 2 ketones. The
mainly PGI-2. The general increase of the stanol/stenol
laboratory procedure was based on a method described by
ratio may illustrate the progressive reduction of stenols to
Kawakami and Montone (2002). This consists of analysis
stanols within the deepest sediment layers (Shanchun et al.,
by gas chromatography with flame ionization detection
1994; Fernandes et al., 1999), showing that the rates of sterol
(GC-FID), after Soxhlet extraction, adsorption column
degradation in sediments are a group of several processes,
chromatography and derivatization with BSTFA/TCMS.
which the hydrogenation appears to be relatively more
Data was subject to quality control procedures, like
156
recoveries ranged from 99-139 %. Detection limits (DL)
important (Volkman et al., 1987).
the analysis of spiked samples (4 replicates), precision
Once the most energetically favorable metabolic
tests (4 replicates) and evaluation of the instrumental
pathways for bacteria involve oxygen as the electron
performance (response factors). Analysis of procedural
acceptor, the organic carbon degradation (and preservation)
blanks (6 replicates) indicated minor amounts of
in sediments is strongly controlled by the average time that
dehidrocholesterol and cholesterol, which were subtracted
organic matter is exposed to oxygen (Wakeham & Canuel,
from the samples. Surrogate recoveries (5α-cholestane)
2006). Hence, it is feasible that stanols are relatively less
ranged from 66-132%. Sediment and blank samples
abundant at the surface than at the bottom sections of the
were spiked with a mixture of steroids and the standard
PGI-1 and PGI-2 corers.
| Annual Activity Report 2010
Figure 1. Location of sampling stations (PGI-1 and PGI-2) in the Antarctic continent and the South Shetland Islands.
Science Highlights - Thematic Area 3 |
157
Figure 2. Mean value of four pairs of stanol/stenol rate in PGI-1 and PGI-2.
This process occurs in opposition to the progressive
as is noted by the reduction and increase in the values at
input of stanols from potentially new sources of biogenic
several depths of both corers. This variation may reflect the
saturated molecules being identified by different studies,
change of water chemistry of the site at the time of sediment
such as dinoflagellates, diatoms and some species of
deposition due to a general renewal of bottom water and
invertebrates, usually represented by low values in the ratio
thus its re-oxygenation (Pinturier-Geiss et al., 2002).
(Hudson et al., 2001; Ternois et al., 1998).
158
Jeng et al. (1997) analyzing sediment cores of the coast of
According to Wakeham and Canuel (2006), values of the
Taiwan, found that the rate of degradation of sterols follows
stanol/stenol ratio varied between 0.1 and 0.2 for oxic water
a typical kinetic mechanism of 1st order reaction. To this
columns and between 0.6 and 1.2 in sub-oxic and anoxic
evaluation, the linear relation between the natural logarithm
interfaces in the water column from the Cariaco Trench
(ln) of total sterols concentration and depth (along the
(Caribbean shelf) and Black Sea. In the present study, the
cores) was determined. In order to complement the results
ratio varied from 0.33 to 0.57 (0.43 ± 0.07) (PGI-1) and
obtained, graphs of linear regression (R2) for both cores
0.11 to 0.57 (0.39 ± 0.12) (PGI-2) indicating well oxygenated
(Figure 3) were done. It is possible to observe a decrease in
sediments. The results also show that the redox conditions
the concentration of sterols toward the lower depth layers,
of sediment appear to have been potentially modified,
for most points in the sedimentary columns. These results
| Annual Activity Report 2010
Figure 3. Sterol degradation model indicated by linear regression between Ln stigmasterol concentration vs depth to PGI-1 and PGI-2 sediment cores.
confirm the trend of degradation over the preservation of
Penguin Island is an important environment process of
organic compounds and, consequently, of sedimentary
organic matter transformation.
organic matter, which is of fundamental importance for understanding the processes prevailing in this environment. In both corers, the linear regression values showed that the degradation occurs according to kinetic mechanism of 1st order (R2 < 0.75). Fluctuations in the natural supply of
Conclusion According to the values found for the stanol/stenol ratio, the sediments around Penguin Island are well oxygenated.
sterols and over the years may change the regular pattern
However, some changes were detected along the sedimentary
with increased depth, which explains the absence of a perfect
column and may have resulted by change of water chemistry
linear correlation, especially in PGI-1. The degradation can
related to the time-scale of sediments deposition and the
be defined as the decrease of compound concentration by
general renewal of bottom water and thus its re-oxygenation.
transformation into other molecules (such as conversion of stenols to stanols), decomposition into smaller molecules, or incorporation into high molecular weight components. As
Linear regression analysis confirmed the degradation trend over the preservation of sedimentary organic matter. This
all processes are related with removal of extractable sterols
information helps a better understanding of the processes
from the sediments (Jeng et al., 1997), the results suggest
related to contribution and the transformation of organic
that the diagenesis of organic matter in sediments around
matter around Penguin Island.
Science Highlights - Thematic Area 3 |
159
Acknowledgements
The authors thank the financial support obtained from
Liziane M. M. Ceschim expresses gratitude for DTI-3
the Ministério do Meio Ambiente (MMA), Ministério de
scholarship (CNPq 382434/2009-9) related to Brazilian
Ciência e Tecnologia (MCT) and Conselho Nacional de
“National Science and Technology Institute on Antarctic
Pesquisa (CNPq - GEOLs Project 550014/2007-1) and the
Environmental Research” (INCT-APA, CNPq 574018/2008-5
logistical support from Comissão Interministerial para os
and FAPERJ E-16/170023/2008). C.C. Martins expresses
Recursos do Mar (CIRM).
gratitude for the PQ-2 Grant (CNPq 307110/2008-7).
References Barrett, S.M.; Volkman, J.K.; Dunstan, G.A. & LeRoi, J.M. (1995). Sterols of 14 species of marine diatoms (Bacillariophyta). Journal of Phycology, 31(1): 360-69. Birkenmajer, K. (1982). The Penguin Island Volcano, South Shetland Island (Antarctica): It’s structure and succession. Studia Geologica Polonica, 74(3): 155-73. Fernandes, M.B.; Sicre, M.A.; Cardoso, J. N. & Macedo, S. J. (1999). Sedimentary 4-desmethyl sterols and n-alkanols in na eutrophic urban estuary, Capibaribe River, Brazil. The Science of the Total Environment, 231(1): 1-16. Gagosian, R.B.; Smith, S.O.; Lee, C.; Farrington, J.W. & Frew, N.M. (1980). Steroid transformations in recent marine sediments. In: Douglas A.G. & Maxwell, J.R. (Editors). Advances in Organic Geochemistry. Oxford: Pergamon, pp. 407-419. Hudson, E.D.; Parrish, C.C. & Helleur, R.J. (2001) Biogeochemistry of sterols in plankton, settling particles and recent sediments in a cold ocean ecosystem (Trinity Bay, Newfoundland). Marine Chemistry, 76(4): 253-70. Jeng, W.L.; Huh, C.A. & Chen, C.L. (1997). Alkanol and sterol degradation in a sediment core from the continental slope off Southwestern Taiwan. Chemosphere, 35(11): 2515-23. Kawakami, S.K. & Montone, R.C. (2002). An efficient ethanol-based analytical protocol to quality fecal steroids in marine sediments. Journal of the Brazilian Chemical Society. 13(2): 226-32. Laureillard, J.; Pinturier, L.; Fillaux, J. & Saliot, A. (1997). Organic geochemistry of marine sediments of the Subantarctic Indian Ocean sector: Lipid classes – sources and fate. Deep-Sea Research. II, 44(5): 1085-108. Michel, R.F.M.; Schaefer, C.E.G.R.; Dias, L.; Simas, F.N.B.; Benites, V. & Mendonça, E.S. (2006). Ornithogenic gelisols (cryosols) from Maritime Antarctica: pedogenesis, vegetation and carbon studies. Soil Science Society of America Journal, 70(1): 1370-76. Mudge, S. M. & Norris, C. E. (1997). Lipid biomarkers in the Conwy Estuary (North Wales, U. K.): a comparison between fatty alcohols and sterols. Marine Chemistry, 57(1-2): 61-84. Nishimura M. & Koyama T. (1977). The occurrence of stanols in various living organisms and the behaviour of sterols in contemporary sediments. Geochimica et Cosmochimica Acta, 41(1): 379-385. Pinturier-Geiss, L.; Mejanelle, L.; Dale, B. & Karlsen, D.A. (2002). Lipids as indicators of eutrophication in marine coastal sediments. Journal of Microbiological Methods, 48(2): 239-57. Robinson, N.; Cranwell, P.A.; Finlay, B.J. & Eglinton, G. (1984). Lipids of aquatic organisms as potential contributors to lacustrine sediments. Organic Geochemistry, 6(2): 143-52. Sander, M.; Balbão, T.C.; Costa, E. S.; Santos, C. R. & Petry, M. R (2007). Decline of the breeding population of Pygoscelis Antarctica and Pygoscelis adeliae on Penguin Island, South Shetland, Antarctica. Polar Biology. 30(5): 651-4. Shanchun, J.; O’Leary, T.; Volkman, J.K.; Huizhi, Z.; Rongfen, J.; Suhua, Y.; Yan, W.; Zuofeng, L.; Zuoqing, S.; Ronghua, J. (1994). Origins and simulated thermal alteration of sterols and keto-alcohols in deep-sea marine sediments of the Okinawa Trough. Organic Geochemistry, 21(3-4): 415-22.
160
| Annual Activity Report 2010
Ternois, Y.; Sicre, M.A.; Boireau, A.; Beaufort, L.; Miquel, J.C. & Catherine, J. (1998). Hydrocarbons, sterols and alkenones in sinking particles in the Indian Ocean sector of the Southern Ocean. Organic Geochemistry, 28(7-8): 489-501. Villinski, J. C.; Hayes, J. M.; Brassell, S. C.; Riggert, V. L. & Dunbar, R. B. (2008). Sedimentary sterols as biogeochemical indicators in the Southern Ocean. Organic Geochemistry, 39(5): 567-88. Volkman, J.K.; Farrington, J.W. & Gagosian, R.B. (1987). Marine and terrigenous lipids in coastal sediments from the Peru upwelling region at 15ยบS: Sterols and triterpane alcohols. Organic Geochemistry, 11(6): 463-77. Wakeham, S.G. & Canuel, E.A. (2006). Degradation and Preservation of Organic Matter in Marine Sediments. Environmental Chemistry, 2(Part-N): 295-321. Zhu, R.; Liu, Y.; Ma, E.; Sun, J.; Xu, H. & Sun, L. (2009). Nutrient compositions and potential greenhouse gas production in penguin guano, ornithogenic soils and seal colony soils in coastal Antarctica. Antarctic Science 21(5): 427-38.
Science Highlights - Thematic Area 3 |
161
11 OCCURRENCE OF MICROBIAL FAECAL POLLUTION INDICATORS IN SEDIMENT AND WATER SAMPLES AT ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA Cristina Rossi Nakayama2, Priscila Ikeda Ushimaru1, Daniela Vilela Lima1, Vivian Helena Pellizari1,* 2
1 Laboratório de Ecologia Microbiana, Instituto Oceanográfico, Universidade de São Paulo – IOUSP, São Paulo, SP, Brazil Instituto de Ciências Ambientais, Químicas e Farmacêuticas, Universidade Federal de São Paulo – UNIFESP, Diadema, SP, Brazil
*e-mail: vivianp@usp.br
Abstract: Assessment of microbial faecal indicators was carried out in water and sediment samples of Admiralty Bay. Quantification of total coliforms, Escherichia coli, sulphite reducing clostridia and Clostridium perfringens was performed through the most probable number technique (MPN) using selective or differential media. Total coliforms were found in all sediment samples, but results may be due to false positive results as a consequence of adaptations in the method to increase its sensitivity. In water, positive results were found in EACF (CF) in all samples along the water column, and in one replicate from Botany Point, Thomas Point and Arctowski. E.coli results were positive only in CF sediment samples and in one Refuge 2 replicate, no E.coli was detected in water. The group of sulphide reducing clostridia showed to be widespread in Martel inlet and was also detected in Refuge 2, suggesting a possible influence of animal faeces in addition to human contribution. C. perfringens was detected in higher numbers in CF and Ullmann Point samples, but positive results were also observed at the other sites. The count values were variable between replicates, but results suggest that contamination in the CF area may persist to a small extent. Analysis of the microbial indicators in samples as animal faeces and a new assessment of the wastewater treatment system are necessary to provide lacking complementary information. Keywords: microbial faecal indicator, coliforms, clostridia, water, sediment
Introduction
162
Traditionally, the determination of faecal coliforms has been
gastrointestinal tract of warm-blooded animals and are
used to study the pollution caused by sewage discharge,
more resistant to stressful environmental conditions and
due to the specificity of the group and the presence of
anoxic conditions in sediments. In general, coliforms
high densities of coliform cells in wastewater. However,
and E. coli are indicative of recent contamination and
the coliforms do not survive long periods under stress
Clostridium perfringens indicates remote contamination
in the environment and are less resistant to temperature
(CETESB, 1978). Examples of other Antarctic Stations that
variations and disinfection processes than some pathogenic
assessed faecal indicator microorganisms include the Italian
microorganisms. For this reason, the quantification
Base at Terra Nova Bay, in Ross Sea (Bruni et al., 1997) and
of sulphite reducing clostridia (especially Clostridium
the American MacMurdo Station (Lisle et al., 2004). Both
perfringens) has been used as an auxiliary analysis, since
studies were able to detect faecal contamination in areas near
these microorganisms are frequently associated to the
sewage discharge using coliform analysis, and at MacMurdo
| Annual Activity Report 2010
C. perfringens were detected in areas at longer distances from
stored in sterile whirl pack bags until use. Samples from
the sewage source. Lisle et al. (2004) also quantified these
all sites and replicates were analysed for coliforms. As
groups in seal faeces, highlighting that animal source must
for Clostridia, analysis of all replicates was carried out
also be considered.
at both sites 1 and 2 at EACF and Botany Point and at
The present study illustrates the results of faecal pollution indicators from water and sediment collected in the XXVIII Brazilian Antarctic Expedition 2009/2010 through comparison with preterit data obtained in previous studies.
site 1 at Ulmann Point. Ulmann Point site 2 and Refuge 2 sites 1 and 2 had one triplicate screened only.
Microbiological analysis The quantification of coliform and clostridia groups in water and sediment samples was carried out using the
Material and Methods
Most Probable Number (MPN) technique (APHA, 1995).
Sampling and sample processing
the medium Colilert® (IDEXX), which allows the detection
Coliform and Escherichia coli analysis was performed in
Water sampling was carried out in February 2010, in
of total coliform growth by yellow colour production and
five stations at the 30 m isobaths (Table 1). Samples were
E.coli by fluorescence production under UV light. Clostridia
collected along the water column at the surface, in the
were cultivated in media DRCM (differential reinforced
middle and at 1m from the bottom, as determined by an
clostridial medium) and the presence of C. perfringens
ecobathymeter Vexilar mod LPS-1. The samples were stored
confirmed by growth in Litmus Milk.
in borosilicate glass bottles until analysis, which took place in a maximum period of 24 hours after sampling. Samples from all sites and depths were analysed for coliforms. In the
Results and Discussion
case of clostridia, only surface samples were analysed, with
Total coliforms and E. coli
exception of CF samples, which received all depth screening.
All sediment samples presented positive counts for
Sediment sampling was carried out in February-March
total coliforms (Figure 1), with higher values of about
2010, at four sites: EACF, and the reference sites Botany
2.5 × 104 MPN/100 mL being found in CF and BP. These
Point, Ulmann Point and Refuge 2. For each site, two areas
results contrast with previous analysis, in which no
200 m distant from each other were sampled in triplicate
coliforms were detected in the reference areas. However,
at 20 to 30 m depth (Table 2). The areas selected in CF are
adaptations were made in the sample dilution procedure,
related to potential pollution sources (the oil tank and the
based on the protocol adopted by the São Paulo State
sewage outlet).
environmental agency (CETESB) for multiple tubes
Sediment from the 10 cm top layer was collected
technique using Lactose Broth, and this change may have
aseptically using 60 mL adapted disposable syringes and
increased the probability of occurring false positives, due to
Table 1. Location of water sampling sites in Admiralty Bay.
Station
Name
Latitude (S)
Longitude (W)
Location
1
Ferraz (CF)
62° 05,216'
058° 23,175'
Martel inlet
2
Botany Point (BP)
62° 05,910'
058° 20,304'
Martel inlet
3
Machu Picchu (MP)
62° 05,357'
058° 27,558'
Mackellar inlet
4
Point Thomas (PT)
62° 09,275'
058° 29,180'
Ezcurra inlet
5
Arctowski (AR)
62° 09,272'
058° 27,631'
Admiralty Bay western shore
Science Highlights - Thematic Area 3 |
163
Table 2. Location and depth of sediment sampling sites in Admiralty Bay.
Site 1
Ferraz (CF)
Botany Point (BP)
Ullman Point (PU)
Refuge 2 (RF)
CF1 (oil tank)
BP1
PU1
RF1
Location
Depth (m)
Location
Depth (m)
Location
Depth (m)
Location
Depth (m)
1
62° 05.131' S 058° 23.369' W
24,0
62° 05.701' S 58° 19.849' W
27,0
62° 05.015' S 58° 20.987' W
21,0
62° 04.21' S 58° 25.19' W
26,4
2
62° 05.142' S 58° 23.370' W
26,5
62° 05.713' S 58° 19.844' W
27,3
62° 05.015' S 58° 20.987' W
21,0
62° 04.373' S 58° 25.335' W
26,0
3
62° 05.130' S 058° 23.356' W
22,8
62° 05.734' S 58° 19.919' W
26,0
62° 05.015' S 58° 20.987' W
21,6
62° 04.373' S 58° 25.335' W
21,0
Site 2
CF2 (sewage)
BP2
PU2
RF2
Location
Depth (m)
Location
Depth (m)
Location
Depth (m)
Location
Depth (m)
1
62° 05.050' S 58° 23.195' W
28,0
62° 05.181' S 58° 20.182' W
24,0
62° 05.038' S 58° 21.055' W
29,0
62° 04.1' S 58° 25.19' W
21.0-27.0
2
62° 05.049' S 58° 23.195' W
27,0
62° 05.48' S 58° 20.10' W
26,0
62° 05.133' S 58° 21.317' W
28,0
62° 04.18' S 58° 25.19' W
25,0
3
62° 05.130' S 58° 23.356' W
27,0
62° 05.48' S 58° 20.10' W
26,0
62° 05.133' S 58° 21.317' W
27,6
62° 04.1' S 58° 25.19' W
29,0
a
b
Figure 1. Most probable number counts of total coliforms (a) and E.coli (b) in sediment samples of Admiralty Bay. CF: EACF; BP: Botany Point; PU: Ulmann Point; RF: Refuge 2.
164
the characteristics of Colilert® medium used in this work. A
all CF samples along the water column (with values ranging
higher occurrence of false positives in marine samples when
from 13 to 240 MPN/100 mL), in the bottom sample of BP
using the Colilert® medium was observed by Pisciotta et al.
and PT (13 and 2 MPN/100 mL, respectively) and at AT,
(2002), and it is suggested that higher dilutions be used
in the middle water column sample (240 MPN/100 mL).
in order to avoid this bias. In water samples, this massive
These results may be also related to the contribution of other
detection did not occur, but total coliforms were detected in
warm-blooded animals’ faeces.
| Annual Activity Report 2010
Clostridium perfringens
a
1.60E+005
800
1.40E+005
700
1.20E+005
600
1.00E+005 8.00E+004 6.00E+004
500 400 300
4.00E+004
200
2.00E+004
100
0.00E+000
1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 2 CF1
CF2
BT1
BT2
PU1
b
0
1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 2 CF1
CF2
BT1
BT2
PU1
PU2 RF1 RF2
NMP/100 mL
900
PU2 RF1 RF2
NMP/100 mL
Sulphite reducing clostridia 1.80E+005
Figure 2. Most probable number counts of sulphite reducing clostridia (a) and C.perfringens (b) in sediment samples of Admiralty Bay. CF: EACF; BT: Botany Point; PU: Ullmann Point; RF: Refuge 2.
In contrast to total coliform results, E. coli analysis in
detected in RF site. Values of C. perfringens in CF sites
sediment were positive only in two out of three samples
ranged from 20 to 790 MPN/100 mL, but counts did not
in CF1 (oil tank, with values of 18 and 20 MPN/100 mL)
exceed the values observed previously (800 MPN/100 mL,
site, in 1 out of 3 samples in CF2 (18 MPN/100 mL), and
as described in Montone et al., 2006). No clostridia were
in 1 of 3 samples of RF (18 MPN/100 mL) (Figure 1). No
detected in water samples.
E. coli was detected in water samples. The values obtained
The results obtained indicate a widespread presence of
for sediment are lower than the values observed in previous
clostridia in Martel inlet sediment, a behaviour that was
analysis, which revealed counts of up to 790 MPN/100 mL
also observed in previous studies. The highest values were
at the CF2 at 20 m (Montone et al., 2006). As the presence
found at CF sites, but as it is a long term indicator, these
of coliforms is an indicative of recent contamination, this fluctuation may be related to variations in the sewage distribution due to differences in hydrodynamic circulation or even a reduction of the contamination previously detected in the area. Linking up of these results with other parameters is necessary to better analyse the data obtained. Detection of E. coli in one RF sample may also indicate influence of animal faeces.
results may reflect the influence not only of human activities but also of animal faeces. High variability between counts of replicates also suggests heterogeneity in the distribution of the cells in the sediment.
Conclusions The data generated in this study showed high variability of counts between replicates. The detection of higher values
Sulphite reducing clostridia and C. perfringens
of E. coli and C. perfringens in CF samples suggest that
Both sulphite reducing clostridia and C. perfringens were
contamination in the station area may persist as an impact
detected in all sediment samples analysed (Figure 2).
of small magnitude, and has not increased when comparing
Although values varied considerably, no pattern of
present data to previous results. Total coliform analysis may
distribution was observed in Martel inlet, regarding sulphite
have been subjected to a method bias and future analysis
reducing clostridia, but CF and PU were the sites with the
shall consider the use of higher sample dilutions in order to
highest counts of C. perfringens. Low counts were also
avoid false positive results. Sulphite reducing clostridia was
Science Highlights - Thematic Area 3 |
165
found to be widespread in Martel inlet, possibly reflecting the influence of animal faeces. Data obtained shall be
Acknowledgements This Project integrates the INCT-APA (Instituto Nacional de
integrated to parameters in order to evaluate the efficiency of
Ciência e Tecnologia Antártico de Pesquisas Ambientais),
the indicators in detecting possible changes under Antarctic
and is supported by CNPq (574018/2008-5) and FAPERJ
conditions or in the scale of impact observed in EACF
(E-16/170.023/2008). The authors also acknowledge
area. Also, analysis of microbial indicators in other kinds
the Brazilian Ministries of Environment (MMA) and
of samples, such as animal faeces, and a new assessment of
Science and Technology (MCT), and the Inter-Ministry
the wastewater treatment system are proposed in order to
Commission for Sea Resources (CIRM).
obtain complementary important information.
References APHA; AWWA; WEF (1995). Standard methods for the examination of water and wastewater 19th edition. Washington DC: APHA. Bruni, V.; Maugeri, T.L. & Monticelli, L. (1997). Faecal pollution indicators in the Terra Nova Bay (Ross Sea, Antarctica). Marine Pollution Bulletin, 34(11): 908-12. CETESB - Companhia de Tecnologia de Saneamento Ambiental. (1978). NT-08 Análises microbiológicas de águas. São Paulo. Lisle, J.T.; Smith, J.J.; Edwards, D.D. & McFeters, G.A. (2004). Occurrence of microbial indicators and Clostridium perfringens in wastewater, water column samples, sediments, drinking water, and Weddell Seal feces collected at McMurdo Station, Antarctica. Applied and Environmental, 70 (12): 7269-76. Montone, R.C.; Pellizari, V.H.; Corbisier, T.N.; Mahiques, M.M.; Pereira, A.B.; Schaefer, C.E.; Alvarez, C.E.; Sander, M.; Bícego, M.C.; Saraiva, E.S.B.G.; Campos, L.S.; Dani, N.; Castro Filho, B.M.; Ngan, P.V.; Ito, R.G. & Weber, R. (2006). Rede 2: Gerenciamento Ambiental na Baía do Almirantado, Ilha Rei George, Antártica. Technical report. Pisciotta, J.M.; Rath, D.F.; Stanek, P.A.; Flanery, D.M. & Harwood, V.J. (2002). Marine bacteria cause false-positive results in the Colilert-18 rapid identification test for Escherichia coli in Florida waters. Applied and Environmental, 68 (2): 539-44.
166
| Annual Activity Report 2010
12 ASPECTS OF POPULATION STRUCTURE OF Nacella concinna (Strebel, 1908) (GASTROPODA – NACELLIDAE) AT ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA Maria Isabel Sarvat de Figueiredo1,*, Helena Passeri Lavrado1 1
Laboratório de Benthos, Departamento de Biologia Marinha, Instituto de Biologia, Universidade Federal do Rio de Janeiro –UFRJ, Ilha do Fundão, RJ, Brazil *e-mail: belfig@gmail.com
Abstract: Antarctic intertidal zones are extremely stressful environments, and the Antarctic limpet Nacella concinna is one of the most conspicuous components of the megafauna, colonizing these areas at Admiralty Bay. This species has the potential to be a biomonitor, since it suffers the direct effects of environmental variations and anthropic impacts. In the summer 2010, specimens of N. concinna were collected at 6 sites in Admiralty Bay, in order to investigate population variability. Most individuals were larger than 20 mm, with positive allometric growth. Females were smaller and usually outnumbered males in the population. The preliminary results showed that limpets near the Brazilian station did not present any atypical values, so it seems that human activities do not significantly affect the population structure. Differences found should be considered a response to natural physical or biological factors. Keywords: Nacella concinna, population structure, Admiralty Bay
Introduction Antarctic intertidal zone is extremely stressful, since it
(Favero et al., 1997), this gastropod represents an important
is often subject to large environmental variation, such as
link between marine and terrestrial ecosystems.
freezing and ice foot in winter, and melt water runoff in
Although several studies of Admiralty Bay benthos
summer (Weihe & Abele, 2008). The gastropod Nacella
(Sicinski et al., 2010), have been carried out in the past
concinna (Strebel, 1908) (Figure 1), is the most conspicuous
30 years, the knowledge about benthic ecology is still
invertebrate of the intertidal megafauna (Kim, 2001),
incipient, especially concerning the mollusk Nacella
colonizing throughout most of the intertidal zone of
concinna. Recent studies have been focused on physiological
Admiralty Bay. This species is physiologically sensitive to
and biochemical processes, as well as on the phylogeny of the
freshwater, high temperatures and long aerial exposures
species (Nakano & Ozawa, 2007). However, the knowledge
(Weihe & Abele, 2008), suffering the direct effects of
about population dynamics is fundamental to understand
environmental variations or anthropic impacts. In addition,
the ecosystem processes (Jones et al., 2007) and to evaluate
as one of the largest herbivorous (Kim, 2001), and the main
the meaning of environmental changes, increasingly evident
prey of kelp gull Larus dominicanus Lichtenstein, 1823
in the Southern Ocean.
Science Highlights - Thematic Area 3 |
167
from both (Figure 2), where specimens of N. concinna were counted in transects parallel to the shore at low tide. Limpets were collected until the number of individuals reached at least 100 at each site, and they were fixed in 10% formaldehyde. The sex of each individual was determined, shell length was measured with a digital calliper (0.01 mm precision) and each individual was weighed. To detect significant differences (p < 0.05) in population mean size and weight among different sites, a one-way Figure 1. Gastropod Nacella concinna collected at Admiralty Bay, Antarctica.
ANOVA was used. Homogeneity of variances was checked by Cochran’s test, and data was log-transformed whenever necessary. Shell length (SL) and wet weight (W) were used
This research study aims to characterise of the population structure of N. concinna in Admiralty Bay, as well as to establish the degree of population variability. It will provide a baseline study for the region, considered as an Antarctic Specially Managed Area - ASMA.
Material and Methods From January 2009 to February 2010, 5 sites were chosen
to plot regression curves (W = a.SLb). To verify differences in sex ratio, Chi-Square test was performed, and Student’s t-test was used for differences in size and weight between males and females.
Results The mean size of Nacella concinna significantly varied among sites (F = 78.93 ; p < 0.0001). The smallest individuals (14.33 mm) occurred at Refúgio I (site 3), and the largest
in Admiralty Bay, encompassing areas under the influence
ones (46.41 mm) at Punta Plaza (site 1) (Table 1). In
of ice, anthropic activities (Brazilian Station), and far
summer, specimens showed positive allometric growth
Figure 2. Admiralty Bay, Antarctica. In zoom, Mackellar Inlet (MKI) and Martel Inlet (MTI) with the sampling sites: 1) Punta Plaza; 2) EACF; 3) Refúgio I; 4) Refúgio II; 5) Botany Point.
168
| Annual Activity Report 2010
Table 1. Shell length and sex ratio of individuals of N. concinna collected in the intertidal zone of Admiralty Bay in the summer, 2009/2010. Different letters indicate statistically different means, from post hoc test in ANOVA results.
Sites
n (total)
Mean (mm)
SE
Min
Max
Sex ratio (F/M)
ChiSquare
p
1
71
36.66a
0.40
30.24
46.41
1.74
3.769
0.052
2
74
30.01
0.059
3 4
0.47
17.93
40.82
1.57
3.556
103
c
26.30
0.36
14.33
33.55
0.96
0.044
0.833
95
32.31d
0.59
19.54
45.03
1.74
6.720
0.009*
5
102
34.37e
0.38
24.20
43.74
1.83
8.824
0.003*
Total
445
-
-
-
-
1.51
16.844
< 0.0001*
b
Obs: *Denotes significance p < 0.05.
(W = 2∙10–5SL3,6268; R2=0.96). Females usually outnumbered
habitats for optimizing reproductive success. Also, in the
males in the population, the sex ratio being, 1:1.51
Maxwell Bay population, similar to Admiralty Bay, females
(male:female), which is significantly different from 1:l
were smaller than males. According to Kim (2001), since the
(χ2 = 16.844; p < 0.0001) (Table 1). Furthermore, mean shell
large females appear to put more effort into reproduction
size of male limpets (35.38 mm ± 4.28 SE) was significantly
than males under food-limited conditions, the former may
higher than those of females (33.82 mm ± 3.42 SE) at site 5 (t = –2.008; p < 0.047). Site 2, where the Brazilian station is located, did not show either abnormal or discrepant values for all the parameters analyzed, being within the range found for all the sites analyzed.
Discussion Environmental stress may be the most feasible explanation for the scarceness of limpets with shell size smaller than 20 mm in the population. Small specimens have high surface-to-volume ratios, being unable to tolerate desiccation conditions, thermal stress and osmotic stress (Kim, 2001; Weihe & Abele, 2008). So, at the intertidal limit, small limpets are at a disadvantage if compared to the large ones, probably being restricted to lower intertidal levels, or to the sublittoral zone. Kim (2001) also found more females
result in a higher mortality of the females and may lead to a decrease in the proportion of large females in N. concinna population. Finally, positive allometric growth found in the population of this study can be a result of the probable high gonad weight, since summer is a reproductive period of this species (Stanwell-Smith & Clarke, 1998).
Conclusion Our results suggest that the presence of the Brazilian Station does not interfere in the N. concinna population. The differences found between sites seem to be related to natural dynamics of the species as well as a response to physical stress and natural variations in the intertidal zone.
than males in the population of Maxwell Bay, adjacent to
Acknowledgements
Admiralty Bay. This author suggests that, in the case of
This work was supported by the Brazilian Antarctic
N. concinna, the dominance of females in the intertidal
Program (PROANTAR), and INCT-APA (CNPq process
population may be explained by the migratory behaviour.
n° 574018/2008-5 and FAPERJ process n° E-16/170.023/2008)
The bias toward females of the species for intertidal
and SECIRM. Maria Isabel Figueiredo thanks to CNPq for
N. concinna may be a local adaptation to heterogeneous
the master fellowship under the process n° 132125/2010-2.
Science Highlights - Thematic Area 3 |
169
References Favero, M.; Silva, P. & Ferreyra, G. (1997). Trophic relationships between the kelp gull and the Antarctic limpet at King George Island (South Shetland Islands, Antarctica) during the breeding season. Polar Biology, 17(5): 431-6. Jones, D.O.B.; Bett, B.J. & Tyler, P.A. (2007). Depth-related changes to density, diversity and structure of benthic megafaunal assemblages in the Fimbul ice shelf region, Weddell Sea, Antarctica. Polar Biology, 30(12): 1579-92. Kim, J. (2001). Seasonality of marine algae and grazers of an Antarctic rocky intertidal, with emphasis on the role of the limpet Nacella concinna Strebel (Gastropoda: Patellidae). PhD Thesis in Biology/Chemistry. Bremen University. Nakano, T. & Ozawa, T. (2007). World wide phylogeography of limpets of the order Patellogastropoda: molecular, morphological and paleontological evidence. Journal of Molluscan Studies, 73(1): 79-99. Sicinski, J.; Jazdzewski, K.; Broyer, C.; Presler, P.; Ligowski, R.; Nonato, E.F.; Corbisier, T.N.; Petti, M.A.V.; Brito, T.A.S.; Lavrado, H.P.; Paszkowycz, M.B.; Pabis, K.; Jazdzewska, A. & Campos, L.S. (2010). Admiralty Bay Benthos Diversity - A census of a complex polar ecosystem. Deep-Sea Research II, 58(1-2): 30-48. Stanwell-Smith, D. & Clarke, A. (1998). The timing of reproduction in the Antarctic limpet Nacella concinna (Strebel, 1908) (Patellidae) at Signy Island, in relation to environmental variables. Journal of Molluscan Studies, 64 (1):123-7. Weihe, E. & Abele, D. (2008). Differences in the physiological response of inter- and subtidal Antarctic limpets Nacella concinna to aerial exposure. Aquatic Biology, 4: 155-66.
170
| Annual Activity Report 2010
13 MONITORING THE IMPACT OF HUMAN ACTIVITIES IN ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA: PRELIMINARY RESULTS OF THE MEIOFAUNA COMMUNITY Thaïs Navajas Corbisier1,*, Paula Foltran Gheller1, Maria Claúdia Yuri Ujikawa1, Sandra Bromberg1, Mônica A. Varella Petti1 Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil
1
*e-mail: tncorbis@usp.br
Abstract: Meiofauna is a component of the marine benthos widely used in environmental impact studies, especially in coastal areas. A monitoring program of Admiralty Bay has been underway since 2008 (INCT-APA/CNPq), and in the summer of 2010, the meiofauna and the phytodetritus were sampled at two sites in three areas of Martel Inlet (CF, UP, BP) and at one area in Mackellar Inlet (RE). Densities were in the range of those found in previous studies in the bay and did not differ significantly between the eight sampling sites. Nevertheless lower densities (<3,000 inds. 4.9 cm2) were found at one site in front of the Brazilian Station (CF1), under the influence of the sewage outfall, and at other three sites. Higher densities (>5,000 inds. 4.9 cm2) were found at Ullmann Point (UP) and at one site in Botany Point (BP1). Nematodes were the dominant meiofauna group. A change in the meiobenthic community structure was detected at the site under the sewage outfall influence (CF1: low density, different composition), suggesting some influence of human activities on the benthic system in front of the Brazilian Station. Keywords: meiofauna, monitoring, human impact, Admiralty Bay
Introduction A joint project carried out some years ago (Weber & Montone,
especially concerning the sewage outfall (Martins et al.,
2006) permitted a preliminary characterization of Admiralty
2005; Bícego et al., 2009).
Bay marine environment. The influence of sewage and of
Benthic meiofauna is a component of the marine biota
the aliphatic hydrocarbons (AHs) and polycyclic aromatic
widely used in environmental impact studies, especially
hydrocarbons was observed only in Martel Inlet in the proximity of the Brazilian station (EACF) sewage outfall within a distance of 200 m in the water column and of 400 m (human sterols) and 700 m (hydrocarbons) in the sediment. Nonetheless, the dispersion of the sewage plume in the shallow coastal zone of Martel Inlet is favoured by the hydrodynamics, especially influenced by the effect of tides.
in coastal areas. Due to its characteristics, such as small size, limited mobility, short life cycle lived entirely in the sediment, reproductive strategy without a larval dispersion phase, and close association with and dependence on the marine bottom (sediment and interstitial water), this community has been widely used for environmental monitoring (Coull & Chandler, 1992; Schratzberger et al., 2000).
As a result, the contamination in Admiralty Bay is assumed
Previous meiofauna samplings, including measures of
to be punctual and restricted to the proximities of the EACF,
microphytobenthic biomass, were done at 15-20 m depth
Science Highlights - Thematic Area 3 |
171
in seven areas of Martel Inlet, Admiralty Bay, during two
previous studies. Results showed no significant differences
consecutive summers (1996/97 and 1997/98) and revealed
in composition and abundance of meiofauna between the
that high densities are characteristic of this whole inlet,
two sampling areas, which suggested no anthropogenic
varying between 1,952 ± 326 and 6,738 ± 1542 ind.10 cm ,
impact near the Brazilian Station.
–2
and were correlated with the percentage of gravel, silt and
A continuous monitoring program has been established
clay (Skowronski & Corbisier, 2002). In both summers,
since 2008 (INCT-APA), and in the summer of 2010, the
the areas with the highest densities were in front of the
meiofauna and the microphytobenthos, among other
Brazilian Station (CF) and Ullman Point (UP), and also
variables, were sampled at three sites in Martel Inlet (CF,
Hennequin Point (HP) in the first summer (1996/97),
UP, BP) and at one site in Mackellar Inlet (RE) in order to
and Plaza Point (PP) in the second (1997/98). There was
verify the environmental status of the area in front of the
no significant difference in the densities between the two
Brazilian Station (CF) in comparison to reference areas.
summers, although the higher microphytobenthic biomass, the potential food for the meiofauna, was found in the first
Material and Methods
summer.
Samplings were done at 20-30 m depth in four areas of
A meiofauna study was also undertaken in the
Admiralty Bay, during February 2010 (Figure 1). In each
summer of 2004/2005, at 20-30 m depth, and aimed to
area, two sites (200 m distant) were sampled with a 0.04 m2
verify possible impacts due to the Brazilian activities,
mini box-corer in triplicate. From each box corer one
comparing CF with a reference area (Botany Point - BP)
meiofauna sample was obtained from the sediment with
(Gheller, 2007). Mean densities varied from 7,028 ± 1,529
a cylindrical copper corer (area of 4.9 cm²), sectioned
to 16,245 ± 12,282 ind. 10 cm–2 a wider range than that from
into 2 cm layers up to 10 cm, and formalin preserved. In
Figure 1. Admiralty Bay and the sampling sites (Google Earth, 2011).
172
| Annual Activity Report 2010
the laboratory, samples were stained with rose bengal and
at UP2 (Figure 2). Mean densities were lower than 3,000 ind.
washed through 0.5 mm and 0.063 mm meshes. Animals
4.9 cm–2 at CF1, BP2, RF1 and RF2, but these were not
between these sieves were sorted to higher taxonomic
significantly different from those at the other four points
groups and counted. The first two layers of the sediment
(mean densities > 5,000 ind. 4.9 cm–2) (H = 133.2, p = 0.065).
(0 to 4 cm) were sorted up to date. Sediment samples for
The meiofauna density presented positive correlation with
grain size, phytopigments biomass (0-1 cm), and organic
the sediment organic matter (p < 0.05), and not with the
matter and hydrocarbon analysis were also obtained from
chlorophyll-a and phaeopigment biomasses. Nematodes were dominant, representing between 79%
each box corer. The mean meiofauna density and standard-deviation of
and 99% of the total meiofauna (Figure 3). In RF Polychaeta
the replicates from 0-4 cm of the sediment were calculated
(6%), Nauplii (5%) and Copepoda (3%) showed higher
for each site. Significant differences were investigated using
representation than at the other points. In CF1, under the
the Kruskal-Wallis test (p < 0.05). Spearman rank was
sewage outfall influence, the dominance of Nematodes was
applied to search for correlation between meiofauna density
higher, and other taxa were nearly absent.
and phytopigments biomass and organic matter percentage
In the nMDS analysis considering the main meiofauna
(BioEstat v.4). An ordination nMDS analysis was done
groups, CF1 and RF (1 and 2) were separated from the other
considering the main meiofauna taxonomic groups at the
sampling sites (Figure 4).
eight sampling sites (Primer v6).
Discussion
Results
Densities were high and in the range of those observed in
A total of 103,557 meiofaunal organisms were recorded
previous studies in Admiralty Bay (Skowronski et al., 1998;
in the first layers of sediment. The densities ranged from
Skowronski & Corbisier, 2002; Gheller, 2007). A higher mean
972 ± 317 (mean± SD) at RF1 to 8,166 ± 5,612 ind.4.9 cm
density was observed in UP (around 16,000 ind. 10 cm–2), in
–2
Figure 2. Meiofauna density (mean + standard deviation) at each sampling site at the four studied areas in Admiralty Bay.
Science Highlights - Thematic Area 3 |
173
Figure 3. Relative percentage of meiofauna taxa at each sampling site at the four studied areas in Admiralty Bay.
2,701 and 1,983 ind. 10 cm–2, respectively. Regarding CF1, under the sewage outfall influence, previous mean densities (Skowronski & Corbisier, 2002; Gheller, 2007) were two to four times higher than that found in the present study. On the other hand, at CF2, in front of the oil tanks, the mean density was high (around 12,000 ind. 10 cm–2) and similar to that found in the summer of 2004 (Gheller, 2007). Sediment features and availability of microphytobenthos/ phytodetritus, as a potential food source, are important factors determining the meiofauna distribution in Antarctic seas (Vanhove et al., 1998; Skowronski & Corbisier, 2002). Both chlorophyll-a and phaeopigment biomasses did not Figure 4. nMDS display of the sampling sites at the four studied areas in Admiralty Bay.
the range of densities found in the beginning of the summer
174
correlate to meiofauna density, although sediment organic matter percentage did. It was not possible to relate those differences to sediment grain size and contaminants, which results are not available yet.
of 2004 in CF and BP (Gheller, 2007). CF1, BP2, RF1 and
The fact that a difference in the meiobenthic
RF2 had lower meiofauna densities (less than 6,000 ind.
community structure in CF1 (lower density and distinct
10 cm–2), especially CF1 and RF1 with mean densities of
meiofauna composition) was detected, suggests that some
| Annual Activity Report 2010
impact due to human activities at this site in front of the
Acknowledgements
Brazilian Station is possible, although of small magnitude
Sponsorship from Instituto Nacional de Ciência e Tecnologia
and range in the benthic system. Additional studies on the
Antártico de Pesquisas Ambientais (CNPq process
benthic community (mega and macrofauna) and other
574018/2008-5 and FAPERJ process E-26/170.023/2008),
biotic and abiotic components of the bay will contribute
Ministério do Meio Ambiente (MMA), Ministério de
to a better understand of the real antropogenic influence
Ciência e Tecnologia (MCT) and Comissão Interministerial
in the area.
para Recursos do Mar (CIRM).
References Bícego, M.C.; Zanardi,-Lamardo, E.; Taniguchi, S.; Martins, C.C.; Silva, D.A.M.; Sasaki, S.T.; Albergaria-Barbosa, A.C.R.; Paolo, F.S.; Weber, R.R. & Montone, R.C. (2009). Results from a 15-year study on hydrocarbon concentrations in water and sediment from Admiralty Bay, King George Island, Antarctica. Antarctic Science, 21(3): 209-20. Coull, B.C. & Chandler, G.T. (1992). Pollution and meiofauna: field, laboratory, and mesocosm studies. Oceanography and Marine Biology: An Annual Review, 30: 191-271. Gheller, P.F. (2007). A meiofauna e os Nematoda da enseada Martel (Antártica) e seu uso em monitoramento ambiental. Dissertação de Mestrado. Universidade de São Paulo, Instituto Oceanográfico, 103 p. Google Earth 6.0.3 (2011). Available from: <http://www.gogle.com.br/intl/pt-BR/earth/index.html.> Martins, C.C.; Montone, R.C.; Gamba, R.C. & Pellizari, V.H. (2005). Sterols and fecal indicator microorganisms in sediments from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1-2): 1-12. Schratzberger, M; Gee, J.M; Rees, H.L; Boyd, S.E. & Wall, C.M. (2000). The structure and taxonomic composition of sublittoral meiofauna assemblages as an indicator of the status of marine environments. Journal of the Marine Biological Association of the United Kingdom, 80(6): 969-80. Skowronski, R.S.P.; Corbisier, T.N. & Robles, F.R. (1998). Meiofauna along a coastal transect in Admiralty Bay, King George Island (Antarctica). Pesquisa Antártica Brasileira, 3(1): 117-31. Skowronski, R.S.P. & Corbisier, T.N. (2002). Meiofauna distribution in Martel Inlet, King George Island (Antarctica): sediment features versus food availability. Polar Biology, 25(2): 126-34. Vanhove, S.; Beghyn, M.; Van Gansbeke, D.; Brockington, S. & Vincx, M. (1998) The metazoan meiofauna in its biogeochemical environment: the case of an antarctic coastal sediment. Journal of the Marine Biological Association of the United Kingdom, 78(2): 411-34. Weber, R. R. & Montone, R. C. (Coord.) (2006). Rede-2: Gerenciamento ambiental na Baía do Almirantado, Ilha Rei George, Antártica. Relatório final. Ministério do Meio Ambiente/ CNPq/SeCIRM/Proantar, Brasil. 255 p.
Science Highlights - Thematic Area 3 |
175
14 ROLE OF METEOROLOGICAL EVENTS ON THE MACROFAUNA COMMUNITY AND SEDIMENT COMPOSITION OF THE SHALLOW WATERS OF MARTEL INLET (ADMIRALTY BAY, ANTARCTICA) Gabriel Sousa Conzo Monteiro1,*, Mônica Angélica Varella Petti1, Maria Clara Eloed Ribeiro dos Santos¹, Beatriz Wolf Grotto¹, Paula Foltran Gheller1, Edmundo Ferraz Nonato1, Thaïs Navajas Corbisier1 Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil
1
e-mail: gabrielmonteiro@usp.br
*
Abstract: The short-term variability of the benthic macrofauna community in the shallow coastal area off the Brazilian Antarctic Station Comandante Ferraz (EACF) was investigated during the austral summer of 2008. Three replicates of sediment samples were obtained by a van Veen grab (0.0275 m²) at 20 m depth, in six periods from 1st February to 7th March. Macrofaunal densities and sediment composition varied during this period and were correlated to the wind field. Annelids (Polychaeta and Oligochaeta) were the most abundant group with density values ranging from 202 ind.0.0275m–² to 330 ind.0.0275m–² followed by Mollusca and Crustacea. The Principal Component Analysis (PCA) showed that the main sediment components that distinguish the samples were the percentage of gravel, silt and clay. These variations may be influenced by many factors and the climatic conditions play an important role in the local hydrodynamics that affect the benthic community, mainly the organisms with swimming capacity. Meteorological events may influence differently the sediment composition and the macrofauna community. Additional analysis is ongoing to better understand the short-term variability of the macrofauna, including the identification of the polychaetes. Moreover, studies concerning the local hydrodynamics and the interaction between wind, water and sediment in Admiralty Bay are needed. Keywords: macrofauna, environmental monitoring, wind field, Martel Inlet, Admiralty Bay
Introduction Admiralty Bay (King George Island) is an Antarctic Specially
of this fauna may cause misinterpretation of these results
Managed Area (ASMA) (Figure 1). It is considered a key
which are usually based on sporadic benthic sampling
site to understand the response of Antarctica to global
(Underwood, 1991). The present work is part of the
climatic change because the warming trend over the west coast of the Antarctic Peninsula is greater than over the rest of the continent (Marshall et al., 2002). Studies on benthic macrofauna have been done in this area for
176
International Polar Year (IPY) project “Marine Antarctic Biodiversity in Relation to Environmental Heterogeneity at Admiralty Bay, King George Island, and Adjacent Areas at
almost thirty years. This group is frequently used by
the Bransfield Strait” (MABIREH) and also contributes to
Antarctic environmental monitoring programs and the
the Instituto Nacional de Ciências e Tecnologia Antártico
lack of knowledge concerning the short-term variation
de Pesquisas Ambientais (INCT-APA).
| Annual Activity Report 2010
Figure 1. Admiralty Bay, King George Island, Antarctica. Circle: sampling area. Empty squares: Antarctic research stations, modules and refuges (modified from Simões et al., 2004).
Objective
Methodology
This study aims to evaluate the wind influence on the
Six samples (three replicates each) of sediment were
short-term variation of the macrofaunal community and
obtained using a van Veen grab (0.0275 m²) (Figure 2b) at
sediment composition during the austral summer of 2008
20 m depth almost weekly, from 1st February to 7th March
at the shallow coastal area, closer to the Brazilian Antarctic
2008. In laboratory, the sediment volumes were measured
Station (Figure 2a).
and then washed through sieves of 0.5 mm mesh size. The
Science Highlights - Thematic Area 3 |
177
b
a
Figure 2. a) Martel Inlet (Sampling Point (SP); meteorological station (MS)). b) Sediment sampler.
wind field was provided by the Brazilian National Institute
(removes surface water from Martel Inlet). The prevalence
of Space Research (INPE, 2009). The records of wind speed
of moderate winds at sector II during the 5th sample may
and direction were taken every three hours next to the
have generated bottom currents as a consequence of the
sampling point, reaching a total of 334 records. Kruskal-
surface currents created (Figure 3a). These currents may be
Wallis variance analysis was performed (a posteriori test
capable of resuspending the finer fractions of sediment and
Student-Newman-Keuls) to verify significant differences on macrofauna density, sediment composition and wind field. Spearman Rank Correlation was used to correlate biological and environmental variables.
Results Wind Wind records were analyzed in each period between sampling and 7 days before the first one. The main factor that creates surface currents is the moderate wind (from 4 to 10 m/s). Strong winds (more than 10 m/s) create
178
transport them to deeper areas of the inlet. The occurrence of strong winds was significantly higher (p < 0.05) at the 3rd, 4th and 5th samples (Figure 3b).
Sediment The greatest percentage of gravel was found at the end of this study, varying from 2 to 5.7% in the first four samples and from 16 to 27% in the last two. A significant decrease in the percentage of silt and clay was verified between the first three samples and the last three ones (p < 0.05) (Figure 4a). Small variations were recorded in the organic matter and calcium carbonate in the sediment during the period. The Principal Component Analysis (PCA) showed that the main
intense turbulence at the water surface which may affect the
sediment components that distinguish the samples were the
bottom surface of shallow depth (Pruszak, 1980). Moderate
percentage of gravel, silt and clay (Figure 4b). No iceberg
wind direction was classified in two sectors: i)Â Sector I
grounds were recorded at the sampling point during the
(brings surface water to Martel Inlet) and ii) Sector II
study period.
| Annual Activity Report 2010
a
b
Figure 3. a) Moderate wind direction (%) and b) Strong wind records.
a
b
Figure 4. a) Sediment fractions (%) in each sample. b) Principal Component Analysis of the sediment fractions.
Macrofauna
sample, significantly higher than the 2nd, 3rd and 5th samples
A total of 12,260 organisms were recorded, belonging to
(p < 0.05). Mollusca were represented by Gastropoda
nine taxonomical groups: Platyhelminthes, Nematoda,
and Bivalvia (the latter being 10 times more abundant
Priapulida, Nemertea, Arthropoda, Annelida, Mollusca,
than Gastropoda) with no significant variation in density
Echinodermata e Chordata. The most abundant groups
for the studied period. The main groups of crustaceans
(96% of the total) were Annelida (max. 330 ind.0.0275 m–²
were Amphipoda and Cumacea which showed similar
- min. 202 ind.0.0275 m ²), Mollusca (max. 280
densities, with a positive shift at the 3rd, 4th and 5th samples.
ind.0.0275 m–² - min. 83 ind.0.0275 m–²) and Crustacea
The Amphipoda density at the 3rd and 4th samples was
(max. 316 ind.0.0275 m–² - min. 66 ind.0.0275 m–²). Total
significantly higher than the 1st and 2nd sample (p < 0.05).
macrofauna density did not present significant variations
Benthic swimmer organisms (Amphipoda, Cumacea and
(Figure 5a). Polychaeta had their greatest density in the 6
Isopoda), showed higher densities in the 3rd, 4th and 5th
–
th
Science Highlights - Thematic Area 3 |
179
a
b
Figure 5. a) Mean density (+SD) variation of the Amphipoda and Cumacea; * and ** indicates significant differences between samples. b) Mean density (+SD) variation of the benthic swimmer organisms (Amphipoda, Cumacea and Isopoda); a and b indicate significant differences between these two groups of samples (p < 0.05).
samples in comparison to the other ones (p < 0.05) (Figure
sediment layers but not transport them. Organisms with
5b) and this variation was positively correlated (R = 0.88
great mobility in the water column may move to other areas
and p < 0.05) to the occurrence of strong winds.
while returning to the bottom while other animals and sediment fractions resuspended just sink to the same (or
Discussion Macrofaunal densities may be influenced by many factors,
effect of hydrodynamics on organisms has been documented
one of them related to the climatic conditions that play
before by some authors (Bell et al., 1997; Grant et al., 1997)
an important role in local hydrodynamics affecting the
but there are no studies for Admiralty Bay or other Antarctic
benthic community, mainly the organisms with swimming
regions concerning the hydrodynamic influence on the
capacity. The categorization of the wind data according
benthic community. We cannot state with certainty that
to intensity and direction allowed to better explain the
those events are causing the variation found on macrofauna
sediment composition and macrofauna community short-
because Antarctic benthos of shallow waters present a
term variation. Other authors have used the wind data to
remarkable patch distribution in the area (Bromberg, 2004),
interpret some biological results in the same studied area
which may interfere in the interpretation of the results. This
(Brandini & Rebello, 1994; Skowronski, 2002), but they
is a preliminary discussion since the interaction between
have not classified the wind, difficulting the detection of its
wind, water and sediment is almost unknown in Admiralty
influence on the communities. There is some evidence that
Bay. Additional studies are ongoing to better understand
two types of hydrodynamic effects generated by climatic
the short-term variation of macrofauna. The identification
conditions may result in different physical disturbance for
of Polychaeta species is being carried out. This group has
sediment and macrofauna community: i) strong turbulence
a great variability of feeding, mobility and life habits and
generated by strong winds and ii) currents generated by
further study can be helpful to better interpret the variations
intermediate winds (Pruszak, 1980). Currents seem to affect
of the whole community.
mainly the sediment by resuspending and transporting
180
nearby) area that they belonged to before the turbulence. The
fine fractions without transporting organisms that may
Conclusions
overcome the current and continue in the same place.
Significant short-term variation on the macrofauna density
Turbulence, generated by strong winds, seems to vertically
was found for some taxonomical groups, just the same
resuspend both sediment and organisms from the first
as for sediment composition and wind field for the area.
| Annual Activity Report 2010
Hydrodynamics generated by strong and moderate winds
to Environmental Heterogeneity at Admiralty Bay, King
may affect differently the macrofauna and the sediment
George Island, and Adjacent Areas at the Bransfield Strait”
composition. A long time series of meteorological data is available online and it is an important tool to comprehend the benthic ecosystem functioning in shallow waters nearby EACF. We would like to thank the International Polar Year (IPY) project “Marine Antarctic Biodiversity in Relation
(MCT/CNPq IPY52.0293/2006-1), the Instituto Nacional de Ciências e Tecnologia Antártico de Pesquisas Ambientais (CNPq 574018/2005-5 & FAPERJ E-16/170.023/2008) and the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP scholarship – 2008/55695-5).
References Bell, R.G.; Hume, T.M.; Dolphin, T.J.; Green, M.O. & Walters, R.A. (1997). Characterization of physical environmental factors on an intertidal sandflat, Manukau Harbour, New Zealand. Journal of Experimental Marine Biology and Ecology. 216: 11–31. Brandini, F.P. & Rebello, J. (1994). Wind field effect on hydrography and chlorophyll dynamics in the coastal pelagial of Admiralty Bay, King George Island, Antarctica. Antarctic Science 6: 433-42. Bromberg, S. (2004). A macrofauna bentônica da zona costeira rasa e o seu papel na trama trófica da Enseada Martel, Baía do Almirantado (Ilha Rei George, Antártica). Ênfase para o grupo Polychaeta (Annelida). Phd thesis. Universidade de São Paulo, Instituto Oceanográfico, São Paulo, SP. 240 p. Grant, J.; Turner, S.J.; Legendre, P.; Hume, T.M. & Bell, R.G. (1997). Patterns of sediment reworking and transport over small spatial scales on an intertidal sandflat, Manukau Harbour, New Zealand. Journal of Experimental Marine Biology and Ecology, 216: 33–50. INPE, 2009. <http://antartica.cptec.inpe.br/~rantar/weatherdata.shtml>. (Accessed: August 10th, 2009). Marshall, G.J. & LagunVand Lachlan-Cope, T.A. (2002). Changes in Antarctic Peninsula tropospheric temperatures from 1956 to 1999: a synthesis of observations and reanalysis data. International Journal of Climatology, 22: 291–310. Pruszak, Z. (1980). Currents circulation in the waters of Admiralty Bay. (region of Arctowski Station on King George Island). Polish Polar Research, 1(1): 55-74. Simões, J.C.; Arigony Neto, J. & Bremer, U.F. (2004). O uso de mapas antárticos em publicações. Pesquisa Antártica Brasileira, 4: 191-197. Skowronski, R.S.P. (2002). Distribuição espacial e variação temporal da meiofauna, com ênfase para o grupo Netmatoda, na enseada Martel (Antártica). Phd thesis. Universidade de São Paulo, Instituto Oceanográfico, São Paulo, SP. 134 p. Underwood, A.J. (1991). Beyond BACI: experimental designs for detecting human environmental impacts on temporal variations in natural populations. Australian Journal Marine and Freshwater Research, 42: 569-87.
Science Highlights - Thematic Area 3 |
181
15 MONITORING THE IMPACT OF HUMAN ACTIVITIES IN ADMIRALTY BAY, KING GEORGE ISLAND, ANTARCTICA: ISOTOPIC ANALYSIS OF C AND N IN THE SUMMER OF 2005/2006 Thais Navajas Corbisier1, Sandra Bromberg1, Paula F. Gheller1, Francyne E. Piera1, Mônica A. Varella Petti1 Departmento de Oceanografia Biológica, Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil.
1
*e-mail: tncorbis@usp.br
Abstract: Stable isotopic analyses have been used for assessing anthropogenic influence in marine communities. The variation of stable C and N isotope signatures in sources of organic matter and in benthic invertebrates were investigated at Martel Inlet nearshore zone, during the summer of 2005/2006, to attend a monitoring program. Water, sediment and invertebrates of different trophic types (suspensivore, depositivore, grazer and carnivore) were sampled at the intertidal and subtidal zones (up to 25 m) off the Brazilian Antarctic Station Comandante Ferraz (CF) in two periods of the summer. As a reference area, Ullmann Point (UP) was sampled in the same way. Off CF, the δ13C values for consumers ranged from –23.92 (Laternula elliptica) to –12.34‰ (Nacella concinna) in Nov/2005, and from –23.36 to –12.73‰ (L. elliptica and Yoldia eightsi, respectively) in Feb/2006. Some δ13C values were more enriched in CF in February when compared to November, mostly for POM and sediment. This result was not observed in Ullmann Point and suggested an influence of the sewage organic matter in the coastal area near the Brazilian Station, mainly at the beginning of summer. The δ15N values for sources and consumers did not differ significantly between areas or periods. Keywords: stable isotopes, trophic interactions, benthic communities, nearshore zone
Introduction Stable isotopes have been utilized to trace the transference
Eutrophication or increased load of organic matter
of organic matter of different origins along the trophic webs
in marine nearshore environments can be attributed to
(Peterson, 1999). The isotopic signatures in consumer tissues
anthropogenic inputs of sewage effluents. Stable-carbon or
are, in general, related to the isotopic composition of their
stable-nitrogen isotope analysis are also becoming useful
diet (“you are what you eat”), occurring an enrichment
to identify the source, extent and the fate of biologically
of heavy isotopes, e.g. of carbon ( C/ C) and nitrogen
available sewage carbon and nitrogen (Peterson, 1999;
( N/ N) around 1‰ and of 3-4‰, respectively, between
Costanzo et al., 2001; Waldron et al., 2001; Gartner et al.,
the consumer and its food (Peterson & Fry, 1987). The
2002; Rogers, 2003). Scientific and logistic activities in
13
15
12
14
carbon and nitrogen ratios (expressed as δ C and δ N) are
Antarctica have introduced anthropogenic compounds
generally utilized to indicate the organic matter source and
in otherwise pristine areas (Martins et al., 2005). Sewage
the δ N the trophic level, as well.
isotopic signatures of C or N have already being detected
13
15
182
| Annual Activity Report 2010
15
in sediment and in some benthic organisms near McMurdo
of Martel Inlet is favoured by the hydrodynamics, mainly
Station (Conlan et al., 2006).
influenced by the tides. As a result, the contamination in
The influence of sewage and of the aliphatic hydrocarbons
Admiralty Bay is assumed to be punctual and restricted
(AHs) and polycyclic aromatic hydrocarbons was observed
to the proximities of CF, especially concerning the sewage
only near the sewage outfall close to the Brazilian station
outlet (Martins et al., 2005; Bícego et al., 2009).
(CF). Their presence was detected within a distance of
We analyzed the variation in the isotopic signature of
200 m in the water column and of 400 m (human sterols)
benthic communities to verify if there was anthropogenic
and 700 m (hydrocarbons) in the sediment. Nonetheless, the
influence off the Antarctic Brazilian Station (sewage and
dispersion of the sewage plume in the shallow coastal zone
hydrocarbons), in Martel Inlet during the summer of
58°15’W
62°03’S
58°39’W
62°03’S
Mackellar inlet
UP CF
Mackellar inlet
58°15’W
58°39’W
Admiralty Bay
62°15’S
62°15’S
Figure 1. Admiralty Bay and the sampling areas.
Science Highlights - Thematic Area 3 |
183
Figure 2. Dispersion graphics for δ13C and δ15N values (mean ± sd) for sources and consumers at CF and UP in two summer periods (2005/2006).
184
| Annual Activity Report 2010
2005/2006. This study was part of the Network 2 program (Weber & Montone, 2006). Previous trophic web studies using stable isotopes were undertaken in this area in the summer of 1996/1997 (Corbisier et al., 2004) and in three other areas in Admiralty Bay in 2003 (Corbisier at al., personal communication).
Results Brazilian Station - CF In Nov/2005, δ13C mean values varied from –26.52 to –25.91‰ for POM, from –29.27 to –20.87‰ for sediment, –21.01‰ was the value for the algae Desmarestia sp., and for consumers they ranged from –23.92 (suspensivore bivalve Laternula elliptica) to –13.49‰ (grazer gastropod
Material and Methods Water, sediment and invertebrates of different trophic types (suspensivore, depositivore, grazer and carnivore) were sampled in the intertidal and subtidal zones (up to 25 m) off the Brazilian Station Comandante Ferraz (CF), under the sewage outfall influence area, at the beginning (Nov/2005) and at the end of the summer (Feb/2006). As a reference area, Ullmann Point (UP) was sampled in the same way (Figure 1). Samples of benthic invertebrates, macroalgae, and
Nacella concinna) (Figure 2). In Feb/2006, δ13C mean values for POM were more enriched and ranged from –23.69 to –20.59‰, for sediment from –22.09 to –20.56‰, for macroalgae from –28.33 to –14.13‰, and for consumers from –23.36 to –12.34‰ (L. elliptica and the depositivore bivalve Yoldia eightsi, respectively) (Figure 2). The δ15N mean values for POM in Nov/2005 were close to 0‰ (–1.05 and 0.68‰), whereas for sediment they varied between 0.32 and 4.71‰. The highest value was found
sediments were obtained manually in the intertidal zone
in front of the sewage outfall. For Desmarestia sp. values
and on board of the R/B SKUA, using a van Veen grab,
varied around 3.00‰ and for consumers they varied from
a dredge, or by Scuba diving. Surface water samples for
2.73 (L. elliptica) to 8.69‰ (carnivore amphipod Bovalia
suspended particulate organic matter (POM) analysis were
gigantea) (Figure 2). In Feb/2006, the POM δ15N values
obtained with bottles. Methods followed those of a previous
were also low (–4.21 to 1.94‰); for sediment the δ15N
study with the addition of the δ15N analysis (Corbisier et al.,
values ranged from 0.21 to 1.84‰, for algae between 1.07
2004). The stable isotope measurements were performed by
and 5.32‰, and from 3.31 (L. elliptica) to 8.77‰ (carnivore
the Stable Isotope Facility of the Department of Agronomy
ribbon worm Parborlasia corrugatus) for consumers
and Range Science, Davis, California, U.S., using a Europa
(Figure 2).
Hydra 20/20 isotope ratio mass spectrometer. Stable isotope
The producers and the suspensivore L. elliptica formed
ratios are expressed in δ notation as part per thousand (‰)
a group and the other consumers formed a second group
according to the following relationship:
in which there is no difference between feeding types
δX = [(Rsample/Rstandard) – 1] × 103
(1)
(Figure 2). The comparison of the δ13C data from Nov/2005 with
N/ 14 N
those from Feb/2006 suggests an enrichment of δ13C values
(Peterson & Fry, 1987). The standard reference for carbon is
in the last period. This enrichment was more notable in the
Pee Dee Belemnite (PDB) and atmospheric N2 for nitrogen.
POM (p < 0.05) and sediment (although non significant)
A cluster analysis (Euclidean Distance, average grouping
(Figure 3a). A very small variation of δ15N values was noted
method) was carried out on δ13C and δ15N mean values
between the two periods, being a little more enriched
of sources and consumers (normalized data) in order to
at the end of the summer for POM, sediment, and four
identify similar groups (Primer v6). Significant differences
consumers; nevertheless, these differences were not
were searched using the Kruskall-Wallis test (p < 0.05).
significant (p < 0,05).
where X =
13
C or
15
N, and R =
13
C/ 12 C or
15
Science Highlights - Thematic Area 3 |
185
a
b
Figure 3. Linear regression for δ13C data from Nov/2005 in comparison with those from the Feb/2006 for both areas: a-CF and b-UP.
Ullmann Point - UP
consumers formed two different groups that were distinct
In Ullmann Point, in Nov/2005, POM δ C mean values 13
ranged from –23.12 to –19.40‰; for sediment the value
The comparison of the data from Nov/2005 with those
was –26.18‰, and for macroalgae the range was from
from Feb/2006 does not suggest a difference in the δ13C
–14.93 to –25.94‰. Consumers had δ C values between
values (Figure 3b). Considering the δ15N, the values had a
–25.89 (L. elliptica) and –10.81‰ (Y. eightsi) (Figure 2). In
small enrichment in Feb/2006 in four subtidal components
Feb/2006, δ C values for POM varied between –22.13 and
(not statistically significant).
13
13
–20.97‰, for sediment the mean value was –23.73‰, and for algae the values ranged from –24.27 to –15.04‰. The δ13C values for consumers varied from –24.74 (L. elliptica) and –11.73‰ (Y. eightsi) (Figure 2). Regarding δ15N, in Nov/2005, POM values ranged from –0.81 to 4.22‰; for sediment δ15N value was –3.03‰, for macroalgae it varied from 2.56 to 4.22‰, and for consumers, from 1.93 (L. elliptica) to 8.36‰ (B. gigantea) (Figure 2). In Feb/2006, δ15N values for POM varied between 1.16 and 3.67‰, the sediment mean value was very low (–5‰), for algae δ15N values ranged from –1.32 to 6.20‰, and for
Discussion In front of the Brazilian station (CF), the δ13C values were less enriched for some components of the community than in UP (Figure 2), which could suggest a contribution of organic matter originated from sewage that has usually low δ13C (Peterson, 1999; Waldron et al., 2001; Rogers, 2003; Conlan et al., 2006). The δ15N values for sediment, more enriched in the area under the sewage influence, can be related to a higher ammonia concentration of anthropogenic
consumers, from 2.31 (L. elliptica) and 7.95‰ (the isopod
origin (Peterson, 1999; Waldron et al., 2001; Conlan et al.,
Paraserolis polita) (Figure 2).
2006). The clustering of different feeding types in a same
As occurred in CF, L. elliptica formed a group with the producers, but the sediment was separated, and the
186
in the two periods of the summer (Figure 2).
| Annual Activity Report 2010
group in CF is also an indication of sources of organic matter with more similar signature.
The differences between the two summer periods in CF did not suggest an increase of the sewage influence towards the end of summer, mainly for the δ C results. 13
Acknowledgements Financial support from Network 2 Project (CNPq process 550354/2002-6) and Instituto Nacional de
In the summer of 2010/11 a new sampling will be
Ciência e Tecnologia Antártico de Pesquisas Ambientais
undertaken aiming the continuous monitoring of Admiralty
(CNPq process 574018/2008-5 and FAPERJ process
Bay in the scope of the INCT-APA program. For a better
E-26/170.023/2008), Ministério do Meio Ambiente (MMA),
understanding of the anthropogenic influence, the isotopic
Ministério de Ciência e Tecnologia (MCT) and Comissão
signatures of more areas, periods and different organisms
Interministerial para Recursos do Mar (CIRM).
need to be analyzed in Admiralty Bay. Samples from the sewage are also necessary to compare with the obtained results.
References Bícego, M.C.; Zanardi-Lamardo, E.; Taniguchi, S.; Martins, C.C.; Silva, D.A.M. & Sasaki, S.T.; Albergaria-Barbosa, A.C.R.; Paolo, F.S.; Weber, R.R. & Montone, R.C. (2009). Results from a 15-year study on hydrocarbon concentrations in water and sediment from Admiralty Bay, King George Island, Antarctica. Antarctic Science, 21(3): 209-20. Conlan, K.E., Rau, G.H., Kvitek, R.G. (2006). δ13C and 15N shifts in benthic invertebrates exposed to sewage from McMurdo Station, Antarctica. Marine Pollution Bulletin, 52(12): 1695-1707. Corbisier, T.N., Petti, M.A.V., Skowronski, R.S.P., Brito, T.A.S. (2004). Trophic relationships in the nearshore zone of Martel Inlet (King George Island, Antarctica): δ13C stable isotope analysis. Polar Biology, 27(2): 75-82. Costanzo, S.D., O’Donohue, M.J., Dennison, W.C., Loneragan, N.R., Thomas, M. (2001). A new approach for detecting and mapping sewage impacts. Marine Pollution Bulletin, 42(2): 149-156. Gartner, A.; Lavery, P.; Smit, A.J. (2002). Use of δ15N signatures of different functional forms of macroalgae and filter-feeders to reveal temporal and spatial patterns in sewage dispersal. Marine Ecology Progress Series, 235: 63-73. Martins, C.C.; Montone, R.C.; Gamba, R.C. & Pellizari, V.H. (2005). Sterols and fecal indicator microorganisms in sediments from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1-2): 1-12. Peterson, B.J. (1999). Stable isotopes as tracers of organic matter input and transfer in benthic food webs: A review. Acta Oceanologica, 20(4): 479-487. Peterson, B.J. & Fry, B. (1987). Stable isotopes in ecosystem studies. Annual Revierw of Ecology and Systematics, 18: 293-320. Rogers, K.M. (2003). Stable carbon and nitrogen isotope signatures indicate recovery of marine biota from sewage pollution at Moa Point, New Zealand. Marine Pollution Bulletin, 46(7): 821-827. Waldron, S.; Tatner, P.; Jack, I. & Arnott, C. (2001). The impact of sewage discharge in a marine embayment: a stable isotope reconnaissance. Estuarine, Coastal and Shelf Science, 52(1): 111-115. Weber, R. R. & Montone, R. C. (Coord.) (2006). Rede-2: Gerenciamento ambiental na Baía do Almirantado, Ilha Rei George, Antártica. Relatório final. Ministério do Meio Ambiente/ CNPq/SeCIRM/Proantar, Brasil. 255 p.
Science Highlights - Thematic Area 3 |
187
16 ASSOCIATED FAUNA OF Prasiola crispa (CHLOROPHYTA) RELATED TO PENGUIN ROOKERY AT ARCTOWSKI (KING GEORGE ISLAND, SOUTH SHETLAND ISLANDS, MARITIME ANTARCTIC) Adriana Galindo Dalto1,2,*, Geyze Magalhães de Faria1,3, Caio Amitrano de Alencar Imbassahy1, Tais Maria de Souza Campos1,4, Yocie Yoneshigue-Valentin1 1 Laboratório de Macroalgas Marinhas, Departamento de Botânica, Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ 2 Postdoctoral Researcher (CAPES/FAPERJ Fellow) 3 DTI-3 Fellow (CNPq/INCT-APA) 4 Scientific Initiation Fellow (CNPq/INCT-APA)
*e-mail: agdalto@gmail.com
Abstract: The samples of Prasiola crispa for study of associated fauna were collected on the rocks in the region adjacent to the penguin rookery at the Henri Arctowski Polish Research Station at (Admiralty Bay, Antarctic). The preliminary results showed that Tardigrades and Nematodes are the most abundant organisms of the associated fauna of P. crispa, being found in extremely high density. Others invertebrates were found in low densities (<70 ind.cm–2) along with Acari, Rotifer and Collembola. The specific identifications are still underway, however, the results obtained so far are suggesting that the density and the diversity of the microfauna of P. crispa is strongly conditioned by ice-melt water and the degree of humidity in the thallus of this alga. Keywords: meiofauna, tardigrade, terrestrial communities
Introduction
188
Prasiola crispa is a nitrophilous green algae that occurs
The community of terrestrial invertebrates associated
especially in the supralittoral zone or in free ice areas subject
to the vegetation of ice-free areas consist mainly of Rotifer,
to sea water spray, located near seabird colonies, where they
Nematode, Tardigrade and Microarthropodes such
benefit from the guano (Figures 1 and 2). In these areas,
as Collembola and Acari. Many of these invertebrates
P. crispa develop forming overlapping blades that can reach
are particularly well studied and documented for this
up to 3 inches tall and is distributed in spots 10 to 15 cm
environment, such as Collembola and Acari (i.e. Worland &
long on rocks and soil enriched with nutrients (ornithogenic
Lukesová, 2000; Stevens & Hogg, 2002; Sinclair et al., 2006;
soils), with the capacity of forming extensive mats that
Schulte et al., 2008), others, such as Tardigrade, Nematode,
stretch over some meters. Because of it morphological
Rotifer are particularly poorly studied in the Antarctic
characteristics, the thallus of P. crispa is suitable for the
region. Presently, it is known that the Antarctic terrestrial
formation of a micro-habitat that favours the development
biota has low diversity, a high degree of endemism and clear
of a sizeable community of micro invertebrates, especially
patterns of biogeographic distribution, defined by consistent
in extreme environments such as Antarctica.
biological and climatic differences (Convey & McInnes,
| Annual Activity Report 2010
2008). Recent studies have shown that this biota has an ancient origin and has persisted in isolation for ten million years (Convey & Stevens, 2007; Convey et al., 2009; Chow & Convey, 2007). These characteristics result in the terrestrial communities of Antarctica being particularly sensitive to the effects of human presence in the region and to climate change. In this context, this paper aims to contribute to the knowledge of the terrestrial invertebrate fauna associated to Prasiola crispa of ice-free areas in the coastal region around the Admiralty Bay (King George Island, South Shetland, Antarctica). Firstly this study was focused on the knowledge of the fauna, and in a second instance has the intention of giving emphasis to ecological aspects related to the establishment of these microfaunistic communities.
Materials and Methods The samples of Prasiola crispa were collected from the rocks adjacent to the penguin rookeries of Henri Arctowski Polish Figure 1. Prasiola crispa mats in the Arctowski Polish Station. Photo: Erli Costa.
Research Station (Admiralty Bay, King George Island) during the XXIX Brazilian Antarctic Operation (in January 2011) (Figure 3). Three samples of approximately 3 cm² were observed in vivo and later preserved in 4% formalin for later counting and identification of the associated fauna. In laboratory the organisms were separated through sieves with meshes of 500 and 38 µm. The organisms were counted through stereoscopic microscope and identified through optical microscopy. The identification still underway is using as a basis specific pertinent literature and also the examination of specimens by specialists from the National Museum (MN/UFRJ).
Results and Discussion Figure 2. Prasiola crispa (Chlorophyta) associated to Syntrichia magellanica (Bryopsida Class). Photo: Lubomir Kovacik.
The associated microfauna of Prasiola crispa consisted of Rotifer, Nematode, Tardigrade, Acari and Collembola. Tardigrade was the phylum that occurred with greatest
2005; Convey & Stevens, 2007). Added to this, the Antarctic
density, presenting values of up to 7002.67 ind.cm –²
terrestrial biota include organisms ecophysiology adapted to
(X = 2842.11 ind.cm–2) (Figure 4). Nematode was the
environmental pressures involving very low temperatures,
second phylum of greatest density, being found with up to
nutrient limitation, environmental radiation, lack of liquid
3965 ind.cm–² (X = 1388.89 ind.cm–²). Acari, Collembola
water, desiccation and physical abrasion (Convey et al.,
and Rotifera were encountered with densities inferior to
Science Highlights - Thematic Area 3 |
189
Figure 3. Admiralty Bay (King George Island, South Shetland Islands, Antarctic Peninsula). Illustration: Rafael Bendayan de Moura.
a
b
c
d
Figure 4. Microfauna associated to Prasiola crispa. a) Tardigrade; b) Nematode; c) Collembola; d) Acarina. Photos: Geyze Faria
190
70 ind.cm–² (Table 1). The taxonomic identifications are
Fiesia cf. grisea and Friesia sp.) (Figures 5 and 6), one genera
still underway, however, up to the present time the most
of Nematode (Plectidae, genus Plectus) and one genera of
abundant organisms have all been identified; amongst them
Tardigrade (Hypsibiidae, genus Hysibius,) (Figure 7). All
are three species of Collembola (Cryptopgus antarticus,
the taxa identified up to the present time have already been
| Annual Activity Report 2010
Table 1. Taxa of microfauna associated to Prasiola crispa (ind.cm-2).
Taxa
Arctowski 22
Arctowski 23
Arctowski 24
Sum
Ind.cm-²
DP
Relative Abundance (%)
Tardigrade
147.67
1376.00
7002.67
8526.33
2842.11
2984.39
66.0
Nematode
88.67
112.67
3965.33
4166.67
1388.89
1821.85
32.3
Acari
1.67
45.00
67.33
114.00
38.00
27.26
0.9
Rotifer
74.00
0.00
0.00
74.00
24.67
34.88
0.6 0.3
Collembola
1.00
2.67
28.67
32.33
10.78
12.67
Total Microfauna
314.00
1536.33
11064.00
12914.33
4304.78
4805.47
Figure 5. Friesia sp. (Collembola: Poduroidea: Frieseinae). Photo: Eduardo Abrantes
Figure 6. Cryptopygus antarticus (Colembola: Isotomidae: Anurophorinae). Photo: Eduardo Abrantes.
described as pertaining to the Antarctic Maritime region
be conditioned to the presence of water from ice-melt and
(Convey & McInnes, 2005; Carey et al., 2008; Worland
to the degree of humidity in the thallus of this alga. In the
& Lukesova, 2000) having ample presence throughout
Antarctic Peninsula, the populations of microartropods are
Antarctica. According to Convey and McInnes (2005),
essentially limited by the availability of water, and not by
these terrestrial ecosystems dominated by Tardigrades,
the extreme cold (Convey et al., 2003; Hayward et al., 2004;
and organisms which would generally be ubiquitous, such
Kennedy, 1993; McGeoch et al., 2006).
as Nematode, can also very often be absent. Approximately
Recent studies have shown that global warming, in an
17 genera and 48 species of Tardigrade occur in the ice-melt
indirect way, can significantly affect this micro-habitat,
regions of Sub-Antarctica and Antarctica.
through the increase of the availability of water, which
The results obtained up to the present suggest that the
consequently influences in the transport of nutrients,
density and the diversity of the microfauna of P. crispa can
affecting directly the productivity and development of
Science Highlights - Thematic Area 3 |
191
a
b
c
Figure 7. a) Hypsibiidae (Tardigrade: Eutardigrada); b) Detail of the bucco-pharynx area; c) claw characteristic of the family. Photos: Geyze Faria.
this alga (Wasley et al., 2006). The most important factor
on humans. Their ability to undergo cryptobiosis has created
determining their distribution is the presence of water
an interest in the medical community and approaches to
in liquid form, to which organisms must have at least
cell or organ preservation in humans have been tested.
occasional access in order to grow and reproduce (Wharton
Due to the potential medical applications and their pivotal
& Marshall, 2009). The latter could have a very important
phylogenetic position, branching from the stem lineage
effect on the diversity of microfauna which uses P. crispa as
that led to arthropods, there has been a renewed interest in
a substrate, as shelter and even as food, as is the case of the
the biology of Tardigrades at the genomic and proteomic
Collembola Cryptopygus antarcticus, which has this alga
levels. As studies of Tardigrade distribution and ecology
as its preferential food. There is still, weak evidence that
become more complete they may yet become a useful tool
the anthropogenic activity could influence the population
for biogeography (Pilato & Binda, 2001).
distribution of Tardigrade (Steiner, 1994; Hohl et al., 2001). Furthermore, recent research studies have shown that
192
Acknowledgements
Prasiola crispa possesses potential bioactive substances for
We thank the National Institute of Science and Technology
insecticide activity (Posser et al., in this volume), which is
Antarctic Environmental Research (INCT-APA) for
indicative of how important it is to increase the knowledge
financing this work (CNPq process nº 574018/2008-5 and
about this alga and all the associated microfauna related to
FAPERJ, process nº E-16/170.023/2008), CNPq and CAPES/
it. Moreover, Tardigrades have very little economic impact
FAPERJ for the research fellows.
| Annual Activity Report 2010
References Convey, P.; Block, W. & Peat, H. J. Soil arthropods as indicators of water stress in Antarctic terrestrial habitats? Global Change Biology, 9, 1718-1730. 2003. Convey, P. & McInnes, S. J. Exceptional tardigrade-dominated ecosystems in Ellsworth Land, Antarctica. Ecology, 86, 519-52. 2005. Convey P. & Stevens M. I. Antarctic biodiversity. Science, 317, 1877-1878. (doi:10.1126/science.1147261). 2007. Convey, P.; Gibson, J. A. E.; Hillenbrand, C. D.; Hodgson, D. A.; Pugh, P. J. A.; Smellie, J. L.; Stevens, M. I. Antarctic terrestrial life-challenging the history of the frozen continent? Biological Reviews, 83, 103-117. (doi:10.1111/j.1469-185X.2008.00034.x) 2008 Convey, P.; Bindschadler, R.; Prisco, G. di; Fahrbach, E.; Gutt, J.; Hodgson, D. A.; Mayewski, P. A.; Summerhayes, C. P. & Turner, J. Antarctic climate change and the environment. Antarctic Science, 21, 541. 2009 Chow, S. L. & Convey, P., Spatial and Temporal variability across life’s hierarchies in the terrestrial Antarctic. Philosophical Transactions of The Royal Society B : Biological Science, 362: 2307-2331, 2007. Hayward, S. A. L.; Rinehart, J. P.; Sandro, L. H.; Lee, R. E. & Denlinger, D. L. Slow dehydration promotes desiccation and freeze tolerance in the Antarctic midge Belgica antarctica. Journal of Experimental Biology, 210, 836-844. 2007. Hohl, A. M.; Miller, W. R. & Nelson, D. R. The distribution of tardigrades upwind and downwind of a Missouri Coal-Burning Power Plant. Zoologischer Anzeiger, 240, 395-401. 2001. Kennedy, A. Water as a limiting factor in the Antarctic Terrestrial Environment: A Biogeographical Synthesis. Arctic and Alpine Research, Vol. 25, n° 4, pp. 308-315 <http://www.jstor.org/stable/1551914> 1993. McGeoch, M. A.; Chown, S. L. & Kalwij, J. M. A global indicator for biological invasion. Conservation Biology, 20, 1635-1646. 2006. Pilato, G. & Binda, M. G. Biogeography and limno-terrestrial tardigrades: are they truly incompatible binomials? Zoologischer Anzeiger, 240: 511-516. 2001. Schulte, G. G.; Elnitsky, M. A.; Benoit, J.B.; Denlinger, D. L. & Lee Jr., R. E. Extremely large aggregations of collembolan eggs on Humble Island, Antarctica: a response to early seasonal warming? Polar Biology, 31: 889-892. 2008. Sinclair, B. J., Scott, M. B., Klok, C. J., Terblanche, J. S., Marshall, D. J., Reyers, B.& Chown, S. L. Determinants of terrestrial arthropod community composition at Cape Hallett, Antarctica. Antarctic Science, 18(3): 303-312. 2006. Steiner, W. A. The influence of air pollution on moss dwelling animals: 4. Seasonal and long-term fluctuations of rotifer, nematode and tardigrade populations. Revue Suisse de Zoologie, 101: 1017-1031. 1994. Stevens, M. I. & Hogg, I. D. Expanded distributional records of Collembola and Acari in southern Victoria Land, Antarctica. Pedobiologia, 46: 485-495. 2002. Wasley, J.; Robinson, S. A.; Lovelock, C. E. & Popp, M. Some like it wet - biological characteristics underpinning tolerance of extreme water stress events in Antarctic bryophytes. Functional Plant Biology, 33, 44. 2006. Wharton, D. A. & Marshall, C. J. How do terrestrial Antarctic organisms survive in their harsh environment? Journal of Biology, 8, 9. doi: 10.1186/jbiol142. 2009. Worland, M. R. & Lukesová, A. The effect of feeding on specific soil algae on the cold hardiness of two Antarctic microarthropods (Alaskozetes antarcticus and Cryptopygus antarcticus). Polar Biology, 23:766-774. 2000.
Science Highlights - Thematic Area 3 |
193
17 ASSESSING NON-NATIVE SPECIES IN THE ANTARTIC MARINE BENTHIC ENVIRONMENT Ana Carolina Fortes Bastos1,*, Andrea de Oliveira Ribeiro Junqueira1 Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ
1
*e-mail: carolfbastos@gmail.com
Abstract: Bioinvasion is one of the biggest global threats to biodiversity. In the light of climate change, related risks could be increased. In this context, Antarctica is not immune. Exotic species have been introduced into many other isolated ecosystems worldwide and have already been recorded in the sub-Antarctica islands. However, the pool of information concerning the marine environments is too scarce up to the present. This study has investigated the pathways of alien species introduction in the Antarctic marine environment, as a consequence of scientific research, tourism and fishing activities, including the areas of Antarctica vulnerable to bioinvasion. In addition, biogeographic patterns of the some species recorded over the Brazilian program PROANTAR (Phylum Mollusca, Echinodermata, Annelida) have been surveyed. The area of the scientific stations and temporary shelters, which are built in ice-free locations in the summer located mainly in southwestern part of King George Island, close to the Bransfield Strait. The Bellingshausen, President Eduardo Frei Montalva and Arctowski Henryk bases are the oldest in operation. President Eduardo Frei Montalva, King Sejong and Artigas have the largest contingent of people in the summer. Maxwell Bay and Admiralty Bay have the highest number of tourist spots, although King George Bay has the highest tourist landed number. The phylum Artropoda has the greatest biodiversity in the marine environment of Admiralty Bay. The phylum Annelida has the lowest percentage taxa identified to species. Annelida and Artropoda have the highest percentage of endemic species, when only the Antarctic bioregion is considered. On the other hand, Mollusca was the phylum with the highest percentage of species with disjoint distribution. Keywords: marine-introduction, human activities, pathways, biogeographical components
Introduction
194
Bioinvasion is a branch of Science that studies species
In the multiple dimensions of global environmental
transportation by human activities, away from their original
change, the efforts to prevent bioinvasions must be
biogeographic area, in order to comprehend the dispersion
increased. Schiel et al.(2004) state that responses of benthic
patterns, and to identify control measures to mitigate or
communities to ocean warming were mostly unpredictable
eliminate possible negative impacts caused by introduced
in their research. However, one of the most commonly
species in a native ecosystem (Villac et al., 2008). These
predicted effects of global ocean warming on marine
impacts are particularly critical in islands and isolated
communities discussed in the literature is a poleward shift
ecosystems, which have a high degree of endemism and
in the distributional boundaries of species. Accordingly,
greater vulnerability to invasion by nonnative species
it follows that many exotic species can become invasive
(Gaucel et al., 2005).
leading to a decrease in local genetic stock in a process
| Annual Activity Report 2010
referred to as “biotic homogenization” (Vitousek et al. 1997;
experimental design and scientist offset, including the
McKinney & Lockwood, 1999).
functioning of scientific stations and shelters located on
However, assumptions and inferences about the ecology,
King George Island. On the other hand, it is necessary to
detection and management of alien species requires
fully diagnose the statistical trends concerning the most
a broad range of information about composition and
frequently visited places on this island, both for identifying
community structure in potential donor and recipient areas
areas more susceptible to non native species brought by
of species transfer (Carlton, 2000). Therefore, data such as
tourism, and for providing the necessary knowledge to
biogeography, life history and dispersal ability of species
improve the management quality of the island. Related data
studied, as well as human activities that contribute to the
is reviewed on IAATO’s site (International Association of
spread of these species are becoming essential for any future
Antarctic Tour Operators). The investigations on fishing
elaboration of management actions against bioinvasion,
activities are also contained in the original project, since
especially in environments with large endemism, such as
it is an important sector of non intentional introduction,
the Antarctic.
specially related to marine ecosystems. However, this
All this concern is justified in the Antarctic context.
information was not brought up until now.
The long period of geographical isolation has culminated
To study the species biogeography of the phyla Mollusca,
in the evolution of specialized endemic species in extreme
Echinodermata, Annelida and Artropoda (indicated in
conditions, although non-native species have been identified
the project GEAMB- Rede 2), a study was made on their
in the Antarctic ecosystem, as Poa pratensis and P. annua,
distribution using the online database OBIS - Ocean
detected in small areas in the northeast of the Antarctic
Biogeography Information System (www.iobis.org)
Peninsula and King George Island (Smith, 1996). In relation
and GBIF - Global Biodiversity Information Facility (www.
to the Antarctic marine environment, Tavares and De Mello
gbif.org). According to the distribution pattern in marine
(2004) reported the presence of the exotic crustacean Hyas
biogeographic zones proposed by Rass (1986) (Figure 1),
araneus in Austral Ocean, coming from the North Atlantic.
species were classified as: I) cosmopolitan: for those of
Generally, most of the knowledge about bioinvasion,
wide distribution and present in at least three ocean basins;
even for the sub-Antarctic islands, refers to the terrestrial
II) continuous: for species located in adjacent biogeographic
environment (Frenot et al. 2005).
areas (but at a lower rate than required for classification as
In the light of this scenario, the goals of this study
cosmopolitan), III) disjoint: species that have occurrences
are: I- to search main vectors and pathways of potential
in distinct biogeographic regions (separated by areas of non-
introduction to the marine environment, especially in
occurrence); IV) endemic: for species distributed within the
King George Island and to identify the most vulnerable
boundaries of the Southern Ocean (biogeographic areas 8
areas; II- to develop a database concerning the pattern of
and 9 of Figure 1).
distribution of Mollusca, Annelida, Echinodermata and Artropoda marine species detected in Admiralty Bay by the Brazilian Antarctic Program (Weber & Montone, 2006).
Material and Methods
Results According to data published by KGIs SCAR (Scientific Committee on Antarctic Research, King George Island) there are ten scientific stations on King George Island: eight
To study the main vectors and pathways of potential
permanent (which have activities throughout the year)
introductions in King George Island, three main human
and two temporary. The permanent stations are: 1) Brazil:
activity areas were considered: scientific research in situ,
Comandante Ferraz, 2) Chile: Presidente Eduardo Frei,
tourism and fishing. According to scientific research
3) Chile: Professor Julio Escudeiro, 4) China: Great Wall,
the following activities must be considered: field work,
5) Korea: King Sejong, 6) Poland: Arctowski, 7) Russia:
Science Highlights - Thematic Area 3 |
195
Figure 1. Biogeographical regions of the oceans in the world: 1) Arctic; 2) subarctic; 3) temperate north; 4) subtropical north; 5) tropical, 6) subtropical southern; 7) temperate south, 8) Subantarctic, 9) Antarctica. (Brown & Lomolino, 2006 apud Rass, 1986)
196
Bellingshausen, 8) Uruguay: Artigas. Other countries have
Regarding the second objective, this study only
the following temporary stations: 1) Peru: Machu Picchu,
researched 58.17% (154) of all taxa (263) recorded in
2) Germany: Dallmann Laboratory. Russia, Brazil, Korea,
Admiralty Bay by the project Rede 2. The phylum Artropoda
Argentina, United States, Poland and Ecuador have also full
has the greatest biodiversity in the marine environment
and temporary shelters in King George Island.
of Admiralty Bay. The phylum Annelida has the lowest
The station Bellingshausen (Russia), President Eduardo
percentage of taxa identified to species (71.43%).Of the
Frei Montalva (Chile) and Arctowski Henryk (Poland)
56 taxa found, six were identified to genus (10.71%) and
are the oldest in operation on King George Island, with
only one was identified to family (1.79%). From another
42, 41 and 33 years old respectively.
perspective, there were nine taxa (16.07%), whose
According to data published by the IAATO and
identification was confirmed a posteriori. Finally the phyla
compiled by SCAR KGIs there are 21 main tourist areas in
Mollusca and Echinodermata, despite having the lowest
King George Island, among which 20 are located in coastal
numbers of taxa involved, all were identified to species.
areas free of ice during the summer. Maxwell Bay and
A presence/absence matrix was built based on
Admiralty Bay have the highest number of tourist spots.
biogeographical distribution patterns of those species
However, despite King George Bay having the smallest
studied in this work. Only Annelida an Artropoda had
number of tourist spots, it is the place with the highest
species with no record in the databases consulted. Table 1
number of tourists, once Arctowski and Penguin Island
shows a high degree of endemism in the Southern Ocean
received the highest number of tourists landed during the
for all phyla analyzed. However, it is important to emphasize
period between 1999 and 2002.
that, in this study, the endemic status was indicated for
| Annual Activity Report 2010
Table 1. Numeric values and percentages of each distribution pattern according to the invertebrate groups.
Mollusca
No data
Echinodermata
Annelida
Artropoda
nº
%
nº
%
nº
%
nº
%
0
0
0
0
2
5
6
10
Cosmopolitan
0
0
0
0
5
12.5
1
1.67
Continuous
11
47.83
1
20
3
7.5
12
20
Disjoint
3
13.04
0
0
3
7.5
2
3.33
Endemic
9
39.13
4
80
27
67.5
39
65
Total
23
100
5
100
40
100
60
100
species residents in both Antarctica e subantarctica areas
1999 to 2002, and, based on tourism activities, these are the
(areas 9 and 8, respectively). When only the Antarctic
places most likely to suffer the unintentional introduction
(area 9) is considered, the phyla Annelida and Artropoda
of nonnative species.
have the highest percentage of endemic species, represented
Although there is no irrefutable record of invasion in
by 25% for both groups (with 10 and 15 endemic species,
the Antarctic marine environment, more careful studies
respectively). The phylum Mollusca has only one species
of species with cosmopolitan or disjoint distribution
(4.35%), while the phylum Echinodermata shows no species
are necessary, since these patterns can be correlated to
restricted to this region.
taxonomic misidentification and occurrence of cryptic
Discussion
vectors. According to Carlton (2009), the list of invasive
The scientific stations and temporary shelters are located mainly in southwestern King George Island, closer to the Bransfield Strait. Futhermore, these stations were built in areas where the soil is exposed during the summer, due to the decrease in the percentage of ice cover. Among the permanent stations, President Eduardo Frei Montalva (Chile), King Sejong (Korea) and Artigas (Uruguay) are the scientific bases that have the largest contingent of people in summer. This means that both the pathways and vectors used by these stations, especially those that have the highest uptime, as well as the largest contingents must be targets of investigation for a possible presence of non-native species, since time and human activities are essential factors in the processes of bioinvasion. In general, touristic places are related to areas free of
species or, ultimately, to the dispersal of species by human species across the planet may be underestimated due to the presence of pseudoindigenous species, here defined as introduced species that are mistakenly considered as native (indigenous or endemic) to a location.
Conclusion The results obtained so far do not allow us to make conclusions about the invasive status of species, but provide valuable clues about which species will require more investigation management and monitoring. However, a larger amount of information about vectors and pathways, as well as more vulnerable sites are essential before it is possible to make inferences about the presence of invasive species in the Antarctic marine environment.
Acknowledgements
ice during the summer, and most of these sites are closer
We thank the National Institute of Science and Technology
to the Bransfield Strait. Verifying data provided by SCAR
Southern Environmental Research (INCT-APA) for
KGIs, the Arctowski and Penguin Island stations are the
financing this work (CNPq process nº 574018/2008-5 and
locations of this island where most tourists landed during
FAPERJ, process nº E-16/170.023/2008)
Science Highlights - Thematic Area 3 |
197
References Carlton, J.T. (2000). Global change and biological invasions in the oceans. In: Mooney, H.A.& Hobbs, R.J. Invasive Species in a Changing World. Covelo: Island Press. Carlton, J.T. (2009). Deep invasion ecology and the assembly of communities in historical time. In: Rilov, G & Crooks, J. Biological Invasions in marine ecosystems: Ecological, management and geographic perspectives. Heidelberg: Springer. Ecological Studies 204. Frenot, Y.; Chown, L.S.; Whinam, J.; Selkirk, P.M.; Convey, P.; Skotnicki, M. & Bergstrom, D.M. 2005. Biological invasions in the Antartic: extent, impacts and implications. Biological Reviews, 80: 45-72. Gaucel, S.; Langlais, M. & Pontier, D. (2005). Invading introduced species in insular heterogeneous environments. Ecological Modelling, 188: 62-75. McKinney, M.L. & Lockwood, J.L. (1999). Biotic homogenization: a few winners replacing many losers in the next mass extinction. Trends in Ecology & Evolution, 14: 450-453. Rass, T. S. 1986. Vicariance ichtyogeography of Atlantic Ocean pelagial. Pelagic Biogeography, (49): 237-241. Schiel, D.R., Steinbeck, J.R & Foster, M.S. (2004). Ten years of induced ocean warming causes changes in marine benthic communities. Ecology, 85 (7): 1833-1839. Smith, R.I.L. (1996). Introduced plants in Antarctica: potential impacts and conservation issues. Biological conservation, 76: 135-146. Tavares, M. & De Mello, G.A.S. (2004). Discovery of the first know benthic invasive species in the Southern Ocean: the North America spider Hyas araneus found in the Antarctic Peninsula. Antarctic Science, 16: 129-131. Villac, M.C.; Ferreira, C.E.L & Junqueira, A.O.R. (2008). In: Neto, J.A.B.; Wallner-Kersanach, M. & Patchineelam, S. M. Poluição marinha. Rio de Janeiro: Interciência. Vitousek, P.M., Mooney, H.A. & Melillo, J.M. (1997). Human Domination of Earth’s Ecosystems. Science, 277: 494-499. Weber, R.R & Montone, R.C. (2006). Rede 2 – Gerenciamento Ambiental na Baía do Almirantado, Ilha Rei George, Antártica. Brasília: Ministério do Meio Ambiente. 259 p.
198
| Annual Activity Report 2010
Science Highlights - Thematic Area 3 |
199
THEMATIC AREA 4
ENVIRONMENTAL MANAGEMENT
204 Implementation of Environmental Management System in the Brazilian Antarctic Base 207 Bioremediation, Hydrocarbon Depletion and Microbial Genetic Diversity of Antarctic Oil-polluted Soil 211 Methodology of Thermal Performance Assessment of Comandante Ferraz Antarctic Base (Brazil) 217 Management of the Production of Solid Wastes of the Comandante Ferraz Brazilian Antarctic Base 222 Methodology of Landscape Monitoring in Asma at the Admiralty Bay: Application in Keller Peninsula
200
| Annual Activity Report 2010
Coordinator
Cristina Engel de Alvarez Vice-coordinator
Alexandre de Ă vila Leripio
The thematic area IV focus on the activities on activities related to the anthropic impact on the Antarctic environment, with particular attention to the territorial boundary of the Keller Peninsula, where the Comandante Ferraz Antarctic Station is located. The participating research projects have the characteristics of being pieces of research based on the search for solutions of identified impacts, in the form of technological development, proposals for environmental management and bioremediation. The research studies gain irrefutable scope, with the need to gain knowledge of the atmospheric, terrestrial and the marine environments (Figure 1). Regarding the aspects related to technological development, the research studies have been divided in 10Â sub-themes directly linked to building technology, searching for solutions for greater efficiency of the research stations, or for the minimization of the impacts through modifications of standard procedures. The main themes considered in the research studies have been: acoustics, water, corrosion of metal surface, thermal performance, energy, building materials, landscape, quality of indoor air, waste, and the development of SAM (SAM-Standard Antarctic Module). It is noteworthy that the great scope of
warehouse space, financial economy, amongst others. The results of all these themes, without exception, contribute to the development of the building technique called SAM (Standard Antarctic Module). SAM whose guides building concepts reduce the environmental impacts caused by human presence in the Antarctic environment. Considering the financial and logistic limitation inherent to the Brazilian Antarctic Programme, for the period under consideration priority was given to the continuity of some themes previously developed– such as landscape studies and the finalization of the diagnostic of water consumption at EACF. The first results referring to energy and materials were obtained. Furthermore, specific measuring related to studies of thermal comfort were initiated, and with less emphasis, continuity was given to obtaining and treating the data related to the acoustic impact and the production of solid residues at EACF. Due to the fact that EACF is located in the unique Antarctic environment, with high environmental sensibility, and in accordance with the commitments assumed by the Brazilian government related to the Madrid Protocol, the activities executed at the Brazilian Station should follow procedures that cause the least possible environmental
themes covered is strictly correlated with each other, given
impact. Thus, in parallel to the technological studies,
that the influence of an individual result interferes in one
part of the objectives of Thematic Area IV consider the
or more sub-themes. As an example, the studies referring to
development of the Environmental Management System
the theme of thermal performance of EACF, which results
(EMS) certified by the Standard: NBR ISO 14001:2004 to
directly interfere in the sub-themes, energy and materials,
be implemented at Comandante Ferraz Antarctic Station
since an efficient envelopment offers greater comfort
(in Brazilian-Portuguese: SGA/EACF)
and less energy wastage. In turn, the reduction of energy
The norm requires the establishment and maintenance
consumption signifies less burning of fossil fuel, reduction
of the organization of an up-to-date procedure that
of atmospheric pollution, reduction in soil contamination,
identifies the environmental aspects of its activities and
reduction in the production of residues, optimization in
services. However, not all aspects should be considered,
Science Highlights - Thematic Area 4 |
201
Figure 1. Thematic Area 4 flowchart. (Illustration: Edson Rodrigues).
only those that are considered significant and over which
Ministry of the Environment and in strict connection with
the organization can exercise influence and control.
SECIRM (Interministerial Commission for Sea Resources
The EMS functions objective is to classify the
– Secretariat). After certification, the procedures proposed
environmental aspects and to define the significant impacts
by EMS should be incorporated as routine at the Base, as
that result from the activities at EACF. Additionally, EMS
integral part of the Brazilian Antarctic Programme.
establishes procedures and creates plans for the compliance of objectives from the definition of the indicators. There are very few references to other scientific bases
from EACF. By means of the implementation of the process
in Antarctica certified by NBR ISO 14.001:2004 and EACF
of bioremediation in situ in the areas of EACF contaminated
has some peculiarities. The difficulties encountered are to be
by hydrocarbons. Physical-chemical, toxicological and
expected right from the very concept of the initial project,
ecological analyses, will be undertaken to verify the
but can be seen by visiting the Spanish Base Gabriel de
efficiency of the bioremediation strategy. The results can
Castilla. SBGC was the last Antarctic base certified by the
define as readiness as EACF strategy immediate actions of
norm in February 2010, whose EMS has been adopted by
bioremediation in case of accidents with diesel oil.
EACF. Therefore, EACF is in accordance with the referred Spanish Base norm version. The activities inherent to the EMS are being undertaken by researchers of INCT-APA, with the supervision of the
202
The research studies related to bioremediation are being directed specifically to soil contaminated with hydrocarbons
| Annual Activity Report 2010
The majority of the areas studied in thematic area IV, are not traditionally studied in other Antarctic Programmes, thus broadening the scope of our understanding of the Antarctic environment.
Science Highlights - Thematic Area 4 |
203
1 IMPLEMENTATION OF ENVIRONMENTAL MANAGEMENT SYSTEM IN THE BRAZILIAN ANTARCTIC BASE Alexandre de Avila Leripio1,*, Fernanda Helena Leite2, Rafaela Picolotto1, Mariana de Sá Viana2 1
Laboratório de Sistema de Gestão Ambiental, Universidade do Vale do Itajaí – UNIVALI, Itajaí, SC, Brazil 2 Ministério do Meio Ambiente, Esplanadas dos Ministérios, Bloco B, Brasilia, Brazil *e-mail: sgaeacf@gmail.com
In 2009 the Brazilian Antarctica Programme (well
in March/April and October/November and furthermore
known acronym, PROANTAR in Brazilian-Portuguese)
by members of the Navy Dockyard Personnel from Rio de
decided to implement the Environmental Management
Janeiro – (AMRJ, Portuguese acronym), responsible for the
System – EMS certifiable through the international norm
refurbishments, expansions and structural maintenance of
NBR ISO14001:2004 at Comandante Ferraz Antarctic Base
the base. The floating population consists of approximately
(acronym – EACF in Brazilian-Portuguese). This initiative
50 people lodged at the Base in summer, the majority
is being undertaken with the coordination of the Ministry
researchers. The floating population varies, in that each
of the Environment and with the participation of the
group has a permanence period of approximately 30 days.
National Institute for Science and Technology – Antarctic
Considering the fragility of the Antarctic environment
Environmental Research – (acronym in Brazilian
and the potential environmental impacts associated to
Portuguese – INCT-APA) in strict contact with the
the rotation of researchers and to the routine activities
Secretariat of the Interministerial Commission for the
undertaken at EACF, a system of control of the environmental
Resources of the Sea – (acronym SECIRM in Brazilian-
aspects becomes essential. The Environmental Management
Portuguese) coordinated by the Brazilian Navy, which is the
System is structured in order to manage and minimize
organization responsible for the logistical, administrative
impacts that occur as a consequence of human activity.
and organizational management of EACF. Since EACF is located in such a unique environment
204
According to NBR ISO 14001:2004, the environmental aspect is defined thus:
as the Antarctica, with high environmental sensibility,
“[...] it is the service, activity or product of an organization
and in accordance with commitments assumed by the
that can interfere in the environment, and environmental
Brazilian Government in the Madrid Protocol, the activities
impact is any modification to the environment, adverse or
undertaken at the Brazilian Base should follow procedures
beneficial, resulting from environmental aspects.” (p. 4).
so as to cause the least possible environmental impact. For
NBR ISO 14001:2004 requires that the organization
this purpose, the controls established focus on preventative
establishes and maintains an up-to-date procedure to
actions related to its activities.
identify the environmental aspects of its activities and
EACF consists of several modules in which are
services. However, not all the aspects have to be considered,
distributed, lodgings, laboratories, workshops, sitting
only those that were considered significant and over which
rooms, infirmary, kitchen, bakery, freezers, library, storage
the organization is able to exert control or influence.
area, communication room, a small sports gym (academy)
In January 2009, a team of specialists in EMS went
and research laboratories. Its fixed population is made up of
to EACF to undertake a survey of aspects and impacts
15 military personnel from the Brazilian Navy who are based
of environmental activities that occur at EACF. The
at EACF for a 1 year long period, being relieved in two stages,
team also carried out a preliminary diagnostic of the
| Annual Activity Report 2010
level of compliance with the requirements of norm
Amongst the initiatives undertaken in the sense of
NBR ISO 14001:2004. The results obtained permit the
preparing the Base-Group for the implementation of EMS
preliminary conclusion that there is partial compliance
are: the Course of Reading and Interpretation of norm
with the norm – 42.3% on average of compliance with
NBR ISO 14.001:2004 and the Course of Formation of
norm requirements, which can be considered promising,
Environmental Auditors according to NBR ISO 19.011:2002.
since there is still no EMS formally implemented at this
In February of 2010, the Base-Group were given their
point in time. The verification of environmental aspects and impacts was carried out at EACF during the period, February to March 2010, being validated in a specific meeting for this purpose undertaken at EACF with participation of representatives of the several interested parties (stakeholders). Amongst the participating institutions, attention can be called to: the Brazilian Antarctica Programme (PROANTAR), represented by the Head of EACF and the AMRJ Engineer, the Ministry of the Environment, INCT- APA, apart from support technical staff, characterising a multi-disciplinary group. After the validation at EACF, a preliminary version of the “Survey of Environmental Aspects and Impacts of EACF” was prepared and the initial scope of EMS focused on EACF was delineated including the activities directly related to the routine, maintenance and research carried out at the Base. In July 2010 a meeting was held in Rio de Janeiro with the purpose of identifying the necessities of the interested parties associated to the environmental aspects and impacts verified at EACF and defining the significant environmental aspects and impacts associated to the activities. The participants represented the same institutions present at the first meeting held at EACF, however, with a higher number of participants at the meeting in Rio de Janeiro. The Base-Group of the Brazilian Navy, as already mentioned, is substituted in March of each year, and remains in training for approximately 6 months, following a rigorous selection process, which is undertaken starting
first training concerning EMS, specifically the Course of Reading and Interpretation of norm NBR ISO 14.001:2004, which took place on 18 and 19 February 2010, at the Naval Supply Base in Rio de Janeiro with the participation of 13 military personnel and 1 representative of the Ministry of the Environment. During the course questions related to the basic concepts of environmental management, cycles of continuous improvement which encompasses planning, implementation, control and the action, known as PDCA – plan-do-check-act, were covered. During the course explanations were given concerning the preliminary verification of the environmental impacts and related aspects concerning EACF and in addition the EMS implementation plan was presented. In order to verify the level of knowledge acquired concerning the norm, at the end of the last day, a written evaluation concerning the main concepts presented during the course was applied. In August 2010, the Pre-Deployment Antarctic Training – PAT was held at the Ilha de Marambaia (Marambaia Island) in Rio de Janeiro. The purpose of the training is to prepare the Base-Group of the Navy and researchers who go to Antarctica in order to enable adaptation to the adverse conditions of the environment in which they are subject to for a good period of time. Lectures on security, first-aid, climbing, nutrition, physical conditioning and the environment were given. The mains lines of research which are being carried out in Antarctica are also presented.
in the first semester of the previous year to their going to
During the Pre-Deployment Antarctica Training 2010,
EACF. For this reason, in order to implement EMS, the
a lecture for increasing conscientiousness and awareness
training of the Base-Group is essential, to help with the
towards EMS was delivered; it covered the aspects and
necessary implementation process and afterwards with the
impacts related to the environment raised in the last
maintenance of the System.
Antarctica operation and the importance of the System
Science Highlights - Thematic Area 4 |
205
in the activities undertaken at the Base and its future
transport logistical procedures and the permanence of the
certification according to norm NBR ISO 14.001:2004.The
auditing team.
main purpose of the activity was to present EMS to new Brazilian “candidates to Antarctica�, in order to obtain right from the start their commitment to the EMS objectives. Certification process according to norm NBR
206
Through this initiative, it is hoped to fortify the actions which the Brazilian Antarctic Programme has been seeking to take ever since its creation, with the purpose of protection
ISOÂ 14.001:2004 is initially planned for the month of
of the Antarctic environment, andpursing the improvement
January 2012 beginning with the audit by the certifying
of its procedures for better compliance of what is established
body. This stage will require special attention as regards
in the Madrid Protocol.
| Annual Activity Report 2010
2 BIOREMEDIATION, HYDROCARBON DEPLETION AND MICROBIAL GENETIC DIVERSITY OF ANTARCTIC OIL-POLLUTED SOIL Alexandre Soares Rosado1,*, Juliano de Carvalho Cury2,*, Raquel Silva Peixoto1, Hugo Emiliano de Jesus1, Carlos Ernesto Gonçalves Reynaud Schaefer3, Marcia C. Bícego4, Diogo A. Jurelevicius5, Lucy Seldin5, Paulo Negrais Seabra6, Charles W. Greer7 Laboratório de Ecologia Microbiana Molecular – LEMM, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 2 Universidade Federal de São João Del Rei – UFSJ, Sete Lagoas, MG, Brazil 3 Universidade Federal de Viçosa – UFV, Viçosa, MG, Brazil 4 Instituto Oceanográfico, Universidade de São Paulo – USP, São Paulo, SP, Brazil 5 Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 6 Setor de Meio Ambiente e Biotecnologia, Superintendência de Pesquisa e Engenharia Básica do Abastecimento, Centro de Pesquisas da Petrobras, Rio de Janeiro, RJ, Brazil 7 Biotechnology Research Institute, Canada
1
*e-mail: arosado@globo.com; jccury@hotmail.com
Abstract: Natural environments have been affected by oil spills around the world for decades. In some cases, the attempt to cleanup can be made using physical and chemical methods. However, for the Antarctic environments this is not so simple. Displacement of the machinery necessary for the application of physical methods would be very expensive whereas the application of chemical methods would be dangerous considering the risks of additional environmental impacts. Oil contamination of soils of EACF was caused by a tank rupture in the mid eighties in addition to little spills and intense use of motor vehicles. In some sites the presence of oil can be visually detected, which leads us to believe that a monitored natural attenuation is not feasible. Bioremediation techniques are relatively more cost-effective and benign. These techniques are based on the ability of some microorganisms (especially some bacteria) to use the petroleum hydrocarbons as energy source. However, before any implementation of bioremediation action, it is important to perform studies for the chemical and biological characterization of the contaminated soil. We are performing physical-chemical and microbiological studies of soil samples of Brazilian Antarctic Station contaminated with diesel. The results show an absence of Nitrogen in soil, the presence of high content of petroleum hydrocarbons and a depletion effect of the microbial diversity in polluted soil. Keywords: Antarctic, oil, bioremediation, microbiology
Introduction Natural environments have been affected by oil spills
application of physical methods would be very expensive
around the world for decades. In some cases, the attempt to
whereas the application of chemical methods would be
cleanup can be made using physical and chemical methods.
dangerous considering the risks of additional environmental
However, for the Antarctic environments this is not so
impacts. Oil contamination of soils of EACF was caused by
simple. Displacement of the machinery necessary for the
a tank rupture in the mid eighties in addition to little spills
Science Highlights - Thematic Area 4 |
207
and intense use of motor vehicles. In some sites the presence
contaminated treatment of the microcosm experiment
of oil can be visually detected, which leads us to believe that
consists in a mixture (1:1:1, w) of soil of the samples 1,
a monitored natural attenuation is not feasible.
2 and 3 (collected in oil-polluted area), whereas the oil-
Bioremediation techniques are relatively more cost-
uncontaminated treatment consists in a mixture (1:1, w) of
effective and benign. These techniques are based on the
soil of the samples 4 and 5 (collected in oil-unpolluted area).
ability of some microorganisms (especially some bacteria)
For the bioestimulation microcosm experiment we applied
to use the petroleum hydrocarbons as energy source.
different doses of N (as MAP) in the soil and incubate during
However, in some cases, environmental factors can cause
60 days. For the bioaugmentation experiments, ten bacterial
the recalcitrance of the pollutant. The more frequent cause
strains that grow in solid media with the diesel of EACF as
of recalcitrance is the depletion of nutrients (especially N
the sole carbon source (Figure 2) where isolated and are
and P) due to input of large quantities of carbon sources
being used for the in situ bioaugmentation experiments
(petroleum hydrocarbons). An alternative to overcome
(Figure 3).
this problem is the addition of fertilizers (e.g. N-P-K, MAP,
Molecular approaches are being used to characterize
DAP). This technique is known as biostimulation. However,
microbial structures of the contaminated soil before and
some precautions must be taken. For the biostimulation the
during the experiments. PCR-DGGE (denaturing gradient
most important aspect is to avoid the excess of fertilizer,
gel electrophoresis) technique can be used to determine
which could cause side effects like eutrophication. Therefore,
changes of microbial structures whereas cloning and
it is important to perform studies for the chemical and biological characterization of the contaminated soil. Temperature is a critical factor for bioremediation success. In Antarctic soils, low temperatures can decrease the rate of biodegradation even when nutrients are available in satisfactory concentrations. An alternative to overcome this difficulty is to increase the number of cells of a consortium of degraders in artificial media under conditions of optimum growth before the introduction in nutrient-amended polluted soils. This technique is known as bioaugmentation. Theoretically, bioaugmentation is a
Figure 1. Soil sampling points in the area of EACF. 1-3) diesel-polluted area; 4,5) diesel-unpolluted area.
more promising technique than biostimulation. However, the effectiveness of bioaugmentation is variable due to the low rates of survival and degrading capability of introduced microorganisms. Furthermore, in Antarctic soils the implementation of this technique is not feasible since the introduction of alien species should be avoided. An alternative to overcome these difficulties is to introduce indigenous microorganisms capable of degrading oil to the contaminated site.
Methodology We collected soil samples in the diesel-polluted and diesel-unpolluted areas of the EACF (Figure 1). The oil-
208
| Annual Activity Report 2010
Figure 2. Bacteria growing in culture media containing the diesel of the EACF as the sole Carbon source.
Figure 3. In situ bioaugmentation experiment.
Figure 4. TPH content of the original samples (1 to 5) and microcosm experiment soil. The letter I represents the initial contamination. Numbers after the U (uncontaminated) and C (contaminated) soil treatments indicate the doses of N applied (mg.kg–1).
sequencing techniques can be used to characterize the
Results
taxonomic and functional diversity of soil under different
As expected, analyses revealed a higher content of TPHs in
treatments based on marker genes, in addition to the
the soil of the diesel-contaminated area (Figure 4). Whereas
characterization of the obtained isolates.
the chemical analyses showed the absence of Nitrogen in
Science Highlights - Thematic Area 4 |
209
a
b
Figure 5. Diversity of bacteria (a) and microeukaryotes (b) in diesel-contaminated and diesel-uncontaminated soil of the EACF.
the soil, it was performed a microcosm experiment to test
microbial diversity in polluted soil. At the end of the studies
the application of different doses of N. As show in Figure
we hope to determine a procedure based in biostimulation
4, the application of N until a concentration of 250 mg.kg
and bioaugmentation that may become available and that can
–1
of N caused a reduction of the TPH content after 60 days of incubation. We detected a less microbial diversity of microorganisms in the diesel-contaminated soil, indicating the biological influence of the contaminant (Figure 5).
Conclusions
210
be immediately applied after oil spills in the Antarctic soils.
Acknowledgements We thank to the National Institute of Science and Technology of Antarctic Environmental Research
The results of the studies performed at the present show
(INCT-APA, CNPq process nº 574018/2008-5 and
an absence of Nitrogen, the presence of high content of
FAPERJ process nº E-16/170.023/2008) and to Brazilian
petroleum hydrocarbons, and a depletion effect of the
navy for the support.
| Annual Activity Report 2010
3 METHODOLOGY OF THERMAL PERFORMANCE ASSESSMENT OF COMANDANTE FERRAZ ANTARCTIC BASE (BRAZIL) Fernando Boechat Fanticele1, Cristina Engel de Alvarez1,* 1
Universidade Federal do Espírito Santo – UFES, Vitória, ES, Brazil *e-mail: cristina.engel@ufes.br
Abstract: The studies on thermal comfort establish the conditions required to evaluate and form an idea concerning a thermal environment appropriate for activities and human occupancy, in addition to the institution of methods and principles for a detailed thermal analysis of an environment. The inhospitable climatic conditions in the Antarctic environment (low temperatures, high wind speeds, isolation and the need for conservation of the natural environment) demand a deep study of several fields comprising the environmental comfort of the buildings, since the observance of national and international regulations related to this subject means an additional connection with personal safety, as well as assuring the health and well-being of the users. The purpose of this research is to assess the level of thermal insulation efficiency of the envelopment of the Comandante Ferraz Brazilian Antarctic Base (EACF, acronym in Portuguese) by means of measurements of thermal comfort indices in pre-selected environments, using for this proper equipment in accordance with international standards. The results showed differences in temperature in evaluated environments and reflect inefficiency in the insulating material. Keywords: thermal comfort, thermal performance, architecture and climate, cold climate
Introduction The American Society of Heating, Refrigerating and Air-
polyurethane or glass wool according with the building area
Conditioning Engineers ASHRAE Standard 55 (2004)
and time of construction.
defines thermal comfort as a state of mind which expresses
In previous studies it was noted that from several refits
human satisfaction with the thermal environment. Thus, the
and expansions, where some modules were attached to
studies of thermal comfort establish conditions required to
the former structure, the replacement of polyurethane for
assess and conceive a thermal environment appropriate for
glass fibre as isolating material had occurred drastically
activities and human occupancy, in addition to the instituted
reducing the inefficiency of the intended insulation.
methods and principles for a detailed thermal analysis of
According to Alvarez (1995), this had occurred mainly
an environment.
through the accumulation of moisture inside the panels with
The Comandante Ferraz Brazilian Antarctic Base
concentration at the floor level, thus allowing the transfer
(Lat = 62° 05’ S and Long = 58° 24’ W) in general has
of cold to the inside of the environments and differences in
sandwich sealing with their external partitions made
temperature of about 10 °C between the floor and ceiling.
from corrugated steel and internal partitions with wood
This research is aimed firstly to identify the problems
wainscoting and filled with isolating material like expanded
concerning the thermal comfort of the EACF by means
Science Highlights - Thematic Area 4 |
211
of analysis of data from the internal air temperature of
After selecting the environments, in each place the
environments and the building characteristics in order
equipment placement points were determined, located in
to establish the level of efficiency of the envelopment
accordance with the ISO 7726 (ISO, 1998) recommendations,
of building. Secondly, considering that the cultural and
which for environmental variables predict measurement
psychological aspects interfere with feeling of feeling hot
heights of 0.10, 0.60 and 1.70 m in relation to the floor.
or cold, data related to the satisfaction of the users will be
Thus, in February 2010, in each environment three pieces
aggregated, furthermore with the expectancy of relating the data of envelopment with the energy consumption of the EACF. This study refers to the results obtained from the measurements concerning the first stage of evaluation of the envelopment.
of equipment were placed which were predicted for working with data collection till the summer of 2010. Therefore, in this paper the analysis is be based on the two environments where the equipment is installed (Figure 1), and for testing the methodology the period analyzed is 1-30 June 2010, considering it to be a month with low external temperatures and, therefore, with higher demands of efficiency of the
Materials and Methods The verification of thermal behaviour of the EACF throughout the study was carried out following the parameters of performance established by international standardization, in that the indications for the levels of comfort to users provided basis to assess the building. With this, data of air humidity and temperature to proceed with the analysis of the research was obtained. To obtain the data, measurements were undertaken in pre-selected environments for their features aiming at larger representations of several situations found at the EACF. For the selection of the environments, the criterion adopted was the condition of exposure to winds. Thus, for the collection of environmental variables the following environments were selected: cabin 1 (the most exposed) and cabin 9 (the least exposed). The equipment used for performing the management of the environmental variables were in accordance with
envelopment. The information was collected using a specific software program (BoxCar Pro) that allows reading the data in form of tables and graphs with the recording taking place automatically every hour.
Results and Discussion The data presented in Figures 2 and 3 show the differences in vertical temperature existing in the same environment, which indicates the condition of discomfort located, called the draught, which is the cooling or heating of a body part, caused by air speed and/or differences in temperature between floor and ceiling ISO 7730 (ISO, 2005). Note that in cabin 9 the difference in temperature, on average, was 9.2 °C between the lowest height and the highest height (Figure 2), whereas in the cabin 1 that difference was 7.1 °C, on average (Figure 3).
ISO 7726 (ISO, 1998), observing the minimal requirements
By comparing the temperatures in the two environments
for collection of data to evaluate the thermal comfort.
for the same height, is was noted that there were marked
Chart 1 shows the specifications of the thermo-hygrometer
differences, as shown in the Figure 4 for measurements at the
employed in the present research.
height of 0.10 m, while the mean difference equalled 5.5 °C.
Chart 1. Description of the main equipment used for in situ measurements.
212
VARIABLE
DESCRIPTION OF EQUIPMENT
Air temperature and relative humidity
HOBO U12 Temp/RH/2 External Channel Logger, manufactured by Onset Corporation. This equipment is 58 x 74 x 22 mm, and has sensors capable of recording and storing up to 430,000 records of data of air temperature and humidity.
| Annual Activity Report 2010
a
b
Figure 1. Location of the thermo-hygrometers in the cabin 1 (a) and the cabin 9 (b).
Figure 2. Air temperature measurements in the cabin 1 in three different heights.
Science Highlights - Thematic Area 4 |
213
Figure 3. Air temperature measurements in the cabin 9 in three different heights.
Figure 4. Temperature in the cabin 3 and 9 for the same height of 0.10 m.
214
| Annual Activity Report 2010
Figure 5. Temperatures in the cabin 1 and cabin 2 for the same height of 1.70 m.
For the height of 1.70 m, the differences were lower
• There was a local thermal discomfort due to the
in the both cabins, since they reached 0.4 °C, on average
differences in temperature vertically, which proved the
(Figure 5). It was also noted that the temperatures in the
existence of draught;
cabin 9 ranged more than those in the cabin 1. To evaluate the thermal comfort the knowledge of the environmental variables of namely, temperature, humidity, air velocity, and the mean radiant temperature, are needed. The respective characterizations for the environmental variables, measurement methods and instruments are described in the ISO 7726 (ISO, 1998). Although the information about the mean radiant temperature, humidity and internal air velocity had been collected, the results shown in the present paper do not consider those data since they are used for assessing thermal sensation defined in ISO 7730 (ISO, 2005) and are an integral part of a broader research. For the performance evaluation of envelopment the internal temperature data provided elements for a preliminary analysis.
Conclusions
• The difference in temperature of the floor in both the environments reflected inefficiency of the isolating material since the difficulty to maintain the heat was very likely due to transmission of cold to the inside of the environments. Considering the previous results reported by Alvarez (1995), it is believed that the inefficiency in the insulation may have due to the lack of thickness of the material associated with accumulation of humidity inside the panel; • At higher heights the difference in temperature was lower, however disproportionate variation in temperatures were found, most likely due to changes in the characteristics of the envelopment, thus revealing the inefficiency of the insulating material and, therefore, the envelopment of the building. For a complete analysis it is necessary to relate the data collected from inside the environment with the external temperatures, as well as to calculate the thermal
In a preliminary analysis of data of the air temperature
comfort indices PMV (Predicted Mean Vote) and PPD
of the two studied environments, it was possible to
(Predicted Percentage of Dissatisfied) proposed in ISO 7730
conclude that:
(ISO, 2005).
Science Highlights - Thematic Area 4 |
215
Acknowledgements
Interministerial Commission for Resources of the
We thank the FAPES (Foundation for Support of Science
Sea). We also thank National Institute of Science and
and Technology of the Espírito Santo), the CNPq
Technology for Environmental Research in Antarctica
(National Council for Scientific and Technological
(CNPq, process # 574018/2008-5 and FAPERJ, process
Development), and the SECIRM (Secretariat of the
# E-16/170,023/2008).
References Alvarez, C. E. (1995). Arquitetura na Antártica: ênfase nas edificações brasileiras em madeira. Dissertação em Tecnologia da Arquitetura, Universidade de São Paulo, São Paulo. ASHRAE Standard 55 (2004). Thermal Environmental Conditions for Human Occupancy. American Society of Heating, Refrigeration and Air-Conditioning Engineers, Inc. Atlanta, USA. INTERNATIONAL ORGANIZATION FOR STANDARDIZATION. ISO 7726 (1998); Thermal environments-instruments and methods for measuring physical quantities. Geneva. INTERNATIONAL ORGANIZATION FOR STANDARDIZATION. ISO 7730 (2005): Ergonomics of the thermal environment – analytical determination and interpretation of thermal comfort using calculation of the PMV and PPD indices and local thermal comfort criteria. Geneva.
216
| Annual Activity Report 2010
4 MANAGEMENT OF THE PRODUCTION OF SOLID WASTES OF THE COMANDANTE FERRAZ BRAZILIAN ANTARCTIC BASE Anderson Buss Woelffel1,*, Cristina Engel de Alvarez1 Universidade Federal do Espírito Santos – UFES, Vitória, ES, Brazil
1
*e-mail: andersonbwarquiteto@gmail.com
Abstract: Since 2001, specific studies on the subject of solid wastes produced at the Comandante Ferraz Brazilian Antarctic Base (EACF) have been carried out in order to characterise, quantify and identify the overall production of solid wastes in several activities performed in that Antarctic station. In 2006 a new spreadsheet to control the wastes was adopted in order to optimize the monitoring task, from the initial collection to final storage. Thus, this study is aimed at assessing the annual production of solid wastes, specifically from January 2009 to March 2010, and researching significant potential changes in the waste quantities after application of the new spreadsheet, based on the values of the production from 2001 to 2008 (historic series). Methodologically, the past results of production of wastes of the EACF and the data of current situation supplied by SECIRM were analyzed. From the results, a general increase of the solid wastes documented from 2006 was noted, reflecting improvement in procedures in the identification and quantification of waste generated at EACF. This increase is concurrent to two factors affecting the final production of waste: the early studies of the EACF Revitalization Program and the increase of the number of users at the station. Keywords: solid residues, waste, Antarctica, environmental monitoring
Introduction Since the establishment of the Comandante Ferraz Brazilian
production quantities and some more specific waste
Antarctic Base (Lat. = 62° 05’ S and Long. = 58° 24’ W),
categories were clustered into related categories, which made
mark of Brazilian presence in Antarctica, the concern
their correct management difficult.
with the destination of the solid wastes produced through the undertaking of a number of local activities has been constant in the scope of the Brazilian Antarctic Program (PROANTAR, acronym in Portuguese) and have encouraged initiatives in order to cause minimal environmental impact as a consequence of Brazilian occupancy on that continent (Alvarez et al., 2006). With the advent of the Madrid Protocol (1991), which in its Appendix 3 deals with the issue of solid waste by
Since 2001, with the goal to fill that information gap, specific studies on the issue of solid wastes at the Comandante Ferraz Brazilian Antarctic Base have been undertaken, aiming mainly to characterise, quantify and identify the general production of wastes related to the several activities developed at the EACF. In 2006/2007, further studies focused on the waste generated by the activities of production and consumption of food
advocating that all garbage should be removed from area
(Alvarez et al., 2007a); and in the summer 2007/2008, all
of the Antarctic Treaty, the practices previously developed
the waste management process was investigated, from the
were renewed. Nevertheless, little was known about the
initial collection to final storage.
Science Highlights - Thematic Area 4 |
217
In 2006, as a reflex of a change in the systematic selection
covered in each category were designed. Then, the data was
and measurement, a new spreadsheet of control of the
reassembled and the overall results were divided between
production of solid wastes in the EACF was adopted, aiming
productions in summer and in winter for addition to the
at optimizing the management task, as a result seeking to
historical series.
know and quantify better the waste for directing initiatives of specific treatment and final destination. The spreadsheet in question discriminated new
Results The spreadsheet adopted from 2006 contains not only
categories and subdivided other general categories
information related to solid waste itself but also data of the
into specific waste amounts. This innovation was quite
fuel consumption, separated by category, in addition to a
satisfactory since to perform correct waste management
section that predicts the recording of sewage and household
it is necessary to first diagnose carefully its production,
waste. However, the absence of hydrometers in the related
sectorization and quantification (Maroun, 2006).
piping at the EACF impedes the measurement of effluent.
Aims
Moreover, the spreadsheet also covers the production of chemical liquid, fuels, hospital, scientific research waste, in
The primary aim of this research is to evaluate the
addition to waste from constructions and maintenance of
production of solid waste generated in the EACF, based
buildings. Another aspect to be considered when analyzing
on the data obtained from the Reports of Waste Generated
the spreadsheet is that it informs, in general lines, the control
in EACF, provided by SECIRM (Secretariat of the
method for each category.
Interministerial Commission for Resources of the Sea),
Initially, the data from gross production of waste was
specifically between January 2009 and March 2010. It is also
compared and their treated results were inserted in the
aimed to study significant potential changes in the waste
historical series from 2001 to 2008 (Figure 1). the overall
quantities after application of a new spreadsheet, based on
increase of the documented production of solid waste from
the recorded values of the production from 2001 to 2008
2006 was noted, including year of adoption of the new
(historical series).
spreadsheet, in comparison with the former years, i.e., from
The secondary aim is to proceed the studies integrating
2001 to 2005, reflecting improvement in the procedures of
a wider technological research project which has been
identification and quantification of the waste generated in
developed making use of the scope of the Brazilian Antarctic
EACF. This increase is concomitant to two factors affecting
Program (PROANTAR), whose general aim is to develop
the final production of waste: the initial studies of the EACF
solutions to optimize the systems operating in EACF and the environmental efficiency of the Brazilian buildings on Antarctica as a whole, also considering the reproducibility of methodology and the solutions proposed in similar situations and the pertinence of this subject for the country’s economy.
Methodology To develop this work the past results of the production of wastes in EACF and the data of the current situation provided by SECIRM were analyzed. The current data was treated according to classification proposed by the new spreadsheet and quantitative graphs for the time period
218
| Annual Activity Report 2010
Figure 1. Generation of solid waste in the EACF: comparison between summer and winter. The increased amounts of waste noted in 2007 reflect the period of intensive works to revitalize the Base.
Revitalization Program (Alvarez et al., 2007b) and the extension of the number of users of that station.
The quantity of organic waste measured in December was 1,601 kg, above the mean of 925 kg of the other months
Another aspect to be considered when interpreting
in the summer of 2009/2010 (Figure 4). It was noted that
the Graph in question concerns the initial tendency for
with the arrangement of provisions coming with the ship
stabilization of the total production of waste from 2008,
in early summer a routine evaluation of existing stock is
which should be investigated in future measurements.
established, particularly concerning the conditions of stored
The waste materials contaminated with paint and oil/
material consumption. Thus, in that period were discarded
grease reached the peak of 904 kg in October, which is well
892 kg of refrigerated provisions in addition to 427 kg of
above the mean of 145.81 kg among the considered months
dry provisions classified as not suitable for consumption.
(Figure 2). It should be observed that in the period the
Concerning the paper waste, an increase of production
cleaning of fuel tanks of EACF with consequent extension
in March 2009 was found, above the mean of 159.26 kg
of that waste class occurred.
(Figure 5). This may be explained by activities of organization
Furthermore in October, the scrap quantity reached
of material and discarding of unnecessary packages during
the value of 547 kg, above the mean of 191.2 kg (Figure 3),
the winter, considering the concentration of loading for
corresponding to the period in which were carried out the
embarkation for return to Brazil.
preparations of the waste produced during the winter for
With respect to the waste related to construction and
embarkation.
maintenance activities, there is special attention on the
Figure 2. Production of waste materials contaminated with paint or oil/ grease in the EACF, with increased quantity in October 2009.
Figure 4. Production of organic waste in the EACF, with increased amount in December 2009.
Figure 3. Production of waste scrap in the EACF, with increased quantity in October 2009.
Figure 5. Production of paper waste in the EACF, with increased amount in March 2009.
Science Highlights - Thematic Area 4 |
219
production of polyurethane and polystyrene foam waste,
and in training personnel to perform the activities are
as well as the production of PVC waste, also comprising in
needed.
this category other plastics.
waste on Antarctic soil and for the proposal of management
significant quantities of polyurethane and polystyrene
alternatives, comparing data of waste production of
foam (235 kg), most likely due to works of repair in the
EACF with data from other Antarctic stations cannot be
location called Spares Bunker, whose isolating material was practically completely replaced. Concerning the increased production of PVC and other plastics in December 2009 (286 kg), this fact very likely was related with the discarding of 19 damaged “marfinites”, according to a specific report of the month. The term “marfinite” refers to a box with a standard size, made from rigid PVC and used by PROANTAR to transport and temporarily store materials.
Conclusions It is highlighted that a detailed categorization of the production of waste allows effective knowledge of the material used in the EACF, either for routine or eventual activities. This in turn allows the study of alternatives to reduce the production of waste, its final destination and even the feasibility of its replacement for other materials whose performance is more efficient from a logistic and environmental standpoint. It is worth mentioning that relevant advances were obtained, especially for the rigor and reliability of the data recorded in the worksheet, allowing for an appropriate diagnosis of the production of solid waste. The acquisition of a new incinerator is also noteworthy, characterised by greater ability to burn and reduce the release of pollutants
220
Although desirable for understanding the problem of
In March 2009, it was found that the EACF produced
undertaken directly, especially in light of the following aspects: 1) difficulty of obtaining data by the official coordinators of activities in Antarctica, mainly for countries that are out of the RAPAL(Meeting of Latin-American Antarctic Manager Programs) system; 2) measurements made by other bases or stations using different methodology of that adopted by the Brazilian station makes it hard or impossible to obtain a desirable result correlation; and 3) different user habits, related with the culture of their country of origin, interfering, especially, in the amount of waste generated. The continuity in measurements and data processing must be a priority due to its primary importance for the development of appropriate solutions to the problem of solid waste in Antarctica and also to the possible interrelation with other areas of knowledge. Therefore, the study on the co-generation of energy deserves to be mentioned, which would take into account the solid waste combustion, an important source to be exploited.
Acknowledgements We thank the FAPES (Foundation for Support of Science and Technology of the Espírito Santo), the CNPq (National Council for Scientific and Technological Development),
into the atmosphere, furthermore the evaluation of
and the SECIRM (Secretariat of the Interministerial
the feasibility of reusing the heat generated during the
Commission for Resources of the Sea).
incineration of organic materials for energy co-generation
We also thank National Institute of Science and
in the EACF is under study. However, still due to the lack of
Technology for Environmental Research in Antarctica
adequate studies of the system for measuring and evaluating
(CNPq, process nº 574018/2008-5 and FAPERJ, process
wastewater, investments both in measurement equipment
nº E-16/170,023/2008).
| Annual Activity Report 2010
References Alvarez, C.E.; Woelffel, A.B.; Cruz, D.O. & Marchi, L.B. (2007a). Evaluación de la producción de residuos sólidos resultantes de las actividades de elaboración y consumo de alimentos en la Estación Antártica Comandante Ferraz (BRASIL). Documento de Información de La XVIII RAPAL - Reunión Anual de Administradores Antárticos Latinoamericanos, Brasília. p. 1-8. Alvarez, C.E. de, Casagrande, B. & Soares, G.R. (2007b). Resultados alcançados com a implementação do Plano Diretor da Estação Antártica Comandante Ferraz (EACF). Anais do IV Encontro Nacional e II Encontro Latino-Americano Sobre Edificações e Comunidades Sustentáveis, Campo Grande. p.1297 – 1306. Alvarez, C.E. de; Marchi, L.B.; Cruz, D.O.; Soares, G.R. & Paneto, G.G. (2006). Diagnóstico Preliminar dos resíduos gerados na EACF – Estação Antártica Comandante Ferraz, Brasil. Documento de Información de La XVII Reunión Anual de Administradores Antárticos Latinoamericanos, Punta Arenas. Maroun, C.; Firjan, S. (2006). Manual de Gerenciamento de Resíduos: Guia de procedimento passo a passo. Rio de Janeiro: GMA.
Science Highlights - Thematic Area 4 |
221
5 METHODOLOGY OF LANDSCAPE MONITORING IN ASMA AT THE ADMIRALTY BAY: APPLICATION IN KELLER PENINSULA Priscila Faria Gomes1,*, Cristina Engel de Alvarez1 1
Universidade Federal do Espírito Santo, Vitória, ES, Brazil *e-mail: priscila_fariagomes@hotmail.com
Abstract: The first Brazilian buildings on the Antarctic Continent date from 1984, with the establishment of isolated and readymade structures from Brazil, whose primary function was supporting the development of research and marking the Brazilian intention of developing long-term activities in that place. Since then, the Comandante Ferraz Antarctic Base, located in Keller Peninsula, has undergone deep and disorganized transformations, reaching 2,250 m2 in its main body to date, not considering the individual units. At first the establishment of the Base and its scale indicated minimal changes in the natural landscape and would allow the complete recovery of the environment, if there was a need for its removal. However, concurrent with its growth, the need for assessing the impact caused by the human presence in the region from a landscape perspective was verified. Thus, this study has the purpose of obtaining results with the view to creating a methodology of monitoring and subsequent analysis of the landscape impact on Antarctic environment and applying it to Keller Peninsula. The morphological approach is aimed at assuring the ecological sustainability of that landscape, keeping the large structures working and establishing the link between past and present. Keywords: Antarctica, methodology, sectorial measurement, tracking
Introduction
222
Admiralty Bay, an Antarctic Specially Managed Area
land use and occupation performed by the animals. Thus,
(ASMA), is an area of undoubted value to science and the
the landscape’s monitoring can identify possible animals’
environment. As the first ASMA of Antarctica region, the
behavioural changes that may occur due to new landscape
occupancy of the Admiralty Bay demands special care,
configuration. Thus, a methodology for monitoring of the
considering also the replicability of monitoring methods
landscape of the Admiralty Bay was developed in order
proposed to apply them in other areas of the Antarctica
to subsequently assess the impacts caused by human
region. Accordingly, the issue of the value of the landscape
occupation in the location, with the methodological test
is of paramount importance, particularly given the difficulty
to verify the applicability and feasibility performed in
establishing procedures of analysis and the valuation
Keller Peninsula, where the Comandante Ferraz Brazilian
criteria. The landscape’s monitoring not only allows us to
Antarctic Base is located (Gomes, 2009).
evaluate and monitor human activities in Admiralty Bay, but
The choice of the Keller Peninsula as initial place is
also helps us to identify changes in its covering vegetation, in
justified by the following aspects: 1) the adoption of the
the increasing and/ or decreasing of glaciers, and in the new
Carneiro’s concept (2006) where “[...] the landscape is the
| Annual Activity Report 2010
result of a dynamic combination of physical, biological, and
away from the coastline, with views both inside and outside
human elements, which interconnected one with other, make
the Peninsula; ii) sea points – collected from an inflatable
a single and undivided set [...]”(p. 20), and as the Peninsula
boat up to 100 m away from the coastline, with views for
is a clearly defined geographic portion, it is understood
the Peninsula and Admiralty Bay; iii) air points – collected
that the sense of unity is met; 2) because it has conserved
from a helicopter.
and impacted areas, as well as elements related to cultural
The views were defined from the ability to capture
heritage; 3) because it is the place containing most of
pictures using the photographic equipment available (Nikon
Brazilian buildings.
D-90 camera) covering the entire coast of the Peninsula. The Nikon D-90 camera has an 18-105 mm lens, which allows
Materials and Methods
an aperture of 75°. Based on this data, 8 pictures oriented at
Aiming to create repeatable procedures periodically, the
each predetermined point can be taken in order to fully cover
methodological proposal is started from the establishment
every georeferenced point, with 360° images (Figure 1). The
of the so called IRP – Image Reference Points -, placed so as
taking of pictures at each point follows two lines: the first,
to allow an image scanning of the entire Peninsula, noting
directed towards the Peninsula perpendicular to the coast
that the repetitions have been done always from the same
in order to record 360° pictures of each point. Thus, the
point and directed to the same predetermined angle of
georeferenced points were established for obtaining Image
vision. Initially, the intervals for repeating the procedures
Reference Points (IRP) both on sea and land. It should be
were defined at 2-, 5-, and 10-year, i.e., in 2012, 2015, and
noted that the Keller Peninsula is the main focus chosen for
2020.
monitoring, taking into account the views from sea to land
The establishment of monitoring points started from the
and vice versa. For each IRP eight images were used oriented
three possible strands of work: i) land points – collected 10 m
(N, NE, E, SE, S, SW, W, NW, clockwise direction) and, on
Figure 1. Croquis drawing of obtaining images from IRP 16.
Science Highlights - Thematic Area 4 |
223
the sea points, three or more images perpendicular to the
points a 10 m off-set line from the coastline was employed,
land line in order to subsequently design mosaics (Figure 2).
towards the inside of the Peninsula, in order to bear tidal ranges. From that off-set line, several distances for
Results
establishing the points were tested, and it was concluded that
Determination of the land Image Reference Points (IRPs)
25 points would be ideal. The off-set line was divided into
to achieve a photographic scan of the entire Keller Peninsula 25 georeferenced points equidistant from each other about
The achievement of the land IRPs was done through the
300 m straight (Figure 3). From that division were obtained
use of georeferenced base map. For determining the land
IRPs from A to Y, where each has a specific coordinate.
Figure 2. Example of mosaic designed from IRP 16.
a
b
Y
10 A
X
B
W C V
x: 427331 y: 3115614
I
D
U E T
10
F
S G R
H J
Q I
P
10
J
O K N
L M
x: 427272 y: 3115307
Figure 3. a) Georeferenced IRPs equidistant from each other; b) detail of the referenced IRPs and 10 m off-set line.
224
| Annual Activity Report 2010
49 48
a
b 15
47
100
46 45 3 2 4 5
44 43 42 41 40 39
16
6
x: 427419 y: 3115546
7 8 9
38 37
100
10 11 12 13 14
36 35 34 33
17
15
32
27
26
25
24
23
22
21
20
19
18
19
0
17 29 28
10
30
x: 427440 y: 3115379
18
16 31
x: 427463 y: 3115712
1
x: 427358 y: 3115236
x: 427219 y: 3115143
Figure 4. a) Georeferenced IRPs equidistant from each other; b) detail of the georeferenced IRPs and 100 m off-set line.
Determination of the sea Image Reference Points (IRPs) The achievement of the sea IRPs was done through the use of the same georeferenced base map as used for the land IRPs. After tests for determination of the sea points an off-set line 100 m away from the coastline was employed in order to bear every possible view of the Peninsula while not allowing overlap of the images. From that off-set line several distances were tested to determine the points, and it was concluded that to achieve a photographic scan of the entire Keller Peninsula 49 points would be sufficient. Then applied the same way of division as the land points thus resulting in 49 georeferenced points equidistant from each other about 160 m between them (Figure 4). From that division were obtained IRPs from 1 to 49, where each has a specific coordinate.
Figure 5. Example of scheme for obtaining pictures (IRP 16).
Science Highlights - Thematic Area 4 |
225
Figure 6. Model of panoramic image arrange from the attainment of pictures of the IRP 16.
Attainment of pictures in the field
current landscape and to propose guidelines for possible
In the field, in the summer 2010, in addition to GPS
interventions, mainly those related to news buildings. The
MAP 76 – GARMIN device and the photographic material
climatic conditions and particularly the accumulation
a compass to the precise orientation of the pictures was
of snow harmed the work in progress since the need
used. The inadequacy of the IRPs numbers 1, 2, 3 and 49 to
for visualization of the landscape landmarks, such as
obtain figures due to close proximity to glaciers providing
the “Cousteau’s Whale” and the delimitation of trails.
risk for field staff was also observed; therefore those points
It was not possible to perform a panoramic flight over
were removed from the study. To obtain the pictures of the
the Keller Peninsula, but the air pictures are needed to
land IRPs the same methodology described previously was
add more information to that obtained from land and
employed, with the aid of a compass and GPS. In obtaining
sea IRPs. Past data could not be analyzed and should
pictures at each IRP it was decide to take three pictures for
not be used as a comparison because of the inexistence
each oriented view in order to assure quality and choice
of base information or exact location of the place the
of pictures, highlighting the difficulty to verify the results
pictures had been taken, which could lead to an
in situ, due to excessive light or due to constant wind. Thus,
erroneous assessment of the situation of the past. In spite
at each IRP 24 pictures were taken, starting from North and
of all the difficulties, the feasibility of the methodology
following in clockwise direction to make the subsequent
used in this study was also noted, permitting repetition in
tabulation easy (Figure 5).
Admiralty Bay.
Conclusion
Acknowledgements
In the summer 2010 pictures of the land and sea IRPs
We thank the FAPES (Foundation for Support of Science
could be obtained, creating a database with 360° panoramic
and Technology of the Espírito Santo), the CNPq (National
images of each IRP (Figure 6) and also the mosaic of the
Council for Scientific and Technological Development),
entire Keller Peninsula. That database has allowed for the
and the SECIRM (Secretariat of the Interministerial for
monitoring of landscape changes of the region and to
Sea Resources).
assess the impact caused by either human action or natural phenomena. From both that database and the cataloging of those pictures it is aimed to evaluate the situation of the
We also thank National Institute of Science and Technology for Environmental Research in Antarctica (CNPq, process # 574018/2008-5 and FAPERJ, process # E-16/170,023/2008).
References Carneiro, A. B. (2006). Paisagem: conceitos, personagens, enquadramentos. 112 f. Projeto de Graduação (Graduação) Departamento de Arquitetura e Urbanismo, UFES, Vitória. Gomes, P. F. (2009). Proposta de metodologia para avaliação de impacto paisagístico : aplicação nas instalações brasileiras na Antártica. 115 f. Projeto de Graduação (Graduação) – Departamento de Arquitetura e Urbanismo, UFES, Vitória.
226
| Annual Activity Report 2010
Science Highlights - Thematic Area 4 |
227
EDUCATION AND OUTREACH ACTIVITIES Deia Maria Ferreira1, Benedita Aglai Oliveira da Silva1, Rômulo Loureiro Casciano1,2, Bianca Gonçalves Souza1,3, Leilane Fasollo de Azevedo1,4, Francine Nascimento Quintão Costa1,4, Jenifer Souza dos Santos1,3 Laboratório de Ensino de Ecologia, Departamento de Ecologia/Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 2 Thecnical Support Fellow 3 Scientific Iniciation Fellow 4 Scientific Iniciation PIBEX Fellow
1
The researchers from the National Institute of Science
For the first axis educational materials were prepared
and Technology – Antarctic Environmental Research
related to the different environments of Antarctica and
– INCT – APA develop a number of activities in the
concerning what the researchers do on The Frozen
area of education and outreach activities for making the
Continent - Antarctica: a folder with information about
Antarctic science more popular. These activities transcribe
the biota, describing the research activities of the four
the complex scientific language and bring the daily work
thematic areas of INCT-APA was prepared and distributed;
of the Brazilian researchers closer to a large public, and
a big memory game with twenty four pieces completed the
especially to teachers and students of basic education.
information for the student public, a miniature memory
Two axis mark the educational area and outreach activities
game was distributed to the teachers who visited the stand;
for disseminate the knowledge generated by INCT-APA:
a video with images recorded by researchers over the period
development of educational materials and participation
of the last few years was prepared for sparking curiosity of
in events of Outreach activities, such as National Science
the public on the Antarctic continent, its fauna and flora
Weeks, regional exhibitions, lectures and presentations in
and; a panel with 3 m × 2 m which gave information on the
schools and other institutions (Figures 1, 2 and 3).
thematic areas of research in Antarctica was also exhibited;
Figure 1. National Week of Science and Technology in 2010 (UFRJ, Rio de Janeiro). Photos: Rômulo L. Casciano.
228
| Annual Activity Report 2010
a panel with an interactive magnetic field with the different
Conferences, presenting the Antarctica biodiversity
environments and animals of Antarctica provoked curiosity
and developing educational materials and spreading
from all the visitors; a model of the Brazilian Antarctic
information on the researchers activities in Antarctica
Station Comandante Ferraz measuring 1 m2 and finger
from the Brazilian society. Between 2010 and 2011 a
puppets representing seals and penguins were prepared
public estimated at 20,000 people visited the exhibitions
to illustrate the aspects of life on the Antarctic Research
organized in several regions of the country by researchers
Station.
from INCT-APA, as well as assisted more than 50 lectures
The participation in Outreach events includes video exhibitions and many lectures given by the Brazilian
given to the general public, in the different institutions that integrate the INCT-APA.
researchers. Since 2009 the INCT-APA has been actively
In the National Week of Science and Technology in 2010,
participating in Science and Outreach Events and
two stands were introduced with the presence of members
Figure 2. National Week of Science and Technology in 2010 (UFRJ, Rio de Janeiro). Photos: R么mulo L. Casciano.
Education and Outreach Activities |
229
of the several thematic areas of INCT-APA. In Cinelândia square (Rio de Janeiro, between 18 and 23 October 2010) 3,600 visitors were received on a stand mounted by FINEP (Project and Research Financier, an entity linked to the Ministry of Science and Technology). At this exhibition about seabirds’ research undertaken by INCT-APA were presented. While on the main campus of UFRJ (Federal University of Rio de Janeiro, 20 and 23 October 2010), 4,000 visitors were received during an exhibition of the work developed by the researchers of the INCT-APA with foam models of the Antarctic biota. A high number of students of the basic education from several regional schools of Rio de Janeiro who visited the exhibition and learnt a little about the role of Brazil in Antarctic Region. In Addition, the exhibition includes folders and game sets, video projections, information panels, biological samples (plants, algae, marine invertebrates and a Papua-penguin) and architectural model of the Brazilian Antarctic Station (Figure 4). In FAPERJ Science and Technology Event (29 and 30 June 2010, Rio de Janeiro), the researches developed by INCT-APA were presented on the panels and Antarctic organisms, clothes and accessories, architectural of the Brazilian Antarctic Station were exposed. In addition folders were distributed illustrating the relevance of the Institute.
Figure 3. Education materials developed by INCT-APA. Photos: Rômulo L. Casciano.
Figura 4. Architectural model of the Brazilian Antarctic Station. Photo: Rômulo L. Casciano.
230
| Annual Activity Report 2010
Figura 5. Book published in cooperation with researchers from INCT-APA and INCT-Criosfera (INCT-Cryosphere).
With the contribution from the researchers from
Peninsula” at the School of Chemistry at Federal
INCT-APA in partnership with INCT-Criosfera (INCT-
University of Rio de Janeiro (Researchers of Thematic
Cryosphere), was published a book “Antarctica and global
Area 3);
changes: a challenge for humanity” from E. Blucher
• Conferences to undergraduates students of UNISINOS,
Publisher. The book discusses the role of the Antarctic
UNIPAMPA, UCS and PUCRS (Researchers of
Continent and the Austral Ocean in the environmental
Thematic Area 2);
system and the evidence of climate change. It has the
• The Science and Technology Fair held in Dinamis school
purpose of informing the general public of the signs of
(Rio de Janeiro/State of Rio de Janeiro) in September
rapid climatic changes, which have been observed in the
2010: video projections observation of Antarctic
last decades and the responses of the polar biota. Apart
organisms and conference “Journey to the Bottom of
from the latter, an identification manual was prepared of the main species of musk and lichens of Antarctica (Figure 5). In 2010, other events were realised by INCT-APA researchers of different thematic areas, as follows:
the Sea” (Researchers of Thematic Area 3); • Conference on “Why Brazil is in Antarctica?” during the Biology Academic Week at the Federal University of Rio de Janeiro in September 2010 (INCT-APA Coordinator Dra. Yocie Yoneshigue Valentin).
• Conference cycles in students from Primary and
The general information on the INCT-APA, videos
Secondary Education at regional schools of the Porto
and educational materials on the thematic researches area
Alegre State (Rio Grande do Sul) (Researchers of
developed by the Institute can be found on its website
Thematic Area 2);
(www. biologia.ufrj.br/inct-antartico).
• Workshop, conferences and video projections in schools of São Paulo and Taubaté cities (São Paulo State) (Researchers of Thematic Area 1 and 3); • Conference “The biodiversity in the Austral Ocean: Brazilian studies of phytoplankton in the Antarctic
Education and Outreach Activities |
231
FACTS AND FIGURES Human Resources: Capacity Building The majority of researchers from the INCT-APA are
an increment of fellowships guaranteeing some source of
involved in undergraduate and postgraduate activities,
income to a higher number of students, hence they may
besides lecturing several scientific talks and courses during
commit to and engage in further training to become highly
the second year of the institute’s existence. Consequently, this
qualified professionals.
fact has increased the development of appropriate Antarctic
The list below highlights the Antarctic capacity building
science competences. The demand for fellowships is fairly
of human resources during the two first years of the INCT-
high especially at the higher level (PhDs, postdoctoral
APA, taking into account all the funding provided by CNPq,
fellows), but younger students have also been engaged in
CAPES, FAPERJ and others regional foundations.
4 PhD STUDENTS IN THE AREAS:
(2) ATMOSPHERIC IMPACT (2) LOWER IONOSPHERE TO TRANSIENT SOLAR
6 MScs STUDENTS IN THE AREAS: ( 1 ) AEROBIOLOGY ( 2 ) SOLAR EVENTS ( 2 ) IONOSPHERE ( 1 ) ATMOSPHERIC IMPACT
14 UNDERGRADUATE SCIENTIFIC FELLOWS IN THE AREAS:
( 3 ) RADIOMETRIC PROPERTIES ( 3 ) OCEANOGRAPHIC CONDITIONS ( 4 ) ANTARCTIC OZONE ( 4 ) IONOSPHERIC DISTURBANCES
19
GRADUATE TECHNICAL FELLOW WORKING ON THE METEOROLOGY
1
VISITING RESEARCHER
( 1 ) VERTICAL PROFILE OF OZONE CONCENTRATION
232
| Annual Activity Report 2010
THEMATIC AREA 2
THEMATIC AREA 1
the studies, as well as trained technical staff. There has been
1 POST-DOCTORATE FELLOWS IN THE AREA: ( 1 ) LICHENS IDENTIFICATION
3 MScs STUDENTS IN SEABIRD ECOLOGY ( 1 ) ORGANIC MARKER ( 1 ) FLOW OF GREENHOUSE GASES IN SOILS ( 1 ) PLANT COMMUNITIES
5 UNDERGRADUATE SCIENTIFIC FELLOWS IN THE AREAS:
( 1 ) ORGANIC GEOCHEMICAL MARKERS OF CLIMATE CHANGE ( 1 ) PLANT COMMUNITIES ( 1 ) BRYOPHYTES ( 1 ) SOIL MICROBIOLOGY ( 1 ) MORPHOLOGICAL DIFFERENCES OF MOSSES
THEMATIC AREA 4 THEMATIC AREA 3
5 POST-DOCTORATE FELLOWS IN MARINE BIOLOGY ( 1 ) FISH ECOLOGY ( 1 ) INDICATORS OF FECAL POLLUTION ( 2 ) PHYTOPLANKTON ( 1 ) ASSOCIATED FAUNA TO MACROALGAE
6 PhD STUDENTS IN THE AREAS:
( 2 ) MARINE INVERTEBRATES (MEIOFAUNA) ( 2 ) NOTOTHENIIDAE ( 1 ) METALS EXPOSITION (GASTROPODA) ( 1 ) ORGANIC MATTER INPUT
9 GRADUATE STUDENTS WITH DTI-3 FELLOWSHIPS:
( 3 ) MARINE INVERTEBRATES (MEIOFAUNA AND MACROFAUNA) ( 1 ) HUMAN IMPACTS ON ANTARCTIC ORGANISMS ( 1 ) HYDROCARBONS EVALUATION ( 1 ) ORGANIC POLLUTANTS IN ANTARCTIC ORGANISMS ( 1 ) MACROALGAE COLLECTION ( 1 ) ASSOCIATED FAUNA TO MACROALGAE ( 1 ) ORGANIC MARKERS OF FECAL POLLUTION IN SEDIMENTS
2 PhD STUDENTS IN THE AREAS: ( 1 ) AIR QUALITY ( 1 ) BIOREMEDIATION
6 MScs STUDENTS IN THE AREAS: ( 1 ) WATER CONSERVATION ( 1 ) EVALUATION OF THERMAL COMFORT ( 1 ) LANDSCAPE IMPACT ASSESSMENT ( 1 ) QUALITY OF LIFE ( 1 ) ALTERNATIVE ENERGIES ( 1 ) BIOREMEDIATION
1 GRADUATE STUDENT WITH DTI-3 FELLOWSHIPS: ( 1 ) ENVIRONMENTAL MANAGEMENT
3 UNDERGRADUATE SCIENTIFIC FELLOWS: ( 1 ) LANDSCAPE IMPACT ASSESSMENT ( 1 ) LED LIGHTING ( 1 ) ENERGY MONITORING
1 GRADUATE TECHNICAL FELLOWS
9 MScs STUDENTS IN THE AREAS:
( 1 ) MARINE INVERTEBRATES (MEIOFAUNA) ( 1 ) BIOMARKER OF ENVIRONMENTAL IMPACT (GASTROPOD) ( 4 ) ENERGY METABOLISM AND IMPACT IN ANTARCTIC FISH NOTOTHENIA SP. ( 1 ) HUMAN ACTIVITIES IMPACTS ON ANTARCTIC FISH ( 1 ) SEDIMENTARY ORGANIC MATTER ( 1 ) ORGANIC MARKER OF THE THAW
19 UNDERGRADUATE SCIENTIFIC FELLOWS
WORKING IN DIFFERENT AREAS OF OCEANOGRAPHY, GEOSCIENCES AND MARINE BIOLOGY
( 4 ) BIOMARKER ORGANISMS ( 3 ) ECHINODERMATA ( 2 ) CRUSTACEA ( 2 ) THERMAL STRESS - NOTOTHENIA ROSSII ( 3 ) ANTARCTIC MEIOFAUNA AND MACROFAUNA ( 1 ) PHYTOPLANKTON ( 2 ) GEOCHEMISTRY ( 1 ) FECAL STEROLS ( 1 ) ORGANIC GEOCHEMICAL MARKERS OF CLIMATE CHANGE
6 GRADUATE TECHNICAL FELLOWS TO ASSIST IN
ZOOLOGICAL LABORATORY AND FIEL TECHNICAL ACTIVITIES
Facts and Figures |
233
PUBLICATIONS Book Chapters Campos, L.S. A biodiversidade antártica: adaptações evolutivas e a sensibilidade às mudanças ambientais. In: Goldenberg, J. Antártica e mudanças globais: um desafio para a humanidade. Série Sustentabilidade. Volume 9. São Paulo, Blucher. 2011. p. 121-162.
Papers Alencar. A.S.; Evangelista, H.; Santos, E.A.; Correa, S.M.; Khodri, M.; Garcia, V.M.T.; Garcia, C.A.E. & Pereira, E.B. IRA, Piola & A.R., Felzenszwalb, I. Potential source regions of biogenic aerosol number concentration apportioning at King George Island, Antarctic Peninsula. Antarctic Science. 1-9. http://dx.doi.org/10.1017/ S0954102010000398 2010. Bageston, J.V.; Wrasse, C.M.; Batista, P.P.; Hibbins, R.E.; Fritts, D.C.; Gobbi, D. & Andrioli, V.F. Observation of a mesospheric front in a dual duct over King George Island, Antarctica. Atmospheric Chemistry and Physics Discussion (Online), v. 11, p. 16185 - 16206, http://dx.doi.org/10.5194/acpd-11-16185-2011. 2011. Bageston, J.V., Wrasse, C.M.; Hibbins, R.E.; Batista, P.P.; Gobbi, D.; Takahashi, H.; Andrioli, V.F.; Echine, J.& Denardini, C.M. Case study of a mesospheric wall event over Ferraz station, Antarctica (62°S). Annales Geophysicae (Berlin), v. 29, p. 209 - 219, http://dx.doi. org/10.5194/angeo-29-209-2011. 2011. Barboza, C.A. de M.; Moura, R.B.; Lanna, A.M.; Oackes, T.; Campos, L.S. Echinoderms as Clues to Antarctic ~ South American Connectivity. Oecologia Australis, v. 15, p. 86-110, 2011. Campos, L.S.; Bassoi, M.; Nakayama, C.; Valentin, Y.Y.; Lavrado, H. P.; Menot, L.; Sibuet, M.; Campos, L.S. Antarctic ~ South American Interactions in the Marine Environment: A Comarge and Caml Effort Through the South American Consortium on Antarctic Marine Biodiversity. Oecologia Australis, v. 15, p. 5-22, 2011.
234
| Annual Activity Report 2010
Cipro, C.V.Z.; Taniguchi, S.; Montone, Rosalinda Carmela. Occurrence of organochlorine compounds in Euphausia superba and unhatched eggs of Pygoscelis genus penguins from Admiralty Bay (King George Island, Antarctica) and estimation of biomagnification factors. Chemosphere (Oxford), v. 78, p. 767-771, 2010. Colabuono, F.I.; Taniguchi, S.; Montone, Rosalinda Carmela. Polychlorinated biphenyls and organochlorine pesticides in plastics ingested by seabirds. Marine Pollution Bulletin., v. 60, p. 630-634, 2010. Correia, E. Study of Antarctic-South America Connectivity from Ionospheric Radio Soundings. Oecologia Australis, v. 15, p. 10-17. 2011. Correia, E.; Kauffmann, P.; Raulin, J.P.; Bertoni, F.C. & Gavilán, H.R. Analysis of daytime ionosphere behavior between 2004 and 2008 in Antarctica. Journal of Atmospheric and Solar-Terrestrial Physics, v. 73, p. 2272-2278. 2011. Costa, E.S.; Ayala, L.; Sul, J.A.I.; Coria, N.R.; SánchezScaglioni, R.E.; Alves, M.A.S.; Petry, M.V.; Piedrahita, P. Antarctic and Sub-antarctic Seabirds in South America: A Rewiew. Oecologia Brasiliensis (Impresso), v. 15, p. 59-68, 2011. de Laat, A.T.J.; van der A, R.J.; Allaart, M.A.F.; van Weele, M.; Benitez, G.C.; CASICCIA, C.; Paes Leme, N.M.; Quel, E.; SALVADOR, J.; Wolfram, E. Extreme sunbathing: Three weeks of small total O3 columns and high UV radiation over the southern tip of South America during the 2009 Antarctic O3 hole season. Geophysical Research Letters, v. 37, p. L14805-L14805, 2010. Evangelista, H.; Maldonado, J.; dos Santos, E.A.; Godoi, R.H.M.; Garcia, C.A.E.; Garcia, V.M.T.; Jonhson, E.; Cunha, K.D., Leite, C.B.; Van Meel, R.V.G.K.; Makarovska, Y. & Gaiero, D.M. Inferring episodic atmospheric iron fluxes in the Western South Atlantic. Atmospheric Environment 44:703-712. 2010. Fernandes, A.S.; Mazzei, J.L.; Alencar, A.S.; Evangelsita, H. & Felzenszwalb, I. Effects of Sanionia uncinata extracts in protecting against and inducing DNA cleavage by reactive oxygen species. Redox Report. 16(5): 201207. DOI 10.1179/1351000211Y.0000000011. 2011.
Guerra, R.; Fetter, E.; Ceschim, L.M.M.; Martins, C.C. Trace
Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.;
metals in sediment cores from Deception and Penguin
Silva, D.A.M.; Campos, L.S.; Weber, R.R. Distribution of
Islands (South Shetland Islands, Antarctica). Marine
sewage input in marine sediments around a maritime
Pollution Bulletin., v. 62, p. 2571-2575, 2011.
Antarctic research station indicated by molecular geochemical indicators. Science
Justino, F.; Setzer, A.; Bracegirdle, T.J.; Mendes, D.;
of
the
Total
Environment, v. 408, p. 4665-4671, 2010.
Grimm, A.; Dechiche, G & Schaefer, C.E.G.R. Harmonic analysis of climatological temperature over Antarctica: present day and greenhouse warming. International Journal of Climatology, 17 pp. DOI 10.1002/ joc.2090.
<http://www3.interscience.wiley.com/cgi-
bin/fulltext/123261383/PDFSTART>. 2010. Krüger, L.; Petry, M.V. On the Relation of Antartctic and Subantarctic Seabirds with Abiotic Variables of South and Southeast Brazil. Oecologia Brasiliensis (Impresso), v. 15, p. 20-27, 2011.
Magalhães, N.; Evangelista, H.; Tanizaki-Fonseca, K.; Meirelles, M.S.P. & Garcia, C.A.E. A multi-parametric analysis of the Antarctic sea ice since 1979. Climate Dynamics, 23(7-8):1-14. DOI 10.1007/s00382-0111162-6. 2011. Petry, M.V.; Petersen, E.S.; Scherer, J.F.M.; Krüger, L.; Scherer, A.L. Ocorrência e dieta de Macronectes giganteus na costa do Rio Grande do Sul, Brasil (Procellariiformes: Procellariidae). Ararajuba (Rio de Janeiro), v. 18, p. 237-239, 2010.
Laat, A.T.J. de; Van der A.R.J.; Allaart, M.A.F.M.; Van Weele, Benitez, G.C.; Casiccia, C.; Paes Leme, N.M.; Quel, E.; Salvador, J. & Wolfram, E. Extreme sunbathing:
Raulin, J.P.; Bertoni, F.C.; Gavilán, H.R.; Guevara-Day, W.; Rodriguez, R.; Fernandez, G.; Correia, E.; Kaufmann, P.; Pacini, Alessandra; Stekel, T.R.C.; Lima, W.L.C.;
Three weeks of small total O3 columns and high UV
Schuch, N.J.; Fagundes, P. & Hadano, Y.R. Solar flare
radiation over the southern tip of South America during
detection sensitivity using the South America VLF
the 2009 Antarctic O3 hole season. Geophysical
Network (SAVNET). Journal of Geophysical Research,
Research Letters, vol. 37, L14805, http://dx.doi.
v. 115, p. A07301. 2010.
org/10.1029/2010GL043699. 2010. Raulin, J.P.; Bertoni, F.C.; Kaufmann, P.; Gavilán, H.R.; Martins, C.C.; Bícego, M.C.; Rose, N.L.; Taniguchi, S.;
Correia, E.; Hadano, Y.R. & Schuch, N.J. Solar-Terrestrial,
Lourenço, R.A.; Figueira, R.C.L.; Mahiques, M.M.;
ionospheric and natural phenomena studies using the
Montone, Rosalinda C. Historical record of polycyclic
South America VLF Network (SAVNET). Journal of
aromatic
Atmospheric and Solar-Terrestrial Physics, v. 73, p.
hydrocarbons
(PAHs)
and
spheroidal
carbonaceous particles (SCPs) in marine sediment cores from Admiralty Bay, King George Island, Antarctica. Environmental Pollution (1987), v. 158, p. 192-200, 2010. Miloslavich, P.; Klein, E.; Díaz, J.M.; Hernández, C.E.; Bigatti, G.; Campos, L.; Artigas, F.; Castillo, J.; Penchaszadeh, P.E.; Neill, P.E.; Carranza, A.; Retana, M.V.; Díaz de A.,
1581-1586. 2011. Ribeiro, A.P.; Figueira, R.C.L.; Martins, C.C.; Silva, C.R.A.; França, E.J.; Bícego, M.C.; Mahiques, M.M.; Montone, Rosalinda C. Arsenic and trace metal contents in sediment profiles from the Admiralty Bay, King George Island, Antarctica. Marine Pollution Bulletin., v. 62, p. 192-196, 2011.
Juan M.; Lewis, M.; Yorio, P.; Piriz, M.L.; Rodríguez, D.;
Rodrigues, E.; Suda, C.N.K.; Rodrigues Júnior, Edson;
Yoneshigue-Valentin, Y.; Gamboa, L.; Martín, A.; Thrush,
Feijó de Oliveira, M.; Carvalho, C.S.; Vani, G.S.
S.; Campos, L.S. Marine Biodiversity in the Atlantic and
Antarctic Fish Metabolic Responses as Biomarkers of
Pacific Coasts of South America: Knowledge and Gaps.
Environmental Impact. Oecologia Australis, v. 15, p.
Plos One, v. 6, p. e14631, 2011.
124-149, 2011.
Publications |
235
Sicinski, J., Jazdzewski, K., De Broyer, C.b, Presler, P., Ligowski, R., Nonato, E., Corbisier, T.N., Petti, Monica A.V., Brito, T.A.S., Lavrado, H.P., BlazewiczPaszkowycz, M., Pabis, K., Jazdzewska, A., Campos, L.S. Admiralty Bay Benthos Diversity A census of a complex polar ecosystem. Deep-Sea Research. Part 2. Tropical Studies in Oceanography, v. 58, p. 3048, 2011. Sul, Juliana Assuncão Ivar; Barnes, David K A; Costa, Monica F; Convey, Peter; Costa, Erli S; Campos, Lúcia S; CAMPOS, L.S. Plastics in the Antarctic Environment: Are We Looking Only at the Tip of the Iceberg?. Oecologia Australis, v. 15, p. 150-170, 2011. Victoria, F.C.; Oliveira A.C.; Peters, J.A. Establishment of the moss Polytrichum juniperinum hedw. under axenic conditions. Bioscience Journal (UFU. Impresso), v. 27, p. 673-676. 2011.
Papers Accepted for Publications Kaufmann, P.; Holman, G.D.; Su, Y.; Giménez de Castro, C.G.; Correia, E.; Fernandes, L.O.T.; Souza, R.V.; Marun, A. & Pereyra, P. Unusual emissions at various energies and coronal mass ejection prior to the November 4, 2003 large solar flare. Solar Physics. 2011. Kaufmann, P.; Marcon, R.; Giménez de Castro, C.G.; White, S.; Correia, E.; Fernandes, L.O.T.; Souza, R.V.; Godoy, R.; Marun, A. & Pereyra, P. Sub-THz and Halpha activity during the preflare and main phases of a GOES class M2 event. The Astrophysical Journal. 2011. Pereira, A.B. & Putzke, J. The Brazilian research contribution to knowledge of the plant communities from Antarctic ice free areas. Aceito para publicação no Anais da Academia Brasileira de Ciências. 2011. Pezzopane, M.; Fagundes, P.; Ciraolo, L.; Correia, E.; Cabrera, M.A. & Ezquer, R.G. Unusual nighttime impulsive foF2 enhancement below the southern anomaly crest under geomagnetically quiet conditions. Journal of Geophysical Research. 2011.
236
| Annual Activity Report 2010
Setzer, A.W. & Kirchhoff, V.W.H.J. Episodes of very low surface Ozone in the So.Shetland Islands (62°S) and their stratospheric polar origin. Accepted, Revista Pesquisa Antártica Brasileira. 2011. Thompson, A.M; Miller, S.K.; Witte J.C.; Oltmans, S.J.; Johnson, B.J.; Fujiwara, M.; Schmidlin, F.J.; Coetzee, G.J.R.; Komala,; Maata, M.; Mohamad, M.; Mutai, C.; Ogino, S-Y.; Da Silva; F.R.; Paes Leme; N.M.; Posny, F.; Scheele, R.; Selkirk, H.B.; Shiotani, M.; Stübi, R.; Levrat, G.; Calpini, B.; Thouret, V.; Tsuruta, H.; Canossa, J.V.; Holger Vömel, V.; Yonemura, S.; Diaz, J.A.; Nguyen T. Tan Thanh & Huang T. Thuy Há. SHADOZ (Southern Hemisphere Additional Ozonesondes) Ozone Climatology. 4. Tropospheric and Lower Stratospheric Profiles (2005-2009) with Comparisons to OMI Total Ozone. <http://www.wcrp-climate.org/conference2011/ posters/C15/C15_Thompson_T111A.pdf>. Journal of Geophysical Research. 2011.
Publications |
237
E-MAILS
I N C T – A PA R E S E R A C H T E A M Thematic Area 1
ANTARCTIC ATMOSPHERE AND ENVIRONMENTAL IMPACTS IN SOUTH AMERICA Dr. Neusa Maria Paes Leme – Coordinator of Thematic Area 1 (INPE) neusa_paesleme@yahoo.com.br
Dr. Amauri Pereira de Oliveira (IAG/USP) amauri@usp.br
Dr. Jacyra Ramos Soares (IAG/USP) jacyra@usp.br
Dr. Arthur José da Silva Rocha (IOUSP) arthur@usp.br
Dr. José Henrique Fernandez (UNITAU) henrique@unitau.br
Dr. Damaris Kirsch Pinheiro (UFSM) damariskp@gmail.com
Dr. José Valentin Bageston (INPE) jvb@laser.inpe.br
Dr. Emília Correia (INPE – CRAAM) ecorreia@craam.mackenzie.br Thematic Area 2
GLOBAL CHANGES ON TERRESTRIAL ANTARCTIC ENVIRONMENT Dr. Antonio Batista Pereira – Coordinator of Thematic Area 2 (UNIPAMPA) antoniopereira@unipampa.edu.br
Dr. Cláudio Vinícius de Senna Gastal Jr. (UNIPAMPA) gastalcv@terra.com.br
Dr. Maria Virginia Petry (UNISINOS) vpetry@unisinos.br
Dr. Jair Putzke (UNISC) jair@unisc.br
Dr. Ricardo José Gunski (UNIPAMPA) rgunski@yahoo.com.br
Dr. Luiz Fernando Würdig Roesch (UNIPAMPA) luizroesch@unipampa.edu.br
Dr. Uwe Schulz (UNISINOS) uwe@unisinos.br
Thematic Area 3
IMPACT OF HUMAN ACTIVITIES ON THE ANTARCTIC MARINE ENVIRONMENT Dr. Helena Passeri Lavrado – Coordinator of Thematic Area 3 (IB/UFRJ) hpasseri@biologia.ufrj.br/ hplavrado@gmail.com
238
Dr. Adriana Galindo Dalto (IB/UFRJ) agdalto@gmail.com
Dr. Cristina Rossi Nakayama (IOUSP) crnakayama@gmail.com
Dr. Andrea de Oliveira Ribeiro Junqueira (UFRJ) ajunq@biologia.ufrj.br
Dr. Denise Rivera Tenenbaum (IB/UFRJ) deniser@biologia.ufrj.br
Dr. Andreza Portella Ribeiro (IOUSP) aportellar@yahoo.com.br
Dr. Edmundo Ferraz Nonato (IOUSP) efnonato@usp.br
Dr. Cecilia Nahomi Kawagoe Suda (UNITAU) cnksuda@hotmail.com
Dr. Edson Rodrigues (UNITAU) rodedson@gmail.com
Dr. César de Castro Martins (IUFPR) ccmart@ufpr.br
Dr. Flavia Sant’Anna Rios (UFPR) flaviasrios@ufpr.br
Dr. Cleoni dos Santos Carvalho (UFSCar) carvcleo@yahoo.com.br
Dr. Gannabathula Sree Vani (UNITAU) srvani@hotmail.com
| Annual Activity Report 2010
Dr. Joel Campos de Paula (UNIRIO) depaula.joelc@gmail.com
Dr. Rubens Cesar Lopes Figueira (IOUSP) rfigueira@usp.br
Dr. José Juan Barrera Alba (IB/UFRJ) juanalba@usp.br
Dr. Rubens Duarte (IOUSP) rubensduarte13@yahoo.com.br
Dr. Lísia Mônica de Souza Gestinari (NUPEM/UFRJ) lisiagestinari@ufrj.br
Dr. Sandra Bromberg (IOUSP) bromberg@usp.br
Dr. Lucélia Donatti (UFPR) donatti@ufpr.br
Dr. Satie Taniguchi (IOUSP) satie@usp.br
Dr. Lúcia de Siqueira Campos (IB/UFRJ) luciascampos@gmail.com
Dr. Susete Wambier Christo (UEPG) wambchristo@yahoo.com.br
Dr. Manuela Bassoi (IB/UFRJ) manu.bassoi@gmail.com
Dr. Tânia Zaleski (UFPR) taniazaleski@gmail.com
Dr. Marcelo Renato Lamour (UFPR – CEM) mlamour@ufpr.br
Dr. Thais Navajas Corbisier (IOUSP) tncorbis@usp.br
Dr. Márcia Caruso Bícego (IOUSP) marciacaruso@usp.br
Dr. Theresinha Monteiro Absher (UFPR) tmabsher@ufpr.br
Dr. Márcio Murilo Barboza Tenório (IB/UFRJ) mbtenorio@hotmail.com
Dr. Vicente Gomes (IOUSP) vicgomes@usp.br
Dr. Maurício Osvaldo Moura (UFPR) mauricio.moura@ufpr.br
Dr. Vivian Helena Pellizari (IOUSP) vivianp@usp.br
Dr. Mônica Angélica Varella Petti (IOUSP) mapetti@usp.br
Dr. Yocie Yoneshigue Valentin (IB/UFRJ) General Coordinator of INCT–APA yocie@biologia.ufrj.br/ yocievalentin@gmail.com
Dr. Rolf Roland Weber (IOUSP) rweber@usp.br Dr. Rosalinda Carmela Montone (IOUSP) Vice–coordinator INCT–APA rmontone@usp.br Thematic Area 4
ENVIRONMENTAL MANAGEMENT Dr. Cristina Engel de Alvarez - Coordinator of Thematic Area 4 (UFES) cristinaengel@pq.cnpq.br
Dr. Alexandre de Ávila Lerípio (UNIVALI) leripio@terra.com.br
Dr. Neyval Costa Reis Junior (UFES) neyval@inf.ufes.br
Dr. Alexandre Soares Rosado (IMPPG/UFRJ) arosado@globo.com
Dr. Paulo Sérgio de Paula Vargas (UFES) pvargas@terra.com.br
Dr. Domingos Sávio Lyrio Simonetti (UFES) d.simonetti@ele.ufes.br
Dr. Raquel Silva Peixoto (IMPPG/UFRJ) r.s.peixoto@globo.com
Dr. Juliano de Carvalho Cury (UFRJ) jccury@hotmail.com
Dr. Ricardo Franci Gonçalves (UFES) franci@npd.ufes.br
Dr. Jussara Farias Fardin (UFES) jussara@ele.ufes.br
Dr. Roseane Simões Palavizini (IBA/UFRJ) palavizini@gmail.com
E-mails |
239
EDUCATION AND OUTREACH ACTIVITIES MSc. Déia Maria Ferreira dos Santos (IB/UFRJ) deia@biologia.com.br
Dr. Benedita Aglai Oliveira da Silva (IB/UFRJ) aglai@biologia.com.br
EXTERNAL COLLABORATORS Thematic Module 1
ANTARCTIC ATMOSPHERE AND ENVIRONMENTAL IMPACTS IN SOUTH AMERICA Dr. Alberto Waingort Setzer – Brazil (INPE/REDE CLIMA/INCT para Mudanças Climáticas) alberto.setzer@cptec.inpe.br
Dr. Francesco Zaratti – Bolivia (University of San Andrès) zaratti@entelnet.bo
Dr. Heitor Evangelista da Silva – Brazil (UERJ/INCT – Criosfera) heitor@uerj.br/ evangelista.uerj@gmail.com
Dr. Cláudio Cassicia R. Salgado – Chile (University of Magallanes – UMAG) claudio.casiccia@umag.cl
Dr. Luciano Marani – Brazil (INPE/REDE CLIMA/INCT para Mudanças Climáticas) lmarani@dge.inpe.br
Dr. Félix Zamorano – Chile (University of Magallanes – UMAG) felix.zamorano@umag.cl
Dr. Plínio Carlos Alvalá – Brazil (INPE/REDE CLIMA/INCT para Mudanças Climáticas) plinio@dge.inpe.br
Andrés Mansilla – Chile (University of Magallanes – UMAG) andre.mansilla@umag.cl
Dr. Eduardo J. Quel – Argentina (Argentine Armed Forces Scientifi c and Technical Research Institute – CITEFA) quel@citefa.gov.ar
Kazuo Makita – Japan (Takushoku University) kmakita@la.takushoku-u.ac.jp makita@R2.dion.ne.jp
Dr. Elian Wolfram – Argentina (Argentine Armed Forces Scientifi c and Technical Research Institute – CITEFA) ewolfram@citefa.gov.ar
Hiromasa Yamamoto – Japan (Rikkyo University) yamamoto@rikkyo.ac.jp
Dr. Jacobo Salvador – Argentina (Argentine Armed Forces Scientifi c and Technical Research Institute – CITEFA) jsalvador@citefa.gov.ar
Thematic Module 2
GLOBAL CHANGES ON TERRESTRIAL ANTARCTIC ENVIRONMENT Lubomir Kowacik – Slovakia (Comenius Univiversity) kovacik@fns.uniba.sk
240
| Annual Activity Report 2010
A nnual Ac t ivi t y Rep o r t 2010 Expedient
Editors
Production Management Proofreader
Collaboration Photograph Courtesy
Yocie Yoneshigue Valentin – IB/UFRJ Adriana Galindo Dalto – IB/UFRJ Helena Passeri Lavrado – IB/UFRJ Editora Cubo Rafael Mozeto and Larissa Orlandi Yocie Yoneshigue Valentin – IB/UFRJ Adriana Galindo Dalto – IB/UFRJ Geyze Magalhães de Faria – IB/UFRJ Caio Amitrano de Alencar Imbassahy – IB/UFRJ Geyze Magalhães de Faria – IB/UFRJ Caio Amitrano de Alencar Imbassahy – IB/UFRJ Adriana Galindo Dalto (Backgrounds: Cover, Expedient, Summary, Presentation, Introduction, Science Highlights, Thematic Area 3, Facts and Figures) Andre Monnerat Lanna (Background: Thematic Area 1, Thematic Area 4, Education and Outreach Activities, Publications, Email) Luiz Fernado Wurdig Roesch (Background: Thematic Area 2)
The editors express their gratitude to the INCT-APA colleagues that contribute to this edition. This document was prepared as an account of work done by INCT-APA users and staff. Whilst the document is believed to contain correct information, neither INCT-APA nor any of its employees make any warranty, expresses, implies or assumes any legal responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed within. As well, the use of this material does not infringe any privately owned copyrights.
Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais (INCT-APA) INCT-APA Headquarters
Telephone/ Fax E-mail Home Page
Instituto de Biologia, Centro de Ciências da Saúde (CCS) Universidade Federal do Rio de Janeiro (UFRJ) Av. Carlos Chagas Filho, 373 - Sala A1-94 - Bloco A Ilha do Fundão, Cidade Universitária - CEP: 21941-902 Rio de Janeiro - RJ, Brazil +55 21 2562-6322 / +55 21 2562-6302 inctapa@gmail.com www.biologia.ufrj.br/inct-antartico
Management Committee General Coordinator Yocie Yoneshigue Valentin – IB/UFRJ
Education and Outreach Activities – Team Leader Déia Maria Ferreira – IB/UFRJ
Vice-coordinator Rosalinda Carmela Montone – IO/USP
International Scientific Assessor Lúcia de Siqueira Campos – IB/UFRJ
Thematic Area 1 (Antarctic Atmosphere) – Team Leader Neusa Paes Leme – INPE
Project Manager Assessor
Thematic Area 2 (Antarctic Terrestrial Environment) – Team Leader Antonio Batista Pereira – UNIPAMPA Thematic Area 3 (Antarctic Marine Environment) – Team Leader Helena Passeri Lavrado – IB/UFRJ Thematic Area 4 (Environmental Management) – Team Leader Cristina Engel de Alvarez – UFES
Adriana Galindo Dalto – IB/UFRJ Executive Office Carla Maria da Silva Balthar – IB/UFRJ Finance Technical Support Maria Helena Amaral da Silva – IBCCF/UFRJ Marta de Oliveira Farias – IBCCF/UFRJ
Support
Instituto Nacional de Ciência e Tecnologia Antártico de Pesquisas Ambientais (INCT-APA) Collaborations
Production
Instituto de Biologia, Centro de Ciências da Saúde (CCS) Universidade Federal do Rio de Janeiro (UFRJ) Av. Carlos Chagas Filho, 373 - Sala A1-94 • Bloco A Ilha do Fundão, Cidade Universitária - CEP: 21941-902 Rio de Janeiro- RJ, Brazil +55 21 2562-6322 / +55 21 2562-6302 inctapa@gmail.com www.biologia.ufrj.br/inct-antartico
ISSN 2177-918X
ANNUAL ACTIVITY REPORT
ANNUAL ACTIVITY REPORT 2010 - National Institute of Science and Technology - Antarctic Environmental Research
Support
Collaborations
N a t i o n a l I n s t i t u t e o f S c i e n c e a n d Te c h n o l o g y Antarctic Environmental Research